query_id
int64 0
355k
| query
stringlengths 2
25.6k
| neg_doc_0
stringlengths 13
360k
| neg_doc_1
stringlengths 9
301k
| neg_doc_2
stringlengths 9
364k
| neg_doc_3
stringlengths 13
347k
| neg_doc_4
stringlengths 14
562k
| neg_doc_5
stringlengths 13
589k
| neg_doc_6
stringlengths 14
293k
| neg_doc_7
stringlengths 11
403k
| doc_id
int64 0
355k
| positive
stringlengths 1
679k
| neg_query_0
stringlengths 3
23.4k
| neg_query_1
stringlengths 2
47.3k
| neg_query_2
stringlengths 3
47.3k
| neg_query_3
stringlengths 3
37.6k
| neg_query_4
stringlengths 2
64.1k
| neg_query_5
stringlengths 3
64.1k
| neg_query_6
stringlengths 2
21.3k
| neg_query_7
stringlengths 3
64.1k
|
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
100 | Application Time and Effectiveness of Four Systemic Nematicides Against Meloidogyne arenaria on Florunner Peanuts | The nematicidal activity and control effects of 6 phytochemicals against Meloidogyne incognita J2 were separately tested in glass culture dishes and greenhouse.The result showed that oxalic acid had the strongest inhibition activity,of which EC50 was 102.183 4 mg/L.According to the inhibition activity,the order from big to small was oxalic acidcrotonic acidtartaric acidmandelic acidmalic acidcitric acid.The result in greenhouse indicated that the control effect of oxalic acid(76.8%) was the most significant and citric acid the lowest(10.4%).And the control effect order of 6 chemicals against M.incognita in greenhouse was consistent with that of their nematicidal activity. | Efficacy of Six Nematicides and Six Commercial Bioproducts Against Root-Knot Nematode, Meloidogyne incognita on Tomato | Six neem and its products (powdered neem leaf, neem bark, nimboli, kitguard, neem tonic & neem oil) were tested against Meloidogyne incognita on mung in pots. All the treatments were found effective in reducing the nematode population and disease incidence. However, leaf powder, nimboli and kitguard were found superior than neem tonic, bark and neem oil. | In nematicidal activitiy of sixty plant crude extracts from Albizzia spp. leaf, Nerium indicum leaf,Ricinus communis leaf,Lantana indica leaf, Tithonia spp. leaf and Tithonia spp. flower extracted by ten different solvents were determined against the second juvenile (J2) of Meloidogyne spp..The result showed that the Albizzia spp. leaf ethanol, methanol, chloroform, ethyl acetate and carbon tetrachloride crude extracts, Lantana indica leaf methanol crude extract,Tithonia spp. flower ethanol, acetone, methanol and ethyl acetate crude extracts had stronger nematicidal activities against the J2. When concentration of these plant crude extracts were 2% (relating concentration of plant powder) , J2 mortality rate were 100% in 24 hours. Several nematicidal components may exist in Albizzia spp. leaf and Tithonia spp. flower. | Peanut (Arachis hypogaea L.) is subject to parasitisation by various species of plant parasitic nematodes. Usually field populations consist of several species (Ingram and Rodriguez-Kabana, 1980). During a preliminary survey, plant parasitic nematodes, Rotylenchulus reniformis Linford et Oliveira, Hoplolaimus indicus Sher, Pratylenchus zeae Graham and Helicotylenchus ahunaamai Siddiqi were isolated from the rhizosphere of peanut plants in central farm, O.U.A.T., Bhubaneswar. Three granular and three E.C. formulations of nematicides, singly and/or in combinations were tested with a view to find a suitable control measure against the nematodes occurring in peanut fields. | Nematicidal activity using a pure culture ofSyncephalastrum racemosum was studied. The results showed that the metabolites ofS. racemosum have pretty high nematicidal activity. The nematicidal principles were solube in water and had high thermal stability. The major acid metabolites extracted from cultures ofS. racemosum identified from HPLC were oxalic acid dihydrate and tartaric acid. Soil application with culture filtrate ofS. racemosum significantly (P<0.05) reduced nematode population densities and subsequent root-knot development in tomato compared with the controls. | Bioassay tests were conducted to find out the nematicidal activity of eight essential oils against Meloidogyne incognita (Kofoid and White) Chitwood at four concentrations. Maximum activity was recorded in oils of Eucalyptus citriodora, Eucalyptus hybrida and Ocimum basilicum followed by Pelargonium graveolens, Cymbopogon martinii, Mentha arvensis, Mentha piperita and Mentha spicata oils, respectively. The eucalyptus (E. citriodora and E. hybrida) and Indian basil (O. basilicum) oils were highly toxic to M. incognita even at the lower concentrations, namely 500 and 250 ppm. The remaining oils were also toxic to the nematode but at different amounts. | THE CURRENT STATUS OF IMAZALIL: A POST HARVEST FUNGICIDE FOR CITRUS | 100 | Influence of Cropping Systems on Stem Rot (Sclerotium rolfsii), Meloidogyne arenaria, and the Nematode Antagonist Pasteuria penetrans in Peanut | Stem Rot of Strawberry Caused by Sclerotium rolfsii in Korea | Comparative Efficacy of Rhizosphere Mycoflora, Fungicides, Insecticides and Herbicides against Groundnut Stem rot caused by Sclerotium rolfsii* | Biological Control of Sclerotium Rolfsii Root Rot of Sugarbeet with Trichoderma Harzianum | Integrated Management of Sclerotium rolfsii, The Incitants of Root Rot Complex of Chilli | Management of Sclerotium rolfsii‐caused stem and pod rots of groundnut—a critical review† | Soil and Residual Herbicide Affect Peanut Seedling Development | Control of root‐knot nematodes, Meloidogyne spp., on tomato, Lycopersicon esculentum Mill., with poultry manure | Transcriptional reprogramming underpins enhanced plant growth promotion by the biocontrol fungus Trichoderma hamatum GD12 during antagonistic interactions with Sclerotinia sclerotiorum in soil |
101 | Such a waste of money | Too expensive for the quality of the product. Too simple and boring | You get for what you pay for I guess. I was a little disappointed in the product. | As advertised. Far better, and much more economical than the cheap ones that only last about 30-45min. | It is cheap and works. In Home Depot this item is sold with other garbage you don't need for $3 a pair. | Too many ads! I’d pay $5+ to get rid of them completely but keep their benefits. | So I was on a free palm readings group, none of which were actually free. I didn’t have money to donate and also like I mentioned in the title people kept telling me sacrifice rituals to my ancestors were necessary to ward dark spirits because my enemy cast a spell, is this a scam or is it true? | I read that these rigs can cost $200 000 a **day**. What makes them so expensive to run? | This is a great product for the money and a good alternative to the more expensive brands that could be double the cost. | 101 | They didn't fit my sons foot so I had to give them away. Such a waste of money! | They fit nice around top half of the foot securing The foot ... | These fit my foot like a glove and were as I expected | they fit great after you pull and tug to get your foot ... | I would of sent them back however my daughter love them so much that she forced her feet in | They did not fit my car, and to return ... | These fit, but they're also tight! My foot ... | They didn't fit well. My toes kept coming out ... | They couldn't fit my daughter so i gave them to someone else who loved them. |
102 | who commanded the japanese forces in the battle of wake island | Wake Island some of the civilian laborers were enslaved by the Japanese and tasked with improving the island's defenses. The island's Japanese garrison was composed of the IJN 65th Guard Unit (2,000 men), Japan Navy Capt. Shigematsu Sakaibara and the IJA units which became 13th Independent Mixed Regiment (1,939 men) under command of Col. Shigeji Chikamori. The Japanese-occupied island (called by them Ōtorishima (大鳥島) or "Big Bird Island" for its birdlike shape) was bombed several times by American aircraft; one of these raids was the first mission for future United States President George H.W. Bush. After a successful American air raid on | The US never recaptured Wake Island because of its strategy of 'island hopping', which involved bypassing certain Japanese-held territories and invading ones that were of significant importance. This policy of 'island hopping' was started due to the lack of resources that were being deployed to the Pacific theater of operations. Because America agreed to the Allies' grand strategy of dealing with Germany first, with a majority of equipment and troops being sent to Europe, commanders adopted tactics and policies that suited their available forces. So in the case of Japanese bases on Rabul and in this case, Wake, the islands were heavily bombarded in order to reduce their capabilities as staging areas, and were ultimately bypassed. Other islands, such as Guadalcanal and Saipan, were invaded for their ability to hold an airbase and their strategic location (The former being close to Austrailia and the latter having an airbase for B-29 use). | Because there were more useful locations that were taken instead. Wake was most important for keeping the Hawaii Philippines route open, as well as scouting the Marshall Islands to the South. With the fall of the Philippines the Allies shifted the strategic focus South first to defend Australia, and then to the Solomon islands. However once the counter offensive of the Allies got rolling it bent South of Wake and seized the Marshalls instead. This allowed for the usage of large easily accessed lagoons as fleet bases which was not to be found at Wake. From there the fleet moved West and North again to take the Marianas. Islands there such as Guam, Peleliu, and Tinian were large enough to support heavy bombers like the B-29 to reach the Home Islands. And to then support the invasion of the Philippines and Home Islands. Wake was simply left to wither on the vine and bombarded into impotency. | Battle of Shanggao The Battle of Shanggao (), also called Operation Kinkō (), was one of the 22 major engagements between the National Revolutionary Army and Imperial Japanese Army during the Second Sino-Japanese War. On March 14, 1941, the Japanese 11th army attacked the headquarters of the Chinese 19th army. Fierce fighting broke out, and a series of bloody see-saw battles continued as both sides contested the position. On March 15, after the base was lost to the Japanese, a Chinese air strike destroyed Japanese food and ammo reserves, demoralizing the Japanese and stalling their attack on the Chinese troops, | facilities was started. Now under U.S Army control, the island, which is located north of Kwajalein Atoll, became a rocket launch site for the Kwajalein Missile Range known as the Wake Island Launch Center. In July 1995, various units of the U.S. military established a camp on Wake Island to provide housing, food, medical care and social activities for Chinese illegal immigrants as part of "Operation Prompt Return" (also known as "Joint Task Force Prompt Return"). The Chinese immigrants were discovered on July 3 on board the "M/V Jung Sheng Number 8" when the 160-foot-long vessel was interdicted by the | What battle ended japanese threat to hawaii? | Japan campaign of 500,000 Japanese citizens (mostly civilians), as well as the loss thousands of aircraft and flak guns. The Allies, in turn, only lost a few hundred aircraft (mostly bombers) to Japanese anti-air defenses and fighters. In early 1945, there were two major island battles: There were also two naval battles: Allied warships also bombarded several Japanese cities during July and August 1945. The battles of Iwo Jima and Okinawa foretold what was to be expected when the Japanese Home Islands were attacked. Iwo Jima and Okinawa were lost only after extremely fierce resistance was overcome. In both cases, the Japanese | Japan campaign of 500,000 Japanese citizens (mostly civilians), as well as the loss thousands of aircraft and flak guns. The Allies, in turn, only lost a few hundred aircraft (mostly bombers) to Japanese anti-air defenses and fighters. In early 1945, there were two major island battles: There were also two naval battles: Allied warships also bombarded several Japanese cities during July and August 1945. The battles of Iwo Jima and Okinawa foretold what was to be expected when the Japanese Home Islands were attacked. Iwo Jima and Okinawa were lost only after extremely fierce resistance was overcome. In both cases, the Japanese | 102 | Battle of Wake Island working anti-aircraft director among them); eighteen Browning heavy machine guns; and thirty heavy, medium and light water- and air-cooled machine guns. On 28 November, naval aviator Commander Winfield S. Cunningham, USN reported to Wake to assume overall command of U.S. forces on the island. He had 10 days to examine the defenses and assess his men before war broke out. On 8 December, just hours after the attack on Pearl Harbor (Wake being on the opposite side of the International Date Line), 36 Japanese Mitsubishi G3M3 medium bombers flown from bases on the Marshall Islands attacked Wake Island, destroying eight | how many crew members were on wake island when it was evacuated | when did the camp on wake island open | what was the japanese garrison on wake island | Why was Wake Island never recaptured by the US during WWII? | Why did the US allow the Japanese to keep Wake Island throughout the Second World War? | who flew the flag on wake island in 1898 | when did wake up wa start broadcasting | how many copies ofhes of the wake sold in the us |
103 | who made the ford tvr griffith 400 | TVR Griffith Width: Wheelbase: Front track: Rear track: Ground clearance: On 8 September 2017, to coincide with the marque's 70th anniversary year at the Goodwood Revival, a new Griffith was revealed under the now resurrected TVR marque, featuring design work by Gordon Murray. It features a Cosworth modified Ford Coyote 5.0-litre V8 engine producing , double wishbone suspension with adjustable coilover dampers, a carbon fibre ground effect chassis.. It can accelerate from 0 to in approximately 4 seconds and can achieve a top speed in excess of . The new Griffith retains the manual transmission as used in the previous TVR models | including Peugeot itself with the 206-cc. Three models of the 1930s were the Peugeot 202, Peugeot 302, and Peugeot 402. These cars had curvaceous designs, with headlights behind sloping grille bars, evidently inspired by the Chrysler Airflow. The 2.1-liter 402 entered production in 1935 and was produced until the end of 1941, despite France's occupation by the Nazis. For 1936, the new Airflow-inspired 302 (which ran until 1938) and a 402-based large model, designed by Andrean, featured a vertical fin and bumper, with the first high-mounted taillight. The entry-level 202 was built in series from 1938 to 1942, and about | Rover 200 / 25 of the Volkswagen Golf was called the Jetta, and Vauxhall would soon launch an Astra-based saloon called the Belmont. The Rover 200 Series, however, was not based on a hatchback. Earlier in 1984, Austin Rover had confirmed that the successor to the Acclaim would be badged as a Rover rather than a Triumph - a decision which signalled the end for the Triumph brand. Essentially, the 200 series was a British-built Honda Ballade, the original design of which had been collaborated upon by both companies. Engines employed were either the Honda Civic derived E series 'EV2' 1.3-litre 12-valve engine, or | Massey-Harris Model 101 used the same 124 in³ (2,031 cc) engine of the later 81 and 20, and produced 31 hp (23 kW) at the belt, Manufactured by Continental, it was used in many Massey Harris tractors at the time, as well as by the Cockshutt 20 and Oliver Super 44. The comparable kerosene (tractor vaporising oil, or TVO, in Britain) version was known as the 102 Junior. In 1940, the 124 in³ engine was replaced by a 140 in³ (2,293 cc) Continental of 19 drawbar/23 belt hp (14/17 kW) and in 1943 with a 162 in³ (2,654 cc) version. While the C$895 | The Rolls-Royce/MAN Turbo RB.153 was a high-performance dry thrust turbofan engine developed jointly by Rolls-Royce Limited and MAN Turbo. Developed for the German EWR VJ 101D interceptor with a German-developed thrust-deflector system. The engine was also proposed for a number of other military VTOL projects including the Hawker P.1157 and Dornier Do 31. A commercial-version of the engine was also considered for the Messerschmitt Me P.160 airliner. The VJ101D project was cancelled and the engine never flew, being retained as a test bed.
Applications
EWR VJ 101D cancelled.
Specifications
See also
References
Notes
Turbofan and turbojet engines: database handbook p395 (2007) By Élodie Roux
1960s turbofan engines
RB153 | The Johnson Rocket 185 was a 1940s American two seat cabin monoplane designed by Johnson and built at Fort Worth, Texas.
Development
Johnson originally built a homebuilt Rocket 125 which first flew in 1942. The Rocket 125 was a low-wing cabin monoplane powered by a Lycoming O-290 engine. He developed the design into the Rocket 185 with a 185 hp (138 kW) Lycoming O-435-A engine and retractable landing gear. It was a high performance aircraft for the late 1940s with a top speed of 180 mph (290 km/h). In August 1945, Fred Pittera who had been an Advanced Military Pilot Training instructor on the four-engine B-24 Bomber at the nearby Fort Worth Army Air Field, joined the Johnson Rocket Aircraft as a test pilot, flying the P-39 aircraft look-alike through its various test regimens and finally in late 1945 flew the Johnson Rocket 185 with an FAA flight examiner for its first production qualification approval. A Federal Aviation Authority Type Certificate was issued on 10 September 1946. Introduced in August 1945, the Rocket 185 was pitched with the phrase "get a super-performing airplane for only $5,000 – order your 'Rocket' now!". A sales tour began in June 1946. However, because of its high performance and limited seating (two, sometimes three), the market was limited to experienced pilots and only 18 were built.
A four-seat variant was produced as the Bullet 125 but all rights to the two designs were sold on in the early 1950s. The new owner of the design was the Aircraft Manufacturing Company based at Tyler, Texas. They developed a variant of the Bullet powered by a Menasco inline engine and named the Texas Bullet 205 but it was not successful.
Specifications (Rocket 185)
See also
References
Notes
Bibliography
1940s United States civil utility aircraft
Single-engined tractor aircraft
Low-wing aircraft
Aircraft first flown in 1945 | George Brayton and Oil Engines". The petroleum engine in these tests was made by the "New York and New Jersey Ready Motor Company". This is followed by a similar analysis of Simon's engine which was an adaptation of the Brayton engine made by Louis Simon & Sons, in Nottingham, UK and marketed as "The Eclipse Silent Gas Engine". The Simon engine had an added complexity in that it injected some of the water/steam heated by the engine/exhaust into the engine. The indicator diagrams for this engine are also reported by Dugald Clerk and show that the addition of the water has little | Great fit and ride. These do fit 1980-96 Ford Broncos with front quad shock set ups. The 344049 is the FR, and the 344076 is the FF. | 103 | copies of the 400 and 10 600s off the assembly line at the Griffith factory in Plainview, Long Island, N.Y, USA, the company was dissolved. TVR Griffith 400 The TVR Griffith Series 400 is a 2-door coupe sports car produced by Griffith Motor Company in Plainview, New York ( a Ford Dealer in Plainview/Hicksville NY, Long Island ), between 1964 and 1967. It is the successor to the TVR Griffith 200, featuring improved cooling via a larger radiator with twin electric fans, redesigned rear suspension, and a redesigned rear with better visibility and the round taillights sourced from the Ford | where is the cessna 400 being made | when was the carolina dodge dealers 400 added | how many hp does a chevrolet 400 super sport have | when did the first mitsubishi gv4 come out | when did the jaguar s100 go on sale | For the price you can't go wrong with the 400 ... | where was the original packard 200 car produced | what system did the atari 400 and 800 use |
104 | Metric Regularity Relative to a Cone | Regularity Theory for Mean Curvature Flow | We give some estimates for the volume of a cone with vertex a submanifold P of a Riemannian or Kaehler manifold M. The estimates are functions of bounds of the mean curvature of P and the sectional curvature of M. They are sharp on cones having a basis which is contained in a tubular hypersurface about P in a space form or in a complex space form. | Regularity theory for $2$-dimensional almost minimal currents I: Lipschitz approximation | In order that isothermal parameters exist it is necessary to impose on the metric some regularity assumptions. In fact, it was shown recently by Hartman and Wintnerl that it is not sufficient to assume the functions E, F, G to be continuous. So far the weakest conditions under which the isothermal parameters are known to exist were found by Korn and Lichtenstein.2 To formulate their theorem we recall that a function f(x, y) in a domain D of the (x, y)-plane is said to satisfy a Holder condition of order X, 0 | Fixed point theorems for metric spaces with a conical geodesic bicombing | Maximal Regularity In Continuous Interpolation Spaces And Quasilinear Parabolic Equations | Let $(\Omega,K_{\Omega})$ be a convex domain in $\mathbb C^d$ with the Kobayashi metric $K_{\Omega}$. In this paper we prove that $m$-convexity is a necessary condition for $(\Omega, K_{\Omega})$ to be CAT(0) if $d=2$. Moreover, when $\Omega \subset \mathbb{C}^d, \: d\geq3$, we obtain a similar result with the further smoothness assumption on its boundary. | On the Index of Differential Operators on Manifolds with Conical Singularities | 104 | The purpose of this paper is to discuss some of the highlights of the theory of metric regularity relative to a cone. For example, we establish a slope and some coderivative characterizations of this concept, as well as some stability results with respect to a Lipschitz perturbation. | This paper sheds new light on regularity of multifunctions through various characterizations of directional Hölder/Lipschitz metric regularity, which are based on the concepts of slope and coderivative. By using these characterizations, we show that directional Hölder/Lipschitz metric regularity is stable, when the multifunction under consideration is perturbed suitably. Applications of directional Hölder/Lipschitz metric regularity to investigate the stability and the sensitivity analysis of parameterized optimization problems are also discussed. | Lipschitz Continuity of the Solution Mapping of Symmetric Cone Complementarity Problems | A cone generalized b-metric like space over Banach algebra and contraction principle | Abstract Recently, Du [W.-S. Du, A note on cone metric fixed point theory and its equivalence, Nonlinear Anal. (2009), doi:10.1016/j.na.2009.10.026 ] introduced the notion of TVS-cone metric space. In this paper we present fixed point theorem for nonlinear quasi-contractive mappings defined on TVS-cone metric space, which generalizes earlier results obtained by Ilic and Rakocevic [D. Ilic, V. Rakocevic, Quasi-contractions on a cone metric space, Appl. Math. Lett. 22 (2009) 728–731] and Kadelburg, Radenovic and Rakocevic [Z. Kadelburg, S. Radenovic, V. Rakocevic, Remarks on quasi-contractions on a cone metric space, Appl. Math. Lett. 22 (2009) 1674–1679]. | Some Common Fixed Point Theorems in Cone Rectangular Metric Space under T – Kannan and T – Reich Contractive Conditions | Limiting Subdifferential Calculus and Perturbed Distance Function in Riemannian Manifolds | We study the Abreu's equation in n-dimensional polytopes and derive interior estimates of solutions under the assumption of the uniform K-stability. 1 2 CHEN, HAN, LI, AND SHENG Donaldson [11] also considered a stronger version of stability which we call uniform K-stability in this paper. Under the assumption of the uniform K-stability, Donaldson [11] derived interior estimates for solutions of the Abreu's equation (1.1) satisfying Guillemin's boundary conditions in polytopes in the case of dimension 2. Donaldson [13] subsequently solved (1.1) when A is constant in the 2 dimensional case, and hence proved the existence of metrics with constant scalar curvature on 2-dimensional toric varieties. Recently, Chen, Li and Sheng [6], [7] generalized this result and proved the existence of metrics with prescribed scalar curvature on 2-dimensional toric varieties.These works suggest that the uniform K-stability is the correct notion of the stability associated with the existence of metrics with prescribed scalar curvature on toric varieties. Indeed, Chen, Li and Sheng [8] proved that the uniform K-stability is a necessary condition of the existence of solutions of (1.1) satisfying Guillemin's boundary conditions. It is natural to ask whether such a uniform K-stability is a sufficient condition. Results by Donaldson [13] and by Chen, Li and Sheng [6], [7] answered this question affirmatively in the 2-dimensional case.It remains an open problem to study the existence of metrics with prescribed scalar curvature in higher dimensional toric varieties.Recently, there have been several results on the pure PDE aspects of the Abreu's equation. Feng and Székelyhidi [14] studied periodic solutions of the Abreu's equation and proved the existence of a smooth periodic solution of (1.1) if A is periodic and has a zero average. Chen, Li and Sheng [4] studied the Abreu's equation in bounded, smooth and strictly convex domains and proved the existence of smooth solutions of (1. | A NOTE ON A RESIDUAL SUBSET OF LIPSCHITZ FUNCTIONS ON METRIC SPACES |
105 | which novel by robert graves was adapted for radio by robin brooks | first novel, "The Whistling Song" with cover illustrations by Curt Kirkwood was published in 1991 and his second novel, "Distortion" in 2000. Two novellas, "Some Phantom" and "No Time Flat" were published in 2006 and have been described as a cross between "The Turn of the Screw" and Herk Harvey's "Carnival of Souls". Robert Gluck said, "Stephen Beachy is a visionary. In these twin novellas, he explores madness and crime with the nocturnal lyricism of empty time and space." His novel "boneyard," was published in 2011. It is a collaboration with a young Amish boy, Jake Yoder, whose existence is | book, television and film formats. Examples of American radio comedy can be heard on streaming internet radio stations. Humorous storytelling is the focus of "The Moth Radio Hour". Garrison Keillor's "A Prairie Home Companion" can be heard on public radio stations in the United States and a different version of the shows can be heard on BBC Radio 4 Extra and RTÉ under the name "Garrison Keillor's Radio Show". Old shows can be listened to online at the websites of "A Prairie Home Companion" or RTÉ. British radio comedy can be heard on BBC Radio 4, BBC Radio 2 and | The Radio Man is a science fiction novel by American writer Ralph Milne Farley. It is the first book in Farley's Radio Man series. The novel was originally serialized from the June 28, 1924 issue of Argosy. It was first published in book form in 1948 by Fantasy Publishing Company, Inc. in an edition of 1,000 copies. Modern publishers often release The Radio Man under the title An Earth Man on Venus.
Plot introduction
The novel concerns electrical engineer Myles Cabot, who disappears from his home in Boston while performing an experiment. He finds himself transported to the planet Venus where he is captured by the Formians, a race of ant-like creatures. After learning of the Cupians, a human-like race that is subservient to the Formians, Cabot escapes and falls in love with the Cupian princess Lilla. He goes on to introduce the Cupians to gunpowder and leads them in a revolt against their Formian masters.
Adaptations
Wally Wood illustrated a 26-page adaptation of the story in a one-shot comic book entitled An Earth Man on Venus for Avon Periodicals in 1951, with cover by Gene Fawcette. The story was reprinted in Strange Planets #11 from I.W. Enterprises in the early 1960s. with cover by Ross Andru and Mike Esposito.
See also
Planetary romance
Venus in fiction
Sources
External links
1948 American novels
American science fiction novels
Novels first published in serial form
Novels set on Venus
Works originally published in Argosy (magazine) | Millard Lampell (January 23, 1919 – October 3, 1997) was an American movie and television screenwriter who first became publicly known as a member of the Almanac Singers in the 1940s.
He was born in Paterson, New Jersey and studied at the West Virginia University, where he gained his first exposure to folk music. In 1940 he formed the Almanac Singers with Pete Seeger and Lee Hays, later adding Woody Guthrie. Lampell wrote songs with both Seeger and Guthrie, and adapted traditional songs into labor anthems and pro-union messages. During the period of the Hitler-Stalin pact from 1939 to 1941, the group also sang songs attacking Franklin D. Roosevelt as a warmonger and opposing Britain's war against Nazi Germany.
After the Almanac Singers disbanded in 1942, Lampell wrote the lyrics for The Lonesome Train, a ballad opera on the death of Abraham Lincoln, with music composed by Earl Robinson. He went on to a career as a scriptwriter for movies and, later, television. In the 1950s, he refused to testify before the House Un-American Activities Committee and was blacklisted. He wrote the screenplay for the marriage guidance film This Charming Couple (1950) using the pseudonym H. Partnow. Some other of his screenplays were Blind Date (1959), The Idol (1966) and Do Not Fold, Staple, Spindle or Mutilate (1967).
Notable television plays included The Adams Chronicles and the mini-series Rich Man, Poor Man (both 1976). In 1966, he was awarded an Emmy for his teleplay for the Hallmark Hall of Fame drama Eagle in a Cage. He also wrote novels, and the play The Wall which was produced on Broadway.
Lampell died of lung cancer in 1997 at the age of 78.
External links
1919 births
1997 deaths
Writers from Paterson, New Jersey
American male screenwriters
American folk singers
Deaths from lung cancer
Deaths from cancer in Virginia
20th-century American singers
Screenwriters from New Jersey
20th-century American male writers
20th-century American screenwriters | I tried this one out on Audiobook but DNF'd it. I absolutely love The Adventures of Robin Hood. If there's a movie out there based off of Roger Lancelyn Green' story, you can bet I've seen it! So I HAD to add Hood to the list, of course. Unfortunately, it did not hold my interest for very long. I DNF'd at 33% in. The book is very detailed and descriptive. I hope to try it again in actual print in the future. | Hey, r/audiobooks! We wanted to let you know about our latest audio release, a Sci-Fi Thriller narrated by the great R.C. Bray (The Martian, Expeditionary Force). OPTIONAL RETIREMENT PLAN, by Chris Pourteau, is perfect for fans of the Expanse, Minority Report, and Titanborn.
*Join retired assassin, Stacks Fischer, on the run across the solar-system as he fights to survive against his old employers. They want to erase the secrets he knows... he just wants to live...*
**"A smart, character-driven story that keeps you guessing to the last page."** \-- Jason Anspach, bestselling author of *Galaxy's Edge*
"**One of the finest writers I've ever had the pleasure to read..."** \-- Jasper T. Scott, *USA Today* bestselling author of the *Rogue Star* series
Audible link: | Amos Garrett Roberts took John Hammond, Jr., to see Levon and the Hawks for the first time. The Hawks would later be recommended by Hammond to Bob Dylan. In 1968, Garrett began a two-year stint of touring and recording with the Canadian duo Ian & Sylvia, which led to becoming a founding member of Great Speckled Bird. This band is featured in the film "Festival Express", playing the song "C.C. Rider" with members of the Grateful Dead and Delaney Bramlett in 1970. As a special feature on the DVD release of the film, Great Speckled Bird is shown playing the Dylan-Manuel song | I really enjoy listening to the audio books. The Vince Flynn books are all great listens and Extreme Meausres was probably the best. | 105 | I, Claudius (radio adaptation) I, Claudius is a six-part 2010 radio adaptation of the novels "I, Claudius" and "Claudius the God" by Robert Graves. Broadcast as part of the "Classic Serial" strand on BBC Radio 4, it was adapted by Robin Brooks and directed by Jonquil Panting, with music composed by David Pickvance. Claudius was played by Tom Goodman-Hill and the series' cast is also notable for including Derek Jacobi, who played Claudius in the 1976 BBC TV adaptation of the same works. The series was released as a BBC Audiobook on 6 January 2011. It won the 2012 Audie | who directed the 2010 radio adaptation of 'i claudius' | who directed the radio adaptation of i claudius | who created the radio 4 adaptation of the martian chronicles | who produced the adventures of nero wolfe radio series | when did iv play come out on radio | who was appointed chairman of the bbc's musicians union in 1976 | who was the presenter of manx radio's'solace in wicca' | who directed the radio 4 play 'the better half' |
106 | I am sure he will love it as it is a heavy weight flannel | This was a gift. He carries it, so, it can't be terrible. :)
But I think it might be a little bulky. Maybe needs more time to get all flattened out/compressed by his arse.
Color is great. Not easy to lose. | Will give as Christmas present. I'm sure nephew will love it | True to size and light weight for summer. Goes with any shirt and so cute! Also a good idea for potty training because he can easily pull them down himself. | It is too large and will not work, we are getting the pants hemmed and he will be able to wear the jacket :( he wears a size 4t at all other stores. | bought as a present have not seen the child's reaction yet but I think he will love it | This shirt is also a gift, and I know he'll love it. | My daughter loves it. It's a little big but after a few washes it will be perfect! | This was a great buy! It was given as a gift and has been worn at least 10 times since then. It's his favorite scarf! | 106 | I got this shirt for my son for Christmas....I am sure he will love it as it is a heavy weight flannel. Well worth the price! | ... this shirt for my nephew for Christmas and he loved the design | The quality and weight of this shirt is excellent. Far heavier than Bean's flannels | My son loves this shirt. The fabric is very ... | i bought this shirt for my son and I'm super happy i did | Yo anyone want this shirt? | This is very nice. I bought it as a summer shirt to ... | I would not recommend ordering this shirt at all | Wonderful shirt! I bought this for my boyfriend for ... |
107 | what is the total number of residues in complement component 4 | Complement component 4 undergoes proteolytic cleavage into three chains (in order of how they are chained, β-α-γ). The β-chain consists of 656 residues, coded by exons 1-16. The most prominent aspect of the β-chain is the presence of a large intron, ranging from six to seven kilobases in size. It is present in the first locus (coding for C4A) for all C4 genes and in the second locus (coding for C4B) only in a few C4 genes. The α-chain consists of residues 661-1428, encoding exons 16-33. Within this chain, two cleavage sites marked by exons 23 and 30 produces the C4d fragment (where | A foundation is laid for discussion of the various features of complement-fixation reactions in terms of clearly defined concepts and a uniform notation. | The fourth component of complement (C4) in man has an important central role in the classical pathway of complement activation. It interacts with other complement components (C1, C2, C3) and binds covalently to antibody or antigen on cell surfaces. The highly complex polymorphism is thought to relate to its diversity of function (Porter 1983) and is limited, with one reported exception (Mauff et al. 1983a), to the ∝ chain of the molecule or more precisely to the C4d (∝2) fragment (Tilley et al. 1978, Mevag et al. 1981). Since the C4d fragment contains structures involved in the activation, inactivation and covalent binding of C4 and also 13 of the 15 reported nucleotide sequence differences (Belt et al. 1985), Porter suggests that the ∝ chain is probably on the exterior of the C4 molecule. | Complement (music) other intervals the complements are the same as above (for instance a perfect fifth, or 7, is the complement of the perfect fourth, or 5, 7+5 = 12 = 0 mod 12). Thus the #Sum of complementation is 12 (= 0 mod 12). In musical set theory or atonal theory, "complement" is used in both the sense above (in which the perfect fourth is the complement of the perfect fifth, 5+7=12), and in the additive inverse sense of the "same" melodic interval in the opposite direction - e.g. a falling 5th is the complement of a rising 5th. In twelve-tone | The opsonic fragment of the third component of human complement (C3) | Biochemical Abnormalities of the Third Component of Complement in Neonates | Multiallelic copy number variation in the complement component 4A (C4A) gene is associated with late-stage age-related macular degeneration (AMD) | in AH50). Increased CH50 values may be seen in cancer or ulcerative colitis. Decreased CH50 values may be seen in cirrhosis or hepatitis or Systemic lupus erythematosus. Total complement activity Total complement activity is a test performed to assess the level of functioning of the complement system. The terms "CH50" or "CH100" may refer to this test. The test is based on the capacity of a serum to lyse sheep erythrocytes coated with anti-sheep antibodies (preferably rabbit IgG). In combination with the Alternative pathway hemolytic assay ("AH50") it can indicate terminal pathway deficiencies (C3, C5-C9; absence of hemolysis in both | 107 | Complement component 4 point in time, the genomic and derived amino acid sequence of either C4A or C4B had yet to be determined. The early studies vastly expanded the knowledge of the C4 complex, laying down the foundations that paved the way to discovering the gene and protein structures. C. Yu successfully determined the complete sequence of the human complement component C4A gene. In the findings, the whole genome was found to have of 41 exons, with a total of 1744 residues (despite avoiding the sequence of a large Intron 9). The C4 protein is synthesized into a single chain precursor, which then | Amino acid sequence around the proposed thiolester bond of human complement component C4 and comparison with the corresponding sequences from C3 and α2-macroglobulin | A physical map of the human regulator of complement activation gene cluster linking the complement genes CR1, CR2, DAF, and C4BP | Effects of cell differentiation on the synthesis of the third and fourth component of complement (C3, C4) by the human monocytic cell line U937. | Nonsense-codon-mediated decay in human hereditary complement C3 deficiency | who discovered the two components of complement system | Characterization and expression analysis of a complement component gene in sea cucumber (Apostichopus japonicus) | To find protein-protein interactive sites in complement component C3, we examined regions of C3 that are proximal to sites of length polymorphism or indels in the C345 protein family. We reasoned that indels probably mark protein interactive sites because they usually involve residues at protein surfaces. To test for the involvement of individual indels, we examined the effects on complement function of synthetic peptides corresponding to indel-proximal segments of C3. We inferred that if such a segment made direct contact with a C3 binding protein, then the corresponding peptide might also bind to that protein and inhibit binding to C3. Twenty-one peptides were tested; four of these inhibited complement-mediated erythrocyte lysis at | Detection of mRNA for the terminal complement components C5, C6, C8 and C9 in human umbilical vein endothelial cells in vitro |
108 | What’s the status of God in philosophy? | Who is the god of this world? | Who are the real God? | God in Abrahamic religions is One". God is conceived of as eternal, the creator of the universe, and the source of morality. God has the power to intervene in the world. The term God thus corresponds to an actual ontological reality, and is not merely a projection of the human psyche. Maimonides describes God in this fashion: "The foundation of all foundations and the pillar of wisdom is to know that there is a Primary Being who brought into being all existence. All the beings of the heavens, the earth, and what is between them came into existence only from the truth of His | Which religion is Albert Einstein? | God in Christianity the 1251 list of the Fourth Lateran Council which was then adopted at Vatican I in 1870 and the Westminster Shorter Catechism in the 17th century. Two attributes of God that place him "above" the world, yet acknowledge his involvement "in" the world, are transcendence and immanence. Transcendence means that God is eternal and infinite, not controlled by the created world and beyond human events. Immanence means that God is involved in the world, and Christian teachings have long acknowledged his attention to human affairs. However, unlike pantheistic religions, in Christianity God's being is not of the substance of the | What is the nature of God according to Judaism? | Term for the belief in the existence of god? | Which sun god as the patron of prophecy music and medicine? | 108 | Although most philosophers are atheists, is philosophy moving more toward the existence of God or against? The Kalam and Aquinas arguments are really good defense for the existence of god. However, does god most likely to exist according to philosophy? | Is Atheism a worldview or a philosophical position? | What are the atheistic existentialist and comparison to Christianity? | Why did Christian existentialism fail to become as popular as atheist existentialism? | Does the God debate = Justified True Belief + The Absurd? | Atheism is the default position in regards to theism | Does atheism have any basis for objective morality? | Can atheists go to heaven? | Is there a difference between criticizing theism and criticizing atheism? |
109 | (E)-1-(2,4-Dichlorobenzylidene)thiosemicarbazide | In the title compound, C13H10N2S, the dihedral angle between the imidazole and thiophene rings is 16.89 (19)°, and the double bond adopts an E configuration. In the crystal structure, N—H⋯N hydrogen bonds link the molecules into rows along b. There is also evidence of weak C—H⋯S interactions. | In the title compound, C15H16N2O4S, the dihedral angles between the planes of the benzodioxole and ester groups and the plane of the six-membered tetrahydropyrimidine ring are 89.5 (1) and 20.2 (1)°, respectively. Intermolecular N—H⋯S hydrogen bonds assemble the molecules into dimers, which are further connected via N—H⋯O interactions into chains parallel to [010]. Weak C—H⋯S and C—H⋯π interactions enhance the stability of the crystal structure. | In the title compound, C29H27N3O4S·0.5C6H14, the heterocyclic thiazine ring adopts a half-chair conformation with the S and N atoms displaced by 0.500 (5) and 0.229 (5) A, respectively, on opposite sides from the mean plane formed by the remaining ring atoms. The mean planes of the pyrazole ring and the benzene ring bonded to it form a dihedral angle of 35.76 (11)° and an intramolecular O—H⋯O hydrogen bond ocurs. The crystal structure features O—H⋯O and C—H⋯O hydrogen bonds. There is a half-molecule of hexane in the asymmetric unit lying about an inversion center. It is disordered over two sets of sites with occupancy factors 0.590 (9) and 0.410 (9). | Is the second element in the formula of a binary compound named using -ite? | In the title compound, C36H28O4, the two 2-naphthoyl groups at the 1- and 8-positions of the central 2,7-diethoxynaphthalene ring system are aligned almost antiparallel and make a dihedral angle of 48.35 (5)°. The dihedral angles between the central 2,7-diethoxynaphthalene ring system and the terminal naphthalene ring systems are 77.64 (4) and 73.73 (4)°. In the crystal, molecules are linked into chains along the a-axis direction by dual C—H⋯O interactions between naphthoyl groups. | The title compound, dl-threonine–arsenic acid (1/1), C4H9NO3·H3AsO4, is an unusual adduct containing zwitterionic threonine and neutral arsenic acid molecules. The component species interact by way of N—H⋯O and O—H⋯O hydrogen bonds, leading to parallel [001] chains of threonine and arsenic acid molecules which are crosslinked by further O—H⋯O and N—H⋯O bonds, resulting in a three-dimensional network. | In the title compound, C20H22N42+·2I−·H2O, the two imidazolium rings are twisted away from the central naphthalene plane by 76.6 (1) and 74.5 (1)°. The crystal packing is stabilized by O—H⋯I, C—H⋯O and C—H⋯I hydrogen bonds. | The structure of the title complex has been determined by single-crystal X-ray diffraction. The complex belongs to the space group P21/a(Z= 4) and the data has been refined to R= 0.042 from 4 073 reflections [F > 3σ(F)]. The complex contains [AsPh4]+ cations and pseudo-octahedral cis[Ru(DL-MeSeCH2CH2SeMe)Cl4]– anions [Ru–Se 2.446(1), 2.457(1); Ru–Cl(trans Se) 2.386(2), 2.404(2); Ru–Cl(trans Cl) 2.344(2), 2.353(2)A]. The diselenoether adopts the DL conformation, and is the first example of this invertomer to be structurally characterised. | 109 | In the crystal structure of the title compound, C8H7Cl2N3S, the Schiff base is approximately planar. An intramolecular N—H⋯S hydrogen bond stabilizes the molecular structure. The molecules are linked by N—H⋯S and N—H⋯Cl hydrogen bonds, forming a chain along the c axis. | An Enantiomerically Pure Schiff Base Ligand | The Schiff base 3,4-methylenedioxybenzaldehyde semicarbazone | Synthesis, structure and characterization of some Schiff bases bearing phenylferrocene | Low barrier hydrogen bonds in sterically modified Schiff bases | The title compound, C 7 H 10 O 5 , was synthesized by reaction of d-xylose with paraformaldehyde. In the crystal, the central part of the molecule consists of a five-membered C 4 O ring with an envelope conformation, with the methine C atom adjacent to the O atom being the flap. The protected O atoms of both cyclic acetal groups are oriented so that the four chiral C atoms of the furanose part show an R configuration. C-HÁ Á ÁO hydrogen bonds are present between adjacent molecules, generating a three-dimensional network. | Research on Some Aromatic Schiff Base Compounds and Metal Complexes with Different Substituted Groups | In the title compound, C 18 H 27 N 3 OS, the cyclohexane ring has a chair conformation. The azomethine C N double bond has an E configuration. The nearly planar hydrazinecarbothioamide moiety and substituted benzene ring are twisted by 31.13 (5) relative to each other. The amide moiety and the cyclohexane ring are almost perpendicular to each other; a similar conformation was previously observed in reported structures. In the crystal, molecules are linked by N-HÁ Á ÁS hydrogen bonds, forming inversion dimers with an R 2 2 (8) ring motif. | Crystal and molecular structure of 6,7,9,10,12,13,20,21,23,24,26,27-dodecahydrodibenzo[b,n][1,4,7,10,13,16,19,22]octaoxacyclotetracosin (dibenzo-24-crown-8) |
110 | Settlers Cafe on a Sunday afternoon | Anyone know which restaurants in Windsor are open 24 hours? | Staying in Elkhart for the weekend for the game. Where are some good spots for breakfast on a gameday? Should I stick in Elkhart and then head to south bend or go directly to SB? | Cadbury Creme Egg available to play and each of them was shown as a cartoon sketch. It took place between 1 January to 4 April 2012. In 2016, Cadbury opened a pop-up café titled "Crème de la Creme Egg Café" in London. Tickets for the café sold out within an hour of being published online. The café on Greek Street, Soho, was open every Friday, Saturday, Sunday from 22 January, to 6 March 2016. In 2018, Cadbury opened a pop-up camp. The camp in Last Days of Shoreditch, Old Street was open every Thursday to Sunday from 19 January, to 18 February 2018 | There's a possibility of a board game cafe opening in our area in the future. Since Central PA is not a large metropolis like NYC or Toronto, it will be harder for a gaming cafe to thrive around here. So, before this business dumps a bunch of money into the idea, there's the question of: Would you be willing to pay a small fee to game at a gaming cafe or would you only game if it's free?
Feel free to discuss below, but make sure to head to the **MeetUp Poll Page** to submit your official answer. | National Register of Historic Places in 1978. The diner has been held by the same owner for over 28 years. Its signature Custard French Toast has been featured on television's Food Network. Modern Diner The Modern Diner is a historic diner at 364 East Avenue in Pawtucket, Rhode Island, United States. The Modern Diner is one of two known surviving Sterling Streamliner diners still in operation. (The other is the Salem Diner in Salem, Massachusetts. Another lies abandoned on Hix Bridge Road in Westport, Massachusetts.) It was manufactured in 1940 by the John B Judkins Company of Merrimac, Massachusetts, and | National Register of Historic Places in 1978. The diner has been held by the same owner for over 28 years. Its signature Custard French Toast has been featured on television's Food Network. Modern Diner The Modern Diner is a historic diner at 364 East Avenue in Pawtucket, Rhode Island, United States. The Modern Diner is one of two known surviving Sterling Streamliner diners still in operation. (The other is the Salem Diner in Salem, Massachusetts. Another lies abandoned on Hix Bridge Road in Westport, Massachusetts.) It was manufactured in 1940 by the John B Judkins Company of Merrimac, Massachusetts, and | I was wondering if anyone knew of any 24 hr restaurants, fast food, or caterers downtown Toronto.
I ask because our office runs on a 24 hr, 3 shift system. The day shift and afternoon shift will often get food delivered from various places, from Pizza places, to Catering, to some restaurant food.
While on the night shift, we are limited to Pizza (basically) and those places usually close at 1 or 2am depending. There are McDonalds and Tim Hortons not far that are open, but we are looking for something more.
Recently we got food catered to us, but it came at 10pm (latest they would deliver). Unfortunately this is not an optimal solution since most of the night staff starts work at 11pm or midnight. An hour or 2 AFTER food has arrived for them to eat. This is at the start of our shift, most people do not actually eat lunch until 2-4am.
So by then the food is now 4-6 hrs old. A nice gesture from management, but not a great solution. | There have been a lot of places setting up, but it's hard to know when they all open (some have social media presences and some don't). I wanted to know if there are any places that have just moved in, that people notice opening recently. Basically to share cool new business in the Hamilton area!
I found out Copper Branch at limeridge has finally opened (people were waiting for that one for a long time), and still waiting on news about an esports/LAN cafe that's been getting set up near McMaster. | 110 | I was thinking of going over to Settlers Cafe this afternoon to play some boardgames with some strangers. I'm visiting from the US by myself and wanted to hang out, chat with the locals, and play some games. I'm just not sure if anyone will actually be at Settlers. Is anyone familiar with that Cafe? Or better yet, anyone want to join me? | Opening a Board Game Cafe in the Bay Area - Please take our survey | I plan to open a gaming cafe. Need help, advice, any guidance. | I am opening a board game cafe in Edmonton Alberta called Table Top Cafe. Looking for feedback/input and answering any questions that I can. | Gaming Cafe for foreigner in Xuhui district? | Boardgaming in Wellington - Is anyone interested? | Anyone in the Bay Area want to meet up? | Colony Club people (5th by Northwest) | Anybody down for a meetup on 4/20 in the Burlington Area? |
111 | who lived in the hotel earle in the movie barton fink | Gil Birmingham Birmingham appeared in the film "Crooked Arrows", cast in the role of Ben Logan. Birmingham voiced Wounded Bird in the animated film "Rango" and has provided voice work for the television series "The Wild Thornberrys" (in which he voiced an Inuit elder) and the film "Night at the Museum". He played the partnering Texas Ranger to Jeff Bridges' character in the 2016 bank robbery film "Hell or High Water". In the Chickasaw Nation production of "Te Ata", Birmingham plays Thomas Benjamin 'T.B.' Thompson, Mary Frances 'Te Ata' (Thomoson) Fisher's father. Birmingham attended the film's premiere in Moore, Oklahoma, on September | Gil Birmingham Birmingham appeared in the film "Crooked Arrows", cast in the role of Ben Logan. Birmingham voiced Wounded Bird in the animated film "Rango" and has provided voice work for the television series "The Wild Thornberrys" (in which he voiced an Inuit elder) and the film "Night at the Museum". He played the partnering Texas Ranger to Jeff Bridges' character in the 2016 bank robbery film "Hell or High Water". In the Chickasaw Nation production of "Te Ata", Birmingham plays Thomas Benjamin 'T.B.' Thompson, Mary Frances 'Te Ata' (Thomoson) Fisher's father. Birmingham attended the film's premiere in Moore, Oklahoma, on September | Foster (short story) "Foster" is a short story or novella by Irish author Claire Keegan. 1981 County Wexford, Ireland. A girl is sent to live with foster parents on a farm, while her mother gives birth. She has no notion of when she will return home. In the strangers' house she finds affection she has not known before, and slowly she begins to blossom in their care. But when a secret is suddenly revealed, she realizes how fragile her idyll is. "Foster" has received a very positive reception, winning the 2009 Davy Byrne's Irish Writing Award (it was submitted for | Casey Ryback character named Casey Seagal works at the Spread Eagle Saloon as a line cook and janitor. The character has many physical similarities to Steven Seagal (he has a ponytail and his character model is physically modeled after Seagal), and if the player chooses to accept his help as a Gun for Hire, he eventually opens up about his past as a member of the Navy and how he returned to the town of Fall's End after his service during Operation Iraqi Freedom to heal the severe anxiety he suffers as a result of a botched patrol that resulted in the | said Annakin years later, "although the later Huggett films don't hold up well." Holiday Camp (film) Holiday Camp is a 1947 British comedy drama film directed by Ken Annakin, starring Flora Robson, Jack Warner, Dennis Price, and Hazel Court, and also features Kathleen Harrison and Jimmy Hanley. It is set at one of the then-popular Butlin's holiday camps. It documents a postwar working class London family's first visit to a summer holiday camp. It was the first film to feature the Huggett family, who went on to star in the Huggetts Trilogy. It resonated with post-war audiences and was very | Kevin Anderson (actor) for his role in the revival of "Death of a Salesman". He appeared on Broadway in the Manhattan Theatre Club production of "Come Back, Little Sheba" as Doc from January 24, 2008 to March 16, 2008. Anderson starred as Andy Dufresne in the stage version of the film "The Shawshank Redemption" which premiered at the Gaiety Theatre, Dublin in May 2009. The play transferred to the West End at the Wyndham's Theatre in London, from 4 September 2009 to 29 November 2009. He appeared in "A Guide for the Perplexed" at the Victory Gardens Theater, Chicago in July–August 2010. Anderson | North Star (1996 film) wife, intervenes at gunpoint; McLennon disarms Santeek and the two engage in a fight. After Santeek floors McLennon, he kidnaps Sarah, steals a dogsled and rides off into the Alaskan wilderness. Without the permission of the local sheriff, McLennon forms a posse and treks out into the tundra to kill Santeek and rescue his wife. On the course of the journey, Santeek talks to his captive about her husband's murderous property deed scams, but she does not immediately believe him and re-avows her loyalty to her husband. However, when McLennon and his men locate Santeek's cabin hideout and shoot at | Bridgette Andersen discovering and choosing Andersen for the part. In a contemporary interview, Andersen opined that she and the Driscoll character were "like twins! We do the same things." According to "The Cumberland Times", only three months after the release of "Savannah Smiles", Miller was already writing another script to star Andersen. That same year, Andersen portrayed the six-year-old Mae West in the biographical television film, "Mae West". In 1983, Andersen explained that she preferred working in films versus television because they gave her more to do. During the 1983–84 run of "The Mississippi", Anderson was nominated for a Youth in Film | 111 | Barton Fink home of Jack Lipnick. The spooky, inexplicably empty feel of the Hotel Earle was central to the Coens' conception of the film. "We wanted an art deco stylization", Joel explained in a 1991 interview, "and a place that was falling into ruin after having seen better days". Barton's room is sparsely furnished with two large windows facing another building. The Coens later described the hotel as a "ghost ship floating adrift, where you notice signs of the presence of other passengers, without ever laying eyes on any". In the film, residents' shoes are an indication of this unseen presence; another | what body of water is in the canary wharf hotel | what was the construction style of the harbour view hotel | what is the name of the hotel in the movie clue | what is the cat's name on embassy suites by hilton | which tv detective lived at the randolph hotel | who wrote the lost girls and love hotels | who sings home in hotel cabana with naughty boy | The Glass Hotel |
112 | educational math review toy | I teach 8th grade Algebra and the students were a little shy at first to try this in front of the class using the pre-made questions about money because it was so simple they didn't want to get it wrong in front of the class. When I made up some questions and made a quiz related to the material the students couldn't wait to try it! I love that it gives a score at the end of a quiz. The only thing it needs is a tiny screwdriver and batteries. I would recommend this to teachers of students of any age. | This is an amazingly versatile toy! I am a homeschooling mom for a 5 years old and a 2 year old, and they can both use this toy. They added fractions to this toy and I had no idea it had that when I bought it you can work on logic, colors, addition and subtraction, and they even added a puzzle on the back for the shapes. You can see the different options in the pictures I have added. In addition the quality is wonderful. They put A LOT of thought into this toy. It's one of my favorite toys. | Kindergarten Children’s Interactions with Touchscreen Mathematics Virtual Manipulatives: An Innovative Mixed Methods Analysis | Exampleof math investigatory project? | Online quizzes as a form of assessment in pure mathematics | This paper describes and reflects on a project that introduced animation into assessment for undergraduate students. | Many educational products designed for young children go through extensive user testing, but rarely through a rigorous examination of whether they improve learning. We describe our experiences and lessons learned from conducting a multi-classroom study to examine learning from an iPad math app we developed for preschool and kindergarten children. Focusing on the research experience itself, we describe six common challenges to conducting learning research with technology and young children, as well as six principles to help mitigate the challenges. This paper is intended to help others who wish to assess learning from educational games for children. | Hi all,
I just got my daughter (5) a raspberry pi 3 because she has shown an interest in computers. I have some plans to show her what computers can do and the backbone/coding side (Scratch, Retropie, Minecraft). She is super excited for her "pretty computer". We just built a "rainbow" case for it out of legos last night.
However my wife just told me that she is bored at school, they are not challenging her mentally. Are there any programs that are educational for math/reading/history/etc.? I am looking for something like Math Blasters, Super Solvers, Mario Teaches Typing, and Oregon Trail.
Thank you for your help in advance.
Side note - my first post on Reddit. Hope I am doing things correctly. | 112 | My 8yo twins received this for review and were actually excited to practice math with it during their summer vacation! It requires 2 AA batteries in a rear compartment that can be unscrewed with a coin. As stated in other reviews, the battery door bulges with the batteries inside although it does not affect the function. The screen is a very basic design typical of a calculator but with functions that allow testing in addition, subtraction, multiplication, division, decimals, fractions and percentiles. There are 9 levels for each function and a help button to provide clues. It's simple enough that my 6yo was able to figure it out and the green and red light next to the screen lets the player know if they have the correct answer. It's great for building math skills and since my kids are happy to play with it as an electronic toy I'm very happy | The amount of button batteries in here gives me anxiety | how old was michael dell when he bought his first calculator | Older Game, Batteries may not work | Awesome game! Batteries a bit tricky to put in ... | the batteries are easily gotten to and with 2 young kids isn't the ... | My four year old nephew loved this! A couple batteries and he was good ... | I like that it has batteries | The amount of adults who don't know which way batteries should be put is frankly terrifying |
113 | [Rare Product Inquiry] JWH-073 (US/International) | I have a king mod #IMPROOF edition, with the whole box, and certificate of authenticity, If I get people who would be interested in it, I will post pictures of it, It has no dents kinks or real scratches, so to say it's in great condition. | When I was looking for a DDJ-400 someone posted a stock alert here that helped me out, so I am returning the favor. ProAudioStar has them in stock AND a 15% off coupon code "LB15"... but be aware, it's the gold version. The regular version is not in stock.
(Not affiliated with this vendor, but I have bought a couple of things from them with no issues.) | New here but have been verified on other communities and done business on reddit before.
For Sale is a Pulsar APX Wax. Not the latest and greatest but it’s a cheap concentrates intro and aside from being a bit harsh for hits has gotten some decent feedback.
This unit is brand new. Still in shrink wrap.
photo with time stamp here
For Sale - **40 USD shipped within the USA.**
Why so cheap? I already have a Sai as my daily driver and this was given to me as a gift.
Please let me know if you have any questions. | This was sold to me by Holgadget US, Do Not Buy from them. They sell you half good product and half bad product, they mix it in so you don't know until it's to late and then you can't return. I have reported them, | Update: so after a not too lengthy back and forth with the seller I was able to get $269.94 back and I get to keep the figure. In the end I paid $31.32 for a *very* impressive ko. I’m gonna work on making a YouTube video detailing what I found and hopefully this’ll help others not settle for a ko by mistake.
___________________________________
So I recently purchased an MP-36 Masterpiece Megatron, while the seller advertised it as being authentic, and for the most part from what I’ve compared it looks to be so, I’m starting to scratch my head on this and I’m hoping someone can help.
A couple of details, item came taped shut and never opened, that being said it also didn’t come with the orange plug in either the gun barrel and silencer.
Second issue is the stock, it’s missing the release button.
Thirdly, there’s a bit of packaging tape in the screw hole, same used to tape up the box it arrived in.
Fourthly, after finding the required LR44 batteries, I’ve found the sound from the fusion cannon is very loud and distorted, there’s either a crackling noise or high pitch screeching sound.
Speaking of the fusion cannon, there’s a noticeable gap here on top.
If anyone is interested in any specific pics I’m more than happy to produce, I’m just hoping I didn’t make a mistake here. | JWH-200 JWH-200 (WIN 55,225) is an analgesic chemical from the aminoalkylindole family that acts as a cannabinoid receptor agonist. Its binding affinity, "K" at the CB receptor is 42 nM, around the same as that of THC, but its analgesic potency "in vivo" was higher than that of other analogues with stronger CB binding affinity "in vitro", around 3 times that of THC but with less sedative effect, most likely reflecting favourable pharmacokinetic characteristics. It was discovered by, and named after, Dr. John W. Huffman. JWH-200 is considered a Schedule 9 prohibited substance in Australia under the Poisons Standard (October | I am looking for this piece but on d2l and so on people are asking for many rares and even a key for just the 1 uncommon piece... any reason why? | Timestamps!
&#x200B;
|Item|Condition|Price|
|:-|:-|:-|
|GMK Hyperfuse Origins + Purple Spacebars|Used, in bag.|£220 + shipping|
|~~GMK Botanical Deskmat~~|~~Brand new, has not been used.~~|~~£70 + shipping~~ **SOLD**|
|RAMA x ePBT Ivory PVD Brass Keycap|New, unused.|£90 + shipping|
|RAMA x GMK 9009 Pink Swirl Keycap|New, unused.|£60 + shipping|
|RAMA x GMK 9009 Beige Swirl Keycap|New unused.|£60 + shipping|
|RAMA LNY Keycap|Mounted once.|£120 + shipping|
I can ship worldwide. Thanks for looking! | 113 | Hi, I've been looking for some JWH-073 for a while now on a few markets to no avail, is is still around somewhere? Thank you | sounds great. Not much new here just more JH | when is the next j-xx coming out | [question] Is there still a JB source for 7.0?? | JBL Bar 9.1 no longer available? | when does triple j magazine come out each month | when was the first j7w1 built | Finally time to buy a JHAS... | ... was purchased as a used unit for a very good price. This is my second JX680 |
114 | They are so much more durable and I get WAY better traction! The chain coverage does have some gaps ... | Great price great quality. Buy them here, don't waste your money on the big box store for this item. They do adjust so I don't have the gap other reviewers have mentioned well not bigger than 1/8 inch which I think is normal | These are great and the stay-in-place lining does its job well. My only issue is the point was for them to be no show, and these still tend to show in the corners and look a bit odd. | So this is like the 4th time I've bought these and they always have air gap all around the corners so I won't be buying these again. | Great fit, good modest coverage and great price. Only thing that would make them better is if they were lined or slightly thicker material...not see-thru but could be a little thicker. I anticipate they will wear out sooner than I hope due to the thinner material. | they are unique in style but the rubber treads move and show gaps. They were too cheap to cut them long enough so they stayed in place. This shows a company that tried to save costs and cut quality. | Previous owner said it’s better to just leave these gaps, but they visually annoy me... and I don’t know where to start. Thoughts if this is a simple DIY project for a newbie?
| I made the right choice. THe dead pedal coverage with this is much better than WeatherTech. They do not look / feel like cheap plastic and do not make tapping sound when I tap my toes on it (well, it was one of the doubts I had).
I am planning to buy second and third rows as well from Husky | These won't disappoint you. I love them. Only thing is I wish they came with a gap wedge and 3 iron cover. | 114 | I do snow removal in North Idaho in the winter, and I completely destroyed a pair of the cheap shoe chains that have the wire wound around the rubber. I'm on cross-slopes sometimes and making lots of turns with the snowblower, so the other pair would actually unwind itself from the rubber and then the loose wire would tear the rubber itself until there was so much broken rubber that I had to hold them together with zip ties. I decided enough was enough and bought these. They are so much more durable and I get WAY better traction! The chain coverage does have some gaps so sometimes if I step a certain way I slip a little, but there's enough grip that I always end up grabbing some kind of traction even if I slip a little bit initially. I use these over snow boots so the sizing was a concern, but they fit great and have kept me upright all season. We'll see how they hold up against the salt, but even if I have to buy a new pair every season, they're affordable enough that it's still a great buy. | Great Rubbers to protect your shoes in snow up to about 6" | these hikers are well made and have excellent traction. However | These ICETrekkers provide excellent traction, and they stayed securely on my boots | These have the best traction of any trail shoes I've tried | These are the best for snow skiing | Snow boots for men, focus on traction | These boots are not good for snow! | They are great for running on trails and in wet slippery conditions |
115 | Finally, the guitar support I need | How do they have such crazy sustain in the main guitar line? I want to learn to play it but no clue what to do with that part. | Can you use rockband guitar for guitar hero? | This thing is completely useless and is a really great way to damage your guitar if you miss. | Why doesnt your guitar on guitar hero work? | How do you play a double neck guitar? | Awesome guitar work. I thought this was a couple people playing, | Quint Neck Guitar The Quint Neck Guitar (also known as a five neck guitar) consists of 5 guitar necks, hardware and pick-ups in one oversized body, used by Rick Nielsen from the rock band Cheap Trick. The guitar's birth was first conceived on ruled note book paper by musician Rick Nielsen during one of his frequent scribble sessions. He brought the idea to his manufacturer (Hamer Guitars) to build. The original design sought by Rick was a circular guitar allowing him to spin the guitar from neck to neck. This design was scrapped by Hamer due to weight and logistical | Quint Neck Guitar The Quint Neck Guitar (also known as a five neck guitar) consists of 5 guitar necks, hardware and pick-ups in one oversized body, used by Rick Nielsen from the rock band Cheap Trick. The guitar's birth was first conceived on ruled note book paper by musician Rick Nielsen during one of his frequent scribble sessions. He brought the idea to his manufacturer (Hamer Guitars) to build. The original design sought by Rick was a circular guitar allowing him to spin the guitar from neck to neck. This design was scrapped by Hamer due to weight and logistical | 115 | I tried many different guitar supports in an effort to lift the neck of my guitar high enough. Foot stools aggravated my back injuries, the Dynarette Cushion (which I used for two years) is comfortable but doesn't go high enough and is completely non-adjustable, and the A-Frame was a flimsy, unstable, and instant failure that I regretted purchasing almost immediately.
Enter the ErgoPlay....
I love this thing. It is very stable, comfortable, adjustable, and it can easily raise the guitar nearly a foot. The suction cups actually held on to my flat finish guitar, unlike my experience with the A-Frame Support which couldn't stick to anything. At first I wasn't really sure if I liked it but after a few days of playing with it I felt more and more comfortable with it. I eventually set it up so that it is extended almost to its full length and I don't think I'll ever be able to go back to using any other method.
My only complaint is that I wish it came with a small lint-free carrying bag because the suction cups tend to attract any felt, lint, pet hair, or dust nearby. This support will not fit in most guitar cases. | Offers good support and stays in place | These fenders offer good cushioning and protection | Sturdy guitar stand that takes up little space | The support is great. Will be buying more from this brand | Not supportive (at 34C) weak ribbon-like straps- spillin' out the top | It's a nice fitting underbust and it is great back/spine support regarding ... | Collapsible guitar Stand | needs a support arm to seat base to hold it better. other than that |
116 | ScienceDirect 12 th International Conference on Hydroinformatics , HIC 2016 Accuracy and computational efficiency of 2 D urban surface flood modelling based on cellular automata | A 2D flood inundation model based on cellular automata approach | Urban Flood Control through a Mathematical Cell Model | Numerical modelling is a major challenge in the prevention of risks related to the occurrence of catastrophic phenomena. A Cellular Automata methodology was developed for modelling large scale (extended for kilometres) dangerous surface flows of different nature such as lava flows, pyroclastic flows, debris flows, rock avalanches, etc. This paper presents VALANCA, a first version of a Cellular Automata model, developed for the simulations of dense snow avalanches. VALANCA is largely based on SCIDDICA-SS2, the most advanced model of the SCIDDICA family developed for flow-like landslides. VALANCA adopts several of its innovations: outflows characterized by their mass centre position and explicit velocity. First simulations of real past snow avalanches occurred in Switzerland in 2006 show a satisfying agreement, concerning avalanche path, snow cover erosion depth and deposit thickness and areal distribution. | A Cellular Automata model for soil erosion by water | This study proposes a fuzzy cellular automata model based on the subpixel fractions extracted from multitemporal satellite images and discusses the relationship between sophisticated remote sensing techniques and an urban process model within the socioeconomic dimension. Accordingly, the major objectives of the present research are: (1) to incorporate the subpixel membership derived from remote sensing images into a fuzzy cellular automata model to simulate urban landscape change; (2) to standardize the quantitative method to incorporate subpixel information into a subcell cellular automata model and to find a better way to determine the parameters in the model’s development, calibration, and validation. The comparison between the traditional cell-based model and subcell model suggests that the subpixel technique improves the accuracy of both urban mapping and modeling using medium resolution satellite images. | A new spatial load forecasting(SLF) method for distribution network by using cellular automata(CA) theory to simulate the process of urban land-use dynamic development and forecast future land-use types of each small-area is introduced.The iteration time and adjusting time of transition rules of CA are determined by the practical situation of urban development.In order to eliminate redundancies,overcome faults such as land-use rules which are always static and suffer influence from subjectivity by traditional methods,rough sets(RS) theory is used to carry out step-by-step attribute reduction for potential influencing factors and obtain dynamic transition rules of CA.Finally,the validity of this method is validated by an actual example. | AbstractIn this work, a one dimensional–two dimensional (1D–2D) coupled hydrodynamic model is developed for prediction of water levels in the lower Tapi River and its coastal urban floodplain (Surat city in Gujarat, India). A one-dimensional (1D) hydrodynamic model, calibrated for the 1998 flood, is coupled with a two-dimensional (2D) hydrodynamic model of an urban floodplain with due consideration of the upstream (releases from Ukai reservoir) and downstream (tidal level of the sea) boundary conditions. The resistance coefficient for the floodplain is estimated using satellite imagery based on the land use and land cover pattern. The coupled hydrodynamic model is validated with independent data for flooding in the year 2006 and is used to develop a stage-discharge curve along the lower Tapi River for computation of the stream power during the flood. The methodology for river flood prediction on a coastal urban floodplain using the 1D–2D coupled hydrodynamic model is generic and can be applied to similar ... | Developing countries have been undergoing dramatic urban growth over the past three decades. It is essential to understand and simulate the urban growth process for smart urban planning and sustainable development purposes. Cellular automata (CA) modeling is an efficient approach to simulating urban land use/cover change; however, the traditional CA method has limitations in simulating the various urban growth patterns and processes. This study aims to analyze the influences of different urban growth characteristics on the effectiveness of CA modeling by conducting a case study over the area in the Pearl River Delta of Southern China. We used the growth rate, landscape expansion index, and spatial dependency to quantify the urban growth characteristics. The effectiveness of CA modeling was measured through a comparison of the simulation results with the reference data. The simulation results and validation analyses reveal that the traditional CA is not applicable for the following three situations: (1) the urban growth pattern characterized by less growth area or a higher ratio of outlying expansion; (2) the urban region that includes several subregions with disparate growth characteristics; and (3) the existence of temporal differences in growth characteristics over a long period. | 116 | JFLOW: a multiscale two-dimensional dynamic flood model | A 1D–2D Coupled Hydrodynamic Model for River Flood Prediction in a Coastal Urban Floodplain | Flood Modeller | Flood fill algorithm not flooding properly (Pygame) | Operational Flood Forecasting in Israel | 2D Flood Simulation for Estimating the Economic Loss in the Building Areas | Two Dimensional Simulation Of Chemical Flooding | Large-Scale Hydrodynamic Modeling of a Complex River Network and Floodplains | MODCEL : A MATHEMATICAL MODEL FOR URBAN FLOOD SIMULATION AND INTEGRATED FLOOD CONTROL DESIGN |
117 | [USA-NY] [H] i7-2600, Alienware x51 mATX Motherboard, X51 R2 [W] Paypal, Google Wallet | Hello reddit!
because of a shipping error i have an extra i7 4770k. brand in box unopened looking for 280$ paypal or a little bit less if local and willing to pay cash.
edit: im retarded and forgot timestamp! | [USA - PA]
[H] PayPal
[W] Sapphire R9 290x Tri-X
I'm especially looking for the New Edition. Thanks! | ~~Asus RTX 2080 Ti Strix 11GB - This was used in my mITX build for the past 3 months. It was undervolted to 875mV / 1890Mhz to help keep things cool. Comes in original box. Some slight paint wear on the DP port and backplate.~~
~~- $725 Shipped OBO~~
Pixel 4a 5G - Black, 128GB, unlocked. BNIB.
- $450 Shipped OBO
Timestamps | Processor: Intel(R) Core(TM) i7-6700HQ CPU @ 2.60GHz
Video Card: NVIDIA GeForce GTX 960M
RAM 8.0 GB | Selling an older gaming PC for either an offer as a whole or parts:
CPU - Phenom II X4 960T (Motherboard has the ability to unlock this, got it to unlock to 6 cores, but never ran serious stability tests)
Mobo - Gigabyte 870A-USB3 Pictures here
RAM - 8GB (4x2) - mix of PNY and Crucial
GPU - XFX Radeon HD 6790 (Double D model) Pictures here
HDD - 320GB Seagate Barracuda
PSU - Corsair CX500
Cooler - Cooler Master Hyper TX3
Case - Xion XON-570 ATX Mid Tower Pictures here
Shipped anywhere in the US by USPS Priority Mail. PayPal preferred! Thanks for looking!
EDIT: Picture Album Here
EDIT 2: Cable management and tidying up. Picture here | I posted the other day about a board and processor and got some good messages and it helped me to determine a little more in what i wanted. I am looking for most likely an I5 3rd or 4 gen and matching motherboard and a video card preferably a 660 or newer. I have $250 in paypal right now. Please comment here before sending messages my way. | **Item Name:** GeForce RTX™ 2070 WINDFORCE 8G
**Condition:** Used (installed March 2019)
**Any additional information:** Still have the box/full packaging. Used in a gaming PC & for VR (but by a man with a full time job and freelance jobs, so not absolutely rinsed!) | its an inspiron 530s, with a core 2 duo, The last dell Mobo I had was the weird inverted kind so I want to make sure this one is a standard ATX / MATX etc. before I buy a case | 117 | I'm looking to sell my Alienware x51 R2, it makes a great living room steambox and can play most games at solid frame rates (~60-65 fps) that are not too GPU demanding (like Warframe, DOTA 2, TF2) but will struggle (~30-35 fps) if you're looking to play BF4 or Skyrim on Ultra or something like that. If you're looking to play Witcher 3 on something like this I would not recommend it because on Ultra it dips into 20 fps at certain points. But if you're looking for just a living room media center this thing has been great to me. Currently I'm using it as a Wii emulator with Dolphin and playing Project M I get 60 frames every time without any lag or stutters.
I'm looking to upgrade and don't have much need for it anymore so I'm going to try to get rid of it. It's literally in perfect condition so I'm going to ask 400 obo for it.
&amp;amp;nbsp;
Timestamp
&amp;amp;nbsp;
Earlier Stamp
&amp;amp;nbsp;
I'll ship with everything but the Hard Drive, so 8GB DDR3 1600 Ram, the included GT 545 (with mount), i7-2600, stock fan cooler, external PSU, start up disk and manuals as well as the motherboard and power board.
&amp;amp;nbsp;
If I don't get any interest I'd be willing to sell the i7-2600 separately either with the motherboard or without. I'd take 140 for the CPU and stock fan and 160 if you wanted the motherboard included. For the graphics card I would take like 40 for it if you're interested.
All prices include shipping. If you're interested just send me a PM, thank you!
&amp;amp;nbsp;
If you just want the case and nothing else because it's cool we may be able to work that out as well, since I've seen people show a lot of interest in small form factor cases lately. | Budget pc for wii games and GC games on dolphin | £500 Desktop for casual gaming and general use | Gaming PC for around $2000? | Basic gaming desktop (WoW, Heroes of the Storm) Help! >$800 | Looking for a laptop that can run Skyrim and other games with similar requirements with decent performance (US, screen size doesn't matter, budget $300) | $3000 Budget for Gaming PC that is able to run AAA games at Ultra Settings 4K 60FPS+ and VR at max settings | Budget Gaming Pc, £1000, for playing Borderlands 2, Top Settings, 60 fps or higher. | Help needed to get a pure gaming laptop, budget $1000-$1600, USA |
118 | Impact of Unstitched and Stitched Laminates by Line Loading | Toughening and self-healing of epoxy matrix laminates using mendable polymer stitching | Bearing strength tests were carried out on stitched laminates with different stacking direction and stitching direction. The main factors affecting the bearing strength were determined. The experimental results show that the stitching node position has significant effect on the bearing strength of stitched laminates. And the factors about stacking, such as stacking ratio and stacking sequence also affect the mechanical .joint performance of stitched laminate. | In order to solve the application of stitched composites in aircraft structures, experimental studies were carried out on the post-impact compressive properties of internal stitched laminates made by resin film infusion(RFI) process. Three different environments were used in this test. It shows that stitching changes compressive mechanisms of the laminates after low velocity impact. Post-impact compressive strength is improves highly through stitching at dry / normal temperature. But stitching has little influence on residual compressive strength of laminates after low velocity at wet / high temperature. Damage areas and post-impact strength are little affected by stitching directions. Stitching in 0 degree is much better than that in other directions. | The alteration of the in-plane elastic properties in laminates caused by stitching was modeled and the in-plane effective tensile strength of the stitched composite laminates was predicted. The distortion of in-plane fibers was considered to be the main reason that influences the in-plane mechanical properties. The fiber distortion model was proposed to characterize the fiber misalignment and the fiber content concentration caused by stitching. The inhomogeneous elastic properties of the stitched composite laminates were obtained by using hierarchical multiscale model. By using two-dimensional finite element analysis, the tensile strength of composite laminates was predicted, an acceptable agreement with experimental data was showed, and the effects of stitch density on the in-plane tensile strength were studied. | Abstract The classical method for obtaining the stiffness of composite laminates is presented, highlighting stretching, bending, and bending/stretching coupling behavior. The resulting stresses and/or strains are then combined in failure criteria. Different criteria are presented along with some of their drawbacks. The use of lamination parameters to calculate stiffness properties and obtain conservative failure envelopes is presented. The discussion is extended to the notched strength of laminates by briefly treating laminates with holes. Woven composites are also introduced with a brief overview of methods to obtain stiffness and strength. Issues related to some defects, such as porosity or delaminations that may be present in composite aircraft parts are also discussed. The chapter closes with a summary of future trends, such as grid-stiffened and variable stiffness structures. | A model for predicting tensile strength of stitched laminates is presented.The stitch yarns were simplified as elliptic inclusions.A special finite element including an elliptic inclusion was applied to analyze the stress distribution.The tensile strength was predicted on the base of characteristic length and the point stress criteria and maximum stress theory.There is a good agreement between computational and experimental results.The effects of stitching parameters on tensile strength are discussed.Some useful conclusions are made. | These are high quality. I may laminate to prolong wear. They are great for kids or seniors. Happy with my purchase. | Analysis of laminates with ply drops | 118 | Results of impact responses for both unstitched and stitched laminates to line-loading at low striking velocities are presented in this paper. These laminates, made of E-glass dry preform and having a (0°2/90°2)s stacking sequence, were fabricated by resin transfer molding. For the stitched laminates, Kevlar-29 untwisted roving of 3000 denier was used for the through-the-thickness reinforcement. Impact tests were conducted on a specially designed falling tower with a line-nosed impactor. It was found that the number of matrix cracks, the splitting crack lengths, the delamination areas, and the laminate residual deflections were all much reduced due to the stitching reinforcement. The major impact-induced damage mechanism gradually changed from delamination for the unstitched laminates to the plastic-hinge type of localized deformation at the impact location for the stitched specimens as the stitching density increased. Further, delamination damage in an unstitched laminate could be detected from the recor... | NUMERICAL PREDICTION OF STRENGTH OF NOTCHED UD LAMINATES BY ANALYZING THE PROPAGATION OF INTRA-AND INTER-LAMINAR DAMAGE | Abstract In this paper, the impact response of unidirectional cross-ply GF/epoxy laminates with different shape memory alloys (SMAs) positions was investigated. According to vacuum assisted resin injection (VARI) process, we manufactured the laminates without SMAs, the laminates with one layer of SMAs were inserted in 1/8 thickness, in 1/2 thickness, in 14/16 thickness, and in 15/16 thickness of specimen, respectively, the laminates with two layers of SMAs were inserted in the 15/16 and 14/16 thickness, in 15/16 and 1/2 thickness, in 15/16 and 1/8 thickness, in 14/16 and 1/2 thickness, in 14/16 and 1/8 thickness, and in 1/2 and 1/8 thickness of specimen, respectively. The low-velocity impact experiment was performed by Dynatup 9250HV Drop Weight Impact Testing Machine under the impact energy of 28 J to analyze the impact response, and the impact parameters such as contact force ( F ), displacement ( D ) and energy ( E ) of the laminates were obtained. To further observe and analyze the impact damage morphology, we also adopted visual inspection and scanning electron microscope (SEM) technology. The experimental results showed that impact performance of laminates improved by embedding SMAs. By contrast, the impact performance of the laminates with two layers of SMAs was optimum. | Progressive Failure Modelling of Transverse Cracking in Cross-Ply Laminates with Double-Edge-Semicircular Notches | The effect of impactor shape on the impact response of composite laminates | A simplified analysis of transverse ply cracking in cross-ply laminates | Analysis of Inelasticity Effect Due to Damage on Stress Distributions in Composite Laminates | Hypervelocity impact damage prediction in composites: Part II—experimental investigations and simulations | Modelling of damage and failure of glass/epoxy composite plates subject to impact fatigue |
119 | who was hela the first human cell line | Quantitative Studies on the Growth of Herpes Virus in HeLa Cells | Human cloning a few scientists promised to make a clone within the next few years. The first hybrid human clone was created in November 1998, by Advanced Cell Technology. It was created using SCNT - a nucleus was taken from a man's leg cell and inserted into a cow's egg from which the nucleus had been removed, and the hybrid cell was cultured, and developed into an embryo. The embryo was destroyed after 12 days. In 2004 and 2005, Hwang Woo-suk, a professor at Seoul National University, published two separate articles in the journal "Science" claiming to have successfully harvested pluripotent, embryonic |
Introduction
Early embryos at different stages of development have been used for derivation of new hESC lines. The most common isolation of ICM has been from 5-8-day-old blastocysts, but 9-dayold blastocysts have also been used [1,2,3]. HESC lines have also been derived from plating the whole blastocyst without isolation of the ICM [4,5,6]. Earlier stage embryos have also resulted in hESC lines [7]. Single blastomeres cultured together in groups either in co-culture with hESC or without co-culture have generated hESC lines [8,9,10]. One hESC line has been derived from the only blastomere which survived thawing after cryopreservation of a 4cell stage embryo [11]. Efficiency of the derivation has been poor from arrested embryos [12]. In 2008, Lerou et al. [13,14] compared derivation of hESC from one-cell arrested embryos to the blastocyst stage, and came to the conclusion that poor quality embryos can generate hESC lines (1/171), but that derivation efficiency significantly correlates with embryo status and that the embryos that have reached the blastocyst stage to a much greater extent generate hESC lines (8/94). Liu et al. reported a derivation efficiency of 2.4% (4/166) when calculated from day-three embryos. When derivation efficiency was calculated from day-five blastocysts, it was significantly higher (12.5%) [15].
In 2006, Stephenson et al. [16,17] first proposed that all research groups deriving hESC lines should have a common consensus standard for reporting established hESC lines. The derivation methods and embryo quality and therefore hESC lines can then be more easily compared.
Only poor-quality embryos on days two or three, with a small likelihood of surviving freezing and thawing and generating a pregnancy, have been donated to stem cell research in our hospital. Good-quality embryos frozen for the maximum five-year period which is allowed by the Swedish law have also been donated by couples no longer interested in using them for fertility treatments.
In this analysis, we found that we could derive hESC lines from very poor-quality embryos as frequently as from good quality embryos. A 3PN zygote also gave rise to a karyotypically normal hESC line.
Materials and Methods
We obtained approval from the Ethics Committee of Karolinska Institutet for derivation, characterisation, and early differentiation of hESC lines from donated supernumerary embryos. Blastocysts were obtained as donations from infertile couples undergoing in vitro fertilisation treatment at our Fertility Unit. Both partners signed an informed consent form after receiving verbal and written information. Only embryos that could not be used in infertility treatment were used in stem cell line derivation. No payment was made to the donors. Good quality embryos have only been donated to stem cell derivation if they have been frozen for the maximum of five years allowed by the Swedish law. Most of the donated fresh embryos with a high score at the time of ICM isolation were slow in development and were therefore not regarded as suitable for IVF treatment. These couples always had good-quality embryos which were transferred as their infertility treatment.
A total of 234 embryos were donated and included in this study between 2002 and 2009. From these embryos we managed to derive 30 permanent fully characterised hESC lines, and 29 early lines which did not continue to grow. The first four derivations were carried out using foetal calf serum (FCS) in the derivation medium [2]. The following 26 hESC lines have been derived and cultured in serum replacement (SR), (Invitrogen, Gothenburg, Sweden) containing media [18]. All the 30 fully characterised lines [19] were included in the EU hESC Registry [20]. An additional 20 ICM derivation attempts were made in a xeno-free medium, which contained X-VIVO 10 (Cambrex Bio Science Walkersville, Inc. Walkersville, MD) as a supplement. Two early hESC lines were obtained, but none of them continued to grow beyond passage two.
Embryo cultures
Two different embryo culture media were used. After aspiration, the oocytes were collected in ISM1 (Medicult, Jyllinge, Denmark) or G1 (Vitrolife, Gothenburg, Sweden) and incubated for 4-6 hours before insemination by IVF or ICSI. Oocyte and embryo culture was performed in 20 ml drops of culture medium under paraffin oil (Ovoil, Vitrolife) in an atmosphere of 6% CO 2 in air at 37uC. Pronuclear formation was evaluated 16-18 hours post-insemination (hpi), and only zygotes displaying two pronuclei were selected for embryo transfer. The embryos were cultured from the day of fertilisation up to day three in ISM1 or G1 and from day three to blastocyst stage in ISM2 (Medicult) or G2 (Vitrolife). Evaluation of the embryo quality was performed at 200 times magnification using an inverted microscope equipped with differential interference contrast optics, at 42-44 hpi and at 66-68 hpi. A modified scoring system first described by Mohr et al. [21] was used to score and select embryos for transfer and cryopreservation. A maximal score of 3.5 was given to the embryo if no factor reducing embryo quality was observed. The score was reduced in increments of 0.5 for every reducing factor observed. The reducing factors are; non-ideal numbers of blastomeres (four cells on day two and eight cells on day three were considered ideal), or the presence of more than 10% fragmentation, nonspherical blastomeres, unequal size of blastomeres, uneveness of the cell membrane, cytoplasmic abnormalities or if the embryo did not fill the zona pellucida.
Embryos with multi-nuclear blastomeres were not used for IVF treatment but they could be donated for stem cell derivation.
Embryos scoring 3.0-3.5 were regarded as of top quality, those with a score of 2.5 were considered good quality, and 4-8 cell embryos with a score of at least 2.0 were considered suitable for cryopreservation. Selection of blastocysts for transfer or cryopreservation was performed at the IVF unit using the system described by Gardner et al. [22]. The blastocoel was graded from one to six as follows: (1) early blastocyst with a blastocoel of less than 50% of embryo volume; (2) early blastocyst with a blastocoel of 50-80%; (3) fully developed blastocoel of at least 80% of embryo volume; (4) expanded blastocyst; (5) hatching blastocyst; (6) fully hatched blastocyst. The inner cell mass was graded as follows: (A) many cells and tightly packed; (B) average number of cells; (C) few cells and loosely packed. The trophectoderm was graded; (A) for many cells, equal in size and (B) for uneven cells and (C) for few cells. Expanded blastocysts with a good inner cell mass and trophectoderm, i.e. at least 4AB were considered to be of high quality. Blastocysts scoring at least 3AA were considered to be of good quality. For an example of embryos of different scores, see Surplus embryos donated for stem cell research were transferred at the blastocyst stage from the IVF unit at Karolinska University Hospital Huddinge, Sweden, to the stem cell laboratory in the same hospital for hESC derivation.
Isolation of the ICM
Isolation of the ICM using immunosurgery was carried out for the first 20 hESC derivations [2] using 126 blastocysts. The zona pellucida was first removed by using 0.5% Pronase (Sigma-Aldrich Co., St Louis, USA) and the trophectoderm was removed by immunosurgery as described earlier [23], using rabbit antihuman whole serum (Sigma) and guinea-pig complement serum (Sigma).
For the following 108 blastocyst the ICMs were isolated using a specially made flexible metal needle with a diameter of 0.125 mm, made for us at the Helsinki School of Micromechanics (Espoo, Finland) and now commercially available from Hunter Scientific (Essex, UK). One needle was used to hold the blastocyst while cutting the ICM out with a second needle, as described earlier [3]. The ICM was allowed to grow on human skin feeder cells for 12-15 days before the first transfer to a new feeder plate. For an example of a successful establishment of a new hESC line see Fig. 2.
Human foreskin fibroblasts (CRL-2429; ATCC, Manassas, VA) [2] were used as feeder cells. They were mitotically inactivated by irradiation (40 Gy), and 100,000 cells were plated onto 2.84 cm 2 dishes (Falcon) overnight to form a confluent monolayer.
The medium for culture of the feeder cells consisted of Iscove's medium supplemented with 10% FCS and 0.5% penicillinstreptomycin (all from Gibco Invitrogen Corporation). We also tested the use of human serum for the feeder cells, and they attached and grew similarly.
HESC culture medium
The medium used for derivation and culture of the first four established hESC lines consisted of Knockout Dulbecco's modified Eagle's medium (GibcoBRL, Life Technologies), supplemented with 2 nmol/l L-glutamine, 20% FCS (R&D, Sweden), 0.1 mmol/l b-mercaptoethanol (Gibco), 1% non-essential amino acids (Gibco), and recombinant human LIF, 1 ml/ml (Chemicon, UK). Since 2003 all derivations have been carried out in Knockout Dulbecco's modified Eagle's medium supplemented with 20% Knockout SR, 2 mM Glutamax, 0.5% penicillinstreptomycin, 1% non-essential amino acids (all from Gibco Invitrogen Corporation), 0.5 mM 2-mercaptoethanol (Sigma) and 8 ng/ml bFGF (R&H Systems, Oxon, U.K.) [18]. Twenty ICM isolations were carried out in a third medium, supplemented by X-Vivo 10.
Propagation of the lines
The hESC lines were propagated as described earlier [18,24]. Splitting of the hESC colonies was performed mechanically at 6-8day intervals. Colonies were cut into smaller pieces (approximately 6-8) and then transferred onto fresh feeder cells. For passaging, only non-differentiated cells were chosen, as judged morphologically.
Characterisation of new hESC lines
All new hESC lines were cryo-preserved as soon as sufficiently large cell numbers were attained, at passage level two to ten. The lines were stored in the master bank, and characterised [2,3,18,19]. They have been used in a large number of research projects by many laboratories.
For characterisation, expression of pluripotency markers such as Oct-4, Nanog, SSEA-3, SSEA-4, TRA-1-60, TRA-1-81 and SSEA-1 have been analysed using immune cyto-chemistry and RT-PCR [2,3,18,19], see supporting Fig. S2. Microarray expression analyses by Affymetrix two-cycle GeneChip (Affymetrix, Santa Clara, CA) have been carried out [25,26], and single nucleotide (SNP) analyses have been run from two of the lines [27,28].
For the testing of pluripotency, the hESC were differentiated into embryoid bodies by culturing colonies of hESC as spheres in low adhesion culture dishes in SR-containing medium, without the addition of bFGF, for three weeks. They expressed components of all three germ layers, bone morphogenetic protein-4 (BMP-4) for mesoderm, nestin and sex determining region Y-box (SOX-1) for ectoderm and alpha-fetoprotein (AFP) for endoderm.
Pluripotency was also tested in vivo by the formation of teratoma in SCID beige mice as described earlier [18]. In brief 10 3 to 10 4 hESC were washed twice in D-PBS and put in an 1.5 mL collection tube together with 80 mL culture medium and subsequently implanted beneath the testicular capsule of a young (7-week old) severely combined immunodeficient/beige male mouse (C.B.-17/GbmsTac-scid-bgDF N7, M&B, Ry, Denmark). Teratoma growth was determined by palpation every week and mice were killed (cervical dislocation) eight weeks after implantation. Three to five animals were injected using each hESC line. The teratomas were fixed, and sections were stained with hematoxylin and eosin to analyse the presence of tissue components of all three germ layers, see supporting Fig. S2.
Karyotype analyses were performed by G-banding. Samples of hESCs were treated with colcemid KaryoMAX (0.1 mg/ml;Gibco) for 5 h, trypsinised and treated for 10 min with a hypertonic solution (0.0375 M KCl) and fixed in a 3:1 methanol and acetic acid solution. Metaphase spreads were G-banded by brief exposure to trypsin and stained with 4:1 Gurr's/Leishmann's stain (Sigma-Aldrich). A minimum of 10 metaphases were analysed [19].
Statistical analysis
Logistic regression analysis was performed to assess the association between number of cells on day two and three, morphological score day two and three, ICM score, trophectoderm score and expansion status with the success of establishing a new hESC line. As prior knowledge was sparse regarding the chosen predictors and their relationship to the success of establishing a new hESC line, a backward selection procedure was performed. P-values less than 0.1 were used as the exclusion criterion.
Generalised additive models (GAM) was used to evaluate the functional form of the relationship between each predictor and the probability of successfully establishing a new hESC line. All variables displayed a nonlinear relationship to the outcome and were therefore categorised prior to the logistic regression analysis. Cells on days two and three were classified as (,4 cells, = 4 cells, .4 cells) and (,8 cells, = 8 cells, .8 cells) respectively. Morphological score day two and three were both classified as, ,2, 2-2.5, .2.5. ICM score, trophectoderm score and expansion status were classified as (0-1, 2, 3), (0-1, 2, 3) and (1-3, 4, .4), respectively.
The statistical analysis was performed in SAS version 9.3 (SAS Institute inc., Cary, NC, USA). Descriptive statistics was done in SPSS 18.0 (SPSS Inc., Chicago, IL).
Results
Established hESC lines
We have derived 59 hESC lines since 2002, using 234 early embryos. Thirty of these hESC lines continued to grow and are fully characterised and banked (Table 1). Among these 30 permanent lines we have two lines from two sibling embryos, and three lines from another set of sibling embryos.
The quality of the embryos, the number of outgrowths and establishment of new lines are shown in Figure 3a-d.
Morphology and developmental rates of the embryos by days two and three after fertilization
The early embryos resulting in pluripotent hESC lines had between one and seven cells when counted on day two (see Table 1) and the score varied between 1.0 and the maximum of 3.5 on days two and three. On day three the numbers of cells in the early embryos varied between two cells and ten cells for the embryos resulting in hESC lines.
Day of ICM isolation
Fourteen blastocysts were used for derivation on day five after fertilisation. Eleven of them (78.6%) resulted in outgrowths. We obtained two new hESC lines from the 14 day-five blastocysts (14%). 163 blastocysts were used for derivation on day six after fertilisation, and 137 of these (84%) resulted in outgrowths. Twenty-two of our 30 hESC lines were obtained from day-six blastocysts. In addition, we obtained two early lines that were lost at passages nine and 13. Fifty-six derivations were carried out on seven-day-old blastocysts and 48 of the derivations (85.7%) resulted in outgrowths. Five new hESC lines were established from the 56 day-seven derivations. For summary of these data see
Expansion status
Only six early embryos were used for stem cell derivation before reaching the blastocyst stage. They had been arrested at the morula stage. One of the arrested embryos was a preimplantation genetic diagnosis (PGD), Huntington's disease. It was the only non-blastocyst embryo that attached to the feeder layer after removal of the zona pellucida. It did not start to proliferate.
One early blastocyst with the expansion status one (early blastocyst with a blastocoel of less than 50% of embryo volume) was used for isolation of the ICM. This resulted in an outgrowth and was passaged twice. No permanent hESC line could be established, See Figure 3b. Eleven embryos with the expansion status two (early blastocyst with blastocoel filling 50-80% of the volume of the total blastocyst) were used for ICM isolation. 36.4% (four out of 11) resulted in outgrowths and were further passaged, but only one (9.1%) resulted in a permanent hESC line, HS207 (Figure 3b).
Thirty-eight of all blastocysts had expansion status three: fully developed blastocoel filling at least 80% of embryo volume. Of these 38 blastocysts, 16 (42.1%), resulted in an outgrowth, eight were further passaged, and seven (22.3%) of all the embryos with expansion status three gave rise to permanent hESC lines (Figure 3b).
Of all 234 early embryos included in this study, 117 had the expansion status four (fully expanded blastocysts). Fifty-four of the blastocysts resulted in outgrowths (46.2%) and 32 were further passaged (27.4%). Three early lines stopped growing at passage two, one at passage nine, and one early line at passage 15. Fifteen (12.8% of all blastocysts with expansion status four) resulted in stable, fully characterised hESC lines (Figure 3b).
Thirty-eight derivations were carried out using blastocysts with the expansion status five, meaning that they had started to hatch. Twenty-two of these resulted in outgrowths and 13 could be further passaged two or three times (34.2%). Five permanent hESC lines were established (13.2%) out of all the blastocysts with expansion score five (Figure 3b).
Twenty-three blastocysts with expansion status six, meaning fully hatched, were used for ICM isolation. Thirteen (56.5%) resulted in outgrowth. Four were passaged further (17.4%). One promising outgrowth stopped growing at passage four. Two permanent hESC lines were established, 8.7% of all hatched blastocysts (Figure 3b).
ICM score
Of all derivations performed, 226 had a complete score for the ICM. Out of these 226 blastocysts, 40 had the score A (17.7%), 122 had the score B (54.0%) and 64 blastocysts had the score C (28.3%). Of all blastocysts with the score A for the ICM, 20 (50%) resulted in an outgrowth and 13 (31%) were passaged further. Seven of these resulted in hESC lines. One stopped growing early, at passage four. The remaining six (15%) have been fully characterised as pluripotent hESC lines (Figure 3c).
Fifty-nine (48.4%) of the 122 blastocyst with ICM score B resulted in outgrowths. Thirty-five (28.7%) of these were passaged at least once. Three early lines stopped growing at passages five, nine and 15. Eighteen permanent hESC (14.8%) lines have been established from blastocysts with the score B for the ICM (Figure 3c).
Sixty-four (27.4%) of all blastocyst had the score C for the ICM. Thirty-two of these (50%) resulted in an outgrowth and were also passaged at least once. Of the 64 blastocysts where the ICM consisted of very few cells, six permanent hESC (9.4%) were derived and characterised (Figure 3c).
Trophectoderm score
Twenty-five (10.7%) of all isolated blastocysts had the sore A for the trophectoderm layer, 173 (73.9%) had the score B and 28 (11.7%) had the score C. Of the early embryos with trophectoderm score A, twelve (48%) resulted in an outgrowth and seven of these were passaged further and two new hESC line was established (8%) (Figure 3d).
Of the 173 blastocyst with trophectoderm score B, 85 (49.1%) resulted in an outgrowth and 46 (26.6%) were passaged, three early lines died out at passage four, five and nine, and in total 24 permanent hESC lines were established from blastocyst with score B for the trophectoderm (13.9%) (Figure 3d).
Twenty-eight of all early embryos had the throphectoderm score C at the blastocyst stage, meaning very few cells of different sizes. Fourteen (50%) resulted in outgrowths, five were passaged and four (14.3%) resulted in new permanent hESC lines (Figure 3d).
Three pronuclear zygotes
Two 3PN zygotes were donated to stem cell derivation after reaching the blastocyst stage. Both attached to the feeder layer and one started to grow. This 3PN embryo two days after fertilisation had four cells and a score of 3.0, and on day three had eight cells and a score of 3.0. On day five the embryo was still compacted, but it had reached the blastocyst stage at day six. Eight days after fertilisation the blastocyst had started to hatch and mechanical isolation was performed to isolate the ICM. The derivation resulted in the cell line HS429, which is a karyotypically normal well-growing hESC line.
Statistical analysis
Complete information on the number of cells and morphological score on days two and three, ICM score, trophectoderm score and expansion status was available for 206 embryos. The only variable that showed a significant predictive value for the probability of successfully establishing a new hESC line was having less than four cells on day two, P = 0.018 (Table 2). No other variables included in the model showed any significance, see supporting Table S1.
Discussion
We managed to obtain 30 permanent and 29 early hESC lines from 234 embryos which could not be used for infertility treatment because of poor quality. Often the reason for excluding them from transfer or cryopreservation was developmental delay. That is the reason why we initially received many relatively good-quality blastocysts for stem cell derivation. The policy in our IVF unit has now been changed. The embryos which are not transferred or cryopreserved at the cleavage stage are further cultured to blastocysts and vitrified for possible infertility treatment in the future.
The difficulties with prediction of developmental competence were discussed earlier [29]. However, the term 'surplus embryos' based on the morphology on day three was questioned here, since many of the late and also severely fragmented day-three embryos could still develop further to the blastocyst stage. In our data we can see that also embryos with a poor morphology on day five can 'recover' to a quite good morphology on day six.
Several of the hESC lines derived from embryos regarded as being of 'good quality' on the day of ICM isolation were regarded as 'poor quality' on day five. Both hESC lines, HS181 and HS364, when observed by the IVF embryologists five days after fertilisation were still compacted morulae. Therefore they were transferred to the stem cell laboratory where they were left in culture for one more day. The next day (day six), both embryos had developed into fully expanded blastocysts, with the score 4BB. Two more hESC lines, HS293 and HS400, were donated to stem cell derivation on day five with a score of one. These were kept in culture one more day, and when ICM isolation was performed on day six, HS293 had the score 4BB and HS400 had the score 4AB. As a result of these findings the policy at our fertility unit has changed. Embryos are kept for one more day in the IVF laboratory and cryo-preserved for infertility treatment in the future, if they develop to the blastocyst stage with the minimum score of 2BB. Blastocysts with a lower score than 2BB, including all embryos with a score of C for the ICM, can still be donated to stem cell research. There are several slightly different scoring systems, which are all based on the same criteria. We do not believe that using different numbers in scoring would have influenced our results.
Statistical comparison of embryo quality was difficult because of the high degree of variability. We have received 12 early embryos regarded as top quality by the IVF unit with the score 4AA-6AA. Only one hESC line has been successfully derived from them, HS475. The top quality embryos did not appear to result in new hESC lines more often than the others. Five of our hESC lines were derived from embryos with the score C for the ICM, meaning that the ICM contains only a few cells which are hard to visualise. Apparently only a few pluripotent cells, perhaps only one, are needed for the establishment of a stem cell line. Only five embryos arrested at the cleavage stage were included in this study. None of them resulted in any outgrowth after plating on feeder cells.
We derived hESC lines from embryos regarded as having too poor quality by IVF standards for cryo-preservation, the lowest score being 2CB (cell line HS207). One blastocyst had 3PN when observed one day after fertilisation. For this reason this embryo was regarded as not being suitable for IVF treatment and was donated for stem cell derivation. Six days after fertilisation the blastocyst was fully expanded. Mechanical isolation of the ICM was performed, and the ICM was plated onto feeders. The result was a well growing hESC line, HS429. When analysed at passage eight it had the normal female karyotype 46XX. The line has grown well and remained karyotypically normal at high passages.
We can only speculate why this 3PN embryo resulted in a hESC line with a normal karyotype. One reason could be that when the early zygote was observed, one day after fertilisation, one polar body had still not been extruded, but that this process happened later on. There is also the possibility of normalisation: that the extra sets of chromosomes had been excluded from metaphase and then discarded by the developing embryo. It has been previously shown that 3PN zygotes can be rescued to heteroparental blastocysts by microsurgical correction [30,31]. Sathananthan et al. [32] have previously described the development of human dispermic embryos. Ten out of 103 3PN zygotes developed to the blastocyst stage. In a case report in 2003, Kattera and Chen described how microsurgical enucleation of a single pronucleus from three 3PN zygotes was performed, and the embryos were transferred to a woman for fertility treatment. The result was a normal healthy baby [33]. No earlier derivation of hESC has been reported from 3PN embryos.
A high proportion of human oocytes are affected by chromosomal abnormalities, but the vast majority of such embryos are unable to develop to blastocyst stage, fail to implant or culminate in a miscarriage [34]. All our 30 hESC lines have been derived from embryos at blastocyst stage. A recent study came with the conclusion that embryo morphology screening might be a better tool than genetic screening for at least a part of the IVF patients [35]. It is interesting to note that large chromosomal abnormalities such as aneuploidy in hESC lines at low passages are not common. Smaller changes seen in hESCs seem to most often appear due to culture adaptations and they are not inherited from the germ cells [28].
In 2006, Zhang et al. [12] described the derivation of two hESC lines from 15 arrested morula stage embryos, but we were not successful in our six such attempts.
We have experience from deriving 30 permanent, and the additional 29 early lines that have been lost either due to differentiation, lack of proliferation or infection (one) before the line could be cryo-stored. On this basis, we can say that both highquality and poor-quality embryos, and even those containing three pronuclei, can generate pluripotent hESC lines that grow well. Our success rate in derivation of permanent hESC lines was 12.8% (30/234) in 2001-2009. Here we tried to see if we can foresee the likelihood for an embryo of generating a stem cell line by calculating on the scores from day two, three and on the day of derivation, and the number of cells in the early dividing embryo. We compared the different data sets individually or in combination. The only data of significance was the number of cells on day two. Embryos with fewer than four cells had a significant advantage in derivation success compared to embryos with four cells on day two. This correlation with the number of cells, and the likelihood of generating a new cell line was, however, lost on day three. The likelihood of pregnancy is highest when the embryo on day two has exactly four blastomeres, but this parameter does not anticipate stem cell line derivation success.
Our conclusion is that all embryos donated to research that have reached blastocyst stage can give rise to new hESC lines, and attempts should be made even if the blastocyst has a poor score. Table S1 Logistic regression analysis was performed to assess the association between number of cells on days two and three, morphological score on days two and three, ICM score, trophectoderm score and expansion status with the success of establishing a new hESC line. Statistical predictive value was only seen for the number of cells on day two after fertilisation. (DOC)
Supporting Information
Fig. 1 .
1Photographs of 25 of the donated embryos resulting in new hESC lines are shown in Supporting Fig. S1. More pictures of embryos of different scores not resulting in new hESC lines can be available upon request.
Figure 2 .
2The successful derivation of the hESC line HS429, derived from a 3PN embryo. (A) The blastocyst with the score 4CB before inner cell mass isolation. (B) The mechanically isolated inner cell mass on human fibroblast feeder layer. (C) One day after isolation the inner cell mass has attached. (D) Outgrowth four days after isolation. (E) Lower magnification of the outgrowth 16 days after inner cell mass isolation, now with the typical stem cell colony morphology. From this outgrowth a small piece had been mechanically passaged four days earlier. (F) A colony of the hESC line HS429 at passage two. (Original magnification A-D 40x and E-F 400x). Normal karyotype 46,XX of the line HS429 at passage eight. doi:10.1371/journal.pone.0015329.g002
Figure 1 .
1Photographic examples representing the different scores of blastocysts donated for stem cell derivation. HS475. Fully hatched blastocyst with clear tightly packed ICM. This embryo generated a new hESC line, HS475. Exp462. Hatching blastocyst with average number of cells in ICM, even trophectoderm layer. Exp472. Hatching blastocyst. Trophectoderm layer is uneven and the cells in the ICM are few in number and loosely packed. Exp404. Fully expanded blastocyst with clear tightly packed ICM and even trophectoderm layer. Exp439. Fully expanded blastocyst, with thin zona pellucida. Small ICM and trophectoderm cells of different size. Exp412. Fully developed blastocoel. Zona pellucida is still thick, meaning that the blastocyst is not fully expanded. Exp367. Early blastocyst. HS361. Early blastocyst with blastocoels filling less than 50% of embryo volume. This embryo generated the hESC line HS361. Exp457. This embryo is still compacted and has not reached blastocyst stage. All pictures were taken with a 40x objective, phase contrast or DIC, scale bar 50 mm. (Exp = experiment number. HS is used as a prefix for established hESC lines at Karolinska Institutet). doi:10.1371/journal.pone.0015329.g001
Figure 3a .
3a(For an example of a successful establishment of a new hESC line see Fig. 2, for pictures of the embryos resulting in new hESC lines see supporting Fig. S1).
Figure 3 .
3Summary of blastocyst scores and efficiency in derivation. Percentage of successful establishment of permanent hESC lines, for each criteria, is includes above the staple for established hESC lines. (A) Day of inner cell mass (ICM) isolation, number of isolations performed on embryos at different days after fertilisation, number of outgrowths from these embryos and the number of successful derivations of hESC lines. (B) Expansion Score. Number of isolations performed on embryos with different expansion scores, number of outgrowths and successful derivations. (C) ICM Score. Number of isolations performed on embryos with different ICM scores, number of outgrowths and established hESC lines from these embryos. (D) Trophectoderm Score. Number of isolations performed on embryos with different expansion scores, number of outgrowths and established hESC lines. doi:10.1371/journal.pone.0015329.g003
Figure S1
S1Pictures of 25 of the early embryos that have resulted in established hESC lines with the score at the time of derivation. (TIF) Figure S2 Panel shows teratoma formation from cell line HS401, A. Neural tissue ectoderm 10X, B. Intestinal endoderm 20X, C Cartilage mesoderm 10X. D. Shows expression of pluripotency markers by immunostaining of cell line HS207. (TIF)
Table 1 .
1Data from all our 30 established hESC lines at Karolinska Institutet.hESC line
Derivation day
Derivation method
Score D2
Score D3
Score D5
Score D6 Score D7
Score D8
Expansion status
Score ICM
Score
Throphectoderm
HS 181
6
Immunosurgery
2C 2,0
4C 2,0
COMP
4BB
4
B
B
HS 207
7
Immunosurgery
3C 2,5
6C 1,5
COMP
2CB
2CB
2
C
B
HS 235
6
Immunosurgery
7C 2,0
10C 2,5
COMP
3CB
3CB
3
C
B
HS 237
6
Immunosurgery
4C 2,0
8C 1,5
1AB
3BB
3BB
3
B
B
HS293
6
Immunosurgery
2C 1,0
4C 1,5
1
4BB
4
B
B
HS306
5
Immunosurgery
4C 2,5
8C 2,5
3BB
3
B
B
HS346
7
Immunosurgery
4BB
4
B
B
HS351
6
Immunosurgery
6C 1,5
3AB
4AB
4
A
B
HS360
6
Immunosurgery
2C 1,5
4C 3,0
COMP
4CB
4
C
B
HS361
7
Immunosurgery
4C 2,0
8C 2,5
MORULA
1
4CB
4
C
B
HS362
6
Immunosurgery
2C 2,5
5C 1,5
2BB
4BB
4
B
B
HS363
6
Immunosurgery
3C 2,5
5C 2,5
4AC
4AB
4
A
B
HS364
6
Immunosurgery
3C 2,0
4C 2,0
COMP
4BB
4
B
B
HS366
6
Immunosurgery
2C 2,5
5C 2,0
COMP
3BB
3
B
B
HS368
7
Immunosurgery
5C 2,0
2C 1,0
COMP
2CB
4CB
4
C
B
HS380
6
Immunosurgery
4C 3,0
7C 2,0
4CB
4BB
4
B
B
HS382
6
Immunosurgery
4C 3,5
9C 2,5
2AB
4BB
4
B
B
HS400
6
Immunosurgery
4AB
4
A
B
HS401
6
Immunosurgery
3C 1,5
6C 2,5
2CB
3AB
3
A
B
HS402
6
Immunosurgery
5C 1,5
6C 1,5
2BB
4AA
4
A
A
HS415
6
Mechanical Isolation
4C 2,0
8C 3,5
4CB
5
5
C
B
HS420
6
Mechanical Isolation
4C 2,0
5C 1,0
4CB
4BB
4
B
B
HS422
6
Mechanical Isolation
1C
4C 2,0
COMP
4BC
4
B
C
HS426
8
Mechanical Isolation
4C 3,0
8C 3,0
COMP
2BB
5
5
B
B
HS429
6
Mechanical Isolation
4CB
4
C
B
HS475
7
Mechanical Isolation
5C 2,5
8C 3,5
COMP
2CC
6AA
6
A
A
HS480
6
Mechanical Isolation
5C 2,5
8C 2,5
4BC
6BC
6
B
C
HS481
6
Mechanical Isolation
5C 1,5
10C 1,5
COMP
3AB
3
A
B
HS491
6
Mechanical Isolation
4C 3
5C 3
COMP
4BC
4
B
C
HS539
5
Mechanical Isolation
5BB
5
B
B
COMP = Compacted, C = cells, D = day, hESC = human embryonic stem cell, ICM = inner cell mass.
doi:10.1371/journal.pone.0015329.t001
Table 2 .
2Differences of number of cells day two. Least squares means. Having less than four cells on day two showed a significant predictive value for the probability of successfully establishing a new hESC line. doi:10.1371/journal.pone.0015329.t002Number of cells day 2
Number of cells day 2
Pr |t|
Odds Ratio
Lower Odds Ratio
Upper Odds Ratio
,4 cells
4 cells
0.0181
0.274
0.094
0.800
,4 cells
.4 cells
0.2540
0.468
0.127
1.731
4 cells
.4 cells
0.3369
1.708
0.571
5.111
PLoS ONE | www.plosone.org
December 2010 | Volume 5 | Issue 12 | e15329
AcknowledgmentsWe are grateful to the staff at the IVF unit, Karolinska University Hospital for obtaining consents and culturing blastocysts for us. We are also grateful to Jakob Bergström at LIME, Karolinska Institutet for the help with the statistical analyses.Author Contributions
Optimal timing of inner cell mass isolation increases the efficiency of human embryonic stem cell derivation and allows generation of sibling cell lines. A E Chen, D Egli, K Niakan, J Deng, H Akutsu, Cell Stem Cell. 4Chen AE, Egli D, Niakan K, Deng J, Akutsu H, et al. (2009) Optimal timing of inner cell mass isolation increases the efficiency of human embryonic stem cell derivation and allows generation of sibling cell lines. Cell Stem Cell 4: 103-106.
A culture system using human foreskin fibroblasts as feeder cells allows production of human embryonic stem cells. O Hovatta, M Mikkola, K Gertow, A M Stromberg, J Inzunza, Hum Reprod. 18Hovatta O, Mikkola M, Gertow K, Stromberg AM, Inzunza J, et al. (2003) A culture system using human foreskin fibroblasts as feeder cells allows production of human embryonic stem cells. Hum Reprod 18: 1404-1409.
Mechanical isolation of the inner cell mass is effective in derivation of new human embryonic stem cell lines. S Strom, J Inzunza, K H Grinnemo, K Holmberg, E Matilainen, Hum Reprod. 22Strom S, Inzunza J, Grinnemo KH, Holmberg K, Matilainen E, et al. (2007) Mechanical isolation of the inner cell mass is effective in derivation of new human embryonic stem cell lines. Hum Reprod 22: 3051-3058.
Derivation, characterization, and differentiation of human embryonic stem cells. N Heins, M C Englund, C Sjoblom, U Dahl, A Tonning, Stem Cells. 22Heins N, Englund MC, Sjoblom C, Dahl U, Tonning A, et al. (2004) Derivation, characterization, and differentiation of human embryonic stem cells. Stem Cells 22: 367-376.
Derivation of a xeno-free human embryonic stem cell line. C Ellerstrom, R Strehl, K Moya, K Andersson, C Bergh, Stem Cells. 24Ellerstrom C, Strehl R, Moya K, Andersson K, Bergh C, et al. (2006) Derivation of a xeno-free human embryonic stem cell line. Stem Cells 24: 2170-2176.
Wholeblastocyst culture followed by laser drilling technology enhances the efficiency of inner cell mass isolation and embryonic stem cell derivation from good-and poor-quality mouse embryos: new insights for derivation of human embryonic stem cell lines. J L Cortes, L Sanchez, Catalina P Cobo, F Bueno, C , Stem Cells Dev. 17Cortes JL, Sanchez L, Catalina P, Cobo F, Bueno C, et al. (2008) Whole- blastocyst culture followed by laser drilling technology enhances the efficiency of inner cell mass isolation and embryonic stem cell derivation from good-and poor-quality mouse embryos: new insights for derivation of human embryonic stem cell lines. Stem Cells Dev 17: 255-267.
Morula-derived human embryonic stem cells. N Strelchenko, O Verlinsky, V Kukharenko, Y Verlinsky, Reprod Biomed Online. 9Strelchenko N, Verlinsky O, Kukharenko V, Verlinsky Y (2004) Morula-derived human embryonic stem cells. Reprod Biomed Online 9: 623-629.
Human embryonic stem cell lines generated without embryo destruction. Y Chung, I Klimanskaya, S Becker, T Li, M Maserati, Cell Stem Cell. 2Chung Y, Klimanskaya I, Becker S, Li T, Maserati M, et al. (2008) Human embryonic stem cell lines generated without embryo destruction. Cell Stem Cell 2: 113-117.
Human embryonic stem cell lines derived from single blastomeres. I Klimanskaya, Y Chung, S Becker, S J Lu, R Lanza, Nature. 444Klimanskaya I, Chung Y, Becker S, Lu SJ, Lanza R (2006) Human embryonic stem cell lines derived from single blastomeres. Nature 444: 481-485.
Derivation of human embryonic stem cells from single blastomeres. I Klimanskaya, Y Chung, S Becker, S J Lu, R Lanza, Nat Protoc. 2Klimanskaya I, Chung Y, Becker S, Lu SJ, Lanza R (2007) Derivation of human embryonic stem cells from single blastomeres. Nat Protoc 2: 1963-1972.
Derivation of the first Swiss human embryonic stem cell line from a single blastomere of an arrested four-cell stage embryo. A Feki, A Bosman, J B Dubuisson, O Irion, S Dahoun, Swiss Med Wkly. 138Feki A, Bosman A, Dubuisson JB, Irion O, Dahoun S, et al. (2008) Derivation of the first Swiss human embryonic stem cell line from a single blastomere of an arrested four-cell stage embryo. Swiss Med Wkly 138: 540-550.
Derivation of human embryonic stem cells from developing and arrested embryos. X Zhang, P Stojkovic, S Przyborski, M Cooke, L Armstrong, Stem Cells. 24Zhang X, Stojkovic P, Przyborski S, Cooke M, Armstrong L, et al. (2006) Derivation of human embryonic stem cells from developing and arrested embryos. Stem Cells 24: 2669-2676.
Derivation and maintenance of human embryonic stem cells from poor-quality in vitro fertilization embryos. P H Lerou, A Yabuuchi, H Huo, J D Miller, L F Boyer, Nat Protoc. 3Lerou PH, Yabuuchi A, Huo H, Miller JD, Boyer LF, et al. (2008) Derivation and maintenance of human embryonic stem cells from poor-quality in vitro fertilization embryos. Nat Protoc 3: 923-933.
Human embryonic stem cell derivation from poor-quality embryos. P H Lerou, A Yabuuchi, H Huo, A Takeuchi, J Shea, Nat Biotechnol. 26Lerou PH, Yabuuchi A, Huo H, Takeuchi A, Shea J, et al. (2008) Human embryonic stem cell derivation from poor-quality embryos. Nat Biotechnol 26: 212-214.
Derivation and characterization of human embryonic stem cell lines from poor quality embryos. W Liu, Y Yin, X Long, Y Luo, Y Jiang, J Genet Genomics. 36Liu W, Yin Y, Long X, Luo Y, Jiang Y, et al. (2009) Derivation and characterization of human embryonic stem cell lines from poor quality embryos. J Genet Genomics 36: 229-239.
Proposal for a universal minimum information convention for the reporting on the derivation of human embryonic stem cell lines. E L Stephenson, P R Braude, C Mason, Regen Med. 1Stephenson EL, Braude PR, Mason C (2006) Proposal for a universal minimum information convention for the reporting on the derivation of human embryonic stem cell lines. Regen Med 1: 739-750.
International community consensus standard for reporting derivation of human embryonic stem cell lines. E L Stephenson, P R Braude, C Mason, Regen Med. 2Stephenson EL, Braude PR, Mason C (2007) International community consensus standard for reporting derivation of human embryonic stem cell lines. Regen Med 2: 349-362.
Derivation of human embryonic stem cell lines in serum replacement medium using postnatal human fibroblasts as feeder cells. J Inzunza, K Gertow, M A Stromberg, E Matilainen, E Blennow, Stem Cells. 23Inzunza J, Gertow K, Stromberg MA, Matilainen E, Blennow E, et al. (2005) Derivation of human embryonic stem cell lines in serum replacement medium using postnatal human fibroblasts as feeder cells. Stem Cells 23: 544-549.
Derivation of 30 human embryonic stem cell lines-improving the quality. S Strom, F Holm, R Bergstrom, A M Stromberg, O Hovatta, In Vitro Cell. Dev. Biol. -Animal. 46Strom S, Holm F, Bergstrom R, Stromberg AM, Hovatta O (2010) Derivation of 30 human embryonic stem cell lines-improving the quality. In Vitro Cell. Dev. Biol. -Animal 46: 337-344.
Deep-freezing and transfer of human embryos. L R Mohr, A Trounson, L Freemann, J In Vitro Fert Embryo Transf. 2Mohr LR, Trounson A, Freemann L (1985) Deep-freezing and transfer of human embryos. J In Vitro Fert Embryo Transf 2: 1-10.
Blastocyst culture: toward single embryo transfers. D K Gardner, Hum Fertil (Camb). 3Gardner DK (2000) Blastocyst culture: toward single embryo transfers. Hum Fertil (Camb) 3: 229-237.
Immunosurgery of mouse blastocyst. D Solter, B B Knowles, Proc Natl Acad Sci. 72Solter D, Knowles BB (1975) Immunosurgery of mouse blastocyst. Proc Natl Acad Sci USA 72: 5099-5102.
Cultures of human embryonic stem cells: serum replacement medium or serumcontaining media and the effect of basic fibroblast growth factor. H Koivisto, M Hyvarinen, A M Stromberg, J Inzunza, E Matilainen, Reprod Biomed Online. 9Koivisto H, Hyvarinen M, Stromberg AM, Inzunza J, Matilainen E, et al. (2004) Cultures of human embryonic stem cells: serum replacement medium or serum- containing media and the effect of basic fibroblast growth factor. Reprod Biomed Online 9: 330-337.
Unique gene expression signature by human embryonic stem cells cultured under serum-free conditions correlates with their enhanced and prolonged growth in an undifferentiated stage. H Skottman, A M Stromberg, E Matilainen, J Inzunza, O Hovatta, Stem Cells. 24Skottman H, Stromberg AM, Matilainen E, Inzunza J, Hovatta O, et al. (2006) Unique gene expression signature by human embryonic stem cells cultured under serum-free conditions correlates with their enhanced and prolonged growth in an undifferentiated stage. Stem Cells 24: 151-167.
Expression of leukimia inhibitory factor and its receptors is increased during differentiation of human embryonic stem cells. L Aghajanova, H Skottman, A M Stromberg, J Inzunza, R Lahesmaa, Fertility and Sterility. 86Aghajanova L, Skottman H, Stromberg AM, Inzunza J, Lahesmaa R, et al. (2006) Expression of leukimia inhibitory factor and its receptors is increased during differentiation of human embryonic stem cells Fertility and Sterility 86:3: 1193-1209.
A teratocarcinoma-like human embryonic stem cell (hESC) line and four hESC lines reveal potentially oncogenic genomic changes. O Hovatta, M Jaconi, V Tohonen, F Béna, S Gimelli, PLoS ONE. 54Hovatta O, Jaconi M, Tohonen V, Béna F, Gimelli S, et al. (2010) A teratocarcinoma-like human embryonic stem cell (hESC) line and four hESC lines reveal potentially oncogenic genomic changes. PLoS ONE 5:4, e10263.
Highresolution DNA analysis of human embryonic stem cell lines reveals cultureinduced copy number changes and loss of heterozygosity. E Narva, R Autio, N Rahkonen, L Kong, N Harrison, Nature Biotechnology. 28Narva E, Autio R, Rahkonen N, Kong L, Harrison N, et al. (2010) High- resolution DNA analysis of human embryonic stem cell lines reveals culture- induced copy number changes and loss of heterozygosity. Nature Biotechnology 28:4, 371-377.
Preimplantation genetic diagnosis as a source of human embryonic stem cells for disease research and drug discovery. E L Stephenson, C Mason, P R Braude, BJOG. 116Stephenson EL, Mason C, Braude PR (2009) Preimplantation genetic diagnosis as a source of human embryonic stem cells for disease research and drug discovery. BJOG 116: 158-165.
Heteroparental blastocyst production from microsurgically corrected tripronucleated human embryos. M J Escriba, J Martin, C Rubio, D Valbuena, J Remohi, Fertil Steril. 86Escriba MJ, Martin J, Rubio C, Valbuena D, Remohi J, et al. (2006) Heteroparental blastocyst production from microsurgically corrected tripronu- cleated human embryos. Fertil Steril 86: 1601-1607.
A microsurgical technique for enucleation of multipronuclear human zygotes. V Ivakhnenko, J Cieslak, Y Verlinsky, Hum Reprod. 15Ivakhnenko V, Cieslak J, Verlinsky Y (2000) A microsurgical technique for enucleation of multipronuclear human zygotes. Hum Reprod 15: 911-916.
Development of the human dispermic embryo. A H Sathananthan, J J Tarin, L Gianaroli, S C Ng, V Dharmawardena, Hum Reprod Update. 5Sathananthan AH, Tarin JJ, Gianaroli L, Ng SC, Dharmawardena V, et al. (1999) Development of the human dispermic embryo. Hum Reprod Update 5: 553-560.
Normal birth after microsurgical enucleation of tripronuclear human zygotes: case report. S Kattera, C Chen, Hum Reprod. 18Kattera S, Chen C (2003) Normal birth after microsurgical enucleation of tripronuclear human zygotes: case report. Hum Reprod 18: 1319-1322.
Embryo aneuploidity and the role of morphological and genetic screening. D Wells, Reprod Biomed Online. 21Wells D (2010) Embryo aneuploidity and the role of morphological and genetic screening. Reprod Biomed Online 21: 274-277.
Sequential embryo scoring as a predictor of aneuploidy in poor-prognosis patients. A Finn, L Scott, T O'leary, D Davies, Hill, J Reprod Biomed Online. 21Finn A, Scott L, O'Leary T, Davies D, Hill (2010) Sequential embryo scoring as a predictor of aneuploidy in poor-prognosis patients. J Reprod Biomed Online 21: 381-390.
| Objective To construct the lentiviral expression vector of HLA-E gene and investigate its significance for further study on tumor immunity.Methods After the lentiviral expression vector of HLA-E gene(pGC-E1-GFP-HLA-E)was transduced HepG2 cell lines,the transduction efficiency,the HLA-E mRNA level by RT-PCR and the expression of HLA-E by immunohistochemistry were detected between October 2006 and November 2007 in the Liver Transplautation Center of Third Affiliated Hospital of Sun Yat-sen University.Results The transduction efficiency of HepG2 cell lines using the lentiviral vectors was 95.0%±1.3% which allowing the stable expression of HLA-E after 72 hr.The HLA-E mRNA level in vitro was detected more 8.73±1.05 times and 293.48±42.01 times than normal level by RT-PCR(P0.01).The expression of HLA-E by immunohistochemistry was displayed significant enhancement.Conclusion The lentiviral expression vector is ideal vetor of gene therapy and made genes transducted stable expression in target cell. | We used HeLa cells as recipients in a gene transfer assay to characterize DNA sequences that negatively regulate mammalian cell growth. In this assay, genomic DNA from quiescent human embryo fibroblasts was more inhibitory for HeLa replication than was DNA from either Escherichia coli or HeLa cells. Surprisingly, growth inhibitory activity depended on the growth state of the cells from which genomic DNA was prepared; it was strongest in DNA prepared from serum-deprived, quiescent embryo fibroblasts. This latter observation implies a role for DNA modification(s) in regulating the activity of the inhibitory sequences detected in our assay. The level of the observed growth inhibitory activity was sometimes high, suggesting that the relevant sequences may be abundantly represented in the mammalian genome. We speculate that these findings may provide new insights into the molecular mechanisms involved in cellular quiescence and in vitro senescence. | When did virchow cells come from cells that already exist? | Background ::: One of evolution’s most important achievements is the development and radiation of multicellular organisms with different types of cells. Complex multicellularity has evolved several times in eukaryotes; yet, in most lineages, an investigation of its molecular background is considerably challenging since the transition occurred too far in the past and, in addition, these lineages evolved a large number of cell types. However, for volvocine green algae, such as Volvox carteri, multicellularity is a relatively recent innovation. Furthermore, V. carteri shows a complete division of labor between only two cell types – small, flagellated somatic cells and large, immotile reproductive cells. Thus, V. carteri provides a unique opportunity to study multicellularity and cellular differentiation at the molecular level. | One hundred and four H-2 congenic lines were typed for alleles at seven loci, Qa-1, Qa-2, Tla, C3, Ce-2, Pgk-2, and Upg-1, residing distal to the H-2 complex. The results of the typing were used to estimate the length of the segment of chromosome 17 derived from the donor strain of each line--that is, the minimal length of the differential segment. The results indicate that only lines derived by intra-H-2 crossing-over in such a way that they inherited the right-hand portion of H-2 from the inbred partner have the telomeric half of chromosome 17 identical with that of the inbred-partner strain. In other lines the differential segment is at least 3 to 10 cM long. It is argued that in some lines the entire telomeric half of chromosome 17 might be of donor-strain origin. | 119 | Stanley Michael Gartler identical, and further, all carried the G6PD allele found almost exclusively in people of African descent. HeLa, the first successfully established human cell line, was derived from a woman of African descent named Henrietta Lacks, so this result suggested that the cell lines were not truly independent, but had been contaminated by HeLa cells. It was not realized at the time that nearly all attempts to establish human cell cultures resulted in cell lines with limited life spans. Dr. George Gey, the originator of HeLa, had sent his cells to all who requested them, and this problem arose because many | What makes HeLa cells unique among immortalised cell lines? Aside from widespread availability, how are they superior for research purposes? | who proposed the idea that all cells come from existing cells | what is the use of hela cells | what did hela cells test in 1953 | How does contamination occur in other experiments with HeLa cells, and why is it such a problem? | Stemming the tide of HeLa cells | Tissue cultures of HeLa cells in Hank's medium suspension, previously mixed with a solution containing reticulocyte polysomes and/or free globin, hemoglobin and blood plasma from bled rabbits, were homogenized, and an electrophoretic pattern of hemoglobin band was obtained from the supernatant; hemoglobin denatures under the tissue culture conditions. HeLa cells show typical hemosomes, identical to those found in immature erythrocytes of embryos, and adult mammals with hemolytic anemias. When HeLa cell suspensions are mixed with solutions void of anemic blood plasma, or containing normal rabbit blood plasma, anomalous organelles are formed in the cells, and no hemoglobin biosynthesis occurs. | HLA antigens in ocular tissues. I. In vivo expression in human eyes. |
120 | Running Apps with Achievements | Can someone please tell me where to find my achievements in the Xbox mobile app? It’s literally driving me crazy. It was never this hard to find it before the whole redesign. Even if I tap a game from my library it just takes me to the product page wth?? With no achievements button!?! The Xbox logo in the top left also literally drives me insane. It should be how you get to your achievements! How can they put that there when it literally does nothing, completely goes against any Xbox player’s habits when they see that logo. We push it on the controller!! | I built an app using the power apps function in my SharePoint list. My goal is to have an app that other employees can access from their phone to submit help desk type tickets. The main functions I need it to do are:
1. Allow a sales associate to submit the form from the app to SharePoint
2. Allow analysts to respond to the request in SharePoint and have it notify the sales associate and update the application to show the response received from the analyst.
I have the first step working but can’t get any further. I don’t have support from my IT department due to capacity and truly feel I am in over my head. Does anyone consult on the side? I need this app for my department to continue to grow, however am officially stuck. | Hello.
I really like the OneUI aesthetic and the looks of app icons. I was wondering if there's a way to get OneUI apps on my Honor 9.
I know apps like Phone, Messages and Camera probably won't work, but what about other ones?
Thanks in advance. | Hi guys,
2 weeks ago, I shared with you guys. The idea comes from the fact that you are more likely to reach your goals if you make them public. It's very simple, but it works! I got many interesting suggestions that I will gradually start implementing inside the app.
For New Year's, I have released a simple version of the app that allows you to create a New Year's resolution with a epic background and then share it with your friends. This way you are accountable to achieving it.
You can try it here: goalcast.it
Thanks. This is just a beta and would love some feedback on how to make the app better. | Hi, I need to make an App for my IT certificate, so I decided to make an Rust app, but I like to know what funcionalities I should implement. For start I was thinking in something related to furnaces split stacks, and timer, such as decay timers, that could send a notification to the user when is about time to log in the game to reset the timer. If everything go as planed, I was thinking in publish the app on Google Play, without ads (I hate those annoying ads popping up when u use an app), because I'm doing this for study propouse and not for money.
So any advices and suggestions I will apreciate.
English is not my native language so, sorry for possible gramar mistakes. | I struggle to find a perfect calendar app much like others struggle to find a perfect email or task management app. I am yet to find a calendar app that allows you to hide events in a subscribed calendar, for instance, holidays in the default holidays calendar that I don't celebrate. I also am yet to find a calendar app that shows all events in a single calendar in a list so that you could for instance see all of the days you have off of school without scrolling through the calendar. I would like to address this. However, rather than making a calendar app like fantastical I would like to make a utility app that addresses annoyances like the ones I listed above and I'm looking for suggestions. | I've been working on the app on and off and I posted this to this sub and got great feedback last time, some of which I have gone ahead and implemented so I wanted to share back with the sub!
Here's the updated WP app
Here's the soon to be updated W8 app!
Let me know what you think!
The next few things I plan to work on are:
1.Port new goodies to WinApp
2.Design Arena helper (let me know what would be most helpful to you!)
3.Deck builder
4.HS News | I notice on the front page that someone created an app that calculates gold cost to upgrade cards. I thought this was super cool, and it reminded me that I could do something like this to.
I'm finishing up and android app I have been working on for a while now, and I need something else to work on afterwards.
If you could have a CR related app that did anything in the world, what would it do?
If it's doable and not some shitpost, I'll make the suggestion with the most upvotes.
I'll give you all a week or so. | 120 | Hi guys,
I currently use Nike+ as a running app. Like many other users, I was pretty disappointed when they overhauled it, particularly because the ability to get achievements seems to have vanished. Maybe it's the gamer in me, but I liked getting an achievement for running on my birthday or being active 12 months in a row. They were motivating. Yes, you can still access them online, but I think they've been phased out of the mobile app (which was kinda the point, you know?).
Can anyone recommend an app that offers similar achievements? Or really, any achievements at all? Does such an app exist?
Thanks for your help. | Is the a C25K program with the Nike Run Club app? What app is the best? | "Runners Watch"? Nike, Garmin, or something else? What do you recommend? | Worked great for Running and Nike+ | Any good loyalty rewards app or devices? | This is Sunday: What were your running achievements this week? | This is Sunday: What were your running achievements this week? | idea for an app: boston subway | App with a good exercise library |
121 | Water, Sewer, Trash in St. Louis City | Sewage backed up and flooded homes in Queens. City officials will bring in contractors to help clean up the mess. | ['Monday - Sunday: 9:00-17:00.', 'Oadby Recycling And Household Waste Site. Wigston Road, Oadby. LE2 5JE.'] | Ivy City drainage problems began to be addressed in 2013. The solution went back to 2005, when the United States Environmental Protection Agency (EPA) sued the District of Columbia Water and Sewer Authority (DWSA) for extensive violations of the Clean Water Act. The District of Columbia had a combined sewer system. This meant that when stormwater and sewage were both dumped into the same sewer lines. Whenever precipitation was heavy, such as during a thunderstorm, the system became overwhelmed. The system then dumped mixed water (containing raw sewage and stormwater) into local rivers and streams untreated. This happened so frequently, and in | My basement flooded and I need to have someone in to look at the electrical that got wet and appliances like the washer/dryer and hot water heater. Preferably someplace that can also supply me with replacements. I'd like to minimize the number of companies that I have to deal with.
I'd like to have a second floor drain installed and some plumbing redone. (won't be covered)
I'd like to do a floor coating of some kind instead of replacing the carpet/underlay. Not sure what options are or where to go.
Will need to have a bathroom completely demolished and replaced. | I just moved to Minneapolis a few days ago. Today I went for a bike ride on the Greenway. Got on at Bryant and I immediately noticed a bunch of trash and then about a 1/2 mile in all the tents started showing up. So many people and garbage everywhere.
I feel awful for those people but what is being done to help them or keep them from getting severely ill? Why isn't the city putting out more trash containers so that there isn't a plethora of shit on the trail... I rode from Bryant & Lake to Brackett Park and there were tents the entire way.
How did the homeless problem get so out of control? I lived here originally about 7 years ago and the Greenway was almost spotless. | densely populated areas can cause groundwater pollution. In some localities and varieties of English, particularly outside North America, the term "outhouse" refers "not" to a toilet, but to outbuildings in a general sense: sheds, barns, workshops, etc. Outhouses vary in design and construction. They are by definition outside the dwelling, and are not connected to plumbing, sewer, or septic system. The World Health Organization recommends they be built a reasonable distance from the house balancing issues of easy access versus that of smell. The superstructure exists to shelter the user, and also to protect the toilet itself. The primary purpose | In Lucknow, India, urban slums have sprung up much faster than the authorities' capacity to service them. Here, the three-way partnership of government, community-based NGOs and the private sector is the key to planning adequate urban drainage. | You have a smell from toilet in basement you have no septic tank? | 121 | Hi folks, I found a couple posts that were archived about paying water/sewer/trash in St. Louis City, but I still had a couple questions. We're thinking of renting a place that doesn't cover these utilities but are worried about how much it will cost. How much is the bill for a 2 bathroom house? How do you sign up for these utilities? | How do I figure out utilities when looking at new apartments? | Utilities Included Apartments | Plumbing problem out near the street (under the sidewalk) - can I get the city to front the bill? | How much would utilities for off campus accommodation cost? | Apartment renters of Reddit, how much do you pay per month for your area and what items/services do you only have to keep costs low? | Looking to get out of a lease. Sewage dumped in yard. | Friend and I plan on moving out soon..can anyone give me an idea on how much utilities would be? | Rental For Rent - - 4 Bedrooms - 2 Bathrooms - Price $2,600 - 88478852 |
122 | Didn't work with my Pentax camera | This may work perfectly with most cameras. But it was worthless with my Pentax K5 and K3 ii. Just acted weird. I tossed it in the trash. Pity. | I've just recently bought a Pentax 6X7 and even though I know the camera won't fire without film (despite there being tricks to go around this) I've inserted new batteries, put in a fresh roll of film and the camera advances the film, however, the shutter doesn't seem to fire, and although the advancing lever does work the frame counter won't so does the shutter. I've watched numerous videos on youtube and looked for what could I possibly be doing wrong, if there's anyone in here who can help I would highly appreciate that. Cheers. | Pentax cameras New F-1, Olympus OM-2, and Contax RTS cameras. It replaced the K2 DMD as the Pentax 35mm flagship. It is rugged, weatherised and sealed against dust, yet compact and light. It has interchangeable viewfinders (more than any of its rivals) and focussing screens; the S69 screen is particularly bright. The LX uses an advanced metering system that also reads the light falling on the film and the first shutter curtain during exposure, the TTL OTF (off the film) feature, a Minolta patent, but utilised in the Olympus OM-2 in 1975. The selected aperture value and shutter speed are shown in | For some reason, which could be the age of my camera, this does not work. It won't format completely, so I am unable to return it. They should tell you this before you buy it. | Doesn't work in my Nikon D800. I've returned it and ordered another one. Hopefully, it will work as other have reported. | Does not work for this camera. Either does the car charger. Very disspointed. I have the Lumix Panasonic DMZ-FZ18 CAMERA. | caleb at amcrest help me with my camera set up and now it worked great. He was very nice to talk to and was very helpful | It worked for 1 use. We thought it was the batteries and changed those too, twice, but nope, the camera is not turning on. Now, I'm past my return deadline. Guess I'm not buying this brand again for a camera! | 122 | Didn't work with my Pentax K-S2. The angle of the grip was such that there was no way you could get your hand in the right angle to release the shutter. Guess it just depends on your camera, but this didn't work for me. | Works great on Pentax K-30 | Will not work with a camera using a Battery Grip with an attached follow focus | No Option for Immediate Shutter Release | sx-70 model 2 shutter issue | Using 2 Cameras, & Touchpanel with SX80 codec | QUESTION FOR THOSE FAMILIAR WITH OLYMPUS PEARLCORDER S702 | Does not work with my Canon MG7120. I watched ... | they do not work with the nikon camera |
123 | I thought this book was a textbook but it turns out that it looks more like a workbook that you write it in and I ... | I ordered the actually textbook and they sent me a workbook... Not useful, since I don't have the textbook that I actually ordered | The listing of this item changes to look like the actual textbook. this is not the textbook but a workbook based on the textbook. The textbook is the one with the flowers on it. don't get mixed up or it will cost you an extra 30 bucks, and no one wants that. Also if you are looking for this particular book, be warned that it's likely full already with other people's notes, even when I bought the new listing. | This helped me a lot more than I though it would . It's one textbook I don't regret buying ! | Basically a workbook, hardly any explanations on how to work the problems....You could not learn on your own from this book... | This book is a decent text however it's not an easy read. I had to reread some parts to totally get the concept. It's not the worst textbook I have ever been assigned thought. | This is not a book. It's just tables of contents. Know what you are getting. If that's what you want for some reason, that's all it is. | The textbook I received was missing all of Part 3! Luckily a classmate let me borrow her copy. I would have been royally screwed if not. | This is a textbook for school. It was in good shape as advertised. | 123 | I know this isn't a review but I have a question hopefully someone knows the answer. I thought this book was a textbook but it turns out that it looks more like a workbook that you write it in and I decided to rent it. Besides I rent it, I can't write in it. I'm not sure if I should keep it for now and wait what my teacher says or take it back and buy one instead. If someone could give me some opinions that would be awesome! | Renting the book is better than owning it since the one I own is ... | The textbook was well loved before me | great deal for a textbook | not returning a rented textbook | The book is appropriate for the class, but the customer service from Amazon is terrible! | Any reason to keep old financial accounting textbook? | If I Stay was a much better book. I purchased this for my daughter who ... | I have only good reviews for the books that I bought from this ... |
124 | Unrecorded watermark, colour shade and perforation variation in philatelic issues commemorating the World Youth Stamp Exhibition (2014) from Malaysia | Marked (documentary) Marked is a television program produced by NorthSouth Productions for the History channel that premiered August 27, 2009. It explores the world of tattoos belonging to modern day tribes that operate at the edges of society, including motorcycle clubs, urban gangs, and hardcore prisoners. The show takes the viewer into the minds of members as they explain what the mysterious symbols decorating their bodies mean on the street, and mean to them personally. Initiation rites, turf wars, and the fierce pride of belonging to an outlaw family are all part of the territory. Tattoo artists and cultural experts | Philatelists' traditional method of identifying postage stamps uniquely has long been to number each country's stamps consecutively; Norway #1 is the 4-skilling blue stamp issued in 1855, and so forth. However, this seemingly straightforward numbering system runs into immediate difficulties, which have been solved in different ways by different stamp catalogs.
Issues
The difficulties are as follows:
What is a "country"?
What is a postage stamp?
What is a distinct type of postage stamp?
What if several stamps are issued on the same day?
What if the date of issue is unknown?
What if stamps of a single series appear one at a time, interspersed with commemorative stamps?
Should special-purpose stamps be grouped together?
Although the definition of "country" may seem obvious, there are occupations of one country by another, stamp issued by areas in rebellion, reunifications, and regions that have issued their own stamps for one reason or another. A classic example is Germany; unified from many smaller entities, then divided into multiple zones of occupation at the end of World War II, then divided into West Germany and East Germany, then reunified. Catalogs typically treat West Germany as part of a single sequence under the name "Germany" while giving East German stamps their own numbers.
The definition of "postage stamp" can also be problematic for catalogers. For instance, some countries have issued adhesive labels purporting to be postage stamps, but which had the "cancel" printed directly on the stamp and shipped to dealers, without ever being sold to the public for use on letters. The treatment of these has long been a vexing issue, and catalogs vary greatly on whether to list the stamps. A related issue is a small number of extremely rare stamps that may or may not be old forgeries; the assignment or removal of a number is a key step in the consensus as to their authenticity.
Philatelists typically identify more types of stamps than do the governments issuing them. Changes of perforation, watermark, often occur without any official notice, as do printing errors. In a few cases, even the date of first issue of a stamp has no surviving record.
The issuance of multiple types on a single day is an old practice, but usually these were different denominations, and could be numbered in ascending order of value. More recently, it has become common to issue a group of stamps with related designs and the same denomination on the same day.
Finally, it is common for the stamps of a definitive series to be issued one or a few at a time, as postal rates change. Logically, they are part of a single group, with a unified design theme and a sequence of values, even though ten years or more may have elapsed from the first to the last. The same reasoning could be applied to special-purpose stamps such as airmail or postage due stamps.
Catalog numbering systems
Over time, stamp numbers may become a shorthand for collectors and dealers. Scott Catalogue, Gibbons, Yvert and Michel catalogs all use different arrangements for numbering regular and special-purpose types, and attach different importance to variations in paper, perforation, watermark and other types.
Because of its commercial importance the publishers of the Scott Catalogue claim copyright on their numbering systems, and grant only limited licences for their use by others. The inconsistency with which Scott enforced these licences resulted in a lawsuit by Krause Publications (publishers of the Minkus Catalogue) for copyright infringement. After Krause filed a defence the suit was settled out of court, and Krause continued to reference the Scott numbers. It has been speculated that Scott was not successful. Attempts by philatelists to establish an alternative have not yet been successful.
Official numbering systems
In general, governments have not tried to number their own stamps. The People's Republic of China is a notable exception, having inscribed most of its stamps with a unique numbering system since 1949.
In 2002, as part of efforts to control allegedly illegal stamps, the Universal Postal Union introduced the WADP Numbering System (WNS) for new issues by UPU members.
References
External links
Alphabet soup: Scott catalog prefixes and suffixes
Stamp collecting
Philatelic terminology | slightly different types of overprint, three types applied locally, and a fourth made in the Netherlands and sold by the UN in New York City. These were superseded on 1 May 1963 by stamps of Indonesia overprinted "IRIAN BARAT" and a series of six commemoratives whose designs included a map of Indonesia stretching "from Sabang to Merauke" and a parachutist landing in New Guinea. These, as were later issues in 1968 and 1970, were inscribed both "IRIAN BARAT" and "REPUBLIK INDONESIA". Postage stamps and postal history of Western New Guinea Since 1963 Western New Guinea has been part of Indonesia. | Postage stamps and postal history of Pakistan July 1948. Since then, numerous other people have designed stamps for the country, including some well-known artists. These artists include Saeed Akhtar, Bashir Mirza, Askari Mian Irani, Jimmy Engineer and Zahoor ul Akhlaq. Others designers were Nighat Saeed, Saleem Uddin Ghori, Zahid Shah, Talat Sultana and A. J. McCoy. A famous Pakistani designer is Adil Salahuddin, who in his capacity as the official designer for almost 40 years, designed over 350 stamps for his country. Most of the stamps designed are by local designers. However, photographs have been also used for stamps as in the Louis Pasteur issue (1995)(SG 978) | The picture is very misleading. It shows three markers in black, red and blue, but I just received one marker. | Not as clear and easy to read as the old Pyrex markings. Why do people change what has already been perfected?Still better than the competition. | Stainless Steel Permanent Marker Made to last through years of use, this Sharpie is ideal for all your work, art and marking needs. | I love using Neenah paper for stamping! It works SO well, gives a great image and is a versatile paper for many colouring techniques. I love the white and now here is another colour - GREAT! | 124 | A watermark is applied to an official paper document of value, such as postage and revenue stamps, bank notes and passports, as a device to reduce counterfeiting (Mackay, 2003). Typically, it comprises a pattern, image or letters that appear when viewed under transmitted light, or via reflected light on a dark background. Watermarks on postage stamps are often what differentiate a common stamp from a rare and valuable one, and recognition and study of watermarks is an active field of philately. Colour variation in stamps are more common and may be significant, especially in cases of missing colours. However, changelings (stamps that change colours due to condition of storage, etc) are of little philatelic value, and may be difficult to scientifically document (Guertin, 1965; Herendeen, 2013). Perforation types are also noteworthy, and recorded in detailed catalogues. As in watermarks, perforations can result in price differences between stamps, and fake perforations are common (Prill, 2011). | what was used to mark stamps in looms | Watermark recommendations? | the study of stamps is the same as what | what is the term for a digital watermark that is not easily detectable after a modification | AnnoWaNO: An annotation watermarking framework | What do you guys think about watermarks? | Sheet protectors and marker/pens for character sheets. | How do you use watermark on Microsoft word? |
125 | what type of sets can order theory be generalized to | The best known connection between partial orders and linear orders is the Szpilrajn theorem: ::: Any partial order on a set can be extended to a linear order on the same set. ::: From this, it follows that any partial order is the intersection of its linear extensions; equivalently, every ordered set can be represented as some subset of a Cartesian product of chains. | On ordered fields and definite functions | In the mathematical field of order theory, an order isomorphism is a special kind of monotone function that constitutes a suitable notion of isomorphism for partially ordered sets (posets). Whenever two posets are order isomorphic, they can be considered to be "essentially the same" in the sense that either of the orders can be obtained from the other just by renaming of elements. Two strictly weaker notions that relate to order isomorphisms are order embeddings and Galois connections.
Definition
Formally, given two posets and , an order isomorphism from to is a bijective function from to with the property that, for every and in , if and only if . That is, it is a bijective order-embedding.
It is also possible to define an order isomorphism to be a surjective order-embedding. The two assumptions that cover all the elements of and that it preserve orderings, are enough to ensure that is also one-to-one, for if then (by the assumption that preserves the order) it would follow that and , implying by the definition of a partial order that .
Yet another characterization of order isomorphisms is that they are exactly the monotone bijections that have a monotone inverse.
An order isomorphism from a partially ordered set to itself is called an order automorphism.
When an additional algebraic structure is imposed on the posets and , a function from to must satisfy additional properties to be regarded as an isomorphism. For example, given two partially ordered groups (po-groups) and , an isomorphism of po-groups from to is an order isomorphism that is also a group isomorphism, not merely a bijection that is an order embedding.
Examples
The identity function on any partially ordered set is always an order automorphism.
Negation is an order isomorphism from to (where is the set of real numbers and denotes the usual numerical comparison), since −x ≥ −y if and only if x ≤ y.
The open interval (again, ordered numerically) does not have an order isomorphism to or from the closed interval : the closed interval has a least element, but the open interval does not, and order isomorphisms must preserve the existence of least elements.
By Cantor's isomorphism theorem, every unbounded countable dense linear order is isomorphic to the ordering of the rational numbers. Explicit order isomorphisms between the quadratic algebraic numbers, the rational numbers, and the dyadic rational numbers are provided by Minkowski's question-mark function.
Order types
If is an order isomorphism, then so is its inverse function.
Also, if is an order isomorphism from to and is an order isomorphism from to , then the function composition of and is itself an order isomorphism, from to .
Two partially ordered sets are said to be order isomorphic when there exists an order isomorphism from one to the other. Identity functions, function inverses, and compositions of functions correspond, respectively, to the three defining characteristics of an equivalence relation: reflexivity, symmetry, and transitivity. Therefore, order isomorphism is an equivalence relation. The class of partially ordered sets can be partitioned by it into equivalence classes, families of partially ordered sets that are all isomorphic to each other. These equivalence classes are called order types.
See also
Permutation pattern, a permutation that is order-isomorphic to a subsequence of another permutation
Notes
References
.
.
.
.
Order theory
Morphisms | Topological sorting linear extension of a partial order in mathematics. A partially ordered set is just a set of objects together with a definition of the "≤" inequality relation, satisfying the axioms of reflexivity ("x" ≤ "x"), antisymmetry (if "x" ≤ "y" and "y" ≤ "x" then "x" = "y") and transitivity (if "x" ≤ "y" and "y" ≤ "z", then "x" ≤ "z"). A total order is a partial order in which, for every two objects "x" and "y" in the set, either "x" ≤ "y" or "y" ≤ "x". Total orders are familiar in computer science as the comparison operators | partial order is an antisymmetric preorder. A set with a partial order is called a partially ordered set (also called a poset). The term "ordered set" is sometimes also used, as long as it is clear from the context that no other kind of order is meant. In particular, totally ordered sets can also be referred to as "ordered sets", especially in areas where these structures are more common than posets. For "a, b", elements of a partially ordered set "P", if "a" ≤ "b" or "b" ≤ "a", then "a" and "b" are comparable. Otherwise they are incomparable. In | Two orders on the same set are orthogonal if the constant maps and the identity map are the only maps preserving both orders. We construct linear orders orthogonal to the order on the rationals. | Elementary extensions of models of set theory | Universal theories with model completions are characterized. A new omitting types theorem is proved. These two results are used to prove the existence of a universal ℵ 0 -categorical partial order with an interesting embedding property. Other aspects of these results also are considered. | 125 | does not have to be a lower set. Furthermore, it is often generalized to preordered sets. A subset which is - as a sub-poset - linearly ordered, is called a chain. The opposite notion, the antichain, is a subset that contains no two comparable elements; i.e. that is a discrete order. Although most mathematical areas "use" orders in one or the other way, there are also a few theories that have relationships which go far beyond mere application. Together with their major points of contact with order theory, some of these are to be presented below. As already mentioned, the | a partially ordered set is also known as a | a generalization of totally ordered sets with ties is called | which theory states that there are no intermediate cardinal numbers between aleph-null and the | What are the subordinating subordinating? | The rowmotion action on order ideals or on antichains of a finite partially ordered set has been studied (under a variety of names) by many authors. Depending on the poset, one finds unexpectedly interesting orbit structures, instances of (small order) periodicity, cyclic sieving, and homomesy. Many of these nice features still hold when the action is extended to $[0,1]$-labelings of the poset or (via detropicalization) to labelings by rational functions (the birational setting). In this work, we parallel the birational lifting already done for order-ideal rowmotion to antichain rowmotion. We give explicit equivariant bijections between the birational toggle groups and between their respective liftings. We further extend all of these notions to labellings by noncommutative rational functions, setting an unpublished periodicity conjecture of Grinberg in a broader context. | who defined the definition of ordered pair | when is the subset of a partially ordered set bounded | how many definitions are there in an ordered field |
126 | Tips for keeping a bird in a room. | So my family and I made a birdbox out of wood. It’s fully sealed, got a 37mm diameter hole with a dowel underneath. We put it on a wall in our garden about human head height up the wall. We’ve got loads of birds in our garden: tits, robins, etc. Several great tits and blue tits have perched, taken a look inside for a few seconds then left again. Like, nope, this isn’t fancy enough for me 😂
But seriously, how can we entice the birds in to stay? | My birds used to live in an aviary in my backyard, but recently I've moved to an apartment and was only able to keep four of my birds. They live in cages on the balcony but don't seem to be coping with seeing me walk around the house. They squawk and get very wound up. If I try to walk away from them after being near the cages they squawk and I basically have to run into the house and yank the blinds shut to make them stop. Anyone got any tips on how to help them calm down? I try to just sit calmly in their line of sight on weekends and they get a bit more used to seeing me come and go but as soon as I go back to work on Monday the cycle begins again. Anyone got any tips on how to help them chill out a bit? | This is perfect for keeping those pesky birds away! | Bird owners: I am curious how you deal with care for your bird if you're away from home for one, two, maybe three nights.
Context:
My GF and I are looking into getting a pet bird. I've grown up with budgies and now that we've a house of our own, and the budget to spare, we'd love a bird (or pair of birds?) of our own. (Something a bit larger than a budgie but still compact-ish sized: Caique or Cockatiel comes to mind.)
We both have full-time jobs, but most days we'll be home at least mornings and evenings. I often work from home during the day as well. However, every now and then we like to head out for the weekend.
* What's the longest time you normally leave your bird unattended?
* Do you leave the cage locked, or is your bird free to fly around the room when you're not home?
* When you're away from home for 1-3 days:
-Do you just have a friend or neighbor come over to fill up the food and water?
-Do you ask someone to actively spend time with them?
-Do you bring the bird to a friend?
* Would it be better to get a pair of birds, so they have each other's company when you're away?
* Are certain breeds better suited to spend time without having humans around than others?
Side note: the point of this post is of course not to ask how much I can skimp on care for my bird :) I know it's a commitment and I take that seriously.
edit: formatting | Bought it for my "bird room". I have a cockatoo who puts off a LOT of dust and dander. It's made a significant difference. | This has saved me. I was having so much trouble keeping birds out to the dryer vent. | I have been wanting to get a parrot for a while now. I am a pretty lonely person. No friends that live near, I work from home and only have to go into my job once a week for 3 hours. So I have more than enough time to spend with an animal.
My only concern is that live in only about 350 square feet. I have no problem with having a cage take up a large portion of that space, but am worried that the small space I live in wouldn’t be enough for a bird? I do live on close to an acre of land and enjoy going on walks and hikes. It is realistic to buy a harness and take the bird out with me every day? Or would that not be enough/safe? Any and all advice is appreciated. | Hello everyone,
this bird is chilling on the bench on my front porch. My wife is afraid it may be hurt. Can anyone tell me what it is? (I think Pigeon)
| 126 | Hello!
My fiance and I own a GCC and currently we are constrained to two places in a house (our bedroom and then a personal gaming/media room that's pretty big, Our birdcage is in the gaming room and we let the free roam this room since we are in it pretty much all day for work, gaming, tv etc. Our roommates own cats/dogs and we don't want our bird to be injured if it flies out the door when we are leaving to grab something. Anyone have a tip to have extra security in preventing the bird from flying out the room when the gaming room door opens? We don't want to put the bird in the cage every time we need to open the door for something.
&#x200B;
Thanks! | Hens blocking door at night | My bird literally flies into other rooms to attack people | This worked great!! We had birds flying into our windows ... | when did the bird cage house come out | Slight warning changing your habitat with animals inside | Great idea, didn't work on the current bird house | Advice on space and taking birds out with a harness | Definitely scares the birds away - just need to put it on some sort of perch. |
127 | Stuck on 4.85 HFW after PS3Xploit | [SOLVED]
Hello I have a problem while installing HFW 4.85, I'm currently on OFW 4.85 but hat 4.84 CEX installed before.
My problem is that after installing the 4.85 HFW twice via recovery, the console freezes when I'm opening the internet explorer and going to ps3xploit.com, after typing that address the console freezes and I have to restart it. This happens every time, I tried it over 10 times now and it even sometimes freezes when I just open the internet explorer.
Pls help.
CECH-2504A | (sorry I have been talking to people all day about the PS4 mean my PS3)
For some reason my PS3 refuses to go into 1080p I have it set to automatically update yet it give gives me large mode all the time, I've gone into the settings and forced it into 1080p but as soon as it is done testing and conferring how I want it swaps me right back 720. I have swapped my Xbox cable with it so I have no idea what's wrong can anyone help me? | Hey guys, we had our ps3 die totally and there's disc still inside. What would be the best way to get it out?
As the title says, there's no power at all coming to ps3 so...
Please? I can't find shit by searching. :( | Hello guys,
I tried to hack my ps3 using ps3Xploit following this guide until the end of method one, I have a slim CECH-25XX, and when I tried to restart to install a cfw, the ps3 now shut down almost instantly at boot.
I followed the guide very closely so not to sure of what went wrong (only had ROS0 error, but guide said it was okay), but I'd want some advices of what I can do to unbrick it. Can I even unbrick it without an hardware flasher ? And if so, what do I need to buy ? | Recently I've written a post in /r/ps3 but it seems no one helped me, so I hope you guys have a solution.
I've been furious with this game on my Playstation 3 Slim.
The game is always stuck during loading screen and never lets me get past starting the game. It works on my other friends' Playstation3 but not on mine.
I can't even close the game and I am forced to restart the PlayStation 3.
I've tried the following threads:
And much, much more but to no avail.
My PS3 model: cech-420c3
Nothing is wrong with the disc because it worked on all of my 7 friends' playstations. Yes, even the ones who had slims but they were not the same exact model as mine.
Last of Us, Battlefield 4, Driver: San Francisco and GTA V all work fine. | My PS3 Super Slim 500GB is turning on for no reason at night at its creepy as hell. It couldnt be anyone from my family trolling me becouse all controllers are here with me and update is installed. | I'd found that the PCI wasn't where I thought it was- I'd move up to a high fastball, but the feedback would show that the PCI hadn't moved from dead center. I'd written the issue off as network lag.
I Googled a bit, and hit on instructions to "rebuild PS4 database." It was a simple process. I followed the instructions, and back into the game in less than five minutes.
What a world of difference- the lag is gone! I hope this can help someone else. | Is anyone else having trouble rewinding on YouTube for PS4? Like I try to go back ten seconds but it goes forward ten. | 127 | Hey all, I'm stuck on 4.85 HFW after using PS3Xploit. I'm trying to install 4.84.2 Rebug, but I'm unable to install any CFWs. I've tried the Rogero and Rebug 9.99 Downgraders as well as the 4.86.1 Rebug Lite, but they all come up with corrupt data (the MD5's all match) and I can't install any of them in recovery mode. I'm probably just dumb, but I'm brand new to PS3 Homebrew and honestly I'm not afraid to admit that I don't know what I'm doing (i'm more fluent in 3DS HB). Any help is appreciated, thanks!
