query_id
int64 0
355k
| query
stringlengths 2
25.6k
| neg_doc_0
stringlengths 13
360k
| neg_doc_1
stringlengths 9
301k
| neg_doc_2
stringlengths 9
364k
| neg_doc_3
stringlengths 13
347k
| neg_doc_4
stringlengths 14
562k
| neg_doc_5
stringlengths 13
589k
| neg_doc_6
stringlengths 14
293k
| neg_doc_7
stringlengths 11
403k
| doc_id
int64 0
355k
| positive
stringlengths 1
679k
| neg_query_0
stringlengths 3
23.4k
| neg_query_1
stringlengths 2
47.3k
| neg_query_2
stringlengths 3
47.3k
| neg_query_3
stringlengths 3
37.6k
| neg_query_4
stringlengths 2
64.1k
| neg_query_5
stringlengths 3
64.1k
| neg_query_6
stringlengths 2
21.3k
| neg_query_7
stringlengths 3
64.1k
|
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1,999,900 | which canadian province won the 2016 jubilee trophy | the Canada Cup was replaced by the World Cup of Hockey in 1996. The Canada Cup trophy is shaped like half of a maple leaf and is made of solid nickel (120 pounds worth). It was refined at the Inco nickel smelter in Sudbury, Ontario in 1976, commissioned by D. Scott McCann, President of Teledyne Canada. Donna Scott (Queen's University, Bachelor of Fine Arts, 1985 ) designed the cup, her inspiration was Pink Floyd's Dark Side Of the Moon album cover. It is on display at Rideau Hall, the residence of the Governor General in Ottawa. The 1981 win by | The Huber Trophy (formerly known as the Tarry Cup) is the trophy awarded annually to the team that finishes the Colonial/United/International Hockey League regular season with the best overall record, as determined by points earned in the standings.
The regular season championship award was first presented in 1991–92. It was renamed the Tarry Cup in 1994 in memory of Doug Tarry, who was the owner of the St. Thomas Wildcats, a charter member of the CoHL. On September 24, 2007, the trophy was given its current name in honor of the founder of the original International Hockey League, Fred Huber, which was awarded to the original league's regular-season champion.
Winners
2007–08 — Fort Wayne Komets
2006–07 — Fort Wayne Komets
2005–06 — Kalamazoo Wings
2004–05 — Muskegon Fury
2003–04 — Fort Wayne Komets
2002–03 — Fort Wayne Komets
2001–02 — Quad City Mallards
2000–01 — Quad City Mallards
1999–00 — Quad City Mallards
1998–99 — Muskegon Fury
1997–98 — Quad City Mallards
1996–97 — Flint Generals
1995–96 — Flint Generals
1994–95 — Thunder Bay Senators
1993v94 — Thunder Bay Senators
1992–93 — Brantford Smoke
1991–92 — Michigan Falcons
References
IHL's official site
International Hockey League (2007–2010) | Triple Gold Club and traditions. Unlike the trophies awarded by the other three major professional sports leagues of North America, a new Stanley Cup is not made each year; winners keep it until a new champion is crowned. It is the only trophy in professional sports that has the name of the winning players, coaches, management and club staff engraved on its chalice. Originally inscribed the "Dominion Hockey Challenge Cup", the trophy was donated in 1892, by then Governor General of Canada Lord Stanley of Preston, as an award for Canada's top-ranking amateur ice hockey club. The competition for the Cup went through | leaf has been one of Canada's symbols since as early as the 18th century, and in 1965 the national flag of Canada was adopted with a maple leaf on it. The club became affiliated to the International Ice Hockey Federation in 1911. They were named English champions again in 1911, and participated in the 1912 LIHG Championships, which were unofficially considered to be "World Championships". The Oxford Canadians were the only "non-European" participants in the tournament, in which they finished second behind Berliner Schlittschuhclub, who were representing Germany in the competition. The club were the English champions for the fourth | Alberta also defeated Saskatchewan 8-0 to win Bronze.
Not sure if anyone watched the game, but it was exciting. Ontario should have scored in OT. | Sports in Vancouver Hockey Association team, attempted to compete with the Canucks between 1973 and 1975, but moved to Calgary thereafter. An early professional hockey team known as the Vancouver Millionaires won the Stanley Cup in 1915. The Vancouver Warriors are a box lacrosse team in the National Lacrosse League. The team moved from Everett, Washington for the 2014 NLL season. Between 2014 and 2017, the team (then known as the Vancouver Stealth) were based in the Vancouver suburb of Langley, British Columbia, with home games played at the Langley Events Centre (LEC). In 2018, the team was purchased by Canucks Sports & | The Ontario Hockey League has 17 titles, and the Quebec Major Junior Hockey League has 12. Since the creation of the Memorial Cup, the Toronto Marlboros have won the most titles with seven. | This is probably the wrong form of hockey in Canada, but Canada beat India who is ranked 6 in the world 3-2
Great achievement! | 1,999,900 | 2016 Jubilee Trophy The 2016 Jubilee Trophy is the national championship for women's soccer clubs in Canada. It was held in St. John's, Newfoundland from October 5–10, 2016. Ten teams were granted entry into the competition; one from each Canadian province excluding Prince Edward Island. As host, Newfoundland and Labrador was permitted a second entry into the competition. This represents an increase of two teams from the eight sides that contested the 2015 Jubilee Trophy. Teams are selected by their provincial soccer associations; most often qualifying by winning provincial leagues or cup championships such as the Ontario Cup. The ten | which team did great britain beat to win the women's hockey gold medal in | 2014 FIRS Women's Roller Hockey World Cup | when was the last time british women's hockey was in the olymp | how many teams participate in the christy ring cup 2017 | where did canada come in netball world cup 2015 | 2016 Under-19 Provincial Championship | where is the 2010 women's hockey world cup being held | when is the next ncaa women's hockey championship |
1,999,901 | Pinball Map - spent the last 14 months rewriting the app with RN | This would be really handy since the footsteps are gone. The original pokevision is here:
The servers are down.
Apparently there's a way to make your own map, see here:
Would be awesome if someone here had the technological knowhow to make one for Boston and share it! | Greetings, fellow space enthusiasts!
I've recently launched three Android space apps on Google Play.
The first one is a map of our galaxy, the Milky Way, inspired from the concept art image from NASA.
Here is the download link: Galaxy Map.
The second one is a star map that can access over 248.000 stars and 14 black holes in the online database. The map is divided into 10 parsec sectors (cubes) or 32.62 light years. Sector (0 ,0 ,0) is our home sector and Sol is the Solar System.
Here is the download link: Star Map.
The third app combines the apps above into a single one, for a small fee. There are no advertisments in this app.
Here is the link for the paid app Galaxy Map Pro.
EDIT: For all the iOS users out there - the Galaxy Map (paid version) has just been released! Here is the link [iTunes] (
Here are 20 codes for iOS:
* EA9RW9JJXKJ3
* 3MFX47LL3TXR
* NTKNJWPJXHHA
* 73WLX6EKP3K7
* EP3HF7M7Y4TY
* EY6PPK4KJR4K
* NH3M6LYW3XJR
* 76M9PY9H4APR
* PET4N7TT96WY
* 4XTEYY6TETN3
* PHN4AFWYYXYW
* KPKJHMXNWT3H
* 4TKTW6JWXHYY
* 7N6XT3LHY349
* 49MR9KHK64ET
* 9F7N9NHAH3A3
* F9WMWFRJK46E
* FF493HTENWFX
* NMRPWP7MJEWR
* 7AXH7TM3KPNK
EDIT - Thank you for all your comments and messages! If you have the time, please leave me a rating or a review on the google play store.
EDIT - Android used codes
* WCPW35V0K48BY3VS2M0184U
* BEMWL38FHNJZDZNQ7HQ4WBP
* THL92PESMEXNK0GL86M6NJC
* 7PLUA5Q92QA5NLR11CJSNY2
* A54EL8CBBCTHPEWD1HC22DD
* ZE97LBC1EU6LVETYGFNF5TC
* SHYZ2LZX1MCSNNMCG52PZGP
* 8JJ9KCDJXA0JE85ADBNY6C9
* AERAT2SLEM6RZMVVZTQ7G1Y
* UVAWAY9WX21U9M7YH1EGYN4
* G6ZQZKCXCU6ESVPW46DAVHC
* HNJVC5GH480AN9A550GKBSE
* JSTV4GZJ13XLF4CUJHLGEDZ
* QA8X9BP9UNUF4K9414YS4DU
* NWAF2DYAB85D09P9C8BD0EE
* 4U6GEZG865CADH6ZG35UA6M
* HDQX66B2J8X2DQNL1GUX8PZ
* 9SR99DDSVH09HAA7BKH2SFB
* 11S0RS6J007K9NCZR4FQGEM
* GFRPXW4L4TEEL0UQ9566XSG
* RN7ZKLPP68CHME5PT8GVS9X
* 1DPH00THDK5YKAR9LRBEVG7
* N8WS24MS4KRMRB75352T6MF
* KV1UD9NG21AULYSSE7ZFV3E
* SWP6FDKHTKGHRR6RP9RY6LR
* 80UMBZKRA6GBM3T8E7108Z7
* WABG9JMU5S2NCUGCPC5T9W5
* AD2XWRHD9TL5XF370FZKLN7
* 3CYM63NDRZ02YVJKEGXCTFG
* E5TGSK4JP2WVNZ11HQ6NVD6
* 82YSWUYB95MR4NH482JK92H
* 2566QZ0AZQC37ZZLDJ4L3E6
* 477VY1JERRSB480UDJ70VQE
* U6ZQRZK1AA2NDFH8YDT3JY8
* 487UR96L4Z793597V3PS0M0
* G41R46UCXHH6BAC1ASXZ8LF
* TKWEAUPEBYY81JZWT13YQKC
* AB25P9A2HHLWPGR8ALN4G3S
* WXKGH7K2C1NBRURJSS5J4E3
* MJF69JZPJVCV7M9SNTVGXT6
* Z2VR6YVE5KM54MV35CX530C
* PLZLPEH68JY7B37DZKAN2UV
* V490RXRFS9H9769ERB3ZLVC
* 9Y2AKYJCBPRBS2JQ43FVRZY
* D5UEY10UBTV940BNN0FZ0L2
* 0B6WCB2GXKYUKUL8UKL9FEK
* FNQR6ESCUJR12NRLWKVNZUG
* Q3WQPE7YS6WLFZ6217L58DS
* NQEXMA9RUY1A3P0S7LF570S
Enjoy! | In the new app, there is a new button for Map. It does not open for me, just keeps spinning. Anyone else have this problem? Or can you at least tell me what it is supposed to do?
Thanks | Okay, so. I've been doing some fiddling with the GPS spoofing on my Galaxy S5 CM13. Basically what I wanted to do was use one of the GPS spoofing apps along with the PogoMaps that we all use here to detect my location in the map and then just use the GPS joystick to move my little blue location dot all over the map (since I can track the pokemon I want and just go straight to their location. NOT SNIPING). My problem arose when I kept switching between PokemonGo and my browser. My phone would kill Pogo and/or the browser while switching between apps, and I would have to log back into Pogo, or relaunch the GPS joystick...ugh, such a headache. So, bright idea time.
What if I could use my TV as a map? Not just a map...but a LIVE map with my current Android location? Possible. Very possible. I'm currently using two apps to accomplish this. GPS over BT and ShareGPS. Both are free on the Play Store. GPS over BT has given me some very interesting results. Here's an example of what I did:
Installed GPS over BT on my Galaxy S5 (Which can use any spoofing app and does not rubberband at all). After installing, I set the connection up to broadcast the NMEA (raw GPS information) data over BlueTooth. Then, I connected my girlfriend's Un-Rooted Android 7.0 phone to my Galaxy S5 via Bluetooth. Keep in mind, her phone cannot spoof. I can't root it (No root method for that phone) and no amount of tinfoil has kept the GPS from picking up. I installed an app on her phone called Bluetooth GPS. This app picks up NMEA information via bluetooth and lets the phone use it as location data. Once I allowed Mock Locations and set the Bluetooth GPS app as the mock app...some really magical things happened.
I set her phone into Device Only location mode, then opened up Google Maps. On my Galaxy S5, I opened my regular spoofing app (with joystick), and started transmitting my GPS information via Bluetooth. Her phone picked it up. Not only did it pick it up, but any movement I made with the joystick on my Galaxy made her phone move as well. So...this is effectively PokemonGo Co-op. One phone controls the movement of 2 players. This works beautifully and is very fun. Keep in mind, that her phone could not log into Pogo because Mock Locations had to be enabled. This would work perfectly with any phone that can spoof properly as a really interesting way to co-op.
Now...on to my actual problem. I discovered a program by the name of GPSGate, which you install on a PC. This program receives NMEA data via USB, Bluetooth, AND TCP/IP. So you can see where I'm going with this. I can install this on a PC/Laptop and have it mirror the same location as my Galaxy...which in turn would allow me to bring up a browser, head on over to the Pogo maps, and use a much smoother and larger interface to track my location. I just can't get my browser to return the proper location. I'll have to do some more tweaking, but I figured I would throw this out there to see if anyone wanted to give it a shot. My ultimate goal is to have my laptop use my Galaxy's location in real time, then bring up the live Pogo maps, then use my Roku to cast my entire screen to my TV. That way I can just kick back and watch my location in Boston/Vegas/NY in real time as the little blue dot moves from area to area. I'm close...very close...
Edit: Found an app that does what I want. GPS Link. Install it in chrome as an extension, then install app on phone, boom. You can create a GPS party and link them all together then activate the extension on the PoGo map. This is awesome. I have a 55" map that follows my location in real time. | Hey r/dnd crew, I just got a pretty sweet new tablet PC with a fairly decent stylus. (Samsung Galaxy tab s3.) I'm curious if anyone out there uses something similar for drawing maps, and if so what app in particular do you use? | This MAP IS BEAUTIFUL! Bought it as a gift for a family member who travels a lot. When you get it in the mail it doesn't look like your standard push pin map which makes it all the better. | hey all, so i know that tracking projects having a hard time overcoming niantic's roadblocks, but i am wondering, if any apps like the pokemon go live map from github can still be used to map out pokestops, gyms, and spawn points? | So i have had this car about 4 month's now and the map is really out of i date. I have no clue how i can update it but from the little research i have done people say you can. | 1,999,901 | For the last... 8 years or so we were maintaining (or struggling to maintain, since we're a 2-3 person team who just does this for fun in our free time) native Android and iOS apps. Then last year we started from scratch with RN. Best decision we ever made! With two primary devs, it took us 14 months in our free time to build the app.
It's so much easier to roll out updates with RN, vs with native code. And I find it way more intuitive and pleasant to design the app in RN.
It's a mapping app, that shows you publicly-playable pinball machines (like, bars and laundromats that have machines you can play). The data is user-updated, and we have a strong userbase.
We used:
* Expo
* React Native Elements
* React Navigation
* React Native Maps
Github
app store
play store
website | Has anyone tried to build Native (Android) after RN? | My first React Native app is live! Things I learnt 🎉 | Reusing an open source application - practical experiences with a mobile CRM pilot | Better results with native samsung app ? | Building React Native apps using ClojureScript w/out iOS | Interested in developing blockchain apps using React Native | Acabei de lançar um curso na Udemy de React Native (Desenvolvimento para Android e IOS) | Any App developers here on the sub? |
1,999,902 | Things you'd like to see in Season 2? | I talked about this on another site, but what would you like to see next season? | i know season 2 hasnt been announced yet
i just want to know if anybody can speculate or make some ideas on what season 2 should be a about | I'm part of the way through book 2 and I'm all caught up on the TV show. Without spoiling anything, can anyone give an idea of what is to come in the next season?
I'm restless and I just need an idea of what I have to look forward to. Cheers. | I’m just curious about what is everyone’s favorite part of Season 2 and why?
I really love how Washimi and Gori band together and support Retsuko towards the end. We all need good friends like that! | I would like to give these items to an individual that has not played through the Half-Life 2 series. Please be honest with your request so I may spread these amazing works of art.
TO ENTER
___________________________________________________________
1) SteamID
2) Why Half-Life interests you, or when did you first hear about the sequel and what did you think about it?
3) Leave something funny, but wouldn't be appropriate to laugh at in public(optional)
I will make my choice in 24ish hours. | Hi Guys, Following the last post I am back with Season 2. With the feedback I got for last post I am referring as Notable Incidents, not plot holes ;)
| If you do want a season two what do you think could possibly happen in a second season for this show.
These were just some thoughts I had last night after watching the last episode. Like I liked the show and want a second season but I can’t possibly think WHAT a second season would even be?! | ... And I'm back in! I don't think I'm gonna bother watching the rest of season 2 because it doesn't seem to be the same show for all intents and purposes. There are a ton of new characters, in a new location, and the characters I remember are behaving so different they are practically new characters anyway.
Season 1 was great, but season 2 was way too meandering. How many plotlines like, say, Japan world might as well not happened? | 1,999,902 | Do we think there will be a Season 2? I was worried there wouldn't be due to backlash but I think after all the awards recognition there probably will be. What are some things we'd like to see?
I know I'd really love if they moved away from Tulsa and focused on another city. I also really want to see a Nite-Owl III, and maybe the government using masks again for spec-ops like how they used the Comedian. | will there be a season 2 of night manager? | will there be a season 2 of undone? | is there a 2nd season of the morning show? | After 4 years....should there be a TNT Olympics Season 2? | Which Kdrama do you think needs a second season? | Do you guys think Season 2 May be announced on Christmas/New Years? | 16 days until season 2! What are your hopes for the season? | Do you want a season two? Why or why not? |
1,999,903 | Great for rooms of any size | I have three of these, one for each room and they are great!!! | I like it for my grand daughters room .The size is perfect for a childs room. | Very roomie. Can fit a lot of clothes. Great price for good luggage. | For your sewing room it's great. Sturdier than I thought. I would not recommend if you would be changing the settings a lot, don't think it would hold up, set it and leave it alone....works for me. | It's a bit small for my little office. I had hoped it could handle my 6x10 room. It is decent but not what I expected. | This was a hit at my house. Small bedroom and it fit right in there. The girls use it for everything. Thank you Sooo much!! | This item is being used in a dorm room with a twin size bed and is just what we were looking for this space. | not to big not to small, really is perfect for the room size. | 1,999,903 | I bought this heater about 2 years ago, I love it! Works great in any size room - even in my 25'x27' living room. The timer on it is fantastic, you set it and if you accidentally fall asleep it automatically turns off when time is up. And because it has the option to oscillate, it warms up the entire room equally. | This is a fantastic heater! My office is usually around 65 in ... | I purchased this heater based on reviews of how great it worked | This heater is fantastic. Make sure to let it run for 24 ... | Awesome. Perfect for heating a bedroom-sized room | What a great heater! I like it so much I'm buying ... | THIS HEATER IS GREAT. MY APARTMENT IS 950 SQ | I love this space heater | Good Little Heater for Heating Up a Bedroom |
1,999,904 | How to get massive roots when cloning? | Hi! So I've been propagating my wandering jew (interesting name...) and it's growing roots like crazy. Multiple of my cutting have roots growing from multiple nodes.
In the picture you can see the roots growing from three points. Can I just stick the whole thing in the ground up to the top roots? I'm kinda scared the stalk will start rotting... Should I cut of the top roots and only put in the bottom ones?
| How do you work out cube roots? | clones to be sure that the desired DNA construct is obtained. This may be accomplished through a very wide range of experimental methods, including the use of nucleic acid hybridizations, antibody probes, polymerase chain reaction, restriction fragment analysis and/or DNA sequencing. Molecular cloning provides scientists with an essentially unlimited quantity of any individual DNA segments derived from any genome. This material can be used for a wide range of purposes, including those in both basic and applied biological science. A few of the more important applications are summarized here. Molecular cloning has led directly to the elucidation of the complete | Handmade cloning: recent advances, potential and pitfalls | Transformation (genetics) million bases). The length transferred is likely double stranded DNA and is often more than a third of the total chromosome length of 4215 kb. It appears that about 7-9% of the recipient cells take up an entire chromosome. The capacity for natural transformation appears to occur in a number of prokaryotes, and thus far 67 prokaryotic species (in seven different phyla) are known to undergo this process. Competence for transformation is typically induced by high cell density and/or nutritional limitation, conditions associated with the stationary phase of bacterial growth. Transformation in "Haemophilus influenzae" occurs most efficiently at the end | Up the Long Ladder left to start the colony. As this was insufficient to establish a stable gene pool, and the survivors were all scientists, they turned exclusively to cloning instead, and consequently no longer have any desire for biological reproduction. For almost three centuries, every Mariposan has been a clone derived from one of the five original colonists, and now the colony is in danger of dying out because of replicative fading: each subsequent generation introduces additional minor flaws in the genetic code, which within only a few more generations will make further clones nonviable. The Mariposans ask the "Enterprise" crew for samples | How cloning is done? | I thought it would be fun to make a thread for people to show off their ridiculous amounts of DNA. Whether it be the unfortunate roles of your epic incubators or just the hard core raptor farmers, I think it would be interesting to see what you guys have!
- my highest is currently lvl 15 stego at 15000 DNA | 1,999,904 | Ive seen it ever now and then like this where people have insane roots on fresh cuttings and i'm wondering how the heck are they doing it? I remember once someone mentioned bleach but i'm not sure about that. So what's the big secret?
edit: look at this crazy shit | How are folks digging the final cut? | Cuts through plant roots nicely. | What would you think of a Slice of Life Bleach? | what is pesquisa in bleach? | Cut very well and fast. Using water/trace of soap ... | Some fundamental aspects of bleaching | It literally looks like someone cut it by hand with crappy scissors | My mother in law doesn't know how she ever cut ... |
1,999,905 | Extracting model parameters from thermal transient measurements for thermal stress simulation | The requirement of electrical-thermal-stress (ETS) modeling of semiconductor devices demands the use of finite element analysis (FEA) for device simulation. In this work, we employ a new finite element analysis software, FEMLAB for the ETS simulation of power diode, a basic building blocking for power electronic devices. In this preliminary work, static electrical and recovery transient characteristics are considered. The E-T model of the power diode is compared with the results from Medici, and the T-S model of the power diode is compared with the results from ANSYS. Good agreement are obseved from the comparison. | Transient Frequency-Domain Thermal Measurements With Applications to Electronic Packaging | A stress pattern analysis by thermal emission (SPATE) technique for noncontacting stress measurement is discussed which has application to the evaluation of design concepts, the analysis of defects, and the monitoring of structural fatigue. The method is based on the principles of thermoelasticity, and it involves the IR detection of minute temperature changes that accompany stress changes. Equipment is described for producing calibrated full-field stress maps. Surface preparation for SPATE and methods for system calibration are discussed. 28 references. | Measurement of Transient Fluid Temperature in the Heat Exchangers | Framework for integrated dynamic thermal simulation of future civil transport aircraft | Accurate simulation of transient device thermal behavior is essential to predict CMOS VLSI circuit failures under electrical overstress (EOS). In this paper, we present an efficient transient electrothermal simulator that is built upon a SPICE-like engine. The transient device temperature is estimated by the convolution of the device power dissipation and its thermal impulse response which can be derived an analytical solution of the heat diffusion equation. New fast thermal simulation techniques are proposed including a regionwise-exponential (RWE) approximation of thermal impulse response and recursive convolution scheme. The recursive convolution provides a significant performance improvement over the numerical convolution by orders of magnitude, making it computationally feasible to simulate CMOS circuits with many devices. | The thermal response of the GMR sensor during the ESD pulse is investigated using finite element model. The simulation compares the transient temperature rise in GMR sensor when they are subjected to the Human Body Model (HBM) and Charged-Device Model (CDM) waveforms. The results indicate that the ESD threshold damage for GMR head depends on both the thermal time constant and the ESD transient current. | Recently, regulators have used irradiated reference temperature estimates as a screening criterion for pressurized thermal shock evaluations adding increased emphasis to the accuracy with which shift predictions as measured by the Charpy impact curve are made. Since the evaluation of the pressure vessel structural integrity is directly linked to the prediction of shifts in reference temperature, a closer review of the methods used to model these predictions was required. | 1,999,905 | In this article it is presented how structural information and temperature distribution can be calculated from thermal transient measurement results. We show how the temperature distribution can be approximated from a time domain temperature transient using simple calculations and that not only the temperatures but the geometry of a three dimensional model can also be calculated from the thermal RC network. The identification method is demonstrated using the measurement results of a simple package structure and the source and magnitude of uncertainties are also investigated. | A Network Technique for Analysis of the Thermal Transient Casting Process | Accurate measurement of interface thermal resistance by means of a transient method | Inclusion of RC compact models of packages into board level thermal simulation tools | Characterizing materials with spatially varying thermal conductivities is significant to unveil the structure-property relation for a wide range of functional materials, such as chemical-vapor-deposited diamonds, ion-irradiated materials, nuclear materials under radiation, and battery electrode materials. Although the development of thermal conductivity microscopy based on time/frequency-domain thermoreflectance (TDTR/FDTR) enabled inplane scanning of thermal conductivity profile, measuring depth-dependent thermal conductivity remains challenging. This work proposed a machine-learning-based reconstruction method for extracting depth-dependent thermal conductivity ( ) directly from frequency-domain phase signals. We demonstrated that the simple supervised-learning algorithm kernel ridge regression (KRR) can reconstruct ( ) without requiring preknowledge about the functional form of the profile. The reconstruction method can not only accurately reproduce typical ( ) distributions such as the pre-assumed exponential profile of chemical-vapor-deposited (CVD) diamonds and Gaussian profile of ion-irradiated materials, but also complex profiles artificially constructed by superimposing Gaussian, exponential, polynomial, and logarithmic functions. In addition to FDTR, the method also shows excellent performances of reconstructing ( ) of ion-irradiated semiconductors from TDTR signals. This work demonstrates that combining machine learning with pump-probe thermoreflectance is an effective way for depth-dependent thermal property mapping. | Accurate knowledge of temperatures in power semiconductor modules is crucial for proper thermal management of such devices. Precise prediction of temperatures allows to operate the system at the physical limit of the device avoiding undesirable over-temperatures and thus improve reliability of the module.Commonly used thermal models can be based on detailed expert knowledge of the device's physical structure or on precise and complete temperature distribution measurements. The latter approach is more often used in the industry. Recently, we have proposed a linear time invariant state-space thermal model based on a compartment representation and its identification procedure that is based on the Expectation-Maximization algorithm from incomplete temperature data. However, the model still requires to measure temperatures of all active elements.In this contribution, we aim to relax the need for all measurements. Therefore, we replace the previous dark gray-box approach with a structured compartment model. The structure of the model is designed by a mesh-based discretization of the physical layout of the module. All compartments are assumed to share parameters that are identified from the data of the measured elements. Temperatures of the unmeasured elements are predicted using the shared parameters.Identification of the parameters is possible only with suitable regularization due to limited amount of the data. In particular, the model tightening is accomplished by sharing parameters among compartments and by constraining the process covariance matrix of the model in this contribution. Applicability of the proposed identification procedure is discussed in terms of growing state-space and therefore speeding up of the identification algorithm is suggested. Performance of the proposed approach is tested and demonstrated on simulated data. | Software for transient and thermal load analysis | Fluid temperature measurement under transient conditions | The theory of thermal regular regime and its application to the determination of thermal characteristics |
1,999,906 | Wich part of the eye allows light to enter? | What part of the eye prevents light from scattering? | What part of the microscope controls the amount of light entering? | What part of the microscope controls the amount of light entering? | What part of your eye absorbs light energy? | How the part of your eye work? | What are the parts of eyes? | What part of the eyes is light finally fouled on? | What system does eye belong to? | 1,999,906 | What structure allows light to teh enter the eye? | What part of the eye is light finally focused on? | What is the layer of the eye that absorbs light? | How do human eyes respond to light? | How is light formed in the eye? | Where in the eye is light perceived? | What is the thing in your eyes that lets us see color? | What part of the eye prevents scattering of light? | What structures regulates the amount of light passing to the visual receptors to the eye? |
1,999,907 | Reddit, are there any websites where I can list the ingredients I have and it will match me with some recipes? | What are the best websites for yummy recipes? | I used to use this website years ago, but I can’t find it anymore. Everywhere I search is a join site or find irrelevant recipes. It was great when you have random ingredients and can’t go out and spend on groceries. | hey guys, i have been doing some research and i have found that a subreddit that let's you ask for recipe suggestions on the ingredients you already have in your house, like giving people a food audit list and having them suggest possible ingredients based off that list.
so i did some research and found
r/askculinary won't let you ask for recipe suggestions they tell you to post on r/recipes
r/recipes won't let you post a question or text, i will only let you post a picture of what you made
r/recipe same thing as r/recipes
and i can't find a specific subreddit dedicated to asking for recipe suggestions based on what you already have, and i wanted to ask you guys if there was any subreddits dedicated to something specifically like that, thank you. | Hi guys, after getting tired of scrolling through all the recipe websites out there, I decided to create one of my own:
You can input the ingredients you have in your kitchen, and the site recommends recipes. It also proposes food combinations if you are searching for inspiration. This way, you can find recipes based on only what you have available without needing to run to the store.
As an added bonus, you can customize the search results based on allergies, food restrictions, and dislikes. Feedback would be much appreciated! | If you want to find recipes with the ingredients you have in your kitchen, there's about thirty websites that will help you. Unfortunately, they're all mostly terrible. All they can really do is find recipes that happen to have ingredients you selected. There's no intelligence behind the decision. As the top comment on a recent thread pointed out, these websites rarely come up with recipes you'd actually be able, or want, to cook.
For a long time I've wanted to create a better version of a "find me a recipe" app. While there's no chance of me finishing it before this virus goes away (although the way the doomsayers talk, you never know), I would like to have it completed before the next world stopping virus comes along.
So I'd like to ask, what would you like to see in an app to find recipes based on ingredients? What has been your major troubles with the many sites already out there that claim to do the exact same thing? | Looking for specific recipe recommendations? Post it here!
Please keep original comments to requests so it's easier for people to find those who want help! | Exactly what I was looking for! It will be lots of fun making these recipes... | Is there a website that you prefer when buying your ingredients or recipe kits? Are some places cheaper or have higher quality ingredients? Are there any companies you swear by? I'm in the US, if that makes any difference.
EDIT: Thanks for the help everyone! | 1,999,907 | I'm 19, poor and I always find myself wanting to eat something more than two-minute noodles or toasted sandwiches. Are there any websites that will give me a list of recipes after I list the ingredients I have?
**EDIT: TIL I learned Google is a great search engine.
But I definitely appreciate suggestions from Redditors more than any search engine!** | simple recipes with easy to find ingredients | How can I add additional ingredients to meals? | Quick and easy meal prep recipes for work? | Which websites have food recipes? | I've got a microwave and a fridge/freezer and I don't like bread or pasta. Need help with meal ideas! | I'm a college student who spends way too much
eating out... what quick, easy, and inexpensive
recipes (that taste good) do you know? | Any paleo meal plans online or created by redditors available? | Does anyone know any good lowcal frozen meals? |
1,999,908 | Application of Swales' model in research papers by non-native authors | This study is a productivity review on the literature gleaned from SSCI, SCIE databases concerning the TRA and TAM of Web of Science created by ISL The result indicats that the number of literature productions on TRA and TAM is still growing. The main research development country is the United States, and from the analysis of the distribution of language, English is the most popular language for TRA and TAM literature. Moreover, by applying bibliometric techniques (Lotka's Law, Price's Law and 80/20 Law), this study investigated literature growth and author productivity from 1982 to 2009. The research findings show that a relatively large percentage of authors (82.48%) contributed only one article, which is a much higher percentage than the 60% found in Lotka's original data. According to the K-S test, the distribution of frequency indexes of author productivity match Lotka's law, but Price's Law and the 80/20 Rule don't apply to this study. | Part 1 - General plagiarism issues.- What is plagiarism?.- Differences between Anglophone and non-Anglophone journals.- Publication in more than one language.- How not to deal with it: a case study.- Part 2 - Discipline-specific plagiarism issues.- Biosciences: Replication of Methods sections.- Computing and Electrical & Electronic Engineering: republication of conference papers.- Part 3 - What to do about it.- Promoting awareness of publication ethics.- Avoiding plagiarism as an author.- Detecting potential plagiarism.- Dealing with plagiarism as an editor. | This work provides information about the use of Sebera Equation in the calculation of permanence index of paper documents based on simulations that include relative humidity and temperature changes, being an useful tool to predict the long-term life of paper documents in libraries, museums and archives. | Use of Electronic Journals through UGC-Infonet Consortium by the Research Scholars of Sri Venkateswara University, Tirupati A Study | Starting from the present situation of the lower use rate of the paper-based foreign periodicals in USTC,the article makes an analysis of the causes of the problem above-mentioned,and advances some relative measures. | This paper through that citation of a general equilibrium theory in econometroics,will carry out analogy that both the science and technology innovate degree and market price,analogy that both the science and technology achievement repeat curve and the demand curve,bring forward that a general equilibrium theory of the science technology innouvtion.Hence,it with both the rate of thesis repeat curve and the rate of thesis adduction curve has necessarily exist a crossing in coordinate and that formed a equilibrium in certain state.Accordingly,we can make certain the science innovation degree in scientometrics. | The analysis of the modern native scientific-pedagogical online periodicals (there are concurrent, integrated and original) are represented in this article. Their structure and their informational renewal, advantages and disadvantages as the manner of scientific-pedagogical communication are observed. | The statistical analysis on the manuscript submission and acceptance situations of Anhui Agricultural Sciences was made from 2006 to April 2009,and the causes of total articles changed and acceptance rate decreased year by year were analyzed. | 1,999,908 | This paper reports the investigation of the organisational structure of introductory sections of research papers written by Polish authors in English and Polish. The aim of the study was to test whether in view of cultural differences, reflected in the Anglo-American and Polish intellectual styles, the rhetorical pattern of research papers would vary between the two cultures. The selected texts were analysed in terms of Swales' Creating a Research Space (CARS) model (Swales 1990). On application of the model in the analysis of articles from the English corpus, it was found that it could only be employed in very generic terms. The analysis of the Polish corpus revealed that the Variation between Anglo-American and Polish schematic patterns was too significant to justify the implementation of the same investigative tool. | the empirical study of literature is particularly relevant to | Although it is a very small part of the research paper, the title plays an important role as the first point of contact between writer and potential reader and may decide whether or not the paper is read. Research paper titles in the widely differing fields of science, literature and linguistics are studied in detail with a view to showing what researchers from each discipline implicitly feel are important features in the succinct knowledge transmission required in title design. Three basic types of titles in the three disciplines are analyzed: full sentence, compound and a remaining group made up largely of noun phrases with or without postmodification. Very clear-cut differences in frequency and form were found across the three disciplines reflecting fundamental differences in pragmatic intention inherent in the disciplines concerned. Analysis focusses on the role of titles in informing the reader as to what the paper is about and also in attracting him/her to read the paper. Discussion of how these functions are met rests on techniques involved in both information packaging and advertising. | An Analysis of Academic Rules of Literary Research | what is the difference between basic and applied research sociology quizlet? | Little is known about what an apprentice scholar in a non-Anglophone context undergoes when writing a research article for publication in English-medium journals. This study highlights “a rich notion of agency” by examining a nonnative-English-speaking graduate student's engagement with his community of practice (Lave & Wenger, 1991; Wenger, 1998) as he wrote the first draft of an article in chemistry. The primary data were the student's process logs, his developing text, and his Bulletin Board System message exchanges and post-hoc interviews. The study illustrates the apprentice scholar's engagement with the local research community, the laboratory data, his own experience/practice of writing research articles (RAs), and the global specialist research community. His engagement with the global specialist research community includes a critical orientation. The article also points out the value of providing EAP pedagogical support for the critical perspectives that students like Yuan adopt, and it calls for the training of EAP-qualified professionals in non-Anglophone contexts. | Research in Linguistic Engineering: Resources and Tools | A Case Study of Swedish Scholars' Experiences with and Perceptions of the Use of English in Academic Publishing. | Metadiscourse in Research Article Abstracts: A Cross Lingual and Disciplinary Investigation |
1,999,909 | My 3 year old loved playing with this ball | My 3 1/2 year old loves this. Although he broke the ball off the other day, we just hot glued it back on and still works. | We bought this for our 3 yr old & 5 yr old. Great all purpose ball for out door fun! | My kid LOVES this ball and so ........I couldn't be happier. | My 5 month old loves this ball. She tosses it around and gets super excited when she sees it. | I bought this for my 3 month old grandson and he has a ball playing the piano with his feet. | glad i got the football instead of plain round ball!
my 4 month old loves it!!
you can see the excitement in his eyes when i hand it to him. | My 2 grandsons love playing with this ball. Great bounce and easy to find if it gets tossed into bushes. | I bought this as a Xmas gift for my 3-year old nephew and he LOVES it. I was unable to see him, but his mom tells me he won't stop playing with it, so I'm happy! | 1,999,909 | My 3 year old loved playing with this ball. The glow in the dark feature is ok. It glows a little. | Ball is great but the glow in the dark is not so ... | My 2 grandsons love playing with this ball | This ball is adorable! My daughter loves it and so do all ... | Its very ok&my kids loved it, ball came with it but the inflatable ... | Awesome ball for my 2 year old | what is the name of the kid's happy fun ball | Both my 3 year old and my 10 year old love this adorable kangaroo hopper ball | This is by far the coolest glow football. My ... |
1,999,910 | during which war was alexander stephens known as 'the sage of liberty hall | Alexander Hamilton Stephens (sculpture) Alexander H. Stephens is a marble sculpture commemorating the American politician of the same name by Gutzon Borglum, installed in the United States Capitol as part of the National Statuary Hall Collection. The statue was gifted by the state of Georgia in 1927. Stephens earned his place in the National Statuary Hall Collection by being elected to the US House of Representatives both before and after the Civil War and serving as the Vice-President of the Confederate States of America. At the unveiling of Stephen's statue on December 8, 1927, William J. Harris said of him, | Half King's Rock on May 27, 1754 when he learned of a nearby French encampment and sent word urging an attack to Washington at the Great Meadows, about five miles (8 km) east of Chestnut Ridge in what is now Fayette County, Pennsylvania (near Uniontown). Washington immediately ordered 40 men to join Tanacharison and at sunset followed with a second group, seven of whom got lost in heavy rain that night. It was dawn before Washington reached the Half King's Rock. After a hurried war council, the English and Tanacharison's eight or nine warriors set off to surround and attack | Liberty Road (France) 1146 Milestones. The design of these Milestones is symbolic: The Flaming Torch of Liberty, emerging from the sea, is carried eastward. Along the circumference of the Milestone’s dome-shaped top, the 48 stars representing the (then) 48 United States which took part in the Liberation of France. The “Liberty Highway” was officially opened on September 17, 1947 at Fontainebleau, by Mr Paul Ramadier, then President du Conseil, in the presence of Mr Jefferson Caffery, United States Ambassador to France and members of the American Legion. Many military and civilian dignitaries of the Allied Nations were also present at the ceremonies. President | Can you go inside the liberty? | Island, "Liberty", away on a supply run, escaped the fate of most of Arnold's fleet, only to be destroyed the following summer as Burgoyne marched south. Online resources Further reading USS Liberty (1775) USS "Liberty" was a schooner built at Skenesboro, New York, on Lake Champlain, for wealthy landowner and former British Army Captain Philip Skene. It was captured on 11 May 1775 during a raid on Skenesboro led by Capt. Samuel Herrick, an early action in the American Revolution. Originally named Katherine, she was renamed "Liberty" to honor the patriot cause. She sailed to Fort Ticonderoga on 13 May | replace the American flag that flies over the cemetery with a new one. This is the only time of year the family plots, behind two locked gates and fenced off from the public cemetery, are open to the public. The inscription on Butler's monument reads, "the true touchstone of civil liberty is not that all men are equal but that every man has the right to be the equal of every other man—if he can." Benjamin Butler Benjamin Franklin Butler (November 5, 1818 – January 11, 1893) was a major general of the Union Army, politician, lawyer and businessman from | married four times: Following years of ill health, he died on 12 November 1995 at the age of 64 due to complications during surgery, eleven months after having been knighted. Robert Stephens Sir Robert Graham Stephens (14 July 193112 November 1995) was a leading English actor in the early years of Britain's Royal National Theatre. He was one of the most respected actors of his generation and was at one time regarded as the natural successor to Laurence Olivier. Stephens was born in Shirehampton, Bristol, in 1931. When aged 18, he won a scholarship to Esme Church's Bradford Civic Theatre | Battle of Liberty Place B. Penn made a proclamation calling on the militia of the state to assemble "for the purpose of driving the usurpers from power". Frederick Nash Ogden was appointed provisional general of the "Louisiana State Militia" (here representing the White League) by Penn and a statement was made to blacks in Louisiana that their rights and property should not be harmed. Already by 3 PM armed men were stationed at the intersection of all streets on the south side of Canal Street, from the river to Clayborne street. At 4 PM, a body of Metropolitan Police with cavalry and artillery, commanded | 1,999,910 | Alexander H. Stephens American Civil War, he counseled delay in moving militarily against U.S.-held Fort Sumter and Pickens so that the Confederacy could build up its forces and stock resources. In 1861, Stephens was elected as a delegate to the Georgia Secession Convention to decide Georgia's response to the election of Abraham Lincoln. During the convention, as well as during the 1860 presidential campaign, Stephens, who came to be known as "the sage of Liberty Hall", called for the South to remain loyal to the Union, likening it to a leaking but fixable boat. During the convention he reminded his fellow delegates that | who did stephens speak to during the civil war | who did stephens and toombs support in the georgia platform | when did stephen heard became the president of georgia | benjamin lincoln was the secretary of war for which state | who was the president of the marshall confederate confederate confederate | when was the first city hall built in macon georgia | who was the president of the georgia national bank | who was the city hall in macon georgia |
1,999,911 | it's well made and looks nice. | Very well made. Attractive. Serves the purpose well. | It's well made, fits almost like a glove and is a different and fun color. I love it! | I'm sure this is made well, but it is very, very small. A lot smaller than I expected and in my opinion, too small for the price. I sent it back. | Very well made,was very Happy with my purchase | Nice and very well made I thought it was expensive when I first saw it on line , but it is well worth it . | Well made. Good materials. Excellent fit. Well worth the price. Highly recommend. | Very well made. Purchased as gift for my grandson. He really likes this. | Well made. Perfect design for my needs. Sturdy and comfortable! | 1,999,911 | outside the fact it will not hold a bottle of Gink(without tape), it's well made and looks nice. | Durable bottle holder that will last | How long can you keep an open bottle of gin? | It is a nice bottle opener but was much bigger than expected | I was very pleased with how well it holds different size bottles and ... | It's a water bottle. It is wider than the ... | the gummy material is great = provides a nice "tacky" surface to keep the ... | Very nice Bottle Vase | I like this bottle holder |
1,999,912 | Free Evening and Morning Power? | Transitions into and out of daylight saving time compromise sleep and the rest-activity cycles | I work a midnight shift. My only free hours are from midnight to 3am. It gets kind of lonely, but I'm done just playing video games.
Is there any good way to use this time? Ideally something other than education (I will be approved for work paid education down the road so I don't wanna waste money now) | Hour of Power Hour of Power is a weekly American Christian television program formerly broadcast from the Crystal Cathedral in Garden Grove, California, a cathedral that is now a Catholic church. The program is currently broadcast from Shepherd's Grove. The program was founded and first hosted by Robert H. Schuller. It is currently hosted by Bobby Schuller, who is Robert H. Schuller's grandson and the son of Robert A. Schuller, himself a former host. It was also once hosted by Sheila Schuller Coleman, a daughter of Robert H. Schuller. The program is normally one hour long, but some networks broadcast | The scientific concept is 'circadian rhythm' - basically you have an inner clock that gives you a sense for the time of day. Unfortunately for most people, the inner clock is not set to 24 hours exactly. If you have a short circadian rhythm, you are likely a morning person because your subjective days are shorter and don't require that much sleep - on the other hand a long evening will feel wrong for you much quicker. With a longer circadian rhythm you are likely an evening person. Your rhythm demands a longer night than reality can provide, so you will rise late and/or fight drowsiness. You can go much longer in the evenings though because in your rhythm barely a part of the day has passed. | The Waking Hour The Waking Hour is the only album by English band Dalis Car, the side project of Peter Murphy of Bauhaus and Mick Karn of Japan. It was released in November 1984 by record label Paradox, which was created specifically to release the record (it was later reissued on Beggars Banquet). The album's cover is the painting "Daybreak" by Maxfield Parrish. "Trouser Press" wrote: "As a mellifluous noise, "The Waking Hour" is fine, if a bit heavy on the bass; dig any deeper, however, and what you get is a hollow attempt to create art without any redeeming | What kind of energy do you have when you sleep? | Hi,
I feel like I am performing better in the evening than in the morning (8:00 AM vs 6:00 PM). Usually, I exercise on my Smarttrainer after work in the evening. However, during holidays or weekends, I usually do morning workouts.
I saw that most people perform better in the morning than in the evening. In my case however, I push more watts at a lower heart rate in the evening than in the morning, while also feeling better - it just feels easier.
When I work out in the morning, I try to eat at least one hour before working out (porridge & banana). When working out in the evening, I usually eat a banana at 4:00 PM after having had lunch at 12:00.
Anybody in the same situation?
many thanks in advance | I much prefer the simplicity of Night Clock to the presence of AOD. Is there any way to have Night Clock run all day rather than just 18 hours in the day?
Thanks. | 1,999,912 | Hey guys. I just moved into a 1 bedroom apartment and signed up for a free evenings and mornings energy plan through TXU. Basically my power is free from 7pm to 10pm and 7am to 10am. I know to only use my laundry machines and dishwasher during those times but what else can I do to take advantage of this free power?
[edit] thanks for the advise guys! I never would have thought about the battery stores or the water heater! | Best Ways to Save Home Energy & Free Tips to Save Gas 2008! | Paying for electric when I'm not at home more than 4 days a month | 15 hours in and only have my power automated. Help? | I am tired of paying so much for normal heat and power. Reddit, what systems can I put into my house to help save money on heat and electricity. | 5 ways on how to conserve electricity? | How can I utilize free electricity and an empty room for mining? | What way save energy in a home or in a large company? | Lowering my utility bills! |
1,999,913 | what kind of hot dog is krystal | Which dog breed begins with the letter k? | A couple of months ago I rescued a then 4-month old dog who was found wandering around the streets of a town in Croatia. I thought she was a German Shepherd mix until a few days ago. Someone told me that my dog looked a lot like her old Kelpie.
My dog is a mix so its obviously going to be hard to say. But has anyone seen a Kelpie that looks like her?
Pics here: | What breed is ashleys dog maui? | Here's another cool thing about Five Guys: they're a burger joint that serves hot dogs. And not just any hot dogs: these are all-beef, kosher, premium franks from Hebrew National. Note that hot dogs are cooked on the same grill as beef, so although the dogs are kosher, the way they're prepared is not. | What does a double dapple dachshund look like? | Wire haired dog similar to Airedale but smaller? | There is a breed of dog called an Akita. Maybe her akita's name is Evita. If not that, I have no idea what you are talking about. | Can dogs eat eggs and hot dogs? | 1,999,913 | Krystal (restaurant) with reported customer satisfaction and an evolving menu. Krystal's product line centers on a square hamburger patty slider with a steamed bun, together with diced onions, pickle, and mustard, and collectively called a "Krystal". Small hot dogs called "pups" are also featured menu items. The chain has occasionally expanded its menu to include larger burgers, such as the "Big Angus Burger," a full-size hamburger made of 100% Angus beef. Krystal is known for a diverse breakfast menu, which includes a made-to-order country breakfast, meat and egg sandwiches, and biscuits, as well as other items. One particularly popular breakfast item is | what was the name of the krabby patty restaurant | Variety for Breakfast | kurkure is a popular snack originating from which country | what is the name of the eating contest held at krystal restaurants | what is the name of the breakfast sandwich at colombian mcdonalds | Best weekly lunch specials (e.g. Kid's half price burgers on Tuesday) | Breakfast sandwich variations? | how do you eat small fancy food |
1,999,914 | Is this a queen ant? It was crawling on my kitchen floor, so I have no idea why it would be there...help? | This is an exceptional product and gets rid of the queen carpenter ants at a much better price the the hardware store. | Its been over 3 weeks now, and there are still ants... granted, not as many, but I would've thought the queen and all her soldiers would be at an ant farm in the country by now. | Today I was looking at my Formica sp. colony and noticed the queen lying on her side. I panicked and rolled the test tube to check if she was alive, which thankfully she is.
Is this normal ant behavior? I provided them a constant source of honey and a bit of protein here and there. If protein is necessary for ant survival (and not just reproduction) then I realize my error. Otherwise, how can I correct this problem?
Edit: I realized that their tube has been without water for a while, and since there's another tube in their outworld with a source of water, I assumed they would eventually move in. This has not been the case. I injected some water into their setup to hopefully revive the queen, but I'm worried that there's no going back. Is there a chance that my queen can recover? | Carpenter ant queens measure about 13 to 17 mm in length and, depending on the species, are dark brown, yellow, red or black in color. After mating with the male carpenter ant, the queen sheds her wings and looks for a new nesting site for her young. The queen prefers moist and rotten wood to establish a new colony. | I remember that the site for the comic has a green background and the artist would update Monday through Friday with daily web comics. I thought it had the word "Ant" in the title, but I can't find it at all. Seaching for "Ant web comic" isn't returning what I'm looking for.
I think the ant represents the author of the comic themselves. | Can anyone give me some tips on finding a queen ant? I’m from Asia, please help :D
Thanks in advance | My car was parked under some oak trees and as I went to open my door, I walked into a web. I then noticed this half dollar sized spider is crawling on my car. Unfortunately I did not get to snap a picture because it kept moving and I was afraid to get too close. It was orange-ish or tan in color, and the two front legs seemed to be longer than the rest. I’m sorry if this isn’t enough information ID. I’ll be more than happy to answer questions to the best of my abilities. Thank you all! | Formica aerata, the grey field ant, is a species of ant in the family Formicidae.
References
Further reading
aerata
Articles created by Qbugbot
Insects described in 1973 | 1,999,914 | *edit 2* Solved! It's an oil beetle!
*edit* I'm an idiot and linked wrong, here's the album:
As the title said, I found it casually strutting across my kitchen floor. it has the head/torso of an ant, but the butt of it (sorry, complete clueless about insects) is large and bulbous. She's very, very black and on her back there almost seems to be a small imprint of wings, or maybe even a very small set of wings that aren't in use anymore.
I'd love any help in identifying it, so I can know if I should be concerned that it was in my house. It did rain today, and sometimes odd bugs find their way into the house when that happens.
*sorry for the quality of the pictures, iPods don't take great pictures, especially up close :/ | What kind of beetle is this? | Help wanted identifing type of insect sting! | [whatsthisbug] Beetle with a cool pattern on its back! | Flour beetle | what is the sex of the insect with wings | Chestnut-crested antbird | Black bug with two orange stripes on body? | Potato bug |
1,999,915 | Can anyone explain what just happened? I ordered Pizza delivery from Dominos and the other place at the same time. | It took them two hours to deliver it, then when the guy came he insulted us for being gay and threatened to call the police on us because we were angry. Pizza Hut refuses to answer us on Twitter, and we're honestly afraid he might have tampered with the pizza. It tastes very off and is inedibly dry. We don't have the money to just be buying food like that, pizza is a rare treat for us... | What happens when someone doesn't pick up a pizza they ordered, or someone prank orders pizza? What happens to the pizza/who pays for it/is there a "prank pizza" budget for each store? COMEON WITH THE DETAILS! | We pre-ordered 10 pizzas for our kid's birthday party today. Costco just called us and let us know their food court doesn't have power so our order was cancelled. :(
Time to scramble to find pizzas for noon today. | Domino's Pizza is a well-known pizza chain that many people like to order from. If you want to order their pizza online, this article is for you! | This is kind of interesting, today I ordered a pizza off skip the dishes for what I thought was a new place called Zippys New York Pizza. When I went to go pick it up, it wasn't there, it wasn't even nearby. Zippys pizza does not physically exist. All it is, is Birminghams opening a skip the dishes page as a "new" pizza only focused restaurant when it in fact isn't, its just Birminghams. After confusion of where the hell to go for pickup, I contacted skip support which refunded me about 30 mins after the order was complete. After I saw the facebook page for Zippys references delivery only so there is a kink on skip's end for accepting pickup orders, or, on Birminghams side that allowed me to order for pickup.
When it is indeed delivery no one would ever know Zippys isn't its own restaurant and rather is a way for Birminghams to increase pizza sales
Zippys FB page
Zippys skip page (Note address)
Birminghams skip page (Note address)
This is really bizarre, I didn't want to order from a "pub everything food" place with a 12 page menu, I wanted to order from a restaurant specifically dedicated to pizza | Dominos 50% off any pizza ends today. Only good if you order online! | I got an order for a pizza place not too far from where I was, but took me about 10-12 minutes to get there because of traffic. When I get there they say "oh I just put the order in so it will be about 20-25 minutes" I immediately try to unassign and it won't let me saying it's too late to auto unassign, so stupid. It took the support person nearly 25 minutes to unassign me. I literally drove home and was sitting in my house for almost 15 minutes before they finally unassign me. Support is just absolute trash but that's nothing new here. | Lost two packages delivered to my front door yesterday, wonder anyone else experienced this recently? | 1,999,915 | My friend and I wanted pizza but we wanted it from two different places so just to be silly I ordered delivery to the same address from both places, Dominoes first, then Pizzahut about 2 minutes later.
Just to be weird and see who gets theirs first.
Anyway, Pizzahut got theirs delievered first, no big deal. But then I wait for dominos... no show... wait longer, check online, it says it's already been delivered!
So I call up the number on the dominoes website to see what's going on... rep says something like "Oh, I'm sorry, I know exactly what happened. It looks like we got two deliveries to the same house. I will refund your order and get a new one out to you, but it will be 30 more minutes."
I politely said OK thank you.
...30 minutes later, Dominos guy comes by with the pizza, hands it to me, says thank you and runs off without a receipt or chance to give him a tip.
What just happened? And how did the person on the phone know about both orders from two different companies? | Just got an order for a customer who claimed I didn’t deliver last time? | Help! Pizza hut manager got my info with orders and is texting me! | Order Domino's Pizza Online | Am I screwed if I didn't mail order? | Received a call saying my package had been seized? | The staff of Domino's Pizza have spent the last 20 minutes 'quality checking' 2 pizzas. | Anyone else have a consistent problem with Dominos forgetting sauces no matter what location? | Do I have a lawsuit against Domino's pizza? |
1,999,916 | Alright, let's stop with the inception threads | The thread is a Twitter thread and includes helpful pictures for each tip.
Thread Begins Here! | My experience with Gutermann threads has always been good. | A CNN-RNN Framework for Image Annotation from Visual Cues and Social Network Metadata | Just started it. Thread was already separated, which is great. Color numbers appear to be DMC, which means no worry if I make a mistake and run short. | |Thread Link|r/pics: Well, I guess I know what I’m going to look like when I’m old.|
|:-|:-|
|Thread Author|u/randokomando|
|Num Reminders|661|
|Reminddit Summary|link|
Use this thread to continue reminder discussion when thread is fucked, or you want to announce yourself to others. e.g. Did OP deliver or was OP correct?
50% of Remind Times are between **2020-11-19 00:00:00Z**]( 00:00:00Z) and [**2070-03-19 15:14:15Z**.
|Remind Time Summary||
|:-|:-|
|First Reminder Created|**2020-03-19 16:38:44Z**|
|Time To P25|8 months|
|Min|**2020-11-01 16:38:44Z**|
|P25|**2020-11-19 00:00:00Z**|
|IQR|49.3 years|
|P50|**2070-03-19 15:14:15Z**|
|P75|**2070-03-19 15:14:15Z**|
|Max|**2070-11-19 00:00:00Z**| | Use this thread to talk about anything you want, Untappd related or not. | Can we just stop with the endless 'Michael Jackson' "memes"... It's been posted 20 000 times already. | Do you have a rant or rave that you want to get off your chest but didn't feel like submitting your own thread for? That's totally fine! Go ahead and post it here. That way we can all rant and rave about it with you! | 1,999,916 | Within the past couple of hours, I've been noticing threads with a title such as 'triple inception' and a simple screenshot of the same screenshot in one handed mode, or a screenshot of the same screenshot of the same screenshot in one handed mode.
Alright, it's cool and clever, but do we really need all these threads? I've made rants before about things like home screen threads and they all get downvoted loads because I should apparently 'chill out and let people have fun', but I am chilled here, and what's the fun in taking a screenshot of a screenshot, etc just to get upvotes?
If I get downvoted loads on this thread then it just proves that the majority of users in this subreddit either like or don't mind these types of posts. So you're cool with this sub being spammed? Alright then.
Let's think. This is just like the 'I GOT ANDROID PIE ON SUCH AND SUCH CARRIER!!!!!' or 'look at my home screen, it looks good right, and it totally deserves an individual thread' flood of posts. Even though I personally think that those threads are useless and should be banned, they do kind of have a purpose. Even if it's not a very big one, they still have a purpose. The inception threads? Nah.
The first couple of inception threads weren't much of an issue. A couple of users who recently stumbled upon this neat little trick decided to post about it on this sub. But the threads after that, do we really need them? No.
If I wake up tomorrow and these threads are still being made, I'm going to PM the moderators of this sub and ask them to do something about it.
Thanks for reading. This may take you 1 minute to read but it took me 10 to write. So please read it thoroughly and consider my points before you just go ahead and downvote this. | [Discussion] Tips and Help on catching thread | A request to the mods about post game threads. | Mods, Can We Pretty Please Get A Daily Discussion Thread? | [Meta] Mods, can we have a thread dedicated to 'I got in!' posts? | Is it too much to ask for a ME:A opinions megathread? | Hey mods are we going to create sticky threads for the show? | Could we get a mega thread for all the drama/outrage/complaining? | Please help move LT thread titles to this forum |
1,999,917 | Bulk ultra-fine-grained (UFG) materials produced by severe plastic deformation (SPD) usually have high strength but relatively low ductility at ambient temperatures. This low ductility is attributed to insufficient strain hardening due to an inability to accumulate dislocations. For a singlephased UFG material where dislocation slip is the primary deformation mechanism, a long-standing fundamental question concerns the feasibility of developing microstructures that offer high ductility without sacrificing strength. The answer appears to be positive because there are some isolated examples where excellent mechanical behavior has been observed. Nevertheless, the structural features contributing to high strength and good ductility remain undefined, and this lack of understanding has hindered the search for effective procedures to simultaneously improve the strength and ductility of UFG materials. Here, we report a new process in which high ductility is achieved without sacrificing strength by plastically deforming UFG Cu in liquid nitrogen. The enhanced ductility is attributed primarily to the presence of a high density of preexisting deformation twins (PDTs) and also possibly to a large fraction of high-angle grain boundaries (HAGBs) formed during cryogenic processing. We conclude that this procedure provides a new strategy for increasing the ductility of UFG materials without any concurrent loss in strength. Strength and ductility are often mutually exclusive, i.e., materials may be strong or ductile but are rarely both. This also applies to bulk UFG materials. The low ductility of UFG materials has invariably limited their practical application and, accordingly, much attention has been paid to the development of strategies for improving this poor ductility. For singlephase UFG and nanostructured materials, several of the reports documenting high ductility and strength describe experiments on Cu where the stacking-fault energy is relatively low. In some investigations the high ductility was attributed to the development of a bimodal grain size distribution or pre-existing growth twins (PGTs), but in other investigations the reasons for the high ductility were not clearly defined. In practice, however, a bimodal grain size distribution must sacrifice some of the strength gained from nanostructuring. Another challenge is the need to fabricate UFG materials in large bulk form suitable for structural applications. This requirement has been hindered because the evidence suggests that PGTs occur only in electrodeposited thin films of nanostructured Cu, and in nanocrystalline Cu by inert-gas condensation (IGC) followed by compaction. However, the ductility of IGC-prepared nanocrystalline Cu is very low. The objectives of this study were twofold: First, to develop a procedure for increasing the ductility of large bulk UFG Cu without incurring any significant loss in strength. Second, to evaluate the mechanism contributing to high ductility in UFG Cu. A pure Cu (99.99%) bar was initially processed by equalchannel angular pressing (ECAP) to produce a UFG structure (hereafter designated the UFGECAP sample), then cryodrawn (D) to a reduction in area of ca. 95%, followed by cryorolling (R) with a reduction in thickness of ca. 96% (hereafter designated the UFGECAP+D+R sample). Figure 1a shows that the UFGECAP+D+R sample has superior mechanical properties compared to the UFGECAP sample. The UFGECAP Cu sample has a 0.2% yield strength of ca. 410 MPa ( ), which is significantly higher than the value of ca. 40 MPa in coarse-grained (CG) Cu. In addition, necking occurs rapidly after the stress reaches a maximum value, yielding a uniform elongation of only ca. 1.3% and an elongation to failure of only ca. 5.9% in the UFGECAP sample. By contrast, the yield strength is increased to ca. 500 MPa in the UFGECAP+D+R sample, and, more importantly, this sample undergoes strain hardening, giving a uniform elongation of C O M M U N IC A IO N S |
Introduction
Metallic materials are significantly crucial for manufacturing industry and structural applications. Metals with an optimized balance of higher strength and ductility are in demand for many industrial applications. Unfortunately, strength and ductility are antinomies in conventional homogeneous materials. Over many years, ultrafine-grained (UFG) metallic materials proved to be attractive structural materials due to higher strength [1][2][3], especially when compared to their coarse-grained (CG) counterparts. However, the drawback of homo UFG materials is typically a poor elongation due to the lack of sustained strain hardening rate in the early stage of deformation [4,5]. A major challenge, therefore, is to engineer novel microstructures to obtain materials with high synergetic strength and ductility. Therefore, recently, new fabrication and subsequent processing approaches were introduced synergetic strength and ductility. Therefore, recently, new fabrication and subsequent processing approaches were introduced to achieve overall as well as nano-scale microstructural control via grain engineering. One can now create ultrafine-grained homo and heterostructures in metallic materials. The strength and ductility trade-off became a primary challenge in developing high-performance metallic materials.