EDIT: I updated to 4.87 and followed MrMario's guide instead and it worked well. Thanks to everyone who helped out! | Downgrading from CFW rebug 4.85.1 Lite to rebug 4.84 ?????? | I sold my PS3 with CFW 4.82, now the guy updated it to OFW 4.84 | A3 F stock installation trouble shooting | Be sure to update the witcher 3 to 3.4 | PREPARATION AND CHARACTERIZATION OF α-H_5[GeW_9Mo_2VO_(40)]·22H_2O | Anyone tried to install an AUX or Bluetooth "add-on" to their H3 ? I am getting sick of the FM receivers I am using. | PSA: Install A9LH if you are using the outdated boot/Non-A9LH methods (e.g. Menuhax, Ninjhax) to load Luma3DS | [UPDATE] psvimgtools-frontend v0.2 With 32-Bit Support! |
128 | when was the last time ingonish had a high temperature | What is the highest temperature ever achieved? | Atmosphere of Uranus at the solstice of 1986, when "Voyager 2" passed by the planet, they were concentrated near the sunlit pole, making it dark in ultraviolet light. The outermost layer of the Uranian atmosphere, extending for thousands of kilometres, is the thermosphere/exosphere, which has a uniform temperature of around 800 to 850 K. This is much higher than, for instance, the 420 K observed in the thermosphere of Saturn. The heat sources necessary to sustain such high temperatures are not understood, since neither solar FUV/EUV radiation nor auroral activity can provide the necessary energy. The weak cooling efficiency due to the depletion | How do you make my temperature go up? | We were very happy with the unit until the temperature got stock in the same number. We replaced the batteries, and did everything we could to figure out the problem to no avail. Now we have a useless unit that only lasted almost a year. | At-273.15C lowest temp? | What cave has the highest average temperature? | To convert to a Sous Vide cooker I removed the crock and sealed the holes in the bottom with red high temp RTV silicone (you can get it at the auto store). The silicone is still holding fine after a year of weekly use. Added a circulating pump, temp controller & solid state relay, keeps to within 0.5 degrees F (I use the High setting). Has a nice hole in the lid for your temp probe. | Heat illness in the army in Cyprus. | 128 | into the fall. These warm southwest winds blow down-slope from the Cape Breton Highlands, drying out and warming as it descends. Although the surrounding water freezes during winter, it warms very quickly through the summer, with sea surface temperatures peaking around 21°C (70°F) in August. The highest temperature ever recorded was on 10 August 2001. The lowest temperature was on 18 January 1982. Weather data has been recorded at Parks Canada in Ingonish Beach since 1950. In 2000, Environment Canada upgraded the climate station to an automated weather station. Ingonish Ingonish is a Canadian rural community in northeastern Victoria County, | in which month does qu'appelle, saskatchewan, record its highest temperature | when is the hottest month of the year in crystal lake illinois | what type of climate is aboyne scotland | when was the record high temperature in mcheny illinois | when is the hottest month in beira lake | Best weather source for the UK? | when is stayton oregon the hottest month of the year | when did the coldest temperature ever hit fort qu'appelle |
129 | TIFU by opening my pressure cooker | What is the use of pressure cooker in cooking? | This pressure cooker has made life so much easier. Love making a roast in no ti.r at all. | This is my first pressure cooker. It is awesome. Just set it and let it do its thing. | Explaon the principle of the pressure cooker? | I have made a few dishes with my electric pressure cooker where I have left the valve open to see what happens. The product is normally a much crispier version of whatever I would normally make (i.e. carnita with a crust to them on the bottom) and maybe a little tougher to pull apart but still not hard by any means. What is actually happening to the food instead of cooking under pressure? | I'm, most likely, the millionth five star review on this pressure cooker. This one has replaced my former electric pressure cooker for one reason. My older one was non-stick and the inner pot looks scratched and worn. If I had ONE criticism it's that I miss the oval pot in my former pressure cooker. I could, literally, fit a roast inside without having to cut it up! Other than that, my Instant Pot gets a TON of use. It doesn't hog my counter space. The pot is super easy to clean. I've had 15 years of experience with pressure cooking, so I rarely use the pre-programmed buttons-- and I mostly stick to manual settings. I bought a steamer insert that fits the circumference of the pot, so I can steam heavy items like potatoes. I don't boil potatoes any longer, because steaming them is easier AND I think more flavorful.. I mash my potatoes in the pot, and use the additional glass lid that I purchased, keeping them WARM with the setting. I also bought a silicone steam insert, for lighter vegetables-- and that works out beautifully (thought it took practice to learn the correct timing so that I don't overcook the veggies).
I've also purchased a springform pan that fits inside so I can make cheesecakes. Wow! They are fast, creamy and just the right size for the two of us. I even bought a ring pan, so I could make flan-- that turned out well. I have made so many recipes with this Instant Pot, that I could almost write my own cookbook (I have a food blog). I absolutely love pressure cooking, and I love this pressure cooker. I find it easy to use, I love the browning cycle. Next up: learn how to make yogurt. That's coming soon! | I have always used a pressure cooker. I have friends telling me their instapot is better. Any thoughts on this? | I bought this pressure cooker for everyday use, it worked well for the first few months, however after a few months it stopped building pressure. I have tired to stretch the rubber gasket but it still does not work as a pressure cooker any more. The stainless steel is an inferior quality, the food burns and sticks to the bottom very quickly. | 129 | Obligatory not today, but a few months ago
So there I was cooking some meat in my pressure cooker on the stove. I had just turned off the stove to allow the steam to escape so it can de-pressurize. However, it was boiling so fast that it managed to build up sufficient pressure to activate the lock which keeps the intellectually challenged such as myself from opening it while it’s pressurized.
I wanted to check if they were done, but didn’t want to wait for for it to fully de-pressurize. I wanted my meat NOW. So I forced and twisted the top (which you’re not supposed to do) to open the lid.
Now I’ve done this before, even on the exact same settings when I was making dinner last week. There’s usually a little bit of pressure, just enough to activate the lock, so when you twist the lid off it will pop off a little bit that’s all.
This time, however, it didn’t just pop off. As soon as the lid was twisted enough to be lifted off, a deluge of boiling meat water and steam exploded out of the pot, covering the entire counter, stove, my phone, shirt, and pants.
I had to stand there in awe of the stupidity I have exhibited. The meaty juices was dripping onto the floor, behind the cabinet doors, on the walls, just fucking everywhere.
Luckily almost all of the meat stayed in the pot, so I cleaned everything up (the meat was done).
tl;dr: I opened my pressure cooker while it was under pressure and boiling meat juice exploded all over my kitchen. | Help :( pressure cooker problem | This cookbook is a good resource for information on using a pressure cooker along ... | Pressure Cooker/Autoclave Reviews? | Everything you want to know about pressure cookers | Pros/Cons of pressure cooker | Goodbye crockpot! Hello pressure cooker! | I have saved a lot of money by using a pressure cooker | Pressure Cooker Not Pressurizing? |
130 | how soon should i take a pregnancy test? | Can you take a pregnancy test 1 week before period is due? | When can be the best time to take a home pregnancy test? | How long should you wait of taking a pregnacy test after taking the morning after pill? | How long should you wait after you've had unprotected sex to take a pregnancy test if you have irregular periods? | When is the best time to see if your pregnant? | Can taking a pregnancy test two weeks before your period is due? | How long after you take a pregnancy test will it give you your result? | earliest pregnancy test? | 130 | hi! so i was supposed to get my period on june 17th but so far, my flo app is telling me i’m two days late [today is june 19th].
how soon after should i take a pregnancy test? a week after the 17th, which will be june 24th?
thank you & i’m sorry for the dumb question 😅 just a little freaked out.
edit: also i’m sure this is important but i just forgot to add, i had protected sex on june 12th! | Took aamc FL today, should I postpone? (8/22 test date) | Too early to take pregnancy test? | can i take a pregnancy test wen im on my period or should i wait till it ends??and why? | Should I move my test date or wait for one | When should I be taking a pregnancy test? | You are 2 weeks late for your period but 3 pregnancy test said negative Whats going on? | On Nexplanon. Period is 5 days late. Pregnancy tests are negative. | Will a pregnancy test work a week before your period is due? |
131 | Six Steps to Overcome Bias in the Forecast Process | Forecast bias A forecast bias occurs when there are consistent differences between actual outcomes and previously generated forecasts of those quantities; that is: forecasts may have a general tendency to be too high or too low. A normal property of a good forecast is that it is not biased. As a quantitative measure, the "forecast bias" can be specified as a probabilistic or statistical property of the forecast error. A typical measure of bias of forecasting procedure is the arithmetic mean or expected value of the forecast errors, but other measures of bias are possible. For example, a median-unbiased forecast | The paper considers the use of information by a panel of expert industry forecasters, focusing on their information-processing biases. The panel forecasts construction output by sector up to three years ahead. It is found that the biases observed in laboratory experiments, particularly ‘anchoring’, are observable. The expectations are formed by adjusting the previous forecast to take new information into account. By analysing forecast errors it is concluded that the panel overweight recently released information and do not understand the dynamics of the industry. However, their forecasts, both short and long term, are better than an alternative econometric model, and combining the two sources of forecasts leads to a deterioration in forecast accuracy. The expert forecasts can be ‘de-biased’, and this leads to the conclusion that it is better to optimally process information sources than to combine (optimally) alternative forecasts. | hopefully this is an acceptable thread to make.
the title is basically it: how extensively do you use forecasts? are you satisfied with what's available? is there any information that you wish you had? | The paper explores probability theory foundations behind evaluation of probabilistic forecasts. The emphasis is on a situation when the forecast examiner possesses only partially the information which was available and was used to produce a forecast. We argue that in such a situation forecasts should be judged by their conditional auto-calibration. Necessary and sufficient conditions of auto-calibration are discussed and expressed in the form of testable moment conditions. The paper also analyzes relationships between forecast calibration and forecast efficiency. | Forecasts are necessary, but not in themselves sufficient for effective decision making. Here, Alec Finney describes his takeaways from asking decision makers to reveal what's missing from the numerical outputs they receive from forecasters. Key themes that emerge are the need to agree on assumptions, manage risk, and sell "a story-not a spreadsheet." His analysis led to the development of a new sharing platform to improve communication and decision making. Journal: Foresight: The International Journal of Applied Forecasting | of experiments, training with interactive computer games that provided players with personalized feedback, mitigating strategies, and practice, reduced six cognitive biases by more than 30% immediately and by more than 20% as long as three months later. The biased reduced were anchoring, bias blind spot, confirmation bias, fundamental attribution error, projection bias, and representativeness. Training in reference class forecasting may also improve outcomes. Reference class forecasting is a method for systematically debiasing estimates and decisions, based on what Daniel Kahneman calls the outside view. As pointed out by Kahneman in Thinking, Fast and Slow (p. 252), one of the reasons | Abstract ::: Weak-form rationality of fixed-event forecasts implies that forecast revisions should not be correlated. However, significant positive correlations between consecutive forecast revisions were found in most USDA forecasts for U.S. corn, soybeans, wheat, and cotton. This study developed a statistical procedure for correction of this inefficiency which takes into account the issue of outliers, the impact of forecast size and direction, and the stability of revision inefficiency. Findings suggest that the adjustment procedure has the highest potential for improving accuracy in corn, wheat, and cotton production forecasts. | Abstract Using forecasts is a prerequisite for good decision making but often decision makers ignore the forecasts' outcomes and rely on their personal assessment. This usually leads to worse decisions. But forecasts can also be defective. Thus, it is crucial that decision makers do not rely blindly on forecasts but scrutinize critically the results. The question is under which circumstances decision makers follow or ignore forecasts. Therefore, we conducted a laboratory experiment where decision makers have the choice between two alternatives. The forecast provided gives an advice. But it is manipulated so that it is only partly reliable. Results show that participants do not act optimally. Many decision makers follow the manipulated forecast if for example their performance is dominated by the forecast or if they perceive competition. Hence, gamifying such research may impact the results that can be to some extent reinforced. However, the general meaning is not distorted. | 131 | A technically sound forecast goes nowhere if it is not accepted by those in power, whether they are politicians or upper management. Elaine notes that often the forecast gets manipulated to satisfy political ends or meet targets and plans. Politics is also about biases, motivations, and interests, and comes into play when various incentives and reward structures influence the forecast. She maintains that we need to examine some common problems that organizations face and provide solutions that allow the technically sound forecast to prevail, free of manipulation or bias. She describes a case study in the politics of budget forecasting and offers six strategies to overcoming organizational politics. Copyright International Institute of Forecasters, 2005 | who is in charge of forecasting the demand | What goes into budgeting and forecasting? How would I practice doing it? | What drives decision makers to follow or ignore forecasting tools - A game based analysis | Why forecasts wrong sometimes? | when did the institute for strategy and reconciliation start forecasting presidential elections | Forecasting for planning: Time series analysis | The art of forecasting, artfully dissected | The purpose of the proposed article is to study the probabilistic approach to political forecasts, obtained from experts' survey. The article describes expert information collection characteristic features, in particular, the networking: for obtaining probabilistic estimates of specialists. Especially the paper considers the different ways of interpreting these estimates. The author concludes that not only forecasting methods play an essential role in scientific forecast, (although obtained estimates values depend on the correctly chosen data and information collecting professional method), but also the obtained prognostic probabilities interpretation. |
132 | Hydrogen-Bonded Helical Self-Assembly of Sterically-Hindered Benzyl Alcohols: Rare Isostructurality and Synthon Equivalence Between Alcohols and Acids | The self-assembly of a series of small peptidomimetic cyclophanes in organic solvents was studied. X-ray diffraction, NMR spectroscopy, and molecular modelling were used to understand the structural features of these self-assembling compounds both at the molecular and supramolecular level. The factors that could influence the formation of gels rather than crystals were studied and a model for the arrangement of molecules in the gel was proposed. Furthermore, scanning electron microscopy revealed that in some cases these compounds undergo a transcription of chirality when going from organogelator to helicoidal gel fibres. | still employ only hydrogen bonds and coordination bonds. Molecular self-assembly is at the heart of crystal engineering, and it typically involves an interaction between complementary hydrogen bonding faces or a metal and a ligand. By analogy with the retrosynthetic approach to organic synthesis, Desiraju coined the term "supramolecular synthon" to describe building blocks that are common to many structures and hence can be used to order specific groups in the solid state. The carboxylic acid dimer represents a simple supramolecular synthon, though in practice this is only observed in approximately 30% of crystal structures in which it is theoretically possible. | Abstract The structures of supramolecular columnar mesophases that depend on the presence of either N–H⋯O, or N⋯H–O– hydrogen bonds (subsumed under the term ‘N|H|O-bonds’) are reviewed. The thesis is supported that supramolecular mesogenes bridge different fields of liquid crystal research, offering the opportunity to create a unified picture of thermotropic, and lyotropic mesomorphism. With the examples of N|H|O hydrogen bond mesogenes the molecular structures of the respective mesogenes are presented, and general principles to rationally construct such molecules are discussed. A connection is drawn to systems from isolated columns as found in low molecular weight organogels. Perspectives, and outlooks for possible applications of N|H|O hydrogen bonded columnar phases are given. | Hydrogen bonding acts as a ubiquitous glue to sustain the intricate architecture and functionality of proteins, nucleic acids and many supramolecular assemblies1,2, but this weak interaction is seldom used as a force for promoting chemical reactions3,4,5. Here we show that a simple chiral alcohol uses hydrogen bonding to catalyse an important family of cycloaddition reactions of a diene with various aldehydes — moreover, this reaction is highly enantioselective, generating only one of the mirror-image forms of each dihydropyran product. This type of catalysis mimics the action of enzymes and antibodies, and is unlike traditional, metal-based catalysts used in organic chemistry6. | Hydrogen Bonding Interaction between Amide and Alcohols: Dielectric Relaxation and FTIR Study | Hierarchical Self-Assembled Structures from Diblock Copolymer Mixtures by Competitive Hydrogen Bonding Strength | Cyclic dipeptides (CDPs) are heterocyclic 2,5-diketopiperazines with exceptional structural rigidity, enzymatic stability, and biological activity, exhibiting a substantial tendency to take part in intermolecular interactions. Strong intermolecular interactions driven by unique hydrogen bonding patterns render CDPs with a high propensity to undergo molecular self-assembly. In this Review, the aim is to provide a comprehensive summary of design strategies used to engineer the molecular self-assembly of CDPs into functional nano- and micro-architectures and molecular gels with potential applications in biomedical and materials engineering fields. | Low-molecular-mass organic gelators (LMOG), tris(phenylisoxazolyl)benzenes, were synthesized, and their self-assembling behavior was examined using 1H NMR and UV–vis absorption spectroscopies. They turned into a gel in both nonpolar and highly polar solvents such as methylcyclohexane, ether, acetone, dimethylsulfoxide, etc. Field emission scanning electron microscopy (FESEM) observation of the xerogels of 1 and 3 possessing the saturated alkyl chains revealed that well-developed straight fibers were formed, whereas the unsaturated termini of the alkyl chains of 2 promoted the formation of both the right- and left-handed helical fibers. The self-association behavior of 1, 2, and 5 in solution were investigated using 1H NMR and UV–vis spectroscopies. The flat aromatic compound 1 stacked in a columnar fashion along its C3 axis via π–π stacking interactions. The assemblies were regulated by the peripheral alkyl substituents; the saturated alkyl groups facilitated the assemblies while terminal double bonds imp... | 132 | Hydrogen-bonded aggregation has been examined in a series of sterically hindered benzyl alcohols with an objective to explore how sterics influence the otherwise inconsistent and variable synthons generally observed for alcohols. All the sterically hindered alcohols 8–15 were found to adopt a helical hydrogen-bonded synthon, and crystallize uniformly in the rare I41/a space group, for which the statistical prevalence in the CSD is abysmally small. Remarkably, the crystal packing in all of these alcohols is found to be isostructural to analogous sterically hindered carboxylic acids 1–4. The reason as to why all alcohols sustain the helical motif, despite being aggregated via rather weak hydrogen bonds as compared those in analogous acids 1–4 is traceable to unique molecular topology that permits close-packing as well as exploitation of intermolecular interactions comprehensively. It is shown that sterics permit a very rare packing as well as synthon equivalence between carboxylic acids and alcohols. It eme... | Hydrogen Bonded Rings, Chains and Lassos: The Case of T-butyl Alcohol Clusters | Synthesis, Structure, and Characteristics of Hyperbranched Polyterpene Alcohols | Allylic sulfones, owning to their widespread distributions in biologically active molecules, received increasing attention in the past few years. However, the synthetic method under mild conditions is still a challenging task. In this paper, we report a sulfinic acids ligation with allylic alcohols via metal-free dehydrative cross-coupling. Both aliphatic and aromatic sulfinic acids react with various allylic alcohols to deliver the desired allylic sulfones in high yields with excellent selectivity. This carbon-sulfur bond formation reaction is highly efficient and practical since it works under metal-free, neutral, aqueous media and at room temperature in which the products even can be obtained by simple filtration without the need for organic extraction or column chromatography. Water is found to be essential for the success of this carbon-sulfur bond formation reaction. DFT calculations imply that water acts as promoter in this transformation via intermolecular hydrogen bonds. | Reductive Cleavage of Allylic Alcohols, Ethers, or Acetates to Olefins: 3-Methylcyclohexene | Iridium-catalyzed coupling reaction of primary alcohols with 1-aryl-1-propynes leading to secondary homoallylic alcohols. | Mechanistic Insights into the Pd-Catalyzed Direct Amination of Allyl Alcohols: Evidence for an Outer-Sphere Mechanism Involving a Palladium Hydride Intermediate | Supramolecular helical architecture assembled by double-helical [Ag2L2] units | Is hydrogen bonding possible between ethanol and diethyl ester? |
133 | Shoes Christmas Gift for Smelly Feet? | I've noticed that my feet smell, It's something to do with my shoes.
How can I prevent this from happening? I've febreezed them, and I've left them outside overnight. Nothing seems to air them out properly. | Great shoe! Nice arch support, keeps feet dry in rainy conditions, lightweight. However, after a season of golfing they smell BAD! I tried baking soda, Norwex deodorizer, tennis shoe deodorizer balls. I ran them thru the washer & dryer then in the sun. They smelled better for a short time, but now back to smelly! I will buy again though because it's the shoe my daughter likes to wear. | How do you stop foot odor in shoes? | A good pair of shoes for the toddlers, easy to put on, comfortable to wear, my boy wear it almost everyday...but it smells a bit after hours of wearing... | Shoe looks really nice, but I aired it out for a week and it still smells to the point that I cannot take them to the office. Returned. | I'm having a summer, outdoor wedding. I chose apple red, tea-length, chiffon dresses, but it is surprisingly hard to find shoes. I wanted something similar to my shoes, but at this point, a cute pair of sandals with a low/no heel and a bow would be fantastic. I just keep finding 5" sandals or closed toe flats.
I also want a ruby or ruby-like jewelry set for them. I have a silver heart with blue topaz stones. I want something similar....but they also seem scarce.
Where can I find red accessories?
EDIT: I found jewelry! Thank you for your help.
EDIT 2: I found shoes! Thanks again for the advice. I ended up going with some nice silver ballet slippers. | Loved these shoes for my daughter! They match many things. However they do get very stinky cause she has very sweaty feet | The sandals make your feet stink like you were wearing shoes with no socks. I would never buy these again. | 133 | Hey all!
Longtime lurker using a throwaway... (sorry!) My partner wants a nice pair of new shoes as a Christmas gift, and suggested I make it a present for both of us -- something that is comfortable and fashionable (for her), but will also make her feet extra smelly (for me). She's the best!
She likes flats, so I'm thinking a high end pair of "slipper flats" like Birdies Slippers or Rothy's Loafers that she can wear for comfort and fashion. Does anyone have experience with these, and know if they'll be a gift "for both of us" after some wear? Any other recommendations??
Thanks! | Looking for Slippers for a gift to my wife. Any boutique stores in TO that carry nice pairs? | loved these sandals and ordered another pair for a friend who admired them for a present | We Both Love These Sandals! | Great looking pair of slipper/sandals only wish I could of ... | My wife has a hard time finding shoes and especially ... | far too small. have never used a slipper or ... | Want to give my SO a gift certificate for a nice pair of heels...seeking store recommendations and any other advice | Slippers for my husband |
134 | who led the soviet union in the red inferno | Red Inferno: 1945 halting the Allied advance into Germany, new US President Harry S. Truman authorizes the US Army to continue across the Elbe and head for Berlin to bring a quick end to the war to guarantee the West's share of the to-be divided German capital with their forces in the city. However, Soviet Premier Joseph Stalin, despite the agreed terms of dividing Berlin and Germany with the Western Allies, wants to take Berlin for himself, on the grounds that the Soviet Union best deserved to conquer its archenemy's capital, after the unparalleled brutality of the Eastern Front. He even goes as | Soviet war crimes War crimes perpetrated by the Soviet Union and its armed forces from 1919 to 1991 include acts committed by the Red Army (later called the Soviet Army) as well as the NKVD, including the NKVD's Internal Troops. In some cases, these acts were committed upon the orders of the Soviet leader Joseph Stalin in pursuance of the early Soviet Government's policy of "Red Terror", in other instances they were committed without orders by Soviet troops against prisoners of war or civilians of countries that had been in armed conflict with the USSR, or they were committed during | Red Nightmare them to their church that has been turned into a museum glorifying the Soviet Union, including many inventions made by Americans which the Soviets claim to have invented. Jerry knocks the exhibits over, and is arrested by troops led by a Commissar (Peter Breck). Jerry is brought to trial at a Soviet tribunal (Judge, Andrew Duggan; prosecutor, Mike Road), where there is no jury nor a defense attorney. Jerry demands to know what he is charged with, but the rights Americans take for granted are long gone. After condemning testimony from several witnesses, including his own wife, Jerry is convicted | Red Storm Rising government for political purposes, while the SACEUR expresses doubt that the new Soviet government will remain stable and secure liberties. The SACEUR and Alekseyev view the withdrawal of Soviet forces from West Germany with relief; the aftermath of the conflict left unknown. In 1987, it was published in French as "Tempête Rouge" (Red Storm), translated by France-Marie Watkins, with the collaboration of Jean Sabbagh. Tom Clancy met Larry Bond in August 1982. Clancy had purchased Bond's "Harpoon" board game, and became friends after meeting at a gaming convention. They used the board game's second edition miniatures rules to test key | Red Zone Cuba head towards the mine, but the car runs out of oil. The law catches up with them along the way and police cars approach them; Griffin impulsively shoots Ruby and runs into the fields, while Landis and Cook are arrested. Chastain returns from Cuba alive and is reunited with his surviving wife after she is rescued and escorted home by a policeman. Griffin dies in a shootout with the police who then collect his belongings, a penny and a bent cigarette, and a voice-over (Francis) somberly intones that Griffin "ran all the way to hell... with a penny and a | the Red Terror for the initial period of repression are at least 10,000. Estimates for the total number of victims of Bolshevik repression vary widely. One source asserts that the total number of victims of repression and pacification campaigns could be 1.3 million, whereas another gives estimates of 28,000 executions per year from December 1917 to February 1922. The most reliable estimations for the total number of killings put the number at about 100,000, whereas others suggest a figure of 200,000. The Red Terror in the Soviet Russia was justified in the Soviet historiography as a wartime campaign against counter-revolutionaries | Red Storm Rising command of Marine Colonel Chuck Lowe, who supports Toland's conclusions. Impressed by Toland's findings, the Commander of the United States Fleet Forces Command promotes Toland and transfers him to active duty aboard the . Meanwhile, the Politburo arranges a bomb blast in the Kremlin that destroys the Council of Ministers Building and kills seven visiting Young Octobrists from Pskov. The Soviet government claims that the bombing was a terrorist attack by Gerhardt Falken, a West German spy. (Toland speculates that Falken is actually a KGB sleeper agent.) The Soviets demand the dissolution of the Federal Republic of Germany at a | Red Star (comics) in "Titans Together" along with Starfire and Bumblebee in the headquarters of the Brotherhood of Evil to help the Titans fight the assembled supervillains. How he survived the outburst of his energy is never explained, though his newly acquired flight ability would allow him to return easily after the explosion. He also acquired the ability to create fire from his hands, like his comic book counterpart. Red Star's father, Konstantin Kovar, is mentioned in season four episode "Lost in the Flood" as a Russian criminal and dictator by Taiana Venediktov who rules her village Krasnoyarsk. After Oliver mortally wounds her | 134 | Red Inferno: 1945 halting the Allied advance into Germany, new US President Harry S. Truman authorizes the US Army to continue across the Elbe and head for Berlin to bring a quick end to the war to guarantee the West's share of the to-be divided German capital with their forces in the city. However, Soviet Premier Joseph Stalin, despite the agreed terms of dividing Berlin and Germany with the Western Allies, wants to take Berlin for himself, on the grounds that the Soviet Union best deserved to conquer its archenemy's capital, after the unparalleled brutality of the Eastern Front. He even goes as | who was the president when red inferno started | Eva's Journey Through The Red War | when does red jihad take place in the book | what title was given to kiev by the red army in 1945 | who argued that the red army did not have enough time to prepare their offensive plans | when did the red army faction kill german president | when did red ruffing hit a homerun | Red Alert 3 Soviet Union vs Wolfenstein Nazi Germany (1960) |
135 | how many sangam verses are written by alathur kilar | Aintinai Eḻupatu situation and emotions specific to each landscape. The five landscapes of Sangam poetry are "mullai" – forest, "kurinji" – mountains, "marutham" – farmland, "paalai" – arid land and "neithal" – seashore. Aintinai Eḻupatu Aintinai Eḻupatu (), is a Tamil poetic work belonging to the "Patiṉeṇkīḻkaṇakku" anthology of Tamil literature, belonging to the post-Sangam period corresponding to between 100–500 CE. "Aintinai Eḻupatu" contains seventy poems written by the poet Muvathiyaar. The poems of "Aintinai Eḻupatu" deals with the subjective ("agam") concepts. "Agam" in the Sangam literature denotes the subject matters that deal with the intangibles of life such as human emotions, | Long metre Long Metre or Long Measure, abbreviated L.M. or LM, is a poetic metre consisting of four line stanzas, or quatrains, in iambic tetrameter with alternate rhyme pattern "a-b-a-b". The term is also used in the closely related area of hymn metres. When the poem is used as a sung hymn, the metre of the text is denoted by the syllable count of each line; for long metre, the count is denoted by 8.8.8.8, 88.88, or 88 88, depending on style. It is similar to common metre (for poems or melodies denoted as 8.6.8.6, 86.86, or 86 86) which | Ayyavazhi the daughter versions such as the "Swamithope" version, the "Kottangadu" version as well as the "Panchalankurichi" versions, are the earliest existing palm-leaf versions of Akilam. Other released versions includes the Sentrathisai Ventraperumal, the Vivekanandan, the highly criticised VTV and the earliest and commonly accepted Palaramachandran version. Akilam contains more than 15,000 verses in seventeen sections. It is written in poetic Tamil in a ballad form, and is composed with a unique literal-style with two subgenres, "Viruttam" and "Natai" throughout. The secondary scripture, Arul Nool, includes various books that are believed to be written by Arulalarkal (one possessed by divine power). | (WAB 41.2), are 24-bar long. Afterwards a 2- (3-)bar "Amen" was added to the settings. In the 1888 version the settings are score for mixed choir "a cappella". In the setting in E-flat major the "" is used on ""ritui"" (bars 15-16). The first recording occurred in 1931: There is a single recording with all four "Tantum ergo": There are three recordings with all four "Tantum ergo": Four Tantum ergo, WAB 41 The four ("Let us raise"), WAB 41, are settings of the hymn "Tantum ergo" composed by Anton Bruckner in 1846. Bruckner composed these four motets A.M.D.G. in 1846 | Naalayira Divya Prabhandham The Nalayira Divya Prabandham () is a collection of 4,000 Tamil verses (Naalayiram in Tamil means 'four thousand') composed by the 12 Alvars, and was compiled in its present form by Nathamuni during the 9th – 10th centuries. The work, an important liturgical compilation of the Tamil Alvars, marks the beginning of the canonization of 12 "Vaishnava" poet saints, and these hymns are still sung extensively today. The works were lost before they were collected and organized in the form of an anthology by Nathamuni. The "Divya Prabandham" sings the praise of Narayana (or Vishnu) and his | Harbans Jandu Harbans Singh Jandu, also known as Jandu Littranwala, is a composer. He was born in the village of Littran in Jalandhar District, Punjab. He first started writing lyrics for Punjabi songs in 1968. He placed first (out of 52 composers) in the "Des Pardes" paper songwriting competition, with the song "Nachdi di Photo Kich Mundeya", in 1968. He has written songs for many famous Bhangra and Punjabi artists, including AS Kang, Kuldip Manak, Surinder Shinda, Balwinder Safri, Jazzy B, Sukhshinder Shinda, H-Dhami, Amrinder Gill, Azaad, Alaap, Heera Group UK, Holle Holle, Apna Sangeet, Awaaz, Bhujhangy Group, DCS, Dippa | Idris Alooma Idris Alooma (r. 1570–1603) was Mai (king) of the Kanem-Bornu Empire, located mainly in Chad, Cameroon, Niger and Nigeria. His name is more properly written Idris Alawma or Idris Alauma. An outstanding statesman, under his rule Kanem-Bornu touched the zenith of its power. Idris is remembered for his military skills, administrative reforms and Islamic piety. His feats are mainly known through his chronicler Ahmad bin Fartuwa. He succeeded queen Aissa Koli. His main adversaries were the Hausa to the west, the Tuareg and Toubou to the north, and the Bulala to the east. One epic poem extols his | Hurrian songs complete hymn, but four composers' names are found for five of the fragmentary pieces: Tapšiẖuni, Puẖiya(na), Urẖiya (two hymns: h.8 and h.12), and Ammiya. These are all Hurrian names. The Akkadian cuneiform music notation refers to a heptatonic diatonic scale on a nine-stringed lyre, in a tuning system described on three Akkadian tablets, two from the Late Babylonian and one from the Old Babylonian period (approximately the 18th century BC). Babylonian theory describes intervals of thirds, fourths, fifths, and sixths, but only with specific terms for the various groups of strings that may be spanned by the hand over that | 135 | Alathur Kilar Alathur Kilar, originally pronounced "Ālathur Kiḻhār" (Tamil: ஆலத்தூர் கிழார்), was a Tamil poet of Sangam period. He has authored seven poetries in the Sangam literature, including five in Purananuru and two in Kurunthogai. Alathur Kilar has written seven Sangam verses in all. This includes verses 34, 36, 69, 225, and 324 in Purananuru and verses 112 and 350 in Kurunthogai. The three Chola emperors mentioned by Alathur Kilar include Setchnni Nalankilli, Cholan Nalankilli, and Cholan Kulamuttratthu Thunjiya Killi Valavan. Alathur Kilar cites the Tirukkural in verse 34 of the Purananuru, calling it 'Aram' which later became one of | who is the aunt of akil in kil | when was the english translation of thiruvasagam hymn done | how many days after ashurah does the battle of karbala occur | who transcribed the sani poem ashma | how many verses in epic of utnoa | who is kapila according to hemla poem | who wrote the lyrics of koyil puraa 1981 | how many unique verses are there in samaveda |
136 | what was the charge in the cohoes fire | Depending on the conditions of the fire, some bodies can end up burned down to the bone. Why would the crematory charge full price just to finish the job? | Caribou Fire The Caribou Fire (also known as the Linklater Fire) was a wildfire in the Kootenai National Forest, 21 miles northwest of Eureka, Montana in the United States. The fire, which was first reported on August 11, 2017, was started by a lightning strike and burned a total of , including acres in Canada. The fire threatened the community of West Kootenai, Montana, resulting in a mandatory evacuation of the community. It destroyed 10 homes. The Caribou Fire was one three fires burning in the forest, alongside the Gibralter Fire and Weasel Fire. The Caribou Fire was reported on | Esperanza Fire The Esperanza Fire was a large, wind-driven, arson-caused wildfire that started on October 26, 2006, in a river wash near Cabazon, California, west of Palm Springs, California. By October 29, 2006, it had burned over (or ) and was 85% contained. On October 30, 2006, the fire was fully contained. Five firefighters were killed defending a vacant house locally known as the "Octagon" that was ultimately destroyed by the fire: Jason McKay, Jess McLean, Daniel Najera, Mark Loutzenhiser, and Pablo Cerda. In June 2009, Raymond Lee Oyler was sentenced to death for starting the fire. The fire was | Fire (Rodgers novel) bomb goes off in Kansas City. Meanwhile, a genetic engineering research facility has developed a strain of bacteria that can reanimate fossilized tissues from remaining DNA. Due to a bomb explosion at the facility, the bacteria is spread in the area around the facility, animating a dead dog. This occurs while ashes from a fossil trilobite that had been reanimated, then incinerated, by the head researcher, are also loose. He had left the facility with the vial containing the ashes, and died in a fire, with the ashes, having been poured on his body by an angry drug addict (mistaking | What was the causes of the triangle shirtwaist factory fire? | Going to Blazes discipline the boy beagle by giving slaps to the little dog's rear. But before the firechief could land a hand, they receive a distress call. Oswald and the firewoman set off and bring along their fire apparatus. Unfortunately, the fire apparatus falls into a manhole along with the firewoman. Oswald, who is on the surface, then settles for a horse and handful of equipment. Meanwhile, the boy beagle follows their trail. At the scene of the incident, a condominium is up in smoke. Oswald sprays water at the building but the flames appear immune. One of the condominium's inhabitants is | Going to Blazes discipline the boy beagle by giving slaps to the little dog's rear. But before the firechief could land a hand, they receive a distress call. Oswald and the firewoman set off and bring along their fire apparatus. Unfortunately, the fire apparatus falls into a manhole along with the firewoman. Oswald, who is on the surface, then settles for a horse and handful of equipment. Meanwhile, the boy beagle follows their trail. At the scene of the incident, a condominium is up in smoke. Oswald sprays water at the building but the flames appear immune. One of the condominium's inhabitants is | Small fire at Seattle police station was arson | 136 | reported. There were minor injuries, including a firefighter who was taken to a hospital. Gomes pleaded guilty to arson and in June 2018 he was sentenced to one year in jail and a US$600,000 fine. 2017 Cohoes fire The 2017 Cohoes fire was a non-fatality fire that destroyed three residential buildings and affected 28 others in Cohoes, New York. Damage was estimated to millions of dollars. The fire started on November 30, 2017 when a local resident, John Gomes, attempted to imitate a metalworking technique he saw on the History Channel series "Forged in Fire". Flames from a burn-barrel he | how many people in a chevrolet tahoe fire | how much did the aspen fire cost in damages | Suspicious fire destroys another Heidelberg Project property in Detroit .
ATF and Detroit fire officials investigate suspected arson in string of fires .
Project security saw a man in dark clothing fleeing "The War Room" installation . | what is the lesser offense of arson in california | when is forged in fire returning? | how many fatalities did the neola north fire cause | how many buildings were destroyed in the creagerstown fire of 1914 | Vandals struck the Stratton Mountain fire tower and Caretakers Cabin. |
137 | Finding a pair of Oxfords - In Europe/Scandinavia | Hi all,
I'm looking to become an au pair in France and currently using au pair world. Does anyone have any recommendations for agencies that could help me with this process once I find a suitable family on au pair world? I'm from Canada
Thanks! | I am currently learning Swedish, and I would love to find other speakers to converse/practice with.
Tak! | Hi Reddit!
I'm currently facilitating music groups using group singing as a tool for community development. I would like to expand to providing basic instrument tuition, and as a ukulele player myself I think the uke would be the perfect instrument, as it's possible to make music together in a very short amount of time and with minimum intervention from the tutor.
I would like to purchase about 20-25 low end ukeleles. I want them to be playable, but not precious as I will be working with children, and well, accidents happen!
So, could anyone recommend a brand, and possibly a wholesaler in Europe or the UK as I'm based in Ireland.
I would be very grateful for any advice! | Which city is Oxford University in? | The university in the county town of Oxford ( whose name came from Anglo-Saxon Oxenaford = `` ford for oxen '' ) grew in importance during the Middle Ages and early modern period . | Hi everyone!!
I am currently preparing for a Skype interview for Brunel University’s MSc Pre-Registration OT program. Brunel is in England and I am from the US.
For my interview, I know they commonly ask about the impact of current events/issues on OT in the UK. However, when I try and search for such topics online, I can't find anything substantial.
So for those of you who practice OT in the UK, or who may have an inside-scoop on things over there, what current events/issues should I be focusing on? In what ways have you seen those issues having a potentially negative impact on OT in the UK? Additionally, how have you seen that OT has had a positive impact on current events/issues in the UK?
Any insider information would be greatly appreciated!! Brunel is my DREAM school and I want to smash this interview out of the park! | I'm tired of falling for European girls, but I can't help it, they're better than Americans. They're smarter, more cultured, watch less TV, text less, don't have religion, they're awesome. Had a year-and-a-half relationship with an English girl, which was perfect, but distance killed it. Had a thing with a French girl, now really getting close with a German girl. Is there any hope without moving overseas? Has anyone upped and moved to Europe for a girl and think it was the best thing they've ever done? | As they've started appearing in other subreddits, I thought it would be interesting to see one for /r/britishproblems
| 137 | Hey MFA
I'm searching for a pair of Oxfords, as my previous shoes are no more.
So far I got my eyes on the Walk-over George (dark brown), the thing they don't seem to have any seller(s) based in my country - Denmark - or Scandinavia and I'd definitely prefer if I could find a store to actually try the shoes before I buy.
I plan to ask a local store if they'd able to get their hands on a pair, but should that fail I would like to have a backup plan!
Church's has a store in Copenhagen but I think their price point is a bit higher than what I'm aiming for. F.x. the Maltby from the contemporary collection sits at 650 € while the Walk-over pair is 345 $.
Thanks in advance for your guidance. | Found a pair of slightly used Michel Domit (Vero Cuoio) leather dress shoes. No idea where to price them at. | Anyone know any good UK based Etsy/Independent Shops | [TOMT] I'm looking for this pair of shoes. Look like dress shoes in the top and nikes on the bottom. | Looking to buy first pair of dress shoes, need recommendations | For those interested, the Oxford coffee bean set will go on sale tomorrow | Looking for some help getting some fairly hard-wearing smart office shoes (preferably UK) | AE Shoe Bank - Promontory Point Boots - $127 | Infrared 6 - Sz 8 - won extra raffle.. will buy/ship shoes .. anyone interested? |
138 | Polaroid Type 80 viva film | Brigid Berlin sold for $175,000 at auction to artist Richard Prince. Both Berlin and Warhol used the medium of Polaroid photography obsessively, and are said to have been very competitive in the Polaroid film department, whether over the best equipment or the best film. In 1969–1970 German art dealer Heiner Friedrich did a small showing of Berlin's work called "Polaroids and Tapes" and created a catalogue for the work of the same name. The experimental nature of Berlin's double-exposed Polaroids transcend the static, emotionless "icon" Polaroids of Warhol's, clearly showing the power of her personal vision and photographic style. Common subject matter | Hey guys! Do you know any neat movies where a Polaroid was used for a cool scene or maybe just present?
For me, the obvious one is ”Memento” where he’s wielding a SLR 690 I believe. Other than that there is a thai horror movie called ”Shutter” from 2004 where the protagonist uses an Impulse in a creepy scene. | film works like its suppose to. little smaller than the old-timey polaroids from back when. wish it was less $$$$. | Hey Polaroid community.
I recently bought my very first polaroid camera, an SX-70 Model 1. I purchased some 600 film, well knowing it wouldn't work with my camera, but i just wanted to try it out. After shooting a couple of pictures with some black and white film, i noticed the film was over 2 years old(Produced 07 18). Now for the last two pictures i got out of the B&W film, they turned out really great since i had gotten an ND filter and a frog tongue for my camera at this point.
The camera had, had some issues with not ejecting some film, tho i think it might had gotten caught in between the frog tongue and the rollers. This was easily fixed and isn't a problem anymore.
Now i decided to try out some color film (Produced 01 20) And with the first picture it got caught in the rollers but the intact part of the picture looked good. For the rest of the film the between the shutter opening and closing again was way too long, and the pictures where either way over exposed and shaky, or just completely white.
I thought the problem was with the light sensor, so i cleaned it. It did need cleaning, but this didn't fix the problem. Shooting without the ND filter, the shutter speed was normal, but of course way over exposed.
Does anybody know of this kind of issue? Any help would be highly appreciated.
Have a great day :) | available on VHS format in a direct-to-video release in 1994. It was issued on DVD on May 2, 2000, followed by a reissued VHS version on May 8, 2000. The DVD contained a cropped 4:3 aspect ratio, which was a transfer from the original video release and reversible cover artwork. Redemption released two subsequent DVD editions in the UK, the first on September 3, 2007, presenting the film complete and uncensored for the first time. The second was released on May 18, 2015, containing newly commissioned artwork. As of 2017, none of Rollin's films, "La morte vivante" included, have been | stock and nature photography. Digital media gradually replaced transparency film. All color reversal film sold today is developed with the E-6 process. The non-substantive Kodachrome films, the last of which was discontinued in 2009, were processed with the K-14 process. Polaroid produced an instant slide film called Polachrome. It was packaged in cassettes like normal 35mm film. A separate processing unit was used to develop it after exposure. Black-and-white transparencies can be made directly with some modern black-and-white films, which normally yield negatives. The negative image is developed but not fixed. The negative image is removed by bleaching with a | Ok hear me out there's this Okami trailer from 2006: it's in Japanese and it's SO. FUCKIN. BEAUTIFUL. I love it so much, but there's a LITTLE problem: the quality is...L O W. I mean, it's not 240 p, IT'S 0,240 P LMAO.
Seriously, guys, if anyone knows if the trailer can be found in a higher quality, in Okami official sites or wherever, please help me I'm goin crazy here. | VERY DISAPPOINTED! FILM DOESN'T FIT THE SCREEN AND DOESN'T STICK. AMAZON DO NOT SELL THESE TOGETHER, THEY DO NOT GO WITH EACH OTHER...YOUR JUDGEMENT ON MAKING THIS A PART OF A BUNDLE PLUS THE AWFUL QUALITY IS SHAKY AT BEST. FIND A FILM THAT FITS THE SCREEN YOU MAKE A BUNDLED DEAL. THANK YOU SO MUCH, NONETHELESS. | 138 | Polaroid viva film is the best alternative to most Type 80 Polaroid film.
Being that there is no alternative other, Polaroid viva, is the choice film for my Holgaroid (Polga), Polaroid Square Shooter 2, and my current Polaroid Type 100 back modified, allowing the usage of Polarod viva in the same Polaroid back that processes all of my Type 100 films - like polaroid Type 665, 669 and 690.
Lately, I allow the film to dry completely before scanning.
Polaroid, we see you now! | Fuji instax or Polaroid film -- which do you prefer? | What alternatives are there for a polaroid and camera 160? | I'm looking to get into polaroid photography. What's a half decent (not too expensive) camera to start with? Is it true that all film is now expired? | Uses of Polaroids in movies | Fujifilm 1014258 Superia X-TRA 400 35mm Film--4 Pack | Polaroid one step 2 or fuji 90 or fuji wide 300 | instax film for the Fujifilm instax mini 90 neo classic camera | Polaroid OneStep 2 not recognising film! Please please help! |
139 | Recommendations for screen recording 3D models | I’ve been looking all over the internet trying to learn as much as I can about 3D cameras. I first found out about the Nishika, and since then, the Nimslo and the Reto. For the price I’m a bit hesitant to buy one without much background so I was wondering which you guys recommend? | Hello master race
I am getting into pc bench marking and wanted to start recording my testing and had a few concerns. Some of the systems I plan on testing are not using Nvidia GTX graphics cards so Shadow Play is not an option, as well as some of the processors I plan to test may struggle to hold up heavy software in the background. What hardware, or light but effective software, have you used to record your screen, being around the $100 range or less? I'm open to all suggestions!
Thanks in advance! | Hey guys, I need help figuring out what camera add on I should get. I just bought P3D and the PMDG 777 since I'll be flying that in the near future and figured some practice at home couldn't hurt. I've used XP and I liked how you can use the mouse to pan view. Is there anything like that for P3D? And I guess being able to set view presets would be nice as well. TYIA. | I get my first printer tomorrow and need to get into some modeling asap.
There seems to be several good free 3D modeling apps but am looking for opinions on them. | I hope this is OK to post here.
My nephew showed me the 3D models he has created yesterday and I wanted to share. I told him how good I think they are and have really encouraged him. He's only 12 and uses a pretty old laptop to do these.
You can see them all here: | I know this probably isn't the best place to ask, but I like the community here and want to know your guys' opinions. I consider myself fairly good at spelunky, and want to start recording my self in case I do something spectacular, but I don't know what to use, so here is my question.
What screen recorder do you use for games like Spelunky?
Preferably free, but I'm not opposed to less than, er, legitimate methods of getting it. Thanks Spelunkers! | I want a 3d modeling software for my university purposes, and want detailed description which software i must use which is compatible with my M1 air, and is free for student usage. | Just wondering what people suggest for screen recording Fusion 360?
Planning to design something cool, and I'd like to show how it was designed first to fit the car.
I'm integrating a tablet into the car, rather than physical gauges I'll be using digital ones via the ECU outputs, and I can also have GPS Maps for off-road on it (single licence is cheaper than one for phone and tablet, plus bigger screen = better for maps)
I'm sure people would be interested in seeing not just the end product, but the design of it. | 139 | I am using a PC laptop, and I can make very basic screen recording of my full res scans using the xbox app. I use reality capture, and their video option is for fly throughs I think intended for drone projects only.
I would like a nice, slow rotating view of a model recorded to video format, rather tha the jerky rotation and view used with just a cursor. Anyone know of any programs that you can use for more polished screen recording of 3D models? | How to record gameplay from different angles? | Screen Recording Fusion 360 | Landscape Screen Recording (iOS 11) | Best camera software for P3D? | What is a good screen recording program I can use to make Photoshop tutorials/videos? | New here and looking for tips on recording 3DS games without a Capture Card | Best Free 1080p 60 FPS Desktop Recording Software? | Screen Recording Tool that records crisp/clear videos |
140 | Directional characteristics of electrodiffusion anemometric triple-split probes | A novel measurement probe system is introduced in this paper. The stylus shaft of the probe is mounted on a special diaphragm spring that is exclusively designed with the utilization of finite element analysis. In the probe system, Giant Magneto-Resistive (GMR) sensors are utilized to measure the motion of the stylus shaft in the fundamental directions. The proposed implemented probe is tested on a three-axis CNC electrical discharge machine and the position estimation performance of the proposed paradigm is discussed briefly. The preliminary work presented in this paper demonstrates the capabilities of GMR based probing technology in dimensional metrology. | It is suggested that the same angle probe has different incident point in different materials.The test data show that the variations are very large and maybe seriously affect the accuracy of defect location.The comparative study on block CSK-IA of ultrasound path of the measured and the theory incident point reveals that the measured incident point has relation with velocity of material for test.Thereupon the equivalent sound path is of spindle shape is put forward,which varied with the refraction angle,and well explains the phenomenon. | A Small ELF Electric Field Probe | The present application discloses a multi-nanometer probe tip means and to a method for detecting a sample using multiple tip while the probe device for nanometer, which are located on a substrate using: (1) with respect to the substrate non-removable probe tip; and a motion sensor (3) and the probe tip movably coupled; (2) movable relative to the probe tip of the substrate. Since the motion sensor and movable close-coupled probe tip and the probe tip is movable relative to the immovable retractable tip of the probe, this multi-tip nanoprobes apparatus and associated method provide an improved sample detection . | The novel scanning impedance microscope (SIM) based on scanning tunneling microscopy (STM) can be used to measure impedance of dielectric surface, but because tips used for STM are not suitable for this mode,a new type of tips is needed. The electrochemical method is preferred to produce tips for SIM,and the effect of etching conditions on tips was investigated. The experimental results suggest different ideas from the conventional view on the effect of cut-off time.The characteristic of tips best fit for SIM is also studied, and it is found that the optimal tips should have radii of curvature from 100 to 200 nm with small aspect ratio and only one meniscus step. | Electrical resistance survey most having four probes, often mounted on a rigid frame. In these systems, Two of the probes, called current probes, are used to introduce a current (either direct or low-frequency switching current) into the earth. The other two probes, called voltage or potential probes, are used to measure the voltage, which indicates the local resistivity. In general, greater probe spacings yield greater depth of investigation, but at the cost of sensitivity and spatial resolution. Early surveys (beginning in the mid 20th century) often used the Wenner array, which was a linear array of four probes. These were arranged current-voltage-voltage-current, at | Recent Progress on Probe-Based Storage Devices | If you're in need of piercing probes for automotive diagnostics, I have no qualms recommending these. Much heavier than my bench probes, which are for much finer work. I don't use piercing probes often, but I had a scenario that required them and these performed admirably. | 140 | Abstract The theory of steady convective diffusion to a circular cylinder in cross flow shows that the directional characteristics of triple-split anemometric probes depend strongly on Re due to the changing wake structure in the range of medium Re. Resulting predictions of the directional characteristics agree well with the data for a real electrodiffusion three-segment anemometric probe. | Axial conduction effect in flow through circular porous passages with prescribed wall heat flux | Impact of a Splitter Plate on Flow and Heat Transfer Around Circular Cylinder at Low Reynolds Numbers | An analytic solution for the temperature distribution in flow through porous media in narrow gap II. Radial injection | The wake behavior behind a heated cylinder in forced and mixed convection regimes | Measurements of Turbulent Mixed Convection Flow Over a Vertical Forward-Facing Step | Convective Heat Transfer with Multiflow in an Annular Pipe of Circular Cross Section | Turbulent heat transfer of polyacrylarnide solutions in the thermal entrance region of circular tube flows | On the Brinkman correction in unidirectional Hele-Shaw flows |
141 | Phosphorylation by tyrosine kinases has been shown to promote cellular growth and hypertrophy and to play a key role in modulating ion channels. We have examined possible effects of genistein, a protein tyrosine kinase (PTK) inhibitor, on cardiac delayed-rectifier K currents (IK). Guinea pig ventricular myocytes were voltage-clamped by conventional whole-cell mode (5.4 mM [K]out/150 mM [K]in; pCa = 8; 36 degrees C). Amplitudes of tail and steady-state (2-s pulse) currents were measured as IK. Micromolar concentrations of genistein (10-100 microM) reversibly inhibited basal, swelling-enhanced (by 70% hypotonic solution), and intrapipette Cyclic adenosine monophosphate (cAMP) (1 mM)-enhanced IK concentration-dependently, while intrapipette cAMP-enhanced IK were also affected by daidzein, an inactive analog of genistein. In contrast, lavendustin A (10 microM) and tyrphostin 51 (100 microM), other types of PTK inhibitors, had no effect on IK. These results suggest that genistein may inhibit IK and that this inhibition is not mediated by an inhibition of tyrosine kinase activity. | Activation of muscarinic K+ current in guinea-pig atrial myocytes by a serum factor. | AIM: To investigate the effects of resveratrol on the L-type calcium current in isolated guinea pig ventricular myocytes.METHODS: The whole cell patch clamp method was used.RESULTS:(1)Resveratrol(1,50,100 μmol/L) reduced the ICa-L by 18.31%±3.15%,56.20%±2.50% and 84.51%±4.01% in a concentration-dependent manner(n=5,P0.05).But it has no change on I-V shape of ICa-L.(2) 8Br-cGMP(100 μmol/L),an activator of protein kinase G(PKG),deduced the density of ICa-L by 10.50%±1.11%.Applying resveratrol and 8Br-cGMP simultaneously decreased the ICa-L significantly by 87.58%±3.49%(n=6,P0.05).(3) 5 μmol/L H8,a PKG inhibitor,inhibited the decrease in ICa-L caused by resveratrol.CONCLUSION: Resveratrol inhibits ICa-L in guinea pig ventricular myocytes,and this inhibitory effect involves the PKG pathway. | Tedisamil blocks the transient and delayed rectifier K+ currents in mammalian cardiac and glial cells. | Subcellular localization of the delayed rectifier K+ channels KCNQ1 and ERG1 in the rat heart | in SGK1, or serum and glucocorticoid-inducible kinase 1, can lead to a shortening of the QT interval, which represents the repolarization time of the cardiac cells after a cardiac muscle contraction action potential. SGK1 does this by interacting with the KvLQT1 channel in cardiac cells, stimulating this channel when it is complex with KCNE1. SGK1 stimulates the slow delayed rectifier potassium current through this channel by phosphorylating PIKfyve, which then makes PI(3,5)P2, which goes on to increase the RAB11-dependent insertion of the KvLQT1/KCNE1 channels into the plasma membrane of cardiac neurons. SGK1 phosphorylates PIKfyve, which results in regulated channel activity | The efficacy and mechanism of alpha-dendrotoxin (DTX) block of K+ channel currents in Vicia stomatal guard cells was examined. Currents carried by inward- and outward-rectifying K+ channels were determined under voltage clamp in intact guard cells, and block was characterized as a function of DTX and external K+ (K+o) concentrations. Added to the bath, 0.1-30 nM DTX blocked the inward-rectifying K+ current (IK,in), but was ineffective in blocking current through the outward-rectifying K+ channels (IK,out) even at concentrations of 30 nM. DTX block was independent of clamp voltage and had no significant effect on the voltage-dependent kinetics for IK,in, neither altering its activation at voltages negative of -120 mV nor its deactivation at more positive voltages. No evidence was found for a use dependence to DTX action. Block of IK,in followed a simple titration function with an apparent K1/2 for block of 2.2 nM in 3 mM K+o. However, DTX block was dependent on the external K+ concentration. Raising K+o from 3 to 30 mM slowed block and resulted in a 60-70% reduction in its efficacy (apparent Ki = 10 mM in 10 nM DTX). The effect of K+ in protecting IK,in was competitive with DTX and specific for permeant cations. A joint analysis of IK,in block with DTX and K+ concentration was consistent with a single class of binding sites with a Kd for DTX of 240 pM. A Kd of 410 microM for extracellular K+ was also indicated. These results complement previous studies implicating a binding site requiring extracellular K+ (K1/2 approximately 1 mM) for IK,in activation; they parallel features of K+ channel block by DTX and related peptide toxins in many animal cells, demonstrating the sensitivity of plant plasma membrane K+ channels to nanomolar toxin concentrations under physiological conditions; the data also highlight one main difference: in the guard cells, DTX action appears specific to the K+ inward rectifier. | Effects of myosin light chain kinase inhibitors on carbachol-activated nonselective cationic current in guinea-pig gastric myocytes | Abstract We have developed a detailed mathematical model for Ca handling and ionic currents in the human ventricular myocyte. Our aims were to: (1) simulate basic excitation–contraction coupling phenomena; (2) use realistic repolarizing K current densities; (3) reach steady-state. The model relies on the framework of the rabbit myocyte model previously developed by our group, with subsarcolemmal and junctional compartments where ion channels sense higher [Ca] vs. bulk cytosol. Ion channels and transporters have been modeled on the basis of the most recent experimental data from human ventricular myocytes. Rapidly and slowly inactivating components of I to have been formulated to differentiate between endocardial and epicardial myocytes. Transmural gradients of Ca handling proteins and Na pump were also simulated. The model has been validated against a wide set of experimental data including action potential duration (APD) adaptation and restitution, frequency-dependent increase in Ca transient peak and [Na] i . Interestingly, Na accumulation at fast heart rate is a major determinant of APD shortening, via outward shifts in Na pump and Na–Ca exchange currents. We investigated the effects of blocking K currents on APD and repolarization reserve: I Ks block does not affect the former and slightly reduces the latter; I K1 blockade modestly increases APD and more strongly reduces repolarization reserve; I Kr blockers significantly prolong APD, an effect exacerbated as pacing frequency is decreased, in good agreement with experimental results in human myocytes. We conclude that this model provides a useful framework to explore excitation–contraction coupling mechanisms and repolarization abnormalities at the single myocyte level. | 141 | It has been suggested that protein tyrosine kinase (PTK) activity can directly regulate cardiac L-type Ca(2+) channels. This conclusion is based to a large extent on the observation that the PTK inhibitor genistein can inhibit the cardiac L-type Ca(2+) current. The purpose of the present study was to determine whether the ability of genistein to inhibit cardiac L-type Ca(2+) channel activity is due to inhibition of PTK activity. Genistein significantly reduced the magnitude of the L-type Ca(2+) current in guinea pig ventricular myocytes recorded using the whole-cell patch-clamp technique. However, this effect was associated with extracellular, not intracellular, application of the drug. Peroxovanadate (PVN), a potent protein tyrosine phosphatase inhibitor, had no effect on the basal Ca(2+) current. PVN was also ineffective in preventing the inhibitory effect of genistein. Internal perfusion of cells with a pipette solution containing ATPgammaS was used to prevent reversibility of phosphorylation-dependent processes. This treatment did not alter the inhibitory effect of genistein, although it did result in irreversible protein kinase A-dependent regulation of the Ca(2+) current. Bath application of lavendustin A, a PTK inhibitor that is structurally unrelated to genistein, did not affect the Ca(2+) current amplitude. The inhibitory effect of genistein was also associated with a hyperpolarizing shift in the voltage dependence of Ca(2+) channel inactivation. These results are consistent with the conclusion that the cardiac L-type Ca(2+) current is not directly regulated by PTK activity and that the inhibitory effect of genistein is due to direct non-catalytic blockade of the channels. | Tetrodotoxin (TTX) is believed to be one of the most selective inhibitors of voltage-gated fast Na + channels in excitable tissues. Recently, however, TTX has been shown to block L-type Ca 2+ current (I Ca ) in canine cardiac cells. In the present study, the TTX-sensitivity of I Ca was studied in isolated canine ventricular myocytes as a function of (1) channel phosphorylation, (2) extracellular pH and (3) the redox potential of the bathing medium using the whole cell voltage clamp technique. Fifty-five micromoles of TTX (IC 50 value obtained under physiological conditions) caused 60% ± 2% inhibition of I Ca in acidic (pH = 6.4), while only a 26% ± 2% block in alkaline (pH = 8.4) milieu. Similarly, the same concentration of TTX induced 62% ± 6% suppression of I Ca in a reductant milieu (containing glutathione + ascorbic acid + dithiothreitol, 1 mM each), in contrast to the 31% ± 3% blockade obtained in the presence of a strong oxidant (100 μM H 2 O 2 ). Phosphorylation of the channel protein (induced by 3 μM forskolin) failed to modify the inhibiting potency of TTX; an IC 50 value of 50 ± 4 μM was found in forskolin. The results are in a good accordance with theOPEN ACCESSMar. Drugs 2013, 11 2141 predictions of our model, indicating that TTX binds, in fact, to the selectivity filter of cardiac L-type Ca channels. | An increase in intracellular Ca2+ concentration ([Ca2+]i) augments late sodium current (INa.L) in cardiomyocytes. This study tests the hypothesis that both Ca2+-calmodulin-dependent protein kinase II (CaMKII) and protein kinase C (PKC) mediate the effect of increased [Ca2+]i to increase INa.L. Whole cell and open cell-attached patch clamp techniques were used to record INa.L in rabbit ventricular myocytes dialyzed with solutions containing various concentrations of [Ca2+]i. Dialysis of cells with [Ca2+]i from 0.1 to 0.3, 0.6, and 1.0 μM increased INa.L in a concentration-dependent manner from 0.221 ± 0.038 to 0.554 ± 0.045 pA/pF (n = 10, P < 0.01) and was associated with an increase in mean Na+ channel open probability and prolongation of channel mean open-time (n = 7, P < 0.01). In the presence of 0.6 μM [Ca2+]i, KN-93 (10 μM) and bisindolylmaleimide (BIM, 2 μM) decreased INa.L by 45.2 and 54.8%, respectively. The effects of KN-93 and autocamtide-2-related inhibitory peptide II (2 μM) were not different.... | Dendroaspis natriuretic peptide (DNP), a new member of the natriuretic peptide family, is structurally similar to atrial, brain, and C-type natriuretic peptides. However, the effects of DNP on the cardiac function are poorly defined. In the present study, we examined the effect of DNP on the cardiac L-type Ca 2+ channels in rabbit ventricular myocytes. DNP inhibited the L-type Ca 2+ current (ICa,L) in a concentration dependent manner with a IC 50 of 25.5 nM, which was blocked by an inhibitor of protein kinase G (PKG), KT5823 (1 μM). DNP did not affect the voltage dependence of activation and inactivation of I Ca,L . The α 1c subunit of cardiac L-type Ca 2+ channel proteins was phosphorylated by the treatment of DNP (1 μM), which was completely blocked by KT5823 (1 μM). Finally, DNP also caused the shortening of action potential duration in rabbit ventricular tissue by 22.3 ± 4.2% of the control (n = 6), which was completely blocked by KT5823 (1 μM). These results clearly indicate that DNP inhibits the L-type Ca 2+ channel activity by phosphorylating the Ca 2+ channel protein via PKG activation. | Protons inhibit Ca2+current and contraction in heart muscle. The present study compares the effects of lowering the pH of the bath solution on single-cell contraction, action potential configuration and Ca2+currents between neonatal and adult rabbit hearts. We found that a reduction of extracellular pH from 7.3 to 6.3 decreased cell contraction amplitude to 84.3% of control in isolated neonatal myocytes. A comparable change in extracellular pH resulted in a decrease in cell contraction to 56.2% of control in adult cells. Similarly, tension generation in intact neonatal papillary muscles was less sensitive to a decrease in external pH as compared to papillary muscles from adult animals. In addition, acidosis caused a less pronounced inhibition of Ca2+current in neonatal cells than in adult cells (85±4%v62±4% of control, pH=6.3,P<0.001; 63±5%v32±5% of control, pH=5.8,P<0.001). Thus, the effect of external acidosis on myocardial contractility is commensurate with the effect on trans-sarcolemmal Ca2+current. The membrane potential at which peak Ca2+current occurred was not altered by low pH in neonatal cells, but was shifted toward positive potentials by 17.7 mV in adult myocytes. Further, low external pH solution reduced Ca2+current conductance more in adult cells than in neonatal cells. Moreover, action potential configuration in neonatal cells was altered less by acidosis as compared with adult cells. These findings may help explain the greater resistance of neonatal hearts to extracellular acidosis. | Background: Sinus bradycardia is frequently observed in patients treated with crizotinib, a receptor tyrosine kinase inhibitor used for the treatment of anaplastic lymphoma kinase (ALK)-rearranged non-small cell lung cancer (NSCLC). We investigated whether crizotinib could influence heart rate (HR) through direct cardiac effects. Methods: The direct effect of crizotinib on HR was studied using ECG analysis of Langendorff-perfused mouse hearts. The whole-cell patch clamp technique was used to measure the effects of crizotinib on the hyperpolarizationactivated funny current, I f , in mouse sinoatrial node cells (SANCs) and hyperpolarization-activated cyclic nucleotidegated channel 4 (HCN4) activity in HEK-293 cells stably expressing human HCN4. Results: Crizotinib resulted in a dose-dependent reduction in HR in isolated intact mouse hearts with a half maximal inhibitory concentration (IC50) of 1.7 ± 0.4 μmol/L. Because ECG analysis revealed that crizotinib (0-5 μmol/L) resulted in significant reductions in HR in isolated mouse hearts without changes in PR, QRS, or QT intervals, we performed whole-cell patch clamp recordings of SANCs which showed that crizotinib inhibited I f which regulates cardiac pacemaker activity. Crizotinib resulted in diminished current density of HCN4, the major molecular determinant of I f , with an IC50 of 1.4 ± 0.3 μmol/L. Crizotinib also slowed HCN4 activation and shifted the activation curve to the left towards more hyperpolarized potentials. Conclusions: Our results suggest that crizotinib's effects on HCN4 channels play a significant role in mediating its observed effects on HR. | Arachidonic acid (AA) modulates T-type Ca 2 ϩ channels and is therefore a potential regulator of diverse cell functions, including neuronal and cardiac excitability. The underlying mechanism of modulation is unknown. Here we analyze the effects of AA on the T-type Ca 2 ϩ channel ␣ 1G heterologously expressed in HEK-293 cells. AA inhibited ␣ 1G currents within a few minutes, regardless of preceding exposure to inhibitors of AA metabolism (ETYA and 17-ODYA). Current inhibition was also observed in cell-free inside-out patches, indicating a membranedelimited interaction of AA with the channel. AA action was consistent with a decrease of the open probability without changes in the size of unitary currents. AA shifted the inactivation curve to more negative potentials, increased the speed of macroscopic inactivation, and decreased the extent of recovery from inactivation at Ϫ 80 mV but not at Ϫ 110 mV. AA induced a slight increase of activation near the threshold and did not significantly change the deactivation kinetics or the rectification pattern. We observed a tonic current inhibition, regardless of whether the channels were held in resting or inactivated states during AA perfusion, suggesting a state-independent interaction with the channel. Model simulations indicate that AA inhibits T-type currents by switching the channels into a nonavailable conformation and by affecting transitions between inactivated states, which results in the negative shift of the inactivation curve. Slow-inactivating ␣ 1G mutants showed an increased affinity for AA with respect to the wild type, indicating that the structural determinants of fast inactivation are involved in the AA-channel interaction.key words: Low voltage-activated calcium channel • fatty acid • kinetic model • inactivation • mutant | Ca2+ Influx During the Cardiac Action Potential in Guinea Pig Ventricular Myocytes | Effects of the extracellular Ca2+ concentration ([Ca2+]o) on whole cell membrane currents were examined in mouse osteoclastic cells generated from bone marrow/stromal cell coculture. The major resting conductance in the presence of 1 mm Ca2+ was mediated by a Ba2+-sensitive, inwardly rectifying K+ (IRK) current. A rise in -Ca2+-o (5-40 mM) inhibited the IRK current and activated an 4'4'-diisothiocyano-2,2'-stilbenedisulfonate (DIDS)-sensitive, outwardly rectifying Cl- (ORCl) current. The activation of the ORCl current developed slowly and needed higher [Ca2+]o than that required to inhibit the IRK current. The inhibition of the IRK current consisted of two components, initial and subsequent late phases. The initial inhibition was not affected by intracellular application of guanosine 5'-O-(3-thiotriphosphate) (GTPgammaS) or guanosine 5'-O-(2-thiodiphosphate) (GDPbetaS). The late inhibition, however, was enhanced by GTPgammaS and attenuated by GDPbetaS, suggesting that GTP-binding proteins mediate this inhibition. The activation of the ORCl current was suppressed by pretreatment with pertussis toxin, but not potentiated by GTPgammaS. An increase in intracellular Ca2+ level neither reduced the IRK current nor activated the ORCl current. Staurosporine, an inhibitor for protein kinase C, did not modulate the [Ca2+]o-induced changes in the IRK and ORCl conductances. These results suggest that high [Ca2+]o had a dual action on the membrane conductance of osteoclasts, an inhibition of an IRK conductance and an activation of an ORCl conductance. The two conductances modulated by [Ca2+]o may be involved in different phases of bone resorption because they differed in Ca2+ sensitivity, temporal patterns of changes and regulatory mechanisms. |
142 | Tavern Brawl idea: train an AI | Can real machine learning AI help create more challenging enemies? Can they make games more engaging? Is it worth the development costs?
This experiment is created by 4 students in our Software Engineering Class of 2016. We’ve created a top-down arcade shooter for the purpose of showcasing non-deterministic AI that adapts to your playstyle. You can check out some gameplay on our instructions page.
If you have ~15 minutes to spare, please try it out here. There will be a short survey at the end. Results will be shared at the conclusion of this experiment! | I was searching for a Brawl for so long that the matchmaking system filled both teams with AI as much as it could. Actually the game was fun when I treated the AIs as players as they played relatively well. Maybe that could feel as an AI battle with human skill irrelevant to someone.
What are your thoughts? Is it a good measure to replace human players with AI? Did Blizzard succeed in creating a good AI system? | I was playing brawlhalla ranked and i realized that i have trouble countering people when they dodge through you as they last resourse.
&#x200B;
Ok, well, i went to training mode and i tried to make the bot appears in the limit of the map to make the bot act like that, i failed, i asked for help to a friend he barely helped me, and i thought:
Hey, it would be great to have a mode in the training room to temporally take control over the bot, do something and then that the bot repeat it.
&#x200B;
Just think about, it would be perfect to replicate almost any scenario that you can find on a real match, i putted an example but there can be unlimited things that you could do with that.
&#x200B;
And come on! it doesn't sound to hard to program, it would be just make a list of the moves that the player does and turn it into a step list for the bot.
&#x200B;
What you think about it? | I'm having trouble with a few matches in Domination with the AI literally winning by fiat. Every other match, I've blown the AI out, yet magically without an increase in difficulty, my guys start playing like they've been visited by the aliens from Space Jam. I'm wondering, is there a play you can cheese the AI with when it busts out this handwaving BS? Thanks in advance | Mastering StarCraft could drive forward the entire field of artificial intelligence (AI). On Wednesday, DeepMind and the game's creator, Blizzard Entertainment, opened a StarCraft training ground for AI--a suite of tools designed to make it easier for researchers to build them, and coming soon, hundreds of thousands of videos showing real games for them to train on. The new foray comes hot on the heels of DeepMind's success at cracking Go. Earlier this year, its AlphaGo, an AI with superhuman mastery of the game, defeated the world's best human player after analyzing and learning from millions of human games. | When you have to fight multiple characters at once and your health runs low and your mentor decides to show up, they make the situation worse. At least solo the AI won't jump you, but once they show up you are getting your ass handed to you even after they are knocked out. PQ 122 makes this painfully obvious. Also has anyone noticed the change to AI when it comes to reviving. They liiterally stand there targeting you getting their asses kicked and inch towards one every 20 seconds. | I played the demo a lot this weekend against the Master bot. I win most games, but sometimes there are sets for which the AI seems unbeatable; even if I spend an hour trying different openings, it always counters me. I have the impression that these sets are those forcing you into tight tactical games rather that wider strategic decisions, and that the calculation power of the AI just takes over.
But maybe it's just me being a noob.
Are there situations where the best players can't beat the AI ?
ps: props to the guys who did the AI, it's awesome. It's rare that playing against an AI is interesting. | I’m playing my first game of online poker with friends. I’m not concerned with them, but I was wondering how often you’ve heard of someone using an AI to watch the action and make the moves the AI suggests. | 142 | We all figured the Burndown brawl was collecting AI training data. Wouldn't it be cool to see your PvE opponent go from 0% to 50+% win rate as the week goes on?
Depending on how the team does it, you could train a deckbuilding or gameplay AI, or both.
Imagine: the AI can see your deck before the game and build something in response. On Wednesday it throws in random cards and makes random moves. You win easily. By Friday it can spot your aggro/midrange/control build and tech for it. By the end of the brawl it's solved the meta and we only win with obscure combos and RNG. | Word Of The Week - "BRAWL" | Funny how through most of Brawl week, there have been mostly Melee posts coming up | Share your experience with AI-only Brawls | MTG Arena (Mobile) Brawl Matchmaking Data | New Brawler Concept: The Blaze | [brawl] I cream my friends, but I tend to lose to level 9 CPUs if I treat them like humans. | How to increase the chances to become big brawler? | Hearthstone needs more combo disruption |
143 | how many days of measurable precipitation does wichita get | Wichita, Kansas exceeds an average of 62 days a year and an average of 12 days a year. The minimum temperature falls to or below on an average 8.5 days a year. The hottest temperature recorded in Wichita was in 1936; the coldest temperature recorded was on February 12, 1899. Readings as low as and as high as occurred as recently as February 10, 2011 and July 29–30, 2012, respectively. During an average year, Wichita receives of precipitation, most of which falls in the warmer months, and experiences 88 days of measurable precipitation. The average relative humidity is 80% in the morning | Wichita Falls, Texas level on 28 days annually, with 102 days of or higher annually; the average window for the latter mark is April 9–October 10. However, 59 to 60 nights of freezing lows occur, and an average of 4.8 days where the high does not rise above freezing. The monthly daily average temperature ranges from in January to in July. Extremes in temperature have ranged from on January 4, 1947, to on June 28, 1980. Snowfall is sporadic and averages per season, while rainfall is typically greatest in early summer. In September 2011, Wichita Falls became the first Texas city to have | Wichita Falls, Texas level on 28 days annually, with 102 days of or higher annually; the average window for the latter mark is April 9–October 10. However, 59 to 60 nights of freezing lows occur, and an average of 4.8 days where the high does not rise above freezing. The monthly daily average temperature ranges from in January to in July. Extremes in temperature have ranged from on January 4, 1947, to on June 28, 1980. Snowfall is sporadic and averages per season, while rainfall is typically greatest in early summer. In September 2011, Wichita Falls became the first Texas city to have | Great Bend, Kansas 112 days a year. The first fall freeze typically takes place by the third week of October, and the last spring freeze by the second week of April. Great Bend receives of precipitation during an average year, and there are, on average, 71 days of measurable precipitation each year. The average relative humidity is 67%. Annual snowfall averages . Measurable snowfall occurs an average of seven days a year with at least an inch of snow being received on six of those days. Snow depth of at least an inch occurs an average of 23 days a year. As of | Abstract This paper identifies temporal and spatial patterns in the diurnal cycle of hourly warm season precipitation events over the Great Plains of the United States. Results from 30 years of hourly precipitation records from 515 stations indicate that over 60% of all warm season rainfall (≥0.25 mm) occurs at night from southern Nebraska to panhandle Oklahoma and portions of northern Texas. The larger precipitation events (≥2.54 mm) display a much larger region where 60% of the warm season precipitation occurs at night. Harmonic analysis reveals a remarkably uniform longitudinal gradient in the timing of maximum rainfall frequencies across much of the Great Plains. The more precise identification of these spatial and temporal patterns should be particularly useful in 1) assessing the many theories of nocturnal precipitation in the central United States, 2) verifying numerical precipitation models for the region, and 3) generating rainfall forecasts for various times of the day. | three winters, but accumulation and snow itself are very rare. Winters may pass without any frozen precipitation at all, and up to a decade has passed between snowfalls. According to the National Weather Service, there have been 32 instances of snowfall (a trace or more) in the city in the past 122 years, about once every four years. Snow was most recently seen on December 7, 2017, when of snow coated the city. On January 13, 1985, San Antonio received a record snowfall of . San Antonio and New Braunfels, to the northeast, are some of the most flood-prone regions | Roseburg, Oregon period, rainfalls of per month are not uncommon, with as much as during the record wet month of December 1955. Roseburg averages of rain per year, more than half of which falls between November and January. The wettest “rain year” has been from July 1955 to June 1956 with and the driest from July 2000 to June 2001 with only . Light dustings of snow can sometimes be seen, but accumulations are rare. The most snowfall in a month is in January 1950, but no other month has had even . As of the census of 2010, there were 21,181 | This paper provides an overview of the thunderstorm climate of the Baltic countries during the period of 1951–2000. Our study area is in northeastern Europe and encompasses Estonia, Latvia, and Lithuania. Visual thunderstorm observations at 59 weather stations were used as a data source. The mean annual number of thunderstorm days was 12–29.5. The seasonal cycle of thunderstorm hours with a daily step unexpectedly showed two maxima, whereas the monthly numbers of thunderstorm days had one clear mid-latitude specific peak between June and August. The diurnal cycle of thunderstorm hours showed a peak between 1400 and 1800 local time and a minimum between 0400 and 1000 hours local time. The average annual duration of thunderstorm events was 112 min. The average number of thunderstorm events per thunderstorm day was around 1.1–1.2. Our results showed that the thunderstorm climate of the Baltic countries generally resembles that of other mid-latitude study sites. | 143 | Wichita, Kansas exceeds an average of 62 days a year and an average of 12 days a year. The minimum temperature falls to or below on an average 8.5 days a year. The hottest temperature recorded in Wichita was in 1936; the coldest temperature recorded was on February 12, 1899. Readings as low as and as high as occurred as recently as February 10, 2011 and July 29–30, 2012, respectively. During an average year, Wichita receives of precipitation, most of which falls in the warmer months, and experiences 88 days of measurable precipitation. The average relative humidity is 80% in the morning | how many days a year does it get cold in wichita kansas | when was the coldest temperature in liberal kansas | when was the coldest temperature in fort scott kansas | when did it start getting cold in wichita falls texas | how many days a year does it stay cold in manhattan kansas | when was the last time it was freezing in wichita falls texas | when is the coldest month in ellsworth kansas | what is the hottest month in kashmir valley |
144 | glad I know how to sew | I love this machine didn't know how to sew when I purchased . It is easy to thread very smooth . Would buy again! | If you are new to sewing, you need this. I am still learning how to sew correctly and I am consistently having to stop, rip apart what I just did and try again. This ripper make it easier for me to redo my sewing projects. | Hello,
I would like to start learning how to sew as i am a complete beginner at this. I have my grandma"s old sewing machine (one where you step on a pedal so it sews) and it still works pretty good. So I was wondering what would be the best way to start learning how to sew? Or are there any tips which you would have liked to know yourself before you started sewing which could be really helpful? All help is very appreciated! | Exactly what I was looking for. This was a Christmas gift for my 9-year old daughter who sews. She uses it regularly. | Item was missing a critical part so it sat in my basement for the past year and I gave it to someone else who sews and they were able to find the part somewhere and finally get it to work. | Somehow this item did not make it in the shipment it was suppose to. Though with one contact, it was in the mail and i got it two days later. As described and i am sure it will help me loads as i learn to sew. | This machine only worked well for a week when I bought it. I don't sew often. Last time when I took it out to hem my son's pants it kept showing error message. It's so frustrating!! Hight tech headache! | I purchased this Velcro to use for a few chuneis. I haven't gotten a chance to sew them up yet but the Velcro appears to be great quality. It's for sure better than what I could buy at Joann's so I'm happy! | 144 | String and button came off after a few times wearing these boots, glad I know how to sew. Great boots for the price though. | The boots are great but one boot came with a shoe string but ... | these are beautiful boots! the string tie up in the back ... | Left boot lace hook broke off.. Should have listened to other reviews. | The split opening along the back of the boot makes it easily to get these on and off | I had to throw these boots out after wearing them ... | Good boots, cheap toggle string. | Nice boots - strings are very long and they feel ... | To those that complain about a bloused-boots feature being added in Breakpoint |
145 | great for photo props | The BEST props I've used! Ive tried several brands and I like these best, they are well balanced. Also, the colored ones are very bright and vibrant, the pictures don't do them justice. Great props from a great company. | Great piece for a photo prop, at a crazy low price. I didn't expect it to look as good as it does, but it was perfect for my needs. | We run a photo booth rental company and find this prop to hold up to the wear and tear of all the guests so far! Definitely would purchase again when we have another need for western themed props. | Using this as a picture prop. Nice product; doesn't look cheap. | VERY disappointed!! Bought for a special event photo booth and I cannot even use HALF the "props" that were sent in this bundle because they are SO SMALL!!! Not to mention the "glue dots" that come with this set are totally worthless!! Spend the extra money and buy from a local store!! I have included a picture with my chapstick as a size reference to the props... | This prop set was absolutely perfect for our DIY photo booth! We own a high end camera (and or peoples cell phones), in which we provided cute painted frames and simply rented a backdrop and voila, we had a our own photo booth for a fraction of the money! These were perfect and photographed REALLY well! | This thing came to me all beat up... I had bought it as a prop for pictures, I couldn't even really use it because it was dented and beat up. That may not have been how it shipped but it was how it was received, poor packaging could have been the result... not only that but trying to use it for what it was designed for was pretty worthless as well. | Absolutely loved these photo props! They are great quality and really easy to put together. It can take a while to put them together because there's so many pieces but my family loved them | 145 | great sticks for crafts. made photo props, worked great. | great craft sticks - I use these for all sorts ... | Sticks well and seems well made and durable | Was great fun. The props don't stay on the sticks ... | Great, high quality aluminum sticks. | Good size props for adults and kids, great for Christmas party. Could include stronger sticker/adhesive but would buy again. | I love Elmer's glue sticks | Craft sticks. As expected. | Sturdy sticks, looks professional, great value |
146 | The greatest crime I have ever read | I read this a long time ago, and I plan to buy it for my Kindle to revisit this masterpiece.
I have read many, many true crime novels, and this has to be in the top three--and I believe others' top three: Until the Twelfth of Never, Small Sacrifices, and this, Blood and Money. | I have been an avid true crime reader for years, and never have I found a book any more disappointing than this one. It truly is almost as if the author retyped the trial transcripts word-for-word and renamed as a "book." I got no real insight into any of the characters, which is the most important part of what makes a true crime account so fascinating. There was also a lot of skipping around, with a less than smooth effort to present the sequence of events in a manner the reader can follow easily. Hopefully, this was a "first book" for this author, and future efforts will improve. Otherwise, I think I will stick with known authors in the genre that I can count on to deliver. | The Winner's Crime is the second novel of The Winner’s Trilogy, written by Marie Rutkoski. The Winner’s Crime is a story about a girl called Kestrel, the daughter of a soldier. It is fantasy novel with mystery.
The Huffington Post rated it as the best young adult sequel book of 2015.
References
2015 American novels
Young adult fantasy novels
Farrar, Straus and Giroux books | Seth Harwood is an excellent crime writer
This story just pulls you in and you can't help but be one the good and bad side of things
The criminal is a bad man but you kinda are on his side as well as the side of the law
I was sad when I got to the end
An excellent read ! | The Ultimate Crime "The Ultimate Crime" is a short story by Isaac Asimov, dealing with a minor aspect of one of the Sherlock Holmes stories of Sir Arthur Conan Doyle. It is the 24th of Asimov's Black Widowers mystery stories, and it appeared in his anthology "More Tales of the Black Widowers" (Doubleday, 1976), which collects the second dozen stories of the series. It was written specially for that book. It subsequently appeared again in "Sherlock Holmes Through Time and Space" (Severn House, 1985), an anthology of stories written by different authors and co-edited by Asimov, and "Another Round at | This thread is for weekly discussions of what story first sparked your fascination with true crime! Feel free to share any other favorite stories you may have, as well.
Links to Wikipedia and other articles are encouraged, but as always, please remember **rule #2: no links to graphic photos!** Articles with pictures are fine as long as you tag the link as **NSFL.** | This thread is for weekly discussions of what story first sparked your fascination with true crime! Feel free to share any other favorite stories you may have, as well.
Links to Wikipedia and other articles are encouraged, but as always, please remember **rule #2: no links to graphic photos!** Articles with pictures are fine as long as you tag the link as **NSFL.** | This is an interesting collection of true crime stories. There is a good mix of older and modern accounts. Some I was familiar with, others I hadn't heard of.
The writing is clear and precise, with a journalist feel. Each chapter is relatively short, highlighting the specifics of the case without a lot of in-depth detail or commentary. At times the writing felt a little dry and didn't spark as much emotion as the subject matter should have demanded. But it's perfect for those interested in crime facts and/or researching these topics, particularly if you prefer a detached approach. | 146 | The greatest crime I have ever read! The story-twist about half way in the novel is mind blowing.
Even the last sentence is a cliffhanger!
Great read! | I thought this was a great crime novel and I had not heard of this ... | the book was so fantastic. The Straight Crimes takes place in a society ... | That cliffhanger! OMG! I have to go read ... | A Quick Reading Novella With Shudder-Causing Twists! | Fantastic real crime read. | Stunningly Good True-Crime Book | Plot twist: Dean is a criminal mastermind | Outstanding crime and punishment drama - a real "must read"! |
147 | HIGH QUALITY FINISHING OF BEVEL GEARS BY ELECTROCHEMICAL HONING | CNC Machining Method of Whole Modified Surface of Cylindrical Gears with Arcuate Tooth Trace | Accurate modeling of spiral bevel gear laid the foundation of the key technology namely Tooth Contact Analysis(TCA)and correction of the deviation of tooth-surface in its digitized manufacturing. It summarized the related outcomes and divided modeling approaches of the tooth-surface of spiral bevel gear into three categories,modeling by the tooth-surface of discrete points and suturing curves and simulation machining,and generalized their vital idea and step. What is more, according to the analysis of some problems and their inadequacies and advanced ways and ideas in the modeling,it proposed three development direction for modeling technology of spiral bevel gear in the future,these development direction were high in accuracy and high efficiency and high flexibility,so as to provide some methods for faster and more accurate design of spiral bevel gear and its machining. | Abstract This study is based on the parametric conjugate tooth profiles of bevel gear sets having the properties of invariant speed ratios, fixed skew axes (pitch line), zero length of common perpendicular line, two rotating axes intersecting at a point, etc. The geometric characteristics of the tooth profiles of bevel gears can be studied by using the kinematics parametric polar angular (pressure angle) function, the meshing equation and the constraints of continuity conditions. In this paper, the author derives the general profile equations, meshing constraint equations and non-undercut condition equations. By using the above-mentioned equations, gear geometric solid models are constructed. In addition, some gearing examples are presented to verify the developed theories. The non-undercut conditions and curvature properties are discussed in the paper. These developed theories have demonstrated bevel gear tooth profiles that can be parameterized by specifying certain relative parameters and are studied by a series of developed procedures. For the machining of these gears, the CAD/CAM software package from PRO/Engineering is used to transfer the solid models into NC programs. The method of transferring the manufacturing cutting NC codes to protect the tools and avoid impacting fixtures is demonstrated. This study is important for engineering design and for manufacturing factories involved in actual machining. | The present invention discloses a method of warm and cold forming large precision high modulus boss bevel gear comprising a pre-cutting upsetting blank, then in the closed warm forging molding for forming a mold closing warm forging, and then spheroidizing annealing, shot blasting derusting, surface phosphating, saponification treatment, and finally into the die to cold finishing tooth qualified extruded, molded gears of roughing, roughing member for heat treatment and then, finishing off the reserve margin, to give qualified product. The present invention improves the yield of material, saving tooling costs, and the mechanical properties of the product, the surface of high dimensional accuracy, with suitable for mass production. | Parametric Design of Straight Bevel Gears Based on Solidworks | Gear-tooth profile modifications and gear-tooth crowning do not change the geometric dimensions of the gear smoothness and can distribute the contact stress throughout the tooth surface and improve the reliability and capacity of the gear transmission, the smoothness of transmission thus it can reduce the effect of heat deformation after machining, resulting in a longer life span and decrease the vibration. Owing to the advantages of high efficiency, high precision, and environmental consciousness, etc., the electrochemical gear-tooth profile modification (ECGTPM) will become a valuable new technique. The focus is laid on developing an automatic control system for ECGTPM in this paper. The control architecture, the processing mechanism, the main components and their functionalities are demonstrated in detail. The implementation of the control system for ECGTPM is helpful to the improvement of productivity, safety, automation, etc. Some experiments are verified to the advantages of this new technique. | Durng the process of spiral bevel gear addendum chamferng, the cutter moves materal according to acertain trajectory and this process must first determine the mathematical model of tooth top line. Based on thetooth surface of spiral bevel gear processing principle,this paper established the mathematical model for spiral bevel gear,and then,with gears outside the cone surface equation according intersection method to get the mathematical model of the tooth top line,for the spiral processing to provide theoretical support. |
INTRODUCTION
Extrusion Honing (EH) is also known as Abrasive flow machining (AFM) was developed by the Extrude Hone Corporation, USA in 1960s as a method to deburr and polish difficult-to-reach surfaces and edges by flowing abrasive laden polymer with special rheological properties [1]. EH can be applied to an impressive range of finishing operations, providing uniform repeatable and predictable results. Experimental investigations have been carried out by various researchers to investigate the effects of process parameters like extrusion pressure, number of cycles, viscosity, abrasive concentration and grain size on the output responses namely, surface finish and material removal during EH. Jain and Adsul [2] reported that softer material has higher material removal and more improvement in surface finish (ΔRa) compared to harder material. Gorana et al. [3] reported that extrusion pressure, abrasive concentration and grain size affect the cutting forces, active grain density and finally reduction in surface roughness (Ra value). In Extrusion Honing (EH), abrasive concentration, abrasive grit size, viscosity of the abrasive media, extrusion pressure, geometry of machining surface, are the factors which influence on material removal and surface roughness. Material properties like hardness and ductility also influence upon material removal and improvement in surface roughness. Abrasives with higher grit size give better surface finish with lower Raju et.al [4] have reported that extrude honing of SG iron (600 grade) has been performed hydraulically actuated extrude honing set-up using a select grade of polymer as abrasive carrier medium. SiC grit of 36 mesh size is used as abrasive. The surface finish parameters were measured at two locations on entry side and exit side of the abrasive media. The results obtained show that extrusion honing process in 10 bar range shows good improvement in surface finish parameters is seen till seventh pass, beyond which the surface starts deteriorating. The extrusion honing process in the lower pressure range yields good results in finishing SG Cast Iron (600 grade). Out of roundness of extrude honed surface is improved, and Surface in the middle zone is better than the entry/exit zone due to better contact with the abrasive medium. This process is capable of finishing regions which are difficult to reach by flowing abrasive which are mixed with polymer of special rheological properties. Extrusion Honing produces repeatable, uniform and predictable results based on a notable range of finishing operation. Some of the abrasive grains commonly used in Extrusion Honing process are Aluminium Oxide, Boron Carbide, Diamond and Silicon Carbide. In EH process, medium or tool used to machine the material comprises of polymer based on visco-elastic material matrix which is mixed with abrasive particle and additive, which is used to extrude different primitives of work piece. While extruded through the passage which is formed by the work piece and tooling, this medium tries to finish the work piece surface selectively. Here in the process tooling plays the important role. So, the design of the fixture or tooling should be done carefully. One of property of the polymer is that the polymer chain holds the abrasive particle flexibly and movies them around in the direction of the extrusion pressure. Thus, the medium is used as a multi-point tool cutter which starts abrading the work piece surface. Extrusion process is one the most extended process used in wide range of industrial applications in the field of manufacturing which have different approaches of extrusion process. This finishing technique also reduces the human effort and provides the high-quality surface finish
II.
EXPERMENTAL DETAILS Experiment conducted on one-way Extrusion honing machine built in Laboratory and surface parameters are evaluated for each trial. Surface roughness parameters measurements were taken at entry and exit positions for ϕ6mm, ϕ8mm and ϕ10mm. Finally, SEM images of work pieces before and after the 10 EH passes were taken.
A. Work Material Details
Super alloy Nitronic-60 is an iron-based high temperature and high strength alloy. The following datasheet provides an overview of super alloy Nitronic-60. 1) Applications of Nitronic-60 a) Automotive valves -can withstand gas temperatures of upto 1500°F for a minimum of 50,000 miles. b) Fastener galling -capable of frequent assembly and disassembly, allowing more use of the fastener before the threads are torn up, also helps to c) Eliminate corroded or frozen fasteners. d) Pins -Used in roller prosthetics & chains to ensure a better fit of parts (closer tolerance, non-lubricated) and longer lasting. e) Marine shafts -better corrosion than types 304 and 316, with double the yield strength. f) Pin and hanger expansion joints for bridges -better corrosion, galling-resistance, low temperature toughness, & high charpoy values at sub-zero temps compared to the A36 and A588 carbon steels commonly used.
B. Specimen Preparation
Nitronic-60 specimens of 25 mm diameter and length 12 mm with hole diameter of 6, 8 and 10 mm. The specimens were initially drilled using carbide drill bits and thoroughly washed with acetone to remove the clogged particles. Surface roughness parameters were measured using a surface roughness measuring instrument (Surfcom 130A) before conducting the experiment.
(a)
C. Preparation of Abrasive media
Abrasive media is prepared by thoroughly mixing Silicone carbide abrasives with silicone polymer using abrasive mixer. The volume fraction of Silicone carbide abrasives with silicone polymer used is 35%
(b)(
D. Experimental Procedure
Initially the extrusion honing machine is switched "on", the actuation of directional control valve in forward direction results in abrasive media to extrude through the specimen from one side and exits out at the other. After each trails the test specimens were thoroughly cleaned with acetone solution to remove clogged polymer and other dust particles and surface roughness parameter were measured at 2 locations (drill entry side and drill exit side) each at 3 position (120 o C apart). This procedure is repeated for 10 passes and results were tabulated. RESULTS AND DISCUSSION The main aim of the present work is to remove roughness and to attain a fine surface finish by applying extrusion honing process on Nitronic 60. After each finishing cycle, the finished surface of specimens was evaluated for its surface finish parameters (Ra, Rt, Rz and Rpk). Graphs were plotted for the parameters obtained after each experimental for all specimens of diameter of 6 mm, 8 mm and 10 mm under consideration. There exhibits a drastic decrease in the surface roughness parameters after 1 st pass followed by a progressive reduction afterwards and attains core roughness between 3th to 6th pass, in later passes, surface deterioration can be seen. Fig 3.4 compares the surface roughness (Ra) achieved on both entry and exit side of the specimens. It can be seen that, Ra along exit side of the media is better than the entry side.
CONCLUSION
In the present study, Extrusion Honing of Nitronic 60 was done using a working medium developed using a select grade silicone polymer and silicon carbide (SiC) abrasive particles. The Extrusion Honed surface of each specimens were evaluated at three different points on both entry and exit side of the specimen with respect to medium entry. From the present study, following conclusion could be drawn,
A. The present study shows that, working medium made of silicone polymer and SiC abrasives was able to produce a good surface finish on Nitronic 60. B. Surface finish increases greatly after first pass followed by a progressive improvement and once the surface attains core roughness, deterioration of surface sets in. C. Surface finish of specimen along exit side is better than the entry side. D. The uneven Surface irregularities and lay pattern have been effectively replaced with fine surface having a uniform lay. a b
c d e f
Fig
Fig 2.2: Extrusion honing machine
roughness parameters v/s number of passes (a) Entry side, (b) Exit side (a) (b) Fig 3.3: Surface roughness parameters v/s number of passes (a) Entry side, (b) Exit side ISSN: 2321-9653; IC Value: 45.98; SJ Impact Factor: roughness (Ra) at Entry and Exit side v/s number of passes; (a) Ø 6 mm, (b) Ø 8 mm and (c) Ø 10 mm
Fig
the impact of honing on roughness parameter on both entry and exit sides of the specimen respectively.
Fig 3 . 5 :
35SEM images for 500 magnification; (a) 6 mm, Zero pass (b) 6 mm, Ten Passes (c) 8 mm, Zero pass (d) 8 mm, Ten Passes (e) 10 mm, Zero pass (f) 10 mm, Ten Passes From the above SEM images (fig: 3.5), it can be seen that the uneven initial tool feed marks and macro surface irregularities of drilling operation have been effectively removed and replaced with a fine surface having a uniform lay.IV.
TABLE 2 .
21
Chemical composition of Nitronic-60
Element
Content (%)
Iron, Fe
58.47
Nickel, Ni
8 to 9
Chromium, Cr
16 to 18
Molybdenum, Mo
0.75
Manganese, Mn
7 to 9
Silicon, Si
3.5 to 4.5
Carbon, C
0.10
TABLE 2.2
Physical properties of Nitronic-60
Properties
Metric
Density
7.6gm/cm 3
Melting point
1375 o C
TABLE 2 .
24
Extrusion Honing Process Parameters
Parameters
Details
Number of passes
10
Hole diameter (mm)
6, 8, 10
Abrasive mesh size
36
Volume fraction of abrasives 35%
Pressure
60 bar
Temperature
Ambient
Stroke length
600
Abrasive Flow Machining. J Lawrwnce, Hilary A Rhodes, Clouser, ASM Handbook. 16MachiningLawrwnce J. Rhodes and Hilary A. Clouser, Abrasive Flow Machining, ASM Handbook, Volume 16: Machining, p 514 -519.
Experimental investigations into abrasive flow machining (AFM). V K Jain, S G , International Journal of Machine Tools & Manufacture. 40Jain V. K. and S. G. Adsul, Experimental investigations into abrasive flow machining (AFM), International Journal of Machine Tools & Manufacture 40 (2000) 1003-1021.
Experimental investigation into cutting forces and active grain density during abrasive flow machining. V K Gorana, V K Jain, G K , International Journal of Machine Tools & Manufacture. 44Gorana V. K., V. K. Jain and G. K. Lal, Experimental investigation into cutting forces and active grain density during abrasive flow machining, International Journal of Machine Tools & Manufacture 44 (2004) 201-211.
Extrusion Honed Surface Characteristics of Inconel 600. H P Raju, V R Devadath, Murali Krishna, International Journal of Engineering Research and Applications. 3Raju H P, Devadath V R, Murali Krishna N L, "Extrusion Honed Surface Characteristics of Inconel 600", International Journal of Engineering Research and Applications, Vol. 3, Issue 6 (Nov-Dec 2013), pp.1338-1343.
Study of Surface Parameters of Inconel 600 by Extrusion Honing Process. L Manjunath, Naduvinamani, H P Raju, Int. Journal of Research. 4Manjunath L Naduvinamani and Raju H P, "Study of Surface Parameters of Inconel 600 by Extrusion Honing Process", Int. Journal of Research, e-ISSN: 2348- 6848, p-ISSN: 2348-795X, Vol. 4, Issue 9, August 2017.
Extrusion Honed Surface Characteristics of Inconel 625 Fabricated by EDM for Square Shape. Murali Krishna, N L Raju, H P , Int. Journal of Engineering Research and Applications. 46Murali Krishna N L and Raju H P, "Extrusion Honed Surface Characteristics of Inconel 625 Fabricated by EDM for Square Shape", Int. Journal of Engineering Research and Applications, ISSN: 2248-9622, Vol. 4, Issue 6 (Version 3), June 2014, pp.68-72.
| 147 | Investigations on surface quality improvement of straight bevel gears by electrochemical honing process | RESEARCH FOR INFLUENCE OF CONTACT AREA OFFSET ON SPIRAL BEVEL GEARS BENDING STRENGTH | Abstract The process performance of electrochemical honing (ECH) is often increased by the use of the appropriate and optimal input process parameters. This study focuses on the types of power supply and inter-electrode gap in ECH of spur gears, with the aim to determine which parameters are most significant for the required output. Based on the experimental findings, pulse assisted ECH gives marginal improvement in surface finish at the cost of three times higher processing time as compared with direct current ECH and higher value of IEG up to 1 mm helps to give controlled anodic dissolution in ECH of spur gears. | TOOTH CONTACT ANALYSIS OF SPIRAL BEVEL GEARS BASED ON THE DESIGN OF TRANSMISSION ERROR | Contact Stress Analysis of Spiral Bevel Gears Using Nonlinear Finite Element Static Analysis. Joint Propulsion Conference and Exhibit (29th) held in Monterey, California on June 28 - 30, 1993 | Dynamic characteristics analysis of spiral bevel gear drive system | Relation between CNC Bevel Gear Generator Spatial Errors and Machine Setting Errors | Tooth surface wear damage is one of the main causes of gearing system failure. Excessive wear leads to tooth profile loss and an increase in transmission errors, as the worn gear surfaces are no longer conjugate. Thus, the enhancement of gear durability against wear is important for gear application. Recent works show that cutter modification can aid in reducing the tool wear in gear processing, while the wear performance of the gears produced by modified cutters is still unknown. Therefore, this study focuses on the wear performance of the gear generated by modified cutter. Numerical results show that the wear resistance can be enhanced through proper cutter modification. | Abstract : An experimental study was conducted to determine the effect of lubricant jet location on spiral bevel gear bulk temperatures. Transient surface temperatures were also measured. Tests were conducted on aircraft quality spiral bevel gears in a closed-loop test facility. Thermocoupled pinions and an infrared microscope were used to collect the pertinent data. A single fan jet lubricated the test gears. Lubricant flow rate (lubricant jet pressure) and applied torque were also varied. The results of this study showed that jet placement had a significant effect on the gear bulk temperatures. |
148 | name the type of laser used to heat crystalline silicon | By laser heating silicon nanocrystals, researchers have more than tripled the emission rate of photons from silicon. Silicon is the most critical semiconductor for use in electronic devices and solar cells, but it suffers from poor optical properties, including low rates of light absorption and photon emission. Now, Elinore de Jong of the University of Amsterdam and co-workers have boosted the photon emission rate by over 300% by laser-induced heating silicon nanocrystals embedded in silica. Simulations revealed that this effect, which is the opposite to that observed in bulk silicon, occurs because the intense laser illumination generates large amounts of phonons. The finding demonstrates that the optical properties of silicon nanocrystals can be tailored and enhanced through the judicious control of their temperature. | Abstract:In 1988, Becker first described the “laser silicone flash” encountered while using the CO2 laser to remove breast siliconosis, but no subsequent use of the CO2 laser to remove siliconomas has been reported since. To our knowledge, lasers have not been described to treat facial silicone gran | Ablation of silicon using high power GHz femtosecond lasers achieves specific removal rate of 2.5 mm3/min/W. Ablation morphologies are discussed in terms of thermal and non-thermal mechanisms © 2019 The Author(s) | An important challenge in the field of three-dimensional (3D) ultrafast laser processing is to achieve permanent modifications in the bulk of silicon (Si) and narrow-gap materials. Attempts by increasing the energy of infrared femtosecond pulses with conventional laser machining configurations have failed [1]-[3]. | Many microelectromechanical systems (MEMS) applications utilize laser irradiation as an integral part of the system functionality, including projection displays, optical switches, adaptive optics (Andrews et al., 2011; Andrews et al., 2008), optical cross-connects (Knoernschild et al., 2009), and laser powered thermal actuators (Serrano & Phinney, 2008; Serrano et al., 2005). When laser irradiation is incident on small-scale systems, such as these MEMS applications, the propensity for exceeding the thermal handling capability of the devices dramatically increases, often leading to overheating, and subsequent deformation and permanent damage to the devices. In most instances, this damage is a direct consequence of the device geometry and the material thermal properties, which hinder the transport of heat out of any locally heated area. Such thermally-driven failures are common in electrically-powered systems (Baker et al., 2004; Plass et al., 2004). However, for laserirradiated MEMS, particularly those fabricated of surface-micromachined polycrystalline silicon (polysilicon), the optical properties can also affect the thermal response of the devices by altering how the laser energy is deposited within the material. Even more concerning in these types of devices is the fact that the thermal, optical, and mechanical response can be intimately coupled such that predicting device performance becomes difficult. In this chapter, we focus on understanding some of the basics of optical interactions in laserirradiated MEMS. We will first look at how the optical properties of the materials affect the laser energy deposition within a device. We will then expand upon this by looking at the coupling that exists between the optical and thermal properties, paying particular attention to the implications that transient temperature changes have in the optical response, ultimately leading to device failure. Finally, we will look at various cases of laser-induced damage in polysilicon MEMS where the device geometry and design and optical-thermal coupling have led to device failure. | Summary form only given. Previous work in our group has shown that novel conical microstructures are formed on the surface of silicon when it is irradiated with 100-fs laser pulses in the presence of halogen-containing gases. Structures are also formed using other background gases, such as N/sub 2/ or air, but they tend to be more blunt and irregular in shape. We have measured the optical,properties of microstructures formed in various gases. The structures are typically 1 /spl mu/m wide at the top and several /spl mu/m wide at the base, with a height in the range 1-20 /spl mu/m, depending on ambient gas pressure, and laser fluence. | How a semiconductor laser works? | Ablation and amorphization of crystalline Si by ultrashort pulse laser irradiation is reported in this paper. Laser pulse width was changed in the range of 100fs-200ps. We investigated the dependences of ablation rate and fluence for amorphization on laser pulse width. From the dependence of ablation rate, we derived the "effective" light penetration depth, which was much shorter than that calculated from spectroscopic data. At the lower fluence than single shot ablation threshold, femtosecond laser irradiation induced amorphization of crystalline Si. Thickness of the amorphoized layer, which was about 50nm and almost uniform, did not depend on the number of irradiated laser pulses and fluence. The interaction process was investigated by an imaging pump-probe technique. | 148 | Crystalline silicon is the use of a laser to heat the silicon locally without heating the underlying substrate beyond some upper temperature limit. An excimer laser or, alternatively, green lasers such as a frequency-doubled Nd:YAG laser is used to heat the amorphous silicon, supplying energy necessary to nucleate grain growth. The laser fluence must be carefully controlled in order to induce crystallization without causing widespread melting. Crystallization of the film occurs as a very small portion of the silicon film is melted and allowed to cool. Ideally, the laser should melt the silicon film through its entire thickness, but not damage the | Excimer laser-induced heating, melting, and mass diffusion in crystal silicon in nanosecond and nanometer scale | Lateral crystallization of silicon films using Joule heating | Photonic crystals and silicon photonics | The scope of this thesis is to study new methods for control of the most important phenomena in crystallization processes: nucleation and crystal growth. In order to achieve this, novel process equipment, which utilize alternative driving forces, were developed. It was proven that primary nucleation for solution crystallization can be controlled using laser irradiation. The relationship between creation, expansion and collapse of a vapor cavity induced by a laser pulse and the subsequent nucleation of crystals was both experimentally and theoretically investigated. Regarding crystal growth, it was shown that it can be controlled in an airlift crystallizer, in which, under the right conditions, growth can become the dominant crystallization mechanism, suppressing almost completely secondary nucleation. This air-mixed crystallizer enables the production of crystals with high quality and offers a large flexibility of the final crystal size. The research presented in this thesis brings new alternatives for control of nucleation and growth of the crystals and thus new methods for flexible process operation and enhanced product quality in industrial crystallization processes. | Crystallization of amorphous silicon films by a Nd:YAG laser and correlated surface morphology | Liquid crystal claddings for passive temperature stabilization of silicon photonics | Abstract In this work we present a detailed study of the wavelength influence in pulsed laser annealing of amorphous silicon thin films, comparing the results for material modification at different fluence regimes in the three fundamental harmonics of standard DPSS (diode pumped solid state) nanosecond laser sources, UV (355 nm), visible (532 nm) and IR (1064 nm). The crystalline fraction (% crystalline silicon) profiles resulted from irradiation of amorphous silicon thin film samples are characterized with MicroRaman techniques. A finite element numerical model (FEM) is developed in COMSOL to simulate the process. The crystalline fraction results and the local temperature evolution in the irradiated area are presented and analyzed in order to establish relevant correlation between theoretical and experimental results. For UV (355 nm) and visible (532 nm) wavelengths, the results of the numerical model are presented together with the experimental results, proving that the process can be easily predicted with an essentially physical model based on heat transport at different wavelengths and fluence regimes. The numerical model helps to establish the optimal operation fluence regime for the annealing process. | Laser induced lifetime degradation in p-type crystalline silicon |
149 | Very disappointed for the price | Not what I expected, disappointed with purchase. | item as described. great price. no disappointment here | Exactly what I was expecting. I'd buy it again. Plus, the price here is much less than in stores! | Wasn't what I expected. Was disappointed won't order again | Not quite what I expected for the price. It's pretty cheaply made. Maybe better than a Walmart purchase, but idk. | Kind of cheap feeling, not really what I expected but it wasn't all that expensive so it is what it is for the price. | Was just as we expected. Good product at reasonable pricing. | Great value! Decided to buy on amazon instead of a local store where it was the same price for less qty. | 149 | Is no where near as bright as it is let on to be. Very disappointed for the price. I've had better for less. | Not very bright but it works great and setup is easy | Not quite as bright as you would like it to be | Not sure its quite as bright as is listed, ... | Very, very bright. I use is for night ... | Not very bright at all.. have to really ... | very bright. works well as a light to let ... | Not at all super bright. Cranking it while carrying or on the ... | Not as bright as I would have liked. It does work |
150 | who was the author of the book 173 hours in captivity | Seven Out of Time Seven out of Time is a science fiction novel by author Arthur Leo Zagat. It was originally serialized in the magazine "Argosy" beginning in 1939. It was first published in book form in 1949 by Fantasy Press in an edition of 2,612 copies. The novel is written as a first-person narrative, the narrator being a young attorney from New York named John March. While investigating the disappearance of Evelyn Rand, a young heiress, March is transported across time and space. He finds himself on a strange world which is inhabited by bizarre tentacled creatures who claim | Watership Down. The average reader will spend 9 hours and 13 minutes reading this book at 250 WPM (words per minute). | This edited book is the first complete book-length study to consider the work of Robert Louis Stevenson and Joseph Conrad within the same framework. It contains essays from internationally renowned scholars of both authors and seeks to reposition Stevenson as an author whose work should be considered alongside that of Conrad and as an author whose influence is more significant than has previously been acknowledged. | War and Peace. The average reader will spend 38 hours and 46 minutes reading this book at 250 WPM (words per minute). | I've been trying to find the name of this book, but all I know about it is that there is some guy who is in a concentration camp but he thinks he isn't. He may have also thought he discovered time travel. If anyone can help me find this book, thanks a million! | The length of the book isn't worth the price. Of course we love to see animals rescued BUT the book is more I,e a booklet. | This has to be the Kindle bargain of the year for aviation buffs. The hardcopy version is nearly 500 pages. I thoroughly enjoyed this factional first-hand account of a copilot facing numerous challenges. The technical descriptions of flying a classic 747-200 are spot on and described in a non-technical fashion. Interspersed with accounts of the interactions among the members of the flight crew, the book is really three books in one. I defy anyone to put it down once the events of the potentially catastrophic flight to LAX begin. I had never considered the implications of a deranged pilot locking himself in the cockpit beyond the virtually impregnable door standard since 9/11 --- the lives of 500 others hanging in the balance. | A Guide to Grand-Jury Men A Guide to Grand-Jury Men — in full, A Guide to Grand Jury Men, Divided in two books. In the first, is the Author’s best advice to them what to do, before they bring in a Billa vera in cases of Witchcraft, with a Christian Direction to such as are too much given upon every cross to think themselves bewitched. In the Second, is a Treatise touching Witches good and bad, how they may be known, evicted, condemned, with many particulars tending thereunto was first published in 1627 and written by a puritan clergyman named | 150 | 173 Hours in Captivity 173 Hours In Captivity: The Hijacking of IC 814 is a 2000 book () written by Neelesh Misra, a New Delhi-based correspondent of the "Associated Press". The book is about the hijacking of Indian Airlines Flight 814 on its journey from Kathmandu to New Delhi on Christmas Eve, December 24, 1999. The sequence of events outside the plane (IC 814) is a well-documented and familiar story. The book presents the events inside the plane. During their 173 hours of captivity, the passengers and the crew lived and re-lived, experienced and re-experienced many uncomfortable emotions. The book | when was the indian airlines flight ic427 hijacked | who was the leader of plebiscite front during the indian airlines hijacking | who was the leader of the indian airlines hijacking movement | how many hijackers were on pakistan international airlines flight 544 | what airline was involved in the hijacking of flight 961 | who hijacked xiamen airlines flight 8301 | where was the cargo door of flight 811 found | how many pilots were on pan am flight 1104 |
151 | Nice Nautical Addition to Steampunk World | Within weeks of open enrollment at the UCPE (University of Cincinnati Physics and Engineering), one of the top students has perfected the steam engine on campus. The government purchased this idea and have begun mass producing steam engine naval cruisers. Made of steel, and outfitted with balistae, these are the most innovative ships on the seas. Due to lack of people willing to work in the dangerous factory conditions at oak harbor, the government has been forced to "recruit" workers from the surrounding countryside. This will bolster the industry of Cincinnati, while we produce a brand new steam powered offensive navy.
[This is a two part event. +1 to industry right now and i will make a separate event when I launch the navy in 1 year]
Abstract:
Link to Coal post: | My game is called “Skycharters”, though I was rather close to calling it “Steam Trek”. Essentially, the PC are exploring the Fallen World via their airship, trying to make new colonies and contact other civilisations.
One of my players suggested a loot table, as they often scavenge in the wilderness. Thought that was a good idea, and I have some inklings as how to do it. However, I need stuff for the players to find.
So any ideas for loot that could exist in a steampunk post-apocalypse? I’d be especially interested in ideas for more tonics with different effects.
Thanks in advance! | Who designed the first steam powered ship? | the Maritime Museum of the Atlantic. Ertl released a number of Theodore Tugboat toys, including die-cast boats,a set of rubber boats that float, a "Press'n Roll" series of plastic boats (where pressing the smokestack then releasing it makes the boat move), and sets of glow in the dark wall decorations. BRIO released many Theodore Tugboat toys for interaction with its toy trains. Other than the tugboats, Brio released Benjamin Bridge, Clayton the Crane, Chester the Container Ship, Barrington, Bonavista, and the Dispatcher. The tugs and the Dispatcher feature moving eyes. International Playthings released the Theodore Tugboat Cargo Game. Theodore Tugboat | It's what I was looking for. I bought it for a man who had just added a deck to his house rather than for a boater. I hope he gets the humor. | I'd never really given the Hull series much of a second glance before, but just been going through the Q&A pages and honestly...I'm actually quite intrigued.
The Hull-C and above have a really nice vibe about them. I want to fly them around with no cargo, just folded up in their compact mode.
Honestly I'd really like a less specialised ship with a similar visual look, maybe something with a little more punch and a vehicle bay. But I love the landing-gear stairs, gives it an oddly Forbidden Planet vibe.
And yeah, I know, I've just basically described the Carrack.. | It is the end of an era, the old-school operations of single-screw tugboats, steam propulsion and seasoned engineers and captains grinding to a halt in an age of advanced technology. Opening the interiors of America and Canada to the world, the Great Lakes shipping industry was indomitable, hard working and relentless in carrying goods through the waterways, tugs, barges, passenger and work boats and gigantic ore boats. In this collection of over three hundred historical black and white photographs, a great past is revealed, those creaking, weighted vehicles, large and small. That braved the Greta Lakes in every weather condition, furthering the commerce of a region defined by its shipping lanes and the constant traffic of goods to the interior.
With detailed text accompanying the images, the author covers the lakers, tugboats, barges, passenger ships, fish tugs and workboats, even the decaying monsters relegated to the boneyard, all relayed with an intimate knowledge of the craft and a love of the trade, a variety of vessels designed for specific purposes, the fresh water giving steamships decades longer life than their saltwater counterparts, each built "bigger, stronger and more efficient", the wooden schooners and straight deck iron freighter all but disappeared with time. The ubiquitous tugboats are a mainstay of commercial navigation, the little-engines-that-could, from 40 ft. dredges to 150 ft. over-lake towing tugs. Summoned in the most extreme weather conditions, the tugs are invaluable, with their own particular lore. Barges are the most common commercial vessels, today's cargoes handled by fewer crew members. Early passenger boats carried people, livestock and mail, "packet freighters" that went from port to port until the 1950s. All that remains today are the excursion boats and gambling ships that appeal to the modern tourist.
Regardless of their colorful histories, all eventually end up in the boneyard, relegated to disuse and decay, only good for scrapping. This chapter emphasizes the invaluable images that remain of the Great Lakes crafts, a rapidly changing history with little time for nostalgia. Piles of rusting metal that are hazardous to the environment, a few preserved as maritime museums, most are towed to breaking yards in India, Turkey, China and Spain. This book preserves a maritime history in an era of rising industrialization, a reminder of the men and women who spent their lives on the waterways, the captains and crews of a variety of vessels, some frozen forever in the dark of watery graves, ships that ferried cargoes and people hungry for goods and services, a fascinating maritime legacy captured in black and white. Luan Gaines/ 2006. | An exploration of realist novels and short stories produced by Maritime writers in the twentieth century. | 151 | Really like this Steampunk series. The lost world of oracles is a nice addition to the nautical arena of Steampunk. Nicely developed characters. Each book has a new couple to focus on. Wanted to get a sense of what steampunk is, and I am getting that from these novellas. Good read. | This is a great book. If you like steampunk you should pick ... | Fantastic Steampunk novel with everything you can imagine! | Looking for a good Steampunk novel. | Stupid Steampunk book | A Fun Steampunk Series | Fantastic Steampunk series | Steampunk/gaslight fantasy genre | Great steampunk graphic novel |
152 | who plays jessie in gerald's game | Gerald's Game Steve Miller song, "The Joker"), saying out loud that he is "not anyone", and that he was only "made of moonlight". A combination of panic and thirst causes Jessie to hallucinate. She hears voices in her head, each ostensibly the voice of a person in her life, primarily "The Goodwife" or "Goody Burlingame" (a Puritanical version of Jessie), and Ruth Neary (an old college friend) and Nora Callighan (her ex-psychiatrist), neither of whom Jessie has spoken to in years. These voices represent different parts of her personality which help her extract a painful childhood memory she has kept suppressed for | Gerald (film) Festival, winning several awards including best actor for Louis Mandylor. The role of Gerald, a mentally challenged individual, was a departure from Louis Mandylor's earlier tough guys roles, but it is also an endearing addition to his indie film roles, such as Nick Portokalos in "My Big Fat Greek Wedding". Gerald Andrews was dropped on his head at birth. 30 years later, the man-child Gerald works at the local bowling alley and lives with his mother in a mobile home park. When his mother suddenly dies, he finds himself still needing her close, and has her ashes placed inside her | Josie Totah Josie Jay Totah (born August 5, 2001), formerly known as J. J. Totah, is an American actress. She is known for her recurring role on the Disney Channel series "Jessie" and her starring role on the 2013 ABC comedy series "Back in the Game". Totah received critical praise for her role as Justin in the 2016 film "Other People". In 2018, she starred in the short-lived NBC comedy series "Champions". Totah began her career playing male roles but publicly came out as transgender in August 2018, when she also changed her first name to Josie. Totah was born | Kathleen Cody (actress) 1975, Cody appeared in the Vincent McEveety-directed film "The Last Day", starring Richard Widmark, Barbara Rush, Tim Matheson and Robert Conrad. Cody appeared in the supporting role of Julia Johnson as Matheson's love interest. The western-genre film was released on February 15, 1975. While she had previously retired from acting, relocating from Los Angeles to Jacksonville, Florida, Cody responded to a 1987 call for local actors to appear in the Peter Bogdanovich directed film "Illegally Yours". She was cast in a minor supporting role in the film, which starred Rob Lowe, Colleen Camp, and Kenneth Mars. The film was released | Jeannine Riley Jeannine Brooke Riley (born October 1, 1940, Madera, California) is an American actress. She appeared in guest roles on numerous television series ("Route 66", "The Man from U.N.C.L.E.", "The Wild Wild West") and a few feature films such as "The Big Mouth" (1967), "Fever Heat" (1968), "The Comic" (1969) and "Electra Glide in Blue" (1973). Also made a guest appearance in an episode of "The Virginian". She may be best known for her role as Billie Jo Bradley on the first two seasons of the CBS sitcom "Petticoat Junction" (1963–1965). Riley left the series in 1965 to pursue | Billie (film) taught a man's sport from a girl, he soon notices how gifted she is and is happy to listen to her. One day, the school coach Jones, sees her running on the track, and allows her to be on the team. The town is shocked by this event, with most people feeling that it is inappropriate for a girl to be associated with athletics. Billie is unaffected by the gossips and criticism, though she feels sad over how much trouble she is causing her father, Howard. Howard is running for Mayor against Charlie Davis, and is harmed by the string | Alex Kingston 2011, Kingston was a cast member on British supernatural series "Marchlands", portraying Helen Maynard. She also guest-starred in the "Grey's Anatomy" spin-off "Private Practice" as Marla Tompkins, a psychiatrist who writes book reviews for newspapers. Kingston appeared in Friedrich Schiller's "Luise Miller" at the Donmar Warehouse in London. In early 2013, Kingston appeared in "Arrow", playing Professor Dinah Lance, the mother of Laurel and Sara Lance. In July 2013 Kingston played Lady Macbeth opposite Kenneth Branagh in "Macbeth" at Manchester International Festival. Her performance was broadcast to cinemas on 20 July as part of National Theatre Live. She reprised the | of film and television music. Wendy Melvoin Wendy Ann Melvoin (born January 26, 1964) is an American guitarist and singer-songwriter, best known for her work with Prince as part of his backing band The Revolution, and for her collaboration with Lisa Coleman as one half of the duo Wendy & Lisa. Shortly after the completion of Prince and The Revolution's 1986 album "Parade", Coleman and Melvoin left the Revolution and started their own duo, Wendy & Lisa, also known as Girl Brothers. Melvoin and Coleman also composed music for the first season of the TV series "Heroes". In September 2008, | 152 | Gerald's Game having been abandoned, was shot and killed by the police. In May 2014, "Deadline Hollywood" reported that Mike Flanagan was set to direct a film adaptation. In an interview with Rue Morgue in September 2016, Mike Flanagan said that the film adaptation would premiere on Netflix. He did not state when the film would premiere or whether Stephen King would be involved. In October 2016, Deadline reported that Carla Gugino and Bruce Greenwood will star in the film as Jessie and Gerald Burlingame. On October 17, 2016, Flanagan tweeted indicating the first day of production had begun. The film premiered | when was the movie gerald made in australia | who played gerald in the movie gerald | which actor played gerald kingsland in the 1986 film ‘castaway’ | who wrote the script for stan and ollie | who does michael steger play in 90210 | who is the actress in the movie coach | who played bobby davis in freddy vs jason | who played the title role in the 2006 film 'june r' |
153 | Should I visit my abusive dying grandmother? | I just got a phone call from a family friend who says my grandmother is in rehab after a fall. She said my mother sold all of her belongings, leaving her with only a bed and a table, and are trying to buy a house with the earnings. According to her, in 50 years, she's never seen my grandmother so depressed. She gave me the number of the rehab facility where she's recovering, but told me not to call because my mother "might do something weird." I've called someone else who is apparently involved but can't get her to talk to me.
My question for you wonderful readers is this: if I call elder abuse, are they required to investigate immediately? Should I just fly out to her and see what's happening with my own eyes, which is my plan next week? Any advice would be so appreciated! Thank you in advance. | I just had a phonecall from my mother a few hours ago and she told me that my grandmother suddenly fell ill with pneumonia and some other stuff. She's been ill ever since her husband passed away from lungcancer about half a year ago . I wasn't really close with her after I grew up but when me and my brother were younger and went to their house we would get all kinds of candy, money, food etc. When I became older, I found out they were alcoholics and that was the reason why we stopped visiting them.
Anyway, the thing is.. I don't know how much time she has left and I haven't seen her in about a year, but I don't feel sad about her dying. I mean, I'll miss her, but it's been kind of expected since she's had a rough life and she's almost 80 right now. Is this because I've accepted the fact that she won't be around forever or am I just emotionless? | I am 18 and I think my grandmother is better off dead.
She has had Alzheimers for a long time now, and doesn't recognize anyone or anything, and she hates living in her nursing home. I drove up to visit her last week and she didn't know who I was and ask me to leave. She is miserable. She is clueless and is basically just a walking shell that sits on her bed all day doing nothing. Infact, she was on Dr. Phil some time ago because she thought she saw ghost children everywhere. The show totally exploited her for their entertainment and ratings. She is really ill, and the "psychic" told her all this bullshit. It was painful. Am I wrong to think this? | our dad died three months ago, then my grandpa died 2 weeks ago, so we are both struggling. she wanted me to come visit, so we could help each other out, but her ex-husband is threatening to go to court if i go as stay with her and the kids. I would obviously provide for myself. | Relative tried to kill me.
She ended up leaving my family home because staying there any longer would raise suspicion on my end and even ours.
I’m watching her until I can get a lawyer and call law enforcement to make a report. I can’t do it NOW because I’m a “caregiver” to my elderly mother who’s bedridden.
I believe she tried to say my my death was accident but at the same time she had plans to kill me. I believe she planned on doing the same thing she did to her husband. Many police officers showed up 3 years ago and were suspicious they didn’t find anything, and I said it was a wrongful death what she did, again
Anything I can do or gather before something happens to me or my family until I can get help? I know she left but it doesn’t mean she didn’t plan. | I went to visit my grandma today and she said that she has been feeling weird and feels like she is going to die. I am going away to college at the end of the week, but after what she said I can’t help but feel guilty about leaving, and I began thinking, what if she dies while I’m not here. What should I do? | My grandma was abusing my grandpa. He had m.s. for about 40-50 years when he died. She resented taking care of him and would hit him . . . Or worse.
A couple days before his fatal stroke she was almost arrested for domestic violence. Me, my bio dad, and my aunt all knew it was happening. And we did nothing.
Basically she killed him. He lived for years with her.
And I feel a lot of guilt over it. And I should have stopped it. Should have gotten him out. Should have saved him. And I didn't. | My grandmother had been battling mantle cell lymphoma for three months, on a slow spiral downwards; she slept most of every day because of the strong pain medication. I spent every weekday evening at the hospital, but had to catch up on studying Friday so I didn't go up there then. My father told me that she had a good day again on Friday. I didn't go see her on Saturday because I was "too tired" from spending the day with my younger sister. I had every intention of going to see my grandma Sunday morning; she died early Sunday morning while I was still asleep. I doubt I'll ever be able to forgive myself for wasting my chance to say goodbye. | 153 | On mobile and English isn't my first language.
also a first time poster.
Tldr:
Abusive grandmother is dying, should I go visit her and my grandfather that I blame for my father slight abusiveness?
Storytime!
My father was severely abused his entire childhood. I (24f) know that my grandfather even broke my father's arm and at some point my father ran from home and moved in with my mother's parents.
Many years and many events later, they apologized to my father and my father forgave them, as I was told.
But my father in turn became an abusive man. Though not nearly as bad as my grandparents and I think in many of the FEW instances he exploded, my mom took the hit. The only instances I remember were when he hit my brother who than had a bloody nose. Him pushing me to the ground and kicking me (not sure if this actually happened or that my young brain made this up for some reason...) Him throwing water at me and than the glass as well (he threw the glass towards my stomach, not my head)
For some reasons I don't have many memories of my childhood, either good or bad. What I do remember is being scared of my father, wishing other dad's were actually my dad and thinking if my dad were to die in an accident, I'd be sad, but my life would be better for it. I also cried when my mom left for work and I remember never wanting to move out because I didn't want my mom to be alone with him, listening in to them fighting in case I had to jump in and my mom having an escape plan ready. Keep in mind that I was a child when these thoughts processes happened.
My relationship with my dad is complicated, but I'm on good terms with him right now. However, I haven't seen his parents in years, though I accepted their call on my birthday. I mostly blame them for how my father has treated us. My grandmother had a sister, who is the complete opposite of her, why couldn't she be like her sister? Why did she abuse her children together with her husband? I don't hate her, but I do blame her.
To my actual problem: grandmother is dying and my father asked me if I wanted to go visit her. I don't know if I should or shouldn't go and I would like some advice to what others would do. Should I just suck my issues up and go? I'm young (24f), I'm not the wisest. Will I regret going? What would I even talk about with them if I went? Will I regret not going? If I don't go, would that hurt my dad? How should I even bring it if I don't go. | My Uncle verbally abuses my elderly grandfather and it infuriates me. What should I do? | I feel wrong about how im dealing with my mothers death | How do I cope with the insane grief coming out he caused for my parents? | Was I abused by my father? | Should I visit my abusive (but not towards me) dying grandmother that I haven't seen in years? | Thoughts about fighting with my mom, about my dad and lack of a real family. | im just 20 and live at home with my mum and step dad and brother. the last 4 months have been hell, for no reason he wont talk to me and looks at me horrible all the time and intimidates me alot. he is paralysed and doesnt speak to his own daughter who is younger than me, is he bitter? we got on great by the way for 6 years and suddenly without me doing anything to piss him off.making me soo upset. what can i do (and he is the kind of the guy you cant talk!) and now i dont really talk to my mum. pls advice, so distressing when i have an amazing dad all the way across the world. :( | Any advice for me and my mum when we finally leave my abusive dad? |
154 | Purposefully getting a Master's degree in a seperate major? | Is it hard to get a job with master's degree? | I'm a sophomore in liberal studies and I'm planning on majoring in psych at CAS, but I've realized that I can finish the requirements for my psych major in the next two semesters, leaving me with 3 semesters empty. I want to double major, but I want the second major to be something that can help me get a job before I move on to grad school. I was told that the best majors to do that would be math-related majors or something in compsci, but I've taken compsci and I wasn't very good at it. I've heard that economics is a good way to go, but I don't know. What do you guys think? Also, since I'm doing an internal transfer and I'm currently finishing liberal studies, does that mean I'm done with core requirements after I transfer? I don't have to take any general CAS courses when I transfer, right?
EDIT: I'm seeing people recommending business. I can't major in business because CAS doesn't allow cross school majors, but I can minor in business studies, which I recently found out, funnily enough, requires some intro to econ classes. So I've decided to take intro to micro next semester to see how I like it. What's your guys' experience with minors? Have they helped you? Would a Business studies minor be useful in finding jobs? (thinking of making this a separate post) | If one of your majors is a science major and the other is an arts. What degree do you graduate with? Bachelor of science right? | Once you get accepted for an MBA is it possible to try and convert that into a dual degree? Is that easier than applying straight out for a dual degree? I would be trying to combine with MPP. | Hi,
I'm joining for PhD next semester and I will be graduating from my Master's program this month. I was wondering if people generally transfer credits from Master's to PhD programs and if it's possible.
I know I can contact my department to ask about this, I wanted a general consensus about it. Is it common? Does it help you bypass the coursework?
Edit: Both programs are in the US.
Thanks! | I am about to graduate and have a job. I was wondering if my employer pays for a masters, is it worth doing? The cost for me would be the time after work of taking 1 class.
I plan to hold a software engineering or maybe management job for the rest of my life | Do you need a bachelor's degree before getting a masters? | Hello, I am in a but of a strange spot, might be a silly question.
I want to do a double major along with CS because I like math, but at the same time I feel like all that time I spend on school work because of increased classes would detract from time I spend on projects/applying/Leetcoding.
Is this a valid concern? Or should I just do what I want. Would love input from people doing similar things or advice in general from anyone lol. | 154 | I'm currently pursuing an undergraduate degree in Mechanical Engineering with plans to go back to school for Master's after I graduate. But the thing is that I'm highly interested in both Mechanical and Electrical and was considering getting a Master's in that instead of Mechanical. Is there anything particularly wrong with this idea? | Having multiple master degrees? | Would it be immediately useful to pursue a master's degree in electrical engineering? | Do top grad schools care if you have a bachelor’s in mechanical engineering instead of aerospace? Is your chance of acceptance ultimately down to your research? | Get a master's degree or accept return offer? | Does it matter if I don't have my masters | Is masters degree worth it | Should I pursue a Master of Science in Engineering in Software Engineering/Computer Science if I plan to move and live abroad after graduating? | Should I go for 2 college diplomas, one in mechanical engineering and the other in electrical engineering OR would I be better off going to a university to get a bachelor's in one of them in order to get a career in robotics? |
155 | Live oak saplings survive prescribed fire and sprout | SYNOPSIS The desired attributes of tree species grown for fuelwood are discussed. Such trees should be well suited to the climate and soil of the area, cheap and easy to establish, fast growing, amenable to management in woodlots, capable of regenerating naturally and should yield firewood with good burning properties. Tab-ularised information is given about species recommended for fuelwood production in South Africa. | Prescribed burning is part of Land and Resource Management Plans on National Forest System lands throughout the southeastern United States, and is sometimes implemented to achieve a desired future condition of oak-dominated forest or woodland habitat. However, effects of burning on oak (Quercus spp.) competitors, such as red maple (Acer rubrum L.) are not well understood. | Effects of prescribed fire and thinning on tree recruitment patterns in central hardwood forests | Redwood National and State Parks and allows a more fertile and natural ecosystem. Fire is also used to protect prairie grasslands and to keep out forest encroachment, ensuring sufficient rangeland for elk and deer. The oak forest regions also benefit from controlled burns, as Douglas fir would otherwise eventually take over and decrease biodiversity. The use of fire in old-growth redwood zones reduces dead and decaying material, and lessens the mortality of larger redwoods by eliminating competing vegetation. In the park, a fire management plan monitors all fires, weather patterns and the fuel load (dead and decaying plant material). This fuel load is removed from | Abstract Not Available – First paragraph follows: ::: Live oak—Quercus wislizenii—sprouts that develop after burning or bulldozing make conversion of a site to grass a difficult task. | Fire is a major disturbance agent in North American forests. Fires injure trees when heat transfer through the bark partially kills the cambium and the compartmentalization process results in a fire scar. Dendrochronologists use these scars in the xylem to reconstruct fire regimes. However, little information exists on the wood anatomy of fire scars. Consequently, this study quantifies changes in xylem (tracheid and ray traits) caused by fire-induced wounding in 2 individuals each of Larix occidentalis, Pseudotsuga menziesii and Pinus ponderosa. Transverse and tangential microsections were cut from samples for light microscopy. Using image analysis, anatomical measurements of cells are being performed three-dimensionally: at 4 heights along the tree axis, within 4 cm from the wound margin and in 5 different rings; 1 control ring and 4 rings after the injury. These results will contribute to understanding the effects of fire on wood formation and improve fire histories in conifers. | ABSTRACT: The sustainability of eastern oak-dominated forests is threatened by high oak mortality rates and widespread oak regeneration failure, and presents a challenge to natural area managers. We tracked the rate and cause of mortality of 287 mature oak trees of five species for 15 years to determine the temporal patterns and sources of mortality. We observed a 15.3% total mortality rate during the study period. Mortality was due to oak decline (7.3% of trees) and high-intensity wind events (6.6% of trees). Decline-related mortality was gradual, averaging 0.5% annually. Windthrow was episodic, occurring during hurricane-related weather events in 1995 and 2004. Within species, total mortality was disproportionately high for scarlet oak (Quercus coccinea Muenchh) (41.2%) compared to other species in the red oak group (13.8% for northern red oak (Q. rubra L.); 12.5% for black oak (Q. velutina Lam.)) or the white oak group (10.4% for white oak (Q. alba L.); 5.7% for chestnut oak (Q. prinus L.)). Decline-re... | Are there any dangerous elements when traveling in the coniferous forest? | 155 | Prescribed Fire Effects on Deciduous Oak Woodland Stand Structure, Northern Diablo Range, California | A Comparison of Stand Structure and Fire History in Two Black Oak Woodlands in Northwestern Indiana | The effect of prescribed fire on gap fraction in an oak forest understory on the Cumberland Plateau1,2 | Prescribed fire use may be effective for increasing fire resilience in young coniferous forests by reducing surface fuels, modifying overstory stand structure, and promoting development of large trees of fire resistant species. Questions remain, however, about when and how to reintroduce fire in regenerated forests, and to what end. We studied the effects of spring prescribed fires on stand structure and canopy fuel properties in 25- to 34-year old ponderosa pine forest that was planted following the Entiat wildfire in 1970. Six adjacent units were ignited over the course of four days within a 256-acre, south-facing management unit in the Preston Creek drainage, near Entiat, Washington. Fire effects were assessed on a grid of 264 small (0.014 acre) plots, of which 219 (83%) contained at least one tree. Fires reduced mean tree density from 426 to 280 trees per acre and reduced mean stand basal area from 47 to 38 ft 2 /acre. Fires also modified canopy fuels, raising mean canopy base heights from 1.0 to 6.3 feet and reducing canopy bulk density from 0.0064 to 0.0061 lbs/ft 3 . Fire behavior and fire effects were heterogeneous within treatment units, however, and local fire severity was positively correlated with local stand basal area. Tree mortality probabilities declined with increasing tree diameter for all species. For any given diameter, however, mortality probabilities increased with local stand basal area, probably due to higher fuels and local fire intensity. At the median basal area (37 ft 2 /acre), fires killed mostly small trees (dbh < 2 inches). In more dense stands, fires also killed larger trees (dbh up to 5-6 inches). Mortality rates varied little among species except for larger trees in patches with high basal area, where survival rates were higher for ponderosa pines than for Douglas-firs and other conifer species. Overall, prescribed fires were effective for thinning stands from below, raising canopy base heights, and, to some extent, favoring ponderosa pine over Douglas-fir and lodgepole pine. Additional fires (and possibly some mechanical thinning) may be needed, however, to maintain low surface fuel loads, further modify canopy fuels, and further increase forest resilience to future wildfires. | Effects of fire on forest dynamics in southern Switzerland | Grazing and Overstory Effects on Rotationally Burned Slash Pine Plantation Ranges | Postfire plantation results and pattern of natural revegetation process were monitored for six years after wildfire in the artificial Pinus brutia forest of the suburban park of Thessaloniki, northern Greece. Some flood-preventing treatments and plantings took place on half of the burned area immediately after the fire, while the rest of the burned area was left to regenerate naturally. Based on the survival rate and growth of the planted species, the establishment of plantations was considered satisfactory six years after the fire. The pattern of postfire regeneration of Pinus brutia was similar in both planted and non-planted areas, although the saplings’ density was significantly higher in the non-planted areas (4,145 saplings per hectare compared to 1,841 saplings per hectare in the planted burned areas). The former saplings’ density can secure the species dominance in future stands, that means an auto-succession pattern ensues in this case, while the lower saplings’ density of P. brutia in the planted areas, does not secure species dominance in future stands. This suggests that a mixed forest will be established in this case as a result of the plantings and pine natural regeneration. In both cases the sprouted shrubs Quercus coccifera and Phillyrea latifolia will accompany the stand structure appearing in the shrub story. | Fire on the Mountain: A Forest Fire Ignored? | Mitigating fire risk to late-successional forest reserves on the east slope of the Washington Cascade Range, USA |
156 | what surrounded the big bang singularity before it banged? | What occurred soon after it happened the big bang? | What isthe story behind the big bang? | Initial singularity The initial singularity was a singularity of seemingly infinite density thought to have contained all of the mass and space-time of the Universe before quantum fluctuations caused it to rapidly expand in the Big Bang and subsequent inflation, creating the present-day Universe. The initial singularity is part of the Planck epoch, the earliest period of time in the history of the universe. General relativity is used to predict that at the beginning of the Universe, a body containing all mass, energy, and spacetime in the Universe would be compressed to an infinitely dense point. The use of only | How long did it take for the universe big bang? | I was browsing some forums when I bumped into some talk about the big bang, where they were mentioning singularities etc and it got me thinking.
What if the singularity the universe expanded from after the big bang was a black hole in an even larger universe, and the reason the universe is expanding is because our black hole is eating up matter from another universe. That would explain the reason it's expanding so quickly. and maybe even have some room in there to explain dark matter/ energy.
Now, Since I know nothing about physics beyond A level, can someone tell me why I'm wrong or at least where my flaws in thinking are. | Who explained the universe began and what black holes are? | The beginnings of the universe was a point of infinite energy-density. So, how could any conditions exist in a point of infinite density?? If it had a volume at all, A point of infinite energy-density would be homogeneous throughout because of the enormous density, so how could any variations/distinctions exist in that state?? I would understand how initial conditions could exist in a later universe where fluctuations etc., existed but not at the Singularity or thereabouts?? We cannot comprehend the state called The Singularity much less posit that somehow it gave rise to initial conditions.
I’m referring to the first instant after t=0, I know that we could get into problems actually giving a value to that because if we keep inching closer to t=0, it could take forever and we would be in a convergent infinity, getting closer to t=0, but never reaching it?? And if the initial conditions were not present at t=0, or thereabouts then when did they come into being??
If the initial conditions existed before the Big Bang in another universe, wouldn’t they be wiped out by the Big Bang Singularity?? ~ Jaime Tan | Was there a time before the Big Bang where there was simply nothing? No planets, no stars, solar systems etc. Would there have just been one big void? | 156 | What was around the singularity concurrent to it being a singularity and did that singularity emit or did it suck. And, can such a singularity exist in our current universe waiting to bang | what was the initial singularity in the universe | The Big Bang or something else? | Singularity in nearer than we think. | When do you think the Singularity will occur and why? | I wonder how initial conditions could arise out of the Big Bang Singularity | Experiences involving black holes, or the Big Bang? | Reflections on the Singularity Journey | I gots a theory about Singular point. |
157 | In vivo and ex vivo needle-based confocal endomicroscopy of intraductal papillary mucinous neoplasm of the pancreas. | A Review of Probe-Based Confocal Laser Endomicroscopy for Pancreaticobiliary Disease | The 2012 International Consensus Guidelines of Intraductal Papillary Mucinous Neoplasms of the Pancreas (Fukuoka Criteria) Predict the Malignant Potential, Even in Actual Clinical Situations | Prognosis of malignant intraductal papillary mucinous tumours of the pancreas after surgical resection. Comparison with pancreatic ductal adenocarcinoma. | Endoscopic ultrasound (EUS)-guided needle-based confocal laser endomicroscopy (nCLE) is a new technique, which enables a real-time in vivo histopathology evaluation during EUS. Recently, nCLE used in the assessment of pancreatic cysts 1 2 . Solid pseudopapillary neoplasm (SPN) is rare, accounting for 1-2% of all pancreatic tumors 3 . We herein report the first case that shows a typical nCLE image of SPN. This article is protected by copyright. All rights reserved. | A 71-year-old male suffering from an intraductal papillary tumor of the pancreas was admitted to our hospital for further investigation. Diagnostic trials, including endoscopic retrograde pancreatography, did not produce an adequate ductography because of a large amount of mucinous fluid. Therefore, we performed endoscopic ultrasonographic-guided punctured pancreatic ductography (EPPD). This procedure was safely performed without any complications. We report this initial and successful trial of EPPD. | Fibrous Extracellular Spheroids in an Endoscopic Ultrasound-Guided Pancreatic Fine Needle Aspiration Correlating to a Gyriform Pancreatic Endocrine Tumor with a Unique Cobblestone Pavement Growth Pattern | Intraductal growth of nonfunctioning endocrine tumors of the pancreas may be very rare, and our survey of literature shows only two cases have been described. We report a case of a 43-year-old man with a nonfunctioning endocrine tumor of the pancreas that uniquely grew within the lumen of the main pancreatic duct (MPD) without ductal involvement and completely obstructed the MPD. Endoscopic ultrasonography (EUS) and endoscopic retrograde cholangiopancreatography (ERCP) were very helpful to delineate the intraductal growth of the tumor and to determine the resection line of the pancreas. A nonfunctioning pancreatic endocrine tumor is important to consider on differential diagnoses when complete obstruction of the MPD is demonstrated on ERCP. It is speculated that the tumor originated from precursor cells of the pancreatic duct or islet cells adjacent to the MPD and slowly proliferated within the lumen of the MPD. | Endoscopic ultrasound (EUS) has evolved from being primarily a diagnostic modality into an interventional endoscopic tool for the management of both benign and malignant gastrointestinal illnesses. EUS-guided therapy has garnered particular interest as a minimally invasive approach for the treatment of pancreatic cancer, a disease often complicated by its aggressive course and poor survival. The potential advantage of an EUS-guided approach revolves around real-time imaging for targeted therapy of a difficult to reach organ. In this review, we focus on EUS-guided therapies for pancreatic neoplasms. | 157 | Validation of diagnostic characteristics of needle based confocal laser endomicroscopy in differentiation of pancreatic cystic lesions | Confocal laser endomicroscopy, Current indications and future perspectives in gastrointestinal diseases | Novel method of diagnosing solid pseudopapillary neoplasms of the pancreas: Needle‐based confocal laser endomicroscopy | While flexible endoscopy is essential for macroscopic evaluation, confocal laser endomicroscopy (CLE) has recently emerged as an endoscopic method enabling visualization at a cellular level. Two systems are currently available, one based on miniprobes that can be inserted Core tip: Confocal laser endomicroscopy (CLE) enables cellular visualization during on-going endoscopy. Lately, the method has been further refined by using fluorescent labelled molecular probes for estimation of receptors in carcinomas, illumination of subtle lesions and assessment of the affinity of drugs to specific lesions. This article presents the method of molecular CLE and gives a review of the current applications and drawbacks. WJG 20 th Anniversary Special Issues (13): Gastrointestinal endoscopy TOPIC HIGHLIGHT Karstensen JG, Klausen PH, Saftoiu A, Vilmann P. Molecular confocal laser endomicroscopy: A novel technique for in vivo cellular characterization of gastrointestinal lesions. World J Gastroenterol 2014; 20(24): 7794-7800 Available from: URL: | Confocal laser endomicroscopy of the colon. | Optical biopsy of bladder cancer using confocal laser endomicroscopy | Probe-based confocal laser endomicroscopy of the duodenal mucosa with fluorescein dispersion | Citation: Takahashi, K.; Yasuda, I.; Hanaoka, T.; Hayashi, Y.; Araki, Y.; Motoo, I.; Kajiura, S.; Ando, T.; Fujinami, H.; Tajiri, K.; et al. Diagnostic Fine-Needle Biopsy of Small Solid Pancreatic Lesions Using a Franseen Needle during Endoscopic Ultrasound Examination. Diagnostics 2021, 11, 27. https://dx. | Diagnostic Efficacy of Cell Block Immunohistochemistry, Smear Cytology, and Liquid-Based Cytology in Endoscopic Ultrasound-Guided Fine-Needle Aspiration of Pancreatic Lesions: A Single-Institution Experience |
158 | Actually better than my old one | Was exactly as stated. Much better than the original one I had before | Compared this to the old one we had and the quality of this one was obviously far superior. And my wife loves it. | I have a much older one, which is better quality. It was ordered from a different company. | I had to replace the old one after approximately 3 years, this one is better because of the hot water and the option for the ladies | This is a replacement for one which died but after 9 years so not bad. | I just replaced the old one without problems. This one is working very good. | Great, well made replacement. Better than the original. | I had bought this for my girlfriend to replace an old one she had. I was very impressed with the quality and overall look of it. My girlfriend loves it! Only thing i can really say bad about it is that the top lid doesnt sit back very far but that was easily fixed when i bent it back a little bit. | 158 | It worked well for what I needed it for. Actually better than my old one. | It works great, exactly what I needed it for | Worked great for what I needed it for | It works fine for what I needed | It worked great for what it was bought for | It does a good job for what I wanted it for | It worked for what I needed it for, but ... | Great it works for what i needed it for i ... | It worked great for what we needed it for |
159 | Proteomic analysis of changes in pea roots caused by the apoptosis-inducing concentration of salicylic acid | The effects of exogenous spermidine on anti-oxidative enzyme activities,contents of proline and soluble protein and root vigor in roots of rice cultivars(Pokkali,salt-tolerant and Peta,salt-sensitive) under salt stress were studied in this paper.The results showed that the activities of SOD,POD and CAT and contents of proline in roots of two rice cultivars with exogenous spermidine treatment under salt stress were increased,while the O2-· producing rate and contents of MDA were decreased.Moreover,the decline of contents of soluble protein and root vigor in roots of rice cultivars was alleviated by exogenous spermidine treatment.These results suggested that exogenous spermidine could alleviate the injury of NaCl stress in roots of rice cultivars.Moreover,the alleviation effect of exogenous Spd in roots of salt-tolerant was less than that of salt-sensitive Peta under salt stress. | A key factor of immunity, salicylic acid (exogenous or accumulating under the action of biotrophic or semibiotrophic pathogens on plants), causes the formation of not only protective antipathogenic proteins but also many proteins, which enhance the resistance of host plant cells. Salicylate-induced proteins, which are encoded by nuclear genes and formed with cytoplasmic ribosomes, function in the cytosol or are transported into nuclei, vacuoles, plastids, mitochondria, and outside the plasmalemma. This review is focused on salicylate-induced proteins, which are not only delivered into different compartments but are also involved in their transmembrane transport. |
Introduction
Salicylic acid and its derivatives as one of the plant hormones produced by the plant naturally belongs to the group of phenolic acids and consists of a ring linked to the group of hydroxyl and carboxyl group, and the starting ingredient to form is the cinnamic acid (Figure 1). It is mainly manufactured within the plant in cytoplasmic cell. This acid was first discovered in Salix spp., which contains the salicin compound by 9.5-11% and is present in the plant in the form of free phenolic acids or associated with amino compounds [1]. Symbolized by the symbol SA called chemical ortha hydroxyl benzoic acid chemical formula is C 7 H 6 O 3 [2].
Salicylic acid plays an important role in the growth and development of the plant for important physiological roles such as increasing the plant's response to stress conditions (biotic and abiotic) by increasing the resistance of the plant to System Acquired Resistance (SAR) by stimulating or changing the internal paper dissection endogenous signaling to withstand a large number of stresses. Salicylic acid acts as a stimulant or transmitter of the cell to withstand environmental stress conditions such as dryness, coldness, heat, stress of heavy elements, and conditions of ammonia tension and also increases the plant's ability to withstand salt stress salt particularly harmful sodium chloride compound NaCl [3].
It also has the ability to bind conjugate with some amino acids such as proline and arginine, which increase the plant's effectiveness in resisting environmental stresses and at the same time maintain systemic acquired resistance [4].
The most important effects of salicylic acid are to stimulate the production of antioxidants. Antioxidant against the effect of free radicals from the group Reactive Oxygen species (ROS) when exposed to heat stress and stress Drought stress and prevents the oxidation of algebraic and oxytin and cytokinein and also has a role at the genetic level. It stimulates the genes of antioxidant enzymes such as manganese superoxide dismutase (Masud) [5].
Salicylic acid increases the plant's response to tolerance and resistance to various diseases affecting plants as it is found that increasing its internal concentration activates the protective role of pathogenic pathogens [6]. The SA also has many important physiological roles, such as stimulating the flowering, ion absorption, nutrient transfer, increasing the representation of CO 2 gas, controlling the movement of stomata, photo materials, gas exchange, and protein synthesis. It also contributes to increasing the percentage of nucleic acids and amino acids and the accumulation of dry matter and speeds up the formation of various plant dyes and increasing their levels such as chlorophyll and carotene and prevents the representation of ethylene gas, and it is contrary to the work of ABA responsible for the fall of leaves. It also plays an important role in increasing metabolic rates, which contributes to the energy saving of the plant through alternative pathways accompanied by a change in the level of nucleic and amino acids within the plant [7].
Effect of salicylic acid in growth and yield
De Kock et al. [8] were the first to talk about the role of salicylic acid as a growth regulator during the past two decades, after which the interest in this compound has increased, and many studies have been conducted that showed a relationship between salicylic acid and the growth and development of plants. Among these studies is the finding of the cotton plant Gossypium hirsutum L., which belongs to the Malvaceae family in three levels of salicylic acid (50, 100, and 150) mg/l had it. The highest rate of the studied traits was the plant height (143.80) cm, the number of branches (34.28 branches), and the total cotton yield (3371.9) kg/Ha in relation to other concentrations used [9]. Najafian [10] concluded that Rosmarinus officinalis L. spraying with three levels of salicylic acid (450, 300, and 150) mg/l resulted in a significant increase in growth rates and photosynthesis compared to untreated plants. The increase was more pronounced when spraying plants with a concentration of 300 Mg.
Najafian [11] found that spraying SA acid at three levels (150, 300, and 450) mMol on Thymus vulgaris L. had a significant effect on the studied traits. Spraying at a concentration of 150 mM gave an increase in the dry weight of the vegetative total and photosynthesis and increased plant tolerance for salt stress conditions.
In a study on the response of the Indian mustard Brassica juncea L. to spraying with two levels of salicylic acid (35 and 70 mg), there was a significant superiority in all vegetative traits studied (plant height, number of branches, and leaf area). In addition, there was a significant increase in all the parameters of the crop (the weight of one mustard, the total yield of the seed, and the seed yield), when spraying the plants at a concentration of 70 mg/l in comparison with the concentration of 35 mg/l and spraying with distilled water only [12]. In a study conducted in Pakistan on the Abelmoschus esculentus L., which belongs to the marsh family, [13] found that salicylic acid spraying with concentrations of 50 and 75 mg/l had a significant effect on most studied traits. The effect of spraying was 50 mg/l is more pronounced in increasing vegetative growth rates and leaf content than chlorophyll.
Abbas and Ibrahim reported [14] that the growth regulator SA was sprayed on Niggella sativa L. at several levels (50, 100, and 200) mg/l with significant effect on the studied traits. And 200 mg/l. Spraying at a concentration of 50 mg/l was the best in increasing growth, yield, and oil ratio indices.
Al-Mohammadi and Al-Rawi also [15] observed a study on the effect of spraying on some of the growth catalysts on Datura stramonium L. The spraying with acetylsalicylic acid at 200 ppm gave the highest rate of all vegetative and studied traits (plant height, dry and vegetative content of the leaves, nitrogen and potassium, number of fruits, plant and the total yield kg/hectare) compared to non-treated plants.
Effect of salicylic acid in qualitative and medical qualities
The significant phylogenetic effects reflected by the salicylic acid act towards the growth and development of the plant and the improvement of its health made it a popular vehicle for those interested in agricultural production. This has already been shown to improve the qualities of many plants that occupy a high economic position. It also activates the roles of many enzymes and also has an important action towards syphilis and the bio-synthesis of ethylene gas (the maturation hormone and aging) and the movement of stomata and contributes to plant metabolism and transfer of ions [16,17].
Through research and studies on the effect of salicylic acid treatment on the specific qualities of plants, Gharib [18] noted that the spray of the basil plants Ocimum basilicum L. and the Majorana hortensi L. were planted in a 40 cm pot with three concentrations of salicylic acid [10 −3 , 10 −4 , 10 −5 ] mole resulted in a significant increase in the ratio of the active ingredient of both plants compared to the comparison treatment. The spraying of two varieties of Cymbopogon flexuous L. with a concentration of 5-10 m of salicylic acid developing in the plants gave a significant increase in the specific qualities and active substances of plants and antioxidants compared to non-treated plants [19].
Khandaker et al. showed [20] that spray of red Amaranthus tricolor L. plants with three concentrations of salicylic acid (10 −3 , 10 −4 , and 10 −5 mm) had the most significant effect on plant active compounds compared to untreated plants and significant increase in properties (total phenols, antioxidant, and plant pigments). Salicylic acid spraying with concentrations (25 and 50 mg/l) on the vegetative group of Cumin cyminum L. resulted in a significant increase in the percentage of plant pigments at a concentration of 50 mg/l compared to comparison plants [21].
The addition of salicylic acid with three concentrations (30, 60, and 90 mg/l) resulted in a significant increase in the production of some plant antioxidants from blackwheat leaves when treated with concentrations of 60 and 90 mg/l compared with non-treated plants [22].
Majoul showed [23] a significant increase in the percentage of nutrients P, N, and the leaf content of chlorophyll when spraying the okra plants were measured at two levels of salicylic acid (78 and 155 mg/l) and in two steps compared to the comparison treatment.
The medicinal seeds of the Digitalis trojanaivanina collected from the Turkish Aida mountains with three concentrations of salicylic acid resulted in significant superiority in the studied active substances (pigment content, total phenols, phenols, and flavonoids) compared to non-treated plants [24].
Figure 1 .
1Chemical structure of SA acid. Review on the Role of Salicylic Acid in Plants DOI: http://dx.doi.org/10.5772/intechopen.89107
T. Effect of salicylic acid and salinity in rosemary (Rosmarinus officinalis L.): Investigation on changes in gas exchange, water relations, and membrane stabilization. Advances in Environmental Biology. 2009;3(3):322-328. Iran [11] Najafian S, Khoshkhui M, Tavallali V, Saharkhiz MJ. Effect of salicylic acid and salinity in thyme (Thymus vulgaris L.): Investigation on changes in gas exchange, water relations, and membrane stabilization and biomass accumulation. Australian Journal of Basic and Applied Sciences. 2009;3(3):2620-2626 [12] Dugogi EH, Mahdi NK, Matroud SAK. Response of Indian mustard (Brassica juncea L.) to the distance of planting and spraying with salicylic acid and their effect on growth, seed yield and hard oil. In: Second Scientific Conference of the Faculty of Agriculture, University of Karbala; 2012. pp. 173-181. The Republic of Iraq [13] Raza SH, Shafiq F, Khan I. Seed invigoration with water, ascorbic and salicylic acid stimulates development and biochemical characters of okra (Ablemoschus esculentus) under normal and saline conditions. International Journal of Agriculture and Biology. Faisalabad University. 2013;15:486-492. Pakistan [14] Abbas J, Ibrahim BA. Effect of salicylic acid in some vegetative and fruit traits of the black bean. Iraqi Journal of Agricultural Sciences. 2014;45(8):845-853. (Special number) The Republic of Iraq
5Review on the Role of Salicylic Acid in Plants DOI: http://dx.doi.org/10.5772/intechopen.89107
Magical mystery tour: Salicylic acid signaling. Environmental and Experimental Botany. M Janda, E Ruelland, In PressJanda M, Ruelland E. Magical mystery tour: Salicylic acid signaling. Environmental and Experimental Botany. 2014. In Press
Salicylic acid-mediated abiotic stress tolerance. M Pál, G Szalai, V G Kovács, O K Janda, Salicylic Acid. Hayat S, Ahmad A, Alyemeni MNNetherlandsSpringerPál M, Szalai G, Kovács VG, Janda OK. Salicylic acid-mediated abiotic stress tolerance. In: Hayat S, Ahmad A, Alyemeni MN, editors. Salicylic Acid. Netherlands: Springer; 2013. pp. 183-247
Exogenous application of salicylic acid and nitric oxide on the ionic contents and enzymatic activities in NaCl-stressed soybean plants. M Simaei, R A Khavari-Nejad, F Bernard, Simaei M, Khavari-Nejad RA, Bernard F. Exogenous application of salicylic acid and nitric oxide on the ionic contents and enzymatic activities in NaCl-stressed soybean plants.
. American Journal of Plant Sciences. 3American Journal of Plant Sciences. 2012;3:1495-1503
Effect of drought stress and its interaction with as corbate and salicylic acid on okra (Hibiscus esculents L.) ruination and seedling growth. A Baghizadeh, M Hajmohammadrezaei, Journal of Stress Physiology & Biochemistry. 71Baghizadeh A, Hajmo- hammadrezaei M. Effect of drought stress and its interaction with as corbate and salicylic acid on okra (Hibiscus esculents L.) ruination and seedling growth. Journal of Stress Physiology & Biochemistry. 2011;7(1):55-65
Induction of a biotic stress tolerance by salicylic acid signaling. E Horvath, G Szalai, T Janda, Journal of Plant Growth Regulation. 263Horvath E, Szalai G, Janda T. Induction of a biotic stress tolerance by salicylic acid signaling. Journal of Plant Growth Regulation. 2007;26(3):290-300
Salicylic acid signaling in disease resistance. D Kumar, Plant Science. 228Kumar D. Salicylic acid signaling in disease resistance. Plant Science. 2014;228:127-134
The plant hormones: Their nature, occurrence and function. P J Davies, Plant Hormones: Biosynthesis, Signal Transduction, Action. Davies PJDordrechtKluwer Academic Publishers3rd edDavies PJ. The plant hormones: Their nature, occurrence and function. In: Davies PJ, editor. Plant Hormones: Biosynthesis, Signal Transduction, Action. 3rd ed. Dordrecht: Kluwer Academic Publishers; 2004. pp. 1-15
The effect of salicylic acid on the growth of Lemna gibba L. P C De Kock, F B Grabowsky, A M Innes, Annals of Botany. 38De Kock PC, Grabowsky FB, Innes AM. The effect of salicylic acid on the growth of Lemna gibba L. Annals of Botany. 1974;38:903-908
. Ant Al-Rawi, M H Al-Ani, Al-Saad Tm, Response of cottonAl-Rawi ANT, Al-Ani MH, Al-Saad TM. Response of cotton
Effect of planting date, growth promoters, type of organic manure on growth and yield, and active ingredient of Datura stramonium L. A N Al-Mohammadi, Al-Rawi Ar, Tikrit Journal for Agricultural Sciences. 162The Republic of IraqAl-Mohammadi AN, Al-Rawi AR. Effect of planting date, growth promoters, type of organic manure on growth and yield, and active ingredient of Datura stramonium L. Tikrit Journal for Agricultural Sciences. 2016;16(2):26- 50. The Republic of Iraq
Effect of Salicylic Acid on Solute Transport in Plants. Timiryazev Institute of Plant Physiology. M S Krasavina, SpringerMoscow, RussiaKrasavina MS. Effect of Salicylic Acid on Solute Transport in Plants. Timiryazev Institute of Plant Physiology. Moscow, Russia: Springer; 2007. pp. 25-68
Salicylic acid: Biosynthesis, metabolism and physiological role in plants. S Hayat, B Ali, A Ahmed, Salicylic Acid-A Plant Hormone. NetherlandsSpringerHayat S, Ali B, Ahmed A. Salicylic acid: Biosynthesis, metabolism and physiological role in plants. In: Salicylic Acid-A Plant Hormone. Netherlands: Springer; 2007. pp. 1-14
Effect of salicylic acid on the growth metabolic, activities and oil content bail and major. Fae Gharib, International Journal of Agriculture and Biology. 84Gharib FAE. Effect of salicylic acid on the growth metabolic, activities and oil content bail and major. International Journal of Agriculture and Biology. 2006;8(4):485-492
Salicylic acidinduced physiological and biochemical changes in lemongrass varieties under water stress. M M Idrees, M A Khan, T Aftab, M Naeem, N Hashmi, Journal of Plant Interactions. Aligarh Muslim University. 54Idrees MM, Khan MA, Aftab T, Naeem M, Hashmi N. Salicylic acid- induced physiological and biochemical changes in lemongrass varieties under water stress. Journal of Plant Interactions. Aligarh Muslim University. 2010;5(4):293-303. India
Foliar application of salicylic acid improved the growth, yield and leaf 's bioactive compounds in red amaranth (Amaranthus tricolor L.). Vegetable Crops Research Bulletin. L Khandaker, A S Akond, S Oba, Japan74Khandaker L, Akond AS, Oba S. Foliar application of salicylic acid improved the growth, yield and leaf 's bioactive compounds in red amaranth (Amaranthus tricolor L.). Vegetable Crops Research Bulletin. 2011;74:77-86. Japan
A physiological study of the effect of planting method, the number of plants in Joura and the spraying of salicylic acid concentrations and their interactions in the vegetative and syphilis growth of Cuminum cyminum L. M S Shouaily, Basrah Journal of Agricultural Sciences. 252The Republic of IraqShouaily MS. A physiological study of the effect of planting method, the number of plants in Joura and the spraying of salicylic acid concentrations and their interactions in the vegetative and syphilis growth of Cuminum cyminum L. Basrah Journal of Agricultural Sciences. 2012;25(2):37-46. The Republic of Iraq
Effect of some plant growth regulators on field properties and antioxidant production of blackwheat leaves. A Y Nasrallah, Hse Saadallah, S I Ne'ma, Iraqi Journal of Agricultural Sciences. 465The Republic of IraqNasrallah AY, Saadallah HSE, Ne'ma SI. Effect of some plant growth regulators on field properties and antioxidant production of blackwheat leaves. Iraqi Journal of Agricultural Sciences. 2015;46(5):682-694. The Republic of Iraq
Effect of salicylic acid and boron in the growth and yield of the plant Abameoschus esculentus L. A K Majoul, Btira. Al-Furat Journal of Agricultural Sciences. 73The Republic of IraqMajoul AK. Effect of salicylic acid and boron in the growth and yield of the plant Abameoschus esculentus L. Btira. Al-Furat Journal of Agricultural Sciences. 2015;7(3):27-35. The Republic of Iraq
Effect of salicylic acid on thermo tolerance and cardenolide accumulation under high temperature stress in Digitalis trojana Ivanina. G S Cingoz, G Ekrem, Journal of Plant Physiology and Biochemistry. Abnat Izzet Baysal University. 105TurkeyCingoz GS, Ekrem G. Effect of salicylic acid on thermo tolerance and cardenolide accumulation under high temperature stress in Digitalis trojana Ivanina. Journal of Plant Physiology and Biochemistry. Abnat Izzet Baysal University. 2016;105:145-149. Turkey
| In order to understand the salicylic acid role in hulless barley seedlings with salt stress,the effects of 1 mmol/L(SA) pretreatment on relative water content(RWC),relative electrical conductivity and contents of malondialehyde(MDA),soluble protein,soluble sugar,proline in hulless barley seedlings under 200 mmol/L NaCl stress were investigated.The results showed that RWC decreased more slowly,while the relative electrical conductivity and MDA content were obviously lower and rose more slowly,contents of soluble sugar,protein and proline were significantly higher in hulless barley seedlings by 1mmol/L SA pretreated than CK under same concentration NaC1 stress.The results suggested that salicylic acid could enhance the ability of salt resistance,alleviate damages in hulless barley seedlings by salt stress. |
INTRODUCTION
Potato (Solanum tuberosum L.) is an important food source worldwide (Wijesinha-Bettoni and Mouillé, 2019). Potato plants have comparatively shallow root systems and are sensitive to stress conditions (Turtola et al., 2005). The influence of pathogens is an important factor affecting the sustainable production of the crop (Obidiegwu et al., 2015). When plants are under pathogen stress, several physiological processes are disrupted by the production of elevated levels of reactive oxygen species (ROS), leading to oxidative stress within plant cells and thus photosynthetic activity, chlorophyll (chl) biosynthesis, hormonal balance, ion homeostasis, membrane stability, ATP production, lipid peroxidation, DNA damage, and imbalances in nutrient and water relationships, leading to cell abnormalities and death (Hasanuzzaman and Fujita, 2012). Plants deal with pathogen toxicity through various physiological and biochemical processes. Among the latter, plants endogenously activate both enzymatic and non-enzymatic antioxidant defense systems to scavenge ROS. Enzymatic antioxidants involved either directly or indirectly in scavenging ROS under pathogen-loaded conditions include superoxide dismutase (SOD), catalase (CAT), polyphenol oxidase (PPO), phenylalanine ammonia-lyase (PAL) and peroxidase (POD) (Rahman et al., 2016). Exogenous application of salicylic acid (SA) results in the induction of signaling cascades that can enhance plant growth and productivity under various environmental stress conditions by enhancing and scavenging antioxidant activities ROS (Khan et al., 2015). Salicylic acid is one of the phenolic compounds with a hydroxyl or derivative group formed by plants (Cetinkaya and Kulak, 2019); it acts as a ubiquitous growth regulator that can regulate various physiological and metabolic processes and plays an important role in the defense mechanism against toxicity .
It has been reported that SA triggers various gene expressions related to defense, either directly or through the H2O2mediated signal transduction pathway regulating mitogen-activated protein kinase (MAPK) (Chai et al., 2014). Lelliottia amnigena, which is a Gram-negative, plant-pathogenic bacterium belonging to the family Enterobacteriaceae is a new species identified as a causal agent of soft rot of potato (Abd-Elhafeez et al., 2018). There are no adequate studies on the mechanism underlying SA-mitigated in L. amnigena infestations in potato plants. The objectives of this study were to evaluate the effect of SA on the physiological traits of potato plant roots under L. amnigena stress, and determine the effect of SA on molecular parameters of potato plant roots under L. amnigena stress.
MATERIALS AND METHODS
Study area and source of materials
The experiment was conducted in a greenhouse at Gansu Agricultural University in Lanzhou, Gansu, China, in summer 2020. In this experiment, potato (Solanum tuberosum L.) 'Atlantic' was used. Mini tubers of this potato variety were purchased for the experiment from Gansu Haofeng Seed Company Limited, Lanzhou, China. The pure bacterial strain PC3 (Lelliottia amnigena) was obtained from the Plant Pathology Laboratory of Gansu Agricultural University, Lanzhou, P.R. China.
Experimental design and treatments
The experimental design was completely randomized with two factorial arrangements having two controls, positive control (plants inoculated with strain PC3), negative control (plants inoculated with distilled water without PC3) and salicylic acid (SA) treatment (plants inoculated with strain PC3 and treated with 0.5, 1.0, 1.5, and 2.0 mM SA). Each of these groups consisted of three replicates. For each procedure, three plastic pots were used (9 cm in diameter and 10.5 cm in depth), each containing 1 kg sterile substrate. Fittings were inserted in the bottom of each plastic pot to allow water drainage and to allow air into plastic pots. Eighteen (18) uniform healthy mini tubers were sown 1 cm deep in the substrate and covered. The pots were arranged in a complete randomized design with three replicates. Plants were irrigated every 24 h and maintained at a constant temperature of 25 ± 0.5 °C, with supplemental day/night lighting of 16/8 h and relative humidity of 65%. Two independent experiments were performed.
Preparation of SA solutions and inoculation of the pathogen
Salicylic acid (SA; 2-hydroxybenzoic acid; Sangon Biotech Co. Ltd., Shanghai, China) solutions at different concentrations (0.5, 1.0, 1.5, and 2.0 mM) (pH 6.0-6.5) were prepared with distilled water containing 0.01% Tween-20 as surfactant according to the method of Cao et al. (2013) with some modification.
The bacterial suspension (0.3 mL; 3.69 × 10 7 CFU mL -1 ) was inoculated into potato plants through stem injection. The potato plants were sprayed with solutions of 0.5, 1.0, 1.5, and 2.0 mM SA 24 h after inoculation of the pathogen. The SA treatments were repeated every 1 wk and control plants were sprayed with distilled water. This procedure was repeated for 60 d.
The roots of the sampled plants were washed and cut from the shoots and weighed immediately for measurement of fresh weight. To determine dry weight, all samples were oven-dried at 80 °C till constant weight. Relative water content (RWC) was calculated using a formula described by Tian and Philpot (2015): RWC(%) = (FW -DW)/FW × 100; where FW is fresh weight and DW is dry weight.
Oxidants and antioxidants determination
The content of malondialdehyde (MDA), a product of lipid peroxidation produced by the thiobarbituric acid reaction and an indicator of oxidative damage to a biological system, was measured according to the manufacturer's protocol/kit (Malondialdehyde (MDA) Content Assay Kit; Beijing Solarbio Science and Technology, Beijing, China) (BC0025). The absorbance of each sample was measured at 600, 532, and 450 nm. The content of MDA was expressed as μmol g -1 FW. The content of H2O2 in potato leaves was determined according to the manufacturer's protocol/kit (hydrogen peroxide (H2O2) content assay kit; Beijing Solarbio Science and Technology) (BC3595). In brief, 0.1 g fresh potato leaf was crushed in liquid nitrogen and placed on an ice bath in 1 mL acetone. The absorbance of each sample was measured at 415 nm.
The total activities of superoxide dismutase (SOD; EC 1.15.1.1), catalase (CAT; EC 1.11.1.6), peroxidase (POD; EC 1.11.1.7), and polyphenol oxidase (PPO; E.C. 1.14.18.1) were determined according to the manufacturer's protocol. One unit of SOD (YX-W-A500-WST-8, Beijing Solarbio Science and Technology) activity was measured as the amount of crude enzyme extract that inhibited the reduction of β-nitroblue tetrazolium chloride by 50% at 560 nm in the spectrophotometer. The CAT (YX-W-A501, Beijing Solarbio Science and Technology) activity was monitored in the spectrophotometer by calculating the degradation of H2O2 at 240 nm. The POD (YX-W-A502, Beijing Solarbio Science and Technology) activity, expressed as U mg -1 FW, was determined spectrophotometrically by measuring the increased absorbance at 470 nm. One unit of PPO was defined as the change in absorbance by 0.1 units per minute under assay conditions. The antioxidant kits were provided by Beijing Solarbio Science and Technology.
RNA extraction and real-time quantitative PCR (RT-qPCR)
Total RNA extraction and analysis of 100 mg roots treated with different concentrations of SA was performed according to the methods of Xie et al. (2013) and using PureLink RNA Mini Kit (Tiangen Biotechnology, Beijing, China). The quantity and quality of isolated RNA were analyzed using a Nano-Drop spectrophotometer at the absorbance of 230 and 260 nm. The A260/A280 ratio indicated that the RNA was free from protein contamination. First-strand cDNA synthesis was performed using Revert Aid TM First Strand cDNA Synthesis Kit (Tiangen Biotechnology). Specific primers for the SOD, POD, CAT and glutathione S-transferase (GST) genes and the internal control actin gene were used to amplify amplicons specific for potato leaves. For quantitative real-time PCR (RT-qPCR), 2× SYBR Green qPCR Master Mix was used. Analysis 20 μL reaction mixture consisting of 10 μL 2× SYBR Green qPCR Master Mix, deionized water (6.6 μL), diluted cDNA (1 μL), ROX reference dye (0.4 μL), and 1 μL each primer. The relative expression of SOD, POD, CAT, GST and actin genes was determined using the 2 -ΔΔCt formula of Livak and Schmittgen (2001). The RT-qPCR primers used in this study are listed in Table 1.
Statistical analysis
All statistical analyses were performed using SPSS 17.0 software (SPSS, Chicago, Illinois, USA) followed by one-way ANOVA. Experimental results were expressed as means (± SE) of two independent experiments with three replicates. Means were separated by the Duncan multiple range test at a probability level of 5%.
Superoxide dismutase (SOD) F GCTGGTGCTAGAGTAGCCTG R TCAAAGTTATCTGCCGTTCTCCA Peroxidase (POD) F GTTGCCTTATCAGGTTTGTTCTTT R CGGACGTGTTTGAATCAACTT Catalase (CAT) F TTTCAGGAGATGTGCAGCGT R ATGTATGAGGCTTTTATGCTGCT Glutathione S-transferase (GST) F AGCTGGTGCCCATCAATCTC R CCCTCTGAGACTCCTAATGATCC Actin F GCTCCTAGAGCTGTATTCCCAAGT R CAGTCGAAACGTGGTATCTTGACT Genes Primers Sequence (5'-3')
RESULTS
Effect of SA on growth parameters
The application of SA resulted in a significant (p < 0.05) increase in fresh root weight, dry root weight, and relative water content. There was a significant decrease in fresh and dry root weight in plants inoculated with L. amnigena. Under L. amnigena infestation, root fresh weight of potato plants was decreased by 44.80% compared to control plants ( Figure 1A). However, the application of SA across the four concentrations (0.5, 1.0, 1.5, and 2.0 mM) increased fresh weight by 18.1%, 36.6%, 37.8%, and 47.0%, respectively, compared to the control ( Figure 1A). In the case of L. amnigena infestation, root dry weight and RWC also decreased by an average of 11.8% and 34.80%, respectively, compared to the control. Application of SA across the four concentrations increased dry weight and RWC by 4.2%, 9.3%, 10.5%, 17.1% and 2.4%, 14.9%, 15.0%, 21.7%, respectively, compared to the control (Figures 1B, 1C).
Effect of SA on MDA and H2O2 content
In response to L. amnigena infestation, lipid peroxidation (MDA) and hydrogen peroxide (H2O2) content in the root increased significantly (p < 0.05) by 40.9% and 42.8%, respectively, compared to the control ( Figure 2 (Figures 2A, 2B).
Effect of SA on antioxidant enzyme activities
To inhibit ROS in potato plants under L. amnigena stress, their antioxidant system was activated and enzymes such as SOD, POD, CAT, PPO and phenylalanine ammonia-lyase (PAL) were significantly (p < 0.05) increased under SA treatments ( Figure 3). Under normal conditions, the infestation of L. amnigena increased the activities of SOD, POD, CAT, PPO
Figure 1. Effect of salicylic acid (SA) on root fresh weight (A), root dry weight (B) and relative water content (C) of roots under Lelliottia amnigena stress (PC3 strain).
Figure 2. Effect of salicylic acid (SA) on malondialdehyde (MDA) (A) and hydrogen peroxide (H2O2) (B) content of potato roots under Lelliottia amnigena stress (PC3 strain).
Data represent means ± SE of three replicates. Lowercase letters denote significant difference between treatments according to LSD test (p < 0.05).
Data represent means ± SE of three replicates. Lowercase letters denote significant difference between treatments according to LSD test (p < 0.05).
Figure 3. Effect of salicylic acid (SA) on superoxide dismutase (SOD) (A), peroxidase (POD) (B), catalase (CAT) (C), polyphenol oxidase (PPO) (D) and phenylalanine ammonia-lyase (PAL) (E) activities in roots of potato plants under Lelliottia amnigena stress (PC3 strain).
Data represent means ± SE of three replicates. Lowercase letters denote significant difference between treatments according to LSD test (p < 0.05).
and PAL by 25.7%, 24%, 25.7%, 25.8%, and 26.8%, respectively, compared to the control. However, application of SA across the four concentrations significantly increased SOD by 30.6%, 35.6%, 36.7%, and 40.8%, respectively, compared to the control ( Figure 3A). Also, application of SA across the four concentrations significantly increased POD by 28.4%, 30.2%, 34.0% and 36.4, respectively, compared to the control ( Figure 3B). In addition, SA across the four concentrations significantly increased CAT by 29.6%, 31.7%, 33.8% and 39.8%, respectively, compared to the control ( Figure 3C). Application of SA across the four concentrations also increased PPO by 29.8%, 30.5% 31.2% and 41.5%, as well as PAL by 34.9%, 36.7%, 38.1% and 45.9%, respectively, compared to the control ( Figures 3D, 3E).
Effect of SA on antioxidant gene expression
The results showed that the level of expression of SOD, POD, CAT and GST genes in the roots of potato plants under L. amnigena stress was increased by treatment with SA compared to control plants ( Figure 4). Treatment with SA induced transcriptional levels of the SOD and POD gene expression across the five levels by 2.12-fold, 2.92-fold, 3.32-fold, 3.50-fold, 3.74-fold and 2.10-fold, 3.41-fold, 3.46-fold, 3.90-fold and 4.43-fold, respectively, compared to the control. In addition, application of SA induced transcriptional levels of the CAT and GST gene expression across the five levels by 1.90-fold, 2.82-fold, 2.98-fold, 3.08-fold, 3.85-fold and 2.80-fold, 3.48-fold, 3.82-fold, 4.21-fold and 4.84-fold, respectively, compared to the control. However, treatment of SA showed the highest expression level for all antioxidant enzyme genes, especially when treated with 2.0 mM (Figures 4A-4D). This indicates that treatment with SA modulated biotic stress-responsive gene expression in potato plants, which in turn increased their tolerance to L. amnigena infestation. Significantly (p < 0.05), all antioxidant enzyme genes were relatively up-regulated in the plants treated with SA at all concentrations compared to the plants not treated with SA, indicating the important role of SA and antioxidant enzymes under biotic stress.
DISCUSSION
The results of our study showed that plants inoculated with L. amnigena reduced fresh and dry root weight compared to control plants. The application of SA significantly increased fresh weight of roots of potato plants (Zhang et al., 2011). The role of SA in plant growth can be attributed to its effect on increasing cell division (Gunes et al., 2007) and we can say that the increase in fresh and dry root weight of the plant is attributed to the application of SA to trigger the negative effects of stress caused by L. amnigena and improving plant growth. Arfan et al. (2007) reported improved fresh and dry root weight of stressed maize plants treated with SA. Salicylic acid is reported to counteract the adverse effects of stress by enhancing root growth (Aldesuquy et al., 2012). Relative water content (RWC) is a suitable factor to assess the physiological water status of stressed plants (Kadioglu et al., 2011). In this study, RWC decreased in potato plants under pathogen stress conditions, but the treatment of SA significantly increased RWC in these plants. Other studies have shown that SA can lead to an increase in RWC under stress (Alam et al., 2013;Ali et al., 2020); these results are consistent with our observations in potato plants. The RWC was reduced under stress, which is consistent with the results in Nigella sativa (Kabiri et al., 2014). Treatment with SA caused an increase in RWC under stress, which is similar to the observations of Farooq et al. (2009). Salicylic acid caused increased accumulation of compatible osmolytes in plants followed by increased water uptake. In this present study, MDA content increased in plants under L. amnigena stress, which is consistent with the results of Zafari et al. (2012). Salicylic acid significantly mitigated this effect; such an effect was also reported by Yadav et al. (2018). Moreover, lower MDA content in SA-treated plants could be correlated with the increased activities of antioxidant enzymes. Our result is consistent with the findings in wheat (Agarwal et al., 2005). Interestingly, the application of SA in this study significantly reduced MDA (ROS representative) and increased antioxidant content in L. amnigena-stressed plant roots. In this study, the H2O2 level was significantly increased under L. amnigena stress, which is in agreement with Zafari et al. (2012). The results in this current study showed that increasing concentrations of SA significantly decreased H2O2 content, with 2.0 mM SA having the lowest H2O2 content.
Figure 4. Effect of salicylic acid (SA) on gene expression of superoxide dismutase (SOD) (A), peroxidase (POD) (B), catalase (CAT) (C) and glutathione S-transferase (GST) (D) in roots of potato plants under Lelliottia amnigena stress (PC3 strain).
Salicylic acid has been significantly recognized as an endogenous natural signaling molecule involved in plant defense mechanisms by regulating both physiological and biochemical processes (Dong et al., 2015). All these researches have shown that SA-regulated abiotic and biotic stress tolerance in plants is involved in antioxidant responses, suggesting that the protection of plants from oxidative damage by SA is closely associated with an enhanced antioxidant system (Suruchi et al., 2014). In our study, the application of SA to plants under L. amnigena stress significantly increased the activities of antioxidant enzymes (SOD, POD, CAT, PPO, and PAL) compared to the control plants. Attenuation of oxidative damage by scavenging ROS via antioxidant enzymes is an important strategy of plants to protect them from stress. In addition, SA enhances enzymatic (SOD, POD, CAT, PPO, and PAL) and plays a major role in increasing plant stress tolerance and reducing oxidative stress (Mutlu et al., 2016), which in turn improves plant growth of pathogen-stressed plants. In short, CAT is the key enzyme in the removal of hydrogen peroxide (H2O2) and complements the action of superoxide dismutase (Sewelam et al., 2016). In this study, the activities of antioxidant enzymes were altered in response to SA treatment. A similar change in these enzymes was also observed by Kaur et al. (2012). However, exogenous SA restored the activities of the tested enzymes, reducing ROS and oxidative damage in potato roots. The data confirm that the key role of SA is to serve as a signaling molecule, thereby strengthening the defense system. Similar results were also observed by Singh et al. (2015). Our results suggest that exogenous SA regulates antioxidant enzymes, thereby lowering ROS and protecting potato plants from pathogen stress. In general, based on the increased activities of SOD, POD, CAT, PPO and PAL, it can be said that the treatment of SA effectively increased the antioxidants of potato plant roots to defend against the pathogen.
Exogenous supplementation of SA to L. amnigena-infested potato plants enhanced the up-regulation of enzymatic antioxidants in the roots. Importantly, exogenous application of SA up-regulated all the enzymes that were down-regulated under L. amnigena stress and further up-regulated the enzymes that showed increased activity under L. amnigena stress. Accordingly, by up-regulating enzyme activities such as SOD, POD, CAT, which play important roles in ROS scavenging, plants can avoid ROS injury (Abdelaal et al., 2020). Finally, SA scavenges excess ROS while L. amnigena stress-induced oxidative damage by upregulating antioxidant defense systems, making plants more resistant to this form of biotic stress (Mutlu et al., 2016). Results suggest that the application of SA enhances L. amnigena-induced stress resistance in potato plants by mitigating oxidative damage through up-regulation of the antioxidant defense system, thereby improving growth and productivity.
CONCLUSIONS
The results of the current study on potato plants showed that salicylic acid (SA) treatment plays an important role in plant-pathogen tolerance. Our findings revealed that the application of SA through the spraying induces an antioxidant system in the roots of potato plants under Lelliottia amnigena stress. Therefore, the results obtained in this study suggest that 2.0 mM SA could be used as bactericide for the management of L. amnigena. Based on our findings, we suggest that a concentration of 2.0 mM SA is the best for controlling L. amnigena.
Table 1 .
1Genes and primers sequences used for RT-PCR.
Data represent means ± SE of three replicates. Lowercase letters denote significant difference between treatments according to LSD test (p < 0.05).
ACKNOWLEDGEMENTS
Isolation and characterization of Enterobacter strains causing potato soft rot disease in Egypt. E Abd-Elhafeez, M Alkhazindar, E Sayed, Minia Science Bulletin. 291Botany SectionAbd-Elhafeez, E., AlKhazindar, M., and Sayed, E. 2018. Isolation and characterization of Enterobacter strains causing potato soft rot disease in Egypt. Minia Science Bulletin, Botany Section 29(1):1-13.
Treatment of sweet pepper with stress tolerance-inducing compounds alleviate salinity stress oxidative damage by mediating the physiobiochemical activities and antioxidant systems. K A Abdelaal, L M El-Maghraby, H Elansary, Y M Hafez, E I Ibrahim, M El-Banna, 10.3390/agronomy10010026Agronomy. 1026Abdelaal, K.A., EL-Maghraby, L.M., Elansary, H., Hafez, Y.M., Ibrahim, E.I., El-Banna, M., et al. 2020. Treatment of sweet pepper with stress tolerance-inducing compounds alleviate salinity stress oxidative damage by mediating the physio- biochemical activities and antioxidant systems. Agronomy 10:26. doi:10.3390/agronomy10010026.
Role of ABA, salicylic acid, calcium and hydrogen peroxide on antioxidant enzymes induction in wheat seedlings. S Agarwal, R Sairam, G Srivastava, A Tyagi, R Meena, 10.1016/j.plantsci.2005.05.004Plant Science. 169Agarwal, S., Sairam, R., Srivastava, G., Tyagi, A., and Meena, R. 2005. Role of ABA, salicylic acid, calcium and hydrogen peroxide on antioxidant enzymes induction in wheat seedlings. Plant Science 169:559-570. doi:10.1016/j.plantsci.2005.05.004.
Exogenous salicylic acid ameliorates short-term drought stress in mustard (Brassica juncea L.) seedlings by up-regulating the antioxidant defense and glyoxalase system. M M Alam, M Hasanuzzaman, K Nahar, M Fujita, Australian Journal of Crop Science. 77Alam, M.M., Hasanuzzaman, M., Nahar, K., and Fujita, M. 2013. Exogenous salicylic acid ameliorates short-term drought stress in mustard (Brassica juncea L.) seedlings by up-regulating the antioxidant defense and glyoxalase system. Australian Journal of Crop Science 7(7):1053-1063.
Role of glycine betaine and salicylic acid in improving growth vigour and physiological aspects of drought wheat cultivars. H S Aldesuquy, S A Abo-Hamed, M A Abbas, A H Elhakem, Journal of Stress Physiology. 8Aldesuquy, H.S., Abo-Hamed, S.A., Abbas, M.A., and Elhakem, A.H. 2012. Role of glycine betaine and salicylic acid in improving growth vigour and physiological aspects of drought wheat cultivars. Journal of Stress Physiology 8:149-171.
Physiological study of the effect spraying with salicylic acid on growth characteristics and some vegetative traits of chickpea plant Cicer arietinum under salinity stress. A H Ali, E K Al-Doree, R N Abdulrahman, EurAsian Journal of BioSciences. 142Ali, A.H., Al-Doree, E.K., and Abdulrahman, R.N. 2020. Physiological study of the effect spraying with salicylic acid on growth characteristics and some vegetative traits of chickpea plant Cicer arietinum under salinity stress. EurAsian Journal of BioSciences 14(2):6599-6603.
Does exogenous application of salicylic acid through the rooting medium modulate growth and photosynthetic capacity in two differently adapted spring wheat cultivars under salt stress. M Arfan, H R Athar, M Ashraf, 10.1016/j.jplph.2006.05.010Journal of Plant Physiology. 1646Arfan, M., Athar, H.R., and Ashraf, M. 2007. Does exogenous application of salicylic acid through the rooting medium modulate growth and photosynthetic capacity in two differently adapted spring wheat cultivars under salt stress? Journal of Plant Physiology 164(6):685-694. doi:10.1016/j.jplph.2006.05.010.
Effects of postharvest salicylic acid dipping on Alternaria rot and disease resistance of jujube fruit during storage. J Cao, J Yan, Y Zhao, W Jiang, 10.1002/jsfa.6167Journal of the Science of Food Agriculture. 93Cao, J., Yan, J., Zhao, Y., and Jiang, W. 2013. Effects of postharvest salicylic acid dipping on Alternaria rot and disease resistance of jujube fruit during storage. Journal of the Science of Food Agriculture 93:3252-3258. doi:10.1002/jsfa.6167.
Salicylic acid effect on cadmium-induced accumulation of mineral content in leaves of pistachio species from Turkey: An analysis coupled with chemometrics and multiple regression analysis. H Cetinkaya, M Kulak, 10.15666/aeer/1703_71137133Applied Ecology and Environmental Research. 17Cetinkaya, H., and Kulak, M. 2019. Salicylic acid effect on cadmium-induced accumulation of mineral content in leaves of pistachio species from Turkey: An analysis coupled with chemometrics and multiple regression analysis. Applied Ecology and Environmental Research 17:7113-7133. doi:10.15666/aeer/1703_71137133.
Mitogen-activated protein kinase 6 regulates NPR1 gene expression and activation during leaf senescence induced by salicylic acid. J Chai, J Liu, J Zhou, D Xing, 10.1093/jxb/eru369Journal of Experimental Botany. 65Chai, J., Liu, J., Zhou, J., and Xing, D. 2014. Mitogen-activated protein kinase 6 regulates NPR1 gene expression and activation during leaf senescence induced by salicylic acid. Journal of Experimental Botany 65:6513-6528. doi:10.1093/jxb/eru369.
Interaction effects of nitric oxide and salicylic acid in alleviating salt stress of Gossypium hirsutum L. Y Dong, Z Wang, J Zhang, S Liu, Z He, M He, 10.4067/S0718-95162015005000024Journal of Soil Science and Plant Nutrition. 15Dong, Y., Wang, Z., Zhang, J., Liu, S., He, Z., and He, M. 2015. Interaction effects of nitric oxide and salicylic acid in alleviating salt stress of Gossypium hirsutum L. Journal of Soil Science and Plant Nutrition 15:561-573. doi:10.4067/S0718-95162015005000024.
Plant drought stress: effects, mechanisms and management. M Farooq, A Wahid, N Kobayashi, D Fujita, S Basra, 10.1007/978-90-481-2666-8_12Agronomy for Sustainable Development. 29Farooq, M., Wahid, A., Kobayashi, N., Fujita, D., and Basra, S. 2009. Plant drought stress: effects, mechanisms and management. Agronomy for Sustainable Development 29:185-212. doi:10.1007/978-90-481-2666-8_12.
Salicylic acid induced changes on some physiological parameters symptomatic for oxidative stress and mineral nutrition in maize (Zea mays L.) grown under salinity. A Gunes, A Inal, M Alpaslan, F Eraslan, E G Bagci, N Cicek, Journal of Plant Physiology. 1646Gunes, A., Inal, A., Alpaslan, M., Eraslan, F., Bagci, E.G., and Cicek, N. 2007. Salicylic acid induced changes on some physiological parameters symptomatic for oxidative stress and mineral nutrition in maize (Zea mays L.) grown under salinity. Journal of Plant Physiology 164(6):728-736.
Heavy metals in the environment: current status, toxic effects on plants and possible phytoremediation. M Hasanuzzaman, M Fujita, 10.1201/b12954-4Phytotechnologies: remediation of environmental contaminants. Anjum, N.A., Pereira, M.E., Ahmad, I., Duarte, A.C., Umar, S., Khan, N.A.Boca Raton, Florida, USACRC PressHasanuzzaman, M., and Fujita, M. 2012. Heavy metals in the environment: current status, toxic effects on plants and possible phytoremediation. p. 7-73. In Anjum, N.A., Pereira, M.E., Ahmad, I., Duarte, A.C., Umar, S., Khan, N.A. (eds). Phytotechnologies: remediation of environmental contaminants. CRC Press, Boca Raton, Florida, USA. doi:10.1201/b12954-4.
Effect of exogenous salicylic acid on some physiological parameters and alleviation of drought stress in Nigella sativa plant under hydroponic culture. R Kabiri, F Nasibi, H Farahbakhsh, 10.17221/56/2012-PPSPlant Protection Science. 50Kabiri, R., Nasibi, F., and Farahbakhsh, H. 2014. Effect of exogenous salicylic acid on some physiological parameters and alleviation of drought stress in Nigella sativa plant under hydroponic culture. Plant Protection Science 50:43-51. doi:10.17221/56/2012-PPS.
Exogenous salicylic acid alleviates effects of long-term drought stress and delays leaf rolling by inducing antioxidant system. A Kadioglu, N Saruhan, A Sağlam, R Terzi, Acet , T , 10.1007/s10725-010-9532-3Plant Growth Regulation. 64Kadioglu, A., Saruhan, N., Sağlam, A., Terzi, R., and Acet, T. 2011. Exogenous salicylic acid alleviates effects of long-term drought stress and delays leaf rolling by inducing antioxidant system. Plant Growth Regulation 64:27-37. doi:10.1007/s10725-010-9532-3.
Arsenic (As) inhibits radicle emergence and elongation in Phaseolus aureus by altering starch-metabolizing enzymes vis-à-vis disruption of oxidative metabolism. S Kaur, H P Singh, D R Batish, A Negi, P Mahajan, S Rana, 10.1007/s12011-011-9258-8Biological Trace Element Research. 146Kaur, S., Singh, H.P., Batish, D.R., Negi, A., Mahajan, P., Rana, S., et al. 2012. Arsenic (As) inhibits radicle emergence and elongation in Phaseolus aureus by altering starch-metabolizing enzymes vis-à-vis disruption of oxidative metabolism. Biological Trace Element Research 146:360-368. doi:10.1007/s12011-011-9258-8.
Salicylic acid-induced abiotic stress tolerance and underlying mechanisms in plants. M I R Khan, M Fatma, T S Per, N A Anjum, N A Khan, 10.3389/fpls.2015.00462Frontiers in Plant Science. 6462Khan, M.I.R., Fatma, M., Per, T.S., Anjum, N.A., and Khan, N.A. 2015. Salicylic acid-induced abiotic stress tolerance and underlying mechanisms in plants. Frontiers in Plant Science 6:462. doi:10.3389/fpls.2015.00462.
Analysis of relative gene expression data using real-time quantitative PCR and the 2 -ΔΔCT method. K J Livak, T D Schmittgen, 10.1006/meth.2001.1262Methods. 25Livak, K.J., and Schmittgen, T.D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2 -ΔΔCT method. Methods 25:402-408. doi:10.1006/meth.2001.1262.
Exogenous salicylic acid alleviates cold damage by regulating antioxidative system in two barley (Hordeum vulgare L.) cultivars. S Mutlu, Ö Atici, B Nalbantoğlu, E Mete, 10.1080/21553769.2015.1115430Frontiers in Life Science. 9Mutlu, S., Atici, Ö., Nalbantoğlu, B., and Mete, E. 2016. Exogenous salicylic acid alleviates cold damage by regulating antioxidative system in two barley (Hordeum vulgare L.) cultivars. Frontiers in Life Science 9:99- 109. doi:10.1080/21553769.2015.1115430.
Coping with drought: stress and adaptive responses in potato and perspectives for improvement. J E Obidiegwu, G J Bryan, H G Jones, A Prashar, 10.3389/fpls.2015.00542Frontiers in Plant Science. 6542Obidiegwu, J.E., Bryan, G.J., Jones, H.G., and Prashar, A. 2015. Coping with drought: stress and adaptive responses in potato and perspectives for improvement. Frontiers in Plant Science 6:542. doi:10.3389/fpls.2015.00542.
Manganese-induced cadmium stress tolerance in rice seedlings: Coordinated action of antioxidant defense, glyoxalase system and nutrient homeostasis. A Rahman, K Nahar, M Hasanuzzaman, M Fujita, 10.1016/j.crvi.2016.08.002Comptes Rendus Biologies. 339Rahman, A., Nahar, K., Hasanuzzaman, M., and Fujita, M. 2016. Manganese-induced cadmium stress tolerance in rice seedlings: Coordinated action of antioxidant defense, glyoxalase system and nutrient homeostasis. Comptes Rendus Biologies 339:462- 474. doi:10.1016/j.crvi.2016.08.002.
Global plant stress signaling: reactive oxygen species at the cross-road. N Sewelam, K Kazan, P M Schenk, 10.3389/fpls.2016.00187Frontiers in Plant Science. 7187Sewelam, N., Kazan, K., and Schenk, P.M. 2016. Global plant stress signaling: reactive oxygen species at the cross-road. Frontiers in Plant Science 7:187. doi:10.3389/fpls.2016.00187.
Exogenous proline application ameliorates toxic effects of arsenate in Solanum melongena L. seedlings. M Singh, V P Singh, G Dubey, S M Prasad, 10.1016/j.ecoenv.2015.03.021Ecotoxicology and Environmental Safety. 117Singh, M., Singh, V.P., Dubey, G., and Prasad, S.M. 2015. Exogenous proline application ameliorates toxic effects of arsenate in Solanum melongena L. seedlings. Ecotoxicology and Environmental Safety 117:164-173. doi:10.1016/j.ecoenv.2015.03.021.
Salicylic acid and acquisition of desiccation tolerance in Pisum sativum seeds. P Suruchi, T Mamta, S Keshavkant, 10.3923/biotech.2014.217.225Biotechnology. 13Suruchi, P., Mamta, T., and Keshavkant, S. 2014. Salicylic acid and acquisition of desiccation tolerance in Pisum sativum seeds. Biotechnology 13:217-225. doi:10.3923/biotech.2014.217.225.
Relationship between surface soil water content, evaporation rate, and water absorption band depths in SWIR reflectance spectra. J Tian, W D Philpot, 10.1016/j.rse.2015.08.007Remote Sensing of Environment. 169Tian, J., and Philpot, W.D. 2015. Relationship between surface soil water content, evaporation rate, and water absorption band depths in SWIR reflectance spectra. Remote Sensing of Environment 169:280-289. doi:10.1016/j.rse.2015.08.007.
Clone-specific responses in leaf phenolics of willows exposed to enhanced UVB radiation and drought stress. S Turtola, M Rousi, J Pusenius, K Yamaji, S Heiska, V Tirkkonen, 10.1111/j.1365-2486.2005.01013.xGlobal Change Biology. 11Turtola, S., Rousi, M., Pusenius, J., Yamaji, K., Heiska, S., Tirkkonen, V., et al. 2005. Clone-specific responses in leaf phenolics of willows exposed to enhanced UVB radiation and drought stress. Global Change Biology 11:1655-1663. doi:10.1111/j.1365-2486.2005.01013.x.
The contribution of potatoes to global food security, nutrition and healthy diets. R Wijesinha-Bettoni, B Mouillé, 10.1007/s12230-018-09697-1American Journal of Potato Research. 96Wijesinha-Bettoni, R., and Mouillé, B. 2019. The contribution of potatoes to global food security, nutrition and healthy diets. American Journal of Potato Research 96:139-149. doi:10.1007/s12230-018-09697-1.
Two modified RNA extraction methods compatible with transcript profiling and gene expression analysis for cotton roots. C Xie, C Wang, X Wang, Yang , X , 10.1080/10826068.2012.759967Preparative Biochemistry Biotechnology. 43Xie, C., Wang, C., Wang, X., and Yang, X. 2013. Two modified RNA extraction methods compatible with transcript profiling and gene expression analysis for cotton roots. Preparative Biochemistry Biotechnology 43:500-511. doi:10.1080/10826068.2012.759967.
Salicylic acid induced changes on some physiological parameters symptomatic for oxidative stress in maize (Zea mays L.) grown under cinnamic acid stress. V Yadav, H Singh, A Singh, I Hussain, N Singh, 10.3103/S1068367418010202Russian Agricultural Sciences. 44Yadav, V., Singh, H., Singh, A., Hussain, I., and Singh, N. 2018. Salicylic acid induced changes on some physiological parameters symptomatic for oxidative stress in maize (Zea mays L.) grown under cinnamic acid stress. Russian Agricultural Sciences 44:9-17. doi:10.3103/S1068367418010202.
Effect of phytoplasma infection on metabolite content and antioxidant enzyme activity in lime (Citrus aurantifolia). S Zafari, V Niknam, R Musetti, S N Noorbakhsh, 10.1007/s11738-011-0855-0Acta Physiologiae Plantarum. 34Zafari, S., Niknam, V., Musetti, R., and Noorbakhsh, S.N. 2012. Effect of phytoplasma infection on metabolite content and antioxidant enzyme activity in lime (Citrus aurantifolia). Acta Physiologiae Plantarum 34:561- 568. doi:10.1007/s11738-011-0855-0.
Salicylic acid alleviates cadmium-induced inhibition of growth and photosynthesis through upregulating antioxidant defense system in two melon cultivars. Y Zhang, S Xu, S Yang, Chen , Y , 10.1007/s00709-014-0732-yCucumis melo L.) Protoplasma. 252Zhang, Y., Xu, S., Yang, S., and Chen, Y. 2015. Salicylic acid alleviates cadmium-induced inhibition of growth and photosynthesis through upregulating antioxidant defense system in two melon cultivars (Cucumis melo L.) Protoplasma 252:911-924. doi:10.1007/s00709-014-0732-y.
Exogenous application of salicylic acid alleviates cadmium toxicity and reduces hydrogen peroxide accumulation in root apoplasts of Phaseolus aureus and Vicia sativa. F Zhang, H Zhang, Y Xia, G Wang, L Xu, Z Shen, 10.1007/s00299-011-1056-4Plant Cell Reports. 308Zhang, F., Zhang, H., Xia, Y., Wang, G., Xu, L., and Shen, Z. 2011. Exogenous application of salicylic acid alleviates cadmium toxicity and reduces hydrogen peroxide accumulation in root apoplasts of Phaseolus aureus and Vicia sativa. Plant Cell Reports 30(8):1475-1483. doi:10.1007/s00299-011-1056-4.
| The possible mediatory role of salicylic acid in paraquat toxicity in maize seedlings was investigated. Inhibitory effects of paraquat on plant growth were observed by significant reduction in chlorophyll, carotenoid and leaf total protein content. Lipid peroxidation, free proline, and catalase activity were significantly increased in paraquat treatments as compared to control. The results indicated that salicylic acid increased tolerance of maize to paraquat stress by enhancing chlorophyll and carotenoid content and leaf total protein. In addition, salicylic acid significantly reduced free proline, lipid peroxidation and catalase activity in paraquat stressed maize seedlings. Alleviation, Antioxidant, maize, herbicide, Physiological response | During a pathogen attack, cells triggers the overproduction of reactive oxygen species causing oxidative stress and physiological damage. Plants develop strategies using these reactive molecules for protection against pathogen attack. Phytoplasma are bacteria lacking cell walls that inhabit plant phloem and reduce yield, tuber quality, and commercial harvest value. Sprayed salicylic acid (SA) activated plant defense response against phytoplasma attack and reduced infection symptoms, favored photosynthate translocation, and improved tuber quality. Low levels of exogenous SA (0.001 mM) induced higher biological activity. Damage reduction was associated with high hydrogen peroxide and ascorbic acid contents together with reduction of peroxidase activity, suggesting an important SA role regulating these molecules counteracting pathogen effects. |
Background
The fundamental mechanism of salinity effect on plant function is the increase in osmotic pressure of the plants environment that inhibits the absorption of water and nutrients (Borzouei et al. 2012). Invariably, salinity inhibits photosynthesis through its effect on stomatal conductance, water and nutrient uptake and decrease in chlorophyll concentration (Khare et al. 2020;Hu et al. 2020). Mechanisms exhibited by plants to mitigate the deleterious effects of salinity include: compartmentalization of ions, synthesis of compatible solutes (osmolytes), induction of plant hormones and alteration of membrane structure (Zainab et al. 2021). During the initial stages of salinity stress, water absorption capacity of root system decreases and water loss from leaves is accelerated due to osmotic stress of high salt accumulation (Zhao et al. 2015;Bhatt 2020). Proline is a water-soluble amino acid classified as a compatible osmolyte, i.e., it does not damage cell structures at high concentrations, but is capable of lowering the cell osmotic potential (Ibrahim et al. Page 2 of 6 Ologundudu Bull Natl Res Cent (2021) 45:152 2018). It performs multiple functions in stress adaptation, recovery and signaling, stabilization of proteins and protein complexes in the chloroplast, cytosol and protection of the photosynthetic apparatus in plants (Ozgur et al. 2013). Bacha et al. (2017) suggested that the application of proline successfully improved stress tolerance in plants. Production of reactive oxygen species (ROS) has been touted as one of the biochemical changes possibly occurring when plants are subjected to salinity stress (Hu et al. 2020). The photosynthetic apparatus is an important site for the production of such radicals which include superoxide (O 2 − ), hydrogen peroxide (H 2 O 2 ) and hydroxyl radicals (Naveed et al. 2020). These ROS disrupt normal cellular metabolism through membrane alteration and damage to lipids, proteins and nucleic acids (Naveed et al. 2020). Plants have developed complex defense mechanism involving a series of enzymatic antioxidants, such as catalase (CAT), glutathione (GSH), superoxide dismutase (SOD), ascorbate peroxidase (APX) and guaiacol peroxidase (GPX), and non-enzymatic antioxidants which include ascorbate, carotenoids, flavonoids and other phenolics to mitigate the deleterious effects of oxidative damage (Bacha et al. 2017). Superoxide dismutase (SOD) plays an important role in scavenging of hydroxyl radicals imposed by oxidative damage (Ozgur et al. 2013;Gharsallah et al. 2016). Thus, SOD is regarded as a key enzyme for maintaining normal physiological function and managing oxidative stress in ROS (Aref and Rad 2012). Glutathione is abundant in several eukaryotic organisms where it performs plethora of functions, which include sulfide transport and regulation of redox potential of intracellular organelles (Rahman et al. 2016;Zainab et al. 2021). It is a potent reductant capable of scavenging ROS directly or in conjunction with other antioxidants (Sharma et al. 2012;Ibrahim et al. 2018). Membrane damage is sometimes regarded as an indicator of lipid destruction under various stresses (Aref and Rad 2012). Malondialdehyde (MDA) is synthesized as a result of degradation of polyunsaturated lipids by ROS. This aldehyde production has been used as an important biomarker to determine the level of oxidative stress (Khare et al. 2020). Therefore, this study investigated the effects of salinity stress on the activities of osmolytes (antioxidative and non-antioxidative enzymes) in the leaves of two cowpea (Vigna unguiculata L. Walp)-Ife brown and Ife bpc. This is with the aim of better understanding the biochemical mechanisms of salt tolerance.
Methods
Plant material
Seeds of cowpea (Vigna unguiculata L. Walp), namely Ife brown and Ife bpc, were utilized in the experiment. The seeds were collected from International institute of Tropical Agriculture (IITA), Ibadan, Nigeria. They were authenticated at the Herbarium unit of the Federal University of Technology Akure, Nigeria.
Soil and pre-planting analysis
The soil was collected at the school farm of the Federal university of Technology Akure. The following physicochemical properties of the soil were determined: particle size and textural class, organic carbon, organic matter, pH, total nitrogen, available phosphorus, potassium, sodium, calcium, magnesium, effective cation exchange capacity and exchangeable acidity. The soil was later airdried and transferred into 48 plastic pots of about 21 cm diameter and 17 cm depth. The pots were perforated to enhance drainage during the course of the experiment.
Screen house experiment
The experimental setup was located in the screen house. The essence is to monitor the plant growth and to avoid being destroyed by rodents, contaminations and direct rainfall.
Preparation of salt solution
Salts of sodium chloride (NaCl) and sodium sulfate (Na 2 SO 4 ) were used for this study. The saline solution was prepared following standard methods of Meot-Duros and Magne (2008).
Experimental design
A 2 × 2 × 4 × 3 randomized complete block design (RCBD) was adopted. The experimental factors include salt type (NaCl and Na 2 SO 4 ), variety (Ife brown and Ife bpc) and salt concentrations {control, 5dS/m, 10dS/m and 15dS/m and replicated three times.
Experimental setup
The experiment was conducted at the screen house of the Department of Biology, Federal University of Technology Akure. About 5 kg of air-dried soils was filled into perforated plastic pots. Five (5) seeds of cowpea varieties (Ife brown and Ife bpc) were sown in each pot and watered regularly until the plants were fully established.
Salinity treatment
Salinization commenced four (4) weeks after planting, and each pot was administered with 200 ml of saline solution every three days till the end of the experimental period.
Non-enzymatic antioxidants assay Lipid peroxidation
Lipid peroxidation in fresh cowpea leaf samples was determined by estimating the malondialdehyde (MDA) following standard protocols of (Zeb and Ullah 2016). About 1 g of frozen leaf samples was ground to a fine powder with liquid nitrogen and extracted with ice-cold 50 mM phosphate buffer (pH 7.0). Centrifugation of the homogenate was done for ten minutes, and 0.5 ml of the supernatant was then mixed with 1. 5 ml, 0.5% thiobarbituric acid (TBA). Incubation of the supernatant was done in a water bath at 95 °C for 25 min. The concentration of MDA was determined from the absorbance at 532 nm (correction factor was applied by subtracting the absorbance at 600 nm for unspecific turbidity) by using extinction coefficient of 155 mM −1 cm −1 .
Proline determination
0.5 g of leaf samples from each variety was homogenized in 3% (w/v) sulfosalicylic acid, and the homogenate filtered was then filtered using Whatman's filter paper following standard methods of Bates et al. (1973). The mixture was heated at 100 °C for 1 h in water bath after acid ninhydrin and glacial acetic acid have been added.
The reaction was then stopped by ice bath. The mixture was extracted with toluene, and the absorbance of fraction aspired from liquid phase was read at 520 nm. Proline concentration was determined using calibration curve and expressed as µmol proline g −1 FW.
Glutathione (GSH)
The method of Beutler et al. (1963) was adopted in the estimation of the level of reduced glutathione (GSH) in the leaves of cowpea. Sample homogenate (0.2 ml) was added to 1.8 ml of distilled water, and 3 ml of the precipitating agent, sulfosalicylic acid, was mixed with the sample. This was centrifuged at 3,000 g for 4 min. Thereafter, 0.5 ml of the supernatant was added to 4.5 ml of Ellman reagent. A blank was prepared with 0.5 ml of the diluted precipitating agent and 4 ml of phosphate buffer and 0.5 ml of Ellman's reagent. The absorbance of the reaction mixture was taken within 30 min of color development at 412 nm against a reagent blank. The concentration of the GSH was extrapolated from the GSH standard curve.
Antioxidant enzyme assays Superoxide dismutase (SOD)
Total SOD (EC 1.15.1.1) activity was determined by measuring its ability to inhibit the photochemical reduction of nitrotetrazolium blue chloride (NBT), as described by Giannopolitis and Ries (1977). The reaction mixture (1.5 mL) contained 50 mM phosphate buffer (pH 7.8), 0.1 µM ethylenediaminetetraacetic acid (EDTA), 13 mM methionine, 75 µM NBT, 2 µM riboflavin and 50 µL enzyme extract. Riboflavin was added, and the tubes were subjected to mechanical shaker and later illuminated with two 20-W fluorescent tubes. The reaction was allowed to proceed for 15 min after which the lights were switched off and the tubes covered with a black cloth. Absorbance of the reaction mixture was read at 560 nm. One unit of SOD activity (U) was defined as the amount of enzyme required to cause 50% inhibition of the NBT photoreduction rate, and the results were expressed as units mg −1 protein.
Statistical analysis
Data collected were subjected to one-way analysis of variance (ANOVA), and means were separated with Duncan Multiple Range Test (DMRT) at 0.05 probability level (SPSS version 21.0).
Results
Proline accumulations in the leaves of Ife brown (IFB) and Ife bpc (IBPC) under NaCl and Na 2 SO 4 salinity are shown in Table 1. Minimum proline content (12.07 mg/g) and maximum proline determination (16.05 mg/g) were observed in Ife bpc at 5 and at 15 dS/m under NaCl and Na 2 SO 4 treatments. There was significant difference in the proline content of Ife brown and Ife bpc at 15 dS/m under both treatments. Also, there was significant difference in the maximum proline (14.85 mg/g) that was recorded in Ife brown at 5 dS/m relative to the control. Lipid peroxidase (LP) accumulations in the leaves of Ife brown (IFB) and Ife bpc (IBPC) under NaCl and Na 2 SO 4 salinity are shown in Table 2. Maximum lipid peroxidation was recorded in Ife bpc at 5 dS/m under Na 2 SO 4 treatment. However, minimum MDA content was also noticeable in Ife brown at 10 dS/m under Na 2 SO 4 salinity. The LP content significantly increased in Ife brown at 15 dS/m under NaCl treatment and at 10 dS/m (9.49 mg/g) under Na 2 SO 4 salinity. Meanwhile, Ife bpc did not record any induction of lipid peroxidase at 5 dS/m under NaCl treatment.
Glutathione (GSH) contents in the leaves of Ife brown (IFB) and Ife bpc (IBPC) under NaCl and Na 2 SO 4 salinity are shown in Table 3. Minimum GSH content (120 µm/g) and maximum glutathione accumulation (138.97 µm/g) were observed in Ife bpc in the stressed cowpea seedlings (5 and 10 dS/m) under NaCl treatment with respect to the control. Maximum GSH (134 µm/g) was also recorded in Ife brown at 15 µm/g under NaCl treatment. The minimum GSH content (125.75 µm/g) in Ife brown was observed at 5 dS/m under NaCl treatment. There were significant differences in the GSH accumulations for Ife brown at 15 dS/m under NaCl and Na 2 SO 4 stresses. Significant increase was also recorded in Ife bpc at 5 dS/m under NaCl and Na 2 SO 4 treatments.
Superoxide dismutase (SOD) activities in the leaves of Ife brown (IFB) and Ife bpc (IBPC) under NaCl and Na 2 SO 4 salinity are shown in Table 4. SOD activities in the leaves of Ife brown increase with increase in salinity stress in both NaCl and Na 2 SO 4 treatments. There were significant differences in the SOD activities for Ife brown at 10 dS/m under NaCl and Na 2 SO 4 treatments. Significant differences were also recorded in Ife bpc at 15 dS/m under NaCl and Na 2 SO 4 treatments. SOD activities in the stressed seedlings of both varieties were found to be lower compared to the control seedlings.
Discussion
The structural stability and osmotic adjustment of proline during stress had been an important indicator of oxidative damage in plants (Michael and Krishnaswamy 2012). Miranda et al. (2014) previously reported proline accumulations in response to various stresses in leaf in many studies. The observed maximum proline accumulations in IBPC under NaCl and Na 2 SO 4 are in agreement with these findings. Cellular architecture releases compatible osmolytes to maintain cell turgor and osmoregulation. Compatible osmolytes act as stabilizer by cushioning the effect of oxidative damage to macromolecules by salinity stress (Gharsallah et al. 2016). The increased MDA content in IFB under both treatments possibly indicates that IFB is capable of maintaining high degree of cell membrane homeostasis under high salt stress. Osmotic adjustment remained an integral factor and an important physiological character associated with salinity tolerance. This mechanism had attracted much attention and generated much debate during the past years. The observed minimum MDA content recorded in Ife brown (IFB) at 10 dS/m under Na 2 SO 4 stress possibly demonstrates that the IFB displays higher antioxidative ability, thereby reflecting higher salinity tolerance. This is in agreement with the findings of Sharma et al. (2012). Ozgur Table 2 Lipid peroxidase (LP) accumulations in the leaves of Ife brown (IFB) and Ife bpc (IBPC) under NaCl and Na 2 SO 4 salinity stress Means followed by different letters in the column are significantly different (P < 0.05) from one another using Duncan's new multiple range rest (DNMRT) (2013) reported that increase in reactive oxygen species (ROS) and lipid peroxidation is indicators of the decrease in antioxidant defenses. Osmotic adjustment simply involves the differential accumulation of compatible solutes in a cell in response to a decrease in solute potential of the cell's environment (Rahman et al. 2016). Oxidative damage necessitated by salinity stress is mitigated by a combined action of both enzymatic and non-enzymatic antioxidant systems. These include α-tocopherol (α-toc), β-carotenes, carotenoids, ascorbate (ASC), reduced glutathione (GSH), enzymes including superoxide dismutase (SOD), peroxidase (POD), ascorbate peroxidase (APX), catalase (CAT), polyphenol oxidase (PPO) and glutathione reductase (GR). Superoxide radicals are produced in various physiological processes under conditions of abiotic stress (Das et al. 2014). The observed increase in SOD activities in IFB under NaCl treatment is an indication that SOD is capable of mitigating effect of oxidative stress in cowpea seedlings. An increase in the activities of antioxidative enzymes under salt and water stress possibly indicates an increased production of reactive oxygen species (ROS). Findings from this research are in agreement with Karuppanapandian et al. (2011), who reported that increased production of ROS is capable of developing mechanisms to reduce oxidative damage in plants. It is widely perceived that the biosynthesis of many secondary metabolites in plants is an important part of the defense response to stress conditions (Isah 2019). The increase in glutathione activities in response to salinity stress in IFB may possibly be connected with increased stress tolerance (Khare et al. 2020). Stress tolerance is a complex phenomenon involving coordinated response that includes ion sequestration, metabolic adjustment and antioxidative defense (Abogadallah 2010). Salinity-induced alterations and disruptions in the physiology and biochemistry of the plant may elicit metabolic disturbances that trigger an abundant production of the product of oxidative damage (Naveed et al. 2020).
Conclusions
The increased proline content in IBPC confers structural stability to cellular machinery by acting as osmolyte capable of detoxifying reactive oxygen species (ROS) toward ameliorating salinity-induced damage in cowpea seedlings. The increased lipid peroxidation content in IFB suggests that the variety is capable of acting as osmoprotectant against membrane damage by salinity stress. The accumulation of superoxide dismutase (SOD) and glutathione (GSH) in IFB clearly demonstrates that enzymatic and non-enzymatic antioxidants are capable of scavenging reactive oxygen species, thereby mitigating salinity-induced oxidative damage in cowpea.
Table 1
1Proline accumulations in the leaves of Ife brown (IFB) and Ife bpc (IBPC) under NaCl and Na 2 SO 4 salinity stress Means followed by different letters in the column are significantly different (P < 0.05) from one another using Duncan's new multiple range test (DNMRT)Treatment
Conc (dS/m)
Biochemical parameters
(mean ± SE)
IFB proline (mg/g)
IFBPC proline
(mg/g)
NaCl
5.00
13.06 ± 0.14b
16.05 ± 0.04d
10.00
14.15 ± 0.40bc
12.69 ± 0.03b
15.00
14.53 ± 0.42 cd
12.07 ± 0.04a
Na 2 SO 4
5.00
14.85 ± 0.21d
15.76 ± 0.00e
10.00
13.75 ± 0.19b
14.38 ± 0.04d
15.00
12.94 ± 0.24a
13.34 ± 0.04c
Distilled H 2 O
0.0
13.77 ± 0.05b
14.26 ± 0.43d
Table 3
3Glutathione (GSH) contents in the leaves of Ife brown
(IFB) and Ife bpc (IBPC) under NaCl and Na 2 SO 4 salinity stress
Means followed by different letters in the column are significantly different
(P < 0.05) from one another using Duncan's new multiple range test (DNMRT)
Treatment
Conc (dS/m) Biochemical parameters (mean ± SE)
IFB GSH (µm/g) IFBPC GSH (µm/g)
NaCl
5.00
125.75 ± 0.11b
138.97 ± 0.11d
10.00
130.42 ± 0.12d
123.65 ± 0.13ab
15.00
132.29 ± 0.21e
120.64 ± 0.12a
Na 2 SO 4
5.00
128.52 ± 0.13c
138.29 ± 0.12d
10.00
126.04 ± 0.26b
131.49 ± 0.12c
15.00
123.81 ± 0.23a
125.30 ± 0.87b
Distilled H 2 O
0.0
127.37 ± 1.36bc
131.91 ± 2.76c
Table 4
4Superoxide dismutase (SOD) activities in the leaves of
Ife brown (IFB) and Ife bpc (IBPC) under NaCl and Na 2 SO 4 salinity
stress
Means followed by different letters in the column are significantly different
(P < 0.05) from one another using Duncan's new multiple range test (DNMRT)
Treatment
Conc (dS/m)
Biochemical parameters
(mean ± SE)
IFB SOD (%)
IFBPC SOD (%)
NaCl
5.00
38.87 ± 0.18b
45.24 ± 1.37d
10.00
42.11 ± 0.27c
42.86 ± 0.01cd
15.00
48.81 ± 0.20d
28.67 ± 0.06b
Na 2 SO 4
5.00
36.16 ± 2.38c
38.19 ± 1.37ab
10.00
45.76 ± 0.19d
26.59 ± 1.38a
15.00
51.10 ± 0.01e
21.06 ± 0.02c
Distilled H 2 O
0.0
51.50 ± 2.89e
46.03 ± 4.20d
AcknowledgementsThe researchers want to appreciate the technical and academic staff of the Department of Biology, Federal University of Technology, Akure, Nigeria.Authors' contributionsThe author read and approved the final manuscript.FundingThere was no funding for this research.DeclarationsEthics approval and consent to participate Not applicable.Consent for publicationNot applicable.Competing interestThe author declare that he has no competing interest.Received: 29 June 2021 Accepted: 7 September 2021
Insights into the significance of antioxidative defense under salt stress. G M Abogadallah, 10.4161/psb.5.4.10873Plant Signal Behav. 54Abogadallah GM (2010) Insights into the significance of antioxidative defense under salt stress. Plant Signal Behav 5(4):369-374. https:// doi. org/ 10. 4161/ psb.5. 4. 10873
Physiological characterization of rice under salinity stress during vegetative and reproductive stages. F Aref, H E Rad, 10.17485/IJST/2012/V5I4/30427Indian J Sci Technol. 54Aref F, Rad HE (2012) Physiological characterization of rice under salinity stress during vegetative and reproductive stages. Indian J Sci Technol 5(4):2578-2586. https:// doi. org/ 10. 17485/ IJST/ 2012/ V5I4/ 30427
Impact of salt stress on morpho-physiological and biochemical parameters of Solanum lycopersicum cv. Microtom leaves. H Bacha, M Tekaya, S Drine, F Guasmi, L Touil, H Enneb, T Triki, F Cheour, A Ferchichi, 10.1016/j.sajb.2016.08.018South Afr J Bot. 108Bacha H, Tekaya M, Drine S, Guasmi F, Touil L, Enneb H, Triki T, Cheour F, Ferchi- chi A (2017) Impact of salt stress on morpho-physiological and biochemi- cal parameters of Solanum lycopersicum cv. Microtom leaves. South Afr J Bot 108:364-369. https:// doi. org/ 10. 1016/j. sajb. 2016. 08. 018
Rapid determination of free proline for water-stress studies. L S Bates, R P Waldren, I D Teare, 10.1007/BF00018060Plant Soil. 391Bates LS, Waldren RP, Teare ID (1973) Rapid determination of free proline for water-stress studies. Plant Soil 39(1):205-207. https:// doi. org/ 10. 1007/ BF000 18060
Improved method for the determination of glutathione. E Beutler, O Duron, B M Kelly, J Labor Clin Med. 61Beutler E, Duron O, Kelly BM (1963) Improved method for the determination of glutathione. J Labor Clin Med 61:882-888
Salt tolerance mechanisms and approaches: future scope of halotolerant genes and rice landraces. T Bhatt, Rice Sci. 275Bhatt T (2020) Salt tolerance mechanisms and approaches: future scope of halotolerant genes and rice landraces. Rice Sci 27(5):368-383
Long term salinity stress in relation to lipid peroxidation, super oxide dismutase activity and proline content of salt-sensitive and salt-tolerant wheat cultivars. A Borzouei, M Kafi, E Akbari-Ghogdi, M Mousavi-Shalmani, 10.4067/s0718-58392012000400003s0718- 58392 01200 04000 03Chil J Agric Res. 724Borzouei A, Kafi M, Akbari-Ghogdi E, Mousavi-Shalmani M (2012) Long term salinity stress in relation to lipid peroxidation, super oxide dismutase activity and proline content of salt-sensitive and salt-tolerant wheat cultivars. Chil J Agric Res 72(4):476-482. https:// doi. org/ 10. 4067/ s0718- 58392 01200 04000 03
Reactive oxygen species (ROS) and response of antioxidants as ROS-scavengers during environmental stress in plants. K Das, A Roychoudhury, N A Anjum, 10.3389/fenvs.2014.00053Das K, Roychoudhury A, Anjum NA (2014) Reactive oxygen species (ROS) and response of antioxidants as ROS-scavengers during environmental stress in plants. https:// doi. org/ 10. 3389/ fenvs. 2014. 00053
Effect of salt stress on ion concentration, proline content, antioxidant enzyme activities and gene expression in tomato cultivars. C Gharsallah, H Fakhfakh, D Grubb, F Gorsane, 10.1093/aobpla/plw055Gharsallah C, Fakhfakh H, Grubb D, Gorsane F (2016) Effect of salt stress on ion concentration, proline content, antioxidant enzyme activities and gene expression in tomato cultivars. https:// doi. org/ 10. 1093/ aobpla/ plw055
Superoxide dismutase. I. Occurrence in higher plants. N Giannopolitis, S K Ries, J Plant Physiol. 59Giannopolitis N, Ries SK (1977) Superoxide dismutase. I. Occurrence in higher plants. J Plant Physiol 59:309-314
Evolution of abscisic acid signaling for stress responses to toxic metals and metalloids. B Hu, F Deng, G Chen, X Chen, W Gao, L Long, J Xia, Z H Chen, 10.3389/fpls.2020.00909Front Plant Sci. 11Hu B, Deng F, Chen G, Chen X, Gao W, Long L, Xia J, Chen ZH (2020) Evolution of abscisic acid signaling for stress responses to toxic metals and metal- loids. Front Plant Sci 11:1-16. https:// doi. org/ 10. 3389/ fpls. 2020. 00909
Antimicrobial and free radical scavenging potentials of N-hexane and ethyl acetate fractions of Phyllanthus fraternus. A M Ibrahim, B Lawal, A N Abubakar, N A Tsado, G N Kontagora, J A Gboke, 10.4314/njbas.v25i2.2Nig J Bas Appl Sci. 25Berinyuy EBIbrahim AM, Lawal B, Abubakar AN, Tsado NA, Kontagora GN, Gboke JA, Berinyuy EB (2018) Antimicrobial and free radical scavenging potentials of N-hexane and ethyl acetate fractions of Phyllanthus fraternus. Nig J Bas Appl Sci 25:2-6. https:// doi. org/ 10. 4314/ njbas. v25i2.2
Stress and defense responses in plant secondary metabolites production. T Isah, 10.1186/s40659-019-0246-3Bio Res. 521Isah T (2019) Stress and defense responses in plant secondary metabolites pro- duction. Bio Res 52(1):39-45. https:// doi. org/ 10. 1186/ s40659-019-0246-3
. Ologundudu Bull Natl Res Cent. 45152Ologundudu Bull Natl Res Cent (2021) 45:152
Reactive oxygen species in plants: their generation, signal transduction, and scavenging mechanisms. T Karuppanapandian, J C Moon, C Kim, K Manoharan, W Kim, Aust J Crop Sci. 56Karuppanapandian T, Moon JC, Kim C, Manoharan K, Kim W (2011) Reactive oxygen species in plants: their generation, signal transduction, and scavenging mechanisms. Aust J Crop Sci 5(6):709-725
Plant secondary metabolites synthesis and their regulations under biotic and abiotic constraints. S Khare, N B Singh, A Singh, I Hussain, K Niharika, V Yadav, C Bano, R K Yadav, N Amist, 10.1007/s12374-020-09245-7J Plant Biol. 633Khare S, Singh NB, Singh A, Hussain I, Niharika K, Yadav V, Bano C, Yadav RK, Amist N (2020) Plant secondary metabolites synthesis and their regula- tions under biotic and abiotic constraints. J Plant Biol 63(3):203-216. https:// doi. org/ 10. 1007/ s12374-020-09245-7
Effect of salinity and chemical factors on seed germination in the halophyte (Crithmum maritimum L.). L Meot-Duros, C Magne, Plant Soil. 313Meot-Duros L, Magne C (2008) Effect of salinity and chemical factors on seed germination in the halophyte (Crithmum maritimum L.). Plant Soil 313:83-87
Oxidative stress and antioxidants in cowpea plants subjected to boron and high irradiance stresses. P I Michael, M Krishnaswamy, 10.1080/01904167.2012.724498J Plant Nutr. 3514Michael PI, Krishnaswamy M (2012) Oxidative stress and antioxidants in cow- pea plants subjected to boron and high irradiance stresses. J Plant Nutr 35(14):2180-2197. https:// doi. org/ 10. 1080/ 01904 167. 2012. 724498
Salinity effects on proline accumulation and total antioxidant activity in leaves of the cape gooseberry (Physalis peruviana L.). D Miranda, G Fischer, I Mewis, S Rohn, C Ulrichs, 10.5073/JABFQ.2014.087.010J Appl Bot Food Qual. 87Miranda D, Fischer G, Mewis I, Rohn S, Ulrichs C (2014) Salinity effects on proline accumulation and total antioxidant activity in leaves of the cape gooseberry (Physalis peruviana L.). J Appl Bot Food Qual 87:67-73. https:// doi. org/ 10. 5073/ JABFQ. 2014. 087. 010
Alleviation of salinity-induced oxidative stress, improvement in growth, physiology and mineral nutrition of canola (Brassica napus L.) through calcium-fortified composted animal manure. M Naveed, H Sajid, A Mustafa, B Niamat, Z Ahmad, M Yaseen, M Kamran, M Rafique, S Ahmar, J T Chen, 10.3390/su12030846Susty. 123Naveed M, Sajid H, Mustafa A, Niamat B, Ahmad Z, Yaseen M, Kamran M, Rafique M, Ahmar S, Chen JT (2020) Alleviation of salinity-induced oxida- tive stress, improvement in growth, physiology and mineral nutrition of canola (Brassica napus L.) through calcium-fortified composted animal manure. Susty 12(3):1-17. https:// doi. org/ 10. 3390/ su120 30846
Reactive oxygen species regulation and antioxidant defence in halophytes. R Ozgur, B Uzilday, A H Sekmen, I Turkan, 10.1071/FP12389Funct Plant Biol. 409Ozgur R, Uzilday B, Sekmen AH, Turkan I (2013) Reactive oxygen species regulation and antioxidant defence in halophytes. Funct Plant Biol 40(9):832-847. https:// doi. org/ 10. 1071/ FP123 89
Manganese-induced salt stress tolerance in rice seedlings: regulation of ion homeostasis, antioxidant defense and glyoxalase systems. A Rahman, M Shahadat Hossain, J A Mahmud, K Nahar, M Hasanuzzaman, 10.1007/s12298-016-0371-1Physiol Mol Biol Plants. 22Rahman A, Shahadat Hossain M, Mahmud JA, Nahar K, Hasanuzzaman M (2016) Manganese-induced salt stress tolerance in rice seedlings: regulation of ion homeostasis, antioxidant defense and glyoxalase systems. Physiol Mol Biol Plants 22:34-42. https:// doi. org/ 10. 1007/ s12298-016-0371-1
Reactive oxygen species, oxidative damage, and antioxidative defense mechanism in plants under stressful conditions. P Sharma, A B Jha, R S Dubey, M Pessarakli, 10.1155/2012/217037J Bot. Sharma P, Jha AB, Dubey RS, Pessarakli M (2012) Reactive oxygen species, oxidative damage, and antioxidative defense mechanism in plants under stressful conditions. J Bot. https:// doi. org/ 10. 1155/ 2012/ 217037
Review of oxidative stress and antioxidative defense mechanisms in Gossypium hirsutum L. in response to extreme abiotic conditions. Q Zainab, T C Muhammad, D Xiongming, H Lori, T A Muhammad, 10.1186/s42397-021-00086-4J Cot Res. 4Zainab Q, Muhammad TC, Xiongming D, Lori H, Muhammad TA (2021) Review of oxidative stress and antioxidative defense mechanisms in Gossypium hirsutum L. in response to extreme abiotic conditions. J Cot Res 4:9-13. https:// doi. org/ 10. 1186/ s42397-021-00086-4
A simple spectrophotometric method for the determination of thiobarbituric acid reactive substances in fried fast foods. A Zeb, F Ullah, 10.1155/2016/9412767J Anal Methods Chem. Zeb A, Ullah F (2016) A simple spectrophotometric method for the determina- tion of thiobarbituric acid reactive substances in fried fast foods. J Anal Methods Chem. https:// doi. org/ 10. 1155/ 2016/ 94127 67
Nitric oxide-associated protein1 (AtNOA1) is essential for salicylic acid-induced root waving in Arabidopsis thaliana. X Zhao, J Wang, J Yuan, X L Wang, Q P Zhao, P T Kong, X Zhang, 10.1111/nph.13327New Phytol. 207Zhao X, Wang J, Yuan J, Wang XL, Zhao QP, Kong PT, Zhang X (2015) Nitric oxide-associated protein1 (AtNOA1) is essential for salicylic acid-induced root waving in Arabidopsis thaliana. New Phytol 207:211-224. https:// doi. org/ 10. 1111/ nph. 13327
Publisher's Note. Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Springer Nature remains neutral with regard to jurisdictional claims in pub- lished maps and institutional affiliations.
| 159 | Effects of salicylic acid on protein content and 14C-amino acid incorporation into proteins of pea roots | Effects of exogenous salicylic acid on biochemical properties in lettuce(Lactuca sative)seedlings | Effect of Salicylic Acid on Leaf Anatomy and Chloroplast Ultrastructure of Barley Plants | Induction of Several Defense Response Enzymes in Arabidopsis Seedlings by Salicylic Acid | Active accumulation of 14C-salicylic acid by rat kidney cortex in vitro. | Effects of Salicylic Acid on Some Enzyme Activities Related to Stress Resistance and Content of MDA in Vanilla planifolia | It has been shown that salicylic acid (SA) acts as an endogenous signal molecule responsible for inducing stress tolerance. The aim of the present work is to investigate the effect of sodium chloride (0, 100, and 200 mM) and exogenous SA (1 mM) on some biochemical and molecular responses of safflower. Results revealed that K + , Ca 2+ , indol-3-acetic acid (IAA), and gibberellic acid (GA) contents decreased under salinity however, Na + content, and SOS1 and NHX1 genes expression increased. Further, palmitic and oleic acids contents decreased, while stearic, linoleic, and linolenic acids content increased under salinity. Exogenous SA had a positive effect on K + , Ca 2 + , IAA, and GA contents, but decreased Na + content. In addition, SA induced expression of SOS1 and NHX1 genes in all plants. Our data indicate that SA helps safflower to better cope with salinity. The results provide new insights to mechanisms that help regulate salinity resistance in safflower. SA may be considered as a foliar application to ameliorate salinity effects, due to its low price and availability.ARTICLE HISTORY | Salicylic acid priming before and after accelerated aging process increases seedling vigor in aged soybean seed | The Mitigative Effects of Salicylic Acid Pretreatment on Hulless Barley Seedlings Under Salt Stress |
160 | worked great for a while (5 months) | Worked well first couple days, then wore out pretty quickly after that. | Didn't work even for 6 month. worked well at the beginning but then stopped. | It's only been a couple weeks, but so far it's working just fine. | This product works great for about a month and then stops working. I have had several that had this issue. | worked well for a few months then stopped working out of no where. This is my second one that stopped working | It's been a little over a year, it's starting to not work all the time. While it did work, it was great | Worked very well but after 4 months it stopped working to its full function and stopped working completely yesterday. | Worked well ...while it was working. It lasted about a month of medium usage. | 160 | worked great for a while (5 months)...now the transmitter is shutting off by itself...I have to go over and toggle the on/off switch to get it to turn back on...after 10 minutes it will just shut off again...I replaced the batteries in both the receiver and the headphones and the problem persisted | Works fine but transmitter and sub NEVER turn off now | Worked great for 4 months but now turn off constantly | Worked really good for the first 6 months then it stopped transmitting | Changed to fresh battery and it works fine again. They're a little pricey but much better ... | It worked great for 5 mins then it shut itself off | May have been defective. The wireless only worked if ... | Remote stopped working after week 2. Replaced batteries several ... | Shuts-Off While In Use! |
161 | where does the old bering sea start and end | Inlet on the south coast to Oliktok Point on the Arctic coast. It occurs on the Yukon River as far upstream as Dawson City, on the Porcupine River, and in the lakes of the Brooks Range. There are some reports of Bering ciscoes from the Chukchi Peninsula and the Kamchatka Peninsula, these presumably being migrants from Alaska. The Bering cisco is usually found in river mouths, brackish lagoons, and coastal waters, but may penetrate far upstream. Most populations are anadromous, migrating as far as inland to spawn during the late summer. In most of its range, the Bering cisco is | geographical range: Europe, Africa, Asia, and North America. The only way they could reach the New World was by the Bering land bridge. Had this bridge not existed at that time, the fauna of the world would be very different. Beringia Beringia is defined today as the land and maritime area bounded on the west by the Lena River in Russia; on the east by the Mackenzie River in Canada; on the north by 72 degrees north latitude in the Chukchi Sea; and on the south by the tip of the Kamchatka Peninsula. It includes the Chukchi Sea, the Bering | On the Oceanographic Structure and the Ice Formation on the Continental Shelf in the Eastern Bering Sea | Who is is the bering sea named after and what was he doing in alaska? | Anomalous conditions in the south-eastern Bering Sea, 1997: nutrients, phytoplankton and zooplankton | The Bering Strait () is a strait between the Pacific and Arctic oceans, separating the Chukchi Peninsula of the Russian Far East from the Seward Peninsula of Alaska. The present Russia-United States maritime boundary is at 168° 58' 37" W longitude, slightly south of the Arctic Circle at about 65° 40' N latitude. The Strait is named after Vitus Bering, a Danish explorer in the service of the Russian Empire.
The Bering Strait has been the subject of the scientific theory that humans migrated from Asia to North America across a land bridge known as Beringia when lower ocean levels – perhaps a result of glaciers locking up vast amounts of water – exposed a wide stretch of the sea floor, both at the present strait and in the shallow sea north and south of it. This view of how Paleo-Indians entered America has been the dominant one for several decades and continues to be the most accepted one. Numerous successful crossings without the use of a boat have also been recorded since at least the early 20th century.
Geography and science
The Bering Strait is about wide at its narrowest point, between Cape Dezhnev, Chukchi Peninsula, Russia, the easternmost point (169° 39' W) of the Asian continent and Cape Prince of Wales, Alaska, United States, the westernmost point (168° 05' W) of the North American continent. It is wide, and at its deepest point is only in depth. It borders the Chukchi Sea (part of the Arctic Ocean) to the north and the Bering Sea to the south. The strait is a unique habitat sparsely populated by the Yupik , Inuit, and Chukchi residents which have cultural and linguistic ties to each other.
Expeditions
From at least 1562, European geographers thought that there was a Strait of Anián between Asia and North America. In 1648, Semyon Dezhnyov probably passed through the strait, but his report did not reach Europe. Danish-born Russian navigator Vitus Bering entered it in 1728. In 1732, Mikhail Gvozdev crossed it for the first time, from Asia to America. It was visited in 1778 by the third voyage of James Cook.
American vessels were hunting for bowhead whales in the strait by 1847.
In March 1913, Captain Max Gottschalk (German) crossed from the east cape of Siberia to Shishmaref, Alaska, on dogsled via Little and Big Diomede islands. He was the first documented modern voyager to cross from Russia to North America without the use of a boat.
In 1987, swimmer Lynne Cox swam a course between the Diomede Islands from Alaska to the Soviet Union in water during the last years of the Cold War. She was congratulated jointly by American President Ronald Reagan and Soviet leader Mikhail Gorbachev.
In June and July 1989, three independent teams attempted the first modern sea-kayak crossing of the Bering Strait. The groups were: seven Alaskans, who called their effort Paddling Into Tomorrow (i.e. crossing the international dateline); a four-man British expedition, Kayaks Across the Bering Strait; and a team of Californians in a three-person biadarka, led by Jim Noyes (who launched his ambitious expedition as a paraplegic). Accompanying the Californians was a film crew in a umiak, a walrus-skin boat traditional to the region; they were filming the 1991 documentary Curtain of Ice, directed by John Armstrong.
In March 2006, Briton Karl Bushby and French-American adventurer Dimitri Kieffer crossed the strait on foot, walking across a frozen section in 15 days. They were soon arrested for not entering Russia through a border control.
August 2008 marked the first crossing of the Bering Strait using an amphibious road-going vehicle. The specially modified Land Rover Defender 110 was driven by Steve Burgess and Dan Evans across the straits on its second attempt following the interruption of the first by bad weather.
In February 2012, a Korean team led by Hong Sung-Taek crossed the straits on foot in six days. They started from Chukotka Peninsula, the east coast of Russia on February 23 and arrived in Wales, the western coastal town in Alaska on February 29.
In July 2012, six adventurers associated with "Dangerous Waters", a reality adventure show under production, made the crossing on Sea-Doos but were arrested and permitted to return to Alaska on their Sea-Doos after being briefly detained in Lavrentiya, administrative center of the Chukotsky District. They were treated well and given a tour of the village's museum, but not permitted to continue south along the Pacific coast. The men had visas but the western coast of the Bering Strait is a closed military zone.
Between August 4 and 10 (US time), 2013, a team of 65 swimmers from 17 countries performed a relay swim across the Bering Strait, the first such swim in history. They swam from Cape Dezhnev, Russia, to Cape Prince of Wales, United States (roughly , due to the current). They had direct support from the Russian Navy, using one of its ships, and assistance with permission.
Proposed crossing
A physical link between Asia and North America via the Bering Strait nearly became a reality in 1864 when a Russian-American telegraph company began preparations for an overland telegraph line connecting Europe and America via the east. It was abandoned when the undersea Atlantic Cable proved successful.
A further proposal for a bridge-and-tunnel link from eastern Russia to Alaska was made by French engineer Baron Loicq de Lobel in 1906. Czar Nicholas II of Russia issued an order authorising a Franco-American syndicate represented by de Lobel to begin work on the Trans-Siberian Alaska railroad project, but no physical work ever commenced.
Suggestions have been made to construct a Bering Strait bridge between Alaska and Siberia. Despite the unprecedented engineering, political, and financial challenges, Russia green-lighted a US$65-billion TKM-World Link tunnel project in August 2011. If completed, the tunnel will be the world's longest. China considered construction of a "China-Russia-Canada-America" railroad line that would include construction of a underwater tunnel that would cross the Bering Strait.
Proposed dam
In 1956, the Soviet Union proposed to the US a joint bi-national project to warm the Arctic Ocean and melt some of the ice cap. As designed by Petr Borisov, the Soviet project called for a dam across the Bering Strait. It would block the cold Pacific current from entering the Arctic. By pumping low-salinity cold surface water across the dam to the Pacific, warmer and higher salinity sea water from the Atlantic Ocean would be introduced into the Arctic Ocean. However, citing national security concerns, the CIA and FBI experts opposed the Soviet plan by arguing that while the plan was feasible, it would compromise NORAD and thus the dam could be built at only an immense cost. Soviet scientist D. A. Drogaytsev also opposed the idea, stating that the sea north of the dam and north-flowing rivers in Siberia would become unnavigable year round, and the Gobi and other deserts would be extended to the northern Siberia coastline.
American Charles P. Steinmetz (1865-1923) earlier proposed to widen the Bering Strait by removing St. Lawrence Island and parts of Seward and Chukotski Peninsulas. A strait wide would let the Japan Current melt the Arctic Ocean.
In the 21st century, a dam has also been proposed. However, the aim of the proposal is to preserve the Arctic ice cap against global warming.
"Ice Curtain" border
During the Cold War, the Bering Strait marked the border between the Soviet Union and the United States. The Diomede Islands—Big Diomede (Russia) and Little Diomede (US)—are only apart. Traditionally, the indigenous people in the area had frequently crossed the border back and forth for "routine visits, seasonal festivals and subsistence trade", but were prevented from doing so during the Cold War. The border became known as the "Ice Curtain". It was completely closed, and there was no regular passenger air or boat traffic.
Since 2012, the Russian coast of the Bering Strait has been a closed military zone. Through organized trips and the use of special permits, it is possible for foreigners to visit. All arrivals must be through an airport or a cruise port, near the Bering Strait only at Anadyr or Provideniya. Unauthorized travelers who arrive on shore after crossing the strait, even those with visas, may be arrested, imprisoned briefly, fined, deported and banned from future visas.
See also
List of Russian explorers
Old Bering Sea
Strait of Anián
References
Further reading
Demuth, Bathsheba (2019) Floating Coast: An Environmental History of the Bering Strait. New York: W. W. Norton & Company. .
External links
PBS Video of St. Lawrence Island in Bering Strait
Strait
Geography of Northeast Asia
Geography of North America
International straits
Bodies of water of Chukotka Autonomous Okrug
Bodies of water of the Chukchi Sea
Russia–United States border
Straits of Alaska
Straits of Russia
Straits of the Arctic Ocean
Straits of the Pacific Ocean
Beringia | What peninsula in eastern Siberia that extends into the Bering Sea? | The region of the western Arctic stretching from the Lena River in northeast Russia to the Mackenzie River in Canada is geographically known as Beringia. The lowlands of Beringia remained ice-free during Pleistocene glaciations, while nearly all other high-latitude regions of the Northern Hemisphere were covered by ice sheets. The lowering of sea level during glacial stadials exposed large regions of the Bering and Chukchi sea shelves, repeatedly forming the Bering Land Bridge. The Bering Land Bridge cut off circulation between the waters of the North Pacific and Arctic oceans, greatly increasing the continentality of adjacent land masses and diminishing the inland flow of relatively warm, moist air masses from the North Pacific (Harris SA (2005) Thermal history of the Arctic Ocean environs adjacent to North America during the last 3.5 Ma and a possible mechanism for the cause of cold events (major glaciations and permafrost events). Progress in Physical Geography 29: 1–19). | 161 | Old Bering Sea Old Bering Sea is an archaeological culture associated with a distinctive, elaborate circle and dot aesthetic style and is centered on the Bering Strait region; no site is more than 1 km from the ocean. Old Bering Sea is considered, following Henry B. Collins, the initial phase of the Northern Maritime tradition. Despite its name, several OBS sites lie on the Chukchi Sea. The temporal range of the culture is from 400 BCE to possibly as late as AD 1300. The culture was initially named the "Bering Sea" culture by Canadian archaeologist Diamond Jenness in 1928 following | Oceanographic Structure in the Bering Sea | when was old luce discovered in scotland | What was the Iron age culture? | the nok culture is thought to be a precursor to which age | Old. Just know it was probably not made in this century. | Interpreting AMS Radiocarbon Age Determinations from Selected Central Plains Tradition Sites | when was the yellow bellied sea snake first used as a scientific name | who recorded the british iron age trade between england and gaul |
162 | What was the significance of the Treaty of Paris in 1763? | 3 What did England gain in the Treaty of Paris of 1763? | Who negotiated the treaty of paris 1783? | Treaty of paris end of french and indian war? | What did the orginal treaty of paris say? | Which nations was represented in france at the signing of the treaty of paris in 1763? | Who negotiated a treaty alliance with France? | How did the treaty of paris take so long? | What was the goal of the colonies of quebec and neew amsterdam? | 162 | What did the treaty of paris in 1763 result in? | Who was represented in france at the signing of the treaty of paris in 1763? | who did the french give land to in the 1763 treaty of paris | What did the actual treaty of paris say? | Did the french and indian war end with the treaty of paris? | who negotiated the treaty of paris between france and england | What territories did england gain in the treaty of paris? | Who was the negotiator of the treaty of paris in 1783? | what was the name of the treaty between france and the united states |
163 | what type of acting is available in the play the weavers | Acting which he defines the desire to imitate in play as an essential part of being human and our first means of learning as children: For it is an instinct of human beings, from childhood, to engage in mimesis (indeed, this distinguishes them from other animals: man is the most mimetic of all, and it is through mimesis that he develops his earliest understanding); and equally natural that everyone enjoys mimetic objects. (IV, 1448b) This connection with play also informed the words used in English (as was the analogous case in many other European languages) for drama: the word "play" or | Preface 1. The art of the theatre 2. Drama as opera 3. New lamps for old 4. What has happened: now read on 5. The problem of Hamlet 6. The parties themselves, the actors 7. A pair of star-crossed lovers 8. Reality and artifice 9. Antike Romans 10. The director clarifies 11. Falstaff and the House of Lancaster 12. Two comedies translated 13. Conclusions. | Rhinoceros (play) has been ignored by literary scholars who have seen Ionesco only as a French playwright and neglected the fact that Ionesco saw himself as both Romanian and French. In April 1960 the play was performed by the English Stage Company at the Royal Court Theatre in London, England under the direction of Orson Welles with Laurence Olivier as Bérenger, Joan Plowright as Daisy, and Michael Bates, Miles Malleson and Peter Sallis in the cast. The production moved to the Strand Theatre (now the Novello Theatre) that June. Following the move Dudard and Daisy were played by Michael Gough and Maggie | I'm a middle school director at a school with a sizable Indian (from the country of India) population. For our upcoming fall play, I would like to potentially put on a play that is written by an Indian and/or has Indian representation in it. Flexible cast, ages 12-14, no more than 90 minutes long. Any suggestions? Thanks in advance! | These five short plays, which were originally produced at the Actors Theatre of Louisville, are great material for high school students. The casts range from two to five; the scripts are contemporary and unique, offering the actors opportunities for much interplay and range of emotion. They can be effective as a full evening of theatre or for scene study, directing projects, or competitions. | Act (drama) to divide plays into a number of acts separated by intervals. Acts may be further divided into scenes; in classical theater each regrouping between entrances and exits of actors is a scene, while later use describes a change of setting. Though there are no limits to the number of acts which might exist within a dramatic work, the most common formats are the three-act and five-act structures. Both of these are derived from different interpretations of Aristotle's "Poetics" in which he stresses the primacy of plot over character and "an orderly arrangement of parts". Modern plays often have only one | Why is Film acting differnet fron stage acting? | Director, for a three-week run. "Crucible" transferred to 59E59 theaters in New York City in May 2018 as part of the theatre's Brits Off Broadway Festival and was Ben Brantley's New York Times Critics Pick. It was adapted for BBC Radio Four and aired in July 2018 directed by Toby Swift. "Crucible" started an Off-Broadway run at the Davenport Theatre in October 2018. Salvatore D’Aquila, Christopher McCurry, James Wallwork, and playwright Kieran Knowles play the four men trapped by the bombing. The play is actor Kieran Knowles's first work as a playwright. Operation Crucible (play) Operation Crucible is a play | 163 | The Weavers (play) characters are proletarians struggling for their rights. Unlike most plays of any period, as pointed out many times in literary criticism and introductions, the play has no true central character, providing ample opportunities for ensemble acting. Barrett H. Clark's comments: "as one of Gerhart Hauptmann's experiments in dramatic form, "The Weavers" is highly significant. Instead of a hero, he has created a mob; this mob is, therefore, the protagonist—or chief character—and if individuals emerge from the rank and file they are not thrust into the foreground to stay long. It is the weavers as a class that is ever before | What Is Wrong with the English Playwright | James Joyce's one extant play, Exiles , has never been held in great critical esteem. But rather than viewing it as an aberration in the Joyce canon, a fairer reading of the play takes into consideration the play's own theatrical context: what contemporary dramatists were doing both in print and on stage, what evidence there is of Joyce's own theatrical interests and what models he may have used in his own playwriting. The conclusion is that Joyce, surprisingly, wrote neither a ‘bad’ Edwardian play nor a slavishly Ibsenist one, but a pastiche of Victorian and Symbolist drama that roots the play firmly in the theatrical currents of the 1890s. In addition, Harold Pinter's landmark productions of the play in 1970 and 1971 revealed affinities with postmodernist drama, so that the play looks forward as well as back – it is simply not of its own time. If Exiles seems out of step with the developments of modernism, that is largely because it takes its inspiration from the European experimental theatre of the fin de siecle – not from the theatrical world of the Dadaists, Joyce's contemporaries. While this realization may not rehabilitate Exiles into the modernist canon or indeed the theatrical one, looking at the play's context and history raises key questions about the role of theatre and performance in the historiography of modernism. | who wrote the first one act play in newari literature | the play tancred and gismund is a revised version of which play by | Contemporary Absurdist playwrights? | how many anti lynching plays were produced by african american playwrights between | The Plays of Margaretta D’Arcy and John Arden | what is the main problem with the title of the play ‘the seagull |
164 | Context, Not Conflict, Drives Cognitive Control. | Background. Context-dependent behavior is a phenomenon in which people demonstrate superior performance in the context where a motor task was originally learned, but show poorer performance in an u... | What is term for when mastery of one task conflicts with the learning of another task? | Evidence of the pervasiveness of neural reuse in the human brain has forced a revision of the standard conception of modularity in the cognitive sciences. One persistent line of argument against such revision, however, cites the evidence of cognitive dissociations. While this article takes the dissociations seriously, it contends that the traditional modular account is not the best explanation. The key to the puzzle is neural redundancy. The article offers both a philosophical analysis of the relation between reuse and redundancy as well as a plausible solution to the problem of dissociations. | In instrumental conditioning, there is a rather precise definition of goal-directed control, and therefore an acute boundary between it and the somewhat more amorphous category comprising its opposites. Here, we review this division in terms of the various distinctions that accompany it in the fields of reinforcement learning and cognitive architectures, considering issues such as declarative and procedural control, the effect of prior distributions over environments, the neural substrates involved, and the differing views about the relative rationality of the various forms of control. Our overall aim is to reconnect some presently far-flung relations. | Abstract Obsessive compulsive disorder (OCD) is associated with altered processing in brain regions involved in conflict resolution. However, limited research has examined the extent to which conflict from emotional distracters characterizes OCD such that responsiveness to task-irrelevant emotional stimuli is altered compared to controls. In the present study, 16 patients with OCD and 15 healthy controls underwent functional magnetic resonance imaging (fMRI) during resolution of conflict from emotional or nonemotional distracters. Results in healthy controls demonstrated that rostral anterior cingulate cortex (rACC), middle frontal gyrus (MFG), and medial superior frontal gyrus (MSFG) showed greater activation for high conflict versus low conflict. Responses in these regions differed between the emotional and nonemotional distracter tasks, with rACC and MSFG having greater activation for conflict from nonemotional distracters and anterior MFG showing greater activation for conflict from emotional distracters. Furthermore, between-group differences revealed a region in right posterior MFG in which controls similarly exhibited greater activation during high conflict versus low conflict with emotional distracters; however, OCD patients showed the opposite pattern with greater activation during low conflict compared to high conflict. These findings suggest that activity of right posterior MFG may be relevant in better understanding inefficient responding during emotional conflict in OCD. |
INTRODUCTION
Executive control (Miller and Cohen, 2001;Mansouri et al., 2016b) is essential for optimizing the flexible use of limited cognitive resources to currently prioritized tasks, in order to support goal directed behavior (Mansouri et al., 2009(Mansouri et al., , 2015b(Mansouri et al., , 2016bBonte et al., 2011). This control, amongst other processes, may be achieved via the detection and resolution of conflict between behavioral choices (Botvinick et al., 2001;Mansouri et al., 2007Mansouri et al., , 2009Marchewka et al., 2014;van Steenbergen et al., 2009;Olk et al., 2015). Conflict-induced behavioral adjustments appear as a decline in performance when conflict arises in a trial (conflict cost) and also as an improved ability to resolve the conflict in the subsequent trial (conflict adaptation) (Mansouri et al., 2009(Mansouri et al., , 2017b.
Recent studies indicate that executive control processes are influenced by emotional factors (van Steenbergen et al., 2009(van Steenbergen et al., , 2010Inzlicht et al., 2015;Saunders et al., 2015). There has been long lasting debate regarding the mechanisms underlying the interaction of emotion and executive control of behavior when a choice between conflicting-competing options becomes necessary (van Steenbergen et al., 2009(van Steenbergen et al., , 2010Fritz and Dreisbach, 2015). The dual competition model explains the interaction of emotion and executive functions in terms of shared processing resources (Egner et al., 2008;Mansouri et al., 2009;Pessoa, 2009;Etkin et al., 2011;Padmala et al., 2011). This model postulates that task performance is impaired in the presence of any task-irrelevant stimuli, whether emotionally salient or not, as resources for the primary task are utilized toward processing this external stimuli (Padmala et al., 2011). This proposition was validated in a study which revealed that the presentation of task-irrelevant images presented immediately prior to trials, increased reaction time (Hart et al., 2010;Padmala et al., 2011). Other studies also suggest that the interaction between executive functions and emotional regulation (Garcia et al., 2011) might be mediated through overlapping neural substrates as imaging studies have revealed a large overlap in brain areas which support executive functions and those which regulate emotional state (Bock, 2010). In this view, the demand for attentionalcognitive resources by each regulatory system might shape the outcome of interaction between emotional stimuli and executive functions and influence the ability to resolve conflict in various cognitive tasks.
In contrast to this, other models propose that priming of emotional state may specifically influence conflict monitoring and resolution (van Steenbergen et al., 2009(van Steenbergen et al., , 2010. This model stems from the proposal that conflict is innately aversive (Botvinick, 2007;Padmala et al., 2011), and postulates that conflict resolution is sensitive to emotional state, as it is dependent on the assessment of conflict as an aversive cue (van Steenbergen et al., 2010). This proposal was validated in studies where conflict-induced behavioral adjustments were either attenuated when paired with a reward, as the reward diminished the aversive assessment of the conflict (van Steenbergen et al., 2010), or enhanced when paired with a negatively valenced stimuli, as the stimuli heightened the aversive assessment of the conflict (Padmala et al., 2011).
Other models also propose that conflict has an affective cost (a negative influence upon emotion) while inducing behavioral adaptation to reduce further costs if this conflict reappears (van Steenbergen and Band, 2013). A related view proposes that resolving conflict is cognitively demanding and has an inherent cost, thus people aim to minimize cognitive efforts and avoid instances which induce them (van Steenbergen and Band, 2013). Complimentary to this, it has been shown that conflict between behavioral choices trigger negative emotional state and avoidance behavior (Schouppe et al., 2012;van Steenbergen and Band, 2013). It has been proposed that such negative emotion is an important factor in triggering and recruiting executive control to resolve the conflict . These studies suggest that the emergence of conflict and the efforts to resolve it or avoid its reoccurrence are associated with emotional state change and therefore what appears as interaction of emotion and executive control is an inherent property of conflict processing .
The interaction of emotional state and conflict might also be considered as a subset of a broader model of interaction between arousal-emotional state and decisionmaking processes. The somatic marker hypothesis postulates that alterations in emotional regulation and arousal state may influence the decision-making process (Bechara et al., 1999(Bechara et al., , 2005. In this context, conflict and its associated cognitive difficulty or uncertainty might induce emotional state change with concomitant autonomic and somatic responses and consequently influence executive functions and conflict resolution (Mansouri et al., 2017a).
In this study, we aimed at examining the interaction of background emotional information on executive functions, and specifically conflict processing. A prominently used neuropsychological test for assessing executive control, particularly the ability in resolving conflict between competing behavioral rules, is the Wisconsin Card Sorting Test (WCST) (Berg, 1948;Stuss et al., 2000;Mansouri et al., 2016a). The WCST assesses the participants' ability to shift between abstract rules (which change without notice) using trial and error (Mansouri et al., 2016a). Previous studies have revealed that this ruleshifting leads to conflict between potential rules, and impairs both accuracy and response time (RT) (conflict cost) (Monsell, 2003;Aron et al., 2004;Mansouri et al., 2016a).
We hypothesized that contextual factors with emotional content might convey emotional information and influence cognitive functions, particularly when resolving conflict requires recruitment and allocation of executive control (Mansouri et al., 2017a). Such an interaction between emotional regulation and cognitive control might influence the ability to resolve the conflict. Therefore, we introduced two sources (from two different modalities) of information with emotional content, "visual stimuli with emotional/social content" and "music, " while participants performed different versions of the WCST.
Previous studies have revealed that music may improve (Salamé and Baddeley, 1989;Bottiroli et al., 2014) or reduce (Furnham and Strbac, 2002;Brown et al., 2006) performance in various perceptual, motor, and cognitive tasks (Mansouri et al., 2016a(Mansouri et al., , 2017aFeizpour et al., 2018). It has been proposed that these effects may be mediated through the direct influence of music over executive functions by limiting available cognitive resources (Koelsch et al., 2006;Gyurak et al., 2011;Moore, 2013). Music may also influence emotional state and arousal (Cockerton et al., 1997) and indirectly alter the interaction of emotional and executive control processes, consequently modulating performance in cognitive tasks (Haddon and Killcross, 2006;Mansouri et al., 2016a). Our previous studies have indicated that music tempo is a crucial component of the acoustic stimuli which alters subjective experience, so that high-and low-tempo music evoke happy and sad feelings, respectively (Supplementary Material Control Study 2). In addition, high-tempo, but not low-tempo music, significantly affected the practice-related alterations in the response inhibition and this was accompanied by concomitant changes in arousal response in the context of Stop signal task (Mansouri et al., 2017a). Therefore, in this study we included high-tempo and low-tempo music as background acoustic conditions while participants performed the cognitive task and hypothesized that music would affect the emotionalarousal state and influence conflict resolution.
Previous studies have also shown that visual stimuli with emotional content influence performance in the context of various cognitive tasks (McKenna and Sharma, 1995;Tipples and Sharma, 2000;Rudebeck et al., 2006;Zarei et al., 2019). Inclusion of two sources of emotional stimuli from two different modalities (visual stimuli and music) could potentially help delineating the interaction of various emotional stimuli in influencing conflict processing. If both emotional factors elevate the arousal level their additive effects might appear as larger alterations in behavioral measures in the cognitive task.
We also monitored participant's event-related arousal/ emotional response during cognitive task performance in all conditions. Rapid transient shifts in electrodermal activity (EDA) (Wallin, 1981;Critchley, 2002;Lang and Bradley, 2010) can be measured as an index of arousal level and reflect emotional state change by aspects of cognitive task (e.g., conflict and error commission) and/or external modulating factors, such as music (Zimny and Weidenfeller, 1963;Bechara et al., 1999;Khalfa et al., 2002;Hajcak et al., 2003;Garcia et al., 2011;Ullsperger et al., 2014;Ebitz and Platt, 2015;Mansouri et al., 2017a). We hypothesized that if changes in arousal level mediate the interaction of emotion and conflict processing, this would be reflected in concomitant changes in event-related EDA.
MATERIALS AND METHODS
Participants
Fifty-five Monash University undergraduate (third year) students (35 female) were recruited to complete the WCST in three separate 2-hour sessions, each one week apart. A priori power analysis was performed for the estimate of required sample size based on data obtained and reported in our recently published study (Mansouri et al., 2016b). The effect size for conflict-induced behavioral adjustment (conflict adaptation) was estimated using Cohen's criteria (Cohen, 1988) based on η p 2 , which was 0.156. With an alpha set at 0.05, and power set at 0.80, the estimated sample size required for this effect size was 36 participants (using G * Power 3. 1 Faul et al., 2007). To achieve counterbalancing for all conditions we recruited even more participants. Thus, our sample size of 55 is adequate for the detection of the smallest effect with 80% power, given the current design. All participants (age range between 20 and 27) had similar educational background and no history of any neurological disorders. Approval was obtained from Monash University Human Research Ethics Committee. Written and informed consent was obtained from all participants.
Apparatus
An automated test apparatus was used to perform the WCST. Participants were seated in front of a switch and a touchsensitive screen (17 MicroTouch surface capacitive touch display) on which the stimuli were displayed. Participants were approximately 60 cm from the screen and were informed to maintain focus in the middle of the screen. The size of each stimulus ranged between 5 and 7 cm. The switch was fixed on a pad with a wrist rest in line with the bottom center of the screen. The subjects were informed to only use their dominant index finger to press the switch and then the target stimulus on the screen.
Participants were also monitored via camera during the completion of the task. Data acquisition was controlled by CORTEX program (National Institute of Mental Health) at millisecond resolution. Before performing the WCST, participants read an explanatory note regarding the test procedure following this a structured verbal briefing was also provided, using a written script to ensure consistency.
Procedure
The main task shown in Figure 1 has been described and validated in previous studies (Mansouri et al., 2007(Mansouri et al., , 2014(Mansouri et al., , 2016a. The start cue was an emotionally salient image (positive, negative or neutral images) presented randomly at the start of each trial. After the start cue onset, participants had to press the switch with their dominant index finger within 10 s. If the switch was pressed, the start cue was replaced by a sample stimulus (for 400 ms). If the participant kept the switch pressed, three test items appeared surrounding the sample (to the left, right, and below the sample stimulus). The sample stimuli presented were selected at random from a set of 36 stimuli (combination of 6 colors and 6 shapes). The test items were also selected from this pool at random (with restrictions imposed to meet the necessity to generate either a congruent or incongruent condition). Once test items were displayed, participants had to rapidly release the switch and touch the appropriate test item that matched the sample according to the relevant rule. Participants had to respond as quickly as possible within a limited time window (900 ms). Failure to touch the screen within this window was considered as a time-out error. If target selection was correct, confirmation feedback was given to the subject (the target item flashed twice). However, if erroneous, all presented stimuli were replaced with a large error signal (a purple annulus) which was displayed for 500 ms. Early release of the switch during the presentation of the sample stimuli alone was also considered as an error.
The appropriate matching rule (either color or shape) was maintained in blocks of trials, and changed without any notice when the shift criterion (9 correct responses from 10 trials) was met. Within the task there were two trial types, incongruent and congruent, with two levels of conflict between the behavioral rules (Figure 1). Within incongruent trials the sample stimuli matched one of the test items in color, yet another item in shape. The other test item did not match the sample in either shape or color. Therefore, participants had to resolve the conflict between the two potentially matching targets in applying the appropriate rule FIGURE 1 | Wisconsin Card Sorting Test (WCST). The incongruent (also termed high-conflict) and congruent (also termed low-conflict) trials were randomly presented, in equal proportion, throughout the testing period. and selecting the correct target item. However, within congruent trials, the sample stimuli matched one of the test items in both color and shape, but did not match with the other test items in color nor shape. Thus, in congruent trials there was only one potentially matching target.
Each weekly testing session comprised of two stages of the WCST with a 10-minute break between stages to minimize fatigue effects. Each of these two testing stages ran for approximately 30 to 45 minutes, dependent on performance. The task commenced with three practice blocks, in which data was not analyzed. The first practice block included only congruent trials, while the second and third practice block included only incongruent trials, requiring the application of the color or shape rule, respectively. Within these practice blocks the shift criterion was set at 5 correct responses from 5 trials. Following these practice blocks, 10 blocks were ran, alternating between the color or shape rule with the aforementioned rule shift criterion (9 correct responses from 10 trials).
Electrodermal Activity Recording
Event-related EDA was recorded, in microsiemens (µS), continuously for the entire duration of the task (at 75 kHz sampling rate using an electrodermal recording unit: ML116 GSR Amp and PowerLab 26T, ADInstruments). Task-relevant events were simultaneously encoded during EDA recording. The electrodes were connected to the palmar surface of the index and ring fingers of the non-dominant hand, and participants were informed to keep this hand stationary during testing.
Amplitude of phasic activity was measured as the difference between the maximum and minimum value of the EDA waveform within an event-related epoch (Wolfram, 2012). Within this study, two epochs were used: a post-feedback epoch [response selection onward (4 s)], to examine changes in arousal level after the awareness of trial outcome, and a pre-feedback epoch [From the start cue to response feedback onset (2.4 s window)], to examine changes in arousal level before feedback.
Visual Images With Emotional Content
We used music and visual stimuli as "background contextual stimuli" without any relation to the rule-based target selection which was the main task in the WCST. For visual stimuli, multicolor images of items and faces were categorized (by one female and one male) to images with positive, negative and neutral emotional content.
At the start of each trial, multi-colored natural or cartoon images including human faces were shown as the Start-cue. These visual images were categorized to three conditions with positive, negative and neutral emotional content by one female and one male before the start of data collection. Visual images were not repeated in the testing session to avoid multiple exposure (trial unique design). Participants performed the test in three consecutive weeks and none of the visual stimuli was repeated. Trial unique design for exposing the participants to emotional stimuli was a crucial aspect of our study because any repeated exposure would have introduced confounding issues such as familiarity and memory processing and indirectly evoked other cognitive processes and associated changes in arousal state.
Participants were not aware of the categorization of the visual images based on their emotional content and were instructed to press a switch and initiate the trial as soon as they see any image. The presentation of the images as start cues, enables the examination of the influence of emotional stimuli on behavior and on arousal state. Concomitant alterations in arousal level was assessed in before (pre-feedback epoch) or after feedback (post-feedback epoch) to participants' responses.
We also replicated the study using stimuli from the Nencki Affective Picture System (NAPS). NAPS is a large collection of multicolor photographs classified into five categories (People, Faces, Animals, Objects, and Landscapes) and are controlled in terms of "dimension, " "luminance, " "entropy, " and "contrast" (Marchewka et al., 2014;Riegel et al., 2016). In Supplementary Material Control Study 2 a subset of 360 images (same size of image pool as the main study) were randomly selected from the NAPS pool of images (120 for each emotional category: positive, negative, neutral). In NAPS, the emotional aspects of images were rated on a scale of 1-9 by 204 people, on subjective "valence" and "arousal." We assigned images to three separate categories (Positive, Negative, and Neutral) based on each image's ranking for Affective valence (Marchewka et al., 2014). Images within a range of 1.00-2.50, 3.75-6.25, and 7.50-9.00 were used for the selection of Negative, Neutral, and Positive image pool, respectively.
Music
In each of the three weekly testing sessions, participants listened to one of the three types of music: high tempo with lyrics, low tempo with lyrics, or no-lyric music (of mixed tempo) for the duration of the task. We included no-lyric music to control for any effect of lyrics. We first selected a set of pop songs and then classified them based on their tempo: low [80-100 beats per minute (bpm)] and high tempo (120-140 bpm) music. Songs were excluded if they contained any offensive lyrical statements. The volume of the music across sessions was set (at 70 decibels), however, participants were able to change it only if it was too loud or quiet. The order of the three music conditions (low tempo, high tempo and no-lyrics) was counterbalanced across weekly testing sessions (see Supplementary Table S1 for the list of songs).
Data Analyses
Each of the daily testing sessions comprised of two testing stages (first and second), which allowed assessment of within-session practice-related learning (Fehring et al., 2019). We measured the time from the onset of the target stimuli to the first touch on the screen as RT. Repeated-measure Analysis of Variance tests (ANOVA) were used to assess the effects of practice, emotional images and music on various behavioral measures. All data points were used in data analyses without removal of outliers. In this study, participants had to deliver a response within a limited response window (900 ms) and if participants could not deliver their response within this window the trial was assigned as a timeout trial. Therefore, all RT data used for analyses were within this response window. Implementing arbitrary procedures for the removal of outliers might bias the results and outcome of statistical analyses. Therefore, we followed our previously published approach (Mansouri et al., 2016b(Mansouri et al., , 2017a and did not remove any data point as outlier and included all data points in the statistical analyses. Distributional properties for key measures are shown in Supplementary Figure S2.
To ease comparison of the emotional conditions (such as positive, negative, neutral) and different sessions, RT and EDA were calculated for each condition in each testing stage and then normalized by dividing each value by the grand average for all conditions. We have implemented such normalization procedure for RT (Mansouri et al., 2007(Mansouri et al., , 2015a(Mansouri et al., , 2016b(Mansouri et al., , 2017a and EDA (Mansouri et al., 2017a) in our previous studies. Early switch release during sample presentation was considered as an error and participants received an error signal to avoid such errors, however, these procedural errors were not included in the calculation of accuracy. When coloror shape-matching was required, the majority of errors were perseverative errors (selecting the target based on irrelevant rule) or timeout trials and participants rarely committed nonperseverative errors (selecting the target that did not match the sample by either color or shape). Accuracy was calculated as the percentage of correct trials [correct trials/(correct + perseverative errors + non-perseverative error + timeout trials)] and analyzed without normalization. All participants successfully completed the required number of rule-shifts and achieved high percentage of correct responses in the WCST and therefore accuracy data were used without normalization (Mansouri et al., 2015a(Mansouri et al., , 2016a(Mansouri et al., , 2017a.
Each participant performed rule-based target selection at different conflict levels and therefore Conflict was included in a ANOVA as a within-subject factor. Each participant was exposed to all categories of visual images and different background Music conditions. Therefore, Emotion (visual stimuli with emotional content: positive/negative/neutral) and Music (high-tempo/Low-tempo/mixed tempo with no-lyrics) were included in the ANOVA as within-subject factors. For repeated-measure ANOVA, sphericity was examined (Mauchly's test) and Greenhouse-Geisser correction was applied when necessary. The alpha level was set at 0.05 for all statistical tests. For significant effects, η p 2 was also reported, which indicates the proportion of the variance explained by the effect in ANOVA analysis. Where significant interactions were detected pairwise comparisons were conducted. All pairwise comparisons were two-tailed t test with Bonferroni adjustment for multiple comparison. To ease interpretation when presented graphically: Significance level of * p < 0.05, * * p < 0.01, and * * * p < 0.001. No additional manipulations of data or measures were implemented.
RESULTS
We first report the results obtained in the Main blocks in which color or shape was the relevant matching rule. Participants rarely (<10%) chose the test item which did not match the current rule (color or shape), and only rarely committed errors in congruent trials. Within incongruent trials, most errors committed were perseverative, defined as selecting the target item which matched the sample by the alternative rule. These perseverative errors were mostly committed immediately after the rule change.
Emotionally Negative Visual Stimuli Enhance Conflict Resolution
Music and visual stimuli with emotional content can potentially influence the emotional/arousal state. To examine the interaction of these factors with aspects of executive control such as conflict processing and practice-related learning, we applied a multi-factor ANOVA [Conflict (congruent/incongruent trials, within-subject factor) × Music (high tempo with lyrics/low tempo with lyrics/mixed tempo with no-lyrics, within-subject factor) × Practice (first/second stage of testing, withinsubject factor) × Emotion (visual stimuli with emotional content: positive/negative/neutral, within-subject factor)] to RT in correct trials. The main effect of Conflict was significant, F(1,54) = 222.09; p < 0.001, η p 2 = 0.80, indicating that the higher level of conflict in incongruent trials increased RT (conflict cost) ( Figure 5A). There was a significant main effect of Practice, F(1,54) = 14.51; p < 0.001, η p 2 = 0.21, indicating that RT decreased from the first to the second stage in the same testing day (within-session learning).
Importantly, the main effect of Emotion was significant, F(2,108) = 9.20; p < 0.001, η p 2 = 0.15, indicating that the emotional content of the visual stimulus influenced RT. Pairwise comparisons (two-tailed t test with Bonferroni adjustment for multiple comparison) of the differences in RT for each emotional condition revealed that trials which commenced with negative emotional stimuli had the lowest RT in comparison to those which commenced with a positive (p < 0.001) or neutral (p = 0.02) stimuli (Figure 2A). Furthermore, there was also a significant difference in RT between trials which commenced with positive stimuli and those with neutral stimuli (p = 0.03). We also used another set of visual stimuli (NAPS image system) in another participant cohort (Supplementary Material Control Study 2). The results with the new image set replicated and confirmed that exposure to the negative stimuli enhanced performance, as indexed by the lowest RT and higher accuracy in comparison to positive and neutral stimuli exposure (Supplementary Figure S3).
There was also a significant interaction between Conflict and Emotion, F(2,108) = 26.37; p < 0.001, η p 2 = 0.33, indicating that the effect of emotional stimuli was dependent on the level of conflict. RT was shorter in incongruent trials which contained negative stimuli however, such a decline in RT was not observed in congruent trials ( Figure 3A). Figure 3B shows the difference in RT between congruent and incongruent trials (conflict cost for each emotional category). Pairwise comparisons (two-tailed t test with Bonferroni adjustment for multiple comparison) of the differences in conflict cost for each emotional condition revealed that negative stimuli attenuated the magnitude of conflict cost in comparison to positive (p < 0.001) and neutral (p < 0.001) stimuli.
The main effect of Music was not significant, F(2,108) = 1.93; p = 0.15, indicating that music did not influence RT. There was a significant interaction between Conflict, Emotion and Practice, F(2,108) = 3.26; p = 0.04, η p 2 = 0.06, indicating that the rate of within-session learning was heightened in incongruent trials commencing with an emotionally negative stimulus ( Figure 3C). To further assess this 3-way interaction, we calculated the difference in learning between congruent and incongruent trials for each emotional condition ( Figure 3D). The learning related decline in conflict cost was significantly higher in negative condition when it was compared with neutral emotional condition (two-tailed t test with Bonferroni adjustment for multiple comparison p = 0.04). The difference between negative and positive conditions was not significant (p = 0.08). There were no other significant main effects, nor significant interactions.
The multi-factor ANOVA [Conflict × Music × Practice × Emotion] was also applied to the percentage of correct responses. The main effect of Conflict was significant, F(1,54) = 83.84; p < 0.001, η p 2 = 0.61, indicating that accuracy was lower in incongruent trials. The main effect of Emotion was also FIGURE 2 | Emotional content of images shown as the start cue influenced performance in the WCST. (A) Response time (RT) in correct trials are shown for each emotional category. RT was lowest in trials which contained a negative visual stimulus (shown as the start cue) (B) The percentage of correct trials are shown for each emotional category. Accuracy was the highest in trials which contained a negative visual stimulus. * represents p < 0.05, * * * represents p < 0.001.
Frontiers in Human Neuroscience | www.frontiersin.org FIGURE 3 | Behavioral effects of conflict were modulated by the emotional content of visual stimuli. (A) RT in correct trials are shown for congruent and incongruent trials for each emotional category. The effects of emotional stimuli was dependent on the conflict level. Incongruent trials, which commenced by negative stimuli had a decreased RT, while in congruent trials this effect was not observed. (B) The difference in RT between congruent and incongruent trials, conflict cost, is shown for each emotional category. Negative stimuli attenuated the magnitude of conflict cost. (C) Rate of learning (the difference in RT between the first to the second stage of testings in the same daily session) is shown for congruent and incongruent trials for each emotional category. Within session learning was dependent on the emotional valence and the conflict level. (D) Difference in learning between incongruent and congruent trials is shown (incongruent -congruent) for different emotional conditions. Learning decreased the conflict cost (difference between incongruent and congruent trials) in negative emotional conditions. * represents p < 0.05, * * * represents p < 0.001. significant, F(2,108) = 10.26; p < 0.001, η p 2 = 0.16, indicating that the emotional content of the visual stimulus influenced accuracy ( Figure 2B). Pairwise comparison of the differences in accuracy for each emotional condition (two-tailed t test with Bonferroni adjustment for multiple comparison) revealed that trials which commenced with negative visual stimuli had the highest accuracy in comparison to those which commenced with positive (p < 0.001) or neutral (p < 0.001) stimuli. The main effect of Practice, F(1,54) = 9.77; p = 0.003, η p 2 = 0.15, was also significant. There were no other significant main effects, nor significant interactions. These findings indicate that the presentation of negative emotional stimuli at the beginning of a trial significantly improved the resolution of conflict between behavioral rules.
Conflict Adaptation Was Influenced by Emotional Content of Visual Stimuli
The behavioral effects of conflict are not just limited to the current trial, and can also be observed in the subsequent trial, manifested as a behavioral improvement if the subject is faced with the same level of conflict again (conflict adaptation) (Gratton et al., 1992;Botvinick et al., 1999;Mayr et al., 2003;Mansouri et al., 2009). In the context of the WCST, this can be examined through contrasting incongruent trials that were immediately preceded by another incongruent trial (HH sequence) against those incongruent trials that were immediately preceded by a congruent trial (LH sequence). We examined whether conflict adaptation was influenced by emotion-modulating factors such as music and visual stimuli. A multi-factor ANOVA [Conflict Adaptation (HH/LH sequences, withinsubject factor) × Music × Practice × Emotion] was applied to RT in the second trial in both HH and LH sequences. The main effect of Conflict Adaptation was significant, F(1,54) = 80.54; p < 0.001, η p 2 = 0.60, and manifested as a lower RT in HH sequences than LH sequences ( Figure 6A). The main effects of Practice, F(1,54) = 13.93; p = 0.01, η p 2 = 0.21, and Emotion, F(2,108) = 17.27; p < 0.001, η p 2 = 0.24, were also significant. Importantly, there was a significant interaction between Conflict Adaptation and Emotion, F(2,108) = 3.73; p = 0.03, η p 2 = 0.07, indicating that the magnitude of conflict adaptation was differentially influenced by the emotional content of the visual stimuli (Figures 4A,B). For ease of comparison Figure 4A presents the normalized RT for both LH and HH sequences, while Figure 4B presents the magnitude of conflict adaptation (LH-HH). Pairwise comparisons (two-tailed t test with Bonferroni adjustment for multiple comparison) of the FIGURE 4 | Conflict adaptation was modulated by the emotional content of visual stimuli. (A) The RT for incongruent trials that are immediately preceded by another incongruent trial (HH sequence), and those incongruent trials that are immediately preceded by a congruent trial (LH sequence) is shown for each emotional category. In both LH and HH sequences, trials which contained a negative start cue had lower RT than those which contained a positive start cue. (B) The magnitude of conflict adaptation (the difference in RT between LH and HH sequences) is shown for each emotional category. The magnitude of conflict adaptation was highest in trials which commenced with positive stimuli. * represents p < 0.05, * * * represents p < 0.01. differences in conflict adaptation for each emotional condition revealed that the magnitude of conflict adaptation was increased in trials which commenced by positive stimuli in comparison to those which started with negative (p = 0.046) or neutral (p = 0.003) stimuli. However, this increase was primarily facilitated from the higher RT in LH sequences with positive stimuli (Figure 4A). There were no other significant main effects, nor significant interactions.
This ANOVA was also applied to the accuracy in the second trial in both HH and LH sequences. The main effect of Conflict Adaptation was significant, F(1,54) = 493.45; p < 0.001, η p 2 = 0.90, indicating that accuracy was increased when the high conflict level was presented again (HH sequences). There were no other significant main effects, nor significant interactions.
Conflict Processing in the WCST Influenced Emotional/Arousal State
We measured event-related EDA within two epochs: a postfeedback epoch [response selection onward (4 s)], to examine changes in arousal level after the participants became aware of their decision outcome, and a pre-feedback epoch [from the start cue to response feedback onset (2.4 s window)], to examine changes in arousal level before feedback.
Participants' RT was longer in incongruent trials than congruent trials (Figure 5A), indicating that conflict between behavioral options adversely affected performance in the WCST (conflict cost). To examine if processing conflict led to a shift in arousal level a multi-factor ANOVA [Conflict × Emotion × Music × Practice] was applied to post-feedback EDA in congruent and incongruent trials. The main effect of Conflict was significant, F(1,54) = 36.14; p < 0.001, η p 2 = 0.40, and EDA was higher in incongruent trials. This indicates that conflict between behavioral options evoked a higher EDA and presumably a higher arousal level ( Figure 5B). This suggests that following the behavioral effects of a higher level of conflict (Figure 5A), conflict-induced elevation in arousal level occurs as a sustained effect of conflict during the assessment of behavioral outcome (Figure 5B).
Although the emotional stimuli influenced behavior, no modulation of pre-or post-feedback arousal level was observed (p = 0.632 and p = 0.096. respectively). These indicate that the influence of emotional stimuli upon behavior was not necessarily mediated through changes in arousal level, but rather through a direct influence on executive control processes.
Conflict Influenced Behavior and Arousal in the Following Trial
To examine whether conflict adaptation (Figure 6A) was also accompanied by shifts in emotional/arousal state, we applied a multi-factor ANOVA [Conflict Adaptation (HH/LH) × Emotion × Music × Practice] to the pre-feedback EDA in the second trial of HH and LH sequences. Pre-feedback EDA was selected for this analysis as the process of conflict adaptation must be triggered in the preceding trial and continue into the current trial to influence response selection. The ANOVA indicated that the main effect of Conflict Adaptation was highly significant, F(1,52) = 11.70; p = 0.001, η p 2 = 0.20. This indicates that the process of conflict-induced behavioral adaptation is also reflected in changes in EDA and presumably in emotional/arousal state. In HH sequences, pre-feedback EDA was lower than that of LH sequences, implying that the process of conflict adaptation is accompanied by lower levels of arousal ( Figure 6B). This suggests that those cognitive processes mediating the conflict-induced recruitment of executive control (Botvinick, 2007;Carter and van Veen, 2007;Mansouri et al., 2009Mansouri et al., , 2017b also influence emotional/arousal state. There were no other significant main effects, nor significant interactions. Furthermore, to assess if conflict adaptation is also accompanied by concurrent changes in post-feedback arousal level, we applied the multi-factor ANOVA [Conflict The RT is shown for correct incongruent and congruent trials. RT was longer in incongruent trials than that congruent trials (conflict cost). (B) Post-feedback EDA is shown for correct incongruent and congruent trials. Post-feedback EDA was significantly higher following incongruent trials.
Adaptation × Emotion × Music × Practice] to the post-feedback EDA in the second trial in both HH and LH sequences. The main effect of Conflict Adaptation was significant, F(1,53) = 34.03; p < 0.001, η p 2 = 0.39, indicating that conflict adaptation was also accompanied by post-feedback arousal shifts. The highest level of arousal was observed within LH trial sequences ( Figure 6C). There were no other significant main effects, nor significant interactions.
These findings indicate that conflict induces alterations in both behavior and arousal level in the following trial. The improvement in behavioral performance seen as a shorter RT ( Figure 6A) was accompanied by a lower arousal level in the periods before ( Figure 6B) and after feedback (Figure 6C) in the second trial of HH sequences.
DISCUSSION
Our findings identified intriguing interactions between contextual factors with emotional content and conflict processing in the context of the WCST. We also assessed concomitant alterations in arousal level that reflected such behavioral alterations. We will discuss the significance of these findings in two aspects:
(1) Modulation of conflict resolution and conflictinduced behavioral adjustment by contextual emotional information.
(2) Alterations in arousal level in relation to the interaction between conflict processing and emotional information.
Conflict Resolution Was Modulated by Contextual Emotional Information
Within the computerized WCST, the start cue was an image with emotional content of either positive, negative or neutral valence. We found that the emotional content of these stimuli induced significant changes in performance. RT was decreased ( Figure 2A) and accuracy was enhanced ( Figure 2B) in trials which commenced with negative stimuli. Executive functions and emotional regulation are intrinsically linked in goaldirected behavior (Bock, 2010;Garcia et al., 2011), with the somatic marker hypothesis proposing that alterations in emotional and arousal state may influence decision making (Bechara et al., 1999(Bechara et al., , 2005. In line with this hypothesis, our findings indicate that a brief exposure to emotional stimuli at the start of a trial, induced changes in emotional state and consequently influenced conflict resolution. Negative emotional stimuli distinctly enhanced performance, complimentary to the proposal that negative stimuli may be more salient than equivalent positive stimuli (McKenna and Sharma, 1995;Tipples and Sharma, 2000), due to evolutionary mechanisms which prioritize threat responses within the environment (Eysenck, 1997). In the context of an emotional Stroop task (McKenna and Sharma, 1995), performance was impaired in trials which contained negative stimuli. Albeit in the opposing direction, this result is compatible with our findings. Within their task, emotional stimuli were presented at response selection, whereas within our task the emotional stimuli were presented at the start of the trial. Therefore, in their study the heightened saliency of negative stimuli might have engaged attentional resources at the point of response selection and consequently disrupted performance. Whereas, within our study the heightened saliency of the negative stimuli presented at the start of the trial may heighten attention and executive control processes, consequently improving behavioral performance, as observed (Figures 2A,B).
These findings indicate that the higher saliency of negative stimuli may modulate behavior across various tasks via augmenting attention, having the capacity to either heighten or impair performance dependent on when the stimuli is presented. In our study, emotional content of visual stimuli modulated behavior, but did not alter EDA in pre-or post-feedback periods. Therefore, the effects of emotional stimuli were not necessarily mediated through alterations in trial-by-trial arousal level. Instead, emotionally salient stimuli might divert attention FIGURE 6 | Conflict adaptation was accompanied via concurrent shifts in both pre-and post-feedback arousal. (A) The RT is shown for incongruent trials preceded by another incongruent trial (HH) and incongruent trials preceded by a congruent trial (LH). RT was shorter in HH sequences than LH sequences. (B) Pre-feedback EDA in the second trial in both HH and LH sequences are shown. The history of conflict level in the first trial in the sequences modulated pre-feedback EDA in the second, with incongruent trials preceded by another incongruent trial (HH) having lower pre-feedback EDA than those incongruent trials preceded by a congruent trial (LH sequences). (C) Post-feedback EDA in the second trial in both HH and LH sequences are shown. Similarly, to the pre-feedback epoch concomitant shifts in arousal accompanied conflict adaptation, with incongruent trials preceded by another incongruent trial (HH) having lower post-feedback EDA than those incongruent trials preceded by a congruent trial (LH sequences).
from extra-task events or inner mental world (attenuating mind wandering) toward the on-going task and therefore enhance upcoming task performance.
Conflict between available behavioral options impairs performance in numerous neuropsychological tests (Botvinick et al., 2001;Kerns et al., 2005;Carter and van Veen, 2007;Melcher et al., 2008;Mansouri et al., 2009Mansouri et al., , 2014Mansouri et al., , 2016aWessel et al., 2014). As demonstrated in this study, and past studies (Mansouri et al., 2009(Mansouri et al., , 2016a, RT was longer in incongruent trials than congruent trials ( Figure 5A). The behavioral effects of the emotional content of the start cue was dependent on the conflict level ( Figure 3A) and appeared as a larger modulation in incongruent trials. This suggests that the influence of emotional state on performance is exaggerated when there is more demand for executive control of behavior.
We found significant practice-related learning within each testing session, which appeared as an improved ability in resolving conflict. Interestingly, this practice-related learning was also modulated by emotional state and was dependent on the conflict level ( Figure 3C). Negative stimuli enhanced practicerelated learning in incongruent trials, but had an opposite effect in congruent trials ( Figure 3C). This suggests that within-session learning depends on an interaction between various contextual factors that influence executive and emotional regulation in the context of goal-directed behavior.
Our results do not fit within the emotional priming model which stems from the postulation that conflict is innately aversive (Botvinick, 2007;Padmala et al., 2011), and sensitive to emotional state (van Steenbergen et al., 2010). This idea gained support from a study where conflict-induced behavioral adjustments were attenuated when paired with a reward, as the reward diminished the aversive assessment of the conflict (van Steenbergen et al., 2010). Furthermore, this model was elaborated upon (Padmala et al., 2011) suggesting that heightening the aversive assessment of conflict, through the pairing of conflicting behavioral choices and negative stimuli, may increase the magnitude of conflict-induced behavioral adaptations (Padmala et al., 2011). The emotional priming model predicts that negative stimuli would heighten the aversive nature of the conflict, increasing conflict-induced behavioral adjustment manifested as an increased magnitude of conflict cost.
However, we found that negative stimuli instead attenuated the magnitude of conflict cost (Figure 3B), and therefore our results are in contrast to this model. Therefore, an alternative explanation could be that the influence of emotional content on conflict is mainly facilitated through the modulation of attention. As negative stimuli may be more salient than equivalent positive stimuli (McKenna and Sharma, 1995;Tipples and Sharma, 2000), the heightened level of attention induced by negative stimuli might enhance conflict resolution, and consequently attenuate conflict cost.
We found heightened practice-related learning in incongruent trials that commenced with negative emotional stimulus. It can be suggested that the heightened "attention capture" by negative stimuli promoted an increased rate of learning within incongruent trials (Figures 3C,D).
Emotional Stimuli Influenced Executive Functions Without Changing Arousal Level
Although emotional visual stimuli influenced behavior, no modulation of pre-or post-feedback arousal was observed, indicating that the influence of emotional stimuli upon behavior was not necessarily mediated through changes in trial-by-trial arousal level. In our study, categorization of visual stimuli based on emotional content was done by independent raters and not by participants. They were also presented in a trial unique design. These were necessary to avoid the effects of repeated exposure to visual stimuli which could have evoked alterations in cognitive processes and arousal level due to familiarity and memory processing. We did not categorize visual stimuli based on the evoked arousal level because it could have introduced a bias in the outcome of our study and prevented assessing whether emotional stimuli induce their cognitive effects through changes in arousal level. We believe this was an important improvement (difference) in our task design, which allowed us to show "emotional stimuli affect executive functions without changing arousal level." We may also assume that other features in visual stimuli such as complexity or lowlevel visual features, rather than the emotional content, could have led to behavioral modulations. We used a large set of stimuli, which were matched for their overall size and resolution and then categorized them by two independent assessors. Each participant was exposed to a large pool of stimuli in each category in a trial unique design in three consecutive weeks. Stimuli in each category included images with very different features. For example, the negative category included picture of a wound or image of a crying baby and therefore various colors, objects and complexity levels were included in each category. Therefore, it is highly unlikely that the behavioral effects were due to a particular feature or low-level visual information. The behavioral modulation was seen by negative stimuli and not by neutral or positive stimuli and therefore, attributing the differences to a difference in low-level visual information between the emotional categories and neutral images does not fit the findings.
Executive control and emotional regulation are intrinsically interrelated (Garcia et al., 2011), with imaging studies revealing a large overlap in brain areas which support executive control functions and those which regulate emotional state such as the amygdala, insula and prefrontal cortex (Craig, 2002;Bock, 2010;Mansouri et al., 2016b). As emotional stimuli modulated behavior without concurrent alterations in arousal level it can be proposed that this modulation occurred primarily through a direct influence on these executive control/emotional areas, rather than an alternative indirect influence facilitated via shifts in arousal level. It is important to acknowledge that shifts in arousal level accompanying conflict-induced behavioral adjustments were detected by our recording system. Therefore, the absence of a change in arousal level by the emotional stimuli was not due to a lack of sensitivity in the measurements. This framework diverges from a bulk of past research which has proposed that the influence of emotional content on behavior was primarily facilitated via changes in arousal level. Our findings instead indicate that emotional regulation is directly associated with cognitive flexibility and control of goal-directed behavior, and may be independent of changes in arousal level.
In contrast to the observed effects of emotional visual stimuli, which were dependent on valence, we did not find any significant modulation of performance depending on the music tempo. In Supplementary Material Control Study 1 we confirmed that participants could perceive differences between music conditions dependent on tempo, and therefore the absence of music effect was not because of an inability to distinguish differences in music characteristics. These findings suggest that in the context of the WCST emotional content of visual stimuli is more effective in modulating behavior than alterations in music tempo.
Conflict-Induced Behavioral Adjustments Were Accompanied by Shifts in Arousal Level
We found that conflict-induced behavioral adjustment in the current trial (conflict cost) and in the subsequent trial (conflict adaptation), were accompanied by parallel changes in arousal level. In correct trials, post-feedback EDA was higher in incongruent than congruent trials (Figure 5B), indicating that the higher level of conflict present within incongruent trials evoked parallel shifts in both arousal and behavior (Figures 5A,B). This increase in arousal level in response to conflict was previously reported in other autonomic measures of arousal, such as pupil dilation (Brown et al., 1999;Gilzenrat et al., 2010;van Steenbergen and Band, 2013;Ebitz and Platt, 2015). Furthermore, we found that arousal was also influenced by conflict adaptation and appeared as a difference in EDA between the second trial of HH and LH sequences in both pre-and post-feedback epochs (Figures 6B,C). Pre-feedback arousal was lower in HH sequences than that of LH sequences. This shift in arousal level was dependent upon the conflict level in the preceding trial and presumably occurred concurrently as conflict-induced recruitment of executive control facilitated the conflict resolution in the second trial of HH sequences. Thus, it can be proposed that this arousal shift may be an autonomic manifestation of conflict-induced executive control adjustment. Moreover, within the post-feedback period arousal was still lower in HH sequences than that of LH sequences. These results are complimentary to a study which revealed concomitant shifts in pupil size, as an index of arousal, and conflict adaptation processes in the context of the Simon Task (van Steenbergen and Band, 2013), where the degree of pupil dilation positively correlated with the magnitude of conflict adaptation. An alternative hypothesis is that in the second trial of HH sequences, additional executive control processes are recruited and the system is in a better condition to resolve the conflict. This might decrease conflict-related uncertainty and therefore attenuate arousal levels in HH conditions.
LIMITATIONS
In this study, participants were young adults within a limited age range (20-27 years old) and were all university students and therefore, it was a uniform cohort highly suitable for decreasing between-subject variabilities. However, generalizing our findings to other age ranges or the general population needs to be cautiously done. Future studies will be necessary to examine the interaction of emotional stimuli and conflict processing in children and elderly to verify whether the observed effects are age related. In addition, we used contemporary songs separated based on their tempo as background music. Future studies need to examine a broader range of music. The first set of visual stimuli used in this study were not rated by participants in terms of arousal or valence. However, in Control study 2, we used the second set of visual stimuli (NAPS images), which were rated based on arousal and valence by 204 people. Our findings with the first set were replicated and confirmed in Control study 2. Future studies may assess the correlation between subjective assessment of stimulus valence and arousal and the behavioral effects of emotional stimuli. In our study, the emotional stimuli were irrelevant to the task performance and therefore participants did not need to pay attention to them. It will be crucial to examine the interaction of emotional regulation and conflict processing when resolution of conflict depends on the processing of emotional information.
CONCLUSION
We examined the effect of contextual factors with emotional content on conflict processing and arousal in the WCST. Our findings identified that brief exposure to emotional stimuli can modulate behavior, with behavior enhanced following negative stimuli. However, arousal was not modulated by emotional content. We have replicated and validated these findings in a control study (Supplementary Material Control Study 2) with a completely different set of images in another participant cohort.
This additional study confirmed that the effects of emotional stimuli do not depend on a particular set or type of images and instead arises from emotional valence of visual images. We propose that the emotional modulation of behavior occurs primarily through a direct influence on highly interrelated brain areas which support conflict resolution and emotional regulation, rather than indirectly via changes in arousal level. Such an interaction might also be mediated through alterations in allocation of attention without altering arousal level. This novel framework diverges from a plethora of past research which postulated that the influence of emotion on behavior was primarily facilitated via changes in arousal level. Future research should more so consider the hypothesis that emotional regulation is directly associated with cognitive flexibility and control of goal-directed behavior, and may be independent of arousal level.
DATA AVAILABILITY
The datasets for this manuscript are not publicly available because, other factors within the datasets are still being examined. However, datasets are available to editors and reviewers upon request. Requests to access the datasets should be directed to FM, [email protected].
ETHICS STATEMENT
The approval was obtained from Monash University Human Research Ethics Committee. Written consent was obtained from all participants.
AUTHOR CONTRIBUTIONS
FM and DF designed the experiment, performed the analyses and wrote the manuscript. DF and RS collected the data. MR contributed to the manuscript preparation. All authors read and approved the final manuscript.
FIGURE 5 |
5Conflict induced modulation in both behavior and emotional/arousal state. (A)
FUNDING
August 2019 | Volume 13 | Article 282
Frontiers in Human Neuroscience | www.frontiersin.org
SUPPLEMENTARY MATERIAL
A componential analysis of task-switching deficits associated with lesions of left and right frontal cortex. A R Aron, S Monsell, B J Sahakian, T W Robbins, 10.1093/brain/awh169Brain. 127Aron, A. R., Monsell, S., Sahakian, B. J., and Robbins, T. W. (2004). A componential analysis of task-switching deficits associated with lesions of left and right frontal cortex. Brain 127, 1561-1573. doi: 10.1093/brain/awh169
Different contributions of the human amygdala and ventromedial prefrontal cortex to decision-making. A Bechara, H Damasio, A R Damasio, G P Lee, 10.1523/jneurosci.19-13-05473.1999J. Neurosci. 19Bechara, A., Damasio, H., Damasio, A. R., and Lee, G. P. (1999). Different contributions of the human amygdala and ventromedial prefrontal cortex to decision-making. J. Neurosci. 19, 5473-5481. doi: 10.1523/jneurosci.19-13- 05473.1999
The iowa gambling task and the somatic marker hypothesis: some questions and answers. A Bechara, H Damasio, D Tranel, A R Damasio, Trends Cogn. Sci. 9Bechara, A., Damasio, H., Tranel, D., and Damasio, A. R. (2005). The iowa gambling task and the somatic marker hypothesis: some questions and answers. Trends Cogn. Sci. 9, 159-162; discussion 162-154.
A simple objective technique for measuring flexibility in thinking. E A Berg, 10.1080/00221309.1948.9918159J. Gen. Psychol. 39Berg, E. A. (1948). A simple objective technique for measuring flexibility in thinking. J. Gen. Psychol. 39, 15-22. doi: 10.1080/00221309.1948.9918159
Sensorimotor adaptation is influenced by background music. O Bock, 10.1007/s00221-010-2289-0Exp. Brain Res. 203Bock, O. (2010). Sensorimotor adaptation is influenced by background music. Exp. Brain Res. 203, 737-741. doi: 10.1007/s00221-010-2289-0
Executive control of perceptual features and abstract relations by baboons (Papio papio). E Bonte, T Flemming, J Fagot, 10.1016/j.bbr.2011.03.034Behav. Brain Res. 222Bonte, E., Flemming, T., and Fagot, J. (2011). Executive control of perceptual features and abstract relations by baboons (Papio papio). Behav. Brain Res. 222, 176-182. doi: 10.1016/j.bbr.2011.03.034
The cognitive effects of listening to background music on older adults: processing speed improves with upbeat music, while memory seems to benefit from both upbeat and downbeat music. S Bottiroli, A Rosi, R Russo, T Vecchi, E Cavallini, 10.3389/fnagi.2014.00284Front. Aging Neurosci. 6284Bottiroli, S., Rosi, A., Russo, R., Vecchi, T., and Cavallini, E. (2014). The cognitive effects of listening to background music on older adults: processing speed improves with upbeat music, while memory seems to benefit from both upbeat and downbeat music. Front. Aging Neurosci. 6:284. doi: 10.3389/fnagi.2014. 00284
Conflict monitoring and decision making: reconciling two perspectives on anterior cingulate function. M M Botvinick, 10.3758/cabn.7.4.356Cogn. Affect. Behav. Neurosci. 7Botvinick, M. M. (2007). Conflict monitoring and decision making: reconciling two perspectives on anterior cingulate function. Cogn. Affect. Behav. Neurosci. 7, 356-366. doi: 10.3758/cabn.7.4.356
Conflict monitoring and cognitive control. M M Botvinick, T S Braver, D M Barch, C S Carter, J D Cohen, Psychol. Rev. 108Botvinick, M. M., Braver, T. S., Barch, D. M., Carter, C. S., and Cohen, J. D. (2001). Conflict monitoring and cognitive control. Psychol. Rev. 108, 624-652.
Conflict monitoring versus selection-for-action in anterior cingulate cortex. M M Botvinick, L E Nystrom, K Fissell, C S Carter, J D Cohen, 10.1038/46035Nature. 402Botvinick, M. M., Nystrom, L. E., Fissell, K., Carter, C. S., and Cohen, J. D. (1999). Conflict monitoring versus selection-for-action in anterior cingulate cortex. Nature 402, 179-181. doi: 10.1038/46035
Brain activation and pupil response during covert performance of the stroop color word task. G G Brown, S S Kindermann, G J Siegle, E Granholm, E C Wong, R B Buxton, 10.1017/s1355617799544020J. Int. Neuropsychol. Soc. 5Brown, G. G., Kindermann, S. S., Siegle, G. J., Granholm, E., Wong, E. C., and Buxton, R. B. (1999). Brain activation and pupil response during covert performance of the stroop color word task. J. Int. Neuropsychol. Soc. 5, 308-319. doi: 10.1017/s1355617799544020
Music and language side by side in the brain: a PET study of the generation of melodies and sentences. S Brown, M J Martinez, L M Parsons, 10.1111/j.1460-9568.2006.04785.xEur. J. Neurosci. 23Brown, S., Martinez, M. J., and Parsons, L. M. (2006). Music and language side by side in the brain: a PET study of the generation of melodies and sentences. Eur. J. Neurosci. 23, 2791-2803. doi: 10.1111/j.1460-9568.2006.04785.x
Anterior cingulate cortex and conflict detection: an update of theory and data. C S Carter, V Van Veen, 10.3758/cabn.7.4.367Cogn. Affect. Behav. Neurosci. 7Carter, C. S., and van Veen, V. (2007). Anterior cingulate cortex and conflict detection: an update of theory and data. Cogn. Affect. Behav. Neurosci. 7, 367-379. doi: 10.3758/cabn.7.4.367
Cognitive test performance and background music. T Cockerton, S Moore, Norman , D , 10.2466/pms.1997.85.3f.1435Percept. Mot. Skills. 85Cockerton, T., Moore, S., and Norman, D. (1997). Cognitive test performance and background music. Percept. Mot. Skills 85, 1435-1438. doi: 10.2466/pms.1997. 85.3f.1435
Statistical Power Analysis for the Behavioral Sciences. J Cohen, L. Erlbaum AssociatesHillsdale, NJCohen, J. (1988). Statistical Power Analysis for the Behavioral Sciences. Hillsdale, NJ: L. Erlbaum Associates.
How do you feel? Interoception: the sense of the physiological condition of the body. A D Craig, 10.1038/nrn894Nat. Rev. Neurosci. 3Craig, A. D. (2002). How do you feel? Interoception: the sense of the physiological condition of the body. Nat. Rev. Neurosci. 3, 655-666. doi: 10.1038/nrn894
Electrodermal responses: what happens in the brain. H D Critchley, 10.1177/107385840200800209Neuroscientist. 8Critchley, H. D. (2002). Electrodermal responses: what happens in the brain. Neuroscientist 8, 132-142. doi: 10.1177/107385840200800209
Neuronal activity in primate dorsal anterior cingulate cortex signals task conflict and predicts adjustments in pupil-linked arousal. R B Ebitz, M L Platt, 10.1016/j.neuron.2014.12.053Neuron. 85Ebitz, R. B., and Platt, M. L. (2015). Neuronal activity in primate dorsal anterior cingulate cortex signals task conflict and predicts adjustments in pupil-linked arousal. Neuron 85, 628-640. doi: 10.1016/j.neuron.2014.12.053
Dissociable neural systems resolve conflict from emotional versus nonemotional distracters. T Egner, A Etkin, S Gale, J Hirsch, 10.1093/cercor/bhm179Cereb. Cortex. 18Egner, T., Etkin, A., Gale, S., and Hirsch, J. (2008). Dissociable neural systems resolve conflict from emotional versus nonemotional distracters. Cereb. Cortex 18, 1475-1484. doi: 10.1093/cercor/bhm179
Emotional processing in anterior cingulate and medial prefrontal cortex. A Etkin, T Egner, R Kalisch, 10.1016/j.tics.2010.11.004Trends Cogn. Sci. 15Etkin, A., Egner, T., and Kalisch, R. (2011). Emotional processing in anterior cingulate and medial prefrontal cortex. Trends Cogn. Sci. 15, 85-93. doi: 10.1016/j.tics.2010.11.004
Anxiety and Cognition. M Eysenck, Psychology PressHoveEysenck, M. (1997). Anxiety and Cognition. Hove: Psychology Press.
G * Power 3: a flexible statistical power analysis program for the social, behavioral, and biomedical sciences. F Faul, E Erdfelder, A G Lang, A Buchner, 10.3758/bf03193146Behav. Res. Methods. 39Faul, F., Erdfelder, E., Lang, A. G., and Buchner, A. (2007). G * Power 3: a flexible statistical power analysis program for the social, behavioral, and biomedical sciences. Behav. Res. Methods 39, 175-191. doi: 10.3758/bf031 93146
Interaction of task-related learning and transcranial direct current stimulation of the prefrontal cortex in modulating executive functions. D J Fehring, R Illipparampil, N Acevedo, S Jaberzadeh, P B Fitzgerald, F A Mansouri, 10.1016/j.neuropsychologia.2019.05.011Neuropsychologia. 131Fehring, D. J., Illipparampil, R., Acevedo, N., Jaberzadeh, S., Fitzgerald, P. B., and Mansouri, F. A. (2019). Interaction of task-related learning and transcranial direct current stimulation of the prefrontal cortex in modulating executive functions. Neuropsychologia 131, 148-159. doi: 10.1016/j.neuropsychologia. 2019.05.011
Cognitive sex differences in effects of music in wisconsin card sorting test. A Feizpour, H C Parkington, F A Mansouri, 10.1177/0305735618795030Psychol. MusicFeizpour, A., Parkington, H. C., and Mansouri, F. A. (2018). Cognitive sex differences in effects of music in wisconsin card sorting test. Psychol. Music doi: 10.1177/0305735618795030
The time course of the aversive conflict signal. J Fritz, G Dreisbach, 10.1027/1618-3169/a000271Exp. Psychol. 62Fritz, J., and Dreisbach, G. (2015). The time course of the aversive conflict signal. Exp. Psychol. 62, 30-39. doi: 10.1027/1618-3169/a000271
Music is as distracting as noise: the differential distraction of background music and noise on the cognitive test performance of introverts and extraverts. A Furnham, L Strbac, 10.1080/00140130210121932Ergonomics. 45Furnham, A., and Strbac, L. (2002). Music is as distracting as noise: the differential distraction of background music and noise on the cognitive test performance of introverts and extraverts. Ergonomics 45, 203-217. doi: 10.1080/00140130210121932
EEG and autonomic responses during performance of matching and non-matching to sample working memory tasks with emotional content. A Garcia, C E Uribe, M C Tavares, C Tomaz, 10.3389/fnbeh.2011.00082Front. Behav. Neurosci. 582Garcia, A., Uribe, C. E., Tavares, M. C., and Tomaz, C. (2011). EEG and autonomic responses during performance of matching and non-matching to sample working memory tasks with emotional content. Front. Behav. Neurosci. 5:82. doi: 10.3389/fnbeh.2011.00082
Pupil diameter tracks changes in control state predicted by the adaptive gain theory of locus coeruleus function. M S Gilzenrat, S Nieuwenhuis, M Jepma, J D Cohen, 10.3758/CABN.10.2.252Cogn. Affect. Behav. Neurosci. 10Gilzenrat, M. S., Nieuwenhuis, S., Jepma, M., and Cohen, J. D. (2010). Pupil diameter tracks changes in control state predicted by the adaptive gain theory of locus coeruleus function. Cogn. Affect. Behav. Neurosci. 10, 252-269. doi: 10.3758/CABN.10.2.252
Optimizing the use of information: strategic control of activation of responses. G Gratton, M G Coles, E Donchin, 10.1037/0096-3445.121.4.480J. Exp. Psychol. Gen. 121Gratton, G., Coles, M. G., and Donchin, E. (1992). Optimizing the use of information: strategic control of activation of responses. J. Exp. Psychol. Gen. 121, 480-506. doi: 10.1037//0096-3445.121.4.480
Explicit and implicit emotion regulation: a dual-process framework. A Gyurak, J J Gross, A Etkin, 10.1080/02699931.2010.544160doi: 10.1080/ 02699931.2010.544160Cogn. Emot. 25Gyurak, A., Gross, J. J., and Etkin, A. (2011). Explicit and implicit emotion regulation: a dual-process framework. Cogn. Emot. 25, 400-412. doi: 10.1080/ 02699931.2010.544160
Prefrontal cortex lesions disrupt the contextual control of response conflict. J E Haddon, S Killcross, 10.1523/jneurosci.3243-05.2006J. Neurosci. 26Haddon, J. E., and Killcross, S. (2006). Prefrontal cortex lesions disrupt the contextual control of response conflict. J. Neurosci. 26, 2933-2940. doi: 10.1523/jneurosci.3243-05.2006
To err is autonomic: errorrelated brain potentials, ANS activity, and post-error compensatory behavior. G Hajcak, N Mcdonald, R F Simons, 10.1111/1469-8986.00107Psychophysiology. 40Hajcak, G., Mcdonald, N., and Simons, R. F. (2003). To err is autonomic: error- related brain potentials, ANS activity, and post-error compensatory behavior. Psychophysiology 40, 895-903. doi: 10.1111/1469-8986.00107
Emotional priming effects during Stroop task performance. S J Hart, S R Green, M Casp, A Belger, 10.1016/j.neuroimage.2009.10.076doi: 10.1016/j. neuroimage.2009.10.076Neuroimage. 49Hart, S. J., Green, S. R., Casp, M., and Belger, A. (2010). Emotional priming effects during Stroop task performance. Neuroimage 49, 2662-2670. doi: 10.1016/j. neuroimage.2009.10.076
Emotional foundations of cognitive control. M Inzlicht, B D Bartholow, J B Hirsh, 10.1016/j.tics.2015.01.004Trends Cogn. Sci. 19Inzlicht, M., Bartholow, B. D., and Hirsh, J. B. (2015). Emotional foundations of cognitive control. Trends Cogn. Sci. 19, 126-132. doi: 10.1016/j.tics.2015.01.004
Decreased conflict-and error-related activity in the anterior cingulate cortex in subjects with schizophrenia. J G Kerns, J D Cohen, A W Macdonald, Iii, M K Johnson, V A Stenger, H Aizenstein, 10.1176/appi.ajp.162.10.1833Am. J. Psychiatry. 162Kerns, J. G., Cohen, J. D., Macdonald, A. W. III, Johnson, M. K., Stenger, V. A., Aizenstein, H., et al. (2005). Decreased conflict-and error-related activity in the anterior cingulate cortex in subjects with schizophrenia. Am. J. Psychiatry 162, 1833-1839. doi: 10.1176/appi.ajp.162.10.1833
Event-related skin conductance responses to musical emotions in humans. S Khalfa, P Isabelle, B Jean-Pierre, Manon , R , 10.1016/s0304-3940(02)00462-7Neurosci. Lett. 328Khalfa, S., Isabelle, P., Jean-Pierre, B., and Manon, R. (2002). Event-related skin conductance responses to musical emotions in humans. Neurosci. Lett. 328, 145-149. doi: 10.1016/s0304-3940(02)00462-7
Investigating emotion with music: an fMRI study. Hum. Brain Mapp. S Koelsch, T Fritz, D Y Cramon, K Muller, A D Friederici, 10.1002/hbm.2018027Koelsch, S., Fritz, T., V Cramon, D. Y., Muller, K., and Friederici, A. D. (2006). Investigating emotion with music: an fMRI study. Hum. Brain Mapp. 27, 239-250. doi: 10.1002/hbm.20180
Emotion and the motivational brain. P J Lang, M M Bradley, 10.1016/j.biopsycho.2009.10.007Biol. Psychol. 84Lang, P. J., and Bradley, M. M. (2010). Emotion and the motivational brain. Biol. Psychol. 84, 437-450. doi: 10.1016/j.biopsycho.2009.10.007
Interactive effects of music and prefrontal cortex stimulation in modulating response inhibition. F A Mansouri, N Acevedo, R Illipparampil, D J Fehring, P B Fitzgerald, Jaberzadeh , S , 10.1038/s41598-017-18119-xdoi: 10.1038/ s41598-017-18119-xSci. Rep. 718096Mansouri, F. A., Acevedo, N., Illipparampil, R., Fehring, D. J., Fitzgerald, P. B., and Jaberzadeh, S. (2017a). Interactive effects of music and prefrontal cortex stimulation in modulating response inhibition. Sci. Rep. 7:18096. doi: 10.1038/ s41598-017-18119-x
Monitoring demands for executive control: shared functions between human and nonhuman primates. F A Mansouri, T Egner, M J Buckley, 10.1016/j.tins.2016.11.001Trends Neurosci. 40Mansouri, F. A., Egner, T., and Buckley, M. J. (2017b). Monitoring demands for executive control: shared functions between human and nonhuman primates. Trends Neurosci. 40, 15-27. doi: 10.1016/j.tins.2016.11.001
Behavioral consequences of selective damage to frontal pole and posterior cingulate cortices. F A Mansouri, M J Buckley, M Mahboubi, K Tanaka, 10.1073/pnas.1422629112Proc. Natl. Acad. Sci. Natl. Acad. Sci1123940Mansouri, F. A., Buckley, M. J., Mahboubi, M., and Tanaka, K. (2015a). Behavioral consequences of selective damage to frontal pole and posterior cingulate cortices. Proc. Natl. Acad. Sci. 112:E3940. doi: 10.1073/pnas. 1422629112
Working memory in the service of executive control functions. F A Mansouri, M G Rosa, Atapour , N , 10.3389/fnsys.2015.00166doi: 10.3389/ fnsys.2015.00166Front. Syst. Neurosci. 9166Mansouri, F. A., Rosa, M. G., and Atapour, N. (2015b). Working memory in the service of executive control functions. Front. Syst. Neurosci. 9:166. doi: 10.3389/ fnsys.2015.00166
Mnemonic function of the dorsolateral prefrontal cortex in conflict-induced behavioral adjustment. F A Mansouri, M J Buckley, K Tanaka, 10.1126/science.1146384Science. 318Mansouri, F. A., Buckley, M. J., and Tanaka, K. (2007). Mnemonic function of the dorsolateral prefrontal cortex in conflict-induced behavioral adjustment. Science 318, 987-990. doi: 10.1126/science.1146384
The essential role of primate orbitofrontal cortex in conflict-induced executive control adjustment. F A Mansouri, M J Buckley, K Tanaka, 10.1523/JNEUROSCI.1637-14.2014J. Neurosci. 34Mansouri, F. A., Buckley, M. J., and Tanaka, K. (2014). The essential role of primate orbitofrontal cortex in conflict-induced executive control adjustment. J. Neurosci. 34, 11016-11031. doi: 10.1523/JNEUROSCI.1637-14.2014
Direct current stimulation of prefrontal cortex modulates errorinduced behavioral adjustments. F A Mansouri, D J Fehring, A Feizpour, A Gaillard, M Rosa, R Rajan, 10.1111/ejn.13281doi: 10.1111/ ejn.13281Eur. J. Neurosci. 44Mansouri, F. A., Fehring, D. J., Feizpour, A., Gaillard, A., Rosa, M., Rajan, R., et al. (2016a). Direct current stimulation of prefrontal cortex modulates error- induced behavioral adjustments. Eur. J. Neurosci. 44, 1856-1869. doi: 10.1111/ ejn.13281
Sex dependency of inhibitory control functions. F A Mansouri, D J Fehring, A Gaillard, S Jaberzadeh, H Parkington, 10.1186/s13293-016-0065-yBiol. Sex Differ. 711Mansouri, F. A., Fehring, D. J., Gaillard, A., Jaberzadeh, S., and Parkington, H. (2016b). Sex dependency of inhibitory control functions. Biol. Sex Differ. 7:11. doi: 10.1186/s13293-016-0065-y
Conflict-induced behavioural adjustment: a clue to the executive functions of the prefrontal cortex. F A Mansouri, K Tanaka, M J Buckley, 10.1038/nrn2538Nat. Rev. Neurosci. 10Mansouri, F. A., Tanaka, K., and Buckley, M. J. (2009). Conflict-induced behavioural adjustment: a clue to the executive functions of the prefrontal cortex. Nat. Rev. Neurosci. 10, 141-152. doi: 10.1038/nrn2538
The nencki affective picture system (NAPS): introduction to a novel, standardized, widerange, high-quality, realistic picture database. A Marchewka, L Zurawski, K Jednorog, A Grabowska, 10.3758/s13428-013-0379-1Behav. Res. Methods. 46Marchewka, A., Zurawski, L., Jednorog, K., and Grabowska, A. (2014). The nencki affective picture system (NAPS): introduction to a novel, standardized, wide- range, high-quality, realistic picture database. Behav. Res. Methods 46, 596-610. doi: 10.3758/s13428-013-0379-1
Conflict adaptation effects in the absence of executive control. U Mayr, E Awh, P Laurey, 10.1038/nn1051Nat. Neurosci. 6Mayr, U., Awh, E., and Laurey, P. (2003). Conflict adaptation effects in the absence of executive control. Nat. Neurosci. 6, 450-452. doi: 10.1038/nn1051
Intrusive cognitions: an investigation of the emotional Stroop task. F Mckenna, D Sharma, 10.1037/0278-7393.21.6.1595J. Exp. Psychol. 21McKenna, F., and Sharma, D. (1995). Intrusive cognitions: an investigation of the emotional Stroop task. J. Exp. Psychol. 21, 1595-1607. doi: 10.1037//0278-7393. 21.6.1595
Functional brain abnormalities in psychiatric disorders: neural mechanisms to detect and resolve cognitive conflict and interference. T Melcher, P Falkai, O Gruber, 10.1016/j.brainresrev.2008.06.003Brain Res. Rev. 59Melcher, T., Falkai, P., and Gruber, O. (2008). Functional brain abnormalities in psychiatric disorders: neural mechanisms to detect and resolve cognitive conflict and interference. Brain Res. Rev. 59, 96-124. doi: 10.1016/j.brainresrev. 2008.06.003
An integrative theory of prefrontal cortex function. E K Miller, J D Cohen, 10.1146/annurev.neuro.24.1.167Annu. Rev. Neurosci. 24Miller, E. K., and Cohen, J. D. (2001). An integrative theory of prefrontal cortex function. Annu. Rev. Neurosci. 24, 167-202. doi: 10.1146/annurev.neuro.24. 1.167
Task switching. S Monsell, Trends Cogn. Sci. 7Monsell, S. (2003). Task switching. Trends Cogn. Sci. 7, 134-140.