There have been several successful research studies to achieve high strength while retaining reasonable ductility through solid solution strengthening, precipitation strengthening, transformation hardening, dispersion hardening, etc., by incorporating multiple phases in alloys with several elements, as well as developing composites [6][7][8][9][10]. In addition, several techniques were used to refine the microstructures and improve the mechanical properties through grain refinement by several means, for example; severe plastic deformation, thermo-mechanical treatments, friction stir processing, etc. These techniques use the interruption in the dislocations' motion, but still make a dislocation activity possible to ensure some ductility. It was also reported that using a combination of the above-mentioned approaches, i.e., compositional change and thermomechanical treatment can be used to achieve balanced mechanical properties [11,12]. The focus of this review is, however, on single-phase metallic materials, such as; pure metals (Ti and Ni) or solid solutions (SUS316L) based on principal elements.
The Strength-Ductility Behavior of Homo-and Hetero-Structured Materials
For the conventional UFG homo metallic materials, the slope of the engineering stress-strain curve after the yield point, i.e., during work hardening, is remarkably lower than that of the counterpart materials with comparatively coarse grains. Figure 1 depicts a schematic drawing of a true stress-true strain diagram of conventional homo-structured metallic materials. It is well known that, during the tensile deformation, the localized reduction in the cross-sectional area of the tensile specimen, i.e., necking, occurs when the rate of strain hardening is lower than the flow stress of the material. It can be expressed as dσ/dε ≤ σ (σ is the true stress and ε is the true strain).
In general, high strength but poor ductility of the metallic materials with microstructural homogeneity and fine grains is due to the poor strain hardening capabilities ( Figure 1a). However, by introducing heterogeneities in the microstructure matrix, the strain hardening rate dσ/dε of the metallic materials can be improved while preventing the inequality conditions ( Figure 1b). In other words, a good combination of superior strength and ductility can be achieved when a larger strain hardening rate is achieved. In addition, at the same time, deformation localization should be suppressed to obtain further elongation. In general, high strength but poor ductility of the metallic materials with microstructural homogeneity and fine grains is due to the poor strain hardening capabilities (Figure 1a). However, by introducing heterogeneities in the microstructure matrix, the strain hardening rate dσ/dε of the metallic materials can be improved while preventing the inequality conditions ( Figure 1b). In other words, a good combination of superior strength and ductility can be achieved when a larger strain hardening rate is achieved. In addition, at the same time, deformation localization should be suppressed to obtain further elongation.
To address this strength-ductility trade-off issue, heterogeneous structures with large microstructural heterogeneities were introduced in metallic materials [3,[13][14][15][16], such as bimodal structure [17], gradient structure [18][19][20], gradient nano-twined structure [21], nano-laminae structure [22], and heterogeneous laminae structure [13]. Such heterogeneous-designed structures were prepared via developing modern processing techniques without changing the composition, which includes surface grinding or rolling, severe plastic deformation, and electrodeposition. The resulting structured heterogeneous materials exhibit excellent mechanical properties.
Many pieces of research are being conducted on hetero-structured materials owing to their controllable and superior mechanical properties that are unattainable in the conventional homogeneous-structured materials. Therefore, structured heterogeneous materials are quickly emerging as a major materials research area, which also presents renewed concepts of materials science that challenged our traditional perceptions and impressions. In this review paper, we primarily focus on the microstructural heterogeneities in the metallic materials. Compared to conventional homo materials, hetero-structured metallic materials contain heterogeneous regions that contrast in their constitutive properties. It was reported that structured heterogeneous materials are advantageous properties owing to the synergetic effects occurring from the interactivity and pairing between structural contrasting. For example, the trade-off in strength and ductility can be alleviated or controlled [13][14][15]. This intended structural contrasting induces heterogeneous plastic deformation, and the fine-scale constituents stipulate exorbitant strain gradients. As a result, higher strain hardening and consequently uniform tensile ductility at high flow stresses can be achieved. However, the realization of heterogeneous design together with their microstructure and properties control is limited by multiple complex processing steps. Nevertheless, their properties are limited to the uni-or bidirectional (anisotropic characteristics).
Recently, Ameyama et al. proposed a novel concept of "harmonic structure" (HS) design, consisting of a specific spatial distribution of ultra-fine grains (UFG) and coarse grains (CG), that is, the CG areas (core) surrounded by three-dimensionally (3D) continuously connected network of UFG areas (shell) [23][24][25][26][27][28][29][30][31]. Owing to its unique topological 3D gradient structure, the harmonic-structured materials were reported to exhibit high work hardening that extends to higher strain regions, leading to delay in the initiation of plastic instability. Consequently, a good combination of high strength and high ductility can be achieved [29][30][31].
In the present review, an overview of the basics of harmonic structure design and highlighting recent developments in harmonic structured materials is presented, as well as identifying perspectives and future challenges and opportunities.
Concept of Harmonic Structure Design and Processing Considerations
From the above points, the harmonic structure (HS) design can be a candidate material design, which combines high strength with high ductility at the same time. Figure 2 demonstrates a concept of the HS design. The HS material is composed of a shell/core bimodal particle unit. A harmonic structure designed material is produced by the sintering of the particle units. In contrast to a homo-UFG material, HS material has a heterogeneous microstructure consisting of controlled and uniquely arranged fine and coarse grains with a particular topological distribution in a network. That is, the HS can be visualized as homogeneous on large scale but heterogeneous on a small scale, as shown in Figure 2.
During fabrication processing, it is crucial to control and optimize the characteristics of the shell/core regions, such as; volume fraction, grain size, morphology, and topology. These characteristics may strongly influence the properties of the HS materials. The physical properties of the HS materials can be affected by the grain size distribution and grain gradients and morphology of the shell/core regions. To control these factors in the as-fabricated HS compacts, it is necessary but challenging to invent efficient processing methods. In this regard, the unique three-dimensional network-type microstructure of the HS materials adds considerable complexity to processing. In addition to the wide range of multiple variables, the type of material, i.e., the behavior of a particular class of materials, also affects the microstructure of the as-fabricated HS compacts. However, in general, by varying these parameters, HS microstructure was developed in various metals and alloys. To achieve a tailor-made HS microstructure design, the following efficient and feasible processing method, based on powder metallurgy processing, was developed. During fabrication processing, it is crucial to control and optimize the characteristics of the shell/core regions, such as; volume fraction, grain size, morphology, and topology. These characteristics may strongly influence the properties of the HS materials. The physical properties of the HS materials can be affected by the grain size distribution and grain gradients and morphology of the shell/core regions. To control these factors in the as-fabricated HS compacts, it is necessary but challenging to invent efficient processing methods. In this regard, the unique three-dimensional network-type microstructure of the HS materials adds considerable complexity to processing. In addition to the wide range of multiple variables, the type of material, i.e., the behavior of a particular class of materials, also affects the microstructure of the as-fabricated HS compacts. However, in general, by varying these parameters, HS microstructure was developed in various metals and alloys. To achieve a tailor-made HS microstructure design, the following efficient and feasible processing method, based on powder metallurgy processing, was developed.
Mechanical Milling Process (MM Process)
The MM process involves mechanical milling (i.e., ball milling, high-pressure gas milling, etc.) of Plasma Rotating Electrode Processed (PREP) powder of metallic powder and their subsequent sintering. As shown in Figure 3a, powder with a bimodal grain size distribution, i.e., SPD powder surface with fine grains (shell), and comparatively less deformed (or undeformed) powder interior (core), can be fabricated by the MM process. The MM processed powder surface becomes the threedimensional shell network structure after sintering. As depicted in the schematic diagram of Figure 3a, the depth of plastic deformation, at the powder surface, can be changed by changing the mechanical milling time. Consequently, it is feasible to achieve a tailor-made microstructure with predetermined shell/core fractions. However, it is to be noted that the deformation at the surface and respective microstructure evolution depends on the type of initial material.
Bimodal Milling Process (BiM Process)
The BiM process involves milling initial powders of coarse-grained large-sized (IP-CG) and comparatively fine-grained small-sized (IP-FG) powders, wherein the powder fractions and milling time are chosen depending on the desired fractions and grain size of shell/core, respectively [32]. The hierarchical distribution of fine/coarse-grains can be achieved due to repeated coating of plastically deformed IP-FG to the IP-CG powder, during milling. A schematic diagram illustrating the BiM powder metallurgy-based processing approach is demonstrated in Figure 3b. As depicted in the schematic diagram of Figure 3b, the fraction of a tailor-made microstructure with desired shell/core fractions can be achieved either by varying the fractions of IP-FG and IP-CG powders, and/or varying milling time.
Mechanical Milling Process (MM Process)
The MM process involves mechanical milling (i.e., ball milling, high-pressure gas milling, etc.) of Plasma Rotating Electrode Processed (PREP) powder of metallic powder and their subsequent sintering. As shown in Figure 3a, powder with a bimodal grain size distribution, i.e., SPD powder surface with fine grains (shell), and comparatively less deformed (or undeformed) powder interior (core), can be fabricated by the MM process. The MM processed powder surface becomes the three-dimensional shell network structure after sintering. As depicted in the schematic diagram of Figure 3a, the depth of plastic deformation, at the powder surface, can be changed by changing the mechanical milling time. Consequently, it is feasible to achieve a tailor-made microstructure with predetermined shell/core fractions. However, it is to be noted that the deformation at the surface and respective microstructure evolution depends on the type of initial material. The selection of a specific fabrication process was based on many factors such as the type of material, powder particles size, the susceptibility of the material with milling media, the permitted level of contamination from the milling vial and balls, and malleability and work hardening characteristics of the materials being processed [27]. For example, the soft materials can be flattened, i.e., might form flakes, during the severe milling process. Therefore, the BiM processing approach can be utilized to achieve a high shell fraction in a short time milling. On the other hand, less ductile materials can be processed through the MM process.
Microstructure of BiM and MM Processed Powders
The effect of controlled milling through BiM and MM processes on the morphology and microstructure of SUS316L alloys powders is shown in Figure 4. In the BiM process, IP-FG (powder particle size ~7 μm) and IP-CG (powder particle size ~142 μm) powders were mixed in a 3:2 ratio, respectively, and BiM processed for 36 and 360 ks (Figure 4a,b). On the other hand, in the MM process, the PREP alloy powder of SUS316L IP-CG was milled for 108 and 540 ks.
Bimodal Milling Process (BiM Process)
The BiM process involves milling initial powders of coarse-grained large-sized (IP-CG) and comparatively fine-grained small-sized (IP-FG) powders, wherein the powder fractions and milling time are chosen depending on the desired fractions and grain size of shell/core, respectively [32]. The hierarchical distribution of fine/coarse-grains can be achieved due to repeated coating of plastically deformed IP-FG to the IP-CG powder, during milling. A schematic diagram illustrating the BiM powder metallurgy-based processing approach is demonstrated in Figure 3b. As depicted in the schematic diagram of Figure 3b, the fraction of a tailor-made microstructure with desired shell/core fractions can be achieved either by varying the fractions of IP-FG and IP-CG powders, and/or varying milling time. The selection of a specific fabrication process was based on many factors such as the type of material, powder particles size, the susceptibility of the material with milling media, the permitted level of contamination from the milling vial and balls, and malleability and work hardening characteristics of the materials being processed [27]. For example, the soft materials can be flattened, i.e., might form flakes, during the severe milling process. Therefore, the BiM processing approach can be utilized to achieve a high shell fraction in a short time milling. On the other hand, less ductile materials can be processed through the MM process.
Microstructure of BiM and MM Processed Powders
The effect of controlled milling through BiM and MM processes on the morphology and microstructure of SUS316L alloys powders is shown in Figure 4. In the BiM process, IP-FG (powder particle size~7 µm) and IP-CG (powder particle size~142 µm) powders were mixed in a 3:2 ratio, respectively, and BiM processed for 36 and 360 ks (Figure 4a,b). On the other hand, in the MM process, the PREP alloy powder of SUS316L IP-CG was milled for 108 and 540 ks. The selection of a specific fabrication process was based on many factors such as the type of material, powder particles size, the susceptibility of the material with milling media, the permitted level of contamination from the milling vial and balls, and malleability and work hardening characteristics of the materials being processed [27]. For example, the soft materials can be flattened, i.e., might form flakes, during the severe milling process. Therefore, the BiM processing approach can be utilized to achieve a high shell fraction in a short time milling. On the other hand, less ductile materials can be processed through the MM process.
Microstructure of BiM and MM Processed Powders
The effect of controlled milling through BiM and MM processes on the morphology and microstructure of SUS316L alloys powders is shown in Figure 4. In the BiM process, IP-FG (powder particle size ~7 μm) and IP-CG (powder particle size ~142 μm) powders were mixed in a 3:2 ratio, respectively, and BiM processed for 36 and 360 ks (Figure 4a,b). On the other hand, in the MM process, the PREP alloy powder of SUS316L IP-CG was milled for 108 and 540 ks. It is evident that the overall morphology of the spherical shape of the powder does not change as a result of both MM and BiM processing. However, it is to be noted that a highly deformed zone (shell) is formed at the surface, whereas the inner regions (Core) of the powder remain approximately undeformed or partially deformed, depending on the milling conditions. It is interesting to note that the high fraction of shell could be achieved in a shorter time of BiM processing compared to the MM processing. In contrast to the MM powder, the outer surface of BiM powder is composed of several layers of fine powder particles.
Therefore, it can be predicted that the shell evolution mechanism in both BiM and MM process is different. It was reported that the powder particle size of BiM powders increases with BiM processing time, whereas in the case of the MM process, the MM powder particle size remains approximately similar to the starting powder. Therefore, it can be assumed that the surface irregularity of the BiM powder is primarily due to the repeated coating of SPD fine powder to the surface of coarse powder, during milling. On the other hand, the surface irregularity in MM powder is owing to the surface deformation of the starting powder particles. However, it can be ensured that both MM and BiM powders show a bimodal microstructure wherein the center of powder is coarse-grained, whereas the surface composed of SPD sub-micron-sized grains. Similar morphological changes were also reported wherein it was observed that the increase in milling time leads to the formation of the severely deformed layer, consisting of nano-crystallites, near the surface of the powders [33][34][35][36][37]. Moreover, it must be realized that a gradient of the degree of deformation exists in both BiM and MM processed powders, and the severity of the accumulated plastic strain decreases from the particle surface towards the center of the particles.
In particular, the successful application of the new BiM process to achieve controlled deformation in the variety of materials is of important technological interest, which is a feasible, energy-efficient, and cost-effective process, particularly, for industrial-scale production. The effectiveness of the BiM process to create a controlled microstructure at shell and core is owing to the fine and coarse powders, respectively. It must be pointed out that the finer powder particles make the milling process easier, and grain refinement occurs in a shorter time when compared to coarse powder particles. Therefore, in contrast to the prolonged milling in the MM process, significantly shorter milling might result in the development of a large shell fraction with nano grain formation. It naturally follows that one can build a hierarchical microstructure with controlled fractions of shell/core zones by varying amounts of IP-FG and IP-CG powders, and/or milling time. Optimizing such hierarchical grained zones and their fractions for a better synergy of superior strength and ductility, in an as-sintered bulk compact, calls for modern fabrication approaches for precise microstructure control. Hence, it would be appealing to analogize the designs of BiM-and MM-processed SUS316L compacts for a better interpretation and rationalization of the synergistic effects of various combinations of structural contrasts. Figure 5 shows TEM micrographs near the shell region of the mechanically milled pure titanium powder with enlarged areas of selected rectangular areas indicated as A, B, and C. It could be observed that near to the surface, equiaxed grains (<20 nm) were observed whereas a layer of elongated grains was seen in the inner zones of the milled powder. The grain subdivision and rotation of those elongated grains led to the formation of equiaxed nano-grain structure in milled powder [30,33,[37][38][39][40][41].
Microstructure of Harmonic Structure Designed Compacts
The milled powders via the BiM and MM process were sintered at 1173 and 1223 K temperatures, respectively, to prepare bulk compacts. Recently, spark plasma sintering (SPS) was utilized extensively for the consolidation of powders due to fast sintering together with avoidance of significant grain growth even at high-temperature operations. The microstructures of the Hstructured compacts (MM and BiM) SUS316L compacts are shown in Figure 6.
As shown in Figure 6a,b, the BiM compacts exhibited a network-type arrangement of bimodal grains wherein the coarse grains (d > 5.0 μm) were surrounded by comparatively finer grains (d ≤ 5.0 μm). Particularly, it is to be noted that the well-defined and dense shell network could be achieved
Microstructure of Harmonic Structure Designed Compacts
The milled powders via the BiM and MM process were sintered at 1173 and 1223 K temperatures, respectively, to prepare bulk compacts. Recently, spark plasma sintering (SPS) was utilized extensively for the consolidation of powders due to fast sintering together with avoidance of significant grain growth even at high-temperature operations. The microstructures of the H-structured compacts (MM and BiM) SUS316L compacts are shown in Figure 6. Figure 7 shows the representative engineering stress-strain curves of harmonic structured compacts of SUS316L developed by BiM and MM approaches. All of the HS materials that were examined indicated high strength, high ductility, and high tensile toughness at the same time. That is to say, regardless of the fabrication process, the HS compacts of SUS316L had a good combination of strength and elongation compared to the conventional counterparts developed and/or processed by different methods, such as; casting, powder metallurgy, selective laser melting, and thermomechanically treated compacts of SUS316L alloy (Figure 8) [42][43][44][45][46][47][48][49][50][51][52][53][54][55][56][57][58][59][60][61]. In general, it was reported that the conventional homo-structured compacts of SUS316L exhibited significant strength-ductility trade-off owing to the grain size strengthening effect [42][43][44][45][46][47][48][49][50][51][52][53][54][55][56][57][58][59][60][61]. However, in contrast, as shown in Figure 7, the improvement in the strength of harmonic structured SUS316L compacts were accompanied by a nominal ductility loss. The improvement in strength and nominal ductility loss can be attributed to grain boundary strengthening caused by grain refinement in the shell and higher shell fraction. Particularly, the reduction in ductility is associated with a higher shell fraction, as shown in Figure 6. Plastic deformation in most metallic materials was commonly mediated by the As shown in Figure 6a,b, the BiM compacts exhibited a network-type arrangement of bimodal grains wherein the coarse grains (d > 5.0 µm) were surrounded by comparatively finer grains (d ≤ 5.0 µm). Particularly, it is to be noted that the well-defined and dense shell network could be achieved even after a short time (36 ks) of BiM processing (Figure 6c). The grain size contrast of the shell and core could be observed in the enlarged Elecrtron Backscatter Diffraction (EBSD) grain size images. It should be noted that the core grains are not remarkably deformed even after a long milling time (180 ks). Therefore, it can be envisaged that the shell area of BiM compacts mainly developed due to the coating and frequent plastic deformation of fine particles to the surface of coarse particles, during milling. However, the spherical shape of the core gradually deformed with milling time, suggesting that the prolonged milling leads to the partial deformation of the outer core area. Therefore, it can be envisaged that increasing milling time leads to effective plastic deformation of fine powder, which in turn increases the fraction of fine shell grains (<3 µm), which was obvious in the shell grain size distribution through the color-coded grain size distribution map of BiM compacts. Also, in the case of MM compacts (Figure 6c,d), a harmonic structure was achieved. However, substantial damage apparent to the core area was noticed after a long period of milling (540 ks). In addition, most notable was that even after prolonged milling up to 540 ks, the large fractions of shell grains were in the range of 3-5 µm, which is significantly larger than that of the BiM-processed specimens. Finally, it would be worth emphasizing that, in comparison to the MM process, the BiM approach is highly efficient in achieving ultra-fine shell grains in a shorter period. Figure 7 shows the representative engineering stress-strain curves of harmonic structured compacts of SUS316L developed by BiM and MM approaches. All of the HS materials that were examined indicated high strength, high ductility, and high tensile toughness at the same time. That is to say, regardless of the fabrication process, the HS compacts of SUS316L had a good combination of strength and elongation compared to the conventional counterparts developed and/or processed by different methods, such as; casting, powder metallurgy, selective laser melting, and thermomechanically treated compacts of SUS316L alloy (Figure 8) [42][43][44][45][46][47][48][49][50][51][52][53][54][55][56][57][58][59][60][61]. In general, it was reported that the conventional homo-structured compacts of SUS316L exhibited significant strength-ductility trade-off owing to the grain size strengthening effect [42][43][44][45][46][47][48][49][50][51][52][53][54][55][56][57][58][59][60][61]. However, in contrast, as shown in Figure 7, the improvement in the strength of harmonic structured SUS316L compacts were accompanied by a nominal ductility loss. The improvement in strength and nominal ductility loss can be attributed to grain boundary strengthening caused by grain refinement in the shell and higher shell fraction. Particularly, the reduction in ductility is associated with a higher shell fraction, as shown in Figure 6. Plastic deformation in most metallic materials was commonly mediated by the dislocation slip [26,27]. The increased fractions of fine-grained shell from a certain level suppressed the dislocation initiation and slip phenomena, and increased the prospect of dislocation annihilation at boundaries by thermally activated cross slip and climb, which in turn leads to ductility loss [28,29]. The most noticeable was the synergy of high strength and ductility of harmonic-structured BiM compacts, which was achieved in an efficient time compared to that achieved by MM processing. As can be seen, the improvement in mechanical properties by efficient BiM processing was encouraging, which may lead to the synergetic strength-ductility combination by introducing an optimized fraction of the shell network. In the present case, the optimized grain size and shell fractions were approximately 2 µm and 30%, respectively [32].
Mechanical Properties of Harmonic Structure-Designed Compacts
Mechanical Properties of Harmonic Structure-Designed Compacts
Metals 2020, 10, x FOR PEER REVIEW 9 of 17 dislocation slip [26,27]. The increased fractions of fine-grained shell from a certain level suppressed the dislocation initiation and slip phenomena, and increased the prospect of dislocation annihilation at boundaries by thermally activated cross slip and climb, which in turn leads to ductility loss [28,29]. The most noticeable was the synergy of high strength and ductility of harmonic-structured BiM compacts, which was achieved in an efficient time compared to that achieved by MM processing. As can be seen, the improvement in mechanical properties by efficient BiM processing was encouraging, which may lead to the synergetic strength-ductility combination by introducing an optimized fraction of the shell network. In the present case, the optimized grain size and shell fractions were approximately 2 μm and 30%, respectively [32]. Figure 9 shows the microstructure of conventional homogeneous-structured (homo) and harmonic-structured pure Ti compacts after 10% cold rolling. EBSD Kernel Average Misorientation (KAM) images show that, in contrast to the homo Ti with significant KAM values in the matrix, slight KAM value increased especially in the shell region. Since the increase in the KAM value strongly related to the dislocation storage, it suggests that deformation took place in the shell and shell/core interface regions.
Mechanism of the Outstanding Mechanical Properties
Stress Concentration Effects
Metals 2020, 10, x FOR PEER REVIEW 10 of 17 Figure 9 shows the microstructure of conventional homogeneous-structured (homo) and harmonic-structured pure Ti compacts after 10% cold rolling. EBSD Kernel Average Misorientation (KAM) images show that, in contrast to the homo Ti with significant KAM values in the matrix, slight KAM value increased especially in the shell region. Since the increase in the KAM value strongly related to the dislocation storage, it suggests that deformation took place in the shell and shell/core interface regions. As reported by Ameyama et al. [35] using ECCI (Electron Channeling Contrast Image) of Figure 10a: shell area and Figure 10b core area, it can be seen that dislocations were mainly in the shell grains, whereas the core dislocations were cell-like, and comparatively not highly dense ( Figure 10). These results were quite consistent with the KAM distribution observed for pure Ti (Figure 9). The higher dislocation density in the shell region was evidence of stress concentration in the shell. Therefore, it was confirmed that during the early stage of deformation, the shell and its network can be an effective dislocation source. It is to be noted that such a "dislocation-source network" structure is a unique characteristic of the HS materials. Consequently, a large strain hardening rate and higher uniform As reported by Ameyama et al. [35] using ECCI (Electron Channeling Contrast Image) of Figure 10a: shell area and Figure 10b core area, it can be seen that dislocations were mainly in the shell grains, whereas the core dislocations were cell-like, and comparatively not highly dense ( Figure 10). These results were quite consistent with the KAM distribution observed for pure Ti (Figure 9). The higher dislocation density in the shell region was evidence of stress concentration in the shell. Therefore, it was confirmed that during the early stage of deformation, the shell and its network can be an effective dislocation source. It is to be noted that such a "dislocation-source network" structure is a unique characteristic of the HS materials. Consequently, a large strain hardening rate and higher uniform elongation can be achieved in the HS materials. Interestingly, despite the soft core regions, the hard shell deforms before the core in the early stage of deformation. Such a stress concentration effect was also predicted by a multi-scale-FEM simulation ( Figure 11) [62]. From the numerical simulation, the UFG shell regions are the high-stress concentration areas, while the CG core region did not show evidence of accumulation of any significant stress concentration.
Mechanism of the Outstanding Mechanical Properties
Stress Concentration Effects
Strain Dispersion Effects
It was also reported that the mutual constraints of the unstable UFG area and the comparatively stable CG area made the deformation processing captive and lead to a different stress level [63]. The geometrically necessary dislocations (GNDs) emerged due to the geometrical constraints of soft (core) and hard (shell) areas in the HS specimens' need to accommodate the strain gradient areas; if not, the voids and overlaps may occur between the grain boundaries [64]. As a consequence of the interaction and amassing of dislocations, extraordinary work hardening occurs.
As shown in the numerical simulation results of strain distribution (Figure 11), higher strain concentration was seen in the shell zones aligned parallel to the tensile axis. In contrast, no evidence of accumulated strain concentration was seen in the shell zones aligned perpendicular to the tensile deformation axis [62]. However, interestingly, accumulated strain concentration successively increased from the shell to core. Consecutively, the highest accumulated strain was observed at the center of the core.
In general, the early necking of fine-grained materials is due to high-stress concentration. The crack propagation is hard to block with fine grains owing to suppressed dislocation initiation and slip phenomenon [1,65]. However, when the well-bonded, tri-directional network of hierarchical microstructure was stressed, the fast strain localization tendency of the fine-grained shell can be effectively constrained by the stable coarse-grained core through the interfaces [66]. In addition, the strain partitioning between incompatible shell and core areas may also play a crucial role in alleviating the strain localization [62,67,68]. Such behavior may suggest that the complete shell network structure plays a crucial role in the uniform strain dispersion, and thus, deformation localization is prevented.
Strain Dispersion Effects
It was also reported that the mutual constraints of the unstable UFG area and the comparatively stable CG area made the deformation processing captive and lead to a different stress level [63]. The geometrically necessary dislocations (GNDs) emerged due to the geometrical constraints of soft (core) and hard (shell) areas in the HS specimens' need to accommodate the strain gradient areas; if not, the voids and overlaps may occur between the grain boundaries [64]. As a consequence of the interaction and amassing of dislocations, extraordinary work hardening occurs.
As shown in the numerical simulation results of strain distribution (Figure 11), higher strain concentration was seen in the shell zones aligned parallel to the tensile axis. In contrast, no evidence of accumulated strain concentration was seen in the shell zones aligned perpendicular to the tensile deformation axis [62]. However, interestingly, accumulated strain concentration successively increased from the shell to core. Consecutively, the highest accumulated strain was observed at the center of the core.
In general, the early necking of fine-grained materials is due to high-stress concentration. The crack propagation is hard to block with fine grains owing to suppressed dislocation initiation and slip phenomenon [1,65]. However, when the well-bonded, tri-directional network of hierarchical microstructure was stressed, the fast strain localization tendency of the fine-grained shell can be effectively constrained by the stable coarse-grained core through the interfaces [66]. In addition, the strain partitioning between incompatible shell and core areas may also play a crucial role in alleviating the strain localization [62,67,68]. Such behavior may suggest that the complete shell network structure plays a crucial role in the uniform strain dispersion, and thus, deformation localization is prevented.
Strain Dispersion Effects
It was also reported that the mutual constraints of the unstable UFG area and the comparatively stable CG area made the deformation processing captive and lead to a different stress level [63]. The geometrically necessary dislocations (GNDs) emerged due to the geometrical constraints of soft (core) and hard (shell) areas in the HS specimens' need to accommodate the strain gradient areas; if not, the voids and overlaps may occur between the grain boundaries [64]. As a consequence of the interaction and amassing of dislocations, extraordinary work hardening occurs.
As shown in the numerical simulation results of strain distribution (Figure 11), higher strain concentration was seen in the shell zones aligned parallel to the tensile axis. In contrast, no evidence of accumulated strain concentration was seen in the shell zones aligned perpendicular to the tensile deformation axis [62]. However, interestingly, accumulated strain concentration successively increased from the shell to core. Consecutively, the highest accumulated strain was observed at the center of the core.
In general, the early necking of fine-grained materials is due to high-stress concentration. The crack propagation is hard to block with fine grains owing to suppressed dislocation initiation and slip phenomenon [1,65]. However, when the well-bonded, tri-directional network of hierarchical microstructure was stressed, the fast strain localization tendency of the fine-grained shell can be effectively constrained by the stable coarse-grained core through the interfaces [66]. In addition, the strain partitioning between incompatible shell and core areas may also play a crucial role in alleviating the strain localization [62,67,68]. Such behavior may suggest that the complete shell network structure plays a crucial role in the uniform strain dispersion, and thus, deformation localization is prevented.
Fracture Behavior of HS Materials
The superior strength-ductility combination of pure HS materials can be attributed to the three-dimensional topological distribution of connected-type hard shell regions. In particular, the higher toughness can be associated with topology-driven diversion of crack propagation paths as well as an obstacle in their growth and propagation due to the soft core regions [69]. To analyze the fatigue crack propagation and growth mechanism, Kikuchi et al. [70] and Osaki et al. [71] investigated the effect of grain size on fatigue crack propagation in HS pure Ti. It was reported that the fatigue crack propagation and growth resistance of HS Ti were significantly reduced for a high-stress ratio as compared to the counterpart with homogeneous coarse-grained microstructure. Nukui et al. [72] found that the fatigue strength is increased because the resistance of the material to the initiation of fatigue cracks was improved by the grain refinement at the shell. The beginning of fatigue cracks was also observed in the coarse grains core in harmonic-structured designed materials, including CP titanium [72], Ti-6Al-4V alloys [73,74], and austenitic stainless steel [75,76]. However, in alloys, it can be attributed to both the network topology and strain-induced phase transformations, for example; α-fcc to ε-hcp in CCM [28]. However, further exhaustive studies should be carried out to confirm the fracture behavior of different metallic materials.
Perspectives of HS Materials and Future Challenges
Harmonic structure-designed materials are emerging structural materials that are becoming an attractive research field. The area of hetero-structured materials was extensively studied. However, in particular, harmonic structure-designed materials are in their infancy, requiring intense studies both in terms of characterization methods, scientific modeling tools, and fabrication approaches.
A complete clarification of the underlying mechanism and availability of any consolidated model regarding the excellent strengthening of HS materials is still a matter of pursuit. Some efforts were made to annotate this direction through experimental documentation as well as theoretical techniques [77][78][79][80]. In particular, owing to the unique 3D connected type microstructural design of harmonic-structured materials, rigorous efforts are required to decipher the mechanism of strengthening completely.
In addition, it should be mentioned that development and microstructure controlling of all the customized microstructures, including harmonic structure, are relatively laborious to produce and are not comprehensive. The microstructure control at micro-as well as macro-scale and repeatability in performances are another great challenge. To this aspect, further efforts are required to develop a consolidated design concept and mechanistic approach for harmonic structure-designed materials.
The technological and engineering affairs need to be addressed by both theoretical models and experiments to quantify the correlation between structural heterogeneity and mechanical performance, which is crucial for the development of harmonic structure materials with efficient design and optimized mechanical performance.
Conclusions
In this review, a relatively new concept of harmonic structure materials has been introduced, and its basic concept, mechanical performance, and advantages along with present development status and perspectives are discussed. The harmonic structure (HS)-designed metallic materials can be successfully produced by efficient powder metallurgy approaches, such as mechanical milling and bimodal milling (BiM). In contrast to the significant strength-ductility trade-off issues of conventional homogeneous-structured materials, harmonic-structured materials exhibit a superior combination of high synergetic strength and ductility. The superior tensile strength of the HS materials is owing to its unique network-type arrangement of the UFG grains (shell), which provides higher strain hardening due to the stress concentration effect, whereas the superior ductility of the HS materials is attributed to the soft core regions. The results suggested that the higher ductility of the HS materials was due to strain dispersion effects. In other words, microstructural singularity in harmonic structure design plays a crucial role in achieving an outstanding combination of strength and ductility.
Figure 1 .
1Schematic illustrations of true stress-true strain curves in; (a) materials with conventional homogeneous microstructure, and (b) advanced materials with a combination of higher strength and ductility.
Figure 1 .
1Schematic illustrations of true stress-true strain curves in; (a) materials with conventional homogeneous microstructure, and (b) advanced materials with a combination of higher strength and ductility.
Figure 2 .
2Concept of the harmonic structure (HS) design.
Figure 2 .
2Concept of the harmonic structure (HS) design.
Metals 2020 ,
202010, x FOR PEER REVIEW 5 of 17
Figure 3 .
3Fabrication processes of the harmonic structure materials; (a) Mechanical Milling (MM) and (b) Bimodal Milling (BiM) process.
Figure 3 .
3Fabrication processes of the harmonic structure materials; (a) Mechanical Milling (MM) and (b) Bimodal Milling (BiM) process.
Figure 3 .
3Fabrication
Figure 4 .
4SEM images of SUS316L powders cross-section after BiM and MM processing. (a) BiM 36 ks, (b) BiM 360 ks, (c) MM 108 ks, and (d) MM 540 ks.
Figure 5 .
5TEM micrographs of the shell area of milled pure Ti powder. Enlargement of rectangular areas of (A), (B) and (C) are separately presented.
Figure 5 .
5TEM micrographs of the shell area of milled pure Ti powder. Enlargement of rectangular areas of (A), (B) and (C) are separately presented.
Figure 6 .
6EBSD image quality maps of BiM (a and b), and MM compacts (c and d) of SUS316L. (a) BiM 36 ks, (b) BiM 180 ks, (c) MM 216 ks, and (d)MM 540 ks. The corresponding enlarged grain size images of the shell-core interface are separately shown (the grain size legend is presented at the bottom).
Figure 6 .
6EBSD image quality maps of BiM (a,b), and MM compacts (c,d) of SUS316L. (a) BiM 36 ks, (b) BiM 180 ks, (c) MM 216 ks, and (d) MM 540 ks. The corresponding enlarged grain size images of the shell-core interface are separately shown (the grain size legend is presented at the bottom).
Figure 7 .
7Tensile engineering stress-strain curves of harmonic structured SUS316L compacts developed through BiM and MM processes.
Figure 7 .
7Tensile engineering stress-strain curves of harmonic structured SUS316L compacts developed through BiM and MM processes.
Figure 7 .
7Tensile engineering stress-strain curves of harmonic structured SUS316L compacts developed through BiM and MM processes.
Figure 8 .
8Ultimate tensile strength versus total elongation chart for HS SUS316L compacts, and their comparison with SUS316L counterparts produced by various methods[42][43][44][45][46][47][48][49][50][51][52][53][54][55][56][57][58][59][60][61].
Figure 8 .
8Ultimate tensile strength versus total elongation chart for HS SUS316L compacts, and their comparison with SUS316L counterparts produced by various methods[42][43][44][45][46][47][48][49][50][51][52][53][54][55][56][57][58][59][60][61].
Figure 9 .
9KAM image of; (a) homo and (b) HS structured pure Ti compacts.
Figure 9 .
9KAM image of; (a) homo and (b) HS structured pure Ti compacts.
Figure 10 .
10ECCI of pure Ni HS after 5% tensile deformation. (a): shell and (b): core.
Figure 10 .
10ECCI of pure Ni HS after 5% tensile deformation. (a): shell and (b): core.
Figure 10 .
10ECCI of pure Ni HS after 5% tensile deformation. (a): shell and (b): core.
Figure 11 .
11Numerical simulation (FEM) results of HS pure Ti illustrating the stress and strain distribution after ~12% tensile deformation[62].
Figure 11 .
11Numerical simulation (FEM) results of HS pure Ti illustrating the stress and strain distribution after~12% tensile deformation[62].
Mechanical properties of nanocrystalline materials. M A Meyers, A Mishra, D J Benson, 10.1016/j.pmatsci.2005.08.003Prog. Mater. Sci. 51Meyers, M.A.; Mishra, A.; Benson, D.J. Mechanical properties of nanocrystalline materials. Prog. Mater. Sci. 2006, 51, 427-556. [CrossRef]
Compressive properties of Cu with different grain sizes: Sub-micron to nanometer realm. H Khan, B Farrokh, L Takacs, 10.1007/s10853-008-2508-2J. Mater. Sci. 43Khan, H.; Farrokh, B.; Takacs, L. Compressive properties of Cu with different grain sizes: Sub-micron to nanometer realm. J. Mater. Sci. 2008, 43, 3305-3313. [CrossRef]
Towards strength-Ductility synergy through the design of heterogeneous nanostructures in metals. E Ma, T Zhu, 10.1016/j.mattod.2017.02.00320Ma, E.; Zhu, T. Towards strength-Ductility synergy through the design of heterogeneous nanostructures in metals. Mater. Today 2017, 20, 323-331. [CrossRef]
Novel ultra-high straining process for bulk materials-Development of the accumulative roll-bonding (ARB) process. Y Saito, H Utsunomiya, N Tsuji, T Sakai, 10.1016/S1359-6454(98)00365-6Acta Mater. 47Saito, Y.; Utsunomiya, H.; Tsuji, N.; Sakai, T. Novel ultra-high straining process for bulk materials-Development of the accumulative roll-bonding (ARB) process. Acta Mater. 1999, 47, 579-583. [CrossRef]
Extreme grain refinement by severe plastic deformation: A wealth of challenging science. Y Estrin, A Vinogradov, 10.1016/j.actamat.2012.10.038Acta Mater. 61Estrin, Y.; Vinogradov, A. Extreme grain refinement by severe plastic deformation: A wealth of challenging science. Acta Mater. 2013, 61, 782-817. [CrossRef]
New multiphase compositionally complex alloys driven by the high entropy alloy approach. A M Manzoni, U Glatzel, 10.1016/j.matchar.2018.06.036Mater. Charact. 147Manzoni, A.M.; Glatzel, U. New multiphase compositionally complex alloys driven by the high entropy alloy approach. Mater. Charact. 2019, 147, 512-532. [CrossRef]
Mechanical behavior of nanocrystalline metals and alloys11The Golden Jubilee Issue-Selected topics in Materials Science and Engineering: Past, Present and Future. K Kumar, H Van Swygenhoven, S Suresh, 10.1016/j.actamat.2003.08.032Acta Mater. S. Suresh51Kumar, K.; Van Swygenhoven, H.; Suresh, S. Mechanical behavior of nanocrystalline metals and alloys11The Golden Jubilee Issue-Selected topics in Materials Science and Engineering: Past, Present and Future, edited by S. Suresh. Acta Mater. 2003, 51, 5743-5774. [CrossRef]
. Y H Zhao, E J Lavernia, S H Whang, Nanostructured Metals and Alloys. Woodhead PublishingZhao, Y.H.; Lavernia, E.J.; Whang, S.H. Nanostructured Metals and Alloys; Woodhead Publishing: Cambridge, UK, 2011; pp. 375-376.
Precipitation reactions in a Cu-Ni-Al medium carbon alloyed dual hardening steel. M Hofinger, C Turk, M Ognianov, H Leitner, R Schnitzer, 10.1016/j.matchar.2020.110126Mater. Charact. 160Hofinger, M.; Turk, C.; Ognianov, M.; Leitner, H.; Schnitzer, R. Precipitation reactions in a Cu-Ni-Al medium carbon alloyed dual hardening steel. Mater. Charact. 2020, 160, 110126. [CrossRef]
Bioinspired structural materials. U G K Wegst, H Bai, E Saiz, A P Tomsia, R O Ritchie, 10.1038/nmat4089Nat. Mater. 14Wegst, U.G.K.; Bai, H.; Saiz, E.; Tomsia, A.P.; Ritchie, R.O. Bioinspired structural materials. Nat. Mater. 2015, 14, 23-36. [CrossRef]
Optimizing the coupled effects of Hall-Petch and precipitation strengthening in a Al 0.3 CoCrFeNi high entropy alloy. B Gwalani, V Soni, M Lee, S Mantri, Y Ren, R Banerjee, 10.1016/j.matdes.2017.02.072Mater. Des. 121Gwalani, B.; Soni, V.; Lee, M.; Mantri, S.; Ren, Y.; Banerjee, R. Optimizing the coupled effects of Hall-Petch and precipitation strengthening in a Al 0.3 CoCrFeNi high entropy alloy. Mater. Des. 2017, 121, 254-260. [CrossRef]
Controllable fabrication of a carbide-containing FeCoCrNiMn high-entropy alloy: Microstructure and mechanical properties. H Cheng, H Y Wang, Y C Xie, Q H Tang, P Q Dai, 10.1080/02670836.2017.1342367Mater. Sci. Technol. 33Cheng, H.; Wang, H.Y.; Xie, Y.C.; Tang, Q.H.; Dai, P.Q. Controllable fabrication of a carbide-containing FeCoCrNiMn high-entropy alloy: Microstructure and mechanical properties. Mater. Sci. Technol. 2017, 33, 2032-2039. [CrossRef]
Heterogeneous lamella structure unites ultrafine-grain strength with coarse-grain ductility. X Wu, M Yang, F Yuan, G Wu, Y Wei, X Huang, Y Zhu, 10.1073/pnas.1517193112Proc. Natl. Acad. Sci. Natl. Acad. SciUSA112PubMedWu, X.; Yang, M.; Yuan, F.; Wu, G.; Wei, Y.; Huang, X.; Zhu, Y. Heterogeneous lamella structure unites ultrafine-grain strength with coarse-grain ductility. Proc. Natl. Acad. Sci. USA 2015, 112, 14501-14505. [CrossRef] [PubMed]
Steel-based composites: Diving forces and Classifications. D Embury, O Bouaziz, 10.1146/annurev-matsci-070909-104438Annu. Rev. Mater. Res. 40Embury, D.; Bouaziz, O. Steel-based composites: Diving forces and Classifications. Annu. Rev. Mater. Res. 2010, 40, 213-241. [CrossRef]
Heterogeneous materials: A new class of materials with unprecedented mechanical properties. X Wu, Y T Zhu, 10.1080/21663831.2017.1343208Mater. Res. Lett. 5Wu, X.; Zhu, Y.T. Heterogeneous materials: A new class of materials with unprecedented mechanical properties. Mater. Res. Lett. 2017, 5, 527-532. [CrossRef]
Stabilizing nanostructures in metals using grain and twin boundary architectures. K Lu, 10.1038/natrevmats.2016.19Nat. Rev. Mater. Lu, K. Stabilizing nanostructures in metals using grain and twin boundary architectures. Nat. Rev. Mater. 2016, 1, 16019. [CrossRef]
High tensile ductility in a nanostructured metal. Y Wang, M Chen, F Zhou, E Ma, 10.1038/nature01133Nat. Cell Biol. 419Wang, Y.; Chen, M.; Zhou, F.; Ma, E. High tensile ductility in a nanostructured metal. Nat. Cell Biol. 2002, 419, 912-915. [CrossRef]
Revealing Extraordinary Intrinsic Tensile Plasticity in Gradient Nano-Grained Copper. T H Fang, W L Li, N R Tao, K Lu, 10.1126/science.1200177Science. 331Fang, T.H.; Li, W.L.; Tao, N.R.; Lu, K. Revealing Extraordinary Intrinsic Tensile Plasticity in Gradient Nano-Grained Copper. Science 2011, 331, 1587-1590. [CrossRef]
Extraordinary strain hardening by gradient structure. X Wu, P Jiang, L Chen, F Yuan, Y T Zhu, 10.1073/pnas.1324069111Proc. Natl. Acad. Sci. Natl. Acad. SciUSA111Wu, X.; Jiang, P.; Chen, L.; Yuan, F.; Zhu, Y.T. Extraordinary strain hardening by gradient structure. Proc. Natl. Acad. Sci. USA 2014, 111, 7197-7201. [CrossRef]
Dynamic creation and evolution of gradient nanostructure in single-crystal metallic microcubes. R Thevamaran, O Lawal, S Yazdi, S.-J Jeon, J.-H Lee, E L Thomas, 10.1126/science.aag1768Science. 354Thevamaran, R.; Lawal, O.; Yazdi, S.; Jeon, S.-J.; Lee, J.-H.; Thomas, E.L. Dynamic creation and evolution of gradient nanostructure in single-crystal metallic microcubes. Science 2016, 354, 312-316. [CrossRef]
Extra strengthening and work hardening in gradient nanotwinned metals. Z Cheng, H Zhou, Q Lu, H Gao, L Lu, 10.1126/science.aau1925Science. 362Cheng, Z.; Zhou, H.; Lu, Q.; Gao, H.; Lu, L. Extra strengthening and work hardening in gradient nanotwinned metals. Science 2018, 362, eaau1925. [CrossRef]
Strain-Induced Ultrahard and Ultrastable Nanolaminated Structure in Nickel. X C Liu, H Zhang, K Lu, 10.1126/science.1242578Science. 342PubMedLiu, X.C.; Zhang, H.; Lu, K. Strain-Induced Ultrahard and Ultrastable Nanolaminated Structure in Nickel. Science 2013, 342, 337-340. [CrossRef] [PubMed]
Improvement of mechanical properties in SUS304L steel through the control of bimodal microstructure characteristics. Z Zhang, S K Vajpai, D Orlov, K Ameyama, 10.1016/j.msea.2014.01.023Mater. Sci. Eng. A. 598Zhang, Z.; Vajpai, S.K.; Orlov, D.; Ameyama, K. Improvement of mechanical properties in SUS304L steel through the control of bimodal microstructure characteristics. Mater. Sci. Eng. A 2014, 598, 106-113. [CrossRef]
The Development of High Performance Ti-6Al-4V Alloy via a Unique Microstructural Design with Bimodal Grain Size Distribution. S K Vajpai, M Ota, T Watanabe, R Maeda, T Sekiguchi, T Kusaka, K Ameyama, 10.1007/s11661-014-2649-7Met. Mater. Trans. A. 46Vajpai, S.K.; Ota, M.; Watanabe, T.; Maeda, R.; Sekiguchi, T.; Kusaka, T.; Ameyama, K. The Development of High Performance Ti-6Al-4V Alloy via a Unique Microstructural Design with Bimodal Grain Size Distribution. Met. Mater. Trans. A 2015, 46, 903-914. [CrossRef]
Microstructure and mechanical properties of hetero-designed Ti-25Nb-25Zr alloy fabricated by powder metallurgy route. B Sharma, K Nagano, M Kawabata, K Ameyama, 10.22226/2410-3535-2019-4-511-516Lett. Mater. 9Sharma, B.; Nagano, K.; Kawabata, M.; Ameyama, K. Microstructure and mechanical properties of hetero-designed Ti-25Nb-25Zr alloy fabricated by powder metallurgy route. Lett. Mater. 2019, 9, 511-516. [CrossRef]
Application of High Pressure Gas Jet Mill Process to Fabricate High Performance Harmonic Structure Designed Pure Titanium. M Ota, S K Vajpai, R Imao, K Kurokawa, K Ameyama, 10.2320/matertrans.M2014280Mater. Trans. 56Ota, M.; Vajpai, S.K.; Imao, R.; Kurokawa, K.; Ameyama, K. Application of High Pressure Gas Jet Mill Process to Fabricate High Performance Harmonic Structure Designed Pure Titanium. Mater. Trans. 2015, 56, 154-159. [CrossRef]
Three-dimensionally gradient harmonic structure design: An integrated approach for high performance structural materials. S K Vajpai, M Ota, Z Zhang, K Ameyama, 10.1080/21663831.2016.1218965Mater. Res. Lett. 4Vajpai, S.K.; Ota, M.; Zhang, Z.; Ameyama, K. Three-dimensionally gradient harmonic structure design: An integrated approach for high performance structural materials. Mater. Res. Lett. 2016, 4, 191-197. [CrossRef]
Effect of bimodal harmonic structure design on the deformation behavior and mechanical properties of Co-Cr-Mo alloy. S K Vajpai, C Sawangrat, O Yamaguchi, O P Ciuca, K Ameyama, 10.1016/j.msec.2015.09.055Mater. Sci. Eng. C. 58Vajpai, S.K.; Sawangrat, C.; Yamaguchi, O.; Ciuca, O.P.; Ameyama, K. Effect of bimodal harmonic structure design on the deformation behavior and mechanical properties of Co-Cr-Mo alloy. Mater. Sci. Eng. C 2016, 58, 1008-1015. [CrossRef]
Mechanical Milling Process as Severe Plastic Deformation Method. H Fujiwara, E Oda, K Ameyama, 10.2355/tetsutohagane.94.608Tetsu-to-Hagane. 94Fujiwara, H.; Oda, E.; Ameyama, K. Mechanical Milling Process as Severe Plastic Deformation Method. Tetsu-to-Hagane 2008, 94, 608-615. [CrossRef]
Unique Mechanical Properties of Harmonic Structure Designed Materials. K Ameyama, N Horikawa, M Kawabata, 10.2355/tetsutohagane.TETSU-2018-089Tetsu-to-Hagane. 105Ameyama, K.; Horikawa, N.; Kawabata, M. Unique Mechanical Properties of Harmonic Structure Designed Materials. Tetsu-to-Hagane 2019, 105, 124-126. [CrossRef]
Nano-ferrite formation and strain-induced-ferrite transformation in an SUS316L austenitic stainless steel. H Fujiwara, H Inomoto, R Sanada, K Ameyama, 10.1016/S1359-6462(01)00858-2Scr. Mater. 44Fujiwara, H.; Inomoto, H.; Sanada, R.; Ameyama, K. Nano-ferrite formation and strain-induced-ferrite transformation in an SUS316L austenitic stainless steel. Scr. Mater. 2001, 44, 2039-2042. [CrossRef]
Fabrication of SUS316L Harmonic Structure Compacts by Bi-Modal Milling Process. K Yagi, B Sharma, M Kawabata, K Ameyama, 10.2497/jjspm.67.239J. Jpn. Soc. Powder Powder Met. 67Yagi, K.; Sharma, B.; Kawabata, M.; Ameyama, K. Fabrication of SUS316L Harmonic Structure Compacts by Bi-Modal Milling Process. J. Jpn. Soc. Powder Powder Met. 2020, 67, 239-244. [CrossRef]
Effects of Microstructure on Mechanical Properties of Harmonic Structure Designed Pure Ni. M Nagata, N Horikawa, M Kawabata, K Ameyama, 10.2320/matertrans.MT-M2019145Mater. Trans. 60Nagata, M.; Horikawa, N.; Kawabata, M.; Ameyama, K. Effects of Microstructure on Mechanical Properties of Harmonic Structure Designed Pure Ni. Mater. Trans. 2019, 60, 1914-1920. [CrossRef]
Application of Harmonic Structure Design to Biomedical Co-Cr-Mo Alloy for Improved Mechanical Properties. C Sawangrat, O Yamaguchi, S K Vajpai, K Ameyama, 10.2320/matertrans.MA201303Mater. Trans. 55Sawangrat, C.; Yamaguchi, O.; Vajpai, S.K.; Ameyama, K. Application of Harmonic Structure Design to Biomedical Co-Cr-Mo Alloy for Improved Mechanical Properties. Mater. Trans. 2014, 55, 99-105. [CrossRef]
ISOPE-I-19-101. K Ameyama, M Kawabata, B Sharma, 978-1-880653-85-2Proceedings of the 29th International Ocean and Polar Engineering Conference. the 29th International Ocean and Polar Engineering ConferenceHonolulu, HI, USAAmeyama, K.; Kawabata, M.; Sharma, B. ISOPE-I-19-101. In Proceedings of the 29th International Ocean and Polar Engineering Conference, Honolulu, HI, USA, 16-21 June 2019; ISBN 978-1-880653-85-2.
Harmonic-structured copper: Performance and proof of fabrication concept based on severe plastic deformation of powders. C Sawangrat, S Kato, D Orlov, K Ameyama, 10.1007/s10853-014-8258-4J. Mater. Sci. 49Sawangrat, C.; Kato, S.; Orlov, D.; Ameyama, K. Harmonic-structured copper: Performance and proof of fabrication concept based on severe plastic deformation of powders. J. Mater. Sci. 2014, 49, 6579-6585. [CrossRef]
Enhanced Mechanical Properties of Nano/Meso Hybrid Structure Materials Produced by Hot Roll Sintering Process. H Fujiwara, R Akada, A Noro, Y Yoshita, K Ameyama, 10.2320/matertrans.ME200703Mater. Trans. 49Fujiwara, H.; Akada, R.; Noro, A.; Yoshita, Y.; Ameyama, K. Enhanced Mechanical Properties of Nano/Meso Hybrid Structure Materials Produced by Hot Roll Sintering Process. Mater. Trans. 2008, 49, 90-96. [CrossRef]
Formation of (α + γ) Nano-duplex Structure by Severe Plastic Deformation in an SUS316L Stainless Steel. H Fujiwara, H Inomoto, K Ameyama, 10.2355/tetsutohagane1955.91.11_839Tetsu-to-Hagane. 91Fujiwara, H.; Inomoto, H.; Ameyama, K. Formation of (α + γ) Nano-duplex Structure by Severe Plastic Deformation in an SUS316L Stainless Steel. Tetsu-to-Hagane 2005, 91, 839-845. [CrossRef]
A dislocation model for the minimum grain size obtainable by milling. F A Mohamed, 10.1016/S1359-6454(03)00230-1Acta Mater. 51Mohamed, F.A. A dislocation model for the minimum grain size obtainable by milling. Acta Mater. 2003, 51, 4107-4119. [CrossRef]
Synthesis and Characterization of NanocrystallineMg-7.4%Al Powders Produced by Mechanical Alloying. A K Chaubey, S Scudino, M S Khoshkhoo, K G Prashanth, N K Mukhopadhyay, B Mishra, J Eckert, 10.3390/met30100583Chaubey, A.K.; Scudino, S.; Khoshkhoo, M.S.; Prashanth, K.G.; Mukhopadhyay, N.K.; Mishra, B.; Eckert, J. Synthesis and Characterization of NanocrystallineMg-7.4%Al Powders Produced by Mechanical Alloying. Metals 2013, 3, 58-68. [CrossRef]
Nano Grain Formation in Tungsten by Severe Plastic Deformation-Mechanical Milling Process. E Oda, H Fujiwara, K Ameyama, 10.2320/matertrans.ME200704Mater. Trans. 49Oda, E.; Fujiwara, H.; Ameyama, K. Nano Grain Formation in Tungsten by Severe Plastic Deformation-Mechanical Milling Process. Mater. Trans. 2008, 49, 54-57. [CrossRef]
Enhanced ductility in harmonic structure designed SUS316L produced by high energy ball milling and hot isostatic sintering. R Zheng, Z Zhang, M Nakatani, M Ota, X Chen, C Ma, K Ameyama, 10.1016/j.msea.2016.07.048Mater. Sci. Eng. A. 674Zheng, R.; Zhang, Z.; Nakatani, M.; Ota, M.; Chen, X.; Ma, C.; Ameyama, K. Enhanced ductility in harmonic structure designed SUS316L produced by high energy ball milling and hot isostatic sintering. Mater. Sci. Eng. A 2016, 674, 212-220. [CrossRef]
Superior strength and ductility of 316L stainless steel with heterogeneous lamella structure. J Li, Y Cao, B Gao, Y Li, Y T Zhu, 10.1007/s10853-018-2322-4J. Mater. Sci. 53Li, J.; Cao, Y.; Gao, B.; Li, Y.; Zhu, Y.T. Superior strength and ductility of 316L stainless steel with heterogeneous lamella structure. J. Mater. Sci. 2018, 53, 10442-10456. [CrossRef]
Effect of heat treatment on microstructure, mechanical and corrosion properties of austenitic stainless steel 316L using arc additive manufacturing. X Chen, J Li, X Cheng, H Wang, Z Huang, 10.1016/j.msea.2017.10.002Mater. Sci. Eng. A. 715Chen, X.; Li, J.; Cheng, X.; Wang, H.; Huang, Z. Effect of heat treatment on microstructure, mechanical and corrosion properties of austenitic stainless steel 316L using arc additive manufacturing. Mater. Sci. Eng. A 2018, 715, 307-314. [CrossRef]
Mechanism of high yield strength and yield ratio of 316 L stainless steel by additive manufacturing. Y Yin, J Sun, J Guo, X Kan, D Yang, 10.1016/j.msea.2018.12.092Mater. Sci. Eng. A. 744Yin, Y.; Sun, J.; Guo, J.; Kan, X.; Yang, D. Mechanism of high yield strength and yield ratio of 316 L stainless steel by additive manufacturing. Mater. Sci. Eng. A 2019, 744, 773-777. [CrossRef]
Microstructure and mechanical properties of AISI 316L steel with an inverse gradient nanostructure fabricated by electro-magnetic induction heating. Q Long, J Lu, T Fang, 10.1016/j.msea.2019.02.061Mater. Sci. Eng. A. 751Long, Q.; Lu, J.; Fang, T. Microstructure and mechanical properties of AISI 316L steel with an inverse gradient nanostructure fabricated by electro-magnetic induction heating. Mater. Sci. Eng. A 2019, 751, 42-50. [CrossRef]
Strengthening austenitic steels by using nanotwinned austenitic grains. K Lu, F Yan, H Wang, N Tao, 10.1016/j.scriptamat.2011.12.044Scr. Mater. 66Lu, K.; Yan, F.; Wang, H.; Tao, N. Strengthening austenitic steels by using nanotwinned austenitic grains. Scr. Mater. 2012, 66, 878-883. [CrossRef]
Enhancing fracture toughness of nanotwinned austenitic steel by thermal annealing. L Xiong, Z You, L Lu, 10.1016/j.scriptamat.2016.03.024Scr. Mater. 119Xiong, L.; You, Z.; Lu, L. Enhancing fracture toughness of nanotwinned austenitic steel by thermal annealing. Scr. Mater. 2016, 119, 55-59. [CrossRef]
Tensile properties of a nanocrystalline 316L austenitic stainless steel. X Chen, J Lu, L Lu, K Lu, 10.1016/j.scriptamat.2005.01.023Scr. Mater. 52Chen, X.; Lu, J.; Lu, L.; Lu, K. Tensile properties of a nanocrystalline 316L austenitic stainless steel. Scr. Mater. 2005, 52, 1039-1044. [CrossRef]
Quantifying the synergetic strengthening in gradient material. Y Wang, C Huang, M Wang, Y Li, Y Zhu, 10.1016/j.scriptamat.2018.02.039Scr. Mater. 150Wang, Y.; Huang, C.; Wang, M.; Li, Y.; Zhu, Y. Quantifying the synergetic strengthening in gradient material. Scr. Mater. 2018, 150, 22-25. [CrossRef]
Enhanced fatigue properties of nanostructured austenitic SUS 316L stainless steel. H Ueno, K Kakihata, Y Kaneko, S Hashimoto, A Vinogradov, 10.1016/j.actamat.2011.07.061Acta Mater. 59Ueno, H.; Kakihata, K.; Kaneko, Y.; Hashimoto, S.; Vinogradov, A. Enhanced fatigue properties of nanostructured austenitic SUS 316L stainless steel. Acta Mater. 2011, 59, 7060-7069. [CrossRef]
Grain Size Effects in Micro-Tensile Testing of Austenitic Stainless Steel. W A Poling, Golden, CO, USAColorado School of MinesMaster's ThesisPoling, W.A. Grain Size Effects in Micro-Tensile Testing of Austenitic Stainless Steel. Master's Thesis, Colorado School of Mines, Golden, CO, USA, 2012.