A systematic review on the neural effects of music on emotion regulation: implications for music therapy practice. K S Moore, 10.1093/jmt/50.3.198J. Music Ther. 50Moore, K. S. (2013). A systematic review on the neural effects of music on emotion regulation: implications for music therapy practice. J. Music Ther. 50, 198-242. doi: 10.1093/jmt/50.3.198
Attention and control of manual responses in cognitive conflict: findings from TMS perturbation studies. B Olk, C Peschke, C C Hilgetag, 10.1016/j.neuropsychologia.2015.02.008Neuropsychologia. 74Olk, B., Peschke, C., and Hilgetag, C. C. (2015). Attention and control of manual responses in cognitive conflict: findings from TMS perturbation studies. Neuropsychologia 74, 7-20. doi: 10.1016/j.neuropsychologia.2015.02.008
Negative emotion impairs conflictdriven executive control. S Padmala, A Bauer, L Pessoa, 10.3389/fpsyg.2011.00192Front. Psychol. 2192Padmala, S., Bauer, A., and Pessoa, L. (2011). Negative emotion impairs conflict- driven executive control. Front. Psychol. 2:192. doi: 10.3389/fpsyg.2011.00192
How do emotion and motivation direct executive control?. L Pessoa, 10.1016/j.tics.2009.01.006Trends Cogn. Sci. 13Pessoa, L. (2009). How do emotion and motivation direct executive control? Trends Cogn. Sci. 13, 160-166. doi: 10.1016/j.tics.2009.01.006
Characterization of the nencki affective picture system by discrete emotional categories (NAPS BE). M Riegel, Ł Żurawski, M Wierzba, A Moslehi, Ł Klocek, M Horvat, 10.3758/s13428-015-0620-1doi: 10. 3758/s13428-015-0620-1Behav. Res. Methods. 48Riegel, M.,Żurawski, Ł., Wierzba, M., Moslehi, A., Klocek, Ł., Horvat, M., et al. (2016). Characterization of the nencki affective picture system by discrete emotional categories (NAPS BE). Behav. Res. Methods 48, 600-612. doi: 10. 3758/s13428-015-0620-1
A role for the macaque anterior cingulate gyrus in social valuation. P H Rudebeck, M J Buckley, M E Walton, M F Rushworth, 10.1126/science.1128197Science. 313Rudebeck, P. H., Buckley, M. J., Walton, M. E., and Rushworth, M. F. (2006). A role for the macaque anterior cingulate gyrus in social valuation. Science 313, 1310-1312. doi: 10.1126/science.1128197
Effects of background music on phonological short-term memory. P Salamé, A Baddeley, 10.1080/14640748908402355doi: 10.1080/ 14640748908402355Q. J. Exp. Psychol. 41Salamé, P., and Baddeley, A. (1989). Effects of background music on phonological short-term memory. Q. J. Exp. Psychol. 41, 107-122. doi: 10.1080/ 14640748908402355
Variation in cognitive control as emotion regulation. B Saunders, M Milyavskaya, M Inzlicht, 10.1080/1047840x.2015.962396doi: 10.1080/ 1047840x.2015.962396Psychol. Inquiry. 26Saunders, B., Milyavskaya, M., and Inzlicht, M. (2015). Variation in cognitive control as emotion regulation. Psychol. Inquiry 26, 108-115. doi: 10.1080/ 1047840x.2015.962396
Conflict: run! Reduced stroop interference with avoidance responses. N Schouppe, J De Houwer, K R Ridderinkhof, W Notebaert, 10.1080/17470218.2012.685080Q. J. Exp. Psychol. 65Schouppe, N., De Houwer, J., Ridderinkhof, K. R., and Notebaert, W. (2012). Conflict: run! Reduced stroop interference with avoidance responses. Q. J. Exp. Psychol. 65, 1052-1058. doi: 10.1080/17470218.2012. 685080
Wisconsin card sorting test performance in patients with focal frontal and posterior brain damage: effects of lesion location and test structure on separable cognitive processes. D T Stuss, B Levine, M P Alexander, J Hong, C Palumbo, L Hamer, 10.1016/s0028-3932(99)00093-7doi: 10.1016/ s0028-3932Neuropsychologia. 3899Stuss, D. T., Levine, B., Alexander, M. P., Hong, J., Palumbo, C., Hamer, L., et al. (2000). Wisconsin card sorting test performance in patients with focal frontal and posterior brain damage: effects of lesion location and test structure on separable cognitive processes. Neuropsychologia 38, 388-402. doi: 10.1016/ s0028-3932(99)00093-7
Orienting to exogenous cues and attentional bias to affective pictures reflect separate processes. J Tipples, D Sharma, 10.1348/000712600161691Br. J. Psychol. 91Pt 1Tipples, J., and Sharma, D. (2000). Orienting to exogenous cues and attentional bias to affective pictures reflect separate processes. Br. J. Psychol. 91(Pt 1), 87-97. doi: 10.1348/000712600161691
Neurophysiology of performance monitoring and adaptive behavior. M Ullsperger, C Danielmeier, Jocham , G , 10.1152/physrev.00041.2012Physiol. Rev. 94Ullsperger, M., Danielmeier, C., and Jocham, G. (2014). Neurophysiology of performance monitoring and adaptive behavior. Physiol. Rev. 94, 35-79. doi: 10.1152/physrev.00041.2012
In the mood for adaptation: how affect regulates conflict-driven control. H Van Steenbergen, G P Band, B Hommel, H Van Steenbergen, G P Band, B Hommel, 10.1177/0956797610385951doi: 10.1177/0956797610385951Psychol. Sci. 20Psychol. Sci.van Steenbergen, H., Band, G. P., and Hommel, B. (2009). Reward counteracts conflict adaptation. Evidence for a role of affect in executive control. Psychol. Sci. 20, 1473-1477. doi: 10.1111/j.1467-9280.2009.02 470.x van Steenbergen, H., Band, G. P., and Hommel, B. (2010). In the mood for adaptation: how affect regulates conflict-driven control. Psychol. Sci. 21, 1629-1634. doi: 10.1177/0956797610385951
Pupil dilation in the Simon task as a marker of conflict processing. H Van Steenbergen, G P H Band, 10.3389/fnhum.2013.00215doi: 10.3389/ fnhum.2013.00215Front. Hum. Neurosci. 7215van Steenbergen, H., and Band, G. P. H. (2013). Pupil dilation in the Simon task as a marker of conflict processing. Front. Hum. Neurosci. 7:215. doi: 10.3389/ fnhum.2013.00215
Sympathetic nerve activity underlying electrodermal and cardiovascular reactions in man. B G Wallin, 10.1111/j.1469-8986.1981.tb02483.xdoi: 10.1111/ j.1469-8986.1981.tb02483.xPsychophysiology. 18Wallin, B. G. (1981). Sympathetic nerve activity underlying electrodermal and cardiovascular reactions in man. Psychophysiology 18, 470-476. doi: 10.1111/ j.1469-8986.1981.tb02483.x
Lesions to the prefrontal performance-monitoring network disrupt neural processing and adaptive behaviors after both errors and novelty. J R Wessel, T A Klein, D V Ott, M Ullsperger, 10.1016/j.cortex.2013.09.002doi: 10.1016/ j.cortex.2013.09.002Cortex. 50Wessel, J. R., Klein, T. A., Ott, D. V., and Ullsperger, M. (2014). Lesions to the prefrontal performance-monitoring network disrupt neural processing and adaptive behaviors after both errors and novelty. Cortex 50, 45-54. doi: 10.1016/ j.cortex.2013.09.002
Electrodermal Activity. B Wolfram, SpringerBoston, MAWolfram, B. (2012). Electrodermal Activity. Boston, MA: Springer.
The effects of oxytocin on primates' working memory depend on the emotional valence of contextual factors. S A Zarei, V Sheibani, C Tomaz, F A Mansouri, 10.1016/j.bbr.2018.12.050Behav. Brain Res. 362Zarei, S. A., Sheibani, V., Tomaz, C., and Mansouri, F. A. (2019). The effects of oxytocin on primates' working memory depend on the emotional valence of contextual factors. Behav. Brain Res. 362, 82-89. doi: 10.1016/j.bbr.2018. 12.050
Effects of music upon GSR and heart-rate. G H Zimny, E W Weidenfeller, Am. J. Psychol. 76Zimny, G. H., and Weidenfeller, E. W. (1963). Effects of music upon GSR and heart-rate. Am. J. Psychol. 76, 311-314.
| Under the theoretical framework of the General Aggression Model (Anderson & Bushman, 2002), this study investigated the effects of watching and listening to violent rap music videos and rap audio recordings on aggressive cognitions using a mixed betweenwithin subjects design. We hypothesize that violent content would prime aggressive cognitions regardless of media mode (song alone or music video). Additionally, an interaction between mode and content was hypothesized in which we predicted that violent music videos would have a greater effect on aggression cognitions than violent audio tracks. Aggressive cognition was measured using a word pronunciation task that recorded reaction times to violent and non-violent words. The results lend support to both hypotheses. The results are discussed with regard to the General Aggression Model. Implications for theory, as well as future directions for research are discussed. | What is control over others actions called? | 164 | Theories of cognitive control generally assume that perceived conflict acts as a signal to engage inhibitory mechanisms that suppress subsequent conflicting information. Crucially, an absence of conflict is not regarded as being a relevant signal for cognitive control. Using a cueing, a priming, and a Simon task, we provide evidence that conflict does not have this unique signal status: Encountering a conflict does not lead to behavioral adjustments on subsequent conflict trials, whereas encountering a nonconflict trial does lead to behavioral adjustments on subsequent nonconflict trials. We propose that this apparent role-reversal can be explained by a mechanism that responds to both the presence and the absence of conflict, down-regulating the visuomotor system following conflict, and up-regulating it following nonconflict. (PsycINFO Database Record (c) 2011 APA, all rights reserved). Language: en | Paradoxical Thinking as a Conflict-Resolution Intervention: Comparison to Alternative Interventions and Examination of Psychological Mechanisms | Individual differences in conflict detection during reasoning | Conflict is inevitable among people who live together and share a lot of things in common. Conflict is therefore neutral, natural and normal in organizations. It occurs because individuals are unique and have different opinions, convictions, desires and priorities. Pennebaker (1990) points out that, conflicts are a natural part of life and therefore a natural part of school life. Learning to deal constructively with conflict is a life-skill students need so that they can learn to resolve their own conflicts so that the atmosphere at school is more pleasant for all. Locus of control on the other hand, refers to a person’s perception of personal control over their own behavior. Rotter (1996) contended that individuals with internal locus of control would continue to engage in activities that would reinforce the expectancy that their behaviors affected subsequent consequences. Essentially individual’s locus of control would impact how they perceived and interacted within their surroundings. When individuals were introduced to novel experiences they would expect to react in a consistent level of cognitive processing. This paper sought to find out the relationship between conflict resolution and locus of control in secondary schools. The study focused on Schools in Eldoret district. Causal comparative (Ex-post facto) design was used in the study. From the results few students who had low levels of locus of control had low levels of conflict resolutions while those with high levels of locus of control had high levels of conflict resolution. However no significant relationship existed between locus of control and conflict resolution at least for this study. Keywords: relationship, locus of control, conflict resolution | how many interrelated effects does task conflict have | Conflict-Monitoring and Reaction Time Distributions : an Extension | Taking shortcuts: Cognitive conflict during motivated rule-breaking | This investigation tests Honeycutt's (2003) conflict linkage theory in the context of serial arguing. Reports on the characteristics of imagined interactions were obtained before, after, and between two episodes of the same serial argument. Analysis (N = 223) showed that imagined interactions affect the goals and tactics used in serial arguments. Imagined interactions have strong relationships among themselves, and this is a stronger effect than that of the arguments on the imagined interactions. Results support conflict linkage theory and add consistent support to the emerging empirical description of the internal dynamics of serial arguing processes. | Why does conflict exist? What is the nature of confliction between humans, and confliction within our minds? |
165 | Good router- no issues. Strong signal and easy set-up | This router is everything you want. It is fast, stable, looks good and even smells good. As soon as I pulled it out of the box I knew I was holding a quality product. The setup was exceptionally easy. The software running the router is top-notch-- and this is very rare for consumer routers. There are two main areas of the software: fast, easy setup for 95% of users and then advanced settings for power users. The advanced settings aren't kidding around--all the options you want are cleanly displayed. Also, my wireless signal has significantly improved range. Areas I used to get 1 bar out of 5 now get 3 out of 5.
Once you've had a bad router in your network you truly appreciate a solid performer-- and solid performance is what you get with this. | This router has been great! Signal strength is super strong with very little loss to internet speeds. Also, the amount of control and customization of the router in the settings is phenomenal. Highly recommend. | Best router Ive ever used. Look at the specs and take the time to use all the functions with it because it is NICE. The price might seem intimidating, but trust me when I say its TOTALLY worth it. Great investment if you want guaranteed great internet in your home. | Great router. Little bigger then expected, but issues with hardware or performance. | Good router. I had to replace one that was acting up. I wasn't looking to break the bank and chose this one. It's been flawless and easy to set up. I have good coverage through my whole house and halfway out in my yard. | Best router I have ever had. Speed and range have been excellent on the dozen or so devices we have throughout the house. | Great router for the price. Works well with no interference. | This router is wonderful! I purchased it over other brands because it has a great brand image and great customer service. It was super easy to set up and connect my 2 roku boxes for internet tv to the 5GHz band and assigned the rest of the traffic to the 2Ghz band. I had an old linksys that worked great but was dying and now I'm taking full advantage the speed from my ISP and getting 65Mbps down and 35Mbsp up and the wifi works great out on my patio to boot! So far, I am extremely happy with this device and it's dual band. | 165 | Easy set-up, solid signal. No issues other than downloaded and installed the EU firmware update from the website by mistake as they're kinda thrown in together (should be more clearly identified as US customers should probably not be given the option as a top choice)- still works perfectly. | Great signal, easy to setup | Quick setup. Strong signal. | Great product with easy set-up and connectivity | Easy to install and reception unchanged. | Easy setup. Picked up several more HD channels than ... | simple set up and works great. | Not happy with this modem | Horrible connectivity. Very disappointing form |
166 | when did harsh vardhan become the chief minister of delhi | having made the statement. Harsh Vardhan is married to Nutan, and they have two sons and a daughter. Harsh Vardhan (Delhi politician) Dr. Harsh Vardhan is the incumbent minister at Ministry of Science & Technology (India), Ministry of Environment, Forest and Climate Change and Ministry of Earth Sciences in the BJP-led NDA government of Prime Minister Narendra Modi. He represents Chandni Chowk in Delhi as a Member of Parliament in the 16th Lok Sabha. He was also the Chief Minister of Delhi candidate for the BJP in the 2013 Delhi assembly election. Harsh Vardhan was born in Delhi to Om | firing, Sh. Nanak Chand Mishra sustained "Bullet Injuries". Honourable Prime Minister Smt. Indira Gandhi honoured on 15 August, 1972 with “Tamrapatra” to Sh. Nanak Chand Mishra being Freedom Fighter for his struggle in independence of country India Chandni Chowk was once the grandest Indian market. Mughal imperial processions passed through Chandni Chowk. The tradition was continued when Delhi Durbar was held in 1903. Delhi Town Hall was built in 1863 by the British. Chandni Chowk runs through the middle of the walled city, from the Lahori Gate of the Red Fort to Fatehpuri Masjid. Originally, a canal ran through the | Indian Constituent Assembly and was one of the signatories of the Indian constitution, but chose not to enter politics. Padampat Singhania Sir Padampat Singhania (1904–1979) was an Indian industrialist and member of the Indian Constituent Assembly. He was the oldest grandson of Lala Juggilal and son of Lala Kamlapat Singhania. His brothers were Kailashpat (who owned Raymonds) and Lakshmipat Singhania. He was chairman of the JK Mills, part of the J. K. Organisation. He was knighted in the 1943 New Year Honours list, and invested with his knighthood by the Viceroy of India, the Marquess of Linlithgow, at Viceroy's House | Harshavardhan Patil Harshvardhan Shahaji Patil () (born 21 August 1963), is an Indian politician from Indian National Congress. He was one of the few ministers who was presiding as a minister for four consecutive terms in Government of Maharashtra. He has shouldered responsibilities of Cooperative Ministry and currently Legislative Affairs. He is known for cordial relations with all party members. He is Minister since 1995. He was elected MLA as an independent in 1995, 1999, 2004. In 2009 he was elected MLA as an Indian National Congress. candidate. He was appointed as co-operation and parliamentary affairs minister in Chief minister | Sardar Surjit Singh Majithia Sardar Surjit Singh Majithia is an Indian politician. He was elected to the Lok Sabha, the lower house of the Parliament of India from the Tarn Taran constituency of Punjab as a member of the Indian National Congress. From 1945 to 1947, he was member of Central Legislative Assembly and in 1947, he was also ambassador to the neighboring country of Nepal and remained their until 1949. He was also President of Board of Control for Cricket in India and Wrestling Federation of India; Vice-president of National Rifle Association of India and President of All India | D. V. V. S. Varma the imagination of the people of the state. He also played a central role in Lok Satta conceiving and leading the hugely successful statewide Movement for Empowerment of Local Governments and the historic '1-crore signature campaign' that brought the issue of empowerment of the third-tier of government (i.e. panchayats and municipalities) to the forefront of public and political debate. He was also actively involved in coordinating the "Vote India" campaign. DVVS Varma was chosen as the Party General Secretary in 2006. He was one of the contestants that ran for the President of Lok Satta Party in the first organizational | wife had preceded him in death three years earlier. K. Sankaran Nair K. Sankaran Nair (1919–2015), known as Colonel Menon among his colleagues, was an Indian civil servant, diplomat and the director of Research and Analysis Wing (RAW), the apex intelligence agency in India. He served as the Indian High Commissioner to Singapore from 1986 to 1988 and was the last member of the Indian Imperial Police. He was reported to have played a crucial role in the formation of Bangladesh, through RAW operations during the Bangladesh Liberation War. His memoirs, "Inside IB and RAW: A Rolling Stone that Gathered | coming within its ambit. On February 9, 2014, Narendra Modi during his prime-ministerial campaign in Kerala he critisied Mishra's report for creating "insecurities of the Dalit communities". National Commission for Religious and Linguistic Minorities National Commission for Religious and Linguistic Minorities, also called as Ranganath Misra Commission was constituted by Government of India on 29 October 2004 to look into various issues related to Linguistic and Religious minorities in India. It was chaired by former Chief Justice of India Justice Ranganath Misra. The commission submitted the report to the Government on 21 May 2007. Initially, the commission was entrusted with | 166 | having made the statement. Harsh Vardhan is married to Nutan, and they have two sons and a daughter. Harsh Vardhan (Delhi politician) Dr. Harsh Vardhan is the incumbent minister at Ministry of Science & Technology (India), Ministry of Environment, Forest and Climate Change and Ministry of Earth Sciences in the BJP-led NDA government of Prime Minister Narendra Modi. He represents Chandni Chowk in Delhi as a Member of Parliament in the 16th Lok Sabha. He was also the Chief Minister of Delhi candidate for the BJP in the 2013 Delhi assembly election. Harsh Vardhan was born in Delhi to Om | how many sons does harsh vardhan have | Finance minister of kerala in 2010? | [P] I wish BJP had made Varun Gandhi its CM in UP | Who is the current prime minister of India in 2009? | who is the new chemicals minister of tamilnadu | varanasi mahamana express is a national express from which country | who is the new chemicals minister of tamilnadu 2017 | who is the bjp leader in india 2009 budget |
167 | 'My Cancer' Blog Marks First Birthday | 186Background: Cancer patients and their caregivers are increasingly using social media as a platform to share cancer experiences, connect with support, and exchange cancer-related information. Yet, little is known about the nature and scientific accuracy of cancer-related information exchanged on social media. Methods: We conducted a content analysis of 12 months of data from 18 publically available Facebook pages hosted by parents of children with Acute Lymphoblastic Leukemia (n = 15,852 posts), and extracted all exchanges of medically-oriented cancer information. We systematically coded for themes in the nature of cancer-related information exchanged on personal Facebook pages, and two oncology experts independently evaluated the scientific accuracy of each post. Results: Of the 15,852 total posts, 171 posts contained medically-oriented cancer information. The most frequent type of cancer information exchanged was information related to treatment protocols and health services use (35%) followed by info... | i don’t know if it’s just me, but i hate my birthday. it reminds me that i’m still alive and that i’m just letting yet another year pass by me. i can’t see why my life should be celebrated when i didn’t even want to be born. | June 23rd Zodiac As a Cancer born on June 23rd, your personality is founded on creativity and emotional understanding. Almost like a sixth sense, you can easily pick up what others are feeling and thinking. | Also, if Remus’s birthday is 25/6 that makes him a literal Cancer ♋️. So yeh. Just going off a very brief google search here so apologies if that’s wrong x | This patient's birthday was the happiest day of her life. But that's only half the reason the hospital pharmacist has never forgotten her. | By . Emma Innes . They are not the photos that any parents would ever want to take. But the mothers and father of these youngsters hope that by sharing them, they will raise awareness of the gruelling journey cancer has taken them on. They posted the heart-rending pictures of their children before, during and after their treatment on a designated Facebook page in a bid to show what their children have been through. The parents of children being treated for cancer at Royal Manchester Children's Hospital have shared pictures of them before, during and after treatment in a bid to raise awareness of the disease. Image shows Ruby Mae who was diagnosed with leukaemia at the age of five . The photos of children, being treated on . Ward 84 at Royal Manchester Children’s Hospital (RMCH), were shared in . response to the ‘no make-up selfie’ trend sweeping the internet. The parents feared that make-up free selfies could trivialise cancer and wanted to show how the disease really affects people. The page, which tells the stories of 60 patients, has already had more than 4,700 ‘likes’. Heartfelt tributes have also been left to children who passed away from the disease. The aim of the page is also to raise money for the RMCH charity and other causes supporting children with cancer. Eleanor Massey, 30, was one of the parents who came up with the idea for the page. The parents were inspired to set up the Facebook page by the 'no make-up selfie craze' which they felt trivialised the disease. Image shows Josh, three, who had lymphoma . The children in the photos were all treated on the hospital's Ward 84. Image shows Mackenzie, six, who suffered from acute lymphoblastic lymphoma . The page, which tells the stories of 60 patients, has already had more than 4,700 'likes'. Image shows Niamh who was diagnosed with juvenile granulosa cell tumour of the ovary at the age of seven . Her son Jacob, three, was treated on Ward 84 after being diagnosed with leukaemia in December 2013 and is now in remission. Ms Massey, said: ‘We’ve always had a Facebook group for people whose children are being treated on Ward 84 and a lot of people were offended by the ‘no make-up selfie’ thing. ‘They were concerned people were just posting photos but not understanding they also had to make a donation to cancer charities. ‘We wanted to show the real face of cancer and have also asked people to describe their child’s symptoms as lots of parents want to know what to look out for. ‘We hope by letting people into our world a bit we can raise awareness of childhood cancers and raise money for charities who have helped us.’ The Facebook page is also designed to raise money for children's cancer charities. Image shows Euan who was diagnosed with Ewing's sarcoma - a type of bone cancer - in 2003 at the age of four . Image shows Megan, 14, from Stockport, who developed leukaemia . Sophie, from Wythenshawe, was diagnosed with neuroblastoma - a nerve cell cancer - when she was four . Clair Beswick’s daughter Lily was also treated on Ward 84 - but sadly passed away eight months after being diagnosed with soft tissue cancer rhabdomyosarcoma at just one year old. Ms Beswick, who lives in Bolton, said: ‘It’s good that it raised so much money but I found the no make-up selfie thing quite indulgent. This is our way of raising awareness of cancer.’ Sarah Naismith, head of charities for RMCH, said: ‘The Faces of Ward 84 page is inspiring and heart-breaking in equal measure and we applaud the bravery of the patients’ families in sharing their stories.’ For more details go to facebook.com/Facesofward84 or to donate text RMCH14 and the amount you wish to donate to 70070. Eleanor Massey was one of the parents who came up with the idea for the Facebook page - her son, Jacob, three, was diagnosed with leukaemia last year and is now in remission . | I have it set to "only me" on all of the usual social media sites and don't go around telling anyone about it. I would be perfectly fine if I made it through the day without a single person saying "happy birthday". | We celebrate birthdays with people we barely (if at all) know on Facebook all the time, but how about Twitter?
And by celebrate, I mean we look at the list of birthdays on Facebook, write on their wall and it ends there for the most part. If you creep down that list and consciously decide *not* to wish them a happy birthday? Congrats, you're *Facebook friends*!
I took an even more isolated approach with this experiment. By using Twitter’s advanced search, I looked for happy birthday tweets in Canada and the US. From here, I reached out to strangers on their big day hoping they spent it well and with those close to them.
**Would people find that creepy?** That’s what I wanted to find out. While many aspects of etiquette are quite established on social media, congratulations seemed like an untouched topic. If the response was positive, I also wanted to see if it could be used to give my personal branding a little boost in the process.
Full Article: | 167 | It's hard to believe, but at the end of this month, the blog will be one year old. As I sit here now, it feels like this past year has flown by. But time heals a lot of things. Memories start to fade. It's possible to forget those hours in the chemo chair that felt like days, the days of feeling sick that seemed like weeks. I realize that I have changed. A lot. My thinking about cancer is different. Cancer has lost some of its terror. I remember how panicked I was the first time I was told that there were tumors in my body. I wanted them out, that minute. Now, if the next scans find something, I'll be disappointed, but I won't panic. I know that there is time, that there are ways to attack them. I went back and read the first blog entry. It was about denial, something that I think all cancer patients are familiar with. I found this passage: I know it's in there. I know that, most likely, it will kill me. But that doesn't stop me from dreaming. I still think about things I'd like to be doing in ten years, five years, next year. Well, now it is "next year." It wasn't all that certain that I would still be here for the end of the first year, but here I am. Have I done those things I was dreaming about the first time I sat down to write a blog? Honestly, I don't remember what those dreams were. I do think about the future, every day. I don't know if any of those dreams will turn into reality, I don't know if I'll get the time. But I made it this far. And sitting here, right now, that feels like a victory. | Is Cancer Making Me Dysphoric? | Coping with cancer through self-instruction: a hypothesis. | Identity loss and maintenance: commonality of experience in cancer and dementia | Writing the breast cancer journey : illness narratives from an Internet forum | Relay for Life is coming back to Grenfell, to offer hope and support to those who have been affected by cancer. | Will you believe me if I told you that there are multiple cure of cancer ?? | I think my parents are hiding the fact that my grandpa is going through chemo for cancer again. | ELI5: The concept of "hanging on" or "fighting" when you're dying from a disease like cancer |
168 | Getting ready to sell home in Central Texas. Should I replace master bedroom carpeting with wood flooring? | We are planing to sell our SFH this spring. Our neighborhood is very desirable and all homes tend to go under contract within days. We are planning to repaint the interior and move a majority of our excess stuff into storage before listing. I just don’t know if we should spend the money replacing the carpet in the master bedroom. There is a rip in the entryway where my dog ripped it up as a puppy and you can’t miss it. There is also a large stain in the interior part of the room. I got some quotes to replace it, but it will not be a 100% match to the other carpet upstairs and the carpet isn’t even that nice in general. I wonder if it’s not even worth it since the buyer may come in and want to change out all the carpets? Or is it worth investing the money because it will show better? I know it’s a sellers market but I don’t want my house to show poorly. | Hi all. The room I’m intending to put my tonal in is carpeted. Any advice or suggestion as to whether I can/should leave it or if I just put down something else (e.g. a mat, special flooring, etc.) Thanks! | Starting the process of finishing the basement. We've decided to start with the floor to make it somewhat livable and inviting to company. Looking at carpet, cork, and laminate. What would be the better option? More affordable?
* Basement is dry and mostly even.
* No drains.
* I'm going to lay down a waterproofer/ paint first for piece of mind.
* Plan on refinishing the rest later. |
Why should I have to pay for the more expensive wood flooring when I had carpet originally? Does this make sense?
Edit* - I get it. I see what she meant now. Sucks.
Thanks all. | I have laminate floors instead of carpet, and something like this was a must for my little guy. It's a good size and good quality. I also build boxes, towers, and even castles with it when I play with the baby. | I'm moving into a new apartment soon, and after looking around for inspiration on here I've noticed almost every apartment I'm drawn to ends up being wood floors with area rugs for the main living room area. Unfortunately both the living room and bedroom of my new apartment are carpeted, it's new carpet and seems cozy but is fairly thick so I don't think any sort of rugs would work on top of it. What kinds of suggestions would you guys have for a carpeted space to add some substance so it doesn't feel like just a solid colored boring room? And before anyone says "just find an apartment with wood floors then", I live in a small town with very little choices for rentals and everything else about the size/location is perfect for me, so the carpet wasn't a deal breaker | We are looking at hardwood flooring. Reviews are all over the place. Looking at 5-10 dollars a square foot. Any quality brands out there for that price? Thanks | Hello!
Looking for recommendations for hardwood installation in a single condo bedroom. I've reached out to a few companies I found via Google for quotes, but am curious to hear if anyone has recent experience with a company/contractor they would vouch for?
Looking for assistance with matching the existing flooring in our unit installed by a previous owner. Room is standard condo bedroom.
Thanks in advance! | 168 | My house is 5 years old and has ceramic tile in living areas, carpeting in bedrooms. The master bedroom carpeting shows wear. I'm trying to decide if I should just re-carpet or invest in wood flooring. Any thoughts? | Should I repair carpet before listing my home? | the floors are a thousand times better, and we can take our time to replace ... | Is replacement carpet with mass backing just as good as MLV on the floor? | How to deal with old vinyl flooring? (adding new flooring) | Replacing wood floors, can I start here? | My wood floors feel like butter and are super clean when I'm done and ... | Our entire home has hard wood floors and no other carpet weve owned has done this or has as terrible as this one | [Landlord US-MD] After signing lease, tenant wants carpet changed. |
169 | when did white water world open at ocean parade | a licensed bar where guests can purchase alcoholic drinks and food options including Eagle Boys pizza. It is located on the park's western border between the Cave of Waves and the splashdown of The Wedgie. Salty's Kiosk is located next to The BRO and sells slushies, ice creams and other snack foods. Since September 2007, WhiteWater World has hosted an undercover events venue, the largest at an Australian theme park, The Shell. The venue can cater for up to 2000 guests and is located on the southeast corner of WhiteWater World. From April 2011, WhiteWater World has offered guests the | water park by fences and landscaping. On December 5, 2010, during the Columbus Zoo and Aquarium's annual Jack Hanna's Into the Wildlights holiday television special, Columbus Zoo Executive Director Dale Schmidt announced Zoombezi Bay's first major expansion, which included the addition of two new water slides from manufacturer WhiteWater West. Python Plunge would be WhiteWater's first tall Master Blaster Express uphill water coaster, while Big Boa Falls represented WhiteWater's first Boomerango Express half-pipe tube slide. Both attractions opened to the public on May 21, 2011. For the 2014 season, Zoombezi Bay announced that it would be saying goodbye to an | water park by fences and landscaping. On December 5, 2010, during the Columbus Zoo and Aquarium's annual Jack Hanna's Into the Wildlights holiday television special, Columbus Zoo Executive Director Dale Schmidt announced Zoombezi Bay's first major expansion, which included the addition of two new water slides from manufacturer WhiteWater West. Python Plunge would be WhiteWater's first tall Master Blaster Express uphill water coaster, while Big Boa Falls represented WhiteWater's first Boomerango Express half-pipe tube slide. Both attractions opened to the public on May 21, 2011. For the 2014 season, Zoombezi Bay announced that it would be saying goodbye to an | WhiteWater West WhiteWater West is a manufacturing company based in Richmond, British Columbia, Canada. It was established in 1980 and manufactures a variety of products for water parks including water slides and water play areas. The company also owns Hopkins Rides and Prime Interactives which manufacture water rides for amusement parks and dry play areas, respectively. In 1980, WhiteWater West was established by Geoff Chutter, a former accountant. The company's first project was the WhiteWater Waterslide and Recreation Complex in Penticton, Canada. In 1982, WhiteWater West acquired WhiteWater Composites. This was followed by the merger with Brookside Engineering in 1985 | the force of gravity during the ride. Reef Diver Reef Diver was an Enterprise amusement ride in the Ocean Parade section of Dreamworld on the Gold Coast, Australia. "Reef Diver" opened in the County Fair section of Dreamworld in 1983. At that time it operated under the name "Enterprise". In 2000, the actual ride from Schwarzkopf Industries was replaced with a new one from Meshio. In 2002, Ocean Parade was expanded to encompass the remaining rides in County Fair. The processed involved the renaming and retheming of the ride to "Reef Diver". On 28 April 2014, Reef Diver closed and | WhiteWater World for those who desire a mild thrill. Some of the slides on this tower interact with Dreamworld's Cyclone roller coaster. The Little Rippers are two ProSlide duelling cannon bowl slides. The slides can accommodate guests riding in either one or two person tubes. Riders begin in one of two parallel chutes before entering tunnels and splitting off in opposite directions. Each tunnel has a steep drop into the bowl element of the ride, after which the raft drops down through the centre and into a run-out chute. The other three slides on this tower are collectively known as The Temple | Six Flags White Water like the old Disney ticket system.) Eventually visitors paid a single fee to play at the park. Unlike most parks, American Adventures did not have a gate. Visitors could enter the attraction of their choice simply by walking across the parking lot. White Water maintained a single point of entry and the two promoted each other often, to the point of having a connecting pathway between the open plan of AA and the WW park entrance. In an attempt to build attendance, the indoor mini golf course was removed to make way for an interactive "theater." Several years later (and | White Water Bay (Oklahoma) Movies - An arrangement of movies from rated G-PG-13, The Bay hosts a movie in the wave pool area. They close the entire park except the wave pool and the guests who stay to watch the movie relax in chairs or enter the water to enjoy the movie. Movie starts at when it gets dark and finishes at the end of the duration of the film. Often riders would skip across the surface of the splash pool on their kickboards in the same way a stone skips across a pond. Due to this, inflated inner tubes were secured to the | 169 | Ocean Parade (Dreamworld) all of the area once occupied by Country Fair. Since its opening, the most major change to the land was when The Claw was added in September 2004. This installation required the redesign of the pathway, dining and merchandise shops. In 2006, Ocean Parade opened a "park-hop" entrance to WhiteWater World, which is also owned by Ardent Leisure (the owners of Dreamworld). In June 2011, Dreamworld will open a Zamperla Disk'O called "Shockwave". In 2014, Dreamworld renovated Ocean Parade with the rebuild of Wipeout and the opening of Tail Spin. In 2015, The Cyclone was renovated and transformed into Hot | what is the name of the reef diver ride in dreamworld | what is the name of the tourist in ocean water park | how many studios are there in ocean way | REEEG! REGIS PHILBIN TO HOST PAGEANT, LEAD PARADE IN OCEAN CITY | Anticipation mounts for Oceanside's beachfront resort | how many roller coasters are there at dreamworld australia | Worldbox: Ocean Update (Concept idk) | Advice for Mermaid Parade ? |
170 | Great 2D pictures, easy to use. | Seems easy enough to use so far, I haven`t uploaded any pictures yet. I can`t wait for summer and pics of the grand children. Then I will know better whether it was the right choice. | Wonderful. Just like the photos...perfect for what I need. Got here quick! | Awesome pictures, line art is not dark and it is easy to color. Designs are just best | Any books, resources, or tutorial that can teach me about 2D to 3D transformation ? I am starting in Computer Vision and this seems to be interesting | sir, i am try 2 make lingam pics but cant find a nice source image o gogole images. if sum1 is willing 2 make for me pliss 2 chek dat it is 25px X 25px big.
Thanks u in advance | I love these photo albums. I started using them years ago, and they are the only ones I use. The photos slide in very easily and I like that there is a place to caption each photo. It is also nice to be able to put a picture in front of the album. Highly recommend!! | Great way to show off a variety of pictures. Well made and the color is nice. A little challenging to line up the photos at first, but i used tape to align them to each display and it turned out great | Very informational and just what I wanted and needed. The photos are excellent! | 170 | Great pictures and easy to use. Love having an extra battery! The 3D picture mode isn't all that great, but we didn't get it for that. | Great picture: colors, clarity, contrast, brightness delightful. 3D is awesome | It has a good picture, the ability to zoom in and out ... | Best picture quality If you can do w/o 3D best ... | This is an excellent 3D camcorder, just okay for taking pictures. | It is a good camera but not very user friendly if you have ... | Takes good photos, works well in Auto mode | Camera looks great, easy to use | It was a great way to keep the camera with you and have ... |
171 | Multiaxial Stress Relaxation of Dual-Cross-Link Poly(vinyl alcohol) Hydrogels | Hydrogels are cross-linked polymeric networks, which have the ability to hold water within the spaces available among the polymeric chains. The hydrogels have been used extensively in various biomedical applications, e.g., drug delivery, cell carriers and/or entrapment, wound management and tissue engineering. Though far from extensive, this article has been devoted to study the common methods used for the characterization of the hydrogels and to review the range of applications of the same in health care. | Tuning Physical Crosslinks in Hybrid Hydrogels for Network Structure Analysis and Mechanical Reinforcement | In this study network structure of polyacrylamide based hydrogels prepared by radiation induced polymerization has been investigated. Polyacrylamide based hydrogels in the rod form were prepared by copolymerization of acrylamide(AAm) with hydroxyl ethyl methacrylate(HEMA) and methyl acrylamide(MAAm) in the presence of cross‐linking agent and water by gamma rays at ambient temperature. Molecular weight between cross‐links and effective cross‐link density of hydrogels were calculated from swelling as well as shear modulus data obtained from compression tests. The results have shown that simple compression analyses can be used for the determination of effective cross‐link density of hydrogels without any need to some polymer‐solvent based parameters as in the case of swelling based determinations. Diffusion of water into hydrogels was examined by analyzing water absorption kinetics and the effect of network, structure on the diffusion type and coefficient was discussed. | Novel hydrogels with excellent mechanical properties have prompted applications in biomedical and other fields. The reported tough hydrogels are usually fabricated by complicated chemical and/or physical methods. To develop more facile fabrication methods is very important for the practical applications of tough hydrogels. We report a very simple yet novel method for fabricating tough hydrogels that are totally physically cross-linked by cooperative hydrogen bonding between a pre-existing polymer and an in situ polymerized polymer. In this work, tough hydrogels are prepared by heating aqueous acrylamide (AAm) solution in the presence of poly(N-vinylpyrrolidone) (PVP) but without any chemical initiators or covalent bonding cross-linking agents. Mechanical tests of the as-prepared and swollen PVP-in situ-PAAm hydrogels show that they exhibit very high tensile strengths, high tensile extensibility, high compressive strengths, and low moduli. Comparative synthesis experiments, DSC characterization, and molecu... | The dependence of the streaming potential across hydrogel membranes on time was measured. The gel membranes used were obtained by blending various amounts of poly(vinyl alcohol) and poly(sodium L-glutamate), which have different average molecular weights per cross-linked unit. The streaming potential increased rapidly just after applying a pressure difference and then increased gradually up to a steady-state value. The time dependence of the streaming potential was analyzed as the relaxation of the polymer chains dissolved in the liquid phase of the membrane. The relaxation for all the gel membranes consisted of a single component. The relaxation time was long if the gel had a large average molecular weight per cross-linked unit. The effects of cross-linking and the concentration of the external solution on the relaxation time are discussed. | Abstract The swelling and mechanical properties of poly(vinyl alcohol) (PVA) hydrogel, and PVA gels obtained by swelling precursors in various solvents were investigated. On the basis of the experimental results, the structure of the gels in various solvents was estimated. PVA gels have a uniform structure with flexible PVA chains in a mixed solvent of dimethyl sulphoxide (DMSO) and water. On the other hand, those swollen in methanol, ethanol and formamide have a two-phase structure, which is composed of PVA-rich and solvent-rich phases. The PVA chains in the PVA-rich phase are crosslinked by hydrogen bonding. | Polyampholyte Hydrogels in Biomedical Applications | Poly(vinyl alcohol) is a non-toxic, biosynthetic polymer and biocompatible polymer that has the ability to form hydrogels either via chemical or physical crosslinking. Whilst chemical crosslinking provides greater control on the properties of the resultant hydrogel, physically crosslinked hydrogels or blends with other biocompatible polymers are more suited for biomedical applications. In this paper we report a systematic study on the effect of varying concentrations of PVA, physical methods of crosslinking, and PVA-gelatin and PVA-PVP blends on the physical and mechanical properties of the hydrogels. | 171 | Dual-cross-link hydrogels, which are composed of poly(vinyl alcohol) chains cross-linked by covalent bonds and transient physical bonds via borate ions, have received considerable interest due to the high extensibility as well as the self-healing properties. The dual-cross-link gels exhibit pronounced stress relaxation after the imposition of step strain, reflecting the breaking dynamics of temporary chains which sustain the initial stress. Multiaxial stress relaxation experiments using equibiaxial, planar, and uniaxial stretching with various degrees of strain unambiguously validate the time-strain separability in relaxation stress for a general type of deformation. The time effect is satisfactorily described by an existing model, while the strain effect is well approximated by the neo-Hookean model. Furthermore, the magnitude of total stress relaxation to the initial stress is constant, independently of the type and degree of imposed strain. These simple features provide an important basis for formulati... | A dynamic-coupling-reaction-based autonomous self-healing hydrogel with ultra-high stretching and adhesion properties | Failure in a soft gel: Delayed failure and the dynamic yield stress | Relaxation of Polymer Chains Dissolved in the Liquid Phase of Membranes under a Pressure Gradient. III. Hydrogel Membranes of Poly(vinyl alcohol) and Poly(sodium L-glutamate) | Facile Fabrication of Tough Hydrogels Physically Cross-Linked by Strong Cooperative Hydrogen Bonding | Multiscale Energy Dissipation Mechanism in Tough and Self-Healing Hydrogels | Novel polyethylene oxide (PEO) hydrogel films were synthesized via UV crosslinking with varying concentrations of pentaerythritol tetra-acrylate (PETRA) as crosslinking agent. The aim was to study the effects of the crosslinking agent on the material properties of hydrogel films intended for dermatological applications. Fabricated film samples were characterized using swelling studies, scanning electron microscopy, tensile testing and rheometry. Films showed rapid swelling and high elasticity. The increase of PETRA concentration resulted in significant increase in the gel fraction and crosslinking density (ρ ), while causing a significant decrease in the equilibrium water content (EWC), average molecular weight between crosslinks ( ), and mesh size (ζ) of films. From the scanning electron microscopy, cross-linked PEO hydrogel network appeared as cross-linked mesh-like structure with interconnected micropores. Rheological studies showed PEO films required a minimum of 2.5% w/w PETRA to form stable viscoelastic solid gels. Preliminary studies concluded that a minimum of 2.5% w/w PETRA is required to yield films with desirable properties for skin application.OPEN ACCESSPharmaceutics 2015, 7 306 | This paper investigates the influence of three different processing parameters on the global mechanical behavior of PVA (Polyvinyl alcohol)/DMSO (Dimethylsulfoxide) hydrogels: the initial concentration of PVA, the DMSO:H2O ratio and the number of freeze/thaw cycle applied to the material. A specific thermo-regulated testing apparatus for hydrophilic materials is presented, along with the performed cyclic and rupture tests. The observed mechanical responses are explained by an in-depth analysis of the cross-linking phenomenon. Using the Neo-Hookean hyperelastic model, the experimental data is fitted and a link between the density of macro-molecular chains in the material and its mechanical behavior is established. Strong differences are observed and discussed. | Hydrogels, as a series of three-dimensional, crosslinked, hydrophilic network polymers, exhibit extraordinary properties in softness, mechanical robustness and biocompatibility, which have been extensively utilized in various fields, especially for electronic devices. However, since hydrogels contain plenty of water, the mechanical and electrochemical properties are susceptible to temperature. The thermal characteristics of hydrogels can significantly affect the performance of flexible electronic devices. In this review, recent research on the thermal characteristics of hydrogels and their applications in electronic devices is summarized. The focus of future work is also proposed. The thermal stability, thermoresponsiveness and thermal conductivity of hydrogels are discussed in detail. Anti-freezing and anti-drying properties are the critical points for the thermal stability of hydrogels. Methods such as introducing soluble ions and organic solvents into hydrogels, forming ionogels, modifying polymer chains and incorporating nanomaterials can improve the thermal stability of hydrogels under extreme environments. In addition, the critical solution temperature is crucial for thermoresponsive hydrogels. The thermoresponsive capacity of hydrogels is usually affected by the composition, concentration, crosslinking degree and hydrophilic/hydrophobic characteristics of copolymers. In addition, the thermal conductivity of hydrogels plays a vital role in the electronics applications. Adding nanocomposites into hydrogels is an effective way to enhance the thermal conductivity of hydrogels. |
172 | [Podcast] Why you don't want to start with Starting Strength or Stronglifts - Revive Stronger: 150 | Do you have a question and are:
* A novice and basically clueless by default?
* Completely incapable of using google?
* Just feeling plain stupid today and need shit explained like you're 5?
Then this is the thread FOR YOU! Don't take up valuable space on the front page and annoy the mods, ASK IT HERE and one of our resident "experts" will try and answer it. As long as its somehow related to powerlifting then nothing is too generic, too stupid, too awful, too obvious or too repetitive. And don't be shy, we don't bite (unless we're hungry), and no one will judge you because everyone had to start somewhere and we're more than happy to help newbie lifters out.
#SO FIRE AWAY WITH YOUR DUMBNESS!!! | Do you have a question and are:
* A novice and basically clueless by default?
* Completely incapable of using google?
* Just feeling plain stupid today and need shit explained like you're 5?
Then this is the thread FOR YOU! Don't take up valuable space on the front page and annoy the mods, ASK IT HERE and one of our resident "experts" will try and answer it. As long as its somehow related to powerlifting then nothing is too generic, too stupid, too awful, too obvious or too repetitive. And don't be shy, we don't bite (unless we're hungry), and no one will judge you because everyone had to start somewhere and we're more than happy to help newbie lifters out.
#SO FIRE AWAY WITH YOUR DUMBNESS!!! | Do you have a question and are:
* A novice and basically clueless by default?
* Completely incapable of using google?
* Just feeling plain stupid today and need shit explained like you're 5?
Then this is the thread FOR YOU! Don't take up valuable space on the front page and annoy the mods, ASK IT HERE and one of our resident "experts" will try and answer it. As long as its somehow related to powerlifting then nothing is too generic, too stupid, too awful, too obvious or too repetitive. And don't be shy, we don't bite (unless we're hungry), and no one will judge you because everyone had to start somewhere and we're more than happy to help newbie lifters out.
#SO FIRE AWAY WITH YOUR DUMBNESS!!! | Do you have a question and are:
* A novice and basically clueless by default?
* Completely incapable of using google?
* Just feeling plain stupid today and need shit explained like you're 5?
Then this is the thread FOR YOU! Don't take up valuable space on the front page and annoy the mods, ASK IT HERE and one of our resident "experts" will try and answer it. As long as its somehow related to powerlifting then nothing is too generic, too stupid, too awful, too obvious or too repetitive. And don't be shy, we don't bite (unless we're hungry), and no one will judge you because everyone had to start somewhere and we're more than happy to help newbie lifters out.
#SO FIRE AWAY WITH YOUR DUMBNESS!!! |
As a natural bodybuilder, it is frustrating to fight for the little gains I have earned over this slow strength journey. It is definitely rewarding to read that you have reached level standard:
"Strong - Your lifts are around a 200 raw bench, 300 raw squat and 400 raw deadlift. This doesn't seem strong compared to powerlifting records, but you are still stronger than 90% of men walking the earth." - M&S Article
Where do you rank my fellow Fitness—Redditor?
*Obviously this is meant to gauge men and not women? So if as a woman you can do any of these standards. Much Respect!
One of the best articles to stroke my strength journey (ego).
| I've competed in a few powerlifting meets and I'm taking 6 months to focus on hypertrophy and beltless/sleeveless lifting.
My competing numbers are
Bodyweight: 181lb
Squat: 500lb
Bench: 335lb
Deadlift: 590lb
After my 6 month block of hypertrophy is done I'm looking to start back on a strength cycle to really gear in my numbers and nsuns has really caught my attention from reddit.
My question is how well do experienced lifters deal with this fatigue? Looking at the Android app I don't see myself being able to handle such volume. I get the novice lifters being able to breeze through this due to lifting intensities far below their true potential but has anyone with a wilks +400 tried this with great success? (Adding to total) | If you're a climber wanting to learn the basics of deadlifting, then this is for you! A clear, no-nonsense guide that will have you lifting heavy things off the ground in no time! | Basically the title. I have no aspirations for powerlifting whatsoever and just want to look in shape. Given those parameters are the big 3 still relevant? | 172 | Podcast
>This time we're talking about the times of uncertainty and mostly why starting strength or stronglifts are not good programmes for hypertrophy!
**Timestamps:**
00:20 We're talking about our current state
33:44 Starting strength, 5x5
42:52?
54:32 Best tips for leg training @ home? In having a really tough time stimulating them. | Effective Leg Training - Red Delta Project Podcast | MyFitnessPal help - strength training? | What is an upper limit of running performance you can develop while being a powerlifter? | Brad Schoenfeld's "MAX Muscle" routine | If you just started on the hypertrophy routine, take a Current ("Before") photo of your physique! | What does your stretching and cross/strength training schedule look like? | awesome effective workout regimen for those with tight schedules! | Why can I not find a routine that's purely hypertrophy training? |
173 | Edward J. Hendrick | Eldrick "Tiger" Woods | Who is jonathan edwards? | Andrew J. Love (September 2, 1907 - March 5, 1986) was an American professional baseball right fielder and first baseman in the Negro leagues. He played with the Detroit Stars in 1930 and 1931, and the Washington Pilots in 1932.
References
External links
and Seamheads
Detroit Stars players
Washington Pilots players
1907 births
1986 deaths
Baseball outfielders
Baseball first basemen
Baseball players from Alabama
20th-century African-American sportspeople | How many edwards had been king of england befor edward? | What was edward james olmos carrer? | Who is Adam Carlos Millard-Belcher? | James Weldon Johnson and the Genteel Tradition | James Weldon Johnson and the Genteel Tradition | 173 | Edward Joseph Hendrick (March 23, 1910 - August 12, 1987) was a leader in American prison systems and public administration. From 1952 to 1972, he was Deputy Commissioner of Public Welfare for the City of Philadelphia, and simultaneously served as Superintendent of the Philadelphia Prison System. By virtue of office, he was the lead named defendant in Jackson v. Hendrick, which set important legal precedents regarding humane conditions and overcrowding in US prisons. He was previously Chief Probation Officer for the United States District Court for the Eastern District of Pennsylvania. During World War II, he served in the US Navy as prison administrator for the 12th Naval District based in San Francisco, California.
His career was bookended by service in the Catholic Church. As a young man he entered the Jesuit formation and taught Latin at Regis High School in New York City. After retiring from government service, he became one of the most senior laypeople in the Archdiocese of Philadelphia, leading Adult Social Services - including the management of various nursing homes and shelters, and related programs. He was made a Knight of St. Gregory the Great by Pope John Paul II.
Early life
Edward was the first child born to Foscola Orrimela (F.O.) Hendrick and his second wife Helen C. Hendrick (née O'Neil). Foscola was an inventor and restaurateur, serving as general manager of Childs Restaurants, which was owned by his mother's family. Foscola's first wife, Frederikke Marie Blix, had died in 1902, leaving Foscola with four children. Foscola subsequently met and married Helen C. O'Neil, who had been a cashier in one of the Childs restaurants. In addition to Edward, Foscola and Helen had three further children: Helen, Catherine, and James.
As a boy, Edward attended Xavier High School in New York City, and then proceeded into the Jesuit formation, attending Woodstock College and Georgetown University.
Career
In 1940, Hendrick was appointed US Probation Officer for the District of New Jersey, by the Honorable Guy Leverne Fake; the appointment was confirmed by US Attorney General Robert H. Jackson. In 1943, Hendrick accepted a transfer to the Eastern District of Pennsylvania, reporting to Randolph E. Wise, Chief US Probation Officer. When Wise resigned, Hendrick was appointed to succeed him. Wise and Hendrick formed a professional relationship that would span another 40 years, through the City of Philadelphia (1952–1972) and the Archdiocese of Philadelphia (1973–1984), when both men retired.
In July 1944, Hendrick was granted a leave of absence from his federal role, in order to join the US Navy in support of World War II. During the war, he ran several Navy prisons in the Western US.
In 1952, Wise was appointed Philadelphia's first Commissioner of Public Welfare. Wise named Hendrick as one of his three Deputy Commissioners, with a specific focus on the city's penal system. They were part of a wave of reformers coming in under Joseph Clark, who was the city's first Democratic mayor in 68 years. Wise and Hendrick would continue in their respective roles through the next 20 years under Mayors Clark, Dilworth, and Tate.
Hendrick was recognized as a progressive and vocal advocate of prison reform efforts – mounting campaigns to end prison overcrowding, to improve staffing and training levels, and to offer inmates rehabilitation and vocational programs.
As early as 1957, Hendrick gave an interview to The Philadelphia Inquirer where he called attention to the issue of overcrowding and under-staffing in his own prison system, lobbying for the construction of a new facility "to replace the overcrowded, outdated Moyamensing Prison".
Nevertheless, the Philadelphia prison population exploded during his tenure, the city did not provide adequate funding to expand capacity or programs, and the system began to crack. On July 4, 1970, inmates at Holmesburg Prison rioted. In February 1971, five inmates filed a class action (Jackson v. Hendrick), "seeking injunctive relief from conditions of confinement alleged to violate the prisoners' constitutional and statutory rights". Over 15 years the case worked its way through the legal system, ultimately to the Pennsylvania Supreme Court.
In 1972, a frustrated Hendrick surprised new Mayor Frank Rizzo by resigning his City post and joining the Archdiocese of Philadelphia, to help lead the Catholic Social Services Administration. The move should not have been a great surprise, as his friend and boss Randolph Wise had also left the City and joined the Archdiocese, just months prior.
In 1984 at the age of 74, Hendrick retired from the Archdiocese. In 1986, Pope John Paul II made him a Knight of St. Gregory; he was invested by Cardinal John Krol. He died at his home in Philadelphia on August 12, 1987.
References
Knights of St. Gregory the Great
1910 births
1987 deaths
Woodstock College alumni
Georgetown University alumni
Xavier High School (New York City) alumni
People from East Orange, New Jersey | If Dorian was a dangerous American prison inmate, why was he not put under the custody of Oliva? | who designed the dame phyllis frost prison | where is the federal prison in philadelphia located | How do you find an inmate in new jersey prisons? | who accredited the hennepin county jail | Why was Feanor punished so harshly? | when did the us prison system end | what is the prison in michigan city indiana |
174 | USB Port not compatible with iPhone or iPod | I just changed from iPhone to android, before I was able to charge and control my music using my car stereo just fine (not stock) now it just says USB n/a when I plug it in and won't work. I've tried selecting it as a different input device on my phone but that doesn't work either. I think it's something to do with USB C. Is there a specific stereo I need to buy now? | I accidentally bought this because I thought it said "Compatible" with iPhone/ipod but when I read it now it obviously says it's incompatible with those devices. While it's my fault I bought it why do they even mention that it's not compatible? I mean. My iPhone charging cable doesn't support Sony Walkman but there was no tag on the box that said "Not compatible with Sony Walkman" on it. I think they put that on there because they knew that people would see it more searching the term iPhone or iPod and the giant label on the box that says don't open it if you plan to return it and the iPhone warning on a huge label indicates that I'm not the only dolt to make this mistake.
I am giving them 1 star because they are purposely trying to get hits on this product using keywords. Amazon, fix this listing. | I drive a 2014 Subaru Crosstrek and it has a USB port for charging and playing music. It worked fine with y iPhone 6s. I am using an Anker USB c to USB 3 (see below) to connect my ph-1 to the car. When connected it is charging but does not recognize the phone as a device and therefore cannot play music. Any suggestions how to fix this ? Or any suggestions on a cheap USB c to aux adaptor so I can just plug in an aux chord to the phone? Thanks
(Anker USB Type C Cable, PowerLine USB C to USB 3.0 Cable (3ft) with 56k Ohm Pull-up Resistor for Samsung Galaxy Note 8, Galaxy S8, S8+, S9, MacBook, Sony XZ, LG V20 G5 G6, HTC 10 and More
Edit** I ended up connecting the phone via Bluetooth and the sound/media quality is great so I'll just stick with that | quick question. since the Soundock series 3 will have a lightning port for newer iPhones if I buy a 30 pin adaptor for my old iPod and connect it to the soundock 3 will it work? and will it charge? thanks for the replies | This works and charges my iPhone on a regular outlet, but when connected to my vehicle through usb it shows as "not supported hardware". | I posted on here about an hour ago regarding the Blue & Me USB port in my Fiat Punto not working.
Since then I’ve gone onto a couple of forums and found out that I might need to buy a USB adapter so my phone can connect.
I have an iPhone and I’d like to connect it to the car so I can listen to music from my phone. My Apple USB lead isn’t working whenever I plug it into the USB port, I read something about an adapter that I can buy which may help, however, it does state on the website that only SOME 60 plates need the adapter. I was just wondering how I’d find out if I need it?
I also saw something about downloading the latest Blue & Me software, does anyone know where I’d find the link and instructions for this? Thank you!
LINK TO WEBSITE - | Anyway i can make the ipod act as usb device for a radio with a usb port for playback? | I'm trying to sync my iPod with iTunes (did so last week with no problems at all) and as soon as I plug it in it'll say "Connected" along with the little jingle my laptop plays when something is plugged in USB-wise, and then less than a second later it'll say "Ejecting" and play the unplugging jingle. The jingles are unrelated technically, but proof that my laptop thinks that it's ejected.
I'm using an external hard drive, have updated my iTunes and it still hasn't solved it, rebooted my iPod by holding the middle and menu button down, and have also just tried it with my iPhone and it didn't auto eject. Any idea as to what's going on? | 174 | The USB drive is not compatible with either the iPhone or the iPod. This was a huge disappointment. It appears that is is meant for connecting only to a thumb drive. Lame... | not compatible with IPOD! ...discontinued product... | Can you use any ipod usb with the iPod touch? | GT200 Iphone or Ipod not compatible with your device. | What's the best way so sync an iPod in Ubuntu? | It's not compatible with the New Video Ipod, newest Ipod | not compatible with ipod video! | i plug my ipod nano into the computer.\ni try to download songs and drag them into where it says:\nKatharine K's ipod, but it keeps saying: "no ipod connected"\ni dont know why this is happening because im SURE it's plugged in... | Is there a direct way to transfer music from my iPod to my iPhone? |
175 | Sputtered Pd77%Ag23% membranes of thickness 2.2-8.5 µm were subjected to a three-step heat treatment in air (HTA) to investigate the relation between thickness and the reported beneficial effects of HTA on hydrogen transport. The permeability experiments were complimented by volumetric hydrogen sorption measurements and atomic force microscopy (AFM) imaging in order to relate the observed effects to changes in hydrogen solubility and/or structure. The results show that the HTA-essentially an oxidation-reduction cycle-mainly affects the thinner membranes, with the hydrogen flux increasing stepwise upon HTA of each membrane side. The hydrogen solubility is found to remain constant upon HTA, and the change must therefore be attributed to improved transport kinetics. The HTA procedure appears to shift the transition from the surface to bulk-limited transport to lower thickness, roughly from~5 to ≤2.2 µm under the conditions applied here. Although the surface topography results indicate that HTA influences the surface roughness and increases the effective membrane surface area, this cannot be the sole explanation for the observed hydrogen flux increase. This is because considerable surface roughening occurs during hydrogen permeation (no HTA) as well, but not accompanied by the same hydrogen flux enhancement. The latter effect is particularly pronounced for thinner membranes, implying that the structural changes may be dependent on the magnitude of the hydrogen flux. | Abstract The hydrogen permeation and separation properties of alumina, zeolite (ZSM-5), palladium and Pd–Ag alloy membranes were measured and compared. Hydrogen separation from a commercial Towngas mixture (49% H 2 , 28.5% CH 4 , 19.5% CO 2 and 3% CO) was conducted. The commercial alumina membrane displayed excellent hydrogen permeation rate but was unable to separate hydrogen from the Towngas. Supported ZSM-5 membrane prepared by ex situ method was able to produce a product stream containing 60% H 2 from Towngas, whereas, high purity hydrogen was generated using thin palladium and Pd–Ag alloy membranes prepared by electroless plating technique. Some of the constituent gases in Towngas mixture inhibit hydrogen flux through the palladium membrane, but the addition of silver serves to ameliorate the situation. | Publisher Summary This chapter investigates proton conducting ceramic membranes, thin palladium membranes supported on porous ceramic substrates, cermet membranes, and dense metallic membranes. Membranes made from metals and alloys of Group IVB and VB elements (i.e. Nb, Ta, V, Zr) exhibited the best overall performance. These materials have long been used as hydrogen separation membranes in the nuclear industry and possess hydrogen permeabilities 10 to 100 times better than palladium in the desired temperature range of 340-440°C. Studies were performed to determine the feasibility of using various dense hydrogen transport membranes for economical separation of hydrogen from CO2 in high-pressure water-gas shift reactors. If membranes were commercially available to separate CO2 from H2 in water-gas shift reactors, the hydrogen could be utilized as a clean fuel, and the CO2, remaining at high pressure and undiluted by nitrogen, would be in a very concentrated form desirable for economic sequestration. | The diffusion mechanism of H in metals and metal hydrides is studied particularly at high H2 pressures. Thin films of Mg and Ti offer a convenient tool to quantify the atomic transport. We show how different parameters of hydrogenation affect the kinetics. At 200°C, the Pd-Mg interface is predominant and a linear regime of hydrogenation is observed, whereas at 300°C a parabolic regime is detected. In Mg, the hydride forms from the surface to the substrate whereas in Ti growth of TiH2 starts from the substrate. A linear kinetics is seen during hydrogenation of Ti films, which is due to the oxide layer on top, measured to be about 10nm thick. In the studied high pressure regime, the hydrogenation is not pressure dependent any more. Quantitative calculation of the growth rate and the diffusion coefficient of H in the hydrides is presented. | spillover on reducible supports such as titanium oxide is established, yet questions remain about whether hydrogen spillover can take place on nonreducible supports such as aluminium oxide. The study shows a convincing proof of the spillover effect at well-defined distances away from the metal catalyst explaining why hydrogen spillover is slower on an aluminum oxide catalyst support than on a titanium oxide catalyst support. The results reveal that hydrogen spillover is fast and efficient on titanium oxide, and extremely slow and short-ranged on aluminium oxide. Hydrogen spillover increases with adsorption temperature and metal dispersion. A correlation has been reported between | The basic features of the catalytic membrane dehydrogenation of n-butane have been studied in a reactor with membrane modules based on Pd/Ag foil of 9.3 and 30 μm thickness and in the absence of the membrane (temperature, 500–550°C; feed space velocity, 150–1200 h−1). It has been shown that in the absence of the membrane, the dehydrogenation of n-butane occurs in the kinetic region. The membrane thickness has a significant effect on the performance of the catalytic membrane reaction, presumably, because of the difference in the rate of H2 withdrawal from the reaction mixture. In the reactor with the 9.3-μm thick Pd/Ag-foil, the reaction is controlled by the H2 formation rate. As the thickness of the palladium foil is increased to 30 μm, the reaction proceeds to the diffusion region, thereby resulting in both enhancement of selectivity for butenes and a reduction of the yield of hydrocarbon deposits. | Abstract A composite membrane (TS-1/PDMS) was used as a catalytic interphase contactor in the two-phase reaction of n-hexane oxyfunctionalization by hydrogen peroxide. An experimental study allowed to establish the effects of the main membrane parameters (thickness, loading, chemical modifications . . .) on the performances of the membrane reactor. A simple mathematical model of the catalytic phase contactor was derived and shown to represent quantitatively the observed experimental trends. | Numerical characterization on concentration polarization of hydrogen permeation in a Pd-based membrane tube | Introduction The ITM Syngas Team led by Air Products and Chemicals and including Ceramatec, ChevronTexaco, Eltron Research, McDermott Technology and other partners, in collaboration with the U.S. Department of Energy, is developing ceramic Ion Transport Membrane (ITM) technology for the production of synthesis gas and hydrogen from natural gas. The ITM Syngas technology is in the fifth year and Phase 2 of a co-funded $90 MM, nine year, three phase development program. ITM membranes are fabricated from non-porous, multicomponent metallic oxides that operate at high temperatures and have exceptionally high oxygen flux and selectivity. A conceptualization of the ITM Syngas process is illustrated in Figure 1. The membrane structure incorporates a non-porous ITM and reduction and reforming catalyst layers. The membrane material must show long-term stability in reducing and oxidizing atmospheres, and long-term compatibility with the reduction and reforming catalysts. | 175 |
Introduction
Palladium-based membranes have been the focus of many studies due to their high hydrogen permeability and selectivity, which may find application in efficient separation technologies [1,2]. At temperature below~300 • C and pressure below~2 MPa, however, pure palladium undergoes the α-to-β phase transition that results in irreversible lattice strain. Over time, cycling of the temperature causes the Pd to become brittle; leading to fractures. In order to prevent hydrogen embrittlement, Pd is conveniently alloyed with other metals [3,4]. Silver is a widely used alloying element, reducing the α-to-β phase transition to below room temperature. Moreover, Pd-Ag alloys exhibit higher hydrogen permeability than pure palladium [4][5][6], with a maximum at~23 wt.% of Ag [6].
Hydrogen flux can be also enhanced by heat treatment in air (HTA) procedures [7][8][9][10][11][12][13][14][15][16][17][18][19], which are essentially oxidation-reduction cycles. For thin membranes, typically in the range of 1-3 µm, the total hydrogen flux through the membrane can be doubled upon air thermal treatment [8][9][10][11]16], and HTA has also been used to regenerate deactivated membranes [14,20,21]. Moreover, Mejdell et al. reported a significant reduction of the CO inhibitive effects on hydrogen permeation through a~3 µm Pd-Ag (23%) membrane after HTA [9]. The phenomena behind these advantageous effects are, however, still not clear. Different hypotheses have been suggested to explain the influence of heat treatment in air; including cleaning of the Pd-Ag surface, microstructural rearrangement, and induced segregation of Pd towards the surface. Oxidation is known to remove certain impurities and poisoning species from Pd-based surfaces [5,15,16,20]. This can facilitate and improve hydrogen flux, but is not a sufficient explanation that can fully elucidate the positive effects of HTA [14].
Microstructural changes are commonly observed in Pd-based membranes after air exposure, while the permeation properties are maintained or enhanced and even the stability/durability seems upheld. These include increase in surface roughness [10,13,14,17,22,23], as well as defect/void formation [8,11,14,17,19]. The increased surface roughness leads to an enlarged active surface area which can promote the hydrogen flux through the membrane given that surface phenomena are transport limiting. Furthermore, surface roughening is associated with grain growth in the membrane bulk [10,13,14,17,19]. As there is no clear agreement on whether larger grains inhibit [24][25][26] or enhance [27,28] hydrogen flux, it is not possible to irrefutably attribute hydrogen flux enhancement to formation of larger grains. Recently we established, however, a possible correlation between the solubility of hydrogen and the average grain boundary density in sputtered membranes, rendering the diffusivity practically unaffected as long as the hydrogen transport was controlled by bulk diffusion [29]. On the other hand, Zhang and co-workers [17] reported an increase in the hydrogen sorption kinetics that was attributed to higher hydrogen diffusivity for a 25 µm cold-rolled Pd-Ag 25 wt.% membrane after heat treatment in air at 300 • C for 1 day.
Another hypothesis is related to surface segregation of Pd as a result of the heat treatment in air, since H 2 dissociates over and binds to Pd but not to Ag. It is well established that Ag segregates to the membrane surface of ideal Pd-Ag alloys in absence of adsorbates; i.e., under vacuum or inert gas conditions, while a reverse segregation of Pd is induced after exposure of Pd-Ag surfaces to hydrogen and several other chemisorbing species [30][31][32]. The thermal treatment in air has been found to yield formation of a~2 nm thick PdO layer [13] on the Pd-Ag surface and to an enrichment of Pd that can be involved in the enhancement of hydrogen flux through Pd-Ag membranes [13,15,16,32]. Segregation and rearrangement of the outmost atomic layers could also be linked, in the sense that this could affect in particular the transfer of hydrogen from the surface to the bulk or vice versa; processes that are particularly difficult to study experimentally.
In this work, a new approach to the heat treatment in air procedure has been applied in order to further investigate its effect on hydrogen transport properties in Pd-Ag membranes. The procedure was performed so that each side of the membranes was consecutively exposed to ambient air in order to probe the individual surface responses, which to our knowledge have not been previously addressed in the literature. A final HTA applied to both sides together was also performed in order to establish if additional effects exist. Different membrane thicknesses have been included to the investigation, as well as measurements of hydrogen solubility before and after heat treatment, to better understand the transport mechanisms involved. The membranes were characterized using atomic force microscopy (AFM) for as-grown membranes, hydrogen-stabilized, and heat-treated in air (with subsequent hydrogen stabilization), to monitor changes in surface topography.
Materials and Methods
Membrane Preparation
Pd77%Ag23% thin, self-supported membranes were produced by SINTEF using a unique two-step magneton sputtering technique onto silicon single crystal substrates [33,34]. Pd-Ag films with thicknesses of 2.2, 4.7, 6.9, 8.5, and 11.2 µm were studied. The membrane thickness was determined using white light interferometry. In this work, the membranes analyzed have been categorized as follows: 'as-grown' refers to Pd77%Ag23% thin film samples just pulled-off from the silicon substrate; 'hydrogen-stabilized' refers to membranes exposed to hydrogen permeation measurements only; 'air-treated' corresponds to membranes that have been heat-treated in air (HTA) and subsequently stabilized under hydrogen according to the procedures described below. The 'growth/feed side' of the membranes is the side growing during the magneton sputtering deposition and was always exposed to the feed gas during permeation experiments. The 'substrate/permeate side' refers to the membrane side facing the silicon wafer under fabrication, and was always kept to the permeate (low pressure) side of the membranes during permeation experiments.
Hydrogen Stabilization/Permeation
The permeation behavior under pure hydrogen (purity 99.999%) through the Pd77%Ag23% membranes was studied as a function of temperature and pressure with no use of sweep gas. All membranes were mounted in a microchannel configuration as depicted in Figure 1. The membranes were placed in between a polished stainless steel feed housing and a polished stainless steel plate. The feed housing had seven channels for gas flow corresponding to a total active surface area of 0.91 cm 2 , in accordance with the permeate side steel plate geometry. On the permeate side, an open stainless steel housing was sealed to the perforated steel plate by a polished copper gasket. In conjunction with absence of sweep gas or dilutants, this configuration enables investigation of very thin membranes in absence of transport limitations from the gas phase (concentration polarization) or the support [35]. Membrane leakage was checked by using an Agilent 490 Micro-GC (Agilent Technologies, Santa Clara, CA, USA). No leakage could be detected during any of the permeation experiments both before and after the three-step heat treatment procedure. Experiments were performed at selected temperatures of 300, 350, and 400 • C. 300 • C was reached by ramping at 2 • C per minute with nitrogen (purity 99.999%) flushing on the feed side and argon (purity 99.999%) on the permeate side. After reaching 300 • C, nitrogen and argon were slowly removed from the system and hydrogen introduced. The permeate side was left at atmospheric pressure while a differential pressure of maximum 2 bar was applied on the retentate side. The permeate flow was measured by a bubble flow meter.
Heat Treatment in Air (HTA)
The three-step heat treatment in air (HTA) procedure was performed between hydrogen permeation experiments for three selected membrane thicknesses; 2.2, 4.7, and 8.5 µm respectively. The HTA was mainly performed using the following sequence: (i) permeate side, (ii) feed side, (iii) both sides one more time, with hydrogen permeation experiments between each step. Each HTA step was carried out at 300 • C for one hour. Before exposing the membranes to ambient air, hydrogen was removed from the system by introducing nitrogen on the feed side and argon on the permeate side for about 15 min. Nitrogen/argon were reintroduced for 15 min at the feed/permeate sides in order to flush out air. Hydrogen was then introduced again and nitrogen/argon slowly removed. As will be shown, HTA had the largest effect for the thinnest membranes. Another 2.2 µm membrane was therefore subjected to an alternative HTA sequence, denoted HTA2: (i) feed side, (ii) permeate side, (iii) both sides one more time, again with hydrogen permeation experiments between each step and procedures otherwise as described above.
Hydrogen Solubility
Equilibrium sorption measurements were carried out as described in [29] using an ASAP 2020 chemisorption analyzer (Micromeritics Instrument Corporation, Norcross, GA, USA) for 2.2 µm and 8.5 µm as-grown membranes, as well as after heat treatment in air. The heat treatment in air for the sorption samples was performed in a furnace at 300 • C under ambient air for one hour. Volumetric sorption was performed with a hydrogen pressure between 0.02 and 90.7 kPa. In every measurement, a sample mass close to 0.1 grams was used, taking into account also mass loss from degassing of the sample. The sorption measurements were carried out twice at three different temperatures: 300, 350, and 400 • C.
AFM Imaging
The surface topography was investigated by atomic force microscopy (AFM, Bruker, Boston, MA, USA) using a Multimode AFM instrument with a Veeco Multimode controller. All force spectroscopy analysis was performed in tapping mode under atmospheric conditions. Surface topography was investigated for both growth/feed side and substrate/permeate side for all the as-grown membranes, for hydrogen stabilized membranes and selected membranes after heat treatment in air with subsequent hydrogen stabilization. At least five surface scans were obtained at different locations for each sample. The first flattening order, provided by the AFM-instrument software (Nanoscope Software Version 7.2, by Veeco, Plainview, NY, USA), was performed in order to remove tilt and noise from all images. Surface roughness was estimated as the root mean square roughness (Rq) from the measured AFM images.
Results and Discussion
Permeability
Hydrogen permeation through Pd-Ag membranes generally follows the solution-diffusion mechanism, where Fick's law of diffusion describes the mass transport
J H 2 = P t (p n 1 − p n 2 ) = SD t (p n 1 − p n 2 )(1)
P is the permeability of the membrane, t the thickness, p 1 and p 2 the partial pressure of hydrogen on the high pressure side and low pressure side of the membrane, respectively, S the solubility, and D the diffusion coefficient. The n-value is determined by the rate-limiting step of the transport mechanism as explain further below. The diffusivity can be expressed as
D = D 0 exp − E a RT(2)
where D 0 is a pre-exponential factor and E a the activation energy for diffusion. Hydrogen permeance (P/t, Equation (1)) values, measured at 300 • C for untreated membranes (not subjected to HTA), are plotted in Figure 2 as a function of inverse thickness. In the calculation of the permeance, n = 0.5 was applied, which is essentially valid only with bulk diffusion as the rate-limiting step [36][37][38][39][40][41]. When the kinetics is bulk-limited, the permeance should be proportional to the inverse thickness, leading to a constant value for the permeability (a material property). In thick Pd-membranes, hydrogen generally forms a dilute solution and the transport is bulk-limited. The full line (Figure 2) refers to a bulk value of permeability equal to 1.5 × 10 −8 mol·m·m −2 ·s −1 ·Pa −0.5 that has been reported for a 100 µm thick Pd77%Ag23% membrane at 300 • C [5]. A previous investigation of pure Pd membranes in the thickness range 10 to 150 µm indicated that bulk diffusion was rate limiting for thicknesses above 20 µm [37]. As the thickness decreases, the transport mechanism may be controlled by a combination of surface effects and bulk diffusion (0.5 < n < 1) [42,43]. Eventually, surface phenomena such as adsorption/dissociation and/or association/desorption become completely rate-limiting, and the pressure exponent approaches unity [36][37][38][39][40][41]. Figure 2 indicates a bulk limited transport with permeance values somewhat higher than the bulk literature value for the thicker membranes (≤4.7 µm), while the thinnest membranes exhibit permeance values indicative of surface limitations affecting hydrogen permeation. The thickness at which this transition appears may depend both on the conditions (T, P, H 2 feed content) and the material properties as affected by the fabrication and eventual pre-treatment of the membrane. Several studies report that surface phenomena start to have an impact from 4-5 µm [10,29,40,44]. There are some variations in the measured permeance between membranes of the same thickness; larger for the 2.2 µm membrane relative to the 4.7 µm and 8.5 µm membrane. There could be several reasons for this variation, including experimental uncertainty. There may be a gradient in membrane thickness as large as~10% across the silicon wafer, but we take care to mainly utilize the mid-sections for permeation experiments to reduce this deviation. Time and contamination during ambient storage may have an effect, as well as slight stretching of the material under total pressure difference [10]. Such sputtered membranes of similar thickness are, however, not found to exhibit major differences in microstructure, composition, or surface topography [10,45,46], but a general observation that will be further discussed below is that this variation between principally equivalent samples is also reduced by HTA [10].
After stabilization under hydrogen and measurement of the permeance, membranes with thicknesses of 2.2, 4.7, and 8.5 µm were subjected to the three-step HTA procedures as described above. The results are displayed in Figure 3 and Table 1. Figure 3a shows the hydrogen permeance plotted as a function of inverse thickness before HTA as well as after each step in the HTA procedure; n assumed equal to 0.5 also here. HTA has larger effect as the thickness decreases, with practically no effect for the 8.5 µm thick membrane. Moreover, the permeance increases after each of the first two HTA steps, i.e., upon oxidation-reduction of each side of the membrane. The first increase amounts to~20% (HTA permeate/substrate) while the second (HTA feed/growth) is 60-40% (Table 1), depending on temperature, for the 2.2 µm membrane. There is no significant change when both sides are simultaneously exposed one more time to air. Figure 3a also implies that the permeance is inversely proportional to the membrane thickness after HTA. Hence, the oxidation-reduction cycle imposed by the HTA procedure apparently shifts the surface transport limitation to lower thickness and bulk diffusion becomes rate-limiting for the hydrogen transport over the whole thickness range and experimental conditions investigated. Moreover, the surface limitations appear to impose transport limitations on both sides initially, which can be lifted stepwise by oxidizing one side at the time. In order to investigate the importance of the order of the heat treatment with respect to growth/feed or substrate/permeate side of the membrane an experiment in the opposite order (HTA2) was performed for the 2.2 µm thickness as mentioned above. The results are displayed in Figure 3b and in Table 1. The stepwise increase in permeability is definitely maintained, possibly with some differences due to the order, i.e., feed or permeate side first. The relative increases are now~40% (HTA feed/growth) followed by 70-30% (HTA permeate/substrate) with increasing temperature, to eventually reach similar permeances values as for the main HTA sequence. Conclusions with respect to order are, however, complicated by the variation in values obtained for the hydrogen stabilization as discussed above. The dissociative adsorption of hydrogen over palladium surface atoms is practically non-activated [47]. It is thus difficult to ascribe the observed permeation increase on the feed side for either of the sequences in terms of adsorption properties only. Moreover, the hydrogen-stabilization as well as the HTA should have promoted Pd termination of the surface over Ag, but (temperature dependent) coverage effects may complicate the segregation behavior [48]. Nevertheless, the subsurface structure and elemental distribution may also be affected by the treatment and play a role in the transfer from the surface to the bulk and may affect both sides.
After exposure to air of both sides of the membranes, the permeability approaches a value of 2.1 ± 0.1 × 10 −8 ·mol·s −1 ·m −2 ·Pa −0.5 at 300 • C, as shown by Table 1 as well as the values for the 4.7 µm thickness (not shown). This is comparable to previous values reported in literature for similar membranes [10], for which the HTA also seems to partially diminish the variations between samples from different wafers or fabrication batches that is observed during the initial stabilization under hydrogen. The oxidation-reduction cycle may hence induce a higher degree of structural and compositional uniformity. The flux increase after HTA of both sides of the thinnest membrane corresponds to a doubling of the permeability, also in accordance with what has been previously reported in literature [10,13,14,16], although a comparison of permeabilities based on n equal to 0.5 is not valid in the strictest sense. The final permeability value at 300 • C is, however, higher than the value of 1.5 × 10 −8 ·mol·m·m −2 ·s −1 ·Pa −0.5 at 300 • C expected for bulk-limited transport reported in literature [5]. This could be related to differences in grain structure/density [29], grain orientation (the sputtered PdAg films contain predominantly grains oriented along <111> parallel/normal to the surface [49]), as well as purity, but requires further investigation.
Hydrogen Solubility and Diffusivity
In addition to hydrogen permeation experiments before and after the three-step heat treatment procedure, hydrogen sorption measurements were carried out to investigate possible variation caused by the HTA. The hydrogen solubility values were obtained before and after heat treatment in air of both sides simultaneously for 2.2 µm and 8.5 µm membranes, and the Sieverts' constants are reported in Table 2. Solubility decreases with increasing temperature, as expected [3,[50][51][52][53][54]. Moreover, the solubility increases as the thickness decreases as we have recently reported [29]. These thickness dependent changes in solubility were related to differences in the grain structure of the sputtered Pd-Ag films. After HTA of both sides, the values of Sieverts' constant remain basically unaffected for 300 and 400 • C. There is, however, some increase for the values at 350 • C, especially for the 8.5 µm. We are unsure whether this discrepancy can be considered an experimental error, but the data are not sufficient to conclude on significant HTA-induced changes in solubility. Previous results for a 25 µm cold-worked Pd-Ag25 wt.% indicated no change in hydrogen solubility after heat treatment in air [17,18].
Hydrogen diffusivities calculated based on reaction (1) for the 2.2 µm and 8.5 µm thick membranes before and after HTA are shown in Figure 4 as a function of inverse temperature. Estimated values for the pre-exponential factor (D 0 ) and activation energy (E a ) using Equation (2) are listed in Table 3. There are no significant changes found in diffusivity for the 8.5 µm membrane as both the permeability ( Table 2) and solubility (Table 3) are constant before and after HTA. The solubility value obtained after HTA at 350 • C has been omitted from the fit in Figure 4, but the values remain if it is taken in. The apparent activation energy of 20 kJ/mol (before and after HTA) is comparable to results obtained for Pd-Ag with bulk-limited kinetics. Völkl and Alefeld collected data for the diffusion coefficient of hydrogen in Pd from 25 authors and estimated a mean value of E a~2 2.4 kJ/mol and D 0 2.9 × 10 −7 m 2 /s [55]. Moreover, Holleck calculated for a Pd80%Ag20% (0.08-0.20 cm thick) membrane values of E a of~22.3 ± 0.4 kJ/mol and D 0~( 2.33 ± 0.2) × 10 −7 m 2 /s [56]. This suggests that HTA does not change the hydrogen transport mechanism for thick sputtered Pd77%Ag23% membranes. Table 3. Estimated values of the pre-exponential factor (D 0 ) and of the activation energy (E a ) for 2.2 µm and 8.5 µm thick membranes before and after the main HTA sequence.
Sample Thickness (µm)
Before HTA After HTA D 0 (m 2 /s) E a (kJ/mol) D 0 (m 2 /s) E a (kJ/mol) 2.2 4.9 × 10 −7 29 3.6 × 10 −7 24 8.5
1.5 × 10 −7 20 1.7 × 10 −7 20
In the case of the 2.2 µm thick membrane, the permeability enhancement must be attributed to an apparent increase in the diffusivity since the solubility seems to remain constant. Both the pre-exponential factor and the activation energy changes after HTA: E a decreases from 29 kJ/mol before HTA to 24 kJ/mol after HTA on both sides, and similar values were obtained for the opposite order of stepwise air-treatment (HTA2). Since E a exceeds the values reported for thicker membranes in literature [56], this supports the idea that surface phenomena are rate-limiting before HTA. However, if the enhanced kinetics of hydrogen transport upon heat treatment in air is associated with a transition from surface to bulk limited transport, there should be a change in the n-value that essentially complicates the comparison by fitting. However, comprehensive analysis to extract n-values also requires a larger pressure range that what could been applied here [11,35]. Nevertheless, the activation energies associated with (associative) desorption should be generally higher than those for diffusion, but may depend on the surface composition (Pd/Ag) as well as the coverage as discussed in [29].
Surface Topography
AFM was used in order analyze how the hydrogen stabilization and HTA procedure affects the surface topography of the different membranes. Figures 5 and 6 show representative AFM images of 2.2 µm and 8.5 µm thick as-grown, hydrogen-stabilized, and air-treated membranes. The corresponding roughness values of all the measured membranes are reported in Table 4. The feed/growth side of as-grown samples shows an increase in the surface roughness as the thickness increases. The corresponding permeate/substrate side is very smooth (0.2-0.4 nm) with some variation in surface roughness between the different samples and thicknesses analyzed. This is in accordance with previous results for similar, sputtered membranes [10,29], and reflects the nature of the nucleation and growth phenomena involved during sputtering. A relatively high density of nuclei seem to form on the substrate, and then growth proceeds by continuing some grains while others are terminated [19]. Table 4. Surface roughness for as-grown membranes, after hydrogen stabilization and HTA with subsequent hydrogen stabilization obtained from AFM imaging analysis for both the growth/feed and substrate/permeate side. The analyzed areas are based on (5 × 5) µm 2 images except for the substrate/permeate side as-grown membranes where images with an area of (1 × 1) µm 2 are used. Upon hydrogen permeation, the feed side surface roughness is found to increase moderately, while the effect of H 2 stabilization on the permeate side is found to be strongly thickness dependent. Hydrogen exposure/permeation has already been reported to increase the surface roughness of 1.3 µm sputtered Pd-Ag films [10]. For thick membranes (≥8.5 µm), hydrogen exposure causes only small changes to the surface structure. The permeate side becomes more roughened as the thickness decreases and the surface roughness of the 2.2 µm membrane becomes comparable for the two opposite sides. The reason behind this trend is not known, and it has-to our knowledge-not been reported before. The thickness dependent surface roughening on the permeate side under hydrogen permeation may possibly be connected to the fact that thinner membranes experience higher hydrogen flux than thicker membranes. In general, substantial roughening is associated with grain growth [19,29] and the higher hydrogen flux should hence facilitate restructuring and grain growth. After the HTA procedure and subsequent hydrogen stabilization the surface topology undergoes further changes, depending on thickness. For the thickest (8.5 µm) membrane analyzed, the roughness of the feed side is mainly enhanced upon exposure to hydrogen while the HTA procedure has only minor effect ( Figure 5). The permeate side, on the other hand, is strongly roughened after HTA. The feed side of the 4.7 µm thick membrane, already roughened during the hydrogen stabilization step, has yet another increase in roughness once oxidized. A similar behavior is also observed for the permeate side. Heat treatment in air contributes to a strong additional increase in surface roughness of feed side for the 2.2 µm membrane ( Figure 4, Table 2). The permeate side roughness, instead, is enhanced only after hydrogen exposure to around 12 nm, and no further increase after HTA is observed.
Membrane
Eventually, upon HTA the roughness values end up in the range of 20-30 nm on the growth/feed side and 9-15 nm on the substrate/permeate side, irrespective of the thickness dependent differences existing due to the growth process or developing during H 2 stabilization only. This is in agreement with several other investigations [10,13,14,17,22,23], reporting that the heat treatment in air helps the overall surface roughening process, thus creating new active sites and an increase of surface area. However, the roughening occurs also during hydrogen permeation-in particular for the thinner membranes-without observing an associated strong increase in flux. The permeation enhancement effect of the heat treatment in air can therefore not be fully attributed to an increase in surface area [14,19,57].
Conclusions
A three-step heat treatment in air has been performed on sputtered Pd77%Ag23% membranes with thickness ranging from 2.2 µm to 8.5 µm. The HTA is found to increase hydrogen permeability after each of the steps and to have a larger effect as the membrane thickness decreases. Air oxidation has no apparent effect on the hydrogen solubility, implying that enhancement in permeability may be related to an increase in diffusivity for thinner membranes (≤5 µm). The data also suggest that bulk diffusion is the rate-limiting step for transport after HTA for all membranes, while surface phenomena are rate-limiting for thinner membranes prior thermal air treatment. Moreover, AFM studies reveal that the HTA increases the surface roughness of the membranes. However, significant surface roughening is already experienced upon stabilization under hydrogen, in particular for the thinner membranes, indicating that increase in permeability is not only attributable to increased surface area.
Figure 1 .
1Sketch of the microchannel reactor configuration.
Figure 2 .
2Measured hydrogen permeance as function of inverse thickness at 300 • C for membranes not subjected to HTA. The full line refers to values of permeance reported if bulk is the rate limiting step (1.5 × 10 −8 ·mol·s −1 ·m −2 ·Pa −0.5 )[5].
Figure 3 .
3Permeance measured at 300 • C for each single step of heat treatment in air; (a) as function of inverse thickness for the main HTA membrane side sequence with the full line indicating a permeability of 2.1 × 10 −8 mol·s −1 ·m −2 ·Pa −0.5 , and (b) as function of the difference in the square root of the hydrogen partial pressure for the HTA2 membrane side sequence applied to a 2.2 µm thick membrane.
Figure 4 .
4Arrhenius plot of the diffusivity for 2.2 µm and 8.5 µm thick membranes before and after HTA of both sides for the temperature range 300-400 • C. The diffusivity scale is presented in logarithmic form and the dotted lines are linear fits.
Figure 5 .
5AFM images of the 2.2 µm thick membrane for the feed/growth side (left panel) and permeate/substrate side (right panel) for (a) as-grown; (b) hydrogen stabilized; and (c) HTA-subjected samples. Image areas: (a) right: 1 × 1 µm 2 ; rest: 5 × 5 µm 2 .
Figure 6 .
6AFM images of the 8.5 µm thick membrane for the feed/growth side (left panel) and permeated/substrate side (right panel) for (a) as-grown; (b) hydrogen stabilized; and (c) HTA-subjected samples. Image areas: (a) right and (b) right: 1 × 1 µm 2 ; rest: 5 × 5 µm 2 .
Author
Contributions: Conceptualization, T.P. and H.V.; Methodology, T.P., H.V., and R.B.; Validation, N.V., H.V. and I.-H.S.; Investigation, N.V.; Resources, T.P. and N.V.; Writing-Original Draft Preparation, N.V. and I.-H.S.; Writing-Review & Editing, T.P. and H.V. and R.B.; Visualization, N.V., I.H.S.; Supervision, H.V.; Project Administration, T.P. and H.V.; Funding Acquisition, T.P. and R.B. Funding: This research was funded by the Research Council of Norway through the RENERGI Program (190779/S60) and CLIMIT Program (215666/E20), and NTNU, SINTEF and Statoil ASA through the Gas Technology Centre NTNU-SINTEF.
Table 1 .
1Permeability measured at 300 • C after before, between and after each of the three steps in the main HTA membrane side sequences for the 2.2 µm thick membranes.T ( • C)
Permeability 10 8 (mol·m·m −2 ·s −1 ·Pa −0.5 )
Main HTA Sequence
HTA2 Sequence
Before
Feed
Perm
Both
Before Feed
Perm
Both
300
1.1
1.3
2.1
2.0
0.9
1.3
2.2
2.1
350
1.2
1.5
2.3
2.3
1.1
1.6
2.4
2.3
400
1.5
1.8
2.5
2.5
1.5
2.1
2.7
2.7
Table 2 .
2Sieverts' constant measured at different temperature for 2.2 µm and 8.5 µm thick membranes before and after heat treatment in air.Sample Thickness (µm)
Temperature ( • C)
Sieverts' Constant (µmol/g·Pa 0.5 )
Before HTA
After HTA
8.5
300
0.77
0.79
350
0.53
0.63
400
0.44
0.45
2.2
300
0.82
0.81
350
0.57
0.60
400
0.47
0.47
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Acknowledgments: Marit Stange is gratefully acknowledged for the manufacturing of the Pd-alloy films and MSc Live Nova Naess is acknowledged for contributing with some of the AFM data.Conflicts of Interest:The authors declare no conflict of interest.
Innovations in palladium membrane research. S N Paglieri, J D Way, 10.1081/SPM-120006115Sep. Purif. Methods. 31Paglieri, S.N.; Way, J.D. Innovations in palladium membrane research. Sep. Purif. Methods 2002, 31, 1-169. [CrossRef]
Chapter 11 Palladium-based Membranes in Hydrogen Production. R Bredesen, T A Peters, M Stange, N Vicinanza, H J Venvik, Membrane Engineering for the Treatment of Gases. Cambridge, UKThe Royal Society of Chemistry2Gas-Separation Problems Combined with Membrane ReactorsBredesen, R.; Peters, T.A.; Stange, M.; Vicinanza, N.; Venvik, H.J. Chapter 11 Palladium-based Membranes in Hydrogen Production. In Membrane Engineering for the Treatment of Gases: Volume 2: Gas-Separation Problems Combined with Membrane Reactors; The Royal Society of Chemistry: Cambridge, UK, 2011; pp. 40-86.
The purification of hydrogen. A review of the technology emphasizing the current status of palladium membrane diffusion. G J Grashoff, C E Pilkington, C W Corti, Platinum. Met. Rev. 27Grashoff, G.J.; Pilkington, C.E.; Corti, C.W. The purification of hydrogen. A review of the technology emphasizing the current status of palladium membrane diffusion. Platinum. Met. Rev. 1983, 27, 157-169.
The effect of alloying of palladium with silver and rhodium on the hydrogen solubility, miscibility gap and hysteresis. A K M F Kibria, Y Sakamoto, 10.1016/S0360-3199(00)00006-9Int. J. Hydrogen Energy. 25Kibria, A.K.M.F.; Sakamoto, Y. The effect of alloying of palladium with silver and rhodium on the hydrogen solubility, miscibility gap and hysteresis. Int. J. Hydrogen Energy 2000, 25, 853-859. [CrossRef]
Selective Hydrogenation of Phenol to Cyclohexanone Using Palladium-Based Membranes as Catalysts. N Itoh, W C Xu, 10.1016/0926-860X(93)85117-8Appl. Catal. A Gen. 107Itoh, N.; Xu, W.C. Selective Hydrogenation of Phenol to Cyclohexanone Using Palladium-Based Membranes as Catalysts. Appl. Catal. A Gen. 1993, 107, 83-100. [CrossRef]
Hydrogen Permeable Palladium Silver Alloy Membrane Supported on Porous Ceramics. S Uemiya, T Matsuda, E Kikuchi, 10.1016/S0376-7388(00)83041-0J. Membr. Sci. 56Uemiya, S.; Matsuda, T.; Kikuchi, E. Hydrogen Permeable Palladium Silver Alloy Membrane Supported on Porous Ceramics. J. Membr. Sci. 1991, 56, 315-325. [CrossRef]
A comparison of palladium-silver and palladium-yttrium alloys as hydrogen separation membranes. D Fort, J P G Farr, I R Harris, 10.1016/0022-5088(75)90204-0J. Less Common Met. 39Fort, D.; Farr, J.P.G.; Harris, I.R. A comparison of palladium-silver and palladium-yttrium alloys as hydrogen separation membranes. J. Less Common Met. 1975, 39, 293-308. [CrossRef]
Developing a heating procedure to optimise hydrogen permeance through Pd-Ag membranes of thickness less than 2.2 µm. J N Keuler, L Lorenzen, 10.1016/S0376-7388(01)00562-2J. Membr. Sci. 195Keuler, J.N.; Lorenzen, L. Developing a heating procedure to optimise hydrogen permeance through Pd-Ag membranes of thickness less than 2.2 µm. J. Membr. Sci. 2002, 195, 203-213. [CrossRef]
The effect of heat treatment in air on CO inhibition of a~3 µm Pd-Ag (23 wt.%) membrane. A L Mejdell, D Chen, T A Peters, R Bredesen, H J Venvik, 10.1016/j.memsci.2010.01.012J. Membr. Sci. 350Mejdell, A.L.; Chen, D.; Peters, T.A.; Bredesen, R.; Venvik, H.J. The effect of heat treatment in air on CO inhibition of a~3 µm Pd-Ag (23 wt.%) membrane. J. Membr. Sci. 2010, 350, 371-377. [CrossRef]
Hydrogen permeation of thin, free-standing Pd/Ag23% membranes before and after heat treatment in air. A L Mejdell, H Klette, A Ramachandran, A Borg, R Bredesen, 10.1016/j.memsci.2007.09.024J. Membr. Sci. 307Mejdell, A.L.; Klette, H.; Ramachandran, A.; Borg, A.; Bredesen, R. Hydrogen permeation of thin, free-standing Pd/Ag23% membranes before and after heat treatment in air. J. Membr. Sci. 2008, 307, 96-104. [CrossRef]
On the high pressure performance of thin supported Pd-23%Ag membranes-Evidence of ultrahigh hydrogen flux after air treatment. T A Peters, M Stange, R Bredesen, 10.1016/j.memsci.2010.11.022J. Membr. Sci. 378Peters, T.A.; Stange, M.; Bredesen, R. On the high pressure performance of thin supported Pd-23%Ag membranes-Evidence of ultrahigh hydrogen flux after air treatment. J. Membr. Sci. 2011, 378, 28-34. [CrossRef]
Hydrogen permeability of 2.5 µm palladium-silver membranes deposited on ceramic supports. D Pizzi, R Worth, M G Baschetti, G C Sarti, K.-I Noda, 10.1016/j.memsci.2008.08.020J. Membr. Sci. 325Pizzi, D.; Worth, R.; Baschetti, M.G.; Sarti, G.C.; Noda, K.-I. Hydrogen permeability of 2.5 µm palladium-silver membranes deposited on ceramic supports. J. Membr. Sci. 2008, 325, 446-453. [CrossRef]
Surface characterization of Pd/Ag23 wt.% membranes after different thermal treatments. A Ramachandran, W M Tucho, A L Mejdell, M Stange, H J Venvik, J C Walmsley, R Holmestad, R Bredesen, A Borg, 10.1016/j.apsusc.2010.03.131Appl. Surf. Sci. 256Ramachandran, A.; Tucho, W.M.; Mejdell, A.L.; Stange, M.; Venvik, H.J.; Walmsley, J.C.; Holmestad, R.; Bredesen, R.; Borg, A. Surface characterization of Pd/Ag23 wt.% membranes after different thermal treatments. Appl. Surf. Sci. 2010, 256, 6121-6132. [CrossRef]
The effect of air exposure on palladium-copper composite membranes. F Roa, J D Way, 10.1016/j.apsusc.2004.06.023Appl. Surf. Sci. 240Roa, F.; Way, J.D. The effect of air exposure on palladium-copper composite membranes. Appl. Surf. Sci. 2005, 240, 85-104. [CrossRef]
Changes in hydrogen permeability and surface state of Pd-Ag/ceramic composite membranes after thermal treatment. L Yang, Z Zhang, X Gao, Y Guo, B Wang, O Sakai, H Sakai, T Takahashi, 10.1016/j.memsci.2004.12.006J. Membr. Sci. 252Yang, L.; Zhang, Z.; Gao, X.; Guo, Y.; Wang, B.; Sakai, O.; Sakai, H.; Takahashi, T. Changes in hydrogen permeability and surface state of Pd-Ag/ceramic composite membranes after thermal treatment. J. Membr. Sci. 2005, 252, 145-154. [CrossRef]
Hydrogen permeance and surface states of Pd-Ag/ceramic composite membranes. L Yang, Z Zhang, B Yao, X Gao, H Sakai, T Takahashi, 10.1002/aic.10892AIChE J. 52Yang, L.; Zhang, Z.; Yao, B.; Gao, X.; Sakai, H.; Takahashi, T. Hydrogen permeance and surface states of Pd-Ag/ceramic composite membranes. AIChE J. 2006, 52, 2783-2791. [CrossRef]
A sorption rate hypothesis for the increase in H 2 permeability of palladium-silver (Pd-Ag) membranes caused by air oxidation. K Zhang, S K Gade, Ø Hatlevik, J D Way, 10.1016/j.ijhydene.2011.09.078Int. J. Hydrogen Energy. 37Zhang, K.; Gade, S.K.; Hatlevik, Ø.; Way, J.D. A sorption rate hypothesis for the increase in H 2 permeability of palladium-silver (Pd-Ag) membranes caused by air oxidation. Int. J. Hydrogen Energy 2012, 37, 583-593. [CrossRef]
Effects of heat treatment in air on hydrogen sorption over Pd-Ag and Pd-Au membrane surfaces. K Zhang, S K Gade, J D Way, 10.1016/j.memsci.2012.02.025J. Membr. Sci. 2012Zhang, K.; Gade, S.K.; Way, J.D. Effects of heat treatment in air on hydrogen sorption over Pd-Ag and Pd-Au membrane surfaces. J. Membr. Sci. 2012, 403-404, 78-83. [CrossRef]
Microstructural studies of self-supported (1.5-10 µm) Pd/23 wt.%Ag hydrogen separation membranes subjected to different heat treatments. W M Tucho, H J Venvik, J C Walmsley, M Stange, A Ramachandran, R H Mathiesen, A Borg, R Bredesen, R Holmestad, 10.1007/s10853-009-3671-9J. Mater. Sci. 44Tucho, W.M.; Venvik, H.J.; Walmsley, J.C.; Stange, M.; Ramachandran, A.; Mathiesen, R.H.; Borg, A.; Bredesen, R.; Holmestad, R. Microstructural studies of self-supported (1.5-10 µm) Pd/23 wt.%Ag hydrogen separation membranes subjected to different heat treatments. J. Mater. Sci. 2009, 44, 4429-4442. [CrossRef]
Deactivation and regeneration of Pd-Ag membranes for dehydrogenation reactions. J K Ali, E J Newson, D W Rippin, 10.1016/0376-7388(93)E0219-AJ. Membr. Sci. 89Ali, J.K.; Newson, E.J.; Rippin, D.W.T. Deactivation and regeneration of Pd-Ag membranes for dehydrogenation reactions. J. Membr. Sci. 1994, 89, 171-184. [CrossRef]
Hydrogen transport through a selection of thin Pd-alloy membranes: Membrane stability, H 2 S inhibition, and flux recovery in hydrogen and simulated WGS mixtures. T A Peters, T Kaleta, M Stange, R Bredesen, 10.1016/j.cattod.2011.12.028Catal. Today. 193Peters, T.A.; Kaleta, T.; Stange, M.; Bredesen, R. Hydrogen transport through a selection of thin Pd-alloy membranes: Membrane stability, H 2 S inhibition, and flux recovery in hydrogen and simulated WGS mixtures. Catal. Today 2012, 193, 8-19. [CrossRef]
New Technique of Activating Palladium Surface for Absorption of Hydrogen or Deuterium. U Hideo, O Tsugio, S Kazutaka, Jpn. J. Appl. Phys. 5095Hideo, U.; Tsugio, O.; Kazutaka, S. New Technique of Activating Palladium Surface for Absorption of Hydrogen or Deuterium. Jpn. J. Appl. Phys. 1993, 32, 5095.
Enhanced rates of hydrogen absorption resulting from oxidation of Pd or internal oxidation of Pd-Al alloys. D Wang, J D Clewley, T B Flanagan, R Balasubramaniam, K L Shanahan, 10.1016/S0925-8388(99)00638-6J. Alloys Compd. 298Wang, D.; Clewley, J.D.; Flanagan, T.B.; Balasubramaniam, R.; Shanahan, K.L. Enhanced rates of hydrogen absorption resulting from oxidation of Pd or internal oxidation of Pd-Al alloys. J. Alloys Compd. 2000, 298, 261-273. [CrossRef]
Nanostructured palladium-iron membranes for hydrogen separation and membrane hydrogenation reactions. K J Bryden, J Y Ying, 10.1016/S0376-7388(01)00736-0J. Membr. Sci. 203Bryden, K.J.; Ying, J.Y. Nanostructured palladium-iron membranes for hydrogen separation and membrane hydrogenation reactions. J. Membr. Sci. 2002, 203, 29-42. [CrossRef]
Hydrogen in nanocrystalline palladium. H Natter, B Wettmann, B Heisel, R Hempelmann, 10.1016/S0925-8388(96)02922-2J. Alloys Compd. 253Natter, H.; Wettmann, B.; Heisel, B.; Hempelmann, R. Hydrogen in nanocrystalline palladium. J. Alloys Compd. 1997, 253, 84-86. [CrossRef]
An investigation of hydrogen diffusion in nanocrystalline Pd by neutron spectroscopy. U Stuhr, T Striffler, H Wipf, H Natter, B Wettmann, S Janssen, R Hempelmann, H Hahn, 10.1016/S0925-8388(96)03062-9J. Alloys Compd. Stuhr, U.; Striffler, T.; Wipf, H.; Natter, H.; Wettmann, B.; Janssen, S.; Hempelmann, R.; Hahn, H. An investigation of hydrogen diffusion in nanocrystalline Pd by neutron spectroscopy. J. Alloys Compd. 1997, 253-254, 393-396. [CrossRef]
Nanostructured thin palladium-silver membranes: Effects of grain size on gas permeation properties. B A Mccool, Y S Lin, 10.1023/A:1017938403725J. Mater. Sci. 36McCool, B.A.; Lin, Y.S. Nanostructured thin palladium-silver membranes: Effects of grain size on gas permeation properties. J. Mater. Sci. 2001, 36, 3221-3227. [CrossRef]
In situ high-temperature X-ray diffraction study of thin palladium/α-alumina composite membranes and their hydrogen permeation properties. J Okazaki, T Ikeda, D A P Tanaka, T M Suzuki, F Mizukami, 10.1016/j.memsci.2009.03.009J. Membr. Sci. 335Okazaki, J.; Ikeda, T.; Tanaka, D.A.P.; Suzuki, T.M.; Mizukami, F. In situ high-temperature X-ray diffraction study of thin palladium/α-alumina composite membranes and their hydrogen permeation properties. J. Membr. Sci. 2009, 335, 126-132. [CrossRef]
Thickness dependent effects of solubility and surface phenomena on the hydrogen transport properties of sputtered Pd77%Ag23% thin film membranes. N Vicinanza, I.-H Svenum, L N Naess, T A Peters, R Bredesen, A Borg, H J Venvik, 10.1016/j.memsci.2014.11.031J. Membr. Sci. 476Vicinanza, N.; Svenum, I.-H.; Naess, L.N.; Peters, T.A.; Bredesen, R.; Borg, A.; Venvik, H.J. Thickness dependent effects of solubility and surface phenomena on the hydrogen transport properties of sputtered Pd77%Ag23% thin film membranes. J. Membr. Sci. 2015, 476, 602-608. [CrossRef]
Reversed surface segregation in palladium-silver alloys due to hydrogen adsorption. O M Løvvik, S M Opalka, 10.1016/j.susc.2008.07.016Surf. Sci. 602Løvvik, O.M.; Opalka, S.M. Reversed surface segregation in palladium-silver alloys due to hydrogen adsorption. Surf. Sci. 2008, 602, 2840-2844. [CrossRef]
Surface segregation of PdAg membranes upon hydrogen permeation. J Shu, B E W Bongondo, B P A Grandjean, A Adnot, S Kaliaguine, 10.1016/0039-6028(93)91484-7Surf. Sci. 291Shu, J.; Bongondo, B.E.W.; Grandjean, B.P.A.; Adnot, A.; Kaliaguine, S. Surface segregation of PdAg membranes upon hydrogen permeation. Surf. Sci. 1993, 291, 129-138. [CrossRef]
Adsorbate-induced segregation in a PdAg membrane model system: Pd 3 Ag(1 1 1). I H Svenum, J A Herron, M Mavrikakis, H J Venvik, 10.1016/j.cattod.2012.01.007Catal. Today. 193Svenum, I.H.; Herron, J.A.; Mavrikakis, M.; Venvik, H.J. Adsorbate-induced segregation in a PdAg membrane model system: Pd 3 Ag(1 1 1). Catal. Today 2012, 193, 111-119. [CrossRef]
. R Bredesen, H Klette, Method of Manufacturing Thin Metal Membranes. U.S. Patent. 686Bredesen, R.; Klette, H. Method of Manufacturing Thin Metal Membranes. U.S. Patent 6,086,729, 11 July 2000.
Sputtering of very thin palladium-alloy hydrogen separation membranes. H Klette, R Bredesen, 10.1016/S0958-2118(05)70414-6Membr. Technol. Klette, H.; Bredesen, R. Sputtering of very thin palladium-alloy hydrogen separation membranes. Membr. Technol. 2005, 2005, 7-9. [CrossRef]
Experimental investigation of a microchannel membrane configuration with a 1.4 µm Pd/Ag 23 wt.% membrane-Effects of flow and pressure. A L Mejdell, M Jondahl, T A Peters, R Bredesen, H J Venvik, 10.1016/j.memsci.2008.11.028J. Membr. Sci. 327Mejdell, A.L.; Jondahl, M.; Peters, T.A.; Bredesen, R.; Venvik, H.J. Experimental investigation of a microchannel membrane configuration with a 1.4 µm Pd/Ag 23 wt.% membrane-Effects of flow and pressure. J. Membr. Sci. 2009, 327, 6-10. [CrossRef]
Preparation and characterization of a composite palladium-ceramic membrane. J P Collins, J D Way, 10.1021/ie00024a008Ind. Eng. Chem. Res. 32Collins, J.P.; Way, J.D. Preparation and characterization of a composite palladium-ceramic membrane. Ind. Eng. Chem. Res. 1993, 32, 3006-3013. [CrossRef]
Diffusion of hydrogen through palladium. R C Hurlbert, J O Konecny, 10.1063/1.1701003J. Chem. Phys. 34Hurlbert, R.C.; Konecny, J.O. Diffusion of hydrogen through palladium. J. Chem. Phys. 1961, 34, 655-658. [CrossRef]
High-Flux Palladium Membranes Based on Microsystem Technology. J T F Keurentjes, F C Gielens, H D Tong, C J Van Rijn, 10.1021/ie0341202Ind. Eng. Chem. Res. 43Keurentjes, J.T.F.; Gielens, F.C.; Tong, H.D.; van Rijn, C.J.M.; Vorstman, M.A.G. High-Flux Palladium Membranes Based on Microsystem Technology. Ind. Eng. Chem. Res. 2004, 43, 4768-4772. [CrossRef]
Multilayer metal membranes for hydrogen separation. T S Moss, N M Peachey, R C Snow, R C Dye, 10.1016/S0360-3199(97)00030-XInt. J. Hydrogen Energy. 23Moss, T.S.; Peachey, N.M.; Snow, R.C.; Dye, R.C. Multilayer metal membranes for hydrogen separation. Int. J. Hydrogen Energy 1998, 23, 99-106. [CrossRef]
Preparation of a palladium alloy composite membrane supported in a porous stainless steel by vacuum electrodeposition. S.-E Nam, S.-H Lee, K.-H Lee, 10.1016/S0376-7388(98)00262-2J. Membr. Sci. 153Nam, S.-E.; Lee, S.-H.; Lee, K.-H. Preparation of a palladium alloy composite membrane supported in a porous stainless steel by vacuum electrodeposition. J. Membr. Sci. 1999, 153, 163-173. [CrossRef]
Model of hydrogen permeation behavior in palladium membranes. T L Ward, T Dao, 10.1016/S0376-7388(98)00256-7J. Membr. Sci. 153Ward, T.L.; Dao, T. Model of hydrogen permeation behavior in palladium membranes. J. Membr. Sci. 1999, 153, 211-231. [CrossRef]
Membrane reactors for hydrogenation and dehydrogenation processes based on supported palladium. R Dittmeyer, V Höllein, K Daub, 10.1016/S1381-1169(01)00149-2J. Mol. Catal. A Chem. 173Dittmeyer, R.; Höllein, V.; Daub, K. Membrane reactors for hydrogenation and dehydrogenation processes based on supported palladium. J. Mol. Catal. A Chem. 2001, 173, 135-184. [CrossRef]
State-of-the-art of supported metal membranes for gas separation. S Uemiya, 10.1080/03602549909351644Sep. Purif. Methods. 28Uemiya, S. State-of-the-art of supported metal membranes for gas separation. Sep. Purif. Methods 1999, 28, 51-85. [CrossRef]
Novel method for preparing palladium membranes by photocatalytic deposition. L.-Q Wu, N Xu, J Shi, 10.1002/aic.690460518AIChE J. 46Wu, L.-Q.; Xu, N.; Shi, J. Novel method for preparing palladium membranes by photocatalytic deposition. AIChE J. 2000, 46, 1075-1083. [CrossRef]
Microstructural characterization of self-supported 1.6 µm Pd/Ag membranes. W Mekonnen, B Arstad, H Klette, J C Walmsley, R Bredesen, H Venvik, R Holmestad, 10.1016/j.memsci.2007.11.022J. Membr. Sci. 310Mekonnen, W.; Arstad, B.; Klette, H.; Walmsley, J.C.; Bredesen, R.; Venvik, H.; Holmestad, R. Microstructural characterization of self-supported 1.6 µm Pd/Ag membranes. J. Membr. Sci. 2008, 310, 337-348. [CrossRef]
Thin Pd-23%Ag/stainless steel composite membranes: Long-term stability, life-time estimation and post-process characterization. T A Peters, W M Tucho, A Ramachandran, M Stange, J C Walmsley, R Holmestad, A Borg, R Bredesen, 10.1016/j.memsci.2008.10.053J. Membr. Sci. 326Peters, T.A.; Tucho, W.M.; Ramachandran, A.; Stange, M.; Walmsley, J.C.; Holmestad, R.; Borg, A.; Bredesen, R. Thin Pd-23%Ag/stainless steel composite membranes: Long-term stability, life-time estimation and post-process characterization. J. Membr. Sci. 2009, 326, 572-581. [CrossRef]
Ab initio Investigation of Hydrogen Atom Adsorption and Absorption on Pd(110) Surface. A A B Padama, H Kasai, Y W Budhi, N B Arboleda, 10.1143/JPSJ.81.114705J. Phys. Soc. Jpn. 81114705Padama, A.A.B.; Kasai, H.; Budhi, Y.W.; Arboleda, N.B. Ab initio Investigation of Hydrogen Atom Adsorption and Absorption on Pd(110) Surface. J. Phys. Soc. Jpn. 2012, 81, 114705. [CrossRef]
Reversed Hysteresis during CO Oxidation over Pd 75 Ag 25 (100). V R Fernandes, M V D Bossche, J Knudsen, M H Farstad, J Gustafson, H J Venvik, H Gronbeck, A Borg, 10.1021/acscatal.6b00658ACS Catal. 6Fernandes, V.R.; Bossche, M.V.d.; Knudsen, J.; Farstad, M.H.; Gustafson, J.; Venvik, H.J.; Gronbeck, H.; Borg, A. Reversed Hysteresis during CO Oxidation over Pd 75 Ag 25 (100). ACS Catal. 2016, 6, 4154-4161. [CrossRef]
Studies of self-supported 1.6 mu m Pd/23 wt.% Ag membranes during and after hydrogen production in a catalytic membrane reactor. B Arstad, H Venvik, H Klette, J C Walmsley, W M Tucho, R Holmestad, A Holmen, R Bredesen, 10.1016/j.cattod.2006.01.041Catal. Today. 118Arstad, B.; Venvik, H.; Klette, H.; Walmsley, J.C.; Tucho, W.M.; Holmestad, R.; Holmen, A.; Bredesen, R. Studies of self-supported 1.6 mu m Pd/23 wt.% Ag membranes during and after hydrogen production in a catalytic membrane reactor. Catal. Today 2006, 118, 63-72. [CrossRef]
Absorption of gases by metals. A Sieverts, Z. Metallkd. 21Sieverts, A. Absorption of gases by metals. Z. Metallkd. 1929, 21, 37-46.
A comparative study of hydrogen permeabilities and solubilities in some palladium solid solution alloys. D T Hughes, I R Harris, 10.1016/0022-5088(78)90229-1J. Less Common Met. 61Hughes, D.T.; Harris, I.R. A comparative study of hydrogen permeabilities and solubilities in some palladium solid solution alloys. J. Less Common Met. 1978, 61, P9-P21. [CrossRef]
High-temperature thermodynamics of the solutions of hydrogen in palladium-silver alloys. C Picard, O J Kleppa, G Boureau, 10.1063/1.437857J. Chem. Phys. 70Picard, C.; Kleppa, O.J.; Boureau, G. High-temperature thermodynamics of the solutions of hydrogen in palladium-silver alloys. J. Chem. Phys. 1979, 70, 2710-2719. [CrossRef]
Thermokinetic modeling and parameter estimation for hydrogen permeation through Pd 0.77 Ag 0.23 membranes. A Bhargav, G S Jackson, 10.1016/j.ijhydene.2009.04.010Int. J. Hydrogen Energy. 34Bhargav, A.; Jackson, G.S. Thermokinetic modeling and parameter estimation for hydrogen permeation through Pd 0.77 Ag 0.23 membranes. Int. J. Hydrogen Energy 2009, 34, 5164-5173. [CrossRef]
Physical properties of some palladium alloy hydrogen diffusion membrane materials. D Fort, I R Harris, 10.1016/0022-5088(75)90037-5J. Less Common Met. 41Fort, D.; Harris, I.R. Physical properties of some palladium alloy hydrogen diffusion membrane materials. J. Less Common Met. 1975, 41, 313-327. [CrossRef]
Diffusion of hydrogen in metals. J Voelkl, G Alefeld, Top. Appl. Phys. 28Voelkl, J.; Alefeld, G. Diffusion of hydrogen in metals. Top. Appl. Phys. 1978, 28, 321-348.
Diffusion and solubility of hydrogen in palladium and palladium-Silver alloys. G L Holleck, 10.1021/j100698a005J. Phys. Chem. 74Holleck, G.L. Diffusion and solubility of hydrogen in palladium and palladium-Silver alloys. J. Phys. Chem. 1970, 74, 503-511. [CrossRef]
Effects of thermal activation on hydrogen permeation properties of thin, self-supported Pd/Ag membranes. W M Tucho, H J Venvik, M Stange, J C Walmsley, R Holmestad, R Bredesen, 10.1016/j.seppur.2009.06.015Sep. Purif. Technol. 68Tucho, W.M.; Venvik, H.J.; Stange, M.; Walmsley, J.C.; Holmestad, R.; Bredesen, R. Effects of thermal activation on hydrogen permeation properties of thin, self-supported Pd/Ag membranes. Sep. Purif. Technol. 2009, 68, 403-410. [CrossRef]
| Abstract The Pd 4 S phase of palladium sulfide is known to be a highly selective alkyne hydrogenation catalyst at atmospheric pressure. Results presented here demonstrate that high selectivity can be retained at the elevated pressures required in industrial application. For example, in a mixed acetylene/ethylene feed, 100% conversion of acetylene was attained with a selectivity to ethylene in excess of 80% at 18 bar pressure. Similarly, almost 85% selectivity can be obtained with mixed C3 feeds containing methyl acetylene, propadiene, propylene and propane at 18 bar pressure. Using a low loaded sample (0.1 wt% Pd) it was possible to estimate the TOF to be 27 s −1 . High selectivity was related to the crystal structure of Pd 4 S with the unique spatial arrangement thought to favour Pd atoms acting in isolation from one another. Based on these results, it is proposed that this catalyst could be a potential replacement for PdAg alloys currently used by industry. | Shape-Dependent Interactions of Palladium Nanocrystals with Hydrogen | The optical properties of hydrogen exposed palladium (Pd) and palladium oxide (PdO) thin films are calculated from reflectance and transmittance measurements in the visible and near infrared range (400–900nm). The time evolution of the films’ optical constants when exposed to hydrogen is shown. The real part of palladium’s refractive index increases about 5%, whereas the imaginary part decreases nearly 15% after hydrogen absorption. The Pd films’ resistance also increased upon hydrogen absorption, as expected. Pd oxide reduces to metallic palladium upon hydrogenation, showing a dramatic change in all the properties. The palladium films’ resistance initially decreases after a first exposure to 5Torr of hydrogen, and this is tentatively explained by the reaction of hydrogen with impurities trapped in the films. | A simultaneous voltammetric and dilatometric study of hydrogen absorption in Pd and amorphous Pd80Si20 | Abstract Understanding and optimizing water and thermal management in the catalyst layer of proton-exchange-membrane fuel cells is crucial for performance and durability improvements. This is especially the case at low temperatures, where liquid water and even ice may exist. In this article, the durability of a traditional Pt/C dispersed and a nanostructure thin film (NSTF) membrane-electrode assembly (MEA) are examined under wet/dry and freeze/thaw cycles using both in situ and ex situ experiments. Multiple isothermal cold starts result in a performance degradation for the dispersed MEA, while no such a degradation is found in the NSTF. The results are consistent with stand-alone MEA tests, wherein the dispersed catalyst layer results in an exponential increase in the number and size of cracks until it delaminates from the membrane due to the impact of the freeze/thaw process within the catalyst-layer pores. The NSTF catalyst layer shows minimal crack generation without delamination since the ice forms on top of the layer. The results are useful for understanding degradation due to phase-change containing cycles. | Electrochemical hydrogen relief of Ti-Pd alloy | Effect of Hydration on the Hydrogen Abstraction Reaction by HO in DMS and its Oxidation Products† | Abstract Hydride nucleation and growth is studied by electrochemical hydrogenography on Pd-thin films with modified adhesion between the film and the glass substrate. Modification was controlled by a Nb-adhesive. A clear influence of the adhesion on the hydride formation was found. The adhering films showed small hydrides far beyond the resolution limit of the method. Contrary to this, the weak-adhering films showed low nucleation densities and large separated hydrides extending in the μm-range. The difference was attributed to enhanced hydride formation in quasi stress-free volumes and an easily propagating delamination front that supports hydride growth. |
176 | [TOMT] [books] [UK] Tim and the witch? | Brief summary of the devil and tom walker? | First off this is an excellent book. Diana Wynne Jones has a knack for spinning humourous, engaging stories around sympathetic characters. In the Chrestomanci series, I would rate this as my second favourite, "The Lives of Christopher Chant" being my first.
On the connection between the Harry Potter books and Diana Wynne Jones' books: the Harry Potter books are strongly influenced by Jones' books (the Chrestomanci series in particular). I don't remember any references to "Witch Week", but Harry Potter #3 refers to "The Lives of Christopher Chant" (Crookshanks = Throgmorten), "Dogsbody"(Sirius Black is named after Sirius Dogstar, a 'murderer'who takes the form of a dog in order to clear his name), etc. And I think Harry Potter is modeled a little on Christopher Chant, the boy magician with uncontrollable hair and horrible relatives.
So if you're a Harry Potter fan, you should definitely check out this series, and the rest of Diana Wynne Jones'books, because there are probably a lot of connections I've missed. | I so thoroughly enjoyed this book...esp. the shenanigans of Gwyns Mother, Hazel. I found myself giggling and just having a wonderful read. The witches in this book are older with Phyllis being Mercys grandma. So the young witches were also mentioned in this book. There is also Vic, who is Chars husband but who is unfortunately a dog. Makes for more giggles. | This first book int the Books Of Magic series is a novelization of the original 4-issue Books of Magic series from DC Comics. Many believe that Harry Potter was based on Timothy Hunter (whose original name was Seeker).
Timothy Hunter is a young English boy from a broken home (his parents had a car accident). He is somewhat of a nebish and where spectacles. But one day he is given the chance to learn magic, for it is his fate to possibly be the era's greatest wizard. He quickly gains an owl for a familiar and embarks on a series of journeys to learn about magic and whether he would walk its path.
He begins by traveling to the past where he encounters a young Merlin. Then he explores the present-day world and meets a number of evil wizards who would like him dead. From there he travels the lands of Faerie where he meets Queen Titania and falls afoul of the Babba Yagga. Then he must go into the future. Here he sees some of white might come to pass, sees the end of everything, meets Death and survives another attempt on his life.
Returning to the present, Timothy must decide if he is to follow the ways of magic or remain in the mundane world.
This book does an adequate job of retelling the story, but despite the fact that novels can usually flesh out a comic book (more space available), this on is actually lacking much of the original story.
Some of the characters in the original story do not even make an appearance here. Boston Brand (Deadman) supplied an wonderful bit of suspense and foreshadowing in the original, but here he is completely absent. The John Constantine section lacks the wonder and thrill of the original, although an explanation is given as to how Zatana made such a big blunder.
Overall, not a bad book, but not as good as the original. | My toddler and I love this book. It is so much fun. The text is sparse but interactive--you have to keep guessing things about Daisy O'Grady; in the end she is revealed to be a witch, a friendly witch, however. The award-winning illustrations are just superb. They look like photographs, albeit surrealistic photographs, filled with an explosion of animals, household products, hats, you name it. One caveat: If you are afraid of/offended by witches and want books containing anything mythical/supernatural censored from school libraries, then this book is not for you. | This is one of the better books I have read. There is so much insight. Tim is not trying to make a point, he just wants to share others thoughts about life. | Excellent book on Iroquois Witches and other supernatural stories.. It is complete and explains why witches and sorcerers were not allowed into their villages. The Iroquois even had their own witch trials. interesting. | Please note: Not only spoilers for D.O.D.O. but also the Philip K Dick story *Captive Market* follow.
So in addition to the obvious references and homages in D.O.D.O.(to wit, the inevitably naked *Terminator*-style time travel, the Fuggers who are clearly the Rothchilds - down to the Coloboma defect of their irises, and an overall influence I believe detect from the game *Arcanum*) there is a very strong parallel between the way time travel magic operates in D.O.D.O. and in PKD's story. If you are unfamiliar with it, please check it out - it is, like nearly everything Dick wrote, superb. In it a witch has found what she calls a chain (but what D.O.D.O. readers would likely call a strand) of a future where a small community of people who have survived an apocalypse is attempting to build a rocket ship to travel to Venus. Since the blasted landscape is filled with the drifting debris of the past, the community has access to gathering dollar bills, so she fills her truck with what she knows they need and then sells it to them, taking the money back in time with her an banking it. The witch can manipulate the future directly by choosing which chain/strand becomes reality - so it's a bit of an inversion there but the same basic concept.
Just wondering in general what other influences/homages people had detected in the book and where people were on it overall. | 176 | OK, this was a series of books from when I was in primary school in the late 80s. It may have been for readers aged 8, 9 or 10.
The premise was a series of books, possibly 'Tim' and a witch. But this kid was some how initiated into some kind of witch fraternity and had a cat, or familiar.
The books were small, not novel sized, and maybe had illustrations taking up the top half of pages. they seemed quite dark in nature, and were serialised.
Struggling to remember them. | [TOMT] [BOOK] [1990s-2000s] Children’s Book About A Child Witch Whose Teacher is Also a Witch. The Teacher and the Dad Fall in Love and All Three of Them Go on Vacation to the Dead Sea. | Adult Fiction Horror?? Two young sisters in a small town...one is a witch?? | A Witches Path Series by N E Conneely | Fiction kid's book about a girl and a boy who think there is a witch's house and a witch in the woods. One or both of the kids may have moved to the area and started exploring the forest by their house. | Little witch goes to school book | Looking for manga about witches | Hey guys. Any beginning books about witchcrafts? | what is the name of the book in the witch hunter series |
177 | Reductive Lie Groups, such as the orthogonal groups, the Lorentz group, or the unitary groups, play essential roles across scientific fields as diverse as high energy physics, quantum mechanics, quantum chromodynamics, molecular dynamics, computer vision, and imaging. In this paper, we present a general Equivariant Neural Network architecture capable of respecting the symmetries of the finitedimensional representations of any reductive Lie Group G. Our approach generalizes the successful ACE and MACE architectures for atomistic point clouds to any data equivariant to a reductive Lie group action. We also introduce the lie-nn software library, which provides all the necessary tools to develop and implement such general G-equivariant neural networks. It implements routines for the reduction of generic tensor products of representations into irreducible representations, making it easy to apply our architecture to a wide range of problems and groups. The generality and performance of our approach are demonstrated by applying it to the tasks of top quark decay tagging (Lorentz group) and shape recognition (orthogonal group). |
In recent years, the use of machine learning has become increasingly popular in the context of lattice field theories. An essential element of such theories is represented by symmetries, whose inclusion in the neural network properties can lead to high reward in terms of performance and generalizability. A fundamental symmetry that usually characterizes physical systems on a lattice with periodic boundary conditions is equivariance under spacetime translations. Here we investigate the advantages of adopting translationally equivariant neural networks in favor of non-equivariant ones. The system we consider is a complex scalar field with quartic interaction on a two-dimensional lattice in the flux representation, on which the networks carry out various regression and classification tasks. Promising equivariant and non-equivariant architectures are identified with a systematic search. We demonstrate that in most of these tasks our best equivariant architectures can perform and generalize significantly better than their non-equivariant counterparts, which applies not only to physical parameters beyond those represented in the training set, but also to different lattice sizes.
The 38th International Symposium on Lattice Field Theory, LATTICE2021 26th-30th July, 2021 Zoom/Gather@Massachusetts Institute of Technology
Introduction
Lattice field theories require an intensive use of numerical simulations, and often supercomputers are employed in order to render such simulations feasible in terms of time consumption. The outstanding developments which occurred in the realm of machine learning in the past decade, together with the efforts made to improve hardware technology, have attracted a lot of interest from physicists, who have largely relied on neural networks (NNs) in a wide variety of problems, ranging from condensed matter physics to string theory [1,2]. Even though these applications have proven to be successful, oftentimes no adaptation of architectures adopted in other fields, e.g. image processing, was put in place. A wise strategy when using tools is to tailor them to meet the requirements of the problem in question. In the case of field theories, a cornerstone is represented by Noether's theorem [3], which states that for every continuous symmetry of the action there exists a respective conserved current. Therefore, a desirable approach is to design NNs in such a way that the underlying symmetries are respected. A very important result in this direction has been achieved with the introduction of group equivariant convolutional neural networks (G-CNNs) [4], which take care of the preservation of global symmetries, such as translations, rotations and reflections. Also in the context of gauge symmetries there have been recent developments [5][6][7][8].
Lattice field theories are often characterized by invariance under spacetime translations. While in [4] the effectiveness of G-CNNs was shown in computer vision applications, in our recent work [9] we focus on the relevance of translational symmetry in lattice field theory. For this discussion, it is sufficient to employ convolutional neural networks (CNNs), which were conceived precisely to include translational equivariance in the network properties. Our goal is to investigate how crucial the preservation of such a symmetry is, with a particular attention to the generalization capabilities of the architectures in terms of different lattice sizes and different physical parameters.
Physical system
In this study we focus on a complex scalar field in 1+1 dimensions with quartic interaction and nonzero chemical potential , whose action is the following:
= ∫ d 0 d 1 | 0 | 2 − | 1 | 2 − 2 | | 2 − | | 4 ,(1)
where 0 = 0 − , is the mass and is the coupling constant. The discretization procedure leads to the action
= ∑︁ | | 2 + | | 4 − 2 ∑︁ =1 ,2 * +ˆ+ − ,2 * −ˆ ,(2)
with = 4 + 2 . The two terms involving the complex conjugation lead to a sign problem that can be eliminated via a dual formulation [10]. It maps the field into the positive integer field , and the integer field , , where indicates either the temporal or the spatial direction.
Architecture types
In lattice field theories, the input for the NNs is typically a field configuration, while the output is represented by one or more observables. A translationally invariant architecture produces the same output observables for any shift of the input configuration. Architectures that break the symmetry can learn it only approximately.
The general structure we choose for our networks is inspired by typical architectures used in computer vision and can be seen in fig. 1: a first part consisting of several convolutional layers alternated with spatial pooling layers, then a global pooling layer or a flattening step, after which an optional dense network can be appended to make the network more expressive. The type of global pooling depends on the task under examination. For example, the prediction of intensive quantities calls for a global average pooling layer, while global sum pooling is suited for extensive observables. An architecture is guaranteed to be translationally invariant if every layer in the convolutional part of the network is equivariant, meaning that a shift in the input induces a corresponding shift in the output. Another aspect that is worth mentioning is that the theory we study here features periodic boundary conditions, so every layer is equipped with circular padding. We design three architecture types: the first one (EQ) is translationally equivariant, in the second one (ST) equivariance is broken because of a stride larger than one in the convolutions or in the pooling layers, and in the third one (FL) a flattening step instead of global pooling is used, which also breaks equivariance. ST architectures still retain a residual symmetry based on translations that are a multiple of the stride, but equivariance is lost in general. An additional drawback of the flattening layer is the impediment of employing that architecture on lattice sizes different from the one it has been trained on.
Prediction of observables
The first task we perform is a regression on two observables, namely the particle number density
= 1 ∑︁ ,2(3)
and the average of the modulo squared field
| | 2 = 1 ∑︁ ( + 2) ( ) ,(4)where = ∑︁ [| , | + | −ˆ, | + 2( , + −ˆ, )] , ( ) = ∫ ∞ 0 d +1 e − 2 − 4 .(5)
These two observables are intensive quantities and therefore we opt for a global average pooling in EQ and ST. The training set is made up of configurations generated with specific values of the physical parameters:
= 1, = 4.01, = 1.05 and lattice sizes = 60, = 4. In the attempt to make the fairest comparison possible, we define for each architecture a large search space for many hyperparameters (e.g. the number of convolutional layers and of linear layers, the kernel size and the number of channels in each convolution, the position of a spatial pooling layer) and run an automatized optimizer called Optuna [11] to select the most promising values of such hyperparameters. The criterion to identify the winning hyperparameter combination is the minimum validation loss, which is chosen to be the mean squared error (MSE). Ten instances of the resulting best model of each architecture type are then trained all over again. We repeat the same operation for various training set sizes, ranging from 100 to 20000 samples. After that, we compute the loss on the test set, which consists of 4000 samples for every ∈ {0.91, . . . , 1.05} with steps of Δ = 0.005. This set is therefore generated with 29 different values of , while for training and validating only one was used. This is done because we aim at inspecting the generalization capabilities of the models. Figure 2 shows the outcome of the whole procedure. As is apparent in the top plot, the EQ type performs much better than its non-equivariant counterparts independently of the number of samples used during training. Also, the test loss improves for EQ when increasing the training set size, while for the other two architectures it remains approximately constant. In order to counteract the missing translational equivariance in ST and FL, a new training process is carried out with data augmentation, meaning that configurations are randomly shifted in both directions before being fed into the network. Surprisingly, this does not produce substantial differences in the test loss for ST and FL, as reported in the middle and bottom plot of fig. 2.
In the following, we consider only the 10 instances found using 20000 samples during training for each architecture type. In fig. 3, we report the behaviour of the test loss for every individual value of . In this analysis we also include 4000 configurations generated at each chemical potential in the range ∈ {1.1, . . . , 1.5} with steps of Δ = 0.1 to check extrapolation abilities of the models. While ST and FL perform well only where training took place, EQ is able to generalize very well to smaller chemical potentials. The performance deteriorates for all architectures for larger chemical potentials (see a detailed discussion of the reasons in [9]), but EQ proves to be a more reliable choice with respect to its non-equivariant counterparts, yielding a test loss smaller by about one order of magnitude.
We now want to examine the generalization to lattice sizes other than the one used for training lattice size test MSE: |φ| 2 Figure 4: Comparison of the test loss as a function of the lattice size. The best models found at the largest training set size are tested on several lattice sizes, while being trained on only one specific value (60 × 4). Image from [9]. and validating, so we have to restrict ourselves to a comparison between EQ and ST. Figure 4 undeniably confirms that for this problem translational equivariance is extremely beneficial, evident from the fact that the loss of EQ is about three orders of magnitude smaller than the loss of ST for all lattice sizes. It is worth mentioning that this task has already been tackled previously in [12]. There, an architecture of type FL with ∼ 10 7 parameters was trained on the 200 × 10 lattice at two values of the chemical potential and was able to reach a test loss of 10 −6 , two orders of magnitude less accurate than our best EQ instance can achieve, even though this last one is trained on a different lattice size on just one value of with much fewer parameters (∼ 10 4 ). Lastly, we point out that the kink in the ST bands is due to another drawback of a stride larger than one: a spatial pooling layer with a stride of two can use the first four rows of the lattice, but discards the fifth one, losing 20% of information, which leads to a much larger loss.
Detection of flux violations
The dual formulation of the complex scalar field given in sec. 2 is also called flux representation [10], because the field obeys the conservation law , − −ˆ, = 0. Physical configurations must respect this flux conservation, but we can artificially create configurations exhibiting flux violations by slightly modifying the so-called worm algorithm [13] used for the data generation in the first task. The algorithm proposes a field update at a particular lattice site; then, if accepted, another update is proposed for one of the next-neighboring sites. The mechanism repeats itself, drawing a path on the lattice that is referred to as a worm, whose head moves until it meets the
t t t t t t t t t t t t t t t t t t t t t t t t t
t t t t t t t t
field configuration
x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x t t t t t t t t t t t t t t t t t t t t t t t t t
t t t t t t t t flux violation
(a) Example field configuration
Best EQ model channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 x
Best ST model x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x t t t t t t t t t t t t t t t t t t t t t t t t t
t t t t t t t t
x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x xx x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x xx x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x xx x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t tx x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x xx x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x
channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 channel 2 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 channel 3 Figure 5b shows that it is sufficient for the models to detect only one of the flux violations. Also in this case, an appropriate search space for the hyperparameters is defined and explored using Optuna to suggest the values that minimize the validation loss, which is the binary cross entropy. In a classification task it is not clear what kind of global pooling is the most fitting, which is why this choice is part of the hyperparameter optimization. 50 instances of the best architecture are trained, yielding the results in fig. 6. The test loss and the test accuracy do not strongly depend on the physical parameters, as we can see in fig. 6a, where the worse performance of the FL models compared to the other two architecture types is also clearly visible. Figure 6b tells us that the loss deteriorates on larger lattices and that EQ and ST achieve very close results in this classification task.
x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x x channel
Counting open worms
An extension of the previous section can be achieved by adding more than only one open worm on top of a physical configuration. This is then treated as a regression task, which is reminiscent of counting problems such as crowd counting and, with an appropriate adaptation, can be used for the evaluation of -point functions.
The combinations of physical parameters are inherited from the previous section with the addition of a number of open worms ranging from 0 to 10. For training we will use the two combinations employed in the classification task with 0 and 5 worms. This amounts to only four combinations out of the 396 possible ones. The number of training samples is 20000, and also in this case we optimize the hyperparameters by means of Optuna. Since we are dealing with an extensive quantity, we adopt a global sum pooling. Figure 7a reports the test loss and accuracy on 8 × 8 lattices as a function of open worms, where ST and FL perform worse than EQ. In particular, they have a hard time predicting a number of worms from 1 to 4. In fig. 7b the results on every lattice are shown, indicating that EQ has to be preferred, even achieving 100% test accuracy with all of its 20 instances.
Conclusions
We have tested the performance of three architecture types on three different tasks. The architectures that respect translational symmetry proved to be a highly reliable choice in all tasks, while the architectures that break translational invariance can feature a poor performance when it comes to generalizing to physical parameters that were absent in the training set. Moreover, breaking invariance brings other drawbacks along: if a stride larger than one is used, part of the input information can be lost, while a flattening layer hinders the possibility of applying the same architecture to other lattice sizes. Another important aspect to keep in mind is that the automated optimizer we have used, Optuna, has favored small or medium-sized architectures, with a number of trainable parameters between 10 2 and 10 5 . In conclusion, our study shows that it is sensible to use translationally equivariant neural networks for problems that are characterized by translational symmetry.
Figure 1 :
1The architecture types employed to test the relevance of translational symmetry. Checkmarks indicate whether a layer preserves equivariance () or not (). A stride of one in the convolutions and in the spatial pooling layers respects translational equivariance (a), while a stride of two or larger breaks it, as in (b) and (c). A flattening layer (c) breaks equivariance and restricts the use of the network to a specific lattice size. Figures from[9].
Figure 2 :
2Results of Optuna hyperparameter search. For each architecture type, the model suggested by Optuna is trained for various training set sizes. The bands contain ten instances of such a model, the dashed lines indicate the average test losses and the continuous line passes through the median test losses. The top plot features the comparison of the three architecture types with no data augmentation, the middle and the bottom ones show the test loss behavior with data augmentation for ST and FL, respectively. Image from[9].
Figure 3 :
3Comparison of the test loss as a function of the chemical potential. The winning architectures in the top plot offig. 2at the largest training set size are tested on a wide range of chemical potential, while being trained on only one specific value (1.05). Image from[9].
Feature maps of convolutional part in best EQ and ST models
Figure 5 :
5Task visualization and network prediction. The top plot in (a) shows a possible path drawn by the worm algorithm on top of a preexisting physical configuration, while the bottom plot highlights flux violations, which coincide with the worm endpoints. The feature maps in (b) show that successful models detect just one flux violation in only some of the channels in order to discriminate between open and closed worm configurations. Image from [9]. tail. Before this happens, the ends of the worms violate flux conservation, so we save configurations that feature an open worm. An example of this is depicted in fig. 5. Apart from , which is kept fixed at 1, the dataset is generated using multiple combinations of physical parameters: ∈ {4.01, 4.04, 4.25}, ∈ {1, 1.25, 1.5} and lattice sizes = ∈ {8, 16, 32, 64}. Only two combinations are used for training, specifically ( , ) ∈ {(4.01, 1.5), (4.25, 1)} on 8 × 8 lattices. A total of 4000 samples make up the training set, half of them without open worms, the other half with open worms. The task of the networks is classifying correctly whether a configuration features an open worm or not.
Figure 6 :
6Results for open worm detection. The bands contain 50 instances of the architectures indicated by Optuna. In (a), the test loss and the test accuracy are reported as functions of the chemical potential on 8 × 8 configurations, while in (b) they are given as functions of the lattice size. Images from[9].
Comparison of test loss and test accuracy vs number of open worms on 8 × 8 lattices.
Comparison of test loss and test accuracy vs lattice size.
Figure 7 :
7Results for worm counting. The bands contain 20 instances of the architectures indicated by Optuna. In (a), the test loss and the test accuracy are reported as a function of the open worms on 8 × 8 configurations, whereas in (b) they are given as functions of the lattice size. Images from[9].
(a) Comparison of test loss and test accuracy vs chemical potential on 8 × 8 lattices.(b) Comparison of test loss and test accuracy vs lattice size.EQ
ST
FL
1
1.25
1.5
0.2
0.4
0.6
0.8
1
µ
test accuracy
10 −6
10 −4
10 −2
test loss
EQ
ST
8×8
16×16
32×32
64×64
1
0.998
0.996
lattice size
test accuracy
AcknowledgmentsThis work has been supported by the Austrian Science Fund FWF No. P32446-N27, No. P28352 and Doctoral program No. W1252-N27. The Titan V GPU used for this research was donated by the NVIDIA Corporation.
Machine learning phases of matter. J Carrasquilla, R G Melko, 10.1038/nphys4035Nature Physics. 13J. Carrasquilla and R.G. Melko, Machine learning phases of matter, Nature Physics 13 (2017) 431-434.
A cornucopia of AdS5 vacua. N Bobev, T Fischbacher, F F Gautason, K Pilch, 10.1007/jhep07(2020)240Journal of High Energy Physics. 2020N. Bobev, T. Fischbacher, F.F. Gautason and K. Pilch, A cornucopia of AdS5 vacua, Journal of High Energy Physics 2020 (2020) .
. E Noether, Invariante Variationsprobleme, Nachrichten von der Gesellschaft der Wissenschaften zu Göttingen, Mathematisch-Physikalische Klasse. 235E. Noether, Invariante Variationsprobleme, Nachrichten von der Gesellschaft der Wissenschaften zu Göttingen, Mathematisch-Physikalische Klasse 1918 (1918) 235.
Group equivariant convolutional networks. T S Cohen, M Welling, Proceedings of The 33rd International Conference on Machine Learning. The 33rd International Conference on Machine Learning4816 2. 7576T.S. Cohen and M. Welling, Group equivariant convolutional networks, in Proceedings of The 33rd International Conference on Machine Learning, vol. 48, pp. 2990-2999, JMLR, Jun, 2016 [16 2. 7576].
Gauge equivariant convolutional networks and the icosahedral CNN. T S Cohen, M Weiler, B Kicanaoglu, M Welling, Proceedings of the 36th International Conference on Machine Learning. the 36th International Conference on Machine Learning9719 2. 4615T.S. Cohen, M. Weiler, B. Kicanaoglu and M. Welling, Gauge equivariant convolutional networks and the icosahedral CNN, in Proceedings of the 36th International Conference on Machine Learning, vol. 97, pp. 1321-1330, JMLR, Jun, 2019 [19 2. 4615].
Equivariant flow-based sampling for lattice gauge theory. G Kanwar, M S Albergo, D Boyda, K Cranmer, D C Hackett, S Racanière, 10.1103/physrevlett.125.121601Physical Review Letters. 1252 3. 6413G. Kanwar, M.S. Albergo, D. Boyda, K. Cranmer, D.C. Hackett, S. Racanière et al., Equivariant flow-based sampling for lattice gauge theory, Physical Review Letters 125 (2020) [2 3. 6413].
Sampling using ( ) gauge equivariant flows. D Boyda, G Kanwar, S Racanière, D J Rezende, M S Albergo, K Cranmer, 10.1103/PhysRevD.103.074504Phys. Rev. D. 103745042 8. 5456D. Boyda, G. Kanwar, S. Racanière, D.J. Rezende, M.S. Albergo, K. Cranmer et al., Sampling using ( ) gauge equivariant flows, Phys. Rev. D 103 (2021) 074504 [2 8. 5456].
Lattice gauge equivariant convolutional neural networks. M Favoni, A Ipp, D I Müller, D Schuh, 212M. Favoni, A. Ipp, D.I. Müller and D. Schuh, Lattice gauge equivariant convolutional neural networks, 2 12.129 1.
Generalization capabilities of translationally equivariant neural networks. S Bulusu, M Favoni, A Ipp, D I Müller, D Schuh, 10.1103/PhysRevD.104.074504Phys. Rev. D. 1047450421 3.14686S. Bulusu, M. Favoni, A. Ipp, D.I. Müller and D. Schuh, Generalization capabilities of translationally equivariant neural networks, Phys. Rev. D 104 (2021) 074504 [21 3.14686].
Lattice study of the Silver Blaze phenomenon for a charged scalar 4 field. C Gattringer, T Kloiber, 10.1016/j.nuclphysb.2012.12.005Nuclear Physics B. 86912 6.2954C. Gattringer and T. Kloiber, Lattice study of the Silver Blaze phenomenon for a charged scalar 4 field, Nuclear Physics B 869 (2013) 56-73 [12 6.2954].
Optuna: A next-generation hyperparameter optimization framework. T Akiba, S Sano, T Yanase, T Ohta, M Koyama, 10.1145/3292500.3330701Proceedings of the 25th ACM SIGKDD International Conference on Knowledge Discovery and Data Mining. the 25th ACM SIGKDD International Conference on Knowledge Discovery and Data MiningAssociation for Computing Machinery19 7.1 9 2T. Akiba, S. Sano, T. Yanase, T. Ohta and M. Koyama, Optuna: A next-generation hyperparameter optimization framework, in Proceedings of the 25th ACM SIGKDD International Conference on Knowledge Discovery and Data Mining, p. 2623-2631, Association for Computing Machinery, Jul, 2019, DOI [19 7.1 9 2].
Regressive and generative neural networks for scalar field theory. K Zhou, G Endrődi, L.-G Pang, H Stöcker, 10.1103/physrevd.100.011501Physical Review D. 100181 .12879K. Zhou, G. Endrődi, L.-G. Pang and H. Stöcker, Regressive and generative neural networks for scalar field theory, Physical Review D 100 (2019) [181 .12879].
Worm algorithms for classical statistical models. N , B Svistunov, 10.1103/PhysRevLett.87.160601cond-mat/ 1 3146Physical Review Letters. 87N. Prokof'ev and B. Svistunov, Worm algorithms for classical statistical models, Physical Review Letters 87 (2001) [cond-mat/ 1 3146].
| By considering the Lie algebra of the general linear group in ndimensions over the complex field $GL( {n,\mathbb{C}} )$ and inspecting the weight diagrams corresponding to its irreducible representations it may be possible to see how a representation of $GL( {n,\mathbb{C}} )$ reduces into irreducible representations of a subgroup. The problem is manageable for a number of irreducible representations of $GL( {4,\mathbb{C}} )$, $GL( {5,\mathbb{C}} )$ and $GL( {7,\mathbb{C}} )$ when the subgroups are, respectively, the symplectic group in four dimensions over the complex field $Sp( {4,\mathbb{C}} )$, the rotation group in five dimensions over the complex field $SO( {5,\mathbb{C}} )$, and Cartan’s exceptional group of rank two $G_2 $. The weight diagrams for homogeneous integral representations of $GL( {n,\mathbb{C}} )$ are constructed by using Young tableaux and basis vectors related to the Lie algebra of a subgroup. To illustrate the method explicit calculations are made for $n = 4$. The structure of the we... | The character of the principal series of representations of SL(n,R) is evaluated by using Gel'fand and Naimark's definition of character. This representation is realized in the space of functions defined on the right coset space of SL(n,R) with respect to the subgroup of real triangular matrices. This form of the representations considerably simplifies the problem of determination of the integral kernel of the group ring which is fundamental in the Gel'fand-Naimark theory of character. An important feature of the principal series of representations is that the `elliptic' elements of SL(n,R) do not contribute to its character. | There is standard methodology available to facilitate electronic structure computations on a space that is invariant under a symmetry group. Here, we focus on additional consequences that arise if the basis itself is invariant under the symmetry group (i.e., in the case that application of symmetry operations to each basis vector yields, up to proportionality, a single basis vector). In illustration of the formal development, examples are considered where the symmetries are point-group symmetries and the basis vectors are Slater determinants over singly occupied atomic orbitals, as for an open-shell valence bond (VB) model. Several other types of examples are mentioned, e.g., a basis of chemically motivated resonance structures, as for a VB model, or an orbital basis of atomic orbitals for a one-electron Huckel-type model. | The generators of the group or group algebra are used in an analog of the Lie‐Cartan method, which can be applied to finite or infinite groups. This gives a mean for reduction of an arbitrary group representation, using only the matrix representatives of the generators. It is a set of algorithms using pivotal condensation and can easily be coded as a digital computer program. Connections with Lie‐Cartan theory are suggested, the reduction of the symmetric group discussed, and methods for the reduction of representations of the n × n unitary, orthogonal, and proper orthogonal groups suggested. | Hypercubic groups in any dimension are defined and their conjugate classifications and representation theories are derived. Double group and spinor representation are introduced. A detailed calculation is carried out on the structures of four-dimensional cubic group O4 and its double group, as well as all inequivalent single-valued representations and spinor representations of O4. All representations are derived adopting Clifford theory of decomposition of induced representations. Based on these results, single-valued and spinor representations of the orientation-preserved subgroup of O4 are calculated. | We show here the possibility of finding a unique Lie group Ḡ associated with each connected Lie group G such that every projective unitary representation of Ḡ can be lifted to a unitary representation of Ḡ, that is to say, all PUR of G can be found from the UR of only one group Ḡ. This method is applied to the research of PUR of the Galilei group and compared with the preceding ones. | Algebraic method to construct irreducible representations of space groups is presented by making an example of white tin having screw axes and glide planes in the symmetry operations. In present method it is enough to treat explicitly at most only symmetry elements equal in number to the operations of the point group to which concerned lattice belongs, regardless of the cases with or without spin and also of interior points or the points of the Brillouin zone boundary. This becomes very simplification compared to usual group-theoretical method. | 177 |
Introduction
Convolutional Neural Networks (CNNs) (LeCun et al., 1989) have become a widely used and powerful tool for computer vision tasks, in large part due to their ability to achieve translation equivariance. This property led to improved generalization and a significant reduction in the number of parameters. Translation equivariance is one of many possible symmetries occurring in machine learning tasks.
A wide range of symmetries described by reductive Lie Groups is present in physics, such as O(3) in molecular mechanics, SO(1,3) in High-Energy Physics, SU(2 N ) in quantum mechanics, and SU(3) in quantum chromodynamics. Machine learning architectures that respect these symmetries often lead to significantly improved predictions while requiring far less training data. This has been demonstrated in many applications including 2D imaging with O(2) symmetry (Cohen and Welling, 2016a;Esteves et al., 2017), machine learning force fields with O(3) symmetry (Anderson et al., 2019;Bartók et al., 2013;Batzner et al., 2022;Batatia et al., 2022a) or jet tagging with SO + (1, 3) symmetry (Bogatskiy et al., 2022;.
One way to extend CNNs to other groups (Finzi et al., 2020; is through harmonic analysis on homogeneous spaces, where the convolution becomes an integral over the group. Other architectures work directly with finite-dimensional representations. We follow the demonstration of Bogatskiy et al. (2020a) who constructed a universal approximation of any equivariant map with a feed-forward neural network with vector activations belonging to finite-dimensional representations of a wide class of Lie groups. In this way, one can avoid computational challenges created by infinite-dimensional representations. Figure 1: Examples of natural science problems and associated reductive Lie groups. For high energy physics, the Lorentz group SO(1, 3); for chemistry, the Euclidean group E(3); for quantumchromodynamics, the SU(3) group.
Alternatively, our current work can be thought of as a generalization of the Atomic Cluster Expansion (ACE) formalism of Drautz (2019) to general Lie groups. The ACE formalism provides a complete body-ordered basis of O(3)-invariant features. By combining the concepts of ACE and E(3)equivariant neural networks, Batatia et al. (2022a) proposed the MACE architecture, which achieves state-of-the-art performance on learning tasks in molecular modelling. The present work generalizes the ACE and MACE architectures to arbitrary Lie groups in order to propose a generic architecture for creating representations of geometric point clouds in interaction.
Concretely, our work makes the following contributions:
• We develop the G-Equivariant Cluster Expansion. This new framework generalizes the ACE (Drautz, 2019) and MACE (Batatia et al., 2022b) architectures to parameterize properties of point clouds that are equivariant under the action of a reductive Lie group G. • We prove that our architecture is universal, even for a single layer. • We introduce lie-nn, a new library providing all the essential tools to apply our framework to a variety of essential Lie Groups in physics and computer visions, including the Lorentz group, SU(N ), SL 2 (C) and product groups. • We demonstrate the generality and efficiency of our general-purpose approach by demonstrating excellent accuracy on two prototype applications, jet tagging, and 3D point cloud recognition.