Controlling strength and ductility: Dislocation-based model of necking instability and its verification for ultrafine grain 316L steel. A Vinogradov, I Yasnikov, H Matsuyama, M Uchida, Y Kaneko, Y Estrin, 10.1016/j.actamat.2016.01.005Acta Mater. 106Vinogradov, A.; Yasnikov, I.; Matsuyama, H.; Uchida, M.; Kaneko, Y.; Estrin, Y. Controlling strength and ductility: Dislocation-based model of necking instability and its verification for ultrafine grain 316L steel. Acta Mater. 2016, 106, 295-303. [CrossRef]
Additive manufacturing of 316L stainless steel by electron beam melting for nuclear fusion applications. Y Zhong, L E Rannar, L Liu, A Koptyug, S Wikman, J Olsen, D Cui, Z Shen, 10.1016/j.jnucmat.2016.12.042J. Nucl. Mater. 486Zhong, Y.; Rannar, L.E.; Liu, L.; Koptyug, A.; Wikman, S.; Olsen, J.; Cui, D.; Shen, Z. Additive manufacturing of 316L stainless steel by electron beam melting for nuclear fusion applications. J. Nucl. Mater. 2017, 486, 234-245. [CrossRef]
Comparison of microstructure and mechanical properties of 316L austenitic steel processed by selective laser melting with hot-isostatic pressed and cast material. A Röttger, K Geenen, M Windmann, F Binner, W Theisen, 10.1016/j.msea.2016.10.012Mater. Sci. Eng. A. 678Röttger, A.; Geenen, K.; Windmann, M.; Binner, F.; Theisen, W. Comparison of microstructure and mechanical properties of 316L austenitic steel processed by selective laser melting with hot-isostatic pressed and cast material. Mater. Sci. Eng. A 2016, 678, 365-376. [CrossRef]
Microstructure and Fracture Behavior of 316L Austenitic Stainless Steel Produced by Selective Laser Melting. R Casati, J Lemke, M Vedani, 10.1016/j.jmst.2016.06.016J. Mater. Sci. Technol. 32Casati, R.; Lemke, J.; Vedani, M. Microstructure and Fracture Behavior of 316L Austenitic Stainless Steel Produced by Selective Laser Melting. J. Mater. Sci. Technol. 2016, 32, 738-744. [CrossRef]
316L stainless steel mechanical and tribological behavior-A comparison between selective laser melting, hot pressing and conventional casting. F Bartolomeu, M Buciumeanu, E Pinto, N Alves, O Carvalho, F Silva, G Miranda, 10.1016/j.addma.2017.05.007Addit. Manuf. 16Bartolomeu, F.; Buciumeanu, M.; Pinto, E.; Alves, N.; Carvalho, O.; Silva, F.; Miranda, G. 316L stainless steel mechanical and tribological behavior-A comparison between selective laser melting, hot pressing and conventional casting. Addit. Manuf. 2017, 16, 81-89. [CrossRef]
Mechanical behavior of selective laser melted 316L stainless steel. J Suryawanshi, K Prashanth, U Ramamurty, 10.1016/j.msea.2017.04.058Mater. Sci. Eng. A. 696Suryawanshi, J.; Prashanth, K.; Ramamurty, U. Mechanical behavior of selective laser melted 316L stainless steel. Mater. Sci. Eng. A 2017, 696, 113-121. [CrossRef]
Thermal stability and tensile property of 316L stainless steel with heterogeneous lamella structure. S Wang, J Li, Y Cao, B Gao, Q Mao, Y Li, 10.1016/j.vacuum.2018.03.040152Wang, S.; Li, J.; Cao, Y.; Gao, B.; Mao, Q.; Li, Y. Thermal stability and tensile property of 316L stainless steel with heterogeneous lamella structure. Vacuum 2018, 152, 261-264. [CrossRef]
A comparison on metallurgical behaviors of 316L stainless steel by selective laser melting and laser cladding deposition. M Ma, Z Wang, X Zeng, 10.1016/j.msea.2016.12.112Mater. Sci. Eng. A. 685Ma, M.; Wang, Z.; Zeng, X. A comparison on metallurgical behaviors of 316L stainless steel by selective laser melting and laser cladding deposition. Mater. Sci. Eng. A 2017, 685, 265-273. [CrossRef]
Relationship between microstructure and mechanical properties of friction stir processed AISI 316L steel produced by selective laser melting. P Peng, K.-S Wang, W Wang, P Han, T Zhang, Q Liu, S Zhang, H Wang, K Qiao, J Liu, 10.1016/j.matchar.2020.110283Mater. Charact. 163Peng, P.; Wang, K.-S.; Wang, W.; Han, P.; Zhang, T.; Liu, Q.; Zhang, S.; Wang, H.; Qiao, K.; Liu, J. Relationship between microstructure and mechanical properties of friction stir processed AISI 316L steel produced by selective laser melting. Mater. Charact. 2020, 163, 110283. [CrossRef]
Three-Dimensionally Gradient and Periodic Harmonic Structure for High Performance Advanced Structural Materials. S K Vajpai, H Yu, M Ota, I Watanabe, G Dirras, K Ameyama, 10.2320/matertrans.MH201509Mater. Trans. 57Vajpai, S.K.; Yu, H.; Ota, M.; Watanabe, I.; Dirras, G.; Ameyama, K. Three-Dimensionally Gradient and Periodic Harmonic Structure for High Performance Advanced Structural Materials. Mater. Trans. 2016, 57, 1424-1432. [CrossRef]
A superior strength-ductility combination in gradient structured Cu-Al-Zn alloys with proper stacking fault energy and processing time. X Yang, J Zhang, Y Gong, M Nakatani, B Sharma, K Ameyama, X Zhu, 10.1016/j.msea.2020.139619Mater. Sci. Eng. 2020139619Yang, X.; Zhang, J.; Gong, Y.; Nakatani, M.; Sharma, B.; Ameyama, K.; Zhu, X. A superior strength-ductility combination in gradient structured Cu-Al-Zn alloys with proper stacking fault energy and processing time. Mater. Sci. Eng. A 2020, 789, 139619. [CrossRef]
Influence of plastic deformation heterogeneity on development of geometrically necessary dislocation density in dual phase steel. A Kundu, D P Field, 10.1016/j.msea.2016.05.022Mater. Sci. Eng. A. 667Kundu, A.; Field, D.P. Influence of plastic deformation heterogeneity on development of geometrically necessary dislocation density in dual phase steel. Mater. Sci. Eng. A 2016, 667, 435-443. [CrossRef]
Back stress strengthening and strain hardening in gradient structure. M Yang, Y Pan, F Yuan, Y Zhu, X Wu, 10.1080/21663831.2016.1153004Mater. Res. Lett. 4Yang, M.; Pan, Y.; Yuan, F.; Zhu, Y.; Wu, X. Back stress strengthening and strain hardening in gradient structure. Mater. Res. Lett. 2016, 4, 145-151. [CrossRef]
Making strong nanomaterials ductile with gradients. K Lu, 10.1126/science.1255940Science. 345PubMedLu, K. Making strong nanomaterials ductile with gradients. Science 2014, 345, 1455-1456. [CrossRef] [PubMed]
Towards strength-ductility synergy through hierarchical microstructure design in an austenitic stainless steel. R Zheng, M Liu, Z Zhang, K Ameyama, C Ma, 10.1016/j.scriptamat.2019.05.017Scr. Mater. 169Zheng, R.; Liu, M.; Zhang, Z.; Ameyama, K.; Ma, C. Towards strength-ductility synergy through hierarchical microstructure design in an austenitic stainless steel. Scr. Mater. 2019, 169, 76-81. [CrossRef]
Improving the tensile ductility of metal matrix composites by laminated structure: A coupled X-ray tomography and digital image correlation study. G Fan, L Geng, H Wu, K Miao, X Cui, H Kang, T Wang, H Xie, T Xiao, 10.1016/j.scriptamat.2017.03.030Scr. Mater. 135Fan, G.; Geng, L.; Wu, H.; Miao, K.; Cui, X.; Kang, H.; Wang, T.; Xie, H.; Xiao, T. Improving the tensile ductility of metal matrix composites by laminated structure: A coupled X-ray tomography and digital image correlation study. Scr. Mater. 2017, 135, 63-67. [CrossRef]
Fractographical Analysis on Fracture Mechanism of Stainless Steel Having Harmonic Microstructure. A Ueno, H Fujiwara, M Rifai, Z Zhang, K Ameyama, 10.2472/jsms.61.686J. Soc. Mater. Sci. Jpn. 61Ueno, A.; Fujiwara, H.; Rifai, M.; Zhang, Z.; Ameyama, K. Fractographical Analysis on Fracture Mechanism of Stainless Steel Having Harmonic Microstructure. J. Soc. Mater. Sci. Jpn. 2012, 61, 686-691. [CrossRef]
Evaluation of near-threshold fatigue crack propagation in harmonic-structured CP titanium with a bimodal grain size distribution. S Kikuchi, T Mori, H Kubozono, Y Nakai, M O Kawabata, K Ameyama, 10.1016/j.engfracmech.2017.06.026Eng. Fract. Mech. 181Kikuchi, S.; Mori, T.; Kubozono, H.; Nakai, Y.; Kawabata, M.O.; Ameyama, K. Evaluation of near-threshold fatigue crack propagation in harmonic-structured CP titanium with a bimodal grain size distribution. Eng. Fract. Mech. 2017, 181, 77-86. [CrossRef]
The effects of thermo-mechanical processing on fatigue crack propagation in commercially pure titanium with a harmonic structure. K Osaki, S Kikuchi, Y Nakai, M O Kawabata, K Ameyama, 10.1016/j.msea.2019.138892Mater. Sci. Eng. 2020138892Osaki, K.; Kikuchi, S.; Nakai, Y.; Kawabata, M.O.; Ameyama, K. The effects of thermo-mechanical processing on fatigue crack propagation in commercially pure titanium with a harmonic structure. Mater. Sci. Eng. A 2020, 773, 138892. [CrossRef]
Fractographic analysis of fatigue crack initiation and propagation in CP titanium with a bimodal harmonic structure. Y Nukui, H Kubozono, S Kikuchi, Y Nakai, A Ueno, M O Kawabata, K Ameyama, 10.1016/j.msea.2018.01.054Mater. Sci. Eng. A. 716Nukui, Y.; Kubozono, H.; Kikuchi, S.; Nakai, Y.; Ueno, A.; Kawabata, M.O.; Ameyama, K. Fractographic analysis of fatigue crack initiation and propagation in CP titanium with a bimodal harmonic structure. Mater. Sci. Eng. A 2018, 716, 228-234. [CrossRef]
Evaluation of the 4-points bending fatigue properties of Ti-6Al-4V alloy with harmonic structure created by mechanical milling and spark plasma sintering. S Kikuchi, K Takemura, A Ueno, K Ameyama, 10.2472/jsms.64.880J. Soc. Mater. Sci. Jpn. 64Kikuchi, S.; Takemura, K.; Ueno, A.; Ameyama, K. Evaluation of the 4-points bending fatigue properties of Ti-6Al-4V alloy with harmonic structure created by mechanical milling and spark plasma sintering. J. Soc. Mater. Sci. Jpn. 2015, 64, 880-886. [CrossRef]
Statistical fatigue properties and small fatigue crack propagation in bimodal harmonic structured Ti-6Al-4V alloy under four-point bending. S Kikuchi, H Kubozono, Y Nukui, Y Nakai, A Ueno, M O Kawabata, K Ameyama, 10.1016/j.msea.2017.11.010Mater. Sci. Eng. A. 711Kikuchi, S.; Kubozono, H.; Nukui, Y.; Nakai, Y.; Ueno, A.; Kawabata, M.O.; Ameyama, K. Statistical fatigue properties and small fatigue crack propagation in bimodal harmonic structured Ti-6Al-4V alloy under four-point bending. Mater. Sci. Eng. A 2018, 711, 29-36. [CrossRef]
Evaluation of Fatigue Properties under Four-point Bending and Fatigue Crack Propagation in Austenitic Stainless Steel with a Bimodal Harmonic Structure. S Kikuchi, Y Nakatsuka, Y Nakai, M Nakatani, M O Kawabata, K Ameyama, 10.3221/IGF-ESIS.48.5213Frattura ed Integrità StrutturaleKikuchi, S.; Nakatsuka, Y.; Nakai, Y.; Nakatani, M.; Kawabata, M.O.; Ameyama, K. Evaluation of Fatigue Properties under Four-point Bending and Fatigue Crack Propagation in Austenitic Stainless Steel with a Bimodal Harmonic Structure. Frattura ed Integrità Strutturale 2019, 13, 545-553. [CrossRef]
Effect of bimodal harmonic structure on fatigue properties of austenitic stainless steel under axial loading. S Kikuchi, Y Nukui, Y Nakatsuka, Y Nakai, M Nakatani, M O Kawabata, K Ameyama, 10.1016/j.ijfatigue.2019.06.016Int. J. Fatigue. 127Kikuchi, S.; Nukui, Y.; Nakatsuka, Y.; Nakai, Y.; Nakatani, M.; Kawabata, M.O.; Ameyama, K. Effect of bimodal harmonic structure on fatigue properties of austenitic stainless steel under axial loading. Int. J. Fatigue 2019, 127, 222-228. [CrossRef]
A 3D crystal plasticity model of monotonic and cyclic simple shear deformation for commercial-purity polycrystalline Ti with a harmonic structure. X Wang, F Cazes, J Li, A Hocini, K Ameyama, G Dirras, 10.1016/j.mechmat.2018.10.006Mech. Mater. 128Wang, X.; Cazes, F.; Li, J.; Hocini, A.; Ameyama, K.; Dirras, G. A 3D crystal plasticity model of monotonic and cyclic simple shear deformation for commercial-purity polycrystalline Ti with a harmonic structure. Mech. Mater. 2019, 128, 117-128. [CrossRef]
A three-dimensional multi-scale polycrystalline plasticity model coupled with damage for pure Ti with harmonic structure design. J Liu, G Dirras, K Ameyama, F Cazes, M Ota, 10.1016/j.ijplas.2017.10.006Int. J. Plast. 100Liu, J.; Dirras, G.; Ameyama, K.; Cazes, F.; Ota, M. A three-dimensional multi-scale polycrystalline plasticity model coupled with damage for pure Ti with harmonic structure design. Int. J. Plast. 2018, 100, 192-207. [CrossRef]
Dynamic Hall-Petch versus grain-size gradient effects on the mechanical behavior under simple shear loading of β-titanium Ti-25Nb-25Zr alloys. G Dirras, D Tingaud, D Ueda, A Hocini, K Ameyama, 10.1016/j.matlet.2017.07.027Mater. Lett. 206Dirras, G.; Tingaud, D.; Ueda, D.; Hocini, A.; Ameyama, K. Dynamic Hall-Petch versus grain-size gradient effects on the mechanical behavior under simple shear loading of β-titanium Ti-25Nb-25Zr alloys. Mater. Lett. 2017, 206, 214-216. [CrossRef]
Conventional vs. harmonic-structured β-Ti-25Nb-25Zr alloys: A comparative study of deformation mechanisms. F Mompiou, D Tingaud, Y Chang, B Gault, G Dirras, 10.1016/j.actamat.2018.09.032Acta Mater. 161Mompiou, F.; Tingaud, D.; Chang, Y.; Gault, B.; Dirras, G. Conventional vs. harmonic-structured β-Ti-25Nb-25Zr alloys: A comparative study of deformation mechanisms. Acta Mater. 2018, 161, 420-430. [CrossRef]
| Abstract In order to make clear the special deformation mechanism of nanotwinned copper, the mechanical properties of two kinds of ultrafine-grained copper, one with nano-scale growth twin in the ultrafine grains and another one without twin, were compared in this study. Though it hardly exhibits work-hardening capacity, the nanotwinned copper shows much higher strength combined with good ductility than the copper without growth twin. The microstructure of nanotwinned copper was separated by twins into nano-scale regions where dislocation intersections and pile-up rarely take place. That leads to the weak work-hardening capacity in nanotwinned copper. The good ductility is attributed to its enhanced strain rate sensitivity which originates from the shortened dislocation segment length. Meanwhile, both the blocking effect of twin boundary on dislocation slipping and the shortened dislocation segment length enhance the strength in nanotwinned copper. | Ultrafine-grained metals whose grain size is less than one micron have attracted interest as high strength materials. Whereas nanostructured metals produced by severe plastic deformation express remarkably peculiar behavior in both material and mechanical aspects, its mechanism has been clarified by neither experimental nor computational approaches. In this study, we develop a multiscale crystal plasticity model considering an effect of grain boundary. In order to express release of dislocation from grain boundaries, information of misorientation is introduced into a hardening law of crystal plasticity. In addition, carrying out FE simulation for FCC polycrystal, the stress-strain responses such as increase of yield stress due to existence of grain boundary are discussed. We investigate comprehensively the effect of dislocation behavior on the material property of nanostructured metal. |
subgrain size (low angle boundary spacing [27]) with increasing strain, misorientation some of them gradually increase and which may become HAGBs. Additionally, other types of HAGBs such as new HAGBs and pre-existing HAGBs can form. Former is due to different orientation paths during subsequent deformation and latter attributes to increase the grain boundaries with increasing strain.
Since elongation of the original grains increase the HAGBs in the microstructure, therefore it is worth emphasizing that the imposed strain during MMR process is effectively affected by grain boundary density which in turn affects the dislocation density. By considering the strain limitations during secondary plastic deformation processes, it is necessary to understand how way and how much can be applied a huge plastic strain ( > 4) to a material (herein CNT/Al composite) to obtain a good coordination of CNT dispersion, reaction CNT-Al, and microstructure properties of the matrix grains such as size, geometry and crystallography texture.
Here, it will be proposed a microstructural property-based model which is containing the lamellar ultrafine-grains to calculate the dislocation density with relation to grain size, shape and crystallography texture. To this end, the required strain for achieving to a lamellar UFG architecture during preparing process is calculated. The nanoscale architecture is produced by means of a novel and smart SPD technique derived from flake PM technique that so-called micro-macro rolling (MMR) process. Actually, a strategy of task allocation two-stage rolling, one in micro-scale and the other in macro-scale is used to tailor lamellar UFGed architecture of CNT/Al composite. The effect of different reductions of macro-rolling process on the CNT dispersion, the reaction extent of CNT with aluminum as well as the size, shape, and crystallography of the matrix grains are studied.
Experimental procedure
Spherical aluminium powders with mead diameter of 40 µm and CNTs were selected as the raw materials. 1.0 and 1.5 wt.% of CNTs is chosen as appropriate content for reinforcing. Flake PM technique via solution approach and following conventional rolling process was employed to fabricate UFGed CNTs/Al composite. Firstly, to ensure the breaking of CNTs clusters, they were dispersed in ethanol, assisted by an ultrasonic shaker for 1 h to get a gel-like dispersion. After that, the raw Al powders are added in the gel-like CNTs-ethanol solution, stirred and then dried in vacuum at 70℃ for 2 h to obtain CNTs/Al spherical powders. To make the composite, flake PM via a dualspeed BM route [18,45] conducted using a planetary ball mill at low-speed BM(LSBM) at 160rpm for 8h, hereafter denoted as 160/8, followed by high-speed BM (HSBM) at 270rpm for 1h, hereafter denoted as 270/1, in an argon atmosphere at 1 atm. Preliminary experiences demonstrated that the combination of LSBM and HSBM lads to uniform CNT dispersion in Al flakes thanks to LSBM, and good bonding of CNT/Al flakes thanks to HSBM. Vacuum hot pressing (VHP) was employed for the consolidation of the composite powders. Powders were firstly cold pressed before sintering at 550°C for 2 hours in a graphite die. The processing of the studied composites is shown in Figure 1. The rolling processing conditions sequence is shown in table 1. where the TKD and TEM specimens were prepared by the lift-out method using focused ion beam system (FIB, FEI Scios).
Tensile and hardness tests were performed to measure the materials mechanical properties. Tensile
Results and discussion
Deformation model
Concerning the overall strain of MMR process, it is approximately consistent with the sum of the overall reduction of bulk materials during both micro-rolling ( ) and macro-rolling process ( ). Therefore, the total strain imposed can be decomposed into its micro rolling induced strain and macro rolling induced strain parts as given in Eq.1.
= + (1)
During milling the powder evolution follows five different stages [1]. Among all stages, the particle flattening (the first stage) results from plastic deformation, leading to change the spherical aspect to plate (flake)-shape appearance. The typical HSBM method caused severe damage and excessive interfacial reaction of CNTs, while LSBM enhances the dispersion of CNTs and minimizes the damage. The amount of strain that a metallic particle experienced by one collision can be expressed as in Eq. 2 [2,3]:
= − ln {1− ℎ ( ) 1/2 }(2)
Where h = 2 [48] where is the mean diameter of the as-received powder, is the balls speed (m/s), is the ball radius, is the balls density, and is the vital Vickers hardness.
The number of collisions experienced by each particle during ball milling process can be calculated through Eq. 3.
N = 3 4 ( )(3)
Where is a constant related to the milling instrument, is defined as the charge ratio (mass of balls/mass of powder), is the frequency of milling, is the powder density and is the time of the milling.
The frequency of collisions in a planetary ball milling can be expressed as in Eq. 4:
= ( -)(4)
Where si the number of balls and K is a constant and was evaluated to be approximately 1.5 [49]. and are the rotational speed of disk of the mill and of the vial, respectively. And ~ -2 for 500ml planetary ball milling system in our lab.
The time required to flatten the spherical aluminium powder particles is proportional to the time interval between different ball collisions, (in minutes), that can be expressed by Eq. 5 [50]:
∝ = 1 60 (5)
Where and are the volume of powder associated with each ball and the powder volume affected by a collision, respectively. can be calculated by Eq. 6:
= 4 √3 ( 1/2 ( ) 1/2 ( )ℎ )(6)
Where ℎ = 2 .
The volume fraction of aluminium particles can be defined by Eq. 7 [51] :
= + + +(7)
Where , , and is the volume fraction of aluminium powders, CNTs, PCA and balls in LSBM process.
The variation of the powder hardness during milling is a fundamental parameter affecting the imposed strain to powder. Maurice et al. [52] showed that the variation of hardness of milled powder by increasing imposed strain during milling can be calculated by eq. 8.
= 0 + 3 (8)
The strain is determined from Eq. 9.
= -ln{ ℎ− ℎ } (9)
And is the deformation of the powder trapped between two balls and is calculated by Eq. 10.
= ( 0 ) 1/2 - 2(10)
Where 0 is the initial powder hardness, is the strength coefficient , is the work-hardening exponent of powder and is the distance from the center of two powders in contact.
As a first assumption, the variation of the hardness onto the powder surface will be only considered.
In such condition, = .
Therefore, the strain imposed to the overall aluminium powder particles during LSBM as a microrolling model can be expressed as Eq. 11:
= × N × ×(11)
Therefore, by using Eq. 1-5, can be re-written as in Eq. 12:
= − ln {1− ℎ ( ) 1/2 } × 1 45 ( ( ) 1/2 1/2 ℎ ) ×(12)
Where A is a constant related to the milling instrument.
The reduction ratio for normal rolling can be obtained as described in Eq. 13:
= ℎ 0 − ℎ ℎ 0(13)
Where ℎ 0 and ℎ are the original thickness and final thickness of the specimens, respectively.
By considering each of the matrix powders experiences the same deformation, Tan et al. [53] showed that ratio of the original transverse length, 0 , and the final short transverse length, , should be given by Eq. 14.
0 = √(14)
After applying the macro-rolling, short-transverse length of matrix powder, , and the original matrix powder size, should have an approximately same ratio with that of the change in thickness (Eq. 15),
0 = ℎ 0 ℎ(15)
Therefore, it can be expected that the imposed strain during macro-rolling process to the materials can be expressed as Eq. 16.
= ℎ 0 −ℎ ℎ 0 = {1 -(√ ) −1 }(16)
Therefore, it can be concluded that overall strain imposed after MMR process is given by Eq. 17.
= − ln {1− ℎ ( ) 1/2 } × 1 45 ( ( ) 1/2 1/2 ℎ ) × + 1 -(√ ) −1(17)
In the proposed model, the focus will be on the strengthening resulted from the evolution of dislocation during plastic deformation strain ( ). Therefore, since then, it will be paid to the impacts of the plastic strain imposed during MMR process on the shape, size and crystallography texture parameters of the matrix. Therefore, the contribution of MMR process on the generation of dislocations should be considered separately, namely as in Eq. 18.
= − + −(18)
The formation of several domains which in turn reflects the different orientations inside grains, are directly affected by the micro-strain imposed during micro-rolling process. Actually, the misorientation between the domains inside the CNTs/Al composite particle ranges between that of low angle grain boundaries (LAGBs) to high angle grain boundaries (HAGBs). In early stages of milling, the LAGBs first increases due to the produced dislocation walls and subgrains, and then decreases due to the rearrangement of LAGBs through dynamic recovery.
However, it is found that the LAGB extent in aluminium alloys remains approximately constant at strains larger than 1-2 [27]. Many HAGBs formed, but they did not evolve into new grains banding the grain interiors in order to create just regions of different orientation. Hence, by progressing the milling, the increase not only in the density of LAGBs but also in the density of HAGBs occurred.
The former is arisen from the large changes in orientation inside the lamellar grains and latter is originated from the gradual increasing of the misorientation in subgrain boundaries as a consequence of the increased dislocations density.
To calculate the dislocation density caused by − , the dislocation density evolution in grain boundaries and grain interior should be considered. Hence, it should be first calculated the number of dislocations arriving at grain boundaries ( 0 ) during imposed plastic strain ( − ). Besides, the effect of deformation geometry on the density of HAGBs should also be considered in the micro-rolling process. To this end, the situation is summarized in Eq. 19 [54][55][56].
0 − = λ [1 − 0 0 * ](19)
Where λ is the average distance between slip bands which is equal to the width of lamellar grain. 0 * is the maximum number of dislocations or screening at a GB and λ is the average length of dislocation loops. are Taylor factor and Bergers' vector for aluminum.
Recently, Razavi-Tousi et al. [57] proposed an interesting technique to calculate the grain boundary density according to processing the misorientation data for EBSD patterns. The method is summarized in Eq. (20).
= × ×(20)
Where is the boundaries density with misorientation per area, the frequency of counted pixels with misorientation , the step size of EBSD image, the total pattern pixels number and is the indexed pixels to the total number of pixels ratio.
Where and are the average aspect ratio of the subgrains and grains with LAGBs and HAGBs, respectively. Therefore, the contribution of grain boundaries in increasing the dislocation density during MMR process, can be expressed from Eq. 24:
={ × }+{ × }(24)
In ultrafine-grain CNTs/Al composites, the evolution of dislocation inside grain interior ( ) during the deformation process is governed by the following dynamic process, due to dislocation-dislocation pinning, annihilation of dislocations as a consequence of dynamic recovery and an additional term (-) which reflect dynamic recovery of additional dislocation at GBs due to decrease grain size [5,58]. During the process of deformation, the evolution of dislocations density for a given strain Owing to the presence of CNTs, the strain incompatibility between different grains should be considered, therefore = 1.25, otherwise = 1 if only the grain boundaries dislocations are considered [59].
The dislocation annihilation in FCC metals can be described by Eq. 27.
Where g = ( ) and is the volume of the oblate sphere that is calculated by Eq. 30.
= 4 3 ( 2 )(30)
Where and are half of the length and width of the micro-rolled grain.
Since the majority of the lamellar grains sectioned by transverse LAGBs as well as HAGBs throughout the grains during ball milling process, thus the average area sweap by dislocation, , can be expressed by Eq. 31.
= ( ) 2(31)
Therefore, basing on these considerations, Eq. (28) can be re-written through Eq. 32
= × × × −(32)
Where − is aspect ratio for the lamellar aluminium grain after micro-rolling process.
Micro-rolling process originally resulted in the flattening of powder particles as a consequence of plastic deformation imposed during transferring the kinetic energy of balls to powder particles; no overall texture is developed by imposing deformation due to continuously change of stress direction and deformation mode for each particle. However, secondary plastic deformation process, as is here macro-rolling process, is responsible to form the crystallography texture. Furthermore, in many FCC materials, dislocation density and distribution depend on crystallography texture of the grains with respect to the stress axis [62].
Therefore, it should be also considered the contribution of crystallography texture parameter on the dislocation density related to the macro-rolling process. To this end, the percentage of (ℎ )
oriented grains along rolling direction, ℎ , can be calculated by Eq. 33.
Where M is the Taylor factor and is the average glide distance of the dislocations. Since, the distance between the center and edge of the lamellar UFGs is the minimum distance for gliding the dislocations, it is hence logical to assume that the short transverse length of matrix grain is equal to the average glide distance of the dislocations. Hence, it can be expressed by Eq. 35.
= cos (35) Therefore, the density of the dislocations is given by Eq. 36.
− = {1 -(√ ) −1 }× ×cos × × ℎ(36)
By and large, the overall density of dislocation resulted from plastic deformation imposed during MMR process can be calculated through Eq. 37.
= { × }+{ × }+ / + M ( × × × ){ 2 + 3 2 } + { {1 -(√ ) −1 }× ×cos × × ℎ } (37)
Results and discussion
Microstructural evolution
The microstructure of the CNTs/Al composite with 1.0 % of carbon nanotubes as a function of the thickness reduction during hot rolling is shown in Figure 3. From the first glance, it can be found that the grains are mostly consisted of UFG grains (>100nm) while some rod-like Al4C3 (<10 nm in diameter) are also visible. Plus, the average of grain size of Al is decreased as the thickness reduction increases. However, formation of rod-like Al4C3 is inevitable as a consequence of compressing force and collision frequency which were directly proportional to the milling speed [18,63] as well as pressure caused by conventional rolling process [33]. Blocked dislocations Blocked dislocations that was consistent with previous studies [63,64]. The addition of CNTs leads to the significant increase of UFG grains, and with the CNT content increasing, the proportion of UFG grains increases in CNT/Al composites as the thickness reduction increases. From the perspective of the overall grain size distribution, as the CNT content increases, the grain size becomes smaller which attributed to the strong pinning effect of CNTs. Especially when the CNT content is 1.5 wt.%, all the grain sizes are smaller than 300nm and showed an acceptable homogeneity in the UFG range.
Developing the thickness reduction from 10%, 30%, and 50% causing a large number of CNTs are singly dispersed on the grain boundaries, as shown by the white arrow, while a small amount of Al4C3 nanorods, as shown by the red arrow, are distributed in the grain interiors at all thickness reductions.
A close inspection of the figures 3 and 4, can be depicted that the CNT-enriched zones are formed near the grain boundaries due to thermodynamically equilibrium. Accordingly, the probability of dislocation annihilation is decreased, and dislocation generation and accumulation gradually overtook its annihilation as the governing mechanism of deformation [15] as the imposed strain caused by conventional rolling process increases.
The mean grain size measurements for all the studied conditions are listed in Figure 5. the main results are that the grain size decreases as the thickness reduction increases for both the reinforcement percentages; in addition, the composite with 1.5% of carbon nanotubes reveals finer grain sizes with respect to the material with 1.0% of CNTs, evolving towards an equiaxed structure. The uniform distribution of CNTs is confirmed through the observation of EBSD maps shown in Figure 6 on the normal direction (ND) of CNT/Al rolled composites. There was an obvious equiaxed structure to some extent elongated grains along with RD in both 1 and 1.5 wt.% of CNTs/ Al. It can be seen that CNTs were found to be aligned unidirectionally to some extent, which should be the RD due to the shear stress during rolling process [65]. Both maps belong to the material deformed with 50% of thickness reduction.
The grain size in equiaxed structure was determined primarily by the amount of the shear deformation the Al powders experienced during milling especially LSBM and then followed by thickness reduction of the conventional rolling. With increasing thickness reduction, the UFG grains structure was gradually pronounced. The UFG Al grain in the 1 wt. % and 1.5 wt.% CNT/Al composite were found to have relative shear textures with the dominant (001)<110> of rotated cube texture, consistent with the results observed in CNT/Al composites produced by SPS and hot rolling process [63,65].
Mechanical properties
The tensile properties of the studied materials are shown in Figure 7. It is obvious that the flow stress is increased with increasing the thickness reduction of 10, 30 and 50% for both 1 wt.% and 1.5 wt.% CNT-Al composite, indicating that the flow stress has a dependency of both strain and consistent. In fact, as 1 wt.% of CNT content increased to 1.5 wt.%, the flow stress increase for all the thickness reductions, indicating strength depends on the CNT content. Plus, the observed variations of total elongation are basically retributed to the strain hardening capacity especially at higher strain where the accumulated dislocation density is significant. Considering the concept of tensile ductility, it can be fairly pointed out that tensile ductility depends on the uniform accumulation of dislocations in the UFG grains. In fact, the strain hardening capability can be manifested by the ability of the accumulation of dislocation in grains which conversely related to grain size. So, it expected that by increasing the dislocation density, this criterion is improved as seen in Figure 7. The average dislocation velocity for a given strain rate and strain can be connected to strain rate by:
= •(38)
Where A is an experimentally constant, equal to 10 9 , and is the plastic strain, • strain rate.
In fact, under higher strain, dislocation velocity decrease which resulted in enhancing dislocation number and more interactions between dislocations, leading to increase dislocation density.
Therefore, it can be concluded that the internal stresses are increase, affecting the dislocation behavior especially in their generation, annihilation, and accumulation under different strains. It expected that by developing the accumulation of dislocation in CNT-enriched regions, the strain hardening capability increase, leading to enhance the tensile ductility of the CNT/Al composites.
The hardness behaviour is shown in Figure 8. The fracture surfaces of the tensile tested materials are shown in Figure 9. nanotubes. Both maps belong to the material deformed with 50% of thickness reduction.
The fracture surfaces aspect reveals a uniform distribution of very fine dimples replying the materials grain size. The main difference is represented by the more pronounced voids coalescence with formation of larger craters in the 1.5% CNTs reinforced material with respect to the 1.0 % CNTs one.
It is believed that a larger concentration of carbon nanotubes leads to stress concentration in certain locations leading to intergranular fracture more pronounced as the nanotubes concentration increases.
Conclusions
The microstructural and mechanical evolution of carbon nanotubes reinforcing aluminium composites produced via flake metallurgy and rolling are described in the present paper. All the produced composites do not show carbon nanotubes agglomeration for all the selected reinforcing percentages. As the CNTs percentage increases, pronounced grain refinement is obtained. All the studied materials showed ultrafine grained structures. Grain refinement is more efficient as the rolling thickness reduction increases. The increase in deformation is accompanied with more pronounced textures and mechanical strength increase. The fracture surfaces observations revealed a very ductile behaviour of the tensile deformed materials.
Declarations:
The manuscript was not submitted to other journals for simultaneous consideration.
The submitted work is original and was not published elsewhere in any form or language.
Results were presented clearly, honestly, and without fabrication, falsification or inappropriate data manipulation.
No data, text, or theories by others are presented.
Figure 1 :
1processing schematic of dual speed flake PM of CNT/Al composite during MMR.
samples were cut from the rolled composite foils with 50 mm length, 4 mm width and 15 mm gauge length at a constant strain rate 0.5 mm/min in a direction parallel to the rolling one (RD). Vickers hardness (HV) tests were conducted on polished cross section parallel to the rolling surface, under an applied load of 50 g for 10 s. The hardness measurements were done on seven different random points of the rolled surface.
the lamellar UFG width of aluminium. is the average angle between the slip direction and the tensile direction, which is assumed to be 45° as shown in figure 2.
Figure 2 :
2Illustration of the dislocations behaviour.
as the dislocation storage factor and is in the range of 1× 10 13 -1× 10 14 −2[60].The terms 2 and 3 are parameters directly linked to cross slip of screw dislocation and annihilation coefficient of edge dislocation accumulated. 2 can be calculated by , where is the proportionality factor. The term 3 corresponds to the grain boundary diffusion coefficient and the effective forest hardening effects of grain boundary dislocations. The terms 2 and 3 are considered by 0.025[61] and 0.00423 m for CNTs/metal composites.The decrease of grain size and the change of the aspect ratio could effectively affect the dislocation density. Thereby, in the case under study where the grains are UFGed having a non-isotropic grain shape, the effective grain size should be defined. Hence, is the effective grain size of the matrix by taking into account both the average dislocation loop length, , and the average area sweap by dislocation, . Therefore, it can be defined by Eq.
ℎ is the sum of the Bragg reflections intensity of each (hkl). Usually, {001}<110> texture forms as the rolling shear texture in the Al flat are produced. Hence, it seems that the rolling direction is consistent with the direction of <110> which is the major direction of shear texture in FCC materials. Additionally, for our work, (hkl) represents three most intensive Brag reflection
Figure 3 :
3CNTs/Al composite after 10 % (a), 30 % (b) and 50 % of thickness reduction (c); the microstructure belongs to a percentage of CNTs of 1.0. The microstructure of the CNTs/Al composite with 1.5 % of carbon nanotubes as a function of the thickness reduction during hot rolling is shown in Figure 4. There is no agglomeration of CNTs in content of CNTs and they are mainly distributed along the grain boundaries in the CNT/
Figure 4 :
4CNTs/Al composite after 10 % (a), 30 % (b) and 50 % of thickness reduction (c); the microstructure belongs to a percentage of CNTs of 1.5.Under flake BM condition and subsequent conventional rolling process as a high strain rate regime, dislocations are generated as a consequence of intrinsic and non-intrinsic incompatibilities such as different crystallographic orientation in grain boundaries, domains as well as the presence of CNTs at grain boundaries, giving rise the driving stress for increasing the internal stresses of the UFG grains. and CNT-Al interfaces are the main long-range barriers to dislocation motion that cannot be overcome by thermal activation especially[18]. Hence, impeding and piling up the dislocation in such border regions result in a much higher dislocation density in the CNT-enriched regions. Moreover, short-range barriers such as impurity atoms, forest dislocations, and Peierls barriers can be readily overcome by assistance of thermal activation which in turn causes reduce the applied stress needed for dislocation passing obstacles[19]. Considering the uniform dispersity of CNTs at the grain boundaries, accumulating the mobile dislocations behind tough obstacles such as grain boundaries and CNT at border regions of the UFG grains, as well as forest dislocations inside the UFG grains. The accumulation of dislocations back of the CNTs could generate a stacked dislocation lines back of the grain boundaries as specified by blue rectangular inFigure 3, 4.
Figure 5 :
5CNTs/Al composites grain size as a function of the thickness reduction and of the CNTs content.
Figure 6 :
6EBSD maps of the CNTs/Al composites with 1.0% (a) and 1.5% (b) of carbon nanotubes.
Figure 7 :
7Tensile properties of the studied composites as a function of the CNTs percentage and of the thickness reduction per each composition.
Figure 8 :
8Hardness variation as a function of the CNTs percentage and of the thickness reduction.
Figure 9 :
9Fracture surfaces of the CNTs/Al composites with 1.0% (a) and 1.5% (b) of carbon
Table 1 .
1Processing conditions employed to produce the CNTs/Al composites. spherical powders are milled at 270 rpm for 9h and then sintered following the same macro rolling condition to evaluate the effect of micro-rolling process on the size, shape and crystallography texture of the matrix grains as well as the CNTs dispersion level and interfacial bonding degree. Such a combined process regime of MMR makes flake PM applicable to fabricate special UFG architectures otherwise cannot be achieved by present methods.To characterize the microstructure of CNT/Al powders and composites, FESEM and HRTEM images are used. Since, EBSD can examine bigger areas compared to TEM images, thus it can be used to investigate the grain boundaries evolution during MMR process. The mean grain size, the fraction of low angle grain boundaries (LAGBs), and high angle grain boundaries (HAGBs) are obtained using EBSD data and discuss in details. Boundaries with misorientation between 2° and 15° were defined as LAGBs and those of misorientation > 15° as HAGBs. To investigate the impacts of the Boundaries with misorientation between 2° and 15° were defined as LAGBs and those of misorientation > 15° as HAGBs. To investigate the impacts of the microstructure and crystallography orientations relevant to the architecture of the micro-macro rolled composites, EBSD images is taken.Material
CNT,
wt.%
Micro-rolling
Macro-rolling
LSBM
HSBM
Thickness
Reduction (%)
Temperature
(°C)
Al
1.0, 1.5
selective
270 rpm, 1h 10,20,30,40,50
150
Macro-rolling was performed to different reductions in thickness (10, 20, 30, 40 and 50%) at 150 ℃
which was below recrystallization temperature for pure Al [46, 47]. For comparison, CNTs/Al
To calculate the dislocation density of involved in grain boundaries per area , , can be expressed by Eq. 21.−
=
0
(21)
Razavi et al. [57] proposed a technique to calculate the geometry effect of deformation on the increase
in the HAGBs density. Similarly, it can be used in our case concerning the dependency of the
geometry effect on LAGBs density. To this end, HKL software is used to measure the average aspect
ratio of the grains both with LAGBs (Eq. 22) and HAGBs (Eq. 23).
=
1+
2√
(22)
=
1+
2√
The authors have the consent to participate.The authors consent to publish the presented data. No funding was received for conducting this study.The authors have no financial or proprietary interests in any material discussed in this article.The authors have no competing interests.The data are available on request to the corresponding author.
Review on superior strength and enhanced ductility of metallic nanomaterials. Ovid'ko Ia, R Z Valiev, Y T Zhu, 10.1016/j.pmatsci.2018.02.002Prog Mater Sci. 94Ovid'ko IA, Valiev RZ, Zhu YT (2018) Review on superior strength and enhanced ductility of metallic nanomaterials. Prog Mater Sci 94:462-540. https://doi.org/10.1016/j.pmatsci.2018.02.002
High-strength CNT/Al-Zn-Mg-Cu composites with improved ductility achieved by flake powder metallurgy via elemental alloying. R Xu, Z Q Tan, G L Fan, Ji G Xiong, D B Guo, Q Su, Y Li, Z Zhang, D , 10.1016/j.compositesa.2018.05.012Composites A. 111Xu R, Tan ZQ, Fan GL, Ji G, Xiong DB, Guo Q, Su Y, Li Z, Zhang D (2018) High-strength CNT/Al-Zn-Mg-Cu composites with improved ductility achieved by flake powder metallurgy via elemental alloying. Composites A 111:1-11. https://doi.org/10.1016/j.compositesa.2018.05.012
The use of flake powder metallurgy to produce carbon nanotube (CNT)/aluminum composites with a homogenous CNT distribution. L Jiang, Z Q Li, G L Fan, L L Cao, D Zhang, Jiang L, Li ZQ, Fan GL, Cao LL, Zhang D (2012) The use of flake powder metallurgy to produce carbon nanotube (CNT)/aluminum composites with a homogenous CNT distribution. Carbon
Effect of processing parameters on the microstructural and mechanical properties of aluminum-carbon nanotube composites produced by spark plasma sintering. B Sadeghi, M Shamanian, P Cavaliere, F Ashrafizadeh, 10.3139/146.111686Int J Mater Res. 10910Sadeghi B, Shamanian M, Cavaliere P, Ashrafizadeh F (2018) Effect of processing parameters on the microstructural and mechanical properties of aluminum-carbon nanotube composites produced by spark plasma sintering. Int J Mater Res 109(10):900-909. https://doi.org/10.3139/146.111686
Effect of Al2O3, SiO2 and carbon nanotubes on the microstructural and mechanical behavior of spark plasma sintered aluminum based nanocomposites. B Sadeghi, P Cavaliere, A Perrone, Sadeghi B, Cavaliere P, Perrone A (2020) Effect of Al2O3, SiO2 and carbon nanotubes on the microstructural and mechanical behavior of spark plasma sintered aluminum based nanocomposites.
. 10.1080/02726351.2018.1457109Particul Sci Technol. 381Particul Sci Technol 38(1):7-14. https://doi.org/10.1080/02726351.2018.1457109
Enhanced interfacial bonding and mechanical properties in CNT/Al composites fabricated by flake powder metallurgy. G L Fan, Y Jiang, Z Q Tan, Q Guo, D B Xiong, Y S Su, R Lin, L Hu, Z Li, D Zhang, 10.1016/j.carbon.2018.01.037Carbon. 130Fan GL, Jiang Y, Tan ZQ, Guo Q, Xiong DB, Su YS, Lin R, Hu L, Li Z, Zhang D (201). Enhanced interfacial bonding and mechanical properties in CNT/Al composites fabricated by flake powder metallurgy. Carbon 130:333-339. https://doi.org/10.1016/j.carbon.2018.01.037
Effect of local alloying on interfacial bonding in laminated copper matrix composites reinforced by carbon nanotubes. Y Jiang, D Wang, S Liang, F Cao, J Zou, P Xiao, 10.1016/j.msea.2019.01.013Mater Sci Eng A. 748Jiang Y, Wang D, Liang S, Cao F, Zou J, Xiao P (2019) Effect of local alloying on interfacial bonding in laminated copper matrix composites reinforced by carbon nanotubes. Mater Sci Eng A 748:173-179. https://doi.org/10.1016/j.msea.2019.01.013
Recent Progress on the Dispersion and the Strengthening Effect of Carbon Nanotubes and Graphene-Reinforced Metal Nanocomposites: A Review. Z Baig, O Mamat, M Mustapha, 10.1080/10408436.2016.1243089Crit Rew Solid State. 431Baig Z, Mamat O, Mustapha M (2018) Recent Progress on the Dispersion and the Strengthening Effect of Carbon Nanotubes and Graphene-Reinforced Metal Nanocomposites: A Review. Crit Rew Solid State 43(1):1-46. https://doi.org/10.1080/10408436.2016.1243089
Progress of the Current Interface Research on Carbon Nanotubes Reinforced Aluminum-matrix Composites. C Wu, W X Ma, Y P Chen, Y Li, Y Chen, J Li, 10.4028/www.scientific.net/AMR.842.196Int J Manuf Mater Mech Eng. 842Wu C, Ma WX, Chen YP, Li Y, Chen Y, Li J (2014) Progress of the Current Interface Research on Carbon Nanotubes Reinforced Aluminum-matrix Composites. Int J Manuf Mater Mech Eng 842:196-200. https://doi.org/10.4028/www.scientific.net/AMR.842.196
Recent progress in the development and properties of novel metal matrix nanocomposites reinforced with carbon nanotubes and graphene nanosheets. S C Tjong, 10.1016/j.mser.2013.08.001Mater Sci Eng R. 7410Tjong SC (2013) Recent progress in the development and properties of novel metal matrix nanocomposites reinforced with carbon nanotubes and graphene nanosheets. Mater Sci Eng R 74(10):281-350. https://doi.org/10.1016/j.mser.2013.08.001
Carbon nanotube reinforced metal matrix composites-a review. S R Bakshi, D Lahiri, A Agarwal, 10.1179/095066009X12572530170543Int Mater Rev. 551Bakshi SR, Lahiri D, Agarwal A (2010) Carbon nanotube reinforced metal matrix composites-a review. Int Mater Rev 55(1):41-64. https://doi.org/10.1179/095066009X12572530170543
Dual-nanoparticulate-reinforced aluminum matrix composite materials. H Kwon, S Cho, M Leparoux, A Kawasaki, 10.1088/0957-4484/23/22/225704Nanotechnology. 2322225704Kwon H, Cho S, Leparoux M, Kawasaki A. Dual-nanoparticulate-reinforced aluminum matrix composite materials. Nanotechnology 2012;23(22):225704. https://doi.org/10.1088/0957- 4484/23/22/225704
Design of an efficient flake powder metallurgy route to fabricate CNT/6061Al composites. M Chen, G Fan, Z Tan, D Xiong, Q Guo, Y Su, J Zhang, Z Li, M Naito, D Zhang, 10.1016/j.matdes.2018.01.044Mater Des. 142Chen M, Fan G, Tan Z, Xiong D, Guo Q, Su Y, Zhang J, Li Z, Naito M, Zhang D (2018) Design of an efficient flake powder metallurgy route to fabricate CNT/6061Al composites. Mater Des 142:288-296. https://doi.org/10.1016/j.matdes.2018.01.044
Fabrication of carbon nanotube reinforced Al composites with well-balanced strength and ductility. X Yang, E Liu, C Shi, C He, J Li, N Zhao, K Kondoh, J Alloys Compd. 563Yang X, Liu E, Shi C, He C, Li J, Zhao N, Kondoh K (2013) Fabrication of carbon nanotube reinforced Al composites with well-balanced strength and ductility. J Alloys Compd 563:216-220.
. 10.1016/j.jallcom.2013.02.066https://doi.org/10.1016/j.jallcom.2013.02.066
Development of Flake Powder Metallurgy in Fabricating Metal Matrix Composites: A Review. G L Fan, R Xu, Z Q Tan, D Zhang, Z Q Li, Acta Metall Sin-Engl. 275Fan GL, Xu R, Tan ZQ, Zhang D, Li ZQ (2014) Development of Flake Powder Metallurgy in Fabricating Metal Matrix Composites: A Review. Acta Metall Sin-Engl 27(5):806-815.
. 10.1007/s40195-014-0148-xhttps://doi.org/10.1007/s40195-014-0148-x
Balanced strength and ductility in CNT/Al composites achieved by flake powder metallurgy via shift-speed ball milling. R Xu, Z Tan, D Xiong, G Fan, Q Guo, J Zhang, Y Su, Z Li, D Zhang, 10.1016/j.compositesa.2017.02.017Composites A. 96Xu R, Tan Z, Xiong D, Fan G, Guo Q, Zhang J, Su Y, Li Z, Zhang D (2017) Balanced strength and ductility in CNT/Al composites achieved by flake powder metallurgy via shift-speed ball milling. Composites A 96:57-66. https://doi.org/10.1016/j.compositesa.2017.02.017
Towards strong and stiff carbon nanotube-reinforced high-strength aluminum alloy composites through a microlaminated architecture design. H Wei, Z Q Li, D B Xiong, Z Q Tan, G L Fan, Z Qin, D Zhang, 10.1016/j.scriptamat.2013.11.014Scripta Mater. 75Wei H, Li ZQ, Xiong DB, Tan ZQ, Fan GL, Qin Z, Zhang D (2014) Towards strong and stiff carbon nanotube-reinforced high-strength aluminum alloy composites through a microlaminated architecture design. Scripta Mater 75:30-33. https://doi.org/10.1016/j.scriptamat.2013.11.014
Solid-state interfacial reaction and load transfer efficiency in carbon nanotubes (CNTs)-reinforced aluminum matrix composites. B Chen, J Shen, X Ye, H Imai, J Umeda, M Takahashi, K Kondoh, 10.1016/j.carbon.2016.12.013Carbon. 114Chen B, Shen J, Ye X, Imai H, Umeda J, Takahashi M, Kondoh K (2017) Solid-state interfacial reaction and load transfer efficiency in carbon nanotubes (CNTs)-reinforced aluminum matrix composites. Carbon 114:198-208. https://doi.org/10.1016/j.carbon.2016.12.013
Effectively enhanced load transfer by interfacial reactions in multi-walled carbon nanotube reinforced Al matrix composites. W W Zhou, T Yamaguchi, K Kikuchi, N Nomura, A Kawasaki, Zhou WW, Yamaguchi T, Kikuchi K, Nomura N, Kawasaki A (2017) Effectively enhanced load transfer by interfacial reactions in multi-walled carbon nanotube reinforced Al matrix composites.
. 10.1016/j.actamat.2016.12.022Acta Mater. 125Acta Mater 125:369-376. https://doi.org/10.1016/j.actamat.2016.12.022
Effect of interfacial reaction on Young's modulus in CNT/Al nanocomposite: A quantitative analysis. Z Y Yu, Z Q Tan, G L Fan, D B Xiong, Q Guo, R B Lin, Mater Charact. 137Yu ZY, Tan ZQ, Fan GL, Xiong DB, Guo Q, Lin RB (2018) Effect of interfacial reaction on Young's modulus in CNT/Al nanocomposite: A quantitative analysis. Mater Charact 137:84-90.
. 10.1016/j.matchar.2018.01.024https://doi.org/10.1016/j.matchar.2018.01.024
A flake powder metallurgy approach to Al2O3/Al biomimetic nanolaminated composites with enhanced ductility. L Jiang, Z Q Li, G L Fan, D Zhang, Scripta Mater. 655Jiang L, Li ZQ, Fan GL, Zhang D (2011) A flake powder metallurgy approach to Al2O3/Al biomimetic nanolaminated composites with enhanced ductility. Scripta Mater 65(5):412-415.
. 10.1016/j.scriptamat.2011.05.022https://doi.org/10.1016/j.scriptamat.2011.05.022
Strong and ductile carbon nanotube/aluminum bulk nanolaminated composites with two-dimensional alignment of carbon nanotubes. L Jiang, Z Q Li, G L Fan, L L Cao, D Zhang, 10.1016/j.scriptamat.2011.11.023Scripta Mater. 666Jiang L, Li ZQ, Fan GL, Cao LL, Zhang D (2012) Strong and ductile carbon nanotube/aluminum bulk nanolaminated composites with two-dimensional alignment of carbon nanotubes. Scripta Mater 66(6):331-334. https://doi.org/10.1016/j.scriptamat.2011.11.023
Texture, Microstructure and Mechanical Properties of 6111 Aluminum Alloy Subject to Rolling Deformation. L X Zhang, Y H Wang, X H Yang, K Li, S Ni, Y Du, M Song, 10.1590/1980-5373-mr-2017-0549Mater Res Ibero Am J. 205Zhang LX, Wang YH, Yang XH, Li K, Ni S, Du Y, Song M (2017) Texture, Microstructure and Mechanical Properties of 6111 Aluminum Alloy Subject to Rolling Deformation. Mater Res Ibero Am J 20(5):1360-1368. https://doi.org/10.1590/1980-5373-mr-2017-0549
Grain size dependent texture evolution in severely rolled pure copper. C F Gu, M Hoffman, L S Toth, Y D Zhang, Mater Charact. 101Gu CF, Hoffman M, Toth LS, Zhang YD (2015) Grain size dependent texture evolution in severely rolled pure copper. Mater Charact 101:180-188.
. 10.1016/j.matchar.2015.02.003https://doi.org/10.1016/j.matchar.2015.02.003
The transition from discontinuous to continuous recrystallization in some aluminium alloys. H Jazaeri, F J Humphreys, Acta Mater. 5211Jazaeri H, Humphreys FJ (2004) The transition from discontinuous to continuous recrystallization in some aluminium alloys. Acta Mater 52(11):3239-3250.
. 10.1016/j.actamat.2004.03.031https://doi.org/10.1016/j.actamat.2004.03.031
The transition from discontinuous to continuous recrystallization in some aluminium alloys: II -annealing behaviour. H Jazaeri, F J Humphreys, Acta Mater. 5211Jazaeri H, Humphreys FJ (2004) The transition from discontinuous to continuous recrystallization in some aluminium alloys: II -annealing behaviour. Acta Mater 52(11):3251-3262.
. 10.1016/j.actamat.2004.03.031https://doi.org/10.1016/j.actamat.2004.03.031
Extrusion of spark plasma sintered aluminum-carbon nanotube composites at various sintering temperatures. H Kwon, A Kawasaki, J Nanosci Nanotechnol. 911Kwon H, Kawasaki A (2009) Extrusion of spark plasma sintered aluminum-carbon nanotube composites at various sintering temperatures. J Nanosci Nanotechnol 9(11):6542-6548.
. 10.1166/jnn.2009.1357https://doi.org/10.1166/jnn.2009.1357
Microstructure evolution and mechanical properties of carbon nanotubes reinforced Al matrix composites. X Q Liu, C J Li, J Eckert, K G Prashanth, O Renk, L Teng, Y Liu, R Bao, J Tao, T Shen, J Yi, 10.1016/j.matchar.2017.09.036Mater Charact. 133Liu XQ, Li CJ, Eckert J, Prashanth KG, Renk O, Teng L, Liu Y, Bao R, Tao J, Shen T, Yi J (2017) Microstructure evolution and mechanical properties of carbon nanotubes reinforced Al matrix composites. Mater Charact 133:122-132. https://doi.org/10.1016/j.matchar.2017.09.036
Investigation of carbon nanotube reinforced aluminum matrix composite materials. H Kwon, D H Park, J F Silvain, A Kawasaki, Comp Sci Technol. 703Kwon H, Park DH, Silvain JF, Kawasaki A (2010) Investigation of carbon nanotube reinforced aluminum matrix composite materials. Comp Sci Technol 70(3):546-550.
. 10.1016/j.compscitech.2009.11.025https://doi.org/10.1016/j.compscitech.2009.11.025
Microstructures and mechanical properties of carbon nanotubes reinforced pure aluminum composites synthesized by spark plasma sintering and hot rolling. B Guo, S Ni, J Yi, R Shen, Z Tang, Y Du, M Song, 10.1016/j.msea.2017.05.068Mater Sci Eng A. 698Guo B, Ni S, Yi J, Shen R, Tang Z, Du Y, Song M (2017) Microstructures and mechanical properties of carbon nanotubes reinforced pure aluminum composites synthesized by spark plasma sintering and hot rolling. Mater Sci Eng A 698:282-288. https://doi.org/10.1016/j.msea.2017.05.068
Grain refinement and superplastic behavior of carbon nanotube reinforced aluminum alloy composite processed by cold rolling. G Fan, H Huang, Z Tan, D Xiong, Q Guo, M Naito, Z Li, D Zhang, 10.1016/j.msea.2017.10.031Mater Sci Eng A. 708Fan G, Huang H, Tan Z, Xiong D, Guo Q, Naito M, Li Z, Zhang D (2017) Grain refinement and superplastic behavior of carbon nanotube reinforced aluminum alloy composite processed by cold rolling. Mater Sci Eng A 708:537-543. https://doi.org/10.1016/j.msea.2017.10.031
Strengthening and toughening of aluminum by single-walled carbon nanotubes. H J Choi, D H Bae, 10.1016/j.msea.2010.11.090Mater Sci Eng A. 5286Choi HJ, Bae DH (2011) Strengthening and toughening of aluminum by single-walled carbon nanotubes. Mater Sci Eng A 528(6):2412-2417. https://doi.org/10.1016/j.msea.2010.11.090
Microstructure and mechanical properties of carbon nanotubes reinforced aluminum matrix composites synthesized via equal-channel angular pressing. H Zare, M Jahedi, M R Toroghinejad, M Meratian, M Knezevic, Mater Sci Eng A. 670Zare H, Jahedi M, Toroghinejad MR, Meratian M, Knezevic M (2016) Microstructure and mechanical properties of carbon nanotubes reinforced aluminum matrix composites synthesized via equal-channel angular pressing. Mater Sci Eng A 670:205-216.
. 10.1016/j.msea.2016.06.027https://doi.org/10.1016/j.msea.2016.06.027
Fabrication of an aluminum-carbon nanotube metal matrix composite by accumulative roll-bonding. S Salimi, H Izadi, A P Gerlich, 10.1007/s10853-010-4855-zJ Mater Sci. 462Salimi S, Izadi H, Gerlich AP (2010) Fabrication of an aluminum-carbon nanotube metal matrix composite by accumulative roll-bonding. J Mater Sci 46(2):409-415. https://doi.org/10.1007/s10853- 010-4855-z
Singly dispersed carbon nanotube/aluminum composites fabricated by powder metallurgy combined with friction stir processing. Z Liu, B Xiao, W Wang, Z Ma, Carbon. 505Liu Z, Xiao B, Wang W, Ma Z (2012) Singly dispersed carbon nanotube/aluminum composites fabricated by powder metallurgy combined with friction stir processing. Carbon 50(5):1843-1852.
. 10.1016/j.carbon.2011.12.034https://doi.org/10.1016/j.carbon.2011.12.034
Production of aluminum-matrix carbon nanotube composite using high pressure torsion. T Tokunaga, K Kaneko, Z Horita, Mater Sci Eng A. 4901-2Tokunaga T, Kaneko K, Horita Z (2008) Production of aluminum-matrix carbon nanotube composite using high pressure torsion. Mater Sci Eng A 490(1-2):300-304.
. 10.1016/j.msea.2008.02.022https://doi.org/10.1016/j.msea.2008.02.022
Consolidation of carbon nanotube reinforced aluminum matrix composites by high-pressure torsion. H Asgharzadeh, S H Joo, H S Kim, Met Trans A. 459Asgharzadeh H, Joo SH, Kim HS (2014) Consolidation of carbon nanotube reinforced aluminum matrix composites by high-pressure torsion. Met Trans A 45(9):4129-4137.
. 10.1007/s11661-014-2354-6https://doi.org/10.1007/s11661-014-2354-6
Chapter 2 -Combined processing ECAP+TMP. I P Semenova, G I Raab, R Z Valiev, Semenova IP, Raab GI, Valiev RZ (2019) Chapter 2 -Combined processing ECAP+TMP. In:
H Garbacz, I P Semenova, S Zherebtsov, M Motyka, Nanocrystalline Titanium. ElsevierGarbacz H, Semenova IP, Zherebtsov S, Motyka M, editors. Nanocrystalline Titanium: Elsevier; p. 21-35.
A combination of ball milling and high-ratio differential speed rolling for synthesizing carbon nanotube/copper composites. S J Yoo, S H Han, W J Kim, Carbon. 61Yoo SJ, Han SH, Kim WJ (2013) A combination of ball milling and high-ratio differential speed rolling for synthesizing carbon nanotube/copper composites. Carbon 61:487-500.
. 10.1016/j.carbon.2013.04.105https://doi.org/10.1016/j.carbon.2013.04.105
Compressive, shear, and fracture behavior of CNT reinforced Al matrix composites manufactured by severe plastic deformation. H Zare, M Jahedi, M R Toroghinejad, M Meratian, M Knezevic, 10.1016/j.matdes.2016.05.109Mater Des. 106Zare H, Jahedi M, Toroghinejad MR, Meratian M, Knezevic M (2016) Compressive, shear, and fracture behavior of CNT reinforced Al matrix composites manufactured by severe plastic deformation. Mater Des 106:112-119. https://doi.org/10.1016/j.matdes.2016.05.109
Developing high-performance aluminum matrix composites with directionally aligned carbon nanotubes by combining friction stir processing and subsequent rolling. Z Y Liu, B L Xiao, W G Wang, Z Y Ma, 10.1016/j.carbon.2013.05.049Carbon. 62Liu ZY, Xiao BL, Wang WG, Ma ZY (2013) Developing high-performance aluminum matrix composites with directionally aligned carbon nanotubes by combining friction stir processing and subsequent rolling. Carbon 62:35-42. https://doi.org/10.1016/j.carbon.2013.05.049
Multi-layer graphene/copper composites: Preparation using high-ratio differential speed rolling, microstructure and mechanical properties. W J Kim, T J Lee, S H Han, Carbon. 69Kim WJ, Lee TJ, Han SH (2014) Multi-layer graphene/copper composites: Preparation using high-ratio differential speed rolling, microstructure and mechanical properties. Carbon 69:55-65.
. 10.1016/j.carbon.2013.11.058https://doi.org/10.1016/j.carbon.2013.11.058
Effect of hot isostatic pressing on the mechanical properties of aluminium metal matrix nanocomposites produced by dual speed ball milling. S M Almotairy, A F Boostani, M Hassani, D Wei, Z Y Jiang, 10.1016/j.jmrt.2019.11.043J Mater Res Technol. 92Almotairy SM, Boostani AF, Hassani M, Wei D, Jiang ZY (2020) Effect of hot isostatic pressing on the mechanical properties of aluminium metal matrix nanocomposites produced by dual speed ball milling. J Mater Res Technol 9(2):1151-1161. https://doi.org/10.1016/j.jmrt.2019.11.043
Recrystallization mechanisms and microstructure development in emerging metallic materials: A review. K K Alaneme, E A Okotete, J Sci. 41Alaneme KK, Okotete EA (2018) Recrystallization mechanisms and microstructure development in emerging metallic materials: A review. J Sci 4(1):19-33.
Recrystallization mechanisms and microstructure development in emerging metallic materials: A review. K K Alaneme, E A Okotete, 10.1016/j.jsamd.2018.12.007Journal of Science: Advanced Materials and Devices. 41Alaneme KK, Okotete EA (2019) Recrystallization mechanisms and microstructure development in emerging metallic materials: A review. Journal of Science: Advanced Materials and Devices. 4(1):19-33. https://doi.org/10.1016/j.jsamd.2018.12.007
Effect of ball size on steady state of aluminum powder and efficiency of impacts during milling. S S Razavi-Tousi, J A Szpunar, Powder Technol. 284Razavi-Tousi SS, Szpunar JA (2015) Effect of ball size on steady state of aluminum powder and efficiency of impacts during milling. Powder Technol 284:149-58.
. 10.1016/j.powtec.2015.06.035https://doi.org/10.1016/j.powtec.2015.06.035
The application of a milling map in the mechanochemical synthesis of ceramic oxides. T Rojac, M Kosec, B Malič, J Holc, J Eur Ceram Soc. 2616Rojac T, Kosec M, Malič B, Holc J (2006) The application of a milling map in the mechanochemical synthesis of ceramic oxides. J Eur Ceram Soc 26(16):3711-3716.
. 10.1016/j.jeurceramsoc.2005.11.013https://doi.org/10.1016/j.jeurceramsoc.2005.11.013
Modelling of carbon nanotube dispersion and strengthening mechanisms in Al matrix composites prepared by high energy ball milling-powder metallurgy method. Z Y Liu, B L Xiao, W G Wang, Z Y Ma, 10.1016/j.compositesa.2016.11.029Composites A. 94Liu ZY, Xiao BL, Wang WG, Ma ZY (2017) Modelling of carbon nanotube dispersion and strengthening mechanisms in Al matrix composites prepared by high energy ball milling-powder metallurgy method. Composites A 94:189-198. https://doi.org/10.1016/j.compositesa.2016.11.029
Modeling of mechanical alloying: Part II. Development of computational modeling programs. D Maurice, T Courtney, Met Trans A. 269Maurice D, Courtney T (1995) Modeling of mechanical alloying: Part II. Development of computational modeling programs. Met Trans A 26(9):2431-2435.
. 10.1007/BF02671257https://doi.org/10.1007/BF02671257
Modeling of mechanical alloying: Part I. deformation, coalescence, bdand fragmentation mechanisms. Maurice D Courtney, T , Met Trans A. 251Maurice D. Courtney T (1994) Modeling of mechanical alloying: Part I. deformation, coalescence, bdand fragmentation mechanisms. Met Trans A 25(1):147-158.
. 10.1007/BF02646683https://doi.org/10.1007/BF02646683
Powder metal matrix composites: selection and processing. M J Tan, X Zhang, 10.1016/S0921-5093(97)00829-0Mater Sci Eng A. 2441Tan MJ, Zhang X (1998) Powder metal matrix composites: selection and processing. Mater Sci Eng A 244(1):80-85. https://doi.org/10.1016/S0921-5093(97)00829-0
Microstructure-based modeling on structure-mechanical property relationships in carbon nanotube/aluminum composites. R Xu, Z Tan, G Fan, Ji G Li, Z Guo, Q Li, Z Zhang, D , 10.1016/j.ijplas.2019.05.006Int J Plasticity. 120Xu R, Tan Z, Fan G, Ji G, Li Z, Guo Q, Li Z, Zhang D (2019) Microstructure-based modeling on structure-mechanical property relationships in carbon nanotube/aluminum composites. Int J Plasticity 120:278-295. https://doi.org/10.1016/j.ijplas.2019.05.006
Modeling the strain-hardening effect and plastic deformation of nanocrystalline FCC metals dispersed with the finest grains. H Liu, J Zhou, S Zhang, Y Wang, L Wang, S Dong, 10.1007/s11051-014-2449-4J Nanopart Res. 1662449Liu H, Zhou J, Zhang S, Wang Y, Wang L, Dong S (2014) Modeling the strain-hardening effect and plastic deformation of nanocrystalline FCC metals dispersed with the finest grains. J Nanopart Res 16(6):2449. https://doi.org/10.1007/s11051-014-2449-4
Modelling the plastic deformation of nanostructured metals with bimodal grain size distribution. L Zhu, J Lu, 10.1016/j.ijplas.2011.10.003Int J Plasticity. 30Zhu L, Lu J (2012) Modelling the plastic deformation of nanostructured metals with bimodal grain size distribution. Int J Plasticity 30-31:166-184. https://doi.org/10.1016/j.ijplas.2011.10.003
Microstructural evolution and grain subdivision mechanisms during severe plastic deformation of aluminum particles by ball milling. S Razavi-Tousi, J Szpunar, Phil Mag. 9513Razavi-Tousi S, Szpunar J (2015) Microstructural evolution and grain subdivision mechanisms during severe plastic deformation of aluminum particles by ball milling. Phil Mag 95(13):1425-1447.
. 10.1080/14786435.2015.1033028https://doi.org/10.1080/14786435.2015.1033028
Physics and phenomenology of strain hardening: the FCC case. U Kocks, H Mecking, Kocks U, Mecking H (2003) Physics and phenomenology of strain hardening: the FCC case.
. 10.1016/S0079-6425(02Prog Mater Sci. 483Prog Mater Sci 48(3):171-273. https://doi.org/10.1016/S0079-6425(02)00003-8
Analysis of the strain-rate sensitivity of flow stresses in nanocrystalline FCC and BCC metals. G A Malygin, 10.1134/S1063783407120098Phys Solid State. 4912Malygin GA (2007) Analysis of the strain-rate sensitivity of flow stresses in nanocrystalline FCC and BCC metals. Phys Solid State 49(12):266-273. https://doi.org/10.1134/S1063783407120098
Dislocation annihilation in plastic deformation: II. Kocks-Mecking Analysis. E I Galindo-Nava, J Sietsma, Pej Rivera-Díaz-Del-Castillo, Acta Mater. 606Galindo-Nava EI, Sietsma J, Rivera-Díaz-del-Castillo PEJ (2012) Dislocation annihilation in plastic deformation: II. Kocks-Mecking Analysis. Acta Mater 60(6):2615-2624.
. 10.1016/j.actamat.2012.01.028https://doi.org/10.1016/j.actamat.2012.01.028
A quantitative understanding on the mechanical behaviors of carbon nanotube reinforced nano/ultrafine-grained composites. S Dong, J Zhou, D Hui, Int J Mechanical Sci. 101Dong S, Zhou J, Hui D (2015) A quantitative understanding on the mechanical behaviors of carbon nanotube reinforced nano/ultrafine-grained composites. Int J Mechanical Sci 101-102:29-37.
. 10.1016/j.ijmecsci.2015.07.019https://doi.org/10.1016/j.ijmecsci.2015.07.019
Effects of grain size on dislocation organization and internal stresses developed under tensile loading in fcc metals. X Feaugas, H Haddou, Phil Mag. 877Feaugas X, Haddou H (2007) Effects of grain size on dislocation organization and internal stresses developed under tensile loading in fcc metals. Phil Mag 87(7):989-1018.
. 10.1080/14786430601019441https://doi.org/10.1080/14786430601019441
Hot rolling of MWCNTs reinforced Al matrix composites produced via spark plasma sintering. B Sadeghi, P Cavaliere, G A Roeen, M Nosko, M Shamanian, V Trembošová, S Nagy, N Ebrahimzadeh, 10.1007/s42114-019-00095-7Adv Comp Hybrid Mater. 23Sadeghi B, Cavaliere P, Roeen GA, Nosko M, Shamanian M, Trembošová V, Nagy S, Ebrahimzadeh N (2019) Hot rolling of MWCNTs reinforced Al matrix composites produced via spark plasma sintering. Adv Comp Hybrid Mater 2(3):549-570. https://doi.org/10.1007/s42114-019-00095- 7
Correlation Between Microstructural Architecture and Mechanical Behavior of Single-Walled Carbon Nanotube-Aluminum Composites. Y Shi, Y Lu, Z Ni, L Zhao, Z Li, D-B Xiong, J Zhou, Q Guo, 10.1007/s11661-019-05554-wMet Trans A. 512Shi Y, Lu Y, Ni Z, Zhao L, Li Z, Xiong D-B, Zhou J, Guo Q (2020) Correlation Between Microstructural Architecture and Mechanical Behavior of Single-Walled Carbon Nanotube- Aluminum Composites. Met Trans A 51(2):545-551. https://doi.org/10.1007/s11661-019-05554-w
Fabrication and mechanical properties of CNT/Al composites via shift-speed ball milling and hot-rolling. C Yuan, Z Tan, G Fan, M Chen, Q Zheng, Z Li, J Mater Res. 3415Yuan C, Tan Z, Fan G, Chen M, Zheng Q, Li Z (2019) Fabrication and mechanical properties of CNT/Al composites via shift-speed ball milling and hot-rolling. J Mater Res 34(15):2609-2619.
| The thermal stability of ultrafine-grained (UFG) microstructure in Cu processed by different routes of severe plastic deformation (SPD) was studied at both high and room temperatures (RT). It was found that the microstructures produced by multi-directional forging or twist extrusion were more stable than those obtained by equal-channel angular pressing (ECAP) or high-pressure torsion (HPT). During storage of the ECAP-processed specimen at RT for 4 years the vacancy concentration reduced significantly while the dislocation density and the crystallite size remained unchanged. In the case of the HPT-processed sample both grain-growth and reduction of the dislocation density were observed. | An ideal ultrafine-grained (UFG) microstructure for high strength and high ductility should have short dislocation-slip path to impede dislocation slip and very low dislocation density to ensure more room for dislocation accumulation. Such a microstructure is hard to produce, especially for UFG metals produced by severe plastic deformation techniques. Here, we report an ideal UFG structure produced by reverse transformation of deformation-induced martensite in 304 L austenitic stainless steel. It produced small grains and a high density of nanotwins for both high strength and high ductility. This approach is applicable to face-centered cubic metals with low stacking fault energy. |
Introduction
A classical approach to tailoring the mechanical properties (strength/ductility) of materials is through the manipulation of microstructure. Many common classes of microstructure may be described as a spatial distribution of interfaces; e.g., grain boundaries (GBs) in a polycrystal, interfaces between precipitates and a matrix, or phase boundaries in a multi-phase system. The principle behind the modulation of mechanical properties through microstructure design lies on the interactions between lattice dislocations (carriers of plastic deformation) and homo-/hetero-phase interfaces. Hall-Petch strengthening (Hall, 1951;Petch, 1953) is a remarkable example; it is commonly described as the result of dislocation pileups at impenetrable grain boundaries. To achieve strengthening and toughening simultaneously, researchers have designed and synthesized a spectrum of heterostructured materials (Zhu and Wu, 2023), such as nanotwinned structures, gradient structured materials, heterogeneous lamella structured materials, dual-phase alloys, etc. One triumph of such a strategy was the understanding of hetero-deformation induced strengthening (Zhu and Wu, 2019), an interface-mediated mechanism. One consequence of grain-level plasticity interacting with GBs is the activation of GB sliding which, in turn, alters plasticity within the grains. Interface sliding was observed during plastic deformation of bicrystals (Wang et al., 2022) and polycrystalline materials (Linne et al., 2020) and during superplasticity (Wei et al., 2003). The focus of this work is the quantitative prediction of the interaction of plasticity within grains with interfaces in a rigorous, quantitative manner that respects crystallography and loading conditions. This approach is applicable to all types of homo-(GBs, twins, ...) and hetero-phase interfaces.
The interactions between lattice dislocations and interface have been widely explored in the literature since this interaction plays a major role in plasticity, strengthening, fracture, ... The classic picture of grain size/interface is that lattice dislocations pileup against interfaces, causing back stresses that reduce plastic deformation in grains; this is known as Hall-Petch strengthening. Although highly simplified, this is a convenient starting point for thinking about the mechanisms by which dislocation/interface interactions affect plasticity. There is considerable evidence that this pileup may be partially relaxed by slip transfer across an interface (i.e., precipitate cutting (Gleiter and Hornbogen, 1965)). Transmission electron microscopy pirical LRB criteria (Cho et al., 2020;Zhang et al., 2021;Quek et al., 2014). For example, in one case, dislocation transmission through a GB is assumed to occur through a Frank-Read mechanism when criterion (iii) is satisfied (Zhou and LeSar, 2012). In others, both criteria (ii) and (iii) were considered to determine whether a dislocation will penetrate a GB (Fan et al., 2012). In some cases, LRB-like criteria (i.e., criteria established upon slip system alignment and the resolved shear stress) were invoked to determine dislocation absorption/emission at a GB (Zhang et al., 2021). Other semi-empirical GB models were incorporated into CPFEM to study slip transfer in polycrystals (Cermelli and Gurtin, 2002;Ma et al., 2006;Mayeur et al., 2015); e.g., Ma et al. (Ma et al., 2006) considered dislocation transmission according to criterion (ii) (i.e., the minimum residual Burgers) in a CPFEM study. Here, the GB is modeled by an element where the slip resistance is assumed to be proportional to the square of the minimum residual Burger. Mayeur et al. (Mayeur et al., 2015) modeled a GB as an interface affected zone in CPFEM, where the probability of each transfer event is determined based upon criteria (i) and (iii). While these models achieved some success, the empirical nature of the LRB criteria makes such models unreliable. Also note that these models did not include the possibility of dislocation glide in the GB/GB sliding.
Many phenomenological models include interactions between dislocations and GBs within a strain gradient plasticity framework (Fredriksson and Gudmundson, 2007;Gottschalk et al., 2016;Erdle and Böhlke, 2017). A general GB model was developed by Gurtin (Gurtin, 2008) based on the continuum thermodynamic Coleman-Noll procedure, which was partially implemented in a finite element method byÖzdemir et al. (Özdemir and Yalçinkaya, 2014) (this approach couples bulk and GBs via a microscopic force balance). One merit of this method is that grain misorientation and GB orientation may be included through slip-interaction moduli. This method was extended to a microstructure-motivated higher-order internal boundary conditions and numerically implemented to investigate the influence of GBs on shear deformation, at both macroscopic and microscopic levels (Van Beers et al., 2013). Piao and Le (Piao and Le, 2022) noted that standard strain gradient plasticity models ignore the configurational entropy and effective temperature which enables dislocations to satisfy universal laws for plastic flows (Le, 2020); an alternative continuum approach that accounts for configurational entropy was developed and applied to study the dislocation transmission/absorption at a GB at a continuum level. While these models are theoretically more rigorous, the physical mechanisms observed in experiments and atomistic simulations are not explicitly reflected. For example, GB/interface dislocations (residual dislocations) are not arbitrary; their Burgers vectors must correspond to the bicrystallographic translational symmetry (Pond and Smith, 1977;King and Smith, 1980;Balluffi et al., 1982;Han et al., 2018). Again, these methods do not correctly capture interface sliding induced by dislocation-interface interactions, although widely observed in experiments and atomistic simulations (Dao et al., 2006;Ng and Ngan, 2009;Linne et al., 2020;Zhu et al., 2020); Gurtin (Gurtin, 2008) did propose a GB sliding approach, but this has not been implemented (to our knowledge).
In this paper, we address the same question raised by Gurtin (Gurtin, 2008): "Is there a physically natural method of characterizing the possible interactions between the slip systems of two grains that meet at a grain boundary -a method that could form the basis for the formulation of grain boundary conditions?". More general, this question applies to all interfaces -not just GBs. Our approach is based upon irreversible thermodynamics (Onsager relations (Onsager, 1931) and Ziegler's maximum entropy production principle (Ziegler, 2012)). We first propose a Burgers vector reaction-based dislocation-interface interaction model motivated by a wide range of experimental observations and consistent with crystallography constraints. The admissible Burgers vectors of the lattice dislocations are determined by the orientation and lattice structure of the adjoining grains. The admissible Burgers vectors of interface dislocations (or disconnections) must be consistent with the displacement-shift-complete (DSC) vectors determined from the bicrystallography (Pond and Smith, 1977;King and Smith, 1980;Balluffi et al., 1982;Han et al., 2018). We describe Burgers vector reactions by a linear relationship between dislocation fluxes entering, leaving and within the interface and the applicable driving forces. The kinetic coefficient tensor is constrained by the requirement of Burgers vector conservation (or equivalently, compatibility of interface deformation). The overall kinetics are described by a tensorial Robin boundary condition at the interface that is consistent with the linear response theory. Our model is bicrystallography-respecting, explicit about Burgers vector reactions, and simple to implement within different plasticity simulation schemes.
The paper is organized as follows. In Section 2, a general model for individual dislocation reactions at 3 interface is formulated as an interface boundary condition and then extended to multiple slip systems/reactions case (several special cases are discussed to validate the interface BC). In Section 3, the mesoscale interface BC is applied to a one-dimensional continuum dislocation dynamics (CDD) model to examine the dislocation-GB interactions under different crystallographic orientations. We then propose rigorous dislocation transmission conditions and compare those with the predictions from LRB criteria. the transmitted dislocation density is defined to measure the amount of dislocations reacted at the interface and then they are compared with each LRB criterion. The results show that while the LRB criteria are reasonable, they fail in many cases and are not always self-consistent.
Interface boundary condition
Consider the interface-slip system configuration illustrated in Fig. 2a, which shows two slip planes in Phase α (labeled (1) and (2)) and a single slip plane in Phase β (labeled (3)); the two phases are divided by an interface plane (labeled (4)). The Burgers vector of the dislocations on plane (i) is b (i) . b (1) , b (2) and b (3) are lattice dislocation Burgers vectors. b (4) , on the other hand, is not an arbitrary vector in the interface (like the residual Burgers vector commonly defined in the literature), but must be a DSC lattice vector (i.e., determined from the bicrystallography) (Kegg et al., 1973;Pond and Smith, 1977;Shen et al., 1988;Elkajbaji and Thibault-Desseaux, 1988;Lee et al., 1990a;Jin et al., 2006Jin et al., , 2008Kacher and Robertson, 2012;Tsuru et al., 2009;Sangid et al., 2011;King and Smith, 1980;Balluffi et al., 1982;Han et al., 2018). For example, for a coherent twin boundary in a face-centered cubic crystal, an admissible interface dislocation is a twinning partial with b = 112 a 0 /6 (see the dislocations along the twin boundaries in Fig. 1c).
Suppose that dislocations with b (1) glide from the Phase α interior to the interface with a flux J (1) . The following Burgers vector reaction may occur where b (1) contacts the interface (the blue point in Fig. 2a): 4) are nucleated at the contact (the minus sign before J (i) denotes dislocations flowing away from the contact). In this case, J (2) , J (3) and J (4) correspond to dislocation reflection, dislocation transmission and interface sliding, respectively. In general, reactions follow from Burgers vector (flux) conservation:
J (1) b (1) → −J (2) b (2) − J (3) b (3) − J (4) b (4) , i.e., the dislocations b (2) , b (3) and b (4 i=1 J (i) b (i) = 0,(1)
i.e., the four vectors {J (i) b (i) } form a tetrahedron with the origin located at the centroid (see the Fig. 2a inset). Note that to keep dimensions consistent, we consider the flux along the interface J (4) as the number of dislocations crossing a point in the interface (in 2D) per unit time divided by the interfacial width δ I . Equation (1) is not to be confused with a condition of zero net strain rate at the interface (this follows from how the fluxes {J (i) } are defined -all pointing away from the contact point). For example, if two phases are identical with no interface (i.e., a single crystal), dislocations should simply move across the contact point without reaction; in this case, b (1) = b (2) and J (1) = −J (2) such that Eq. (1) is trivially satisfied and the strain strain rate is J (1) b (1) = −J (2) b (2) (i.e., the results are compatible with, but not governed by, Eq. (1)). As a second example, consider an impenetrable, non-reflecting and static interface (J (2) = J (3) = J (4) = 0); here Eq. (1) yields J (1) = 0, which is the classical Neumann BC.
We now focus on the slip plane (i)/interface intersection; for the example shown in Fig. 2b, the slip plane has unit normal n (i) , dislocation slip direction s (i) (parallel to b (i) ), and line direction ξ (i) , from which we define l (i) ≡ n (i) × s (i) and ζ (i) ≡ ξ (i) × n (i) . At the dislocation/interface intersection, ξ (i) is parallel to the intersection line and (n (i) , ξ (i) , ζ (i) ) form a local coordinate frame; the dislocation density ρ (i) is the number of dislocation lines threading a unit area with normal ξ (i) . The dislocation flux is
J (i) = J (i) ζ (i) , where J (i)
is the number of dislocations cutting through a unit segment in n (i) with velocity in ζ (i) per unit time. The Orowan equation defines the dislocation flux
J (i) = ρ (i) v (i) =γ (i) /b (i) ,
where v (i) is the dislocation velocity along the ζ (i) -axis andγ (i) is the shear rate on the i th slip system (the dislocation density on the interface is normalized by the interface width δ I ). Hence, Burgers vector conservation, Eq. (1), is equivalent to the (1) Figure 2: (a) Schematic of a dislocation reaction when the dislocations on slip plane (1) glide to the interface (4). J (i) and b (i) denote the dislocation flux and Burgers vector on plane (i). The reaction products b (2) , b (3) and b (4) are related to dislocation reflection, dislocation transmission and GB sliding, respectively. Since the total Burgers vector is conserved, the four vectors, {J (i) b (i) } (i = 1, 2, 3, 4) form a tetrahedron with the origin located at the centroid, as shown in the inset. (b) Configuration of the interaction between a slip plane and the interface. The blue square at the intersection represents a unit area threaded by dislocations. requirement that iγ (i) s (i) = 0; this guarantees the continuity of the displacement rate component normal to the interface plane.
n (i) s (i) l (i) ξ (i) ζ (i) ρ (i) b (i)( 3 ) (2) Phase α Phase β J (1) J (3) J (4) J (2) b (1) b (3) b (4) b (2) J (1) b (1) J (2) b (2) J (4) b (4) J (3) b (3)
The reaction kinetics described in Fig. 2b and Eq. (1) may be developed based upon linear response theory (Onsager, 1931). We assume that, at a point on an interface where reaction occurs, the Burgers vector flux is linearly proportional to the driving force such that the interface BC is
J (1) b (1) J (2) b (2) J (3) b (3) J (4) b (4) I = L 11 L 12 L 13 L 14 L 22 L 23 L 24 L 33 L 34 sym. L 44 f (1) f (2) f (3) f (4) I ,(2)
where the left-hand side represents a list of Burgers vector fluxes (not dislocation number fluxes), f (i) is the driving force exerted on Burgers vector b (i) , and the kinetic coefficient tensor L = [L ij ] is symmetric (in accordance with the Onsager reciprocity theorem). The subscript "I" denotes quantities evaluated at a point on the interface. The derivation of Eq.
(2) based on the maximum entropy production principle (Ziegler, 2012;Martyushev and Seleznev, 2006) is given in Appendix A -in the derivation we assume local equilibrium and small driving forces. We may understand Eq. (2) from another viewpoint. When a dislocation glides in a grain interior, the dislocation velocity is often expressed by v = Lτ m , where L is the mobility, τ is the resolved shear stress, and m is unity (in the overdamped regime). This equation can be rewritten as Jb = Lf , where J = ρv is the flux, and f = τ ρb is the driving force. We assume the same form for the reaction kinetics at the interface in Fig. 2a, but with two differences. First, the fluxes J considered in Eq. (1) correspond to the annihilation and production rates of dislocations at the interface, rather than movement of dislocations. Hence, mobility L should be treated as a reaction kinetic constant for Burgers vector annihilation and production, rather than dislocation mobility. (Once dislocations are produced at the interface from Burgers vector reaction, they move with different mobility laws within grains.) Second, letting the flux J (i) on each slip system only depend on the driving force f (i) on that slip system alone; i.e., writing
J (i) b (i) = L (i) f (i) would not satisfy Eq.
(1) for general driving forces on different slip systems. Instead, Eq. (1) will be satisfied for general driving forces if J (i) also depends on driving force on other slip systems. Therefore, the kinetics law governing the interfacial reaction is written in tensorial form, Eq. (2); we now discuss each term in Eq. (2).
The driving forces on the dislocations, {f (i) }, are Peach-Koehler (PK) force (see Appendix A). On the i th slip system and under stress σ (including external and internal stresses), the PK force is
f (i) = f (i) · ζ (i) = σ(ρ (i) b (i) ) × ξ (i) · ζ (i) = τ (i) ρ (i) b (i) ,(3)
where ξ (i) is the dislocation line direction at the interface, {ζ (i) , ξ (i) , n (i) } form a local coordinate frame as shown in Fig. 2b, and τ (i) ≡ s (i) · σn (i) is the resolved shear stress (RSS) on slip system (i) (s (i) is the slip direction). Substituting the driving forces Eq. (3) into Eq.
(2), the interface BC described by Eq.
(2) has the form of a Robin BC, i.e., flux is proportional to the densities {ρ (i) }.
The dislocation fluxes at the interface are the result of dislocation reactions, which are constrained by Burgers vector conservation Eq. (1). This constraint requires that the coefficient tensor takes the form
L = κ (c (234) ) 2 c (234) c (314) c (234) c (124) c (234) c (132) (c (314) ) 2 c (314) c (124) c (314) c (132) (c (124) ) 2 c (124) c (132) sym. (c (132) ) 2 = κc ⊗ c,(4)where c ≡ (c (234) , c (314) , c (124) , c (132) ) T , c (ijk) ≡ s (i) · s (j) × s (k)
, and κ is the overall reaction constant for reaction Eq.
(1) (κ is discussed below). Hence, there is one kinetic parameter and all other parameters are purely geometric, which is reasonable as there is only one Burgers vector reaction involving four slip systems (including the slip systems in the interface). Clearly, Eq. (4) does guarantee that Eq. (1) is always satisfied under arbitrary driving forces. We obtain the interface BC by substituting Eq.
(3) and Eq. (4) into Eq. (2):
J I = κB −1 (c ⊗ c)BT I ρ I ,(5)
where J ≡ (J (1) , J (2) , J (3) , J (4) ) T and ρ ≡ (ρ (1) , ρ (2) , ρ (3) , ρ (4) ) T are the generalized dislocation flux and density,
B ≡ diag(b (1) , b (2) , b (3) , b (4) ), T ≡ diag(τ (1) , τ (2) , τ (3)
, τ (4) ), and the subscript "I" denotes the quantities evaluated at a point on the interface. In this equation, c ⊗ c depends on how the slip systems in the two phases and the interface plane are oriented; hence, it may be related to LRB criterion (i). T is simply a matrix of the resolved shear stresses, which may be related to the LRB Schmid factor criterion (ii). B is a matrix of the Burgers vectors, which may be related to the LRB residual Burgers vector criterion (iii). In this sense, interface BC Eq. (5), is related to the three empirical LRB criteria; we demonstrate this point in Section 3. κ is the reaction constant which depends on the microscopic dislocation reaction mechanism, materials properties and temperature. Harmonic transition state theory suggests that it is reasonable to write κ = (κ 0 /T )e −Q/kBT , where T is the temperature, k B is the Boltzmann constant, κ 0 is an attempt frequency, and Q is the energy barrier along the reaction path. The parameter Q contains all the complexity at atomic scale: e.g., the reaction rate will depend sensitively on whether the dislocations are dissociated and the stacking fault energy (Dewald and Curtin, 2006). Q may be determined from atomistic simulations; e.g., Zhu et al. (Zhu et al., 2007) obtained Q for the interaction between a screw dislocation and a coherent twin boundary in copper by atomistic simulations. Their work also suggests that Q may be extracted from experiments by, for example, measuring the the strain-rate sensitivity as a function of stress. Although the interface BC proposed for the reaction involving four slip systems (including the slip systems in the interface) is always valid, we examine two special cases of the interface BC to show that it behaves as expected. Case 1: Two collinear Burgers vectors: e.g., b (1) s (1) and b (2) s (2) are parallel (i.e., s (1) = s (2) ) such that Eq. (1) reduces to
(J (1) b (1) + J (2) b (2) )s (1) + J (3) b (3) s (3) + J (4) b (4) s (4) = 0.(6)
If s (3) and s (4) are not collinear, we recover: (1) and (3) are collinear. Case 2: Three co-planar Burgers vectors: e.g., b (1) s (1) , b (2) s (2) and b (3) s (3) , such that only two are independent. Choosing s (1) and s (2) as the basis vectors, s (3) can be represented as a linear combination: ps (1) +qs (2) (p and q are combination coefficients). Thus, Eq. (1) becomes
J (3) b (3) = J (4) b (4) = 0 and J (1) b (1) = −J (2) b (2) . If s (3) and s (4) are also collinear J (1) b (1) = −J (2) b (2) and J (3) b (3) = −J (4) b((J (1) b (1) + pJ (3) b (3) )s (1) + (J (2) b (2) + qJ (3) b (3) )s (2) + J (4) b (4) s (4) = 0;(7)
i.e., three homogeneous equations in three unknowns (i.e., the coefficients before
{s (i) }). The solution is J (4) b (4) = 0 and J (1) b (1) : J (2) b (2) : J (3) b (3) = p : q : −1.
This reaction only involves three slip systems with coplanar Burgers vectors. Since p and q are only geometry-dependent, the magnitudes of
{J (i) b (i) } (i = 1, 2,
3) have only one degree of freedom. Case 2 applies in two dimensions (2D); e.g., dislocations in monolayer graphene. In a 2D space, the vectors J and ρ contain three components, B and T are 3 × 3, and c = (s (2) · n (3) , s (3) · n (1) , s (1) · n (2) ) T . One example in Section 3 is an application of this 2D model. Above, we only considered the case of a single Burgers vector reaction which may involve up to four slip systems (including the interface). In practice, there may be multiple slip systems in each phase and the interface; reaction may occur amongst any quadruple of these. If there are N slip systems, there will be C 4 N ≡ M possible reactions. We label the l th reaction by subscript "l" (l = 1, · · · , M ) such that Eq. (5) (for the l th reaction) is
J l,I = κ l B −1 l (c ⊗ c) l B l T l,I ρ l,I ,(8)
where all quantities with subscript l are evaluated with parameters for the four relevant slip systems, and κ l is the associated reaction constant. There are M equations similar to Eq. (8). The total Burgers vector fluxes, due to all M reactions is (see Appendix B for details)
J I = M l=1J l,I =B −1 M l=1 κ l (c ⊗ c) l BT IρI ,(9)
where the overline indicates the extended quantities:J ≡ (J (1) , · · · , J (N ) ) T ,ρ ≡ (ρ (1) , · · · , ρ (N ) ) T ,B ≡ diag(b (1) , · · · , b (N ) ),T ≡ diag(τ (1) , · · · , τ (N ) ), and (c ⊗ c) l is the matrix (c ⊗ c) l extended to N × N dimensions with zero padding. The general result, Eq. (9), is the major result of this paper. The reaction constants {κ l } are associated with the detailed atomic-scale mechanisms for the M reactions and thus, depend on interface structure. In this sense, {κ l } should also depend on the macroscopic degrees of freedom of an interface (misorientation, inclination, misfit, ...).
Applications
The interface BC, Eq. (5) or (9), may be easily implemented in different simulation methods, such as CDD, DDD and CPFEM. While we have done such implementations, detailed descriptions are beyond the scope of this paper. Below, we demonstrate the application of the interface BC for the case of a minimal, one-dimensional (1D) CDD model for simplicity and transparency. The goal here is to examine how the interface BC works and if the result is consistent with the empirical LRB criteria.
Consider the simple bicrystal microstructure illustrated in Fig. 3, which represents a 1D bicrystal, periodic along x. Each period consists of two phases, α and β with domain sizes, λ α and λ β . Each phase domain is delimited by two, symmetry related interfaces at x = 0 and x = λ β . For simplicity, assume that there is one slip system in each phase; the slip direction and slip plane normal are s (i) and n (i) for (i) ∈ {α, β}. To model plastic deformation within the grains, we apply the dislocation-density-function crystal plasticity model of Leung et al. (Leung et al., 2015). We denote the densities of dislocations of opposite sign on each slip system by subscripts "+" and "−" (superscripts denote individual slip systems) such that the dislocation flux J (i)
+/− = ρ (i) +/− v (i) +/− , where v (i) +/− is the dislocation velocity.
In the 1D problem, ρ (i) represents the dislocation density averaged over one period along y (see Appendix C). We describe the dislocation velocity magnitude by the power law v (i) where v * (i) and the slip resistance τ * (i) are material parameters for phase (i), and n is a constant that depends on the range of stress; n ≈ 1 at low stress (Argon, 2008;Chang et al., 2001;Fan et al., 2021) and much higher at large stress (Johnston and Gilman, 1959). The velocity law Eq. (10) applies to grain interiors, while Eq.
+/− = ±sgn(τ (i) )v * (i) τ (i) /τ * (i) n ,(10)β α β α −λ α 0 λ β x y J α b α J β b β J I b I s α n α s I n I s β n β θ α θ β d α d β σ
(2) only describes the dislocation reaction at the interface. The dislocation density evolution satisfies the balancė
ρ (i) +/− = −∇ · J (i) +/− +ρ (i),ann +/− +ρ (i),gen +/−(11)
(the equation for the 1D problem is in Appendix C). As proposed by Arsenlis et al. (Arsenlis et al., 2004), annihilation of dislocations occurs when two opposite signed dislocations come within a critical capture radius r c ; i.e., the annihilation rates areρ
(i),ann + =ρ (i),ann − = −ρ (i) + ρ (i) − r c v (i) + − v (i) − .
When a stress is applied, a dislocation pair (opposite signs) is emitted from a source with generation rates (Kocks et al., 1975): ρ (i),gen + =ρ (i),gen − = η τ (i) m , where η and m are constants. Note that in the present model, the sources are assumed to be present everywhere within the grains. The net dislocation density is ρ (i) = ρ (i)
+ − ρ (i) − .
The total RSS τ (i) in Eq. (10) has contributions from both the external and internal (associated with all other dislocations) stress tensors (σ ext and σ int ). For the simulation results presented here, we apply the external shear stress σ ext xy . The internal stress is a functional of dislocation densities on all slip systems (see Appendix C).
The flux J I at the interface obeys the reaction law in Eq.
(2), but once dislocations are generated they are assumed to move with velocity v I of the same form as Eq. (10), albeit with different parameters: v I = sgn(τ I )v * I τ I /τ * I n , where we set n = 1 on all slip systems/interface, although this is not necessary. In the simulations, we employ reduced variables:
ρ ≡ ρ(λ α ) 2 ,x ≡ x/λ α ,t ≡ v * t/λ α ,ṽ ≡ v/v * ,τ ≡ τ /K,
where λ α is the width of the α phase in x (see Fig. 3) and K ≡ µ/[2π(1 − ν)]. For simplicity, we omit the tilde in the reduced quantities below.
Grain Boundaries
When phases α and β represent the same structures (but differently oriented), the interface is a grain boundary (GB). GBs strongly affect the mechanical properties of polycrystals (Hall, 1951;Petch, 1953). On the other hand, different GBs (different misorientations and inclinations) interact with dislocations differently (Abuzaid et al., 2012), which suggests that the mechanical properties of polycrystals may be adjusted by GB engineering. Since GB properties are functions of misorientation and inclination (and bonding), we examine the effects of θ α and θ β (Fig. 3) and the interface properties through the coefficient tensor L in Eq. (2). Upon application of an external shear stress σ ext xy = 0.20 (see Fig. 3), the dislocation 8 density profile, stress within the bicrystal, and strain evolve. Figures 4a-c show (i) the dislocation density at the interface on the α side of the interface ρ α (x = 0), (ii) the average resolved shear stress in Phase ᾱ τ α , and (iii) the strain rate associated with GB sliding˙ I in steady-state (after the transients have relaxed). The GB sliding strain rate is˙ I ≡ u y (x = 0) /δ I ≡ ρ I b I v I , where the term in double brackets is the jump in the y-displacement rate across the interface and δ I is the interface width. When θ β = θ α , the system is a single crystal. This case is indicated by the vertical dashed lines in Figs. 4a-c. Not surprisingly, the net dislocation density at x = 0 is zero ρ α (0) = 0 (Fig. 4a) and no slidinġ I = 0 (Fig. 4c), as expected since there is no GB. For small misorientations ∆θ ≡ |θ α − θ β | , the magnitude of the dislocation pileup at the GB |ρ α (0)| and GB sliding rate both increase with increasing misorientation. When θ α < 45 • , ρ α (0) > 0 (in the region close to the dashed lines in Fig. 4a1 and a2). This may be understood by reference to schematic Fig. 4d. Inside α, the applied stress drives positive dislocations to the GB which react with negative dislocations drawn to the GB from the β grain to produce zero pile-up (ρ(0) = 0) when ∆θ = 0; increasing ∆θ increases the positive-dislocation pileup. When θ α > 45 • , ρ α (0) < 0 (near the red dashed line in Fig. 4a4). Figure 4f illustrates that when θ α = 60 • , the applied stress leads to the pileup of negative dislocations; the pileup increases with increasing ∆θ. When θ α = 45 • , the resolved shear stress is zero and no dislocations are generated in α. The dislocation density on the α side of the GB ρ α (0) is the result of dislocation reactions at the GB. As schematic Fig. 4e shows, when θ β > θ α , the positive dislocations pile up on the β side of the GB with some transferring into the α phase; this is consistent with the θ β > 45 • results in Fig. 4a3. When θ β < θ α , some negative dislocations are "transmitted" from the β to α phases by reaction, consistent with the data for θ β smaller than 45 • in Fig. 4a3.
∆θ ( o ) ∆θ ( o ) ∆θ ( o ) (a1) (a2) (a3) (a4) (b1) (c1) (b2) (c2) (b3) (c3) (b4) (c4)
We also observe a cusp in ρ(0) at θ β = 0 for all θ α (see Fig. 4a). When θ β = 0, the resolved shear stress in β and the pileup on the β side of the GB, ρ β (0), are maximal (since the slip plane is aligned with the external shear stress). Figure 4g shows the pileup at the GB for the special no reaction case κ = 0 (i.e., a Neumann BC). For this case, the pileup increases sharply for θ < 15 • . As shown schematically in Fig. 4h, when θ β = 0, ρ β (0) is very large (corresponding to the sharp peak at θ = 0 in Fig. 4g). Burgers vector reaction then occurs at the GB to produce dislocations (density) that dominate that on the α side of the GB. From the Burgers vector reaction shown in Fig. 4h, the dislocation density on the α side of the GB ρ α (0) is a reaction product and is always negative.
We examine the effects of changing the orientation of the externally applied shear stress (see the top of Fig. 5) by varying ψ (0 ≤ ψ ≤ 45 • ) for a set of bicrystals (θ α , θ β ). For a GB, α and β are the same material, such that we need only consider one side of the GB (phase α here). Figures 5a-c show the dislocation density ρ α (0) with shear orientation ψ = 0 • , 22.5 • and 45 • , respectively. The two rows of figures represent the results under no-reaction (κ = 0, Neumann) and reaction (κ > 0, Robin -Eq. (5)) boundary conditions.
No dislocations react at the GB when κ = 0 (Neumann BC). In this case, the dislocation density ρ α (0) is an extremum when the Schmid factor m α = ±1; and ρ α (0) is zero with m α = 0 (see Fig. 5). When the reaction BC (Eq. (5)) is applied, the dislocation pileup on the β side affects ρ α (0). When θ α = θ β , the system is a single crystal/there is no GB (see the solid black lines in Fig. 5a2-c2), there is no pileup. Focusing on the ψ = 0 reaction BC case (Fig. 5a2) as an example, for fixed θ α (any horizontal line), ρ α (0) is an extremum when the Schmid factor is an extremum, m β = ±1. When the Schmid factor is an extremum, the magnitudes of the dislocation pileup ρ β (0) and ρ α (0) are extrema. This is a result of dislocation reactions at the interface; e.g., at θ α = 15 • ρ α (0) is nearly zero because of reactions with dislocations from β which are very high density at θ β = 0/m β = 1.
When the applied shear orientation ψ increases, the ρ α (0) map evolves as seen in Fig. 5. There are several special points lying on the lines corresponding to m β = ±1 that represent transitions between positive and negative values of ρ α (0). For the reaction BC cases in Fig. 5, the special points for m β = −1 are indicated by the orange points while those for m β = 1 by the green points. All of the special points correspond to ρ α (0) = 0. The special points, along with the ρ α (0) = 0 contours, shift towards the upper right within increasing applied shear orientation from ψ = 0 to 45 • . While dislocation pile-up maps may be generated for any GB and applied shear stress orientation, knowledge of these points and how they change with ψ provide heuristic guidance.
All symmetric tilt GB (STGB) are located along the diagonal line θ α = −θ β in Fig. 5. For any fixed misorientation ∆θ, diagonal lines with slope one represent all possible GB inclinations; e.g., see the cyan dashed lines in Figs. 5a2, b2 and c3. The dislocation density ρ β (0) maps may be obtained by mirroring ρ α (0) maps about θ α = −θ β .
Comparison with the LRB Criteria
The LRB criteria are widely used to determine the likelihood of slip transfer across a grain boundary (Clark et al., 1992;Bieler et al., 2014;Han et al., 2018). These criteria are empirical; they are deduced from extensive experimental observations and simple crystallographic ideas. To evaluate slip transfer, we focus on the question of how the dislocation density changes across the GB when transmission occurs. First, note that even if there are no dislocation reactions at the GB, the plasticity in one grain affects that in the other through the stress concentrations associated with dislocation pile-ups. Hence, we focus on the change in dislocation density at the interface between cases where slip can occur κ > 0 and cannot occur κ = 0: ∆ρ = ρ κ>0 − ρ κ=0 . Next, we realize that ∆ρ will be different on the two sides of the interface (depending on grain orientations with respect to one another and the applied stress); hence, ∆ρ (i) = ρ
(i) κ>0 − ρ (i) κ=0
, where (i) ∈ {α, β}. We now compare the LRB predictions with our simulation observations for ∆ρ (i) .
The first LRB criterion states that slip transfer tends to occur between the pair of slip systems with the minimal misorientation angle. Our interface BC, Eq. (5), fully incorporates the differences in orientation between the two crystals through the tensor c ⊗ c; hence, the interface BC may be used to evaluate the first LRB ansatz. Figure 6a shows that, in general, |∆ρ (i) | decreases with increasing misorientation angle (∆θ ≡ |θ α − θ β |). However, this trend is not universal; we see many examples in Fig. 6a where small ∆θ corresponds to small |∆ρ (i) |. Of course, when the two slip systems each have small Schmid factors, little slip transfer occurs; this effect is included in the third LRB criterion and shows that the three LRB criteria are not necessarily consistent with each other. Therefore, our simulation results based on the interface BC suggest that the first LRB criterion predicts the correct trends but fails in very many particular cases.
The second LRB criterion states that slip transfer occurs in a manner that leads to the smallest residual Burgers vector at the interface. The residual Burgers vector associated with any reaction/slip transfer event is simply related to the difference in the Burgers vectors on the two slip systems b I = b α − b β , where b I is simply b I directed along the GB. For a GB, this is related to the misorientation angle by b I = 2b α sin(∆θ/2) if b α = b β (e.g., for a GB). In Fig. 6a, we plot the transmited dislocation density |∆ρ (i) | versus b I and find that, in general, |∆ρ (i) | decreases with increasing b I . While this trend is consistent with the second LRB criterion, it too fails in many specific cases. The third criterion states that the two slip systems involved in slip transfer are those for which the resolved shear stress in the phases/grains is a maximum. Abuzaid et al. (Abuzaid et al., 2012) suggested the use of the combined resolved shear stresses in the two phases/grains for this condition:
τ ≡ (s α ⊗ n α + s β ⊗ n β ) : σ = τ α + τ β .
(12) Figure 6b shows |∆ρ (i) | versusτ from the simulations. We observe that |∆ρ (i) | indeed increases with increasingτ . This (third) criterion properly describe the trends, but, again, does not always work. Based on the interface BC (Eq. (5)), when the interface dislocation density is small (ρ I → 0), the flux on the α side of the GB is
J α = κ(c βI ) 2 ρ α τ α + κ(c βI c Iα )ρ β τ β .(13)
For the very special case of a symmetric tilt grain boundary, c Iα = c βI and ρ α = ρ β for which Eq. (13) reduces to J α = κ(c βI ) 2 ρ ατ .
This shows that, for this special case (STGB), the maximum combined resolved shear stressτ produces the maximum flux and the third LRB criterion is exactly correct, while our interface BC is applicable in general (symmetric and asymmetric GBs; heterophase interfaces). The three LRB criteria are insightful, but largely heuristic and are often not consistent with one another. For example, consider the case of applying an external stress σ ext xy (σ ext xx = σ ext yy = 0), keeping θ α = 0, and gradually increasing θ β from 0 to 90 • . Since the combined resolved shear stress is a minimum at θ β ≈ 45 • , the third LRB criterion suggests that the transmitted dislocation density |∆ρ (i) | should also be a minimum at this angle. On the other hand, when θ β gradually increases from 0 to 90 • , the misorientation angle between the two slip systems ∆θ increases monotonically and, according to the first criterion, |∆ρ (i) | will decrease monotonically. This means that |∆ρ (i) | does not reach a minimum at θ β ≈ 45 • . This simple example demonstrates that the LRB criteria are not self-consistent, unlike our interface BC.
Conclusion
We proposed a meso-scale boundary condition to model the interactions between dislocations from within grains and interfaces. Our interface BC, based on interface bicrystallography and rigorous linear kinetics, is novel, self-consistent, and easily applied. Consider the following:
(i) The interface BC is established based upon experimentally observed reactions between lattice and interface dislocations/disconnections. Burgers vectors are rigorously conserved. (ii) The interface BC is based on basic kinetic theory (the principle of maximum dissipation rate) for dislocation-interface interactions (rather than energy minimization, as in some other models). (iii) The interface BC is applicable to interfaces in all crystalline systems and to multiple slip systems. (iv) Interface sliding naturally occurs in simulations incorporating the interface BC (i.e., interface dislocations participate in reactions at the interface). We employed the proposed interface BC to examine the validity of the empirical LRB criteria for slip transfer across a GB. We demonstrated that the three LRB criteria correctly predict the slip transfer trends but the LRB criteria fail in many cases and are not self-consistent. The interface BC provides a more rigorous and accurate approach to consider all factors that affect slip transfer, including all bicrystallography (including misorientation angle), the residual Burgers vectors, interface sliding and arbitrary external stress. The proposed interface BC can be applied directly in most plasticity simulation methods, such as continuum dislocation dynamics, discrete dislocation dynamics and crystal plasticity finite element method.
σ = i J (i) u ∂ ∂ζ (i) 1 T + J (i) ∂ ∂ζ (i) − φ (i) T . (A.4)
We define the generalized flux as J ≡ (J
(1) u , · · · , J(4)
u , J (1) , · · · , J (4) ) T and the generalized force as
f ≡ ∂ ∂ζ (1) 1 T , · · · , ∂ ∂ζ (4) 1 T , ∂ ∂ζ (1) − φ (1) T , · · · , ∂ ∂ζ (4) − φ (4) T T .
(A.5)
Then, Eq. (A.4) can be written asσ = J · f . Thus, local thermodynamic equilibrium leads to the constraint:
Γ[J] = (J · f − J · CJ)dV = 0. (A.6)
To maximize Eq. (A.1) under the constraint Eq. (A.6), we construct the functional:
Σ [J] = J · CJdV + λ(J · f − J · CJ)dV, (A.7)
and set δΣ /δλ = 0 and δΣ /δJ = 0. The solution to this variational problem is J = Lf , where L ≡ C −1 ; thus, we have obtained the linear response expression, Eq.
(2). Note that the assumptions include: (i) nearequilibrium and (ii) local equilibrium. It remains to examine the physical meaning of the force f . Recall that f (i) ≡ −(1/T )(∂φ (i) /∂ζ (i) ). The derivative −∂φ (i) /∂ζ (i) represents the decrease of the free energy of a dislocation (per length) when the dislocation is displaced by a small distance dζ (i) . So, f (i) T exactly corresponds to the Peach-Koehler force. In Eq.
(2), T is absorbed into the coefficient tensor such that the {f (i) } represent the Peach-Koehler force.
Appendix B. Derivation of the interface boundary condition for multiple slip systems
Extension of the interface BC to the case of multiple slip systems in both phases is given below. Consider the case where there are multiple non-colinear slip systems in both phases and one slip plane along the interface. As an example, assume that there are two slip systems in the α phase, "α 1 " and "α 2 ", and two in β, "β 1 " and "β 2 ". Including the interface "I", there are five slip systems. Label the five slip systems as "1" ≡ "α 1 ", "2" ≡ "α 2 ", "3" ≡ "β 1 ", "4" ≡ "β 2 ", and "5" ≡ "I". Reactions may occur amongst any four of the five slip systems. For example, where "(i)" is short for "J (i) b (i) s (i) " for the i th slip system. Take Eq. (B.1) (Reaction 3) as an example. Similar to Eq. (5), Reaction 3 kinetics may be described by
J (1) b (1) s (1) + J (2) b (2) s (2) + J (4) b (4) s (4) + J (5) b (5) s (5) = 0. J (1) 3 b (1) J (2) 3 b (2) J (4) 3 b (4) J (5) 3 b (5) = L 11 L 12 L 14 L 15 L 22 L 24 L 25 L 44 L 45 sym. L 55 τ (1) ρ (1) b (1) τ (2) ρ (2) b (2) τ (4) ρ (4) b (4) τ (5) ρ (5) b (5) , (B.2) where J (i) l
is the flux on slip system i generated by Reaction l. We can rewrite this equation as
J (1) 3 b (1) J (2) 3 b (2) J (3) 3 b (3) J (4) 3 b (4) J (5) 3 b (5) = κ 3 (c (245) ) 2 c (245) c (415) 0 c (245) c (125) c (245) c (142) (c (415) ) 2 0 c (415) c (125) c (415) c (142) 0 0 0 (c (125) ) 2 c (125) c (142) sym. (c (142) ) 2 τ (1) ρ (1) b (1) τ (2) ρ (2) b (2) τ (3) ρ (3) b (3) τ (4) ρ (4) b (4) τ (5) ρ (5) b (5) ⇒J 3,I =B −1 κ 3 (c ⊗ c) 3BTIρI , (B.3)
where the quantities with overlines are extended to 5 × 1 vectors or 5 × 5 matrices with zero padding. The tensor (c ⊗ c) 3 depends on the geometry, which slip systems are available, and which four slip systems participate in Reaction 3. We obtain the relationship akin to Eq. Appendix C. One-dimensional problem as coarse-graining of the two-dimensional problem A 1D problem can be deduced from a 2D problem by coarse-graining when the dislocation distribution is periodic along the y-axis in Fig. 3. We focus on the configuration illustrated in Fig. C.7a (i.e., a set of dislocation walls distributed along the x-axis). Each dislocation wall consists of a periodic array of edge dislocations and each dislocation sits on its own slip plane. The dislocation density can be written as ρ(x, y) = (x) ∞ j=−∞ δ (y − y j (x)) , (C.1)
where (x) is the number density of the dislocation walls distributed along the x-axis (i.e., the vertical dashed lines in Fig. C.7a), y j (x) = x tan θ − (j + ς)d sec θ, d is the interplanar spacing, and ς ∈ [0, 1) is the fractional offset along the y-axis at x = 0. We obtain a 1D quantity by averaging (coarse-graining) the corresponding 2D quantity over a period alone y; i.e., D −1 D 0 dy, where D ≡ d sec θ is the period along y. Thus, we define the coarse-grained 1D dislocation density as This equation describes the evolution of dislocation density in 1D. (Note that for the 1D problem studied in the main text, we omit the bar ofρ for simplicity.) Equation (C.3) requires the evaluation of v = sgn(τ )v * |τ /τ * | n and the RSS τ = s · σn. The total stress σ has contribution from the external stress σ ext and the internal one σ int associated with the elastic interaction between dislocations. σ ext is a constant in a stress-controlled experiment. The problem is how to calculate σ int . The internal stress field due to a distribution of dislocations in a 2D space is σ int (r) = ρ(r )σ d (r − r )dr , (C.4) where σ d (r − r ) is the stress at the point r induced by a dislocation located at r . Substituting Eq. (C.1) (with ς = 0) into Eq. (C.4),
σ int (x, y) = (x ) j δ(y − y j (x ))σ d (x − x , y − y )dx dy = (x ) j σ d (x − x , y − x tan θ − jD)dx = (x )σ w (x − x , y − x tan θ; D)dx , (C.5)
where σ w (x−x , y −y ; D) ≡ j σ d (x−x , y −y −jD) is the stress field at (x, y) due to a vertical dislocation wall for which the dislocation spacing is D and one of the dislocations is located at (x , y ). A dislocation wall may be viewed as the superposition of two dislocation walls for which analytical solutions are known; such composition is shown in where σ w⊥/ is resulted from the dislocation wall associated with the Burgers vector b w⊥/ . The analytical solutions to σ w⊥ and σ w are (Anderson et al., 2017) σ w⊥ xx = −σ 0 sin Y (cosh X − cos Y + X sinh X) σ w⊥ yy = −σ 0 sin Y (cosh X − cos Y − X sinh X) σ w⊥ xy = σ 0 X (cosh X cos Y − 1) (C.7)
and
σ w xx = σ 0 X (cosh X cos Y − 1) σ w yy = σ 0 [2 sinh X (cosh X − cos Y ) − X (cosh X cos Y − 1)] σ w xy = −σ 0 sin Y (cosh X − cos Y − X sinh X) , (C.8) where σ 0 ≡ µb/D 2(1 − ν)(cosh X − cos Y ) 2 , X ≡ 2πx D , Y ≡ 2πy D . (C.9) 16
The resolved internal shear stress is τ int = s · σ int n. From this, we write τ int (x, y) = (x )τ w (x − x , y − x tan θ; d sec θ)dx , τ w = τ w⊥ + τ w , τ w⊥ (x, y) = σ 0 X[sinh X sin Y sin 2θ + (cosh X cos Y − 1) cos 2θ], τ w (x, y) = σ 0 [sinh X(cosh X − cos Y ) − X(cosh X cos Y − 1)] sin 2θ − sin Y (cosh X − cos Y − X sinh X) cos 2θ . (C.10)
Since all dislocations sit on the slip planes, we only evaluate the stress at (x, x tan θ); τ int (x) ≡ τ int (x, x tan θ).
Figure 3 :
3Configuration of a system composed of alternating A and B phases, separated by interfaces, uniform in the ydirection, and periodic along x. Gray lines denote slip planes in each phase. Blue vectors denote the slip directions or slip plane normals in each phase. The angles θ α and θ β are defined to be positive in a counterclockwise direction. The red vectors represent Burgers vector fluxes at a point on the α/β interface (into the two domains and along the interface). Fluxes from dislocation reactions (three red vectors) sum to zero.
Figure 4 :
4Steady-state bicrystal properties for a range of grain misorientations θ α , θ β under an external stress τ ext = 0.20. The four rows represent fixed θ α = 15 0 , 30 0 , 45 0 , 60 0 . (a1)-(a4) Dislocation density ρ α (0) vs. θ β . (b1)-(b4) Total resolved shear stress τ α . (c1)-(c4) The strain rate associated with grain boundary sliding˙ I = ρ I v I b I = J I b I . (d)-(f) Schematic of dislocation reactions at the grain boundary for θ α ≈ θ β . The dashed and solid lines represent single crystal and interfaces with small misorientations, respectively. (g) shows the dislocation pile-up density on the β side of the interface ρ β (0) vs. the β crystal slip system orientation θ β for the no reaction case κ = 0 (Neumann BC). (h) Schematic of dislocation reactions at the grain boundary when θ β equals to zero for different θ α denoted by different colors.
Figure 5 :
5Interfacial dislocation density ρ α (0) maps for shear orientations (a) ψ = 0, (b) ψ = 22.5 • and (c) ψ = 45 • . The top and bottom rows represent simulation results under no reaction κ = 0 (Neumann) and reaction κ > 0 (Robin) BCs. The red/blue color represents positive/negative dislocation pileups at the interfaces. Maps of ρ β (0) may be obtained by mirroring the ρ α (0) maps about θ α = −θ β . Note that the Schmid factors for α and β grains are indicated in blue on the right/vertical and top/horizontal axes, respectively.
Figure 6 :
6The change in dislocation density at the GB with the onset of transmission (κ > 0) |∆ρ| for several external stress orientations (ψ = 0, 22.5 • and 45 • ) and grain orientations. (a) |∆ρ (i) | versus misorientation for across the interface (i) = α (denoted by "•") and (i) = β (denoted by "×") and residual interfacial Burgers vector magnituted b I /b α . (b) The change in dislocation density at the GB |∆ρ α | and |∆ρ β | versus the combined resolved shear stressτ for all different shear orientations.
J (i) are, respectively, the entropy flux , the energy flux and the dislocation flux flowing from the i th slip system to the interface point. Substituting Eq. (A.3) into Eq. (A.2), we finḋ
l (c ⊗ c) l BT IρI . (B.4)This example is for the five slip systems and five reactions case. If there are N slip systems (including the slip systems in the interface) and M ≡ C 4 N reactions, the interface BC becomes Eq. (9).
. (C.1) into Eq. (11) and averaging on both sides of Eq. (11) (without the annihilation and generation rates), we haveρ= − ∂(ρv x ) ∂x = − cos θ ∂(ρv) ∂x . (C.3)
Figure
C.7: (a) Geometry of a configuration of parallel slip planes and the coordinate system. (b) A dislocation wall may be viewed as composed of two dislocation walls whose stress fields are known.
Fig. C.7b and can be expressed as σ w (x, y; D) = σ w⊥ (x, y; D) + σ w (x, y; D), (C.6)
4) . In each case, the reaction only involves two slip systems. For example, based on Fig. 2a, direct transmission (without reflection and a residual Burgers vector) can occur when b (1) , b (3) and the intersection between plane
Appendix A. Linear response theoryThe linear response approach, underlying Eq. (2), may be deduced based on the maximum entropy production principle(Ziegler, 2012;Martyushev and Seleznev, 2006)or equivalently the principle of maximum dissipation rate(Onsager, 1931). The general idea behind the derivation is as follows. First, the global entropy production rate is a functional of the (generalized) flux:Σ =Σ[J]. Second, we assume that local thermodynamic equilibrium (1 st law of thermodynamics) applies through the constraint: Γ[J] = 0. Finally, we maximize the global entropy production rateΣ with respect to J under the Γ = 0 constraint via the Lagrange multiplier method: δ(Σ−λΓ) = 0, where λ is the Lagrange multiplier. The three steps are detailed below.Since any nonequilibrium process is characterized by the presence of a flux, the local entropy production rate is a function of the flux:σ =σ(J), where J is a vector of the fluxes along all slip systems into the interface. When the system is near equilibrium, we expandσ(J) about J = 0. From symmetry considerations,σ = J · CJ, where C is a coefficient tensor. The global entropy production rate iṡLocal thermodynamic equilibrium implies we may write the entropy production rate aswhere u is the internal energy density, T is the temperature, s is the entropy density; φ (i) = φ (i) (ζ (i) ) is the free energy of a dislocation (per length) on the i th slip system and located at ζ (i) , where ζ (i) is the coordinate along the ζ (i) -axis (seeFig. 2) and ρ (i) = ρ (i) (ζ (i) ) is the dislocation density at ζ
Slip transfer and plastic strain accumulation across grain boundaries in Hastelloy X. W Z Abuzaid, M D Sangid, J D Carroll, H Sehitoglu, J Lambros, 10.1016/j.jmps.2012.02.001Journal of the Mechanics and Physics of Solids. 60Abuzaid, W.Z., Sangid, M.D., Carroll, J.D., Sehitoglu, H., Lambros, J., 2012. Slip transfer and plastic strain accumulation across grain boundaries in Hastelloy X. Journal of the Mechanics and Physics of Solids 60, 1201-1220. doi:https://doi. org/10.1016/j.jmps.2012.02.001.
A model of crystal plasticity based on the theory of continuously distributed dislocations. A Acharya, 10.1016/S0022-5096(00)00060-0Journal of the Mechanics and Physics of Solids. 49Acharya, A., 2001. A model of crystal plasticity based on the theory of continuously distributed dislocations. Journal of the Mechanics and Physics of Solids 49, 761-784. doi:https://doi.org/10.1016/S0022-5096(00)00060-0.
. P M Anderson, J P Hirth, J Lothe, Cambridge University PressTheory of dislocationsAnderson, P.M., Hirth, J.P., Lothe, J., 2017. Theory of dislocations. Cambridge University Press.
Strengthening mechanisms in crystal plasticity. A S Argon, Oxford University Press on Demand4Argon, A.S., 2008. Strengthening mechanisms in crystal plasticity. volume 4. Oxford University Press on Demand.
On the evolution of crystallographic dislocation density in nonhomogeneously deforming crystals. A Arsenlis, D M Parks, R Becker, V V Bulatov, 10.1016/j.jmps.2003.12.007Journal of the Mechanics and Physics of Solids. 52Arsenlis, A., Parks, D.M., Becker, R., Bulatov, V.V., 2004. On the evolution of crystallographic dislocation density in non- homogeneously deforming crystals. Journal of the Mechanics and Physics of Solids 52, 1213-1246. doi:https://doi.org/ 10.1016/j.jmps.2003.12.007.