Background
We briefly review a few important group-theoretic concepts: A real (complex) Lie group is a group that is also a finite-dimensional smooth (complex) manifold in which the product and inversion of the group are also smooth (holomorphic) maps. Among the most important Lie groups are Matrix Lie groups, which are closed subgroups of GL(n, C) the group of invertible n × n matrices with complex entries. This includes well-known groups such as Sp(2n, R) consisting of matrices of determinant one, that is relevant in Hamiltonian dynamics A finite-dimensional representation of the Lie group G is a finite-dimensional vector space V endowed with a smooth homomorphism ρ : G → GL(V ). Features in the equivariant neural networks live in these vector spaces. An irreducible representation V is a representation that has no subspaces which are invariant under the action of the group (other than {0} and V itself). This means that V can not be decomposed non-trivially as the direct sum of representations. A reductive group over a field F is a (Zariski-) closed subgroup of the group of matrices GL(n, F ) such that every finite-dimensional representation of G on an F -vectorspace can be decomposed as a sum of irreducible representations.
Related Work
Lie group convolutions Convolutional neural networks (CNNs), which are translation equivariant, have also been generalized to other symmetries. For example, G-convolutions (Cohen and Welling, 2016b) generalized CNNs to discrete groups. Steerable CNNs (Cohen and Welling, 2016a) generalized CNNs to O(2) equivariance and Spherical CNNs (Cohen et al., 2018) O(3) equivariance. A general theory of convolution on any compact group and symmetric space was given by . This work was further extended to equivariant convolutions on Riemannian manifolds by Weiler et al. (2021). ACE The Atomic Cluster Expansion (ACE) (Drautz, 2019) introduced a systematic framework for constructing complete O(3)-invariant high body order basis sets with constant cost per basis function, independent of body order (Dusson et al., 2022). e3nn + Equivariant MLPs The e3nn library (Geiger and Smidt, 2022) provides a complete solution to build E(3)−equivariant neural networks based on irreducible representations. The Equivariant MLPs (Finzi et al., 2021) include more groups, such as SO(1, 3), Z n , but are restricted to reducible representations making them much less computationally efficient than irreducible representations. Equivariant MPNNs and MACE Equivariant MPNNs Anderson et al., 2019;Bogatskiy et al., 2020a;Satorras et al., 2021;Brandstetter et al., 2022;Batzner et al., 2022) have emerged as a powerful architecture to learn on geometric point clouds. They construct permutation invariants and group equivariant representations of point clouds. Successful applications include simulations in chemistry, particle physics, and 3D vision. MACE (Batatia et al., 2022a) generalized the O(3)-Equivariant MPNNs to build messages of arbitrary body order, outperforming other approaches on molecular tasks. (Batatia et al., 2022b) showed that the MACE design space is large enough to include most of the previously published equivariant architectures.
The G-Equivariant Cluster Expansion
We are concerned with the representation of properties of point clouds. Point clouds are described as multi-sets (unordered tuples) X = [x i ] i where each particle x i belongs to a configuration domain Ω. We denote the set of all such multi-sets by msets(Ω). For example, in molecular modeling, x i might describe the position and species of an atom and therefore x i = (r i , Z i ) ∈ R 3 × Z, while in high energy physics, one commonly uses the four-momentum x i = (E i , p i ) ∈ R 4 , but one could also include additional features such as charge, spin, and so forth.
A property of the point cloud is a map
Φ : msets(Ω) → Z(1)
i.e., X → Φ(X) ∈ Z, usually a scalar or tensor. The range space Z is application dependent and left abstract throughout this paper. Expressing the input as a multi-set implicitly entails two important facts: (1) it can have varying lengths; (2) it is invariant under the permutations of the particles. The developed in this article are also applicable to fixed-length multi-sets, in which case Φ is simply a permutation-invariant function defined on some Ω N . Mappings that are not permutation-invariant are special case with several simplifications.
In many applications, especially in the natural sciences, particle properties satisfy additional symmetries. When a group G acts on Ω as well as on Z we say that Φ is G-equivariant if
Φ • g = ρ Z (g)Φ, g ∈ G(2)
where ρ Z (g) is the action of the group element g on the range space Z. In order to effectively incorporate exact group symmetry into properties Φ, we consider model architectures of the form
Φ : msets(Ω) −→ embedding V −→ parameterization V −→ readout Z,(3)
where the space V into which we "embed" the parameterization is a possibly infinite-dimensional vector space in which a convenient representation of the group is available. For simplicity we will sometimes assume that Z = V .
The Atomic Cluster Expansion (ACE) framework (Drautz, 2019;Dusson et al., 2022;Drautz, 2020)) produces a complete linear basis for the space of all "smooth" G-equivariant properties Φ for the specific case when G = O(3) and x i are vectorial interatomic distances. Aspects of the ACE framework were incorporated into E(3)-equivariant message passing architectures, with significant improvements in accuracy (Batatia et al., 2022a). In the following paragraphs we demonstrate that these ideas readily generalize to arbitrary reductive Lie groups.
Efficient many-body expansion
The first step is to expand Φ in terms of body orders, and truncate the expansion at a finite order N :
Φ (N ) (X) = φ 0 + i φ 1 (x i ) + i1,i2 φ 2 (x i1 , x i2 ) + · · · + i1,...,i N φ N (x i1 , . . . , x i N ),(4)
where φ n defines the n-body interaction. Formally, the expansion becomes systematic in the limit as N → ∞. The second step is the expansion of the n-particle functions φ n in terms of a symmetrized tensor product basis. To define this we first need to specify the embedding of particles x: A countable family (ϕ k ) k is a 1-particle basis if they are linearly independent on Ω and any smooth 1-particle function φ 1 (not necessarily equivariant) can be expanded in terms of (ϕ k ) k , i.e,
φ 1 (x) = k w k ϕ k (x).(5)
For the sake of concreteness, we assume that ϕ k : Ω → C, but the range can in principle be any field. Let a complex vector space V be given, into which the particle embedding maps, i.e.,
(ϕ k (x)) k ∈ V ∀x ∈ Ω.
As a consequence of (5) any smooth scalar n-particle function φ n can be expanded in terms of the corresponding tensor product basis,
φ n (x 1 , . . . , x n ) = k1,...,kn w k1...kn n s=1 ϕ ks (x s ).(6)
Inserting these expansions into (4) and interchanging summation (see appendix for the details) we arrive at a model for scalar permutation-symmetric properties,
A k = x∈X ϕ k (x), A k = n s=1 A k , Φ (N ) = k∈K w k A k ,(7)
where K is the set of all k tuples indexing the features A k . Since A k is invariant under permuting k, only ordered k tuples are retained. The features A k are an embedding of msets(Ω) into the space V . The tensorial product features (basis functions) A k form a complete linear basis of multi-set functions on Ω and the weights w k can be understood as a symmetric tensor. We will extend this linear cluster expansion model Φ (N ) to a message-passing type neural network model in § 4.4.
We remark that, while the standard tensor product embeds (⊗ n s=1 ϕ ks ) k : Ω n → V n , the ncorrelations A k are symmetric tensors and embed (A k ) k : msets(Ω) → Sym n V .
Symmetrisation
With (7) we obtained a systematic linear model for (smooth) multi-set functions. It remains to incorporate G-equivariance. We assume that G is a reductive Lie group with a locally finite representation in V . In other words we choose a representation ρ = (ρ kk ′ ) : G → GL(V ) such that
ϕ k • g = k ′ ρ kk ′ (g)ϕ k ′ ,(8)
where for each k the sum over k ′ is over a finite index-set depending only on k. Most Lie groups one encounters in physical applications belong to this class, the affine groups being notable exceptions. However, those can usually be treated in an ad hoc fashion, which is done in all E(3)-equivariant architectures we are aware of. In practice, these requirements restrict how we can choose the embedding (ϕ k ) k . If the point clouds X = [x i ] i are already given in terms of a representation of the group, then one may simply construct V to be iterative tensor products of Ω; see e.g. the MTP (Shapeev, 2016) and PELICAN (Bogatskiy et al., 2022) models. To construct an equivariant two-particle basis we need to first construct the set of all intertwining operators from V ⊗ V → V . Concretely, we seek all solutions C α,K k1k2 to the equation
k ′ 1 k ′ 2 C α,K k ′ 1 k ′ 2 ρ k ′ 1 k1 (g)ρ k ′ 2 k2 (g) = K ′ ρ KK ′ (g)C α,K ′ k1k2 ;(9)
or, written in operator notation,
C α ρ ⊗ ρ = ρC α .(10)
We will call the C α,K k generalized Clebsch-Gordan coefficients since in the case G = SO(3) acting on the spherical harmonics embedding ϕ lm = Y m l those coefficients are exactly the classical Clebsch-Gordan coefficients. The index α enumerates a basis of the space of all solutions to this equation. For the most common groups, one normally identifies a canonical basis C α and assigns a natural meaning to this index (cf. § A.2). Our abstract notation is chosen because of its generality and convenience for designing computational schemes. The generalization of the Clebsch-Gordan equation (9) to n products of representations acting on the symmetric tensor space
Sym n (V ) becomes (cf. § A.6) k ′ C α,K k ′ ρ k ′ k = K ′ ρ KK ′ C α,K ′ k ∀K, k = (k 1 , . . . , k N ), g ∈ G,
where
ρ k ′ k = k ′′ =πk ′ π∈Sn ρ k ′′ k and ρ k ′ k = n t=1 ρ k ′ t kt .(11)
Due to the symmetry of the (A k ) k tensors C α,K k need only be computed for ordered k tuples and the sum k ′ also runs only over ordered k tuples. Again, the index α enumerates a basis of the space of solutions. Equivalently, (11) can be written in compact notation as
C α ρ = ρC α .(12)
These coupling operators for N products can often (but not always) be constructed recursively from couplings of pairs (9).
We can now define the symmetrized basis
B K α = k ′ C α,K k ′ A k ′ .(13)
The equivariance of (13) is easily verified by applying a transformation g ∈ G to the input (cf § A.3).
Universality: In the limit as the correlation order N → ∞, the features (B K α ) K,α form a complete basis of smooth equivariant multi-set functions, in a sense that we make precise in Appendix A.4. Any equivariant property Φ V : Ω → V can be approximated by a linear model
Φ K V = α c K α B K α ,(14)
to within arbitrary accuracy by taking the number of terms in the linear combination to infinity.
Dimension Reduction
The tensor product of the cluster expansion in (7) is taken on all the indices of the one-particle basis. Unless the embedding (ϕ k ) k is very low-dimensional it is often preferable to "sketch" this tensor product. For example, consider the canonical embedding of an atom
x i = (r i , Z i ), ϕ k (x i ) = ϕ znlm (x i ) = δ zZi R nl (r i )Y m l (r i ).
Only the (lm) channels are involved in the representation of O(3) hence there is considerable freedom in "compressing" the (zn) channels.
Following Darby et al. (2022) we construct a sketched G-equivariant cluster expansion: We endow the one-particle basis with an additional index c, referred to as the sketched channel, replacing the index k with the index pair (c, k), and renaming the embedding (ϕ ck ) c,k . In the case of three-dimensional particles one may, for example, choose c = (z, n). In general it is crucial that the representation remains in terms of the ρ k,k ′ , that is, (8) becomes
ϕ ck • g = k ′ ρ kk ′ (g)ϕ ck ′ .(15)
Therefore, manipulating only the c channel does not change any symmetry properties of the architecture. We can use this fact to admit a learnable embedding,
A ck = c ′ w cc ′ ϕ c ′ k ,
This mechanism is employed in numerous architectures to reduce the dimensionality of the embedding, but the approach taken in by Darby et al. (2022) and Batatia et al. (2022b) and followed here is the exact opposite: we allow many more learnable c channels but then decouple them resulting in a much lower-dimensional basis of n-correlations, defined bỹ
A ck = n t=1 c ′ w cc ′ x∈X ϕ c ′ kt (x) .(16)
The resulting symmetrized basis is then obtained by
B K cα = k ′ C α,K k ′Ãck ′ .(17)
Following the terminology of Darby et al. (2022) we call this architecture the tensor-reduced ACE, or, G-TRACE. There are numerous natural variations on its construction, but for the sake of simplicity, we restrict our presentation to this one case.
Universality: Following the proof of Darby et al. (2022) one can readily see that the G-TRACE architecture inherits the universality of the cluster expansion, in the limit of decoupled channels #c → ∞. A smooth equivariant property Φ may be approximated to within arbitrary accuracy by an expansion Φ K (X) ≈ c,α c K α B K c,α (X). Since the embeddingà ck is learnable, this is a nonlinear model. We refer to § A.4 for the details.
G-MACE, Multi-layer cluster expansion
The G-equivariant cluster expansion is readily generalized to a multi-layer architecture by reexpanding previous features in a new cluster expansion (Batatia et al., 2022b). The multi-set X is endowed with extra features, h t i = (h t i,cK ) c,K , that are updated for t ∈ {1, ..., T } iterations. These features themselves are chosen to be a field of representations such that they have a well-defined transformation under the action of the group. This results in
x t i = (x i , h t i ) (18) ϕ t ck (x i , h t i ) = α w t,ck α k ′ ,k ′′ C α,k k ′ k ′′ h t i,ck ′ ϕ ck ′′ (x i )(19)
The recursive update of the features proceeds as in a standard message-passing framework but with the unique aspect that messages are formed via the G-TRACE and in particular can contain arbitrary high correlation order:.
m t i,cK = α W t,cK α B t,K cα .(20)
The gathered message m t i = (m t i,cK ) c,k is then used to update the particle states,
x t+1 i = (x i , h t+1 i ), h t+1 i = U t m t i ,(21)
where U t can be an arbitary fixed or learnable transformation (even the identity). Lastly, a readout function maps the state of a particle to a target quantity of interest, which could be local to each particle or global to the mset X,
y i = T t=1 R loc t (x t i ), respectively, y = T t=1 R glob t ({x t i } i ).(22)
This multi-layer architecture corresponds to a general message-passing neural network with arbitrary body order of the message at each layer. We will refer to this architecture as G-MACE. The G-MACE architecture directly inherits universality from the G-ACE and G-TRACE architectures: Theorem 4.1 (Universality of G-MACE). Assume that the one-particle embedding (ϕ k ) k is a complete basis. Then, the set of G-MACE models, with a fixed finite number of layers T , is dense in the set of continuous and equivariant properties of point clouds X ∈ msets(Ω), in the topology of pointwise convergence. It is dense in the uniform topology on compact and size-bounded subsets.
lie-nn : Generating Irreducible Representations for Reductive Lie Groups
In order to construct the G-cluster expansion for arbitrary Lie groups, one needs to compute the generalized Clebsch-Gordan coefficients (11) for a given tuple of representations (see 13). To facilitate this task, we have implemented an open source software library, lie-nn 1 . In this section we review the key techniques employed in this library.
Lie Algebras of Reductive Lie Groups
Formally, the Lie algebra of a Lie group is its tangent space at the origin and carries an additional structure, the Lie bracket. Informally the Lie algebra can be thought of as a linear approximation to the Lie group but, due to the group structure, this linear approximation carries (almost) full information about the group. In particular the representation theory of the Group is almost entirely determined by the Lie algebra, which is a simpler object to work with instead of the fully nonlinear Lie group.
Lie algebra The Lie groups we study can be realized as closed subgroups G ⊂ GL n (R) of the general linear group. In that case their Lie algebras can be concretely realized as g = Lie(G) = {X ∈ M n (R) | ∀t ∈ R : exp(tX) ∈ G} where exp(X) = 1 + X + 1 2 X 2 ... is the standard matrix exponential. It turns out that g ⊂ M n (R) is a linear subspace closed under the commutator bracket [X, Y ] = XY − Y X.
Structure theory We fix a linear basis {X i } ⊂ g, called a set of generators for the group. The Lie algebra structure is determined by the structure constants A ijk defined by
[X i , X j ] = k A ijk X k , in that if X = i a i X i and Y = j b j X j then [X, Y ] = k i,j A ijk a i b j X k .
The classification of reductive groups provides convenient generating sets for their Lie algebras (or their complexifications). One identifies a large commutative subalgebra h ⊂ g (sometimes of g C = g ⊗ R C) with basis {H i } so that most (or all) of the other generators E α can be chosen so that [H i , E α ] = α(H i )E α for a linear function α on h. These functions are the so-called roots of g. Structural information about g is commonly encoded pictorially via the Dynkin diagram of g, a finite graph the nodes of which are a certain subset of the roots. There are four infinite families of simple complex Lie algebras A n = su(n + 1), B n = so(2n + 1), C n = sp(2n), D n = so(2n) and further five exceptional simple complex Lie algebras (a general reductive Lie algebra is the direct sum of several simple ones and its centre). The Lie algebra only depends on the connected component of G. thus when the group G is disconnected in addition to the infinitesimal generators {X i } one also needs to fix so-called "discrete generators", a subset H ⊂ G containing a representative from each connected component. Representation theory The representation theory of complex reductive Lie algebras is completely understood. Every finite-dimensional representation is (isomorphic to) the direct sum of irreducible representations ("irreps"), with the latter parametrized by appropriate linear functional on h ("highest weight"). Further given a highest weight λ there is a construction of the associated irrep with an explicit action of the infinitesimal generators chosen above. The Weyl Dimension Formula gives the dimension of an irrep in terms of its highest weight.
Numerical Computations in lie-nn
The most basic class of the lie-nn library encodes a group G and infinitesimal representation dρ of g using the tuple
ρ := (A, n, {dρ(X i )} i , {ρ(h)} h∈H ) ,(23)
with A the structure constants of the group, n the dimension of the representation, and dρ(X i ) and ρ(h) being n × n matrices encoding the action of the infinitesimal and the discrete generators respectively. The action of infinitesimal generators is related to the action of group generators by the exponential, ∀X ∈ g, ρ(e X ) = e dρ(X) .
As the building blocks of the theory irreps are treated specially; the package implements functionality for the following operations for each supported Lie group:
• Constructing the irrep with a given highest weight.
• Determining the dimension of an irrep.
• Decomposing the tensor product of several irreps into irreps up to isomorphism (the selection rule, giving the list of irreducible components and their multiplicities). • Decomposing the tensor product of several irreps into irreps explicitly via a change of basis ("generalized Clebsch-Gordan coefficients"). • Computating the symmetrized tensor product of the group (see. A.6 for details).
To construct an irrep explicitly as in (23) one needs to choose a basis in the abstract representation space (including a labeling scheme for the basis) so that we can give matrix representations for the action of generators. For this purpose, we use in lie-nn the Gelfand-Tsetlin (GT) basis (Gelfand and Tsetlin, 1950) and associated labeling of the basis by GT patterns (this formalism was initially introduced for algebras of type A n but later generalized to all classical groups). Enumerating the GT patterns for a given algebra gives the dimension of a given irrep, the selection rules can be determined combinatorially, and it is also possible to give explicit algorithms to compute Clebsch-Gordan coefficients (the case of A n is treated by Alex et al. (2011)). For some specific groups, simplifications to this procedure are possible and GT patterns are not required.
In some cases, one wants to compute coefficients for reducible representations or for representations where the analytical computation with GT patterns is too complex. In these cases, a numerical algorithm to compute the coefficients is required. Let dρ 1 , dρ 2 be two Lie aglebra representations of interest. The tensor product on the Lie algebra dρ 1 ⊗ dρ 2 (X) can be computed as,
dρ 1 ⊗ dρ 2 (X) = dρ 1 (X) ⊗ 1 + 1 ⊗ dρ 2 (X)(24)
Therefore, given sets of generators of three representations dρ 1 , dρ 2 , dρ 3 , the Clebsch-Gordan coefficients are the change of basis between (dρ 1 (X) ⊗ 1 + 1 ⊗ dρ 2 (X)) and dρ 3 (X). One can compute this change of basis numerically via a null space algorithm. For some groups, one can apply an iterative algorithm that generates all irreps starting with a single representation, using the above-mentioned procedure (see A.7).
Applications
Lie groups and their applications
In Table 6.1 we give a non-exhaustive overview of Lie groups and their typical application domains, to which our methodology naturally applies.
Benchmarking our method on all of these applications is beyond the scope of the present work, in particular, because most of these fields do not have standardized benchmarks and baselines to compare against. The MACE architecture has proven to be state of the art for a large range of atomistic modeling benchmarks (Batatia et al., 2022a). In the next section, we choose two new prototypical applications and their respective groups to further assess the performance of our general approach. Table 1: Lie groups of interests covered by the present methods and their potential applications to equivariant neural networks. The groups above the horizontal line are already available in lie-nn. The ones below the line fall within our framework and can be added.
Group Application Reference
SU(1) Electromagnetism (Lagrave et al., 2021) SU(3) Quantum Chromodynamics (Favoni et al., 2022) SO(3) 3D point clouds (Batatia et al., 2022a)
SO + (1, 3)
Particle Physics (Bogatskiy et al., 2020b)
SL(3, R)
Point cloud classification -SU(2 N ) Entangled QP -
Sp(N )
Hamiltonian dynamics -SO(2N + 1) Projective geometry -6.2 Particle physics with the SO(1, 3)
Jet tagging consists in identifying the process that generated a collimated spray of particles called a jet after a high-energy collision occurs at particle colliders. Each jet can be defined as a multiset of
four-momenta [(E i , p i )] N i=1
, where E i ∈ R + and p i ∈ R 3 . Current state-of-the-art models incorporate the natural symmetry arising from relativistic objects, e.g, the Lorentz symmetry, as model invariance. To showcase the performance and generality of the G-MACE framework we use the Top-Tagging dataset (Butter et al., 2019), where the task is to differentiate boosted top quarks from the background composed of gluons and light quark jets. G-MACE achieves excellent accuracy, being the only arbitrary equivariant model to reach similar accuracy as PELICAN. We refer to Appendix A.8.1 for the details of the architecture. (Bogatskiy et al., 2022;Qu and Gouskos, 2020;Munoz et al., 2022;Bogatskiy et al., 2020a;Komiske et al., 2019;Pearkes et al., 2017).
3D Shape recognition
3D shape recognition from point clouds is of central importance for computer vision. We use the ModelNet10 dataset (Wu et al., 2015) to test our proposed architecture in this setting. As rotated objects need to map to the same class, we use a MACE model with O(3) symmetry. To create an encoder version of G-MACE, we augment a PointNet++ implementation (Yan, 2019) with G-MACE layers. See the appendix A.8.2 for more details on the architecture.
Architecture Accuracy
PointNet (Qi et al., 2016) 94.2 PointNet ++ (Qi et al., 2017) 95.0 PointMACE (ours) 96.1
Conclusion
We introduced the G-Equivariant Cluster Expansion, which generalizes the successful ACE and MACE architectures to symmetries under arbitrary reductive Lie groups. We provide an open-source Python library lie-nn that provides all the essential tools to construct such general Lie-group equivariant neural networks. We demonstrated that the general G-MACE architecture simultaneously achieves excellent accuracy in Chemistry, Particle Physics, and Computer Vision. Future development will implement additional groups and generalize to new application domains.
A Appendix
A.1 Proof of (7) This statement follows closely the arguments by Dusson et al. (2022); Drautz (2020) and others.
ϕ ks (x j ) = k w k n s=1 A k = k w k A k .
A.2 Custom notation and indexing
We briefly contrast our notation for Clebsch-Gordan coefficients (11) with the standard notation. By means of example, consider the group SO(3) in which case the Clebsch-Gordan equations are written as
m ′ 1 m ′ 2 C LM l1m ′ 1 l2m ′ 2 ρ l1 m ′ 1 m1 (g)ρ l2 m ′ 2 m2 (g) = M ′ ρ L M M ′ (g)C LM ′ l1m1l2m2 .(25)
In this setting, our index α simply enumerates all possible such coefficients. One can often assign a natural meaning to this index, e.g., for the group SO(3) it is given by the pair of angular quantum numbers (l 1 , l 2 ). Specifically, in this case, we obtain
C α,LM l1m1l2m2 = C LM l1m1l2m2 , if α = (l 1 , l 2 ), 0, otherwise,(26)
where C LM l1m1l2m2 are the Clebsch-Gordan coefficients in the classical notation. Thus, the additional index α is not really required in the case of SO(3), nor our other main example, SO(1, 3). Our notation is still useful to organize the computations of equivariant models, especially when additional channels are present, which is usually the case. Moreover, it allows for easy generalization to other groups where such a simple identification is not possible (Steinberg, 1961).
A.3 Equivariance of G-cluster expansion
The equivariance of the G-cluster expansion is easily verified by applying a transformation g to the input,
B K α • g = k C α,K k A k • g = k C α,K k k ′ t ρ kt,k ′ t (g)A k ′ = k ′ k C α,K k t ρ kt,k ′ t (g) A k ′ = k ′ K ′ ρ KK ′ (g)C α,K ′ k ′ A k ′ = K ′ ρ KK ′ (g)B K ′ α .(27)
4. The density of the basis B K α . As the last step one can readily observe that the symmetrization and cluster expansion steps can be exchanged. I.e. first symmetrizing and then employing the steps (7) result in the same model. Letting ϵ → 0 in the foregoing argument while fixing the number of particles #x results in all errors vanishing. Note that this will in particular require taking N → ∞.
Pointwise convergence.
To obtain density in the sense of pointwise convergence we first introduce the canonical cluster expansion without self-interacting terms
Φ K (x) = ∞ n=0 j1<···<jn v (n) K (x j1 , . . . x jn ).
The difference here is that the summation is only over genuine sub-clusters. Because of this restriction the series is finite for all multi-set inputs x. In other words, it converges in the pointwise sense.
One can easily see that v n can be chosen (explicitly) to make this expansion exact. After truncating the expansion at finite n ≤ N and then expanding the potentials v (n) K one can exactly transform the canonical cluster expansion into the self-interacting cluster expansion. This procedure is detailed in (Dusson et al., 2022;Drautz, 2020).
The arguments up to this point establish the claimed universality for the linear ACE model. The corresponding universality of the TRACE model follows immediately from (Darby et al., 2022). Since a single layer of the MACE model is a TRACE model, this completes the proof of Theorem 4.1.
A.5 Product of groups
Let G 1 and G 2 be two reductive Lie groups, and form the direct product group G 1 × G 2 . and ρ 1 be a associated irreducible representations then ρ 1 ⊗ ρ 2 is an irreducible representation of G 1 × G 2 . One can then generate any Clebsch-Gordan coefficient of the product group G 1 × G 2 using the algorithm presented above. It is of particular interest in the case of the equivariant message passing networks on points clouds, where the group of interest is G × S n .
A.6 Symmetric Tensor products
The permutation group is an important concept in the context of tensor products. It can be useful to focus on a subset of the full tensor product space that exhibits certain permutation equivariance. For example, the spherical harmonics are defined as the permutation-invariant part of a tensor product.
The symmetric tensor product can be thought of as a change of basis, or projector, from the tensor product to the symmetric part of the tensor product. In the case of a tensor product of correlation order four we have,
S ν = B ν;ijkl x i y j z k w l(28)
where B is the change of basis that satisfies:
B ν;ijkl = B ν;σ(ijkl) ∀σ ∈ S 4(29)
We propose in lie-nn a new algorithm used to calculate B. The Symmetric Tensor Product is calculated using a tree structure, starting at the leaves and progressing towards the trunk. The leaves are the basis of the individual indices, and they are combined and constrained at each step to impose symmetry.
A.7 Computing the irreps from input representations
For some groups, the computation of the generators X can become a very involved task. However in most applications, the data itself is already given in a form of a representation. One approach proposed by (Finzi et al., 2021) is to not work in the space of irreps but the space of polynomials of the input representation. This approach has the advantage of requiring little previous knowledge of the group. However it is also much less efficient than using irreps. One alternative way is to consider polynomials of the input representation, that are reducible and then compute the block diagonalisation to project down to irreps subspace. One can then work directly as polynomials in this subspace and compute Clebsch-Gordan coefficients numerically. We provide routines in lie-nn to carry out these operations from any given input representation.
A.8 Details of numerical experiments
A.8.1 Jet Tagging
Dataset The dataset (Butter et al., 2019) was generated using a Pythia, Delphes, and FastJet (using cuts for the jet's kinematics on ∆η = 2, R = 0.8) to simulate the response of the ATLAS detector at the Large Hadron Collider (LHC). The dataset is released under the "Creative Commons Attribution 4.0" license. The entire dataset contains 2 millions jets with a 60/20/20 for training, validation, and testing balanced splits.
Model The model uses 3 layers of the G-MACE architecture to generate the Lorentz group equivariant representation of each jet. For the 1 particle basis, we use a product of radial features on the Minkowski distances, and SO(1, 3) spherical harmonics. The radial features are computing by passing a logarithmic radial basis as in (Bogatskiy et al., 2022) into a [64, 64, 64, 512] MLP using SiLU nonlinearities on the outputs of the hidden layers. The internal representations used are (0, 0) and (1, 1). We use 72 channels for each representation. For the embedding, and readout out, we use similar achitectures to LorentzNet.
Training Models were trained on an NVIDIA A100 GPU in single GPU training. Typical training time for the dataset is up to 72 hours. Models were trained with AMSGrad variant of Adam, with default parameters of β 1 = 0.9, β 2 = 0.999, and ϵ = 10 −8 . We used a learning rate of 0.0035 and a batch size of 64. The model was trained for 80 epochs with 2 epochs of linear learning rate warmup and followed by a phase of cosine annealing LR scheduling.
A.8.2 3D shape recognition Dataset ModelNet10 (Wu et al., 2015) is a synthetic 3D object point clouds dataset containing 4,899 pre-aligned shapes from 10 categories. The dataset is split into 3,991 (80%) shapes for training and 908 (20%) shapes for testing. We were unable to find a license.
Model The model uses a three-layer encoder architecture following the PointNet++ one. We use an encoder of the full point cloud into sub-point clouds of sizes [1024,256,128]. Each PointNet layer maps a point cloud of size N t to one of size N t+1 . We compute the node features as the sum of the PointNet output and the MACE output, h (t+1) = PointNet(xyz (t) , h (t) ) + MACE(xyz (t) , h (t) )
Training Models were trained on an NVIDIA A100 GPU in single GPU training. The typical training time for the dataset is up to 12 hours. Models were trained with the AMSGrad variant of Adam, with default parameters of β 1 = 0.9, β 2 = 0.999, and ϵ = 10 −8 .
A.9 Limitations and Future Work
The spectrum of potential applications of the present method is very large. In this paper, we focus on a subset of applications that have known benchmarks and baselines. A broader range of groups is implemented in the lie-nn library. Future work should focus on applying this architecture to tasks with domain-specific knowledge.
Figure 2 :
2Examples of Dynkin diagrams and their associated group class.
Table 2 :
2Comparisson between state-of-the-art metrics on the Top-Tagging dataset. Scores were taken from
Table 3 :
3Accuracy in shape recognition.
https://github.com/lie-nn/lie-nn
Acknowledgments and Disclosure of Funding IB's work was supported by the ENS Paris Saclay. CO's work was supported by NSERC Discovery Grant IDGR019381 and NFRF Exploration Grant GR022937. This work was also performed using resources provided by the Cambridge Service for Data Driven Discovery (CSD3).IB would like to thank Gábor Csányi for his support.A.4 Completeness of the basis and Universality of MACEWe explain in which sense the basis B K α is a complete basis, and briefly sketch how to prove this claim. The argument is contained almost entirely in(Dusson et al., 2022)and only requires a single modification, namely Step 3 below, using a classical argument from representation theory. We will therefore give only a very brief summary and explain that necessary change.We start with an arbitrary equivariant property Φ V embedded in V where we have a representation, i.e. the actual target property is Φ is then given as a linear mapping from V to Z. For technical reasons, we require that only finitely many entries Φ V K may be non-zero, but this is consistent with common usage. For example, if G = O(3) and if Φ is a scalar, thenLM is non-zero if and only if L = 1; and so forth. For other groups, the labeling may differ but the principle remains the same.1. Convergence of the cluster expansion. The first step in our parameterisation is to approximate Φ V in terms of a truncated many-body expansion (4). It is highly application-dependent on how fast this expansion converges. Rigorous results in this direction in the context of learning interatomic potentials can be found in(Bachmayr et al., 2021;Thomas et al., 2022). A generic statement can be made if the number of input particles is limited by an upper bound, in which case the expansion becomes exact for a finite N . This case leads to the uniform density result stated in Theorem 4.1. We adopt this setting for the time being and return to the pointwise convergence setting below.In the uniform convergence setting we also require that the domain Ω is compact.Throughout the remainder of this section we may therefore assume that an N can be chosen as well as smooth components φ (n) such that the resulting model Φ V,N approximates Φ V to within a target accuracy ϵ,2. The density of the embedding. As already stated in the main text, if the components φ (n) K are smooth, and the embedding {ϕ k } k is dense in the space of one-particle functions (5) then it follows that the φ (n)K can be expanded in terms of the tensor product basis ϕ k := ⊗ n s=1 ϕ ks to within arbitrary accuracy. The precise statement is the following standard result of approximation theory: if span{ϕ k } k are dense in C(Ω), then span{ϕ k } k are dense in C(Ω n ). That is, for any ϵ > 0, there exist approximants pThe density of the symmetrized basis. The next and crucial step is to show that, if the φ (n) K are equivariant, then the p (n) K may be chosen equivariant as well without loss of accuracy. If the group G is compact then the representations ρ can be chosen unitary(Broecker, 1985). In that case, the argument from(Dusson et al., 2022)can be used almost verbatim: letwhere H is the normalized Haar measure thenp (n) is equivariant by construction andIf the group is not compact, then one can apply "Weyl's Unitary Trick" (see(Bourbaki, 1989), Ch. 3): first, one complexifies the group (if it is real) and then constructs a maximal compact subgroup K C of the complexification. This new group K will have the same representation as G and in virtue of being compact, that representation may again be chosen unitary. Therefore, symmetrizing p (n) with respect to K C results in an approximant that is not only equivariant w.r.t. K C but also equivariant w.r.t. G.
. Y Lecun, B Boser, J S Denker, D Henderson, R E Howard, W Hubbard, L D , 10.1162/neco.1989.1.4.541Neural Computation. 1541Y. LeCun, B. Boser, J. S. Denker, D. Henderson, R. E. Howard, W. Hubbard, and L. D. Jackel, Neural Computation 1, 541 (1989).
. T S Cohen, M Welling, 10.48550/ARXIV.1612.084982017T. S. Cohen and M. Welling, ICLR 2017 (2016a), 10.48550/ARXIV.1612.08498.
Polar transformer networks. C Esteves, C Allen-Blanchette, X Zhou, K Daniilidis, 10.48550/ARXIV.1709.01889C. Esteves, C. Allen-Blanchette, X. Zhou, and K. Daniilidis, "Polar transformer networks," (2017).
B Anderson, T S Hy, R Kondor, Advances in Neural Information Processing Systems. H. Wallach, H. Larochelle, A. Beygelzimer, F. d'Alché-Buc, E. Fox, and R. GarnettCurran Associates, Inc32B. Anderson, T. S. Hy, and R. Kondor, in Advances in Neural Information Processing Systems, Vol. 32, edited by H. Wallach, H. Larochelle, A. Beygelzimer, F. d'Alché-Buc, E. Fox, and R. Garnett (Curran Associates, Inc., 2019).
. A P Bartók, R Kondor, G Csányi, Physical Review B. 87184115A. P. Bartók, R. Kondor, and G. Csányi, Physical Review B 87, 184115 (2013).
. S Batzner, A Musaelian, L Sun, M Geiger, J P Mailoa, M Kornbluth, N Molinari, T E Smidt, B Kozinsky, Nature Communications. 132453S. Batzner, A. Musaelian, L. Sun, M. Geiger, J. P. Mailoa, M. Kornbluth, N. Molinari, T. E. Smidt, and B. Kozinsky, Nature Communications 13, 2453 (2022).
Mace: Higher order equivariant message passing neural networks for fast and accurate force fields. I Batatia, D P Kovács, G N C Simm, C Ortner, G Csányi, 10.48550/ARXIV.2206.07697I. Batatia, D. P. Kovács, G. N. C. Simm, C. Ortner, and G. Csányi, "Mace: Higher order equivariant message passing neural networks for fast and accurate force fields," (2022a).
A Bogatskiy, T Hoffman, D W Miller, J T Offermann, arXiv:2211.00454Machine Learning and the Physical Sciences workshop. 2022hep-phA. Bogatskiy, T. Hoffman, D. W. Miller, and J. T. Offermann, Machine Learning and the Physical Sciences workshop, NeurIPS 2022 (2022), arXiv:2211.00454 [hep-ph] .
. C Li, H Qu, S Qian, Q Meng, S Gong, J Zhang, T.-Y Liu, Q Li, arXiv:2208.07814hep-phC. Li, H. Qu, S. Qian, Q. Meng, S. Gong, J. Zhang, T.-Y. Liu, and Q. Li, (2022), arXiv:2208.07814 [hep-ph] .
M Finzi, S Stanton, P Izmailov, A G Wilson, PMLR, 2020Proceedings of the 37th International Conference on Machine Learning, Proceedings of Machine Learning Research. H. D. III and A. Singhthe 37th International Conference on Machine Learning, Machine Learning Research119M. Finzi, S. Stanton, P. Izmailov, and A. G. Wilson, in Proceedings of the 37th International Conference on Machine Learning, Proceedings of Machine Learning Research, Vol. 119, edited by H. D. III and A. Singh (PMLR, 2020) pp. 3165-3176.
R Kondor, S Trivedi, Proceedings of the 35th International Conference on Machine Learning, Proceedings of Machine Learning Research. J. Dy and A. Krausethe 35th International Conference on Machine Learning, Machine Learning ResearchPMLR80R. Kondor and S. Trivedi, in Proceedings of the 35th International Conference on Machine Learning, Proceedings of Machine Learning Research, Vol. 80, edited by J. Dy and A. Krause (PMLR, 2018) pp. 2747-2755.
Lorentz Group Equivariant Neural Network for Particle Physics. A Bogatskiy, B Anderson, J T Offermann, M Roussi, D W Miller, R Kondor, arXiv:2006.04780hep-phA. Bogatskiy, B. Anderson, J. T. Offermann, M. Roussi, D. W. Miller, and R. Kondor, "Lorentz Group Equivariant Neural Network for Particle Physics," (2020a), arXiv:2006.04780 [hep-ph] .
. R Drautz, 10.1103/PhysRevB.99.014104Phys. Rev. B. 9914104R. Drautz, Phys. Rev. B 99, 014104 (2019).
)-equivariant atom-centered interatomic potentials. I Batatia, S Batzner, D P Kovács, A Musaelian, G N C Simm, R Drautz, C Ortner, B Kozinsky, G Csányi, 10.48550/ARXIV.2205.06643The design space of e. I. Batatia, S. Batzner, D. P. Kovács, A. Musaelian, G. N. C. Simm, R. Drautz, C. Ortner, B. Kozinsky, and G. Csányi, "The design space of e(3)-equivariant atom-centered interatomic potentials," (2022b).
T Cohen, M Welling, Proceedings of The 33rd International Conference on Machine Learning, Proceedings of Machine Learning Research. M. F. Balcan and K. Q. WeinbergerThe 33rd International Conference on Machine Learning, Machine Learning ResearchNew York, New York, USAPMLR48T. Cohen and M. Welling, in Proceedings of The 33rd International Conference on Machine Learning, Proceedings of Machine Learning Research, Vol. 48, edited by M. F. Balcan and K. Q. Weinberger (PMLR, New York, New York, USA, 2016) pp. 2990-2999.
T S Cohen, M Geiger, J Köhler, M Welling, International Conference on Learning Representations. T. S. Cohen, M. Geiger, J. Köhler, and M. Welling, in International Conference on Learning Representations (2018).
Coordinate independent convolutional networksisometry and gauge equivariant convolutions on riemannian manifolds. M Weiler, P Forré, E Verlinde, M Welling, 10.48550/ARXIV.2106.06020M. Weiler, P. Forré, E. Verlinde, and M. Welling, "Coordinate independent convolutional networks - isometry and gauge equivariant convolutions on riemannian manifolds," (2021).
. G Dusson, M Bachmayr, G Csányi, R Drautz, S Etter, C Van Der Oord, C Ortner, 10.1016/j.jcp.2022.110946Journal of Computational Physics. 454110946G. Dusson, M. Bachmayr, G. Csányi, R. Drautz, S. Etter, C. van der Oord, and C. Ortner, Journal of Computational Physics 454, 110946 (2022).
. M Geiger, T Smidt, 10.48550/ARXIV.2207.09453e3nn: Euclidean neural networks," (2022M. Geiger and T. Smidt, "e3nn: Euclidean neural networks," (2022).
A practical method for constructing equivariant multilayer perceptrons for arbitrary matrix groups. M Finzi, M Welling, A G Wilson, 10.48550/ARXIV.2104.09459M. Finzi, M. Welling, and A. G. Wilson, "A practical method for constructing equivariant multilayer perceptrons for arbitrary matrix groups," (2021).
R Kondor, Z Lin, S Trivedi, Advances in Neural Information Processing Systems. S. Bengio, H. Wallach, H. Larochelle, K. Grauman, N. Cesa-Bianchi, and R. GarnettCurran Associates, Inc31R. Kondor, Z. Lin, and S. Trivedi, in Advances in Neural Information Processing Systems, Vol. 31, edited by S. Bengio, H. Wallach, H. Larochelle, K. Grauman, N. Cesa-Bianchi, and R. Garnett (Curran Associates, Inc., 2018).
E(n) equivariant graph neural networks. V G Satorras, E Hoogeboom, M Welling, 10.48550/ARXIV.2102.09844V. G. Satorras, E. Hoogeboom, and M. Welling, "E(n) equivariant graph neural networks," (2021).
Geometric and physical quantities improve e(3) equivariant message passing. J Brandstetter, R Hesselink, E Van Der Pol, E J Bekkers, M Welling, arXiv:2110.02905cs.LGJ. Brandstetter, R. Hesselink, E. van der Pol, E. J. Bekkers, and M. Welling, "Geometric and physical quantities improve e(3) equivariant message passing," (2022), arXiv:2110.02905 [cs.LG] .
. R Drautz, 10.1103/PhysRevB.102.024104Phys. Rev. B. 10224104R. Drautz, Phys. Rev. B 102, 024104 (2020).
. A Shapeev, Multiscale Model. Simul. 141153A. Shapeev, Multiscale Model. Simul. 14, 1153 (2016).
J P Darby, D P Kovács, I Batatia, M A Caro, G L W Hart, C Ortner, G Csányi, 10.48550/ARXIV.2210.01705Tensorreduced atomic density representations. J. P. Darby, D. P. Kovács, I. Batatia, M. A. Caro, G. L. W. Hart, C. Ortner, and G. Csányi, "Tensor- reduced atomic density representations," (2022).
. I M Gelfand, M L Tsetlin, 82582871I. M. Gelfand and M. L. Tsetlin, 825828, 71 (1950).
. A Alex, M Kalus, A Huckleberry, J Von Delft, 10.1063/1.3521562Journal of Mathematical Physics. 5223507A. Alex, M. Kalus, A. Huckleberry, and J. von Delft, Journal of Mathematical Physics 52, 023507 (2011).
P.-Y Lagrave, Y Cabanes, F Barbaresco, Geometric Science of Information. F. Nielsen and F. BarbarescoChamSpringer International PublishingP.-Y. Lagrave, Y. Cabanes, and F. Barbaresco, in Geometric Science of Information, edited by F. Nielsen and F. Barbaresco (Springer International Publishing, Cham, 2021) pp. 577-584.
. M Favoni, A Ipp, D I Müller, D Schuh, 10.1103/PhysRevLett.128.032003Phys. Rev. Lett. 12832003M. Favoni, A. Ipp, D. I. Müller, and D. Schuh, Phys. Rev. Lett. 128, 032003 (2022).
A Bogatskiy, B Anderson, J Offermann, M Roussi, D Miller, R Kondor, PMLR, 2020Proceedings of the 37th International Conference on Machine Learning, Proceedings of Machine Learning Research. H. D. III and A. Singhthe 37th International Conference on Machine Learning, Machine Learning Research119A. Bogatskiy, B. Anderson, J. Offermann, M. Roussi, D. Miller, and R. Kondor, in Proceedings of the 37th International Conference on Machine Learning, Proceedings of Machine Learning Research, Vol. 119, edited by H. D. III and A. Singh (PMLR, 2020) pp. 992-1002.
. A Butter, 10.21468/SciPostPhys.7.1.014arXiv:1902.09914SciPost Phys. 714hep-phA. Butter et al., SciPost Phys. 7, 014 (2019), arXiv:1902.09914 [hep-ph] .
Particle transformer for jet tagging. H Qu, C Li, S Qian, 10.48550/ARXIV.2202.03772H. Qu, C. Li, and S. Qian, "Particle transformer for jet tagging," (2022).
. H Qu, L Gouskos, 10.1103/PhysRevD.101.056019arXiv:1902.08570Phys. Rev. D. 10156019hep-phH. Qu and L. Gouskos, Phys. Rev. D 101, 056019 (2020), arXiv:1902.08570 [hep-ph] .
Bip: Boost invariant polynomials for efficient jet tagging. J M Munoz, I Batatia, C Ortner, 10.48550/ARXIV.2207.08272J. M. Munoz, I. Batatia, and C. Ortner, "Bip: Boost invariant polynomials for efficient jet tagging," (2022).
. P T Komiske, E M Metodiev, J Thaler, 10.1007/JHEP01(2019)121arXiv:1810.05165JHEP. 01121hep-phP. T. Komiske, E. M. Metodiev, and J. Thaler, JHEP 01, 121 (2019), arXiv:1810.05165 [hep-ph] .
. J Pearkes, W Fedorko, A Lister, C Gay, arXiv:1704.02124hep-exJ. Pearkes, W. Fedorko, A. Lister, and C. Gay, (2017), arXiv:1704.02124 [hep-ex] .
Z Wu, S Song, A Khosla, F Yu, L Zhang, X Tang, J Xiao, 10.1109/CVPR.2015.72988012015 IEEE Conference on Computer Vision and Pattern Recognition (CVPR). Los Alamitos, CA, USAIEEE Computer SocietyZ. Wu, S. Song, A. Khosla, F. Yu, L. Zhang, X. Tang, and J. Xiao, in 2015 IEEE Conference on Computer Vision and Pattern Recognition (CVPR) (IEEE Computer Society, Los Alamitos, CA, USA, 2015) pp. 1912-1920.
. X Yan, github.com/yanx27X. Yan, github.com/yanx27 (2019).
. C R Qi, H Su, K Mo, L J Guibas, arXiv:1612.00593arXiv preprintC. R. Qi, H. Su, K. Mo, and L. J. Guibas, arXiv preprint arXiv:1612.00593 (2016).
. C R Qi, L Yi, H Su, L J Guibas, arXiv:1706.02413arXiv preprintC. R. Qi, L. Yi, H. Su, and L. J. Guibas, arXiv preprint arXiv:1706.02413 (2017).
. R Steinberg, Bull. Amer. Math. Soc. 67406R. Steinberg, Bull. Amer. Math. Soc. 67, 406 (1961).
. M Bachmayr, G Dusson, C Ortner, J Thomas, 2109.14771M. Bachmayr, G. Dusson, C. Ortner, and J. Thomas, ArXiv e-prints 2109.14771 (2021).
. J Thomas, H Chen, C Ortner, Arch. Ration. Mech. Anal. 246J. Thomas, H. Chen, and C. Ortner, Arch. Ration. Mech. Anal. 246 (2022).
T Broecker, Representation of Compact Lie Groups. Berlin; HeidelbergSpringerT. Broecker, Representation of Compact Lie Groups (Springer Berlin Heidelberg, 1985).
N Bourbaki, Lie Groups and Lie Algebras. Berlin; HeidelbergSpringerN. Bourbaki, Lie Groups and Lie Algebras (Springer Berlin, Heidelberg, 1989).
| Group convolutional neural networks (G-CNNs) can be used to improve classical CNNs by equipping them with the geometric structure of groups. Central in the success of G-CNNs is the lifting of feature maps to higher dimensional disentangled representations, in which data characteristics are effectively learned, geometric data-augmentations are made obsolete, and predictable behavior under geometric transformations (equivariance) is guaranteed via group theory. Currently, however, the practical implementations of G-CNNs are limited to either discrete groups (that leave the grid intact) or continuous compact groups such as rotations (that enable the use of Fourier theory). In this paper we lift these limitations and propose a modular framework for the design and implementation of G-CNNs for arbitrary Lie groups. In our approach the differential structure of Lie groups is used to expand convolution kernels in a generic basis of B-splines that is defined on the Lie algebra. This leads to a flexible framework that enables localized, atrous, and deformable convolutions in G-CNNs by means of respectively localized, sparse and non-uniform B-spline expansions. The impact and potential of our approach is studied on two benchmark datasets: cancer detection in histopathology slides in which rotation equivariance plays a key role and facial landmark localization in which scale equivariance is important. In both cases, G-CNN architectures outperform their classical 2D counterparts and the added value of atrous and localized group convolutions is studied in detail. arXiv:1909.12057v1 [cs.LG] 26 Sep 2019 ArXiv preprint. Under review. (a) Pattern of local orientations (b) Density on SE(2) Figure 1: (a) A face descriptor in terms of low level features (e.g. edges) in a pattern of local orientations (elements in SE(2)) relative to an origin e and (b) the same pattern embed as a density on SE(2) that represents idealized neuronal activations in a G-CNN feature map. Representing low-level features via features maps on groups, as is done in G-CNNs, is also motivated by the findings of Hubel & Wiesel (1959) and Bosking et al. (1997) on the organization of orientation sensitive simple cells in the primary visual cortex V1. These findings are mathematically modeled by sub-Riemannian geometry on Lie groups (Petitot, ). In recent work Montobbio et al. (2019) show that such advanced V1 modeling geometries emerge in specific CNN architectures and in Ecker et al. (2019) the relation between group structure and the organization of V1 is explicitly employed to effectively recover actual V1 neuronal activities from stimuli by means of G-CNNs. G-CNNs are well motivated from both a mathematical point of view (Cohen et al., 2018a; Kondor & Trivedi, 2018) and neuro-psychological/neuro-mathematical point of view and their improvement over classical CNNs is convincingly demonstrated by the growing body of G-CNN literature (see Sec.2). However, their practical implementations are limited to either discrete groups (that leave the grid intact) or continuous, (locally) compact, unimodular groups such as roto-translations (that enable the use of Fourier theory). In this paper we lift these limitations and propose a framework for the design and implementation of G-CNNs for arbitrary Lie groups.The proposed approach for G-CNNs relies on a definition of B-splines on Lie groups which we use to expand and sample group convolution kernels. B-splines are piece-wise polynomials with local support and are classically defined on flat Euclidean spaces R d . In this paper we generalize B-splines to Lie groups and formulate a definition using the differential structure of Lie groups in which Bsplines are essentially defined on the (flat) vector space of the Lie algebra obtained by the logarithmic map. The result is a flexible framework for B-splines on arbitrary Lie groups and it enables the construction of G-CNNs with properties that cannot be achieved via traditional Fourier-type basis expansion methods. Such properties include localized, atrous, and deformable convolutions in G-CNNs by means of respectively localized, sparse and non-uniform B-spline expansions.Although concepts described in this paper apply to arbitrary Lie groups, we here concentrate on the analysis of data that lives on R d and consider G-CNNs for affine groups G = R d H that are the semi-direct product of the translation group with a Lie group H that acts on R d . As such, only a few core definitions about the Lie group H (group product, inverse, Log, and action on R d ) need to be implemented in order to build full G-CNNs that are locally equivariant to the transformations in H.The impact and potential of our approach is studied on two datasets in which respectively rotation and scale equivariance plays a key role: cancer detection in histopathology slides (PCam dataset) and facial landmark localization (CelebA dataset). In both cases G-CNNs out-perform their classical 2D counterparts and the added value of atrous and localized G-convolutions is studied in detail. | Deep convolutional networks have witnessed unprecedented success in various machine learning applications. Formal understanding on what makes these networks so successful is gradually unfolding, but for the most part there are still significant mysteries to unravel. The inductive bias, which reflects prior knowledge embedded in the network architecture, is one of them. In this work, we establish a fundamental connection between the fields of quantum physics and deep learning. We use this connection for asserting novel theoretical observations regarding the role that the number of channels in each layer of the convolutional network fulfills in the overall inductive bias. Specifically, we show an equivalence between the function realized by a deep convolutional arithmetic circuit (ConvAC) and a quantum many-body wave function, which relies on their common underlying tensorial structure. This facilitates the use of quantum entanglement measures as welldefined quantifiers of a deep network's expressive ability to model intricate correlation structures of its inputs. Most importantly, the construction of a deep convolutional arithmetic circuit in terms of a Tensor Network is made available. This description enables us to carry a graph-theoretic analysis of a convolutional network, tying its expressiveness to a min-cut in the graph which characterizes it. Thus, we demonstrate a direct control over the inductive bias of the designed deep convolutional network via its channel numbers, which we show to be related to the min-cut in the underlying graph. This result is relevant to any practitioner designing a convolutional network for a specific task. We theoretically analyze convolutional arithmetic circuits, and empirically validate our findings on more common convolutional networks which involve ReLU activations and max pooling. Beyond the results described above, the description of a deep convolutional network in well-defined graph-theoretic tools and the formal structural connection to quantum entanglement, are two interdisciplinary bridges that are brought forth by this work. | In recent years, the use of machine learning has become increasingly popular in the context of lattice field theories. An essential element of such theories is represented by symmetries, whose inclusion in the neural network properties can lead to high reward in terms of performance and generalizability. A fundamental symmetry that usually characterizes physical systems on a lattice with periodic boundary conditions is equivariance under spacetime translations. Here we investigate the advantages of adopting translationally equivariant neural networks in favor of non-equivariant ones. The system we consider is a complex scalar field with quartic interaction on a two-dimensional lattice in the flux representation, on which the networks carry out various regression and classification tasks. Promising equivariant and non-equivariant architectures are identified with a systematic search. We demonstrate that in most of these tasks our best equivariant architectures can perform and generalize significantly better than their non-equivariant counterparts, which applies not only to physical parameters beyond those represented in the training set, but also to different lattice sizes. | Traditional sequential multi-object attention models rely on a recurrent mechanism to infer object relations. We propose a relational extension (R-SQAIR) of one such attention model (SQAIR) by endowing it with a module with strong relational inductive bias that computes in parallel pairwise interactions between inferred objects. Two recently proposed relational modules are studied on tasks of unsupervised learning from videos. We demonstrate gains over sequential relational mechanisms, also in terms of combinatorial generalization.IntroductionNumerous studies[35,17,27,1,22]show that infants quickly develop an understanding of intuitive physics, objects and relations in an unsupervised manner. To facilitate the solution of real-world problems, intelligent agents should be able to acquire such knowledge[31]. However, artificial neural networks are still far from human-level understanding of intuitive physics.Existing approaches to unsupervised learning about objects and relations from visual data can be categorized into either parallel[11,12,10]or sequential[26,25,7,18,6,5,36], depending on the core mechanism responsible for inferring object representations from a single image. One model from the former group isTagger[11] which applies the Ladder Network [20] to perform perceptual grouping. RTagger [19] replaces the Ladder Network by a Recurrent Ladder Network, thus extending Tagger to sequential settings. NEM [12] learns object representations using a spatial mixture model and its relational version R-NEM [30] endows it with a parallel relational mechanism. The recently proposed IODINE [10] iteratively refines inferred objects and handles multi-modal inputs.On the other hand, the sequential attention model AIR [7] learns to infer one object per iteration over a given image. Contrary to NEM, it extracts object glimpses through a hard attention mechanism[26]and processes only the corresponding glimpse. Furthermore, it builds a probabilistic representation of the scene to model uncertainty. Many recent models have AIR as the core mechanism: SQAIR [18] extends AIR to sequential settings, similarly does DDPAE[15]. SPAIR [6] scales AIR to scenarios with many objects and SuPAIR[28] improves speed and robustness of learning in AIR. The recent MoNET [5] also uses a VAE and a recurrent neural network (RNN) to decompose scenes into multiple objects. These methods usually model relations by a sequential relational mechanism such as an RNN which limits their relational reasoning capabilities[3].Here we present Relational Sequential Attend, Infer, Repeat (R-SQAIR) to learn a generative model of intuitive physics from video data. R-SQAIR builds on SQAIR which we augment by a mechanism that has a strong relational inductive bias[2,30,21]. Our explicit parallel model of pairwise relations between objects is conceptually simpler than a sequential RNN-based model that keeps previous interactions in its memory and cannot directly model the effects of interactions of previously considered objects. Our experiments demonstrate improved generalization performance of trained models in new environments. | In the recent years, deep learning techniques have shown great success in various tasks related to inverse problems, where a target quantity of interest can only be observed through indirect measurements by a forward operator. Common approaches apply deep neural networks in a postprocessing step to the reconstructions obtained by classical reconstruction methods. However, the latter methods can be computationally expensive and introduce artifacts that are not present in the measured data and, in turn, can deteriorate the performance on the given task. To overcome these limitations, we propose a class of equivariant neural networks that can be directly applied to the measurements to solve the desired task. To this end, we build appropriate network structures by developing layers that are equivariant with respect to data transformations induced by well-known symmetries in the domain of the forward operator. We rigorously analyze the relation between the measurement operator and the resulting group representations and prove a representer theorem that characterizes the class of linear operators that translate between a given pair of group actions. Based on this theory, we extend the existing concepts of Lie group equivariant deep learning to inverse problems and introduce new representations that result from the involved measurement operations. This allows us to efficiently solve classification, regression or even reconstruction tasks based on indirect measurements also for very sparse data problems, where a classical reconstructionbased approach may be hard or even impossible. We illustrate the effectiveness of our approach in numerical experiments and compare with existing methods. | A core challenge in the interpretation of deep neural networks is identifying commonalities between the underlying algorithms implemented by distinct networks trained for the same task. Motivated by this problem, we introduce DYNAMO, an algorithm that constructs low-dimensional manifolds where each point corresponds to a neural network model, and two points are nearby if the corresponding neural networks enact similar high-level computational processes. DYNAMO takes as input a collection of pre-trained neural networks and outputs a meta-model that emulates the dynamics of the hidden states as well as the outputs of any model in the collection. The specific model to be emulated is determined by a model embedding vector that the meta-model takes as input; these model embedding vectors constitute a manifold corresponding to the given population of models. We apply DYNAMO to both RNNs and CNNs, and find that the resulting model embedding spaces enable novel applications: clustering of neural networks on the basis of their high-level computational processes in a manner that is less sensitive to reparameterization; model averaging of several neural networks trained on the same task to arrive at a new, operable neural network with similar task performance; and semi-supervised learning via optimization on the model embedding space. Using a fixedpoint analysis of meta-models trained on populations of RNNs, we gain new insights into how similarities of the topology of RNN dynamics correspond to similarities of their high-level computational processes.Figure 1: A conceptual diagram of the DYNAMO algorithm and model embedding space. A set of neural networks labelled 1, ..., N called the base models are mapped to corresponding points θ 1 , ..., θ N in the model embedding space. Two points in the model embedding space are nearby if they correspond to neural networks with similar dynamics for their hidden and output states. There is an associated neural network called the meta-model which, when given a θ i , becomes a neural network that emulates the hidden and output dynamics of the corresponding base model i. The meta-model produces a viable neural network for any given any value of θ, including points in the model embedding space that do not correspond to any base model. | Deep network in network (DNIN) model is an efficient instance and an important extension of the convolutional neural network (CNN) consisting of alternating convolutional layers and pooling layers. In this model, a multilayer perceptron (MLP), a nonlinear function, is exploited to replace the linear filter for convolution. Increasing the depth of DNIN can also help improve classification accuracy while its formation becomes more difficult, learning time gets slower, and accuracy becomes saturated and then degrades. is paper presents a new deep residual network in network (DrNIN) model that represents a deeper model of DNIN. is model represents an interesting architecture for on-chip implementations on FPGAs. In fact, it can be applied to a variety of image recognition applications. is model has a homogeneous and multilength architecture with the hyperparameter "L" ("L" defines the model length). In this paper, we will apply the residual learning framework to DNIN and we will explicitly reformulate convolutional layers as residual learning functions to solve the vanishing gradient problem and facilitate and speed up the learning process. We will provide a comprehensive study showing that DrNIN models can gain accuracy from a significantly increased depth. On the CIFAR-10 dataset, we evaluate the proposed models with a depth of up to L � 5 DrMLPconv layers, 1.66x deeper than DNIN. e experimental results demonstrate the efficiency of the proposed method and its role in providing the model with a greater capacity to represent features and thus leading to better recognition performance. knowledge transfer [9, 10], layered training [11], normalized initialization[5,12,13], and residual blocks[14]. Experiments show that residual blocks[14,15]were comparatively good or/and better than these various techniques and indicate that a deeper model should not produce higher training error than its shallower counterpart. e depth of the last residual deep networks[14]is evolved up to thousands of layers while improving their performance. ey have had great success and reached the state of the art in several benchmarks. In this article, we address the degradation problem by introducing an efficient deep neural network architecture for computer vision, deep residual network in network, which takes its name from the deep network in the network article [1] in conjunction with the famous "deep residual learning for image recognition"[14]. e advantages of the architecture are experimentally verified on the CIFAR-10 classification challenges. e contributions of this work are as follows: | Including covariant information, such as position, force, velocity or spin is important in many tasks in computational physics and chemistry. We introduce Steerable E(3) Equivariant Graph Neural Networks (SEGNNs) that generalise equivariant graph networks, such that node and edge attributes are not restricted to invariant scalars, but can contain covariant information, such as vectors or tensors. This model, composed of steerable MLPs, is able to incorporate geometric and physical information in both the message and update functions. Through the definition of steerable node attributes, the MLPs provide a new class of activation functions for general use with steerable feature fields. We discuss ours and related work through the lens of equivariant non-linear convolutions, which further allows us to pin-point the successful components of SEGNNs: non-linear message aggregation improves upon classic linear (steerable) point convolutions; steerable messages improve upon recent equivariant graph networks that send invariant messages. We demonstrate the effectiveness of our method on several tasks in computational physics and chemistry and provide extensive ablation studies. Duits. Roto-translation covariant convolutional networks for medical image analysis. In International conference on medical image computing and computer-assisted intervention, pp. 440-448. Springer, 2018.Lukas Biewald. Experiment tracking with weights and biases, 2020. . Open catalyst 2020 (oc20) dataset and community challenges. ACS Catalysis, 0(0):6059-6072, 2020. A practical method for constructing equivariant multilayer perceptrons for arbitrary matrix groups. arXiv preprint arXiv:2104.09459, 2021. William T Freeman, Edward H Adelson, et al. The design and use of steerable filters. IEEE Transactions on Pattern analysis and machine intelligence, 13(9):891-906, 1991. (3)-transformers: 3d roto-translation equivariant attention networks. arXiv preprint arXiv:2006.10503, 2020. |
178 | If they can remaster LEGO Star Wars the Complete Saga, they should make a new LEGO Harry Potter with the new wave. | Was thinking today that they did a Lego Harry Potter collection for the newer gen consoles and was thinking I would love if they did a similar thing to the Lego Star Wars games, as in the complete saga that was released on the PS3/Xbox 360.
But instead of a port, a full on remaster with similar graphics and features of Lego Star Wars TFA (e.g. explore more planets, the improved shoot outs etc.) in my opinion would be good fun, anyone else agree? | I mean “new” LEGO games in the sense, that it needs to be from new source material entirely. Not just another game in a series of Star Wars games or whatever.
Personally I would love an Avatar the last Airbender game.
With many characters and a linear story, already compiled into individual episodes, I think it would be very adaptable into a LEGO game.
Also it has the potential to have an open world, which I would totally love. | Pretty much just what the title says. On one hand, it'd be a neat nod to Awakening and Fates, and it's something newer fans would expect (and part of the whole point of a remake is to make older games appeal to newer fans, after all). On the other, some combinations would look...really weird, considering all the kids have established designs. What do you guys think? | So back in the early 2010s, LEGO kinda focused on one episode per wave, 2012 was ep1, 2013 was Ep2, 2014 was ep3, and then after that, we got a lot of the same. I think we should go back to the concept of those days, to keep things fresh and have a larger variety out there and not just X-Wings and Luke Landspeeders. | LEGO has done some work in the realm of high fantasy, with Lord of the Rings, the Hobbit, Harry Potter and some LEGO originals. In addition, the classic castle theme is an all-time favorite for many enthusiasts. If LEGO entered another high fantasy IP, which one would you like to see? (Please leave additional ideas, including set ideas, and minifigure ideas in the comments.)
View Poll | Anyone else think this would be a great idea? Every LEGO game up to now together and they could make one like every 5 years and keep on adding to make a huge great game in one. Sounds good to the fans but I tihnk they would lose money on it. | Don't buy the FF7 remake. It's not about politics or which side you fall on. We need to set the precedent to Square Enix that we want to see the creative vision that developers intended in our games, not to have edicts handed down on high from some "ethics" department. These people care about their agenda, not the game, not the franchise, and not the fans. Please do not reward their objectionable behavior.
Updating the Honey Bee Inn scene for "modern times" is no different than going back into E.T. and replacing all of the firearms with Walkie Talkies. Art should be preserved, if not for integrity's sake then at least for the sake of remembering our past so that we can carry those lessons into the future.
Let creators create. Don't try to erase the parts of history you don't like. Send this message to Square Enix instead of your money. | No spoilers here, but after today’s episode I really hope LEGO makes some sets for the new season of the Clone Wars... | 178 | Title says it all. I just think that LEGO Harry Potter which was great deserves a good remaster just like LSWTCS. Not that combine the video games shit. | Would love a Lego Star Wars remaster | They should just remaster the sequels. But overall this ... | What is the difference between Lego Star Wars the complete saga and Lego starwars the original trilogy? | and much better than any lego title that came before it | The Mass Effect Trilogy Doesn't Need To Be Remastered. | When you whas playing lego star wars n wii you finished all the levels you didnt get ghost yoda? | Played LEGO Lord of the Rings and loved it, should I play the other LEGO games? | Is there any difference between the original games and the remasters? |
179 | PASSIVE WI-FI: Bringing Low Power to Wi-Fi Transmissions | We present BackFi, a novel communication system that enables high throughput, long range communication between very low power backscatter devices and WiFi APs using ambient WiFi transmissions as the excitation signal. Specifically, we show that it is possible to design devices and WiFi APs such that the WiFi AP in the process of transmitting data to normal WiFi clients can decode backscatter signals which the devices generate by modulating information on to the ambient WiFi transmission. We show via prototypes and experiments that it is possible to achieve communication rates of up to 5 Mbps at a range of 1 m and 1 Mbps at a range of 5 meters. Such performance is an order to three orders of magnitude better than the best known prior WiFi backscatter system [27,25]. BackFi design is energy efficient, as it relies on backscattering alone and needs insignificant power, hence the energy consumed per bit is small. | Wi-fi backscatter: internet connectivity for RF-powered devices | Is it possible to recieve/send a signal through wifi only using an antenna and decoding the induced voltage in the antenna? Does anyone know of open scource projects who tried that (preferably in C/C++)? | Wireless Powered Communication: Opportunities and Challenges | Generally in radio technology we tend to need passive devices. Power dividers are best passive devices. Power dividers are used to split the power and add the power. When transfer of magnetic attraction power is needed in b/w 2 ports through the transmission line these power dividers square measure used. By using power divider we tend to will simply unreal a quarter wave lines on single written circuit board. This is very low-cost and used as easy splitter and combiner. The frequency used in this device is 2.4GHz. By using Genesys code we tend to will simulate power dividers and the version is 2014.03. | The utility model discloses an intelligent household wireless passive signal-transmitting and -receiving device, and the device comprises a wireless signal-transmitting and -receiving apparatus (1) and a power supply. The device is characterized in that the power supply is a rechargeable battery (3) and a solar cell (2); the solar cell (2) is connected with the rechargeable battery (3); and the rechargeable battery (3) is connected with the wireless signal-transmitting and -receiving apparatus (1). The device is advantageous in that there is no need of a power line; the installation and application are convenient; there is no need of changing a battery; and the device can work for a long time. | Hello samir, first of all welcome to the Yahoo Answers family. Keep asking questions, and answering to questions by others.\n\nWhen you first broadcast a wireless signal it is very strong. As it continues to travel away from its source, the signal strength begins to degrade. The farther the signal travels, the weaker it becomes — until finally it loses its integrity. This is known as attenuation.\n\nA wireless repeater picks up the weak signal, regenerates it and then rebroadcasts it, thus extending the range of your network. This regeneration makes the signal stronger, making it possible to overcome some of the interference you might be encountering. \n\nThis way you can use the signal from a much larger distance than before.\n\nYou are right, you would infact be able to steal the signal from your neighbouring wireless zones by doing this. This is one of the major aspect of threat in network security. To counter this, most people encrypt the data sent by from their hotspot. You would hence need a encryption key to access it, which you cannot do unless you are a legal authorized user. You can do the analysis of the wireless waves for intrusion detection using AirSnare (http://home.comcast.net/~jay.deboer/airsnare/)\n\nYou can look at the source for more information in this field ( The first source mentions 10 tips to improve your wireless comunication) | In this paper we propose a one-dimensional (1-D) proximity power transmission system. The system can transfer the microwave power to the receiver device at an arbitrary position on a 1-D ribbon waveguide without electrical contacts. The power is selectively transferred only to special receivers and not to other objects. Such selectivity is needed for transferring higher-wattage power safely in a general environment. The selectivity is realized by using a low-leakage ribbon waveguide and a high-quality-factor (high-Q) resonant receiver coupler. We also propose a scheme to reduce the receiver position dependency of power transmission by attaching a reflection phase shifter at the end of the waveguide. A fabricated prototype system achieved 16% power transmission in the microwave form. | 179 | Wi-Fi has traditionally been considered a power-consuming communication system and has not been widely adopted in the sensor network and Internet of Things (IoT) space. We introduce Passive Wi-Fi that demonstrates that one can generate 802.11b transmissions using backscatter communication, while consuming 3-4 orders of magnitude lower power than existing Wi-Fi chipsets. Passive Wi-Fi transmissions can be decoded on any Wi-Fi device including routers, mobile phones and tablets. Our experimental evaluation shows that passive Wi-Fi transmissions can be decoded on off-the-shelf smartphones and Wi-Fi chipsets over distances of up to 100 feet. We also design a passive Wi-Fi IC that shows that 1 and 11 Mbps transmissions consume 14.5 and 59.2 ?W respectively. This translates to 10000x lower power than existing Wi-Fi chipsets and 1000x lower power than Bluetooth LE and ZigBee. | In this letter, we consider a wireless-powered backscatter communication (WP-BackCom) network, where the transmitter first harvests energy from a dedicated energy RF source in the sleep state, and then backscatters information and harvests energy simultaneously through a reflection coefficient. Our goal is to maximize the achievable energy efficiency of the WP-BackCom network via jointly optimizing time allocation, reflection coefficient and transmit power of the dedicated energy RF source. The optimization problem is non-convex and challenging to solve. We develop an efficient Dinkelbach-based iterative algorithm to obtain the optimal resource allocation scheme. The study shows that for each iteration, the energy-efficient WP-BackCom network is equivalent to either the network in which the transmitter always operates in the active state, or the network in which the dedicated energy RF source adopts the maximum allowed power. AB Transmitt er AB Receiver h1 RF signals Node A Node B h 0 h 1 h 2 Backscatter signals RF signals Dedicated RF energy source Fig. 1. System Model operation. Hence backscatter communications consume much less energy than WPCN involving active RF transmission components [2]. In [3], the hardware of backscatter communication prototypes was designed by leveraging ambient WiFi signals, to realize backscatter and energy harvesting. In one of the theoretical analysis [4], the authors investigated the impacts of the time allocation and the reflection coefficient on wirelessly powered backscatter communication system, where dedicated RF energy sources were deployed to power backscatter users. The coexistence of harvest-then-transmit protocol and backscatter communication was also investigated in wireless-powered heterogeneous networks [5], where ambient RF signals and dedicated RF signals transmitted by a dedicated energy source are considered. In addition to [4], [5], where the main focus was on system-level backscatter communications, the authors of [6] studied the joint design of time allocation and reflection coefficient to maximize throughput in a typical backscatter communication scenario that consists of one RF energy source, one backscatter user, and one receiver. The outage probability was also derived in a similar scenario [7]. Backscatter communication has also been combined with other types of communication techniques, e.g., cognitive radio [8], [9], device-to-device [10], and relaying [11]. For example, the existing studies [8], [9] showed that, in a backscatter assisted cognitive radio network, the system spectral efficiency (SE) can be significantly improved by choosing appropriate backscatter communication parameters. Another example is the application of backscatter communications to relay networks [11], where the relay is equipped with a backscatter circuit to reflect the received information to the destination via RF signals from the dedicated energy source. It was shown that the combination can improve the system SE by using an advanced transmission scheme. Although the aforementioned works [3]-[12] have laid a solid foundation for understanding backscatter communications from various perspectives, e.g., hardware design and SE, the energy efficiency (EE) of backscatter communication has not been studied yet. Motivated by this observation, in this letter, we focus on the design of energy-efficient resource allocation scheme in a wireless-powered backscatter | A battery-less WiFi-BER modulated data transmitter with ambient radio-wave energy harvesting | Ambient backscatter communications have been identified for ultra-low energy wireless communications. Indeed, a tag can send a message to a reader without emitting any wave and without battery, simply by backscattering the waves generated by a source. In the simplest implementation of such a system, the tag sends a binary message by oscillating between two states and the reader detects the bits by comparing the two distinct received powers. In this paper, for the first time, we propose to study an ambient backscatter communication system, in the presence of a diffusing surface, a simple flat panel that diffuses in all directions. We establish the analytical closed form expression of the power contrast in the presence of the surface. We show that the diffusing surface improves the power contrast. Moreover our approach allows us to express the contrast to noise ratio, and therefore to establish the BER performance. Furthermore, we derive the optimum source transmit power for a given target power contrast. This makes it possible to quantify the amount of energy that can be saved at the source side, thanks to the diffusing surface. | Wireless I2C communication? | Kill-A-Watt with feed over WiFi | What homelab experiments can I do with only WiFi? | Application of Wi-Fi Communication in Smart Watt-Hour Meters | Self-powered and Backscatter-communicated IoT Device System for Zero-energy Wireless Communication in a Wi-Fi Environment |
180 | The activity of the PrkC protein kinase is regulated in a sophisticated manner in Bacillus subtilis cells.In spores, in the presence of muropeptides, PrkC stimulates dormancy exit. The extracellular region containing PASTA domains binds peptidoglycan fragments to probably enhance the intracellular kinase activity. During exponential growth, the cell division protein GpsB interacts with the intracellular domain of PrkC to stimulate its activity. In this paper, we have reinvestigated the regulation of PrkC during exponential and stationary phases. We observed that, during exponential growth, neither its septal localization nor its activity are influenced by the addition of peptidoglycan fragments or by the deletion of one or all PASTA domains. However, Dynamic Light Scattering experiments suggest that peptidoglycan fragments bind specifically to PrkC and induce its oligomerization. In addition, during stationary phase, PrkC appeared evenly distributed in the cell wall and the deletion of one or all PASTA domains led to a non-activated kinase. We conclude that PrkC activation is not as straightforward as previously suggested and that regulation of its kinase activity via the PASTA domains and peptidoglycan fragments binding occurs when PrkC is not concentrated to the bacterial septum, but all over the cell wall in non-dividing bacillus cells.Many bacteria possess a conserved family of serine/threonine protein kinases (STPK) 1 that are involved in the regulation of several cellular processes 2-5 . These enzymes are composed of an intracellular kinase domain resembling the catalytic domain of Hanks-type kinases and, for most, a short transmembrane trait (TM) and an extracellular regulatory C-terminal region containing β-lactam-binding domains 6-8 . These PASTA domains (for penicillin-binding protein and serine/threonine kinase associated domains) are specifically found in bacteria and notably in Firmicutes and in Actinobacteria. They are shown to interact with β-lactam antibiotics 9,10 , peptidoglycan (PG) fragments 6,11 and Lipid II 12 . Despite a poor conservation of their amino acid sequence, the PASTA domains share a globular fold formed by one α helix facing three β strands 13 . The number of these PASTA repeats varies also among STPKs 1,14 but they are predicted to be signal-binding domains sensing the state of the cell wall. One of the best-characterized STPKs is the PrkC protein from B. subtilis. It is constituted of an intracellular kinase domain, a short transmembrane helix and an extracellular region with a linear modular structure composed of three PASTA domains and a C-terminal domain, which structurally resembles an Ig fold presenting the typical features of adhesive proteins involved in cell-cell interactions or signaling 15,16 . Furthermore, unlike its homologues from other species like Mycobacterium tuberculosis or Streptococcus pneumoniae, the inactivation of PrkC does not impact cell division, cell shape or cell growth but rather alters stationary phase physiology and spore germination[17][18][19]. Like its S. pneumoniae homologue, PrkC is also expressed during exponential growth; it is localized at the septum of dividing cells and its activity is directly stimulated by the cytoplasmic cell division protein GpsB 20 . During stationary phase growth, B. subtilis PrkC seems to be required to limit cell lysis and thus, among the pleiotropic effects of prkC deletion, the lysis phenotype would rather be linked to the absence of the elongation factor G (EF-G) phosphorylation 17 . However, in the spore-forming bacteria B. subtilis, it has been proposed that the main function of PrkC is to mediate the exit of dormancy in response to PG fragments. Indeed, muropeptide fragments of the cell wall have been shown to stimulate germination of wild-type B. subtilis dormant spores whereas they have no effect on prkC-mutant spores. This stimulation requires the kinase activity of PrkC since germination is not activated in catalytic mutant (PrkC-K40A) spores 19 . Furthermore, PASTA domains of PrkC were found to bind PG in vitro with a clear preference for DAP-type to Lys-type muropeptides 11 driven by the Arg500 located in PASTA3. The most obvious hypothesis for the muropeptide-driven activation of PrkC would be that their binding to PASTA domains induces dimerization of the extracellular domain thus leading to the formation of the asymmetric active PrkC dimer 16 . Recently, the X-ray structure of the intracellular kinase domain of PknB suggests a model in which a structural and functionally asymmetric 'front-to-front' association occurs 21 . The activated autophosphorylated kinase domain can then mediate spore germination 19 by phosphorylating protein substrates like EF-G. To elaborate this model, the authors demonstrated that, in Bacillus spore preparation, EF-G phosphorylation is due to PrkC and to the addition of cell-free supernatants19. In another study, the same authors examined EF-G phosphorylation from cells grown to the exponential phase in the presence of PG fragments22. Surprisingly, they concluded that PrkC phosphorylates EF-G in response to PG fragments despite the presence of a band corresponding to muropeptide-dependent phosphorylation of EF-G in a ΔprkC mutant. This PrkC activation by muropeptides is challenged by other observations. In particular, the catalytic domain alone, without any PASTA motifs, is active in vitro 17,23 . Furthermore, a study of the oligomerization state of the extracellular domain of PrkC from Staphylococcus aureus, which strongly resembles that of B. subtilis, showed that it is monomeric and that muropeptides do not induce its dimerization 16 . The authors suggested that this dimerization mechanism may require the contribution of the TM domain and maybe indirectly modulated by muropeptides. In addition, whereas the PASTA module is required for the autophosphorylation of the kinase IreK from Enterococcus faecalis in response to cell wall stress, no direct muropeptide-induced activation of PrkC kinase activity has been observed 24 . In some cases, like for PknB from M. tuberculosis and PBP2x or StkP from S. pneumoniae, PASTA domains have been shown to be important for cell division and localization of the protein at mid-cell and at the poles 2,25 . In addition, it was recently shown for StkP from S. pneumoniae that the PASTA repeats are required for the activation of the kinase independently of muropeptides binding and also to control the septal cell wall thickness 26 . These observations suggest that PASTA domains could have several functions in proteins and are not limited to ligand-binding domains. Thus, the mode of activation of STPKs could be species-specific and more complex than the accepted model described so far.In this paper, we show that contrary to what was observed for the two homologues PknB or StkP, the septal localization of PrkC is independent of its PASTA domains but depends only on its TM domain in B. subtilis growing cells. Addition of PG fragments has no effect on this localization. Furthermore, we demonstrate that the deletion of one or all PASTA domains has no effect on PrkC activity in vitro or in vivo during exponential growth. In agreement with these data, whereas the protein is able to bind muropeptides, the kinase activity of PrkC is not stimulated by the addition of these PG fragments neither in vitro nor in vivo. Nevertheless, we show that the PASTA domains are necessary to stimulate PrkC autophosphorylation during the stationary growth phase, when PrkC is no longer concentrated at the septum of the cells but distributed all over the cell wall. All these results suggest that a complex mode of activation for the PrkC kinase activity exists in B. subtilis that depends on its cellular localization and is interconnected with bacterial growth phase. |
The Staphylococcus aureus serine/threonine protein kinase Stk1 (also known as PknB) affects different key pathways such as cell wall metabolism, antibiotic susceptibility, and regulation of virulence. Here we report that the catabolite control protein A (CcpA), a highly conserved regulator of carbon catabolite repression and virulence in a number of Gram-positive pathogens, was efficiently phosphorylated in vitro and in vivo by Stk1 in S. aureus, whereas the CcpA homologues of Bacillus subtilis and Bacillus anthracis were not affected by the Stk1 orthologue PrkC. Mass spectrometry and mutational analyses identified Thr-18 and Thr-33 as the phosphoacceptors; both are located in the DNA binding domain of this protein. Electrophoretic mobility shift assays demonstrated that the CcpA DNA binding activity was completely abrogated for the phosphorylated CcpA. The physiological relevance of CcpA phosphorylation was assessed by generating CcpA phosphoablative (T18A/T33A) or phosphomimetic (T18D/T33D) mutants. In contrast to the wild-type and phosphoablative ccpA alleles, introduction of the phosphomimetic ccpA allele in a ⌬ccpA mutant failed to restore the parental biofilm formation profile and the transcription of citZ and hla to levels seen with the wild type. The strong up regulation of ccpA transcripts and CcpA level in the ccpA mutant trans-complemented with the phosphomimetic CcpA variant suggest furthermore that CcpA acts as a negative regulator of its own expression. Together, these findings demonstrate that Stk1-driven phosphorylation of CcpA inhibits its DNA binding activity toward its regulon in S. aureus, representing a novel regulatory mechanism of CcpA activity in addition to the well known regulation via HprKP/Hpr in this clinically important pathogen.
Carbon catabolite repression is a widespread, global regulatory phenomenon in bacteria that allows modulation of the expression of genes and operons involved in carbon utilization and metabolization in the presence of the preferred carbon source(s). In carbon catabolite repression, the presence of a preferred carbon source usually induces the repression of genes and operons whose products are involved in the metabolism of alternative, less preferred carbon sources. One of the important and highly conserved regulators of carbon catabolite regulation in low-GC Gram-positive bacteria is the catabolite control protein A (CcpA), 3 a member of the LacI/GalR family of bacterial regulatory proteins, which has been intensively studied in Bacillus subtilis (for reviews, see Refs. 1 and 2). In the presence of glucose or other rapidly metabolized carbon sources, CcpA is activated by formation of a complex with its co-regulator Hpr that needs to be phosphorylated on residue Ser-46 by its cognate kinase HprKP. The CcpA⅐Hpr-Ser(P)-46 complex has an increased affinity for particular cis-acting sequences, termed catabolite-responsive element (cre) sequences, and thereby represses or enhances gene expression depending on the position of the cre in relation to the operator sequence (3,4). In a number of Gram-positive pathogens such as Bacillus anthracis (5), Clostridium difficile (6), Staphylococcus aureus (7), Staphylococcus epidermidis (8), Streptococcus pneumoniae (9), and Streptococcus pyogenes (10), CcpA is also involved in the regulation of virulence determinants.
In S. aureus, which is one of the leading causes for nosocomial infections and an important human pathogen responsible for a wide variety of diseases, including soft tissue infections, toxic shock syndrome, and necrotizing pneumonia (11), CcpA was shown to affect antibiotic resistance, biofilm formation, expression of toxins such as hla (encoding ␣-hemolysin) and tst (encoding toxic shock syndrome toxin), and infectivity of this bacterium (7,(12)(13)(14)(15). Recent transcriptome and proteome analyses confirmed the broad effects of CcpA on gene expression in S. aureus and suggested this LacI/GalR type of regulator to be active in the presence and absence of glucose (13). However, the regulatory mechanism(s) that modulates the DNA binding properties of the S. aureus CcpA in the absence of glucose has not yet been identified.
Signal transduction through reversible protein phosphorylation is a key regulatory mechanism of both prokaryotes and eukaryotes. To overcome the stressful conditions imposed by a host, pathogens have evolved various protective and offensive responses generally achieved through cascades of phosphorylation reactions. Many of the stimuli encountered are transduced via sensor kinases in the membrane, allowing the pathogen to adapt for survival in hostile environments. In addition to the classical two-component systems, S. aureus contains one eukaryotic-like serine/threonine protein kinase (STPK), Stk1 (16,17). Recent studies provided the first insights into the reg-ulatory function of Stk1 and the molecular mechanisms of the Ser/Thr phosphorylation system in S. aureus (17). Interestingly, the Ser/Thr kinase Stk1 was identified to influence central metabolic processes in S. aureus (18) and the activity of important regulatory factors such as SarA (19), MgrA (20), and LuxS (21). Therefore, we investigated the possible regulation of CcpA by Stk1. To this end, we have identified CcpA as a new substrate of Stk1 and identified its phosphorylation sites. This allowed us to address the role and contribution of phosphorylation in regulating CcpA activity. Importantly, with both in vitro and in vivo approaches, we provide for the first time evidence that phosphorylation negatively regulates the activity of CcpA, thus inhibiting biofilm formation and modifying CcpA target gene expression.
EXPERIMENTAL PROCEDURES
Bacterial Strains and Growth Conditions-Strains and plasmids used in this study are listed in Table 1. Escherichia coli strains were grown at 37°C in LB medium supplemented with 100 g/ml ampicillin or 100 g/ml spectinomycin when required. S. aureus isolates were plated on tryptic soy agar supplemented with 10 g/ml chloramphenicol or 50 g/ml kanamycin when required or grown in filter-sterilized tryptic soy broth (TSB) medium at 37°C and 150 rpm with a culture to flask volume of 1:10. Cloning, Expression, and Purification of CcpA and Mutant Proteins from S. aureus-The ccpA gene was amplified by PCR using S. aureus N315 chromosomal DNA as a template with the primers listed in Table 2 containing an NdeI and a BamHI restriction site, respectively. The corresponding amplified product was digested with NdeI and BamHI and ligated into the pETPhos plasmid (22), a variant of pET15b (Novagen) that includes a tobacco etch virus protease site instead of the thrombin site and an N-terminal His tag free of Ser/Thr/Tyr residues, thus generating pETPhos_ccpA. pETPhos_ccpA derivatives harboring threonine to alanine substitutions at Thr-18 and/or Thr-33 of the ccpA open reading frame were generated using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) and resulted in the construction of plasmids pETPhos_ccpA_T18A, pETPhos_ccpA_T33A, and pETPhos_ ccpA_T18A/T33A, respectively. The duet strategy was used to generate a hyperphosphorylated CcpA protein as described previously (23). The ccpA gene was cloned into the pCDF-Duet-1 vector containing the Stk1 kinase domain (21), generating plasmid pDuet_ccpA, which was used to transform E. coli BL21(DE3)Star cells. pDuet_ccpA E. coli cells were used to overexpress and purify His-tagged CcpA as described below. All constructs were verified by DNA sequencing. Recombinant strains harboring the different constructs were used to inoculate 200 ml of LB medium supplemented with ampicillin or spectinomycin, and resulting cultures were incubated at 37°C with shaking until the optical density of the culture reached an A 600 of 0.5. Isopropyl 1-thio--D-galactopyranoside (1 mM final) was added to induce the overexpression, and growth was continued for 3 h at 37°C. Purifications of the His-tagged recombinants were performed as described by the manufacturer (Qiagen).
Mass Spectrometry Analysis-Purified His-tagged hyperphosphorylated CcpA from the E. coli strain carrying pDuet_ ccpA and co-expressing the Stk1 kinase was subjected to mass spectrometry without further treatment. Subsequent mass spectrometric analyses were performed as reported previously (24).
Overexpression and Purification of CcpA in S. aureus-The ccpA gene was amplified by PCR using S. aureus N315 chromosomal DNA as a template with the primers listed in Table 2 containing a BamHI and a PstI site, respectively. The PCR product harboring a C-terminal His-tagged fusion was digested with BamHI/PstI, enabling direct cloning into the pMK4-pProt expression vector cut with the same enzymes, thus generating pMK4_ccpA, which allows constitutive expression in S. aureus as described previously (16,25). The double mutant corresponding to T18A and T33A was generated using the QuikChange site-directed mutagenesis kit (Stratagene), generating the pMK4_ccpA_T18A/T33A construct. The resulting vectors were used to transform S. aureus strain RN4220 (26), which served as donor for transducing the plasmids into the stk1 mutant ST1004 (S. aureus 8325-4 ⌬stk1) (16). Purification of soluble CcpA proteins was performed on nickel-nitrilotriacetic acid-agarose beads as described by the manufacturer (Qiagen) and used for immunoblotting. DECEMBER 21, 2012 • VOLUME 287 • NUMBER 52
Regulation of CcpA by Ser/Thr Kinase Phosphorylation
JOURNAL OF BIOLOGICAL CHEMISTRY 43609
In Vitro Kinase Assay-In vitro phosphorylation was performed with 4 g of CcpA protein or mutant derivatives in 20 l of buffer P (25 mM Tris-HCl, pH 7.0, 1 mM dithiothreitol (DTT), 5 mM MgCl 2 , 1 mM EDTA, 50 M ATP) with 200 Ci ml Ϫ1 (65 nM) [␥-33 P]ATP (PerkinElmer Life Sciences; 3000 Ci mmol Ϫ1 ) and 0.5 g of Stk1 kinase for 30 min at 37°C. Control experiments were conducted under the same conditions but without kinase. Cloning, expression, and purification of the Stk1 kinase from S. aureus were described previously (21).
Electrophoretic Mobility Shift Assays-The DNA probes for electrophoretic mobility shift assays (EMSAs) were generated by PCR using S. aureus N315 chromosomal DNA as a template, which encompasses the promoter regions of hla, citZ, ald, tst, malR, and pckA, with respective primer pairs listed in Table 2. The 5Ј-ends of the double-stranded PCR products were labeled using [␥-32 P]ATP and T4 polynucleotide kinase. A typical assay mixture contained (in 20 l) 10 mM Tris-HCl, pH 7.5, 50 mM NaCl, 1 mM EDTA, 1 mM DTT, 0.1 g of nonspecific competitor (poly(dI-dC)), 5% (v/v) glycerol, radioactive DNA probe (2000 cpm ml Ϫ1 ), and various amounts (0, 15, 65, 130, and 200 nM) of the purified CcpA proteins. After 30 min of incubation at room temperature, 20 l of this mixture was loaded onto a native 4% (w/v) polyacrylamide Tris borate-EDTA Ready Gel (Bio-Rad) and electrophoresed in 1% Tris borate-EDTA (v/v) buffer for 1 h at 100 V cm Ϫ1 . Radioactive species were detected by autoradiography using direct exposure to films.
Complementation Studies-For the trans-complementation of the S. aureus SA113 ⌬ccpA mutant KS66 (12), the following plasmids harboring the wild-type ccpA and 500 bp of the upstream region (pCN34_ccpA), the phosphoablative ccpA variant carrying the T18A/T33A modifications (pCN34_ccpA_Ala), and the phosphomimetic ccpA variant carrying the T18D/T33D modifications (pCN34_ccpA_Asp), respectively, were constructed as follows. The ccpA derivatives were synthesized by Genscript (Aachen, Germany) using the N315 sequence information as master template; amplified with specific primers ( Table 2) introducing BamHI and EcoRI sites, respectively; and cloned into the pCN34 vector (27) digested with the same restriction enzymes. The resulting constructs were sequenced and electroporated into S. aureus strain RN4220, which served as donor for transducing the plasmids into KS66.
Antibody Production and Immunoblotting-Polyclonal anti-CcpA antibodies were raised by injecting 500 g of the Histagged recombinant CcpA into rabbits (Eurogentec, Liege, Belgium). The resulting crude antisera were purified against the immobilized CcpA antigen. For the determination of CcpA, cytoplasmic protein extracts were isolated from S. aureus cell cultures grown for 5 h in TSB at 37°C as described previously (28), and protein fractions (10 g/lane) were separated using SDS-PAGE, blotted onto a nitrocellulose membrane, and subjected to Western blot analysis using the antigen-purified polyclonal anti-CcpA antiserum. Phosphorylated CcpA derivatives were detected by immunoblotting as described (23) Table 2. The level of mRNA was normalized against the internal controls gyrB and 16 S rRNA. Transcript amounts were expressed as the -fold difference relative to the control (2 ⌬⌬CT where ⌬CT represents the difference in threshold cycle between the target and control genes).
Biofilm Assay-Bacterial cultures were grown in TSB supplemented with 0.1% (w/v) glucose in glass culture tubes with aeration (150 rpm) at 37°C. Growth medium was inoculated with 0.5 McFarland unit. Biofilm formation on the glass surface and clumping of the cells were monitored after 18 h of growth.
Cloning, Expression, and Purification of PrkC and CcpA from Bacillus Species-The ccpA gene from B. subtilis was amplified by PCR using B. subtilis 168 chromosomal DNA as a template with the primers listed in Table 2 containing NheI and BamHI restriction sites, respectively. The corresponding amplified product was then digested with NheI and BamHI and ligated into the pETPhos plasmid, thus generating pETPhos_ccpA Ba , which was transformed and overexpressed, and the His-tagged CcpA was purified as described above. The B. anthracis ccpA recombinant vector was a kind gift from Marta Perego and purified as described by Chiang et al. (5) to generate CcpA Ba . The prkC kinase domain from B. subtilis was amplified by PCR using B. subtilis 168 chromosomal DNA as a template with the primers listed in Table 2 containing a BamHI and a HindIII restriction site, respectively. The corresponding amplified product was then digested with BamHI and HindIII and ligated into the pGEX(M) vector, thus generating pGEX_prkC, which was transformed and overexpressed, and the GST-tagged PrkC Bs was purified as described previously (30).
Statistical Analysis-The significance of changes was assessed using the Wilcoxon rank sum test. p values Ͻ0.05 were considered significant.
RESULTS
Stk1-mediated Phosphorylation of CcpA-The S. aureus genome encodes one Ser/Thr protein kinase named Stk1 or PknB (16,18). Although Stk1 appears to be involved in different key pathways such as cell wall metabolism, antibiotic susceptibility, and regulation of virulence (17)(18)(19)(31)(32)(33), only a little is known about the nature of the corresponding substrates. Because of our interests in Ser/Thr kinase regulation in S. aureus and in central metabolic pathways of this pathogen, we wished to investigate whether the CcpA might be regulated by Ser/Thr phosphorylation in this organism.
To establish whether the CcpA protein undergoes posttranslational modification by phosphorylation, we first investigated in vitro whether CcpA could be phosphorylated in the presence of the purified Stk1 kinase. Stk1 was expressed as a His-tagged fusion protein and purified from E. coli as described previously (19,21). The purified kinase was incubated with CcpA and [␥-33 P]ATP, the proteins were resolved by SDS-PAGE, and the phosphorylation profile was analyzed by autoradiography (Fig. 1A). The upper bands illustrate the autokinase activity of Stk1, whereas the lower bands represent phosphorylated CcpA (CcpA-P) proteins. The presence of an intense radioactive signal indicated that CcpA was indeed phosphorylated by Stk1. As expected, no radioactive bands were observed in the absence of Stk1 in this assay. These data indicated that CcpA is phosphorylated by Stk1 and suggested that this protein is regulated via this Ser/Thr kinase.
CcpA Is Phosphorylated on Two Threonine Residues, Thr-18 and Thr-33-Mass spectrometry (MS) was subsequently used to identify the number and nature of phosphorylation sites on CcpA as reported previously for other STPK substrates (21, 24, 34 -38). Phosphorylated CcpA-P was purified from E. coli coexpressing Stk1 and CcpA (pDuet_ccpA) and subjected to mass spectrometry analysis after tryptic digestion. We obtained a sequence coverage of 97%, bearing all possible Ser and Thr residues. The ProteinPilot database searching software (using the Paragon method with phosphorylation emphasis) was then used to detect and identify the phosphorylated peptides. The MS/MS spectra unambiguously identified the presence of two phosphate groups on peptide(14 -30) ( Fig. 2A) and peptide (31)(32)(33)(34)(35)(36)(37)(38)(39)(40)(41)(42) (Fig. 2B), thus indicating that CcpA is phosphorylated on two threonines, corresponding to Thr-18 and Thr-33.
To confirm the phosphorylation sites identified by MS/MS, we substituted Thr-18 and Thr-33 by alanines either individually or together by site-directed mutagenesis to introduce either single or double mutations (Thr to Ala) in CcpA. The corresponding CcpA_T18A, CcpA_T33A, and CcpA_T18A/T33A proteins were expressed and purified as His-tagged proteins in E. coli BL21(DE3)Star cells harboring either pETPhos_ccpA_ T18A, pETPhos_ccpA_T33A, or pETPhos_ccpA_T18A/T33A constructs. Following incubation with Stk1 and [␥-33 P]ATP, SDS-PAGE/autoradiogram revealed that all three mutant proteins were no longer phosphorylated by this kinase (Fig. 1A). Surprisingly, single Thr to Ala substitutions were already sufficient to abrogate phosphorylation.
In Vivo Phosphorylation of CcpA-To assess the relevance of our in vitro phosphorylation findings, we also investigated the in vivo phosphorylation of CcpA in a recombinant S. aureus RN4220 strain by Western blot analyses using anti-phosphothreonine, anti-phosphoserine, or anti-phosphotyrosine antibodies, respectively. First, the specificities of the antibodies for the phosphorylated isoforms were determined using the CcpA isoforms purified from either E. coli or E. coli co-expressing Stk1 based on the strategy described by Molle et al. (23). Only the phosphorylated CcpA isoform derived from pDuet_ccpA (CcpA-P) reacted with the anti-phosphothreonine antibodies as expected, whereas the unphosphorylated CcpA protein derived from the pETPhos_ccpA construct (CcpA) failed to give a signal with these antibodies (Fig. 1B). To assess the phosphorylation state of CcpA in S. aureus, we cloned the open reading frames of ccpA and ccpA_T18A/T33A (harboring the Thr to Ala substitutions at Thr-18 and Thr-33) as C-terminal His-tagged fusions into the shuttle vector pMK4-pProt and transformed the resulting plasmids, pMK4_ccpA and pMK4_ccpA_T18A/ T33A, respectively, into the S. aureus strain RN4220. Testing the His tag-purified proteins derived from these RN4220 derivatives in a Western blot analysis using anti-phosphothreonine antibodies revealed a clear signal for the wild-type CcpA, whereas no such signal was detectable with the mutated CcpA (Fig. 1B). This demonstrated that CcpA is phosphorylated in S. aureus in vivo as well and that phosphorylation occurs at Thr-18 and Thr-33 both in vitro and in S. aureus. Moreover, no signal could be detected with either the anti-phosphoserine or the anti-phosphotyrosine antibodies, confirming that CcpA is only phosphorylated at threonine residues (data not shown). To confirm the direct phosphorylation of CcpA by Stk1 in vivo, we transduced the pMK4_ccpA vector into the stk1-null mutant strain ST1004 (16) and overexpressed and purified the CcpA protein from this strain devoid of the Stk1 kinase. As shown in Fig. 1B, we could not detect any phosphorylated CcpA isoform when overexpressed in the S. aureus ⌬stk1 strain, strongly supporting that CcpA is a substrate of Stk1 in vivo.
Structural Analysis of CcpA-To get more insight into the possible role of the double phosphorylation on CcpA by Stk1, DECEMBER Fig. 3, we used the tertiary complexed form of CcpA, Hpr-Ser(P)-46, and its target DNA from Bacillus megaterium (39). The high degree of conservation between the S. aureus and B. megaterium CcpA amino acid sequences (sequence identity, 57% overall and 82% for the first 60 residues representing the sole DNA binding domain) and their target DNAs allowed us to use this structure for our analysis. This structural complex described the twocomponent allosteric DNA binding activation mechanism. The two phosphorylated threonine residues are located on helices 2 and 3 of the helix-turn-helix domain responsible for the DNA binding (Fig. 3). Both residues established multiple contacts with the DNA phosphate through the hydroxyl groups of the lateral chain of both threonines. The phosphorylation of one of these threonines will not only generate a steric clash but also cause an electrostatic repulsion between the DNA binding domain and its target DNA.
Regulation of CcpA by Ser/Thr Kinase Phosphorylation
Phosphorylation Negatively Regulates CcpA-DNA Binding Properties-The structural mapping of the phosphorylation sites suggested that the phosphorylation of CcpA might negatively influence the DNA binding activity of this protein. To test this hypothesis, we analyzed the binding capacities of the nonphosphorylated CcpA form (CcpA) and that of the hyperphosphorylated CcpA form (CcpA-P) to a couple of gene promoter elements that were recently shown to be affected by this regulatory protein (Fig. 4C) (7,(12)(13)(14). Although the unphosphorylated CcpA interacted with all the double-stranded DNA probes tested in our electrophoretic mobility shift assays (Fig. 4, A and B), the phosphorylated CcpA-P failed to shift any of these probes ( Fig. 4A; only the hla probe profile is shown), indicating that CcpA-P had lost its ability to bind to its cre sequences. On the contrary, our EMSAs carried out with the CcpA_T18A/ T33A phosphoablative mutant protein showed that this CcpA derivative retained its DNA binding activity ( Fig. 4A; only the hla probe profile is shown), confirming the critical role of phosphorylation on the DNA binding capacity of this regulatory protein. It is noteworthy to emphasize that the S. aureus CcpA does not essentially require the association with Hpr being phosphorylated by its cognate HprKP kinase (HPr-P) for efficient binding to its DNA targets (15). This observation was confirmed in our EMSAs for which the DNA binding activity of CcpA was assayed in the absence of Hpr-P, which did not essentially modify the DNA binding properties in this in vitro assay (Fig. 4B).
Lack of Complementation with the CcpA Phosphomimetic Mutant in ⌬ccpA Mutant Strain-Acidic residues such as aspartic acid (Asp) qualitatively mimic the phosphorylation effect with regard to functional activity (24,34,36,38,40,41). Therefore, phosphoablative (Thr to Ala replacements) and phosphomimetic (Thr to Asp replacements) ccpA alleles were generated and cloned into the E. coli-S. aureus shuttle plasmid pCN34 under the control of the ccpA promoter to trans-complement the S. aureus SA113 ⌬ccpA mutant KS66 (12). In these constructs, wild-type, phosphoablative (T18A/T33A), and phosphomimetic (T18D/T33D) CcpA isoform expression was monitored by Western blotting using anti-CcpA antibodies. As expected, S. aureus SA113 ⌬ccpA failed to express CcpA, whereas increased amounts of CcpA were synthesized in the KS66 derivatives complemented with the phosphoablative ccpA variant (pCN34_ccpA_Ala) and the ccpA wild-type allele (pCN34_ccpA), respectively, probably due to a multicopy effect of the introduced plasmids (Fig. 5A). In the KS66 derivative complemented with the phosphomimetic ccpA variant (pCN34_ ccpA_Asp), however, a marked increase in CcpA was detected in line with the transcriptional data showing a 63-fold increase in ccpA transcripts in the pCN34_ccpA_Asp-harboring KS66 derivative compared with the wild type (Fig. 5B), suggesting that the expression of this transcriptional regulator is negatively autoregulated in S. aureus.
The impact of constitutive CcpA phosphorylation on gene expression of specific CcpA-regulated target genes was next examined by determining the transcription of citZ encoding the tricarboxylic acid cycle enzyme citrate synthase and hla (encoding ␣-hemolysin) in SA113 and its derivatives (Fig. 5B). In line with our previous findings (7,14), we found a significant increase in citZ transcription in the ccpA mutant KS66 in the early exponential growth phase (i.e. after 3 h of growth in TSB supplemented with 0.1% (w/v) of glucose), whereas transcription of hla, which is expressed mainly during the later stages of growth, was markedly down-regulated in KS66 after 8 h of growth compared with the wild type. Trans-complementation of the ccpA mutant with the ccpA wild-type allele (pCN34_ccpA) and the phosphoablative ccpA variant (pCN34_ ccpA_Ala) led to the production of citZ and hla transcripts to levels seen in the wild type, whereas the introduction of the T18D/T33D-carrying CcpA version (pCN34_ccpA_Asp) into KS66 did not alter the transcription of both genes (Fig. 5B). This DECEMBER 21, 2012 • VOLUME 287 • NUMBER 52
Regulation of CcpA by Ser/Thr Kinase Phosphorylation
JOURNAL OF BIOLOGICAL CHEMISTRY 43613
result suggests that the phosphomimetic CcpA variant is unable to modulate the expression of CcpA-regulated target genes.
Whether phosphorylation of CcpA affects biofilm formation as described previously for a ccpA knock-out mutant (12) was investigated by growing the SA113 derivatives in glucose-supplemented TSB under aeration in glass tubes. Under these conditions, SA113 forms a strong biofilm on the glass surface and shows a high degree of cell clumping, whereas cells of the S. aureus SA113 ⌬ccpA mutant KS66 remain mainly planktonic (12). Here we found that both phenotypes could be restored by complementation with either the wild-type allele or the phosphoablative ccpA variant (Fig. 5C). In contrast, introduction of CcpA_T18D/T33D (ccpA_Asp) failed to restore the parental biofilm profile and clumping, indicating that the phosphomimetic isoform is unable to complement the lack of CcpA activity in biofilm formation presumably as a consequence of its impaired DNA binding activity toward specific regulated genes involved in these processes. It is noteworthy that these effects were not due to a tertiary structure change as confirmed by analysis of the trypsinolysis kinetics of wild-type and mutated CcpA proteins (supplemental Fig. S1) and were consistent with the structural analysis indicating that introduction of Asp at positions 18 and 33 does not seem to induce steric or electrostatic conflicts that could alter the protein fold (Fig. 3). Thus, it can be inferred that CcpA phosphorylation in S. aureus reduces/abolishes its activity, supporting the view that this posttranslational modification plays a role in regulating CcpA activity.
CcpA Orthologue Phosphorylation and Cross-phosphorylation between Species-Given the high degree of similarity between the CcpA proteins of S. aureus and bacilli and based on the finding that the Thr-18 and Thr-33 sites are well conserved among CcpA orthologues (Fig. 6A), we wondered whether the CcpAs from Bacillus species might be phosphorylated as well. Interestingly, CcpA from B. subtilis (CcpA Bs ) could not be phosphorylated by its cognate kinase PrkC (Fig. 6B). This result raised the question whether the phosphoregulation of CcpA might be restricted to pathogens, which led us to test the corresponding CcpA orthologue of B. anthracis (CcpA Ba ). As presented in Fig. 6B, no phosphorylation signal could be detected with CcpA Ba , indicating that the STPK-driven control of CcpA activity does not seem to be present in bacilli.
To determine whether the lack of CcpA phosphorylation observed with the Bacillus orthologues might be due to STPK specificity, we investigated the Ser/Thr cross-phosphorylation between the S. aureus kinase and the B. subtilis CcpA and vice versa. As presented in Fig. 6C, we found that the B. subtilis kinase PrkC was able to cross-phosphorylate CcpA from S. aureus, whereas the CcpA orthologue from B. subtilis remained unphosphorylated in the presence of Stk1. These findings suggest a critical role for the substrate phosphorylation site environment rather than for the kinase specificity at least under in vitro conditions. Interestingly, the in silico comparison of the DNA binding domains of the CcpA orthologues identified a strict conservation around Thr-18 (residues 14 -26), whereas the conservation around Thr-33 was much lower (Fig. 6A). Of note, as mentioned above, the conservation of the N-terminal DNA binding domain of the CcpA protein is very high within orthologues (Ͼ80%), and the only divergent area is centered around Thr-33. All Bacillus CcpAs contained a proline at position 31, which might explain the absence of phosphorylation in this genus. This proline is likely to N-cap one of the ␣-helices of the CcpA DNA binding domain, thus stabilizing this struc- DECEMBER 21, 2012 • VOLUME 287 • NUMBER 52 ture. Therefore, unfolding of the region critical for Stk1 kinase recognition may be in part altered by the presence of this proline residue in Bacillus species. Moreover, it remains to be investigated whether the CcpA orthologues of other Gϩ organisms such as Clostridium perfringens, Lactococcus lactis, and S. pneumoniae, which do not possess a proline residue at position 31 (Fig. 6A), might be regulated by Ser/Thr phosphorylation.
Regulation of CcpA by Ser/Thr Kinase Phosphorylation
DISCUSSION
Recent studies in various S. aureus strains suggest that Ser/ Thr phosphorylation by Stk1 plays an important role in central metabolic processes such as cell wall metabolism, glycolysis, the citrate cycle, purine and pyrimidine synthesis, translation, quorum sensing, and virulence (17,19,21,31,32) presumably due to the regulation of selected global regulators. In line with this assumption, Stk1 was recently shown to affect the activities of regulatory factors such as MgrA, SarA, and LuxS (19 -21). With the present study, we extend previous work demonstrating the regulatory role of Stk1-mediated phosphorylation in central metabolism and virulence pathways by providing first evidence of a Ser/Thr kinase phosphorylation-dependent regulation of the major transcriptional regulator CcpA. This mechanism is of special relevance as CcpA contributes to the pathogenicity of S. aureus (7,8,12,14,15). We demonstrated that phosphorylation of Thr-18 and Thr-33 residues abrogated CcpA DNA binding activity in vitro. Moreover, in the case of growing bacteria, a phosphomimetic mutant displayed a major alteration of the biofilm formation, probably due to the lack of CcpA activity, similar to what was observed for a ⌬ccpA mutant (12). Likewise, the CcpA phosphomimetic strain exhibited reduced transcription of citZ and increased transcription of hla similar to the ⌬ccpA mutant profile, confirming that phosphorylation prevents CcpA regulation toward its target genes in vivo. Previous studies identified Stk1 to affect the expression of a variety of proteins, including virulence determinants like hemolysins (32). Of notable interest is the S. aureus stk1 mutant for which transcription of the hla gene was increased (32), thus supporting the view that the increased ␣ toxin expression in the ⌬stk1 mutant could be linked, at least in part, to the phosphorylation state of CcpA.
Our data presented here now strongly suggest that the activity of this S. aureus global regulator is not only modulated by metabolic signals that lead to the formation of the coregulator Hpr-Ser(P)-46 but also by Stk1 (Fig. 7). However, the environ-mental stimuli that activate Stk1 kinase activity have not yet been identified, making it difficult to predict under which conditions CcpA activity might be affected by Stk1 phosphorylation. However, our findings presented here and elsewhere that this regulatory circuit does not seem to be present in the closely related genus Bacillus (Fig. 7) and that ccpA transcription appears to be autoregulated in staphylococci ( Fig. 5 and Ref. 42) but not in bacilli (43,44) highlight that some fundamental differences in the regulation of CcpA activity between staphylococci and bacilli exist. Moreover, in combination with our recent observations that CcpA also seems to regulate the expression of some of its target genes in the absence of glucose (13) and that CcpA can readily bind to its cre sequences in absence of its coregulator Hpr-Ser(P)-46 ( Fig. 4 and Ref. 15), it is tempting to speculate that the staphylococcal CcpAs might be fairly active even in the absence of Hpr-Ser(P)-46 and therefore need to be controlled by further transcriptional and posttranslational mechanisms, whereas the Bacillus CcpA homologues might not bind efficiently to their cre sequences in the absence of Hpr-Ser(P)-46 and thus do not need to be controlled by these regulatory circuits.
In summary, this study provides conceptual advances in our understanding of how pathogenic bacteria adapt to their physiology. This work also strengthens the biological importance of CcpA in the physiology and virulence of S. aureus as such Ser/Thr kinase-dependent fine-tuning mechanism is not ubiquitous.
Our results furthermore suggest that displacement of the CcpA/CcpA-P balance in favor of the phosphorylated isoform leads to biofilm inhibition and modification of gene expression. The unphosphorylated form of CcpA binds to its target DNA sequences, and this binding is modulated via the HprKP/Hpr system, which is thought to promote the binding of CcpA to its DNA targets if CcpA is complexed with Hpr-Ser(P)-46. The Stk1-mediated phosphorylation of CcpA inactivates the DNA binding activity of this regulatory molecule, thereby preventing the transcriptional control of its target genes. PTS, PhosphoTransferase System; HTH, helix-turn-helix domain. DECEMBER 21, 2012 • VOLUME 287 • NUMBER 52
Regulation of CcpA by Ser/Thr Kinase Phosphorylation
JOURNAL OF BIOLOGICAL CHEMISTRY 43617
Although very challenging, future studies should now focus on the identification of the extracellular cues that are sensed by the Stk1 kinase and lead to CcpA phosphorylation. However, it remains unclear under which conditions and to what extent Stk1 phosphorylates CcpA in this pathogen, how this phosphorylation affects the expression of the regulon controlled by this LacI/GalR type of regulator, and whether this phosphorylation might be reversible by a serine/threonine phosphatase, such as Stp, that is co-transcribed with Stk1 (45). Moreover, the lack of this regulatory circuit in the closely related genus Bacillus together with the observed low degree of conservation in the amino acid sequence surrounding Thr-33 of the CcpA orthologues analyzed here suggests that this regulatory control mechanism of CcpA might only be present in some of the Gϩ organisms harboring CcpA and Stk1 orthologues. Investigations are currently ongoing to address these questions.
From an application standpoint, the selective inhibition of CcpA activity through constitutive phosphorylation may strongly impair S. aureus pathogenicity at least in terms of biofilm formation, thus opening new and original perspectives for future drug development. It is indeed noteworthy that small molecules such as bryostatin (46) can activate STPK, which may be of great therapeutic value in inhibiting S. aureus biofilm formation in vivo.
using antiphosphothreonine, anti-phosphoserine, or anti-phosphotyrosine antibodies (Cell Signaling Technology), respectively. Measurement of Gene Expression by Quantitative Real Time PCR-RNA isolation and real time RT-PCR were carried out as described by Chatterjee et al. (29) using the primer pairs listed in
FIGURE 1 .
1A, in vitro phosphorylation of CcpA and mutant derivatives. The recombinant Stk1 kinase encoded by the S. aureus genome was expressed and purified as a His-tagged fusion in E. coli and incubated in the presence of [␥-33 P]ATP with either the purified His-tagged S. aureus CcpA (CcpA_WT) or the mutated variant CcpA_T18A (harboring a Thr to Ala substitution at Thr-18), CcpA_T33A (harboring a Thr to Ala substitution at Thr-33), or CcpA_T18A/ T33A (harboring Thr to Ala substitutions at Thr-18 and Thr-33). Samples were separated by SDS-PAGE, stained with Coomassie Blue (upper panel), and visualized by autoradiography (lower panel). The upper bands illustrate the autokinase activity of Stk1, and the lower bands represent phosphorylated CcpA proteins. Standard proteins of known molecular masses were run in parallel (M (kDa) lane). B, in vivo phosphorylation of CcpA. Five micrograms of recombinant CcpA proteins purified from either E. coli (pDuet_ccpA and pET-Phos_ccpA, generating a phosphorylated CcpA-P and an unphosphorylated CcpA, respectively), S. aureus (pMK4_ccpA and pMK4_ccpA_T18A/T33A), or S. aureus ⌬stk1 (pMK4_ccpA) were analyzed by SDS-PAGE after staining with Coomassie Blue (upper panel) and detected on an independent SDS-polyacrylamide gel by immunoblotting using anti-phosphothreonine antibodies (Cell Signaling Technology) (lower panel).
FIGURE 2 .
2Identification of the CcpA phosphorylation sites. A, MS/MS spectra at m/z 628.3 (ϩ3) of peptide(14 -30) of CcpA. Localization of the phosphate group on Thr-18 was shown by observation of the "y" C-terminal daughter ion series. Starting from the C-terminal residue, all y ions lose phosphoric acid (Ϫ98 Da) after the phosphorylated residues. B, MS/MS spectra at m/z 484.9 (ϩ3) of peptide(31-42) of CcpA. Localization of the phosphate group on Thr-33 was shown by observation of the y C-terminal daughter ion series. Starting from the C-terminal residue, all y ions lose phosphoric acid (Ϫ98 Da) after the phosphorylated residues.
FIGURE 3 .
3Mapping of the Thr-18 and Thr-33 phosphorylation sites on CcpA. A schematic representation of the crystal structure of the tertiary complex of CcpA (in blue and green), Hpr-Ser(P)-46 (HPr-pS46; in yellow), and its target DNA (in gray) from B. megaterium (Protein Data Bank code 1RZR) is shown. The close view highlights the interaction of threonines 18 and 31 with the phosphate moieties of the DNA.
FIGURE 4 .
4DNA binding activity of CcpA derivatives. A gel EMSA of CcpA binding to the cre sequences of the hla, citZ, ald, tst, malR, ccpA, and pckA promoters. The cre regions of target genes were amplified by PCR; radioactively labeled; and incubated with 15, 65, 130, or 200 nM purified CcpA. A, binding of the unphosphorylated CcpA, CcpA-P, or the CcpA_T18A/T33A double mutant to the hla promoter region. B, binding of the unphosphorylated CcpA and CcpA-P to the cre sequences of the citZ, ald, tst, malR, ccpA, and pckA promoters. The CcpA_T18A/T33A double mutant is not represented as all the probes tested produced profiles identical to those of CcpA. C, schematic representation of the cre sequences (circles) and open reading frames (arrowed boxes) of the promoter elements studied. The putative cre sequences and the probes (lines) used for the EMSA experiments are indicated. The annotation/numbering of genes are based on the genome sequence of S. aureus strain N315.
FIGURE 5 .
5Phenotypic complementation of the ccpA phenotype in S. aureus. A, Western blot analysis of cytosolic protein extracts obtained from 6-h cultures of S. aureus strain SA113, its respective ⌬ccpA mutant KS66, and the KS66 derivatives complemented with the wild-type allele (KS66*pCN34_ccpA), the CcpA_T18A/T33A variant (KS66*pCN34_ccpA_Ala), and the CcpA_T18D/T33D version (KS66*pCN34_ccpA_Asp) with the polyclonal anti-CcpA antibody SY490. B, quantitative transcript analysis of ccpA, citZ, and hla of S. aureus strain SA113 and its derivatives grown in TSB supplemented with 0.1% (w/v) glucose for 3 (ccpA and citZ) and 8 h (hla) at 37°C. C, biofilm formation capacities of S. aureus strains SA113 and its derivatives grown in TSB supplemented with 0.1% (w/v) glucose for 18 h at 37°C. The results are representative of at least two independent experiments (A and C) or are presented as the mean Ϯ S.D. (error bars) of five independent experiments each determined in duplicate (B). *, p Ͻ 0.05; **, p Ͻ 0.01 for wild type versus ccpA mutant and for trans-complemented derivatives versus ccpA mutant, respectively (Wilcoxon rank sum test).
FIGURE 6 .
6A, conservation of the phosphoacceptors in CcpA orthologues within the DNA binding domain. The multiple sequence alignment of CcpA orthologues was performed using ClustalW and ESPript. Numbering of the amino acids corresponds to the CcpA from S. aureus strain COL. Residues conserved in all species are presented in black boxes. The positions of phosphorylated sites of CcpA from S. aureus are indicated by triangles. B, in vitro phosphorylation of CcpA from B. subtilis and B. anthracis orthologues. The recombinant PrkC kinase encoded by the B. subtilis genome was expressed and purified as a GST-tagged fusion in E. coli and incubated in the presence of [␥-33 P]ATP with either the purified His-tagged B. subtilis CcpA (CcpA Bs ) or B. anthracis CcpA (CcpA Ba ). The vector allowing CcpA Ba overexpression and purification was kindly provided by Perego and co-workers (5). Samples were separated by SDS-PAGE, stained with Coomassie Blue (upper panel), and visualized by autoradiography (lower panel). Standard proteins of known molecular masses were run in parallel (M (kDa) lane). C, in vitro cross-phosphorylation. The recombinant PrkC kinase encoded as a GST-tagged fusion was incubated in the presence of [␥-33 P]ATP with the purified His-tagged S. aureus CcpA. In parallel, the recombinant His-tagged fusion Stk1 kinase encoded by the S. aureus genome was incubated in the presence of [␥-33 P]ATP with the purified His-tagged B. subtilis CcpA (CcpA Bs ). Samples were separated by SDS-PAGE, stained with Coomassie Blue (upper panel), and visualized by autoradiography (lower panel). The upper bands illustrate the autokinase activity of the kinases, and the lower bands represent phosphorylated CcpAs. Standard proteins of known molecular masses were run in parallel (M (kDa) lane).
FIGURE 7 .
7Proposed regulatory role of the different isoforms of CcpA as a molecular switch in carbon catabolite repression and virulence gene expression in S. aureus.
TABLE 1
1Strains and plasmids used in this studyStrains and plasmids
Genotype or description a
Source/Ref.
E. coli strains
10G
E. coli derivative ultracompetent cells used for general cloning; F Ϫ mcrA D(mrr-hsdRMS-
mcrBC) f80dlacZÄM15 D lacX74 endA1 recA1araD139 D (ara, leu)7697 galU galK rpsL
nupG-tonA;
Lucigen
BL21(DE3)Star
F2 ompT hsdSB (rB2 mB2) gal dcm (DE3); used to express recombinant proteins in E. coli
Stratagene
S. aureus strains
RN4220
NCTC 8325-4 r Ϫ m ϩ (restriction-negative, modification-positive)
26
SA113
ATCC35556, PIA-dependent biofilm producer, NCTC 8325 derivative, rsbU Ϫ
47
KS66
SA113 ⌬ccpA, biofilm-negative SA113 derivative (Tet R )
7
ST1004
NCTC 8325-4 ⌬stk1 derivative
16
E. coli plasmids
pETPhos
pET15b (Novagen) derivative including the replacement of the thrombin site coding sequence
with a tobacco etch virus protease site and Ser to Gly mutagenesis in the N-terminal His tag
(Amp R )
22
pETPhos_ccpA
pETPhos derivative used to express His-tagged fusion of CcpA (Amp R )
This work
pETPhos_ccpA_T18A
pETPhos derivative used to express His-tagged fusion of CcpA_T18A (Amp R )
This work
pETPhos_ccpA_T33A
pETPhos derivative used to express His-tagged fusion of CcpA_T33A (Amp R )
This work
pETPhos_ccpA_T18A/T33A
pETPhos derivative used to express His-tagged fusion of CcpA_T18A/T33A (Amp R )
This work
pETPhos_ ccpA Bs
pETPhos derivative used to express His-tagged fusion of B. subtilis CcpA in E. coli (Amp R )
This work
pETPhos_ccpA Ba
pETPhos derivative used to express His-tagged fusion of B. anthracis CcpA in E. coli (Amp R )
5
pGEX_prkC
pGEX-4T derivative used to express GST-tagged fusion of B. subtilis PrkC kinase domain in
E. coli (Amp R )
This work
pCDFDuet-1
pET vector derivative designed for the co-expression of two proteins under T7lac promoter
induction (Spec R )
Novagen
pDuet_ccpA
pET vector derivative used for the co-expression of Stk1 and CcpA proteins under T7lac
promoter induction (Spec R )
This work
S. aureus plasmids
pMK4_Pprot
pMK4-derived E. coli-S. aureus shuttle vector with a constitutive promoter (Amp R in E. coli/
Cm R in S. aureus)
25
pMK4_Pprot_ccpA
pMK4_Pprot derivative used to express His-tagged fusion of CcpA in S. aureus (Amp R in
E. coli/Cm R in S. aureus)
This work
pMK4_Pprot_ccpA_T18A/T33A
pMK4_Pprot derivative used to express His-tagged fusion of CcpA_T18A/T33A in S.
aureus (Amp R in E. coli/Cm R in S. aureus)
This work
pCN34
E. coli-S. aureus shuttle vector (Amp R in E. coli/Km R in S. aureus)
27
pCN34_ccpA
pCN34 derivative harboring ccpA and its native promoter (Amp R in E. coli/Km R in S. aureus)
This work
pCN34_ccpA_Ala
pCN34 with a ccpA derivative carrying the CcpA_T18A/T33A mutations under the control of
the ccpA promoter (Amp R in E. coli/Km R in S. aureus)
This work
pCN34_ccpA_Asp
pCN34 with a ccpA derivative carrying the CcpA_T18D/T33D mutations under the control of
the ccpA promoter (Amp R in E. coli/Km R in S. aureus)
This work
a Amp R , ampicillin-resistant; Cm R , chloramphenicol-resistant; Km R , kanamycin-resistant; Spec R , spectinomycin-resistant; Tet R , tetracycline-resistant; PIA, polysaccharide
intercellular adhesin.
TABLE 2
2Primers used in this studyNterm, N-terminal; Cterm, C-terminal; forw, forward; rev, reverse. Restriction sites are underlined and specified in parentheses.5 to 3 sequence a
21, 2012 • VOLUME 287 • NUMBER 52 JOURNAL OF BIOLOGICAL CHEMISTRY 43611 we looked at various crystal structures of CcpA from different homologues. For our structural analysis depicted in
Acknowledgments-We thank I. Zanella-Cléon from the Mass
Carbon catabolite control of the metabolic network in Bacillus subtilis. Y Fujita, Biosci. Biotechnol. Biochem. 73Fujita, Y. (2009) Carbon catabolite control of the metabolic network in Bacillus subtilis. Biosci. Biotechnol. Biochem. 73, 245-259
Control of key metabolic intersections in Bacillus subtilis. A L Sonenshein, Nat. Rev. Microbiol. 5Sonenshein, A. L. (2007) Control of key metabolic intersections in Bacillus subtilis. Nat. Rev. Microbiol. 5, 917-927
Quantitative interdependence of coeffectors, CcpA and cre in carbon catabolite regulation of Bacillus subtilis. G Seidel, M Diel, N Fuchsbauer, W Hillen, FEBS J. 272Seidel, G., Diel, M., Fuchsbauer, N., and Hillen, W. (2005) Quantitative interdependence of coeffectors, CcpA and cre in carbon catabolite regu- lation of Bacillus subtilis. FEBS J. 272, 2566 -2577
Carbon catabolite repression in Bacillus subtilis: quantitative analysis of repression exerted by different carbon sources. K D Singh, M H Schmalisch, J Stülke, B Görke, J. Bacteriol. 190Singh, K. D., Schmalisch, M. H., Stülke, J., and Görke, B. (2008) Carbon catabolite repression in Bacillus subtilis: quantitative analysis of repres- sion exerted by different carbon sources. J. Bacteriol. 190, 7275-7284
Glucose-dependent activation of Bacillus anthracis toxin gene expression and virulence requires the carbon catabolite protein CcpA. C Chiang, C Bongiorni, M Perego, J. Bacteriol. 193Chiang, C., Bongiorni, C., and Perego, M. (2011) Glucose-dependent ac- tivation of Bacillus anthracis toxin gene expression and virulence requires the carbon catabolite protein CcpA. J. Bacteriol. 193, 52-62
CcpA-mediated repression of Clostridium difficile toxin gene expression. A Antunes, I Martin-Verstraete, B Dupuy, Mol. Microbiol. 79Antunes, A., Martin-Verstraete, I., and Dupuy, B. (2011) CcpA-mediated repression of Clostridium difficile toxin gene expression. Mol. Microbiol. 79, 882-899
CcpA mediates the catabolite repression of tst in Staphylococcus aureus. K Seidl, M Bischoff, B Berger-Bächi, Infect. Immun. 76Seidl, K., Bischoff, M., and Berger-Bächi, B. (2008) CcpA mediates the catabolite repression of tst in Staphylococcus aureus. Infect. Immun. 76, 5093-5099
CcpA coordinates central metabolism and biofilm formation in Staphylococcus epidermidis. M R Sadykov, T Hartmann, T A Mattes, M Hiatt, N J Jann, Y Zhu, N Ledala, R Landmann, M Herrmann, H Rohde, M Bischoff, G A Somerville, Microbiology. 157Sadykov, M. R., Hartmann, T., Mattes, T. A., Hiatt, M., Jann, N. J., Zhu, Y., Ledala, N., Landmann, R., Herrmann, M., Rohde, H., Bischoff, M., and Somerville, G. A. (2011) CcpA coordinates central metabolism and bio- film formation in Staphylococcus epidermidis. Microbiology 157, 3458 -3468
Catabolite control protein A (CcpA) contributes to virulence and regulation of sugar metabolism in Streptococcus pneumoniae. R Iyer, N S Baliga, A Camilli, J. Bacteriol. 187Iyer, R., Baliga, N. S., and Camilli, A. (2005) Catabolite control protein A (CcpA) contributes to virulence and regulation of sugar metabolism in Streptococcus pneumoniae. J. Bacteriol. 187, 8340 -8349
A direct link between carbohydrate utilization and virulence in the major human pathogen group A Streptococcus. S A Shelburne, D Keith, N Horstmann, P Sumby, M T Davenport, E A Graviss, R G Brennan, J M Musser, Proc. Natl. Acad. Sci. U.S.A. 105Shelburne, S. A., 3rd, Keith, D., Horstmann, N., Sumby, P., Davenport, M. T., Graviss, E. A., Brennan, R. G., and Musser, J. M. (2008) A direct link between carbohydrate utilization and virulence in the major human pathogen group A Streptococcus. Proc. Natl. Acad. Sci. U.S.A. 105, 1698 -1703
Staphylococcus aureus infections. F D Lowy, N. Engl. J. Med. 339Lowy, F. D. (1998) Staphylococcus aureus infections. N. Engl. J. Med. 339, 520 -532
Staphylococcus aureus CcpA affects biofilm formation. Infect. Immun. K Seidl, C Goerke, C Wolz, D Mack, B Berger-Bächi, M Bischoff, 76Seidl, K., Goerke, C., Wolz, C., Mack, D., Berger-Bächi, B., and Bischoff, M. (2008) Staphylococcus aureus CcpA affects biofilm formation. Infect. Im- mun. 76, 2044 -2050
Effect of a glucose impulse on the CcpA regulon in Staphylococcus aureus. K Seidl, S Müller, P François, C Kriebitzsch, J Schrenzel, S Engelmann, M Bischoff, B Berger-Bächi, BMC Microbiol. 995Seidl, K., Müller, S., François, P., Kriebitzsch, C., Schrenzel, J., Engelmann, S., Bischoff, M., and Berger-Bächi, B. (2009) Effect of a glucose impulse on the CcpA regulon in Staphylococcus aureus. BMC Microbiol. 9, 95
Staphylococcus aureus CcpA affects virulence determinant production and antibiotic resistance. K Seidl, M Stucki, M Ruegg, C Goerke, C Wolz, L Harris, B Berger-Bächi, M Bischoff, Antimicrob. Agents Chemother. 50Seidl, K., Stucki, M., Ruegg, M., Goerke, C., Wolz, C., Harris, L., Berger- Bächi, B., and Bischoff, M. (2006) Staphylococcus aureus CcpA affects virulence determinant production and antibiotic resistance. Antimicrob. Agents Chemother. 50, 1183-1194
CcpA mediates proline auxotrophy and is required for Staphylococcus aureus pathogenesis. C Li, F Sun, H Cho, V Yelavarthi, C Sohn, C He, O Schneewind, T Bae, J. Bacteriol. 192Li, C., Sun, F., Cho, H., Yelavarthi, V., Sohn, C., He, C., Schneewind, O., and Bae, T. (2010) CcpA mediates proline auxotrophy and is required for Staphylococcus aureus pathogenesis. J. Bacteriol. 192, 3883-3892
Characterization of a serine/threonine kinase involved in virulence of Staphylococcus aureus. M Débarbouillé, S Dramsi, O Dussurget, M A Nahori, E Vaganay, G Jouvion, A Cozzone, T Msadek, B Duclos, J. Bacteriol. 191Débarbouillé, M., Dramsi, S., Dussurget, O., Nahori, M. A., Vaganay, E., Jouvion, G., Cozzone, A., Msadek, T., and Duclos, B. (2009) Characteriza- tion of a serine/threonine kinase involved in virulence of Staphylococcus aureus. J. Bacteriol. 191, 4070 -4081
The impact of serine/threonine phosphorylation in Staphylococcus aureus. K Ohlsen, S Donat, Int. J. Med. Microbiol. 300Ohlsen, K., and Donat, S. (2010) The impact of serine/threonine phosphor- ylation in Staphylococcus aureus. Int. J. Med. Microbiol. 300, 137-141
Transcriptome and functional analysis of the eukaryotic-type serine/threonine kinase PknB in Staphylococcus aureus. S Donat, K Streker, T Schirmeister, S Rakette, T Stehle, M Liebeke, M Lalk, K Ohlsen, J. Bacteriol. 191Donat, S., Streker, K., Schirmeister, T., Rakette, S., Stehle, T., Liebeke, M., Lalk, M., and Ohlsen, K. (2009) Transcriptome and functional analysis of the eukaryotic-type serine/threonine kinase PknB in Staphylococcus au- reus. J. Bacteriol. 191, 4056 -4069
Phosphorylation of the virulence regulator SarA modulates its ability to bind DNA in Staphylococcus aureus. J P Didier, A J Cozzone, B Duclos, FEMS Microbiol. Lett. 306Didier, J. P., Cozzone, A. J., and Duclos, B. (2010) Phosphorylation of the virulence regulator SarA modulates its ability to bind DNA in Staphylo- coccus aureus. FEMS Microbiol. Lett. 306, 30 -36
Protein cysteine phosphorylation of SarA/MgrA family transcriptional regulators mediates bacterial virulence and antibiotic resistance. F Sun, Y Ding, Q Ji, Z Liang, X Deng, C C Wong, C Yi, L Zhang, S Xie, S Alvarez, L M Hicks, C Luo, H Jiang, L Lan, C He, Proc. Natl. Acad. Sci. U.S.A. 109Sun, F., Ding, Y., Ji, Q., Liang, Z., Deng, X., Wong, C. C., Yi, C., Zhang, L., Xie, S., Alvarez, S., Hicks, L. M., Luo, C., Jiang, H., Lan, L., and He, C. (2012) Protein cysteine phosphorylation of SarA/MgrA family transcrip- tional regulators mediates bacterial virulence and antibiotic resistance. Proc. Natl. Acad. Sci. U.S.A. 109, 15461-15466
The Staphylococcus aureus autoinducer-2 synthase LuxS is regulated by Ser/Thr phosphorylation. M E Cluzel, I Zanella-Cléon, A J Cozzone, K Fütterer, B Duclos, V Molle, J. Bacteriol. 192Cluzel, M. E., Zanella-Cléon, I., Cozzone, A. J., Fütterer, K., Duclos, B., and Molle, V. (2010) The Staphylococcus aureus autoinducer-2 synthase LuxS is regulated by Ser/Thr phosphorylation. J. Bacteriol. 192, 6295-6301
pETPhos: a customized expression vector designed for further characterization of Ser/Thr/Tyr protein kinases and their substrates. M J Canova, L Kremer, V Molle, Plasmid. 60Canova, M. J., Kremer, L., and Molle, V. (2008) pETPhos: a customized expression vector designed for further characterization of Ser/Thr/Tyr protein kinases and their substrates. Plasmid 60, 149 -153
An improved method to unravel phosphoacceptors in Ser/Thr protein kinase-phosphorylated substrates. V Molle, J Leiba, I Zanella-Cléon, M Becchi, L Kremer, Proteomics. 10Molle, V., Leiba, J., Zanella-Cléon, I., Becchi, M., and Kremer, L. (2010) An improved method to unravel phosphoacceptors in Ser/Thr protein ki- nase-phosphorylated substrates. Proteomics 10, 3910 -3915
Negative regulation by Ser/Thr phosphorylation of HadAB and HadBC dehydratases from Mycobacterium tuberculosis type II fatty acid synthase system. N Slama, J Leiba, N Eynard, M Daffé, L Kremer, A Quémard, V Molle, Biochem. Biophys. Res. Commun. 412Slama, N., Leiba, J., Eynard, N., Daffé, M., Kremer, L., Quémard, A., and Molle, V. (2011) Negative regulation by Ser/Thr phosphorylation of HadAB and HadBC dehydratases from Mycobacterium tuberculosis type II fatty acid synthase system. Biochem. Biophys. Res. Commun. 412, 401-406
Translation elongation factor EF-Tu is a target for Stp, a serinethreonine phosphatase involved in virulence of Listeria monocytogenes. C Archambaud, E Gouin, J Pizarro-Cerda, P Cossart, O Dussurget, Mol. Microbiol. 56Archambaud, C., Gouin, E., Pizarro-Cerda, J., Cossart, P., and Dussurget, O. (2005) Translation elongation factor EF-Tu is a target for Stp, a serine- threonine phosphatase involved in virulence of Listeria monocytogenes. Mol. Microbiol. 56, 383-396
The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. B N Kreiswirth, S Löfdahl, M J Betley, M O'reilly, P M Schlievert, M S Bergdoll, R P Novick, Nature. 305Kreiswirth, B. N., Löfdahl, S., Betley, M. J., O'Reilly, M., Schlievert, P. M., Bergdoll, M. S., and Novick, R. P. (1983) The toxic shock syndrome exo- toxin structural gene is not detectably transmitted by a prophage. Nature 305, 709 -712
Novel cassette-based shuttle vector system for Gram-positive bacteria. E Charpentier, A I Anton, P Barry, B Alfonso, Y Fang, R P Novick, Appl. Environ. Microbiol. 70Charpentier, E., Anton, A. I., Barry, P., Alfonso, B., Fang, Y., and Novick, R. P. (2004) Novel cassette-based shuttle vector system for Gram-positive bacteria. Appl. Environ. Microbiol. 70, 6076 -6085
The B-dependent yabJ-spoVG operon is involved in the regulation of extracellular nuclease, lipase, and protease expression in Staphylococcus aureus. B Schulthess, D A Bloes, P François, M Girard, J Schrenzel, M Bischoff, B Berger-Bächi, J. Bacteriol. 193Schulthess, B., Bloes, D. A., François, P., Girard, M., Schrenzel, J., Bischoff, M., and Berger-Bächi, B. (2011) The B-dependent yabJ-spoVG operon is involved in the regulation of extracellular nuclease, lipase, and protease expression in Staphylococcus aureus. J. Bacteriol. 193, 4954 -4962
Staphylococcus aureus ClpC is required for stress resistance, aconitase activity, growth recovery, and death. I Chatterjee, P Becker, M Grundmeier, M Bischoff, G A Somerville, G Peters, B Sinha, N Harraghy, R A Proctor, M Herrmann, J. Bacteriol. 187Chatterjee, I., Becker, P., Grundmeier, M., Bischoff, M., Somerville, G. A., Peters, G., Sinha, B., Harraghy, N., Proctor, R. A., and Herrmann, M. (2005) Staphylococcus aureus ClpC is required for stress resistance, aco- nitase activity, growth recovery, and death. J. Bacteriol. 187, 4488 -4496
An FHA phosphoprotein recognition domain mediates protein EmbR phosphorylation by PknH, a Ser/Thr protein kinase from Mycobacterium tuberculosis. V Molle, L Kremer, C Girard-Blanc, G S Besra, A J Cozzone, J F Prost, Biochemistry. 42Molle, V., Kremer, L., Girard-Blanc, C., Besra, G. S., Cozzone, A. J., and Prost, J. F. (2003) An FHA phosphoprotein recognition domain mediates protein EmbR phosphorylation by PknH, a Ser/Thr protein kinase from Mycobacterium tuberculosis. Biochemistry 42, 15300 -15309
The role of PknB kinase in antibiotic resistance and virulence in community acquired methicillin resistant Staphylococcus aureus strain USA300. S Tamber, J Schwartzman, A L Cheung, Infect. Immun. 78Tamber, S., Schwartzman, J., and Cheung, A. L. (2010) The role of PknB kinase in antibiotic resistance and virulence in community acquired me- thicillin resistant Staphylococcus aureus strain USA300. Infect. Immun. 78, 3637-3646
Regulation of hemolysin expression and virulence of Staphylococcus aureus by a serine/threonine kinase and phosphatase. K Burnside, A Lembo, M De Los Reyes, A Iliuk, N T Binhtran, J E Connelly, W J Lin, B Z Schmidt, A R Richardson, F C Fang, W A Tao, L Rajagopal, PLoS One. 511071Burnside, K., Lembo, A., de Los Reyes, M., Iliuk, A., Binhtran, N. T., Con- nelly, J. E., Lin, W. J., Schmidt, B. Z., Richardson, A. R., Fang, F. C., Tao, W. A., and Rajagopal, L. (2010) Regulation of hemolysin expression and virulence of Staphylococcus aureus by a serine/threonine kinase and phos- phatase. PLoS One 5, e11071
Phosphorylation of MgrA and its effect on expression of the NorA and NorB efflux pumps of Staphylococcus aureus. Q C Truong-Bolduc, D C Hooper, J. Bacteriol. 192Truong-Bolduc, Q. C., and Hooper, D. C. (2010) Phosphorylation of MgrA and its effect on expression of the NorA and NorB efflux pumps of Staph- ylococcus aureus. J. Bacteriol. 192, 2525-2534
The Mycobacterium tuberculosis -ketoacyl-acyl carrier protein synthase III activity is inhibited by phosphorylation on a single threonine residue. R Veyron-Churlet, V Molle, R C Taylor, A K Brown, G S Besra, I Zanella-Cléon, K Fütterer, L Kremer, J. Biol. Chem. 284Veyron-Churlet, R., Molle, V., Taylor, R. C., Brown, A. K., Besra, G. S., Zanella-Cléon, I., Fütterer, K., and Kremer, L. (2009) The Mycobacterium tuberculosis -ketoacyl-acyl carrier protein synthase III activity is inhib- ited by phosphorylation on a single threonine residue. J. Biol. Chem. 284, 6414 -6424
Dynamic and structural characterization of a bacterial FHA protein reveals a new autoinhibition mechanism. P Barthe, C Roumestand, M J Canova, L Kremer, C Hurard, V Molle, M Cohen-Gonsaud, Structure. 17Barthe, P., Roumestand, C., Canova, M. J., Kremer, L., Hurard, C., Molle, V., and Cohen-Gonsaud, M. (2009) Dynamic and structural characteriza- tion of a bacterial FHA protein reveals a new autoinhibition mechanism. Structure 17, 568 -578
Phosphorylation of the Mycobacterium tuberculosis -ketoacyl-acyl carrier protein reductase MabA regulates mycolic acid biosynthesis. R Veyron-Churlet, I Zanella-Cléon, M Cohen-Gonsaud, V Molle, L Kremer, J. Biol. Chem. 285Veyron-Churlet, R., Zanella-Cléon, I., Cohen-Gonsaud, M., Molle, V., and Kremer, L. (2010) Phosphorylation of the Mycobacterium tuberculosis -ketoacyl-acyl carrier protein reductase MabA regulates mycolic acid biosynthesis. J. Biol. Chem. 285, 12714 -12725
The Mycobacterium tuberculosis GroEL1 chaperone is a substrate of Ser/Thr protein kinases. M J Canova, L Kremer, V Molle, J. Bacteriol. 191Canova, M. J., Kremer, L., and Molle, V. (2009) The Mycobacterium tu- berculosis GroEL1 chaperone is a substrate of Ser/Thr protein kinases. J. Bacteriol. 191, 2876 -2883
Phosphorylation of InhA inhibits mycolic acid biosynthesis and growth of Mycobacterium tuberculosis. V Molle, G Gulten, C Vilchèze, R Veyron-Churlet, I Zanella-Cléon, J C Sacchettini, W R Jacobs, Jr, L Kremer, Mol. Microbiol. 78Molle, V., Gulten, G., Vilchèze, C., Veyron-Churlet, R., Zanella-Cléon, I., Sacchettini, J. C., Jacobs, W. R., Jr., and Kremer, L. (2010) Phosphorylation of InhA inhibits mycolic acid biosynthesis and growth of Mycobacterium tuberculosis. Mol. Microbiol. 78, 1591-1605
Structural basis for allosteric control of the transcription regulator CcpA by the phosphoprotein HPr-Ser46-P. M A Schumacher, G S Allen, M Diel, G Seidel, W Hillen, R G Brennan, Cell. 118Schumacher, M. A., Allen, G. S., Diel, M., Seidel, G., Hillen, W., and Bren- nan, R. G. (2004) Structural basis for allosteric control of the transcription regulator CcpA by the phosphoprotein HPr-Ser46-P. Cell 118, 731-741
Wag31, a homologue of the cell division protein DivIVA, regulates growth, morphology and polar cell wall synthesis in mycobacteria. C M Kang, S Nyayapathy, J Y Lee, J W Suh, R N Husson, Microbiology. 154Kang, C. M., Nyayapathy, S., Lee, J. Y., Suh, J. W., and Husson, R. N. (2008) Wag31, a homologue of the cell division protein DivIVA, regulates growth, morphology and polar cell wall synthesis in mycobacteria. Micro- biology 154, 725-735
Phosphorylation of mycobacterial PcaA inhibits mycolic acid cyclopropanation: consequences for intracellular survival and for phagosome maturation block. R M Corrales, V Molle, J Leiba, L Mourey, C De Chastellier, L Kremer, J. Biol. Chem. 287Corrales, R. M., Molle, V., Leiba, J., Mourey, L., de Chastellier, C., and Kremer, L. (2012) Phosphorylation of mycobacterial PcaA inhibits my- colic acid cyclopropanation: consequences for intracellular survival and for phagosome maturation block. J. Biol. Chem. 287, 26187-26199
Catabolite repression mediated by the catabolite control protein CcpA in Staphylococcus xylosus. O Egeter, R Brückner, Mol. Microbiol. 21Egeter, O., and Brückner, R. (1996) Catabolite repression mediated by the catabolite control protein CcpA in Staphylococcus xylosus. Mol. Micro- biol. 21, 739 -749
Possible function and some properties of the CcpA protein of Bacillus subtilis. Y Miwa, M Saikawa, Y Fujita, Microbiology. 140Miwa, Y., Saikawa, M., and Fujita, Y. (1994) Possible function and some properties of the CcpA protein of Bacillus subtilis. Microbiology 140, 2567-2575
Cloning, expression and functional analyses of the catabolite control protein CcpA from Bacillus megaterium. C J Hueck, A Kraus, D Schmiedel, W Hillen, Mol. Microbiol. 16Hueck, C. J., Kraus, A., Schmiedel, D., and Hillen, W. (1995) Cloning, expression and functional analyses of the catabolite control protein CcpA from Bacillus megaterium. Mol. Microbiol. 16, 855-864
Modulation of cell wall structure and antimicrobial susceptibility by a Staphylococcus aureus eukaryote-like serine/threonine kinase and phosphatase. A M Beltramini, C D Mukhopadhyay, V Pancholi, Infect. Immun. 77Beltramini, A. M., Mukhopadhyay, C. D., and Pancholi, V. (2009) Modu- lation of cell wall structure and antimicrobial susceptibility by a Staphylo- coccus aureus eukaryote-like serine/threonine kinase and phosphatase. Infect. Immun. 77, 1406 -1416
A eukaryotic-like Ser/Thr kinase signals bacteria to exit dormancy in response to peptidoglycan fragments. I M Shah, M H Laaberki, D L Popham, J Dworkin, Cell. 135Shah, I. M., Laaberki, M. H., Popham, D. L., and Dworkin, J. (2008) A eukaryotic-like Ser/Thr kinase signals bacteria to exit dormancy in re- sponse to peptidoglycan fragments. Cell 135, 486 -496
Two restriction and modification systems in Staphylococcus aureus NCTC8325. S Iordanescu, M Surdeanu, J. Gen. Microbiol. 96Iordanescu, S., and Surdeanu, M. (1976) Two restriction and modification systems in Staphylococcus aureus NCTC8325. J. Gen. Microbiol. 96, 277-281
| Previous studies have shown that Bacillus subtilis cells lacking penicillin-binding protein 1 (PBP1), encoded by ponA, have a reduced growth rate in a variety of growth media and are longer, thinner, and more bent than wild-type cells. It was also recently shown that cells lacking PBP1 require increased levels of divalent cations for growth and are either unable to grow or grow as filaments in media low in Mg2+, suggesting a possible involvement of PBP1 in septum formation under these conditions. Using epitope-tagging and immunofluorescence microscopy, we have now shown that PBP1 is localized at division sites in vegetative cells of B. subtilis. In addition, we have used fluorescence and electron microscopy to show that growing ponA mutant cells display a significant septation defect, and finally by immunofluorescence microscopy we have found that while FtsZ localizes normally in most ponA mutant cells, a significant proportion of ponA mutant cells display FtsZ rings with aberrant structure or improper localization, suggesting that lack of PBP1 affects FtsZ ring stability or assembly. These results provide strong evidence that PBP1 is localized to and has an important function in the division septum in B. subtilis. This is the first example of a high-molecular-weight class A PBP that is localized to the bacterial division septum. | The PASTA domain (for penicillin-binding protein and serine/threonine kinase associated domain) is found in the high molecular weight penicillin-binding proteins and eukaryotic-like serine/threonine kinases of a range of pathogens. We describe this previously uncharacterized domain and infer that it binds beta-lactam antibiotics and their peptidoglycan analogues. We postulate that PknB-like kinases are key regulators of cell-wall biosynthesis. The essential function of these enzymes suggests an additional pathway for the action of beta-lactam antibiotics. |
INTRODUCTION
Bacteria disable translation in response to various stress situations including phage infection (1). A case in point is imparted by the anticodon nuclease (ACNase) PrrC, a potential phage-excluding device counteracted by phage-induced transfer RNA (tRNA) repair (2,3). RloC is a novel ACNase of unknown function whose similarity to PrrC and salient features portray it as a stronger antiviral device responsive to an added stress cue (4). Evaluating RloC's distinctive traits and purported role necessitates prior description of its better documented homolog PrrC, particularly the prototype encoded by a rare Escherichia coli strain (EcoPrrC) (5)(6)(7).
EcoPrrC's ACNase is silenced in the uninfected host by the physically associated Type Ic DNA restriction-modification (R-M) protein EcoprrI (6,8). During phage T4 infection, it is activated by the co-opted T4 anti-DNA restriction peptide Stp (9). The activated ACNase nicks tRNA Lys 5 0 to the wobble base yielding 3 0 -cyclic P and 5 0 -OH termini. This damage could disable T4 late translation and contain the infection (2,10). However, T4's tRNA repair proteins 3 0 -phosphatase/5 0 -polynucleotide kinase (Pnk) and RNA ligase 1 (Rnl1) offset it. Specifically, Pnk converts the cleavage termini into a 3 0 -OH and 5 0 -P pair that Rnl1 joins (2). The above restriction/antirestriction cascade may be shared by other PrrCencoding bacteria, judged from prrC's consistent linkage to a Type Ic R-M locus, the ACNase activities of PrrC orthologs looked at (3,4,11) and a case of coincident inactivation of the ACNase and linked R-M system (12). The idea that Pnk and Rnl1 evolved as ACNase antidotes (13,14) is reinforced by their ubiquity among T4-like phage of PrrC/RloC-encoding bacteria but absence from T4-like cyanophage not expected to encounter these ACNases (http://www.ncbi.nlm.nih.gov/sutils/genom_ table.cgi and http://phage.ggc.edu/).
In vitro activation of the latent EcoPrrC ACNase (EcoPrrC-EcoprrI complex) requires besides Stp the hydrolysis of GTP in the presence of dTTP. ATP inhibits the activation but whether it exerts this effect through EcoPrrC or EcoprrI's adenosine triphosphatase *To whom correspondence should be addressed. Tel: +972 3 640 9067; Fax: +972 3 640 6834; Email: [email protected]
The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors.
(ATPase)/DNA translocase is not known (15)(16)(17). Isolated EcoPrrC has overt ACNase activity refractory to Stp and GTP but unstable without dTTP or a non-hydrolyzable dTTP analogue. The significance of this protection is indicated by the importance of the T4-induced accumulation of dTTP for the manifestation of EcoPrrC's ACNase activity (3,15,(18)(19)(20). These observations underlie a scheme where GTP hydrolysis drives the activation of the ACNase and the accumulated dTTP stabilizes the activated form. GTP and dTTP likely exercise their distinct functions through EcoPrrC's ABC-ATPase N-domains, to which these nucleotides bind with vastly differing affinities without displacing each other (3,15 and our unpublished data). EcoPrrC's remaining C-proximal third harbours residues implicated in tRNA Lys recognition (21)(22)(23)(24) and a putative catalytic ACNase triad (3) that is conserved by RloC (4). EcoPrrC may act as a tetramer (3) whose N-domains dimerize head-to-tail like typical ABC-ATPases and the C-domains in parallel (24). Another view is that EcoPrrC is a dimer whose ACNase domains do not interact (11).
RloC shares PrrC's organization into ABC-ATPase and ACNase domains but differs in three key features. First, RloC rarely interacts with an R-M system in cis although teaming of RloC with an R-M system in trans is not excluded (4). Second, RloC excises its substrate's wobble nucleotide, a lesion expected to frustrate damage reversal by phage tRNA repair enzymes (4). Third, a coiled-coil/ zinc-hook (CC/ZH) insert in RloC's ATPase domain likens its N-region to the universal DNA damage checkpoint/repair protein Rad50 (25)(26)(27). Rad50's CC/ZH folds back into an anti-parallel CC protruding from the ATPase head domain with the ZH motif Cys-X-X-Cys at its apex. Two ZH apices join by coordinating Zn + + to the four Cys of their dimerization interface. Such ZH joints form between two flexible CC/ZH protrusions of the same Rad50 dimer or between two different DNA-borne Rad50 dimers (26,27). The latter mode bridges distant DNA molecules and is essential for Rad50-mediated DNA transactions (28,29). Other DNA bridging structure maintenance of chromosomes (SMC) proteins join their CC protrusions through hydrophobic apices (30).
RloC is so far the only protein other than Rad50 known to harbour a CC/ZH insert in its ABC-ATPase domain. A regulatory role of this extension is suggested by ZH mutations that activate RloC's ACNase and exacerbate its toxicity (4). This fact underlies a model where RloC responds to DNA insults by disabling translation, benefiting its host as an antiviral contingency as DNA restriction is alleviated under genotoxic stress (4,31,32).
In this work, we investigated the role of RloC's Rad50like N-region in regulating its C-proximal ACNase, specifically the anticipated involvement of the ZH motif and ABC-ATPase head domain in this function. To accomplish this feat, we used the RloC ortholog from the thermophile Geobacillus kaustophilus (GkaRloC) (4) and model ACNase substrates that also served to further characterize the RloC excision reaction. The data suggest that RloC's ACNase is regulated by its coupled ZH and DNA-break-responsive ATPase, in keeping with the above model. The existence of such internal control may also account for the lateral transfer of rloC without a linked ACNase silencer.
MATERIALS AND METHODS
GkaRloC mutagenesis
Mutations in GkaRloC's ATPase motifs were introduced by Quick Change (33) and verified by DNA sequencing.
GkaRloC expression and purification
Escherichia coli Rosetta TM (DE3) pLysS (Novagen) encoding inducible T7 RNA polymerase and rare tRNA species served as host cell for expressing plasmid pGkaRloC-L-His 6 or the indicated mutant derivatives (4). Cells transformed by them were grown to 1.5 OD 600 at 37 C (wt, K44N, D572N) or 25 C (C291G) in modified TY medium (3.2% trypton, 2.4% yeast extract, 35 mM NaCl, 89 mM potassium phosphate buffer, pH 7.5 and 0.4% glycerol) containing 100 mg/ml ampicillin and 34 mg/ml chloramphenicol. Protein expression was induced by adding 1 mM isopropyl-b-D-thiogalactopyranoside. The culture was shifted then to 16 C and shaken for 16 h. The cells were harvested and washed twice with buffer I (10 mM Tris-HCl, pH 7.5, 15 mM MgCl 2 , 1 M KCl and 10% glycerol) and once in buffer II (10 mM Tris-HCl, pH 7.5, 15 mM MgCl 2 , 50 mM KCl and 10% glycerol). The protein expression level and in vivo ACNase activity were assessed as previously described (4). Protein purification steps were performed at 0-4 C. The bacterial pellet was suspended in 1.5 vol of buffer III (10 mM Na-HEPES, pH 7.5, 10 mM MgCl 2 , 5 mM b-mercaptoethanol and 10% glycerol) containing ethylenediaminetetraacetic acid-free protease inhibitor cocktail (Roche). Following passage through an Aminco pressure cell at 18 000 psi, the lysate was centrifuged 30 min at 30 000 g. The supernatant was made up to 5 mM imidazole and loaded onto an immobilized cobalt affinity resin (TALON, Clontech). The column was washed with 10 vol of buffer III containing 5 mM imidazole and 250 mM NaCl followed by 10 vol of buffer III plus 5 mM imidazole. GkaRloC was eluted in buffer III plus 0.5 M imidazole. Peak fractions were concentrated in Vivaspin 20 concentrator 30000 MWCO (Sartorius), loaded on Q-trap anion exchange column (GE-Healthcare) and eluted in a linear 0-1 M NaCl gradient in buffer III. Peak fractions emerging at $140 mM NaCl were stored in small aliquots at À80 C.
ACNase substrates
Internally labelled Saccharomyces cerevisiae tRNA Glu(UUC) was prepared by treating the total cellular tRNA fraction with the Kluyveromyces lactis tRNase g-zymocin (34) in 20 mM Tris-HCl, pH 7.5 and 1 mM MgCl 2 . The resultant tRNA Glu(UUC) fragments were ligated back within the total tRNA fraction by T4 Pnk and Rnl1 (NEB) in the presence of 1 mM [g-32 P]ATP (3000 Ci/mmol, NEN) essentially as described (35). The ligated back tRNA Glu(UUC) was gel purified along with similar-sized non-labelled 'carrier' tRNA species. The presence of these carrier species did not affect the GkaRloC cleavage pattern of tRNA Glu(UUC) . This was indicated by an identical pattern obtained with the ligated back gel-purified tRNA Glu(UUC) fragments. Derivatives of the labelled sc-tRNA Glu(UUC) partially incised 3 0 or 5 0 to the wobble position were prepared by incubating this substrate with g-zymocin (34) or EcoPrrC-D222E (3).