Dislocation-grain boundary interaction in 111 textured thin metal films. D V Bachurin, D Weygand, P Gumbsch, 10.1016/j.jmps.2003.12.007Acta Materialia. 58Bachurin, D.V., Weygand, D., Gumbsch, P., 2010. Dislocation-grain boundary interaction in 111 textured thin metal films. Acta Materialia 58, 5232-5241. doi:https://doi.org/10.1016/j.jmps.2003.12.007.
CSL/DSC lattice model for general crystalcrystal boundaries and their line defects. R Balluffi, A Brokman, A King, 10.1016/0001-6160(82)90166-3Acta Metallurgica. 30Balluffi, R., Brokman, A., King, A., 1982. CSL/DSC lattice model for general crystalcrystal boundaries and their line defects. Acta Metallurgica 30, 1453-1470. doi:https://doi.org/10.1016/0001-6160(82)90166-3.
Grain boundaries and interfaces in slip transfer. T Bieler, P Eisenlohr, C Zhang, H Phukan, M Crimp, 10.1016/j.cossms.2014.05.003Current Opinion in Solid State and Materials Science. 18Bieler, T., Eisenlohr, P., Zhang, C., Phukan, H., Crimp, M., 2014. Grain boundaries and interfaces in slip transfer. Current Opinion in Solid State and Materials Science 18, 212-226. doi:https://doi.org/10.1016/j.cossms.2014.05.003.
Geometrically necessary dislocations in viscoplastic single crystals and bicrystals undergoing small deformations. P Cermelli, M E Gurtin, 10.1016/S0020-7683(02)00491-21016/ S0020-7683(02International Journal of Solids and Structures. 39Cermelli, P., Gurtin, M.E., 2002. Geometrically necessary dislocations in viscoplastic single crystals and bicrystals under- going small deformations. International Journal of Solids and Structures 39, 6281-6309. doi:https://doi.org/10.1016/ S0020-7683(02)00491-2.
Dislocation motion in BCC metals by molecular dynamics. J Chang, W Cai, V V Bulatov, S Yip, 10.1016/S0921-5093(00)01673-7Materials Science and Engineering: A. 309Chang, J., Cai, W., Bulatov, V.V., Yip, S., 2001. Dislocation motion in BCC metals by molecular dynamics. Materials Science and Engineering: A 309, 160-163. doi:https://doi.org/10.1016/S0921-5093(00)01673-7.
Dislocation dynamics in polycrystalline materials. Modelling and Simulation in Materials Science and Engineering 28. J Cho, J C Crone, A Arsenlis, S Aubry, 10.1088/1361-651X/ab6da835009Cho, J., Crone, J.C., Arsenlis, A., Aubry, S., 2020. Dislocation dynamics in polycrystalline materials. Modelling and Simulation in Materials Science and Engineering 28, 035009. doi:https://doi.org/10.1088/1361-651X/ab6da8.
On the criteria for slip transmission across interfaces in polycrystals. W Clark, R Wagoner, Z Shen, T Lee, I Robertson, H Birnbaum, 10.1016/0956-716X(92)90173-CScripta Metallurgica et Materialia. 26Clark, W., Wagoner, R., Shen, Z., Lee, T., Robertson, I., Birnbaum, H., 1992. On the criteria for slip transmission across interfaces in polycrystals. Scripta Metallurgica et Materialia 26, 203-206. doi:https://doi.org/10.1016/0956-716X(92) 90173-C.
Strength, strain-rate sensitivity and ductility of copper with nanoscale twins. M Dao, L Lu, Y Shen, S Suresh, 10.1016/j.actamat.2006.06.062Acta Materialia. 54Dao, M., Lu, L., Shen, Y., Suresh, S., 2006. Strength, strain-rate sensitivity and ductility of copper with nanoscale twins. Acta Materialia 54, 5421-5432. doi:https://doi.org/10.1016/j.actamat.2006.06.062.
Modeling of dislocation -grain boundary interactions in FCC metals. M De Koning, R J Kurtz, V V Bulatov, C H Henager, R G Hoagland, W Cai, M Nomura, 10.1016/j.jnucmat.2003.08.008Journal of Nuclear Materials. 323De Koning, M., Kurtz, R.J., Bulatov, V.V., Henager, C.H., Hoagland, R.G., Cai, W., Nomura, M., 2003. Modeling of dislocation -grain boundary interactions in FCC metals. Journal of Nuclear Materials 323, 281-289. doi:https://doi.org/10.1016/j. jnucmat.2003.08.008.
Multiscale modelling of dislocation/grain-boundary interactions: I. Edge dislocations impinging on Σ11 (113) tilt boundary in Al. Modelling and Simulation in Materials Science and Engineering 15. M Dewald, W Curtin, 10.1088/0965-0393/15/1/S16S193. doi:10.1088/ 0965-0393/15/1/S16Dewald, M., Curtin, W., 2006. Multiscale modelling of dislocation/grain-boundary interactions: I. Edge dislocations impinging on Σ11 (113) tilt boundary in Al. Modelling and Simulation in Materials Science and Engineering 15, S193. doi:10.1088/ 0965-0393/15/1/S16.
Multiscale modelling of dislocation/grain boundary interactions. ii. screw dislocations impinging on tilt boundaries in al. M Dewald, W Curtin, 10.1080/14786430701297590Philosophical Magazine. 87Dewald, M., Curtin, W., 2007. Multiscale modelling of dislocation/grain boundary interactions. ii. screw dislocations impinging on tilt boundaries in al. Philosophical Magazine 87, 4615-4641. doi:https://doi.org/10.1080/14786430701297590.
Multiscale modeling of dislocation/grain-boundary interactions: III. 60 • dislocations impinging on Σ3, Σ9 and Σ11 tilt boundaries in Al. Modelling and Simulation in Materials Science and Engineering 19. M Dewald, W Curtin, 10.1088/0965-0393/19/5/05500255002Dewald, M., Curtin, W., 2011. Multiscale modeling of dislocation/grain-boundary interactions: III. 60 • dislocations impinging on Σ3, Σ9 and Σ11 tilt boundaries in Al. Modelling and Simulation in Materials Science and Engineering 19, 055002. doi:10.1088/0965-0393/19/5/055002.
Lengthscale-dependent, elastically anisotropic, physically-based hcp crystal plasticity: Application to cold-dwell fatigue in ti alloys. F Dunne, D Rugg, A Walker, 10.1016/j.ijplas.2006.10.013International Journal of Plasticity. 23Dunne, F., Rugg, D., Walker, A., 2007. Lengthscale-dependent, elastically anisotropic, physically-based hcp crystal plasticity: Application to cold-dwell fatigue in ti alloys. International Journal of Plasticity 23, 1061-1083. doi:https://doi.org/10. 1016/j.ijplas.2006.10.013.
Interactions of deformation-induced dislocations with Σ = 9 (122) grain boundaries in Si studied by HREM. M Elkajbaji, J Thibault-Desseaux, 10.1080/01418618808209929Philosophical Magazine A. 58Elkajbaji, M., Thibault-Desseaux, J., 1988. Interactions of deformation-induced dislocations with Σ = 9 (122) grain boundaries in Si studied by HREM. Philosophical Magazine A 58, 325-345. doi:https://doi.org/10.1080/01418618808209929.
A gradient crystal plasticity theory for large deformations with a discontinuous accumulated plastic slip. H Erdle, T Böhlke, 10.1007/s00466-017-1447-7Computational Mechanics. 60Erdle, H., Böhlke, T., 2017. A gradient crystal plasticity theory for large deformations with a discontinuous accumulated plastic slip. Computational Mechanics 60, 923-942. doi:10.1007/s00466-017-1447-7.
Scale dependent crystal plasticity framework with dislocation density and grain boundary effects. L Evers, W Brekelmans, M Geers, 10.1016/j.ijsolstr.2004.04.0215209-5230International Journal of solids and structures. 41Evers, L., Brekelmans, W., Geers, M., 2004. Scale dependent crystal plasticity framework with dislocation density and grain boundary effects. International Journal of solids and structures 41, 5209-5230. doi:https://doi.org/10.1016/j.ijsolstr. 2004.04.021.
Toward a further understanding of intermittent plastic responses in the compressed single/bicrystalline micropillars. H Fan, Z Li, M Huang, 10.1016/j.scriptamat.2012.02.023Scripta materialia. 66Fan, H., Li, Z., Huang, M., 2012. Toward a further understanding of intermittent plastic responses in the compressed sin- gle/bicrystalline micropillars. Scripta materialia 66, 813-816. doi:https://doi.org/10.1016/j.scriptamat.2012.02.023.
Strain rate dependency of dislocation plasticity. H Fan, Q Wang, J A El-Awady, D Raabe, M Zaiser, 10.1038/s41467-021-21939-1Nature Communications. 12Fan, H., Wang, Q., El-Awady, J.A., Raabe, D., Zaiser, M., 2021. Strain rate dependency of dislocation plasticity. Nature Communications 12, 1-11. doi:https://doi.org/10.1038/s41467-021-21939-1.
Modelling of the interface between a thin film and a substrate within a strain gradient plasticity framework. P Fredriksson, P Gudmundson, 10.1016/j.jmps.2006.11.001Journal of the Mechanics and Physics of Solids. 55Fredriksson, P., Gudmundson, P., 2007. Modelling of the interface between a thin film and a substrate within a strain gradient plasticity framework. Journal of the Mechanics and Physics of Solids 55, 939-955. doi:https://doi.org/10.1016/j.jmps. 2006.11.001.
Beobachtung der Wechselwirkung von Versetzungen mit kohärenten geordneten Zonen (II). H Gleiter, E Hornbogen, 10.1002/pssb.19650120123Physica Status Solidi (b). 12Gleiter, H., Hornbogen, E., 1965. Beobachtung der Wechselwirkung von Versetzungen mit kohärenten geordneten Zonen (II). Physica Status Solidi (b) 12, 251-264. doi:https://doi.org/10.1002/pssb.19650120123.
Computational and theoretical aspects of a grain-boundary model that accounts for grain misorientation and grain-boundary orientation. D Gottschalk, A Mcbride, B Reddy, A Javili, P Wriggers, C Hirschberger, 10.1016/j.commatsci.2015.09.048Computational Materials Science. 111Gottschalk, D., McBride, A., Reddy, B., Javili, A., Wriggers, P., Hirschberger, C., 2016. Computational and theoretical aspects of a grain-boundary model that accounts for grain misorientation and grain-boundary orientation. Computational Materials Science 111, 443-459. doi:https://doi.org/10.1016/j.commatsci.2015.09.048.
A theory of grain boundaries that accounts automatically for grain misorientation and grain-boundary orientation. M E Gurtin, 10.1016/j.jmps.2007.05.002Journal of the Mechanics and Physics of Solids. 56Gurtin, M.E., 2008. A theory of grain boundaries that accounts automatically for grain misorientation and grain-boundary orientation. Journal of the Mechanics and Physics of Solids 56, 640-662. doi:https://doi.org/10.1016/j.jmps.2007.05.002.
The deformation and ageing of mild steel: III discussion of results. E O Hall, 10.1088/0370-1301/64/9/303Proceedings of the Physical Society. Section B. 64747Hall, E.O., 1951. The deformation and ageing of mild steel: III discussion of results. Proceedings of the Physical Society. Section B 64, 747. doi:10.1088/0370-1301/64/9/303.
Grain-boundary kinetics: A unified approach. J Han, S L Thomas, D J Srolovitz, 10.1016/j.pmatsci.2018.05.004Progress in Materials Science. 98Han, J., Thomas, S.L., Srolovitz, D.J., 2018. Grain-boundary kinetics: A unified approach. Progress in Materials Science 98, 386-476. doi:https://doi.org/10.1016/j.pmatsci.2018.05.004.
A three-dimensional continuum theory of dislocation systems: kinematics and mean-field formulation. T Hochrainer, M Zaiser, P Gumbsch, 10.1080/14786430600930218Philosophical Magazine. 87Hochrainer, T., Zaiser, M., Gumbsch, P., 2007. A three-dimensional continuum theory of dislocation systems: kinematics and mean-field formulation. Philosophical Magazine 87, 1261-1282. doi:https://doi.org/10.1080/14786430600930218.
Effects of the grain size and shape on the flow stress: A dislocation dynamics study. M Jiang, B Devincre, G Monnet, 10.1016/j.ijplas.2018.09.008International Journal of Plasticity. 113Jiang, M., Devincre, B., Monnet, G., 2019. Effects of the grain size and shape on the flow stress: A dislocation dynamics study. International Journal of Plasticity 113, 111-124. doi:https://doi.org/10.1016/j.ijplas.2018.09.008.
Grain size effect of fcc polycrystal: A new cpfem approach based on surface geometrically necessary dislocations. M Jiang, Z Fan, S Kruch, B Devincre, 10.1016/j.ijplas.2021.103181International Journal of Plasticity. 150103181Jiang, M., Fan, Z., Kruch, S., Devincre, B., 2022. Grain size effect of fcc polycrystal: A new cpfem approach based on surface geometrically necessary dislocations. International Journal of Plasticity 150, 103181. doi:https://doi.org/10.1016/ j.ijplas.2021.103181.
Interactions between non-screw lattice dislocations and coherent twin boundaries in face-centered cubic metals. Z H Jin, P Gumbsch, K Albe, E Ma, K Lu, H Gleiter, H Hahn, 10.1016/j.actamat.2007.11.020Acta Materialia. 56Jin, Z.H., Gumbsch, P., Albe, K., Ma, E., Lu, K., Gleiter, H., Hahn, H., 2008. Interactions between non-screw lattice dislocations and coherent twin boundaries in face-centered cubic metals. Acta Materialia 56, 1126-1135. doi:https://doi.org/10.1016/ j.actamat.2007.11.020.
The interaction mechanism of screw dislocations with coherent twin boundaries in different face-centred cubic metals. Z H Jin, P Gumbsch, E Ma, K Albe, K Lu, H Hahn, H Gleiter, 10.1016/j.scriptamat.2005.11.072Scripta Materialia. 54Jin, Z.H., Gumbsch, P., Ma, E., Albe, K., Lu, K., Hahn, H., Gleiter, H., 2006. The interaction mechanism of screw dislocations with coherent twin boundaries in different face-centred cubic metals. Scripta Materialia 54, 1163-1168. doi:https://doi. org/10.1016/j.scriptamat.2005.11.072.
Dislocation velocities, dislocation densities, and plastic flow in lithium fluoride crystals. W G Johnston, J J Gilman, 10.1063/1.1735121Journal of Applied Physics. 30Johnston, W.G., Gilman, J.J., 1959. Dislocation velocities, dislocation densities, and plastic flow in lithium fluoride crystals. Journal of Applied Physics 30, 129-144. doi:https://doi.org/10.1063/1.1735121.
Dislocation interactions with grain boundaries. Current Opinion in Solid State and Materials Science. J Kacher, B Eftink, B Cui, I Robertson, 10.1016/j.cossms.2014.05.00418Kacher, J., Eftink, B., Cui, B., Robertson, I., 2014. Dislocation interactions with grain boundaries. Current Opinion in Solid State and Materials Science 18, 227-243. doi:https://doi.org/10.1016/j.cossms.2014.05.004.
Quasi-four-dimensional analysis of dislocation interactions with grain boundaries in 304 stainless steel. J Kacher, I Robertson, 10.1016/j.actamat.2012.08.036Acta Materialia. 60Kacher, J., Robertson, I., 2012. Quasi-four-dimensional analysis of dislocation interactions with grain boundaries in 304 stainless steel. Acta Materialia 60, 6657-6672. doi:https://doi.org/10.1016/j.actamat.2012.08.036.
In situ and tomographic analysis of dislocation/grain boundary interactions in α-titanium. J Kacher, I M Robertson, 10.1080/14786435.2013.868942Philosophical Magazine. 94Kacher, J., Robertson, I.M., 2014. In situ and tomographic analysis of dislocation/grain boundary interactions in α-titanium. Philosophical Magazine 94, 814-829. doi:https://doi.org/10.1080/14786435.2013.868942.
Grain boundary dislocations in aluminium bicrystals after high-temperature deformation. G Kegg, C Horton, J Silcock, 10.1080/14786437308225816Philosophical Magazine. 27Kegg, G., Horton, C., Silcock, J., 1973. Grain boundary dislocations in aluminium bicrystals after high-temperature deforma- tion. Philosophical Magazine 27, 1041-1055. doi:https://doi.org/10.1080/14786437308225816.
The effects on grain-boundary processes of the steps in the boundary plane associated with the cores of grain-boundary dislocations. A King, D Smith, 10.1107/S0567739480000782Acta Crystallographica Section A. 36King, A., Smith, D., 1980. The effects on grain-boundary processes of the steps in the boundary plane associated with the cores of grain-boundary dislocations. Acta Crystallographica Section A 36, 335-343. doi:https://doi.org/10.1107/ S0567739480000782.
Kinetics, in: Thermodynamics and kinetics of slip. U F Kocks, A S Argon, M F Ashby, 19Kocks, U.F., Argon, A.S., Ashby, M.F., 1975. Kinetics, in: Thermodynamics and kinetics of slip. volume 19. chapter 3, pp. 68-109.
Interaction of a dislocation pileup with {332} tilt grain boundary in bcc metals studied by MD simulations. N Kvashin, N Anento, D Terentyev, A Bakaev, A Serra, 10.1103/PhysRevMaterials.5.013605Physical Review Materials. 513605Kvashin, N., Anento, N., Terentyev, D., Bakaev, A., Serra, A., 2021. Interaction of a dislocation pileup with {332} tilt grain boundary in bcc metals studied by MD simulations. Physical Review Materials 5, 013605. doi:https://doi.org/10.1103/ PhysRevMaterials.5.013605.
Two universal laws for plastic flows and the consistent thermodynamic dislocation theory. K C Le, 10.1016/j.mechrescom.2020.103597Mechanics Research Communications. 109103597Le, K.C., 2020. Two universal laws for plastic flows and the consistent thermodynamic dislocation theory. Mechanics Research Communications 109, 103597. doi:https://doi.org/10.1016/j.mechrescom.2020.103597.
Prediction of slip transfer mechanisms across grain boundaries. T Lee, I Robertson, H Birnbaum, 10.1016/0036-9748(89)90534-6Scripta metallurgica. 23Lee, T., Robertson, I., Birnbaum, H., 1989. Prediction of slip transfer mechanisms across grain boundaries. Scripta metallurgica 23, 799-803. doi:https://doi.org/10.1016/0036-9748(89)90534-6.
An in situ transmission electron microscope deformation study of the slip transfer mechanisms in metals. T Lee, I Robertson, H Birnbaum, 10.1007/BF02646988Metallurgical Transactions A. 21Lee, T., Robertson, I., Birnbaum, H., 1990a. An in situ transmission electron microscope deformation study of the slip transfer mechanisms in metals. Metallurgical Transactions A 21, 2437-2447. doi:https://doi.org/10.1007/BF02646988.
TEM in situ deformation study of the interaction of lattice dislocations with grain boundaries in metals. T Lee, I Robertson, H Birnbaum, 10.1080/01418619008244340Philosophical Magazine A. 62Lee, T., Robertson, I., Birnbaum, H., 1990b. TEM in situ deformation study of the interaction of lattice dislocations with grain boundaries in metals. Philosophical Magazine A 62, 131-153. doi:https://doi.org/10.1080/01418619008244340.
Advances in discrete dislocation dynamics simulations. R Lesar, L Capolungo, Handbook of Materials Modeling: Methods: Theory and Modeling. LeSar, R., Capolungo, L., 2020. Advances in discrete dislocation dynamics simulations. Handbook of Materials Modeling: Methods: Theory and Modeling , 1079-1110.
A new dislocation-density-function dynamics scheme for computational crystal plasticity by explicit consideration of dislocation elastic interactions. H S Leung, P S S Leung, B Cheng, A H W Ngan, 10.1016/j.ijplas.2014.09.009International Journal of Plasticity. 67Leung, H.S., Leung, P.S.S., Cheng, B., Ngan, A.H.W., 2015. A new dislocation-density-function dynamics scheme for compu- tational crystal plasticity by explicit consideration of dislocation elastic interactions. International Journal of Plasticity 67, 1-25. doi:https://doi.org/10.1016/j.ijplas.2014.09.009.
The effect of microstructure on the relationship between grain boundary sliding and slip transmission in high purity aluminum. M A Linne, T R Bieler, S Daly, 10.1016/j.ijplas.2020.102818International Journal of Plasticity. 135102818Linne, M.A., Bieler, T.R., Daly, S., 2020. The effect of microstructure on the relationship between grain boundary sliding and slip transmission in high purity aluminum. International Journal of Plasticity 135, 102818. doi:https://doi.org/10.1016/ j.ijplas.2020.102818.
Studying the effect of grain boundaries in dislocation density based crystal-plasticity finite element simulations. A Ma, F Roters, D Raabe, 10.1016/j.ijsolstr.2006.07.006International Journal of Solids and Structures. 43Ma, A., Roters, F., Raabe, D., 2006. Studying the effect of grain boundaries in dislocation density based crystal-plasticity finite element simulations. International Journal of Solids and Structures 43, 7287-7303. doi:https://doi.org/10.1016/j. ijsolstr.2006.07.006.
Maximum entropy production principle in physics, chemistry and biology. L M Martyushev, V D Seleznev, 10.1016/j.physrep.2005.12.001Physics reports. 426Martyushev, L.M., Seleznev, V.D., 2006. Maximum entropy production principle in physics, chemistry and biology. Physics reports 426, 1-45. doi:https://doi.org/10.1016/j.physrep.2005.12.001.
Incorporating interface affected zones into crystal plasticity. J Mayeur, I Beyerlein, C Bronkhorst, H Mourad, 10.1016/j.ijplas.2014.08.013International journal of plasticity. 65Mayeur, J., Beyerlein, I., Bronkhorst, C., Mourad, H., 2015. Incorporating interface affected zones into crystal plasticity. International journal of plasticity 65, 206-225. doi:https://doi.org/10.1016/j.ijplas.2014.08.013.
Deformation of micron-sized aluminium bi-crystal pillars. K Ng, A H W Ngan, 10.1080/14786430903164614Philosophical Magazine. 89Ng, K., Ngan, A.H.W., 2009. Deformation of micron-sized aluminium bi-crystal pillars. Philosophical Magazine 89, 3013-3026. doi:https://doi.org/10.1080/14786430903164614.
Reciprocal relations in irreversible processes. i. Physical review 37. L Onsager, 10.1103/PhysRev.37.405405Onsager, L., 1931. Reciprocal relations in irreversible processes. i. Physical review 37, 405. doi:https://doi.org/10.1103/ PhysRev.37.405.
Modeling of dislocation -grain boundary interactions in a strain gradient crystal plasticity framework. İ Ozdemir, T Yalçinkaya, 10.1007/s00466-014-0982-8Computational Mechanics. 54Ozdemir,İ., Yalçinkaya, T., 2014. Modeling of dislocation -grain boundary interactions in a strain gradient crystal plasticity framework. Computational Mechanics 54, 255-268. doi:https://doi.org/10.1007/s00466-014-0982-8.
The cleavage strength of polycrystals. N J Petch, Journal of the Iron and Steel Institute. 174Petch, N.J., 1953. The cleavage strength of polycrystals. Journal of the Iron and Steel Institute 174, 25-28.
Thermodynamic theory of dislocation/grain boundary interaction. Y Piao, K C Le, 10.1007/s00161-022-01088-6Continuum Mechanics and Thermodynamics. 34Piao, Y., Le, K.C., 2022. Thermodynamic theory of dislocation/grain boundary interaction. Continuum Mechanics and Thermodynamics 34, 763-780. doi:https://doi.org/10.1007/s00161-022-01088-6.
On the absorption of dislocations by grain boundaries. R C Pond, D A Smith, 10.1080/14786437708244939Philosophical Magazine. 36Pond, R.C., Smith, D.A., 1977. On the absorption of dislocations by grain boundaries. Philosophical Magazine 36, 353-366. doi:https://doi.org/10.1080/14786437708244939.
Polycrystal deformation in a discrete dislocation dynamics framework. S S Quek, Z Wu, Y W Zhang, D J Srolovitz, 10.1016/j.actamat.2014.04.063Acta materialia. 75Quek, S.S., Wu, Z., Zhang, Y.W., Srolovitz, D.J., 2014. Polycrystal deformation in a discrete dislocation dynamics framework. Acta materialia 75, 92-105. doi:https://doi.org/10.1016/j.actamat.2014.04.063.
Overview of constitutive laws, kinematics, homogenization and multiscale methods in crystal plasticity finite-element modeling: Theory, experiments, applications. F Roters, P Eisenlohr, L Hantcherli, D D Tjahjanto, T R Bieler, D Raabe, 10.1016/j.actamat.2009.10.058Acta Materialia. 58Roters, F., Eisenlohr, P., Hantcherli, L., Tjahjanto, D.D., Bieler, T.R., Raabe, D., 2010. Overview of constitutive laws, kinematics, homogenization and multiscale methods in crystal plasticity finite-element modeling: Theory, experiments, applications. Acta Materialia 58, 1152-1211. doi:https://doi.org/10.1016/j.actamat.2009.10.058.
Energy of slip transmission and nucleation at grain boundaries. M D Sangid, T Ezaz, H Sehitoglu, I M Robertson, 10.1016/j.actamat.2010.09.032Acta Materialia. 59Sangid, M.D., Ezaz, T., Sehitoglu, H., Robertson, I.M., 2011. Energy of slip transmission and nucleation at grain boundaries. Acta Materialia 59, 283-296. doi:https://doi.org/10.1016/j.actamat.2010.09.032.
Dislocation and grain boundary interactions in metals. Z Shen, R Wagoner, W Clark, 10.1016/0001-6160(88)90058-2Acta Metallurgica. 36Shen, Z., Wagoner, R., Clark, W., 1988. Dislocation and grain boundary interactions in metals. Acta Metallurgica 36, 3231-3242. doi:https://doi.org/10.1016/0001-6160(88)90058-2.
On slip transmission and grain boundary yielding. M Stricker, J Gagel, S Schmitt, K Schulz, D Weygand, P Gumbsch, 10.1007/s11012-015-0192-2Meccanica. 51Stricker, M., Gagel, J., Schmitt, S., Schulz, K., Weygand, D., Gumbsch, P., 2016. On slip transmission and grain boundary yielding. Meccanica 51, 271-278. doi:https://doi.org/10.1007/s11012-015-0192-2.
Grain boundary mediated plasticity: The role of grain boundary atomic structure and thermal activation. D Terentyev, A Bakaev, A Serra, F Pavia, K Baker, N Anento, 10.1016/j.scriptamat.2017.10.002Scripta Materialia. 145Terentyev, D., Bakaev, A., Serra, A., Pavia, F., Baker, K., Anento, N., 2018. Grain boundary mediated plasticity: The role of grain boundary atomic structure and thermal activation. Scripta Materialia 145, 1-4. doi:https://doi.org/10.1016/j. scriptamat.2017.10.002.
A predictive model for transferability of plastic deformation through grain boundaries. T Tsuru, Y Shibutani, T Hirouchi, 10.1063/1.4939819AIP Advances. 615004Tsuru, T., Shibutani, Y., Hirouchi, T., 2016. A predictive model for transferability of plastic deformation through grain boundaries. AIP Advances 6, 015004. doi:https://doi.org/10.1063/1.4939819.
Fundamental interaction process between pure edge dislocation and energetically stable grain boundary. T Tsuru, Y Shibutani, Y Kaji, 10.1103/PhysRevB.79.012104Physical Review B. 7912104Tsuru, T., Shibutani, Y., Kaji, Y., 2009. Fundamental interaction process between pure edge dislocation and energetically stable grain boundary. Physical Review B 79, 012104. doi:https://doi.org/10.1103/PhysRevB.79.012104.
Grain boundary interface mechanics in strain gradient crystal plasticity. P Van Beers, G Mcshane, V Kouznetsova, M Geers, 10.1016/j.jmps.2013.08.011Journal of the Mechanics and Physics of Solids. 61Van Beers, P., McShane, G., Kouznetsova, V., Geers, M., 2013. Grain boundary interface mechanics in strain gradient crystal plasticity. Journal of the Mechanics and Physics of Solids 61, 2659-2679. doi:https://doi.org/10.1016/j.jmps.2013.08. 011.
Atomistic modeling of the interaction of glide dislocations with "weak" interfaces. J Wang, R G Hoagland, J P Hirth, A Misra, 10.1016/j.actamat.2008.07.041Acta Materialia. 56Wang, J., Hoagland, R.G., Hirth, J.P., Misra, A., 2008. Atomistic modeling of the interaction of glide dislocations with "weak" interfaces. Acta Materialia 56, 5685-5693. doi:https://doi.org/10.1016/j.actamat.2008.07.041.
Tracking the sliding of grain boundaries at the atomic scale. L Wang, Y Zhang, Z Zeng, H Zhou, J He, P Liu, M Chen, J Han, D J Srolovitz, J Teng, Y Guo, G Yang, D Kong, E Ma, Y Hu, B Yin, X Huang, Z Zhang, T Zhu, X Han, 10.1126/science.abm2612Science. 375Wang, L., Zhang, Y., Zeng, Z., Zhou, H., He, J., Liu, P., Chen, M., Han, J., Srolovitz, D.J., Teng, J., Guo, Y., Yang, G., Kong, D., Ma, E., Hu, Y., Yin, B., Huang, X., Zhang, Z., Zhu, T., Han, X., 2022. Tracking the sliding of grain boundaries at the atomic scale. Science 375, 1261-1265. doi:https://doi.org/10.1126/science.abm2612.
Superplasticity and grain boundary sliding in rolled AZ91 magnesium alloy at high strain rates. Y Wei, Q Wang, Y Zhu, H Zhou, W Ding, Y Chino, M Mabuchi, 10.1016/j.actamat.2008.07.041Materials Science and Engineering: A. 360Wei, Y., Wang, Q., Zhu, Y., Zhou, H., Ding, W., Chino, Y., Mabuchi, M., 2003. Superplasticity and grain boundary sliding in rolled AZ91 magnesium alloy at high strain rates. Materials Science and Engineering: A 360, 107-115. doi:https: //doi.org/10.1016/j.actamat.2008.07.041.
Dislocation-grain boundary interaction-based discrete dislocation dynamics modeling and its application to bicrystals with different misorientations. X Zhang, S Lu, B Zhang, X Tian, Q Kan, G Kang, 10.1016/j.actamat.2020.10.052Acta Materialia. 202Zhang, X., Lu, S., Zhang, B., Tian, X., Kan, Q., Kang, G., 2021. Dislocation-grain boundary interaction-based discrete dislocation dynamics modeling and its application to bicrystals with different misorientations. Acta Materialia 202, 88-98. doi:https://doi.org/10.1016/j.actamat.2020.10.052.
Dislocation dynamics simulations of plasticity in polycrystalline thin films. C Zhou, R Lesar, 10.1007/978-3-319-44677-6_85International Journal of Plasticity. 30Zhou, C., LeSar, R., 2012. Dislocation dynamics simulations of plasticity in polycrystalline thin films. International Journal of Plasticity 30, 185-201. doi:https://doi.org/10.1007/978-3-319-44677-6_85.
In situ atomistic observation of grain boundary migration subjected to defect interaction. Q Zhu, S Zhao, C Deng, X An, K Song, S Mao, J Wang, 10.1016/j.actamat.2020.08.021Acta Materialia. 199Zhu, Q., Zhao, S., Deng, C., An, X., Song, K., Mao, S., Wang, J., 2020. In situ atomistic observation of grain boundary migration subjected to defect interaction. Acta Materialia 199, 42-52. doi:https://doi.org/10.1016/j.actamat.2020.08.021.
Interfacial plasticity governs strain rate sensitivity and ductility in nanostructured metals. T Zhu, J Li, A Samanta, H G Kim, S Suresh, 10.1073/pnas.0611097104Proceedings of the National Academy of Sciences. 104Zhu, T., Li, J., Samanta, A., Kim, H.G., Suresh, S., 2007. Interfacial plasticity governs strain rate sensitivity and ductility in nanostructured metals. Proceedings of the National Academy of Sciences 104, 3031-3036. doi:https://doi.org/10.1073/ pnas.0611097104.
Perspective on hetero-deformation induced (hdi) hardening and back stress. Y Zhu, X Wu, 10.1080/21663831.2019.1616331Materials Research Letters. 7Zhu, Y., Wu, X., 2019. Perspective on hetero-deformation induced (hdi) hardening and back stress. Materials Research Letters 7, 393-398. doi:https://doi.org/10.1080/21663831.2019.1616331.
Heterostructured materials. Y Zhu, X Wu, 10.1016/j.pmatsci.2022.101019Progress in Materials Science. 131101019Zhu, Y., Wu, X., 2023. Heterostructured materials. Progress in Materials Science 131, 101019. doi:https://doi.org/10.1016/ j.pmatsci.2022.101019.
An introduction to thermomechanics. H Ziegler, ElsevierZiegler, H., 2012. An introduction to thermomechanics. Elsevier.
|
Introduction
Nowadays multi-principal element alloys, (also called termed as high entropy alloys (HEAs) [1][2][3][4], have undoubtedly attracted a broad interest in Materials Science. Along with many attractive properties, however, one of the most noticeable disadvantages of single-phase face centered cubic (FCC) structured HEAs is their relatively low strength at room temperature, only about 200 MPa in the as-cast state [1] that is significantly less than the intended strength of metallic structural materials. Grain refinement and precipitation strengthening, being quite effective for improving the strength of HEAs [5][6][7][8][9], may lead to a loss of plasticity. Carbon alloying is recognized as an effective method of increasing the strength of HEAs while at the same time without sacrificing ductility [7,9]. The equiatomic CoCrFeMnNi HEA with FCC crystalline structure is one of the most promising alloys because of its beneficial combination of mechanical and physical properties [10]. Recent experimental studies have clearly demonstrated that its alloying by interstitial carbon (and/or nitrogen) improves both strength and plasticity [5,10,[11][12][13][14][15][16][17][18]. This behavior results from coinfluence of Twinning Induced Plasticity (TWIP), precipitation, and solid solution hardening mechanisms [10,19,20]. Peng et al. [17] discussed in detail the carbide precipitation as a hardening mechanism in the CoCrFeMnNi-based interstitial alloys (in addition to, e.g., solid solution hardening). Significant distortions of the crystal lattice of a high-entropy alloy, considered as one of the so-called core effects [1], contribute to the appearance of additional stresses and might even lead to the improvement of mechanical properties. While solid solution hardening in HEAs attracted a considerable interest [21][22][23][24], the interstitial solid solution hardening has not received much attention and has not yet been studied in detail. Being important for mechanical properties, the interstitial elements might affect the diffusion jumps of substitutional atoms as it was found in the case of austenite [25] or suggested for copper [26]. Since diffusion plays an important role in a number of high-temperature properties of structural materials or even determines some of them [10], reliable data on diffusion of substitutional elements are essential for the development of new materials and for the evaluation of their long-term stability. In our previous work [27], we measured the tracer diffusion coefficients in the CoCrFeMnNi-C alloys at 1373 K. The present work is focused on a detailed study of substitutional diffusion in the FCC CoCrFeMnNi-based HEAs with various carbon contents in an extended temperature interval and evaluation of the carbon effect on the crystal lattice parameter in these alloys. The available tracer diffusion coefficients for all constituting elements in C-free CoCrFeMnNi [27][28][29][30][31] are used as a reference. The impact of interstitial C on the elastic distortions in the HEAs is evaluated, too.
Experimental details 2.1 Materials preparation
The equiatomic CoCrFeMnNi HEAs with different carbon contents were synthesized using technically pure metallic elements and carbon by melting and casting using a vacuum induction furnace. The details of the thermo-mechanical processing and measured bulk chemical compositions of the as-cast alloys as determined by wet-chemical analysis are given in Ref. [10]. The materials in the present study are the same as produced and used in Ref. [10]. The alloy sheets were first hot-rolled at 1223 K to 50 % reduction in thickness and subsequently homogenized at 1473 K for 3 h in Ar atmosphere followed by water-quenching. This processing maximized the amount of dissolved carbon in the FCC matrix.
Microstructure characterization
X-ray diffraction measurements were performed by a X6_WS diffractometer with Cu K radiation operating at 40 kV and 30 mA in − geometry between 30° and 130° with a step size of 0.05° and a counting time of 20 s per step.
The microstructure has been analyzed on samples used later for the diffusion measurements. Discshaped samples of 8 mm in diameter and about 1.5 mm in height were cut by spark-erosion. Subsequently, one face was polished to mirrorlike finish using standard metallography procedures. The samples were again annealed in purified Ar atmosphere at 1373 K for 24 h to remove the induced mechanical stresses. After annealing treatment, the samples were fine polished using an oxide suspension (OPS) with silica particle sizes around 50 nm for more than 30 min. Finally, the samples were polished with soap and ethanol for 5 min to remove the nanosilica particles. Some samples were further annealed to mimic the annealing treatments for diffusion measurements (at 1173 K for 2 days and 12 hours) and characterize the microstructure evolution during diffusion. Electron back-scatter diffraction (EBSD) measurements were carried out on a Zeiss Crossbeam XB 1540 FIB scanning electron microscope (SEM) with a Hikari camera and the TSL OIM software. Back-scattered electron (BSE) and secondary electron (SE) images were taken on a Zeiss-Merlin instrument, and energydispersive X-ray spectroscopy (EDS) was used to identify the elemental distributions on a micrometer scale.
Radiotracer experiments
A standard radiotracer technique [32] [28,29,31] HEAs. Green, black, red and blue bars present the chemical compositions of alloys with 0, 0.2, 0.5 and 0.8 at.% of carbon, respectively. The composition of the C-free CoCrFeMnNi in the presented work and in Refs. [28,31] are quite close (dark green bars). The composition of C-free CoCrFeMnNi from Ref. [29] is highlighted by light green.
The penetration profiles were determined by parallel mechanical sectioning using a precision grinding machine and a Mylar foil with 30 µm large SiC particles. The section masses were determined by weighing the samples before and after each sectioning step on a microbalance to an accuracy of ±0.1 μg. The specific activity of each section was measured by a pure Ge γ-detector equipped with a 16 K multi-channel analyzer (the Co 57 , Cr 51 , Fe 59 , and Mn 54 radioisotopes). The energies of the corresponding γ-decays can easily be distinguished by the available setup. The activity of the Ni 63 radioisotope (β-decays) was analyzed by a Liquid Scintillation Counter TRI-CARB 2910. The background corrected specific radioactivity divided by the section mass is proportional to the tracer concentration in the given section. The density of the reported alloys was measured by weighing the samples using the Archimedes' method, see Table 1, and used for the reliable determination of the penetration depths.
Results
Chemical composition
Since changes of local chemical environments could affect vacancy-mediated diffusion [31], we compared the nominally equiatomic compositions of the studied HEAs with respect to the relative amounts of 3d transition metallic elements, Fig. 1. In all alloys, the substitutional elements are kept at almost equiatomic proportions. Polycrystalline C-free HEA studied in Ref. [29] is seen to be slightly enriched in Cr and depleted with Mn. The present C-free CoCrFeMnNi alloy (identical to that investigated by Gaertner et al. [28,31]) reveals almost an opposite trend with respect to these elements. The C-bearing alloys show almost uniform distributions of the substitutional elements, Fig. 1.
Microstructure characterization
As an example, the microstructures of the reported alloys with 0.2 at. % of carbon annealed at 12 and 48 hours are shown in Fig. 2. Twins and carbides are clearly seen in the studied materials. It was proven that the microstructure remains practically unchanged after annealing treatments mimicking the diffusion annealing. As it was described in [10] the interstitial HEA with a nominal carbon content of 0.2 at. % is characterized by a fully recrystallized microstructure with a large fraction of annealing twins. The average grain size is approximately 45 m. Nano-particles with an average size of 50 to 100 nm and enriched in Cr are found to be randomly distributed in the microstructure. It has been shown that the annealing time does not affect the microstructure. Such microstructure is suitable for reliable volume diffusion measurements.
Impact of C alloying on lattice constant
In Fig. 3a, a FCC unit cell of the Cantor alloy (the elements are shown as coloured spheres of different radii to mimic the CoCrFeMnNi alloy) is sketched with an additional C atom (grey sphere) at an octahedral position. The actual distribution of constituent atoms over the lattice sites is [33] and blue triangles [34]) and the predictions according to Eq. (1) (filled red circles).
C-free Cantor alloy
In the present work, the lattice constant of equiatomic CoCrFeMnNi alloy was measured at 0.3589 nm. If Vegard's law would be used, a slightly smaller value of 0.3585 nm is obtained. The Lubarda approach [35] proposed by Moreen [36] and Toda-Caraballo [37] predicts the lattice constant as 0.3597 nm. These results agree reasonably well with the present data and the reported values of the crystal lattice parameter of equatomic CoCrFeMnNi: 0.3595 nm [38], 0.359 nm [39], 0.3592 nm [40], and 0.3577 nm [41]. A lattice constant of 0.34685 nm was reported for the high-entropy chromium-depleted alloy [42]. For Fe-rich non-equatomic CoCrFeMnNi HEA (Fe40Mn28Ni8Cr24), values of 0.3615 nm [34] and 0.362 nm [43] were found.
The CoCrFeMnNi-C alloys
The Vegard approximation cannot be used for the case of interstitial alloying and we followed the approach suggested for austenite [44]. Rammo et al. [45] have shown that the lattice constant of austenite, a, increases due to carbon alloying following a semi-empirical formula,
= 0 + 2( + )−2√2 4•10 ,(1)
where XC is the concentration of C atoms in at.%, and are the atomic radii of Fe and C atoms. This equation was used with an averaged value of atomic radii of the matrix atoms in the CoCrFeMnNi alloy, , and was determined by the Lubarda approach [35] for the C-free CoCrFeMnNi alloy. Equation (1) predicts a linear increase of the lattice constant of C-alloyed CoCrFeMnNi and a good agreement with the experiment is seen, Fig. 2b.
Tracer diffusion
As an example, the penetration profiles for diffusion of substitutional elements in the CoCrFeMnNi alloys with 0, 0.2, 0.5 and 0.8 at.% of C measured at 1273 K are shown in Fig. 4 in the coordinates of the logarithm of concentration vs. the depth squared, y 2 . Two branches, identified with volume and grain boundary diffusion contributions, are recognized. In the present work, we are focusing on reliable measurements of volume diffusion for all isotopes and we will not report the impact of C alloying on the grain boundary diffusion rates of the substitutional elements. The penetration profiles were fitted accounting for both, volume and grain boundary diffusion contributions, solid lines in Fig. 4, and true volume diffusion data were extracted. The lowest value of the volume diffusion coefficient, being inversely proportional to the slope in the given coordinates, was observed for the C-free CoCrFeMnNi alloy. The alloy with 0.8 at. % of C has obviously the highest value of the volume diffusion coefficient. The same trend is observed for other temperatures. The instantaneous source solution of the diffusion problem has been found to be appropriate and the determined tracer diffusion coefficients are listed in Table 2 and are plotted in Fig. S1 (Supplementary Material) in Arrhenius coordinates.
In Fig. 5, the measured diffusion coefficients of all substitutional elements are shown as functions of both inverse temperature and the carbon content (the filled sphereas). The separate plots are given in Supplementary Material, Figs. S1 and S2. The results for C-alloyed CoCrFeMnNi substantiate the trend observed previously for Cfree CoCrFeMnNi HEA [28][29][30]. Indeed, Mn is the fastest element and Co and Ni are slowest elements in the temperature interval of 1173 to 1373 K. Cr and Fe reveal similar fast diffusivities in all alloys, Fig. 5.
Discussion
Presently, an extensive information on volume diffusion of all constituent elements in the fivecomponent CoCrFeMnNi HEA is accumulated [27,[29][30][31]51,52]. The reported values are generally in very good agreement, although slight variations of the composition (nominally equiatomic) need to be considered. Carbon could be present in HEAs as a spurious element due to manufacturing conditions. Since the diffusion properties are of key importance for predicting the life-time properties and the phase stability, knowing the impact of interstitial carbon and carbide formation on the atomic transport is imperative for developing HEA for advanced applications. Below we will focus on the impact of dissolved carbon on tracer diffusion of substitutional atoms in this alloy system.
Tracer diffusion
Mead and Birchenall [25] analysed self-diffusion of iron in austenite with different carbon contents.
Using the model of Overhauser [26], a linear increase of the logarithm of the tracer diffusion coefficient of Fe with C concentration has been predicted. Adopting this model, following relation is used to describe substitutional diffusion in the CoCrFeMnNi-C alloys,
( ) = (0) [ ] = (0) [ ( ) 2 ].(2)
Here ( ) is the diffusion coefficient of the (
Here g is a dimensionless constant which determines the displacements of substitutional atoms from their ideal lattice positions due to incorporation of an interstitial C atom as a spherical elastic singularity at the octahedral position and its value for FCC Cu has been estimated at 0.06 [26]
. For the estimates, we fitted the measured diffusion coefficients using Eq. (4'). An acceptable agreement is seen, Fig. 5 (or Fig. S2).
Since migration volume, , or the change of the barrier height due to elastic strains, K, depend on the type of diffusing atom, a quantitatively different impact of the C atoms on the diffusion of different substitutional atoms is expected. We analysed the measured diffusion coefficients in two way. In Table 3, the diffusion parameters, the pre-exponential factor D0 and the activation energy Q, determined as Arrhenius parameters for each alloy are given. Additionally, we have used Eq. (4) and determined the parameters D0, Q, and W for each diffusing element. The results are listed in Table 4. It seems that Eqs. (2)-(4) correctly predict the volume diffusion coefficients for the considered group of alloys, especially at temperatures below 1300 K. The open circles in Fig. 5 correspond to predictions of the fit according to Eq. (4') and the measured diffusivities (filled spheres) almost follow the predictions and increase linearly with increasing C content. The parameter W (which is a measure of the impact of interstitial C on migration energies) turned out to be almost identical for all elements, about 12000 K, excepting that for Mn, which features a larger value of about 15000 K. We conclude that diffusion of Mn as an element with the largest radius is most strongly affected by the dissolved C atoms. This reasonable correlation supports indirectly the correctness of the model, Eqs. (2)-(4). An additional tendency is seen at the highest temperature of 1373 K, where the tracer diffusion coefficients (especially of Ni and Co) decrease first at low C concentrations and start to increase with xC ≥ 0.5 at.%, especially for slow-diffusing elements like Co and Ni. We may speculate and associate this behaviour with additional C-induced suppressing of anharmonic effects which in their turn increase the vacancy concentration in C-free alloy at high temperatures. Note that an increase of the vacancy concentration due to temperaturedependent vacancy formation entropy was predicted by careful ab initio calculations for pure Al or Cu [46] or Ni [47]. Thus, at high temperatures, the C alloying is suggested to decrease first the effective vacancy concentration and this trend is reversed at higher C concentrations by the above-discussed impact of interstitial C atoms on the jump barriers.
Fe and Cr diffusion
Diffusion of Fe 59 in the reported materials seems to be extremely interesting. In fact, we guess that one of the closest materials to our alloy is γ-iron from the point of view of the similarity of the crystal lattice and importance of the issue for austenitic steals. It was reported [48,49] that an increase of the carbon content in iron leads to an increase of the Fe diffusion coefficient of γ-iron, that perfectly correlates with the results presented in our work. The impact of the carbon content on the activation energies of Fe diffusion in our materials and in γiron [25] is compared in Fig. 6 and very similar dependencies are observed. As a general tendency, a decrease of the effective activation energy of Fe diffusion with an increase of the C content can be identified, Fig. 6. Following the model of Overhauser [26], the lattice distortions induced by the interstitially dissolved C atoms decreases the migration barriers, see Eq.
(2). The term • contributes to the decrease of the effective activation energy of diffusion by the term ∆ = − (
) . Since the diffusion rates are measured in a relatively narrow temperature interval from 1173 to 1373 K, potential deviations from the linear Arrhenius dependencies are not quantitatively analyzed in the present work. A further analysis would require DFT-informed estimates of the factor b in Eqs.
(2)-(4).
In the case of Cr, only a minor tendency concerning the decrease of the activation energy with the increase of the C content is seen, Fig. 6. The changes only slightly exceed the experimental accuracy. Two opposite tendencies of the impact of C alloying on Fe and Cr diffusion are seen in Fig. 5.
In fact, the majority of data, below the temperature of 1300 K, do follow the predictions of Eqs. (2)-(4), i.e. the diffusion rates increase with addition of interstitial C atoms, while a decrease of the tracer diffusion coefficients at low C concentrations is obvious at the highest temperature of the present measurements of 1373 K. Whereas the increasing tendency is well described by Eqs.
(2) -(4) in term of the impact of interstitial C on the migration barriers, the diffusion retardation at T = 1373 K in low-C alloys need a special consideration. As it was explained above, it may be the C alloying-induced suppressing of the anharmonic contributions to the temperature dependent formation entropy of vacancies in these alloys.
Ni and Co diffusion
Ni and Co are the slowest diffusing elements in CoCrFeMnNi at elevated temperatures above 1173 K [31] and this tendency is generally confirmed also for the C-alloyed CoCrFeMnNi in the present work. Alloying by C increases generally the diffusion rates of both Ni and Co, Fig. 5, and decreases the effective activation energies, Fig. 6, respectively. The trend of increasing diffusivity of Ni and Co with increasing C content is more pronounced at lower temperatures, Fig. 5c and d, although for Ni some drop of the corresponding diffusion rate in low-C alloys might be identified at the higher temperatures.
Mn diffusion
Manganese is the fastest isotope from all substitutional elements in C-fee CoCrFeMnNi and this tendency holds for all alloys investigated in the present work. Whereas an increase of the amount of carbon to 0.8 at. % enhances the diffusion coefficients with respect to the C-free alloy by a factor of two, or even stronger increase is seen for Mn especially at the lowest temperature in this investigation. We note that the increase of the C amount to 0.8 at.% was found to intensify the grain boundary diffusion contribution, especially for Ni and Co. We are highlighting that the impact of C on the selfdiffusion values of the constituent elements is continuous and linear over the significant range of C concentrations, while indicates the high relative stability of the atomic structure of the alloy against carbon alloying.
General tendencies
Summarizing the present findings, several statements are highlighted:
• The volume diffusion coefficients of substitutional elements in the alloy with the highest content of carbon, i.e. in CoCrFeMnNi-0.8 at.% C are slightly larger than those in the C-free alloy by a factor of two to five depending on the temperature and the diffusing element. • Two tendencies are observed. At lower temperatures, T < 1300 K, the diffusion rates of all substitutional elements increase generally with the increasing content of C. On the other hand, a slight decrease of the volume diffusion rates for low-C alloys is found at 1373 K. At this temperature, the slowest diffusion coefficients are recorded for the CoCrFeMnNi-0.2 at.% C alloy. • The activation energies of diffusion are gradually decreasing with increasing C content. The effect is most pronounced for Mn. Fig. 7. The radio of the diffusion coefficients of Mn (fastest) and Ni (slowest) in the alloys under investigation: C-free CoCrFeMnNi (grey diamonds [29,30] and brown squares [31]), and the alloys with 0.2 (black triangles up), 0.5 (red circles) and 0.8 (blue triangles down) at.% of carbon.
In Fig. 7, the ratios of the diffusion coefficients of Mn and Ni in different C-alloyed HEAs are plotted as function of temperature. At elevated temperatures above 1100 K a general trend of increasing ratios of DMn/DNi with increasing C content is seen. In the C-free alloy, this trend is drastically reversed at lower temperatures [31] and this behavior has been related to the appearance of a short-range order in the CoCrFeMnNi HEA. In C-alloyed HEAs, the interstitially dissolved C atoms affect differently the jump barriers for Mn and Ni atoms, in general lowering them. Note that both diffusion coefficients, DMn and DNi, are increasing with the addition of C. The observed behavior correlates with the relative atomic sizes of Mn and Ni atoms and local distortions induced by dissolved C atoms on these substitutional atoms. We may speculate that the C-induced distortions are larger for larger Mn atoms and the Mn diffusion rates are enhanced more significantly in accordance with Eq. (2).
Conclusions
The present study indicates the existence of two different mechanisms of the influence of C alloying on substitutional diffusion in CoCrFeMnNi-C HEAs. At 1373 K, addition of a small amount of carbon (in the range from 0 to 0.2 at. %) gives rise to diffusion retardation, probably due to decreasing anharmonic contributions to the temperature-dependent vacancy formation entropy. The diffusion retardation is more pronounced for slow diffusing Ni, whereas it is only marginal for fast diffusing elements (e.g., Mn, Cr and Fe). The effective activation energy of diffusion decreases significantly in these alloys and changes only slightly at higher C contents for almost all elements. A continuous decrease of the activation energy of diffusion is observed only for Ni in the whole investigated range of C concentrations. At lower temperatures a general trend of enhancement of diffusion rates of substitutional elements is clearly seen. This trend is explained by the elastic distortions induced by interstitially dissolved carbon. The enhancement of Mn atoms is largest and this behaviour correlates with largest atomic radius of Mn atoms. The smallest distortions are expected for the solvent atoms with smallest atomic radii, i.e. Co and Ni. Correspondingly, the C-induced enhancements of Co and Ni diffusion in CoCrFeMnNi HEAs are smallest. The model derived for austenitic steels seems to be applicable for the present interstitially alloyed HEAs and it describes well the change of the crystalline lattice parameter with C alloying.
Here we document the temperature (Fig. S1) and concentration (Fig. S2) dependencies of the diffusion rates of substitutional elements in C-alloyed HEAs. In Fig. S1, the diffusion rates determined for C-free CoCrFeMnNi alloy in Ref. [31] are shown by brown diamonds. The green squares, black triangles up, red circles and blue triangles down present the results of substitutional element diffusion in the alloys with 0, 0.2, 0.5 and 0.8 at.% of carbon, measured in the present work, respectively. The solid lines correspond to 'standard' Arrhenius fits of our experimental results using the data for each alloy separately. Furthermore, we perform a master fit of all data for the given element using Eq. (4) of the main manuscript.
Microstructure and elemental distributions of the CoCrFeMnNi-C HEAs with 0.2at. % C after annealing at 1373 K for 12 hours. (a, c) and 48 hours (b, d) BSE images (a, b) and EDS maps (c, d) show the morphologies of the microstructures and the distributions of the constituent elements, respectively. FCC unit cell of a five-component HEA (coloured spheres) with an interstitial carbon at an octahedral position (grey sphere). b) The measured lattice constant (open red circles) as function of the carbon content in comparison to the literature data (green squares
Fig. 4 .
4Examples of the penetration profiles of 59 Fe (a), 51 Cr (b), 63 Ni (c), 57 Co (d), and 54 Mn (e) diffusion at 1273 K in polycrystalline CoCrFeMnNi HEAs with different carbon content. y is the penetration depth. The profiles measured for the alloys with 0, 0.2, 0.5 and 0.8 at.% of carbon are presented by green squares, black triangles up, red circles and blue triangles down, respectively. The solid lines correspond to fits accounting for both volume and grain boundary diffusion contributions.
( ) 1 −Fig. 5 .
15alloy, D(0) is the diffusion coefficient in the C-free alloy, is the carbon concentration (in at. fractions), Logarithm of the diffusion coefficients (filled spheres, in m 2 /s) as function of the inverse temperature T and the carbon content (in at.%) for Fe (a), Co (b), Cr (c), Ni (d), and Mn (e) in polycrystalline CoCrFeMnNi-C HEAs. The predictions according to Eqs. (2)-(4) are shown by colored surfaces. The open circles correspond to the predicted values at temperatures/compositions of the present measurements.numerical factor, B is the bulk modulus, is the migration volume of vacancy-mediated diffusion, and has its usual meaning. In the original work[26], the constant b in Eq.
,
change of the barrier height at the saddle position, ∆ , due to the elastic strain induced by an interstitial carbon atom; R0 is of the order of the lattice constant a and corresponds to the cutoff of the elastic distortions around C atom. Re-writing Eq. (1) with respect to the elastic distortions induced by carbon atoms, , and expressing the C concentration in at. fractions, , one may correlate the C-induced changes of the diffusion coefficients, ( ), with the local distortions and one arrives at the relation , W', and W are the corresponding constants. Equations (4) or (4') predict a linear enhancement of the logarithm of the diffusion coefficients of the substitutional atoms with increasing C-induced lattice distortions or C content. In Fig. 5, the measured tracer diffusion coefficients are shown as function of the C concentration in the alloys. The concentration dependencies are plotted in Fig. S2 (Supplementary), too. The dashed lines correspond to predictions according to Eqs. (2)-
Fig. 6 .
6Effective activation enthalpy of diffusion of 59 Fe (a), 51 Cr (b), 63 Ni (c), 57 Co (d), and 54 Mn (e) in CoCrFeMnNi HEAs as function of the C concentration. In (a), open squares correspond to Fe diffusion in Fe-C alloys[25].
Fig. S1 .Fig. S2 .
S1S2The results are presented by green dashed-dot lines (C-free alloy), dotted black lines (alloy with 0.2 at. % of carbon), red dotted lines (alloy with 0.5 at. % of carbon), and dashed blue line (alloy with 0.8 at. Arrhenius plots for 59 Fe (a), 51 Cr (b), 63 Ni (c), 57 Co (d), and 54 Mn (e) in polycrystalline CoCrFeMnNi HEAs. The C amount in the alloys are indicated in at.%. The concentration dependencies of the determined diffusion coefficients are shown in Fig. S2. The solid lines present the anticipated trends and the dashed lines correspond to the master fit using Eq. Diffusion coefficients of 59 Fe (a), 51 Cr (b), 63 Ni (c), 57 Co (d), and 54 Mn (e) in CoCrFeMnNi HEAs as function of the C concentration.
Table 2 .
2Tracer diffusion coefficients in polycrystalline CoCrFeMnNi-C HEAs.T, K
D (10 -16 m 2 /s)
Co 57
Cr 51
Fe 59
Mn 54
Ni 63
C = 0 at.%
1373
20.1 −0.1
+0.1
54.6 −0.1
+0.1
35.4 −0.2
+0.2
94.4 −0.2
+0.2
14.7 −0.1
+0.3
1273
1.84 −0.03
+0.01
4.60 −0.26
+0.04
3.69 −0.19
+0.01
5.80 −0.02
+0.19
2.01 −0.02
+0.01
1223
0.862 −0.005
+0.103
1.37 −0.05
+0.09
1.32 −0.17
+0.21
2.28 −0.57
+0.02
1.10 −0.01
+0.01
1173
0.234 −0.014
+0.003
0.73 −0.046
+0.029
0.70 −0.028
+0.030
1.33 −0.05
+0.17
0.10 −0.022
+0.039
C = 0.2 at.%
1373
17.1 −0.3
+0.3
43.3 −0.1
+1.1
28.5 −0.2
+0.2
81.5 −0.4
+0.2
13.4 −0.3
+0.3
1273
3.53 −0.07
+0.10
7.65 −1.03
+0.79
7.78 −0.12
+0.49
1.30 −0.03
+0.04
1.73 −0.04
+0.07
1223
1.30 −0.01
+0.24
3.09 −0.03
+0.14
2.36 −0.04
+0.45
7.53 −0.12
+0.02
0.51 −0.005
+0.009
1173
0.56 −0.050
+0.50
0.15 −0.007
+0.006
1.17 −0.02
+0.42
2.87 −0.07
+0.02
0.14 −0.005
+0.002
C = 0.5 at.%
1373
14.4 −0.2
+0.2
45.7 −0.7
+1.5
39.3 −0.1
+1.1
85.1 −0.2
+0.1
11.3 −0.2
+0.6
1273
3.28 −0.30
+0.15
8.12 −0.59
+0.12
6.57 −0.40
+0.22
12.2 −12.7
+2.10
1.39 −0.03
+0.05
1223
1.23 −0.80
+0.01
2.86 −0.04
+0.25
2.07 −0.05
+0.08
5.63 −0.15
+0.21
0.69 −0.006
+0.009
1173 -
-
0.92 −0.078
+0.011
2.56 −0.03
+0.03
0.12 −0.001
+0.002
C = 0.8 at.%
1373
35.2 −0.1
+0.2
70.4 −0.2
+0.1
50.3 −1.7
+0.7
10.3 −0.2
+0.1
25.6 −0.2
+0.3
1273
5.44 −0.30
+0.14
13.2 −0.50
+0.20
10.1 −2.00
+1.00
2.94 −0.16
+0.11
3.99 −0.09
+0.16
1223
2.32 −0.09
+0.54
4.75 −0.45
+0.14
4.53 −0.13
+0.16
1.79 −0.23
+0.03
1.69 −0.11
+0.04
1173
0.66 −0.003
+0.028
1.83 −0.39
+0.18
2.03 −0.81
+0.82
5.70 −0.10
+1.12
0.49 −0.021
+0.029
Table 3 .
3Arrhenius parameters of volume diffusion (the pre-exponential factor, D0 (in 10 -4 m 2 /s) and the activation
enthalpy, Q (in kJ/mol), of Co, Cr, Fe, Mn and Ni diffusion in CoCrFeMnNi-C HEAs with different content of
carbon.
C = 0 at.%
Co
Cr
Fe
Mn
Ni
Q
312±24
321±26
304±18
212±37
273±19
D0
2.64 −0.40
+17.60
8.50 −0.32
+22.40
0.46 −0.28
+7.77
8.01 −0.08
+81.30
15.60 −0.13
+18.50
C = 0.2 at.%
Q
232±4
248±6
260±66
251±18
289±7
D0
0.01 −0.01
+0.02
0.02 −0.01
+0.06
0.01 −0.01
+0.01
0.02 −0.01
+0.90
5.53 −4.26
+7.17
C = 0.5 at.%
Q
219±7
253±3
261±5
268±14
286±17
D0
0.01 −0.01
+0.02
0.28 −0.18
+0.45
0.21 −0.07
+0.70
5.53 −4.26
+7.17
1.95 −0.16
+23.80
C = 0.8 at.%
Q
264±7
245±3
229±5
177±9
263±6
D0
0.35 −0.16
+0.77
0.16 −0.11
+0.24
0.01 −0.01
+0.02
0.01 −0.01
+0.01
0.24 −0.11
+0.49
Table 4 .
4Parameters D0 (in 10 -5 m 2 /s), Q (in kJ/mol) and W (in 10 3 K) (Eq. (4')) of substitutional element diffusion in
the C-alloyed CoCrFeMnNi HEAs.
Co
Cr
Fe
Mn
Ni
Q
261±12
250±13
237±11
245±17
300±20
D0
1.20 −0.37
+3.89
1.05 −0.30
+3.76
0.27 −0.09
+0.79
1.03 −0.20
+5.36
30.97 −4.72
+203.02
W
12.4±5.8
12.9±6.0
11.9±5.6
15.0±7.0
12.4±7.4
Acknowledgments. O.L. would like to thank Alexander-von-Humboldt Foundation for providing a research fellowship. Financial support from the German Science Foundation (DFG) via research project DI 1419/13-2 is acknowledged. Z. R. would like to thank the China Scholarship Council for providing a PhD scholarship. Z.L. would like to acknowledge the financial support by the National Natural Science Foundation of China (Grant No. 51971248).
Nanostructured High-Entropy Alloys with Multiple Principal Elements: Novel Alloy Design Concepts and Outcomes. J W Yeh, S K Chen, S J Lin, J Y Gan, T S Chin, T T Shun, C H Tsau, S Y Chang, 10.1002/adem.200300567Adv. Eng. Mater. 6J. W. Yeh, S. K. Chen, S. J. Lin, J. Y. Gan, T. S. Chin, T. T. Shun, C. H. Tsau, S. Y. Chang, Nanostructured High-Entropy Alloys with Multiple Principal Elements: Novel Alloy Design Concepts and Outcomes, Adv. Eng. Mater. 6 (2004) 299-303. doi: 10.1002/adem.200300567.
Recent progress in high-entropy alloys. J W Yeh, 10.3166/acsm.31.633-648Ann. Chim. -Sci. Mater. 31J. W. Yeh, Recent progress in high-entropy alloys, Ann. Chim. -Sci. Mater. 31 (2006) 633-648. doi:10.3166/acsm.31.633-648
Sluggish diffusion in Co-Cr-Fe-Mn-Ni high-entropy alloys. K Y Tsai, M H Tsai, J W Yeh, 10.1016/j.actamat.2013.04.058Acta Mater. 61K. Y. Tsai, M. H. Tsai, J. W. Yeh, Sluggish diffusion in Co-Cr-Fe-Mn-Ni high-entropy alloys, Acta Mater. 61 (2013) 4887-4897. doi:10.1016/j.actamat.2013.04.058.
Highentropy alloys-A new era of exploitation. J W Yeh, Y L S J Chen, S K Lin, Chen, 10.4028/www.scientific.net/MSF.560.1Mater. Sci. Forum. 560J. W. Yeh, Y. L. Chen. S. J. Lin, S. K. Chen, High- entropy alloys-A new era of exploitation, Mater. Sci. Forum 560 (2007) 1-9. doi: 10.4028/www.scientific.net/MSF.560.1.
Nano-twin Mediated Plasticity in Carbon-containing FeNiCoCrMn High Entropy Alloys. Z Wu, C M Parish, H Bei, 10.1016/j.jallcom.2015.05.224J. All. Com. 647Z. Wu, C.M. Parish, H. Bei, Nano-twin Mediated Plasticity in Carbon-containing FeNiCoCrMn High Entropy Alloys, J. All. Com. 647 (2015) 815-822. doi: 10.1016/j.jallcom.2015.05.224.
The effect of interstitial carbon on the mechanical properties and dislocation substructure evolution in Fe40.4Ni11.3Mn34.8Al7.5Cr6 high entropy alloys. Z Wang, I Baker, Z Cai, S Chen, J Poplawsky, W Guo, 10.1016/j.actamat.2016.08.072Acta Mater. 120Z. Wang, I. Baker, Z. Cai, S. Chen, J. Poplawsky, W. Guo, The effect of interstitial carbon on the mechanical properties and dislocation substructure evolution in Fe40.4Ni11.3Mn34.8Al7.5Cr6 high entropy alloys, Acta Mater. 120 (2016) 228-239. doi: 10.1016/j.actamat.2016.08.072.
The influences of temperature and microstructure on the tensile properties of a CoCrFeMnNi high-entropy alloy. F Otto, A Dlouhý, C Somsen, H Bei, G Eggeler, E P George, 10.1016/j.actamat.2013.06.018Acta Mater. 61F. Otto, A. Dlouhý, C. Somsen, H. Bei, G. Eggeler, E.P. George, The influences of temperature and microstructure on the tensile properties of a CoCrFeMnNi high-entropy alloy, Acta Mater. 61 (2013) 5743-5755. doi: 10.1016/j.actamat.2013.06.018.
A novel, single phase, non-equiatomic FeMnNiCoCr high-entropy alloy with exceptional phase stability and tensile ductility. M J Yao, K G Pradeep, C C Tasan, D Raabe, 10.1016/j.scriptamat.2013.09.030Scr. Mater. M.J. Yao, K.G. Pradeep, C.C. Tasan, D. Raabe, A novel, single phase, non-equiatomic FeMnNiCoCr high-entropy alloy with exceptional phase stability and tensile ductility, Scr. Mater. 72-73 (2014) 5-8. doi: 10.1016/j.scriptamat.2013.09.030.
. J Y He, H Wang, H L Huang, X D Xu, M W , J.Y. He, H. Wang, H.L. Huang, X.D. Xu, M.W.
A precipitation-hardened high-entropy alloy with outstanding tensile properties. Y Chen, X J Wu, T G Liu, K Nieh, Z P An, Lu, 10.1016/j.actamat.2015.08.076Acta Mater. 102Chen, Y. Wu, X.J. Liu, T.G. Nieh, K. An, Z.P. Lu, A precipitation-hardened high-entropy alloy with outstanding tensile properties, Acta Mater. 102 (2016) 187-196. doi: 10.1016/j.actamat.2015.08.076.
Interstitial equiatomic CoCrFeMnNi highentropy alloys: carbon content, microstructure, and compositional homogeneity effects on deformation behavior. Z Li, 10.1016/j.actamat.2018.10.050Acta. Mater. 164Z. Li, Interstitial equiatomic CoCrFeMnNi high- entropy alloys: carbon content, microstructure, and compositional homogeneity effects on deformation behavior, Acta. Mater. 164 (2019) 400-412. doi: 10.1016/j.actamat.2018.10.050.
The effects of carbon on the phase stability and mechanical properties of heat-treated FeNiMnCrAl high entropy alloys. Z Wu, B Li, P Gault, I Munroe, Baker, 10.1016/j.msea.2019.01.083Mater. Sci.Eng. A. 748Wu, Z. Li, B. Gault, P. Munroe, and I. Baker, The effects of carbon on the phase stability and mechanical properties of heat-treated FeNiMnCrAl high entropy alloys, Mater. Sci.Eng. A 748 (2019) 59-73. doi:10.1016/j.msea.2019.01.083.
Hydrogen embrittlement of an interstitial equimolar high-entropy alloy. H Luo, Z Li, W Lu, D Ponge, D Raabe, 10.1016/j.corsci.2018.03.040Corros. Sci. 136H. Luo, Z. Li, W. Lu, D. Ponge, and D. Raabe, Hydrogen embrittlement of an interstitial equimolar high-entropy alloy, Corros. Sci. 136 (2018) 403-408. doi: 10.1016/j.corsci.2018.03.040.
Interstitial atoms enable joint twinning and transformation induced plasticity in strong and ductile high-entropy alloys. Z Li, C C Tasan, H Springer, B Gault, D Raabe, 10.1038/srep40704Sci. Rep. 740704Z. Li, C.C. Tasan, H. Springer, B. Gault, D. Raabe, Interstitial atoms enable joint twinning and transformation induced plasticity in strong and ductile high-entropy alloys, Sci. Rep. 7 (2017) 40704. doi:10.1038/srep40704.
Ductile-brittle transition of carbonalloyed Fe40Mn40Co10Cr10 high entropy alloys. L B Chen, R Wei, K Tang, J Zhang, F Jiang, J Sun, 10.1016/j.matlet.2018.10.144Mat. Let. L.B. Chen, R. Wei, K. Tang, J. Zhang, F. Jiang, J. Sun, Ductile-brittle transition of carbonalloyed Fe40Mn40Co10Cr10 high entropy alloys, Mat. Let. (2018) 416-419. doi: 10.1016/j.matlet.2018.10.144.
Heavy carbon alloyed FCC-structured high entropy alloy with excellent combination of strength and ductility. L Chen, R Wei, K Tang, J Zhang, F Jiang, L He, J Sun, 10.1016/j.msea.2018.01.045Mater. Sci. Eng. A. 716L. Chen, R. Wei, K. Tang, J. Zhang, F.Jiang, L. He, J.Sun, Heavy carbon alloyed FCC-structured high entropy alloy with excellent combination of strength and ductility, Mater. Sci. Eng. A 716 (2018) 150-156. doi:10.1016/j.msea.2018.01.045.
Carbide precipitation strengthening in fine-grained carbon-doped FeCoCrNiMn high entropy alloy. I Baker, ; J Peng, Z Li, L Fu, X Ji, Z Pang, A Shan, 10.3390/met10050695doi: 10.1016/j.jallcom.2019.06.204Interstitials in f.c.c. High Entropy Alloys. 10MetalsI. Baker, Interstitials in f.c.c. High Entropy Alloys, Metals 10 (2020) 695. doi: 10.3390/met10050695. 17. J. Peng, Z. Li, L. Fu, X. Ji, Z. Pang, A. Shan, Carbide precipitation strengthening in fine-grained carbon-doped FeCoCrNiMn high entropy alloy, J. All. Com. 803 (2019) 491-498. doi: 10.1016/j.jallcom.2019.06.204.
Microstructural evolution and mechanical performance of carbon-containing CoCrFeMnNi-C high entropy alloys. J Y Ko, S I Hong, 10.1016/j.jallcom.2018.01.348J. All. Com. 743J.Y. Ko, S.I. Hong, Microstructural evolution and mechanical performance of carbon-containing CoCrFeMnNi-C high entropy alloys, J. All. Com. 743 (2018) 115-125. doi: 10.1016/j.jallcom.2018.01.348.
Microstructure and hardness characterization of mechanically alloyed Fe-C elemental powder mixture. H Zuhailawati, T C Geok, P Basu, 10.1016/j.matdes.2009.10.034Mater. Des. 31H. Zuhailawati, T.C. Geok, P. Basu, Microstructure and hardness characterization of mechanically alloyed Fe-C elemental powder mixture. Mater. Des. 31 (2010) 2211-2215. doi: 10.1016/j.matdes.2009.10.034.
Effects of recrystallization annealing temperature on carbide precipitation, microstructure, and mechanical properties in Fe-18Mn-0.6C-1.5Al TWIP steel. S Kang, Y S Jung, J H Jun, Y K Lee, 10.1016/j.msea.2009.08.048.21doi: 10.1016/j.matchar.2019.02.034Mater. Sci. Eng. A. C. R. LaRosa, M. Shih, C. Varvenne, M. Ghazisaeidi527Mat. Char.S. Kang, Y.S. Jung, J.H. Jun, Y.K. Lee, Effects of recrystallization annealing temperature on carbide precipitation, microstructure, and mechanical properties in Fe-18Mn-0.6C-1.5Al TWIP steel, Mater. Sci. Eng. A 527 (2010) 745-751. doi: 10.1016/j.msea.2009.08.048. 21. C. R. LaRosa, M. Shih, C. Varvenne, M. Ghazisaeidi, Solid solution strengthening theories of high-entropy alloys, Mat. Char. 151 (2019) 310-317. doi: 10.1016/j.matchar.2019.02.034.
Solid solution hardening in CrMnFeCoNibased high entropy alloy systems studied by a combinatorial approach. T Keil, D Utt, E Bruder, A Stukowski, K Albe, K Durst, 10.1557/s43578-021-00205-6J. Mat. Res. 36T. Keil, D. Utt, E. Bruder, A. Stukowski, K. Albe, K. Durst, Solid solution hardening in CrMnFeCoNi- based high entropy alloy systems studied by a combinatorial approach. J. Mat. Res. 36 (2021) 2558- 2570. doi: 10.1557/s43578-021-00205-6.
Solid-solution hardening of a high-Entropy AlTiVCrNbMo alloy. S A Firstov, T G Rogul, ' , N A Krapivka, S S Ponomarev, V N Tkach, V V Kovylyaev, V F Gorban, ' , M V Karpets, 10.1134/S0036029514040028Russ. Metall. S.A. Firstov, T.G. Rogul', N.A. Krapivka, S. S. Ponomarev, V. N. Tkach, V. V. Kovylyaev, V. F. Gorban' , M. V. Karpets, Solid-solution hardening of a high-Entropy AlTiVCrNbMo alloy. Russ. Metall. 2014, 285-292 (2014). doi: 10.1134/S0036029514040028.
Theory of strengthening in FCC high entropy alloys. C Varvenne, A Luque, W A Curtin, 10.1016/j.actamat.2016.07.040Acta Materialia. 118C. Varvenne, A. Luque, W.A. Curtin, Theory of strengthening in FCC high entropy alloys, Acta Materialia 118 (2016) 164-176. doi: 10.1016/j.actamat.2016.07.040.
Self-Diffusion of Iron In Austenite. H W Mead, C E Birchenall, 10.1007/BF03377878JOM. 8H.W. Mead, C.E. Birchenall, Self-Diffusion of Iron In Austenite. JOM 8, 1336-1339 (1956). doi: 10.1007/BF03377878.
Isothermal Annealing Effects in Irradiated Copper. A W Overhauser, 10.1103/PhysRev.90.393Phys. Rev. 90A. W. Overhauser, Isothermal Annealing Effects in Irradiated Copper, Phys. Rev. 90 (1953) 393-400. doi: 10.1103/PhysRev.90.393.
Impact of interstitial carbon on self-diffusion in CoCrFeMnNi high entropy alloys. O A Lukianova, Z Rao, V Kulitckii, Z Li, G Wilde, S V Divinski, 10.1016/j.scriptamat.2020.07.044Scripta Mater. 188O.A. Lukianova, Z. Rao, V. Kulitckii, Z. Li, G. Wilde, S.V. Divinski, Impact of interstitial carbon on self-diffusion in CoCrFeMnNi high entropy alloys, Scripta Mater. 188:264-268. doi: 10.1016/j.scriptamat.2020.07.044.
Tracer diffusion in single crystalline CoCrFeNi and CoCrFeMnNi high entropy alloys. D Gaertner, J Kottke, G Wilde, S V Divinski, Y Chumlyakov, 10.1016/j.scriptamat.2020.07.044J. Mat. Res. 33D. Gaertner, J. Kottke, G. Wilde, S.V. Divinski, Y. Chumlyakov, Tracer diffusion in single crystalline CoCrFeNi and CoCrFeMnNi high entropy alloys, J. Mat. Res. 33 (2018) 3184-3191. doi: 10.1016/j.scriptamat.2020.07.044.
Ni tracer diffusion in CoCrFeNi and CoCrFeMnNi high entropy alloys. M Vaidya, S Trubel, B S Murty, G Wilde, S V Divinski, 10.1016/j.jallcom.2016.07.239J. All. Com. M. Vaidya, S. Trubel, B.S. Murty, G. Wilde, S.V. Divinski, Ni tracer diffusion in CoCrFeNi and CoCrFeMnNi high entropy alloys, J. All. Com. (2016) 688 994-1001. doi: 10.1016/j.jallcom.2016.07.239.
Bulk tracer diffusion in CoCrFeNi and CoCrFeMnNi high entropy alloys. M Vaidya, K G Pradeep, B S Murty, G Wilde, S V Divinski, 10.1016/j.actamat.2017.12.052Acta. Mater. 146M. Vaidya, K.G. Pradeep, B.S. Murty, G. Wilde, S.V. Divinski, Bulk tracer diffusion in CoCrFeNi and CoCrFeMnNi high entropy alloys, Acta. Mater. 146 (2018) 211-224. doi: 10.1016/j.actamat.2017.12.052.
Tracer diffusion in single crystalline CoCrFeNi and CoCrFeMnNi high-entropy alloys: Kinetic hints towards a low-temperature phase instability of the solid-solution?. D Gaertner, J Kottke, Y Chumlyakov, F Hergemöller, G Wilde, S V Divinski, 10.1016/j.scriptamat.2020.05.060Scripta Materialia. 187D. Gaertner, J. Kottke, Y. Chumlyakov, F. Hergemöller, G. Wilde, S.V. Divinski, Tracer diffusion in single crystalline CoCrFeNi and CoCrFeMnNi high-entropy alloys: Kinetic hints towards a low-temperature phase instability of the solid-solution? Scripta Materialia 187 (2020) 57-62. doi: 10.1016/j.scriptamat.2020.05.060.
D Gaertner, L Belkacemi, V A Esin, F Jomard, A A Fedotov, J Schell, Y V Osinskaya, A V Pokoev, C Duhamel, A Paul, S V Divinski, 10.4028/www.scientific.net/df.29.31Techniques of Tracer Diffusion Measurements in Metals, Alloys and Compounds. 29D. Gaertner, L. Belkacemi, V. A. Esin, F. Jomard, A. A. Fedotov, J. Schell, Y. V. Osinskaya, A. V. Pokoev, C. Duhamel, A. Paul, S. V. Divinski, Techniques of Tracer Diffusion Measurements in Metals, Alloys and Compounds, Diffusion Foundations 29 (2021) 31-73. doi: 10.4028/www.scientific.net/df.29.31.
. Z Wang, I Baker, Z Cai, S Chen, J , Z. Wang, I. Baker, Z. Cai, S. Chen, J. D.
The effect of interstitial carbon on the mechanical properties and dislocation substructure evolution in Fe40.4Ni11.3Mn34.8Al7.5Cr6 high entropy alloys. W Poplawsky, Guo, 10.1016/j.actamat.2016.08.072Acta Mater. 120Poplawsky, W. Guo, The effect of interstitial carbon on the mechanical properties and dislocation substructure evolution in Fe40.4Ni11.3Mn34.8Al7.5Cr6 high entropy alloys, Acta Mater. 120 (2016) 228-239. doi: 10.1016/j.actamat.2016.08.072.
Effect of carbon on recrystallised microstructures and properties of CoCrFeMnNi-type high-entropy alloys. M Klimova, D Shaysultanov, A Semenyuk, S Zherebtsov, N Stepanov, 10.1016/j.jallcom.2020.156839J. All. Com. 851156839M. Klimova, D. Shaysultanov, A. Semenyuk, S. Zherebtsov, N. Stepanov, Effect of carbon on recrystallised microstructures and properties of CoCrFeMnNi-type high-entropy alloys, J. All. Com. 851 (2021) 156839. doi: 10.1016/j.jallcom.2020.156839
On the effective lattice parameter of binary alloys. V A Lubarda, 10.1016/S0167-6636(02)00196-5Mech. Mater. 35V.A. Lubarda, On the effective lattice parameter of binary alloys, Mech. Mater. 35 (2003) 53-68. doi: 10.1016/S0167-6636(02)00196-5.
A model for the prediction of lattice parameters of solid solutions. H A Moreen, R Tagaart, D H Polonis, 10.1007/BF02662668Metall. Trans. 2H.A. Moreen, R. Tagaart, D.H. Polonis, A model for the prediction of lattice parameters of solid solutions, Metall. Trans. 2 (1971) 265-268. doi: 10.1007/BF02662668.
Understanding the physical metallurgy of the CoCrFeMnNi high-entropy alloy: an atomistic simulation study. I Toda-Caraballo, P E Rivera-Diaz-Del-Castillo, 10.1016/j.actamat.2014.11.014.3810.1038/s41524-017-0060-9Computational Materials. Won-Mi Choi, Yong Hee Jo, Seok Su Sohn, Sunghak Lee & Byeong-Joo Lee85Acta Mater.I. Toda-Caraballo, P.E. Rivera-Diaz-del-Castillo, Modelling solid solution hardening in high entropy alloys, Acta Mater. 85 (2015) 14-23. doi: 10.1016/j.actamat.2014.11.014. 38. Won-Mi Choi, Yong Hee Jo, Seok Su Sohn, Sunghak Lee & Byeong-Joo Lee, Understanding the physical metallurgy of the CoCrFeMnNi high-entropy alloy: an atomistic simulation study, npj Computational Materials 4 (2018) 1. 10.1038/s41524-017-0060-9.
Microstructure and texture evolution during annealing of equiatomic CoCrFeMnNi high-entropy alloy. P P Bhattacharjee, G D Sathiaraj, M Zaid, J R Gatti, Chi Lee, Che-Wei Tsai, Jien-Wei Yeh, doi.org/10.1016/j.jallcom.2013.10.237Journal of Alloys and Compounds. 587P.P. Bhattacharjee, G.D. Sathiaraj, M. Zaid, J.R. Gatti, Chi Lee, Che-Wei Tsai, Jien-Wei Yeh, Microstructure and texture evolution during annealing of equiatomic CoCrFeMnNi high-entropy alloy, Journal of Alloys and Compounds 587 (2014) 544-552. doi.org/10.1016/j.jallcom.2013.10.237.
Effect of V content on microstructure and mechanical properties of the CoCrFeMnNiVx high entropy alloys. N D Stepanov, D G Shaysultanov, G A Salishchev, M A Tikhonovsky, E E Oleynik, A S Tortika, O N A Senkov ; G, M A Salishchev, D G Tikhonovsky, N D Shaysultanov, A V Stepanov, I V Kuznetsov, 170-185.10.1016/j.jallcom.2014.12.157.41Journal of Alloys and Compounds. 628N.D.Stepanov,D.G. Shaysultanov, G.A. Salishchev, M.A. Tikhonovsky, E.E. Oleynik, A.S. Tortika, O.N. Senkov, Effect of V content on microstructure and mechanical properties of the CoCrFeMnNiVx high entropy alloys, Journal of Alloys and Compounds 628 (2015) 170-185. 10.1016/j.jallcom.2014.12.157. 41. G.A. Salishchev, M.A. Tikhonovsky, D.G. Shaysultanov, N.D. Stepanov, A.V. Kuznetsov, I.V.
Effect of Mn and V on structure and mechanical properties of highentropy alloys based on CoCrFeNi system. A S Kolodiy, O N Tortika, Senkov, doi.org/10.1016/j.jallcom.2013.12.210Journal of Alloys and Compounds. 591Kolodiy, A.S. Tortika, O.N. Senkov, Effect of Mn and V on structure and mechanical properties of high- entropy alloys based on CoCrFeNi system ,Journal of Alloys and Compounds 591 (2014) 11-21. doi.org/10.1016/j.jallcom.2013.12.210
Tensile properties of the Cr-Fe-Ni-Mn non-equiatomicmulticomponent alloys with different Cr contents. M V Klimova, A O Semenyuk, D G Shaysultanov, G A Salishchev, S V Zherebtsov, N D D Stepanov ; N, D G Stepanov, M A Shaysultanov, G A Tikhonovsky, Salishchev, 10.1016/j.jallcom.2019.152000.43doi.org/10.1002/pssb.19700410221. 45Journal of Alloys and Compounds. 811Journal of Alloys and CompoundsM.V. Klimova, A.O. Semenyuk, D.G. Shaysultanov, G.A. Salishchev, S.V. Zherebtsov, N.D. Stepanov, Effect of carbon on cryogenic tensile behavior of CoCrFeMnNi-type high entropy alloys, Journal of Alloys and Compounds 811 (2019) 152000. 10.1016/j.jallcom.2019.152000. 43. N.D. Stepanov, D.G. Shaysultanov, M.A. Tikhonovsky, G.A. Salishchev, Tensile properties of the Cr-Fe-Ni-Mn non-equiatomicmulticomponent alloys with different Cr contents, Materials and Design 87 (2015) 60-65. 10.1016/j.matdes.2015.08.007. 44. R. Labusch, A statistical theory of solid solution hardening, Physica Status Solidi (B) 41 (1970) 659 - 669. doi.org/10.1002/pssb.19700410221. 45. N.N. Rammo, O.G. Abdulah, A model for the prediction of lattice parameters of iron-carbon austenite and martensite, Journal of Alloys and Compounds 420 (2006) 117-120. doi.org/10.1016/j.jallcom.2005.10.075.
Breakdown of the Arrhenius Law in Describing Vacancy Formation Energies: The Importance of Local Anharmonicity Revealed by Ab initio Thermodynamics. A Glensk, B Grabowski, T Hickel, J Neugebauer, Physical Review X. 411018A. Glensk, B. Grabowski, T. Hickel, J. Neugebauer, Breakdown of the Arrhenius Law in Describing Vacancy Formation Energies: The Importance of Local Anharmonicity Revealed by Ab initio Thermodynamics, Physical Review X 4 (2014) 011018.
Temperature dependence of the Gibbs energy of vacancy formation of fcc Ni. Y Gong, B Grabowski, A Glensk, F Körmann, J Neugebauer, R C Reed, Physical Review B 97. 214106Y. Gong, B. Grabowski, A. Glensk, F. Körmann, J. Neugebauer, R.C. Reed, Temperature dependence of the Gibbs energy of vacancy formation of fcc Ni, Physical Review B 97 (2018) 214106
Effect of carbon on self-diffusion of iron. P L Gruzin, Y V Kornev, G U Kurdjumov, Doklady Akademii Nauk SSSR. 80P. L. Gruzin, Y. V. Kornev, and G. U. Kurdjumov, Effect of carbon on self-diffusion of iron, Doklady Akademii Nauk SSSR, 80 (1951), 49-51.
Iron self Diffusion in liquid pure iron and iron-carbon alloys. A Meyer, F Hennig, T Kargl, Unruh, doi.org/10.1088/1361-648X/ab2855Journal of Physics -Condensed Matter. 31395401A Meyer, L Hennig, F Kargl and T Unruh, Iron self Diffusion in liquid pure iron and iron-carbon alloys, Journal of Physics -Condensed Matter 31, (2019) 395401. doi.org/10.1088/1361-648X/ab2855.
| 1,999,917 | Ultrafine-grained (UFG) materials with grain sizes in the submicrometer or nanometer range may be prepared through the application of severe plastic deformation (SPD) to bulk coarse-grained solids. These materials generally exhibit high strength but only very limited ductility in low-temperature testing, thereby giving rise to the so-called paradox of strength and ductility. This paradox is examined and a new quantitative diagram is presented which permits the easy insertion of experimental data. It is shown that relatively simple procedures are available for achieving both high strength and high ductility in UFG materials including processing the material to a very high strain and/or applying a very short-term anneal immediately after the SPD processing. Significant evidence is now available demonstrating the occurrence of grain boundary sliding in these materials at low temperatures, where this is attributed to the presence of non-equilibrium grain boundaries and the occurrence of enhanced diffusion along these boundaries. | Tensile testing of ultra fine grained metals | Multimodal ultrafine grain size distributions from severe plastic deformation at high strain rates | Ductile ultrafine-grained Ti-based alloys with high yield strength | The occurrence of superplasticity may be traced to the classic work of Pearson conducted in the U.K. in 1934 when an elongation of 1950% was reported in a Pb-Sn eutectic alloy. Subsequently, much attention in Russia was devoted to this scientific curiosity and this led to the first book on superplasticity written by Prof. A.A. Presnyakov and published in 1964. Later, in 1985, Oscar Kaibyshev established in Ufa the Institute of Problems of Superplasticity of Metals of the Russian Academy of Sciences and this was, and remains to this day, the only institute in the world devoted exclusively to studies of the phenomenon of superplastic flow and the development through superplastic forming of complex-shaped parts. An important development occurred in 1988 with the publication of a classic report by Kaibyshev and co-workers describing the potential for achieving low temperature superplasticity in a metallic Al-Cu-Zr alloy that had been specially processed by severe plastic deformation (SPD) to produce a remarkably small grain size of only 300 nm. This report formed the basis for the later development of SPD processing as a major tool for the production of exceptional grain refinement and as a procedure for achieving large superplastic elongations that cannot be achieved using more conventional processing. This report describes this early work, the subsequent developments and the modern status of superplastic flow in ultrafine-grained metals. | Superplasticity of materials as effect of self-organizing of grain-boundary processes | Abstract We employ semi-grand canonical Monte Carlo simulation to investigate layering transitions at grain boundaries in a prototypical binary alloy. We demonstrate the existence of such transitions among various interfacial states and examine the role of elastic fields in dictating state equilibria. The results of these studies are summarized in the form of diagrams that highlight interfacial state coexistence in this system. Finally, we examine the impact of layering transitions on the phononic properties of the system, as given by the specific heat and, by extension, the thermal conductivity. Thus, it is suggested that by inducing interfacial layering transitions via changes in temperature or pressure, one can thereby engineer thermodynamic and transport properties in materials. | Abstract The influence of Mo alloying on the thermal stability of grain size, dislocation density and hardness of ultrafine-grained (UFG) Ni alloys was studied. The UFG microstructure in alloys with low (∼0.3 at.%) and high (∼5 at.%) Mo contents was achieved by high-pressure torsion (HPT) performed for 20 turns at room temperature. The thermal stability of the two alloys was studied by calorimetry. A Curie-transition from ferromagnetic to paramagnetic state was not found for the Ni–5% Mo alloy due to the high Mo content. It was found that heating at a rate of 40 K/min up to ∼850 K resulted in a complete recovery and recrystallization of the UFG microstructure in the alloy with 0.3% Mo. The same annealing for Ni–5% Mo led only to a moderate reduction of the dislocation density and the grain size remained in the UFG regime. Therefore, the higher Mo content yielded a much better thermal stability of the Ni alloy. The influence of the change of the microstructure during annealing on the hardness is discussed. | Plastic deformation and alloying of nanocrystalline Ni-Fe is studied by means of atomic scale computer simulations. By using a combination of Monte-Carlo and molecular dynamics methods we find that solutes have an ordering tendency even if grain sizes are in the nanometer regime, where the phase field of the ordered state is widened as compared to larger grain sizes. Tensile testing of disordered structures with various elemental distributions and the simultaneous analysis of intragranular defects reveal that solid solution strengthening is absent for the studied grain sizes. The composition and relaxation state of the grain boundary control the strength of the material, which is also found for ordered structures (L1 2 ), where dislocation activity is suppressed.542 |
1,999,918 | how many workstations did the wang 2200 have | variety of makes of both desktops and notebooks, including Studio and XPS systems in late 2008. Dell and Dick Smith Electronics (owned by Woolworths Limited) reached an agreement to expand within Dick Smith's 400 stores throughout Australia and New Zealand in May 2009 (1 year since Officeworks — owned by Coles Group — reached a deal). The retailer has agreed to distribute a variety of Inspiron and Studio notebooks, with minimal Studio desktops from the Dell range. , Dell continues to run and operate its various kiosks in 18 shopping centres throughout Australia. On March 31, 2010, Dell announced to | Wang's family of Xincheng was an ol d and well known bureaucratic family rose from populace.In the middle period of the Ming dynasty,it became famous through the imperial examinations,and maintai ned its position for 200 years by good family education,strengthening of the pat riarchal clan,and marriages with other illustrious families.The problems showed in its rise and decline are fairly representative. | The Yuan Wang-class () are used for tracking and support of satellite and intercontinental ballistic missiles by the People's Liberation Army Strategic Support Force of the People's Republic of China (PRC). It is important to note that Yuanwang class is not a single class of identical design, but instead, a group of different designs grouped under the same series that share the one name.
The detailed specifications for every ship are not released by the PLASSF. Yuanwang 1 and Yuanwang 2 are thought to have a displacement tonnage of around 21,000 tons when fully loaded, with a crew of about 470 and a length of about . Their propulsion is from one Sulzer Ltd. diesel engine, with a top speed of 20 knots (37 km/h).
The class was first proposed by Premier Zhou Enlai in 1965, and the idea was personally approved by Mao Zedong in 1968. The first two ships of the class, Yuanwang 1 and Yuanwang 2, were built at the Jiangnan Shipyard in Shanghai and put to sea on 31 August 1977 and 1 September 1978 respectively. The general designer of this class is . For the first time, this gave the PRC the ability to track launches and satellites that were not over their territory.
The first survey mission of the two ships was during May 1980. After being used for tracking of the launches of indigenously developed communications satellites, Yuanwang 1 and Yuanwang 2 underwent overhauls in 1986, so they could be used for supporting international satellite launches by the PRC.
Two further ships of the class have been built. The first was Yuanwang 3, which was commissioned on 20 October 1995. The Yuanwang 4 tracking ship was constructed by China State Shipbuilding Corporation and delivered to the China Satellite Launch and Tracking Control General on 18 July 1999. It had been converted from the previously used Xiang Yang Hong 10 scientific survey ship.
Another two Yuanwang-class vessels were launched in Shanghai in early 2007.
Pictures of Yuanwang 6 were published, and both Yuanwang 5 and the newly commissioned ship were on duty for the Shenzhou 7 mission.
During the Shenzhou spacecraft flights, the four ships were positioned as follows:
Yuanwang 1 in the Yellow Sea
Yuanwang 2 about 1500 km (about 900 statute miles) southwest of French Polynesia
Yuanwang 3 off the Namibian coast
Yuanwang 4 off the coast of Western Australia in the Indian Ocean
Fleet list
Yuan Wang 1 - 1977
Yuan Wang 2 - 1978
Yuan Wang 3 - 1995
Yuan Wang 4 - 1999
Yuan Wang 5 - 2007
Yuan Wang 6 - 2007
Yuan Wang 7 - 2016
Yuan Wang 21 - Long March 5 transport ship
Yuan Wang 22 - Long March 5 transport ship
Type 718
Type 718 tracking ship is the very first design of Yuanwang series, and it consists of two ships, Yuan Wang 1 and Yuan Wang 2, both of which have since retired in the early 2010s. Type 718 can attain speeds of 20 kn.
Yuan Wang 3
Yuan Wang 3 is the second generation tracking ship of Yuan Wang series, and it can attain speeds up to 20 kt, with a range of 18,000 nautical miles and a cruising speed of 18 kt.
Yuan Wang 4
Yuan Wang 4 was converted from Type 643 research vessel Xiangyanghong 10 (向阳红10), which was originally designed in February 1971, with construction begun in July 1975, and entered service in October 1979. Conversion was completed in August 1998, and the ship is capable of carrying a Changhe Z-8. Conversion work included more than four hundred projects in four major categories. Powered by 9000 hp diesel engines, Yuan Wang 4 has an endurance of 100 days and could reach a speed of up to 20 kn, with a range of 18,000 nautical miles cruising at 18 kn.
While in Jiangyin port at 5:10 AM on 5 August 2007, Yuan Wang 4 was hit by a coal carrier Harbor Sea 666 (Gang Hai 666, 港海 666), which caused a massive fire started at the point of collision at 4th fuel tank. The fire was put out after four hours without any casualties, but the equipment on board was severely damaged beyond repair. As a result, Yuan Wang 4 was subsequently converted to a target ship for DF-21 ballistic antiship missile to simulate an aircraft carrier target as it entered Jiangyin Shipyard on 15 April 2010 for repair, and eventually destroyed in the latter half of 2010.
Yuan Wang 5
Yuan Wang 5 is the third generation tracking ship of Yuan Wang series, and entered service on 29 September 2007. Built by Jiangnan Shipyard, Yuan Wang 5 has a displacement of 25,000 tones and withstand wind scale up to 12, and perform duties in sea state 6. The general designer of both Yuan Wang 5 & 6 is Mr. Huang Wei (黄蔚), the general engineer of the 701st Institute of China Shipbuilding Industry Corporation (CSIC).
Yuan Wang 6
Yuan Wang 6, like its sister ship Yuan Wang 5, is also a third generation tracking ship of Yuan Wang series. Designed by the 708th Research Institute, construction begun in April 2006, and the ship was launched on March 16, 2007. The ship entered service on April 12, 2008, and become fully operational in July 2008. Yuan Wang 6 utilizes fiber optic for its information system on board, and the electricity generated by the ship is enough to supply a city of 300,000. Specification:
Length (m): 222.2
Width (m): 25.2
Displacement (t): 24,966
Accommodation: 400
Yuan Wang 7
Yuan Wang 7 was constructed by Jiangnan Shipbuilding, and is said to be able to operate for 100 days at sea. The China Satellite Maritime Tracking and Control Department has said the vessel will be used for maritime tracking of the Shenzhou 11 manned space mission, and the Tiangong 2 space laboratory, using three large dish antennae some 10–12 meters in diameter. It was commissioned on 19 July 2016.
Length (m): 220
Width (m): tbc
Height (m): 40m
Displacement (t): 25,000
Yuan Wang 21
The Yuan Wang 21 is a cargo ship designed by the 708th Research Institute specially to transport rockets such as the Long March 5; construction began on 1 April 2012, and it was launched on 29 November 2012. Yuan Wang 21 entered service on 6 May 2013. Specification:
Length (m): 130
Width (m): 19
Draft (m): 5.8
Displacement (t): 9080
Yuan Wang 22
Yuan Wang 22 is also a cargo ship designed specially to transport rockets such as Long March 5, and it is also built by Jiangnan Shipyard, the same builder of earlier Yuan Wang 21. Yuan Wang 22 might be a sister ship of Yuan Wang 21, but this cannot be confirmed yet, because detailed information / specification of Yuan Wang 22 has not been released by official Chinese governmental sources yet (as of 2014). Yuan Wang 22 was launched on 24 January 2013.
See also
A list of similar ships:
French Navy
, 1990–present
Indian Navy
INS Dhruv, 2020–present
Soviet Navy / Russian Navy
Kosmonavt Vladimir Komarov, 1967–1989
Akademik Sergei Korolev, 1970–1996
Kosmonavt Yuri Gagarin, 1971–1991
United States Navy
USNS Range Tracker (T-AGM-1) 1961-1969
USNS Range Recoverer (T-AGM-2) 1960-1972
USNS Longview (T-AGM-3) 1960-?
USNS Richfield (T-AGM-4) 1960-1968
USNS Sunnyvale (T-AGM-5) 1960-1974
USNS Watertown (T-AGM-6) 1960-1971
USNS Huntsville (T-AGM-7) 1960-1974
USNS Wheeling (T-AGM-8) 1962-1990
USNS General H. H. Arnold (T-AGM-9)
USNS General Hoyt S. Vandenberg (T-AGM-10) 1964-1999
USNS Twin Falls (T-AGM-11) 1960-1969
USNS American Mariner (T-AGM-12) 1959-1964
USNS Sword Knot (T-AGM-13) 1964-1972?
USNS Rose Knot (T-AGM-14) 1964-1969
USNS Coastal Sentry (T-AGM-15)
USNS Coastal Crusader (T-AGM-16) 1964-1977
USNS Timber Hitch (T-AGM-17) 1967-1979
USNS Sampan Hitch (T-AGM-18) 1964-1973
USNS Vanguard (T-AGM-19)
USNS Redstone (T-AGM-20) 1964-1993
USNS Mercury (T‑AGM‑21) 1964-1974?
USNS Range Sentinel (T-AGM-22)
USNS Observation Island (T-AGM-23) 1977–present
USNS Invincible (T-AGM-24) 2000–present
References
External links
Global Security
SinoDefence.com
Auxiliary ships of the People's Republic of China
Maritime vessels related to spaceflight | a valuable technological breakthrough, and expressed regret that the Mongol experiment with printing paper money had failed in the Muslim world. Rashid-al-Din's view was not shared by other chroniclers in the Middle East, who were critical of the experiment's disruptive impact on the Il-khanate. Science and technology of the Yuan dynasty During the Mongol-ruled Yuan dynasty (1271–1368), many scientific and technological advancements were made in areas such as mathematics, medicine, printing technology, and gunpowder warfare. Advances in polynomial algebra were made by mathematicians during the Yuan era. The mathematician Zhu Shijie (1249–1314) solved simultaneous equations with up to four unknowns | calculated the number of possible positions on a go board game (though without a symbol for zero he had difficulties expressing the number). He, along with his associate Liang Lingzan (a government official), is best known for applying the earliest-known escapement mechanism to a water-powered celestial globe. However, Yi Xing's mechanical genius and achievements were built upon the knowledge and efforts of previous Chinese mechanical engineers, such as the statesman and master of gear systems Zhang Heng (78–139) of the Han Dynasty, the equally brilliant engineer Ma Jun (200–265) of the Three Kingdoms, and the Daoist Li Lan (c. 450) | Fei-Ping Hsu (Chinese: 许斐平; December 20, 1949November 27, 2001) was a Chinese-American pianist.
Hsu was born on the island of Gulangyu in southeast China. As the youngest son of a Christian pastor, he grew up singing hymns while his mother played on an upright piano. By the time he was twelve, he played the complete Chopin Etudes and had performed with the Shanghai Philharmonic. Hsu was invited to perform for Queen Elisabeth of Belgium, and she invited him to study and perform in Europe under her sponsorship. He was not allowed to accept because of the advent of the Cultural Revolution during the 1960s. He survived the labor camps and became known in China and toured throughout the Far East as a soloist with the Central Philharmonic.
He was a Gold Medal winner at the Arthur Rubinstein International Piano Competition. He also garnered top prizes in other competitions. Hsu made his New York recital debut at Alice Tully Hall in 1983 and performed throughout the United States, including appearances at Carnegie Hall, Lincoln Center, and the Kennedy Center in Washington, D.C. He also frequently toured Europe, South America, and the Far East.
In 1979, Hsu attended the Juilliard School of Music under the tutelage of Sascha Gorodnitzki. He has appeared as a soloist with major orchestras, including the Montreal Symphony Orchestra, the Moscow Philharmonic, and the Finnish Tempere Symphony Orchestraope. Hsu also played with the China National Symphony Orchestra in Beijing, the Shanghai Symphony Orchestra, the Shanghai Radio Symphony Orchestra and the Kyushu Symphony Orchestra in Japan. Since the early 1970s, Hsu had recorded for labels such as the Columbia Records, the RCA Victor Records, the Hugo Records, the ROI Productions, and the MA Recordings in Japan.
He died in a car accident on a highway from Harbin to Qiqihar while on a concert tour in China on November 27, 2001, aged 51. He is survived by his wife and daughter.
References
Chinese classical pianists
2001 deaths
People from Xiamen
Musicians from Fujian
1952 births
20th-century classical pianists | PowerBook 180 The PowerBook 180 is a portable computer released by Apple Computer, Inc. along with the PowerBook 160 in October 1992. At the time, it constituted the new top-of-the-range model replacing the previous PowerBook 170. Its case design and features are the same as that of the 170, but it shipped with the more powerful 33 MHz Motorola 68030 CPU and Motorola 68882 FPU. Along with the 160, it introduced a new power saving feature which allowed the processor to run at a slower 16 MHz rate, the same speed as the original 140. The PowerBook 180 came with | PowerBook 180 The PowerBook 180 is a portable computer released by Apple Computer, Inc. along with the PowerBook 160 in October 1992. At the time, it constituted the new top-of-the-range model replacing the previous PowerBook 170. Its case design and features are the same as that of the 170, but it shipped with the more powerful 33 MHz Motorola 68030 CPU and Motorola 68882 FPU. Along with the 160, it introduced a new power saving feature which allowed the processor to run at a slower 16 MHz rate, the same speed as the original 140. The PowerBook 180 came with | 1,999,918 | Wang 2200 The Wang 2200 appeared in May 1973, and was Wang Laboratories' first minicomputer that could perform data processing in a common computer language. Unlike some other desktop computers, such as the HP 9830, it had a cathode ray tube (CRT) in a cabinet that also included an integrated computer-controlled cassette tape storage unit and keyboard. Microcoded to run interpretive BASIC, about 65,000 systems were shipped in its lifetime and it found wide use in small and medium-size businesses worldwide. The 2200 evolved into a desktop computer and larger system to support up to 16 workstations and utilized commercial | what was the name of the wang minicomputer | what was the basic version of ibm 1130 | what was the name of the first microcomputer to be developed | what was the first computer made out of | how many early home computers were sold individually | who made the max 80 personal computer | who made the decstation workstation computers in europe | when was the first supercomputer invented at manchester university |
1,999,919 | I want to grow poison potatoes | During the quarantine I'm gardening. I don't want to go searching for seed potatoes if'n I don't have to, especially right now. Could I just plant the eyeing potatoes that I already have? (I've already planted some, in pots.) I have russets and reds and was going to try for a high-yield potato crop because, why not. Thank you. | How do people make poison? | Effects of seed maturity, size and spacing on the yield of potatoes in Ontario | In a series of potato variety trials small but significant differences among varieties have been observed. Although all varieties tested were subject to wireworm attack, some varieties appeared to be more susceptible than others. | Majestic potatoes planted in soil naturally infested withStreptomyces scabies were trickle irrigated to prevent infection of the tubers except during consecutive 7-day periods in the first eight weeks when tubers were developing (28 May to 23 July). | EFFECTS OF ORGANICAL AND CONVENTIONAL GROWING ON THE CONTENT OF BIOLOGICALLY ACTIVE COMPOUNDS OF POTATOES | Is it’s true that if you buy Potatoes from the grocery and cut them , put in soil, and water regularly you can grow more potatoes?
Do this work and if it does, what about sweet potatoes? | Are potatoes bad for your health? | 1,999,919 | Every time I play 2b I plant and grow potatoes. I put lights and give water. I bonemeal it and I got an automatic farm and a big underground farm but in 20 stack of harvested potatoes I got only 7-15 max poision potato. Any advise to get poision potato fast? All time, every time I realize I'm just growing potatoes. I realized I have enough potatoes to feed my 7 man crew, they gave up on growing food because they were happy to see me growing so much potatoes and bake em. Drachenstein even gives me gold ingots for such a good deed. Pyro and Sage Mathias VC and clap in appreciation but slowly I'm obsessed with potato growing in metric tonnes. I made a farm from y67-y256 recently with stone brick and glass and soil and a central water block for irrigation but I don't get poision potato, can't dupe poison potato. Please help, I want to build stuff, not grow potatoes like an autist.
Edit 1: Sage_Mathias : hey sniper what you doing? Me: growing potatoes
3 hours later, Sage_Mathias : hey man what you doing? I reached xx and did xx; Me : growing potatoes
Krobar01: I'm made like 350 TNT bombers, what you been up to;Me: farming potatoes
chuck: fuck you autist, you're irrelevant, what do you even do here?Me: I grow potatoes, I harvest potatoes
Pyro1v1aniac : hey snipe nice spiral farm, quite big, what you gonna do in it? Me: make automatic potato farm
Tenderhart: hey man u heard drach ran away from home and got married? Me: I'll grow potatoes for his family
Jumpyblazeftw: hey mahn subscribe to me, I kill people at spawn and grief shit. Cool videos. Me : I just render potato farms while they grow up
Edit 2 : are you a newjew? Are you a hungry PvP spawn fag? Are you sad and lonely? Are you gay? Are you an artificial girl? Did ya get your waifu on 4chan? Fear not for Sniper has decided to donate my specially cooked potatoes to tanaxis for distributing. Shulker will be in dark green and will have named potatoes and a sweet friend story book and deluxe good food to bring a smile on your face. If none then Sniper will feed you lonely friend! Edit: thank you for the gold. | Uberelder farming. need help | Seriously, how do I farm with someone taking all of it? | [Question] Uber Atziri farming in 2.0 | Farming TOO slow with tinker | Been playing for 5+ years, first time kem farming or any xp farming | DQ2 Farm Help - Newbie Questions | what is succession in mmuock leteh | GI Character Farming Table |
1,999,920 | [R/F] Some sansha/blood raider krab hunting fits I want y'all's takes on | Looking for sub of guys fucking random objects. Like r/notadildo but guys.. | I was browsing /r/Survival when I wondered if there was a sub that was dedicated specifically for traps and snares. First thing I try is (nsfw)/r/Traps and I immediately regretted it. I should have known better.
Edit: indicating /r/Traps as nsfw | Its called r/AteenagersA. Its basically just gonna be r/teenagers but good. | That's it, a sub for the sub adorable porn, but with diverse compilations. | Yet another subreddit created, /r/TitsWorshipingCowGirl.
Check it out.
More to come. | Hi,
I was wondering if there are weapon specific subreddits or something of the like. | For those who have no idea:
Not Always Right]( // [Not Always Working
Just looking for a subreddit with posts similar to the ones on those sites. I've already read every single story on those, and go to check for the 2-4 more that end up on there every day, but I'd like more to read. | /r/tallgirls isn't very active, but it seems like the sort of thing there must be more subs for. | 1,999,920 | Hey guys, I plan on hunting sansha and blooder raider krabs in the south both solo and with a partner/multiboxing. I was theorycrafting and generally liked minmatar and caldari frigs/dessies because selectable damage to punch into the explosive resist hole and in the case of minny, easy tanking of EM damage. Here are my fits:
[Wolf, Krab Hunter]
Assault Damage Control II
Small Ancillary Armor Repairer, Nanite Repair Paste
Gyrostabilizer II
Gyrostabilizer II
Nanofiber Internal Structure II
5MN Y-T8 Compact Microwarpdrive
Warp Scrambler II
125mm Gatling AutoCannon II, Republic Fleet Fusion S
125mm Gatling AutoCannon II, Republic Fleet Fusion S
125mm Gatling AutoCannon II, Republic Fleet Fusion S
125mm Gatling AutoCannon II, Republic Fleet Fusion S
[Empty High slot]
Small Hyperspatial Velocity Optimizer II
Small Hyperspatial Velocity Optimizer II
-
[Svipul, Krab Hunter]
Damage Control II
Gyrostabilizer II
Gyrostabilizer II
Micro Auxiliary Power Core I
5MN Y-T8 Compact Microwarpdrive
Republic Fleet Medium Shield Extender
Republic Fleet Medium Shield Extender
Warp Scrambler II
125mm Gatling AutoCannon II, Republic Fleet Fusion S
125mm Gatling AutoCannon II, Republic Fleet Fusion S
125mm Gatling AutoCannon II, Republic Fleet Fusion S
125mm Gatling AutoCannon II, Republic Fleet Fusion S
Expanded Probe Launcher II, Sisters Combat Scanner Probe
Small Gremlin Compact Energy Neutralizer
Small Core Defense Field Extender II
Small Core Defense Field Extender II
Small Core Defense Field Extender II
-
[Jackdaw, Krab Hunter]
Damage Control II
Ballistic Control System II
Ballistic Control System II
5MN Y-T8 Compact Microwarpdrive
Small Ancillary Shield Booster, Navy Cap Booster 200
EM Ward Amplifier II
Warp Disruptor II
Missile Guidance Computer II, Missile Precision Script
Light Missile Launcher II, Caldari Navy Nova Light Missile
Light Missile Launcher II, Caldari Navy Nova Light Missile
Light Missile Launcher II, Caldari Navy Nova Light Missile
Light Missile Launcher II, Caldari Navy Nova Light Missile
Light Missile Launcher II, Caldari Navy Nova Light Missile
Expanded Probe Launcher II, Sisters Combat Scanner Probe
Small Anti-EM Screen Reinforcer I
Small Processor Overclocking Unit II
Small Hyperspatial Velocity Optimizer I
-
[Hound, Krab Hunter Partner]
Ballistic Control System II
Nanofiber Internal Structure II
Overdrive Injector System II
Peripheral Compact Target Painter
Warp Scrambler II
5MN Quad LiF Restrained Microwarpdrive
Covert Ops Cloaking Device II
Prototype 'Arbalest' Torpedo Launcher
Prototype 'Arbalest' Torpedo Launcher
Prototype 'Arbalest' Torpedo Launcher
Bomb Launcher I
Small Auxiliary Thrusters II
Small Hyperspatial Velocity Optimizer II
-
[Stiletto, Krab Hunter Partner]
Damage Control II
Small Ancillary Armor Repairer, Nanite Repair Paste
Nanofiber Internal Structure II
5MN Quad LiF Restrained Microwarpdrive
Warp Scrambler II
Stasis Webifier II
Warp Disruptor II
125mm Gatling AutoCannon II, Republic Fleet Fusion S
125mm Gatling AutoCannon II, Republic Fleet Fusion S
Rocket Launcher II, Caldari Navy Nova Rocket
Small Low Friction Nozzle Joints II
Small Low Friction Nozzle Joints II
I would probably only go solo with the wolf or svipul, and use the stiletto in partnership with any of the other fits listed.
Any recommendations on other viable ships/viable ship duos, or tips for the fits I have now? | REVIEW: [Land Raider Crusader, Sisters of Battle (Multi-Melta & Heavy Bolter), Grey Hunter Standard Bearer, Cypher, Dark Eldar Succubus, Dreadnoughts(cheap sale dread), Tauros Venator, Recon Tactical Marines, Female Commissar][Z] (XXXX) | 2 x SC or 1 x SC & the Battleforce - Army Composition. | My first list, based mostly on what weapons my models have. C&C por favor! | [WTS - CA, USA]PVS14 parts, Spectre Partizan, SSO Cryes, Army Combat Pants, Jtech Belt, Defender 2, 417 Chest Rig, Airframe Cover, 5.11 Pants, Smersh thing, Guarder Spring, ZCI 229, Camo, Caps, Patches, etc. | 1st Playthrough, Tactician, and no Tank | [PC] W: Low level AA Handmades, low level instigating levers, low level legacies and specific Hunters/Troubleshooters/Mutants slayers/Vanguard/Weightless armor H: Caps, plans, guns, armors etc lined up in a spreadsheet | [PC] Noveske Rogue Hunter Upper, Noveske Gen2 Lower AR15 Custom Package [VA] | Simple Warzones - 40K 8th Ed Campaign Game Trackers |
1,999,921 | when did lewis woodson became president of wilberforce university | of numerous free blacks, a center of abolitionist activity, and a station on the Underground Railroad. Soon the Woodsons helped establish a black Methodist Episcopal congregation there, the first west of the Allegheny Mountains. Lewis and two brothers, Thomas and John, became ministers in the African Methodist Episcopal Church (AME), a new, independent, African-American denomination started in Philadelphia in 1816. The Woodsons helped establish new congregations in what was then thought of as the western United States. Lewis Woodson moved with his family to Pittsburgh, PA in 1830/1. In Chillicothe, Lewis Woodson married Caroline Robinson, also born in Virginia. The | of the twentieth century as Daughters College, it changed its name to William Woods College 1900 to honor a major benefactor (William S. Woods, president of the National Bank of Commerce) and began offering a two-year college program. In 1962, anticipating dramatic changes in the role of American women in the labor force, William Woods became a four-year college. Expanding its mission to address the need for graduate and adult-oriented programs, the institution became known as William Woods University in 1993. It began offering graduate degrees and admitting men as well as women into all of its programs. The university | How did john newton know william wilberforce? | William Julius Wilson the University of Pennsylvania, Northwestern University, Johns Hopkins University, New York University, Bard College, Dartmouth College, and the University of Amsterdam in the Netherlands. A MacArthur Prize Fellow from 1987 to 1992, Wilson has been elected to the National Academy of Sciences, the American Academy of Arts and Sciences, the National Academy of Education, the American Philosophical Society, the Institute of Medicine, and the British Academy. In June 1996 he was selected by "Time" magazine as one of America's 25 Most Influential People. He is a recipient of the 1998 National Medal of Science, the highest scientific honor in the | Harry J. Brooks where he was observed on several occasions by Henry Ford. His father played the violin at dances at a local inn and met Ford. The elder Brooks invited Ford home for dinner and introduced him to his son. Ford hired Harry to work in one of his auto plants. Several months later, Ford gave Harry a job as a test pilot for the Stout Metal Airplane Division of the Ford Motor Company. Although still very young, Brooks soon became Ford’s top pilot, as well as a close friend whom Ford nicknamed "Brooksie". Brooks demonstrated the capabilities of the new monoplane | Eldrick "Tiger" Woods | and his son reached his room, Ruffin had reloaded the rifle and fired a fatal shot. His body was returned to Marlbourne, his plantation in Hanover County, Virginia, for burial. He is often called the "father of soil science" in the United States, and his writings have been influential in soil conservation. The Edmund Ruffin Plantation, also known as Marlbourne, is designated as a National Historic Landmark. Edmund Ruffin Edmund Ruffin (January 5, 1794 – June 18, 1865) was a wealthy Virginia planter and slaveholder, who in the 1850s was a political activist with the so-called Fire-Eaters. He staunchly advocated | Taylor only played in The Open Championship and the U.S. Open."<br> NYF = Tournament not yet founded<br> NT = No tournament<br> CUT = missed the half-way cut<br> "T" indicates a tie for a place John Henry Taylor John Henry "J.H." Taylor (19 March 1871 – 10 February 1963) was an English professional golfer and one of the pioneers of the modern game of golf. Taylor is considered to be one of the best golfers of all time. He was also a significant golf course architect. Taylor was born in Northam, Devon. He was a member of the fabled Great Triumvirate | 1,999,921 | The war also diverted Methodist Church resources, and it was unable to fully fund the school. In 1862 the Board of Trustees temporarily closed Wilberforce University because of financial problems. In 1863 the AME Church purchased the university and assumed full responsibility for it. They selected Bishop Daniel Payne as president, the first African-American college president in the United States. To help raise money for the purchase, the AME Church sold the property used by Union Seminary to put its resources into Wilberforce University. Lewis Woodson died in January 1878. He was buried in the Allegheny Cemetery in Pittsburgh, PA. | who did paul glewwe work with on education reform | when did the boyd buchanan bible school open | who founded augustana college in 1860 | in which year did chichester university secure government and lotteries commission funding | who owns the university of the rockies | edmund richardson died in which us city in 1886 | in 1877, wilford woodruff became the first president of which temple | what type of teaching did anthony chenevix trench introduce at eton |
1,999,922 | Growth Retardation and Bone Loss as Determinants of Axial Osteopenia in Juvenile Chronic Arthritis | Growth retardation and osteopenia have been reported in some children with idiopathic hypercalciuria (IHC), particularly in those with nephrocalcinosis. The duration of hypercalciuria might be a risk factor for osteopenia. A retrospective longitudinal analysis of statural growth and a cross-sectional evaluation of bone mineral density (BMD) was carried out in 26 IHC children followed for 4–13 years. None of the patients had nephrocalcinosis. Growth, including pubertal growth spurt, was normal in all subjects. BMD Z score less than −1 was recorded in 3 subjects with hyperuricosuria. BMD Z score averaged −0.68±0.99 in the 9 subjects with associated hyperuricosuria and 0.21±0.64 in the 17 with occasional or no hyperuricosuria (P=0.018). Our analysis shows that children with long-lasting IHC without nephrocalcinosis have normal growth, but those with associated hyperuricosuria may be at risk for osteopenia. | low impact activities, such as walking or swimming. If patients return to activity before the cartilage has become firm, they will typically complain of pain during maneuvers such as squatting or jumping. The prognosis after different treatments varies and is based on several factors which include the age of the patient, the affected joint, the stage of the lesion and, most importantly, the state of the growth plate. It follows that the two main forms of osteochondritis dissecans are defined by skeletal maturity. The juvenile form of the disease occurs in open growth plates, usually affecting children between the ages | Purpose of review The purpose is to provide a brief overview of factors that impact adolescent bone health and review special populations that deserve extra consideration of their bone health status. Recent findings Optimization of modifiable factors is critical for adolescents to reach peak bone mass. Binge drinking, tobacco use, and certain medications all have accumulating evidence showing detrimental impacts on adolescent bone health and certain populations are more at risk for poorer bone health outcomes because of the nature of their conditions. Furthermore, very recent evidence suggests that in certain patients who have a history of insufficient nutritional and hormone status, ‘catch-up’ bone acquisition may not occur, underscoring the importance of early attention to these modifiable factors. Summary Providers caring for adolescents should be aware of the many different populations at risk for poor bone health. Treatment that might further compromise bone health should be considered judiciously and providers should encourage optimization of any modifiable factor when possible. | Comprehensive Assessment of Orofacial Health and Disease Related Parameters in Adolescents with Juvenile Idiopathic Arthritis—A Cross-Sectional Study | Disturbance of skeletal growth occurs often in children and results in considerable lifelong disability. When acquired, it is most frequently post-traumatic but may also be caused by other insults, such as infection, ischemia, tumoral lesions, and radiation. 15 The complications of growth disturbance (leg length discrepancy, angular deformity, and altered joint mechanics) cause significant morbidity. MR imaging, with its ability to depict the cartilaginous structures of developing bones, has become the modality of choice for evaluating children with growth disorders and directing surgical management. An understanding of normal enchondral ossification and the anatomy of the ends of growing bones is essential for appreciation of the MR imaging findings in such patients. | Abstract Diagnostic assessment of osteoarthritis in children and adolescents is difficult. Here, we report the sixth family with a COL2A1 mutation R275C. The index patient, her mother and her three brothers had severe coxarthrosis, in some cases requiring surgery. Only the mother was hard of hearing, and only her children had brachydactyly of the fourth digit. The index patient suffered a femoral neck fracture after minor trauma at a time when osteoarthritis was not yet radiologically detectable. Hip fracture or osteoarthritis of unclear origin in childhood should prompt genetic work-up for the purposes of correct classification and genetic counseling. |
| INTRODUCTION
The major part of the mammalian skeleton develops via a process in the growth plates named endochondral ossification. 1 Endochondral ossification of long bones typically starts with the formation of a cartilaginous tissue containing highly proliferative chondrocytes. This cartilaginous tissue then gradually transforms into hypertrophic and mineralized cartilage, followed by remodeling into bony tissue. 1 Growth plate activity is directly responsible for skeletal growth and its de novo bone-generating activity peaks during in utero development of the fetus, the first months after birth and during puberty. 2 During these phases of development, the growth plates are most vulnerable for disturbances that affect the endochondral ossification process and in turn may lead to abnormal skeletal development, leading to malformations, dwarfisms, gigantisms, and others. 2,3 Impairment of physical growth and development is seen in patients suffering from juvenile idiopathic arthritis (JIA). 4 Thirty-nine percent of children with JIA experience delayed and restricted growth and have a reduced final body length compared to their peers, 5,6 with significant implications for both physical and psychosocial health. Although initially reversible, long-standing growth plate impairment results in irreversible short stature (below the third percentile) and altered adult body stature. 7 The growth impairment in JIA is often explained by the sustained systemic inflammation, reduced mobility, malnutrition, and catabolic imbalance in pediatric patients. However, the role of the currently used pharmacological treatment in the growth of the skeleton in JIA-affected children was only recently recognized. 7 To manage inflammatory responses, reduce pain, and preserving joint function, JIA patients are pharmacologically treated for prolonged periods with nonsteroidal anti-inflammatory drugs (NSAIDs).