GkaRloC ACNase assays
The standard in vitro ACNase assay mixtures (10 ml) contained 100-500 ng GkaRloC protein, 70 mM Tris-HCl, pH 7.5, 10 mM MgCl 2 , 10 mM dithiothreitol, 0.5 mM ATP, 10 ng/ml double-stranded DNA fragments (BstEIIdigested DNA, NEB) and 0.05-0.1 pmol of [5 0 -32 P]Lys3-ASL or 0.01-0.02 pmol of the internally labelled sc-tRNA Glu(UUC) . After 5-10 min pre-incubation at 25 C, the reaction was started by adding the substrate. Where indicated, other DNA species substituted the standard DNA fragments. They included DNA duplexes or hairpins of defined size (Supplementary Table S1) and pUC19 DNA (Fermentas) used as such, or after relaxation with E. coli DNA topoisomerase I or linearized with Sma I endonuclease, both provided by NEB. The reaction was stopped with 2 vol of 10 M urea, 0.01% each of xylene cyanol and bromphenol blue. The products were separated by denaturing polyacrylamide gel electrophoresis, monitored by autoradiography and quantified by Scion Image software (NIH). In vivo ACNase activity was monitored by in vitro 5 0 -end labelling tRNA fragments generated in cells expressing the indicated GkaRloC allele, as described (4)
RESULTS
GkaRloC excises the wobble nucleotide by successive cleavages in the 3 0 to 5 0 order
The regulation of GkaRloC's ACNase by its Rad50-like N-domain was studied using a His 6 -tagged form expressed in E. coli and purified by immobilized-metal affinity chromatography (IMAC) followed by ion-exchange chromatography (IEC), respectively ( Figure 1A). Its ACNase activity was assayed with two convenient model substrates that were cleaved in a manner similar to that seen with E. coli tRNAs GkaRloC targets in vitro and in vivo. A minimal model ACNase substrate was a [5 0 -32 P] anticodon stem-loop of sequence and base modifications of mammalian tRNA Lys3 (Lys3-ASL) (23,36) ( Figure 2A). Lys3-ASL was preferred over a less reactive ASL with E. coli tRNA Lys modifications or hypomodified counterparts cleaved differently from the full-sized tRNA substrates (not shown). In contrast, Lys3-ASL was cleaved by GkaRloC first 3 0 and then 5 0 to the wobble base, yielding in respective order labelled 8-and 7mers. Prolonged incubation yielded also a labelled 6mer ( Figure 2B and C). Such further trimming has not been observed with full-sized tRNAs (4). Therefore, it was ascribed to greater flexibility of the cleaved minimal substrate.
A full-sized model substrate used was the major S. cerevisiae tRNA Glu [sc-tRNA Glu(UUC) ]. It resembles the E. coli counterpart preferentially cleaved by GkaRloC (4). Importantly, sc-tRNA Glu(UUC) can be readily tagged 3 0 to the wobble base, allowing direct visualization of the excised nucleotide. To introduce this tag, we exploited the specificity of g-zymocin, the poisonous subunit of the toxin secreted by killer strains of the dairy yeast K. lactis. Within target S. cerevisiae cells g-zymocin incises tRNA Glu(UUC) 3 0 to the 5-methoxycarbonylmethyl-2-thiouridine (mcm 5 s 2 U) wobble base (34). Such a reaction performed in vitro and followed by T4 Pnk and Rnl1-mediated repair in the presence of [g-32 P]ATP yielded the desired internally labelled sc-tRNA Glu(UUC) . GkaRloC converted this substrate into three labelled products: $34 and $43 nt fragments formed in relatively low amounts and the excised nucleotide that accumulated ( Figure 3A and B). The $34mer migrated with the labelled fragment released by g-zymocin ( Figure 3D, lanes 2 and 4), indicating that GkaRloC incised sc-tRNA Glu(UUC) similarly. The $43mer migrated with the major labelled fragment formed by EcoPrrC ( Figure 3D, lanes 2 and 3), which normally incises its substrate 5 0 to the wobble base. Thus, GkaRloC incised sc-tRNA Glu(UUC) also at this site. Note that EcoPrrC nicked sc-tRNA Glu(UUC) also 3 0 to the wobble base, albeit, to a lesser extent than at the 5 0 site ( Figure 3D, lane 3). Such a shift in cleavage specificity has been observed with some EcoPrrC mutants and substrate analogues (21,22). The excised wobble nucleotide was seen with GkaRloC but not EcoPrrC (compare lanes 2 and 3). This discrepancy confirmed that GkaRloC rather than a contaminating E. coli activity catalyzed the excision because both ACNases were expressed and purified similarly.
The ability of GkaRloC to incise sc-tRNA Glu(UUC) on either side of the wobble base could be taken to indicate that the excision occurs by successive cleavages not only in the 3 0 ! 5 0 direction, as previously assumed (4) but also in the opposite. Yet, more likely seemed that the 5 0 incision yielded a dead-end product since the $34mer declined with the overall reaction, as would a bona fide intermediate, while the $43mer accumulated ( Figure 3B and C). Moreover, GkaRloC effectively removed the wobble nucleotide from a preformed 3 0 incision product generated by g-zymocin or as EcoPrrC's minor product but not from EcoPrrC's major, 5 0 incision product ( Figure 3E). These data indicated that GkaRloC excised the wobble nucleotide by successive cleavages in the 3 0 ! 5 0 order only ( Figure 3F). It is also noteworthy that the 3 0 pre-incised tRNA was preferentially cleaved in the presence of the intact ( Figure 3E, lanes 3 and 4). This result hinted that the incision is rate-limiting and the overall reaction processive.
GkaRloC's ATPase activates its ACNase
Unlike the overt ACNase activity of isolated EcoPrrC (3) purified GkaRloC was virtually devoid of ACNase activity in the absence of a hydrolyzable nucleotide. As shown, adding ATP to GkaRloC's IMAC fraction dramatically enhanced the cleavage of Lys3-ASL in a sigmoid dose dependence ( Figure 4A). In contrast, adenosine 5 0 -(b,gimido) triphosphate (AMPPNP) did not elicit such activation ( Figure 4B), suggesting that nucleotide hydrolysis is required. However, when ATP was also present AMPPNP not only delayed the activation of the ACNase in a dose-dependent manner but also stabilized the ACNase once activated ( Figure 4C). In this regard GkaRloC superficially resembled EcoPrrC whose latent form is activated by GTP hydrolysis and the activated stabilized by dTTP binding (3,15,20).
To determine whether GkaRloC harbours the ACNase-activating ATPase, we singly mutated its respective Walker A and B residues Lys 44 and Asp 572 as corresponding lesions inactivate other ABC-ATPases (37)(38)(39). When cells expressing wild-type GkaRloC or either ATPase mutant were assayed for in vivo ACNase activity (Materials and Methods) only the former yielded the expected labelled $42mers emanating from mature tRNA substrates and a minor $52mer possibly derived from tRNA precursor(s) carrying a 3 0 -tail (4) ( Figure 4D, left panel). The ATPase mutants were also expressed at a higher level than wild type, in keeping with their ACNase-null phenotypes (right panel). These data indicated that GkaRloC harbours the ACNase-activating ATPase.
GTP (but not ATP) hydrolysis activates in vitro the latent EcoPrrC-EcoprrI ACNase holoenzyme but does not augment the overt ACNase of free EcoPrrC. Moreover, dTTP stabilizes both the activated and overt PrrC ACNases (15). In contrast, ATP and GTP activated GkaRloC's ACNase similarly and regardless of dTTP's presence ( Figure 4E).
ACNase activation by GkaRloC's ATPase requires DNA
When GkaRloC's purer IEC fraction ( Figure 1A) was assayed, we noticed that adding ATP did not activate its ACNase ( Figure 5A). This suggested that an essential activating factor was fractionated away. DNA seemed the culprit since ACNase-enhancing ZH mutations (4) were expected to modulate GkaRloC's interaction with DNA, as with Rad50 (26). Moreover, other SMC proteins harbour a DNA-dependent ATPase (30,39,40). Indeed, GkaRloC's ACNase was activated in the IEC fraction only when both ATP and DNA were added ( Figure 5A, lanes 2, 3 and 5). AMPPNP failed to activate the ACNase regardless of the presence of DNA (lanes 4 and 6). The partial activation seen when only ATP was added to the cruder IMAC fraction ( Figure 5B indicated that the DNase I treatment did not inactivate the ACNase and the minimal DNase I dose needed to degrade the endogenous DNA was overwhelmed by the added DNA.
Defined duplexes of 5-432 bp (Supplementary Table S1) were compared in ACNase activation with the routinely used mixture of large DNA fragments averaging $3.5 kb. The former were used at 100 nM, the latter at an optimal $4 nM level and GkaRloC at $50 nM. Duplexes of 27 bp and less did not detectably activate the ACNase ( Figure 5C, lanes 1 and 2 and data not shown). Duplexes of 34-184 bp activated it modestly (lanes 3-5), $3-fold less than the larger duplexes (lanes 6 and 7). Presumably, the non-activating were smaller than GkaRloC's minimal DNA target, which may be close to the $23 bp DNA binding channel visualized in a Rad50/ AMPPNP co-crystal structure (41). We assume that the biphasic size dependence of the activating duplexes reflects a minimal length and/or bendability needed for the coalescence of GkaRloC molecules in cis. The effect of DNA lanes 1 and 3) or wild-type GkaRloC (wt) (lanes 2 and 4). The chart on the right shows the proportions of intact sc-tRNA Glu(UUC) , the derived 5 0 -or 3 0 -incision products formed respectively by PrrC or by PrrC and g-zymocin as well as the excised wobble nucleotide formed in the subsequent incubation with wild-type GkaRloC. termini on the ACNase activating potential was investigated by comparing supercoiled and relaxed circular forms of the 2686 bp plasmid pUC19 DNA with a linear counterpart ( Figure 5D). As shown, the linear form was by far more reactive, suggesting that DNA termini figure in the activation.
GkaRloC's anticipated DNA-dependent ATPase activity was not detected over the K44N or D572N ATPase mutant backgrounds when IEC fractions were assayed (not shown). We assume that traces of co-purifying DNA-dependent E. coli ATPase(s) masked that of GkaRloC. This assumption concurs with that inferred from AMPPNP's dual effect ( Figure 4C); i.e. once activated by its ATPase, the ACNase is stabilized by nucleotide binding. Noteworthy in this regard is also the weak DNA-dependent ABC-ATPase (0.2 min À1 ) reported for RecF, which is related to Rad50 (42) and, by implication, to RloC.
Mutating GkaRloC's ZH short circuits the ACNase switch It seemed conceivable that ACNase-activating ZH mutations (4) uncouple the ACNase from its activating ATPase. This premise was tested by comparing wild-type GkaRloC with the ZH mutant C291G in their responses to ATP or AMPPNP, without or with DNA. GkaRloC C291G was expressed and isolated similar to wild type, albeit, with poorer yield and purity ( Figure 1B). Unlike the wild-type protein, it featured overt ACNase activity that was refractory to the DNA-dependent ATPase, both when Lys3-ASL ( Figure 6A) or sc-tRNA Glu(UUC) ( Figure 6B) were used as a substrate, and whether the IMAC (Figure 6) or IEC fraction was used (Supplementary Figure S2).
The latter result suggested that ZH joints formed by the wild-type protein silenced its ACNase. Unexpectedly, using IEC fractions we found that Zn + + abolished both the wild-type and ZH mutant ACNases as well as EcoPrrC's (Supplementary Figure S3). Presumably, Zn + + mediated these inhibitions through another or an added site, shared perhaps by RloC and PrrC. Thus, it remained uncertain whether Zn + + coordination by the ZH of the wild-type ACNase accounted for its silencing. Finally, our previous report that Zn + + fails to inhibit the ZH mutant ACNase (4) must have been in error. Namely, it turned out that imidazole left in the IMAC fraction used in the former study titrates the zinc ions and thus prevents the inhibition.
DISCUSSION
GkaRloC's excision mechanism
GkaRloC's ability to cleave Lys3-ASL 3 0 and then 5 0 to the wobble base ( Figure 2) and direct visualization of the wobble nucleotide GkaRloC excises from sc-tRNA Glu(UUC) (Figure 3) support the conclusion that GkaRloC is a wobble nucleotide-excising ACNase (4). Unexpectedly, GkaRloC incised sc-tRNA Glu(UUC) both 3 0 and 5 0 to the wobble base. However, the latter incision yielded a dead-end product that was not further cleaved ( Figure 3). It is noteworthy that GkaRloC generates in vitro a 5 0 incision product also from E. coli tRNA Lys . This result was obtained in an experiment intended to examine whether GkaRloC occludes its incision intermediate from the T4 tRNA repair enzymes. The resultant cleavage ligation junctions labelled from [g-32 P]ATP were mostly of defective products lacking the wobble nucleotide. The remaining junctions were of two comparable fractions of intact tRNA molecules formed by reversal of the 5 0 or 3 0 incision (Supplementary Figure S4). Nonetheless, an in vivo 5 0 incision product derived from tRNA Lys or any other E. coli tRNA targeted by GkaRloC has not been detected (4). These facts and selective inhibition of the 5 0 -incision and excising cleavage (Supplementary Figure S5) indicate that under the in vitro conditions used GkaRloC could occasionally skip the initial 3 0 cleavage site.
GkaRloC's tRNA substrate specificity
GkaRloC disrupts a variety of bacterial and eukaryal tRNAs and their analogues (4; Figures 2 and 3 and data not shown). It differs in this regard from the fungal ACNase g-zymocin, which is highly sensitive to changes in the modifying side chain of the sc-tRNA Glu(UUC) wobble base and poorly cleaves other tRNA species sharing this base (34). Nonetheless, it is conceivable that GkaRloC is less promiscuous in nature. This is suggested by the observation that EcoPrrC's natural specificity for tRNA Lys is compromised when this ACNase is ectopically over-expressed or assayed in vitro (21,23). Moreover, inactivation of a single tRNA species could suffice to disable the synthesis of phage proteins while minimizing the potential hazard to the uninfected bacterial host. Testing this expectation requires a natural RloC encoding host and means to activate its ACNase. On the other hand, from a practical perspective, GkaRloC's in vitro promiscuity and unique cleavage site specificity may facilitate artificial replacements of tRNA wobble bases and identification of novel ones.
RloC's internal ACNase switch
A unique trait of GkaRloC and, by implication, of RloC in general is an internal ACNase regulating device comprising the coupled ZH and DNA-dependent ATPase. The existence of this device is inferred from the activation of GkaRloC's ACNase by ZH mutations (4) that also render this ACNase independent of the otherwise activating DNA-dependent ATPase ( Figure 6). These facts suggest that intramolecular ZH joints accounted for the silencing of the wild-type ACNase in the absence of ATP and DNA ( Figure 5). By analogy with the changes Rad50 undergoes upon DNA binding (27), it may be proposed that DNA binding straightens GkaRloC's CC protrusions and thus disrupts the inhibitory intramolecular ZH joints. The affinity of GkaRloC's ZH for zinc is not known. However, if similar to that of a zinc finger protein (43) it could suffice to capture zinc ions released from the intramolecular hook within an intermolecular. This possibility and the observed effects of DNA size and shape on GkaRloC's ACNase activation ( Figure 5C and D) underlie a proposed scheme where association of RloC dimers bound at proximal DNA termini triggers ATP hydrolysis and consequent activation of the ACNase (Figure 7). It could be argued that a double-stranded DNA break (DSB) satisfies such a need for proximal DNA termini in vivo. However, DSBs did not elicit ACNase activity in the natural RloC encoding Acinetobacter sp. ADP1 although over-expressing the AciRloC in E. coli showed it to be potentially active (our unpublished data). Therefore, DSBs may be only one of the physiological triggers needed to activate RloC's ACNase.
RloC's internal ACNase switch may confer advantages
The advent of an internal ACNase silencer could have provided RloC with important advantages over PrrC, added to the assumed frustration of phage-induced tRNA repair. First, an internal ACNase silencer could free RloC from dependence on PrrC's external silencer; namely, the R-M system to which RloC is only rarely linked. It is noteworthy that rloC often appears as the single cargo of integrated phage, transposon or plasmid elements (4), suggesting it can be laterally inherited without a linked silencer. The advent of an internal silencer could have compensated for this deficiency, enabling such transfer without damage to the recipient cell. Nonetheless, we cannot exclude that an R-M protein interacting in trans partakes in the activation of GkaRloC's ACNase, e.g. relaying foreign DNA and/or genotoxic signals transduced by anti-DNA restriction (9) and/or DNA restriction alleviation (32,44) factors.
Second, RloC's internal silencer could have superseded the dTTP gauging device of its assumed PrrC-like progenitor. PrrC's sensitivity to dTTP's level helps confine the toxicity of this ACNase to its viral target by co-opting the phage-induced dTTP accretion to stabilize its activated form and, possibly precluding potential cytotoxicity of any free PrrC molecules translated in excess over, or inadvertently released from the silencing R-M partner (20). In contrast, the activated form of free RloC is likely stabilized by binding a purine NTP rather than dTTP ( Figure 4C and E). Moreover, since RloC lacks overt ACNase activity, it need not be inactivated in the uninfected cell. The indifference to dTTP's level could expand the range of RloC's viral targets to include phage that do not induce dTTP's accretion.
RloC's evolution
RloC's evolution from a PrrC-like progenitor is favoured to the converse by the greater complexity of RloC and the above-mentioned selective advantages that could have enhanced its antiviral potential and distribution among bacteria. Moreover, comparing matching regions of Photorhabdus luminescens PrrC and E. coli APECO1 RloC ( Figure 8A) suggests that a consensus sequence implicated with PrrC's unusual nucleotide specificity (PrrC Box; 15 and our unpublished data) degenerated in RloC ( Figure 8B). Another determinant associated with PrrC's unusual nucleotide specificity, the 3 0 terminal Arg of PrrC's Walker A motif (marked by arrow) (45) is missing from RloC. An alternative scenario where RloC arose by fusion of an ACNase domain with the bacterial Rad50 homolog SbcC seems less likely since the two ACNases resemble each other in ATPase motifs more than SbcC or any other known ABC-ATPases. Figure 7. Model of GkaRloC's ACNase activation by its DNA-dependent ATPase. By analogy with Rad50 (26,27), it is proposed that a free GkaRloC dimer forms intramolecular ZHs that silence its ACNase (1). Upon DNA binding to the ATPase head domains the CC protrusions straighten liberating the coordinated zinc ion (2) such that only intermolecular zinc hooks can form between dimers bound to different DNA ends (3). At this state, the ATPase is turned on and unleashes the ACNase (4). It is also assumed that zinc ions released from the intramolecular ZH could be trapped by the intermolecular. Supplementary Table S2.
RloC's biological role
The idea that RloC responds to genotoxic stress by disabling translation (4) appears to contradict the requisite synthesis of DNA repair proteins (46). Yet, such response could benefit bacteria that alleviate Type I DNA restriction during recovery from DNA damage (31). This measure precludes degradation of fully unmodified cell DNA made during the recovery (44) but at the cost of increased susceptibility to phage infection (32). Activating RloC's ACNase in this situation could prevent the spread of the infection to vulnerable sibling cells. This model, inferred from the harsh lesion inflicted by RloC, the ACNase-activating ZH mutations (4) and Rad50's functions (26,27) was reinforced by observations indicating that GkaRloC's ACNase is regulated by its coupled ZH and DNA-dependent ATPase, the importance of DNA termini but failure of DSBs alone to detectably activate an RloC ACNase in vivo. Testing this model and the expectation that RloC defies phage-induced tRNA repair call for experimental systems based on natural RloC expressing hosts and cognate phage endowed with tRNA repair enzymes.
SUPPLEMENTARY DATA
Supplementary Data are available at NAR Online: Supplementary Tables 1 and 2 and Supplementary Figures 1-5.
Figure 1 .
1Isolation of GkaRloC alleles. Aliquots of the indicated fractions of wild-type GkaRloC (A) or its ZH mutant C291G (B) were separated by SDS-PAGE and monitored by staining or immunoblotting using an anti-His tag monoclonal antibody (4).
; lanes 1 and 2) was attributed to co-purifying DNA, since prior DNase I treatment abolished it (Supplementary Figure S1, lane 6). Moreover, adding the standard DNA dose to the treated fraction restored the activation (lane 8). This
Figure 2 .
2GkaRloC-mediated digestion of a 5 0 -end labelled ASL substrate. (A) Lys3-ASL sequence (the 3 0 -dT extension facilitated the chemical synthesis of this ASL (36). The arrows indicate incision (Inc.) and excision (Exc.) sites. U 9 is the modified wobble base mcm 5 s 2 U. The arc highlights the anticodon triplet. denotes the 5 0 -label. (B) GkaRloC ACNase activity was assayed using its IMAC fraction and the [5 0 -32 P]Lys3-ASL substrate as detailed in 'Materials and Methods' section. The reaction products were separated by denaturing PAGE. L-size ladder of partially hydrolyzed Lys3-ASL. (C) Time course of Lys3-ASL decay and formation of the labelled products.
Figure 3 .
3GkaRloC excises the wobble nucleotide from sc-tRNAGlu(UUC) . (A and B) The sc-tRNA Glu(UUC) substrate radiolabeled 3 0 to the wobble base was incubated with the IMAC fraction of GkaRloC for the indicated times and the products separated by denaturing PAGE. $34-and $43mer are the respective labelled fragments resulting from 3 0 and 5 0 incisions; Ex.nt is the excised nucleotide. (C) Time course of substrate decay and product formation in (B). (D) Cleavage products of the sc-tRNA Glu(UUC) substrate (C) formed by GkaRloC (R), PrrC (P) or g-zymocin (Z). (E) GkaRloC cleaves the pre-formed 3 0 but not 5 0 incision product of sc-tRNA Glu(UUC) . Sc-tRNA Glu(UUC) was incubated with PrrC (lanes 1 and 2) or g-zymocin (lanes 3 and 4) followed by incubation with the ACNase-null mutant E696A (4) (
(F) The GkaRloC-mediated incising and excising cleavages of sc-tRNA Glu(UUC) . The internally labelled substrate highlighted by an open square (1) is incised by GkaRloC 3 0 to the wobble base to yield compound (2) followed by an excising cleavage upstream that yields the tRNA fragments 1-33 and 35-76 and excised wobble nucleotide (3). Inadvertent incision 5 0 to the wobble base yields a dead-end product (4). The tRNA substrates and products are schematically depicted by their anticodon stem loop region. Indicated in it are the wobble and two flanking bases. denotes phosphate label.
Figure 4 .
4GkaRloC's ATPase activates its ACNase. GkaRloC's ACNase of the IMAC fraction was assayed in vitro in panels (A)-(C) and (E) essentially as described in Materials and Methods but in the absence of added DNA. (A) Dependence of GkaRloC's ACNase activity on ATP's level. (B) GkaRloC's ACNase activity was assayed in the presence of 500 mM of the indicated nucleotides. (C) Time courses of GkaRloC's ACNase activity in the presence of 0.5 mM ATP and indicated amounts of AMPPNP. (D) In vivo ACNase activity of the indicated GkaRloC alleles. Left panel-RNA extracted from cells expressing these alleles was 5 0 -end labelled using T4 Pnk and separated by denaturing PAGE. Right panelthe expression of the indicated GkaRloC alleles were monitored by Western using an anti-His tag monoclonal antibody (4). (E) Nucleotide specificity of GkaRloC's ACNase activation. The activation reaction was performed in the presence of the indicated nucleotides (GTP and ATP at 0.5 mM each, dTTP at 5 mM).
Figure 5 .
5GkaRloC's ACNase-activating ATPase depends on DNA. (A and B) Effect of the indicated additions on ACNase activity in IEC (A) or IMAC (B) fractions of GkaRloC. (C and D) Effect of size (C) or shape (D) of the DNA added to the IEC fraction on the activation of GkaRloC's ACNase.
Figure 6 .
6The ZH mutation C291G uncouples GkaRloC's ACNase from its DNA-dependent ATPase. The IMAC fractions of the indicated GkaRloC alleles were assayed for ACNase activity in the presence of the indicated additions using as a substrate Lys3-ASL (A) or sc-tRNA Glu(UUC) (B).
Figure 8 .
8RloC's putative degenerated PrrC Box. (A) Sequence alignment of Photorhabdus luminescence PrrC and parts of E. coli APEC01 RloC flanking the CC/ZH domain. (B) The aligned consensus PrrC Box and putative degenerated counterpart of RloC were derived from respective ortholog cohorts of bacteria listed in
ACKNOWLEDGEMENTSWe thank Anders S. Bystro¨m for the GST-zymocin plasmid, Darrell R. Davis for Lys3-ASL and Ezra Yagil for comments.Conflict of interest statement. None declared.
Phage-exclusion enzymes: a bonanza of biochemical and cell biology reagents?. L Snyder, Mol. Microbiol. 15Snyder,L. (1995) Phage-exclusion enzymes: a bonanza of biochemical and cell biology reagents? Mol. Microbiol., 15, 415-420.
Bacteriophage T4 anticodon nuclease, polynucleotide kinase and RNA ligase reprocess the host lysine tRNA. M Amitsur, R Levitz, G Kaufmann, EMBO J. 6Amitsur,M., Levitz,R. and Kaufmann,G. (1987) Bacteriophage T4 anticodon nuclease, polynucleotide kinase and RNA ligase reprocess the host lysine tRNA. EMBO J., 6, 2499-2503.
PrrC-anticodon nuclease: functional organization of a prototypical bacterial restriction RNase. S Blanga-Kanfi, M Amitsur, A Azem, G Kaufmann, Nucleic Acids Res. 34Blanga-Kanfi,S., Amitsur,M., Azem,A. and Kaufmann,G. (2006) PrrC-anticodon nuclease: functional organization of a prototypical bacterial restriction RNase. Nucleic Acids Res., 34, 3209-3219.
RloC: a wobble nucleotide-excising and zinc-responsive bacterial tRNase. E Davidov, G Kaufmann, Mol. Microbiol. 69Davidov,E. and Kaufmann,G. (2008) RloC: a wobble nucleotide-excising and zinc-responsive bacterial tRNase. Mol. Microbiol., 69, 1560-1574.
Genetics and physiology of bacteriophage T4 3 0 -phosphatase: evidence for the involvement of the enzyme in T4 DNA metabolism. R E Depew, N R Cozzarelli, J. Virol. 13Depew,R.E. and Cozzarelli,N.R. (1974) Genetics and physiology of bacteriophage T4 3 0 -phosphatase: evidence for the involvement of the enzyme in T4 DNA metabolism. J. Virol., 13, 888-897.
The optional E. coli prr locus encodes a latent form of phage T4-induced anticodon nuclease. R Levitz, D Chapman, M Amitsur, R Green, L Snyder, G Kaufmann, EMBO J. 9Levitz,R., Chapman,D., Amitsur,M., Green,R., Snyder,L. and Kaufmann,G. (1990) The optional E. coli prr locus encodes a latent form of phage T4-induced anticodon nuclease. EMBO J., 9, 1383-1389.
Anticodon nucleases. G Kaufmann, Trends Biochem. Sci. 25Kaufmann,G. (2000) Anticodon nucleases. Trends Biochem. Sci., 25, 70-74.
The Escherichia coli prr region encodes a functional type IC DNA restriction system closely integrated with an anticodon nuclease gene. C Tyndall, J Meister, T A Bickle, J. Mol. Biol. 237Tyndall,C., Meister,J. and Bickle,T.A. (1994) The Escherichia coli prr region encodes a functional type IC DNA restriction system closely integrated with an anticodon nuclease gene. J. Mol. Biol., 237, 266-274.
Phage T4-coded Stp: double-edged effector of coupled DNA and tRNA-restriction systems. M Penner, I Morad, L Snyder, G Kaufmann, J. Mol. Biol. 249Penner,M., Morad,I., Snyder,L. and Kaufmann,G. (1995) Phage T4-coded Stp: double-edged effector of coupled DNA and tRNA-restriction systems. J. Mol. Biol., 249, 857-868.
A role in true-late gene expression for the T4 bacteriophage 5 0 -polynucleotide kinase 3 0 -phosphatase. K Sirotkin, W Cooley, J Runnels, L Snyder, J. Mol. Biol. 123Sirotkin,K., Cooley,W., Runnels,J. and Snyder,L. (1978) A role in true-late gene expression for the T4 bacteriophage 5 0 -polynucleotide kinase 3 0 -phosphatase. J. Mol. Biol., 123, 221-233.
Determinants of eukaryal cell killing by the bacterial ribotoxin PrrC. B Meineke, B Schwer, R Schaffrath, S Shuman, Nucleic Acids Res. 39Meineke,B., Schwer,B., Schaffrath,R. and Shuman,S. (2011) Determinants of eukaryal cell killing by the bacterial ribotoxin PrrC. Nucleic Acids Res., 39, 687-700.
Determinants of the cytotoxicity of PrrC anticodon nuclease and its amelioration by tRNA repair. B Meineke, S Shuman, RNA. 18Meineke,B. and Shuman,S. (2012) Determinants of the cytotoxicity of PrrC anticodon nuclease and its amelioration by tRNA repair. RNA, 18, 145-154.
Structure of a tRNA repair enzyme and molecular biology workhorse: T4 polynucleotide kinase. E A Galburt, J Pelletier, G Wilson, B L Stoddard, Structure. 10Galburt,E.A., Pelletier,J., Wilson,G. and Stoddard,B.L. (2002) Structure of a tRNA repair enzyme and molecular biology workhorse: T4 polynucleotide kinase. Structure, 10, 1249-1260.
Molecular architecture and ligand recognition determinants for T4 RNA ligase. K El Omari, J Ren, L E Bird, M K Bona, G Klarmann, S F Legrice, D K Stammers, J. Biol. Chem. 281El Omari,K., Ren,J., Bird,L.E., Bona,M.K., Klarmann,G., LeGrice,S.F. and Stammers,D.K. (2006) Molecular architecture and ligand recognition determinants for T4 RNA ligase. J. Biol. Chem., 281, 1573-1579.
Bacteriophage T4-encoded Stp can be replaced as activator of anticodon nuclease by a normal host cell metabolite. M Amitsur, S Benjamin, R Rosner, D Chapman-Shimshoni, R Meidler, S Blanga, G Kaufmann, Mol. Microbiol. 50Amitsur,M., Benjamin,S., Rosner,R., Chapman-Shimshoni,D., Meidler,R., Blanga,S. and Kaufmann,G. (2003) Bacteriophage T4-encoded Stp can be replaced as activator of anticodon nuclease by a normal host cell metabolite. Mol. Microbiol., 50, 129-143.
Type I restriction systems: sophisticated molecular machines (a legacy of Bertani and Weigle). Microbiol. N E Murray, Mol. Biol. Rev. 64Murray,N.E. (2000) Type I restriction systems: sophisticated molecular machines (a legacy of Bertani and Weigle). Microbiol. Mol. Biol. Rev., 64, 412-434.
Initiation of translocation by Type I restriction-modification enzymes is associated with a short DNA extrusion. J Van Noort, T Van Der Heijden, C F Dutta, K Firman, C Dekker, Nucleic Acids Res. 32van Noort,J., van der Heijden,T., Dutta,C.F., Firman,K. and Dekker,C. (2004) Initiation of translocation by Type I restriction-modification enzymes is associated with a short DNA extrusion. Nucleic Acids Res., 32, 6540-6547.
Deoxyribonucleoside triphosphate synthesis and phage T4 DNA replication. G R Greenberg, P He, J Hilfinger, M J Tseng, J D Karam, J W Drake, K N Kreuzer, G Mosig, D W Hall, F A Eiserling, L W Black, E K Spicer, E Kutter, K Carlson, Molecular Biology of Bacteriophage T4. Washington DCAmerican Society for MicrobiologyGreenberg,G.R., He,P., Hilfinger,J. and Tseng,M.J. (1994) Deoxyribonucleoside triphosphate synthesis and phage T4 DNA replication. In: Karam,J.D., Drake,J.W., Kreuzer,K.N., Mosig,G., Hall,D.W., Eiserling,F.A., Black,L.W., Spicer,E.K., Kutter,E., Carlson,K. et al. (eds), Molecular Biology of Bacteriophage T4. American Society for Microbiology, Washington DC, pp. 14-27.
Imbalanced deoxyribonucleoside triphosphate pools and spontaneous mutation rates determined during dCMP deaminase-defective bacteriophage T4 infections. R G Sargent, C K Mathews, J. Biol. Chem. 262Sargent,R.G. and Mathews,C.K. (1987) Imbalanced deoxyribonucleoside triphosphate pools and spontaneous mutation rates determined during dCMP deaminase-defective bacteriophage T4 infections. J. Biol. Chem., 262, 5546-5553.
Phage T4-induced dTTP accretion bolsters a tRNase-based host defense. D Klaiman, G Kaufmann, Virology. 414Klaiman,D. and Kaufmann,G. (2011) Phage T4-induced dTTP accretion bolsters a tRNase-based host defense. Virology, 414, 97-101.
Detection of anticodon nuclease residues involved in tRNA Lys cleavage specificity. R Meidler, I Morad, M Amitsur, H Inokuchi, G Kaufmann, J. Mol. Biol. 287Meidler,R., Morad,I., Amitsur,M., Inokuchi,H. and Kaufmann,G. (1999) Detection of anticodon nuclease residues involved in tRNA Lys cleavage specificity. J. Mol. Biol., 287, 499-510.
Specific interaction between anticodon nuclease and the tRNA Lys wobble Base. Y Jiang, R Meidler, M Amitsur, G Kaufmann, J. Mol. Biol. 305Jiang,Y., Meidler,R., Amitsur,M. and Kaufmann,G. (2001) Specific interaction between anticodon nuclease and the tRNA Lys wobble Base. J. Mol. Biol., 305, 377-388.
Structural features of tRNA Lys favored by anticodon nuclease as inferred from reactivities of anticodon stem and loop substrate analogs. Y Jiang, S Blanga, M Amitsur, R Meidler, E Krivosheyev, M Sundaram, A C Bajji, D R Davis, G Kaufmann, J. Biol. Chem. 277Jiang,Y., Blanga,S., Amitsur,M., Meidler,R., Krivosheyev,E., Sundaram,M., Bajji,A.C., Davis,D.R. and Kaufmann,G. (2002) Structural features of tRNA Lys favored by anticodon nuclease as inferred from reactivities of anticodon stem and loop substrate analogs. J. Biol. Chem., 277, 3836-3841.
Parallel dimerization of a PrrC-anticodon nuclease region implicated in tRNA Lys recognition. D Klaiman, M Amitsur, S Blanga-Kanfi, M Chai, D R Davis, G Kaufmann, Nucleic Acids Res. 35Klaiman,D., Amitsur,M., Blanga-Kanfi,S., Chai,M., Davis,D.R. and Kaufmann,G. (2007) Parallel dimerization of a PrrC-anticodon nuclease region implicated in tRNA Lys recognition. Nucleic Acids Res., 35, 4704-4714.
The SbcCD nuclease of Escherichia coli is a structural maintenance of chromosomes (SMC) family protein that cleaves hairpin DNA. J C Connelly, L A Kirkham, D R Leach, Proc. Natl Acad. Sci. USA. 95Connelly,J.C., Kirkham,L.A. and Leach,D.R. (1998) The SbcCD nuclease of Escherichia coli is a structural maintenance of chromosomes (SMC) family protein that cleaves hairpin DNA. Proc. Natl Acad. Sci. USA, 95, 7969-7974.
The Rad50 zinc-hook is a structure joining Mre11 complexes in DNA recombination and repair. K P Hopfner, L Craig, G Moncalian, R A Zinkel, T Usui, B A Owen, A Karcher, B Henderson, J L Bodmer, C T Mcmurray, Nature. 418Hopfner,K.P., Craig,L., Moncalian,G., Zinkel,R.A., Usui,T., Owen,B.A., Karcher,A., Henderson,B., Bodmer,J.L., McMurray,C.T. et al. (2002) The Rad50 zinc-hook is a structure joining Mre11 complexes in DNA recombination and repair. Nature, 418, 562-566.
Mesoscale conformational changes in the DNA-repair complex Rad50/Mre11/Nbs1 upon binding DNA. F Moreno-Herrero, M De Jager, N H Dekker, R Kanaar, C Wyman, C Dekker, Nature. 437Moreno-Herrero,F., de Jager,M., Dekker,N.H., Kanaar,R., Wyman,C. and Dekker,C. (2005) Mesoscale conformational changes in the DNA-repair complex Rad50/Mre11/Nbs1 upon binding DNA. Nature, 437, 440-443.
Mre11-Rad50-Nbs1 conformations and the control of sensing, signaling, and effector responses at DNA double-strand breaks. G J Williams, S P Lees-Miller, J A Tainer, DNA Repair (Amst). 9Williams,G.J., Lees-Miller,S.P. and Tainer,J.A. (2010) Mre11-Rad50-Nbs1 conformations and the control of sensing, signaling, and effector responses at DNA double-strand breaks. DNA Repair (Amst), 9, 1299-1306.
ABC ATPase signature helices in Rad50 link nucleotide state to Mre11 interface for DNA repair. G J Williams, R S Williams, J S Williams, G Moncalian, A S Arvai, O Limbo, G Guenther, S Sildas, M Hammel, P Russell, Nat. Struct. Mol. Biol. 18Williams,G.J., Williams,R.S., Williams,J.S., Moncalian,G., Arvai,A.S., Limbo,O., Guenther,G., Sildas,S., Hammel,M., Russell,P. et al. (2011) ABC ATPase signature helices in Rad50 link nucleotide state to Mre11 interface for DNA repair. Nat. Struct. Mol. Biol., 18, 423-431.
SMC proteins and chromosome mechanics: from bacteria to humans. T Hirano, Philos. Trans. R. Soc. Lond B Biol. Sci. 360Hirano,T. (2005) SMC proteins and chromosome mechanics: from bacteria to humans. Philos. Trans. R. Soc. Lond B Biol. Sci., 360, 507-514.
Genetic control of damage-inducible restriction alleviation in Escherichia coli K12: an SOS function not repressed by lexA. B Thoms, W Wackernagel, Mol. Gen. Genet. 197Thoms,B. and Wackernagel,W. (1984) Genetic control of damage-inducible restriction alleviation in Escherichia coli K12: an SOS function not repressed by lexA. Mol. Gen. Genet., 197, 297-303.
Control of the endonuclease activity of type I restriction-modification systems is required to maintain chromosome integrity following homologous recombination. G W Blakely, N E Murray, Mol. Microbiol. 60Blakely,G.W. and Murray,N.E. (2006) Control of the endonuclease activity of type I restriction-modification systems is required to maintain chromosome integrity following homologous recombination. Mol. Microbiol., 60, 883-893.
Site-specific mutagenesis by using an accurate recombinant polymerase chain reaction method. M Ansaldi, M Lepelletier, V Mejean, Anal. Biochem. 234Ansaldi,M., Lepelletier,M. and Mejean,V. (1996) Site-specific mutagenesis by using an accurate recombinant polymerase chain reaction method. Anal. Biochem., 234, 110-111.
The Kluyveromyces lactis gamma-toxin targets tRNA anticodons. J Lu, B Huang, A Esberg, M J Johansson, A S Bystro¨m, RNA. 11Lu,J., Huang,B., Esberg,A., Johansson,M.J. and Bystro¨m,A.S. (2005) The Kluyveromyces lactis gamma-toxin targets tRNA anticodons. RNA, 11, 1648-1654.
In vitro reconstitution of anticodon nuclease from components encoded by phage T4 and Escherichia coli CTr5X. M Amitsur, I Morad, G Kaufmann, EMBO J. 8Amitsur,M., Morad,I. and Kaufmann,G. (1989) In vitro reconstitution of anticodon nuclease from components encoded by phage T4 and Escherichia coli CTr5X. EMBO J., 8, 2411-2415.
Synthesis and characterization of the native anticodon domain of E. coli tRNA Lys : simultaneous incorporation of modified nucleosides mnm(5)s(2)U, t(6)A, and pseudouridine using phosphoramidite chemistry. M Sundaram, P F Crain, D R Davis, J. Org. Chem. 65Sundaram,M., Crain,P.F. and Davis,D.R. (2000) Synthesis and characterization of the native anticodon domain of E. coli tRNA Lys : simultaneous incorporation of modified nucleosides mnm(5)s(2)U, t(6)A, and pseudouridine using phosphoramidite chemistry. J. Org. Chem., 65, 5609-5614.
ATP hydrolysis and DNA binding by the Escherichia coli RecF protein. B L Webb, M M Cox, R B Inman, J. Biol. Chem. 274Webb,B.L., Cox,M.M. and Inman,R.B. (1999) ATP hydrolysis and DNA binding by the Escherichia coli RecF protein. J. Biol. Chem., 274, 15367-15374.
RecN is a cohesin-like protein that stimulates intermolecular DNA interactions in vitro. E D Reyes, P L Patidar, L A Uranga, A S Bortoletto, S L Lusetti, J. Biol. Chem. 285Reyes,E.D., Patidar,P.L., Uranga,L.A., Bortoletto,A.S. and Lusetti,S.L. (2010) RecN is a cohesin-like protein that stimulates intermolecular DNA interactions in vitro. J. Biol. Chem., 285, 16521-16529.
Structural biochemistry of ATP-driven dimerization and DNA-stimulated activation of SMC ATPases. A Lammens, A Schele, K P Hopfner, Curr. Biol. 14Lammens,A., Schele,A. and Hopfner,K.P. (2004) Structural biochemistry of ATP-driven dimerization and DNA-stimulated activation of SMC ATPases. Curr. Biol., 14, 1778-1782.
ATP-dependent positive supercoiling of DNA by 13S condensin: a biochemical implication for chromosome condensation. K Kimura, T Hirano, Cell. 90Kimura,K. and Hirano,T. (1997) ATP-dependent positive supercoiling of DNA by 13S condensin: a biochemical implication for chromosome condensation. Cell, 90, 625-634.
ATP driven structural changes of the bacterial Mre11:Rad50 catalytic head complex. C Mo¨ckel, K Lammens, A Schele, K P Hopfner, Nucleic Acids Res. 40Mo¨ckel,C., Lammens,K., Schele,A. and Hopfner,K.P. (2012) ATP driven structural changes of the bacterial Mre11:Rad50 catalytic head complex. Nucleic Acids Res., 40, 914-927.
Structural conservation of RecF and Rad50: implications for DNA recognition and RecF function. O Koroleva, N Makharashvili, C T Courcelle, J Courcelle, S Korolev, EMBO J. 26Koroleva,O., Makharashvili,N., Courcelle,C.T., Courcelle,J. and Korolev,S. (2007) Structural conservation of RecF and Rad50: implications for DNA recognition and RecF function. EMBO J., 26, 867-877.
Selection of carbonic anhydrase variants displayed on phage. Aromatic residues in zinc binding site enhance metal affinity and equilibration kinetics. J A Hunt, C A Fierke, J. Biol. Chem. 272Hunt,J.A. and Fierke,C.A. (1997) Selection of carbonic anhydrase variants displayed on phage. Aromatic residues in zinc binding site enhance metal affinity and equilibration kinetics. J. Biol. Chem., 272, 20364-20372.
Is modification sufficient to protect a bacterial chromosome from a resident restriction endonuclease?. S Makovets, L M Powell, A J Titheradge, G W Blakely, N E Murray, Mol. Microbiol. 51Makovets,S., Powell,L.M., Titheradge,A.J., Blakely,G.W. and Murray,N.E. (2004) Is modification sufficient to protect a bacterial chromosome from a resident restriction endonuclease? Mol. Microbiol., 51, 135-147.
Structure-function relations in the NTPase domain of the antiviral tRNA ribotoxin Escherichia coli PrrC. B Meineke, S Shuman, Virology. 427Meineke,B. and Shuman,S. (2012) Structure-function relations in the NTPase domain of the antiviral tRNA ribotoxin Escherichia coli PrrC. Virology, 427, 144-150.
DNA Repair and Mutagenesis. E C Friedberg, G C Walker, W Siede, R D Wood, T Ellenberger, ASM PressWashington, DCFriedberg,E.C., Walker,G.C., Siede,W., Wood,R.D. and Ellenberger,T. (2006) DNA Repair and Mutagenesis. ASM Press, Washington, DC.
|
INTRODUCTION
The concept of protein phosphorylation as a mechanism for regulation began with the pioneering studies of Krebs and Fischer in the middle of the last century [1,2]. These studies, which demonstrated that glycogen phosphorylase was activated by the reversible addition of a single phosphate, laid the foundation for the family of eukaryotic protein kinases (EPKs). We now recognize that this family, termed as the 'kinome', represents one of the largest gene families encoded by most eukaryotic genomes. In humans, there are over 500 EPKs [3], and they regulate most of the biological processes that take place in the cell. How did these unique proteins evolve, and how are they different from the metabolic enzymes that we have studied in such depth? We discuss here the essential features that define the EPKs and distinguish them from the earlier and simpler eukaryotic-like kinases (ELKs). Because we now have a significant 'structural' kinome available that contains over 150 protein kinases [4], we can also elucidate the general unique features of the EPK family as well as features that are associated with each subfamily. Using cyclic AMP (cAMP)-dependent protein kinase (protein kinase A (PKA)) as a model, we will also define how our understanding of the structure and regulation of one protein kinase has served as a prototype for the overall family. cAMP was discovered by Sutherland as a hormone second messenger about the same time that Krebs and Fischer discovered protein phosphorylation as a regulatory mechanism [5,6]. PKA was discovered about a decade later as the kinase that phosphorylated and activated phosphorylase kinase [7]. The discovery of the PKA regulatory subunits as the primary receptor for cAMP provided the mechanism for having PKA under the control of cAMP [8][9][10][11]. Each PKA R-subunit contains two contiguous cyclic nucleotide-binding (CNB) domains, and these CNB domains are widespread in the prokaryotic world [12]. They appear to be an ancient motif that has co-evolved with cAMP as a mechanism for translating the stress-induced cAMP second messenger into a biological response. There are examples of CNB domains being coupled to protein kinase domains in prokaryotic gene sequences, so these motifs have been functionally coupled for a very long time, but none of these have been studied at the protein level. The closest homologue to PKA is cyclic GMP (cGMP)-dependent protein kinase (protein kinase G (PKG)), but in this case the kinase domain is fused to the CNB domains [13,14]. Both cAMP and cGMP domains are first found functionally linked to an EPK early in the evolution of eukaryotes. They are found, for example, in all fungi [15] and even in single cell symbiotic pathogens such as trypanosomes [16] and plasmodia [17].
cAMP is generated in response to the activation of G protein-coupled receptors (GPCRs) through the activation of Gas, the activating G-protein subunit that stimulates adenylate cyclase [18]. Over 30 GPCRs couple to Gas, and there are four functionally non-redundant PKA R-subunits. The inactive PKA holoenzymes are localized to specific sites in the cell by scaffold proteins, the best known being the A kinase anchoring proteins (AKAPs) [19]. These proteins constitute a diverse PKA signalling system that exists in every mammalian cell and provides a mechanism for achieving exquisite specificity. The system is defined by what GPCRs, PKAs and AKAPs are expressed in each cell. These proteins are then assembled into discrete localized 'foci' of PKA signalling. Understanding how these macromolecular complexes are assembled and regulated is our challenge for the future. Elucidating structures of the individual proteins is only the first step. Now that we have well-defined kinases, we must understand how each works in the context of the whole cell. To achieve such an integrated understanding of signalling requires many disciplines that include computational strategies to link the proteins into well-defined pathways.
KINASE CORE
The EPK superfamily is defined by a conserved kinase core. This core consists of a bi-lobal protein of approximately 250 residues that contains most of the essential machinery for catalysis and for scaffolding, the two functions that are essential for downstream signalling (figure 1). Scattered throughout the core are specific conserved sequence motifs that were classified early on into 12 subdomains by Hanks & Hunter [20]. Once the crystal structure of PKA was solved, these motifs could be defined in terms of their putative function [21,22]. Each lobe is made up of helical and beta subdomains, and the active site cleft is formed by the two lobes converging to form a deep cleft where the adenine ring of adenosine triphosphate (ATP) is bound. In this configuration, which is quite distinct from the Walker motif that is associated with most other ATP-binding proteins [23], the g-phosphate is positioned at the outer edge of the cleft where phosphoryl transfer takes place. Catalysis is mediated by opening and closing of the active site cleft allowing for transfer of the phosphate and then release of the nucleotide.
The N-terminal lobe (N-lobe) consists of a fivestranded anti-parallel beta sheet that is an essential part of the ATP-binding mechanism. Between b3 and b4 is the single conserved helix, the aC-helix. b-Strands 1 and 2 are joined by a glycine-rich loop, and this loop packs on top of the ATP with a backbone amide at the tip of the loop anchoring the g-phosphate and positioning it for phosphoryl transfer. b-Strand 3 contains an essential Lys (Lys72 in PKA) that couples to a conserved Glu (Glu91 in PKA) in the aC-helix when the kinase is in an active conformation. The conserved helical subdomain in the N-lobe of PKA and other AGC kinases contains a short aB-helix and a long aC-helix. The aB-helix is not conserved in all kinases, but the aC-helix is an essential conserved feature of every protein kinase. When a kinase is in an active conformation, the N-terminus of the aC-helix typically interacts with the activation loop phosphate (see later text), while the C-terminus is part of the hinge at the base of the active site cleft.
In contrast to the N-lobe, the C-terminal lobe (C-lobe) is mostly helical and quite stable conformationally. The aE-, aFand aH-helices, based on hydrogendeuterium exchange, for example, are very stable and do not exchange much with solvent even after several days [24]. Resting on the helical core is a four-stranded b sheet that contains most of the remaining catalytic residues (figure 1). This b sheet forms the bottom surface of the active site cleft as seen in the classic view of a protein kinase. Between b-strands 6 and 7 lies the catalytic loop (H/YRDXKXXN) (Asp164 in PKA is the catalytic base) that corresponds to subdomain VIb. This segment contains many of the key residues that direct the g-phosphate of ATP to the protein substrate. Between b-strands 8 and 9, referred to as the magnesium positioning loop, is the Asp-Phe-Gly (DFG) motif where a conserved aspartate (Asp184 in PKA) binds to the catalytic magnesium ion. Although substrates can be tethered to either the N-lobe or the C-lobe or through a flanking domain or linker in a way that positions the P-site to serve as the acceptor for the g-phosphate, most are tethered to the C-lobe. This peptide containing the phosphorylation site (Ser, Thr or Tyr) lies along the outer surface of the C-lobe near the active site cleft.
THE N-AND C-LOBES ARE CONNECTED BY HYDROPHOBIC SPINES
Solving the structure of PKA allowed us to see the conserved sequence motifs of the EPK family in three-dimensions and gave functional significance to each motif [21,22]. Having many protein kinase structures available allows us to search for additional conserved motifs. While the original well-defined sequence motifs were mostly hydrophilic and associated directly with ATP binding or catalysis, the analysis of many protein kinase structures provided insights into how hydrophobic residues contribute to the overall kinase assembly and architecture. A rigorous comparison of many protein kinase structures, both active and inactive, revealed that the core is built around a stable yet dynamic hydrophobic core that is made up of three essential elements-a single hydrophobic helix that spans the large lobe (aFhelix) and two hydrophobic spines that are each made up of non-contiguous residues from both lobes (figure 2). These spines are composed of nonlinear residues and would never be recognized as conserved spatial motifs based on sequence comparisons alone. The spines were first recognized when active and inactive kinases were compared using a method referred to as local spatial pattern (LSP) alignment [25]. This method allows one to rapidly compare any two related structures and to identify spatially conserved residues. What became clear in the comparison of active and inactive kinases is that every active kinase had a contiguous hydrophobic spine that is made up of two residues from the N-lobe and two from the C-lobe. Because this spine is broken in the inactive kinases, it was referred to as a 'regulatory' spine or R-spine. Typically, the R-spine is assembled as a consequence of phosphorylation of the activation loop that joins b-strand 9 to the aF-helix. Most often this causes the DFG motif that lies between b-strands 8 and 9 to 'flip' so that the phenylalanine (Phe185 in PKA) is positioned to complete the spine, and leaving the Asp positioned to interact with one of the ATP bound magnesium ions. In general, the 'DFG-in' conformation refers to the completed R-spine, whereas the 'DFG-out' conformation corresponds to a broken Rspine. There are, however, DFG-in conformations that still are inactive because the spine is broken in a different way, emphasizing that one needs to evaluate the overall spine configuration before classifying a particular structure as 'active' or 'inactive'. The four noncontiguous residues that are aligned in every active kinase are the His from the His-Arg-Asp (HRD) motif in the catalytic loop that bridges b-strands 6 and 7. In PKA and some of the other AGC kinases, this His is replaced with a Tyr (Tyr164), but in each case this hydrophobic residue is packed against the Phe from the DFG motif. In the N-lobe of PKA, the two hydrophobic R-spine residues are the leucine Leu95 in the aC-helix and Leu106 in b-strand 5. These two residues are not only linked to the C-lobe through the R-spine but also serve to anchor the beta and helical subdomains in the N-lobe together [4].
The LSP method was then used to compare all protein kinases, and this revealed another hydrophobic 'spine' that runs parallel to the regulatory (R) spine. Unlike the R-spine, this second spine is completed not by the dynamic insertion of a hydrophobic amino acid side chain but rather by the adenine ring of ATP. This spine is therefore referred to as the 'catalytic' spine or C-spine. ATP binding thus positions the two lobes so that the catalytic residues are aligned optimally for catalysis. Both spines are anchored to the aF-helix. The catalytic loop is also firmly anchored through hydrophobic residues to the aF-helix. This hydrophobic core is a conserved feature of all EPKs and is quite distinct from the hydrophobic core of most globular proteins. Assembly of the R-spine in such a dynamic way is a fundamental feature of the 'switch' mechanism.
Outliers of the EPK family are the phosphoinositide 3-kinases (PI-3 kinases) that share much of the catalytic machinery that is found in the EPKs and ELKs. However, the GHI subdomain is different as is the activation loop. These PI-3 kinases, nevertheless, do have the remnants of the two hydrophobic R-and Cspines [26].
EVOLUTION OF THE EUKARYOTIC PROTEIN KINASES
The era of genome sciences has allowed us to delve deeply into the evolutionary history of proteins.
Review. Evolution of protein kinases S. S. Taylor et al. 2519
From such genome-wide screens, we discover that EPKs evolved from much simpler ELKs that are abundant in prokaryotes [27]. Many of the ELKs, such as choline kinase [28] and amino glycoside kinase [29], are metabolic enzymes that act on small molecules. These ELKs also have a bi-lobal structure (figure 3). The N-lobe, in particular, that positions ATP for catalysis is very similar, including the conserved ion pair between Lys72 and Glu91. A portion of the C-lobe, through the aF-helix, is also conserved. The EPKs are distinguished from the ELKs, however, by two unique co-evolved elements-the activation segment that links b-strand 9 to the aF-helix and the GHI helical subdomain (figure 3). While the activation segment in ELKs is short and not regulated, in EPKs it is highly dynamic and is typically assembled in its active conformation by the addition of a phosphate that is mediated by either cis-or transautophosphorylation or by the action of a heterologous activating kinase (trans). This activation by phosphorylation is a characteristic feature of most EPKs, and in some cases, such as ribosomal S6 kinase (RSK), there are 4-5 kinases that contribute to the activation of a single kinase [30]. A few kinases do not require phosphorylation for their activation. This complex regulation by phosphorylation emphasizes that the EPKs have evolved to be highly dynamic 'switches' that initiate a downstream signalling event. The GHI helical subdomain, which has co-evolved with the complex and dynamic activation loop in EPKs, is also missing in the ELKs. This subdomain provides docking sites for tethering protein substrates and also provides additional regulatory/allosteric control. Both the GHI helical subdomain and the activation loop are anchored firmly to the hydrophobic aF-helix and are linked to each other by a highly conserved and buried ion pair that is a hallmark signature motif of the EPKs. This ion pair consists of a conserved arginine (Arg 280 in PKA) that lies between the aHand aI-helices and a conserved glutamate (Glu208 in PKA), which is at the end of the activation loop and part of the Ala-Pro-Glu (APE) motif. The segment that lies between the APE motif and the aF-helix is also a structurally conserved element; it serves as a hydrophobic anchor that locks the activation loop onto the aF-helix [4]. Included in this region is also a conserved tyrosine (Tyr215 in PKA) that reaches back to the phosphorylation site in the activation loop. The Arg -Glu ion pair provides a sensitive allosteric link to the active site [31]. Mutation of either residue, Glu208 or Arg280 in PKA, has a profound effect on catalytic activity through an increase in K m (ATP) and a decrease in k cat . The aH-helix is an allosteric regulatory site in the yeast homologue of PKA, tpk1, and provides a pathway for substrates to communicate with the active site [32]. This Glu208 -Arg280 ion pair thus serves as a central hub of connectivity between these two structurally conserved elements and is a defining feature that distinguishes the EPKs from the ELKs [31].
LINKERS AND TAILS
Although the core that defines the protein kinase superfamily contains most of the essential catalytic machinery, it is surprisingly not usually sufficient to mediate optimal catalysis on its own. Instead, it is assembled into a fully active state by interactions with flanking regions or domains that are anchored to the core (figure 4). In the case of PKA there is a short N-tail (39 residues) and C-tail (50 residues) that wrap around both lobes of the core. Without these tails, the kinase is neither stable nor active. Mitogen-activated kinase is similar in that it has N-and C-tails that wrap around the core in different ways but nevertheless achieve the same function of stabilizing the active kinase and contributing to catalysis [33]. The non-receptor tyrosine kinases, such as Src, typically have two N-terminal domains, an SH2 and an SH3 domain, and these interact with the core to keep it off or on [34]. Specifically, the SH2 and SH3 domains interact with the catalytic kinase core domain to maintain an inactive conformation as exemplified by Src and Abl, whereas the SH2 domain can interact with the N-lobe to promote activity when the kinase inhibition is released as seen in Abl and Fes [35]. The receptor tyrosine kinases are the most challenging because they contain a large extracellular domain that binds typically to a growth factor. Binding of the growth factor to the extracellular domains promotes dimerization and also releases the inhibition of the cytoplasmic kinase domain. In addition to a single transmembrane (TM) helix, there is a linker region that joins the TM helix to the kinase core and also a C-terminal tail. The linker and the C-tail are filled with various phosphorylation sites that constitute a highly sophisticated regulatory mechanism. Transitioning of these linkers between ordered and disordered states is a critical part of the signalling mechanism but extremely difficult to trap in a crystal lattice. The highly sophisticated ways in which the tails can contribute to both regulation and catalysis can perhaps best be appreciated by looking more closely at the PKA catalytic subunit and the AGC subfamily (figure 5). PKA is flanked at its N-terminus by an N-terminal myristoyl moiety that is followed by an amphipathic helix. The hydrophobic surface of the helix is anchored to the large lobe of the kinase core and to a critical hinge socket that lies at the base of the active site cleft [36]. The hydrophilic surface of the helix provides a docking site for another PKA interacting protein called A kinase interacting protein 1 (AKIP1). AKIP1 is involved in trafficking the catalytic subunit to the nucleus [37]. This N-terminal helix is not conserved in the AGC subfamily although other motifs and domains play a similar role in docking to this surface of the core.
The C-tail, however, is highly conserved in all members of the AGC subfamily and is also highly regulated by phosphorylation, both cis and trans [38]. The C-tail of PKA, and indeed of all AGC protein kinases, can be divided into three functionally distinct segments. The first segment (residues 301 -318), referred to as the C-lobe tether, is bound firmly to the large C-lobe of the kinase core. Several conserved motifs are embedded within this segment, including a PXXP motif that was shown in PKCa to bind to Hsp70 [39]. This is followed by a highly dynamic segment, the active site tether (AST). This segment contains an FDX(X)Y/F motif that is an integral part of the ATP-binding site. The first Phe is part of the adenine-binding pocket, and mutation of this Phe results in significant loss of activity [40]. The second aromatic residue (Phe or Tyr) lies on top of the ribose ring when the enzyme is in a closed conformation. Mutation of Tyr330 also leads to loss of activity in PKA [41]. In the absence of bound nucleotide, the AST segment is highly disordered in crystal structures while binding of the nucleotide drives the AST into an active and closed conformation. The C-terminal portion of the C-tail (residues 336-350) is anchored to the N-lobe in the active enzyme and is referred to as the N-lobe tether (NLT). At the end of the NLT is a hydrophobic motif (HM), and this motif (FXXF) is anchored to the aC-helix in the N-lobe (figure 5).
KINASES ARE DYNAMIC SWITCHES
The EPKs are highly regulated enzymes that function as molecular switches, and PKA once again serves as a template to understand how the dynamic features that are a requirement for a 'switch' are implemented. Nuclear magnetic resonance studies of the PKA catalytic subunit, for example, have begun to explore the dynamic properties of the different conformational states of the catalytic subunit. They define the apoenzyme as a catalytically 'uncommitted' state where there are few backbone movements is the ms/ms time frame, the range that is important for catalysis [42,43]. Addition of the nucleotide creates a state that is 'committed' to catalysis where a network of correlated backbone motions throughout the protein are created. The peptide sequence containing the residue to be phosphorylated is also highly dynamic and is typically tethered in close proximity to the substrate through some distal site.
These studies define a 'molecular switch' that is clearly distinct from metabolic enzymes that have evolved to be efficient catalysts and turn over large amounts of substrates. The EPKs, in general, are not efficient enzymes, and efficient catalysis is not a requirement for a switch.
PRE-STEADY-STATE VERSUS STEADY-STATE KINETICS
The EPKs are dynamic switches that are distinct from metabolic kinases such as hexokinases, which are molecular machines that turnover small molecules, often at or near rates limited only by diffusion and proportional to the concentrations of substrates. The other distinction between EPKs and metabolic kinases is the amount of substrates they encounter in the cell. There are usually millimolar concentrations of small molecules that get phosphorylated by other kinases, but EPKs and their protein substrates are present in submicromolar or even nanomolar concentrations. This substrate concentration difference between metabolic kinases and EPKs is one major reason why metabolic enzymes have high K m values with efficient k cat values while EPKs have low K m values with relatively poor k cat values. Because of these drastic concentration differences, EPKs have evolved efficient mechanisms such as scaffolding, small protein : protein interaction domains and peptide-binding pockets in order to increase the effective concentrations of EPK -substrate encounter complexes.
The basic tenet of mechanistic enzymology, carried over from metabolic enzymes, does not apply to the true physiology of EPKs. By this, we mean that steady-state kinetics and the apparent K m and k cat values are no longer relevant when concentrations of the enzyme and substrate are in the same range, sometimes with 1 : 1 stoichiometries. Thus, pre-steady-state kinetics with real numbers for the phosphoryl transfer step as well as K d values are of critical importance to biophysically analyse EPKs. PKA was the first protein kinase to be comprehensively analysed by pre-steadystate kinetics [44], and this analysis revealed that the phosphotransfer step was significantly faster than the steady-state k cat (500 versus 20 s 21 ). Such kinetics are consistent with the sort of rapid and transient reactions that have been optimized for specific and local phosphoryl transfers to proteins involved in a pathway, while minimizing non-specific phosphorylation of offtarget proteins. Unfortunately, pre-steady-state kinetics is not a routine tool for investigating kinase mechanism, but we suggest that it should be routinely used to reveal new details of EPK mechanisms, and steady-state kinetics must be used as a preliminary guide.
Appreciating that efficient catalysis is not a feature that is essential for an EPK allows us to go back and look more carefully at the members of the kinome that were predicted to be pseudo kinases or 'dead' kinases. These kinases were predicted to be inactive because they lacked one or more of the conserved catalytic residues. However, a number of these have subsequently proved to be functional kinases. WNK (with no lysine (K)), for example, which lacked the lysine in b-strand 3 was found to have another spatially conserved basic residue that occupies the same space in the structure and serves the same functional role [45]. In the case of calcium/calmodulin-dependent serine protein kinase (CASK), which lacks the acidic residues that bind to the Mg 2þ ions, it was found that the enzyme works on its specific substrate (neurexin) in the absence of Mg 2þ [46]. Vaccinia-related kinase 3 (VRK3) is an example of a true pseudokinase where the space filled by the adenine ring in the Cspine is filled with aromatic side chains [47]. This kinase with its 'fused' spine is dead as a kinase but can still function as a scaffold. Kinase suppressor of Ras 1 (KSR) was also thought to be a 'dead' kinase that functioned only as a scaffold but it too is thought now to have kinase activity [48,49]. It is not essential for a kinase to be highly active, and in some cases, kinase activity is missed because the kinase is highly selective for a single substrate protein.
REGULATION OF PROTEIN KINASE
Most of the EPKs are themselves phosphoproteins, and PKA serves as a template to understand how phosphorylation contributes to regulation. There are two sites of phosphorylation in the PKA catalytic subunit, Thr197 in the activation loop and Ser338 in the C-tail. Each contributes in unique ways to creating an active enzyme.
Phosphorylation of the activation loop is essential for optimal PKA activity. As seen in figure 6, this phosphate, once in place, touches almost all of the motifs in the core. It allows us to appreciate how one moiety, even a single phosphate, can have such a profound effect. In the case of PKA, Thr197 can be autophosphorylated when it is expressed in Escherichia coli, so until recently, all of the PKA structures have been of the fully phosphorylated and active enzyme. By mutating the P-3 Arg in the activation loop, Arg194, we were able to purify a dephosphorylated enzyme that could then be phosphorylated in vitro by PDK1, which is a universal activating kinase for the AGC subfamily of EPKs. The C-subunit that lacks the phosphate on its activation loop is unstable and is also highly dynamic based on hydrogen deuterium exchange mapping by mass spectrometry (HDXMS), and in each case, the properties of the wild-type protein are restored by simply adding back the phosphate [50]. The catalytic properties of the enzyme are also significantly compromised. The K m values for ATP and peptide are both increased. However, the most profound effect on catalysis is seen when one examines the pre-steady-state kinetics. PKA, such as a number of EPKs, shows an initial burst of activity that then levels off to give a steady-state rate of catalysis. The k cat is regulated by the off-rate of MgADP. In the absence of the Thr197 phosphate, the pre-steady-state burst is virtually eliminated [51].
The crystal structure of the PKA C-subunit lacking its activation loop phosphate shows the profound effect that this phosphate has on the assembly of the active enzyme ( figure 6). It demonstrates how the R-spine is broken and shows that the activation loop is now mostly disordered [51]. It also confirms the HDXMS results and illustrates how the various loops and segments of the C-subunit become more dynamic and in the case of the C-tail become disordered.
In almost every AGC kinase, there are two critical sites, in addition to the activation loop site, that are regulated by phosphorylation ( figure 5). Between the AST and the NLT is a phosphorylation site that is referred to as the turn motif. In some cases, this is a cis-autophosphorylation site and occurs cotranslationally as in the case of Akt [52], whereas in other cases, such as S6K, this site appears to be phosphorylated by a heterologous kinase [53]. With the exception of PKA and PKG, all other AGC kinases have an additional segment that is fused to the C-terminal HM, and a third phosphorylation site directly follows the HM. This HM site is highly regulated and is usually phosphorylated by the mammalian target of rapamycin (mTOR)-containing mTORC2 complex that is a multi-subunit complex protein kinase. In Akt, for example, this site is regulated by mTOR [52]. The HM site is turned over by a specific phosphatase called PHLPP [54]. As the AGC kinases are regulated by multiple phosphorylations that involve usually more than one heterologous kinase, it is of fundamental importance to study the order of the phosphorylation events and the effect that each phosphorylation has on the stability and activity of the kinase. Understanding the order and mechanism for regulation of the C-tail phosphorylation sites has been challenging, but it is essential to unravel this complexity if one is to appreciate how regulation is achieved at the molecular level.
In PKA, the C-tail site is most likely phosphorylated prior to the activation loop; however, once the two sites are phosphorylated they are very resistant to removal by phosphatases [55]. This is not true for other AGC kinases, and this allows the C-subunit to be packaged as part of a holoenzyme complex where activation is now completely dependent on the generation of cAMP. These complexes also recruit phosphatases, which is another reason why the PKA C-subunit itself needs to be resistant to phosphatases. In this way, the phosphatase is committed to the dephosphorylation of the protein substrate not to the dephosphorylation of the C-subunit. The only known physiological condition that makes the C-subunit susceptible to dephosphorylation is oxidation of Cys199, which happens only when the C-subunit is not inhibited by the R-subunit.
THE PROTEIN KINASE CATALYTIC SUBUNIT IS PACKAGED AS A HOLOENZYME
While we have learned much about the structure and function of PKA from studying the free C-subunit, Figure 7. The catalytic subunit of PKA serves as a scaffold that interacts with multiple regulatory proteins. On the left (a) is a representation of the catalytic subunit bound to a peptide from the heat-stable protein kinase inhibitor (PKI) shown in red [22]. The middle (b) shows the catalytic subunit bound to a deletion mutant of RIa that contains a single nucleotide-binding domain (CNB-A) [57]. On the right (c) is the catalytic subunit bound to a deletion mutant of RIa that contains both single nucleotide-binding domains (CNB-A and CNB-B) [58]. The catalytic subunit is shown as a space-filling model with the residues from 1 to 126 in ivory and residues from 127 to 350 in tan. The R-subunits are also shown as space-filling models. The inhibitor site that docks to the catalytic site is shown in red. The CNB-A domain is in turquoise and the CNB-B domain is in dark teal. Panel (d) shows a model of the tetrameric RIa holoenzyme based on the crystal structure of a complex of a deletion mutant of the RIa subunit that contains an extended linker segment [59]. The dimerization domain shown in yellow is joined to the tetramer by a flexible linker. Rotation of the tetramer by 908, minus the D/D domain shows how the N-linker of each heterodimer is docked onto the surface of the R-subunit CNB-A domain in the opposite heterodimer. This view also indicates the symmetry that is achieved in the tetramer. At the bottom is a gradient of cAMP, which regulates the activation and conformational state of the PKA holoenzyme.
H 87 K 189 R-spine R-spine (a) ( b) ( c)
in cells, it is assembled as a holoenzyme complex with inhibitory regulatory (R) subunits. Ultimately, it is the tetrameric holoenzyme complex that reflects the basal physiological state of the enzyme. In all mammals, there are four functionally non-redundant R-subunits (RIa, RIb, RIIa, RIIb), which all have a stable dimerization domain at the N-terminus. This is followed by a flexible linker that is classified as an intrinsically disordered region. Embedded within the linker is an inhibitor site that resembles a substrate and docks to the active site cleft in the holoenzyme. At the C-terminus are two CNB domains. In the absence of cAMP, two fully phosphorylated C-subunits bind to the R-subunit dimer rendering it inactive. The very stable helical dimerization domain is multi-functional. In addition to creating a stable dimer, it serves as a docking site for AKAPs. These are polyvalent scaffold proteins that are characterized by an amphipathic helix that binds with high affinity to the dimerization/docking (D/D) domain of the R-subunits [56]. Other signalling proteins such as phosphatases and phosphodiesterases are also anchored to AKAPs. The AKAP is then targeted in close proximity to specific substrates such as an ion channel, a transporter or a fusion protein on the mitochondria. In this way, the cell creates discrete 'foci' for cAMP signalling. Our understanding of PKA signalling has grown significantly as new structures were solved that included not only the free C-subunit but also complexes between the R-and C-subunits (figure 7). We did not understand, in molecular terms, how the C-subunit was actually regulated by the R-subunit until the structure of an R : C complex was solved [57]. This showed not only how the inhibitor site docked to the active site cleft of the C-subunit but also how the inhibition could be allosterically released by cAMP binding to the CNB domain. Two factors have further emphasized the importance of the complete full-length tetrameric holoenzymes. First, as discussed earlier, is that the Csubunit is unusual in its stability and in its resistance to phosphatases, which allows it to be packaged in a way that is sensitive exclusively to cAMP and not to the dynamic turnover of its activation loop phosphate. Second, is the solution of the structures of tetrameric holoenzyme complexes that allow us for the first time to appreciate the complex allosteric networks that are uniquely created in the tetramer [59]. It is only in the tetramer that one can appreciate the intricate symmetry of this enzyme. What is furthermore apparent is that each of the four tetrameric holoenzymes has a unique quaternary structure in spite of the highly conserved domain organization of each R-subunit and the very similar tertiary structure of each heterodimer. These differences, first predicted by small angle X-ray scattering studies [60,61], are now confirmed as different holoenzyme structures are revealed. The RIIb holoenzyme, for example, is strikingly different from the RIa holoenzyme model [62]. It lends further credence to the idea that the PKA catalytic subunit is assembled as part of four functionally distinct holoenzyme complexes that are then localized to discrete foci in the cell where they are dedicated to the phosphorylation of a specific substrate or set of substrates that are co-localized in close proximity through scaffold and targeting proteins.
CONCLUSION
Clearly, one needs to now consider the entire system if one is to truly appreciate the complexity and beauty of how the eukaryotic cell has evolved to regulate its biological events by a highly dynamic process such as protein phosphorylation. One also needs to revisit the established paradigm that PKA signalling requires full dissociation of the R-and C-subunits. If activation occurs on a macromolecular complex that is anchored to a channel, for example, and co-localized with other signalling proteins such as phosphodiesterases, cyclases and/or phosphatases, it is not difficult to envision PKA signalling as an oscillatory process where full dissociation is not required. Such oscillatory circuits for PKA signalling have been reported recently for cAMP and calcium [63]. We know much about the structure and function of the PKA R-and C-subunits and are now learning about the unique isoform-specific features of the full-length tetrameric holoenzymes that are assembled in the absence of cAMP. As indicated in figure 7, PKA signalling almost certainly occurs somewhere in between these two endpoints in a time frame that probably does not allow for full dissociation and diffusion of the subunits. The initial discovery of protein phosphorylation in the middle of the last century thus continues to offer us new challenges and opportunities as we strive to understand how biological events are actually regulated in cells. It is a challenge that cannot be understood simply by studying one enzyme. Instead, one needs to understand how that molecule functions in the context of its environment and how that molecule is regulated by extracellular signals that communicate stress.
Figure 1 .
1Conserved core of the eukaryotic protein kinases. The bottom panels (c -e) highlight functional motifs in the N-lobe (a) and the C-lobe (b) using PKA as a prototype for the EPK family. Helices are shown in red; b-strands in teal. (a) The N-lobe contains five b-strands and a large aC-helix. (b) The C-lobe is mostly helical with a large activation segment. A four-stranded b-sheet rests on the helical core and forms one surface of the active site cleft. ATP is bound in the cleft between the two lobes. (c) The phosphates of ATP are positioned by a conserved glycine-rich loop between the b1and b2-strands. (d ) Conserved residues Lys72 from the b3-strand, Glu91 from the aC-helix, and Asp164 from the DFG motif in the activation segment where Mg 2þ ions are show as purple balls. (e) The catalytic loop also contains a set of catalytically important residues: Asp166, Lys168, Asn171.
Figure 2 .
2Hydrophobic spines define the internal architecture of the EPKs. (a) Two hydrophobic spines span the two lobes of the kinase core and provide a firm but flexible connection between the N-and C-lobes. (b) The regulatory spine (R-spine) contains four residues from different kinase subdomains and is anchored to the aF-helix by conserved Asp220. The catalytic spine (C-spine) is completed by ATP. (c,d ) In the inactive state, the R-spine is typically disassembled. Disassembly of the R-spine can be achieved in different ways: by movement of the aC-helix like in cyclin-dependent kinase 2 (CDK2) (c) or by movement of the activation segment like in insulin receptor kinase (IRK) (d).
Figure 3 .
3Activation segment and the helical GHI subdomain distinguish EPKs from ELKs. The activation segment (shown in red) that joins the DFG motif to the aF-helix is shown on the left side of the two top panels while the helical GHI subdomains that follow the aF-helix are shown on the right and indicated in teal. (a) PKA, a prototype for EPKs, is compared with a eukaryote-like kinase: (b) choline kinase. (c) The extended activation segment (red), which is typically regulated by phosphorylation, is a unique feature of the EPKs. The GHI helical subdomain is also conserved in EPKs and functions as a docking site and, most likely, as an allosteric link to the active site in EPKs. While the ELKs also have helical subdomains following the F-helix, these helical regions are not conserved with respect to each other or to the EPKs (shown in teal). The GHI subdomain and the activation segment are bound to each other and to the aF-helix via a set of conserved hydrophobic interactions (shown as transparent surfaces) and a buried salt bridge Glu208-Arg280.
Figure 4 .
4Tails and linkers. Flanking regions wrap around the conserved kinase core in different ways for the various kinases but typically, the kinase core alone is not sufficient for optimal activity. These tails provide stability and allosteric mechanisms for regulation. Three EPK examples are shown: (a) protein kinase A (PKA), (b) casein kinase II (CK2) and (c) ERK2. Each kinase core is displayed as a ribbon. The N-terminal tails are shown as a teal surface while the C-terminal tails are in red.
Figure 6 .Figure 5 .
65Phosphorylation of the activation segment drives the assembly of the R-spine. (a) The fully phosphorylated active PKA catalytic subunit shows how phosphorylation of Thr197 creates the contiguous R-spine that spans both lobes. (b) The activation loop phosphate interacts with five different subdomains. (c) In the absence of phosphorylation the R-spine is broken and the C-helix is pushed away from the active site. The activation loops and the C-tails are regulated by phosphorylation. (a) Shows how the tails from the three different kinases shown in figure 4 wrap around the core in different ways but fill the same space. (b) The C-tails are a conserved feature of the AGC subfamily of EPKs. (c) The C-tail of most AGC kinases, exemplified here by PKC z (teal), are assembled into an active conformation by phosphorylation at a turn motif and at the hydrophobic motif near the C-terminus. The C-tail of PKA (red) ends with the HF motif and lacks the final phosphorylation site.
Phil. Trans. R. Soc. B (2012)
This work was supported by grants to S.S.T. from the National Institutes of Health (GM19301 and GM34921). J.M.S. was supported by NIH T32 Training grants nos GM007752 and CA009523.
The phosphorylase-B to phosphorylase-A converting enzyme of rabbit skeletal muscle. E G Krebs, E H Fischer, 10.1016/0006-3002(56)90273-6Biochim. Biophys. Acta. 20Krebs, E. G. & Fischer, E. H. 1956 The phosphorylase- B to phosphorylase-A converting enzyme of rabbit skel- etal muscle. Biochim. Biophys. Acta 20, 150-157. (doi:10.1016/0006-3002(56)90273-6)
Factors affecting the activity of muscle phosphorylase B kinase. E G Krebs, D J Graves, E H Fischer, J. Biol. Chem. 234Krebs, E. G., Graves, D. J. & Fischer, E. H. 1959 Factors affecting the activity of muscle phosphorylase B kinase. J. Biol. Chem. 234, 2867-2873.
The protein kinase complement of the human genome. G Manning, D B Whyte, R Martinez, T Hunter, S Sudarsanam, 10.1126/science.1075762doi:10. 1126/science.1075762Science. 298Manning, G., Whyte, D. B., Martinez, R., Hunter, T. & Sudarsanam, S. 2002 The protein kinase complement of the human genome. Science 298, 1912-1934. (doi:10. 1126/science.1075762)
Protein kinases: evolution of dynamic regulatory proteins. S S Taylor, A P Kornev, 10.1016/j.tibs.2010.09.006Trends Biochem. Sci. 36Taylor, S. S. & Kornev, A. P. 2011 Protein kinases: evol- ution of dynamic regulatory proteins. Trends Biochem. Sci. 36, 65-77. (doi:10.1016/j.tibs.2010.09.006)
The cellular location of adenyl cyclase in the pigeon erythrocyte. P R Davoren, E W Sutherland, J. Biol. Chem. 238Davoren, P. R. & Sutherland, E. W. 1963 The cellular location of adenyl cyclase in the pigeon erythrocyte. J. Biol. Chem. 238, 3016-3023.
The effect of l-epinephrine and other agents on the synthesis and release of adenosine 3 0 ,5 0 -phosphate by whole pigeon erythrocytes. P R Davoren, E W Sutherland, J. Biol. Chem. 238Davoren, P. R. & Sutherland, E. W. 1963 The effect of l-epinephrine and other agents on the synthesis and release of adenosine 3 0 ,5 0 -phosphate by whole pigeon erythrocytes. J. Biol. Chem. 238, 3009 -3015.
An adenosine 3 0 ,5 0 -monophosphate-dependant protein kinase from rabbit skeletal muscle. D A Walsh, J P Perkins, E G Krebs, J. Biol. Chem. 243Walsh, D. A., Perkins, J. P. & Krebs, E. G. 1968 An adenosine 3 0 ,5 0 -monophosphate-dependant protein kinase from rabbit skeletal muscle. J. Biol. Chem. 243, 3763-3765.
Interaction of the subunits of adenosine 3 0 :5 0 -cyclic monophosphate-dependent protein kinase of muscle. C O Brostrom, J D Corbin, C A King, E G Krebs, 10.1073/pnas.68.10.2444Proc. Natl Acad. Sci. USA. 68Brostrom, C. O., Corbin, J. D., King, C. A. & Krebs, E. G. 1971 Interaction of the subunits of adenosine 3 0 :5 0 -cyclic monophosphate-dependent protein kinase of muscle. Proc. Natl Acad. Sci. USA 68, 2444 -2447. (doi:10.1073/pnas.68.10.2444)
A cyclic-3 0 ,5 0 -adenosine monophosphate dependent protein kinase from the adrenal cortex: comparison with a cyclic AMP binding protein. G N Gill, L D Garren, 10.1016/0006-291X(70)90581-4Biochem. Biophys. Res. Commun. 39Gill, G. N. & Garren, L. D. 1970 A cyclic-3 0 ,5 0 -adeno- sine monophosphate dependent protein kinase from the adrenal cortex: comparison with a cyclic AMP binding protein. Biochem. Biophys. Res. Commun. 39, 335-343. (doi:10.1016/0006-291X(70)90581-4)
Separation of regulatory and catalytic subunits of the cyclic 3 0 ,5 0 -adenosine monophosphate-dependent protein kinase(s) of rabbit skeletal muscle. E M Reimann, C O Brostrom, J D Corbin, C A King, E G Krebs, 10.1016/0006-291X(71)90086-6Biochem. Biophys. Res. Commun. 42Reimann, E. M., Brostrom, C. O., Corbin, J. D., King, C. A. & Krebs, E. G. 1971 Separation of regulatory and catalytic subunits of the cyclic 3 0 ,5 0 -adenosine monophosphate-dependent protein kinase(s) of rabbit skeletal muscle. Biochem. Biophys. Res. Commun. 42, 187 -194. (doi:10.1016/0006-291X(71)90086-6)
Mechanism of activation by adenosine 3 0 :5 0 -cyclic monophosphate of a protein phosphokinase from rabbit reticulocytes. M Tao, M L Salas, F Lipmann, 10.1073/pnas.67.1.408doi:10.1073/ pnas.67.1.408Proc. Natl Acad. Sci. USA. 67Tao, M., Salas, M. L. & Lipmann, F. 1970 Mechanism of activation by adenosine 3 0 :5 0 -cyclic monophosphate of a protein phosphokinase from rabbit reticulocytes. Proc. Natl Acad. Sci. USA 67, 408 -414. (doi:10.1073/ pnas.67.1.408)
Evolution of allostery in the cyclic nucleotide binding module. N Kannan, J Wu, G S Anand, S Yooseph, A F Neuwald, J C Venter, S Taylor, 10.1186/gb-2007-8-12-r264Genome Biol. 8Kannan, N., Wu, J., Anand, G. S., Yooseph, S., Neuwald, A. F., Venter, J. C. & Taylor, S. S 2007 Evol- ution of allostery in the cyclic nucleotide binding module. Genome Biol. 8, R264. (doi:10.1186/gb-2007- 8-12-r264)
cGMP-dependent protein kinases and cGMP phosphodiesterases in nitric oxide and cGMP action. S H Francis, J L Busch, J D Corbin, D Sibley, 10.1124/pr.110.002907Pharmacol. Rev. 62Francis, S. H., Busch, J. L., Corbin, J. D. & Sibley, D. 2010 cGMP-dependent protein kinases and cGMP phosphodi- esterases in nitric oxide and cGMP action. Pharmacol. Rev. 62, 525-563. (doi:10.1124/pr.110.002907)
Structure and function of cyclic nucleotide-dependent protein kinases. S H Francis, J D Corbin, 10.1146/annurev.ph.56.030194.001321doi:10.1146/ annurev.ph.56.030194.001321Annu. Rev. Physiol. 56Francis, S. H. & Corbin, J. D. 1994 Structure and func- tion of cyclic nucleotide-dependent protein kinases. Annu. Rev. Physiol. 56, 237 -272. (doi:10.1146/ annurev.ph.56.030194.001321)
Structure of yeast regulatory subunit: a glimpse into the evolution of PKA signaling. J Rinaldi, J Wu, J Yang, C Y Ralston, B Sankaran, S Moreno, S S Taylor, 10.1016/j.str.2010.08.013Structure. 18Rinaldi, J., Wu, J., Yang, J., Ralston, C. Y., Sankaran, B., Moreno, S. & Taylor, S. S. 2010 Structure of yeast regu- latory subunit: a glimpse into the evolution of PKA signaling. Structure 18, 1471-1482. (doi:10.1016/j.str. 2010.08.013)
The regulatory subunit of a cGMP-regulated protein kinase A of Trypanosoma brucei. T Shalaby, M Liniger, T Seebeck, 10.1046/j.0014-2956.2001.02564.xEur. J. Biochem. 268Shalaby, T., Liniger, M. & Seebeck, T. 2001 The regulat- ory subunit of a cGMP-regulated protein kinase A of Trypanosoma brucei. Eur. J. Biochem. 268, 6197-6206. (doi:10.1046/j.0014-2956.2001.02564.x)
cAMP-dependent protein kinase from Plasmodium falciparum: an update. N Wurtz, C Chapus, J Desplans, D Parzy, 10.1017/S003118201000096Xdoi:10. 1017/S003118201000096XParasitology. 138Wurtz, N., Chapus, C., Desplans, J. & Parzy, D. 2011 cAMP-dependent protein kinase from Plasmodium falci- parum: an update. Parasitology 138, 1-25. (doi:10. 1017/S003118201000096X)
Relationship between the beta-adrenergic receptor and adenylate cyclase. E M Ross, M E Maguire, T W Sturgill, R L Biltonen, A G Gilman, J. Biol. Chem. 252Ross, E. M., Maguire, M. E., Sturgill, T. W., Biltonen, R. L. & Gilman, A. G. 1977 Relationship between the beta-adrenergic receptor and adenylate cyclase. J. Biol. Chem. 252, 5761-5775.
AKAP signalling complexes: focal points in space and time. W Wong, J D Scott, 10.1038/nrm1527Nat. Rev. Mol. Cell Biol. 5Wong, W. & Scott, J. D. 2004 AKAP signalling complexes: focal points in space and time. Nat. Rev. Mol. Cell Biol. 5, 959-970. (doi:10.1038/nrm1527)
Protein kinases 6. The eukaryotic protein kinase superfamily: kinase (catalytic) domain structure and classification. S K Hanks, T Hunter, FASEB J. 9Hanks, S. K. & Hunter, T. 1995 Protein kinases 6. The eukaryotic protein kinase superfamily: kinase (catalytic) domain structure and classification. FASEB J. 9, 576-596.
. D R Knighton, J H Zheng, L F Ten Eyck, V A Ashford, N H Xuong, S S Taylor, J Sowadski, Knighton, D. R., Zheng, J. H., Ten Eyck, L. F., Ashford, V. A., Xuong, N. H., Taylor, S. S. & Sowadski, J. 1991
Crystal structure of the catalytic subunit of cyclic adenosine monophosphate-dependent protein kinase. 10.1126/science.1862342Science. 253Crystal structure of the catalytic subunit of cyclic adeno- sine monophosphate-dependent protein kinase. Science 253, 407 -414. (doi:10.1126/science.1862342)
Structure of a peptide inhibitor bound to the catalytic subunit of cyclic adenosine monophosphate-dependent protein kinase. D R Knighton, J H Zheng, L F Ten Eyck, N H Xuong, S S Taylor, J M Sowadski, 10.1126/science.1862343Science. 253Knighton, D. R., Zheng, J. H., Ten Eyck, L. F., Xuong, N. H., Taylor, S. S. & Sowadski, J. M. 1991 Structure of a peptide inhibitor bound to the catalytic subunit of cyclic adenosine monophosphate-dependent protein kinase. Science 253, 414-420. (doi:10.1126/science. 1862343)
A conformational analysis of walker motif A [GXXXXGKT (S)] in nucleotide-binding and other proteins. C Ramakrishnan, V S Dani, T Ramasarma, 10.1093/protein/15.10.783doi:10.1093/ protein/15.10.783Protein Eng. 15Ramakrishnan, C., Dani, V. S. & Ramasarma, T. 2002 A conformational analysis of walker motif A [GXXXXGKT (S)] in nucleotide-binding and other proteins. Protein Eng. 15, 783 -798. (doi:10.1093/ protein/15.10.783)
Allosteric network of cAMP-dependent protein kinase revealed by mutation of Tyr204 in the Pþ1 loop. J Yang, S M Garrod, M S Deal, G S Anand, V L WoodsJr, S Taylor, 10.1016/j.jmb.2004.11.030J. Mol. Biol. 346Yang, J., Garrod, S. M., Deal, M. S., Anand, G. S., Woods Jr, V. L. & Taylor, S. 2005 Allosteric network of cAMP-dependent protein kinase revealed by mutation of Tyr204 in the Pþ1 loop. J. Mol. Biol. 346, 191 -201. (doi:10.1016/j.jmb.2004.11.030)
Surface comparison of active and inactive protein kinases identifies a conserved activation mechanism. A P Kornev, N M Haste, S S Taylor, L F Ten Eyck, 10.1073/pnas.0607656103Proc. Natl Acad. Sci. USA. 103Kornev, A. P., Haste, N. M., Taylor, S. S. & Ten Eyck, L. F. 2006 Surface comparison of active and inactive protein kinases identifies a conserved activation mechan- ism. Proc. Natl Acad. Sci. USA 103, 17 783 -17 788. (doi:10.1073/pnas.0607656103)
Structural basis for activation and inhibition of class I phosphoinositide 3-kinases. O Vadas, J E Burke, X Zhang, A Berndt, R L Williams, 10.1126/scisignal.2002165Sci. Signal. 42Vadas, O., Burke, J. E., Zhang, X., Berndt, A. & Williams, R. L. 2011 Structural basis for activation and inhibition of class I phosphoinositide 3-kinases. Sci. Signal. 4, re2. (doi:10.1126/scisignal.2002165)
Structural and functional diversity of the microbial kinome. N Kannan, S S Taylor, Y Zhai, J C Venter, G Manning, 10.1371/journal.pbio.0050017doi:10. 1371/journal.pbio.0050017PLoS Biol. 517Kannan, N., Taylor, S. S., Zhai, Y., Venter, J. C. & Manning, G. 2007 Structural and functional diversity of the microbial kinome. PLoS Biol. 5, e17. (doi:10. 1371/journal.pbio.0050017)
The crystal structure of choline kinase reveals a eukaryotic protein kinase fold. D Peisach, P Gee, C Kent, Z Xu, 10.1016/S0969-2126(03)00094-7Structure. 1103Peisach, D., Gee, P., Kent, C. & Xu, Z. 2003 The crystal structure of choline kinase reveals a eukaryotic protein kinase fold. Structure 11, 703 -713. (doi:10.1016/ S0969-2126(03)00094-7)
Structure of an enzyme required for aminoglycoside antibiotic resistance reveals homology to eukaryotic protein kinases. W C Hon, G A Mckay, P R Thompson, R M Sweet, D S Yang, G D Wright, A M Berghuis, 10.1016/S0092-8674(00)80274-3Cell. 89Hon, W. C., McKay, G. A., Thompson, P. R., Sweet, R. M., Yang, D. S., Wright, G. D. & Berghuis, A. M. 1997 Structure of an enzyme required for aminoglyco- side antibiotic resistance reveals homology to eukaryotic protein kinases. Cell 89, 887 -895. (doi:10.1016/S0092- 8674(00)80274-3)
The RSK factors of activating the Ras/MAPK signaling cascade. A Carriere, H Ray, J Blenis, P P Roux, 10.2741/3003Front. Biosci. 13Carriere, A., Ray, H., Blenis, J. & Roux, P. P. 2008 The RSK factors of activating the Ras/MAPK signaling cas- cade. Front. Biosci. 13, 4258-4275. (doi:10.2741/3003)
A conserved Glu-Arg salt bridge connects coevolved motifs that define the eukaryotic protein kinase fold. J Yang, J Wu, J M Steichen, A P Kornev, M S Deal, S Li, B Sankaran, V L WoodsJr, S S Taylor, 10.1016/j.jmb.2011.11.035doi:10.1016/j. jmb.2011.11.035J. Mol. Biol. 415Yang, J., Wu, J., Steichen, J. M., Kornev, A. P., Deal, M. S., Li, S., Sankaran, B., Woods Jr, V. L. & Taylor, S. S. 2011 A conserved Glu-Arg salt bridge connects coevolved motifs that define the eukaryotic protein kinase fold. J. Mol. Biol. 415, 666 -679. (doi:10.1016/j. jmb.2011.11.035)
Distal recognition sites in substrates are required for efficient phosphorylation by the cAMP-dependent protein kinase. S J Deminoff, V Ramachandran, P K Herman, 10.1534/genetics.109.102178doi:10.1534/ genetics.109.102178Genetics. 182Deminoff, S. J., Ramachandran, V. & Herman, P. K. 2009 Distal recognition sites in substrates are required for efficient phosphorylation by the cAMP-dependent protein kinase. Genetics 182, 529-539. (doi:10.1534/ genetics.109.102178)
Atomic structure of the MAP kinase ERK2 at 2.3 A resolution. F Zhang, A Strand, D Robbins, M H Cobb, E J Goldsmith, 10.1038/367704a0Nature. 367Zhang, F., Strand, A., Robbins, D., Cobb, M. H. & Goldsmith, E. J. 1994 Atomic structure of the MAP kinase ERK2 at 2.3 A resolution. Nature 367, 704 -711. (doi:10.1038/367704a0)
Communication pathways between the nucleotide pocket and distal regulatory sites in protein kinases. L Wong, P A Jennings, J A Adams, Wong, L., Jennings, P. A. & Adams, J. A. 2004 Communication pathways between the nucleotide pocket and distal regulatory sites in protein kinases.
. 10.1021/ar020128gAcc. Chem. Res. 37Acc. Chem. Res. 37, 304-311. (doi:10.1021/ar020128g)
Structural coupling of SH2-kinase domains links Fes and Abl substrate recognition and kinase activation. P Filippakopoulos, 10.1016/j.cell.2008.07.047Cell. 134Filippakopoulos, P. et al. 2008 Structural coupling of SH2-kinase domains links Fes and Abl substrate recog- nition and kinase activation. Cell 134, 793-803. (doi:10.1016/j.cell.2008.07.047)
Importance of the A-helix of the catalytic subunit of cAMP-dependent protein kinase for stability and for orienting subdomains at the cleft interface. F W Herberg, B Zimmermann, M Mcglone, S S Taylor, 10.1002/pro.5560060306Protein Sci. 6Herberg, F. W., Zimmermann, B., McGlone, M. & Taylor, S. S. 1997 Importance of the A-helix of the catalytic subunit of cAMP-dependent protein kinase for stability and for orienting subdomains at the cleft interface. Protein Sci. 6, 569 -579. (doi:10.1002/pro. 5560060306)
A-kinase-interacting protein localizes protein kinase A in the nucleus. M Sastri, D M Barraclough, P T Carmichael, S S Taylor, 10.1073/pnas.0408608102Proc. Natl Acad. Sci. USA. 102Sastri, M., Barraclough, D. M., Carmichael, P. T. & Taylor, S. S. 2005 A-kinase-interacting protein localizes protein kinase A in the nucleus. Proc. Natl Acad. Sci. USA 102, 349 -354. (doi:10.1073/pnas.0408608102)
The hallmark of AGC kinase functional divergence is its C-terminal tail, a cis-acting regulatory module. N Kannan, N Haste, S S Taylor, A F Neuwald, Kannan, N., Haste, N., Taylor, S. S. & Neuwald, A. F. 2007 The hallmark of AGC kinase functional divergence is its C-terminal tail, a cis-acting regulatory module.
. 10.1073/pnas.0610251104doi:10. 1073/pnas.0610251104Proc. Natl Acad. Sci. USA. 104Proc. Natl Acad. Sci. USA 104, 1272-1277. (doi:10. 1073/pnas.0610251104)
The chaperones Hsp90 and Cdc37 mediate the maturation and stabilization of protein kinase C through a conserved PXXP motif in the C-terminal tail. C M Gould, N Kannan, S S Taylor, A C Newton, 10.1074/jbc.M808436200J. Biol. Chem. 284Gould, C. M., Kannan, N., Taylor, S. S. & Newton, A. C. 2009 The chaperones Hsp90 and Cdc37 mediate the maturation and stabilization of protein kinase C through a conserved PXXP motif in the C-terminal tail. J. Biol. Chem. 284, 4921 -4935. (doi:10.1074/jbc. M808436200)
Contribution of non-catalytic core residues to activity and regulation in protein kinase A. J Yang, E J Kennedy, J Wu, M S Deal, J Pennypacker, G Ghosh, S S Taylor, 10.1074/jbc.M805862200J. Biol. Chem. 284Yang, J., Kennedy, E. J., Wu, J., Deal, M. S., Pennypacker, J., Ghosh, G. & Taylor, S. S. 2009 Contri- bution of non-catalytic core residues to activity and regulation in protein kinase A. J. Biol. Chem. 284, 6241-6248. (doi:10.1074/jbc.M805862200)
Snapping of the carboxyl terminal tail of the catalytic subunit of PKA onto its core: characterization of the sites by mutagenesis. M Batkin, I Schvartz, S Shaltiel, 10.1021/bi000153zBiochemistry. 39Batkin, M., Schvartz, I. & Shaltiel, S. 2000 Snapping of the carboxyl terminal tail of the catalytic subunit of PKA onto its core: characterization of the sites by mutagenesis. Biochemistry 39, 5366-5373. (doi:10.1021/bi000153z)
Dynamics connect substrate recognition to catalysis in protein kinase A. L R Masterson, C Cheng, T Yu, M Tonelli, A Kornev, S S Taylor, G Veglia, 10.1038/nchembio.452doi:10.1038/ nchembio.452Nat. Chem. Biol. 6Masterson, L. R., Cheng, C., Yu, T., Tonelli, M., Kornev, A., Taylor, S. S. & Veglia, G. 2010 Dynamics connect substrate recognition to catalysis in protein kinase A. Nat. Chem. Biol. 6, 821-828. (doi:10.1038/ nchembio.452)
Dynamically committed, uncommitted, and quenched states encoded in protein kinase A revealed by NMR spectroscopy. L R Masterson, L Shi, E Metcalfe, J Gao, S S Taylor, G Veglia, 10.1073/pnas.1102701108Proc. Natl Acad. Sci. USA. 108Masterson, L. R., Shi, L., Metcalfe, E., Gao, J., Taylor, S. S. & Veglia, G. 2011 Dynamically committed, uncom- mitted, and quenched states encoded in protein kinase A revealed by NMR spectroscopy. Proc. Natl Acad. Sci. USA 108, 6969 -6974. (doi:10.1073/pnas.1102701108)
Pre-steady-state kinetic analysis of cAMP-dependent protein kinase using rapid quench flow techniques. B D Grant, J A Adams, 10.1021/bi952144+Biochemistry. 35Grant, B. D. & Adams, J. A. 1996 Pre-steady-state kinetic analysis of cAMP-dependent protein kinase using rapid quench flow techniques. Biochemistry 35, 2022-2029. (doi:10.1021/bi952144+)
Crystal structure of the kinase domain of WNK1, a kinase that causes a hereditary form of hypertension. X Min, B H Lee, M H Cobb, E J Goldsmith, 10.1016/j.str.2004.04.014Structure. 12Min, X., Lee, B. H., Cobb, M. H. & Goldsmith, E. J. 2004 Crystal structure of the kinase domain of WNK1, a kinase that causes a hereditary form of hypertension. Structure 12, 1303-1311. (doi:10.1016/j.str.2004.04.014)
CASK functions as a Mg 2þ -independent neurexin kinase. K Mukherjee, M Sharma, H Urlaub, G P Bourenkov, R Jahn, T C Sudhof, M C Wahl, 10.1016/j.cell.2008.02.036Cell. 133Mukherjee, K., Sharma, M., Urlaub, H., Bourenkov, G. P., Jahn, R., Sudhof, T. C. & Wahl, M. C. 2008 CASK functions as a Mg 2þ -independent neurexin kinase. Cell 133, 328-339. (doi:10.1016/j.cell.2008.02.036)
Structure of the pseudokinase VRK3 reveals a degraded catalytic site, a highly conserved kinase fold, and a putative regulatory binding site. E D Scheeff, J Eswaran, G Bunkoczi, S Knapp, G Manning, 10.1016/j.str.2008.10.018Structure. 17Scheeff, E. D., Eswaran, J., Bunkoczi, G., Knapp, S. & Manning, G. 2009 Structure of the pseudokinase VRK3 reveals a degraded catalytic site, a highly conserved kinase fold, and a putative regulatory binding site. Structure 17, 128-138. (doi:10.1016/j.str.2008.10.018)
A Raf-induced allosteric transition of KSR stimulates phosphorylation of MEK. D F Brennan, A C Dar, N T Hertz, W C Chao, A L Burlingame, K M Shokat, D Barford, 10.1038/nature09860Nature. 472Brennan, D. F., Dar, A. C., Hertz, N. T., Chao, W. C., Burlingame, A. L., Shokat, K. M. & Barford, D. 2011 A Raf-induced allosteric transition of KSR stimulates phosphorylation of MEK. Nature 472, 366 -369. (doi:10.1038/nature09860)
Mutation that blocks ATP binding creates a pseudokinase stabilizing the scaffolding function of kinase suppressor of Ras, CRAF and BRAF. J Hu, H Yu, A P Kornev, J Zhao, E L Filbert, S S Taylor, A S Shaw, 10.1073/pnas.1102554108Proc. Natl Acad. Sci. USA. 108Hu, J., Yu, H., Kornev, A. P., Zhao, J., Filbert, E. L., Taylor, S. S. & Shaw, A. S. 2011 Mutation that blocks ATP binding creates a pseudokinase stabilizing the scaf- folding function of kinase suppressor of Ras, CRAF and BRAF. Proc. Natl Acad. Sci. USA 108, 6067-6072. (doi:10.1073/pnas.1102554108)
Global consequences of activation loop phosphorylation on protein kinase A. J M Steichen, G H Iyer, S Li, S A Saldanha, M S Deal, V L WoodsJr, S S Taylor, 10.1074/jbc.M109.061820doi:10.1074/ jbc.M109.061820J. Biol. Chem. 285Steichen, J. M., Iyer, G. H., Li, S., Saldanha, S. A., Deal, M. S., Woods Jr, V. L. & Taylor, S. S. 2010 Global con- sequences of activation loop phosphorylation on protein kinase A. J. Biol. Chem. 285, 3825-3832. (doi:10.1074/ jbc.M109.061820)
Structural basis for the regulation of protein kinase A by activation loop phosphorylation. J M Steichen, M Kuchinskas, M M Keshwani, J Yang, J A Adams, S S Taylor, 10.1074/jbc.M111.335091J. Biol. Chem. 287Steichen, J. M., Kuchinskas, M., Keshwani, M. M., Yang, J., Adams, J. A. & Taylor, S. S. 2012 Structural basis for the regulation of protein kinase A by activa- tion loop phosphorylation. J. Biol. Chem. 287, 14 672- 14 680. (doi:10.1074/jbc.M111.335091)
mTORC2 can associate with ribosomes to promote cotranslational phosphorylation and stability of nascent Akt polypeptide. W J Oh, C C Wu, S J Kim, V Facchinetti, L A Julien, M Finlan, P P Roux, B Su, E Jacinto, 10.1038/emboj.2010.271doi:10. 1038/emboj.2010.271EMBO J. 29Oh, W. J., Wu, C. C., Kim, S. J., Facchinetti, V., Julien, L. A., Finlan, M., Roux, P. P, Su, B. & Jacinto, E. 2010 mTORC2 can associate with ribosomes to promote cotranslational phosphorylation and stability of nascent Akt polypeptide. EMBO J. 29, 3939-3951. (doi:10. 1038/emboj.2010.271)
Glycogen synthase kinase (GSK)-3 promotes p70 ribosomal protein S6 kinase (p70S6K) activity and cell proliferation. S Shin, L Wolgamott, Y Yu, J Blenis, S O Yoon, 10.1073/pnas.1110195108Proc. Natl Acad. Sci. USA. 108Shin, S., Wolgamott, L., Yu, Y., Blenis, J. & Yoon, S. O. 2011 Glycogen synthase kinase (GSK)-3 promotes p70 ribosomal protein S6 kinase (p70S6K) activity and cell proliferation. Proc. Natl Acad. Sci. USA 108, E1204 - E1213. (doi:10.1073/pnas.1110195108)
PHLPP: a phosphatase that directly dephosphorylates Akt, promotes apoptosis, and suppresses tumor growth. T Gao, F Furnari, A C Newton, 10.1016/j.molcel.2005.03.008Mol. Cell. 18Gao, T., Furnari, F. & Newton, A. C. 2005 PHLPP: a phosphatase that directly dephosphorylates Akt, pro- motes apoptosis, and suppresses tumor growth. Mol. Cell 18, 13-24. (doi:10.1016/j.molcel.2005.03.008)
Enhanced dephosphorylation of cAMP-dependent protein kinase by oxidation and thiol modification. K M Humphries, M S Deal, S S Taylor, 10.1074/jbc.M410242200J. Biol. Chem. 280Humphries, K. M., Deal, M. S. & Taylor, S. S. 2005 Enhanced dephosphorylation of cAMP-dependent protein kinase by oxidation and thiol modification. J. Biol. Chem. 280, 2750-2758. (doi:10.1074/jbc.M410242200)
Structure of D-AKAP2:PKA RI complex: insights into AKAP specificity and selectivity. G N Sarma, F S Kinderman, C Kim, S Von Daake, L Chen, B C Wang, S S Taylor, 10.1016/j.str.2009.12.012Structure. 18Sarma, G. N., Kinderman, F. S., Kim, C., von Daake, S., Chen, L., Wang, B. C. & Taylor, S. S. 2010 Structure of D-AKAP2:PKA RI complex: insights into AKAP specificity and selectivity. Structure 18, 155-166. (doi:10.1016/j.str.2009.12.012)
Crystal structure of a complex between the catalytic and regulatory (RIalpha) subunits of PKA. C Kim, N H Xuong, S S Taylor, 10.1126/science.1104607Science. 307Kim, C., Xuong, N. H. & Taylor, S. S. 2005 Crystal structure of a complex between the catalytic and regulat- ory (RIalpha) subunits of PKA. Science 307, 690-696. (doi:10.1126/science.1104607)
PKA-I holoenzyme structure reveals a mechanism for cAMP-dependent activation. C Kim, C Y Cheng, S A Saldanha, S S Taylor, 10.1016/j.cell.2007.07.018Cell. 130Kim, C., Cheng, C. Y., Saldanha, S. A. & Taylor, S. S. 2007 PKA-I holoenzyme structure reveals a mechanism for cAMP-dependent activation. Cell 130, 1032-1043. (doi:10.1016/j.cell.2007.07.018)
Realizing the allosteric potential of the tetrameric protein kinase A RIalpha holoenzyme. A J Boettcher, 10.1016/j.str.2010.12.005Structure. 19Boettcher, A. J. et al. 2011 Realizing the allosteric poten- tial of the tetrameric protein kinase A RIalpha holoenzyme. Structure 19, 265 -276. (doi:10.1016/j.str. 2010.12.005)
C subunits binding to the protein kinase A RI alpha dimer induce a large conformational change. W T Heller, D Vigil, S Brown, D K Blumenthal, S S Taylor, J Trewhella, 10.1074/jbc.M313405200J. Biol. Chem. 27990Heller, W. T., Vigil, D., Brown, S., Blumenthal, D. K., Taylor, S. S. & Trewhella, J. 2004 C subunits binding to the protein kinase A RI alpha dimer induce a large conformational change. J. Biol. Chem. 279, 19 084-19 090. (doi:10.1074/jbc.M313405200)
Solution scattering reveals large differences in the global structures of type II protein kinase A isoforms. D Vigil, D K Blumenthal, S S Taylor, J Trewhella, 10.1016/j.jmb.2006.01.006doi:10.1016/j. jmb.2006.01.006J. Mol. Biol. 357Vigil, D., Blumenthal, D. K., Taylor, S. S. & Trewhella, J. 2006 Solution scattering reveals large differences in the global structures of type II protein kinase A isoforms. J. Mol. Biol. 357, 880 -889. (doi:10.1016/j. jmb.2006.01.006)
Structure and allostery of the PKA RIIb tetrameric holoenzyme. P Zhang, E V Smith-Nguyen, M M Keshwani, M S Deal, A P Kornev, S S Taylor, 10.1126/science.1213979Science. 335Zhang, P., Smith-Nguyen, E. V., Keshwani, M. M., Deal, M. S., Kornev, A. P. & Taylor, S. S. 2012 Structure and allostery of the PKA RIIb tetrameric holoenzyme. Science 335, 712-716. (doi:10.1126/science.1213979)
Signaling diversity of PKA achieved via a Ca 2þ -cAMP-PKA oscillatory circuit. Q Ni, A Ganesan, N N Aye-Han, X Gao, M D Allen, A Levchenko, J Zhang, 10.1038/nchembio.478doi:10.1038/ nchembio.478Nat. Chem. Biol. 7Ni, Q., Ganesan, A., Aye-Han, N. N., Gao, X., Allen, M. D., Levchenko, A. & Zhang, J. 2011 Signaling diversity of PKA achieved via a Ca 2þ -cAMP-PKA oscil- latory circuit. Nat. Chem. Biol. 7, 34-40. (doi:10.1038/ nchembio.478)
|
Introduction
Polyketides are a large and structurally diverse family of specialized metabolites with a wealth of applications in medicine and agriculture, such as the treatment of infectious diseases and cancer, the protection of crops, and animal health. 1 Many industrially-important polyketides are assembled by type I modular polyketide synthase (PKS) biosynthetic assembly lines. 2 These remarkable molecular machines are capable of constructing a wide range of structurally complex carbon skeletons from acyl thioester building blocks via a series of condensation and modification reactions. With the exception of the loading module, each module in such PKSs is typically responsible for one round of chain elongation and minimally contains an acyl carrier protein (ACP) domain, which is post-translationally modified via attachment of a phosphopantetheine prosthetic "arm" to a conserved serine residue and a ketosynthase (KS) domain, which catalyzes chain elongation. 2 Modular PKSs fall into two distinct phylogenetic groups that are typically distinguished by the presence or absence of acyltransferase (AT) domains in their modules. In cis-AT PKSs, each module contains an AT domain that is responsible for loading an (alkyl)malonyl extender unit onto the adjacent ACP domain, whereas in trans-AT PKSs individual modules lack AT domains.
Instead, a single AT catalyzes the transfer of malonyl extender units from coenzyme A onto the ACP domains in each module of the PKS. Modular PKSs employ several strategies for generating structural diversity, such as the incorporation of a range of starter and extender units, various αand β-carbon processing reactions after each round of chain extension and several distinct mechanisms for release of the fully-assembled polyketide chain. 1 The most frequently encountered and well-studied chain release mechanism involves macrolactonization catalyzed by a thioesterase (TE) domain appended to the C-terminus of the final PKS module. 3 Examples of TE domains that catalyze chain release via thioester hydrolysis or macrolactamization are also known. 3,4 In addition, several other types of catalytic domains have been reported to catalyze chain release. Examples include thioester reductase domains, which catalyze reductive release to form an aldehyde or primary alcohol, 5,6 α-oxoamine synthase domains, which release the polyketide chain via decarboxylative condensation with the α-carbon of an amino acid, 7,8 and KS-like domains that catalyze condensation of the polyketide chain with a glyceryl-ACP to form a 4-hydroxymethyl-2-acyltetronic acid ( Supplementary Fig. 1). 9 Enacyloxin IIa (1) is a polyketide antibiotic 10,11 with clinically-relevant activity against Acinetobacter baumannii (MIC = 3 μg/ml), 12 a problematic multidrug-resistant Gramnegative pathogen. It selectively inhibits bacterial protein biosynthesis by binding to ribosomal elongation factor Tu. [13][14][15] We recently identified the enacyloxin biosynthetic gene cluster in Burkholderia ambifaria AMMD and proposed a pathway for enacyloxin biosynthesis, involving construction of the 25-carbon acyl chain by an unusual modular PKS containing a mixture of cis and trans-AT subunits (Bamb_5925-5919). 12 Release of the fully-assembled polyketide chain from the final (Bamb_5919) subunit is proposed to proceed via an unusual dual transacylation mechanism. A non-elongating ketosynthase (KS 0 ) domain appended to the C-terminus of Bamb_5919 is hypothesized to transfer the polyketide chain from the adjacent ACP domain to the C-terminal peptidyl carrier protein (PCP) domain of Bamb_5917 (Fig. 1a). Such KS 0 domains lack a conserved His residue required for chain elongation and are commonly found in trans-AT PKSs ( Supplementary Fig. 2). They are proposed to transfer biosynthetic intermediates between ACP domains, 16,17 but biochemical evidence for this is limited to a single partially characterized example, 18 and their functional significance remains unclear. Once the fully assembled enacyloxin polyketide chain has been transferred to the PCP domain of Bamb_5917 it is proposed to be released via condensation with the C-3 hydroxyl group of (1S, 3R, 4S)-3, 4dihydroxycyclohexane carboxylic acid (DHCCA). Bamb_5915, which shows sequence similarity to condensation (C) domains, typically responsible for peptide bond formation between PCP-bound amino acyl thioesters in nonribosomal peptide synthetase (NRPS) multienzymes, is hypothesized to catalyze this reaction (Fig. 1a). 12 Here, we report an extensive set of genetic and biochemical experiments that establish the role played by Bamb_5915, Bamb_5917 and the KS 0 domain of Bamb_5919 in the unusual chain release mechanism employed by the enacyloxin PKS. These experiments demonstrate that the Bamb_5919 KS 0 domain overcomes the inability of Bamb_5915 to recognize the Bamb_5919 ACP domain by transferring the fully assembled polyketide chain to the PCP domain of Bamb_5917. We also show that Bamb_5915 possesses relaxed substrate specificity, indicating that it has the potential to be exploited for the production of novel enacyloxin analogues.
Results
Bamb_5915 and Bamb_5917 are required for enacyloxin biosynthesis
To establish whether Bamb_5915 and Bamb_5917 are required for enacyloxin IIa biosynthesis, we created in-frame deletions in the corresponding genes. Because our originally identified enacyloxin producer, B. ambifaria AMMD, proved refractory to genetic manipulation using a homing endonuclease-based mutagenesis system 19 , these deletions were created in B. ambifaria BCC0203 (also known as B. ambifaria BC-F 20 ). The enacyloxin biosynthetic gene cluster in B. ambifaria BCC0203 has the same organization as that in the AMMD strain and shows a very high degree of sequence similarity ( Supplementary Fig. 3). UHPLC-ESI-Q-TOF-MS analyses of extracts from agar cultures showed that enacyloxin production is abolished in the bamb_5915 and bamb_5917 mutants. Complementation of these mutants via in trans expression of deleted genes restored enacyloxin production (Fig. 1b). These results show that Bamb_5915 and Bamb_5917 play an essential role in enacyloxin biosynthesis.
The Bamb_5919 KS 0 domain is a carrier protein transacylase
To investigate the function of the Bamb_5919 KS 0 domain, we overproduced Bamb_5917, its C-terminal PCP domain (lacking the N-terminal domain of unknown function), and the ACP and KS 0 domains of Bamb_5919 (both individually and as an ACP-KS 0 di-domain) in E. coli as N-terminal His 6 -fusion proteins, and purified them to homogeneity using nickel affinity chromatography ( Supplementary Fig. 4). The identity of all purified proteins was confirmed by UHPLC-ESI-Q-TOF-MS (Supplementary Fig. 4; note that Bamb_5917, and the ACP/PCP domains of Bamb_5919 and Bamb_5917 are produced in their apo-forms, presumably because the E. coli phosphopantetheinyl transferase is unable to recognize them).
We first sought to establish the function of the KS 0 domain, which has been hypothesized to catalyze the transfer of the fully assembled polyketide chain from the Bamb_5919 ACP domain to the Bamb_5917 PCP domain. To investigate this hypothesis, we converted the Bamb_5917 PCP domain to its holo-form by incubating it with CoA and the phosphopantetheinyl transferase Sfp ( Supplementary Fig. 5). Similarly, an S-acetyl derivative of the holo-ACP domain from Bamb_5919 was created by incubating the apoprotein with Sfp and acetyl-CoA ( Supplementary Fig. 6). The acetylated Bamb_5919 ACP domain was incubated with the Bamb_5919 KS 0 domain and the Bamb5917 holo-ACP domain to examine whether the KS 0 domain can transfer the acetyl group (which serves as a simple mimic of the fully assembled enacyloxin polyketide chain) from the ACP domain to the PCP domain. UHPLC-ESI-Q-TOF-MS analyses of the resulting mixture showed that 40.2 ± 1.4 % of the PCP domain underwent acetylation (Fig. 2a). Due to the similar bond enthalpies for the linkages broken/formed in this reaction, an approximately 1:1 mixture of the ACP and PCP thioesters is produced. The level of acetylation of the Bamb_5917 PCP domain significantly decreased when the Bamb_5919 KS 0 domain was omitted from the reaction (8.4 ± 0.9 %), or when it was replaced with a C1988A mutant (in which the thiol group has been removed from the active site Cys residue; 7.9 ± 0.8 %). These data are consistent with the hypothesis that the KS 0 domain catalyses translocation of the fully assembled polyketide chain in enacyloxin biosynthesis from the Bamb_5919 ACP domain to the Bamb_5917 PCP domain. Substitution of the Bamb_5919 ACP and KS 0 domains with the ACP-KS 0 di-domain, or the Bamb_5917 PCP domain with full-length Bamb_5917 in these experiments gave analogous results (Supplementary Fig. 7 and 8). This shows that neither the covalent linkage between the ACP and KS 0 domains, nor the N-terminal appendage of the PCP domain present in the wild type system are critical for catalysis of the transacylation reaction.
To directly probe the acylation of the active site Cys residue in the Bamb_5919 KS 0 domain during the transfer of the acetyl group from the Bamb_5919 ACP domain to the Bamb_5917 PCP domain, the KS 0 domain was incubated with a 10-fold molar excess of the acetylated Bamb_5919 ACP domain. Analysis of the protein mixture by UHPLC-ESI-Q-TOF-MS showed that the KS 0 domain undergoes acetylation (35.1 ± 2.3 %) (Fig. 2b). In contrast, no acetylation was observed in such analyses when the acetylated Bamb_5919 ACP domain was incubated with the C1988A mutant of the KS 0 domain.
Bamb_5915 catalyzes chain release from Bamb_5917
The role played by Bamb_5915 (a homologue of NRPS C domains) in enacyloxin biosynthesis was similarly investigated via overproduction in E. coli as an N-terminal His 6 fusion protein, purification using nickel affinity chromatography and confirmation of Masschelein Fig. 4). The S-acetyl derivative of the Bamb_5917 holo-PCP domain was created by incubating the apo-protein with acetyl-CoA and Sfp ( Supplementary Fig. 6). Incubation of this simple mimic of the Bamb_5917-bound enacyloxin polyketide chain with Bamb_5915 and chemically synthesized racemic DHCCA resulted in the production of a monoacetylated DHCCA derivative, as evidenced by UHPLC-ESI-Q-TOF-MS analyses ( Supplementary Fig. 9). The greater thermodynamic stability of the ester bond formed in this reaction than the thioester bond in the acetylated PCP drives product formation. No acetylation of DHCCA was observed when Bamb_5915 was omitted from the reaction. We were unable to confirm the structure of the monoacetylated DHCCA derivative produced in the Bamb_5915-catalysed reaction, due to its propensity to undergo rearrangement during purification and the difficulty of preparing authentic standards. To circumvent this problem, we synthesized racemic (1S, 3R, 4S)-3amino-4-hydroxycyclohexane carboxylic acid (AHCCA), an analogue of DHCCA containing an amino group in place of the C-3 hydroxyl group. Incubation of AHCCA with the acetylated Bamb_5917 PCP domain and Bamb_5915 resulted in a monoacetylated product (Fig. 3a). The identity of this product was confirmed as N-acetyl-AHCCA by comparison with a chemically-synthesised standard (Fig. 3a). None of this product was formed when Bamb_5915 was omitted from the reaction (Fig. 3a), or when an H205A mutant of Bamb_5915 (in which the active site His residue known to play an important role in catalysis in NRPS C domains has been altered) was employed ( Supplementary Fig. 10).
Chain transfer is necessitated by Bamb_5915 carrier protein specificity
Having established that Bamb_5915 is able to catalyse chain release from Bamb_5917, we next investigated whether this enzyme can also offload acyl groups from the Bamb_5919 ACP domain. Thus, the acetylated Bamb_5919 ACP domain was incubated with Bamb_5915 and AHCCA. No products with an m/z corresponding to mono-acetylated AHCCA could be detected by UHPLC-ESI-Q-TOF-MS analysis of the reaction mixture, indicating that Bamb_5915 is unable to recognise acyl groups bound to the Bamb_5919 ACP domain (Fig. 3b). These data are consistent with the ability of the Bamb_5919 KS 0 domain to transfer acyl groups from the Bamb_5919 ACP domain to the Bamb_5917 PCP domain and strongly indicate that such transacylation is required to circumvent the intrinsic carrier protein specificity of Bamb_5915. To directly test this hypothesis, we incubated the acetylated Bamb_5919 ACP domain with the Bamb_5919 KS 0 and Bamb_5917 holo-PCP domains, Bamb_5915 and AHCCA. UHPLC-ESI-Q-TOF-MS analyses confirmed that Nacetyl-AHCCA is produced in this reaction (Fig. 4). When the Bamb_5919 KS 0 domain was omitted from the reaction or replaced by the C1988A mutant, small amounts of N-acetyl-AHCCA were still produced (Fig. 4). This likely results from uncatalyzed transfer of the acetyl group from the Bamb_5919 ACP domain to the Bamb_5917 PCP domain via direct transthioesterifcation, which has been observed in related systems. 21 It is not the result of the spontaneous transfer of the acetyl group from the acetylated Bamb_5919 ACP domain to AHCCA, because no N-acetyl-AHCCA was detected when Bamb_5915 was omitted from the reaction (Fig. 4). Analogous results were obtained when the acetylated full length Bamb_5917 protein was used in place of the acetylated Bamb_5917 PCP domain ( Supplementary Fig. 11). This indicates that the cryptic N-terminal domain of Bamb_5917 plays no specific role in the chain release process and is likely an evolutionary remnant.
However, other roles for this domain (e.g. in mediating protein-protein interactions with other components of the biosynthetic machinery) cannot be excluded. To provide further evidence for the relevance of these findings to chain release from the enacyloxin PKS, we repeated the experiments with acyl groups that more closely mimic the fully assembled enacyloxin polyketide chain. Thus, dodecanoylated and (2E, 4E)-2, 4-hexadienoylated-Bamb_5917_ACP domain were incubated separately with the Bamb_5919 KS 0 and Bamb_5917 holo-PCP domains and Bamb_5915. In both cases, a monoacylated AHCCA derivative was produced ( Supplementary Figs 12 and 13). No product could be detected when Bamb_5915 or the Bamb_5919 KS 0 domain were omitted from reaction, or when the C1988A mutant of the KS 0 domain was used ( Supplementary Figs 12 and 13). Taken together, our data show that Bamb_5915 is unable to interact productively with the Bamb_5919 ACP domain. This necessitates transfer of the fully assembled enacyloxin polyketide chain to the Bamb_5917 PCP domain (catalysed by the Bamb_5919 KS 0 domain) where it is released by Bamb_5915 via condensation with DHCCA.
Bamb_5915 tolerates various acyl acceptor and donor analogues
The observation that Bamb_5915 can tolerate an acetyl thioester and AHCCA in place of the natural acyl donor and acceptor, respectively, prompted us to further investigate the substrate tolerance of this enzyme. To probe acyl acceptor specificity, we incubated Bamb_5915 with the acetylated Bamb_5917 PCP domain and several chemically-synthesized and commercially available DHCCA analogues. Analysis of the reaction mixtures by UHPLC-ESI-Q-TOF-MS showed that Bamb_5915 is able to accept a variety of carbocyclic DHCCA analogues with variations in ring size, degree of unsaturation, substitution pattern and stereochemistry ( Fig. 5a and Supplementary Fig. 9). Moreover, the enzyme was also able to utilise acyclic DHCCA analogues, such as γ-aminobutyric acid (Fig. 5a). Indeed, the minimal determinant of substrate acceptance by Bamb_5915 appears to be the 1, 3juxtaposition of a nucleophile and a carboxyl group (Fig. 5a and Fig. 5b). The acyl donor specificity of Bamb_5915 was investigated by assessing its ability to catalyse acylation of AHCCA with several N-acetyl cysteamine (NAC) thioester analogues of the native substrate ( Supplementary Fig. 14). While various straight chain thioesters (e.g. acetyl, propionyl, and (2E, 4E)-2, 4-hexadienoyl) were well tolerated by Bamb_5915, little or no acylation of AHCCA was observed when the enzyme was incubated with α-branched substrates, such as isobutyryl, pivaloyl and serinyl-NAC thioesters.
Discussion
The dual transacylation mechanism elucidated here for chain release from the enacyloxin modular polyketide synthase has several unusual features. First, it involves a rare intermolecular esterification reaction catalyzed by a standalone C domain, 22 which is a novel mechanism for modular PKS chain release. Second, the standalone C domain appears to possess uncommonly broad substrate tolerance towards both acyl acceptors and acyl donors, and third, the polyketide chain must be translocated by a KS 0 domain from a carrier protein domain that is not recognized by the C domain, to one that is, for chain release to occur.
KS 0 domains are a common feature of trans-AT PKSs, 16 but their functional significance has remained unclear. Our data show that the KS 0 domain appended to the C-terminus of Bamb_5919 functions as a transacylase, consistent with the hypothesis that it shuttles the fully assembled polyketide chain from the upstream ACP domain to the PCP domain of Bamb_5917. This is necessary because Bamb_5915, an NRPS-like C domain that catalyzes polyketide chain release via intermolecular esterification with DHCCA, can recognize acyl donors when they are attached to the Bamb-5917 PCP domain, but not the Bamb_5919 ACP domain. Indeed, KS 0 domains are commonly found at the interface between PKS and NRPS subunits in hybrid trans-AT PKS/NRPS assembly lines (Fig. 6), 16 where they have been shown to play an essential role, 17 and are proposed to translocate an acyl thioester intermediate from an upstream ACP/PCP domain to a downstream PCP/ACP domain. 16 Thus, the inability of C (and other NRPS catalytic) domains to recognize acyl donors when they are attached to trans-AT PKS ACP domains appears to be a general phenomenon. Our results suggest that KS 0 domains have been recruited during the evolution of many such hybrid systems as "adapters" to overcome this obstacle. In the accompanying manuscript, we show that protein-protein interactions mediated by mutually-compatible docking domains are primarily responsible for the specific recognition of the Bamb_5917 PCP domain by Bamb_5915. 23 While it seems very likely that such interactions also underlie similar carrier protein incompatibilities in other systems, further experiments will be required to establish their precise nature.
In (Fig. 6). In the all of these cases, it seems likely that the catalytic domains downstream of the KS 0 domains cannot interact productively with the ACP/PCP domains upstream of them. The KS 0 domains therefore transfer the acyl chains attached to these ACP/PCP domains to the downstream ACP/PCP domains, which can be recognized by the adjacent catalytic domains, allowing the reactions they catalyze to proceed. Modules that recruit trans-acting oxygenases, which modify the growing polyketide chain during its assembly, also employ KS 0 domains. 16 These appear to transfer the requisite intermediate onto an ACP domain that can be recognized by the oxygenase. Further experiments will be required to test these hypotheses, but one obvious consequence is that in each case the ACP/PCP domain downstream of the KS 0 domain must avoid being loaded with a malonyl extender unit by the trans-acting AT. Whether this is controlled solely by protein-protein interactions, as demonstrated for selective ACP recognition by the trans-AT KirCII in kirromycin biosynthesis, 24 or more complex phenomena remains to be established. There is no selective pressure to maintain the HGTGT motif in a KS domain when it is positioned upstream of an ACP or PCP domain that cannot be malonylated. Thus KS 0 domains probably evolved from elongating KS domains via the random accumulation of mutations in the HGTGT motif ( Supplementary Fig. 2).
Although enacyloxin IIa has promising activity against A. baumannii, 12 a multi-drug resistant pathogen for which new antibiotics are urgently required, it is unlikely to find direct clinical application. Enacyloxin analogues with enhanced potency, reduced toxicity and greater chemical stability are therefore needed. The broad acyl acceptor tolerance of Bamb_5915 demonstrated by our work indicates that it may be possible to produce enacyloxin analogues with modifications to the DHCCA moiety via biosynthetic engineering. One attractive strategy for doing this involves feeding of DHCCA analogues to mutants of B. ambifaria blocked in DHCCA biosynthesis. Bamb_5915 is also able to accept a range of thioesters as acyl donors, suggesting that it may be possible to make analogues of enacyloxin with modifications to the polyketide chain via the manipulation of tailoring genes and other biosynthetic engineering strategies. Together, such approaches offer the potential to deliver a library of enacyloxin analogues that illuminate the structure-activity relationship of the natural product, which would be an important milestone in its development towards therapeutic application.
In conclusion, our results provide important insights into the mechanism and specificity of chain release from the enacyloxin polyketide synthase. They not only suggest a general role for KS 0 domains in overcoming an intrinsic incompatibility between several types of catalytic domains and certain types of carrier protein domain in trans-AT PKSs, but also define plausible approaches for the production of enacyloxin analogues via biosynthetic engineering.
Methods
See the Supplementary Information for a description of the methods employed.
Supplementary Material
Refer to Web version on PubMed Central for supplementary material. genes are also shown (bottom and third from bottom, respectively). The peak corresponding to enacyloxin IIa is indicated with an asterisk. The other peaks are isomers resulting from light / acid-promoted isomerization during isolation / analysis. Examples of trans-AT PKS architectures containing KS 0 domains. In each case, we hypothesize that the catalytic domain downstream of the KS 0 domain is unable to interact with the upstream ACP/PCP domain. The KS 0 domain thus transfers the substrate from the upstream to the downstream carrier protein domain, which the neighbouring catalytic domain is able to interact with, allowing the reaction it catalyses to proceed. Domains (other than the KS 0 domain) we propose are able to engage in productive protein-protein interactions are shown in the same colour.
the broader context, KS 0 domains are frequently found juxtaposed between up-and downstream ACP/PCP domains in several other types of trans-AT PKS architecture. 16 Common examples include: ACP-KS 0 -PCP-Cy; PCP-KS 0 -ACP-KS; ACP-KS 0 -ACP-TE; ACP-KS 0 -OMT-ACP; ACP-KS 0 -DH-ACP; and ACP-KS 0 -ER-ACP (domain abbreviations not defined previously are as follows: Cy, heterocyclisation; KR, ketoreductase; DH, dehydratase and related domains, including enoyl isomerases and pyran synthases; OMT, Omethyltransferase; ER, enoyl reductase)
Fig 1 .
1Proposed mechanism for chain release from the enacyloxin PKS and confirmation that Bamb_5915 and Bamb_5917 are involved in enacyloxin biosynthesis. (a) Proposed dual transacylation mechanism for chain release from the type I modular PKS responsible for enacyloxin IIa (1) biosynthesis. The KS 0 domain at the C-terminus of Bamb_5919 (the final PKS module) is proposed to transfer the fully-assembled polyketide chain from the upstream ACP domain to the Bamb_5917 PCP domain. Bamb_5915, which shows sequence similarity to NRPS C domains, catalyzes condensation of the resulting thioester with (1S, 3R, 4S)-3,4dihydroxycyclohexane carboxylic acid. (b) Deletion of the genes encoding Bamb_5915 and Bamb_5917 abolishes enacyloxin production in B. ambifaria BCC0203. Extracted ion chromatograms at m/z = 724.2267 ± 0.005 (corresponding to the [M+Na] + ion for enacyloxin IIa) from UHPLC-ESI-Q-TOF-MS analyses of extracts from agar-grown cultures of wild type B. ambifaria BCC0203 (top), the bamb_5917 (second from top) and bamb_5915 (second from bottom) mutants. The chromatograms for extracts from the bamb_5915 and bamb_5917 mutants complemented by in trans expression of the deleted
Fig 2 .
2Acyl transfer and active site acylation assays reveal that the KS 0 domain of Bamb_5919 functions as a transacylase. (a) Deconvoluted mass spectra from incubation of the holo-Bamb_5917 PCP domain with the acetylated Bamb_5919 ACP domain in the presence of the Bamb_5919 KS 0 domain (top) and the C1988A mutant of the KS 0 domain (middle), and in the absence of the KS 0 domain (bottom). The data demonstrate that the KS 0 domain is able to transfer an acetyl group from the ACP domain to the PCP domain and that the active site Cys residue of the KS 0 domain is required for this reaction. Due to the similar bond enthalpies for the thioester linkages broken/formed in the reaction catalyzed by the KS 0 domain an approximately 1:1 mixture of starting material and product is formed. (b) Deconvoluted mass spectra of the Bamb_5919 ACP domain (left), the Bamb_5919 KS 0 domain (top right) and the C1988A mutant of the Bamb_5919 KS 0 domain (bottom right), following incubation of the wild type and mutant KS 0 domains with a 10-fold excess of acetyl-Bamb_5919 ACP. Transfer of the acetyl group from the ACP domain to the KS 0 domain is observed for the wild type enzyme (top), but not for the mutant in which the active site Cys residue has been mutated to Ala (bottom). The data shown are from a single measurement and are representative of three independent experiments.
Fig. 3 .
3Functional characterization of Bamb_5915. Extracted ion chromatograms at m/z = 224.089 ± 0.005 (corresponding to the [M+Na] + ion for N-acetyl-AHCCA) from UHPLC-ESI-Q-TOF-MS analyses of Bamb_5915-calaysed reactions. (a) Incubation of the acetylated Bamb_5917 PCP domain with AHCCA and Bamb_5915 results in a monoacetylated product with the same retention time as a chemically synthesized authentic standard of Nacetyl-AHCCA. (b) No acetylated products are observed when Bamb_5915 and AHCCA are incubated with the acetylated Bamb_5919 ACP domain. . Author manuscript; available in PMC 2020 March 23.
Fig. 4 .
4In vitro reconstitution of chain release from the enacyloxin PKS. Extracted ion chromatograms at m/z = 224.089 ± 0.005 (corresponding to the [M+Na] + ion for N-acetyl-AHCCA) from LC-ESI-Q-TOF-MS analyses of synthetic N-acetyl-AHCCA (top), and the product of the reaction of the acetylated Bamb_5919 ACP domain with the Bamb_5915 KS 0 domain, the Bamb_5917 holo-PCP domain, Bamb_5915 and AHCCA (second from top). The bottom three chromatograms are from control reactions in which Bamb_5915 has been omitted (third from bottom), the Bamb_5919 KS 0 domain has been omitted (second from bottom), and the C1988A mutant of the Bamb_5919 KS 0 domain has been used in place of the wild type enzyme (bottom).
Fig. 5 .
5Bamb_5915 tolerates a wide range of acyl acceptors. Overview of DHCCA analogues tested as substrates for Bamb_5915 using acetylated Bamb_5917 as an acyl donor. (a) Structures of DHCCA analogues converted to monoacetylated products by Bamb_5915. (b) DHCCA analogues not accepted as substrates by Bamb_5915.
Fig. 6 .
6Fig. 6.
Nat Chem. Author manuscript; available in PMC 2020 March 23.et al.
Page 4
Europe PMC Funders Author Manuscripts
identity by UHPLC-ESI-Q-TOF-MS (Supplementary
Nat Chem. Author manuscript; available in PMC 2020 March 23.
AcknowledgementsThis research was supported by grants from the BBSRC (BB/L021692/1 to G.L.C., E.M. and J.P., and BB/ K002341/1 to G.L.C.), the European Commission (through a Marie Sklodowska-Curie Fellowship to J.M.; contract no. 656067) and the Research Foundation Flanders (to J.M.). Support from the University of Warwick is gratefully acknowledged through a fellowship from the Institute of Advanced Study (to P.K.S.) and a PhD studentshipData availabilityThe genome sequence of B. ambifaria BCC0203 was deposited in the European Nucleotide Archive (Accession No. ERS782625). All other data are available from the authors upon request. Masschelein
The biosynthetic logic of polyketide diversity. C Hertweck, Angew Chem Int Ed Engl. 48PubMed: 19514004Hertweck C. The biosynthetic logic of polyketide diversity. Angew Chem Int Ed Engl. 2009; 48:4688-4716. [PubMed: 19514004]
Assembly-line enzymology for polyketide and nonribosomal peptide antibiotics: logic, machinery, and mechanisms. M A Fischbach, C T Walsh, Chem Rev. 106PubMed: 16895337Fischbach MA, Walsh CT. Assembly-line enzymology for polyketide and nonribosomal peptide antibiotics: logic, machinery, and mechanisms. Chem Rev. 2006; 106:3468-3496. [PubMed: 16895337]
PKS and NRPS release mechanisms. L Du, L Lou, Nat Prod Rep. 27PubMed: 20111804Du L, Lou L. PKS and NRPS release mechanisms. Nat Prod Rep. 2010; 27:255-278. [PubMed: 20111804]
Leinamycin biosynthesis revealing unprecedented architectural complexity for a hybrid polyketide synthase and nonribosomal peptide synthetase. G-L Tang, Y-Q Cheng, B Shen, Chem Biol. 11PubMed: 15112993Tang G-L, Cheng Y-Q, Shen B. Leinamycin biosynthesis revealing unprecedented architectural complexity for a hybrid polyketide synthase and nonribosomal peptide synthetase. Chem Biol. 2004; 11:33-45. [PubMed: 15112993]
Thioester reduction and aldehyde transamination are universal steps in actinobacterial polyketide alkaloid biosynthesis. U R Awodi, J L Ronan, J Masschelein, Elc De Los Santos, G L Challis, Chem Sci. 8PubMed: 28451186Awodi UR, Ronan JL, Masschelein J, de Los Santos ELC, Challis GL. Thioester reduction and aldehyde transamination are universal steps in actinobacterial polyketide alkaloid biosynthesis. Chem Sci. 2017; 8:411-415. [PubMed: 28451186]
Natural products from thioester reductase containing biosynthetic pathways. M W Mullowney, R A Mcclure, M T Robey, N L Kelleher, R J Thomson, Nat Prod Rep. 35PubMed: 29916519Mullowney MW, McClure RA, Robey MT, Kelleher NL, Thomson RJ. Natural products from thioester reductase containing biosynthetic pathways. Nat Prod Rep. 2018; 35:847-878. [PubMed: 29916519]
Elucidation of the Streptomyces coelicolor pathway to 2-undecylpyrrole, a key intermediate in undecylprodiginine and streptorubin B biosynthesis. S J Mo, Chem Biol. 15PubMed: 18291318Mo SJ, et al. Elucidation of the Streptomyces coelicolor pathway to 2-undecylpyrrole, a key intermediate in undecylprodiginine and streptorubin B biosynthesis. Chem Biol. 2008; 15:137-148. [PubMed: 18291318]
Structure, chemical synthesis, and biosynthesis of prodiginine natural products. D X Hu, D M Withall, G L Challis, R J Thomson, Chem Rev. 116PubMed: 27314508Hu DX, Withall DM, Challis GL, Thomson RJ. Structure, chemical synthesis, and biosynthesis of prodiginine natural products. Chem Rev. 2016; 116:7818-7853. [PubMed: 27314508]
In vitro reconstruction of tetronate RK-682 biosynthesis. Y Sun, Nat Chem Biol. 6PubMed: 20081823Sun Y, et al. In vitro reconstruction of tetronate RK-682 biosynthesis. Nat Chem Biol. 2010; 6:99- 101. [PubMed: 20081823]
New polyenic antibiotics active against gram-positive andnegative bacteria. I. Isolation and purification of antibiotics produced by Gluconobacter sp. T Watanabe, K Izaki, H Takahashi, 315Watanabe T, Izaki K, Takahashi H. New polyenic antibiotics active against gram-positive and- negative bacteria. I. Isolation and purification of antibiotics produced by Gluconobacter sp. W-315.
. J Antibiot (Tokyo). 35PubMed: 6216233J Antibiot (Tokyo). 1982; 35:1141-1147. [PubMed: 6216233]
New polyenic antibiotics active against Gram-positive and Gram-negative bacteria. IV. Structural elucidation of enacyloxin IIa. T Watanabe, J Antibiot (Tokyo). 45PubMed: 1592680Watanabe T, et al. New polyenic antibiotics active against Gram-positive and Gram-negative bacteria. IV. Structural elucidation of enacyloxin IIa. J Antibiot (Tokyo). 1992; 45:470-475. [PubMed: 1592680]
Enacyloxins are products of an unusual hybrid modular polyketide synthase encoded by a cryptic Burkholderia ambifaria Genomic Island. E Mahenthiralingam, Chem Biol. 18PubMed: 21609847Mahenthiralingam E, et al. Enacyloxins are products of an unusual hybrid modular polyketide synthase encoded by a cryptic Burkholderia ambifaria Genomic Island. Chem Biol. 2011; 18:665- 677. [PubMed: 21609847]
Enacyloxin IIa, an inhibitor of protein biosynthesis that acts on elongation factor Tu and the ribosome. R Cetin, EMBO J. 15PubMed: 8665868Cetin R, et al. Enacyloxin IIa, an inhibitor of protein biosynthesis that acts on elongation factor Tu and the ribosome. EMBO J. 1996; 15:2604-2611. [PubMed: 8665868]
Enacyloxin IIa pinpoints a binding pocket of elongation factor Tu for development of novel antibiotics. A Parmeggiani, J Biol Chem. 281PubMed: 16257965Parmeggiani A, et al. Enacyloxin IIa pinpoints a binding pocket of elongation factor Tu for development of novel antibiotics. J Biol Chem. 2006; 281:2893-2900. [PubMed: 16257965]
Mutant EF-Tu species reveal novel features of the enacyloxin IIa inhibition mechanism on the ribosome. A M Zuurmond, L N Olsthoorn-Tieleman, Martien De Graaf, J Parmeggiani, A Kraal, B , J Mol Biol. 294PubMed: 10610785Zuurmond AM, Olsthoorn-Tieleman LN, Martien de Graaf J, Parmeggiani A, Kraal B. Mutant EF- Tu species reveal novel features of the enacyloxin IIa inhibition mechanism on the ribosome. J Mol Biol. 1999; 294:627-637. [PubMed: 10610785]
Biosynthesis of polyketides by trans-AT polyketide synthases. Ejn Helfrich, J Piel, Nat Prod Rep. 33PubMed: 26689670Helfrich EJN, Piel J. Biosynthesis of polyketides by trans-AT polyketide synthases. Nat Prod Rep. 2016; 33:231-316. [PubMed: 26689670]
Characterization of the ketosynthase and acyl carrier protein domains at the LnmI nonribosomal peptide synthetase-polyketide synthase interface for leinamycin biosynthesis. Y Huang, G-L Tang, G Pan, C-Y Chang, B Shen, Org Lett. 18PubMed: 27541042Huang Y, Tang G-L, Pan G, Chang C-Y, Shen B. Characterization of the ketosynthase and acyl carrier protein domains at the LnmI nonribosomal peptide synthetase-polyketide synthase interface for leinamycin biosynthesis. Org Lett. 2016; 18:4288-4291. [PubMed: 27541042]
Cis-Double Bond Formation by Thioesterase and Transfer by Ketosynthase in FR901464 Biosynthesis. H-Y He, M-C Tang, F Zhang, G-L Tang, J Am Chem Soc. 136PubMed: 24617828He H-Y, Tang M-C, Zhang F, Tang G-L. Cis-Double Bond Formation by Thioesterase and Transfer by Ketosynthase in FR901464 Biosynthesis. J Am Chem Soc. 2014; 136:4488-4491. [PubMed: 24617828]
A system for the construction of targeted unmarked gene deletions in the genus Burkholderia. R S Flannagan, T Linn, M A Valvano, Environ Microbiol. 10PubMed: 18341581Flannagan RS, Linn T, Valvano MA. A system for the construction of targeted unmarked gene deletions in the genus Burkholderia . Environ Microbiol. 2008; 10:1652-1660. [PubMed: 18341581]
Broad spectrum antibiotic activity and disease suppression by the potential biocontrol agent Burkholderia ambifaria BC-F. W Li, Crop Prot. 21Li W, et al. Broad spectrum antibiotic activity and disease suppression by the potential biocontrol agent Burkholderia ambifaria BC-F. Crop Prot. 2002; 21:129-135.
Skipping in a hybrid polyketide synthase: evidence for ACP-to-ACP chain transfer. I Thomas, C J Martin, C J Wilkinson, J Staunton, P F Leadlay, Chem Biol. 9PubMed: 12144921Thomas I, Martin CJ, Wilkinson CJ, Staunton J, Leadlay PF. Skipping in a hybrid polyketide synthase: evidence for ACP-to-ACP chain transfer. Chem Biol. 2002; 9:781-787. [PubMed: 12144921]
A free-standing condensation enzyme catalyzing ester bond formation in C-1027 biosynthesis. S Lin, S G Van Lanen, B Shen, Proc Natl Acad Sci U S A. 106PubMed: 19246381Lin S, Van Lanen SG, Shen B. A free-standing condensation enzyme catalyzing ester bond formation in C-1027 biosynthesis. Proc Natl Acad Sci U S A. 2009; 106:4183-4188. [PubMed: 19246381]
Molecular basis for condensation domain-mediated chain release from the enacyloxin polyketide synthase. S Kosol, Nat Chem. Kosol S, et al. Molecular basis for condensation domain-mediated chain release from the enacyloxin polyketide synthase. Nat Chem.
Reprogramming acyl carrier protein interactions of an acyl-CoA promiscuous trans-acyltransferase. Z Ye, E M Musiol, T Weber, G J Williams, Cell Chem Biol. 21Ye Z, Musiol EM, Weber T, Williams GJ. Reprogramming acyl carrier protein interactions of an acyl-CoA promiscuous trans-acyltransferase. Cell Chem Biol. 2014; 21:636-646.
. Masschelein, 10Masschelein et al. Page 10
Author manuscript; available in PMC. Nat Chem. Nat Chem. Author manuscript; available in PMC 2020 March 23.
|
The bacterial phosphoenolpyruvate(PEP) 1 :sugar phosphotransferase system (PTS) is a complex protein system that mediates uptake and concomitant phosphorylation of carbohydrates (1)(2)(3). Characterized PTS proteins include the cytoplasmic Enzyme I and HPr, which lack sugar specificity, and membranous Enzyme II complexes, each specific for one or a few sugars. The latter complexes usually consist of three proteins or protein domains that are designated IIA, IIB, and IIC (4). The phosphoryl relay proceeds sequentially from PEP to Enzyme I, HPr, IIA, IIB, and finally to the incoming sugar that is transported across the membrane and concomitantly phosphorylated by IIC. The PTS is present in a wide variety of Grampositive and Gram-negative bacteria, but PTS protein homologues have not been found in archaea or eukaryotes. In addition to its primary functions in sugar transport, sugar phosphorylation, and chemoreception, the PTS is involved in regulatory processes such as catabolite repression and inducer exclusion (5,6).
Novel PTS proteins, NPr and IIA Ntr (paralogues of HPr and IIA Fru , respectively), are encoded by the npr and ptsN genes, respectively, localized to the rpoN operon of Escherichia coli, which also encodes the nitrogen-related factor, 54 (7)(8)(9)(10). ptsN deletion mutants lacking IIA Ntr exhibit a growth defect in the presence of an organic nitrogen source and a sugar or tricarboxylic acid cycle intermediate. Protein phosphorylation involving NPr and IIA Ntr was suggested to function in linking carbon and nitrogen metabolism, and IIA Ntr has also been implicated in the regulation of the essential GTPase, Era, which appears to function in cell cycle progression and the initiation of cell division (10,11). IIA Ntr homologues have been identified in numerous Gram-negative bacteria (10), and a link between the ptsN gene and nitrogen regulation has been suggested for Rhizobium etli (12), Pseudomonas aeruginosa (13), and Klebsiella pneumoniae (14). The crystal structure of Enzyme IIA Ntr has recently been determined (15).
Analysis of the E. coli genome revealed a gene, ptsP, encoding Enzyme I Ntr (EI Ntr ), consisting of 2 domains, an N-terminal domain of 127 amino acids homologous to the N-terminal "sensory" domain of the NifA protein of Azotobacter vinelandii (16) and a C-terminal domain of 578 amino acids homologous to all currently sequenced enzymes I. EI Ntr was suggested to serve a sensory function linking carbon and nitrogen metabolism (17). A mutation in the orthologous EI Ntr -encoding ptsP gene of A. vinelandii resulted in impaired metabolism of poly--hydroxybutyrate as well as diminished respiratory protection of nitrogenase under carbon-limiting conditions (18).
In the present study we report the cloning and overexpression of the ptsP gene from E. coli, the purification of EI Ntr , and the characterization of its biochemical activities. The results of these studies establish for the first time the existence of parallel but independent PTS phosphoryl transfer chains in which distinct Enzyme I paralogues exhibit specificity for their cognate HPr paralogues. Residues are identified that may account for this specificity.
MATERIALS AND METHODS
Bacterial Strains, Plasmids, and Chemicals Used-Salmonella typhimurium strain SB2950(⌬cysKptsHIcrr⌬trpB223) has been described (19). The cloning vector pCR2.1 TM was from Invitrogen (San Diego, CA).
Plasmid pJRENtr used for overexpression of EI Ntr is described below. Purified ppGpp was kindly provided by Mike Cashel (National Institutes of Health, Bethesda, MD). [U-14 C]D-Mannitol (specific activity 32 mCi/mmol) and [␥-32 P]ATP (specific activity Ͼ4000 Ci/mmol) were obtained from ICN (Costa Mesa, CA). Other chemicals were of analytical grade.
Cloning of ptsP and Purification of EI Ntr -A DNA fragment containing the ptsP gene encoding EI Ntr was amplified by polymerase chain reaction using E. coli genomic DNA. The top strand primer (Ntr1) contained a NdeI site within the initiation codon (underlined) of ptsP, 5Ј-ACACGAATTCCATATGCTCACTCGCCTGCGCGAAATAG-3Ј. The bottom strand (Ntr2) contained a SalI site (underlined) 5Ј-CTAAGTC-GACATGATCCGCGCTATAACCCTCCGCGAA-3Ј. Amplification was performed with a Hybaid thermal reactor (Hybaid Ltd., Teddigton, Middlessex, United Kingdom) in a reaction mixture containing Taq DNA polymerase, 100 mM Tris/HCl, pH 8.8, 15 mM MgCl 2 , and 250 mM KCl (Stratagene, La Jolla, CA) in a total volume of 100 l. The amplification mixture was overlaid with 50 l of mineral oil and subjected to 30 cycles of amplification as follows: 1-min denaturation at 94°C, 1-min annealing at 55°C, and 2-min extension at 72°C. The polymerase chain reaction-amplified DNA was ligated to pCR2.1 TM (Invitrogen), and the NdeI-SalI fragment encompassing the complete ptsP gene was then excised from this plasmid and cloned between the NdeI and SalI sites of the overexpression vector pROEX TM -1 (Life Technologies, Inc.) to create the plasmid pJRENtr. Cloning of ptsP was confirmed by nucleotide sequencing using polymerase chain reaction dye terminator sequencing on an ABI 373 sequencer (Applied Biosystems) with a series of oligonucleotides specific for ptsP. Synthetic oligonucleotides were obtained commercially from either GenSet (La Jolla, CA) or Research Genetics, Inc. (Huntsville, AL).
E. coli DH10B was transformed with the expression vector pJRENtr encoding EI Ntr . DH10B cells bearing the overexpression plasmid were grown overnight at 37°C in LB containing ampicillin (100 g/ml) and diluted 50 -100-fold into fresh LB medium containing the same concentration of ampicillin. When the optical density of the culture growing at 37°C reached an A 600 of 0.5-1.0, isopropyl-1-thio--D-galactopyranoside was added to a final concentration of 0.1 mM, and incubation was continued for an additional 3 h. Cells were collected by centrifugation, resuspended in TP buffer (50 mM Tris/HCl, pH 7.4, containing 0.2 mM phenylmethylsulfonyl fluoride), and ruptured as described previously (20). The crude extract was centrifuged for 20 min at 16,000 rpm (SS34 rotor, RC5-centrifuge; Sorvall-DuPont, Wilmington, DE), and the overexpressed EI Ntr , which was found primarily in the pellet, was solubilized with 6 M guanidinium hydrochloride. Following centrifugation for 20 min at 16,000 rpm (SS34 rotor, RC5-centrifuge), the supernatant containing the overexpressed protein was applied to a nickel-nitrilotriacetic acid resin (Novagen, Inc., Madison, WI) column equilibrated with 20 mM Tris/HCl (pH 7.9) containing 0.5 M NaCl and 6 M guanidinium hydrochloride. The column was washed with 10 volumes of 20 mM Tris/HCl, pH 7.9, containing 0.5 M NaCl, 20 mM imidazole, and 6 M guanidinium hydrochloride, and EI Ntr was eluted with 50 mM Tris/HCl buffer, pH 7.9, containing 1 M NaCl, 0.3 M imidazole, 10% glycerol, and 6 M guanidinium hydrochloride. The fraction containing EI Ntr was then dialyzed against 50 mM Tris/HCl buffer, pH 7.5, containing 0.1 mM phenylmethylsulfonyl fluoride, 0.1 mM EDTA, 1 mM dithiothreitol, and 10% glycerol.
Protein Phosphorylation Assay-E. coli EI, HPr, and NPr were overproduced and purified as described previously (10,21,22). [ 32 P]PEP was synthesized from [␥-32 P]ATP using phosphoenolpyruvate carboxykinase from E. coli (23). [ 32 P]PEP was separated from [␥-32 P]ATP and [ 32 P]P i by ion-exchange chromatography on AG-1-X8 bicarbonate resin (analytical grade anion exchange resin, 20 -50 mesh, chloride form (Bio-Rad)). Protein phosphorylation reactions were modified after Powell et al. (10). The EI Ntr -specific phosphorylation reaction (at 37°C for 15 min; 20 l final volume) contained 250 mM HEPES, pH 8.0, 2 mM dithiothreitol, 5 mM MgCl 2 , 0.125 mM [ 32 P]PEP (1.2 ϫ 10 5 counts/min/ nmol), 0.6 g of EI Ntr , and 10 g of NPr. The EI-specific phosphorylation reaction (at 37°C for 15 min, 20 l final volume) contained 50 mM Tris/HCl, pH 7.2, 2 mM dithiothreitol, 5 mM MgCl 2 , 0.125 mM [ 32 P]PEP (1.2 ϫ 10 5 counts/min/nmol), 0.6 g of EI, and 1.25 g of HPr. Proteins were separated by SDS-polyacrylamide gel electrophoresis as described previously (20,24). Proteins labeled with [ 32 P]PEP were detected by autoradiography as described (24).
Concentrations of soluble PTS proteins, EI Ntr , EI, NPr, and HPr, were determined according to the method described by Bradford (25). Protein concentrations in butanol-urea-extracted membranes were measured using the DC Protein Assay as described by the manufacturer (Bio-Rad). Bovine plasma ␥ globulin was used as a standard. Membrane samples and standards were boiled for 5 min in the presence of 1% SDS or N-octyl-3-D-glucopyranoside prior to the addition of the reagents.
Preparation of Butanol-Urea-extracted Membranes-Membranes containing high levels of Enzyme IICBA Mtl , used for assaying EI and EI Ntr , were prepared from strain SB2950, which lacks EI, HPr, and IIA Glc (26). Batch cultures (5 liters) of strain SB2950 were grown overnight in nutrient broth (Difco). Cultures were centrifuged at 16,000 ϫ g (GSA rotor, RC-5 centrifuge) for 5-10 min at 4°C, washed in mineral medium (50 mM potassium phosphate buffer, pH 7.5, containing 15 mM (NH 4 ) 2 SO 4 and 1.7 mM MgSO 4 ), and resuspended in 25 ml of 50 mM potassium phosphate buffer, pH 7.5, containing 2 mM DTT, 1 mM EDTA, and 10 g/ml DNase I. The cells were ruptured at 10,000 p.s.i. in a French pressure cell, and intact cells and cell debris were removed by centrifugation at 14,500 ϫ g (SS34 rotor, RC-5 centrifuge) for 10 min at 4°C. Membranes were recovered from the supernatant by centrifugation at 100,000 ϫ g (Ti rotor, L7-65 Ultracentrifuge, Beckman Instruments) and resuspended in a few ml of 50 mM potassium phosphate buffer, pH 7.5, containing 2 mM DTT and 1 mM EDTA. These membranes were extracted with urea and 1-butanol (27). Urea (480 mg/ml) was added and dissolved by stirring on ice. Then 1-butanol (40 l/ml) was added, and this solution was gently stirred for 2 h on ice. Mem- branes were recovered by centrifugation at 100,000 ϫ g (Ti rotor) for 4 h at 4°C. Extracted membranes from 5 liters of stationary phase cells were resuspended in 10 ml of 25 mM Tris/HCl, pH 7.5, containing 1 mM DTT and 1 mM EDTA to a final protein concentration of 11-32 mg/ml and transferred to boiled dialysis tubes (MWCO: 12-14.000, Spectrum Medical Industries Inc., Houston, TX). Membranes were dialyzed 3 times for 8 h against the same buffer and were then aliquoted in small plastic vials for storage at Ϫ20°C. Extraction of peripheral proteins from the membranes eliminated background sugar phosphorylation activity.
Sugar Phosphorylation Assay-The [ 32 P]PEP-dependent protein phosphorylation assay described above does not provide a rate but instead represents an equilibrium situation. To allow estimation of relative rates of phosphoryl transfer via various PTS proteins, a quantitative assay was required. We found that phosphorylation of [ 14 C]mannitol (or another PTS sugar) could be used for this purpose although the rate of phosphoryl transfer involving EI Ntr and NPr was very low relative to that involving EI and HPr. [ 14 C]Mannitol was selected as the phosphoryl acceptor because this sugar is PTS-specific,
FIG. 3. Dependence of EI Ntr activity on the concentration of PEP.