Next to NSAID's JIA patients are treated with disease-modifying antirheumatic drugs; amongst others methotrexate (MTX). Classically, also glucocorticoids have been frequently used, but these have been shown to have an interfering action on growth, leading to a reduction in final adult height in these patients. 8 The use of new antirheumatic biologicals such as etanercept and tocilizumab have been associated with impaired growth in JIA patients too. 9,10 Despite the positive effects of MTX and NSAIDs, such as naproxen, on the inflammatory condition in JIA, the consequences of these drugs on endochondral ossification have not yet been sufficiently investigated.
The NSAID class of anti-inflammatory drugs mainly focuses on inhibiting cyclooxygenase (COX) activity and thereby reducing pain, inflammation, and fever. Impairment of growth plate development by impaired chondrocyte hypertrophy in the growth plate by selective COX-2 inhibition has been described before. 11 In spite of these observations, there is a controversy over the exact effects of COX inhibitors on the chondrogenic part of endochondral bone formation processes during skeletal growth itself.
MTX is used at high-doses for the treatment of malignancies 12 and at lower doses for the treatment of JIA. From studies in children affected with acute lymphoblastic leukemia (ALL), the bone metabolism after treatment with high dose MTX is disturbed, resulting in reduced bone lengthening and bone loss. Based on these observations, pediatric patients suffering from JIA or ALL and receiving MTX over long periods could be at risk of suppression of skeletal growth. complementary DNA synthesis, and real-time quantitative polymerase chain reaction were performed as described before. 13 Validated primer sequences were used and presented in Table 1. Data were analyzed using the standard curve method, messenger RNA (mRNA) expression was normalized to the reference gene (β-actin) and gene expression was calculated as fold change as compared to day 0 conditions. In a parallel experiment, the glycosaminoglycan (GAG) content was measured using a standardized modified dimethyl methylene blue assay. GAG content was corrected for total protein content with a bicinchoninic acid assay (Sigma-Aldrich)
| Experimental design animal model
For this study 48 healthy skeletally immature (5 weeks old/±20 g) C57BL/6 mice were used (Charles River Laboratories, Wilmington, MA). The Maastricht University Animal Ethical Committee approved the experiment (MUMC DEC Approval 2014-084) and we confirm that all experiments were performed in accordance with relevant guidelines and regulations (ARRIVE). The sample size was calculated according to the formula of L. Sachs n = (sigma/delta)2 × 15.7), corrected for potential drop-out, and 12 animals per group were included (all females). Throughout the experiment, animals were housed in groups under standard conditions with ad libitum access to water and food and 12 hours of light each day. Animal wellbeing and weight were monitored daily. Wild-type animals were randomly assigned to the treatment or control group. Naproxen (10 mg/kg) (Bayer, Leverkusen, Germany) or placebo (water) was orally administered from day 0 on a daily basis by oral gavage. MTX (1 mg/kg) (Emthexate; Pharmachemie BV, Haarlem, The Netherlands) or placebo (0.9% NaCl) was administered by intraperitoneal (IP) injection three times a week from day 0 onwards. After 10 weeks mice were euthanized by O 2 /CO 2 asphyxiation. During further processing, the specimens were coded and the researchers thus blinded to the treatment received. One mouse in the placebo IP group died during the experiment due to complications after injection.
| (Immuno)histochemistry
Whole knee joints were fixed in phosphate-buffered formalin for
| Length measurements
After dissection of the hind limb, the length of femur and tibia was measured using a digital micrometer. Hematoxylin-stained sections from similar middle regions of the growth plate of each mouse were analyzed using a Zeiss Axioscope A.1 (with AxioVision 4.8 software).
The anatomical middle of the growth plates of femur and tibia was used as an internal reference point. From each growth plate, three consecutive sections were measured at the middle, a quarter, and half the distance from the anatomical reference point for the determination of the thickness of the total growth plate, the resting, proliferative and hypertrophic zones. These measurements were performed in triplicate in a randomized and blinded manner by an independent observer.
| Micro-computed tomography
After dissection of the hind leg, the growth plate region of the tibia of each sample was scanned in a micro-computed tomography (micro-CT)
T A B L E
| Alkaline phosphatase activity and hydroxyproline assay
Enzymatic activity of alkaline phosphatase (ALP) and hydroxyproline levels were determined using a colorimetric assay as described before. 14 ALP activity was determined by measuring ALP-depend enzymatic conversion of p-nitrophenyl phosphate to nitrophenyl phosphate. Hydroxyproline levels are determined by the reaction of oxidized hydroxyproline with 4-(dimethylamino)benzaldehyde. The DNA concentration in samples used for ALP and hydroxyproline assay was determined using SYBR Green I Nucleic Acid stain (Invitrogen).
| Statistics
Statistical significance (P < .05) was determined by the Student t test for in vitro experiment shown in Figure 1 and Mann-Whitney test for the in vivo experiment using the Graphpad PRISM 5.0 (La Jolla, CA).
To test for normal distribution of the input data, D'Agostino-Pearson omnibus normality tests were performed. All quantitative data sets presented here passed the normality tests. Lines in graphs represent mean ± SEM. were inhibited by MTX at both days 7 and 14 ( Figure 1C). Exposure of differentiating ATDC5 cells to naproxen or MTX resulted in significantly increased proliferation at day 7 and 14 ( Figure 1D). Naproxen was used at 10 mg/kg on a daily basis (which is comparable to the human dosage for JIA). 15 MTX was used at 1 mg/kg/three times per week, which is at the upper limit of the human dosage used for JIA, 16,17 but within the range of effective arthritis treatment within various mouse models. [18][19][20][21] Prolonged treatment of 5-week-old skeletally immature mice with naproxen or MTX for 10 weeks did not result in significant body weight changes as compared to their control placebo-treated mice (Figure 2A). To determine if these pharmacological compounds affect longitudinal growth of the long bones, bone lengths of the tibia and femur were measured. Figure 2B,C shows that both naproxen and MTX treatment resulted in the significantly reduced bone length of the tibia and femur.
| Naproxen and MTX treatment induces abnormal growth plate development
To determine whether the impaired bone length following naproxen or MTX treatment could be attributed to disturbed growth plate development, key growth plate characteristics were evaluated. Treatment with naproxen did not result in a significant difference in the total F I G U R E 2 Weight and length measurements in control, naproxen, and MTX-treated mice. Five weeks old C57BL/6 mice were orally treated with either naproxen (10 mg/kg/d; n = 12) or placebo (n = 12) or received IP injections with MTX (1 mg/kg; three times per week; n = 12) or placebo (n = 11) for 10 weeks. At 15 weeks of age weight (A) and length of the tibia (B) and femur (C) were analyzed. Each dot represents the determined value for each of the individual mice and lines in graphs indicate mean ± SEM. Statistical significant differences (P < .05) are shown by an *NS. IP, intraperitoneal; MTX, methotrexate; NS, not significant thickness of the growth plate ( Figure 3A), nor the resting zone thickness ( Figure 3B). Interestingly, the proliferative zone of the growth plate of naproxen-administered mice was significantly thicker than in the placebo-administered mice ( Figure 3C), whereas the hypertrophic zone was significantly thinner ( Figure 3D) following naproxen treatment. In accordance with these results, Safranin-O and Col2a1 staining revealed macroscopically discernible higher proteoglycan and Col2a1 positivity in the growth plates of naproxen-treated mice compared to placebotreated mice ( Figure 3E,F), whereas staining intensity of hypertrophic extracellular matrix (ECM) marker Col10a1 was diminished ( Figure 3G).
Treatment with MTX also resulted in abnormal growth plate development; the total thickness of the growth plate was significantly reduced as compared to the placebo (IP) mice ( Figure 3A). A more detailed analysis of the different growth plate zones revealed no significant differences in the thickness of the resting zone ( Figure 3B). A significantly increased thickness of the proliferative zone ( Figure 3C) and a significantly thinner hypertrophic zone ( Figure 3D) were found in the MTX-treated mice when compared to control placebo (IP) mice.
Safranin-O and Col2a1 staining showed greater intensity in the growth
plates of MTX-treated mice ( Figure 3E,F), whereas Col10a1 staining intensity was slightly decreased in the MTX-treated mice ( Figure 3G).
In summary, naproxen and MTX treatment affected growth plate development by altering the development of growth plate zones and ECM composition.
| Altered bone characteristics in naproxen-and MTX-treated mice
To determine if the observed aberrant development of the growth plate due to naproxen and MTX treatment resulted in a bone phenotype beyond the growth plate (compartment), bone micro-CT characteristics directly beneath the proximal tibial growth plate were determined as a measure for bone (micro) structure as a direct result of bone remodeling during endochondral ossification. Micro-CT analysis of this VOI showed a significantly lower bone volume density as a result of naproxen treatment ( Figure 4A). No significant alterations in bone mineral density were observed in naproxen-treated mice as compared to placebo (oral) mice ( Figure 4B). Naproxen treatment resulted in a decreased Tb.N ( Figure 4C) but increased Tb.Th ( Figure 4D) and increased Tb.Sp ( Figure 4E). In mice treated with MTX, no significant differences were observed for bone volume density ( Figure 4A) and Tb.Th ( Figure 4D). Bone mineral density Figure 6C). Previous studies have shown a potential for naproxen to interfere with osteogenic as well as chondrogenic mesenchymal stem cell (MSC) differentiation. 25,26 It appears that the effect of naproxen, especially on hypertrophic gene expression in chondrogenically differentiating MSCs, is timing-dependent. 25,26 As demonstrated by a study from Antoniou et al, 25 after 3 days of differentiation in the presence of naproxen the mRNA expression of hypertrophic markers such as COL10A1 and ALPL was significantly increased, whereas expression of these genes was decreased at 6 and 12 days in differentiation with naproxen exposure. 25 The results are in line with our findings as presented in Figure 1. in these studies. 25,26 In this study, ATDC5 cells were used, which is a (murine) cell model described to resemble the chondrogenic phase of endochondral ossification. 13 Indeed, our findings regarding the response of ATDC5 cells to naproxen, as presented in Figure 1, correspond with results from the in vivo growth plate data presented in Figure 3.
ATDC5 cells showed increased chondrogenic differentiation and
proliferation combined with decreased hypertrophic differentiation when exposed to naproxen, which is validated in the mouse study; where we found increased Safranin-O and Col2a1 staining, increased proliferative zone thickness and decreased Col10a1 staining and thickness of the hypertrophic zone. Little is known about the effect of naproxen on growth plate development in vivo. 27 However, other studies have shown deregulation of growth plate development by other NSAIDs. 11,24,[28][29][30] This study is the first to show that naproxen (in an equivalent human dosage) influences murine growth plate development, the bone microstructure, cortical bone quality, and tibial and femoral bone length.
Next to naproxen, MTX, a potent inhibitor of dihydrofolate reductase and thus thymidylate and purine synthesis is frequently de- 35,36 There are however differences between these studies, including our own, regarding the specific effect of MTX on growth plate composition, specifically concerning proliferation/ proliferative zone, and trabecular microstructures and bone mineral density. 35,36 It is likely that these differences can be attributed to the Figure 1) might be due to deregulated Ihh signaling. Indeed, Figure 5 shows decreased Ihh expression, as well as decreased expression of its receptor and the Gli transcription factors. NSAIDs, such as naproxen, mediate their action via inhibition of COX enzyme activity which diminishes the biosynthesis of prostaglandins (PGs). 42 Indeed, a connection between PG signaling and PTHrP has been proposed before during osteogenesis. 43 In addition, from literature and our own previous studies, it is known that the BMP/Smad1/5/8 signaling axis and subsequent induction of hypertrophic differentiation are sensitive to PGE2 regulation. 11,44 This opens the possibility that the observed chondrogenic/ hypertrophic alterations due to naproxen can be attributed to inhibition of PGs and subsequent BMP-induced Smad1/5/8 activation. treatment was seen in this study might also be explained by deregulated PTHrP/Ihh signaling. In Figure 6, we observed a significant upregulation of PTHrP in the treatment conditions, which is most pronounced at day 7 in ATDC5 differentiation. In line with previous literature, increased
PTHrP is shown to increase chondrogenic marker expression such as Col2a1 in MSCs which might explain our observed effects. 40,50 Overall, these results show that naproxen and MTX have a profound action on endochondral ossification during growth plate development, aberrant subchondral bone morphology, and reduced bone length. A better understanding of how these medications affect growth plate development will improve the insight in endochondral ossification and will reveal possibilities to improve the treatment of pediatric patients.
7 days, decalcified using 0.5M ethylenediaminetetraacetic acid (VWR Prolabo, Amsterdam, The Netherlands), pH 7.8, for 21 days and embedded in paraffin. Coronal issue sections of 5 μM were prepared. Before histochemistry, tissue sections on slides were deparaffinized and rehydrated using standard protocols. Sections for growth plate and cell surface measurements were stained with hematoxylin (Dako, Troy, MI). Proteoglycans were stained with Safranin-O (0.05%) (Sigma-Aldrich) and counterstained with Fast Green (0.1%) (Sigma-Aldrich). Stained sections were dehydrated and mounted in Histomount (Thermo Shandon; Thermo Fisher Scientific, Waltham, MA). For immunohistochemical analysis of Col2a1 and Col10a1 in growth plate sections, rehydrated sections were treated with 0.4% hyaluronidase (Sigma-Aldrich). Endogenous peroxidase activity was inactivated and samples were blocked with 10% normal goat serum. Mouse monoclonal anti-Col2a1 (II-II6B3; Developmental Studies Hybridoma Bank, Iowa City, IA) and mouse negative control IgG1 (negative control; Dako) were used. Rabbit polyclonal anti-Col10a1 (Quartett Immunodiagnostika, Berlin, Germany) and negative control nonimmune normal rabbit serum were used. Bound antibodies were visualized with horseradish peroxidase (HRP)-labeled anti-rabbit or anti-mouse secondary antibodies (EnVision+ System-HRP labeled Polymer; Dako). For detection, 3,3'diaminobenzidine chromogen substrate (Dako) was used. Stained sections were mounted in Histomount.
threshold of 210 per mile of the maximum gray value, corresponding to 453 mgHA/ccm. Contours were drawn manually to identify a volume of interest (VOI) of subchondral bone just distal of the growth plate with a thickness of approximately 200 microns. From the segmented images, the following morphology indices were determined: bone density, bone volume fraction (BV/TV), trabecular number (Tb.N), trabecular thickness (Tb.Th), and trabecular separation (Tb.Sp).14
F I G U R E 1
1Influence of naproxen and MTX on chondrogenic differentiation of ATDC5 cells. ATDC5 cells were differentiated under control conditions (white bars) and with naproxen (1 mM; dotted bars) or MTX (1 µM; black bars) for 7 and 14 days. A, Induction of chondrogenic markers Col2a1 and Sox9 mRNA expression was determined by RT-qPCR at day 7 and 14 in differentiation, relatively to day 0 conditions and normalized for β-actin mRNA expression. B, Glycosaminoglycan (GAG) content (corrected for protein content) was analyzed by DMB assay and fold change of t = 7 and t = 14 samples were calculated as compared to t = 0 samples. C, Induction of hypertrophic markers Col10a1 and Runx2 mRNA expression was determined by RT-qPCR at day 7 and 14 in differentiation, relatively to day 0 conditions and normalized for β-actin mRNA expression. D, DNA content was measured and t = 7 and t = 14 samples were compared to t = 0 samples. In graphs, error bars represent mean ± SEM. Statistical significant differences (P < .05) are shown by an * , **P < .01, ***P < .0001, NS. DMB, dimethyl methylene blue; mRNA, messenger RNA; MTX, methotrexate; NS, not significant; RT-qPCR, real-time quantitative polymerase chain reaction if medications prescribed for JIA have the potency to alter growth plate development, we first tested if naproxen or MTX alter the course of the chondrogenic phase of endochondral ossification in vitro. Under control conditions, ATDC5 cells acquire a chondrogenic phenotype from day 7 in differentiation as determined by increased mRNA expression of collagen type II (Col2a1), sexdetermining region Y box 9 (Sox9), and GAG content (Figure 1A,B;white bars).13 From day 14 in differentiation, these cells also express highly increased levels of chondrocyte hypertrophic marker collagen type X (Col10a1) and Runt-related transcription factor 2 (Runx2)13 (Figure 1C; white bars). The addition of naproxen(Figure 1; gray bars) resulted in significantly increased expression of Col2a1, Sox9, and GAG content at day 7 in differentiation. No significant alterations on Col2a1 expression and GAG content were observed at day 14 in differentiation in the presence of naproxen when compared to control conditions (Figure 1A,B). Sox9 mRNA expression was significantly increased in the naproxen-treated condition at day 14 in differentiation. At day 7 in differentiation, no significant difference was observed in the induction of hypertrophic differentiation markers Col10a1 and Runx2 after naproxen treatment. Conversely, at day 14 in differentiation naproxen treatment did result in significantly decreased induction of Col10a1 and Runx2 (Figure 1C). Treatment of the differentiating ATDC5 cells with MTX (Figure 1A,B; black bars) resulted in increased Col2a1 (significant) and Sox9 (not significant at day 7) mRNA expression on day 7 and 14 in differentiation. Similar results were found for GAG content (Figure 1A,B). Expression of hypertrophic markers Col10a1 and Runx2
F
I G U R E 3 Growth plate stainings and measurements in control, naproxen-and MTX-treated mice. The thickness of the tibia growth plate and individual zones was measured on hematoxylin-stained sections. A, Thickness of the total growth plate. B, The thickness of the resting zone. C, The thickness of the proliferative zone. D, The thickness of the hypertrophic zone. In adjacent growth plate sections (immuno)histochemical stainings were performed and analyzed. E, Safranin-O/Fast green staining. F, Collagen type II immunohistochemical staining. G, Collagen type X immunohistochemical staining. Each dot represents the determined value for each of the individual mice and lines in graphs indicate mean ± SEM. Statistical significant differences (P < .05) are shown by an *NS. IP, intraperitoneal; MTX, methotrexate; NS, not significant [Color figure can be viewed at wileyonlinelibrary.com] was significantly increased in the MTX-treated mice (Figure 4B) and this was accompanied by increased Tb.N (Figure 4C) and decreased Tb.Sp (Figure 4E). To acquire an indication of the biochemical bone quality, ALP activity and hydroxyproline content in cortical bone was measured.Treatment with naproxen resulted in increased ALP activity (Figure 5A), but a decreased hydroxyproline content in cortical bone (Figure 5B). This might indicate that the cortical bone of these mice is more brittle; as there is an increase in mineralization capacity but this is not matched with increased collagen stability. Mice treated with MTX showed significantly increased ALP activity (Figure 5A) and hydroxyproline content in the cortical bone (Figure 5B), indicative of increased bone strength. In summary, notable microstructural features were detected in the subchondral bone directly beneath the growth plate and changes in the cortical bone quality as a result of the treatment with naproxen or MTX. 3.5 | Involvement of PTHrP-Ihh loop in naproxenand MTX-induced alterations in endochondral ossification in vitro Multiple steps during the chondrogenic differentiation process are tightly controlled by Parathyroid hormone-related peptide (PTHrP) and Indian Hedgehog (Ihh) through the mutual regulation of their activities. 22 Ihh acts on PTHrP in a negative feedback loop to regulate early chondrocyte differentiation and the entry to hypertrophic differentiation. To further elucidate the potential biomolecular mechanism explaining the observed alterations in growth plate development as a result of naproxen or MTX treatment, gene expression in the parathyroid hormone-related peptide/Indian hedgehog (PTHrP/Ihh) pathway 1,23 was measured in samples from the ATDC5 chondrogenic differentiation experiment shown in Figure 1. During ATDC5 chondrogenic differentiation naproxen or MTX exposure led to significant deregulation of the PTHrP/Ihh pathway as illustrated by increased PTHrP mRNA expression at day 7 and 14 in ATDC5 differentiation (Figure 6A). Conversely, expression of Ihh was decreased in naproxen and MTX conditions at days 7 and 14 in ATDC5 differentiation. In accordance with this result, the Ihh receptors patched (PTC) 1 and 2 (Figure 6B) were similarly decreased in expression by naproxen and MTX treatment at day 7 and 14 in differentiation. As a measure for functional deregulation of Ihh signaling, the expression of downstream transcription factors Gli1 and Gli3 was determined in these samples. The mRNA expression of both Gli1 and Gli3 was significantly inhibited in ATDC5 differentiation at day 7 and 14 in the naproxen-and MTX-treated cells (
F I G U R E 4
4Bone microstructure analysis in control, naproxen-and MTX-treated mice. Bone microstructure in the first calcified zone in tibia was determined by µCT. A, Quantification of bone volume density. B, Quantification of bone density. C, Quantification of trabecular thickness, number (D), and separation (E). Each dot represents the determined value for each of the individual mice and lines in graphs indicate mean ± SEM. Statistical significant differences (P < .05) are shown by an *NS. µCT, micro-computed tomography; IP, intraperitoneal; MTX, methotrexate; NS, not significant; Tb.N, trabecular number; Tb.Sp, trabecular separation; Tb.Th, trabecular thickness 4 | DISCUSSION Our previous studies 11,14,24 determined that COX enzyme activity is involved in regulating the chondrogenic phase of endochondral ossification. Clinically, this is relevant as inhibition of COX enzymes by NSAIDs can result in hampered endochondral ossification. Following the notion that growth plate development, and thus skeletal growth, can be affected by such commonly used medications, we asked the question if growth reductions observed in JIA 4-6 can also be attributed, at least in part, by the use of commonly used anti-inflammatory medications used in the disease management of JIA. In the present study, we used naproxen and MTX as they are frequently used medications in JIA treatment and established that they can interfere with chondrogenic differentiation both in vitro as in vivo.
Overall, mixed results are found in the literature on the effect of naproxen on chondrogenic marker expression (COL2A1, SOX9, ACAN, and GAG content) and this might be influenced by the cell model, chondrogenic differentiation induction, time of exposure to naproxen and concentration used
scribed to patients with JIA. MTX interferes with the synthesis and repair of DNA during cell cycle replication and has anti-inflammatory properties.31 The effect of MTX on chondrocytes or MSC differentiating into the chondrogenic lineage is not well studied, but it is reported that MTX does not affect the survival, proliferation, and functional characteristics of cultured MSCs.32 In addition, Kastrinaki et al33 showed that bone marrow-derived MSCs from adult patients with rheumatoid arthritis have impaired proliferative and clonogenic capacity when compared to healthy bone marrow-derived MSCs, but this was not correlated to previous MTX treatment of these patients. Our results demonstrate an increased chondrogenic potential and decreased hypertrophic phenotype in differentiating ATDC5 cells when exposed to MTX, accompanied by an increase in proliferation during differentiation(Figure 1), showing that MTX does interfere with the endochondral ossification pathway. In vivo, we observed a decreased tibia and femur length after 10 weeks of treatment with MTX (1 mg/kg/three times a week), and this was accompanied by significant changes in bone microarchitecture, cortical bone quality and growth plate thickness and composition (Figures 2-4). These results are mostly in line with Iqbal et al, 34 who reported reduced length of the long bones which was accompanied F I G U R E 5 ALP activity and hydroxyproline in ulna of control, naproxen-and MTX-treated mice. Skeletal consequences of treatment with naproxen or MTX was determined. A, ALP enzymatic activity of cortical bone samples was determined and normalized to total DNA content. B, Hydroxyproline levels corrected for DNA content were determined in cortical bone samples. Each dot represents the determined value for each of the individual mice and lines in graphs indicate mean ± SEM. Statistical significant differences (P < .05) are shown by an *NS. ALP, alkaline phosphatase; IP, intraperitoneal; MTX, methotrexate; NS, not significant by the reduced height of the growth plate in mice treated with MTX (3.5 mg/kg/every second day for 3 weeks). Other studies in rats and rabbits have also reported suppression in growth plate development and skeletal growth after treatment with various doses and treatment regimens of MTX.
animal model, skeletal age when treatment is started, treatment duration, and concentration of MTX, indicating that more research is needed to fully investigate the effect of MTX on skeletal development and the influence of above-mentioned parameters. However, this is the only study that studies the influence of the medications on endochondral ossification in both in vitro and in vivo. The effects of naproxen and MTX on growth plate morphology are very similar, but those on the character of bone architecture beneath the growth plate (Figure 4) and cortical bone (Figure 5) are different.
Unfortunately, not much is known on how MTX affects major signaling pathways in endochondral ossification. However, Olesen et al45 showed a concentration-dependent decreased hedgehog signaling, as indicated by Gli1 and PTC1 gene expression, after MTX treatment of basal cell carcinoma cells compared to immortalized keratinocytes. In addition, MTX-induced bone loss in rats is mediated by attenuated Wnt/b-catenin signaling; a pathway described to interact with the Ihh signaling and likewise important in regulating hypertrophic differentiation. 46,47 These data are in line with the findings presented in Figure 5 where MTX resulted in decreased Ihh signaling and hypertrophic differentiation. Cell culture models such as ATDC5 or chondrogenic differentiation of MSCs in vitro are synchronized events, where all cells simultaneously differentiate from a progenitor cell towards a chondrogenic and eventually hypertrophic state. This in vitro simultaneous differentiation cannot fully recapitulate the particular spatiotemporal nature of the Ihh/PTHrP feedback loop as it is active in vivo. Decreased Ihh signaling in hypertrophic chondrocytes in vivo would theoretically result in decreased PTHrP expression and thus a shorter proliferative zone. This is not observed in this study. Consequently, future studies should focus on identifying the interaction between JIA medications and the Ihh/PTHrP feedback loop in vivo, to clarify the role of the Ihh/PTHrP feedback loop in the here observed effects on endochondral ossification. An alternative explanation for the observed effects on hypertrophic differentiation in vitro and the hypertrophic zone and subchondral bone in vivo can be found in vascular endothelial growth factor (VEGF) signaling. VEGF expression, essential for vascularization of the hypertrophic zone and bone remodeling during endochondral ossification, is under the tight control of COX-2 and a direct target of Wnt/b-catenin signaling. 48,49 It might, therefore, be possible that COX-2 inhibition by naproxen or Wnt/b-catenin attenuation by MTX results in abnormal VEGF expression and vascularization of the hypertrophic zone of the growth plate and subchondral bone leading to disrupted growth plate remodeling which is seen in this study. The increased chondrogenic marker expression (Col2a1 and Sox9 expression, GAGs content, Safranin-O staining) after either naproxen or MTX
Current treatment strategies of pediatric orthopedic or JIA patients commonly involve naproxen and MTX. To better understand how these mediations affect endochondral ossification and growth plate development, we sought to study the consequences of these two selected pharmacological agents in an in vitro model for endochondral ossification and in growth plate development of skeletally immature mice. ATDC5 cells (RIKEN BRC Cell Bank) were cultured in proliferation medium (Dulbecco's modified Eagle's medium/F12; Invitrogen, Carlsbad, CA), 5% fetal calf serum (FCS; Sigma-Aldrich, St. Louis, MO), 1% antibiotic/antimycotic (Invitrogen), 1% nonessential amino acids (Invitrogen). Cells were plated at 6400 cells/cm 2 . Chondrogenic differentiation was initiated by changing the medium to differentiation medium (proliferation medium supplemented with 10 μg/mL insulin [Sigma-Aldrich], 10 μg/mL transferrin [Roche, Basel, Switzerland], 30 nM sodium selenite [Sigma-Aldrich]) (day 0). Naproxen (final concentration of 1 mM; Sigma-Aldrich) or MTX (final concentration of 1 µM; Sigma-Aldrich) was added to the differentiation medium. Differentiation medium (with naproxen or MTX) was refreshed every 2 days. Samples were lysed in TRIzol (Life Technologies, Carlsbad, CA). RNA isolation from TRIzol, RNA quantification,2 | MATERIALS AND METHODS
2.1 | ATDC5 experiment
1 Primer sequences for RT-qPCROligo sets
mouse
Forward
Reverse
β-Actin
GACAGGATGCAGAAGGAGATTACTG
CCACCGATCCACACAGAGTACTT
Col2a1
TGGGTGTTCTATTTATTTATTGTCTTCCT
GCGTTGGACTCACACCAGTTAGT
Sox9
AGTACCCGCACCTGCACAAC
TACTTGTAGTCCGGGTGGTCTTTC
PTHrP
AAGGGCAAGTCCATCCAAGA
CTCGGCGGTGTGTGGATTTC
Col10a1
CATGCCTGATGGCTTCATAAA
AAGCAGACACGGGCATACCT
Ihh
TGGACTCATTGCCTCCCAGA
CAAAGGCTCAGGAGGCTGGA
Runx2
GACGAGGCAAGAGTTTCACC
GGACCGTCCACTGTCACTTT
Patched 1
GCCTACAAACTCCTGGTGCAA
TTTAGTCAACTGGCTGATGTCGAT
Patched 2
GCTGGTCCTGGCAATGATG
TCAGTTTGATGCCCAGGAATC
Gli1
GGACCTGCAGACGGTTATCC
GGAGATGTGCATCGCGAGTT
Gli3
ACCATACGTCTGTGAGCACGAA
GCGCGATCAGAGGCATTT
Note: The 5′ to 3′ forward and reverse oligonucleotide sequences used for RT-qPCR are listed in the
table.
Abbreviation: RT-qPCR, real-time quantitative polymerase chain reaction.
Overall, expression of chondrogenic markers (Col2a1, Sox9, and GAG content) was increased following naproxen or MTX exposure of differentiating ATDC5 cells, while hypertrophic differentiation (Col10a1 and Runx2) was attenuated as a consequence of naproxen or MTX exposure.3.2 | Tibia and femur bone length are decreased in
mice treated with naproxen or MTX
Considering the profound consequences for ATDC5 chondrogenic
differentiation after naproxen or MTX exposure, we subsequently
evaluated whether these compounds also alter in vivo growth plate
development in mice with consequences for skeletal development.
conditions and normalized for β-actin mRNA expression. In graphs, error bars represent mean ± SEM. Statistical significant differences (p < .05) are shown by an * , **p < .01, ***p < .0001, NS. mRNA, messenger RNA; MTX, methotrexate; NS, not significant; RT-qPCR, real-time quantitative polymerase chain reaction As metaphyseal bone structure formation not only relies on endochondral ossification but also on bone remodeling pathways, it is expected that these medications influence this process in a different manner. Current literature is however inconclusive about the effect of naproxen37 or MTX 38 on bone remodeling and this is worth investigating further. Multiple steps during the chondrogenic differentiation process are tightly controlled by PTHrP and Ihh through the mutual regulation of their activities. Ihh acts on PTHrP in a negative feedback loop to regulated early chondrocyte differentiation and the entry to hypertrophic differentiation. 1 Upon binding of Ihh on the PTC receptor, smoothened is no longer suppressed, and this results in the activation of the Gli transcription factor family. These Gli zinc-finger transcription factors are responsible for Ihh-induced lineage commitment of MSCs, induction of chondrocyte hypertrophy, and can be used as markers for the Ihh signaling activity.39 PTHrP shares the same receptor as PTH and is also described to influence the chondrogenic differentiation of MSCs.40 Interestingly, for naproxen it was already described that its effects on hypertrophic differentiation during osteogenic and chondrogenic differentiation of MSCs could be explained via deregulation of the Ihh/PTHrP signaling.25,26 Amano et al,41 showed that Ihh regulates expression of Col10a1 directly via binding of the Gli1/2 transcription factors on the Col10a1 promoter, but also indirectly via induction of Runx2 and subsequent transcriptional complex formation of Gli1/2, Runx2, and Smads which are able to induce Col10a1 expression. It is thus likely that the observed decreased hypertrophic differentiation (Col10a1, Runx2;F I G U R E 6 Involvement of Ihh-PTHrP loop
in effects of naproxen and MTX on
endochondral ossification in vitro and in vivo.
ATDC5 cells were differentiated under
control conditions (white bars) and with
naproxen (1 mM; dotted bars) or MTX (1 µM;
black bars) for 7 and 14 days. A, PTHrP and
Ihh mRNA expression were determined by
RT-qPCR at day 7 and 14 in differentiation,
relatively to day 0 conditions and normalized
for β-actin mRNA expression. B, mRNA
expression of Ihh receptor patched 1 and 2
was determined by RT-qPCR at day 7 and 14
in differentiation, relatively to day 0
conditions and normalized for β-actin mRNA
expression. C, mRNA expression of Ihh
signaling-induced transcription factors Gli1
and Gli3 were determined by RT-qPCR at day
7 and 14 in differentiation, relatively to day 0
ACKNOWLEDGMENTSThe authors would like to thank the Dutch Arthritis Association (Grant No. LLP14), the Dutch Stichting Annafonds | NOREF(Grant No.O2012/66), and the profile rings fonds from the MUMC+ for their financial support. The study sponsors had no involvement in study design, collection, analysis, and interpretation of data; the writing of the manuscript or in the decision to submit the manuscript for publication.The authors would also like to thank the employees of the animal facility of the Maastricht University for their assistance during this study.CONFLICT OF INTERESTSThe authors declare that there are no conflict of interests.AUTHOR CONTRIBUTIONSSubstantial contributions to research design: MC, AW, and TW. Substantial contributions to the acquisition of samples: MC and TC. Substantial contributions to analysis: MC, TC, BvR, and MH.
Developmental regulation of the growth plate. H M Kronenberg, Nature. 423Kronenberg HM. Developmental regulation of the growth plate. Nature. 2003;423:332-336.
Pubertal growth and epiphyseal fusion. K S Shim, Ann Pediatr Endocrinol Metab. 20Shim KS. Pubertal growth and epiphyseal fusion. Ann Pediatr Endocrinol Metab. 2015;20:8-12.
Recent research on the growth plate: mechanisms for growth plate injury repair and potential cell-based therapies for regeneration. R Chung, C J Xian, J Mol Endocrinol. 53Chung R, Xian CJ. Recent research on the growth plate: mechanisms for growth plate injury repair and potential cell-based therapies for regeneration. J Mol Endocrinol. 2014;53:T45-T61.
Growth retardation in nonsteroid treated juvenile rheumatoid arthritis. C Politoolito, C G Strano, A N Olivieri, Scand J Rheumatol. 26Politoolito C, Strano CG, Olivieri AN, et al. Growth retardation in non- steroid treated juvenile rheumatoid arthritis. Scand J Rheumatol. 1997; 26:99-103.
Growth patterns in early juvenile idiopathic arthritis: results from the Childhood Arthritis Prospective Study (CAPS). F Mcerlanecerlane, R Carrasco, L Kearsley-Fleet, Semin Arthritis Rheum. 48McerlanecErlane F, Carrasco R, Kearsley-Fleet L, et al. Growth pat- terns in early juvenile idiopathic arthritis: results from the Childhood Arthritis Prospective Study (CAPS). Semin Arthritis Rheum. 2018;48: 53-60.
Adult outcomes of patients with juvenile idiopathic arthritis. K Minden, Horm Res. 721supplMinden K. Adult outcomes of patients with juvenile idiopathic arthritis. Horm Res. 2009;72(suppl 1):20-25.
Final height, armspan, subischial leg length and body proportions in juvenile chronic arthritis. A longterm follow-up study. M Zak, J Muller, Karup Pedersen, F , Horm Res. 52Zak M, Muller J, Karup Pedersen F. Final height, armspan, subischial leg length and body proportions in juvenile chronic arthritis. A long- term follow-up study. Horm Res. 1999;52:80-85.
Linear growth and final height in patients with systemic juvenile idiopathic arthritis treated with longterm glucocorticoids. D Simonimon, C Fernando, P Czernichow, A M Prieur, A M Prieur, J Rheumatol. 29Simonimon D, Fernando C, Czernichow P, Prieur AM, Prieur AM. Linear growth and final height in patients with systemic juvenile idiopathic arthritis treated with longterm glucocorticoids. J Rheumatol. 2002;29: 1296-1300.
Catch-up growth during tocilizumab therapy for systemic juvenile idiopathic arthritis: results from a phase III trial. F De Benedettie Benedetti, H Brunner, N Ruperto, Arthritis Rheumatol. 67De Benedettie Benedetti F, Brunner H, Ruperto N, et al. Catch-up growth during tocilizumab therapy for systemic juvenile idiopathic arthritis: re- sults from a phase III trial. Arthritis Rheumatol. 2015;67:840-848.
Effects of long-term etanercept treatment on growth in children with selected categories of juvenile idiopathic arthritis. E H Giannini, N T Ilowite, D J Lovell, Arthritis Rheum. 62Giannini EH, Ilowite NT, Lovell DJ, et al. Effects of long-term eta- nercept treatment on growth in children with selected categories of juvenile idiopathic arthritis. Arthritis Rheum. 2010;62:3259-3264.
Inhibition of cyclooxygenase-2 impacts chondrocyte hypertrophic differentiation during endochondral ossification. T Welting, M Caron, P Emans, Eur Cell Mater. 22Welting T, Caron M, Emans P, et al. Inhibition of cyclooxygenase-2 impacts chondrocyte hypertrophic differentiation during endochondral ossification. Eur Cell Mater. 2011;22:420-436.
Acute lymphoblastic leukaemia. C H Pui, L L Robison, A T Look, Lancet. 371Pui CH, Robison LL, Look AT. Acute lymphoblastic leukaemia. Lancet. 2008;371:1030-1043.
Activation of NF-kappaB/p65 facilitates early chondrogenic differentiation during endochondral ossification. Mmj Caron, P J Emans, Dam Surtel, PLoS One. 733467Caron MMJ, Emans PJ, Surtel DAM, et al. Activation of NF-kappaB/p65 facilitates early chondrogenic differentiation during endochondral os- sification. PLoS One. 2012;7:e33467.
Impairment of cyclo-oxygenase-2 function results in abnormal growth plate development and bone microarchitecture but does not affect longitudinal growth of the long bones in skeletally immature mice. Mmj Caron, Tmr Castermans, B Van Rietbergen, published ahead of print March 17Caron MMJ, Castermans TMR, van Rietbergen B, et al. Impairment of cyclo-oxygenase-2 function results in abnormal growth plate devel- opment and bone microarchitecture but does not affect longitudinal growth of the long bones in skeletally immature mice [published ahead of print March 17, 2019].
. 10.1177/1947603519833149Cartilage. Cartilage. 2019. https://doi.org/10. 1177/1947603519833149
A randomized, doubleblind clinical trial of two doses of meloxicam compared with naproxen in children with juvenile idiopathic arthritis: short-and long-term efficacy and safety results. N Ruperto, I Nikishina, E D Pachanov, Arthritis Rheum. 52Ruperto N, Nikishina I, Pachanov ED, et al. A randomized, double- blind clinical trial of two doses of meloxicam compared with naproxen in children with juvenile idiopathic arthritis: short-and long-term efficacy and safety results. Arthritis Rheum. 2005;52:563-572.
Use of methotrexate in juvenile idiopathic arthritis. A V Ramanan, P Whitworth, E M Baildam, Arch Dis Child. 88Ramanan AV, Whitworth P, Baildam EM. Use of methotrexate in juvenile idiopathic arthritis. Arch Dis Child. 2003;88:197-200.
High dose methotrexate in the treatment of refractory juvenile rheumatoid arthritis. A Reiff, B Shaham, B P Wood, Clin Exp Rheumatol. 13Reiff A, Shaham B, Wood BP, et al. High dose methotrexate in the treatment of refractory juvenile rheumatoid arthritis. Clin Exp Rheu- matol. 1995;13:113-118.
Methotrexate ameliorates T cell dependent autoimmune arthritis and encephalomyelitis but not antibody induced or fibroblast induced arthritis. F Lange, E Bajtner, C Rintisch, Ann Rheum Dis. 64Lange F, Bajtner E, Rintisch C, et al. Methotrexate ameliorates T cell dependent autoimmune arthritis and encephalomyelitis but not antibody induced or fibroblast induced arthritis. Ann Rheum Dis. 2005;64:599-605.
Therapeutic and preventive effects of methotrexate on zymosan-induced arthritis in SKG mice. T Nagate, J Kawai, J Nakayama, J Vet Med Sci. 71Nagate T, Kawai J, Nakayama J. Therapeutic and preventive effects of methotrexate on zymosan-induced arthritis in SKG mice. J Vet Med Sci. 2009;71:713-717.
Methotrexate specifically modulates cytokine production by T cells and macrophages in murine collagen-induced arthritis (CIA): a mechanism for methotrexatemediated immunosuppression. M F Neurath, K Hildner, C Becker, Clin Exp Immunol. 115Neurath MF, Hildner K, Becker C, et al. Methotrexate specifically modulates cytokine production by T cells and macrophages in murine collagen-induced arthritis (CIA): a mechanism for methotrexate- mediated immunosuppression. Clin Exp Immunol. 1999;115:42-55.
Influence of polysaccharide fractions isolated from Caltha palustris L. on the cellular immune response in collagen-induced arthritis (CIA) in mice. A comparison with methotrexate. A Suszko, B Obminska-Mrukowicz, J Ethnopharmacol. 145Suszko A, Obminska-Mrukowicz B. Influence of polysaccharide frac- tions isolated from Caltha palustris L. on the cellular immune response in collagen-induced arthritis (CIA) in mice. A comparison with meth- otrexate. J Ethnopharmacol. 2013;145:109-117.
PTHrP and Indian hedgehog control differentiation of growth plate chondrocytes at multiple steps. T Kobayashi, U I Chung, E Schipani, Development. 129Kobayashi T, Chung UI, Schipani E, et al. PTHrP and Indian hedgehog control differentiation of growth plate chondrocytes at multiple steps. Development. 2002;129:2977-2986.
Indian hedgehog signaling regulates proliferation and differentiation of chondrocytes and is essential for bone formation. B St-Jacques, M Hammerschmidt, A P Mcmahon, Genes Dev. 13St-Jacques B, Hammerschmidt M, McMahon AP. Indian hedgehog signaling regulates proliferation and differentiation of chondrocytes and is essential for bone formation. Genes Dev. 1999;13:2072-2086.
Impairment of the chondrogenic phase of endochondral ossification in vivo by inhibition of cyclooxygenase-2. M P Janssen, M M Caron, B Van Rietbergen, Eur Cell Mater. 34Janssen MP, Caron MM, van Rietbergen B, et al. Impairment of the chondrogenic phase of endochondral ossification in vivo by inhibition of cyclooxygenase-2. Eur Cell Mater. 2017;34:202-216.
The effects of naproxen on chondrogenesis of human mesenchymal stem cells. J Antoniou, H T Wang, I Hadjab, Tissue Eng Part A. 21Antoniou J, Wang HT, Hadjab I, et al. The effects of naproxen on chondrogenesis of human mesenchymal stem cells. Tissue Eng Part A. 2015;21:2136-2146.
Naproxen affects osteogenesis of human mesenchymal stem cells via regulation of Indian hedgehog signaling molecules. O Salem, H T Wang, A M Alaseem, Arthritis Res Ther. 16152Salem O, Wang HT, Alaseem AM, et al. Naproxen affects osteogenesis of human mesenchymal stem cells via regulation of Indian hedgehog signaling molecules. Arthritis Res Ther. 2014;16:R152.
Effects of acetylsalicylic acid and naproxen on the synthesis and mineralization of collagen in the rat femur. L F Solheim, H Ronningen, N Langeland, Arch Orthop Trauma Surg. 105Solheim LF, Ronningen H, Langeland N. Effects of acetylsalicylic acid and naproxen on the synthesis and mineralization of collagen in the rat femur. Arch Orthop Trauma Surg. 1986;105:1-4.
Roles of COX-2 and iNOS in the bony repair of the injured growth plate cartilage. G Arasapam, M Scherer, J C Cool, B K Foster, C J Xian, C J Xian, J Cell Biochem. 99Arasapam G, Scherer M, Cool JC, Foster BK, Xian CJ, Xian CJ. Roles of COX-2 and iNOS in the bony repair of the injured growth plate car- tilage. J Cell Biochem. 2006;99:450-461.
Effects of long-term use of the preferential COX-2 inhibitor meloxicam on growing pigs. Bmc Gorissen, J J Uilenreef, W Bergmann, Vet Rec. 181564Gorissen BMC, Uilenreef JJ, Bergmann W, et al. Effects of long-term use of the preferential COX-2 inhibitor meloxicam on growing pigs. Vet Rec. 2017;181:564.
Nonsteroidal anti-inflammatory drugs cause inhibition of the growth plate in cultured rat metatarsal bones: retracted. H Park, D H Lee, J H Hwang, J J Hong, H W Kim, H W Kim, J Pediatr Orthop. 362218Park H, Lee DH, Hwang JH, Hong JJ, Kim HW, Kim HW. Nonsteroidal anti-inflammatory drugs cause inhibition of the growth plate in cul- tured rat metatarsal bones: retracted. J Pediatr Orthop. 2016;36(2):218.
Molecular therapeutics. Methotrexate and its mechanism of action. B N Cronstein, Arthritis Rheum. 39Cronstein BN. Molecular therapeutics. Methotrexate and its me- chanism of action. Arthritis Rheum. 1996;39:1951-1960.
Differential damage and recovery of human mesenchymal stem cells after exposure to chemotherapeutic agents. J Li, H K Law, Y L Lau, G C Chan, G C Chan, Br J Haematol. 127Li J, Law HK, Lau YL, Chan GC, Chan GC. Differential damage and recovery of human mesenchymal stem cells after exposure to che- motherapeutic agents. Br J Haematol. 2004;127:326-334.
Functional, molecular and proteomic characterisation of bone marrow mesenchymal stem cells in rheumatoid arthritis. M C Kastrinaki, P Sidiropoulos, S Roche, Ann Rheum Dis. 67Kastrinaki MC, Sidiropoulos P, Roche S, et al. Functional, molecular and proteomic characterisation of bone marrow mesenchymal stem cells in rheumatoid arthritis. Ann Rheum Dis. 2008;67:741-749.
Effect of methotrexate and folinic acid on skeletal growth in mice. M P Iqbal, M Ahmed, M Umer, N Mehboobali, A A Qureshi, A A Qureshi, Acta Paediatr. 92Iqbal MP, Ahmed M, Umer M, Mehboobali N, Qureshi AA, Qureshi AA. Effect of methotrexate and folinic acid on skeletal growth in mice. Acta Paediatr. 2003;92:1438-1444.
Damaging effects of chronic lowdose methotrexate usage on primary bone formation in young rats and potential protective effects of folinic acid supplementary treatment. C Fan, J C Cool, M A Scherer, Bone. 44Fan C, Cool JC, Scherer MA, et al. Damaging effects of chronic low- dose methotrexate usage on primary bone formation in young rats and potential protective effects of folinic acid supplementary treat- ment. Bone. 2009;44:61-70.
High-dose methotrexate causes short-term suppression of growth in rabbits. C Moell, S Garwicz, Acta Paediatr. 84Moell C, Garwicz S. High-dose methotrexate causes short-term sup- pression of growth in rabbits. Acta Paediatr. 1995;84:1237-1240.
Effect of naproxen on cancellous bone in ovariectomized rats. N Lane, T Coble, D B Kimmel, J Bone Miner Res. 5Lane N, Coble T, Kimmel DB. Effect of naproxen on cancellous bone in ovariectomized rats. J Bone Miner Res. 1990;5:1029-1035.
Prevention of bone growth defects, increased bone resorption and marrow adiposity with folinic acid in rats receiving long-term methotrexate. C M Fan, B K Foster, S K Hui, C J Xian, C J Xian, PLoS One. 746915Fan CM, Foster BK, Hui SK, Xian CJ, Xian CJ. Prevention of bone growth defects, increased bone resorption and marrow adiposity with folinic acid in rats receiving long-term methotrexate. PLoS One. 2012; 7:e46915.
Evaluating smoothened as a G-protein-coupled receptor for Hedgehog signalling. K L Ayers, P P Therond, Trends Cell Biol. 20Ayers KL, Therond PP. Evaluating smoothened as a G-protein-coupled receptor for Hedgehog signalling. Trends Cell Biol. 2010;20:287-298.
PTHrP promotes chondrogenesis and suppresses hypertrophy from both bone marrow-derived and adipose tissue-derived MSCs. Y J Kim, H J Kim, G I Im, Biochem Biophys Res Commun. 373Kim YJ, Kim HJ, Im GI. PTHrP promotes chondrogenesis and sup- presses hypertrophy from both bone marrow-derived and adipose tissue-derived MSCs. Biochem Biophys Res Commun. 2008;373: 104-108.
Indian Hedgehog signaling regulates transcription and expression of collagen type X via Runx2/Smads interactions. K Amano, M Densmore, R Nishimura, B Lanske, B Lanske, J Biol Chem. 289Amano K, Densmore M, Nishimura R, Lanske B, Lanske B. Indian Hedgehog signaling regulates transcription and expression of collagen type X via Runx2/Smads interactions. J Biol Chem. 2014;289: 24898-24910.
Mechanism of action of anti-inflammatory drugs. J R Vane, R M Botting, Scand J Rheumatol Suppl. 102Vane JR, Botting RM. Mechanism of action of anti-inflammatory drugs. Scand J Rheumatol Suppl. 1996;102:9-21.
Parathyroid hormone-related protein (PTHrP) accelerates soluble RANKL signals for downregulation of osteogenesis of bone mesenchymal stem cells. J Elango, S U Rahman, Y Henrotin, J Clin Med. 88Elango J, Rahman SU, Henrotin Y, et al. Parathyroid hormone-related protein (PTHrP) accelerates soluble RANKL signals for down- regulation of osteogenesis of bone mesenchymal stem cells. J Clin Med. 2019;8:8.
Bone morphogenetic protein 2 induces cyclo-oxygenase 2 in osteoblasts via a Cbfal binding site: role in effects of bone morphogenetic protein 2 in vitro and in vivo. D Chikazu, X Li, H Kawaguchi, J Bone Miner Res. 17Chikazu D, Li X, Kawaguchi H, et al. Bone morphogenetic protein 2 induces cyclo-oxygenase 2 in osteoblasts via a Cbfal binding site: role in effects of bone morphogenetic protein 2 in vitro and in vivo. J Bone Miner Res. 2002;17:1430-1440.
Anticancer drugs and the regulation of Hedgehog genes GLI1 and PTCH1, a comparative study in nonmelanoma skin cancer cell lines. U H Olesen, S Bojesen, J Gehl, M Haedersdal, M Haedersdal, Anticancer Drugs. 28Olesen UH, Bojesen S, Gehl J, Haedersdal M, Haedersdal M. Antic- ancer drugs and the regulation of Hedgehog genes GLI1 and PTCH1, a comparative study in nonmelanoma skin cancer cell lines. Anticancer Drugs. 2017;28:1106-1117.
Attenuated Wnt/betacatenin signalling mediates methotrexate chemotherapy-induced bone loss and marrow adiposity in rats. K R Georgiou, T J King, M A Scherer, Bone. 50Georgiou KR, King TJ, Scherer MA, et al. Attenuated Wnt/beta- catenin signalling mediates methotrexate chemotherapy-induced bone loss and marrow adiposity in rats. Bone. 2012;50:1223-1233.
Wnt/betacatenin signaling interacts differentially with Ihh signaling in controlling endochondral bone and synovial joint formation. K K Mak, M H Chen, T F Day, P T Chuang, Y Yang, Y Yang, Development. 133Mak KK, Chen MH, Day TF, Chuang PT, Yang Y, Yang Y. Wnt/beta- catenin signaling interacts differentially with Ihh signaling in con- trolling endochondral bone and synovial joint formation. Development. 2006;133:3695-3707.
Vascular endothelial growth factor (VEGF) in cartilage neovascularization and chondrocyte differentiation: auto-paracrine role during endochondral bone formation. M F Carlevaro, S Cermelli, R Cancedda, Descalzi Cancedda, F , Descalzi Cancedda, F , J Cell Sci. 113Pt 1Carlevaro MF, Cermelli S, Cancedda R, Descalzi Cancedda F, Descalzi Cancedda F. Vascular endothelial growth factor (VEGF) in cartilage neovascularization and chondrocyte differentiation: auto-paracrine role during endochondral bone formation. J Cell Sci. 2000;113(Pt 1): 59-69.
VEGF couples hypertrophic cartilage remodeling, ossification and angiogenesis during endochondral bone formation. H P Gerber, T H Vu, A M Ryan, Nat Med. 5Gerber HP, Vu TH, Ryan AM, et al. VEGF couples hypertrophic car- tilage remodeling, ossification and angiogenesis during endochondral bone formation. Nat Med. 1999;5:623-628.
Effect of parathyroid hormone on type X and type II collagen expression in mesenchymal stem cells from osteoarthritic patients. F Mwale, G Yao, J A Ouellet, A Petit, J Antoniou, J Antoniou, Tissue Eng Part A. 16Mwale F, Yao G, Ouellet JA, Petit A, Antoniou J, Antoniou J. Effect of parathyroid hormone on type X and type II collagen expression in mesenchymal stem cells from osteoarthritic patients. Tissue Eng Part A. 2010;16:3449-3455.
Evaluation of impaired growth plate development of long bones in skeletally immature mice by antirheumatic agents. Mmj Caron, B Van Rietbergen, Tmr Castermans, J Orthop Res. 39How to cite this article: Caron MMJ, van Rietbergen B, Castermans TMR, et al. Evaluation of impaired growth plate development of long bones in skeletally immature mice by antirheumatic agents. J Orthop Res. 2021;39:553-564.
. 10.1002/jor.24819https://doi.org/10.1002/jor.24819
| Diagnosis and treatment of osteopenia | 1,999,922 | The aim of the study was to evaluate the significance of growth retardation and bone loss as determinants of axial osteopenia in children with juvenile oligo- and polyarthritis. Bone mineral density (BMD), bone size (width), and bone volumetric density (BMDvol) were determined by dual x-ray absorptiometry at the lumbar spine and femoral neck in children with juvenile oligoarthritis (n = 36), polyarthritis (n = 75), and a group of healthy children (n = 66). Comparison of measurements showed that children with juvenile polyarthritis had a significantly reduced BMDvol (p < 0.05) and bone size (p < 0.01) at the lumbar spine, resulting in a 10.5% decrease in BMD (p < 0.001). At the femoral neck, the 16% decrease in BMD (p < 0.001) was attributed only to a decrease in BMDvol (p < 0.001). In juvenile oligoarthritis, the development of osteopenia was nonsignificant except at the femur, where the 6.6% decrease of BMD was associated with significant decrease of BMDvol (p < 0.05). The bone loss associated with juven... | Bone mineral density in juvenile onset Systemic lupus erythematosus | OBJECTIVE ::: X-linked hypophosphataemic rickets (XLH) results in defective bone mineralization and impaired growth. Treatment with oral phosphate (Pi) and calcitriol improves but does not normalize growth. This study assessed whether pubertal growth and metabolic control contribute to the height deficit. ::: ::: ::: METHODS ::: Study included patients with XLH who were treated with Pi-calcitriol from diagnosis to adult height; their hospital records, biochemistry and radiographs were reviewed. ::: ::: ::: RESULTS ::: Six females with XLH were included. Their mean peak height velocity and total height gain during puberty were nearly normal despite deteriorating metabolic control. ::: ::: ::: CONCLUSIONS ::: In treated girls with XLH, the pubertal growth is nearly normal despite suboptimal metabolic control. The major height loss occurs prior to puberty and is not recovered during the pubertal growth spurt. | [Clinico-roentgenological and physiological evaluation of the spine in patients with juvenile kyphosis]. | Aim of the study was to assess bone metabolism disturbances in children with acute lymphoblastic leukemia following cessation of chemotherapy. For this purpose we measured bone mineral density (BMD) and evaluated bone metabolism markers.Seventy-five patients (37 female, 38 males, mean age 10.77±3.80 years) were included. Lumbar spine BMD was measured by dual energy X-ray absorptiometry and serum calcium, phosphorus, magnesium, alkaline phosphatase, parathyroid hormone and 25OH vitamin D levels were analyzed. For characteristics of all patients at diagnosis data were retreived from hospital records and analyzed retrospectively.A total of 18.66% (14 patients) of patients were osteoporotic (z score -1 SD). There were no statisticaly significant differences between normal, osteopenic and osteoporotic groups for mean serum vitamine D (P=0.677), calcium (P=0.280), phosphorus (P=0.179), magnesium (P=0.675), ALP (P=0.092) and serum PTH (P=0.915) levels. According to ages (P=0.745) and gender (P=0.810) there were no significant differences in BMD. There were no significant differences between normal, osteopenic and osteoporotic patients for the total dose of prednisolone (P=0.334), dexamethasone, (P=0.734), methotrexate (P=0.911), granulocyte colony-stimulating factor (P=0.173) and cranial irradiation (P=0.912) they have received during chemotherapy. Bone fracture and aseptic necrosis rates were 12%, 8%, respectively.Osteoporosis and osteopenia are still observed in high rates after chemotherapy. We must be aware of this morbidity and must screen the patients for decreased BMD during the long duration of leukemia treatment. Supportive treatments should be evaluated to minimize these serious complications. | Bone mineral density in children with systemic lupus erythematosus and juvenile rheumatoid arthritis | BONE MINERAL DENSITY MENSURENENT IN 13～15 YEAR-OLD HEALTHY TEENAGERS IN SHENZHEN | Objective To study the change of bone mineral density (BMD) and its relationship with the level of fasting plasma insulin (EPI) in patients with type 2 diabetes mellitus (T2DM).Methods Dural energy X-ray absorptiometry was used to measure the BMD of the lumbar spines (L 1-L 4),proximal femur and bones of the whole body in 104 T2DM patients and 46 normal controls,and the chemiluminescent immunoassay (CLIA) was used to determine the EPI level.Results ① The FPI levels of the trial group and control group were (1.05 ± 0.40) μ U/mL and (0.91 ± 0.25) μ U/mL respectively (P0.05),The levels of BMD of the lumbar spines (L 1-L 4),proximal femur and bones of the whole body were respectively (1.12 ± 0.20) g/cm 2,(0.89 ± 0.16) g/cm 2 and (0.95 ± 0.16) g/cm 2 in the trial group,showed significant differences as compared with (0.92 ± 0.30) g/cm 2,(0.90 ± 0.12) g/cm 2 and (1.09 ± 0.19) g/cm 2 respectively in the control group (P0.05).② The prevalence rates of osteoporosis in the two groups were respectively 14.4% (15/104) and 6.5% (3/46) (P0.05).③ The diabetic patients were subdivided into NBMD group (T2DM with normal BMD) and IBMD group (T2DM with impaired BMD),then the average age in the NBMD group and IBMD group were (56.5 ± 12.5) and (62.4 ± 9.8) respectively,FPI levels were (1.12 ± 0.39) μ U/mL (0.91 ± 0.38) μ U/mL respectively,and the ratio of patients whose times of insulin application being more than one year accounted for 35.8% and 8.1% respectively (P0.05).Conclusion The BMD of type 2 diabetic patients is similar to healthy people,and a higher level of insulin can protect BMD to some extent. | Assessing Osteoporosis in the Young Adult |
1,999,923 | who did mark webster beat in his first grand slam | Tom Watson (golfer) Thomas Sturges Watson (born September 4, 1949) is an American professional golfer on the PGA Tour Champions, formerly on the PGA Tour. In the 1970s and 1980s, Watson was one of the leading players in the world, winning eight major championships and heading the PGA Tour money list five times. He was the number one player in the world according to McCormack's World Golf Rankings from 1978 until 1982; in both 1983 and 1984, he was ranked second behind Seve Ballesteros. He also spent 32 weeks in the top 10 of the successor Sony Rankings in their | Nick Faldo Peugeot Spanish Open, his first European Tour victory since 1984 (Faldo later said the win was a "major turning point," which restored his confidence). Two months later, in July 1987, Faldo claimed his first major title at The Open Championship at Muirfield. After rounds of 68 (-3) and 69 (-2), Faldo emerged through stormy conditions with an even-par 71, thus entering the final round one stroke behind American Paul Azinger. Faldo parred every hole in his final round for a one shot victory. At one point Azinger held a lead of three shots with nine holes to play, but bogeys | Nick Faldo Peugeot Spanish Open, his first European Tour victory since 1984 (Faldo later said the win was a "major turning point," which restored his confidence). Two months later, in July 1987, Faldo claimed his first major title at The Open Championship at Muirfield. After rounds of 68 (-3) and 69 (-2), Faldo emerged through stormy conditions with an even-par 71, thus entering the final round one stroke behind American Paul Azinger. Faldo parred every hole in his final round for a one shot victory. At one point Azinger held a lead of three shots with nine holes to play, but bogeys | Bernard Mitton any Grand Slam tournament, he reached the fourth round on three separate occasions. In his very first Grand Slam tournament in 1973, he reached the fourth round of Wimbledon before losing to Connors 6–3, 6–3, 6–2. In 1976, he again reached the fourth round at Wimbledon, defeating former champion John Newcombe in the third round (3–6, 6–3, 9–7, 9–7) before falling to Raúl Ramírez (9–7, 3–6, 6–1, 6–1). In 1980, he reached the fourth round at the US Open, defeating José Luis Clerc in the first round (6–3, 6–2, 4–6, 2–6, 7–5) before finally losing to Connors (7–6, 6–4, 6–4). | Thomas Sturges Watson (born September 4, 1949) is an American professional golfer on the PGA Tour Champions, formerly on the PGA Tour.