A, activity of EI Ntr was determined using the sugar phosphorylation assay as described under "Materials and Methods" with potassium phosphate as the buffer. Three experiments were carried out with different amounts of NPr added to the reaction mixture: ࡗ, 0.5 g; f, 1 g; and OE, 5 g. B, in these double-reciprocal plots (1/v versus 1/S), two straight lines can be drawn through the data for each concentration of NPr used, one corresponding to a low K m , low V max value and one corresponding to a high K m , high V max value. C, the intercepts on the y axis from B were plotted versus 1/NPr to give the absolute K m and V max values of 2 M and 0.3 mol [ 14 C]mannitol-phosphate/mg EI Ntr for the high affinity, low velocity curve (ࡗ) and values of 10 M and 1 mol [ 14 C]mannitol-phosphate/ mg EI Ntr for the low affinity, high velocity curve (f).
FIG. 4. Time courses of EI Ntr activity revealing that preincubation of EI Ntr with
NPr eliminates the lag phase. Activity of EI Ntr was determined using the sugar phosphorylation assay as described under "Materials and Methods." HEPES (250 mM) was used as the buffer. Reaction mixtures were preincubated for 1 h at 37°C in the absence of one or more selected component(s), and then at zero time the missing component(s) were added. The components that were missing during the preincubation are indicated to the right of the curves. In the controls, all components were present, but there was no preincubation period. and no phosphatase cleaving the product ([ 14 C]mannitol-1-phosphate) is known. The standard assay for PTS sugar phosphorylation employs membranes isolated from disrupted E. coli cells that overproduce several Enzyme II complexes because of a pts operon deletion (28). Because the inverted membrane preparations are "leaky," protein components and sugar phosphate products are not compartmentalized. Thus, this assay provides a useful measure of relative rates of overall phosphoryl transfer employing EI Ntr and NPr as well as EI and HPr, even though the former reaction is not physiologically significant.
The sugar phosphorylation assay used was modified from the method described by Kundig
RESULTS
pH and Divalent Cation Dependence of the EI Ntr -catalyzed
Reaction-To study the properties of EI Ntr , we developed a sugar phosphorylation assay coupling phosphoryl transfer from PEP via purified EI Ntr , NPr, and Enzyme IICBA Mtl to [ 14 C]mannitol (see "Materials and Methods"). Under the condition described by Kundig and Roseman (27) (20 mM potassium phosphate buffer, pH 7.5), EI Ntr showed only marginal activity, but activity was greatly enhanced using 250 mM potassium phosphate, pH 8.0. Potassium phosphate buffer could be replaced by HEPES but not by MOPS, TES, TRIZMA, or Tris. The HEPES-based buffer system was used when precipitation of cations by phosphate was problematic.
The pH range for EI Ntr was examined using the phosphatebuffered assay system. In contrast to Enzyme I, which has a pH optimum of 7.0 -7.5 (29,30), EI Ntr activity was optimal at pH 8.0 (Fig. 1). The dependence of EI Ntr activity on divalent cations was tested with the HEPES-buffered system (31,32). EI Ntr required Mg 2ϩ with saturation being observed at a concentration of about 2 mM (Fig. 2). Mn 2ϩ allowed activity of EI Ntr only at low concentrations (Fig. 2). In the presence of low concentrations of Co 2ϩ or Ni 2ϩ , activity could be measured, but at concentrations above 0.2 mM, strong inhibition was observed.
Kinetic Analysis of PEP-dependent EI Ntr -catalyzed NPr Phosphorylation-Previous reports on the Mg 2ϩ dependence of EI have shown that the divalent cation is required for the PEP-dependent autophosphorylation of EI but not for phosphoryl transfer between EI and HPr (31,32). The dependence of EI Ntr activity on the concentration of PEP was examined using the [ 14 C]mannitol phosphorylation assay in phosphate buffer with three different concentrations of NPr (Fig. 3).
Regardless of the concentration of NPr used, EI Ntr proved to be saturated at PEP concentrations higher than 10 mM. The data shown in Fig. 3A were converted to a double reciprocal plot (1/v versus 1/S, Fig. 3B). As can be seen, a single straight line could not be drawn through the data obtained with any one NPr concentration, but they could be fitted to two distinct lines with differing slopes. This feature is characteristic of an enzyme population that either consists of two distinct enzyme species with differing kinetic properties or of a single enzyme species exhibiting the property of negative cooperativity.
The y intercepts (1/V max apparent) shown in Fig. 3B were plotted versus 1/NPr for the two parts of the curves (Fig. 3C). Straight lines were observed in each case, and these lines extrapolated to give V max and K m values, respectively, of 1 mol of [ 14 C]mannitol phosphate/mg of EI Ntr /min and 10 M for the high velocity, low affinity curve, and 0.3 mol of [ 14 C]mannitol phosphate/mg of EI Ntr /min and 2 M for the low velocity, high affinity curve.
Time-dependent, NPr-dependent activation of EI Ntr -Analysis of time courses for EI Ntr activity showed that the enzyme exhibited a lag phase of 30 -40 min under our standard assay conditions (Fig. 4). When the otherwise complete reaction mixtures were preincubated for 1 h without either [U-14 C]D-mannitol or the extracted membranes, no lag for sugar phosphorylation was observed (Fig. 4). However, the absence of extracted membranes during preincubation yielded lower activity than when mannitol was omitted, suggesting that the membranes might facilitate EI Ntr -NPr association. In contrast, when either EI Ntr or NPr was absent during the preincubation, a lag was still observed. Preincubation of EI Ntr with NPr was therefore required for optimal activity, suggesting that a slow association of these two proteins accounts for the lag phase observed in the control sample.
Specificity of EI Ntr for NPr and of EI for HPr-Selective phosphoryl transfer by EI and EI Ntr could be demonstrated using the 32 P-protein phosphorylation assay. NPr was found to be a specific protein substrate of EI Ntr as the latter could not phosphorylate HPr (Fig. 5A, lanes 3 and 4). In contrast, Enzyme I was found to be specific for HPr and could barely phosphorylate NPr (Fig. 5A, lanes 1 and 2). These observations were confirmed using the [ 14 C]mannitol phosphorylation assay.
Search for Specific Inhibitors of EI Ntr -In a previous report, a regulatory function was suggested for the N-terminal domain of EI Ntr (17). We employed the sugar phosphorylation assay to screen various compounds for effects on the NPr-dependent phosphoryl transfer activity of EI Ntr . The following salts increased the activity of EI Ntr when added to the potassium phosphate (50 mM, pH 8.0) -buffered reaction mixture: (NH 4 ) 2 SO 4 , NH 4 Cl, Na 2 SO 4 , NaCl, K 2 SO 4 , KCl, and LiCl (tested in a concentration range of 10 -400 mM). This demonstrated that EI Ntr activity requires high ionic strength, but no evidence for a specific effect by any one ionic species was obtained. Other compounds (concentrations between 0.1 and 10 mM) tested in the presence of 20 mM Mg 2ϩ (to avoid Mg 2ϩ limitation because of chelation) were L-glutamine, L-glutamate, ␣-ketoglutarate, ATP, ADP, AMP, GTP, GDP, GMP, UDP, ppGpp, and adenosine 3Ј-phosphate 5Ј-phophosulfate. Only GDP and ppGpp at concentrations of 5 mM or higher had effects on the activity of EI Ntr (50 -60% inhibition at 10 mM). The inhibitory effect of GDP was confirmed using the [ 32 P]PEP-dependent protein phosphorylation assay. EI Ntr -dependent phosphorylation of NPr was significantly reduced although the amount of phosphorylated Enzyme I Ntr remained similar (Fig. 5B, lanes 1 and 2). Although phosphorylation of EI was not affected, the inhibition of NPr phosphorylation is not likely to be of physiological FIG. 7. Two parallel phosphorelay chains of the E. coli phosphotransferase system. The top scheme shows the classical PTS that is responsible for sugar group translocation. The bottom scheme shows the parallel sequence of phosphoryl transfer events indicated by the novel PTS constituents (EI Ntr and NPr) studied in this report that presumably have regulatory consequences. All of the arrows shown represent physiologically reversible phosphoryl transfer reactions except for IIC-catalyzed sugar phosphorylation. Some degree of nonspecificity has been demonstrated between the HPr and IIA protein constituents of these chains. IIA Ntr and IIA Mtl , though homologous, exhibit significant conformational differences that may account for their dissimilar functions (47). significance. Cyclic AMP and cyclic GMP were without effect in the concentration range 0.01-1 mM.
A number of redox cofactors were examined with respect to potential regulatory effects. The following compounds were tested in the concentration range of 1-10 mM: NAD, NADH, NADP, NADPH, and FAD. Of these compounds, only FAD was inhibitory (50% with 1 mM FAD). EI was similarly inhibited. DISCUSSION EI Ntr resembles the classical EI except for the N-terminal NifA-like putative sensory domain of EI Ntr . Both enzymes catalyze PEP-dependent phosphoryl transfer to an HPr-like protein in a pH-, salt-, and Mg 2ϩ -or Mn 2ϩ -dependent process (30,33,34). The effects of ionic strength may be because of stabilization of the dimeric forms of these enzymes, and Mg 2ϩ may similarly promote association (35)(36)(37). However, EI Ntr exhibits biphasic kinetics with respect to PEP concentration, whereas EI exhibits monophasic kinetics; EI Ntr exhibits essentially absolute specificity for NPr, whereas EI could phosphorylate NPr at a rate that was only a small fraction of that at which it phosphorylates HPr. The turnover number (38) for EI Ntr using the sugar phosphorylation assay proved to be 0.8 pmol/pmol EI Ntr /min, whereas that for EI is 1.34 nmol/pmol EI/min (39). This 1000-fold difference explains, in part, why EI is absolutely required for sugar phosphorylation under in vivo conditions. ptsI deletion mutants can be mutated so as to express an EI paralogue that can phosphorylate HPr (40), but preliminary evidence suggests that this enzyme is not EI Ntr . 2 The nearly absolute specificity of EI Ntr for NPr and of EI for HPr provides the first evidence that two different EIs in a single organism exhibit specificity at the level of their phosphoryl acceptor PTS proteins. This finding clearly leads to both functional and mechanistic predictions. EI Ntr does not appear to function in sugar phosphorylation and may function exclusively in regulation, possibly controlling the activities of NPr and IIA Ntr . These latter proteins are encoded within the rpoN operon of E. coli and have been implicated in the regulation of 54 -dependent transcriptional initiation of genes concerned with organic nitrogen utilization (10). Moreover, in A. vinelandii, the EI Ntr -encoding ptsP gene has been shown to play a role in poly--hydroxybutyrate metabolism and respiratory protection of nitrogenase under carbon-limiting conditions (18). In K. pneumoniae, P. aeruginosa, and R. etli, IIA Ntr has been shown to function in capacities similar to those demonstrated for E. coli (12)(13)(14)41). EI Ntr , NPr, and IIA Ntr have all been identified in the fully sequenced genome of P. aeruginosa. 3 As for E. coli, these Pseudomonas proteins presumably comprise a phosphoryl transfer chain that functions in parallel with EI, HPr, and various IIA sugar proteins with entirely different physiological consequences (see Fig. 7).
Phylogenetic data have shown that NPr is a distant homolog of HPr (10), whereas EI Ntr is a distant homolog of EI (17). The mechanistic implications of our biochemical observations are that specific residues in EI versus EI Ntr and/or HPr versus NPr must control the interactions and phosphoryl transfer reactions between these proteins. Alignments of two segments of all sequenced EI Ntr s (Fig. 6A, top) with representative EIs (Fig. 6A, bottom) as well as of recognized NPrs (Fig. 6B, top) and HPrs (Fig. 6B, bottom) revealed such candidate residues. Residues that are fully conserved among all homologous proteins are presented in bold print, whereas residues that are fully conserved in one group, but of a different type in the other group, are shaded. In comparing EI Ntr with EI, we found that residues conserved in one of these two sets of proteins but not the other were scattered unevenly throughout the alignment. The greatest abundance of such residues was found to immediately surround the active site histidine (Fig. 6A, top), a region of catalytic importance. This fact is particularly significant as the active site region is well conserved among either the EIs or the EI Ntr s. The second region of the multiple alignment exhibiting a high frequency of residues conserved in only one set of these two proteins occurred far downstream of the active site histidine in a region of unknown function (Fig. 6A, bottom). Neither of these two regions is at the EI-HPr interface (42). In the region that defines the EI-HPr interaction surface, two residues were markedly different in the EIs versus the EI Ntr s. These residues are the (A/G)H dipeptide in the EIs, which corresponds to the (V/L)Y dipeptide in the EI Ntr s. Fig. 6B shows the full alignment of NPr sequences with HPr sequences. As for the EIs, the greatest abundance of residues fully conserved in the NPrs, but of a different nature in the HPrs, surrounds the active site histidine. These dissimilar residues may control relative rates of phosphoryl transfer. A second region exhibiting this characteristic is found C-terminal to the regulatory serine (43). Both of these regions comprise interaction sites with EI (42). Of possible significance to the specificity of EI Ntr for NPr is the AXXM sequence in the NPrs that is lacking in the HPrs (positions 49 -52 in the E. coli HPr). The C termini of NPrs additionally possess a fully conserved NXXFDE sequence that is not found in any of the HPrs. These observations provide a guide for site-directed mutagenic studies aimed at defining their functional differences.
The presence of a NifA protein-like putative sensory domain in EI Ntr led to the postulate that this domain might sense the availability of a ligand that could control the phosphoryl transfer activity of the enzyme. Our search for such a small compound has been unsuccessful until now. Thus, GDP exerted an inhibitory effect but only at superphysiological concentrations. FAD also exerted an inhibitory effect at superphysiological concentrations, but because this effect was shared with EI, it cannot be attributed to the presence of the N-terminal NifAlike domain. It is possible that we have not identified the correct effector molecule, but it is equally possible that the effector we seek is a macromolecule such as the PII nitrogen regulatory protein (44) rather than a small metabolite. Aravind and Ponting (45) have noted that the NifA domain is homologous to a family of so-called GAF domains found in a variety of signal-transducing proteins, but the significance of this observation to EI Ntr function is not known.
In summary, we have found that EI Ntr exhibits virtually absolute specificity for NPr, whereas EI is highly specific for HPr (Figs. 5 and 7). This finding demonstrates for the first time that a single organism can possess two complete and independent PEP-dependent phosphoryl transfer chains, which presumably serve completely different physiological functions. The fact that E. coli possesses 5 paralogues of both EI and HPr (46) now leads to the possibility of multiple parallel and independently functioning phosphoryl transfer chains, each playing a different physiological role in the cell. Determination of the physiological functions of these PTS phosphoryl transfer chains provides exciting challenges for the future.
FIG. 1 .
1Dependence of EI Ntr activity on pH. Activity of EI Ntr was determined using the sugar phosphorylation assay as described under "Materials and Methods." The reaction mixture contained potassium phosphate buffer adjusted to the indicated pH values.FIG. 2.Dependence of EI Ntr activity on the concentration of Mg 2؉ . Activity of EI Ntr was determined using the sugar phosphorylation assay as described under "Materials and Methods." HEPES, pH 8.0, was used as the buffer.
FIG. 5 .
5Phosphoryl transfer from EI Ntr or EI to NPr or HPr. The figure shows autoradiographs from protein phosphorylation experiments as described under "Materials and Methods." Experiments in A show that EI only marginally phosphorylates NPr (lane 2) as compared with HPr (lane 1), whereas EI Ntr does not phosphorylate HPr (lane 3) although it readily phosphorylates NPr (lane 4). B shows that EI Ntr -dependent phosphorylation of NPr (control in lane 1) is inhibited by GDP (10 mM, lane 2).
and Roseman(27) as required by the exceptionally low activity of EI Ntr in this assay. The reaction mixture (50 l) generally consisted of 0.1 g of EI Ntr , 5 g of NPr, 5-10 l of extracted membranes,10 mM PEP, 10 mM MgCl 2 , 25 mM KF, 2.5 mM DTT, 250 mM FIG. 6. Multiple alignments of EI Ntr s versus EIs and NPrs versus HPrs. A, two regions of the multiple alignment of all recognized EI Ntr s (top) and selected recognized EIs (bottom). B, multiple alignment of the entire sequences of all recognized NPrs (top) and selected HPrs (bottom). Residues that are fully conserved among all proteins are shown in bold and are presented below the alignment (identities). Residues that are fully conserved only in one group (e.g. EI Ntr s), but are of a different kind in the other group (e.g. EIs), are shaded. H* (below the alignment) represents the phosphorylation site. Numbers in parentheses indicate the residue numbers. Abbreviations used and accession numbers (O and P for Swiss-Prot; AF, L and Y for Genbank) are as follows: EI Ntr of E. coli (Eco, P37177), A. vinelandii (Avi, Y14681), and P. aeruginosa (Pae, Contig 84); EI of Streptococcus mutans (Smu, L15191), Lactobacillus sakei (Lsa, O07126), Bacillus subtilis (Bsu, P08838), Staphylococcus aureus (Sau, P51183), Listeria monocytogenes (Lmo, AF030824), Mycoplasma genitalium (Mge, P47668), E. coli (Eco, P08839) and Hemophilus influenzae (Hin, P43922); NPr of E. coli (Eco, P33996), K. pneumoniae (Kpn, P51185), and Pae (Contig 95); and HPr of Smu (P45596), Lsa (O07125), Bsu (P08877), Sau (P02907), Lmo (O31148), Mge (P47287), Eco (P07006), and Hin (P43921). HEPES or potassium phosphate, pH 8.0, and 1.5 M [U-14 C]D-mannitol (specific activity 32 mCi/mmol). The reaction mixture was usually preincubated for 1 h in the absence of [U-14 C]D-mannitol, and the reaction was started by the addition of the labeled sugar. After incubation (usually at 37°C for 2 h), the reaction was stopped by the addition of 1 ml of ice-cold deionized water. The sugar phosphorylation assay for EI was in general carried out in 50 mM HEPES buffer, pH 8.0, containing 3 ng of EI, 0.1 g of HPr, 10 l of extracted membrane, 10 mM PEP, 10 mM MgCl 2 , 25 mM KF, 2.5 mM DTT, and 1.5 M [U-14 C]D-mannitol (specific activity 32 mCi/mmol). EI Ntr or EI was present in rate-limiting amounts, whereas all other components of the assay mixtures were present in excess. [U-14 C]D-Mannitol-phosphate was separated from the nonphosphorylated [U-14 C]D-mannitol by ion exchange chromatography. The reaction mixture was transferred to Poly-Prep® chromatography columns (0.8 ϫ 4 cm, Bio-Rad) containing analytical grade Bio-Rad anion exchange resin (AG 1-X2, 50 -100 mesh, chloride form, Bio-Rad) (27). Nonphosphorylated [U-14 C]D-mannitol was washed from the columns by the addition of three 10-ml aliquots of water. [U-14 C]D-Mannitol-phosphate was then eluted with three 3-ml aliquots of 1 mM LiCl and collected in liquid scintillation vials. After the addition of 9 ml of Bio SafeII counting mixture (Research Products International Corp., Mount Prospect, CA), the radioactivity was measured.
This paper is available on line at http://www.jbc.org
R. Rabus, J. Reizer, I. Paulsen, and M. H. Saier, Jr., unpublished results. 3 J. Reizer and M. H. Saier, Jr., manuscript in preparation.
Acknowledgments-We thank Mike Cashel for providing us with purified ppGpp as well as Joy Garg, Don Jack, Peter Jä hn, and Karin Strecker for computational and technical assistance and Milda Simonaitis for manuscript assistance.
. W Kundig, S Gosh, S Roseman, Proc. Natl. Acad. Sci. U. S. A. 52Kundig, W., Gosh, S., and Roseman, S. (1964) Proc. Natl. Acad. Sci. U. S. A. 52, 1067-1074
. N D Meadow, D K Fox, S Roseman, Annu. Rev. Biochem. 59Meadow, N. D., Fox, D. K., and Roseman, S. (1990) Annu. Rev. Biochem. 59, 497-542
. P W Postma, J W Lengeler, G R Jacobson, Microbiol. Rev. 57Postma, P. W, Lengeler, J. W, and Jacobson, G. R. (1993) Microbiol. Rev. 57, 543-594
. M H Saier, Jr, J Reizer, J. Bacteriol. 174Saier, M. H., Jr., and Reizer, J. (1992) J. Bacteriol. 174, 1433-1438
. M H Saier, Jr, Microbiol. Rev. 53Saier, M. H., Jr. (1989) Microbiol. Rev. 53, 108 -120
. M H Saier, Jr, J Reizer, Mol. Microbiol. 13Saier, M. H., Jr., and Reizer, J. (1994) Mol. Microbiol. 13, 755-764
. M J Merrick, Mol. Microbiol. 10Merrick, M. J. (1993) Mol. Microbiol. 10, 903-909
M J Merrick, M Taylor, M H Saier, Jr, J Reizer, Proceedings of the 10 th International Congress on Nitrogen Fixation. Tikhonovich, I. A., Provorov, N. A., Romanov, V. I., and Newton, W. E.the 10 th International Congress on Nitrogen FixationLondonKluwer Academic PublishersNitrogen Fixation: Fundamentals and ApplicationsMerrick, M. J., Taylor, M., Saier, M. H., Jr., and Reizer, J. (1995) in Nitrogen Fixation: Fundamentals and Applications (Tikhonovich, I. A., Provorov, N. A., Romanov, V. I., and Newton, W. E., eds) pp. 189 -194, Proceedings of the 10 th International Congress on Nitrogen Fixation, Kluwer Academic Publishers, London
. D H A Jones, F C H Franklin, C M Thomas, Microbiology (Read.). 140Jones, D. H. A., Franklin, F. C. H., and Thomas, C. M. (1994) Microbiology (Read.) 140, 1035-1043
. B S Powell, D L Court, T Inada, Y Nakamura, V Michotey, X Cui, A Reizer, M H Saier, Jr, J Reizer, J. Biol. Chem. 270Powell, B. S., Court, D. L., Inada, T., Nakamura, Y., Michotey, V., Cui, X., Reizer, A., Saier, M. H., Jr., and Reizer, J. (1995) J. Biol. Chem. 270, 4822-4839
. R A Britton, B S Powell, S Dasgupta, Q Sun, W Margolin, J R Lupski, D L Court, Mol. Microbiol. 27Britton, R. A., Powell, B. S., Dasgupta, S., Sun, Q., Margolin, W., Lupski, J. R., and Court, D. L. (1998) Mol. Microbiol. 27, 739 -750
. J Michiels, T Van Soom, I D'hooghe, B Dombrecht, T Benhassine, P De Wilde, J Vanderleyden, J. Bacteriol. 180Michiels, J., Van Soom, T., D'Hooghe, I., Dombrecht, B., Benhassine, T., De Wilde, P., and Vanderleyden, J. (1998) J. Bacteriol. 180, 1729 -1740
. S Jin, K Ishimoto, Lory , S , J. Bacteriol. 176Jin, S., Ishimoto, K., and Lory, S. (1994) J. Bacteriol. 176, 1316 -1322
. M J Merrick, J R Coppard, Mol. Microbiol. 3Merrick, M. J., and Coppard, J. R. (1989) Mol. Microbiol. 3, 1765-1775
. D Bordo, R L Van Monfort, T Pijning, K H Kalk, J Reizer, M H Saier, Jr, B W Dijkstra, J. Mol. Biol. 279Bordo, D., van Monfort, R. L., Pijning, T., Kalk, K. H., Reizer, J., Saier, M. H., Jr., and Dijkstra, B. W. (1998) J. Mol. Biol. 279, 245-255
. S Austin, M Buck, W Cannon, T Eydmann, R Dixon, J. Bacteriol. 176Austin, S., Buck, M., Cannon, W., Eydmann, T., and Dixon, R. (1994) J. Bacteriol. 176, 3460 -3465
. J Reizer, A Reizer, M J Merrick, G Plunkett, Iii, D J Rose, M H Saier, Jr, Gene (Amst.). 181Reizer, J., Reizer, A., Merrick, M. J., Plunkett, G., III, Rose, D. J., and Saier, M. H., Jr. (1996) Gene (Amst.) 181, 103-108
. D Segura, G Espin, J. Bacteriol. 180Segura, D., and Espin, G. (1998) J. Bacteriol. 180, 4790 -4798
. J C Cordaro, S Roseman, J. Bacteriol. 112Cordaro, J. C., and Roseman, S. (1972) J. Bacteriol. 112, 17-29
. J Reizer, S L Sutrina, M H Saier, Jr, G C Stewart, A Peterkofsky, P Reddy, EMBO J. 8Reizer, J., Sutrina, S. L., Saier, M. H., Jr., Stewart, G. C., Peterkofsky, A., and Reddy, P. (1989) EMBO J. 8, 2111-2120
. J Reizer, A Reizer, M H Saier, Jr, G R Jacobson, Protein Sci. 1Reizer, J., Reizer, A., Saier, M. H., Jr., and Jacobson, G. R. (1992) Protein Sci. 1, 722-726
. J Reizer, S L Sutrina, L F Wu, J Deutscher, P Reddy, M H Saier, Jr, J. Biol. Chem. 267Reizer, J., Sutrina, S. L., Wu, L. F., Deutscher, J., Reddy, P., and Saier, M. H., Jr. (1992) J. Biol. Chem. 267, 9158 -9169
. R L Mattoo, E B Waygood, Anal. Biochem. 128Mattoo, R. L., and Waygood, E. B. (1983) Anal. Biochem. 128, 245-249
. J Reizer, M J Novotny, W Hengstenberg, M H Saier, Jr, J. Bacteriol. 160Reizer, J., Novotny, M. J., Hengstenberg, W., and Saier, M. H., Jr. (1984) J. Bacteriol. 160, 333-340
. M M Bradford, Anal. Biochem. 72Bradford, M. M. (1976) Anal. Biochem. 72, 248 -254
. E B Waygood, N D Meadow, S Roseman, Anal. Biochem. 95Waygood, E. B., Meadow, N. D., and Roseman, S. (1979) Anal. Biochem. 95, 293-304
. W Kundig, S Roseman, J. Biol. Chem. 246Kundig, W., and Roseman, S. (1971) J. Biol. Chem. 246, 1407-1418
. A W Rephaeli, M H Saier, Jr, J. Bacteriol. 141Rephaeli, A. W., and Saier, M. H., Jr. (1980) J. Bacteriol. 141, 658 -663
. E B Waygood, T Steeves, Can. J. Biochem. 58Waygood, E. B., and Steeves, T. (1979) Can. J. Biochem. 58, 40 -48
. M H Saier, Jr, M R Schmidt, Lin , P , J. Biol. Chem. 255Saier, M. H., Jr., Schmidt, M. R., and Lin, P. (1980) J. Biol. Chem. 255, 8579 -8584
. N Weigel, M A Kukuruzinska, A Nakazawa, E B Waygood, S Roseman, J. Biol. Chem. 257Weigel, N., Kukuruzinska, M. A., Nakazawa, A., Waygood, E. B., and Roseman, S. (1982) J. Biol. Chem. 257, 14477-14491
. N Weigel, E B Waygood, M A Kukuruzinska, A Nakazawa, S Roseman, J. Biol. Chem. 257Weigel, N., Waygood, E. B., Kukuruzinska, M. A., Nakazawa, A., and Roseman, S. (1982) J. Biol. Chem. 257, 14461-14469
. H Hoving, J H Koning, G T Robillard, Biochemistry. 21Hoving, H., Koning, J. H., and Robillard, G. T. (1982) Biochemistry 21, 3128 -3136
. M A Kukuruzinska, W F Harrington, S Roseman, J. Biol. Chem. 257Kukuruzinska, M. A., Harrington, W. F., and Roseman, S. (1982) J. Biol. Chem. 257, 14470 -14476
. O Misset, M Brouwer, G T Robillard, Biochemistry. 19Misset, O., Brouwer, M., and Robillard, G. T. (1980) Biochemistry 19, 883-890
. M K Han, J R Knutson, S Roseman, L Brand, J. Biol. Chem. 265Han, M. K., Knutson, J. R., Roseman, S., and Brand, L. (1990) J. Biol. Chem. 265, 1996 -2003
. F Chauvin, L Brand, S Roseman, J. Biol. Chem. 269Chauvin, F., Brand, L., and Roseman, S. (1994) J. Biol. Chem. 269, 20263-20269
Enzyme kinetics. Behaviour and analysis of rapid equilibrium and steady-state enzyme systems. I H Segel, John Wiley & SonsNew YorkSegel, I. H. (1975) Enzyme kinetics. Behaviour and analysis of rapid equilib- rium and steady-state enzyme systems, John Wiley & Sons, New York
. R L Mattoo, E B Waygood, Can. J. Biochem. 61Mattoo, R. L., and Waygood, E. B. (1982) Can. J. Biochem. 61, 29 -37
. A M Chin, S Sutrina, D A Feldheim, M H Saier, Jr, J. Bacteriol. 169Chin, A. M., Sutrina, S., Feldheim, D. A., and Saier, M. H., Jr. (1987) J. Bacteriol. 169, 894 -896
. Y Du, A Holtel, J Reizer, M H Saier, Jr, Res. Microbiol. 147Du, Y., Holtel, A., Reizer, J., and Saier, M. H., Jr. (1996) Res. Microbiol. 147, 129 -132
. D S Garrett, Y.-J Seok, A Peterkofsky, A Gronenborn, G M Clore, Nat. Struct. Biol. 6Garrett, D. S., Seok, Y.-J., Peterkofsky, A., Gronenborn, A., and Clore, G. M. (1999) Nat. Struct. Biol. 6, 166 -173
. M H Saier, Jr, S Chauvaux, G M Cook, J Deutscher, I T Paulsen, J Reizer, Ye , J.-J , Microbiology (Read.). 142Saier, M. H., Jr., Chauvaux, S., Cook, G. M., Deutscher, J., Paulsen, I. T., Reizer, J., and Ye, J.-J. (1996) Microbiology (Read.) 142, 217-230
B Magasanik, Escherichia coli and Salmonella typhimurium. Neidhardt, F. C., ed.) 2nd EdWashington, D. CASM Press1Magasanik, B. (1996) in Escherichia coli and Salmonella typhimurium. Cellular and Molecular Biology (Neidhardt, F. C., ed.) 2nd Ed., Vol. 1., pp. 1344 -1356, ASM Press, Washington, D. C.
. L Aravind, C P Ponting, Trends Biochem. Sci. 22Aravind, L., and Ponting, C. P. (1997) Trends Biochem. Sci. 22, 458 -459
. J Reizer, M H Saier, Jr, Curr. Opin. Struct. Biol. 7Reizer, J., and Saier, M. H., Jr. (1997) Curr. Opin. Struct. Biol. 7, 407-415
. R L Van Montfort, B W Dijkstra, Protein Sci. 7van Montfort, R. L., and Dijkstra, B. W. (1998) Protein Sci. 7, 2210 -2216
|
Introduction
Post-transcriptional mechanisms for the regulation of protein abundance are critical for the control of diverse cellular processes including metabolism and nutritional stress responses [1,2], virulence and antibiotic production [3] and quorum sensing [4]. In addition to well-studied pathways for mRNA translational control by proteins such as RsmA and Hfq [4][5][6], riboswitches [1], and direct ribosomal interference [2], a further potential regulatory mechanism is the specific alteration of ribosome function by posttranslational modification of its associated proteins. Numerous ribosomal proteins undergo posttranslational modifications including methylation, acetylation and methylthiolation, as well as the addition and removal of C-terminal amino-acid residues. However, while there is some evidence that certain modifications affect translational accuracy, or ribosome stability, in most cases their functional and physiological significance is unknown [7].
In Escherichia coli, the α-L-glutamate ligase RimK catalyzes the unique, C-terminal addition of glutamate residues to the ribosomal 30S subunit protein S6 (RpsF). The biochemistry of the transferase reaction [8] and the synthesis of poly-α-L-glutamate peptides [9] have been studied in vitro for E. coli RimK, and a crystal structure for this protein is available [10]. However, while the phenomenon of glutamate addition by RimK is clearly documented, the significance of this modification for ribosomal function and cell behavior remains unknown. The rimK gene is widespread, with homologs in hundreds of prokaryotic and eukaryotic genomes, so determining the biological role of RimK has broad implications for our understanding of ribosome structure and function. Recently, the rim locus (PFLU0261-0263) was identified as part of an In Vivo Expression Technology (IVET) screen for up-regulated loci during Pseudomonas fluorescens interaction with sugar beet [11], prompting us to investigate further.
P. fluorescens is a Gram negative, soil-dwelling bacterium that non-specifically colonizes plant rhizospheres. Here, it utilizes root exudates as a carbon source and protects the host plant by positively affecting health and nutrition, and exhibiting potent antifungal and other biocontrol capabilities [12][13][14]. Successful plant colonisation by P. fluorescens is a complex process that requires the coordinated regulation of phenotypes including motility, the production of attachment factors such as exo/lipopolysaccharides, and the deployment of secondary metabolites [14][15][16]. Plant-colonizing bacteria must adapt both membrane transport and primary metabolism to exploit the carbon and nitrogen resources exuded by plant roots. A recent study of Rhizobium leguminosarum rhizosphere transcriptomes showed both a metabolic shift [11] we first examined how the three rim genes affect different phenotypes associated with plant interaction. To do this, we deleted the rim genes, and confirmed that neither of the two upstream deletions (rimA/B) had significant effects on transcription of the third gene, rimK (S1A Fig). Next, we complemented each deletion with a chromosomally-inserted copy under the predicted rim promoter at the att::Tn7 locus [33]. Deletion of rimK, and to a lesser extent rimA led to enhanced wheat root attachment relative to WT SBW25 (Fig 1B), and also to a defect in swarming motility (Fig 1C). Both phenotypes were complemented in the relevant Tn7 strain. To test the importance of rimABK for growth in the rhizosphere environment, we next Fig 1. RimABK is important for P. fluorescens rhizosphere colonisation. 1A. The SBW25 rimABK operon consists of three co-transcribed genes. Gene numbers and predicted translated proteins are shown in each case. 1B. Wheat root attachment by the ΔrimABK and complementation strains relative to SBW25 WT. 1C. Swarming motility of the ΔrimABK and complementation strains relative to SBW25 WT. 1D. Rhizosphere colonisation competition assays. The graph shows the ratio of SBW25 WT or ΔrimABK to WT-lacZ colony forming units (CFU) recovered from the rhizospheres of wheat plants seven days post-inoculation. Each dot represents CFU recovered from an individual plant. Statistically significant differences between SBW25 and ΔrimABK strains are indicated (*** = p < 0.01, * = p < 0.05) in each case. 1E. SBW25 rimK mRNA abundance determined by qRT-PCR, for wheat rhizospheres sampled at various intervals post-inoculation. Expression of rimK is shown relative to M9 0.4% pyruvate liquid-culture (LC).
doi:10.1371/journal.pgen.1005837.g001 examined the ability of the rim mutants to competitively colonise the rhizospheres of wheat seedlings. After seven days, significantly fewer ΔrimK and ΔrimA colony forming units (CFUs) were recovered from model rhizospheres compared with the WT-lacZ competitor (Fig 1D). No differences in growth-rate were seen for the ΔrimABK mutants compared with WT in rich or poor defined media (S1B and S1C Fig), suggesting that the observed colonisation defects are specific to the rhizosphere environment. Finally, to test whether rim transcription varies as the surrounding environment changes, we examined rimK mRNA abundance at different points during wheat rhizosphere colonisation. SBW25 mRNA was extracted from inoculated wheat rhizospheres after incubation periods of between 1 and 14 days, and rimK mRNA levels assayed by qRT-PCR. 1-day colonisation samples showed significantly increased (261.7 ± 14.8%) transcript abundance compared with overnight growth in M9 pyruvate. However, rimK expression then decreased sharply as colonisation proceeded, with mRNA abundance after 7 days at 39.1 ± 2.1% of that seen in liquid-culture (Fig 1E), representing an almost seven-fold drop from the levels seen in day 1. This suggests that rimABK expression may be triggered by signals present in the early wheat rhizosphere, then down-regulated in the established root environment.
RimK also controls motility, attachment and virulence in plant and human pathogens
To examine whether RimK affects the plant-association behavior of related, pathogenic Pseudomonas species, we investigated the impact of rimK deletion in the phytopathogen P. syringae pv. tomato (Pto) DC3000 [34] and the opportunistic human pathogen P. aeruginosa PA01. Consistent with the findings for SBW25, deletion of rimK in Pto DC3000 led to increased Congo Red (CR) binding (an assay for lipo/exopolysaccharides and proteinaceous attachment factors [35]) and reduced swarming motility compared to WT (Fig 2A and 2B). Next, we examined the effect of rimK deletion on Pto DC3000 infection of Arabidopsis thaliana Col-0. Upon spray infection, ΔrimK presented both noticeably milder disease symptoms ( Fig 2C) and significantly reduced bacterial proliferation in the apoplast. In contrast, no differences were observed between WT and ΔrimK in a leaf infiltration assay (Fig 2D), suggesting that rimK is important during the early stages of P. syringae plant infection only. Compared to WT PA01, ΔrimK also showed reduced swarming motility (Fig 2A) and significantly increased CR binding ( Fig 2B). Furthermore, PA01 ΔrimK was markedly compromised both in its ability to infect lettuce leaves [36] and to induce β-hemolysis on blood agar plates (Fig 2E and 2F), while growth in liquid media was unaffected (S1D Fig).
RimK interacts with the ribosome and affects its function E. coli RimK is an α-l-glutamate ligase and catalyzes both the ATP-dependent synthesis of poly-α-l-glutamate peptides [9], and the sequential addition of glutamate residues to the C-terminus of ribosomal protein RpsF [8]. To examine the relationship between these two proteins in P. fluorescens, SBW25 RimK and RpsF (RimK Pf /RpsF Pf ) were purified and used to test the parameters of RimK enzyme activity. First, a linked pyruvate kinase-lactate dehydrogenase (PK/LDH) assay was used to test RimK Pf ATPase activity ( Fig 3A). Alone, SBW25 RimK displayed low-level ATPase activity (K m 0.37 ± 0.13 mM, V max 14.84 ± 1.6 nmol/min/ mg protein). The V max of RimK Pf barely increased with RpsF Pf (to 17.8 ± 1.3 nmol/min/mg), but changed more noticeably upon glutamate addition (to 64.3 ± 2.8 nmol/min/mg). While K m did not change markedly with the addition of either co-factor, V max /K m increased steadily (RimK = 39.7, +RpsF = 71, +Glu = 100.3, +both = 132.7), an indication of increasing enzymatic efficiency.
Next, we examined RpsF Pf glutamation using SDS-PAGE gel-shift assays adapted from Kino et al. [9]. Purified RimK Pf increased the mass of RpsF Pf (Fig 3B), consistent with previous observations for the addition of C-terminal glutamate residues [9]. MALDI-TOF analysis confirmed that the shifted band was overwhelmingly composed of RpsF peptides, although we were unable to detect the glutamated C-terminal RpsF peptide in this sample. This may be due to its large size (>3000 Da) and strong negative charge resulting in a failure to be retained on the reverse phase column. To examine the relationship between RimK and RpsF in more detail, we purified the E. coli homologs of both proteins (RimK Ec /RpsF Ec ) and used these to carry out (Fig 3B). Unlike RimK Pf , ATPase activity for E. coli RimK was strictly glutamate dependent, with no activity seen for RimK Ec alone (S2 Fig). As expected, purified RimK Ec increased the mass of RpsF Ec by adding glutamate residues to its C-terminus [9]. Interestingly, the RimK proteins from E. coli and SBW25 were functionally interchangeable: RimK Ec was also able to shift RpsF Pf , and RimK Pf successfully increased the mass of RpsF Ec (Fig 3B). The activity of both RimK homologs to modify RpsF was strictly dependent on the presence of glutamate and ATP in the reaction mix.
While we did occasionally see a conventional RpsF band-shift (Fig 3B), in many cases RimK Pf activity led to the formation of very large, diffuse RpsF bands (confirmed by MALDI-TOF) that ran poorly in SDS-PAGE. Formation of these large, diffuse bands was strictly dependent on the glutamate concentration in the assay, with lower levels producing more conventional band shifts (Fig 3C), and suggesting that the hyper-shifting band pattern seen with RimK Pf is due to uncontrolled RpsF glutamation in our assay conditions. To confirm that the RpsF in the large, diffuse complexes was indeed glutamated, gel-shift assays were repeated with radiolabeled 14 C-glutamate. Progressive incorporation of radiolabel into the RpsF band was seen over 24 hours (Fig 3D), confirming that RimK Pf functions as an α-l-glutamate ligase of RpsF.
To further investigate the effects of RpsF glutamation by RimK on the ribosome, we first examined the effect of rimK deletion on ribosomal RNA abundance by qRT-PCR of the 16S rRNA. No significant differences were observed between WT SBW25 and the rimK deletion mutant (ΔrimK/WT 16S rRNA = 1.27 ± 0.1). Next, we purified ribosomes from SBW25 WT and ΔrimK using sucrose cushion ultracentrifugation and examined the relative abundance of ribosomal proteins by semi-quantitative, comparative LFQ analysis using MaxQuant software. Strikingly, almost every detected ribosomal protein was present at a considerably lower level in ΔrimK compared with WT (S1 Table), despite their similar 16S rRNA levels. Consistent with a role for RimK in the regulation of ribosome function, rimK overexpression significantly increased SBW25 sensitivity to the 30S-targeting aminoglycosides gentamycin and kanamycin, but had no effect on sensitivity to the MurA inhibitor phosphomycin (S3 Fig). This suggests that excess RimK activity affects the ribosome in particular, rather than conferring a non-specific sensitivity to antibiotics in general.
RimK activity is controlled by RimA, RimB and the dinucleotide second messenger cdG Next, we probed the protein-protein interactions of RimABK by co-immunoprecipitation with flag-tagged proteins. As expected, the RimK assay highlighted potential interactions with multiple ribosomally-associated proteins (Table 1), consistent with a role for RimK in ribosomal modification. Interestingly, both RimB and RimA also pulled down similar numbers of ribosomal protein peptides, alongside multiple peptides from the other two Rim proteins. These data suggest that the RimABK proteins associate both with each other and with the ribosome, and posit a role for RimA and RimB in the regulation of RimK activity.
To test this, RimK Pf ATPase assays were repeated with the addition of purified RimA/RimB proteins. Addition of RimB led to a substantial increase in RimK Pf activity (e.g. V max = 691. nmol/min/mg, 113.6 without RimB, Fig 4A), while RimA addition produced a consistent, but much smaller activity increase (e.g. V max = 363.6 nmol/min/mg, 234.9 without RimA, Fig 4B). Again, increases in V max were accompanied by corresponding enzyme efficiency increases. The modest effect of RimA was puzzling given the relative phenotypic effects of rimA/rimB disruption, and suggested another function for RimA besides direct stimulatory interaction with RimK. RimA contains an EAL domain, and is predicted to function as a phosphodiesterase (PDE) for the second messenger cdG. RimA PDE activity was subsequently confirmed ( Fig 4C) using a chromatography-based assay alongside an established PDE; YhjH from E. coli [37]. This activity presented the intriguing possibility that cdG may play a role in the regulation of RimK activity, prompting us to test the relationship between cdG and RimK. Excitingly, both RimK Pf and RimK Ec were shown to bind strongly to cdG in biotinylated cdG pull-down assays and with surface plasmon resonance (SPR) after [38], with K d values of 1.0 and 3.8 μM respectively (Fig 4D and 4E, and S4A Fig). Furthermore, cdG addition was shown to substantially increase both RimK Pf ATPase activity (S4B Fig) and the amount of radiolabeled glutamate incorporated into RpsF in vitro (to 225 ± 59% of the cdG-sample, Fig 4E). These data establish a role for cdG signalling in the direct control of RimK activity, and hence ribosome modification.
Deletion of rimK induces specific changes in the P. fluorescens proteome
To more closely examine how RimK affects ribosomal behaviour in vivo, and to probe the wider effects of this on the bacterial proteome, global quantitative mass-spectrometry analysis was conducted on soluble proteomes from liquid-culture grown SBW25 WT and ΔrimK. Approximately 1,000 proteins were identified in all tested proteomes (S6 Table, Table). Once again, reduced levels of 17 ribosomal proteins were detected in the ΔrimK mutant relative to WT, alongside (possibly compensatory) increases in levels of elongation factor P (EF-P) and ribosome-recycling factor (Frr). One of the most strongly down-regulated proteins in the ΔrimK proteome was the global translational regulator Hfq ( Fig 5A, Table 2). Hfq is a small, hexameric RNA-binding protein Table 2. Up-and Down-regulated proteins in the ΔrimK mutant background.
Down-regulated in mutant
ΔrimK fold-change that exerts pleiotropic effects on mRNA translation by mechanisms that include facilitating the binding of regulatory sRNAs with their mRNA targets [5,39] and targeting the degradation of selected mRNAs [40][41][42]. Hfq may also act as a direct repressor of mRNA translation [43].
ΔrimK also contained markedly increased levels of numerous ABC transporter subunits, primarily those for amino acids, dipeptides and the polyamine putrescine. Several ABC-exported peptides were also strongly up-regulated (Table 2). Altered ABC transporter abundance has been linked to hfq deletion in several studies [44][45][46]. Seven NRPS genes, including three synthases for the iron scavenging siderophore pyoverdin (Pvd) were also significantly up-regulated in the ΔrimK strain. Hfq has been implicated in the control of iron homeostasis [44], again suggesting a link between these proteome changes and Hfq down-regulation. A further important class of ΔrimK up-regulated proteins are those involved in oxidative stress responses, including superoxide dismutase (SodA), thioredoxin and glutathione S-transferase and reductase [47]. Once again, regulation of these proteins has been linked to Hfq [48]. Also up-regulated were several enzymes involved in the secretion and post-translational modification of proteins such as the isomerase SurA, disulfide oxidoreductase DsbA and the pre-protein translocase YajC. The up-regulation of these proteins is consistent with a role in processing and folding the excess periplasmic ABC transporter peptides found in the ΔrimK background.
In addition to the drop in Hfq levels, a smaller decrease was observed for a second translational regulator, RsmE [6]. Rsm family proteins control phenotypes including virulence, motility, exopolysaccharide production, carbon metabolism and stress responses in numerous Gram-negative bacteria [49][50][51]. Reduced protein abundance was also seen for the chromatin organization and DNA bending proteins HU1, HU-beta, and IhfB [52,53] (S2 Table). Several transcriptional regulators, including AlgP1 and AlgP2 [54,55] were down-regulated, while the osmosis regulator OmpR was significantly more abundant in the ΔrimK background (S2 Table). Clearly, the proteomic changes that arise as a consequence of rimK deletion are both complex and pleiotropic, and determining their relevance and interconnection is the subject of active enquiry. Following the proteomic analysis, RT-PCR was used to examine the relative mRNA abundance of nine significantly up/down-regulated proteins in WT and ΔrimK. No discernable change was observed in the mRNA levels of hfq, rsmE, or any of the other RimK up-or down-regulated proteins tested (Fig 5B), supporting the hypothesis that the observed differences between the ΔrimK and WT proteomes predominantly occur post-mRNA transcription.
Downstream genetic analysis of the RimK regulon
To further test whether the P. fluorescens ΔrimK phenotypes may be attributed to reduced Hfq abundance, an SBW25 hfq deletion mutant was produced and tested for phenotypes including swarming and wheat rhizosphere colonisation. Deletion of hfq produced small, smooth colonies that took significantly longer to arise than WT SBW25. Similarly to ΔrimK, the Δhfq mutant showed compromised swarming motility (Fig 6A), as well as enhanced Congo Red binding (Fig 6B). Rhizosphere colonisation was also significantly compromised ( Fig 6C), with too few Δhfq CFUs recovered (<0.1% of WT) to quantify in some cases. The phenotypes seen upon hfq deletion were markedly more severe than were seen for ΔrimK, although this is perhaps unsurprising as Hfq is still present in the ΔrimK background, albeit at a reduced abundance. Next, SBW25 WT and Δhfq soluble proteomes were isolated and separated by SDS-PAGE. The region between 25 and 58 kDa (corresponding to the size range of the most strongly upregulated proteins in ΔrimK) was then examined by comparative MaxQuant analysis. Consistent with the results for ΔrimK, hfq deletion led to up-regulation of multiple ABC transporter subunits, stress response proteins, secretion systems and proteins involved in the production/utilization of pyoverdin and other siderophores (S3 Table). A substantial degree of overlap was seen between the ΔrimK and Δhfq proteomes. 25 significantly upregulated proteins were common to both datasets (Table 3, S3 Table), including ten ABC transporters, two stress response proteins including SodA, and three iron homeostasis proteins. These data support the hypothesis that many of the phenotypic and proteomic changes in ΔrimK are ultimately the result of reduced Hfq levels in this strain.
To confirm that the phenotypes associated with the rimK mutant arise specifically as a consequence of the loss of RpsF glutamation, we decided to abolish RpsF glutamation in vivo while disrupting RimK and RpsF as little as possible. To this end, we cloned and purified an allele of SBW25 RpsF with the penultimate C-terminal residue replaced with lysine (RpsF-D139K). This modification should prevent the C-terminal glutamation of RpsF [8]. We then tested the RpsF-D139K variant for glutamation by both SBW25 and E. coli RimK, and confirmed that neither protein could modify this allele in vitro (Fig 6C). Incidentally, RpsF-D139K consistently ran at a slightly different position to WT RpsF, which may be a consequence of neutralizing the strong negative charge of the RpsF C-terminus.
Next, we produced a chromosomal rpsF-D139K substitution mutant by allelic exchange, and tested it for plant association phenotypes alongside ΔrimK. As predicted, we observed both increased wheat root attachment and compromised rhizosphere colonisation to near-identical levels to those seen with the ΔrimK mutant (Fig 6D and 6E), strongly supporting the loss of rpsF glutamation as the major cause of the phenotypes seen in ΔrimK. Like ΔrimK, no differences in growth rate were observed between the rpsF-D139K strain and WT SBW25 in either rich or poor nutrient media (S5 Fig). Finally, we used a newly-raised polyclonal RpsF antiserum to examine levels of the RpsF protein in our various rim/rpsF mutant strains by Western blotting. Levels of the RpsF-D139K allele were comparable to WT RpsF, indicating that the non-glutamated allele is produced and stably maintained in the cell (Fig 6F), and supporting the idea that the phenotypes seen reflect the loss of modification rather than the complete loss of the RpsF protein.
Discussion
Here we identify a new mechanism for control of protein abundance based on differential, post-translational modification of the ribosomal protein RpsF, in the plant-associated bacteria P. fluorescens and P. syringae and the human pathogen P. aeruginosa. Glutamation of RpsF by the α-l-glutamate ligase RimK induces specific, adaptive changes in the bacterial proteome through modification of ribosomal behaviour. These RimK-induced proteomic shifts play an important role in the adaptation of both commensal and pathogenic Pseudomonas species to environmental changes, and contribute to efficient root colonisation and plant infection. RimK catalyzes the ATP-dependent addition of glutamate residues to the C-terminus of the ribosomal protein RpsF. This modification has important impacts on the bacterial ribosome, with rimK deletion leading to reduced ribosomal protein levels. Surprisingly however, the loss of RimK modification does not visibly affect bacterial vitality, as growth rates and colony morphology remain unaffected in the ΔrimK mutant. Similarly, ribosomal RNA levels are unaffected by rimK deletion. Deletion of rimK also leads to marked downstream changes in the P. fluorescens proteome. As these proteomic shifts are not linked to corresponding changes in mRNA abundance for any of the proteins tested, we propose that RimK modification of the ribosome changes its function in such a way as to promote or suppress the translation of specific mRNAs and/or translational regulator abundance. The precise mechanism by which RimK activity affects ribosomal function, and the consequent remodeling of the proteome, is the subject of ongoing research. While the proteomic changes that arise as a consequence of RimK activity are highly complex, many of the phenotypes and proteomic changes seen in ΔrimK may be confidently linked to the translational regulator Hfq, which is strongly down-regulated upon rimK deletion. Like ΔrimK, hfq deletion induces phenotypes including increased attachment factor production, and compromised motility and rhizosphere colonisation. Δhfq also displayed significantly increased abundance of proteins associated with ABC transport, iron scavenging and utilization and oxidative stress responses, in common with the ΔrimK mutant. In support of this, biochemical and whole-cell analyses in various species have connected Hfq to proteomic changes associated with iron homeostasis [44], stress responses [48] and the production of multiple amino-acid ABC transporters in the context of rhizosphere adaptation. Microarray analysis of a R. leguminosarum hfq suppressor mutant shows that Hfq negatively regulates the mRNA stability of various amino-acid ABC transporters [45]. Furthermore, proteomic and transcriptomic studies in S. meliloti show Hfq repression of both solute-binding proteins and aminoacid ABC transporters [44,46]. Multiple proteins involved in amino-acid, nucleotide and carbohydrate metabolism are also up/down-regulated in the ΔrimK strain. Again, some of these changes may be linked to Hfq disruption. Alternatively, they may represent an adaptive response to altered amino-acid abundance, triggered by enhanced ABC transporter levels.
While reduced Hfq levels undoubtedly explain many of the ΔrimK phenotypes, numerous RimK-linked proteins were not identified in the published regulons for Hfq [44,46]. Altered abundance of several important regulatory proteins including RsmE, histone-like proteins and the transcriptional regulators AlgP1 and AlgP2 were seen in the ΔrimK mutant and may explain some aspects of ΔrimK behavior. While these changes may also be Hfq-mediated, it is also possible that translational regulation of some mRNAs may occur as a direct result of RimK ribosomal modification.
Critically, our data suggest that RimK modification of RpsF is not passive, but varies both with differential rimK transcription as the environment changes, and possibly also directly, through RimK interaction with RimA, RimB and the signalling molecule cdG. Both Rim proteins and cdG stimulate RimK Pf enzyme activity in vitro, and thus at first glance appear to function as positive regulators of RimK. However, it is likely that the in vivo situation is more complex. In the case of RimB, strong activation of RimK by protein-protein interaction in vitro does not correspond to noticeable plant-associated phenotypes. This suggests that the relationship between these two proteins is both context-specific, and dependent on additional, as-yet undetermined factors.
RimK is further controlled by direct binding to the important signalling molecule cdG, which increases the glutamate ligase activity of the P. fluorescens protein in vitro. This binding seems to be widespread, with low-μM binding affinities measured for both the P. fluorescens and E. coli RimK homologs. Uniform stimulation of RimK activity by cdG binding runs counter to the generally accepted model for cdG signalling, where increased cdG levels promote sessile, persistent lifestyles over motile, virulent ones. Again, this suggests that the true relationship between cdG and RimK activation is likely to be more complex than that seen in our biochemical assays.
Deletion of rimA produces effects consistent with a loss of rimK in vivo, suggesting that RimA functions as a positive regulator of RimK. While rimB is associated with rimK in around half of the genomes encoding a Rim system, rimA is restricted to plant-associated Pseudomonas species such as P. fluorescens and P. syringae [56]. For example, the P. aeruginosa rim operon lacks a rimA homolog. RimA thus appears to represent a particular refinement of the regulatory system required for colonisation of the complex plant-associated niche. The relationship between RimK and RimA is probably based on more than just the modest, direct stimulation of RimK activity seen in vitro. It seems likely that RimA moderates the relationship between cdG and RimK in some way, although the nature of this control is currently unclear. RimA may play an active role; hydrolyzing RimK-associated cdG under certain circumstances, or a passive one; constitutively degrading cdG to buffer the impact of changing dinucleotide levels on RimK activity. Alternatively, it may act as a trigger enzyme, with cdG hydrolysis altering the RimA-RimK relationship in common with a recently characterized pathway in E. coli [57]. While the details of the RimABK-cdG regulatory circuit remain to be fully established, it is clear that control of RimK activity represents a high-level regulatory mechanism that integrates cdG-signalling with post-translational ribosome modification, and hence control of bacterial protein production. In turn, this enables bacteria to rapidly fine tune their proteomes to optimally respond to the surrounding environment (Fig 7).
In our experiments, P. fluorescens rimK mRNA abundance peaked during initial wheat rhizosphere colonisation, but then progressively declined as the rhizosphere community matured over the next six days. We propose that enhanced RimK levels during the initial stages of root colonisation equates to enhanced RpsF glutamation. This in turn leads to increased abundance of Hfq (and possibly other regulators such as RsmE), and reduced translation of target mRNAs including those for ABC transporters and NRPS pathways. Our model suggests that an early peak in rimK expression promotes a state where organic acid transport, siderophore utilization and a sessile, surface-adherent lifestyle are downplayed in favor of increased motility and rapid [4,44,51]. In the established rhizosphere/plant infection environment (bottom row), rimK transcription decreases. Less RpsF is glutamated, leading to altered ribosomal protein abundance and ribosome function, and lower Hfq levels. Release of Hfq translational repression leads to increased production of amino-acid transporters (ABC), oxidative stress response pathways (SodA), NRPSs and attachment factors. These changes promote resource acquisition, stress resistance and root attachment, and prioritize long-term adaptation to the plant environment. RimK activity is further regulated by direct interaction with the RimA/B proteins and the signalling molecule cdG. '+/-' denotes cases where the nature of protein/dinucleotide control is currently undefined. colonisation of the spatial environment of the rhizosphere (Fig 7). Reduced rimK transcription in the established wheat rhizosphere would lead to decreased Hfq abundance, and consequently to increased root attachment, production of siderophores and deployment of ABC transporters for polyamines, peptides and organic acids (Fig 7). Organic acid catabolism is the predominant form of carbon metabolism in the rhizosphere [17], necessitating a shift towards ABC transporter expression and metabolic enzyme reorganization. Similarly, siderophore production plays an important survival role in the competitive rhizosphere environment [14], scavenging iron and other metals and providing a measure of oxidative stress-protection [58]. Reduced RimK/Hfq abundance in the established rhizosphere also corresponds to up-regulation of oxidative stress response proteins such as SodA. Again, this is logical in the context of a global strategy for adaptation to the rhizosphere environment, where oxidative stress is a constant threat [59]. Induction of the soxR regulon has been shown upon RpsF glutamation in E. coli, and a similar mechanism may function in P. fluorescens [60]. Down-regulating RimK production may therefore represent an effective strategy for optimizing the bacterial proteome to the established rhizosphere environment (Fig 7).
RimABK regulatory effects appear to be both subtle and global; 'tuning' the ribosome for optimal performance in a particular environment rather than acting as a checkpoint for a specific phenotype in response to an input signal. This is reflected in the relatively modest phenotypes seen for P. fluorescens ΔrimK compared to Δhfq. For example, compromised rhizosphere colonisation by ΔrimK is likely to stem from multiple interconnected factors, including an inability to fully adapt the surface transporter complement to optimally exploit the organicacid rich environment of the rhizosphere [17], putrescine transporter overproduction leading to H 2 O 2 toxicity [61,62], and disruption of the complex relationship between motility and attachment during rhizoplane colonisation [6,14,63].
In addition to controlling phenotypes associated with colonisation and metabolic adaptation, RimK plays an important role in the virulence of both human and plant pathogenic pseudomonads. In P. syringae, RimK is important for the initial stages of plant infection but is not required for apoplastic proliferation. This is in agreement with the results seen for rimK expression during P. fluorescens rhizosphere colonisation, and suggests that RimK fulfils a similar, global adaptation role in both species. Thus, RimK activity in the early stages of infection would promote bacterial migration from plant surfaces into the apoplast through stomata and wounds on the plant surface. Once infection is underway, P. syringae changes the expression of metabolic genes to exploit the nutrient availability of the apoplast [64,65], and up-regulates multiple additional loci including genes for polysaccharide synthesis, stress tolerance and nutrient uptake [65]. RimK would therefore become redundant under these conditions. For the opportunistic human pathogen P. aeruginosa, the loss of virulence associated with rimK deletion was more general; occurring even in stabbed lettuce leaves and accompanied by the loss of β-hemolytic activity. This suggests that virulence loci are directly under rimK/hfq control in P. aeruginosa. While significant parallels exist between the RimK regulons of P. fluorescens, P. syringae and P. aeruginosa, there are nonetheless also important differences between them. We are actively investigating the differences between the ΔrimK proteomes of various Pseudomonas species, and how they impact on the relationship between pathogenic and commensal microbes and their respective hosts.
Methods
Strains and growth conditions
Strains and plasmids are listed in S4 Table. Primers are listed in S5 Table. Unless otherwise stated all P. fluorescens and P. syringae strains were grown at 28°C, and P. aeruginosa and E. coli at 37°C in lysogenic broth (LB) [66], solidified with 1.3% agar where appropriate. Gentamycin was used at 25 μg/ml, carbenicillin at 100 μg/ml, piperacillin and fosfomycin at 2 mg/ml and tetracycline (Tet) at 12.5 μg/ml (50 μg/ml for P. aeruginosa). For inducible plasmids, IPTG was added to a final concentration 0.2 (SBW25) or 1 mM (E. coli) as appropriate.
Molecular biology procedures
Cloning was carried out in accordance with standard molecular biology techniques. The pME-rimA/B/K plasmids were constructed by ligation of the appropriate PCR fragments (amplified with primers 5/6, 3/4 and 1/2 respectively, from SBW25 genomic DNA), between the EcoRI and KpnI sites of plasmid pME6032 [67]. The C-terminal flag-tagged rim plasmids were produced from these by the method described by Yu et al. following flag cassette amplification from pSUB11 with primers 9/10, 8/10 and 7/10 [68]. The kanamycin gene inserted downstream of the rim gene was then excised by transformation of the E. coli host with pFLP2 [69] followed by sucrose counter-selection. The pETM11-rpsF, pETM11-rimB, pETM11-rimA and pET42b(+)-rimK purification vectors were produced by ligating PCR fragments (amplified with primers 21/22, 29/30, 13/14, 15/16, 11/12 and 27/28) between the NdeI and XhoI sites of plasmids pETNdeM-11 [70] and pET42b(+) (Novagen) as appropriate. Reverse-transcriptase PCR (RT-PCR) was conducted using primers . The SBW25 rimABK complementation vectors were constructed by ligation of the relevant rimABK PCR fragments (amplified from appropriate rim deletion strains with primers 74-77) between the HindIII and BamHI sites of pUC18T-mini-Tn7T-Gm.
Gene deletions
P. fluorescens, P. syringae and P. aeruginosa deletion mutants were constructed via an adaptation of the protocol described elsewhere [71]. Up-and downstream flanking regions to the target genes were amplified using primers 17-20, 53-56, 57-60, 23-26 and 61-64. PCR products in each case were ligated into pME3087 between EcoRI-BamHI. The resulting vectors were transformed into the target strain, and single crossovers were selected on Tet and re-streaked. Cultures from single crossovers were grown overnight in LB medium, then diluted 1:100 into fresh medium. After 2 hours, 5 μg/ml Tet (20 μg/ml for P. aeruginosa) was added to inhibit the growth of cells that had lost the Tet cassette. After a further hour of growth, samples were pelleted and re-suspended in fresh LB containing Tet and 2 mg/ml piperacillin and phosphomycin to kill growing bacteria. Cultures were grown for a further 4-6 hours, washed once in LB and a dilution series plated onto LB agar. Individual colonies were patched onto LB plates ± Tet, and Tet-sensitive colonies tested for gene deletion/modification by colony PCR.
rpsF-D139K point mutation
The mutant allele with flanking regions for the SBW25 D139K point mutation in rpsF (PFLU0533) was prepared by primer extension PCR. Primer pairs 66/68 and 67/69 were used to produce PCR products that were subsequently combined in a second PCR with primer pair 66/ 69 to produce the mutant allele with flanking regions. This product was ligated into pME3087 between XhoI-BamHI and introduced into the P. fluorescens chromosome as detailed above.
Phenotypic assays
The Congo Red (CR) binding assay was adapted from [72]. Five 10 μl drops of LB overnight cultures per strain were grown on 20 ml King's B agar plates for 24 hours at 28°C. Each colony was then re-suspended in 1 ml 0.005% (w/v) CR (Sigma) and incubated for 2 h at 37°C with shaking. Colony material was pelleted by centrifugation and CR remaining in the supernatant determined by measurement of A 490 compared to appropriate CR standards. To measure swarming motility, 0.3-0.5% Kings B agar plates (as indicated) were poured and allowed to set and dry for 1 hour in a sterile flow chamber. Plates were then inoculated with 2 μl spots of overnight cultures, and incubated overnight at room temperature. Each sample was tested in triplicate. Disc inhibition assays were carried out using paper discs impregnated with 20 μg/ml gentamycin, on LB + 0.004% CR plates spread with 100 μl of OD 1.0 overnight cultures. Plates were then incubated overnight at 28°C. Assays were repeated at least once independently, and statistical significance assessed using Students t-tests where appropriate.
Growth assays
Bacterial growth was monitored in a microplate spectrophotometer (BioTek Instruments) using a minimum of 3 experimental replicates/sample. Wells (of a 96-well plate) contained 150μL of the indicated growth medium, supplemented with 0.1 mM IPTG and 12.5 μg/ml tetracycline where appropriate. For the antibiotic inhibition assays (S3 Fig), gentamycin, kanamycin and carbenicillin were added to the concentrations noted. Growth was initiated by the addition of 5μL of cell culture with an OD 600 = 0.01. Plates were covered with adhesive sealing sheets and incubated statically at 28°C.
Wheat root attachment
SBW25 strains containing the bioluminescent plasmid pIJ-11-282 [73] were grown overnight in M9 0.4% pyruvate media. Cultures were normalized by luminescence using a GloMax Multi JR luminometer (Promega) and diluted 1:100 in 10 ml 25 mM pH7.5 phosphate buffer in sterile 50 ml tubes, each containing 12-15 1.5 cm long sterile 3 day-old wheat root tips. Tubes were incubated for 2 hours at room temperature with gentle shaking, before supernatant was discarded and the roots washed twice with phosphate buffer. 10 roots per sample were transferred to individual tubes and luminescence measured and compared with that obtained for wild-type SBW25. The assay was repeated twice independently, and statistical significance assessed using Students t-tests.
Rhizosphere colonization
Paragon wheat seeds were sterilized with 70% ethanol and 5% hypochlorite, washed, and germinated on sterile 0.8% MS agar for 72 h in the dark. Seedlings were then transferred into sterile 50 ml tubes containing medium grain vermiculite and rooting solution ( WT-lacZ and mutant SBW25 strains were grown overnight in M9 0.4% pyruvate media, then diluted in phosphate buffer and 1 x 10 3 CFU of mutant and WT-lacZ bacteria used to inoculate seven day-old seedlings. Plants were grown for a further seven days, after which shoots were removed, 20 ml PBS was added to each tube and vortexed thoroughly to resuspend bacteria. A dilution series was plated onto XGal + IPTG plates and WT-lacZ/mutant colonies distinguished by blue/white selection. Assays were conducted for 8-12 plants/mutant, repeated at least twice independently, and statistical significance assessed using Mann-Whitney tests.
Bacterial plant infection P. aeruginosa lettuce leaf infections were carried out after [36]. For P. syringae infections, Arabidopsis thaliana ecotype Columbia (Col-0) plants were grown at 20-22°C under 10 h light period for 4 weeks. Pto DC3000 cultures were grown overnight, re-suspended in 10 mM MgCl 2 and adjusted to OD 600 = 0.0002 (10 5 CFU/ml) for syringe infiltration and OD 600 = 0.05 (10 7 CFU/ml) for spray infection. Shortly before spraying 0.02% Silwet L77 was added to the suspension, plants were sprayed until run-off. All plants were covered with vented lids for five days. Six leaf discs (7 mm diameter) from six different plants per strain were collected in 10 mM MgCl 2 and homogenized using a drill-adapted pestle. Serial dilutions were plated and CFUs determined in each case. The assay was repeated three times independently and statistical significance assessed using Students t-tests.
Co-immunoprecipitation
SBW25 pME-rimA/B/K-flag overnight cultures were pelleted by centrifugation, re-suspended in ice-cold IP buffer (20 mM HEPES pH 7.4, 100 mM NaCl, 1 mM EDTA, 1.0% v / v Triton X-100, protease inhibitor), and incubated at 4°C with end-over-end agitation for 6 hours. Samples were then centrifuged (15,000 g, 20 min, 4°C), and the supernatant removed and incubated with 20 μg/ml protein-A agarose beads (4°C, end-over-end agitation, 30 min) to remove non-specifically binding proteins. Samples were then centrifuged (3,000 g, 1 min 4°C) to pellet the beads, an aliquot of the supernatant was taken for analysis, and the remaining supernatant was incubated overnight with 20 μg/ml ANTI-FLAG M2 affinity gel (Sigma) (4°C, end-over-end agitation). Samples were pelleted by centrifugation (3,000 g, 1 min 4°C), the supernatant was discarded and the beads re-suspended in 1.0 ml ice-cold IP buffer. This wash step was repeated 5 times. The beads were then re-suspended in SDS sample buffer, boiled, and pelleted by centrifugation. The presence of Flag-tagged Rim proteins in the supernatant was confirmed by immunoblotting, and interacting proteins were detected by Orbitrap mass spectrometry. Results were compared with two control datasets (M2 bead-only, and a non-specific protein control based on immunoprecipitation of unrelated flag-tagged proteins (PFLU3129 and PFLU3130)).
Ribosomal enrichment
Ribosomal enrichment was adapted from the method described in [74]. 500 ml SBW25 WT and ΔrimK overnight cultures were grown in M9 0.4% pyruvate. 1 mM chloramphenicol was added, and samples were incubated on ice for 20 minutes. Cells were pelleted by centrifugation, re-suspended in 2ml lysis buffer (20 mM Hepes pH 7.8, 6 mM MgCI 2 , 100 mM NaCI, 16% ( w / v ) sucrose), and incubated on ice with 2 mg/ml lysozyme for 1 hour. Samples were then sonicated for 30 seconds, and centrifuged twice (10,000 g, 15 min, 4°C) to remove cell debris. The resulting lysates were diluted threefold with running buffer (20 mM Hepes pH 7.8, 6 mM MgCI 2 , 100 mM NaCI, 2 mM EDTA, protease inhibitor), loaded onto 2 ml 35% sucrose cushions and ultracentrifuged for 2 hours (300,000 g, 4°C). Pellets from the ultracentrifugation step were washed twice and re-suspended in running buffer before analysis by SDS-PAGE and Orbitrap mass spectrometry.
Purification of Rim and RpsF proteins 1.0 litre E. coli BL21-(DE3) pLysS overexpression cultures were inoculated from overnights and grown at 30°C to an OD 600 of 0.6, before protein expression was induced for 2 hours with 1mM IPTG. Cells were then lysed by French press and His 6 -tagged proteins purified by NTA-Ni chromatography. 1 ml HiTrap chelating HP columns (Amersham) were equilibrated with 25 mM KH 2 PO 4 , 200 mM NaCl, pH 8.0 (SBW25 RimA/B/K), 50 mM Tris-Cl, 2.5% glycerol, pH 8.0 (SBW25 RpsF) or 50 mM Tris, 300 mM NaCl, 10 mM imidazole, pH 9.0 (E. coli RimK and RpsF), and loaded with cell lysate. Following protein immobilization, elution was accomplished using a linear gradient to 500 mM imidazole over a 15 ml elution volume.
RpsF glutamation assays
The glutamation assay was adapted from Kino et al. [9]. Briefly, purified RpsF and Rim proteins in a 1:1 ratio were incubated for the indicated times at room temperature in reaction buffer (20 mM glutamate, 20 mM ATP, 20 mM MgSO 4 Á7H 2 O, 100 mM Tris-HCl pH 9). The reaction products were then analyzed using Tricine-SDS-PAGE gels and MALDI-TOF spectroscopy. Reactions were supplemented as indicated with a 1:1 ratio of purified RimA/RimB, 150 μM cdG (Sigma), and/or 13 μM L-[ 14 C(U)]-Glutamic Acid (Perkin Elmer). For the experiments in Fig 4F, assays were repeated in triplicate and radiolabel incorporation was quantified using MultiGauge software (Fuji Film).
Linked Pyruvate Kinase / Lactate Dehydrogenase (PK/LDH) ATPase activity assay ATPase activity was measured indirectly by monitoring NADH oxidation. The reaction buffer consisted of 50 mM Tris-Cl (pH 8.0), 2 mM MgCl2, 1 mM DTT and 10mM KCl. Each 100 μL reaction contained 0.4 mM NADH, 0.8 mM phosphoenolpyruvic acid, 1 μM RimK/RpsF protein, 0.7 μl PK/LDH (Sigma) and was initiated by the addition of 10 μL ATP. Enzyme kinetics were determined by measuring A 340 at 1 minute intervals. Kinetic parameters were calculated by plotting the specific activity of the enzyme (nmol ATP hydrolysed/ min/ mg of protein) versus ATP concentration and by fitting the non-linear enzyme kinetics model (Hill equation) in GraphPad Prism. 25 μM cdG or 1 μM RimB/RimA proteins were included as appropriate.
Phosphodiesterase activity assay
The assay was carried out after Christen et al. [75]. Briefly, 32 P-cdG was produced enzymatically with PleD Ã , then 100 μM cdG supplemented with 0.07 μM 32 P-cdG was incubated with 1.5 μM YhjH, RimA or BSA at 30°C. The reaction buffer contained 25 mM Tris pH 8.0, 100 mM NaCl, 10 mM MgCl 2 , 5 mM β-mercaptoethanol and 5% glycerol. Aliquots were removed after 5 and 60 min, and the reaction stopped with 0.25 M EDTA before TLC separation and visualization.
Biotinylated cdG pull-down experiment
Cell lysates overexpressing RimK were prepared by sonicating 5 ml of culture, previously induced with 0.5mM IPTG for 5 hours at 28°C. The lysed cells were pelleted (20,000 g, 1 hr.) and 45 μL of the soluble fraction was collected and mixed with biotinylated cdG (BioLog B098) at a final concentration of 30 μM. Samples were then incubated overnight with end-over-end rotation at 8°C. Samples were then cross linked for 4 minutes in a UV Stratalinker (Stratagene) before addition of 25μl of streptavidin magnetic beads (Invitrogen) and a further hour of incubation with end-over-end rotation at 8°C. Streptavidin magnetic beads were recovered with a magnet and washed five times with 200 μL of protein wash buffer (20 mM HEPES pH 7.5, 250 mM NaCl, 2 mM MgCl 2 , 2.5% (v/v) glycerol), to remove unbound proteins. Samples were then run on an SDS-PAGE gel and visualized with colloidal Coomassie stain.
Surface plasmon resonance
SPR experiments were conducted at 25°C with a Biacore T200 system using a Streptavidin SA sensor chip (GE healthcare) with four flow cells each containing SA pre-immobilized to a carboxymethylated dextran matrix. Flow cell one (FC1) and flow cell three (FC3) were kept blank for reference subtraction. The chip was first washed three times with 1 M NaCl, 50 mM NaOH to remove unconjugated streptavidin. 100 nM biotinylated cdG (BioLog B098) was then immobilised on FC2 and FC4 at a 50 RU immobilisation level with a flow rate of 5 μL/min. Soluble RimK alleles at the required concentration were prepared in SPR buffer (10 mM HEPES, 150 mM NaCl, 0.1% Tween 20, 2 mM MgCl 2 , pH 6.5). Samples were injected with a flow rate of 5 μL/min over the reference and cdG cells for 90 seconds, followed by buffer flow for 60 seconds. The chip was washed at the end of each cycle with 1 M NaCl. Replicates for each protein concentration were included as appropriate. Sensorgrams were analysed using Biacore T200 BiaEvaluation software 1.0 (GE Healthcare).
Quantitative analysis using isobaric labelling (iTRAQ) 50 ml SBW25 WT and ΔrimK overnight cultures were grown in M9 0.4% pyruvate. Cellular activity was then frozen by addition of 30 ml of 'RNAlater' (saturated (NH 4 ) 2 SO 4 , 16.7 mM Na-Citrate, 13.3 mM EDTA, pH 5.2) and protease inhibitors. Cells were pelleted by centrifugation and washed three times with 10 mM HEPES pH 8.0 + protease inhibitors, before re-suspension in 200 μL. 700 μL pre-cooled RLT + β-mercaptoethanol buffer (RNeasy Mini Kit, QIAGEN) was added and samples lysed with two 30 second Ribolyser 'pulses' at speed 6.5. The supernatant was removed, and the soluble fraction separated by ultracentrifugation (279,000 g, 30 minutes, 4°C). Soluble proteomes were acetone precipitated and protein concentrations determined. The proteomic samples were then subjected to iTRAQ quantitative mass spectrometry.
Specifically, samples were reduced, alkylated and digested with trypsin [76], then labelled with iTRAQ tags according to the manufacturer's instructions (AB Sciex). Samples were then mixed, desalted on a SepPak column (Waters) and fractionated by high-pH reversed phase chromatography on an Xterra HPLC column (Waters). The fractionated samples were analyzed by LC-MS/MS on a Synapt G2 mass spectrometer coupled to a nanoAcquity UPLC system (Waters). Peaklist (.pkl) files were generated in ProteinLynx Global Server 2.5.2 (Waters).
Label-free analysis of protein extracts by LC-MS/MS
Ribosome protein samples were acetone precipitated and re-dissolved in 8 M urea, 100 mM Tris-HCl pH 8.0. Eluates from Co-IPs were run into an SDS gel and bands cut out for protein identification. All samples were reduced, alkylated, and digested with trypsin [76], then analyzed by LC-MS/MS on an LTQ-Orbitrap™ mass spectrometer (Thermo Fisher) coupled to a nanoAcquity UPLC system (Waters). Data dependent analysis was carried out in Orbitrap-IT parallel mode using CID fragmentation of the 5 most abundant ions in each cycle. The Orbitrap was run with a resolution of 30,000 over the MS range from m/z 350 to m/z 1800, an MS target of 10 6 and 1 s maximum scan time. The MS2 was triggered by a minimal signal of 1000 with an AGC target of 3x10 4 ions and 150 ms scan time using the chromatography function for peak apex detection. Dynamic exclusion was set to 1 count and 60 s exclusion with an exclusion mass window of ±20 ppm. Raw files were processed with MaxQuant version 1.5.0.30 (http:// maxquant.org). For relative label-free quantitation (LFQ) the following parameters were used: min. unique peptides = 2, peptides for quantitation = unique, include oxidised (M) peptides, maximum missed cleavages = 1, min. LFQ ratio count = 1, match between runs = yes, intensity determination = sum FWHM (smooth).
Protein identification from gel bands by MALDI-TOF
Gel slices were treated and digested with trypsin [76] and peptides spotted onto a PAC II plate (Bruker Daltonics). The spots were washed briefly with 10 mM NH 4 PO 4 , 0.1% TFA according to the manufacturer, dried and analyzed by MALDI-TOF on an Ultraflex TOF/TOF (Bruker). The instrument was calibrated using the pre-spotted standards (ca. 200 laser shots). Samples were analyzed using a laser power of approx. 25%, and spectra were summed from ca. 10 x 30 laser shots. Data processing was conducted using FlexAnalysis (Bruker).
Database searches in each case were performed using an in-house Mascot 2.4 Server (Matrixscience) on a P. fluorescens protein database (www.uniprot.org). Mascot search results were imported into Scaffold (Proteome Software) for evaluation and comparison. Mass spectrometry data have been deposited to the ProteomeXchange Consortium (http:// proteomecentral.proteomexchange.org) via the PRIDE partner repository [77] [Dataset identifiers PXD001371 and PXD001376, Project DOI: 10.6019/PXD001376, PXD002573, Project DOI: 10.6019/PXD002573].
RNA extraction
To obtain SBW25 rhizosphere RNA, shoots were removed from 8 wheat seedlings, each previously inoculated with 10 8 CFU bacteria. 20 ml of 60% RNAlater (in PBS) was added to each tube, and sealed tubes were vortexed for 10 min at 4°C. The 8 samples were combined and filtered through 4 layers of muslin into sterile tubes, and the filtrate was centrifuged (200 g, 4°C, 1 min) to remove heavy particulate contamination. Cells were then pelleted (10,000 rpm, 4°C, 10 min) and lysed by mechanical disruption before RNA was purified from the lysate by column capture (QIAGEN RNeasy Mini Kit). Purified RNA was subjected to an additional DNase treatment (Turbo™ DNase, Ambion). RNA quantification was performed by specific fluorometric quantitation (Qubit1, Life Technologies).
Quantitative real-time PCR (qRT-PCR) analysis
cDNA synthesis was performed using SuperScript II reverse transcriptase and random primers (Invitrogen) in the presence of RNasin ribonuclease inhibitor (Promega). The quantity of total RNA used was dictated by the lowest concentration sample in each assay in the case of rhizosphere samples. cDNA was then used as template in qRT-PCR performed with a SensiFAST SYBR No-ROX kit (Bioline). Three technical replicates were used for each gene. Specific qPCR primers (31-34 and 70-73) were used to amplify reference and target genes. To normalize for differing primer efficiency, a standard curve was constructed (in duplicate) using chromosomal DNA. Melting curve analysis was used to confirm the production of a specific single product from each primer pair. qRT-PCR was performed using a CFX96 Touch instrument using hardshell white PCR plates (Bio Rad). PCR products were detected with SYBR green fluorescent dye and amplified according to the following protocol: 95°C, 3 min, then 50 cycles at 95°C 5 sec, 62°C 10 sec and 72°C 7 sec. Melting curves were generated at 65 to 95°C with 0.5°C increments. Primers were used at a final concentration of 1 μM. The entire experiment (including RNA extraction) was repeated once independently.
Supporting Information S1 Fig. mRNA abundance and growth curves for ΔrimA, B and K mutants. A. rimK mRNA abundance in ΔrimA, B and K mutant backgrounds, relative to WT SBW25. B. Growth curves for SBW25 WT and ΔrimA, B and K in rooting solution + 0.4% pyruvate, 0.4% glucose (see Methods, Rhizosphere colonisation). C. Growth curves for SBW25 WT and ΔrimA, B and K in rooting solution + 0.4% pyruvate. D. Growth curve for PA01 and ΔrimK in rooting solution + 0.4% pyruvate, 0.4% glucose. No significant differences in growth rate were seen between WT and any of the rim mutants under the tested conditions. Experiments were repeated at least twice independently. (TIF) (p-rimK). B. Growth curves in RSP plus kanamycin (Kan) for SBW25 either containing an empty vector (WT) or overexpressing rimK (p-rimK). C. Growth curves in RSP plus phosphomycin (Phos) for SBW25 either containing an empty vector (WT) or overexpressing rimK (p-rimK). D. Gentamycin disc inhibition assays for SBW25 containing empty vector (WT) or overexpressing rimK (p-rimK). Congo Red dye was added to the plates to improve contrast. helpful comments on the manuscript. The PRIDE proteome database team provided assistance with uploading proteomic datasets.
Fig
Fig 2. RimK is important for P. syringae and P. aeruginosa plant infection. 2A. Swarming motility of Pto DC3000 and PA01 ΔrimK relative to their respective WT strains. 2B. Congo Red binding of Pto DC3000 and PA01 ΔrimK compared with their respective WT strains. 2C. Representative spray-infected Arabidopsis Col-0 plants 4 days post-infection with Pto DC3000 WT/ΔrimK. Disease symptoms are less marked with ΔrimK infection. 2D. log (P. syringae CFU per cm 2 leaf tissue) recovered from Arabidopsis Col-0 plants infected with Pto DC3000 WT or ΔrimK, 2 and 3 days post-infection (dpi). The infection method in each case is stated beneath the graph. 2E. Lettuce leaf infections with P. aeruginosa WT/ΔrimK strains. Lesions photographed after 5 days. 2F. β-hemolysis by P. aeruginosa WT/ΔrimK strains after 24 h growth on horse blood agar.
2 mM glutamate added to the test samples as shown. Running positions of RimK, RpsF and glutamated-RpsF (RpsF*) are marked. 3D. Glutamation assays with RimK Pf , RpsF Pf and U-14 C-glutamate. The contents of each reaction is indicated underneath the relevant lane. Control samples were incubated overnight, while time-course samples show 5, 10, 30, 60, 180 minutes, and overnight incubation. The left hand panel shows an overlay of Coomassie stained and radiolabel visualizations of a single gel. The right hand panel shows radiolabel incorporation into RpsF alone. doi:10.1371/journal.pgen.1005837.g003
10.1371/journal.pgen.1005837.t001
Fig
Fig 4. RimA, RimB and cdG impacts on RimK activity. 4A. ATPase activity of RimK Pf incubated with RimB, BSA and glutamate. RimK Pf specific activity (nmol ATP hydrolyzed/min/mg RimK Pf ) is shown for increasing concentrations of ATP (red, circles). Addition of RimB (purple, up-triangles) increases the RimK Pf V max , while BSA (brown, down-triangles) does not. RimB alone displays no ATPase activity (green, squares). 4B. ATPase activity of RimK Pf incubated with RimA and glutamate. RimK Pf specific activity (nmol ATP hydrolyzed/min/mg RimK Pf ) is shown for increasing concentrations of ATP (purple, squares). Addition of RimA (green, up-triangles) increases the RimK Pf V max , while RimA alone displays no ATPase activity (yellow, down-triangles). 4C. Thin layer chromatography of α-32 P-labeled cdG incubated with BSA, YhjH or RimA for the time periods shown. The product of cdG hydrolysis; pGpG, migrates further than cdG but less than α-32 P-GTP. 4D. Biotinylated-cdG pulldown for RimK Pf . E. coli overexpression cell lysate (RimK sample) is loaded alongside the washed cdG-bead sample (b-cdG pulldown). RimK and streptavidin are indicated with arrows. 4E. SPR sensorgram and affinity data for RimK Pf binding to biotinylated cdG. A range of RimK Pf concentrations was used (0.156, 0.312, 0.625, 1.25, 2.5, 5, and 10 μM) and concentration replicates included as appropriate together with buffer only controls. Protein binding and dissociation phases are shown. For the affinity fit, binding responses were measured 4s before the end of the injection and K d values for each protein calculated using BiaEvaluation software and confirmed by GraphPad. 4F. The effect of cdG addition on glutamation of RpsF Pf by RimK Pf . The contents of each reaction is indicated underneath the relevant lanes. Control samples were incubated overnight, while time-course samples show 5, 10, 30, 60, 180 minutes, and overnight incubation. The panel shows an overlay of Coomassie staining and radiolabel visualization (red) of the same gel, as with Fig 3C.
2 biological replicates of WT and ΔrimK), of which 47 were significantly down-regulated and 157 up-regulated in ΔrimK across two independent experiments(Fig 5A, S2
Fig 5 .
5The RimK regulon in Pseudomonas fluorescens. 5A. Up and down-regulated proteins in the ΔrimK mutant compared with SBW25 WT. Pie chart sections indicate the proportion of significantly up-or down-regulated proteins in each functional category as shown. The numbers in each section of the chart refer to the total number of proteins in that category. Interesting or important functional groups are expanded from the chart in each case. 5B. RT-PCR showing relative mRNA abundance in SBW25 WT (+) or ΔrimK (-) for selected RimK-regulated proteins. The housekeeping gene rpoD (σ 70 ) and rimK are included as controls. Down-regulated proteins in ΔrimK are shown in red, up-regulated proteins in green. (PFLU)-0068 and 6091 encode ABC transporter components, 3222 an NRPS subunit. doi:10.1371/journal.pgen.1005837.g005
Fig 6 .
6Comparison of the P. fluorescens ΔrimK, Δhfq and rpsF-D139K mutant strains. 6A. Swarming motility of Δhfq relative to SBW25 WT. 6B. Congo Red binding of Δhfq, compared to SBW25 WT and ΔrimK. 6C. Glutamation assays with E. coli and SBW25 RimK, and RpsF/RpsF-D139K. The contents of each assay are indicated underneath the relevant lanes. Running positions of RimK, RpsF and glutamated-RpsF (RpsF*) are marked with arrows. Incubation time is shown above the gel image; all controls were incubated overnight. 6D. Wheat root attachment assay for ΔrimK, Tn7::rimK and rpsF-D139K, relative to WT SBW25. 6E. Rhizosphere colonisation competition assays for Δhfq, ΔrimK, rpsF-D139K and WT SBW25. The graph shows the ratio of mutant to WT-lacZ CFU recovered from the rhizospheres of wheat plants seven days post-inoculation. Each dot represents CFU recovered from an individual plant. 6F. Western blot showing RpsF levels in mutant cell lysates. Statistically significant differences between WT SBW25 and mutant strains are indicated throughout (*** = p < 0.01).doi:10.1371/journal.pgen.1005837.g006
Fig 7 .
7A model for RimABK function in Pseudomonas plant interactions. During early stage colonisation/initial infection (top row), increased RimK activity leads to increased RpsF glutamation. This leads to increased Hfq levels, with the resulting translational repression promoting phenotypes important for niche colonisation and the establishment of infection, including motility and virulence
doi:10.1371/journal.pgen.1005837.g007
S2
Fig. ATPase activity of E. coli His 6 -RimK (RimK Ec ) incubated with glutamate. RimK Ec specific activity (nmol ATP hydrolyzed/min/mg RimK) is shown for increasing concentrations of ATP. (TIF) S3 Fig. rimK overexpression effects on antibiotic susceptibility. A. Growth curves in rooting solution + 0.4% pyruvate (RSP) plus gentamycin (Gent) for SBW25 either containing an empty vector (WT) or overexpressing rimK
. CdG effects on RimK. A. SPR sensorgram and affinity data for RimK Ec binding to biotinylated cdG. A range of RimK Ec concentrations was used (1.25, 2.5, 5, 10, 20, and 40 μM) and concentration replicates included as appropriate together with buffer only controls. Protein binding and dissociation phases are shown. For the affinity fit, binding responses were measured 4s before the end of the injection and K d values for each protein calculated using BiaEvaluation software, and confirmed using GraphPad. B. ATPase activity of RimK Pf incubated with glutamate and cdG. RimK Pf specific activity (V max = 234.9 nmol ATP/min/mg protein) is shown for increasing concentrations of ATP (squares). Addition of 25 μM cdG (circles) increases V max to 471.0 nmol ATP/min/mg. (TIF) S5 Fig. The rpsF-D139K mutation does not affect growth. Growth curves for SBW25 WT, ΔrimK and rpsF-D139K in rooting solution + 0.4% pyruvate, ± 0.4% glucose. No significant differences in growth rate were seen between WT and rpsF-D139K in either condition. (TIF) S1
2. RimK is important for P. syringae and P. aeruginosa plant infection. 2A. Swarming motility of Pto DC3000 and PA01 ΔrimK relative to their respective WT strains. 2B. Congo Red binding of Pto DC3000 and PA01 ΔrimK compared with their respective WT strains. 2C. Representative spray-infected Arabidopsis Col-0 plants 4 days post-infection with Pto DC3000 WT/ΔrimK. Disease symptoms are less marked with ΔrimK infection. 2D. log (P. syringae CFU per cm 2 leaf tissue) recovered from Arabidopsis Col-0 plants infected with Pto DC3000 WT or ΔrimK, 2 and 3 days post-infection (dpi). The infection method in each case is stated beneath the graph. 2E. Lettuce leaf infections with P. aeruginosa WT/ΔrimK strains. Lesions photographed after 5 days. 2F. β-hemolysis by P. aeruginosa WT/ΔrimK strains after 24 h growth on horse blood agar. doi:10.1371/journal.pgen.1005837.g002Fig 3. Biochemical analysis of RimK. 3A. ATPase activity of RimK Pf incubated with RpsF Pf and glutamate. RimK Pf specific activity (nmol ATP hydrolyzed/min/mg RimK Pf ) is shown for increasing concentrations of ATP (open circles). Addition of RpsF Pf (triangles), glutamate (filled circles) or both (square) increases the V max of RimK Pf ATPase activity. 3B. Glutamation assays with E. coli and SBW25 RimK and RpsF. The contents of each assay are indicated underneath the relevant lanes. Independent preparations of RimK Pf and RpsF Pf were used in the two panels, which were run separately and are shown side by side for comparative purposes only. Running positions of RimK, RpsF and glutamated-RpsF (RpsF**) are marked with arrows. 3C. Glutamation assays with RimK Pf and RpsF Pf . The contents of each assay are indicated, with 0.2, 2.0 and 20 additional gel-shift experiments
Table 1 .
1RimK interacting proteins. Numbers denote unique peptides detected in each sample.RimK
RimB
RimA
Negative Ctrl
Positive Ctrl
Protein binding and dissociation phases are shown. For the affinity fit, binding responses were measured 4s before the end of the injection and K d values for each protein calculated using BiaEvaluation software and confirmed by GraphPad. 4F. The effect of cdG addition on glutamation of RpsF Pf by RimK Pf . The contents of each reaction is indicated underneath the relevant lanes.4. RimA, RimB and cdG impacts on RimK activity. 4A. ATPase activity of RimK Pf incubated with RimB, BSA and glutamate. RimK Pf specific activity
(nmol ATP hydrolyzed/min/mg RimK Pf ) is shown for increasing concentrations of ATP (red, circles). Addition of RimB (purple, up-triangles) increases the
RimK Pf V max , while BSA (brown, down-triangles) does not. RimB alone displays no ATPase activity (green, squares). 4B. ATPase activity of RimK Pf
incubated with RimA and glutamate. RimK Pf specific activity (nmol ATP hydrolyzed/min/mg RimK Pf ) is shown for increasing concentrations of ATP (purple,
squares). Addition of RimA (green, up-triangles) increases the RimK Pf V max , while RimA alone displays no ATPase activity (yellow, down-triangles). 4C. Thin
layer chromatography of α-32 P-labeled cdG incubated with BSA, YhjH or RimA for the time periods shown. The product of cdG hydrolysis; pGpG, migrates
further than cdG but less than α-32 P-GTP. 4D. Biotinylated-cdG pulldown for RimK Pf . E. coli overexpression cell lysate (RimK sample) is loaded alongside the
washed cdG-bead sample (b-cdG pulldown). RimK and streptavidin are indicated with arrows. 4E. SPR sensorgram and affinity data for RimK Pf binding to
biotinylated cdG. A range of RimK Pf concentrations was used (0.156, 0.312, 0.625, 1.25, 2.5, 5, and 10 μM) and concentration replicates included as
appropriate together with buffer only controls. Control samples were incubated
overnight, while time-course samples show 5, 10, 30, 60, 180 minutes, and overnight incubation. The panel shows an overlay of Coomassie staining and
radiolabel visualization (red) of the same gel, as with Fig 3C.
doi:10.1371/journal.pgen.1005837.g004
Table 2 .
2(Continued) Putative exported protein PFLU_0215
Table 3 .
3Up-regulated proteins common to both Δhfq and ΔrimK mutants. *denotes fold-upregulation of PFLU1213 in ΔrimK. doi:10.1371/journal.pgen.1005837.t003Up-regulated protein
Fold change in
Δhfq
Fold change in
ΔrimK
Ferripyoverdine receptor fpvA
77.43
2.65
Putative aminotransferase PFLU5135
49.45
5.58
Superoxide dismutase sodA
11.96
3.22
Putative exported protein PFLU3741
7.59
4.30
Putative ABC transport system ATP-binding protein PFLU1212
6.51
4.25*
Putative ABC transport system, substrate-binding protein
PFLU2041
6.26
2.25
Phosphoenolpyruvate carboxykinase pckA
6.17
2.75
Putative uncharacterized protein PFLU6020
5.39
2.66
Putative sulfurylase PFLU4624
4.85
2.53
Putative uncharacterized protein PFLU5224
4.83
3.42
Dipeptide ABC transport system, substrate-binding protein
dppA2
4.53
6.35
Putative iron utilization protein PFLU1089
4.40
3.88
Putative sugar ABC transport system, lipoprotein PFLU3117
4.38
3.39
Biopolymer transport membrane protein exbB
3.64
6.27
Glutamate/aspartate ABC transport system, periplasmic binding
protein gltI
3.31
5.30
Putative sugar-binding exported protein PFLU3996
3.30
3.58
Putative uncharacterized protein PFLU5582
3.30
4.05
Lactoylglutathione lyase PFLU2991
3.27
2.64
Dipeptide ABC transport system, substrate-binding protein
dppA3
3.13
7.43
Protein disulfide isomerase II PFLU5007
3.10
3.09
Putative oxidoreductase PFLU0041
3.05
4.35
Putative ABC transport system, exported protein PFLU0376
2.80
3.05
Putative hemin transport system, substrate-binding protein
PFLU5229
2.70
2.60
Putative D-methionine ABC transport system, substrate-binding
protein PFLU0068
2.67
7.09
Putative uncharacterized protein PFLU3219
2.56
3.00
1 mM CaCl 2 .2H 2 O, 100 μM KCl, 800 μM MgSO 4 , 10 μM FeEDTA, 35 μM H 3 BO 3 , 9 μM MnCl 2 .4H 2 O, 0.8 μM
ZnCl 2 , 0.5 μM Na 2 MoO 4 .2H 2 O, 0.3 μM CuSO 4 .5H 2 O, 6 mM KNO 3 , 18.4 mM KH 2 PO 4 , and
20 mM Na 2 HPO 4 ), and transferred to a controlled environment room (25°C, 16 h light cycle).
Table .
.Ribosomal proteins detected in SBW25 WT and ΔrimK. (DOCX) S2Table. Up and down-regulated proteins in SBW25 ΔrimK. (DOCX) S3 Table. Up-regulated proteins in SBW25 Δhfq. (DOCX) S4 Table. Strains and plasmids. (DOCX) S5 Table. Primers. (DOCX) S6 Table. Relative protein abundances in SBW25 WT and ΔrimK. (XLSX)
PLOS Genetics | DOI:10.1371/journal.pgen.1005837 February 4, 2016
PLOS Genetics | DOI:10.1371/journal.pgen.1005837 February 4, 2016 20 / 31
AcknowledgmentsThe authors would like to thank Ramakrishnan Karunakaran and Corinne Appia-Ayme for advice concerning RNA extraction and quantification, Cyril Zipfel for advice and support for the plant infection experiments, and Barrie Wilkinson, Ray Dixon and Mark Buttner forAuthor Contributions
Regulation Of Bacterial Gene Expression By Riboswitches. Annual review of microbiology. W C Winkler, R R Breaker, 1615317759Winkler WC, Breaker RR. Regulation Of Bacterial Gene Expression By Riboswitches. Annual review of microbiology. 2005; 59:487-517. PMID: 16153177.
p)ppGpp: still magical? Annual review of microbiology. K Potrykus, M Cashel, 10.1146/annurev.micro.62.081307.1629031845462962Potrykus K, Cashel M. (p)ppGpp: still magical? Annual review of microbiology. 2008; 62:35-51. Epub 2008/05/06. doi: 10.1146/annurev.micro.62.081307.162903 PMID: 18454629.
The RNA chaperone, Hfq, controls two luxR-type regulators and plays a key role in pathogenesis and production of antibiotics in Serratia sp. ATCC 39006. N M Wilf, N R Williamson, J P Ramsay, S Poulter, K J Bandyra, G P Salmond, 10.1111/j.1462-2920.2011.02532.x21824244Environ Microbiol. 1310Wilf NM, Williamson NR, Ramsay JP, Poulter S, Bandyra KJ, Salmond GP. The RNA chaperone, Hfq, controls two luxR-type regulators and plays a key role in pathogenesis and production of antibiotics in Serratia sp. ATCC 39006. Environ Microbiol. 2011; 13(10):2649-66. Epub 2011/08/10. doi: 10.1111/j. 1462-2920.2011.02532.x PMID: 21824244.
Determination of the regulon and identification of novel mRNA targets of Pseudomonas aeruginosa RsmA. A Brencic, S Lory, 10.1111/j.1365-2958.2009.06670.x19426209Mol Microbiol. 723Brencic A, Lory S. Determination of the regulon and identification of novel mRNA targets of Pseudomo- nas aeruginosa RsmA. Mol Microbiol. 2009; 72(3):612-32. Epub 2009/05/12. MMI6670 [pii] doi: 10. 1111/j.1365-2958.2009.06670.x PMID: 19426209.
Hfq: a bacterial Sm-like protein that mediates RNA-RNA interaction. T Moller, T Franch, P Hojrup, D R Keene, H P Bachinger, R G Brennan, 11804583Mol Cell. 91Moller T, Franch T, Hojrup P, Keene DR, Bachinger HP, Brennan RG, et al. Hfq: a bacterial Sm-like pro- tein that mediates RNA-RNA interaction. Mol Cell. 2002; 9(1):23-30. Epub 2002/01/24. PMID: 11804583.
Posttranscriptional repression of GacS/GacA-controlled genes by the RNA-binding protein RsmE acting together with RsmA in the biocontrol strain Pseudomonas fluorescens CHA0. C Reimmann, C Valverde, E Kay, D Haas, 10.1128/JB.187.1.276–285.200515601712J Bacteriol. 1871538806PubMed Central PMCIDReimmann C, Valverde C, Kay E, Haas D. Posttranscriptional repression of GacS/GacA-controlled genes by the RNA-binding protein RsmE acting together with RsmA in the biocontrol strain Pseudomo- nas fluorescens CHA0. J Bacteriol. 2005; 187(1):276-85. Epub 2004/12/17. doi: 10.1128/JB.187.1. 276-285.2005 PMID: 15601712; PubMed Central PMCID: PMC538806.
Posttranslational Modifications of Ribosomal Proteins in Escherichia coli. M V Nesterchuk, P V Sergiev, O A Dontsova, 22649682Acta naturae. 323347575PubMed Central PMCIDNesterchuk MV, Sergiev PV, Dontsova OA. Posttranslational Modifications of Ribosomal Proteins in Escherichia coli. Acta naturae. 2011; 3(2):22-33. Epub 2011/04/01. PMID: 22649682; PubMed Central PMCID: PMC3347575.
Characterization of the gene rimK responsible for the addition of glutamic acid residues to the C-terminus of ribosomal protein S6 in Escherichia coli K12. W K Kang, T Icho, S Isono, M Kitakawa, K Isono, 2570347Molecular & general genetics: MGG. 2172-3Kang WK, Icho T, Isono S, Kitakawa M, Isono K. Characterization of the gene rimK responsible for the addition of glutamic acid residues to the C-terminus of ribosomal protein S6 in Escherichia coli K12. Molecular & general genetics: MGG. 1989; 217(2-3):281-8. Epub 1989/06/01. PMID: 2570347.
Poly-alpha-glutamic acid synthesis using a novel catalytic activity of RimK from Escherichia coli K-12. K Kino, T Arai, Y Arimura, 10.1128/AEM.02043-1021278279Appl Environ Microbiol. 7763067337PubMed Central PMCIDKino K, Arai T, Arimura Y. Poly-alpha-glutamic acid synthesis using a novel catalytic activity of RimK from Escherichia coli K-12. Appl Environ Microbiol. 2011; 77(6):2019-25. Epub 2011/02/01. doi: 10. 1128/AEM.02043-10 PMID: 21278279; PubMed Central PMCID: PMC3067337.
Structure and function of Escherichia coli RimK, an ATP-grasp fold, l-glutamyl ligase enzyme. G Zhao, Jin Z Wang, Y Allewell, N M Tuchman, M Shi, D , 10.1002/prot.2431123609986Proteins. Zhao G, Jin Z, Wang Y, Allewell NM, Tuchman M, Shi D. Structure and function of Escherichia coli RimK, an ATP-grasp fold, l-glutamyl ligase enzyme. Proteins. 2013. Epub 2013/04/24. doi: 10.1002/ prot.24311 PMID: 23609986.
Genomic and genetic analyses of diversity and plant interactions of Pseudomonas fluorescens. M W Silby, A M Cerdeno-Tarraga, G S Vernikos, S R Giddens, R W Jackson, G M Preston, 10.1186/gb-2009-10-5-r51Genome Biol. 10551Silby MW, Cerdeno-Tarraga AM, Vernikos GS, Giddens SR, Jackson RW, Preston GM, et al. Genomic and genetic analyses of diversity and plant interactions of Pseudomonas fluorescens. Genome Biol. 2009; 10(5):R51. PMID: 19432983. doi: 10.1186/gb-2009-10-5-r51
Biocontrol of Pythium in the pea rhizosphere by antifungal metabolite producing and non-producing Pseudomonas strains. D C Naseby, J A Way, N J Bainton, J M Lynch, 11298238J Appl Microbiol. 903Naseby DC, Way JA, Bainton NJ, Lynch JM. Biocontrol of Pythium in the pea rhizosphere by antifungal metabolite producing and non-producing Pseudomonas strains. J Appl Microbiol. 2001; 90(3):421-9. Epub 2001/04/12. jam1260 [pii]. PMID: 11298238.
Efficient rhizosphere colonization by Pseudomonas fluorescens f113 mutants unable to form biofilms on abiotic surfaces. E Barahona, A Navazo, F Yousef-Coronado, Aguirre De Carcer, D Martinez-Granero, F Espinosa-Urgel, M , 10.1111/j.1462-2920.2010.02291.x20626456Environ Microbiol. 1212Barahona E, Navazo A, Yousef-Coronado F, Aguirre de Carcer D, Martinez-Granero F, Espinosa-Urgel M, et al. Efficient rhizosphere colonization by Pseudomonas fluorescens f113 mutants unable to form biofilms on abiotic surfaces. Environ Microbiol. 2010; 12(12):3185-95. Epub 2010/07/16. doi: 10.1111/ j.1462-2920.2010.02291.x EMI2291 [pii]. PMID: 20626456.
Biological control of soil-borne pathogens by fluorescent pseudomonads. D Haas, G Defago, 10.1038/nrmicro112915759041Nat Rev Microbiol. 34Haas D, Defago G. Biological control of soil-borne pathogens by fluorescent pseudomonads. Nat Rev Microbiol. 2005; 3(4):307-19. Epub 2005/03/11. nrmicro1129 [pii] doi: 10.1038/nrmicro1129 PMID: 15759041.
Pseudomonas fluorescens F113 Mutant with Enhanced Competitive Colonization Ability and Improved Biocontrol Activity against Fungal Root Pathogens. E Barahona, A Navazo, F Martinez-Granero, Zea - Bonilla, T Perez-Jimenez, R M Martin, M , 10.1128/AEM.00320-11Appl Environ Microbiol. 77153147442PubMed Central PMCIDBarahona E, Navazo A, Martinez-Granero F, Zea-Bonilla T, Perez-Jimenez RM, Martin M, et al. Pseu- domonas fluorescens F113 Mutant with Enhanced Competitive Colonization Ability and Improved Bio- control Activity against Fungal Root Pathogens. Appl Environ Microbiol. 2011; 77(15):5412-9. Epub 2011/06/21. AEM.00320-11 [pii] doi: 10.1128/AEM.00320-11 PMID: 21685161; PubMed Central PMCID: PMC3147442.
Attachment of bacteria to the roots of higher plants. D N Rodriguez-Navarro, M S Dardanelli, J E Ruiz-Sainz, 10.1111/j.1574-6968.2007.00761.x17521360FEMS Microbiol Lett. 2722Rodriguez-Navarro DN, Dardanelli MS, Ruiz-Sainz JE. Attachment of bacteria to the roots of higher plants. FEMS Microbiol Lett. 2007; 272(2):127-36. Epub 2007/05/25. doi: 10.1111/j.1574-6968.2007. 00761.x PMID: 17521360.
Adaptation of Rhizobium leguminosarum to pea, alfalfa and sugar beet rhizospheres investigated by comparative transcriptomics. V K Ramachandran, A K East, R Karunakaran, A Downie, P S Poole, Ramachandran VK, East AK, Karunakaran R, Downie A, Poole PS. Adaptation of Rhizobium legumino- sarum to pea, alfalfa and sugar beet rhizospheres investigated by comparative transcriptomics.
10.1186/gb-2011-12-10-r106R106. Epub 2011/10/25. 12Genome Biol. 2011; 12(10):R106. Epub 2011/10/25. gb-2011-12-10-r106 [pii] doi: 10.1186/gb-2011- 12-10-r106 PMID: 22018401.
Pseudomonas syringae pv. tomato DC3000: a model pathogen for probing disease susceptibility and hormone signaling in plants. Annual review of phytopathology. X F Xin, S Y He, 10.1146/annurev-phyto-082712-10232151Xin XF, He SY. Pseudomonas syringae pv. tomato DC3000: a model pathogen for probing disease sus- ceptibility and hormone signaling in plants. Annual review of phytopathology. 2013; 51:473-98. Epub 2013/06/04. doi: 10.1146/annurev-phyto-082712-102321 PMID: 23725467.
The evolution of Pseudomonas syringae host specificity and type III effector repertoires. M Lindeberg, S Cunnac, A Collmer, 10.1111/j.1364-3703.2009.00587.x19849783Molecular plant pathology. 106Lindeberg M, Cunnac S, Collmer A. The evolution of Pseudomonas syringae host specificity and type III effector repertoires. Molecular plant pathology. 2009; 10(6):767-75. Epub 2009/10/24. doi: 10.1111/ j.1364-3703.2009.00587.x PMID: 19849783.
Microbial ecology of the cystic fibrosis lung. F Harrison, 17379702Microbiology. 153Harrison F. Microbial ecology of the cystic fibrosis lung. Microbiology. 2007; 153:917-23. PMID: 17379702
Pseudomonas aeruginosa-plant root interactions. Pathogenicity, biofilm formation, and root exudation. T S Walker, H P Bais, E Deziel, H P Schweizer, L G Rahme, R Fall, 10.1104/pp.103.02788814701912Plant physiology. 1341316311PubMed Central PMCIDWalker TS, Bais HP, Deziel E, Schweizer HP, Rahme LG, Fall R, et al. Pseudomonas aeruginosa-plant root interactions. Pathogenicity, biofilm formation, and root exudation. Plant physiology. 2004; 134 (1):320-31. doi: 10.1104/pp.103.027888 PMID: 14701912; PubMed Central PMCID: PMC316311.
Early adaptive developments of Pseudomonas aeruginosa after the transition from life in the environment to persistent colonization in the airways of human cystic fibrosis hosts. M H Rau, S K Hansen, H K Johansen, L E Thomsen, C T Workman, K F Nielsen, 10.1111/j.1462-2920.2010.02211.x20406284Environ Microbiol. 126Epub 2010/04/22. EMI2211 [piiRau MH, Hansen SK, Johansen HK, Thomsen LE, Workman CT, Nielsen KF, et al. Early adaptive developments of Pseudomonas aeruginosa after the transition from life in the environment to persistent colonization in the airways of human cystic fibrosis hosts. Environ Microbiol. 2010; 12(6):1643-58. Epub 2010/04/22. EMI2211 [pii] doi: 10.1111/j.1462-2920.2010.02211.x PMID: 20406284.
Principles of c-di-GMP signalling in bacteria. R Hengge, 10.1038/nrmicro2109Nat Rev Microbiol. 74Hengge R. Principles of c-di-GMP signalling in bacteria. Nat Rev Microbiol. 2009; 7(4):263-73. PMID: 19287449. doi: 10.1038/nrmicro2109
Mechanisms of cyclic-di-GMP signaling in bacteria. Annual review of genetics. U Jenal, J Malone, 1689546540Jenal U, Malone J. Mechanisms of cyclic-di-GMP signaling in bacteria. Annual review of genetics. 2006; 40:385-407. PMID: 16895465.
When the PilZ don't work: effectors for cyclic di-GMP action in bacteria. R P Ryan, T Tolker-Nielsen, J M Dow, 10.1016/j.tim.2012.02.00822444828Trends in microbiology. 205Ryan RP, Tolker-Nielsen T, Dow JM. When the PilZ don't work: effectors for cyclic di-GMP action in bacteria. Trends in microbiology. 2012; 20(5):235-42. Epub 2012/03/27. doi: 10.1016/j.tim.2012.02. 008 PMID: 22444828.
Second messenger regulation of biofilm formation: breakthroughs in understanding c-di-GMP effector systems. C D Boyd, G A O'toole, 10.1146/annurev-cellbio-101011-155705Annual review of cell and developmental biology. 28Boyd CD, O'Toole GA. Second messenger regulation of biofilm formation: breakthroughs in under- standing c-di-GMP effector systems. Annual review of cell and developmental biology. 2012; 28:439- 62. Epub 2012/10/13. doi: 10.1146/annurev-cellbio-101011-155705 PMID: 23057745.
Analysis of Pseudomonas aeruginosa diguanylate cyclases and phosphodiesterases reveals a role for bis-(3'-5')-cyclic-GMP in virulence. H Kulasakara, V Lee, A Brencic, N Liberati, J Urbach, S Miyata, 16477007Proc Natl Acad Sci. 1038Kulasakara H, Lee V, Brencic A, Liberati N, Urbach J, Miyata S, et al. Analysis of Pseudomonas aerugi- nosa diguanylate cyclases and phosphodiesterases reveals a role for bis-(3'-5')-cyclic-GMP in viru- lence. Proc Natl Acad Sci U S A. 2006; 103(8):2839-44. PMID: 16477007.
Identification of FleQ from Pseudomonas aeruginosa as a c-di-GMPresponsive transcription factor. J W Hickman, C S Harwood, 10.1111/j.1365-2958.2008.06281.x18485075Mol Microbiol. 692Hickman JW, Harwood CS. Identification of FleQ from Pseudomonas aeruginosa as a c-di-GMP- responsive transcription factor. Mol Microbiol. 2008; 69(2):376-89. PMID: 18485075. doi: 10.1111/j. 1365-2958.2008.06281.x
Pseudomonas aeruginosa uses a cyclic-di-GMP-regulated adhesin to reinforce the biofilm extracellular matrix. B R Borlee, A D Goldman, K Murakami, R Samudrala, D J Wozniak, M R Parsek, 10.1111/j.1365-2958.2009.06991.xMol Microbiol. 754Borlee BR, Goldman AD, Murakami K, Samudrala R, Wozniak DJ, Parsek MR. Pseudomonas aerugi- nosa uses a cyclic-di-GMP-regulated adhesin to reinforce the biofilm extracellular matrix. Mol Microbiol. 2010; 75(4):827-42. PMID: 20088866. doi: 10.1111/j.1365-2958.2009.06991.x
The diguanylate cyclase SadC is a central player in Gac/Rsm-mediated biofilm formation in Pseudomonas aeruginosa. J A Moscoso, T Jaeger, M Valentini, K Hui, U Jenal, A Filloux, 10.1128/JB.01850-14PMC4248864J Bacteriol. 19623PubMed CentralMoscoso JA, Jaeger T, Valentini M, Hui K, Jenal U, Filloux A. The diguanylate cyclase SadC is a central player in Gac/Rsm-mediated biofilm formation in Pseudomonas aeruginosa. J Bacteriol. 2014; 196 (23):4081-8. doi: 10.1128/JB.01850-14 PMID: 25225264; PubMed Central PMCID: PMC4248864.
c-di-GMP heterogeneity is generated by the chemotaxis machinery to regulate flagellar motility. B R Kulasekara, C Kamischke, H D Kulasekara, M Christen, P A Wiggins, S I Miller, 10.7554/eLife.0140224347546eLife. 23861689PubMed Central PMCIDKulasekara BR, Kamischke C, Kulasekara HD, Christen M, Wiggins PA, Miller SI. c-di-GMP heteroge- neity is generated by the chemotaxis machinery to regulate flagellar motility. eLife. 2013; 2:e01402. doi: 10.7554/eLife.01402 PMID: 24347546; PubMed Central PMCID: PMC3861689.
Cyclic Di-GMP-Mediated Repression of Swarming Motility by Pseudomonas aeruginosa PA14 Requires the MotAB Stator. S L Kuchma, N J Delalez, L M Filkins, E A Snavely, J P Armitage, O 'toole, G A , 10.1128/JB.02130-14PMC4285984J Bacteriol. 1973PubMed CentralKuchma SL, Delalez NJ, Filkins LM, Snavely EA, Armitage JP, O'Toole GA. Cyclic Di-GMP-Mediated Repression of Swarming Motility by Pseudomonas aeruginosa PA14 Requires the MotAB Stator. J Bacteriol. 2015; 197(3):420-30. doi: 10.1128/JB.02130-14 PMID: 25349157; PubMed Central PMCID: PMC4285984.
A Tn7-based broad-range bacterial cloning and expression system. K H Choi, J B Gaynor, K G White, C Lopez, C M Bosio, R R Karkhoff-Schweizer, 15908923Nature methods. 26Choi KH, Gaynor JB, White KG, Lopez C, Bosio CM, Karkhoff-Schweizer RR, et al. A Tn7-based broad-range bacterial cloning and expression system. Nature methods. 2005; 2(6):443-8. PMID: 15908923.
Identification of Pseudomonas syringae pathogens of Arabidopsis and a bacterial locus determining avirulence on both Arabidopsis and soybean. The Plant cell. M C Whalen, R W Innes, A F Bent, B J Staskawicz, 10.1105/tpc.3.1.491824334PMC1599783PubMed CentralWhalen MC, Innes RW, Bent AF, Staskawicz BJ. Identification of Pseudomonas syringae pathogens of Arabidopsis and a bacterial locus determining avirulence on both Arabidopsis and soybean. The Plant cell. 1991; 3(1):49-59. Epub 1991/01/01. doi: 10.1105/tpc.3.1.49 PMID: 1824334; PubMed Central PMCID: PMC159978.
The structure-function relationship of WspR, a Pseudomonas fluorescens response regulator with a GGDEF output domain. J G Malone, R Williams, M Christen, U Jenal, A J Spiers, P B Rainey, 10.1099/mic.0.2006/002824-0Microbiology. 1534Malone JG, Williams R, Christen M, Jenal U, Spiers AJ, Rainey PB. The structure-function relationship of WspR, a Pseudomonas fluorescens response regulator with a GGDEF output domain. Microbiology. 2007; 153(4):980-94. doi: 10.1099/mic.0.2006/002824-0
Modeling Pseudomonas aeruginosa pathogenesis in plant hosts. M Starkey, L G Rahme, 10.1038/nprot.2008.22419180083Nature protocols. 42Starkey M, Rahme LG. Modeling Pseudomonas aeruginosa pathogenesis in plant hosts. Nature proto- cols. 2009; 4(2):117-24. doi: 10.1038/nprot.2008.224 PMID: 19180083.
Inverse regulatory coordination of motility and curli-mediated adhesion in Escherichia coli. C Pesavento, G Becker, N Sommerfeldt, A Possling, N Tschowri, A Mehlis, 10.1101/gad.47580818765794Genes Dev. 22172532929PubMed Central PMCIDPesavento C, Becker G, Sommerfeldt N, Possling A, Tschowri N, Mehlis A, et al. Inverse regulatory coordination of motility and curli-mediated adhesion in Escherichia coli. Genes Dev. 2008; 22 (17):2434-46. Epub 2008/09/04. doi: 10.1101/gad.475808 PMID: 18765794; PubMed Central PMCID: PMC2532929.
Bacterial Rotary Export ATPases Are Allosterically Regulated by the Nucleotide Second Messenger Cyclic-di-GMP. E Trampari, C E Stevenson, R H Little, T Wilhelm, D M Lawson, J G Malone, 10.1074/jbc.M115.66143926265469PMC4591828J Biol Chem. 29040PubMed CentralTrampari E, Stevenson CE, Little RH, Wilhelm T, Lawson DM, Malone JG. Bacterial Rotary Export ATPases Are Allosterically Regulated by the Nucleotide Second Messenger Cyclic-di-GMP. J Biol Chem. 2015; 290(40):24470-83. doi: 10.1074/jbc.M115.661439 PMID: 26265469; PubMed Central PMCID: PMC4591828.
RNA, but not protein partners, is directly responsible for translational silencing by a bacterial Hfq-binding small RNA. K Maki, K Uno, T Morita, H Aiba, 10.1073/pnas.080310610518650387Proc Natl Acad Sci. 105302492515PubMed Central PMCIDMaki K, Uno K, Morita T, Aiba H. RNA, but not protein partners, is directly responsible for translational silencing by a bacterial Hfq-binding small RNA. Proc Natl Acad Sci U S A. 2008; 105(30):10332-7. Epub 2008/07/25. doi: 10.1073/pnas.0803106105 PMID: 18650387; PubMed Central PMCID: PMC2492515.
Coincident Hfq binding and RNase E cleavage sites on mRNA and small regulatory RNAs. I Moll, T Afonyushkin, O Vytvytska, V R Kaberdin, U Blasi, 14561880Rna. 9111287052PubMed Central PMCIDMoll I, Afonyushkin T, Vytvytska O, Kaberdin VR, Blasi U. Coincident Hfq binding and RNase E cleav- age sites on mRNA and small regulatory RNAs. Rna. 2003; 9(11):1308-14. Epub 2003/10/17. PMID: 14561880; PubMed Central PMCID: PMC1287052.
Both RNase E and RNase III control the stability of sodB mRNA upon translational inhibition by the small regulatory RNA RyhB. T Afonyushkin, B Vecerek, I Moll, U Blasi, V R Kaberdin, 10.1093/nar/gki31315781494Epub 2005/03/23. 331069011PubMed Central PMCIDAfonyushkin T, Vecerek B, Moll I, Blasi U, Kaberdin VR. Both RNase E and RNase III control the stabil- ity of sodB mRNA upon translational inhibition by the small regulatory RNA RyhB. Nucleic Acids Res. 2005; 33(5):1678-89. Epub 2005/03/23. doi: 10.1093/nar/gki313 PMID: 15781494; PubMed Central PMCID: PMC1069011.
RNase E-based ribonucleoprotein complexes: mechanical basis of mRNA destabilization mediated by bacterial noncoding RNAs. T Morita, K Maki, H Aiba, 10.1101/gad.133040516166379PMC1221888Genes Dev. 1918PubMed CentralMorita T, Maki K, Aiba H. RNase E-based ribonucleoprotein complexes: mechanical basis of mRNA destabilization mediated by bacterial noncoding RNAs. Genes Dev. 2005; 19(18):2176-86. Epub 2005/09/17. doi: 10.1101/gad.1330405 PMID: 16166379; PubMed Central PMCID: PMC1221888.
Noncanonical repression of translation initiation through small RNA recruitment of the RNA chaperone Hfq. G Desnoyers, E Masse, 10.1101/gad.182493.11122474262Genes Dev. 2673323883PubMed Central PMCIDDesnoyers G, Masse E. Noncanonical repression of translation initiation through small RNA recruit- ment of the RNA chaperone Hfq. Genes Dev. 2012; 26(7):726-39. Epub 2012/04/05. doi: 10.1101/gad. 182493.111 PMID: 22474262; PubMed Central PMCID: PMC3323883.
Quantitative proteomic analysis of the Hfq-regulon in Sinorhizobium meliloti 2011. P Sobrero, J P Schluter, U Lanner, A Schlosser, A Becker, C Valverde, 10.1371/journal.pone.004849423119037PLoS One. 7103484140PubMed Central PMCIDSobrero P, Schluter JP, Lanner U, Schlosser A, Becker A, Valverde C. Quantitative proteomic analysis of the Hfq-regulon in Sinorhizobium meliloti 2011. PLoS One. 2012; 7(10):e48494. Epub 2012/11/03. doi: 10.1371/journal.pone.0048494 PMID: 23119037; PubMed Central PMCID: PMC3484140.
Mutation of GOGAT prevents pea bacteroid formation and N2 fixation by globally downregulating transport of organic nitrogen sources. G Mulley, J P White, R Karunakaran, J Prell, A Bourdes, S Bunnewell, 10.1111/j.1365-2958.2011.07565.xMol Microbiol. 801Mulley G, White JP, Karunakaran R, Prell J, Bourdes A, Bunnewell S, et al. Mutation of GOGAT pre- vents pea bacteroid formation and N2 fixation by globally downregulating transport of organic nitrogen sources. Mol Microbiol. 2011; 80(1):149-67. Epub 2011/02/01. doi: 10.1111/j.1365-2958.2011.07565.x PMID: 21276099.
Role of the Sinorhizobium meliloti global regulator Hfq in gene regulation and symbiosis. Molecular plant-microbe interactions: MPMI. M Gao, M J Barnett, S R Long, M Teplitski, 10.1094/MPMI-23-4-035523Gao M, Barnett MJ, Long SR, Teplitski M. Role of the Sinorhizobium meliloti global regulator Hfq in gene regulation and symbiosis. Molecular plant-microbe interactions: MPMI. 2010; 23(4):355-65. Epub 2010/03/03. doi: 10.1094/MPMI-23-4-0355 PMID: 20192823.
Glutathione is a key player in metal-induced oxidative stress defenses. M Jozefczak, T Remans, J Vangronsveld, A Cuypers, 10.3390/ijms1303314522489146International journal of molecular sciences. 1333317707PubMed Central PMCIDJozefczak M, Remans T, Vangronsveld J, Cuypers A. Glutathione is a key player in metal-induced oxi- dative stress defenses. International journal of molecular sciences. 2012; 13(3):3145-75. Epub 2012/ 04/11. doi: 10.3390/ijms13033145 PMID: 22489146; PubMed Central PMCID: PMC3317707.
The OxyS regulatory RNA represses rpoS translation and binds the Hfq (HF-I) protein. The EMBO journal. A Zhang, S Altuvia, A Tiwari, L Argaman, R Hengge-Aronis, G Storz, 10.1093/emboj/17.20.60619774349171170932PubMed Central PMCIDZhang A, Altuvia S, Tiwari A, Argaman L, Hengge-Aronis R, Storz G. The OxyS regulatory RNA represses rpoS translation and binds the Hfq (HF-I) protein. The EMBO journal. 1998; 17(20):6061-8. Epub 1998/10/17. doi: 10.1093/emboj/17.20.6061 PMID: 9774349; PubMed Central PMCID: PMC1170932.
Influence of the regulatory protein RsmA on cellular functions in Pseudomonas aeruginosa PAO1, as revealed by transcriptome analysis. E Burrowes, C Baysse, C Adams, O Gara, F , 16436429Microbiology. 1522Burrowes E, Baysse C, Adams C, O'Gara F. Influence of the regulatory protein RsmA on cellular func- tions in Pseudomonas aeruginosa PAO1, as revealed by transcriptome analysis. Microbiology. 2006; 152(Pt 2):405-18. PMID: 16436429.
Pseudomonas aeruginosa biofilm matrix polysaccharide Psl is regulated transcriptionally by RpoS and post-transcriptionally by RsmA. Y Irie, M Starkey, A N Edwards, D J Wozniak, T Romeo, M R Parsek, Irie Y, Starkey M, Edwards AN, Wozniak DJ, Romeo T, Parsek MR. Pseudomonas aeruginosa biofilm matrix polysaccharide Psl is regulated transcriptionally by RpoS and post-transcriptionally by RsmA.
10.1111/j.1365-2958.2010.07320.xEpub 2010/08/26. 782984543PubMed Central PMCIDMol Microbiol. 2010; 78(1):158-72. Epub 2010/08/26. doi: 10.1111/j.1365-2958.2010.07320.x PMID: 20735777; PubMed Central PMCID: PMC2984543.
Post-transcriptional global regulation by CsrA in bacteria. J Timmermans, L Van Melderen, 10.1007/s00018-010-0381-zCellular and molecular life sciences: CMLS. 6717Timmermans J, Van Melderen L. Post-transcriptional global regulation by CsrA in bacteria. Cellular and molecular life sciences: CMLS. 2010; 67(17):2897-908. Epub 2010/05/07. doi: 10.1007/s00018-010- 0381-z PMID: 20446015.
Integration host factor: putting a twist on protein-DNA recognition. T W Lynch, E K Read, A N Mattis, J F Gardner, P A Rice, 12842466J Mol Biol. 3303Lynch TW, Read EK, Mattis AN, Gardner JF, Rice PA. Integration host factor: putting a twist on protein- DNA recognition. J Mol Biol. 2003; 330(3):493-502. Epub 2003/07/05. PMID: 12842466.
IHF and HU: flexible architects of bent DNA. Current opinion in structural biology. K K Swinger, P A Rice, 10.1016/j.sbi.2003.12.0031510244614Swinger KK, Rice PA. IHF and HU: flexible architects of bent DNA. Current opinion in structural biology. 2004; 14(1):28-35. Epub 2004/04/23. doi: 10.1016/j.sbi.2003.12.003 PMID: 15102446.
DNA sequence and expression analysis of algP and algQ, components of the multigene system transcriptionally regulating mucoidy in Pseudomonas aeruginosa: algP contains multiple direct repeats. W M Konyecsni, V Deretic, 2110144J Bacteriol. 1725208891PubMed Central PMCIDKonyecsni WM, Deretic V. DNA sequence and expression analysis of algP and algQ, components of the multigene system transcriptionally regulating mucoidy in Pseudomonas aeruginosa: algP contains multiple direct repeats. J Bacteriol. 1990; 172(5):2511-20. Epub 1990/05/01. PMID: 2110144; PubMed Central PMCID: PMC208891.
Isolation and characterization of polyhydroxyalkanoates inclusions and their associated proteins in Pseudomonas sp. K Matsumoto, H Matsusaki, K Taguchi, M Seki, Y Doi, 12099824Biomacromolecules. 34Matsumoto K, Matsusaki H, Taguchi K, Seki M, Doi Y. Isolation and characterization of polyhydroxyalk- anoates inclusions and their associated proteins in Pseudomonas sp. 61-3. Biomacromolecules. 2002; 3(4):787-92. Epub 2002/07/09. PMID: 12099824.
Pseudomonas Genome Database: improved comparative analysis and population genomics capability for Pseudomonas genomes. G L Winsor, D K Lam, L Fleming, R Lo, M D Whiteside, N Y Yu, 10.1093/nar/gkq86920929876Nucleic Acids Res. 393013766Database issue. PubMed Central PMCIDWinsor GL, Lam DK, Fleming L, Lo R, Whiteside MD, Yu NY, et al. Pseudomonas Genome Database: improved comparative analysis and population genomics capability for Pseudomonas genomes. Nucleic Acids Res. 2011; 39(Database issue):D596-600. Epub 2010/10/12. doi: 10.1093/nar/gkq869 PMID: 20929876; PubMed Central PMCID: PMC3013766.
The EAL domain protein YciR acts as a trigger enzyme in a c-di-GMP signalling cascade in E. coli biofilm control. S Lindenberg, G Klauck, C Pesavento, E Klauck, R Hengge, 10.1038/emboj.2013.12023708798The EMBO journal. 32143715855PubMed Central PMCIDLindenberg S, Klauck G, Pesavento C, Klauck E, Hengge R. The EAL domain protein YciR acts as a trigger enzyme in a c-di-GMP signalling cascade in E. coli biofilm control. The EMBO journal. 2013; 32 (14):2001-14. Epub 2013/05/28. doi: 10.1038/emboj.2013.120 PMID: 23708798; PubMed Central PMCID: PMC3715855.
Metal-induced oxidative stress impacting plant growth in contaminated soil is alleviated by microbial siderophores. C O Dimkpa, D Merten, A Svatos, G Buchel, E Kothe, 10.1016/j.soilbio.2008.10.010PMID: WOS:000262250900020Soil Biol Biochem. 411Dimkpa CO, Merten D, Svatos A, Buchel G, Kothe E. Metal-induced oxidative stress impacting plant growth in contaminated soil is alleviated by microbial siderophores. Soil Biol Biochem. 2009; 41 (1):154-62. doi: 10.1016/j.soilbio.2008.10.010 PMID: WOS:000262250900020.
The Oxidative Burst in Plant Disease Resistance. Annual review of plant physiology and plant molecular biology. C Lamb, R A Dixon, 10.1146/annurev.arplant.48.1.2511501226448251Lamb C, Dixon RA. The Oxidative Burst in Plant Disease Resistance. Annual review of plant physiology and plant molecular biology. 1997; 48:251-75. Epub 1997/06/01. doi: 10.1146/annurev.arplant.48.1. 251 PMID: 15012264.
Positive control of a global antioxidant defense regulon activated by superoxide-generating agents in Escherichia coli. J T Greenberg, P Monach, J H Chou, P D Josephy, B Demple, 1696718Proc Natl Acad Sci U S A. 871654496PubMed Central PMCIDGreenberg JT, Monach P, Chou JH, Josephy PD, Demple B. Positive control of a global antioxidant defense regulon activated by superoxide-generating agents in Escherichia coli. Proc Natl Acad Sci U S A. 1990; 87(16):6181-5. Epub 1990/08/01. PMID: 1696718; PubMed Central PMCID: PMC54496.
Pathway and enzyme redundancy in putrescine catabolism in Escherichia coli. B L Schneider, L Reitzer, 10.1128/JB.05063-11J Bacteriol. 19415Schneider BL, Reitzer L. Pathway and enzyme redundancy in putrescine catabolism in Escherichia coli. J Bacteriol. 2012; 194(15):4080-8. Epub 2012/05/29. doi: 10.1128/JB.05063-11 PMID: 22636776;
. Pubmed Central, Pmcid , PMC3416515PubMed Central PMCID: PMC3416515.
Increased uptake of putrescine in the rhizosphere inhibits competitive root colonization by Pseudomonas fluorescens strain WCS365. Molecular plant-microbe interactions: MPMI. I Kuiper, G V Bloemberg, S Noreen, J E Thomas-Oates, B J Lugtenberg, 10.1094/MPMI.2001.14.9.10961155107414Kuiper I, Bloemberg GV, Noreen S, Thomas-Oates JE, Lugtenberg BJ. Increased uptake of putrescine in the rhizosphere inhibits competitive root colonization by Pseudomonas fluorescens strain WCS365. Molecular plant-microbe interactions: MPMI. 2001; 14(9):1096-104. Epub 2001/09/12. doi: 10.1094/ MPMI.2001.14.9.1096 PMID: 11551074.
Gac/Rsm signal transduction pathway of gamma-proteobacteria: from RNA recognition to regulation of social behaviour. K Lapouge, M Schubert, F H Allain, D Haas, 10.1111/j.1365-2958.2007.06042.x18047567Mol Microbiol. 672Lapouge K, Schubert M, Allain FH, Haas D. Gac/Rsm signal transduction pathway of gamma-proteo- bacteria: from RNA recognition to regulation of social behaviour. Mol Microbiol. 2008; 67(2):241-53. Epub 2007/12/01. doi: 10.1111/j.1365-2958.2007.06042.x PMID: 18047567.
Pseudomonas syringae pv. tomato DC3000 uses constitutive and apoplastinduced nutrient assimilation pathways to catabolize nutrients that are abundant in the tomato apoplast. Molecular plant-microbe interactions: MPMI. A Rico, G M Preston, 10.1094/MPMI-21-2-02691818407021Rico A, Preston GM. Pseudomonas syringae pv. tomato DC3000 uses constitutive and apoplast- induced nutrient assimilation pathways to catabolize nutrients that are abundant in the tomato apoplast. Molecular plant-microbe interactions: MPMI. 2008; 21(2):269-82. Epub 2008/01/11. doi: 10.1094/ MPMI-21-2-0269 PMID: 18184070.
Identification of Pseudomonas syringae pv. tomato genes induced during infection of Arabidopsis thaliana. J Boch, V Joardar, L Gao, T L Robertson, M Lim, B N Kunkel, 11967070Mol Microbiol. 441Boch J, Joardar V, Gao L, Robertson TL, Lim M, Kunkel BN. Identification of Pseudomonas syringae pv. tomato genes induced during infection of Arabidopsis thaliana. Mol Microbiol. 2002; 44(1):73-88. Epub 2002/04/23. PMID: 11967070.
Experiments in molecular genetics. J H Miller, Cold Spring Harbor, New YorkCold Spring Harbor LaboratoryMiller JH. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. 1972:352-5.
stable shuttle vectors based on the minimal pVS1 replicon for use in gram-negative, plant-associated bacteria. S Heeb, Y Itoh, T Nishijyo, U Schnider, C Keel, J Wade, 10659714Molecular plant-microbe interactions: MPMI. 132Heeb S, Itoh Y, Nishijyo T, Schnider U, Keel C, Wade J, et al. Small, stable shuttle vectors based on the minimal pVS1 replicon for use in gram-negative, plant-associated bacteria. Molecular plant-microbe interactions: MPMI. 2000; 13(2):232-7. PMID: 10659714.
An efficient recombination system for chromosome engineering in Escherichia coli. D Yu, H M Ellis, E C Lee, N A Jenkins, N G Copeland, D L Court, 10811905Proc Natl Acad Sci U S A. 9711Yu D, Ellis HM, Lee EC, Jenkins NA, Copeland NG, Court DL. An efficient recombination system for chromosome engineering in Escherichia coli. Proc Natl Acad Sci U S A. 2000; 97(11):5978-83. PMID: 10811905.
A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. T T Hoang, R R Karkhoff-Schweizer, A J Kutchma, H P Schweizer, 9661666Gene. 2121Hoang TT, Karkhoff-Schweizer RR, Kutchma AJ, Schweizer HP. A broad-host-range Flp-FRT recombi- nation system for site-specific excision of chromosomally-located DNA sequences: application for iso- lation of unmarked Pseudomonas aeruginosa mutants. Gene. 1998; 212(1):77-86. PMID: 9661666.
Substitutions in the redox-sensing PAS domain of the NifL regulatory protein define an inter-subunit pathway for redox signal transmission. R Little, P Salinas, P Slavny, T A Clarke, R Dixon, 10.1111/j.1365-2958.2011.07812.xMol Microbiol. 821Little R, Salinas P, Slavny P, Clarke TA, Dixon R. Substitutions in the redox-sensing PAS domain of the NifL regulatory protein define an inter-subunit pathway for redox signal transmission. Mol Microbiol. 2011; 82(1):222-35. Epub 2011/08/23. doi: 10.1111/j.1365-2958.2011.07812.x PMID: 21854469.
Biocontrol of root diseases by Pseudomonas fluorescens CHA0: current concepts and experimental approaches. C Voisard, C T Bull, C Keel, J Laville, M Maurhofer, U , Molecular Ecology of Rhizosphere Microorganisms. O'Gara F, Dowling DN, Boesten BVoisard C, Bull CT, Keel C, Laville J, Maurhofer M, U S. Biocontrol of root diseases by Pseudomonas fluorescens CHA0: current concepts and experimental approaches. O'Gara F, Dowling DN, Boesten B (eds) Molecular Ecology of Rhizosphere Microorganisms 1994:67-89.
Biofilm formation at the air-liquid interface by the Pseudomonas fluorescens SBW25 wrinkly spreader requires an acetylated form of cellulose. A J Spiers, J Bohannon, S M Gehrig, P B Rainey, 14507360Mol Microbiol. 501Spiers AJ, Bohannon J, Gehrig SM, Rainey PB. Biofilm formation at the air-liquid interface by the Pseu- domonas fluorescens SBW25 wrinkly spreader requires an acetylated form of cellulose. Mol Microbiol. 2003; 50(1):15-27. PMID: 14507360.
Mutation of praR in Rhizobium leguminosarum enhances root biofilms, improving nodulation competitiveness by increased expression of attachment proteins. M Frederix, A Edwards, A Swiderska, A Stanger, R Karunakaran, A Williams, 10.1111/mmi.1267024942546Mol Microbiol. 9334149787PubMed Central PMCIDFrederix M, Edwards A, Swiderska A, Stanger A, Karunakaran R, Williams A, et al. Mutation of praR in Rhizobium leguminosarum enhances root biofilms, improving nodulation competitiveness by increased expression of attachment proteins. Mol Microbiol. 2014; 93(3):464-78. doi: 10.1111/mmi.12670 PMID: 24942546; PubMed Central PMCID: PMCPMC4149787.
Subcellular fractionation. A practical approach Graham J., Rickwoods D, editors. U A Bommer, N Burkhardt, R Jonemann, Cmt Spahn, F J Triana-Alonso, K H Nierhaus, Oxford University PressOxford, UKBommer UA, Burkhardt N, Jonemann R, Spahn CMT, Triana-Alonso FJ, Nierhaus KH. Subcellular frac- tionation. A practical approach Graham J., Rickwoods D, editors. Oxford, UK: Oxford University Press; 1996.
Identification and Characterization of a Cyclic di-GMP-specific Phosphodiesterase and Its Allosteric Control by GTP. M Christen, B Christen, M Folcher, A Schauerte, U Jenal, 15994307J Biol Chem. 28035Christen M, Christen B, Folcher M, Schauerte A, Jenal U. Identification and Characterization of a Cyclic di-GMP-specific Phosphodiesterase and Its Allosteric Control by GTP. J Biol Chem. 2005; 280 (35):30829-37. PMID: 15994307.
In-gel digestion for mass spectrometric characterization of proteins and proteomes. A Shevchenko, H Tomas, J Havlis, J V Olsen, M Mann, 10.1038/nprot.2006.46817406544Nature protocols. 16Shevchenko A, Tomas H, Havlis J, Olsen JV, Mann M. In-gel digestion for mass spectrometric charac- terization of proteins and proteomes. Nature protocols. 2006; 1(6):2856-60. Epub 2007/04/05. doi: 10. 1038/nprot.2006.468 PMID: 17406544.
The PRoteomics IDEntifications (PRIDE) database and associated tools: status in 2013. J A Vizcaino, R G Cote, A Csordas, J A Dianes, A Fabregat, J M Foster, 10.1093/nar/gks126223203882Nucleic Acids Res. 413531176PubMed Central PMCIDVizcaino JA, Cote RG, Csordas A, Dianes JA, Fabregat A, Foster JM, et al. The PRoteomics IDEntifica- tions (PRIDE) database and associated tools: status in 2013. Nucleic Acids Res. 2013; 41(Database issue):D1063-9. Epub 2012/12/04. doi: 10.1093/nar/gks1262 PMID: 23203882; PubMed Central PMCID: PMC3531176.
| 180 |
Results and Discussion
PASTA domains are not necessary for septal localization of PrkC. The extracellular domain has been shown to be required for PknB proper localization at mid-cell and at the poles in M. tuberculosis 25 , and for StkP localization at the septum in S. pneumoniae 2,27 . To test if the PASTA repeats are also required for PrkC localization at mid-cell and at the poles in B. subtilis growing cells 20 , we constructed several PrkC truncated proteins fused to GFP (Fig. 1). These proteins were deleted of one, two or three PASTA repeats as well as other deletions of the cytoplasmic domain or of the entire external domain. We analyzed their localization by fluorescence microscopy and noticed that all the truncated forms of PrkC were properly situated at the septum or at the poles of the cell. The only exception was the catalytic domain alone (GFP-PrkCc) that showed fluorescence throughout the cytoplasm of the bacteria (Fig. 1E). The deletion of one or two PASTA repeats or of all the external domain of PrkC had no effect on its localization (Fig. 1B,C,D). Even the deletion of the catalytic domain, alone or coupled with the deletion of the external domain, had no effect ( Fig. 1F and G), as long as the TM domain is present. Since one of the PASTA domain properties is its ability to bind muropeptide fragments of the cell wall, we prepared some PG fragments from an exponential growing cell culture of B. subtilis and tested their addition to the cell culture producing GFP-PrkC at the concentration range known to stimulate spore germination as previously described 19 . In agreement with the former observations, this supplement had no effect on the localization of the protein ( Fig. 1A and A'). The deletions of PASTA domains or their interaction with PG fragments have therefore no consequences on the localization of PrkC. All these data suggest that its septal and polar localization in B. subtilis cells is only mediated by the TM domain. This could be due to the TM domain itself or to its interactions with membrane proteins located at the division sites or at the poles like proteins of the divisome. Some of them may be involved in the localization of PrkC via an interaction of their transmembrane domains. We can already exclude the GpsB, EzrA and DivIVA cell division proteins whose deletion has no effect on PrkC localization 20 . Some proteins recycling the cell wall like hydrolases or PBPs 28,29 may be potential candidates.
The deletion of the PASTA domains has no effect on the kinase activity of PrkC in vitro. The catalytic domain of PrkC 30 alone possesses an efficient kinase activity in vitro 17,23,31 . We thus wanted to test if the deletion of the PASTA repeats could have an effect on the enzymatic activity of PrkC in vitro. For this purpose, we constructed and then purified some truncated forms of PrkC deleted of one or two PASTAs or of the entire extracellular domain (Fig. 2A). The production and purification yield was low depending on the extracellular region (Fig. 2B); however, we used these preparations to test the kinase activity of the corresponding proteins in vitro with radiolabeled ATP. Since GpsB has been shown to stimulate PrkC 20 , the experiments were also carried out in the presence of GpsB. We observed that the autophosphorylation of PrkC as well as its kinase activity were not significantly modified by the deletions of the PASTA domains (Fig. 2C, odd numbered lanes and Fig. S1). In all cases, the activity was stimulated by GpsB (Fig. 2C, even numbered lanes). These data clearly show that the The binding of muropeptides to PrkC doesn't modify its kinase activity in vitro. It has been shown by different biochemical approaches that PrkC PASTA repeats and homologues from other species, Stk1, PknB or StkP, are all able to bind muropeptides in vitro 10,11,15,19,25,32 . However, these studies were carried out with the extracellular domain alone, in the absence of the catalytic domain, and the effect of this binding on the kinase activity has never been tested so far in vitro. In addition, for PrkC from B. subtilis, a specific interaction of DAP-type-tetrapeptide was proposed with the PASTA3 by NMR 11 . To test the effect of muropeptide binding on the kinase activity of PrkC, we first checked by limited proteolysis the ability of our purified full-length PrkC protein to bind a purified PG fragments. The analysis of constituent muropeptides of the vegetative cell wall peptidoglycan of B. subtilis show that they are mostly composed of glycan strands ending with MurNAc units in the anhydro form and of peptide chains containing three or four amino acids with a clear preference for DAP-amidated-type 33 . We then decided to use the disaccharide tetrapeptide GlcNAc-MurNAc-L-Ala-γ-D-Glu-meso-DAP-D-Ala (or TCT) 34 in our tests (Fig. 3A). As purified muropeptides are usually used at the micromolar range in the previously cited biochemical studies, we decided to test TCT in a scale from 50 to 250 µM. We observed that the digestion profile of PrkC was modified by the addition of TCT suggesting a conformational change due to TCT binding to the protein. Indeed, we observed a decrease in the intensity of a specific protein band (see arrow) with the addition of increasing amounts of TCT ( Fig. 3A left gel). This observation could not be made with the PrkCc protein used as negative control (Fig. 3A right gel). These data confirmed that the binding of muropeptides to PrkC protein is dependent of its PASTA domains. This interaction was shown here for the first time by analyzing the entire protein and not only its extracellular domain. The amount of TCT necessary to visualize its binding to PrkC is in agreement with an affinity at the micromolar range for this muropeptide. Furthermore, we tested the effect of this binding on the kinase activity of the same preparation of PrkC using the same amounts of TCT. The catalytic domain PrkCc that is unable to bind the muropeptide was used as negative control. As shown in the autoradiogram, the binding of TCT to PrkC has no effect on its kinase activity in vitro (Fig. 3B). These observations were made in vitro but clearly run counter to the current activation model of PrkC and we decided to test it in vivo.
Addition of PG fragments to full-length PrkC induces its oligomerization. The current activation model of PrkC is based on the observation that B. subtilis spores of a prkC mutant are unable to germinate in response to PG fragments compared to a WT strain 19 , combined to biochemical data showing the interaction between the PASTA3 domain and muropeptides in vitro 11 . However, a clear evidence of a direct muropeptide activation of PrkC in vivo is still missing. We therefore decided to measure the autophosphorylation of PrkC full-length or of truncated forms of PrkC in vivo from cells cultivated in the absence and then in the presence of increasing concentrations of PG fragments. Being limited in the amount of TCT available, we decided to use PG fragments prepared from a B. subtilis cell culture stopped at the exponential growth phase and at the concentration range known to stimulate spore germination as previously described 19 . In order to make sure that our PG preparation was containing enough muropeptides able to interact with PrkC, we checked this binding by Dynamic Light Scattering (DLS). We also included the mutant protein PrkC(R500A) as a negative control in the experiment since this mutation, located in the PASTA3, was shown to abolish PG fragments binding. The effect of the increasing amount of PG fragments on the hydrodynamic size of PrkC, PrkC(R500A) and PrkCc respectively was determined by measuring the intensity of the light diffused by the molecules and their translational speed in solution as presented in the correlograms ( PG. However, the analysis of correlograms, Z-averages ( Fig. 4B) and diameters by intensity distribution median (Di50) (Fig. S2) suggested a difference between the proteins. All three showed differences in their correlograms in the exponential decay and fluctuating times (Fig. 4A). When PG fragments were added to PrkC, we observed a concentration-dependent increase of the fluctuation time and the broadening of the decay was slow showing a progressive increase in polydispersity suggesting a specific binding of PG fragments to PrkC leading to the oligomerization of the protein. When PG fragments were added to PrkC(R500A), the concentration-dependent increase of the fluctuation time was slower and the broadening of the decay was narrower showing that specific binding of PG fragments to PrkC(R500A) was less efficient and consequently the oligomerization too. Conversely, for the catalytic domain, the addition of PG fragments increased the time at which the correlation begins to decay with a broadening of the fluctuation time suggesting an aggregation of PrkCc by PG fragments and high polydispersity thus a nonspecific binding. These results were confirmed by the Di50 (Fig. S2) and Z-average values (Fig. 4B) that increased constantly and to less than 100 nm with increasing concentrations of PG fragments for PrkC. However, for PrkCc, the Z-average increased beyond 100 nm in the presence of 0.15 µg/ml of PG fragments and continued to increase at 1.5 µg/ml. Small variations of the Z-average values (Fig. 4B) and no variation of Di50 values (Fig. S2) for PrkC(R500A) confirmed that PG fragments binding was impaired on this protein. We also measured the denaturation temperatures for both proteins with or without PG fragments (data not shown). The denaturation temperature of PrkC was identical with or without PG fragments (50 °C) suggesting a good stability of the protein that was not modified by muropeptides binding. On the contrary, the denaturation temperature of PrkCc dropped from 70 °C to 50 °C with the addition of the PG fragments confirming a destabilizing effect of muropeptides on the catalytic domain. Altogether, these results suggest that PG fragments interact specifically with PrkC to induce its oligomerization whereas it interacts non-specifically with PrkCc to induce its aggregation. Deletion of PASTA domains or addition of PG fragments has no effect on PrkC activity during exponential phase. Since PG fragments bind to PASTA domains, we first analyzed the effect of PASTA deletions on PrkC activity in B. subtilis growing cells. For this purpose, strains expressing the truncated-PrkC-GFP proteins were grown in a rich medium until the mid-exponential phase (OD 600 = 0.8) and crude extracts were prepared and analyzed by western blots. Using antibodies against the GFP protein, we first checked that all the forms of PrkC were produced at the same level in the cell (Fig. 5A). We then measured the autophosphorylation of PrkC in vivo using antibodies against phospho-threonine (P-Thr). We observed that all the forms of PrkC were phosphorylated except the extracellular domain of PrkC (GFP-TM-P1P2-Ig-like) lacking the catalytic intracellular kinase domain that served as the negative control. These data clearly show that all the forms of PrkC containing the catalytic domain are active. However, the absence of the PASTA domains has no effect on PrkC autophophorylation and therefore on its kinase activity in vivo. This observation has also been made recently for the homologous protein IreK from E. faecalis but to a lesser extent 24 . Indeed, a truncated form of IreK lacking its five PASTA repeats was still active indicating that the extracellular domain of IreK is not required for an answer to a signal associated with growth and/or cell division. However, the specific stimulation of IreK kinase activity in response to cell-wall antimicrobials seemed to be dependent of the PASTA module, which suggests multiple parameters for sensory input in vivo 24 .
Since our preparation of PG fragments contains muropeptides able to bind to PrkC, we decided to test it on PrkC autophosphorylation in vivo. For this, strains producing GFP-PrkC or GFP-PrkCc as negative control were grown in a rich medium in the presence of increasing amount of PG fragments until the mid-exponential phase (OD 600 = 0.8). Then crude extracts were prepared and analyzed by western blots. Using antibodies against PrkC, we observed that both proteins were produced at the same level whatever the amount of PG fragments added (Fig. 5B). In addition, the phosphorylation signal detected in all lanes with antibodies against P-Thr showed that the level of PrkC autophosphorylation was similar (Fig. 5B) PASTA domains are necessary for PrkC activation during stationary phase growth. Since we did not detect any effect of PASTAs deletions or addition of PG fragments during exponential phase, we decided to investigate the localization and the activity of the protein in stationary phase cells. We first analyzed the localization by fluorescence microscopy of GFP-PrkC as well as of the truncated forms of PrkC deleted of one or several PASTA repeats. Unexpectedly, we noticed that all the forms of PrkC were distributed all over the cell wall (Fig. 6A). These observations revealed, for the first time, that the localization of PrkC varies according to the growth phase (Fig. S3). However, the PASTA domains are not necessary for this new positioning of the kinase. Thus, PrkC is concentrated at the septum and at the poles during cell division and delocalizes throughout the cell wall when the cells enter into a non-dividing state, but in both cases, the external domain is not required for PrkC cellular localization. We then wanted to test if a role of the PASTA domains would be to stimulate the kinase activity by autophosphorylation in non-dividing cells. We thus prepared crude extracts from stationary phase cultures producing the PASTA-truncated forms of GFP-PrkC or the mutant protein GFP-PrkC(R500A) unable to bind PG fragments and to oligomerize. These crude extracts were then analyzed by western blots using antibodies against the GFP protein to check that all the forms of PrkC were produced at the same level in the cell and using antibodies against P-Thr to measure the autophosphorylation of PrkC in vivo ( Fig. 6B and C). Whereas all forms of PrkC were expressed at the same level, only the entire protein was still detected by the antibodies against P-Thr. The removal of the PASTA3 or the mutation of the Arg500 to Ala, known to interact with PG fragments, was were grown on LB medium with 0.5% xylose at 37 °C until OD 600 = 0.8. After centrifugation, the pellets were resuspended in 1/100 th volume of lysis buffer and treated as described in Materials and Methods. For each strain, 16 μl of crude extract were separated by SDS-PAGE. After blotting, phosphorylated PrkC was detected using antibodies directed against P-Thr residues. To estimate the relative quantity of PrkC in crude extracts, we used anti-GFP antibodies. (B) Strains SG278 (ΔprkC, amyE::gfp-prkC) and SG465 (ΔprkC, amyE::gfp-prkCc-TM) were grown on LB medium with 0.5% xylose and increasing amounts of PG fragments (0, 0.003, 0.015, 0.03, 0.3 and 3 µg/ml) at 37 °C until OD 600 = 0.8. After centrifugation, the pellets were resuspended in 1/100 th volume of lysis buffer and treated as described in Materials and Methods. For each strain, 16 μl of crude extract were separated by SDS-PAGE. After blotting, phosphorylated PrkC was detected using antibodies directed against P-Thr residues. To estimate the relative quantity of PrkC in crude extracts, we used a specific antibody against PrkC. Full-length blots are presented in the supplemental data. sufficient to lose the phosphorylation signal. These results clearly show that, during stationary phase growth, the binding of PG fragments to the extracellular domain of PrkC is required to allow the autophosphorylation of the protein and therefore to stimulate its kinase activity.
A sophisticated model for kinase activation of PrkC. Our data suggest that PrkC regulation is a complex mechanism that may vary depending on the physiological state of the cell, i.e. growing cells versus non-dividing cells (stationary phase cells or spores) and according to the ligand and the partners of the protein when it is involved in one cellular process or another. We therefore propose a new model for the modulation of PrkC kinase activity depending on its cellular localization, the growth phase and the cellular process regulated (Fig. 7). The current model described for germination conditions and which can also be proposed for stationary phase conditions is summarized in (Fig. 7 top panel) and the designed regulatory model for PrkC kinase activity during exponential growth is presented in (Fig. 7 lower panel). During stationary phase (or germination), PrkC is located all around the cell wall (or the spore membrane), PG fragments are available, and the cells (or spores) probably need to sense an environmental signal to ensure the best rate of cell survival (or induce the exit from dormancy). Thus, stimulation by PG fragments through the PASTA domains of the protein may be required to induce PrkC dimerization and thus kinase activation via its autophosphorylation. This layout could be similar in other sporulating bacteria in which a PASTA-containing protein kinase is involved in spore germination. During growth, PrkC is concentrated at mid-cell or at the poles and, in such conditions, it likely has no access to the extracellular medium and thus to free PG fragments. Actually, no stimulation of its kinase activity by addition of PG fragments has been detected in vivo but it is stimulated by interaction with the division protein GpsB 20 . Moreover, we did not detect any stimulation of the kinase activity by TCT in vitro, although it binds to PrkC. This could be explained by the strong probability for two protein molecules to be in contact in solution before the addition of TCT and to phosphorylate each other. A high percentage of the PrkC molecules are therefore already active. In vivo, ligands like lipid II or other periplasmic molecules may play a role in PrkC dimerization that can also be mediated by its recruitment, via its TM domain, by partners located at the septum and/or at the poles like proteins of the division machinery, PBPs and hydrolases or other membrane associated proteins. During cell division, PrkC molecules are thus focused at the poles and septa where they can phosphorylate each other to become active. Furthermore, GpsB and to a lesser extent EzrA and DivIVA, increase PrkC kinase activity via a yet unknown mechanism. In these conditions, the stimulation by PG fragments may not be necessary. Our results are consistent with the regulation observed in E. faecalis cells, where IreK can respond to cell wall stress by enhancing its kinase activity via its PASTA repeats and can also respond to signal associated with growth and/ or division independently of the presence of its extracellular PASTA-containing domain 24 . We can conclude that PASTA-kinases are subtly stimulated according to their cellular localization and the cellular processes they regulate. This fine-tune regulation may also differ between species.
Methods
Plasmids and strains constructions. Standard procedures for molecular cloning and cell transformation of B. subtilis and E. coli were used. All the strains and plasmids used in this study are listed in Table 1. Primers The scale bar for microscopy images represents 2 µm. (B) PrkC-phosphorylation analysis by western blots. The same strains SG278, SG467, SG466 and SG465 were grown on LB medium with 0.5% xylose at 37 °C for 23 hours (final OD 600~ 6). After centrifugation, the pellets were resuspended in 1/30 th volume of lysis buffer and treated as described in Materials and Methods. For each strain, 16 μl of crude extract were separated by SDS-PAGE. After blotting, phosphorylated PrkC was detected using antibodies directed against P-Thr residues. To estimate the relative quantity of PrkC in crude extracts, we used anti-GFP antibodies. (C) PrkC(R500A)-phosphorylation analysis by western blots. The strains SG278 and SG622 were grown on LB medium with 0.5% xylose at 37 °C for 23 hours (final OD 600~6 ) and the culture pellets were treated as mentioned in (B). Full-length blots are presented in the supplemental data. used in this study are available upon request. Sequencing of PCR-derived DNA fragments in the plasmid constructs was carried out by GATC-Biotech to ensure error-free amplification.
For the generation of fluorescent fusion proteins, the truncated versions of the prkC gene were amplified by PCR using specific primers allowing its insertion between ApaI and XhoI sites in pSG1729 35 . The B. subtilis strain 1A963 17 was then transformed with pSG1729-gfp-prkC-(truncated versions) or pSG1729-gfp-prkC(R500A) generating the strains SG355, SG465, SG466, SG467, SG497, SG498 and SG622. Protein expression was induced with 0.5% xylose (w/v).
The truncated or mutated versions of PrkC were overexpressed in E. coli, with the corresponding genes amplified by PCR using B. subtilis 168 genomic DNA as a template and a primer pair containing SacI and PstI restriction sites. The amplified products were digested with SacI and PstI and then ligated to the pETDuet vector. The resulting plasmids are listed in Table 1.
PG preparation and purification of TCT muropeptide. B. subtilis PG fragments from growing cells were prepared as previously described in 19 . The pellet containing the cell wall PG freed of proteins and lipoteichoic acids was quantified by weighing then resuspended and digested with mutanolysin (10 µg/ml) overnight at 37 °C prior to inactivation of the enzyme at 80 °C for 20 min. The concentration of PG fragments was determined by quantitative aminoacid (diaminopimelic acid) and aminosugar (muramic acid, glucosamine) analysis with a Hitachi L8800 analyzer (ScienceTec, Les Ulis, France) after hydrolysis of samples in 6 M HCl at 95 °C for 16 h. PG fragments were then used in the several tests. TCT muropeptide was produced and purified as described in 36 . mean size of the sample, smaller samples fluctuate quicker than larger samples is solution. The steeper the exponential decay, the more monodisperse (single population) the sample, and if the decay is extended the greater the sample polydispersity (several populations). Size distribution assays were performed at 25 °C. For each assay three measurements were performed; each one consisting in 10-15 runs of 10 seconds. The scattering angle was 173°. Temperature trend assay to calculate aggregation points contained a sequence from 20 to 70 °C with 10 °C intervals. We displayed our results using the correlograms, Z-average (mean intensity size of sample) and Di50 (diameter by intensity of 50% of the molecules in solution) using the Zetaziser software 7.12. PrkC and PrkC(R500A) were prepared at 0.2 mg/ml in 20 mM Tris-HCl pH 7.5, 200 mM NaCl, 7% glycerol following centrifugation for 15 min at 14000 rpm at 6 °C. PrkCc was prepared at 0.1 mg/ml in 20 mM Tris-HCl pH 7.5, 200 mM NaCl, 7% glycerol following centrifugation for 15 min at 14000 rpm at 6 °C. The proteins were analyzed in the absence or presence of increasing concentrations of PG fragments from 0.15-1.6 µg/ml.
Dynamic Light
Microscopy.
Strains were grown on LB medium at 37 °C. The gfp-prkC gene fusion and all truncated versions of prkC were expressed from the inducible P xyl promoter in the presence of 0.5% xylose. The PrkC localization was analyzed by fluorescent microscopy on a Zeiss Upright Axio Imager M2 microscope as described previously 3 .
Western Blot. The cells were grown at 37 °C in 30 ml of LB medium to OD 600 = 0.8 for exponential phase extracts and to OD 600~6 for stationary phase extracts (23-hour cultures) then centrifuged for 10 min at 8000 rpm at 4 °C. When needed, the exponential phase cultures were realized in the presence of increasing amounts of PG fragments (0, 0.003, 0.015, 0.03, 0.3 and 3 µg/ml). Cell pellets were resuspended in 1/100 th and 1/30 th volumes of lysis buffer for exponential and stationary phase cultures, respectively, containing 10 mM Tris-HCl pH 8.0, 150 mM NaCl, 0.1% NP40, 1 mM PMSF, 1 mM DTT, 25 U.ml −1 benzonase and 10 mg.ml −1 lysozyme, and incubated for 30 min at 37 °C. 1/10 th volume of 10% SDS and 1/2 volume of (2×) Laemmli buffer were added to the extracts that were heated at 100 °C for 10 min. Samples were run on a 10% or 12.5% SDS-PAGE and transferred to hybond-ECL membrane by electroblotting. The membrane was blocked with PBS solution containing 5% milk powder (w/v), for 3 hours at room temperature with shaking, then incubated with anti-GFP or anti-PrkC antibodies diluted to 1/10000 th or 1/1000 th , respectively, overnight at 4 °C. After three washes, the secondary antibody, a peroxidase-conjugated Goat anti-Rabbit (DAKO) antibody, was used at 1/10000 th dilution for one hour. After three washes, the membrane was incubated with ECL reagents (Perkinelmer) and scanned for chimioluminescence with an ImageQuant LAS4000 (GE Healthcare). A second membrane was used for anti-P-Thr antibodies as previously described in 20 . Protein purification. Plasmids overproducing 6His-tagged PrkC truncated proteins were used to transform E. coli C41(DE3). Purification of 6His-tagged recombinant proteins was performed with Ni 2+ -NTA resin (Qiagen) as previously described in 18 for PrkCc, the PASTA-truncated forms of PrkC, PrkC and PrkC(R500A). Before purification, in order to solubilize the proteins containing a TM domain, 0.4% Triton X100 was added to the crude extracts, shacked for 1 h at 4 °C then centrifuged at 35000 rpm for 1 h at 4 °C to removed membrane fragments. In addition, the buffer used for the purification steps of these proteins contained 0.2% Triton X100.
Protein phosphorylation. 2 μg of GpsB were incubated for 15 min at 37 °C with 2.5 μg of the several forms of PrkC protein in a 15 μl reaction mixture containing 10 mM HEPES, pH 8.0, 1 mM MgCl 2 , 2 μg of MBP (Myelin Basic Protein) that was shown to be phosphorylated by PrkC 18 and 1 mM [γ-33 P] ATP (1 μCi). The phosphorylation reaction was stopped by adding 5× SDS-sample buffer to the reaction mixtures before SDS-PAGE analysis. Gels were then dried and exposed to autoradiography. When muropeptides were tested, increasing amounts (from 0 to 250 µM) of TCT were added in the reaction mixture containing 2.5 μg of the PrkC or PrkCc protein, 10 mM HEPES, pH 8.0, 1 mM MgCl 2 , 2 μg of MBP and 1 mM [γ-33 P] ATP (1 μCi).
Limited proteolysis.
For each 20 μl sample, 3 μg of PrkC or PrkCc proteins were pre-incubated for 10 min at 37 °C with 40 mM NaCl, 1 mM MgCl 2 , 10 mM Tris-HCl, pH 8.0 in the absence or presence of increasing amounts of TCT muropeptide (50, 100, 150 and 250 µM). After addition of 0.01 μg of trypsin (Promega), the reaction mixture was incubated for 10 min at 37 °C. The digestion was stopped by adding an equal volume of electrophoresis loading buffer to the assay mixtures and by heating 5 min at 100 °C before applying the samples onto a 12.5% or 15% SDS-PAGE. The gels were colored with Coomassie blue then scanned.
Data and materials availability. Data and materials will be made available upon request.
Scientific
REPORTS | (2018) 8:1660 | DOI:10.1038/s41598-018-20145-2 length
Figure 1 .
1Localization of full-length and truncated GFP-PrkC in B. subtilis. 3D representation of GFP-PrkC fusion proteins, with A to G letters and dashed lines indicating the length of the protein. PrkC molecular graphic was modeled with the UCSF Chimera package (supported by NIGMS P41-GM103311) from the 3PY9 PDB structure for the extracellular domain and 4EQM PDB structure for the intracellular domain. Strains were grown on LB medium at 37 °C and all the forms of GFP-PrkC proteins were expressed from the P xyl promoter in the presence of 0.5% xylose and with 3 µg/ml of PG fragments for the full-length protein. PrkC localization was analyzed by fluorescent microscopy for strains: A: SG278 (ΔprkC, amyE::gfp-prkC), A': SG278 in the presence of PG fragments, B: SG467 (ΔprkC, amyE::gfp-prkCc-TM-P1P2), C: SG466 (ΔprkC, amyE::gfp-prkCc-TM-P1), D: SG465 (ΔprkC, amyE::gfp-prkCc-TM), E: SG355 (ΔprkC, amyE::gfp-prkCc), F: SG497 (ΔprkC, amyE::gfp-TM-P1P2-Ig-like) and G: SG498 (ΔprkC, amyE::gfp-TM). The scale bar for microscopy images represents 2 µm. deletion of any component of the external sensing domain do not significantly affect the kinase activity of PrkC in vitro in the absence of muropeptides or other potential enhancer/germinant molecules.
Figure 2 .
2Kinase activity of full-length and truncated PrkC in vitro. (A) 3D representation of PrkC protein with arrows indicating the different truncation sites. (B) Each recombinant PrkC protein was purified and the preparations were visualized on SDS-PAGE gel colored with Coomassie blue. The quantity of purified protein loaded on the gel corresponds to the amount of PrkC protein used in the enzymatic activity test. (C) In vitro phosphorylation assays in the absence or presence of GpsB for PrkC or the truncated forms of PrkC. The recombinant PrkC proteins were incubated with [γ-33 P]ATP, MBP and GpsB (lanes 2, 4, 6 and 8) or without GpsB (lanes 1, 3, 5 and 7) at 37 °C during 15 min. The tests were realized in the presence of PrkCc-TM (4.2 µM) (lanes 1 and 2), PrkCc-TM-P1 (2.6 µM) (lanes 3 and 4), PrkCc-TM-P1P2 (1.6 µM) (lanes 5 and 6), or PrkC (0.6 µM) (lanes 7 and 8). Samples were separated by SDS-PAGE and visualized by autoradiography. The radioactive signals seem to decrease with the length of the protein but these differences are due to the lower amounts of protein used in the tests which depend on their concentration after their purification. Full-length gels are presented in the supplemental data. Scientific REPORTS | (2018) 8:1660 | DOI:10.1038/s41598-018-20145-2
Fig. 4A). The results showed that PrkC, PrkC(R500A) and PrkCc had hydrodynamic diameters of D h = 8.23 nm, D h = 8.60 nm and D h = 4.96 nm, respectively, by volume distribution median (Dv50) in the absence of PG fragments(Fig. 4A insets)suggesting elongated monomers for PrkC and PrkC(R500A) and a globular monomer for PrkCc. In the presence of 1 µg/ml of PG fragments, PrkC had a D h of 9.20 nm, PrkC(R500A) had a D h of 8.20 nm and PrkCc a D h of 8.40 nm suggesting an oligomerization by
Figure 3 .
3Muropeptides binding to PrkC and its effect on kinase activity in vitro. (A) Coomassie-stained SDS-PAGE of partial proteolysis profile of the full-length PrkC (left) or its catalytic domain, PrkCc, used as negative control (right). 3 µg of PrkC and PrkCc were incubated with trypsin (Promega) in the absence or presence of increasing amounts of TCT (0, 50, 100, 150 and 250 µM) for 10 min at 37 °C. The digestion profiles were assessed by electrophoresis in SDS-PAGE. For full-length PrkC (left gel), the arrow indicates a band whose intensity decreases in the presence of increasing amounts of TCT. The area where the pattern of digestion is modified by the addition of TCT is framed and magnified under the full-length gel. (B) In vitro phosphorylation assays in the presence of PrkC or PrkCc. 2.5 µg of protein were incubated with [γ-33 P]ATP and MBP and increasing amounts of TCT (0, 100, 150 and 250 µM) at 37 °C during 15 min. Samples were separated by SDS-PAGE and visualized by autoradiography. Full-length gels are presented in the supplemental data. Scientific REPORTS | (2018) 8:1660 | DOI:10.1038/s41598-018-20145-2
Figure 4 .
4PrkC binds PG. Oligomerization of PrkC, PrkC(R500A) and PrkCc in the presence of increasing concentrations of PG fragments. (A) Correlograms displaying raw data of time dependent diffusion of 3 µM PrkC proteins analyzed with increasing concentrations of PG fragments from 0 to 1.6 µg/ml. The insets represent the size distribution by size of PrkC, PrkC(R500A) or PrkCc delta PG mean size. For PrkC and PrkC(R500A), the values of 8.23 and 8.6 hydrodynamic diameters respectively suggests elongated monomers and for PrkCc the value of 4.96 hydrodynamic diameter suggests a globular monomer. Broken blue lines indicate the start of the exponential decay without PG fragments. (B) Histogram of PrkC (light grey), PrkCc (medium grey) and PrkC(R500A) (white) Z-average values (mean intensity size) in the presence of increasing concentrations of PG fragments from 0 to 1.6 µg/ml. Z-average gradually increases suggesting an oligomerization effect of PG fragments on PrkC but a lower effect on oligomerization of PrkC(R500A) and infers a non-specific aggregation of PrkCc with PG. Z-average displayed on a logarithmic scale. Scientific REPORTS | (2018) 8:1660 | DOI:10.1038/s41598-018-20145-2
Figure 5 .
5The kinase activity of PrkC in vivo is not modified by PASTAs deletions or PG binding during exponential growth. (A) PrkC-phosphorylation analysis by western blots. Strains SG278 (ΔprkC, amyE::gfp-prkC), SG467 (ΔprkC, amyE::gfp-prkCc-TM-P1P2), SG466 (ΔprkC, amyE::gfp-prkCc-TM-P1), SG465 (ΔprkC, amyE::gfp-prkCc-TM) and SG497 (ΔprkC, amyE::gfp-TM-P1P2-Ig-like)
Scientific
REPORTS | (2018) 8:1660 | DOI:10.1038/s41598-018-20145-2
Figure 6 .
6Localization of PrkC during stationary phase growth and role of the PASTA domains. (A) PrkC localization during stationary phase growth. Strains were grown on LB medium at 37 °C during 23 hours and all the forms of GFP-PrkC proteins were expressed from the P xyl promoter in the presence of 0.5% xylose. PrkC localization was analyzed by fluorescent microscopy for strains SG278 (ΔprkC, amyE::gfp-prkC), SG467 (ΔprkC, amyE::gfp-prkCc-TM-P1P2), SG466 (ΔprkC, amyE::gfp-prkCc-TM-P1) and SG465 (ΔprkC, amyE::gfp-prkCc-TM).
Scientific
REPORTS | (2018) 8:1660 | DOI:10.1038/s41598-018-20145-2
Scattering. Dynamic light scattering (DLS) experiments were carried out to determine the hydrodynamic diameter of PrkC, PrkC(R500A) and PrkCc in the presence and absence of PG using a Zetasizer Nano ZS (Malvern Instruments). Particles in solution are in a constant random motion and the intensity of the scattered light fluctuates with time. To determine the particle size, the provided software uses the Stokes-Einstein relation to obtain the intensity averaged size distribution from the raw correlation data. The correlograms give several information about the sample. The time at which the correlation starts to decay is an indication of the
Figure 7 .
7Two activation modes for PrkC. Two activation modes are proposed for PrkC depending on the physiological state of the bacteria. On the top panel (in blue), we designed the model of activation during stationary phase growth or germination of B. subtilis spores. During stationary phase or before germination, PrkC is distributed all over the cell wall of the bacteria or in the internal membrane of the spore. The binding of muropeptides (germination signal for spores) stimulates PrkC dimerization and autophosphorylation. The activated PrkC can then phosphorylate its cytoplasmic substrates. On the panel below (in red), we designed the model of PrkC activation during bacterial growth. Thanks to interactions with membrane proteins at the poles and at the septum, like hydrolases or proteins of the divisome schematically represented by the white shadow, PrkC molecules get closer to each other. PrkC interacts also with the division protein GpsB which stimulates its autophosphorylation and its kinase activity. The activated PrkC is then able to phosphorylate its cytoplasmic substrates. The feedback loop regulation of PrkC activity by phosphorylated GpsB protein 20 is not described here. The divisome schematically represented by the white shadow includes the proteins described in37 and containing EzrA, PBP1, PBP2b, ZapA, SepF, FtsZ, FtsA, FtsL, FtsW, DivIB, DivIC, and DivIVA. Scientific REPORTS | (2018) 8:1660 | DOI:10.1038/s41598-018-20145-2
regardless of the form of the protein. This result indicates that PrkC kinase activity is not stimulated in vivo by PG binding to the PASTA repeats during exponential growth.
Scientific REPORTS | (2018) 8:1660 | DOI:10.1038/s41598-018-20145-2Strain/plasmid Relevant characteristics
Source/reference
B. subtilis strains
WT168
trpC2
lab collection
1A963
trpC2 prkC∆1
17
SG278
trpC2 prkC∆1, amyE::gfp-prkC
20
SG355
trpC2 prkC∆1, amyE::gfp-prkCc
This work
SG465
trpC2 prkC∆1, amyE::gfp-prkCc-TM
This work
SG466
trpC2 prkC∆1, amyE::gfp-prkCc-TM-P1
This work
SG467
trpC2 prkC∆1, amyE::gfp-prkCc-TM-P1P2
This work
SG497
trpC2 prkC∆1, amyE::gfp-TM-P1P2P3-Ig-like This work
SG498
trpC2 prkC∆1, amyE::gfp-TM
This work
SG622
trpC2 prkC∆1, amyE::gfp-prkC(R500A)
This work
© The Author(s) 2018
AcknowledgementsWe thank J.R. Fantino for drawings with Adobe Illustrator and C. Grangeasse for stimulating discussions. This research was supported by the CNRS, the ANR (PiBaKi) and Aix Marseille Univ.Author ContributionsAdditional InformationSupplementary information accompanies this paper at https://doi.org/10.1038/s41598-018-20145-2.Competing Interests: The authors declare that they have no competing interests.Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.Open Access This article is licensed under a Creative Commons Attribution 4.0 InternationalLicense, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
PASTA in penicillin binding proteins and serine/threonine kinases: a recipe of structural, dynamic and binding properties. L Calvanese, L Falcigno, F Squeglia, G D Auria, R Berisio, 10.2174/0929867324666170216112746Curr Med Chem. Calvanese, L., Falcigno, L., Squeglia, F., Auria, G. D. & Berisio, R. PASTA in penicillin binding proteins and serine/threonine kinases: a recipe of structural, dynamic and binding properties. Curr Med Chem, https://doi.org/10.2174/0929867324666170216112746 (2017).
Mutational dissection of the S/T-kinase StkP reveals crucial roles in cell division of Streptococcus pneumoniae. A Fleurie, 10.1111/j.1365-2958.2011.07962.xMol Microbiol. 83Fleurie, A. et al. Mutational dissection of the S/T-kinase StkP reveals crucial roles in cell division of Streptococcus pneumoniae. Mol Microbiol 83, 746-758, https://doi.org/10.1111/j.1365-2958.2011.07962.x (2012).
PrkC-mediated Phosphorylation of Overexpressed YvcK Protein Regulates PBP1 Protein Localization in Bacillus subtilis mreB Mutant Cells. E Foulquier, 10.1074/jbc.M114.562496J Biol Chem. 289Foulquier, E. et al. PrkC-mediated Phosphorylation of Overexpressed YvcK Protein Regulates PBP1 Protein Localization in Bacillus subtilis mreB Mutant Cells. J Biol Chem 289, 23662-23669, https://doi.org/10.1074/jbc.M114.562496 (2014).
Eukaryote-like serine/threonine kinases and phosphatases in bacteria. Microbiology and molecular biology reviews: MMBR 75. S F Pereira, L Goss, J Dworkin, 10.1128/mmbr.00042-10Pereira, S. F., Goss, L. & Dworkin, J. Eukaryote-like serine/threonine kinases and phosphatases in bacteria. Microbiology and molecular biology reviews: MMBR 75, 192-212, https://doi.org/10.1128/mmbr.00042-10 (2011).
Bacterial cell division regulation by Ser/Thr kinases: a structural perspective. A Ruggiero, P De Simone, G Smaldone, F Squeglia, R Berisio, Curr Protein Pept Sci. 13Ruggiero, A., De Simone, P., Smaldone, G., Squeglia, F. & Berisio, R. Bacterial cell division regulation by Ser/Thr kinases: a structural perspective. Curr Protein Pept Sci 13, 756-766 (2012).
The PASTA domain: a beta-lactam-binding domain. C Yeats, R D Finn, A Bateman, Trends Biochem Sci. 270968000402021643Yeats, C., Finn, R. D. & Bateman, A. The PASTA domain: a beta-lactam-binding domain. Trends Biochem Sci 27, 438, S0968000402021643 (2002).
Distribution of PASTA domains in penicillin-binding proteins and serine/threonine kinases of Actinobacteria. H Ogawara, 10.1038/ja.2015.138J Antibiot (Tokyo). 69Ogawara, H. Distribution of PASTA domains in penicillin-binding proteins and serine/threonine kinases of Actinobacteria. J Antibiot (Tokyo) 69, 660-685, https://doi.org/10.1038/ja.2015.138 (2016).
Serine/Threonine Protein Kinases from Bacteria, Archaea and Eukarya Share a Common Evolutionary Origin Deeply Rooted in the Tree of Life. I A Stancik, 10.1016/j.jmb.2017.11.004J Mol Biol. Stancik, I. A. et al. Serine/Threonine Protein Kinases from Bacteria, Archaea and Eukarya Share a Common Evolutionary Origin Deeply Rooted in the Tree of Life. J Mol Biol. https://doi.org/10.1016/j.jmb.2017.11.004 (2017).
Substrate specificity of bacterial DD-peptidases (penicillin-binding proteins). R F Pratt, 10.1007/s00018-008-7591-7s00018-008-7591-7Cell Mol Life Sci. 65Pratt, R. F. Substrate specificity of bacterial DD-peptidases (penicillin-binding proteins). Cell Mol Life Sci 65, 2138-2155, https://doi. org/10.1007/s00018-008-7591-7 (2008).
Recognition of peptidoglycan and β-lactam antibiotics by the extracellular domain of the Ser/Thr protein kinase StkP from Streptococcus pneumoniae. B Maestro, 10.1016/j.febslet.2010.12.016FEBS Lett. 585Maestro, B. et al. Recognition of peptidoglycan and β-lactam antibiotics by the extracellular domain of the Ser/Thr protein kinase StkP from Streptococcus pneumoniae. FEBS Lett 585, 357-363, https://doi.org/10.1016/j.febslet.2010.12.016 (2011).
Chemical basis of peptidoglycan discrimination by PrkC, a key kinase involved in bacterial resuscitation from dormancy. F Squeglia, 10.1021/ja208080rJ Am Chem Soc. 133Squeglia, F. et al. Chemical basis of peptidoglycan discrimination by PrkC, a key kinase involved in bacterial resuscitation from dormancy. J Am Chem Soc 133, 20676-20679, https://doi.org/10.1021/ja208080r (2011).
The cell wall precursor lipid II acts as a molecular signal for the Ser/Thr kinase PknB of Staphylococcus aureus. P Hardt, 10.1016/j.ijmm.2016.12.001Int J Med Microbiol. 307Hardt, P. et al. The cell wall precursor lipid II acts as a molecular signal for the Ser/Thr kinase PknB of Staphylococcus aureus. Int J Med Microbiol 307, 1-10, https://doi.org/10.1016/j.ijmm.2016.12.001 (2017).
The structure of PknB extracellular PASTA domain from Mycobacterium tuberculosis suggests a ligand-dependent kinase activation. P Barthe, G V Mukamolova, C Roumestand, M Cohen-Gonsaud, 10.1016/j.str.2010.02.013Structure. 18Barthe, P., Mukamolova, G. V., Roumestand, C. & Cohen-Gonsaud, M. The structure of PknB extracellular PASTA domain from Mycobacterium tuberculosis suggests a ligand-dependent kinase activation. Structure 18, 606-615, https://doi.org/10.1016/j. str.2010.02.013 (2010).
Role of eukaryotic-like serine/threonine kinases in bacterial cell division and morphogenesis. S Manuse, A Fleurie, L Zucchini, C Lesterlin, C Grangeasse, 10.1093/femsre/fuv041FEMS Microbiol Rev. Manuse, S., Fleurie, A., Zucchini, L., Lesterlin, C. & Grangeasse, C. Role of eukaryotic-like serine/threonine kinases in bacterial cell division and morphogenesis. FEMS Microbiol Rev. https://doi.org/10.1093/femsre/fuv041 (2015).
The extended conformation of the 2.9-Å crystal structure of the three-PASTA domain of a Ser/Thr kinase from the human pathogen Staphylococcus aureus. P Paracuellos, 10.1016/j.jmb.2010.10.012J Mol Biol. 404Paracuellos, P. et al. The extended conformation of the 2.9-Å crystal structure of the three-PASTA domain of a Ser/Thr kinase from the human pathogen Staphylococcus aureus. J Mol Biol 404, 847-858, https://doi.org/10.1016/j.jmb.2010.10.012 (2010).
X-ray structural studies of the entire extracellular region of the serine/threonine kinase PrkC from Staphylococcus aureus. A Ruggiero, 10.1042/BJ20101643Biochem J. 435Ruggiero, A. et al. X-ray structural studies of the entire extracellular region of the serine/threonine kinase PrkC from Staphylococcus aureus. Biochem J 435, 33-41, https://doi.org/10.1042/BJ20101643 (2011).
The PrpC serine-threonine phosphatase and PrkC kinase have opposing physiological roles in stationary-phase Bacillus subtilis cells. T A Gaidenko, T J Kim, C W Price, J Bacteriol. 184Gaidenko, T. A., Kim, T. J. & Price, C. W. The PrpC serine-threonine phosphatase and PrkC kinase have opposing physiological roles in stationary-phase Bacillus subtilis cells. J Bacteriol 184, 6109-6114 (2002).
Characterization of a membrane-linked Ser/Thr protein kinase in Bacillus subtilis. E Madec, A Laszkiewicz, A Iwanicki, M Obuchowski, S Seror, Mol Microbiol. 463178implicated in developmental processesMadec, E., Laszkiewicz, A., Iwanicki, A., Obuchowski, M. & Seror, S. Characterization of a membrane-linked Ser/Thr protein kinase in Bacillus subtilis, implicated in developmental processes. Mol Microbiol 46, 571-586, 3178 (2002).
A eukaryotic-like Ser/Thr kinase signals bacteria to exit dormancy in response to peptidoglycan fragments. I M Shah, M H Laaberki, D L Popham, J Dworkin, 10.1016/j.cell.2008.08.039S0092-8674(08)01128-8Cell. 135Shah, I. M., Laaberki, M. H., Popham, D. L. & Dworkin, J. A eukaryotic-like Ser/Thr kinase signals bacteria to exit dormancy in response to peptidoglycan fragments. Cell 135, 486-496, S0092-8674(08)01128-8, https://doi.org/10.1016/j.cell.2008.08.039 (2008).
Phosphorylation of the cell division protein GpsB regulates PrkC kinase activity through a negative feedback loop in Bacillus subtilis. F Pompeo, E Foulquier, B Serrano, C Grangeasse, A Galinier, 10.1111/mmi.13015Mol Microbiol. 97Pompeo, F., Foulquier, E., Serrano, B., Grangeasse, C. & Galinier, A. Phosphorylation of the cell division protein GpsB regulates PrkC kinase activity through a negative feedback loop in Bacillus subtilis. Mol Microbiol 97, 139-150, https://doi.org/10.1111/ mmi.13015 (2015).
Structural and Genetic Analyses of the Mycobacterium tuberculosis Protein Kinase B Sensor Domain Identify a Potential Ligand-binding Site. D M Prigozhin, 10.1074/jbc.M116.731760J Biol Chem. 291Prigozhin, D. M. et al. Structural and Genetic Analyses of the Mycobacterium tuberculosis Protein Kinase B Sensor Domain Identify a Potential Ligand-binding Site. J Biol Chem 291, 22961-22969, https://doi.org/10.1074/jbc.M116.731760 (2016).
Induction and regulation of a secreted peptidoglycan hydrolase by a membrane Ser/Thr kinase that detects muropeptides. I M Shah, J Dworkin, 10.1111/j.1365-2958.2010.07046.xMol Microbiol. 75Shah, I. M. & Dworkin, J. Induction and regulation of a secreted peptidoglycan hydrolase by a membrane Ser/Thr kinase that detects muropeptides. Mol Microbiol 75, 1232-1243, https://doi.org/10.1111/j.1365-2958.2010.07046.x (2010).
EF-Tu and the stressosome protein YezB are substrates of the Ser/Thr kinase/phosphatase couple, PrkC/ PrpC, in Bacillus subtilis. C Absalon, 10.1099/mic.0.022475-0Microbiology. 155Absalon, C. et al. CpgA, EF-Tu and the stressosome protein YezB are substrates of the Ser/Thr kinase/phosphatase couple, PrkC/ PrpC, in Bacillus subtilis. Microbiology 155, 932-943, https://doi.org/10.1099/mic.0.022475-0 (2009).
Growth-and stress-induced PASTA kinase phosphorylation in Enterococcus faecalis. B D Labbe, C J Kristich, 10.1128/JB.00363-17J Bacteriol. Labbe, B. D. & Kristich, C. J. Growth-and stress-induced PASTA kinase phosphorylation in Enterococcus faecalis. J Bacteriol, https:// doi.org/10.1128/JB.00363-17 (2017).
The extracytoplasmic domain of the Mycobacterium tuberculosis Ser/Thr kinase PknB binds specific muropeptides and is required for PknB localization. M Mir, 10.1371/journal.ppat.1002182PLoS Pathog. 7Mir, M. et al. The extracytoplasmic domain of the Mycobacterium tuberculosis Ser/Thr kinase PknB binds specific muropeptides and is required for PknB localization. PLoS Pathog 7, e1002182, https://doi.org/10.1371/journal.ppat.1002182 (2011).
PASTA repeats of the protein kinase StkP interconnect cell constriction and separation of Streptococcus pneumoniae. L Zucchini, 10.1038/s41564-017-0069-3Nat Microbiol. Zucchini, L. et al. PASTA repeats of the protein kinase StkP interconnect cell constriction and separation of Streptococcus pneumoniae. Nat Microbiol, https://doi.org/10.1038/s41564-017-0069-3 (2017).
Control of cell division in Streptococcus pneumoniae by the conserved Ser/Thr protein kinase StkP. K Beilharz, 10.1073/pnas.1119172109E905-913Proc Natl Acad Sci. 109Beilharz, K. et al. Control of cell division in Streptococcus pneumoniae by the conserved Ser/Thr protein kinase StkP. Proc Natl Acad Sci USA 109, E905-913, https://doi.org/10.1073/pnas.1119172109 (2012).
. Reports Scientific, 10.1038/s41598-018-20145-28Scientific REPORTS | (2018) 8:1660 | DOI:10.1038/s41598-018-20145-2
Interaction of Penicillin-Binding Protein 2x and Ser/Thr protein kinase StkP, two key players in Streptococcus pneumoniae R6 morphogenesis. C Morlot, 10.1111/mmi.12348Mol Microbiol. Morlot, C. et al. Interaction of Penicillin-Binding Protein 2x and Ser/Thr protein kinase StkP, two key players in Streptococcus pneumoniae R6 morphogenesis. Mol Microbiol, https://doi.org/10.1111/mmi.12348 (2013).
Pbp2x localizes separately from Pbp2b and other peptidoglycan synthesis proteins during later stages of cell division of Streptococcus pneumoniae D39. H C Tsui, 10.1111/mmi.1274521-40Mol Microbiol. 94Tsui, H. C. et al. Pbp2x localizes separately from Pbp2b and other peptidoglycan synthesis proteins during later stages of cell division of Streptococcus pneumoniae D39. Mol Microbiol 94, 21-40, https://doi.org/10.1111/mmi.12745 (2014).
Mass spectrometry and site-directed mutagenesis identify several autophosphorylated residues required for the activity of PrkC, a Ser/Thr kinase from Bacillus subtilis. E Madec, J Mol Biol. 330Madec, E. et al. Mass spectrometry and site-directed mutagenesis identify several autophosphorylated residues required for the activity of PrkC, a Ser/Thr kinase from Bacillus subtilis. J Mol Biol 330, 459-472 (2003).
Phosphorylation of CpgA protein enhances both its GTPase activity and its affinity for ribosome and is crucial for Bacillus subtilis growth and morphology. F Pompeo, 10.1074/jbc.M112.340331J Biol Chem. 287Pompeo, F. et al. Phosphorylation of CpgA protein enhances both its GTPase activity and its affinity for ribosome and is crucial for Bacillus subtilis growth and morphology. J Biol Chem 287, 20830-20838, https://doi.org/10.1074/jbc.M112.340331 (2012).
Structural and dynamic features of PASTA domains with different functional roles. L Calvanese, L Falcigno, F Squeglia, G D' Auria, R Berisio, 10.1080/07391102.2016.1217274J Biomol Struct Dyn. 35Calvanese, L., Falcigno, L., Squeglia, F., D' Auria, G. & Berisio, R. Structural and dynamic features of PASTA domains with different functional roles. J Biomol Struct Dyn 35, 2293-2300, https://doi.org/10.1080/07391102.2016.1217274 (2017).
Analysis of peptidoglycan structure from vegetative cells of Bacillus subtilis 168 and role of PBP 5 in peptidoglycan maturation. A Atrih, G Bacher, G Allmaier, M P Williamson, S J Foster, J Bacteriol. 181Atrih, A., Bacher, G., Allmaier, G., Williamson, M. P. & Foster, S. J. Analysis of peptidoglycan structure from vegetative cells of Bacillus subtilis 168 and role of PBP 5 in peptidoglycan maturation. J Bacteriol 181, 3956-3966 (1999).
Crystal structure of the bifunctional N-acetylglucosamine 1-phosphate uridyltransferase from Escherichia coli: a paradigm for the related pyrophosphorylase superfamily. K Brown, Embo J. 18Brown, K. et al. Crystal structure of the bifunctional N-acetylglucosamine 1-phosphate uridyltransferase from Escherichia coli: a paradigm for the related pyrophosphorylase superfamily. Embo J 18, 4096-4107 (1999).
GFP vectors for controlled expression and dual labelling of protein fusions in Bacillus subtilis. P J Lewis, A L Marston, Gene. 227Lewis, P. J. & Marston, A. L. GFP vectors for controlled expression and dual labelling of protein fusions in Bacillus subtilis. Gene 227, 101-110 (1999).
Peptidoglycan molecular requirements allowing detection by the Drosophila immune deficiency pathway. C R Stenbak, J Immunol. 173Stenbak, C. R. et al. Peptidoglycan molecular requirements allowing detection by the Drosophila immune deficiency pathway. J Immunol 173, 7339-7348 (2004).
Two-step assembly dynamics of the Bacillus subtilis divisome. P Gamba, J W Veening, N J Saunders, L W Hamoen, R A Daniel, 10.1128/jb.01758-08J Bacteriol. 191Gamba, P., Veening, J. W., Saunders, N. J., Hamoen, L. W. & Daniel, R. A. Two-step assembly dynamics of the Bacillus subtilis divisome. J Bacteriol 191, 4186-4194, https://doi.org/10.1128/jb.01758-08 (2009).
| Protein kinase G (PknG) in Mycobacterium tuberculosis has been shown to modulate phagosome-lysosome fusion. The protein has three distinct domains, an N-terminal Trx domain, a kinase domain, and a C-terminal TPR domain. The present study extensively analyzes the roles of these domains in regulating PknG kinase activity and function. We find that the kinase domain of PknG by itself is inactive, signifying the importance of the flanking domains. Although the deletion of the Trx domain severely impacts the activity of the protein, the C-terminal region also contributes significantly in regulating the activity of the kinase. Apart from this, PknG kinase activity is dependent on the presence of threonine 309 in the p ؉ 1 loop of the activation segment. Mutating the conserved cysteine residues in the Trx motifs makes PknG refractory to changes in the redox environment. In vitro experiments identify threonine 63 as the major phosphorylation site of the protein. Importantly, we find that this is the only site in the protein that is phosphorylated in vivo. Macrophage infection studies reveal that the first 73 residues, the Trx motifs, and the threonine 63 residue are independently essential for modulating PknG-mediated survival of mycobacteria in its host. We have extended these studies to investigate the role of PknG and PknG mutants in the pathogenesis of mycobacteria in mice. Our results reinforce the findings from the macrophage infection experiments, and for the first time demonstrate that the expression of PknG in non-pathogenic mycobacteria allows the continued existence of these bacteria in host tissues. | Mycobacterium tuberculosis encodes for 11 eukaryotic-like serine/threonine protein kinases. Genetic and biochemical studies show that these kinases regulate various cellular processes including cell shape and morphology, glucose and glutamine transport, phagosome-lysosome fusion and the expression, and/or activity of transcription factors. PknK is the largest predicted serine/threonine protein kinase in M. tuberculosis. Here, we have cloned, overexpressed, and purified protein kinase K (PknK) to near homogeneity and show that its ability to phosphorylate proteins is dependent on the invariant lysine (Lys 55 ), and on two conserved threonine residues present in its activation loop. Despite being devoid of any apparent transmembrane domain, PknK is localized to the cell wall fraction, suggesting probable anchoring of the kinase to the cell membrane region. The pknK gene is located in the vicinity of the virS gene, which is known to regulate the expression of the mycobacterial monooxygenase (mymA) operon. We report here for the first time that VirS is in fact a substrate of PknK. In addition, four of the proteins encoded by mymA operon are also found to be substrates of PknK. Results show that VirS is a bona fide substrate of PknK in vivo, and PknK-mediated phosphorylation of VirS increases its affinity for mym promoter DNA. Reporter assays reveal that PknK modulates VirS-mediated stimulation of transcription from the mym promoter. These findings suggest that the expression of mymA operon genes is regulated through PknK-mediated phosphorylation of VirS.5The abbreviations used are: IPTG, isopropyl -D-thiogalactopyranoside; STPK, serine/threonine protein kinase; MBP, maltose-binding protein; Mbp, myelin basic protein; GST, glutathione S-transferase; DTT, dithiothreitol; EMSA, electrophoretic mobility shift assay. | We have generated a series of plectin deletion and mutagenized cDNA constructs to dissect the functional sequences that mediate plectin9s interaction with intermediate filament (IF) networks, and scored their ability to coalign or disrupt intermediate filaments when ectopically expressed in rat kangaroo PtK2 cells. We show that a stretch of approximately 50 amino acid residues within plectin9s carboxy-terminal repeat 5 domain serves as a unique binding site for both vimentin and cytokeratin IF networks of PtK2 cells. Part of the IF-binding domain was found to constitute a functional nuclear localization signal (NLS) motif, as demonstrated by nuclear import of cytoplasmic proteins linked to this sequence. Site directed mutagenesis revealed a specific cluster of four basic amino acid residues (arg4277-arg4280) residing within the NLS sequence motif to be essential for IF binding. When mutant proteins corresponding to those expressed in PtK2 cells were expressed in bacteria and purified proteins subjected to a sensitive quantitative overlay binding assay using Eu3+-labeled vimentin, the relative binding capacities of mutant proteins measured were fully consistent with the mutant9s phenotypes observed in living cells. Using recombinant proteins we also show by negative staining and rotary shadowing electron microscopy that in vitro assembled vimentin intermediate filaments become packed into dense aggregates upon incubation with plectin repeat 5 domain, in contrast to repeat 4 domain or a mutated repeat 5 domain. | HtrA (high-temperature requirement A) family proteins play important roles in protein-quality control processes in the bacterial periplasm. A common feature of all members of this family is their modular organization comprising a chymotrypsin-like protease domain and at least one PDZ (postsynaptic density of 95 kDa, disks large homolog 1 and zonula occludens 1) domain. All characterized HtrA proteins assemble into complex oligomers consisting of typically 3-24 monomers, which allow a tight regulation of proteolytic activity. Here, we provide evidence that the assembly of proteolytically active, higher-order complexes of DegQ from Legionella pneumophila is triggered by the binding of substrate-derived peptides. Crystal structures of inactive 3-mers and active 12-mers of DegQ reveal molecular details of elements of a conserved allosteric activation cascade that defines distinct protease ON and OFF states. Results from DegQ(Lp) variants harboring structure-based amino acid substitutions indicate that peptide binding to the PDZ1 domain is critical for proteolytic activity but not for the formation of higher-order oligomers. Combining structural, mutagenesis and biochemical data, we show that, in contrast to the proteolytic activity, the chaperone function of DegQ is not affected by the state of the activation cascade. | Transcription in the prpC-yloQ region in Bacillus subtilis | A primary study on purification of subtilisin-like protease(Pr1) from Pythium guiyangense and its enzymological properties | mRNA localization provides polarized cells with a locally renewable source of proteins. In neurons, mRNA translation can occur at millimeters to centimeters from the cell body, giving the dendritic and axonal processes a means to autonomously respond to their environment. Despite that hundreds of mRNAs have been detected in neuronal processes, there are no reliable means to predict mRNA localization elements. Here, we have asked what RNA elements are needed for localization of transcripts encoding endoplasmic reticulum chaperone proteins in neurons. The 3-untranslated regions (UTRs) of calreticulin and Grp78/BiP mRNAs show no homology to one another, but each shows extensive regions of high sequence identity to their 3UTRs in mammalian orthologs. These conserved regions are sufficient for subcellular localization of reporter mRNAs in neurons. The 3UTR of calreticulin has two conserved regions, and either of these is sufficient for axonal and dendritic targeting. However, only nucleotides 1315-1412 show ligand responsiveness to neurotrophin 3 (NT3) and myelin-associated glycoprotein (MAG). This NT3-and MAG-dependent axonal mRNA transport requires activation of JNK, both for calreticulin mRNA and for other mRNAs whose axonal levels are commonly regulated by NT3 and MAG.Grants R01-NS049041 and R01-NS041596 (to J. L. T.) and K99-NR010797 (to D. E. W.). | Mycobacterium tuberculosis is a major human pathogen that has evolved survival mechanisms to persist in an immunecompetent host under a dormant condition. The regulation of M. tuberculosis metabolism during latent infection is not clearly known. The dormancy survival regulon (DosR regulon) is chiefly responsible for encoding dormancy related functions of M. tuberculosis. We describe functional characterization of an important gene of DosR regulon, Rv0079, which appears to be involved in the regulation of translation through the interaction of its product with bacterial ribosomal subunits. The protein encoded by Rv0079, possibly, has an inhibitory role with respect to protein synthesis, as revealed by our experiments. We performed computational modelling and docking simulation studies involving the protein encoded by Rv0079 followed by in vitro translation and growth curve analysis experiments, involving recombinant E. coli and Bacille Calmette Guérin (BCG) strains that overexpressed Rv0079. Our observations concerning the interaction of the protein with the ribosomes are supportive of its role in regulation/inhibition of translation. We propose that the protein encoded by locus Rv0079 is a 'dormancy associated translation inhibitor' or DATIN. Citation: Kumar A, Majid M, Kunisch R, Rani PS, Qureshi IA, et al. (2012) Mycobacterium tuberculosis DosR Regulon Gene Rv0079 Encodes a Putative, 'Dormancy Associated Translation Inhibitor (DATIN)'. PLoS ONE 7(6): e38709. |
181 | The Brinks lock works great and matches all of the other padlocks we use ... | I'm pretty new to this whole thing. I've picked the little clear one but it doesn't really seem like a real lock. Are there any good locks that I can practice on? | Does what it's designed to do. Locks are only made for honest people. They really only serve as a deterrent. | I should've bought one of these a long time ago. After 2 minutes of easy installation, I could lock my camper top for the first time in years. Thank you Gordon Glass. | What is the combo for the padlock on haunted trapped soul? | What is the combo for the padlock on haunted trapped soul? | nice solid lock that is easy to program. It will stand out in the fitness center locker room so I can easily spot my locker. I would recommend the lock | The lock did not work. Other then that nice. | I got a Southord PXS-14 set. For a lock I got a Brinks 663-600014 if/when I get it open I'll be sure to report it here!
Update: GOT IT. - Damn, that felt great. Initially I kept letting go of the tension wrench which apparently set the pins back in place. Also, the book that came with the set strongly emphasized to not put too much pressure on the tension wrench so I think I was too gentle for a while. I'm stoked. I just used the hook btw. I'd like to try the rake next. | 181 | The Brinks lock works great and matches all of the other padlocks we use for our fitness center. Thank you! | This is best lock I've used. | These are fantastic locks. I've been using them to secure the ... | Great Crimper - Poor Lock Design | Best Lock I've ever used. Replaced all my old locks with them. | Different Types of Padlocks? | These locks are a great alternative to the high priced name brand locks | Counter clockwise padlocks | I would love one with a more secure lock |
182 | Induction of Phenol and Defence-Related Enzymes During Wilt (Fusarium udum Butler) Infestation in Pigeon Pea | Thirty nine entries from IVT and AVT genotypes of pigeonpea were screened against wilt disease, among which nine genotypes viz., JSA 59, IPA 17F, ARCCV2, PT 00012, JSA11, LRG 50, VKT 244, JSA34 and JSA47 showed resistant; nine genotypes showed moderately resistant and four genotypes showed moderately susceptible reaction. In multilocation trials, 15 genotypes were evaluated and it was revealed that four genotypes viz., BWR 133, IPA 9F, IPA 234 and ICP 8863 showed resistant reaction; four genotypes viz., BDN 2001-9, PT03–142, IPA 5–3 and MA 3 showed moderately resistant and four genotypes showed moderately susceptible reaction. In promising entries, 50 genotypes were screened against Fusarium wilt, 34 genotypes showed resistant reaction; 12 genotypes showed moderately resistant reaction and BRG-1 showed moderately susceptible reaction. | Fusarium wilt of tomato (FW) caused by Fusarium oxysporum f. sp. lycopersici (FOL) is a major challenge for tomato production worldwide. For sustainable management of FW, the potential of five strains of Trichoderma asperellum was evaluated under greenhouse conditions. The results indicated that FOL infected plants treated with T. asperellum strains significantly reduced disease incidence and severity compared with FOL-only infected plants. The reduction of wilt disease on plants treated with T. asperellum strains was accompanied by a significant reduction in FOL populations in tomato stems and rhizosphere. Moreover, the application of T. asperellum promoted tomato plant growth irrespective of the presence or absence of FOL. Two strains of T. asperellum (TS-12 and TS-39) that showed the best performance in minimizing disease development and increases in plant growth parameters were selected for elucidating their ability in triggering tomato defense mechanisms. The expression levels of defense-related genes, chitinase (SlChi3), β-1,3-glucanase (SlGluA) and PR-1 (SlPR-1a) were significantly increased in the stems and roots of Trichoderma treated, FOL infected plants, compared with FOL-only infected ones. These results indicate that the application of T. asperellum strains TS-12 and TS-39 can be used as an alternative strategy to manage FW through their antagonistic activities and abilities to induce systemic resistance. | The infestation of triticale grains by Fusaria and responses of four cultivars on artifical infection of three Fusarium species were studied. Mycelium penetration through kernel tissues and its presence in embryo and endosperm were found. In inoculated spikes reduction of grains number and weight in relation to the control was noted. The most resistant triticale cultivar appeared to be Grado and the most susceptible - Salvo. | Fusarium oxysporum f.sp.dianthi causes severe wilting in carnation (Dianthus caryophyllus L.) worldwide. The pathogen is present in the soil profile in which carnation roots are distributed and may infect the plants at any time during the growing season. To minimize the losses induced by Fusarium wilt, growers use carnation cuttings free ofFusarium spp. and fumigate the soil with methyl bromide prior to planting. The severity of epidemics and the resulting losses are governed by the main and interacting effects of the three components of the disease syndrome: the host, the pathogen and the environment. Host variables include the type and the degree of cultivar resistance (i.e., complete, partial or tolerance); pathogen variables include the race, its virulence and infectivity, and the amount of initial inoculum; environmental variables include solar radiation intensity, photoperiod, temperature and the growth substrate. In the present review the information available on the effect of the host, the pathogen and the environment, and their interactions, on Fusarium wilt in carnation is summarized. | Fusarium wilt to graft a susceptible variety of melon to a resistant root-stock. Resistant cultivars, liming the soil to change soil pH to 6-7, and reducing soil nitrogen levels also help control "F. oxysporum" f. sp. "melonis". The fungus "Trichoderma viride" is a proven biocontrol agent to control this disease in an environment friendly way. Because "F. oxysporum" is so widespread, it is a significant problem in many crops. It is economically damaging to the banana industry, and the threat of more virulent strains or mutations to damage previously resistant crops is of major concern. "F. oxysporum" also causes damage to many | Alkaloids and phenolics biosynthesis increases mango resistance to infection by Ceratocystis fimbriata | In the present study, we evaluated the susceptibility of different commercial olive cultivars to verticillium wilt. Two Verticillium dahliae isolates, obtained from olive and artichoke, were used in pathogenicity tests. Two-year-old rooted cuttings were inoculated using either the root-dip or the stem-wounding method. The results were similar with both inoculation methods. Cvs Carolea and Cipressino proved to be moderately susceptible whereas Cassanese, Nocellara del Belice, Nocellara Etnea, Tonda Iblea and Uovo di Piccione were very susceptible. The response of cv. Coratina varied from susceptibility to moderate susceptibility. | leaves off the plant helps promote growth, largely because the plant responds by converting pairs of leaflets next to the topmost leaves into new stems. Basil is popularly recommended as a companion plant to the tomato. Common claims are that basil may deter pests or improve tomato flavor. However, in double-blind taste tests, basil did not significantly affect the taste of tomatoes when planted adjacent to them. Basil suffers from several plant pathogens that can ruin the crop and reduce yield. Fusarium wilt is a soil-borne fungal disease that will quickly kill younger basil plants. Seedlings may be killed by | 182 | The present investigation was carried out on wilt (Fusarium udum Butler) resistant ::: (ICPL 87119, BDN 2) and susceptible (T15-15 & ICP 2376) genotypes of pigeon pea ::: at 0 day after infection (DAI), 1 DAI, 4 DAI and 7 DAI in infected and non-infected ::: tissues to identify some biochemical markers like phenol and enzymes ::: related to phenol metabolism viz., PPO and PAL for wilt resistant. The phenol ::: content increased 1 DAI to 4 DAI in leaves and root tissue and decreased later in ::: leaves tissue only during infection of wilt pathogen. The phenylalanine ammonium ::: lyase (PAL) and polyphenol oxidase (PPO) activity were highest in resistant ::: genotypes at all the stages. The root tissues recorded 5 to 10 fold higher PAL ::: activity than leaves in all genotypes. | Screening of pigeonpea genotypes for Fusarium wilt | Fusarium head blight (FHB), caused by Fusarium graminearum, is a very important disease of wheat globally. Damage caused by F. graminearum includes reduced grain yield, reduced grain functional quality, and results in the presence of the trichothecene mycotoxin deoxynivalenol in Fusarium-damaged kernels. The development of FHB resistant wheat cultivars is an important component of integrated management. The objective of this study was to identify QTL for FHB resistance in a recombinant inbred line (RIL) population of the spring wheat cross Kenyon/86ISMN 2137. Kenyon is a Canadian spring wheat, while 86ISMN 2137 is an unrelated spring wheat. The RIL population was evaluated for FHB resistance in six FHB nurseries. Nine additive effect QTL for FHB resistance were identified, six from Kenyon and three from 86ISMN 2137. Rht8 and Ppd-D1a co-located with two FHB resistance QTL on chromosome arm 2DS. A major QTL for FHB resistance from Kenyon (QFhb.crc-7D) was identified on chromosome 7D. The QTL QFhb.crc-2D.4 from Kenyon mapped to the same region as a FHB resistance QTL from Wuhan-1 on chromosome arm 2DL. This result was unexpected since Kenyon does not share common ancestry with Wuhan-1. Other FHB resistance QTL on chromosomes 4A, 4D, and 5B also mapped to known locations of FHB resistance. Four digenic epistatic interactions were detected for FHB resistance, which involved eight QTL. None of these QTL were significant based upon additive effect QTL analysis. This study provides insight into the genetic basis of native FHB resistance in Canadian spring wheat. | Phenolic Content and Ferric Reducing Antioxidant Power of Artemisia Fragrans Willd. and Artemisia Vulgaris l. Herbs | Citation: Genievskaya, Y.; Zatybekov, A.; Abugalieva, S.; Turuspekov, Y. Identification of Quantitative Trait Loci Associated with Powdery Mildew Resistance in Spring Barley under Conditions of Southeastern Kazakhstan. Plants 2023, 12, 2375. https://doi.Abstract: Barley (Hordeum vulgare L.) is one of the most produced cereal crops in the world. It has traditionally been used for the production of animal feed and for malting, as well as for human consumption. However, its production is highly affected by biotic stress factors, particularly the fungal pathogen Blumeria graminis (DC.) f. sp. hordei (Bgh), which causes powdery mildew (PM). In this study, a collection of 406 barley accessions from the USA, Kazakhstan, Europe, and Africa were assessed for resistance to PM over a 3-year period in southeastern Kazakhstan. The collection was grown in the field in 2020, 2021, and 2022 and was genotyped using the 9K SNP Illumina chip. A genome-wide association study (GWAS) was conducted to identify the quantitative trait loci (QTLs) associated with PM resistance. As a result, seven QTLs for PM resistance were detected on chromosomes 4H, 5H, and 7H (FDR p-values < 0.05). Genetic positions of two QTLs were similar to those of PM resistance QTLs previously reported in the scientific literature, suggesting that the five remaining QTLs are novel putative genetic factors for the studied trait. Haplotype analysis for seven QTLs revealed three haplotypes which were associated with total PM resistance and one haplotype associated with the high PM severity in the barley collection. Identified QTLs and haplotypes associated with the PM resistance of barley may be used for further analysis, trait pyramiding, and marker-assisted selection. Plants 2023, 12, 2375. https://doi.org/10.3390/plants12122375 https://www.mdpi.com/journal/plants Plants 2023, 12, 2375 2 of 12PM and other fungal infections in barley fields have traditionally been controlled by fungicides and by the cultivation of resistant plants. Chemical protection provides conditions for the selection of fungicide-resistant strains [10]; however, the cultivation of resistant barley cultivars is the most economically and environmentally friendly method. Cultivating disease-resistant barley cultivars is the most effective strategy for controlling airborne diseases, such as PM[11]. Modern genetic resistance of barley to PM includes the durable race-specific resistance gene mlo, which has played a key role in plant resistance to PM in recent decades[12,13]. In barley, the gene mlo is located in the middle of the long arm of chromosome 4H, with more than 40 mlo-alleles identified[14,15]. However, despite the effectiveness of mlo, it does have several drawbacks. The gene produces a pleiotropic effect, so that necrotic areas on the leaf occur spontaneously; this leads to a reduction in photosynthesis, and therefore, to decreased kernel size and lower yields [13]. In addition, barley plants with the mlo resistance allele are susceptible to spot diseases, such as spot blotch [16] and Ramularia leaf spot [17]. The other important PM resistance gene that exhibits race-specific resistance to Bgh in barley is Mla, located on chromosome 1H [18]. Unfortunately, Mla also has drawbacks. Some Mla alleles require additional genes to express full resistance, such as Rar1-dependent Mla10 [19]. Several other important PM resistance genes in barley have been described. These are MlGa, Mlk, Mlnn, and Mlra on chromosome 1H [20], MlLa and MlMor on chromosome 2H [7,21,22], Mlg and MlBo on chromosome 4H [7,23], Mlj on chromosome 5H [24], Mlh on chromosome 6H [7], mlt and Mlf on chromosome 7H [24], and many others. However, all these genes are race-specific, non-universal, and non-durable, and can therefore be easily overcome by new races of Bgh[25].Despite a large number of identified PM resistance genes and alleles, new virulent Bgh pathotypes continue to be identified around the world. Despite the effectiveness of mlo in the last 50 years, mlo-virulent Bgh isolates have been reported in Europe, Japan, Australia, and China [14,26,27]. In Kazakhstan in 2015 and 2016, 107 isolates of Bgh were collected from seven populations of cultivated barley throughout the country and studied for virulence[28]. All isolates were virulent for Mla8 and avirulent for Mla9, Mla1 + Mla2, Mla6 + Mla14, Mla13 + MlRu3, Mla7 + MlNo3, Mla10 + MlDu2, Mla13 + MlRu3, and Mlo5 resistance genes[28]. Among 46 cultivars of Kazakhstani spring and winter barley which were evaluated for PM resistance in southeastern Kazakhstan in 2021-2022, 17 spring and 11 winter cultivars were found to be of the resistant (R) reaction type, while the remaining cultivars were moderately resistant (MR) or moderately susceptible (MS)[29]. These results mean that, in this host-pathogen race, we need to search for new resistance loci to pyramid them against PM and other barley diseases, while considering other agronomic traits.Previously, restriction fragment length polymorphism (RFLP) [30], cleaved amplified polymorphic sequences (CAPS)[31], and simple sequence repeat (SSR) [32] markers were described for the selection of PM-resistant barley genotypes. However, in the past 15 years, genetic mapping of new quantitative trait loci (QTL) has developed rapidly. The traditional approach to genetic mapping of QTL is based on searching for associations between genotype and phenotype data from segregating populations resulting in bi-parental crosses. However, this process is time-consuming due to the development of bi-parental populations, and the genetic diversity of the resulting population is limited to parental genetic background. Currently, the most common and powerful method of QTL identification is the genome-wide association study (GWAS) based on linkage disequilibrium (LD)[33]. GWAS considers ancestral recombination events to identify significant associations between genotypic and phenotypic variations. Today, this method, along with traditional linkage mapping with bi-parental populations, is routinely used for the identification of QTLs in crops, including barley. During the last decade alone, GWAS in barley has been successfully used for the identification of QTLs for abiotic stress tolerance[34][35][36], adaptation traits [37-39], yield-related traits [40,41], grain components and quality traits [42-44], and resistance to diseases [45-48]. Novel PM resistance QTLs have been identified using GWAS in wheat [49,50], oat [51], rye [52], and, of course, barley [53-56]. However, in Kazakhstan, Plants 2023, 12, 2375 3 of 12no GWAS of barley resistance to local Bgh pathotypes has yet been attempted. Therefore, the main goal of this research was to assess the resistance to PM of a diverse spring barley collection in southeastern Kazakhstan and to identify novel-and possibly unique-QTLs for local Bgh pathotypes. | Background: Wheat straw is a rich resource worldwide. Straw return is an effective strategy to alleviate soil-borne diseases on monoculture watermelon. Previous studies focus on soil structure, physical and chemical properties; however, little is known about the molecular responses on host plant. Results: No significant difference on the population of Fusarium oxysporum f.sp. niveum race 1(Fon1) in rhizosphere soil was found between control (no addition of wheat straw) and the treated groups (addition of 1% (T1) or 2% (T2) wheat straw). RNA-Seq analysis showed that 3419 differentially expressed genes were clustered into 8 profiles. KEGG analysis revealed that phenylpropanoid biosynthesis and plant hormone signal transduction were involved in wheat straw induced response in monoculture watermelon. Genes in lignin biosynthesis were found to be upregulated, and the lignin and auxin contents were higher in T1 and T2 compared to the control. Lignin was also enriched and the Fon1 population decreased in watermelon roots treated with wheat straw. The enzyme activities of phenylalanine ammonia-lyase and peroxidase were increased. Conclusions: Our data suggest that the addition of wheat straw enhances the defense response to Fon1 infection in watermelon through increasing lignin and auxin biosynthesis. | A correlation has been established between production of specific phenylphenalenones and resistance of various banana and plantain varieties towards certain pathogens. In addition a dihydrotrihydroxyphenylphenalene was isolated from the resistant 'Pelipita' plantain variety in relatively high concentrations and its structure and relative configuration were assigned on the basis of 1D and 2D NMR and NOE information. This compound is considered a key intermediate in the biosynthesis of phenylphenalenone phytoalexins. | A study was conducted during 2 years to determine the effects of three different control measures on the development of Verticillium wilt on olive trees cv. ‘Nabali’ at Al-Hallabat, Jordan. The causal agent of the wilt wasVerticillium dahliae Kleb. Treating diseased trees with Cryptonol (8-hydroxyquinoline sulfate) in a soil drench, or covering trees with a solar chamber for 15 days, was effective in suppressing disease development. The fertilizer treatment (NPK, 15:15:30) decreased disease severity and percent infection. All decreases are in comparison with the untreated control, and as recorded during the active phase of the pathogen. The treatments did not differ significantly from each other, and disease incidence in treated trees remained lower than in the control throughout the examined period. | Molecular characterization of the polyphenol oxidase gene in lulo (Solanum quitoense Lam.) var. Castilla |
183 | what does imca stand for in mental health? | Integrative Multi-Level Therapy (IMLT) is a comprehensive interpersonal and intrapsychic approach to clinical assessment and therapeutic intervention with distressed individuals, couples and families. In this article, the principles and practice of IMLT are presented and illustrated with clinical examples. Research support for the IMLT approach is described. | Challenges in interfacing between forensic and general mental health: a Japanese perspective. | from the University of Melbourne to conduct a national review of the ways that seclusion and restraint is used in mental health care services in Australia and identify ways to reduce or eliminate the practice. The project is led by Prof Bernadette McSherry of the Melbourne Social Equity Institute. Following a national survey conducted in May 2014 a final report will be presented to the commission in August 2014. National Mental Health Commission The National Mental Health Commission (NMHC) is an Australian government executive agency established in 2012 to provide independent reports to community and government on mental health services | for Mental Health), and National Day Without Stigma (Active Minds). Mental Illness Awareness Week Mental Illness Awareness Week (MIAW) (also known as Mental Health Awareness Week) was established in 1990 by the U.S. Congress in recognition of efforts by the National Alliance on Mental Illness (NAMI) to educate and increase awareness about mental illness. It takes place every year during the first full week of October. During this week, mental health advocates and organizations across the U.S. join to sponsor events to promote community outreach and public education concerning mental illnesses such as major depressive disorder, bipolar disorder, and schizophrenia. | What is a mental disorder? | These findings raise important questions about im-proving access to mental health care for older veterans with mood disor-ders. The VA Palo Alto Health Care System (VAPAHCS) Geriatric Re-search Education and Clinical Center (GRECC) fulfills one GRECC mis-sion of carrying out transformative clinical demonstration projects by developing programs to address geri-atric mood disorders.The VHA has successfully imple-mented the nationwide integration of mental health management into primary care settings. To design and implement these programs locally, in 2007, all VHAs were invited to submit proposals related to mental health primary care integration. Local sites were given flexibility in their use of different evidence-based models for delivery of this integrated care. | What good is a mental health certificate? | There was a post on TIL (most likely within this year) about how a country had mental care so good that they even provided it for cats and dogs. I'm pretty sure the country was Ireland, or some country starting with I. | 183 | An Independent Mental Capacity Advocate (IMCA) is an advocate appointed to act on your behalf if you lack capacity to make certain decisions. | Toward a Value-Sensitive Absorptive Capacity Framework: Navigating Intervalue and Intravalue Conflicts to Answer the Societal Call for Health | In matters of policy, many scientists view “advocacy” as a dangerous word. In peer-reviewed literature, many scientists practice a subtler form of advocacy in pushing their methods, results, and conclusions. Call this IMRAD (Introduction, Methods, Results, and Discussion) advocacy: Once bold claims about a poorly tested method or weak result are published, their sins are forgiven and they can be worked into future introductions and discussions at will. IMRAD advocates often stretch available data, gloss over uncertainties in their evidence, and ignore contrary results. ::: ::: This occurs throughout the hierarchy of journals. One would hope that it would be least common in prestigious journals. On the other hand, top journals have limited space; they emphasize papers with broad, seemingly decisive conclusions but passively encourage readers not to worry about methods (or rebuttals). Often, this form of advocacy is obvious only to the small percentage of any journal's readers that have scientific expertise in a specialized area—a small pool of appropriate reviewers ([1][1]). ::: ::: As with policy advocacy, there is a gray area between objective justification and flagrant, half-supported promotion. Somewhere in the middle sits the honest, often acrimonious debate necessary for scientific progress. Would anyone disagree that publishing overly liberal conclusions is poor science, that the personal rewards of doing so far outweigh risks, or that the peer-review process should strip papers of this garbage? Humiliation could assist rebuttals and time in the self-correcting process of science. For example, each professional society should survey members at year's end to decide on the five papers in their field with the most overly inflated claims. The authors, approving reviewers, and subject editors could receive suitable prizes. ::: ::: 1. 1.[↵][2]1. R. Hilborn ::: , Fisheries 31, 554 (2006). ::: [OpenUrl][3] ::: ::: [1]: #ref-1 ::: [2]: #xref-ref-1-1 "View reference 1. in text" ::: [3]: {openurl}?query=rft.jtitle%253DFisheries%26rft.volume%253D31%26rft.spage%253D554%26rft.genre%253Darticle%26rft_val_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Ajournal%26ctx_ver%253DZ39.88-2004%26url_ver%253DZ39.88-2004%26url_ctx_fmt%253Dinfo%253Aofi%252Ffmt%253Akev%253Amtx%253Actx | what is the profession of the guy in the advocate | the ability of an ego to control impulses is based on the capacity to tolerate | As utility calculus cannot account for an important part of agents' behaviour in Multi-Agent Systems, researchers have progressively adopted a more normative approach. Unfortunately, social laws have turned out to be too restrictive in real-life domains where autonomous agents' activity cannot be completely specified in advance. It seems that a halfway concept between anarchic and off-line constrained interaction is needed. We think that the concept of right suits this idea. Rights improve coordination and facilitate social action in Multi-Agent domains. Rights allow the agents enough freedom, and at the same time constrain them (prohibiting specific actions). Besides, rights can be understood as the basic concept underneath open normative systems where the agents reason about the code they must abide by. Typically, in such systems this code is underspecified. On the other hand, the agents might not have complete knowledge about the rules governing their interaction. Conflict situations arise, thus, when the agents have different points of view as to how to apply the code. We have extended Parsons's et al. argumentation protocol (Parsons et al. 1998a, b) to normative systems to deal with this problem. | The Diverse Functions of Advocacy and the Implications for All ACC Members | Do you discriminate? An internal self-assessment tool. | Implied Competence, Task Complexity, and Imitative Behavior |
184 | Why change fails: knowledge counts | Taxonomies play an increasingly role in knowledge management, providing the basis on which to find and communicate knowledge, information and metrics. However, knowledge continues to evolve over time. As a result, taxonomies also need to continue to evolve. ::: ::: Two different evolved versions of a taxonomy for best practices, each based on the same original taxonomy were analyzed. This research investigated empirical approaches to trace the changes in the original taxonomy. In so doing, an approach using empirical findings to monitoring and anticipating taxonomy change is initiated. There were a number of findings, including a tendency to evolve to greater complexity. | Knowledge is power.
While some power will always be abused, good Information is always important to have. | Pressures to enhance productivity and to meet changing business needs in a knowledge-based economy are increasingly driving home the need to upgrade the skills of low-qualified workers. At the same time, governments are realising that very little is in place to tackle this challenge. | In this article we describe an integrated view of Change Management (CM) for the pharmaceutical organizations: a powerful concept for the users dealing with change. We present a clear approach that defines the change management framework and provides an efficient means of tracking changes to new and existing systems, applications, and environments within the organization. We argue that change management in information systems enables centralized documentation of the completed changes, establishes responsibility and authority, and closely controls the developmental and/or validation environment prior to production phase. We believe that a clear understanding on change management is necessary to ensure that all changes are validated through a planned approach and to assure all concerned systems, applications and environments remain stable and secure. | Systems change work can relate to electoral politics engagement, unionizing your workplace, planning a protest or rally, or any number of other interventions beyond the therapy room. | Change management ability to manage and adapt to organizational change is an essential ability required in the workplace today. Yet, major and rapid organizational change is profoundly difficult because the structure, culture, and routines of organizations often reflect a persistent and difficult-to-remove "imprint" of past periods, which are resistant to radical change even as the current environment of the organization changes rapidly. Due to the growth of technology, modern organizational change is largely motivated by exterior innovations rather than internal factors. When these developments occur, the organizations that adapt quickest create a competitive advantage for themselves, while the companies that refuse to | Learning transfer – validation of the learning transfer system inventory in Portugal | Most change implementation efforts focus on the initial acquisition-of-skill phase with little attention to maintaining skills in use of a new system. This article looks at the maintenance phases in implementing a new system, using a changeover to problem-oriented recording as an example. Through this illustration, the essential elements for maintaining a high level of performance of a new skill are presented. | 184 | Purpose – This paper aims to examine the relationship between managers' understanding of a specific organizational change process and their attitudes towards implementing the change.Design/methodology/approach – After a review of the current literature on the link between organizational change, knowledge of the change, and attitudes towards implementing the change, limited research was found that examined the relationship between knowledge of change and resistance to change. Then original empirical research was conducted by administering a survey to 296 managers from the Botswana Government.Findings – The results of the regression models suggest that managers who understand the change effort are more likely to be less resistant to change. Specifically, the more a manager understood the change, the more likely they were to be excited about the change, the less likely that they would think the change effort would fail, and the less likely they were to state that they wished their organization had never impl... | Purpose – The purpose of this paper is to cite resistance to change as a significant reason why productivity initiatives fail. Therefore, effectively managing and overcoming resistance to change is a critical factor for the successful outcome of any intervention. This paper explores current knowledge of resistance to change and seeks to review the literature and so understand what methods can be used to manage change initiatives. Design/methodology/approach – An extensive literature review has identified theories, frameworks and methodologies to successfully manage and overcome resistance to organisational change. Findings – Managing and overcoming opposition to change starts by assessing the types of resistance; and this classification will form the basis for the development of an implementation strategy to reduce resistance. This includes creating readiness and urgency for change, creating a vision for change, having employees participate in the change effort, training and coaching employees, effectivel... | CHANGE MANAGEMENT AND ITS EFFECTS ON ORGANIZATION | Purpose:Commonly, employees' resistance to innovation is one of the main barriers to innovative change and one of the negative stimuli of employment relationships in the health-care institutions. Identifying the reasons of resistance is a topical issue for every organization, as the speed of change always affect their competitiveness. Aim of the study is to develop a methodology, which would facilitate the choice of an appropriate strategy necessary to enable the health-care organizations to eliminate or at least to reduce resistance to often essential innovative changes. Methods: The model was formed on the basis of the empirical research as a result of voluntary survey. The new approach manifests itself in original solutions by applying the method of quantitative modeling. This method is designed to calculate the strength of the resistance impact to innovation. A total of 217 employees were interviewed in two of the most innovative public Lithuanian primary health-care clinics (Vilnius and Kaunas university clinics). Results: Using a mathematical approach, the causes of change resistance were ranked and the suggested respective strategies were represented graphically and expressed in the form of a model. Its use will enhance the innovation capacity of the organization by avoiding or mitigating staff resistance. Conclusion: Based on aggregate information from numerous sources, the article pinpoints the causes and briefly reviews possible ways to eliminate resistance to innovation. Suggested methodology is based on quantitative modeling method. Such use of modeling methodology can help the administrators of health-care institutions to eliminate causes of staff resistance for change, and such circumstances will accelerate innovation development. The article reviews the strategies for resistance elimination and assigns them to each specific cause. | Strategic orientation in change management and using it when designing a company’s development | EXPLAINING DEVELOPMENT AND CHANGE IN ORGANIZATIONS. | This paper builds upon work already completed by the authors on the nature of the link between internal communication and the successful implementation of change management programmes in Northern Ireland companies. During 1999 and 2000 the theoretical foundation in the requisite areas of this study was completed. Then in the latter half of 2000 and the early months of 2001 the pilot phase of the research was undertaken. The purpose of this paper is therefore to contextualise and relay the findings of the study thus far. | Linking theory to practice: A theory of change model of the Natural Resources Leadership Institute | Managing change: Evaluating organizational development interventions at GIBB Eastern Africa |
185 | If you have a joint account with someone and they whip you out, is there legally anything you can do? (NY) | Can a collection agency freeze joint account? | Can you divorce someone in prison? | Can florida extradite people from new york who are on misdamenor probation? | How do you file legal seperation? | Friend got divorced 5 years ago. Found out she was taken off joint account but left on an America first credit card. Found out 6 months ago about card. 1700 of 2000 taken out by him and she froze the account so he cant use it after trying to get him to take her off. He's now letting it go to collections. America first stated to just pay it and be done with it (bs because that's what he wants). They also stated they'll go after both accounts for assets. She is planning on taking him to divorce court and amend the decree showing he failed to separated finances and make him liable to pay it. Anything I'm missing? Is there an easier way? | My friend got arrested and his bail is 15,000. Apparently he needs a co-sign on the bail, but if for any reason he messes this up I don't want to be financially responsible for anything. Thanks for helping | Is spanking ileagel in new york? | My mother in law lived with her sister for several months and had paid her DirectTV account multiple times and so that put her debit card on file. After moving away from her sister she let the account go under and out of no where my mother in law was charged $500. DirectTV claims because my mother in law lived at the address and paid the bill multiple times that they have every right to charge her despite the fact the account was not even in her name. How true is this and is there anything she can do? | 185 | Side note: In one of my classes, we were talking about what happens in a divorce proceeding. My professor (who's a lawyer) mentioned that you will probably run into some issues if you share a bank account because it shows that it was something that was intended to be shared. If someone were to theoretically do something shady to a shared bank account, what can be done? Regardless if you're married or not.
Edit: Interesting info. I'd like to also note that class has been over for a long time (good eye I guess). | Married, merging bank accounts and finances | (Texas, USA) Could a person pursue a criminal claim against their spouse for transferring money out of a bank account in only their name, even if they provided said account information to their spouse? | My [27 M] wife [26 F] and I are trying to figure out if we want a joint bank account or separate account. Help us out? | Can you remove your self from a joint checking account? | [Budgeting] Shared Expenses With Spouse | Can one person take another off a credit union joint account? | when does a bank cannot exercise its rights to combine accounts | Using raiz without sharing bank login? |
186 | Peeps with Revision Village Gold - anyone got the N18 Prediction papers? | anyone taken paper 22 for igcse math pls pls pls say the topics that came | Hello, does anyone have the mark scheme of paper 4 IGCSE 0625 Feb/March 2021? Thank you:) | Where can I get the CAT 2015 question paper? | This guide supports PUBA 4410 Policy Analysis (Professor Richard Nafziger) for Winter 2016. | GCF for 1386 and 2058? | I have a math unit test tomorrow and I desperately require past paper questions . Does anyone have a Revision Village Gold Membership? I would highly appreciate if you could share it with me. If not, is it possible for you to share any websites that provide organized and topic wise questions (other than ibdocuments.com).
Thank you so much. |
Enkronos has obtained another wonderful review, this time on the spreadsheet by the famous ZAZ crypto-analyst, with an amazing 89,5&#37;.
You can see the spreadsheet in #gid=228527937 | Does anyone have the mark schemes for the 2014 further mathematics papers?
It would be much appreciated if they could post them! | 186 | Just got an email saying the RV Gold November 2018 prediction papers were out, but I, sadly, am a lowly RV Free pleb.
Anyone willing to share the paper? (specifically the SL if anyone's got it)
Also all of y'all are great. Hope everyone's doing okay <3 | Paper Soldiers Series Now Available as PDF Downloads | Free clutch is not available...and no print magazine either after 4 weeks...just the "free" access on line | Prediction for Gold Pack 2 Release Date | Congratulations 💥 SILVERBACKS 💥 with 59.000 subs. | ♊ Monthly Forecast for Gemini Season ♊ Free For Gemini ♊ | My thanks to the Litecoin community. | Be careful! Random dead altcoins running 100% today whilst increasing odds for Bitcoin volatility is enough for me to realize the gains and wait to see how things develop from here | BRIEF-Neowiz Games to dispose treasury shares for 100 mln won |
187 | what's the population of eagle crest resort | Temple Crest Temple Crest is a neighborhood and district located in northeastern part of Tampa, Florida. The population was 8,621 at the 2000 census. Temple Crest boundaries include 30th Street to the west, Temple Terrace to the east, Busch Blvd. to the north, and the Hillsborough River to the south. Nearby attractions include Busch Gardens, a theme-park located immediately north of the neighborhood, and the University of South Florida, whose campus is located less than two miles (3 km) to the north. "Source: Temple Crest Temple Crest was part of a property called the Riverhills Ranch. Assembled through 1916 by | March 2012, "The Weekend West" reported that the cost of a West Coast Eagles adult club membership was $283, the most of any club in the AFL. The current waiting list for family memberships is over 9,000 people, with a total waiting list in excess of 20,000 people, or around four years. As of July 2015, the club reached a record high of over 60,000 members. It remains the club with the highest number of members in Western Australia, as well as being the 6th highest in the league. With the advent of the new Optus stadium in 2017 at | seen on San Salvador. Today, thanks to its many sandy beaches, the island's prosperous main industry is tourism. About 940 people reside on San Salvador Island and its principal community is Cockburn Town, the seat of local government. The town has a population of 271. A Club Med resort, called "Columbus Isle", is located just north of Cockburn Town. Nearby is the Pleistocene Cockburn Town Fossil Reef. Fossilized Staghorn coral ("Acropora cervicornis"), and Elkhorn coral ("Acropora palmata") are present near the crest of the fossil reef, and other corals, such as "Montastraea", "Diploria", and "Porites," are preserved. The Gerace Research | How many seats are there in the eagles staduim? | of $22,574 versus $15,455 for females. The per capita income for the CDP was $4,995. About 57.1% of families and 62.1% of the population were below the poverty line, including 70.1% of those under age 18 and 74.1% of those age 65 or over. As of 2000, English as a first language was spoken by 59.21% of all residents, while French Creole accounted for 25.84% and Spanish was the mother tongue for 14.94% of the population. Crestwood Middle, Belle Glade High Belle Glade Camp, Florida Belle Glade Camp was a census-designated place (CDP) in Palm Beach County, Florida, United States. | public/private partnership with the former Bank Atlantic Center, now BB&T Center - include fireworks and live music. 'Woodstock. This annual event features hand-made crafts from local artists. Held the first weekend in December, it is a popular event and also features local musical talents, among other entertainment. Sunrise, Florida Sunrise is a city in central-western Broward County, Florida, United States, in the Miami metropolitan area. It was incorporated in 1961 by Norman Johnson – a developer whose Upside-Down House attracted buyers to what was then a remote area. As of the 2010 census, the city had a total population of | Gulf Shore, Nova Scotia Gulf Shore is a community in Cumberland County, Nova Scotia, Canada. The Gulf Shore is home to many cottages due to its warm water beaches and lovely view of Prince Edward Island . Due to the large number of cottages, the population fluctuates dramatically winter to summer, with only a few year-round residents. The main employment is in agriculture and tourism. The Gulf Shore is the location for the Northumberland Links Golf Course. The Gulf Shore was once home to a one-room school house (demolished in the 1980s), and Melville United Church (demolished in the late | Jay Peak Resort capital improvements for the resort over the next few years. The resort company raised $250 million for improvements in 2009–2010, from 250 investors from 43 companies through the incentive of the federal EB-5 visa. Under this visa, every $500,000 invested in the U.S. that results in ten new jobs gains the investor permanent residence. A three-way swap was made with the State of Vermont in 2010. The State deeded to the resort; the resort relinquished its lease to a parcel of nearby undeveloped forest back to the state; and the resort sold to the Green Mountain Club to ensure that | 187 | Eagle Crest Resort Eagle Crest Resort is a destination resort complex in the U.S. state of Oregon. The resort has a large hotel, a conference center, three golf courses, and three major housing developments each with multiple subdivisions. The resort is located west of Redmond in Central Oregon. The development covers on the east slopes of Cline Buttes running eastward to the Deschutes River plus a separate area on the northwest side of the butte. The resort and the area around it is classified as the Eagle Crest census-designated place (CDP) and had a residential population of 1,696 at the | what was the population of eagle county colorado | what's the population of north eagle butte | eagle nest lake is in which us state | Eagles Rest Peak | how high is eagle mountain on lake superior | what is eagle mountain part of in canada | where did west coast eagles finish in 2014 | where do the brockport golden eagles play |
188 | The same we can see our own ranked elo, could we please see our casual elo? | I personally play ranked too win, but I have a few friends who are casual players and the only reason they play ranked is to get gold guns. I dont think this would work at higher elos as you get less casual players, but maybe for lower elos. | what i mean by this is making another account and purposely lowering my elo super low so that when i play with friends, their elo will increase more per win. for those who don't know. the elo system works as an average of your teams elo against the enemies average. This means if you beat a team that has a way higher average elo than your team, you will increase at a higher percentage than if their elo was about the same as your team.
I'm thinking there shouldn't be a problem as for the most part, nobody is getting screwed. the teams i play against while i lose are getting free wins and the teams i win against with my friends are randomly picked anyway regardless of what destinytrialsreport shows for elo. | Why would someone give free elo if he is not a smurf dissipating extra elo?
I know some people who set elo bounds to the games they host, even though their elo is more than the bound they themselves set! We all like winning, but not all games are meant to be won. If your elo is too high for your gameplay, play with someone around that rank and lose the game, rather than offering free elo. Feel free to resign early if you think the opponent is overwhelming, but at least try.
Finally, prefer not to join games if the elo of the host exceeds the bound he set and never ever accept free elo. If you are too low for your rank, you are about to have a winning streak! | i have 500+ matches played on NA servers, I’d like to hit my desired rank but when i only get 5 or 6 elo a game it makes me wanna play the game less. I know 10 elo may seem like a lot but i get annoyed of seeing constant 5-6 elo gain and then lose 10-20.
Also pls make the elo gain difference more stretched out :) id like to not be getting 20 elo automatically after 70 games played :) | I heard a rumor from a friend that if you don't let the other team score at least 3 points, that the game does not count towards your elo rank, can anyone please confirm this or disprove? | Logged in after servers coming back up when it was down for 10+ hours to see all my stats including normals reset to 0, went into a ranked game and asked what elo it was and it was 1200s and checked their stats on statistic sites AMA.
I'll thank Riot more if they let me rank this elo range and then if they end up fixing it they should just add the elo I gained to my existing elo so I can randomly become 2.4k
EDIT: Wonder if they're placement matches too would be nice to just hit 2k+ with 20 wins. | So if you go to match under brawl you can see that there is an elo system like in rank i just noticed that shit i was like tf is this man elo?brawl? | This is on the sports side of the site, not the politics side. Their version of Elo takes into account factors like home-field advantage, travel time, and rest days. It's pretty interesting reading if you're a fan of stats and numbers as well as baseball.
| 188 | I play a lot of casual conquest, and dislike ranked for the most part.
I would like to know about my casual elo.
Thank you for reading. | Casual is not casual at all and should be called Unranked. There should be a real casual mode that doesn't give you any rewards | Picks and Bans for Conquest Casual? | Casual is not the same place anymore | New Game Mode Idea: Casual Ranked | Do you lose as much elo/mmr when a teammate abandons? | Honestly if you are complaining about playing with higher elo players why are you even playing ranked? | How does Dota balance around the top level but still keeps the interests of casuals? | Season1: 1400~ Elo - S2: 1700 Elo ~ - I'll help you with any questions regarding ranked :) AMA |
189 | kabira is the ending song of which movie | Kabira (song) "Kabira" is a Hindi song from the 2013 Bollywood film, "Yeh Jawaani Hai Deewani". Composed by Pritam Chakraborty, the song is sung by Rekha Bhardwaj and Tochi Raina, with lyrics by Amitabh Bhattacharya. The music video of the track mainly focuses on actors Ranbir Kapoor, Deepika Padukone and Kalki Koechlin. A encore version of the same song was released as part of the film soundtrack, which was rendered by Arijit Singh and Harshdeep Kaur. The song is composed by Pritam. The song is a soothing melody with a Sufi touch to it, in a mix of rustic and | Kajarya Kajarya is a 2015 Indian Bollywood docu-drama film directed by Madhureeta Anand. "Kajarya" explores the issue of female infanticide, and was released commercially in India on 4 December 2015 to rave reviews and good audience reception. The film is co-produced by Bengali director Qaushiq Mukherjee popularly known as Q, Starfire movies and Madhureeta Anand’s company Ekaa Films. The film is shot in Haryana. It is a feature film that deals with the pertinent topic of sex selection in India. It is a thriller about two women - The first is Kajarya played by Meena Hooda, a woman who lives | Karsh Kale a two-year collaboration with sitar instrumentalist Anoushka Shankar. In 2011, Kale released "Cinema", which is influenced by Kale's experiences in composing for Bollywood. He also won GIMA Awards best fusion album for the same, beating A.R.Rahman. Kale has composed for crossover and Bollywood films including Chutney Popcorn, Indian Cowboy, Ocean of Pearls, and Pyaar Impossible!. His tracks have also been featured in shows such as HBO's True Blood and Real Time with Bill Maher. Two of his songs were included in as sample music in Windows Vista by Microsoft. Kale's songwriting credits include songs with Sting and Norah Jones, and | Karsh Kale a two-year collaboration with sitar instrumentalist Anoushka Shankar. In 2011, Kale released "Cinema", which is influenced by Kale's experiences in composing for Bollywood. He also won GIMA Awards best fusion album for the same, beating A.R.Rahman. Kale has composed for crossover and Bollywood films including Chutney Popcorn, Indian Cowboy, Ocean of Pearls, and Pyaar Impossible!. His tracks have also been featured in shows such as HBO's True Blood and Real Time with Bill Maher. Two of his songs were included in as sample music in Windows Vista by Microsoft. Kale's songwriting credits include songs with Sting and Norah Jones, and | is the only male singer in the movie who sang with the three Mangeshkar sisters concurrently. (Lata, Asha and Usha) The Macho man Dharmendra usually prefers Mohd. Rafi to sing for him in movies. The film was Super Hit during its release. Kartavya (1979 film) Kartavya is a 1979 Indian Hindi language film directed by Mohan Sehgal. The music in the film is composed by Laxmikant Pyarelal. The film stars Rekha on the lookout for her father's killer, and has Dharmendra as a forest officer. The villain in chief is Utpal Dutt. Aruna Irani, Ranjeet, Nirupa Roy and Suresh Oberoi | Aamayum Muyalum of the film is handled by Divakar Mani and the editing is done by Aiyappan Nair MS. The soundtrack consists of 5 songs composed by M. G. Sreekumar, all which have a rural and folk theme. The item number song "Kaanakombile..", is penned by Priyadarshan. The song has two versions by Rimi Tomy and composer M. G. Sreekumar. The song "Kukukukoo" is in "Maaya Malawa Gowla" ragam, crooned by Nayana and M. G. Sreekumar. ""Ponninkilukkam" song surprises, as traditional music strips mix in brilliantly with a new age feel and beats. Energy wise, it's the best song in the album". | Karyn Kusama American theatrical rights for the film have been acquired by Annapurna Pictures, with a release set for December 2018. Kusama's films have been noted for their strong feminist themes, and with the exception of "The Invitation", all her films have featured female protagonists. Her protagonists are often flawed, with the filmmaker citing an interest in ambiguity and difficulty in characters. Kusama has described herself as a "feminist apologetically" and has criticized the barriers that women face in the film industry. In addition to themes of feminism, Kusama has also explored existential themes such as loss, despair, and anxiety in her | few people dividing the masses to play with their vested interest. KABIR unfolds the eternal message of peace and coexistence. Kabir (film) Kabir (2018) is an Indian Bengali-language thriller film, directed by Aniket Chattopadhyay, starring Dev and Rukmini Maitra which released on 13 April 2018. The storyline of the flim is based on apprehension of co-founder of Indian Mujahideen and conspirator of several bomb blasts in India, Yasin Bhatkal, by National Investigation Agency near Indo-Nepal border. The story of the film begins with a few bomb blasts in Mumbai. A burkha clad lady, Yasmin aged in between 22/23 years took | 189 | the song as his ending act during the concert he held in the parking lot of Inorbit Mall in Malad, on 19 December 2014 and the concert at Emaar Boulder Hills in the city on 27 December 2014. Apart from the vocalists of the song, it was performed by Deepika Padukone in her act from 20th Annual Life OK Screen Awards, along with "Titli", "Nagada Sang Dhol" and "Ang Lagade". Listen online Kabira song Kabira (song) "Kabira" is a Hindi song from the 2013 Bollywood film, "Yeh Jawaani Hai Deewani". Composed by Pritam Chakraborty, the song is sung by Rekha | who wrote the song kabira from yeh jawaani hai deew | how many units of kabhi khushi kabhie gham soundtrack sold | what instrument is used in kabir padavali song | pyar kiya to darna kya is a folk song from which state | which song did swarnalatha sing in the movie karuththamma | who composed the music for kabhi kabhi kabhi kabhi | who sang the song kadhalikka neramillai in 2007 | who sang the song bombai ka babu |
190 | The Reasons, Shortcomings and Implementation of the Policy of Transferring Creditors Rights into Shareholders Equity | The production and development of the company creditors protect system has the profound le- gal reason,which has been paid much attention in the world.It not only relates to the company creditor' s benefit,but also involves the entire social market transaction order and the market credit and the secu- rity.This article researches the origination of the company creditors protect system,stipulation of the previous corporation law,and the existent flaw as well as the new corporation law. | Since the 19th century,with the development of credit economy,the retention of the ownership has been widely used.The nature of the ownership retention directly affects the rights and obligations of the clients concerned.There are mainly several different theories as for the legal nature of the retention of the ownership: partial transfer of ownership,special ownership for security and dual ownership.The author suggests that the retention of the ownership should be a civil juristic act with suspensive conditions and thus proposes the system designs of the ownership retention. | What is creditors holding unsecured non priority claims? | General assignment bankrupt company's assets, thus adding time and expense on to the entire liquidation process. The assets sold in an assignment for the benefit of creditor process do not usually require a judge's intervention. It is this removal of the court from the liquidation process which increases the speed of the assets sold in an assignment process. This is one substantial difference from a regular bankruptcy. Secured and unsecured creditors constitute the creditor body. Both secured and unsecured creditors are ahead of shareholders as noted earlier. A secured creditor is a creditor, who has a priority claim on an asset or | Implementation of Credit Restructuring Provisions for Debtors of Non-Performing Loans in Bank Credits | United Kingdom company law also precluded from giving financial assistance for purchase of their shares, for example through a leveraged buyout, unless the company is delisted and or taken private. Finally, in order to protect investors from being placed at an unfair disadvantage, people inside a company are under a strict duty to not trade on any information that could affect a company's share price for their own benefit. Companies limited by shares also acquire finance through ‘equity’ (a synonym for the share capital). Shares differ from debt in that shareholders rank last in insolvency. The main justification for shareholders’ residual claim is that, | Short-term creditors are usually most interested in? | Company directors are treated as fiduciaries1 and as such must not permit their personal interests and their duty to the company to conflict. In order to avoid such conflicts or potential conflicts arising, transactions between a company and its directors are restricted. Such transactions are regulated in a number of ways, in particular, by means of statutory prohibition, corporate approval and disclosure in the statutory accounts. In this chapter, attention is focused on the Companies Act requirements for disclosure in a company’s financial statements of transactions involving directors (except for those relating to directors’ remuneration which are dealt with in Chapter 26). The provisions determining the legality or otherwise of such transactions are discussed in outline in the Appendix to this chapter. | 190 | With the enforcement of the policy of transferring creditors rights into shareholder's equity, its shortcomings in design were increasingly revealed. In order to ensure that the reform of the state - owned enterprises went on smoothly, the author thought that; it is necessary to regard the act of transferring creditors rights into shareholder's equity as financial aid; it is necessary to combine the transfer of creditors rights into shareholders equity by changing the business operating mechanism ; it is necessary to transform AMC into subsidiaries of banks at anearly date. | Accounting Standards for Business Enterprises No. 12—Debt Restructuring | The choice between corporate and structured financing: evidence from new corporate borrowings | DEBT-EQUITY CONVERSION AND PORT PRIVATIZATION. | Successful Corporate Turnarounds A Guide For Board Members Financial Managers Financial Institutions And Other Creditors | Effective Protection of Creditors’ Interests in Private Companies: Obligatory Minimum Capital Rules Versus Contractual and Other Ex Post Mechanisms | DEBTS RE-COMPOSITION IN THE NEW ACCOUNTING SYSTEM | Debt Covenants and Cross-Sectional Equity Returns | which state recognizes a de facto merger when a corporation misapplies the sale of assets |
191 | After half a decade of Eye Doctors telling me that the problem in my eyes was probably nothing, I've been diagnosed with Keratoconus in both eyes. | Keratoconus is found in conjunction with many ocular and nonocular disorders. We describe five patients with concurrent keratoconus and corneal endothelial dystrophy. | Keratoconus is known to be associated with a variety of ocular and systemic disorders. The common posterior segment disorders known to be associated with keratoconus are retinitis pigmentosa, macular coloboma, Leber’s congenital amaurosis, retinal aplasia and retrolental fibroplasias. Occurrences of keratoconus in association with tapetoretinal degeneration is rare and has been reported infrequently. Visualization of the fundus is often difficult in cases of keratoconus due to the associated refractive error and corneal opacities. This may make it difficult for the ophthalmologist to clinically diagnose associated macular degenerative changes preoperatively. We report a case of keratoconus who was diagnosed to have cone-rod dystrophy following successful corneal transplantation. | In a survey of 162 keratoconus patients, we set out to investigate individual conditions, such as asthma, hay fever, connective tissue syndromes, and eye rubbing, and to determine their relationship of keratoconus. It was found that the prevalence of asthma rises from 0.4% to 1% in the control group to 17.9% in the keratoconus group, or an eighteenfold increase. In addition, the incidence of hay fever in keratoconus patients was found to be 35.7%. As multifactorial disorders, keratoconus and asthma may share some of the multiple genes necessary for the expression of the disorder. Previous findings of excessive eye rubbing in keratoconus patients were confirmed in this study. Finally, we found that the incidence of connective tissue disorders associated with keratoconus was negligible. | I'm a 19 year old male suffering from Keratoconus. Here's my story:
At the age of 15 i realized my sight was not quite as good as everyone elses and it was getting worse. I saw a local optometrist who diagnosed me with "mild astigmatism" and showed me how much glasses would improve my vision. But as an angsty teen i refused to be made to wear glasses, so we didn't buy any.
About two years later, my vision started to deteriorate significantly and rapidly, so i went and saw a more competent optometrist. I was then told that i had a disease. Keratoconus.
He told me all about it and the treatments available. However, when i got home i made the mistake of researching Keratoconus online by myself, and i broke down. It took me some time to come to terms with it. I then was fitted with hard contact lenses, which i struggled with, never making it more then 7 hours at the very most. And going to school became unpleasant and i became very introverted.
We then heard about a treatment called cross-linking, which made me optimistic. I commenced the treatment about 18 months ago in one eye, i was very nervous, but the actual procedure wasn't painful or uncomfortable. The next few days though were hell, i usually have a high pain tolerance, but the pain was intense and i barely slept, even with all the medication, which seemingly barely affected me. However i was relieved to find that the treatment went well and i got the second eye done soon after. this time it wasnt as bad of a recovery and after a few weeks i felt good, and even noticed a slight improvement in vision (although this may have been a mental thing). I continued to wear contacts for a while after, but then that turned into only wearing them to drive, and now i never wear them, as it is too uncomfortable and makes me irritable and depressed. I'm nervous about the future, but am thankful that i still have my sight,and am still able to function (albeit dangerously if i'm driving), even if i am often the punchline of a joke when looking at things at a distance. The plus side of keratoconus is all girls skin looks flawless with or without makeup :D
Would love to know if there are any other sufferers on reddit and hear your stories or just have a general discussion about keratoconus.
THANKS | PURPOSE ::: To describe higher order ocular aberrations in eyes with keratoconus. ::: ::: ::: METHODS ::: Prospective, observational, case-control study comparing higher order ocular aberrations in patients with keratoconus with control subjects with myopia. ::: ::: ::: RESULTS ::: One hundred sixteen patients with keratoconus were recruited. Data were analyzed in 35 keratoconus eyes, 38 keratoconus suspect eyes, and 166 right eyes with myopia. Mean total higher order root-mean-square (RMS) values (3rd to 5th order) were 1.73 +/- 0.71 microm in eyes with keratoconus, 0.94 +/- 0.66 microm in eyes with keratoconus suspect, and 0.49 +/- 0.16 microm in control eyes. Keratoconus eyes had greater total higher order RMS, 3rd to 5th order RMS, and RMS for all Zernike terms than those in the control group (P < .001). ::: ::: ::: CONCLUSIONS ::: Keratoconus and keratoconus suspect eyes had significantly larger higher order aberrations in total higher order RMS and 3rd order RMS than control eyes. | Hey all! So I ended up getting Epi-On CXL in both eyes and also had CK (Conductive Keratoplasty) in my right eye.
Got a few questions if anyone can help answer!
I got the CK on my right eye on Tuesday and CXL in both eyes on Wednesday of last week.
1) When am I able to splash water into my eyes?
Ex. washing my face or if water splashes in eyes when showering.
2) I was taking two eye drops after the procedures (Prednisolone & Polymyxin). As scheduled, I stopped both on Saturday night since that was the last day.
On Monday & today, I’ve been having some slight pain and awkward feeling when blinking my right eye which had the CK and CXL. Felt almost like something was in my eye every time I blinked.
Called the DR office today and was told to take “Prednisolone” again for the next 3 days and also that it may be caused by dry eyes.... but I’ve already been taking something for dry eyes and it was still there.
Surprisingly, that blinking pain went away after taking Prednisolone eye drops.
Anyone know what caused this? Or any idea regarding this? I’m just not sure how the Prednisolone drops have helped and what was causing it.
Thank you! Also AMA regarding my epi-on procedure or anything else! | I have severe filamentary keratitis. Basically, you get these long mucousy strings in your eyes, all day, every day. I am constantly pulling them out! From what I understand, my eyes dont produce enough tears to wash away dead corneal cells, and they get strung together. Some weeks I think I'm going crazy. I probably use eye drops 15-30 times a day and I always am sticking a q-tip in my eye to get them out.
However, everything I read online says that treatment basically consists of moisture drops....which I am already doing.
Just wondering if anyone else experiences this. | ABSTRACTBackground: Ocular surface and corneal involvement in tuberculosis is seldom seen. We report a patient of pulmonary and presumed ocular tuberculosis with immune keratitis along with corneal... | 191 | Relieved to finally get a diagnosis and be able to address the problem, but frustrating that this could have been caught much earlier and a bit upsetting that I have another weird medical issue. I almost didn't even mention it during my most recent visit to the eye doctor but in glad I did.
Also a bit bummed since my insurance now is much worse than it was a few years ago so I'll be paying out thousands of dollars for this crosslinking that's being done in my worse eye. The other eye is mild so the doctor said he wanted to monitor it instead.
How much "better" can I expect my vision to get with these contacts that I'm eventually supposed to get?
Anything you think someone with newly diagnosed Keratoconus should know? | Got back to the doctor, found out my keratoconus has advanced, and I have to wear lenses. Considering just looking into surgery. Any advice? | Does anyone else suffer from filamentary keratitis? (strings in eyes) | Keratoconus sufferers! share your story and general keratoconus discussion. | Corneal crosslinking as treatment for progressive keratoconus | Signs and Symptoms of Dry Eye in Keratoconus Patients: A Pilot Study | A 21-year-old woman had crosslinking for keratoconus in the right eye; the left eye was scheduled for penetrating keratoplasty. Five days postoperatively, she presented with geographic epithelial keratitis and iritis. Analysis of tear samples by polymerase chain reaction confirmed the diagnosis. The patient was treated with oral steroids and acyclovir, with significant improvement. Two months postoperatively, the visual acuity was improved and there was no evidence of herpetic disease recurrence. Crosslinking can induce herpetic keratitis with iritis even in patients with no history of herpetic disease. Early diagnosis and proper treatment are essential for a favorable outcome. | A 27-year-old man presented with corneal ectasia in his left eye 4 years after myopic laser in situ keratomileusis (LASIK) and was treated with riboflavin-ultraviolet-A (crosslinking). During the first post-treatment days, diffuse lamellar keratitis (DLK) (stage III) developed. The microbiology culture was negative. After intensive treatment with topical corticosteroids, the DLK resolved during the following 2 weeks. Crosslinking for post-LASIK corneal ectasia may induce DLK. Early diagnosis and appropriate treatment with intensive topical corticosteroids is essential to successfully manage this post-crosslinking complication. | Purpose: Corneal collagen cross-linking (CXL) has become the standard initial intervention in eyes with progressive keratoconus (KC) that have not undergone keratoplasty. The prolonged exposure of the de-epithelialized cornea predisposes it to adverse complications, such as microbial keratitis and melting. Herein, we report a case of bilateral recurrent peripheral stromal keratitis following CXL. Case Report: We present a 29-year-old woman who complained of ocular redness and discomfort in both eyes for 4 months, and had undergone bilateral CXL 10 months before. The best spectacle corrected visual acuity (BSCVA) was 60/200 in the right and 80/200 in the left eye. Both eyes showed moderate conjunctival hyperemia, dilation, and engorgement of the perilimbal episcleral vessels. There was a peripheral corneal stromal infiltration with thinning, and an overlying epithelial defect in the right eye with a lucid interval from the limbus. She was treated with lubricating eye drops and ointments and topical corticosteroids every 4 hours for 2 weeks then slowly tapered off. Afterwards, she experienced multiple recurrences in both eyes, which were successfully managed with topical corticosteroids and lubricants. After 2 years, her BSCVA was 20/30 with −3.00-5.50 * 90 in the right eye and 20/40 with −4.00-4.50 * 90 in the left. Conclusion: Although CXL is a safe method, studies with longer follow-ups are needed to investigate the risk of rare complications. |
192 | It is excellent. A friend of mine has only been able ... | Very good. Have recommended it to several family and friends who also enjoyed it very much. | It's good and it took quite a bit of time to arrive. It works like how it should've, but I recommend you look up how to use it before trying yourself. | I have only used it a few times - so I really can't give it a good rating. | its good..my daughter loved it vry much,,,but not satisfied with the quality | It's a very good product. Although the user manual was written for advanced users, not for people who see it for the first time. The manual is not intuitive and information in it is scattered and not well organized. It took me some time to follow up it and simply guess some procedures. Otherwise that it's a very decent product. | Although there are some details to improve on it, it is quite good and functional.
It is highly recommended for travelers. | I have only started it, but it is very good so far. | Really like it so far. I haven't put it through any torture test nor do I. Clean sound for my half deaf ears | 192 | This is the only volume by this author that I have read. It is excellent. A friend of mine has only been able to find one other book by this author that he liked. | this book is only volume 1 | Great book! I frequently refer to this volume for ... | An excellent second volume in the Wicked Souls Saga. | This is a book I picked up on a whim and truly enjoyed. I have not read the other books in ... | I like this book since I did not find anything else ... | I think the book is a great read. I bought copies for a couple of ... | I have read and enjoyed other books by this author | There is no other book like this. If it's out there |
193 | Transient thermal modelling of an Axial Flux Permanent Magnet (AFPM) machine with model parameter optimisation using a Monte Carlo method | The rotor discs in axial flux permanent magnet (PM) machines have similar properties as a radial fan, and therefore, the convective cooling may have a significant influence on the thermal design of these machines. To research the impact of convective cooling on the thermal properties of axial flux PM machines, a coupled electromagnetic and thermal model is introduced in this paper. This technique models a segment of the stator and the rotor only and links them together by analytical equations of the convective heat transfer at different boundaries of the machine model. This results in an accurate and time efficient multiphysics model. The coupled electromagnetic and thermal modeling technique is validated with measurements on a 4 kW axial flux PM machine having the yokeless and segmented armature topology. | A novel axial flux permanent magnet (AFPM) machine with a segmented-armature torus (SAT) topology is investigated. The machine's key feature rests on a new and simple configuration of laminated stator poles, which allows high flux density similar to that of the radial flux machines to be established. A full analytical model of the proposed AFPM machine is first developed. To overcome the analytical complexity arising from the novel stator configuration, an efficient and yet realistic approximation is used. Then a three-dimensional (3-D) finite element analysis (FEA) model of a 6 kW AFPM machine is developed for the validation of the analytical model. Finally, experimental results are obtained from an AFPM prototype motor, which has been designed by the sizing equations developed in the analytical model. The results from the analytical model are then compared with those from the FEA model and the tests of the prototype motor. The validity of the analytical model and the viability of the proposed AFPM machine as a leading contender for in-wheel direct drive traction applications are then confirmed. | This paper presents a design process and a detailed multiphysics analysis of an axial-flux permanent-magnet synchronous machine for large-power direct-drive applications. The machine in this paper is 130 kW at 26 r/min with a dual-stator inner-rotor structure. A stator core that is assembled with segmented and prewound teeth is first proposed and applied in a large-power axial-flux permanent-magnet machines (AFPMs). Through this method, the challenges of manufacturing large-diameter AFPMs can be solved. A novel water-cooling system is embedded in the machine to transfer the heat. In addition, the assembling procedure and the manufacture process are also proposed, and a novel distributed follower bearing is used to reduce the deformation and stress of the rotor disk. Finally, based on the multiphysics design, a prototype machine is manufactured and tested. The experiment results match well with the finite-element analysis. | The axial flux (disc shape) permanent magnet machine is an attractive alternative to radial flux (cylindrical shape) machines in various applications. The axial flux configuration is amenable to the low-speed, high-torque operation energy system. In this project, the magnetic field distribution in a single rotor, permanent magnet, and ironless stator axial field generator in compact application is studied. The goal is to develop the analytical model for the machine by which we planned to conserve the mechanical energy which has been wasted in various applications like fans, electrical vehicles etc. | Design and identification of a lumped-parameter thermal network for permanent magnet synchronous motors based on heat transfer theory and particle swarm optimisation | This paper presents a 3D numerical analysis of the thermal transient behavior of the air-cooled interior permanent-magnet synchronous motor (IPMSM) for agricultural electric vehicle (AEV) using finite-element method (FEM). The air-cooled IPMSM is investigated the temperature variation for the insulation of winding coil and demagnetization of permanent-magnet during the rated operation. Therefore, the prediction of a motor temperature is necessary at the motor design stage. This paper shows a good agreement both the numerical calculation and experimental results. The proposed method, electromagnetic field and thermal linked analysis, is able to predict the temperature distribution of IPMSM with the rated 7.5 kW continuous power. | In this paper, the flux focusing slotted double stator and single rotor (DSSR) axial flux permanent magnet motor (AFPM) is analyzed. It has high torque density due to its inherent compact multipolar disc-type structure, which is suitable for direct-driven and in-wheel applications. Permanent magnets (PMs) are inserted in the rotor core and the stator has concentrated double layer winding. The winding arrangement is determined by the star of slot voltage method. To select the stator slots and rotor poles combination, comparative winding analysis is carried out using the winding function theory. Finally, a 3D finite element method (FEM) is utilized for the characteristic analysis of the machine. | This paper presents an optimal design method of short-time rating interior permanent magnet synchronous motor considering transient temperature rise. FEM results are used to compensate the characteristic equation for more accurate analysis. Temperature rise is calculated by using the thermal equivalent network method, and the niching genetic algorithm adopting restricted competition selection is used for optimization in the process of design. Experimental results of the optimally designed motor show good agreement with the simulation results. | 193 | This paper presents the development of a transient thermal model of the EVO Electric AFM 140 Axial Flux Permanent Magnet (AFPM) machine based on a hybrid finite difference and lumped parameter method. A maximum deviation between simulated and measured temperature of 2.4°C is recorded after using a Monte Carlo simulation to optimise model parameters representing a 53% reduction in temperature deviation. The simulated temperature deviations are lower than the measurement error on average and the thermal model is computationally simple to solve. It is thus suitable for transient temperature prediction and can be integrated with the system control loop for feed forward temperature prediction to achieve active thermal management of the system. | Aspects of temperature rise measurement and temperature protection of rotating electrical machines, with particular reference to increased safety motors and operation at variable speed | Thermal model of totally enclosed water-cooled permanent magnet synchronous machines for electric vehicle applications | Experiment and modeling on heat power of permanent-magnet synchronous motor | As the aircraft industry moving towards electrification, light-weight electrical machine design is desired to enable hybrid-electric engine technology. While minimizing machine sizing/weight, thermal management becomes more challenging in the harsh engine environment. This paper discusses various motor cooling options integrated with engine system and evaluates their impacts on electrical machine sizing and performances. Transient duty operation is also studied to learn torque boost capabilities at the takeoff stage. The usage of phase change material shows potential benefits to extend the transient time of motor peak torque operation. | Calculation Method of Transient Thermal Behavior for Turbine Blade with Thermal Barrier Coating | Analysis of electromagnetic performance of flux-switching permanent-magnet Machines by nonlinear adaptive lumped parameter magnetic circuit model | Back EMF calculations for axial-gap permanent magnet synchronous motors (AGPMSM) with disc magnets | Control strategy of a variable flux machine using AlNiCo permanent magnets |
194 | Writing for the Future: Echeverria's "El matadero" and its Secret Rewriting by Jorge Luis Borges and Adolfo Bioy Casares as "La fiesta del monstruo" | Introduction I Arthurian Material in Iberia Paloma Gracia II The Surviving Peninsular Arthurian Witnesses: A Description and an Analysis Jose Manuel Lucia Megias III Arthurian Literature in Portugal Santiago Gutierrez Garcia IV The Matiere de Bretagne in Galicia from the XIIth to the XVth Century Pilar Lorenzo Gradin V The Matiere de Bretagne in the Corona de Aragon Lourdes Soriano Robles VI The Matter of Britain and Historical Reality Carlos Alvar VII The Post-Vulgate Cycle in the Iberian Peninsula Paloma Gracia VIII The Hispanic Versions of the Lancelot en prose: Lanzarote del Lago and Lancalot Antonio Contreras IX The Iberian Tristan Texts of the Middle Ages and Renaissance Maria Luzdivina Cuesta Torre X Amadis de Gaula Rafael Ramos XI Arthur Goes Global: Arthurian Material in Hispanic and Portuguese America and Asia David Hook XII The Contemporary Return of the Matter of Britain to Iberian Letters (XIXth to XXth Centuries) Juan Miguel Zarandona | Mário de Andrade catastrophic. As Severino João Albuquerque has demonstrated, the novel presents "construction and destruction" as inseparable. It is a novel of both power (Macunaíma has all kinds of strange powers) and alienation. Even as "Macunaíma" changed the nature of Brazilian literature in an instant—Albuquerque calls it "the cornerstone text of Brazilian Modernism"—the inner conflict in the novel was a strong part of its influence. "Modernismo", as Andrade depicted it, was formally tied to the innovations of recent European literature and based on the productive meeting of cultural forces in Brazil's diverse population; but it was fiercely nationalistic, based in large part | In the continuation of our study of Antonio Candido and Eduardo Lourenco works, this article presents a brief analysis of the essays “Literatura e Cultura de 1900 a 1945” (Candido, 1950) and “Da literatura brasileira como rasura do tragico” (Lourenco, 1998). There are diverse distances between the authors and even among the selected texts, from temporal to spatial, but they eventually crossover in a comprehensive look of part of the Brazilian literature and in the culture that in itself it reveals, allowing us a comparative reflection. We highlight, in our argumentation, how Sociology and Philosophy contaminated the discourse and the critical project of each one of the authors, inclusively setting a formal difference in their essayism, without necessarily putting them in opposite orbits relatively to the gravitational force that these fragments of Brazilian literature exerted on them. | Author(s): Quiroga, Jose | Abstract: Gonzalez Echevarria, Roberto. Cuban Fiestas. New Haven: Yale University Press, 2010. | El Señor Presidente "measured in terms of its decisive historical influence," the third (Losada) edition is "easily the most important of them all". El Señor Presidente ' (Mister President""') is a 1946 novel written in Spanish by Nobel Prize-winning Guatemalan writer and diplomat Miguel Ángel Asturias (1899–1974). A landmark text in Latin American literature, explores the nature of political dictatorship and its effects on society. Asturias makes early use of a literary technique now known as magic realism. One of the most notable works of the dictator novel genre, developed from an earlier Asturias short story, written to protest social injustice in the | El Señor Presidente Asturias was the first Latin American novelist to combine stream of consciousness writing and figurative language. Hughes Davies argues that from the outset of , the gap between words and reality is exemplified through onomatopoeia, simile and repetition of phrases. Knightly notes that "animistic elements surface occasionally in the characters' stream of consciousness". For example, in the chapter "Tohil's Dance", Tohil, the God of Rain in Maya mythology, is imagined by Angel Face as arriving "riding on a river of pigeons' breasts which flowed like milk". In Angel Face's vision, Tohil demands a human sacrifice and is content only so | Roberto Bolaño stories and two essays, with the title story inspired by Argentinian author Jorge Luis Borges's short story The South, said story being mentioned in Bolaño's work. "The Secret of Evil" ("El Secreto del Mal" in Spanish) is a collection of short stories and recollections or essays. The Spanish version was published in 2007 and contains 21 pieces, 19 of which appear in the English edition, published in 2010. Several of the stories in the collection feature characters that have appeared in previous works by Bolaño, including his alter ego Arturo Belano and characters that first appeared in "Nazi Literature in | El Güegüense El Güegüense El Güegüense (; also known as Macho Ratón, ) is a satirical drama and was the first literary work of post-Columbian Nicaragua. It is regarded as one of Latin America's most distinctive colonial-era expressions and as Nicaragua's signature folkloric masterpiece combining music, dance and theater. There was also a monument built in the center of a rotonda "(roundabout)" in Managua, in its honor. El Güegüense is performed during the feast of San Sebastián in Diriamba (Carazo department) from January 17 to the 27th The theatrical play was written by an anonymous author in the 16th century, making it | 194 | Daguerreotypy, Optical Metaphors, and Visual Power in Echeverría’s "El matadero" | Epic Visions Visuality in Greek and Latin Epic and its Reception | Is art of a bull and matador controversial? | Entre el orden y la disrrupción: la escritura de Clarice Lispector en "A menor mulher do mundo" significado es desafiado sino, sobre todo, constituirse como un montaje de elementos sensibles que expresan sin necesariamente decir.Palabras claves: Clarice Lispector, "A menor mulher do mundo", la escritura de lo sensible, materialidad de la escritura, voz enunciativa.Abstract: Clarice Lispector's work has been described as postmodern, modernist, materialist, avant-garde: classifications that highlight how transgressive the language and stylistic play in her fiction has proven. Many have emphasized how her aesthetics tends to efface the limits of what can be represented, to fracture what can be said and its meaning. While this article doesn't object to the predominant critique of Lispector's work, it seeks to amplify it by focusing on the material and sensuous constitution of her writing. The analysis concentrates on "A menor mulher do mundo" to show how Lispector's writing is predicated on assembling continuities and disruptions that insist on the vacillating quality of her aesthetics. Thus, we examine four key moments in the short story in which vacillation configures her writing as a space in which meaning is no only defied, but also constituted as an assemblage of sensuous elements that express without necessarily saying.Keywords: Clarice Lispector, "A meno mulher do mundo", The writing of the sensible, The materiality of writing, Speaking voice.Recibido: 30 de octubre de 2020 Aceptado: 13 de abril de 2021 https://dx.doi.org/10. 15174/rv.v14i29.525 "L a interpelación ineludible de lo real, en el in-situ de su evidencia" (2013) representa uno de los más recientes estudios que insisten en la conexión entre la escritura de Lispector y la representación de lo real y un tipo específico de realismo social. Su Entre el orden y la disrrupción: la escritura de Clarice Lispector en "A menor mulher do mundo" la locura" (1998) en el cual acertada y elocuentemente concluye el crítico puertorriqueño:La condición de la autoridad de la palabra del testigo, la iluminada, radica, pareciera, en el gesto autoreflexivo que indica en el cuerpo propio cómo el fulgor del extravío, en la catástrofe, le quemó la vista y le marcó la piel.[…] Otros no regresan, ni devuelven la mirada, ni entran en el intercambio de dones que implica el traslado metafórico. [...] Una zona amplia de la literatura moderna se funda, tal vez, sobre las paradojas y las aporías desatadas por lo innombrable de esa ausencia (70). | Justifying the Male: The Function of the Poem in Bernart de Ventadorn and Na Castelloza | what was the lie in el noveno mandamiento | In João Almino's novel The Five Seasons of Love, the construction of prose accompanies the material construction of modernity. Characters must find and re-define themselves in a space of strangeness and estrangement. Their stories are allegories of transformation in a place without history.As cinco estações de Brasília RESUMO No romance de João Almino, As cinco estações do amor, a construção da prosa acompanha a construção material da modernidade. Os personagens precisam redefinir-se e encontrar-se num espaço de estranhamento e alienação. As suas histórias são alegorias de transformação num espaço sem história. | Visual culture in Brazil's First Republic (1889–1930): allegories and elite discourse | Imágenes milenaristas en el arte de vanguardia |
195 | Is there a way to get a SUP on the roof of a car next to a roof top box? | This is a great improvement to laying my SUP directly on the roof of a rental car, although the straps inside the car tend to get in the way. | So after a lot of trial and error and like $200 later I think I figured out a solution to what I've been looking for. I wanna thank everyone who commented on my last post with ideas and links. I was able to order a fully adjustable roof railing system off Amazon called the ALAVENTE Universal Roof Rack...
And I bought the rack off of a friend of mine who had it for his Jeep but was way to small for it. But fits perfectly on my tiny ass car.
| We love this car topper. My daughter was able to put a huge amount of things in it to come home from college and she put it on the roof of her car with no problem it's extremely high-quality I was surprised at how nice it was. I would highly recommend this product | I've got a 2010 Mazda3s hatchback. Me and my fiance do allot of cat camping so I'm wondering if it's possible to attach a roof rack.. Anyone done this before? | Forgive me if this is a bad idea, but I'm just trying to toy with the idea to see if it's possible.
What are some things I should look out for with installing a standard house window to the roof of a cargo van? This is a bad idea, right? Hail damage, etc I imagine would be risky. Are there alternative products for putting in a window I can lay down and see the stars through? | What roof do you go on for on the roof clue in spy island? | How do you attach porch roof to house roof? | My husband and I are looking into roof racks for our Mercedes Freightliner 2500 170 WB with a high roof. We would like to avoid going over $2000 and need one that we can attach our solar to. Double slats are preferable as we won’t spend much time up there besides repairs. Any recommendations are appreciated. We have already checked out Aluminess but the price tag seems lofty | 195 | I have a narrow roof top box that take up about half of the usable space on the rack for my Subaru Forester. Is there any way to get a SUP up there as well?
If I laid the SUP down flat on a traditional carrier, there isn't enough room for the box. Does anyone have any suggestions or unconventional methods? | Emacs and TRAMP: remote su to root. Please help. | Advice on a cargo box for a 2011 STI 5-door? | Securing a kayak to Mini Cooper roof rack? | Suggestion: Increase the max stack size per slot in haulers | Transporting Kayak on Car With no Roof Rack | Roof rack for topper questions | Save your money and purchase a better rooftop cargo carrier | Roof rack/carrier suggestions for 2017 lx hatchback? |
196 | Do "trick" decks last longer than Bicycle decks? | How many decks have you purchased since you've started magic, and how long have you been doing magic? | What does it do, and is it even worth using decks to destroy them? | Bicycle Playing Cards Are The Best! I really like the look of the Black Tiger Deck! Not only do they look cool but they handle real easy too! I highly recommend these you won't be sorry!!! | One person told me once in my LGS that i was mana-weaving, and i disagreed but maybe i'm wrong.
After every round, when i pick up my cards which are still on board, i pick 2 spells, 1 land, 2 spells, 1 land etc...
But i do shuffle normally by piles of 5 after i've put all of my cards in the deck, and i do not check cards in the deck.
So it's is still really randomized.
Is it legal ? Is it mana-weaving ? It's a pretty unclear rules here and there is no judges to ask. (Our judge play most of the times and is a cheater so ...) | One thing that i don't like about keyforge is that deck get chains.
To be honest i like the chain mechanic because it prevents overpowered decks to be used endlessly,but while a deck is fast at gaining chains, losing chains isn't so fast and it requires that you must literally suck at chainbound.
If a deck has 9 chains for example i need to suck at 3 tournaments to lower it by 3 chains.
Clearly this isn't something one want to do,so the player just stop bringing the deck to chainbound events.
What if instead of losing at chainbounds to lose chains, chain disappear or reduce after a certain period in which the deck hasn't been used?
For example after 3 months,but it could also be after 6 months or after a year.
&#x200B;
What do you think about this?
I know that a deck can still be used at competitve tournaments,but certain decks aren't great for more competitive tournaments,but are just good enough for chainbounds and it sucks that a deck can't be used never more (i mean you can,but 9 chains for a deck are tough,especially for a medium one). | You can't go wrong with bicycle cards! As a family, we play cards frequently, and we have recently had to suffer through several months of other brands of cards when our bicycles wore out. What a relief to have the "real thing" again. Standard size numbers. Great feel for shuffling. | I understand that most of the time, these kinds of decks are very powerful due to the MANY things working together to help win.
But what I don't get is how someone could sit down and play solitaire with their SPYral/Zoodiac/Trickstar deck for 15 minutes while the other guy just sits there and watches.
For the record I play Blue Eyes and Cubics so I'm not a huge competitive player. Maybe that's one reason why I don't understand. | If you Trickbind Maralen of the Mornsong, does it only stop the "lose 3 life and search for card" and not the "Players can't draw cards" ability?
Thx | 196 | Hello, beginner here. I picked up cardistry about a month ago.
I have been using a Bicycle deck and it's already starting to wear out. I have probably been damaging more than I should and I love doing the one hand riffle shuffle, so that's probably why. But here's my question, do trick decks(don't know the correct term) like ones by The Virts last longer than Bicycle decks or they are about the same?
I know I'm gonna get one of those unique decks eventually but don't know if it's worth the investment yet since they're relatively pricy. | Bicycle Playing Cards Are The Best! | Does shuffling the deck improve my chances? | Any ideas on how to bring out a new deck of cards for your last trick because it requires setup? | Shuffling and Laying Cards to Choose | when was the deck of cards written | So is there any way to make "slow" decks work anymore? | Is it possible to shuffle decks | Tricks utilizing marked decks |
197 | sharon carter is the head of which superhero group | Peggy Carter "Agent Carter", the 2014 film "", the television series "Marvel's Agents of S.H.I.E.L.D." and "Marvel's Agent Carter," the 2015 films "," "Ant-Man" and a cameo in the 2016 film "". The character first appeared, unnamed, as a wartime love interest of Captain America in "Tales of Suspense" #75 (single panel) and #77 (May 1966), by writer Stan Lee and artist Jack Kirby. She appeared again as the older sister of Sharon Carter in "Captain America" #161 (May 1973). She was later retconned as Sharon's aunt due to the unaging nature of comic book characters (see "Captain America" Vol. 5 #25 | America thought dead, she lives a quiet life for many years. After Captain America reemerges in the present day, unaged after having been in suspended animation, Carter encounters the villain Doctor Faustus, from whom Captain America rescues her. Peggy Carter is portrayed by Hayley Atwell in the Marvel Cinematic Universe. This version is depicted as a British agent rather than an American. Peggy Carter Margaret "Peggy" Carter is a fictional character appearing in American comic books published by Marvel Comics. She is usually depicted as a supporting character in books featuring Captain America. Created by writer Stan Lee and artist | America thought dead, she lives a quiet life for many years. After Captain America reemerges in the present day, unaged after having been in suspended animation, Carter encounters the villain Doctor Faustus, from whom Captain America rescues her. Peggy Carter is portrayed by Hayley Atwell in the Marvel Cinematic Universe. This version is depicted as a British agent rather than an American. Peggy Carter Margaret "Peggy" Carter is a fictional character appearing in American comic books published by Marvel Comics. She is usually depicted as a supporting character in books featuring Captain America. Created by writer Stan Lee and artist | Agent Carter (TV series) Marvel's Agent Carter, or simply Agent Carter, is an American television series created for ABC by Christopher Markus & Stephen McFeely, inspired by the 2011 film "", and the 2013 Marvel One-Shot short film of the same name. It is set in the Marvel Cinematic Universe (MCU), sharing continuity with the films and other television series of the franchise. The series was produced by ABC Studios, Marvel Television, and F&B Fazekas & Butters, with Tara Butters, Michele Fazekas, and Chris Dingess serving as showrunners. The series features the Marvel Comics character Peggy Carter, with Hayley Atwell | Reality War. World's Finest Team The World's Finest Team was a fictional DC Comics superhero team who first appeared in the DC Comics Dollar Comics format series in "World's Finest Comics" #244 (May 1977), created by Gerry Conway, with art by Jim Aparo and George Tuska. The team consisted of the Silver Age versions of Superman, Batman, Green Arrow, and Black Canary, along with the new, original Wonder Woman of Earth-Two. Prior to the events of "Infinite Crisis", Matt Wagner re-invented the origin of the first meeting between Batman, Superman, and Wonder Woman in the DC Comics limited series "" | Lara (comics) was a librarian and historian of high rank and thought it horrifying that Kal-El would be sent to a "primitive" planet such as Earth. In one story, the adult Kal (now Superman) is transported to the past and encounters his parents moments before Krypton's destruction. Lara is disgusted by what she sees and tells Kal not to approach her, finding him "repellent", even as she is ashamed of her feelings. In the 2004 Superman miniseries "", Lara, along with Krypton and Jor-El, more or less again became their Silver Age versions, though with updated touches. In this version, Lara is | Superheroes (song) airplay on United States Contemporary hit radio on 28 July 2014. "Superheroes" was first released as the sole track on the band's twelfth single on 22 July 2014, serving as the first single released in promotion of "No Sound Without Silence". The track was additionally distributed by video hosting service Vevo for streaming media the same day. A music video to accompany the release of "Superheroes" directed by Vaughan Arnell was released on 4 August 2014. The music video was shot in Johannesburg, South Africa over a period of a few days. The location of the video's principal photography was | Cassandra Cain Cassandra Cain (also known as Cassandra Wayne) is a fictional superhero appearing in American comic books published by DC Comics, commonly in association with the superhero Batman. Created by Kelley Puckett and Damion Scott, Cassandra Cain first appeared in "Batman" #567 (July 1999). The character is one of several who have assumed the role of Batgirl, and Cassandra Cain goes by the name of Orphan in current DC Comics continuity. Cassandra's origin story presents her as the daughter of assassins David Cain and Lady Shiva. She was deprived of speech and human contact during her childhood as conditioning | 197 | with the Clone Saga arc telling the people evacuated from Peter Parker's neighborhood that all is well, and Agent Woo is later seen in the Death of a Goblin arc, letting Carol Danvers know about the Goblin's most recent murder. By a 2008 storyline, Carter is the acting head of S.H.I.E.L.D.. She asks the Fantastic Four to investigate a confusing situation at Project Pegasus. Sharon Carter Sharon Carter (also known as Agent 13) is a fictional character appearing in American comic books published by Marvel Comics. She is usually depicted as a secret agent and an ex-field agent of S.H.I.E.L.D. | what is the zodiac in agent carter | who wrote the screenplay for the 2013 marvel film agent carter | The Supervillain (and her sidekick) | Tobias on HOUSE M.D.? Now it is all I want. | who is the heroine of prem rog | who did janis carter play in the woman on pier 13 | what is the name of howard stark's butler in agent carter | The Villain for the last season |
198 | Two LNA topologies for use in UWB systems are examined and compared in this paper. Design specifications have been derived from a ground penetrating radar system which is the target application. Circuits have been designed to cover the frequency range from 3.1GHz to 10.6 GHz. The SiGe:C technology SGB25V of IHP Microelectronics is applied to enable volume production at low prices. For measurement purposes, input and output are matched to 5Ω. | This paper presents an inductor-less low-noise amplifier (LNA) design for ultra-wideband (UWB) receivers and microwave access covering the frequency range from 0.4 to 5.7 GHz using 0.18-µm CMOS. Simulation results show that the voltage gain reaches a peak of 18.94 dB in-band with an upper 3-dB frequency of 5.7 GHz. The IIP3 is about −3 dBm and the noise figure (NF) ranges from 3.15–3.86 dB over the band of interest. Input matching is better than −8.79dB and the LNA consumes 5.77mW at 1.8V supply voltage. A figure of merit is used to compare the proposed design with recently published wideband CMOS LNAs. The proposed design achieves a superior voltage gain and tolerable NF, with the additional advantage of removing the bulky inductors. It is shown that the designed LNA without on-chip inductors achieves comparable performances with inductor-based designs. | This paper present 3.1–5 GHz low noise amplifier (LNA) for UWB receivers. In this proposed circuit, cascade and cascode topology with modified input matching are designed. Proposed LNA achieves a maximum gain 22.252 dB, a noise figure 0.921–1.646 dB with a wide input matching. The power consumption is low under a 1.6-V dc power supply. The proposed UWB LNA is implemented using 0.18 μm based CMOS technology under TSMC. | A fully-integrated LNA is presented in context of a dual-band direct-conversion receiver architecture for 5-6 GHz wireless LAN applications. Designed and fabricated in a 0.24 /spl mu/m standard digital CMOS process, the LNA exhibits a wideband 50 ohm input matching with S/sub 11/ of -23.5 dB at 5.5 GHz. The measured IIP/sub 3/ and P/sub 1dB/ are +10 dBm and -1.5 dBm respectively. It has a noise figure of 4.8 dB at 5.5 GHz. The LNA is shown to meet the requirements of a dual-band receiver architecture for the IEEE 802.11a WLAN standard. | A new design of 3.1~10.6GHz CMOS UWB LNA using TSMC 0.13μm process was proposed in this paper.Common-gate structure was used in the input stage leads to better input matching.Cascode structure is used in the second stage to increase the gain.Simulation and optimization of LNA have been done by ADS2006.Results show noise figure of the amplifier is below 2.5dB under working voltage of 1.2V in 3.1~10.6GHz,gain is 20.5±0.5dB and power consumption is 8mW. | An UWB LNA that employs the differential topology with a cascode common gate stage as the core amplifier is proposed for lower band of ultra wideband (UWB) applications. This differential LNA is designed to obtain a power gain greater than 15dB and a noise figure less than 1dB. The common gate stage at the input offers input matching and the output matching is attained using a common drain buffer amplifier. The input and output matching are aimed at less than − 10dB while the reverse isolation is well below − 40dB. The LNA ensures better linearity with an in-band IIP 3 of − 3dBm. The LNA is allowed to consume a very low power of 4mW at an operating voltage of 1V. The performance analysis of this proposed LNA is carried out using Agilent's ADS 2008 simulator employing 90nm CMOS technology. |
Introduction
Ultra wideband (UWB) has many advantages over narrowband technology such as high data rate, low power, low complexity, and low cost technology. When The US Federal Communication Commission (FCC) recognized the potential advantages of UWB, it issued a report that allows UWB use for commercial communication systems in 2002, and its applications can operate in the unlicensed spectrum of 3.1-10.6 GHz [1]. UWB supports carrierless baseband signals such as impulse-radio IR-UWB, and it supports wideband with carrier such as multiband orthogonal frequency division multiplexing MB-OFDM UWB [2]. In MB-OFDM UWB systems, the spectrum from 3.1 to 10.6 GHz is divided into 14 subbands of 528 MHz as shown in Figure 1, which supports data rates from 53 to 480 Mbps [3,4].
In order to roam across different subbands, devices that support multinetwork applications are required. There is a strong motivation on using single chip supports multiband and multiapplications, due to it provides wireless access for users anywhere and anytime. In such reconfigurable devices, the design of low noise amplifier (LNA) is a critical issue because its has effects in the overall system and requirements as high gain, low noise figure (NF), and lower power consumption, with good input and output matching over each band of interest.
Recently, there are some schemes proposed to the multistandard LNAs like parallel, concurrent, wideband, and reconfigurable LNA. The first approach is the parallel architecture that emploies multiple architectures for each band of interest [5]. However, this approach requires large area, different design for each band, and more time. The concurrent and wideband approaches provide multiband simultaneously [6] by providing the input matching, but this approaches pass the large interference the matching network; therefore, increasing the linearity is required [7,8]. Recently, the reconfigurable approach presents to discrete band and/or concurrent bands [7] to solve the tradeoff between area, power, and cost. Many approaches present a continuous tuning like [8,9]; it is good for narrowband applications, but it is not applicable for widebands. This paper proposed a new reconfigurable MB-OFDM LNA for UWB systems. The proposed LNA reconfigured over dual widebands and it works as a discrete band or concurrent based on the programmable part. This design based on CG topology to provide the input matching over wideband [10,11], current reuse technique shown in Figure 2 used to provide high and flat gain, and low power consumption [12][13][14], and programmable circuit to select the band of operation. This paper is organized as follows, the demonstration of the proposed circuit, defect and solution of current reuse technique will be presented in Section 2. Section 3 discusses the simulation results of the proposed LNA. Finally, the conclusion is presented in Section 4.
Circuit Design of the Proposed Reconfigurable MB-OFDM UWB LNA
The proposed LNA was designed by a standard 0.18 m CMOS process. Figure 3(a) shows the schematic of the LNA. This circuit consists of three stages distinguished by three different blocks in Figure 3(a). The first one, input matching stage in block-1 in Figure 3(a), the CG topology used to control the input matching over wideband [11,15] where the input impedance at resonated with the gate-to-source parasitic capacitance of 1 of 1 is in = 1/ 1 , where 1 is the transconductance of transistor 1 . Therefore, the matching bandwidth can be calculated by Second stage is the programmable switches in block-2 in Figure 3(a), actually this stage is proposed to achieve two main tasks. The first task is used to select the branch that will provide the desired band, consequently, the selected band depends on Table 1, where 0 is the center frequency of the selected mode. The other task is used to solve current reuse defect, without using this stage the control of this circuit can be made by transistor 2 and 2 , but when one of them is OFF, 1 and 2 nodes will be shorted, thereby the overall circuit performance will be effected.
BW = 1 2 1 (1/ 1 ) = 1 2 1(1)
To solve this problem the programmable circuit is proposed, when transistor 2 is OFF as shown in Figure 3(b) 1 and 2 nodes will be disconnected.
Finally, the current reuse stage in block-3 in Figure 3(a), is used to achieve high and flat gain, and lower power consumption. This architecture was simplified in Figure 2 and it consists of series inductor 1 and shunt capacitor 1 connected to DC cascode transistors 1 and 2 . 1 is used to resonate with gate-to-source parasitic capacitance of 2 , 2 , while 1 is selected large in the desired bandwidth to provide high impedance path to block RF signal. Furthermore, when the capacitance is selected large, the transistors 1 and 2 act as two common source (CS) cascaded stage at high frequency [12][13][14].
Simulation Results
Design of the proposed reconfigurable MB-OFDM UWB LNA was carried out using Spectre simulator from Cadence Design Suite. The proposed circuit consumes 3.32 mA from 1.2 V supply when it works in single mode, but when it works in concurrent mode it consumes 3.39 mA. The simulation results for S-parameters and NF are illustrated in Figure 4 and Figure 5. 11 is less than −12, −13.57, and −11 dB for UWB mode-1 with center frequency 3.432 GHz, UWB mode-3 with center frequency 4.488 GHz, and concurrent mode with center frequency 3.96 GHz, respectively. These results depict the input matching network of the proposed LNA under −10 dB, the reason behind this due to CG topology and selection of appropriate value of to resonate with 1 , so the proposed design has a good input matching. Figure 4(b) presents the reverse isolation 12 between output and input ports over bands of interest, where it is less than −50.5, −44.2, and −52 dB for mode-1, mode-3, and concurrent mode, respectively. Also the better isolation comes from CG topology, where the input isolated from the output of this topology. Figure 4(c) illustrates the voltage gain 21 of the proposed LNA. As depicted, the proposed LNA achieves 17.35, 18, and 11 dB for mode-1, mode-3, and concurrent mode, respectively. The high gain of this LNA is due to current reuse, where the overall transconductance of this design is = 1 2 . However, the gain of concurrent mode is lower than single mode, due to the parallel resistance of branches (output resistance of 2 , 2 series with output resistance of 1 , and 1 are parallel with output resistance of 2 , 2 series with output resistance of 2 , and 2 ). Figure 4(d) shows the output return loss 22 of the reconfigurable LNA where it is under −14.9, −9.6, and −14.2 dB for all modes.
The good output matching was achieved due to the selection of appropriate values for output matching network ( 2 , 2 , 2 , out , out , and ). The simulated NF versus bands of interest is shown in Figure 5. As noticed, NF of the proposed LNA achieves 3.49-3.53, 3.9-3.93, and 6.29-6.8 dB for mode-1, mode-3, and concurrent mode, respectively. The high NF of concurrent mode is due to the number of transistors that are used in this mode.
The performance of the proposed LNA and a comparison with existing architectures are summarized in Table 2. As shown in this table, the proposed LNA provides discrete tuning and concurrent, while the existing techniques either provide discrete, concurrent, or continuous tuning. The voltage gain 21 for the proposed architecture is lower than [8,9,16], because they use the cascode and cascade topologies for that they consume higher power when compared with the proposed reconfigurable LNA. and the noise performance of this circuit was presented. The proposed LNA operates by 1.2 V supply and consumes 3.32 mA for single mode (UWB mode-1 or mode-3) and 3.39 mA for concurrent mode. Finally, it has been designed by 0.18 m CMOS process.
Conclusion
Figure 1 :
1Frequency spectrum of MB-OFDM UWB system.
Figure 2 :
2Current reuse architecture.
Figure 4 (Figure 3 :
43a) shows the simulated input return loss11 for different frequency bands based onTable 1.Circuit design of the proposed reconfigurable MB-OFDM UWB LNA: (a) schematic of proposed reconfigurable MB-OFDM UWB LNA and (b) operation of the proposed LNA when 1 ON and 2 OFF.
Figure 4 :
4A reconfigurable LNA for MB-OFDM UWB receivers is proposed. This LNA works in three modes of operation based on programmable current reuse technique. The detailed operation of the proposed reconfigurable LNA including input matching topology (CG), programmable switches circuit, high gain and low power technique (current reuse)S-Parameter results of reconfigurable LNA over multibands: (a) input reflection coefficient 11 , (b) reverse isolation 12 , (c) voltage gain 21 , and (d) output reflection coefficient 22 .
Figure 5 :
5Noise figure NF.
2
International Journal of Microwave Science and TechnologyBand group 1
Band group 2
Band group 3
Band group 4
Band group 5
Band 1
Band 2
Band 3
Band 4
Band 5
Band 6
Band 7
Band 8
Band 9
Band 10
Band 11
Band 13
Band 14
Band 12
3432
3960
4488
5016
5544
6072
6600
7128
7656
8184
8712
9240
9768
10296
(MHz)
Table 1 :
1Look-up table of programmable circuit. the input impedance can be matched to 50 Ω at resonance.1
2
BW (GHz)
0 (GHz)
Mode
0
0
-
-
-
0
1
0.528
3.432
Single
1
0
0.528
4.488
Single
1
1
≈1.4
3.96
Concurrent
hence, by controlling
1
Table 2 :
2The performance of the proposed LNA and comparison with existing architecture. * S: Single mode; * * C: Concurrent mode; * * * Con: continuous.International Journal of Microwave Science and TechnologyTech. CMOS
BW (GHz)
(V)
11 (dB)
22 (dB)
21 (dB)
NF (dB)
Power (mW)
Topology
[7]
0.13
2.8, 3.3, 4.6
1.2
<−18
-
14.2-16
1.7-3.7
6.4
S *
2.05, 5.65
<−8.6
-
14.9
4-4.8
C * *
4.3-10.8
-
3-15.6
4-5.3
UWB
[8]
0.13
1.9-2.4
1.2
<−13
-
14-10
3.2-3.7
17
Con * * *
[9]
0.13
3.4-3.6
1.2
<−18
<−15.3
20.9-21.3
<1.8
16
S
4.2-4.8
1.2
<−15
<−14.5
19.2-20.7
<2.3
[15]
0.18
0.9, 1.5, 2.4
1.8
<−10
-
15-19
1.9-4.5
30
C
[16]
0.13
1.8-2.4
1.2
<−12
-
26-28
3.2-3.4
9.6
This work
0.18
3.168-3.696
1.2
<−12.04
<−14.9
15.8-17.35
3.49-3.53
4
S
4.224-4.752
<−13.57
<−9.6
16-18
3.9-3.93
S
3.432-4.488
<−11
<−14.2
10.25-11
6.28-6.8
C
First Report and Order in The Matter of Revision of Part 15 of the Commission's Rules Regarding Ultra wideband Transmission Systems. 98-153, FCC 02-48Federal Communications Commission (FCC). ET-DocketFederal Communications Commission (FCC), "First Report and Order in The Matter of Revision of Part 15 of the Commis- sion's Rules Regarding Ultra wideband Transmission Systems, " ET-Docket 98-153, FCC 02-48, 2002.
UWB Communication Systems a Comprehensive Overview. M Di Benedetto, T Kaiser, A F Molisch, I Oppermann, C Politano, D Porcino, Hindawi Publishing CoM. Di Benedetto, T. Kaiser, A. F. Molisch, I. Oppermann, C. Politano, and D. Porcino, UWB Communication Systems a Comprehensive Overview, Hindawi Publishing Co., 2006.
Design of reconfigurable UWB transmitter to implement multi-rate MB-OFDM UWB wireless system. C Vennila, G Lakshminarayanan, S Tungala, Proceedings of the International Conference on Advances in Computing, Control and Telecommunication Technologies (ACT '09). the International Conference on Advances in Computing, Control and Telecommunication Technologies (ACT '09)C. Vennila, G. Lakshminarayanan, and S. Tungala, "Design of reconfigurable UWB transmitter to implement multi-rate MB-OFDM UWB wireless system, " in Proceedings of the International Conference on Advances in Computing, Control and Telecommunication Technologies (ACT '09), pp. 411-413, December 2009.
A 6.2-9.5 GHz UWB receiver for WiMedia MB-OFDM. T Gao, F Zhou, W Li, N Li, J Ren, Proceedings of the 10th IEEE. the 10th IEEEIntegrated Circuit TechnologyT. Gao, F. Zhou, W. Li, N. Li, and J. Ren, "A 6.2-9.5 GHz UWB receiver for WiMedia MB-OFDM, " in Proceedings of the 10th IEEE International Conference on Solid-State and Integrated Circuit Technology, pp. 782-784, November 2010.
RF transceiver concepts for reconfigurable and multi-standard radio. M A T Sanduleanu, M Vidojkovic, Proceedings of the 1st European Wireless Technology Conference (EuWiT '08). the 1st European Wireless Technology Conference (EuWiT '08)M. A. T. Sanduleanu and M. Vidojkovic, "RF transceiver concepts for reconfigurable and multi-standard radio, " in Pro- ceedings of the 1st European Wireless Technology Conference (EuWiT '08), pp. 29-32, October 2008.
Pseudo concurrent quad-band LNA operating in 900 MHz/1.8 GHz and 900. S Datta, A Dutta, K Datta, T K Bhattacharyya, S. Datta, A. Dutta, K. Datta, and T. K. Bhattacharyya, "Pseudo concurrent quad-band LNA operating in 900 MHz/1.8 GHz and 900
MHz/2.4 GHz bands for multi-standard wireless receiver. Proceedings of the 24th International Conference on VLSI Design. the 24th International Conference on VLSI DesignMHz/2.4 GHz bands for multi-standard wireless receiver, " in Proceedings of the 24th International Conference on VLSI Design, pp. 124-129, January 2011.
A 2-11 GHz reconfigurable multimode LNA in 0.13 m CMOS. X Yu, N M Neihart, Proceedings of the IEEE Radio Frequency Integrated Circuits Symposium. the IEEE Radio Frequency Integrated Circuits SymposiumIEEEX. Yu and N. M. Neihart, "A 2-11 GHz reconfigurable multi- mode LNA in 0.13 m CMOS, " in Proceedings of the IEEE Radio Frequency Integrated Circuits Symposium, pp. 475-478, IEEE, 2012.
A CMOS low-noise amplifier with reconfigurable input matching network. M El-Nozahi, E Sanchez-Sinencio, K Entesari, IEEE Transactions on Microwave Theory and Techniques. 575M. El-Nozahi, E. Sanchez-Sinencio, and K. Entesari, "A CMOS low-noise amplifier with reconfigurable input matching net- work, " IEEE Transactions on Microwave Theory and Techniques, vol. 57, no. 5, pp. 1054-1062, 2009.
Analysis and design of a fully integrated IMT-advanced/UWB dual-band LNA. Y Wang, F Huang, T Li, Proceedings of the International Symposium on Signals, Systems and Electronics (ISSSE '10). the International Symposium on Signals, Systems and Electronics (ISSSE '10)1Y. Wang, F. Huang, and T. Li, "Analysis and design of a fully integrated IMT-advanced/UWB dual-band LNA, " in Proceedings of the International Symposium on Signals, Systems and Electronics (ISSSE '10), vol. 1, pp. 83-86, September 2010.
0.99 mW 3-10 GHz common-gate CMOS UWB LNA using T-match input network and selfbodybias technique. J F Chang, Y S Lin, Electronics Letters. 4711J. F. Chang and Y. S. Lin, "0.99 mW 3-10 GHz common-gate CMOS UWB LNA using T-match input network and self- bodybias technique, " Electronics Letters, vol. 47, no. 11, pp. 658- 659, 2011.
A 2.76 mW, 310 GHz ultra-wideband LNA using 0.18 m CMOS technology. J F Chang, Y S Lin, Proceedings of the International Symposium on VLSI Design, Automation and Test (VLSI-DAT '11). the International Symposium on VLSI Design, Automation and Test (VLSI-DAT '11)J. F. Chang and Y. S. Lin, "A 2.76 mW, 310 GHz ultra-wideband LNA using 0.18 m CMOS technology, " in Proceedings of the International Symposium on VLSI Design, Automation and Test (VLSI-DAT '11), pp. 188-191, April 2011.
A 3.1-10.6 GHz low power high gain UWB LNA. Using current reuse technique. A N Ragheb, G A Fahmy, I Ashour, A Ammar, Proceedings of the 4th International Conference on Intelligent and Advanced Systems (ICIAS '12). the 4th International Conference on Intelligent and Advanced Systems (ICIAS '12)2A. N. Ragheb, G. A. Fahmy, I. Ashour, and A. Ammar, "A 3.1- 10.6 GHz low power high gain UWB LNA. Using current reuse technique, " in Proceedings of the 4th International Conference on Intelligent and Advanced Systems (ICIAS '12), vol. 2, pp. 741-744, 2012.
A design of 3.1-10.6 GHz ultra-wideband CMOS low noise amplifier with current-reused technique. Q Wan, C Wang, International Journal of Electronics and Communication. 6512Q. Wan and C. Wang, "A design of 3.1-10.6 GHz ultra-wideband CMOS low noise amplifier with current-reused technique, " International Journal of Electronics and Communication, vol. 65, no. 12, 2011.
Analysis and design of two low-power ultra-wideband CMOS lownoise amplifiers with out-band rejection. C P Liang, P Z Rao, T J Huang, S J Chung, IEEE Transactions on Microwave Theory and Techniques. 582C. P. Liang, P. Z. Rao, T. J. Huang, and S. J. Chung, "Analysis and design of two low-power ultra-wideband CMOS low- noise amplifiers with out-band rejection, " IEEE Transactions on Microwave Theory and Techniques, vol. 58, no. 2, pp. 277-286, 2010.
A 0.18 m CMOS reconfigurable multiband multi-gain low noise amplifier. Z Liu, J Wang, Proceedings of the International Conference on Electric Information and Control Engineering (ICEICE '11). the International Conference on Electric Information and Control Engineering (ICEICE '11)Z. Liu and J. Wang, "A 0.18 m CMOS reconfigurable multi- band multi-gain low noise amplifier, " in Proceedings of the International Conference on Electric Information and Control Engineering (ICEICE '11), pp. 961-964, April 2011.
A reconfigurable inductor-less CMOS low noise amplifier for multi-standard applications. A Slimane, M T Belaroussi, F Haddad, S Bourdel, H Barthelemy, Proceedings of the IEEE 10th International Conference on New Circuits and Systems Conference (NEWCAS '12). the IEEE 10th International Conference on New Circuits and Systems Conference (NEWCAS '12)A. Slimane, M. T. Belaroussi, F. Haddad, S. Bourdel, and H. Barthelemy, "A reconfigurable inductor-less CMOS low noise amplifier for multi-standard applications, " in Proceedings of the IEEE 10th International Conference on New Circuits and Systems Conference (NEWCAS '12), pp. 57-60, 2012.
| In this paper, a new CMOS low noise amplifier (LNA) is designed using inductive interstage network for ultra- wideband (UWB) receiver in a standard TSMC 0.18 mum CMOS technology. The Spectre simulations show that the proposed UWB LNA achieves a flat 3-dB gain bandwidth of 4.7 GHz to 10.5 GHz, a power gain of 12 dB, a minimum noise figure of 3.9 dB and a total power dissipation of 7.2 mW from a 1.2 V power supply. | A 21–27 GHz CMOS ultra-wideband low-noise amplifier (UWB LNA) with state-of-the-art phase linearity property (group delay variation is only ±8.1 ps across the whole band) is reported for the first time. To achieve high and flat gain (S21) and small group delay variation at the same time, the inductive series peaking technique was adopted in the output of each stage for bandwidth enhancement. The LNA dissipated 27 mW power and achieved input return loss (S11) of −13 to −20.1 dB, output return loss (S22) of −8.2 to −30.2 dB, flat S21 of 9.3±1.3 dB, reverse isolation (S12) of −52.7 to −73.3 dB, and noise figure of 4.9–6.1 dB over the 21–27 GHz band of interest. The measured 1 dB compression point (P1 dB) and input third-order intermodulation point (IIP3) were −14 and −4 dBm, respectively, at 24 GHz. | 198 | A low noise amplifier (LNA) is implemented in this work for ultra wide band (UWB) localization and sensing systems within a wide frequency range starting from 400MHz and up to 10GHz. The topology used is a resistive shunt feedback and a peaking inductance in series with the output transistor to achieve the desired bandwidth and have better noise performance. The LNA is fabricated in low cost 0.25µm 92GHz f max SiGe-HBT-BiCMOS process technology. The area of the manufactured chip is 0.73mm2. The achieved gain is 12dB with a NF less than 3.7dB over the entire frequency range while the consumed power is only 14.5mW. | Low power 0.18µm CMOS ultra wideband inductor-less LNA design for UWB receiver | A 5.8-GHz monolithic low-noise amplifier (LNA) with a minimum noise figure of 1.65 dB and an associated gain of 15 dB is implemented in a standard SiGe bipolar technology. It dissipates 13 mW from a 1-V supply (with only 9 mW in the gain stages). The measured transducer gain is 13 dB with a noise figure of 2.1 dB at 5.8 GHz. This is believed to be the lowest noise figure reported for a 5.8-GHz LNA in any production-level technology. The transducer gain is above 10 dB from 3.8 to 8 GHz. At 5.8 GHz, the input return loss and reverse isolation are 6 and 28 dB, respectively. | This paper presents the design and implementation of a wideband power amplifier for UWB applications, covering the lower band frequencies of 3.1 GHz to 4.8 GHz. To achieve sufficient linearity and efficiency, this PA operates in the class-AB regime, delivering an output power of -4.2 dBm at an input 1 dB compression point of -22 dBm for a 4 GHz signal. This PA has a differential input and a single-ended output that has been matched to 50 /spl Omega/ at both ends. Complete design and implementation was done using TSMC 0.18 /spl mu/m CMOS technology and it consumes a very low power of 25 mW, while realizing a flat gain of 19/spl plusmn/1 dB across the whole band of operation. | Multistandard, flexible and wideband front-ends emerge to cover an increasing variety of wireless standards. Meanwhile, expensive downscaled CMOS calls for robust, area-efficient circuit solutions. This work presents such low-area, low-cost feedback-enabled LNAs in 45nm CMOS. Wideband or narrow-band operation, exceeding 10GHz is achieved by selecting an appropriate compact load. Several state-of-the-art versions are presented such as a 0.008mm2 3-10GHz UWB LNA with flat 3dB NF consuming 7mW, and a 0.02 mm2 8-16GHz LNA with 4dB NF, 17dB gain and 4.2kV ESD protection. | Design of low power UWB LNA for frequency 3.1–5 GHz in 0.18 μm CMOS technology | This paper presents a low noise amplifier (LNA) design methodology and challenges at Ka Band using BiCMOS technology. A two stage single ended cascode narrowband LNA has been designed and fabricated using 130nm technology. A gain of 22.3dB and noise figure of 3.9dB at 35GHz with −23 dBm 1dB input compression point achieved in measurement results. The LNA consumes only 4.4mA of current from a 1.8V supply voltage and takes chip area, with a size of 1.2mm by 0.7mm including pads. | This work deals with the design of low noise amplifiers for WAVE (WLAN for vehicular environment) application which operates in 5.85–5.925 GHz frequency band considering the center frequency as 5.9 GHz. There are various substrates available in the market that can be used for designing LNA’s and some of them are considered in this work. Out of all the substrates used, RT Duroid 5880 provides better results with a power gain of 16.423 dB and optimum noise figure of 0.687 dB. | μ INTEGRATED POWER AMPLIFIER FOR UWB SYSTEMS |
199 | when did the university of pisa re-open | degraded until 2008 when it was largely reconstructed and refitted. Cittadella Nuova The Cittadella Nuova (New Citadel), now called the Giardino di Scotto or Giardino Scotto (Scotto's Garden) is an old fortress in Pisa. The citadel was called ""nuova"" (new) to distinguish it from the older Cittadella Vecchia on the seaward side of the city. The Cittadella Nuova is located on the extreme opposite side of the city walls of Pisa in Lungarno Fibonacci, on the south bank of the river Arno between the Ponte della Vittoria and the Ponte della Fortezza. Construction began in 1440 during the first period | Leaning Tower of Pisa have toppled. In 1272, construction resumed under Giovanni di Simone, architect of the Camposanto. In an effort to compensate for the tilt, the engineers built upper floors with one side taller than the other. Because of this, the tower is curved. Construction was halted again in 1284 when the Pisans were defeated by the Genoans in the Battle of Meloria. The seventh floor was completed in 1319. The bell-chamber was finally added in 1372. It was built by Tommaso di Andrea Pisano, who succeeded in harmonizing the Gothic elements of the bell-chamber with the Romanesque style of the tower. There | History of Naples from Pisa and Genoa. Apart from the church of San Giovanni a Mare, Norman buildings in Naples were mainly lay ones, notably castles (Castel Capuano and Castel dell'Ovo), walls and fortified gates. Frederick II Hohenstaufen founded the university in 1224, considering Naples as his intellectual capital while Palermo retained its political role. The university remained unique in southern Italy for seven centuries. After the defeat of Frederick's son, Manfred, in 1266 Naples and the kingdom of Sicily were assigned by Pope Clement IV to Charles of Anjou, who moved the capital from Palermo to Naples. He settled in his new | when they enter university, while in other countries 18 is the more common age. Italy has a large and international network of public and state affiliated universities and schools offering degrees in higher education. State-run universities of Italy constitute the main percentage of tertiary education in Italy, and are managed under the supervision of Italian's Ministry of Education. Italian universities are among the oldest universities in the world. In particular the University of Bologna (founded in 1088), University of Padua, founded in 1222, and the University of Naples Federico II, the oldest public and laic university in the world, are | the enhancement of education in science. Gonzaga Institute, Palermo Gonzaga Institute, Palermo, is a Catholic school founded by the Society of Jesus in 1919. It offers educational programs for children from 18 months to 18 years, including an international school that facilitates entrance to universities worldwide. Gonzaga became coeducational in 1996 by uniting with Ancelle Institute for girls, its next door neighbour. In 2008–09 there were 1459 pupils in the various schools: International, 22; military, 130 ; primary 444; secondary 281; classic liceo, 252; scientific liceo, 112; European language, 218 pupils. In May 2017 the school introduced one of the | Tallinn University Tallinn University (TU; , "TLÜ") is a public research university in Estonia. Located in the centre of Tallinn, the capital city of Estonia, Tallinn University is one of the three largest institutions of higher education in the country. In the 2019 edition of QS World University rankings, it has been ranked among the top 1000 universities in the world. Tallinn University's predecessor, Tallinn Teachers' Seminar, was founded in 1919. Tallinn University in its present form was established on 18 March 2005 as the result of a merger of several universities and research institutions in Tallinn: Academic Library of | Pirelli Tower assistance of Pier Luigi Nervi and Arturo Danusso. Construction of the tower began in 1956 when Italy was experiencing an economic boom. The tower was to be surrounded by low lying buildings on a pentagonal plot of land. Upon its completion in 1958, it became a symbol not only of Milan, but also of the economic recovery of Italy after the devastation of World War II. At , it was the tallest building in Italy after Mole Antonelliana until 1995. The company sold the building to the Lombardy regional government in 1978. It's also the seat of the Regional Council. | publications consists of student journalists in elected posts. Laguna State Polytechnic University The Laguna State Polytechnic University (LSPU) () is a state university in the Province of Laguna, Philippines, with four regular campuses and several auxiliary sites. There are four regular campuses which belong to the University. The campus in Siniloan was founded in 1952 (as Baybay National High School), where the university traces its roots. It sits on a land of 33 hectares at Barangay Wawa besides the Laguna de Bay, with an additional 100 ha for plans of future expansion in the mountainous Barangay Kapatalan. It concentrates on | 199 | University of Pisa of a cherub was placed above the gate "Dell'Abbondanza" (the "Gate of Abundance"), leading to the piazza, and today is still the symbol of the university. Following the rebellion and the war against Florence in 1494, the Pisan "Studium" suffered a period of decline and was transferred to Pistoia, Prato and Florence. The ceremonial reopening of the university on November 1, 1543, under the rule of Duke Cosimo I de Medici, was considered as a second inauguration. The quality of the university was furthered by the statute of 1545 and the Pisan Athenaeum became one of the most significant in | which hero founded pisa, greece | how many students were taught at four high schools in florence in 1338 | for how many days did italian students shut down the university of rome in march | who restored the medici rule in florence in 1530 | The first idea of establishing a public astronomical observatory in Florence, Capital of the Grand Duchy of Tuscany, dates to the mid of the 18 th century. Initially, the use of a low building on a high ground was proposed, and the hill of Arcetri suggested as a proper location. At the end of the century, the Florence Observatory -or Specola -was built instead on a tower at the same level as the city's centre. As soon as astronomers started to use this observatory, they recognized all its flaws and struggled to search for a better location.Giovanni Battista Donati, director of the Specola of Florence from the eve of the Italian Unification in 1859, finally succeeded in making a new observatory: first, he obtained funds from the Parliament of the Kingdom of Italy to build an equatorial mount for the Amici 28-cm refractor, which could not be installed conveniently in the tower of the Specola; then, he went through the process of selecting a proper site, seeking funds and finally building the Arcetri Observatory. Although Donati was a pioneer of spectroscopy and astrophysics, his intent was to establish a modern observatory for classical astronomy, as the Italian peninsula did not have any, similar to the national observatories located in many foreign capitals -Florence being the capital of the Kingdom of Italy from 1865 to 1871. To promote the project, he made use of writings by one of the most authoritative European astronomers, Otto Wilhelm Struve.The paper describes all these steps, eventually leading to the final inauguration of the Arcetri Observatory in 1872, almost 150 years ago. | when did lorenzo de' medici become lord of florence | who created the putto in florence in 1420 | where is the san francesco in pisa museum |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.