In the 1970s and 1980s, Watson was one of the leading golf players in the world, winning eight major championships and heading the PGA Tour money list five times. He was the number one player in the world according to McCormack's World Golf Rankings from 1978 until 1982; in both 1983 and 1984, he was ranked second behind Seve Ballesteros. He also spent 32 weeks in the top 10 of the successor Sony Rankings in their debut in 1986.
Watson is also notable for his longevity: at nearly sixty years of age, and 26 years after his last major championship victory, he led after the second and third rounds of The Open Championship in 2009, but lost in a four-hole playoff. With a chance to win the tournament with par on the 72nd hole, he missed an putt, then lost to Stewart Cink in the playoff.
Several of Watson's major victories came at the expense of Jack Nicklaus, the man he replaced as number one, most notably the 1977 Masters, 1977 Open Championship, and the 1982 U.S. Open. Though his rivalry with Nicklaus was intense, their friendly competitiveness served to increase golf's popularity at the time.
In Watson's illustrious career, his eight major championships include five Open Championships, two Masters titles, and one U.S. Open title. The only major that has eluded him is the PGA Championship; if he had won it would have put him in an elite group of golfing "career grand slam" winners that includes Gene Sarazen, Ben Hogan, Gary Player, Jack Nicklaus, and Tiger Woods. In all, Watson's eight majors ranks sixth on the list of total major championship victories, behind only Nicklaus, Woods, Walter Hagen, Hogan, and Player.
Watson is also regarded as one of the greatest links players of all time, a claim backed up by his five Open Championship victories, his runner-up finishes at the 1984 Open Championship and 2009 Open Championship, and his three Senior British Open Championship titles in his mid-50s (2003, 2005, and 2007).
Watson played on four Ryder Cup teams and captained the American side to victory in 1993 at The Belfry in England. More than twenty years later, Watson again captained the U.S. Team in 2014 in Scotland, this time in a loss.
Personal life
Born in Kansas City, Missouri, Watson was introduced to the game by his father Ray. His early coach was Stan Thirsk at the Kansas City Country Club. Watson first gained local renown while on his high school team at The Pembroke-Country Day School in Kansas City. Watson won four Missouri State Amateur championships, 1967, 1968, 1970, and 1971. He attended Stanford University, playing on the golf and table tennis teams, joining Alpha Sigma Phi, and graduating with a degree in psychology in 1971. Today he has a home in Overland Park, Kansas, after fighting a prominent legal battle to prevent annexation by the city.
Although he voted for George McGovern in his first presidential election, Watson later became a Republican. He has donated to the National Rifle Association.
Watson was a member of Kansas City Country Club from the beginning of his professional career. However, in 1990 he was unsettled by the idea that the leaders of the club rejected an applicant due to his Jewish faith. Watson, whose wife at the time and two children were Jewish, stated, "It was a very personal decision. I just didn't feel my family was welcome. It was time to say, 'Hey, let's be fair to people. Let's not judge people on the basis of race or faith.'" Watson abruptly resigned in 1990. However the Jewish applicant, H&R Block founder Henry W. Bloch, was ultimately admitted to the club as were other minorities. Disarmed by these overtures, Watson rejoined the club.
PGA Tour
1970s
Watson joined the PGA Tour in 1971. He hired Bruce Edwards to be his caddie for the first time at the 1973 St. Louis tournament held at Norwood Hills Country Club, and the two connected, with Edwards caddying for Watson at most events after that for a period of many years.
Watson contended in a major championship for the first time at the U.S. Open in 1974 at Winged Foot, but he faded badly in the final round after having the 54-hole lead. Following this disappointment, Watson was approached in the locker room by legendary retired player Byron Nelson, a broadcaster at the event, who offered encouragement, insight and assistance. Nelson and Watson spoke briefly at that time, with Nelson saying he liked Watson's game and aggressiveness, and offered to help him improve. Watson, although disappointed by his weak finish, was flattered to receive Nelson's interest. However, the two men did not manage to get together to work on golf in depth until several months later, when Watson played in the Tour's Byron Nelson Classic in the Dallas area, and visited Nelson's nearby home. The two men would eventually develop a close and productive teacher-student relationship and friendship; Nelson had similarly mentored the young rising star Ken Venturi during the 1950s.
Only two weeks after the Winged Foot collapse in 1974, Watson won his first Tour title at the Western Open near Chicago, coming from six shots back in the final round at Butler National. With Nelson's guidance on swing mechanics and course management, and determined hard work, Watson's game advanced quickly, and he won his first major championship, the 1975 Open Championship, on his first appearance in the event in Britain. Watson holed a 20-foot putt for a birdie on the 72nd hole to tie Jack Newton. The following day Watson won an 18-hole playoff at Carnoustie by a stroke, carding a 71 to Newton's 72. Watson was able to gain the upper hand in the playoff after chipping in for an eagle at the 14th hole. Watson is one of only four players since World War II to have won the Open Championship on their debut, the others being Ben Hogan (1953), Tony Lema (1964) and Ben Curtis (2003).
Watson won his second major championship and his first green jacket as Masters champion in 1977 after a duel with Jack Nicklaus. During the final round, Watson stood on the 17th green tied with Nicklaus for the lead. Watson holed a 20-foot putt for a birdie to go one stroke ahead of Nicklaus. Watson's par on the 18th hole won him the Masters title by two strokes after Nicklaus had a bogey on the 18th.
Watson's 1977 Open Championship victory, at Turnberry in Scotland, was especially memorable, and is considered by many to be the finest tournament played in the second half of the 20th century. After two rounds, he and Jack Nicklaus were one shot out of the lead and paired for the third round. Both shot 65, ending the third round three shots clear of the field. Watson and Nicklaus were again paired for the final round. On the last day, the two were tied after 16 holes. Nicklaus missed a makeable birdie putt on 17, losing his share of the lead to Watson, who birdied 17. On the 18th, Nicklaus drove into the rough, while Watson drove the fairway. Watson's approach landed two feet from the flag, while Nicklaus, after a drive into deep rough and near a gorse plant, managed to get his approach 40 feet away. Nicklaus sank his birdie putt to finish with a 66, but Watson followed suit with his own birdie, finishing with a second straight 65 and his second Open, with a record score of 268 (12 under par). The two players finished well ahead of the other challengers (Hubert Green in third place was ten strokes behind Nicklaus, at 279), and shot the same score every round except for the final day, which was then played on Saturday.
In 1978, as defending Masters champion, Watson needed a par on the 18th hole of his final round to tie over 72 holes with Gary Player, who had shot a record-tying final round of 64. However, Watson missed out on a playoff by sending his approach shot to the 18th into the gallery and missing the 10-foot par putt he needed for a playoff. He finished tied for 2nd place at Augusta, one stroke behind Gary Player. Watson had five PGA Tour victories in 1978, but he also had one of the biggest disappointments of his career in that year's PGA Championship in August at Oakmont. Watson had a five-shot lead after 54 holes, but lost the tournament in a 3-way sudden-death playoff to John Mahaffey. This would be the closest that Watson came to landing the one major title that eluded him.
In 1979, Watson had a further five PGA Tour victories, including a five-shot victory in the Sea Pines Heritage Classic, which he won with a then tournament record 14-under par 270. Watson again finished runner-up at the Masters in 1979, when he lost in a 3-way sudden-death playoff to Fuzzy Zoeller. This was the first sudden-death playoff at the Masters, with the previous playoff at Augusta in 1970 having taken place on Monday under an 18-hole format. Watson also finished 2nd in The Players Championship in 1979.
1980s
Watson had an outstanding year in 1980. A brilliant third round of 64 at Muirfield helped him to win his third Open Championship title in Britain by four strokes. He was the leading money winner on the PGA Tour for the fourth consecutive year, winning six tournaments in America. Watson showed tremendous consistency in 1980, with sixteen top-10 finishes on the PGA Tour that year. In August 1980, after his sixth victory of the year in America, Watson said: "I love this game. I feel that dedication is the only way to improve. I've been more consistent this year than in the previous three years."
In 1981, Watson won his second Masters title at Augusta by two strokes over Jack Nicklaus and Johnny Miller. Watson had a further two Tour victories in 1981 at the USF&G New Orleans Open and the Atlanta Classic.
The U.S. Open was the major that Watson most wanted to win. In 1982 at Pebble Beach, he was able to realize his dream after an engaging duel with Jack Nicklaus in one of the most memorable major championships of all time. Playing three groups ahead of Watson in the final round, Nicklaus charged into a share of the lead with five consecutive birdies. When Watson reached the par-3 17th hole the two were still tied, but with Nicklaus safely in the clubhouse at 4-under par 284. Watson hit his tee shot on the 17th into the rough just off the green, leaving an extremely difficult chip shot downhill on a very fast green. While being interviewed on national television and fully aware of Watson's perilous predicament, Nicklaus appeared confident he was on his way to an unprecedented fifth U.S. Open championship. Watson's chip shot, amazingly, hit the flag stick and fell into the cup, giving him a miraculous birdie and setting the stage for yet another win over Nicklaus. Watson went on to birdie the 18th as well, for a final margin of two shots.
The following month in July 1982 at Royal Troon in Scotland, Watson became only the third golfer since World War II to win the U.S. Open and Open Championship in the same year after Ben Hogan (1953) and Lee Trevino (1971) - a feat later matched by Tiger Woods (2000). After the first two rounds of the 1982 Open Championship, Watson was seven shots behind the leader Bobby Clampett, whose commanding lead was reduced after a third round of 78. During the final round, Nick Price, who was playing in one of the groups behind Watson, gained the lead. Watson stood on the 18th tee of the final round two strokes behind Price. Watson waited patiently after his round as Price's lead evaporated, leaving Watson the Open winner by one stroke.
In 1983, as defending U.S. Open champion at Oakmont, Watson shared the 54-hole lead with Seve Ballesteros. In the final round though, Watson missed a 6-foot putt for par on the 17th and finished in 2nd place, one stroke behind the winner Larry Nelson. The following month in July 1983, Watson won his fifth Open Championship and the last of his eight majors at Royal Birkdale, his only Open victory on English soil. (His four other titles came in Scotland.)
In 1984, Watson finished runner-up for the third time at the Masters, finishing two strokes behind the champion Ben Crenshaw. Watson had three Tour wins in 1984, including his third victory in the Western Open after a playoff against Greg Norman. A fortnight later in the 1984 Open Championship at St Andrews, Watson was in contention during the final holes to win a third consecutive Open and a sixth Open Championship overall to tie the record for the most Open wins by Harry Vardon. However, Watson bogeyed the par-4 "Road Hole" 17th and Seve Ballesteros birdied the 18th, resulting in a victory for Ballesteros and Watson finishing in a tie for 2nd place.
After his runner-up finish in the 1984 British Open, Watson did not manage to win a PGA Tour event for the next three years until the 1987 Nabisco Championship. Watson went from being the PGA Tour money leader in 1984 to finishing 18th on the PGA Tour's money list in 1985. As a result of a decline in form, Watson missed out on a place in the 1985 U.S. Ryder Cup team.
In the 1986 Hawaiian Open, Watson was the third-round leader and was aiming to end his winless streak since July 1984. However, Watson bogeyed the 71st and 72nd holes and finished in a tie for 3rd place, behind the winner Corey Pavin.
In the 1987 U.S. Open, Watson had a one-shot lead going into the final round at the Olympic Club. Watson was a gallery favorite during the tournament. He had strong support from the spectators having played golf for Stanford University, 30 miles south of the Olympic Club in San Francisco. He was aiming to win his ninth major championship, which would have tied him for major wins with Ben Hogan and Gary Player, but Watson lost the tournament by a stroke to Scott Simpson. In the final round, Simpson had three consecutive birdies on the back-nine to take the lead. Watson's 45-foot putt for a birdie on the 72nd hole which would have forced a playoff with Simpson was about two inches short.
Watson's stellar play on the PGA Tour faded in the late 1980s when he began to have problems putting even though his tee-to-green game seemed to improve. During this period he had some near-misses in tournaments. Watson finished 2nd at the 1988 NEC World Series of Golf, missing a 3-foot putt in a playoff against Mike Reid.
In 1989, Watson was in contention during the Open Championship at Royal Troon, but he finished in 4th place, two strokes outside the playoff between Mark Calcavecchia, Wayne Grady and Greg Norman.
1990–2019
At the 1991 Masters Tournament, Watson stood on the 18th tee in the final round at Augusta with a share of the lead but had a double-bogey 6 to finish in a tie for 3rd place, two strokes behind the champion Ian Woosnam. It was Watson's 15th consecutive top-20 finish at The Masters, having finished in the top-10 of The Masters in 13 of the 15 years between 1977 and 1991.
In 1994, when The Open Championship returned to Turnberry, the site of his 1977 victory, Watson commented, "Sometimes you lose your desire through the years. Any golfer goes through that. When you play golf for a living, like anything in your life, you are never going to be constantly, at the top". He finished tied for 11th at the Open Championship that year, but he had a revival in the late 1990s, winning the 1996 Memorial Tournament and gaining the last of his 39 wins on the PGA Tour at the 1998 MasterCard Colonial when he was 48 years old.
In 1997 Watson won the Japan Golf Tour's prestigious Dunlop Phoenix tournament for the second time. It was the last of his four victories in Japan.
In the 2003 U.S. Open, at age 53, he shared the opening-round lead by shooting a 65 with his long-time caddy Bruce Edwards carrying his clubs and giving advice. Edwards had been diagnosed with Lou Gehrig's disease earlier in the year, and Watson contributed significant time and money that year with Bruce to raise money for research into finding a cure for motor neuron disease. Edwards died on April 8, 2004.
Watson was one of two players to play with Jack Nicklaus in the final two rounds of golf in Nicklaus' career, which ended at the 2005 Open Championship on the Old Course at St Andrews. Englishman Luke Donald was the third member of the group.
In the first round of the 2009 Open Championship at Turnberry, Watson shot a 5-under 65, one stroke behind the leader Miguel Ángel Jiménez. In the second round, he tied for the lead after making a huge putt on the 18th green. His score for the round was 70, 38 out and 32 back. This made Watson – at 59 years of age – the oldest man to have the lead after any round of a major. In addition, with a relatively low-scoring third round, one-over-par 71, he kept the lead outright by one shot, so also became the oldest player to lead a major going into the last round. He acknowledged after that 3rd round he was thinking of Bruce Edwards as he walked the 18th fairway.
Watson finished regulation 72-hole play in the Open tied for the lead with Stewart Cink, with a cumulative score of −2. He needed a par on the 72nd hole to capture a sixth career Open Championship title, but his second shot on the 72nd hole went over the green. Then, from several yards behind the 18th green, Watson first putted up the slope and past the hole, then missed a second 8-foot putt by about 6 inches to the right of the cup. His bogey led to a four-hole aggregate playoff with Cink, running through the 5th, 6th, 17th, and 18th holes. With several errant shots not typical of the previous 72 holes, he lost the playoff by six strokes.
The following April, Watson competed in the 2010 Masters Tournament. Watson shot an opening-round 67, one shot off the first-round lead held by fellow Champions Tour player Fred Couples. Watson subsequently posted rounds of 74, 73, and 73. His 72-hole, one-under-par total of 287 gave Watson a share of eighteenth place. Watson thus became only the second player in history, after Sam Snead, to post a top-20 finish in at least one major championship in five different decades. Watson holds the record for the longest time span between first and last playoffs on the PGA Tour. That time span is 34 years, 6 days. Watson won the 1975 Open Championship in an 18-hole playoff and 34 years later lost a playoff for the 2009 Open Championship.
Due to his performance in 2009 and early 2010, along with his 1982 U.S. Open victory at Pebble Beach, the USGA awarded Watson a special exemption to the 2010 U.S. Open. He finished the tournament tied for 29th. Watson is the only golfer to participate in all major professional championships contested at Pebble Beach: 1972, 1982, 1992, 2000, and 2010 U.S. Opens, and the 1977 PGA Championship.
In an interview in 2012, Watson admitted that he was "distraught" at coming so close to becoming the oldest Major winner at the age of 59 and said that the experience in the 2009 Open Championship "tore his guts out". Watson said of his approach shot to the green at the 72nd hole, when he needed a par to win the Open: "I was going right at the flag but with the uncertainty of links golf, maybe a gust of wind took it a bit further than it was supposed to. I felt extreme disappointment that night but the one good thing that came of that was the response of people around the world."
For the 2015 Open Championship, Watson's exemption for his 2009 finish was extended to give him an opportunity to play at St. Andrews and make one final Open appearance. Watson won Open Championships at five different courses, but St. Andrews was not among them. He missed the cut and made an emotional walk across the Swilcan Bridge at twilight. In April 2016, he played in his final Masters. After saying in the lead up to the event that he 'couldn't compete' anymore, Watson missed the cut by two strokes.
Despite no longer competing at the full Masters, Watson won the 2018 Masters Tournament Par-3 contest at the age of 68, the oldest ever to win the event.
In July 2019, Watson played his final competitive event on British soil, when he played in the Senior British Open for the final time.
Streaks
Watson is the only golfer to score a round of 67 or less in all 4 majors at least once in 5 different decades. His best round in the Masters is a 67. His first 67 came in 1977. Other 67s were scored in the 1980s, 1990s and 2010s. His most recent 67 at Augusta was his opening round in 2010. His US Open low score is a 65. He scored 65 in 1987 and 2003, 66 in 1993 and he first shot 67 in 1975. At the British Open, Watson's low score is a 64 in 1980. 65s were scored in 1977 (twice), 1994 and 2009 (all 65s at the Open were scored at Turnberry). Finally, at the PGA Championship, Watson's low score of the 1970s was a 66 in 1979. In the 1980s he scored a 67 in 1980, 1983, 1985, and 1989. His low PGA score is a 65 in 1993 & 2000.
Watson also sets a record for having a round of 65 or less in at least one of the majors in 4 different decades. 1970s: 1977 British Open (65 in rounds 3 and 4), 1980s: 1980 British Open (64 in round 3), 1990s: 1993 PGA Championship (65 in round 2), and 2000s: 2000 PGA Championship (65 in round 3).
Watson's 67 in the first round at the 2010 Masters also gives him a record to be the only person to have at least one round of 67 or less in any of the four majors in five different decades (1970s, 1980s, 1990s, 2000s, and 2010s).
Champions Tour
Watson joined the Champions Tour in 1999, the same year he earned an honorary membership of the Royal and Ancient Golf Club of St Andrews in Scotland. He has 14 wins on the Champions Tour, including six senior majors, while playing a limited schedule of events. Watson shares with Gary Player and Bernhard Langer three victories for each in the Senior Open Championship. Watson revisited his 1977 Open Championship win at Turnberry with another win there in the 2003 Senior Open Championship. He followed this up with victories in 2005 and 2007.
After residing for many years in Mission Hills, Kansas, Watson moved to Stilwell, Kansas with his wife, two children, and three stepchildren. His house has since been annexed by the city of Overland Park within Johnson County.> He designed the National Golf Club of Kansas City golf course.
Playing style
Watson has been one of the most complete players ever to play golf, as evidenced by his competitiveness in the 2009 Open Championship at the age of 59. Standing 5 ft 9 in and weighing 160 pounds during his PGA Tour years, he achieved abundant length with accuracy, played aggressively, developed a superlative short game, and in his prime was a very skilled and confident putter. Watson is renowned as an exceptional bad-weather golfer, having displayed this gritty talent best in the difficult and varied conditions of The Open Championship. At the height of his career, he was well known for his excellent recovery skills, especially around the greens. Years later, if a player escaped from trouble and somehow made par, tour players described the escape as a "Watson par".
Watson also developed a reputation for scrupulous honesty, once even calling a penalty stroke on himself for slightly moving a ball that was in deep rough, although no one else had seen it. In 1991, Watson was critical of the heckling of his playing partner Ian Woosnam during the final round of the Masters. Some of the Augusta crowd were vociferous in their support for Watson, in the hope of seeing him win a third Masters title. Watson, however, calmed Woosnam after he was upset at being yelled at by a member of the crowd on the 14th tee. Watson later said: "There's been a breakdown in decorum, and I don't feel good when partisanship spills over."
In 2010, Watson said that he agreed with Lee Westwood's assertion that Tour players who used 20-year-old Ping-Eye 2 wedges to get around new rules prohibiting box grooves (i.e., grooves rectangular [including square] or U-shaped in cross-section) were going against "the spirit of the game." Watson also reprimanded Tiger Woods for his "language and club-throwing" and said that Woods needed to "show humility" to the public.
Watson has been outspoken about the effect that too much prize money can have on some golfers. In an interview in 2010, Watson said: "I do believe that, in certain instances, players can be corrupted by the amount of money they make. I think too much money corrupts the desire and for some players it's about how much money they make rather than just trying to be the best player they can."
Distinctions and honors
Named PGA Player of the Year 6 times, 1977, 1978, 1979, 1980, 1982 and 1984, and trails only Tiger Woods, who has been named Player of the Year 11 times.
Won the Vardon Trophy for lowest scoring average three straight years: 1977, 1978, and 1979.
Played on four Ryder Cup teams: 1977, 1981, 1983, and 1989 and captained the victorious 1993 team along with the 2014 team. Watson also qualified for the 1979 matches but withdrew from the United States team due to his wife being about to give birth. He was replaced by Mark Hayes.
Voted the Bob Jones Award in 1987, the highest honor given by the United States Golf Association in recognition of distinguished sportsmanship in golf.
Inducted into the World Golf Hall of Fame in 1988.
Inducted into the Stanford Athletic Hall of Fame
Won 1992 GCSAA Old Tom Morris Award
Resigned from the Kansas City Country Club in 1991 in protest to its exclusion of people of Jewish ethnicity. He subsequently rejoined after the club's acceptance of Jewish and minority members.
Became involved with golf course design in the early 1990s.
Author or co-authored several books, including Tom Watson's Strategic Golf. His latest, The Timeless Swing, was released by Atria books in March 2011.
Has written a golf instruction column in Golf Digest magazine since the mid-1970s.
Was ranked as the 10th greatest golfer of all time in the 2000 Golf Digest magazine list.
Is, after Sam Snead, only the second Golf Professional Emeritus at The Greenbrier Resort in White Sulphur Springs, West Virginia
Is the oldest player to hold the lead after 54 holes at a major championship (2009 Open Championship at Turnberry, Scotland)
Is the oldest player to lead after any completed round at a major championship (2009 Open Championship at Turnberry, Scotland)
Is the oldest player to shoot under par at the Masters Tournament (2015 Masters Tournament)
Granted a lifetime membership to the European Tour
At 68, became the oldest player ever to win the Masters Tournament Par-3 contest
Professional wins (70)
PGA Tour wins (39)
PGA Tour playoff record (9–5)
European Tour wins (8)
European Tour playoff record (1–3)
Japan Golf Tour wins (4)
Japan Golf Tour playoff record (0–1)
PGA Tour of Australasia wins (1)
Asia Golf Circuit wins (1)
Other wins (2)
Champions Tour wins (14)
Champions Tour playoff record (3–8)
Other senior wins (9)
1999 Diners Club Matches (with Jack Nicklaus)
2000 Hyundai Team Matches (with Jack Nicklaus)
2004 Wendy's Champions Skins Game
2005 Liberty Mutual Legends of Golf – Raphael Division (with Andy North)
2006 Liberty Mutual Legends of Golf – Raphael Division (with Andy North)
2007 Wendy's Champions Skins Game (with Jack Nicklaus), Liberty Mutual Legends of Golf – Raphael Division (with Andy North)
2010 Wendy's Champions Skins Game (with Jack Nicklaus)
2011 Wendy's Champions Skins Game (with Jack Nicklaus)
Major championships
Wins (8)
1Defeated Newton in 18-hole playoff; Watson (71), Newton (72)
Results timeline
CUT = missed the halfway cut (3rd round cut in 1976 Open Championship)
"T" indicates a tie for a place.
Summary
Most consecutive cuts made – 19 (1985 Open Championship – 1990 Masters)
Longest streak of top-10s – 7 (1982 Masters – 1983 Open Championship)
Results in The Players Championship
CUT = missed the halfway cut
"T" indicates a tie for a place
Results in World Golf Championships
QF, R16, R32, R64 = Round in which player lost in match play
Senior major championships
Wins (6)
1Defeated Mason in a playoff with par at the second extra hole.
2Defeated Smyth in a playoff with par at the third extra hole.
3Defeated Eger in a playoff with birdie at the first extra hole.
Results timeline
Results not in chronological order before 2017.
Note: The Senior British Open was not a Champions Tour major until 2003.
CUT = missed the halfway cut
"T" indicates a tie for a place
U.S. national team appearances
Professional
Ryder Cup: 1977 (winners), 1981 (winners), 1983 (winners), 1989 (tie), 1993 (non-playing captain, winners), 2014 (non-playing captain)
Wendy's 3-Tour Challenge (representing Senior PGA Tour): 1999 (winners), 2000, 2001
Golf courses designed
Watson is a member of the American Society of Golf Course Architects and has designed golf courses through his Tom Watson Design company in Johnson County, Kansas.
Ballybunion Golf Club – County Kerry, Ireland (1995 redesign)
Cassique Golf Course, Kiawah Island, South Carolina
National Golf Club of Kansas City, Parkville, Missouri (Route 45 which passes the course is called the "Tom Watson Parkway")
Independence Course at Reunion Resort & Club, Orlando, Florida
Phoenix Resort, Miyazaki, Japan
The Links at Spanish Bay, Pebble Beach, California (with Sandy Tatum and Robert Trent Jones, Jr.)
Shadow Glen the Golf Club, Olathe, Kansas (with Jay Morrish and Tom Weiskopf)
Loch Lloyd Country Club, Village of Loch Lloyd, Missouri (Renovation)
The Conservatory, Hammock Beach resorts, Palm Coast, Florida
Mozingo Lake Golf Course (Junior 9 course), Maryville, Missouri
The Manor Golf & Country Club, Milton, Georgia
See also
1971 PGA Tour Qualifying School graduates
List of golfers with most PGA Tour wins
List of men's major championships winning golfers
List of golfers with most Champions Tour wins
List of golfers with most Champions Tour major championship wins
List of golfers with most wins in one PGA Tour event
Bay Area Sports Hall of Fame
References
External links
American Society of Golf Course Architects profile
American male golfers
Stanford Cardinal men's golfers
PGA Tour golfers
PGA Tour Champions golfers
Ryder Cup competitors for the United States
Winners of men's major golf championships
Winners of senior major golf championships
World Golf Hall of Fame inductees
Golf writers and broadcasters
Golfers from Missouri
The Greenbrier people
Sportspeople from Kansas City, Missouri
People from Mission Hills, Kansas
People from Stilwell, Kansas
1949 births
Living people | Jeremy Bates (tennis) to France's Guy Forget. In the 1992 encounter Bates held a match point against Forget in the fourth-set, but failed to convert it and ended up losing in five sets 7–6, 4–6, 6–3, 6–7, 3–6, narrowly missing out on a place in the quarter-finals. He was also the first ever opponent of Andre Agassi in the main draw of a Grand Slam tournament, in the first round of the U.S. Open in 1986, winning in four sets. Bates won one top-level singles title during his career – at Seoul in 1994 when he was aged 31, becoming the first British | the Grand Slam era. Although both Ballachulish and Lovat have won the Glasgow Celtic Society and MacTavish Cups respectively, this was outside a Grand Slam season, (indeed Balla's win was before the advent of the MacAulay Cup) although Lovat won the first Grand Slam two years later in 1953. Kingussie won 3 Grand Slams in a row in the late 1990s. The trophies involved in winning the Grand Slam have developed with the advent of the national Premier Division replacing the South Division One and the North Division One. Grand Slam (shinty) The Grand Slam in shinty consists of a | 1977 Open Championship But Nicklaus slashed his 8-iron recovery onto the front of the green and sank his putt for a remarkable birdie and a bogey-free 66. Now needing a seventh birdie of the round to avoid an 18-hole playoff, Watson sank the two-footer for his second straight 65, second Open, and third major title. With birdies on four of the final six holes, his total of 268 was eight strokes better than the previous best score ever in the Open. Watson and Nicklaus finished well ahead of the other challengers, and shot the same score every day, except on Saturday. The third | 1,999,923 | Mark Webster (darts player) said had given him a new lease of life. Webster's first major semi-final in almost four years ended with a 4–1 loss to reigning champion Michael van Gerwen. 5–3 wins over Keegan Brown and Michel van der Horst helped Webster qualify from his group at the Grand Slam and he then took out 10 of his 14 attempts at a double to eliminate Gary Anderson 10–6. However, the opposite happened in the quarter-finals against Raymond van Barneveld as Webster could only hit 34% of his doubles to be beaten 16–12. Webster did not drop a set in seeing off Mick | how many times did john part win the world darts championship | how many test runs did ken barrington score for england in 1964 | how many goals has rowena webster scored in her national league season | what happened to corey webster in 2017 | Harry Kane scored twice as Tottenham beat Chelsea 5-3 on Thursday .
The Spurs striker covered 11.35km at White Hart Lane .
Tottenham fans have been impressed with Kane's effort on the pitch . | how many times has edward whitaker won sports betting writer of the year | Who was the first player to score 4 goals in the english premmier league? | which horse did graham lee ride to victory in the 2006 peterborough chase |
1,999,924 | Newbie Witch looking for help with meditation! | Hello guys I'm new to the meditation please help me give me some tips like where to begin and how to stay on track thanks | Hello,
I am a 19 year old male who stumbled upon this sub a few months ago. I've been lurking for a while, and really believe that I could benefit from what meditation has to offer. I have read the FAQ and briefly looked into the different types of meditation, but I'm hoping for further advice on which type of meditation to begin with.
To tell you a bit about myself, I'm a young university student. I have been dealing with some pretty severe mental health issues for a couple of years now (most notably anxiety, psychosis, and depression). I am a rational thinker (and because of this, would most likely prefer a type of meditation that has proven results), although I am also open to trying new things.
Aside from that, I would appreciate any advice or tips that you may have for a beginner! If you have any further questions about me that may help you give me advice, I would be more than happy to answer any of them. :)
Thank you! | Hello! I know this is going to sound like a conflicting request but lately I’ve really enjoyed guided meditation and was hoping to find something focused specifically on deepening my craft or grounded in magick. The challenge is that, at one point or another, most of what I’ve found on YouTube veers into the realm of fantasy. I am not judging anyone’s beliefs or practices, but when a meditation introduces fairies or magical creatures, it really disrupts the experience for me. Sometimes that can be fun but not when I’m trying to do the work.
Maybe I’m asking for the moon, but can anyone recommend guided meditation for witches that doesn’t go full dungeons and dragons? | What can meditation do to help me? | Meditation is probably one of the most difficult topics to describe and teach yet Sally Kempton has a wonderful way of drawing you into this world. I have read another of her books which prompted me to buy this. Part of me wants to race through it because its so enjoyable to read yet another part of me wants to slowly savour it. I know that she will be a go to read whenever I feel a need to instill fresh enthusiam back into my practice. I would recommend to anyone interested in Meditating whether a beginner or advanced practioner, I have found her to be the most profound author on the topic I have read so far, she makes it so accessible. | Hey, so I'm very new to witchcraft, and I've heard from multiple people online that a good thing to do when starting out is to practice meditation. I was just wondering, is there something specific I'm supposed to think about while meditating, or do I just let my mind wander? | Everyone are speaking on how meditation aids NoFap. I too wanna try it. What are some ways on how to meditate? | This book is a clear, beautifully simple, and straightforward introduction to meditation. Just reading it made me feel calmer, and it gave me many ideas of different types of meditations to try. My favorite section was on learning to let go of thinking we know what's going to happen, and being open to not knowing. In this politically-chaotic time, this was exactly the lesson I needed to hear. I will be recommending this book to all the new working mothers I teach, who are interested in learning how to meditate. | 1,999,924 | Hi, I'm new to all the witchy stuff and I'm trying to start on meditation.
I'm okay sitting with a guide for a longer period of time.
My issue is getting my eyes to settle, I can't seem to keep them closed and focus onto sitting in a spot, they move around so much.
Does anyone have any advice? | New to meditating and wondering where i should be focusing my eyes (Whilst closed)? | Hey Reddit, what to do with your eyes while meditating? | How to focus during meditation? | Help! Can meditate a few times than every time after that I spend the whole time being distracted by thoughts and can never focus | These are probably fine for meditating if you don't move from you back | My mind wonders an awful lot, making Meditation difficult. Advice? | How should one deal with dullness not related to meditation during a sit? | Meditation and Focusing on Pauses |
1,999,925 | Shades of Cool Guitar Solo Pedals | hey all! i really love some of the guitar tones on clean, more specifically on skin and cool. what kind of guitar pedals would work well to get a similar sound? | What is a good guitar distortion pedal? | So like the title says, I'm extremely new to guitar pedals. I have a decent amp, a EXH memory toy, an EXH analogizer (a friend gave it to me for free, threw it in and it sounds pretty nice) and a Boss OD. I know, I know, not really too many great pedals but everyone has to start somewhere.
I'd really love to know what pedals go into something that sounds like this neat section but I've seen the band do a similar sound live, completely with pedals and a guitar.
So, if you can suggest pedals that might give me a similar sound, or an arrangement of certain pedals, I'd really appreciate it! | Title says it.
For me it's my Diamond TRM-1 tremolo pedal. I usually keep the depth set very low, so it's barely noticeable. It gives my guitar tone an interesting "shark" '60s tone that's hard to identify at first. The intro of this video is a good example., but nowadays a pedal is your best bet.
It can also do that very obvious "Quentin Tarantino" type square wave if you're going for a "Bang Bang \(My Baby Shot Me Down\)" Nancy Sinatra thing, but I usually use it for an always-on subtle warmth instead, and just use the tap tempo to match what I'm playing.
What about you? What's your "secret weapon"? | So i wanted to start playing some songs with effects from pedals but im not sure where to start. I wanted something that would be versatile but if we get into specifics i like playing blues and rock. Thanks and sry from bad english :) | The is one of the best pedals I have on my board of 12 pedals. I play various guitars (Strat, Tele, Les Paul, Ibanez) through a Fender Hot Rod Deluxe with a V30 speaker. My band doesn't use a sound man on most gigs so I need a way to boost myself for solos. The EP booster is perfect. When I need to cut through the mix and be heard this pedal does the job. Its a nice clean boost in that it doesn't alter my tone with the exception of very slight mid. The pedal provides more boost than you'll need, easily. I would recommend opening up the pedal and trying different positions on the dip switches inside. You'll need to use a screw driver for this so whatever setting you choose isn't easily changed. Highly recommend for any guitar setup. | John discusses how the sound of pedal inspired the entire song,but he doesn't answer the question to which pedal he's using :(
It's mentioned near the end of this concert | Hi, I am fairly new to electric guitar but I enjoy playing the styles of music as shown in the title of this thread. My question is basically asking if there is some sort of pedal to help produce that certain tone that really gives that sort of musical feel to those types of music.
such as in this link^ it may just be his guitar producing that tone and I may just need a new guitar in general since I only have a cheap squire strat at the moment with a £100 Fender amp. but if there is anything such as a pedal that will improve my tone for the time being until I can afford some new equipment I would Certainly be interested! thanks | 1,999,925 | Hey guys, I've been working on a cover for Shades of Cool and I've been trying to do the guitar solo. Do you guys happen to know what pedals are being used? Obviously there's some sort of distortion but I was just wondering if there was anything else. | Help identifying these pedals? | Can you identify these pedals? | Can someone help me ID these pedals? | Pedals for a Cloud Nothings guitar tone? | Is there a guitar pedal that duplicates this sound? | Anyone know the material/method that companies like Greer Amps or Spaceman use for the art on their pedals? | Help with identifying the pedals on this board? | Great Variety! A nice sampling of pedals |
1,999,926 | Introduction: Melioidosis is endemic in Southeast Asia. Burkholderia pseudomallei is the causative agent. Abscess formation is the commonest surgical presentation. This usually occurs in the skin and subcutaneous tissues but it has also been reported at unusual sites such as the liver, spleen, lung, brain, prostate, bone and joints, lymph nodes, muscles, and eyes. The mortality of those diagnosed with Melioidosis ranges from 10-25%. Early diagnosis and initiation of early surgical and medical treatment can decrease mortality. Methods: Data were collected over 10 years (2007)(2008)(2009)(2010)(2011)(2012)(2013)(2014)(2015)(2016)(2017), from culture-proven patients who were admitted into the emergency department or in the wards. Results: There were 153 patients recruited. 21% of patients were farmers or agricultural workers. The most common risk factor was type 2 Diabetes Mellitus. Patients presented with spleen as the most common organ involved (39%). 10% of those with intra-abdominal abscesses have the involvement of lungs as well. Various interventional radiological procedures such as abscess drainage by ultrasound-guided pig tailing and aspirations are common. Peripheral soft tissue abscess drainage was common and easy to perform. Splenectomy was the least common procedure performed for an abscess. The mortality is 14.7% and is significantly associated with those presenting with bacteremia and sepsis. The surgical intervention had resulted in 92% of patients discharged alive. Conclusions: Early surgical referral and intervention can decrease mortality and morbidity. Further imaging of the abdomen and thorax could decrease the mortality among those with bacteremia and sepsis. | BACKGROUND & OBJECTIVES: Melioidosis and the causative organism Burkholderia pseudomallei are being recognized gradually in various centres in India. In the septicaemic form, melioidosis is a serious and life threatening condition which requires early detection and specific treatment to avoid case fatality. A review of patients with septicaemic melioidosis at a tertiary care hospital in south India was carried out with a view to define the clinical features, predisposing conditions, if any, and the outcome. METHODS: A total of 28 patients with culture proven septicaemic melioidosis during December 1993 to December 2002 were included. Information on clinical details and outcome was obtained and antibiotic susceptibility of the isolates studied. RESULTS: Of the 28 patients of blood culture proven septicaemic melioidosis, the organism was also isolated from pus in two patients. The presenting clinical features were varied, most presenting as pyrexia of unknown origin or visceral abscesses, or septic arthiritis. Associated/predisposing conditions were present in 50 per cent of the patients, and diabetes mellitus was the commonest one. mortality was 58 per cent in our series. INTERPRETATION & CONCLUSION: Melioidosis is an emerging infection in India. The magnitude of the problem can only be assessed by increasing awareness, both of its existence in the clinical setting and its identification in the laboratory. |
Introduction
Burkholderia pseudomallei is a motile, oxidase-positive, Gram-negative, non-fermentative bacillus which causes melioidosis, a glanders-like disease of both humans and animals. It was first described in Myanmar by Whitmore and Krishnaswami in 1911 in a 40-year-old morphine addict who died from acute fulminating pneumonia with superficial abscesses of the leg [1,2]. The disease is now known to be relatively common in parts of South East Asia and Northern Australia, but a recent modelling study suggested that it may still be far commoner than is currently appreciated, with the model estimating some 165 000 cases and 89 000 deaths worldwide each year [3]. The clinical manifestations of melioidosis are extremely varied, including multisystem involvement with deep visceral abscesses, especially in the liver and spleen, pustular necrotic skin or subcutaneous lesions, pyrexia of unknown origin, septicaemia, central nervous system infections, head and neck infections including parotid abscesses, especially in children and pulmonary infections resembling tuberculosis or pneumonia. Severe melioidosis has a high mortality, which may exceed 70% if patients are not treated appropriately and if ICU facilities are lacking [3,4].
Burkholderia pseudomallei is an environmental saprophyte found in the tropics and in endemic areas is readily isolated from mud and surface water, particularly rice paddy [3]. It can be acquired through inoculation, inhalation or ingestion of soil or water. People engaged in occupations such as farming or gardening in endemic environments have an increased risk of acquiring melioidosis. In endemic areas, approximately 5-30% of healthy adults have evidence of exposure to B. pseudomallei, with indirect haemagglutination antibody titres of 1:40 or higher [5,6]. In addition, people with diabetes mellitus are at greater risk of developing melioidosis, which may lead to the disease becoming more common as the prevalence of diabetes increases in a population [3].
Since the early descriptions of B. pseudomallei, when it was said to account for one in every 20 autopsies carried out in Yangon General Hospital [7], melioidosis has been reported rarely in Myanmar. This is probably because it is difficult to diagnose clinically, necessitating microbiological confirmation. Relatively few clinicians and microbiologists are familiar with the disease and its causative organism, which may be discarded as a contaminant, so it frequently goes un-or misdiagnosed [3]. Recently, however, awareness has been increasing and there have been a number of case-reports from the Yangon area over the past 17 years [8][9][10][11][12][13]. The recent modelling study predicted that more than 6200 cases and 3600 deaths due to melioidosis may occur each year in Myanmar [3], so it is likely that many more cases are still undiagnosed. Many patients may thus be dying unnecessarily because they do not receive appropriate diagnosis and treatment. We therefore undertook a prospective study using simple methods to identify cases of melioidosis in four general hospitals in and around Yangon.
Methods
Study sites
We selected four hospitals in Yangon for the study based on their catchment areas (in order to give broad geographical coverage of Yangon) and the presence of in-house microbiology laboratories: Yangon General Hospital (YGH; 2000-bedded hospital located in the centre of Yangon), Thigangyun General Hospital (TGH; 500-bedded hospital located in the eastern part of Yangon), Insein General Hospital (IGH; 500-bedded hospital located in the northern part of Yangon) and North Okklapa General Hospital (NOGH; 800-bedded hospital located in the eastern part of Yangon). The study period was from June 2017 to May 2019.
Clinical case detection
At the start of the study, physicians from the study sites were provided with information about the clinical features, diagnosis and management of melioidosis through oral presentations in order to raise their awareness of the disease. When isolates were confirmed as B. pseudomallei, either by the hospital laboratories or by the Department of Medical Research, Yangon (DMR), the responsible physicians were informed so that patients received the appropriate management for melioidosis. Patients' hospital charts were reviewed for basic socio-demographic and clinical data, including any history of a known exposure event and underlying diseases, which were recorded on a standard proforma (Supplementary material 1).
Hospital microbiological investigations
Prior to the start of sample collection, meetings were held with the microbiologists from the study hospitals' laboratories to alert them to the study and to highlight the key features of B. pseudomallei. Clinical samples were processed according to the normal procedures in the laboratories concerned. Organisms isolated from blood cultures, or in pure or predominant culture from body fluids, pus, sputum or urine, were tested by Gram stain and oxidase test. Isolates suspected of being B. pseudomallei (oxidasepositive Gram-negative bacilli that were not obviously Pseudomonas aeruginosa based on the presence of green pigment and a typical smell) were stored on nutrient agar slants. These were collected weekly from the microbiology laboratories, along with clinical data proformas, and analysed further at DMR.
Processing of samples at DMR
The isolates were sub-cultured from the nutrient agar slants onto Ashdown's selective agar and blood agar, incubated at 35-37°C for 24-96 h aerobically and examined daily. Gram staining and oxidase tests were performed on all isolates. Oxidase-positive Gram-negative rods which grew on Ashdown's agar were screened by disc diffusion for resistance to gentamicin (10 μg) and colistin (10 μg) and susceptibility to co-amoxiclav (20 + 10 μg), and tested by latex agglutination for presumptive identification of B. pseudomallei according to the Standard Operating Procedures developed by Wellcome Trust Mahidol University Oxford Tropical Medicine Research Programme [14]. Finally, the identity of isolates that were consistent with B. pseudomallei by the screening tests was confirmed by API 20 NE (BioMérieux UK Ltd, Basingstoke, UK). All laboratory procedures at DMR were performed in a Class II Biological Safety Cabinet. The study was assessed against the 'Microbiology Investigation Criteria for Reporting Objectively (MICRO)' criteria [15] and complied with the majority of the criteria (Supplementary Table T1).
Antibiotic susceptibility testing
Isolates that were B. pseudomallei latex agglutination positive were tested at DMR for their susceptibility by disc diffusion to ceftazidime (30 μg), meropenem (10 μg), chloramphenicol (30 μg), doxycycline (30 μg), co-amoxiclav and co-trimoxazole (25 μg) using a modification of the Clinical and Laboratory Standards Institute (CLSI) method developed by the Wellcome Trust Mahidol University Oxford Tropical Medicine Research Programme [14] since this study ante-dated the publication of the EUCAST method [16]. Isolates that appeared resistant on initial testing in Yangon were later re-tested using fresh batches of antibiotic discs and were regarded as susceptible if the second tests classified them as such. Seven isolates were also tested against the relevant antibiotics by gradient diffusion (ETEST® BioMérieux) at Menzies School of Health Research, Darwin, Australia, with isolates classified as susceptible or resistant in accordance with the CLSI MIC guidelines 2017 [17].
Molecular testing
The identities of the first nine latex agglutination positive isolates were confirmed using a B. pseudomallei specific real-time PCR assay targeting a 115-bp segment within the Type III Secretion System at the Shoklo Malaria Research Unit, Thailand [18,19]. The nine clinical isolates and seven soil isolates from Myanmar (two from Magway region, four from Bago region and one from Mon state) were also analysed at Menzies School of Health Research, Darwin, Australia using BOX-PCR [20] and whole genome sequencing (the results of which are reported elsewhere) [21].
Results
Twenty-one of 364 oxidase-positive Gram-negative rod isolates (5.7%) from 21 individual patients were identified as B. pseudomallei. Basic clinical and demographic data for these patients are shown in Table 1. Twelve were male, with a median age of 55 years (range 18-79), and nine were female, with a median age of 51 years (range 21-61). Nineteen patients were diagnosed at YGH, one each from IGH and NOGH and none at TGH. Ten patients were from Yangon Region, nine were from Ayeyarwaddy Region, and one patient each was from Kayin and Rahkine States (Fig. 1). Of the 21 patients, a history of soil contact was given by seven, five were reported as having diabetes mellitus and one was reported as having renal insufficiency. The patients presented with septicaemia (12 patients), pneumonia (three patients), urinary tract infection (two patients) and wound infection (four patients). Among the septicaemic patients, two died and one was taken home from hospital in a severe condition and was not expected to survive, but the remaining 18 patients all recovered and were subsequently discharged ( Table 1).
All nine isolates tested by B. pseudomallei specific PCR were confirmed as B. pseudomallei. BOX typing of seven of nine clinical strains demonstrated diversity, with multiple BOX patterns observed ( Figure S1). Furthermore, the BOX patterns of the clinical strains did not match the BOX patterns of any of seven Myanmar environmental strains tested simultaneously, demonstrating no link between the environmental and patient strains, which aligns with the epidemiological data ( Figure S1).
Following repeat testing where appropriate, testing of the 21 B. pseudomallei isolates by disc diffusion in Yangon found one to have intermediate susceptibility to chloramphenicol and one intermediate susceptibility to ceftazidime. Testing of the first
Epidemiology and Infection
seven isolates against selected antibiotics by gradient diffusion in Darwin did not confirm any of the resistances that had been suspected following initial tests in Yangon (Table S2).
Discussion
Melioidosis is a potentially fatal disease caused by B. pseudomallei, which requires specific and prolonged antibiotic treatment to prevent death and relapse. The infection has been recognised increasingly throughout the tropics over the past 40 years, although underdiagnosis remains a significant problem due to a lack of clinical awareness, a lack of familiarity with the organism amongst laboratory staff and the under-development of diagnostic services serving the poor rural population most likely to be affected [3]. The sensitivity of culture for B. pseudomallei from clinical specimens can be improved with the use of selective media [22]. However, even with positive cultures, the organism is frequently misidentified or disregarded as a contaminant [23]. Although not officially recognised as a 'Neglected Tropical Disease' (NTD), it has been estimated that melioidosis may cause a greater burden of disability-adjusted life-years (DALYs) than many recognised NTDs such as dengue, schistosomiasis and leishmaniasis [24]. Even in countries where its importance has been highlighted by researchers, such as Thailand, official statistics have failed to capture the true disease burden, especially in terms of mortality [25].
Myanmar has a special place in the history of melioidosis, as it is where the disease was first recognised by Alfred Whitmore and CS Krishnaswami working in Rangoon in 1911 [1,2]. However, apart from a single case report in 1948 [26], the disease 'disappeared' from the Myanmar medical literature until the beginning of the 21st century [8] and since then only a handful of cases has been reported [27]. We therefore undertook this study in four tertiary hospitals in Yangon, including that in which melioidosis had first been identified, in order better to understand the true incidence of meliodosis in modern day Yangon. We attempted to improve the awareness of the disease amongst clinicians and laboratory staff in the respective hospitals prior to the study in order to encourage submission of relevant diagnostic specimens to their laboratories, and to overcome the difficulties in the identification of B. pseudomallei by collecting all oxidase-positive Gram-negative bacilli for identification in a central laboratory.
Despite this, we only identified 21 B. pseudomallei out of 364 isolates tested (5.7%) over a 2-year period. It is notable that all but two of these were detected at YGH, the largest hospital with the most complex casemix and one of only two of the hospitals in the study with automated systems for blood cultures and bacterial identification. B. pseudomallei had, however, previously been reported to account for only one of 90 episodes of bacteraemia in YGH in a one year period between 2015 and 2016 [28]. In another study reported in 2013, only three B. pseudomallei isolates were obtained from 85 pus and wound swab samples (3.5%) in YGH [12]. Overall, the incidence of confirmed melioidosis in Yangon was not high compared with parts of neighbouring endemic countries such as Thailand, Cambodia and Laos [29][30][31]. It thus appears that melioidosis may not now be as common in Yangon as it was in the time of Krishnaswamy, who in 1917 reported seeing more than 200 cases over 6 years in the mortuary of YGH, accounting for one in every 20 autopsies he performed [7]. There are several possible explanations for this, most notably the fact that all four hospitals were within the city of Yangon, which is considerably more urbanised now than it was in the early part of the 20th century, when there were still paddy fields in what is now the centre of a city with over 5 million inhabitants.
In terms of the clinical and epidemiological features of the 21 patients in our series, there appears to be nothing particularly unusual about melioidosis in modern day Myanmar to distinguish it from other parts of south east Asia [29][30][31], apart from the relatively low mortality [3 of 21 (14%) patients], which suggests that some more severe cases may have been being missed. Unfortunately, we do not have any follow-up data and so cannot be certain whether any patients died or relapsed following hospital discharge. It is worthy of note that only 33.3% of our patients reported an occupation in agriculture, although most of the patients resided in Ayeyarwaddy and outskirts of Yangon (nine and ten cases, respectively), where a high proportion of the population are involved in farming. Even if patients do not report their occupation as 'farmer', many families have some land and engage in agricultural activities such as rice farming some of the time.
Diabetes was a common predisposing factor, reported in five of our patients, although this may have been under-recognised or under-reported. The prevalence of diabetes mellitus, the major risk factor for melioidosis, is rapidly increasing in Myanmar [32]. There were also no patients who were injecting drug users in our series, whereas the majority (31/38) of the original melioidosis cases described by Whitmore and Krishnaswami, and 95% of those later reported by Krishnaswamy, showed evidence of being morphia injectors leading to the nickname 'morphia injector's septicaemia' [2,7]. Although occasional reports of melioidosis in injecting drug users have appeared subsequently [33], this has not featured as a major risk factor for the disease since the early reports from Myanmar. The reason for this particular historic association remains as yet unexplained, although it is likely that it is accounted for by specific behavioural or environmental factors amongst morphine injectors in early 20th century Yangon and possibly the more intensive microbiological investigation of patients who underwent post mortem examination as 'police cases'. Interestingly, there is speculation that some of the more recent unexplained autochthonous cases of melioidosis seen in the USA may be the result of potential contamination of medical commodities, including intravenous products, imported from Southeast Asia [34]. As far as the microbiology of melioidosis in Myanmar is concerned, again the isolates of B. pseudomallei appeared relatively typical for the species. On the basis of disc diffusion testing carried out in Yangon, it initially appeared that there was more resistance to antibiotics usually used to treat melioidosis, particularly beta-lactams, than would generally be expected in B. pseudomallei (data not shown). The prolonged antibiotic regimens used in melioidosis can lead to B. pseudomallei acquiring resistance, although the frequency of co-trimoxazole resistance in B. pseudomallei has previously been over-estimated by disc diffusion testing [35]. Ceftazidime resistance has been widely reported in patients following treatment but is not common [36], and meropenem resistance is exceedingly rare. On re-testing in Yangon, however, the majority of these initial results could not be confirmed and they were assumed to be related to a loss of disc potency on the initial testing. In addition, none of these initial results could be confirmed when seven isolates were re-tested in Darwin by the gradient strip method. Molecular characterisation of nine of the isolates from our study is reported in detail elsewhere [21]. However, in summary, phylogenomic analysis of B. pseudomallei genomes from Myanmar in the context of a global set of B. pseudomallei genomes demonstrated that Myanmar B. pseudomallei reside within the Asian clade and cluster with genomes from countries bordered by the Mekong River. Noteworthy is that Myanmar B. pseudomallei isolates are very diverse with numerous sequence types (STs) detected, and our BOX-PCR results align with the noted high diversity [20,21] (Figure S1).
The main limitation of our study is that it is likely that our enhanced laboratory-based surveillance will still have missed patients with melioidosis. Patients with fevers, pneumonia and abscesses are not always investigated intensively for melioidosis in Myanmar, and selective media such as Ashdown's agar, which are known to increase the yield of culture for B. pseudomallei from sites with a normal flora, were not used for primary isolation in this study because of resource constraints [22]. In addition, by restricting our surveillance to hospital laboratories and not including private laboratories, even culture-positive cases admitted to the four hospitals during the study may have been missed. This is because microbiology services in Myanmar are fragmented and hospital laboratories are currently only open during standard hours of work (8:00 AM to 5:00 PM). Samples collected outside these hours are usually sent to private laboratories and clinicians may also opt to send samples to private laboratories at other times. We are aware of at least two patients with culture-positive melioidosis at IGH who were diagnosed by private laboratories during our study period but were missed by our surveillance for this reason, and it is likely that similar instances occurred at the other hospitals.
Overall, it is clear that melioidosis is still endemic in Yangon and neighbouring provinces, although considerable further work will be needed to establish the true disease burden. Furthermore, it is likely that there will be areas of much higher incidence outside Yangon. For example, melioidosis is relatively uncommon in hospitals in Bangkok compared with hospitals in northeast Thailand where it is a major cause of community-acquired sepsis [30]: similar hotspots may well exist in rural Myanmar. Further studies are therefore necessary to determine the true distribution of B. pseudomallei and incidence of melioidosis at selected locations in Myanmar. Since rice farming is a frequent activity in suburban and rural areas in Myanmar, it is on such populations that efforts should initially be focused. Further work is also needed at a national level to raise awareness of the disease amongst clinicians and laboratory staff to enable patients to be effectively diagnosed and appropriately treated. Data. The data that support the findings of this study are available from Dr Mo Mo Win on request.
Ethical considerationsEthical approval was obtained from the Ethics Review Committee of the Department of Medical Research on 16 June 2017 for the study Detection of Burkholderia pseudomallei in patients attending 2 Mo Mo Win et al. Yangon, Thingangyun, Insein and North Okkalapa General Hospitals (2017) (approval number DMR/2017/081).
Fig. 1 .
1Map showing townships of residence of 21 melioidosis patients. Source : https://images.app.goo.
Supplementary material. The supplementary material for this article can be found at https://doi.org/10.1017/S095026882100128X.
Table 1 .
1Clinical and demographic data for 21 patients with culture-confirmed melioidosis Yangon General Hospital, IGH = Insein General Hospital, NOGH = North Okklapa General Hospital.Sr
no
Admission diagnosis
Age
Gender
Positive
sample
Residence − state
or region
(township)
Underlying disease
Outcome
Hospital
1
Tetanus
51
Male
Blood
Ayeyarwaddy
(Danuphyu)
Nil known
Discharged
YGH
2
Cerebrovascular accident,
hypertension, diabetes
mellitus
70
Male
Suction tip
Yangon
Diabetes mellitus
Discharged
YGH
3
Septicaemia
70
Male
Blood
Ayeyarwaddy
Diabetes mellitus
Discharged
YGH
4
Suspected lung carcinoma
with pneumonia
57
Female
Sputum
Yangon (Thanlyin)
Nil known
Discharged
YGH
5
Liver abscess
39
Male
Blood
Yangon (Thaikkyi)
Nil known
Died
YGH
6
Septicaemia
53
Female
Blood
Yangon
Diabetes mellitus
Discharged
YGH
7
Pneumonia
50
Female
Sputum
Yangon
Nil known
Self
discharged
IGH
8
Septicaemia
49
Male
Blood
Rahkine
Renal insuffciency
Died
YGH
9
Septicaemia
66
Male
Blood
Yangon
Nil known
Discharged
YGH
10
Septicaemia
42
Male
Blood
Ayeyarwaddy
Nil known
Discharged
NOGH
11
Septicaemia
56
Female
Blood
Ayeyarwaddy
Diabetes mellitus
Discharged
YGH
12
Aspiration pneumonia
79
Male
Sputum
Kayin
Past tuberculosis
of lung
Discharged
YGH
13
Septicaemia
18
Male
Blood
Ayeyarwaddy
Nil known
Discharged
YGH
14
Septicaemia
42
Female
Blood
Ayeyarwaddy
Nil known
Discharged
YGH
15
Septicaemia
62
Female
Blood
Ayeyarwaddy
Diabetes mellitus
Discharged
YGH
16
Septicaemia
21
Female
Blood
Ayeyarwaddy
Nil known
Discharged
YGH
17
Urinary tract infection
48
Female
Urine
Ayeyarwaddy
Nil known
Discharged
YGH
18
Wound infection
58
Male
Wound
swab
Yangon
Nil known
Discharged
YGH
19
Wound infection
74
Male
Wound
swab
Yangon
Nil known
Discharged
YGH
20
Wound infection
51
Female
Wound
swab
Yangon
Nil known
Discharged
YGH
21
Urinary tract infection
35
Male
Urine
Yangon
Nil known
Discharged
YGH
Abbreviations:
YGH =
An account of the discovery of a hitherto undescribed infective disease occurring among the population of Rangoon. A Whitmore, C S Krishnaswami, Indian Medical Gazette. 47Whitmore A and Krishnaswami CS (1912) An account of the discovery of a hitherto undescribed infective disease occurring among the popula- tion of Rangoon. Indian Medical Gazette 47, 262-267.
An account of a glanders-like disease occurring in Rangoon. A Whitmore, Journal of Hygiene. 13Whitmore A (1913) An account of a glanders-like disease occurring in Rangoon. Journal of Hygiene 13, 1-34.
Predicted global distribution of Burkholderia pseudomallei and burden of melioidosis. D Limmathurotsakul, Nature Microbiology. 1Limmathurotsakul D et al. (2016) Predicted global distribution of Burkholderia pseudomallei and burden of melioidosis. Nature Microbiology 1, 2-13.
Intravenous therapy duration and outcomes in melioidosis: a new treatment paradigm. M C Pitman, PLoS Neglected Tropical Diseases. 9Pitman MC et al. (2015) Intravenous therapy duration and outcomes in melioidosis: a new treatment paradigm. PLoS Neglected Tropical Diseases 9, 1-16.
Serology and carriage of Pseudomonas pseudomallei: a prospective study in 1000 hospitalized children in Northeast Thailand. P Kanaphun, Journal of Infectious Diseases. 167Kanaphun P et al. (1991) Serology and carriage of Pseudomonas pseudo- mallei: a prospective study in 1000 hospitalized children in Northeast Thailand. Journal of Infectious Diseases 167, 230-233.
The epidemiology of melioidosis in Ubon Ratchatani. Y Supputtamongkol, International Journal of Epidemiology. 23Supputtamongkol Y et al. (1994) The epidemiology of melioidosis in Ubon Ratchatani, Northeast Thailand. International Journal of Epidemiology 23, 1082-1090.
Morphia injector's septicaemia. C S Krishnaswamy, Indian Medical Gazette. 52Krishnaswamy CS (1917) Morphia injector's septicaemia. Indian Medical Gazette 52, 296-299.
Melioidosis: a hidden disease in Myanmar. M K Aung, Myanmar Journal of Current Medical Practice. 5Aung MK (2000) Melioidosis: a hidden disease in Myanmar. Myanmar Journal of Current Medical Practice 5, 57-59.
Win MM Isolation of Peudomonas species in patients with suppurative infections. YangonMaster of Medical Science (Microbiology) thesis 2002. Institute of Medicine 1Win MM Isolation of Peudomonas species in patients with suppurative infections. Master of Medical Science (Microbiology) thesis 2002. Institute of Medicine 1, Yangon.
Isolation of Pseudomonas pseudomallei (Burkholderia pseudomallei) from a case of tetanus in YGH. S S Hlaing, Myanmar Journal of Current Medical Practice. 9Hlaing SS (2004) Isolation of Pseudomonas pseudomallei (Burkholderia pseudomallei) from a case of tetanus in YGH. Myanmar Journal of Current Medical Practice 9, 8-12.
Indigenous isolates of Burkholderia pseudomallei -the causative agent of melioidosis. M K Aung, Myanmar Journal of Current Medical Practice. 9Aung MK (2004) Indigenous isolates of Burkholderia pseudomallei -the causative agent of melioidosis. Myanmar Journal of Current Medical Practice 9, 13-15.
Detection of Burkholderia pseudomallei in patients with suppurative infections attending Yangon General Hospital and New Yangon General Hospital. Z T Htun, Myanmar Health Sciences Research Journal. 25Htun ZT (2013) Detection of Burkholderia pseudomallei in patients with sup- purative infections attending Yangon General Hospital and New Yangon General Hospital. Myanmar Health Sciences Research Journal 25, 114-119.
Re-emergence of melioidosis in Myanmar. M K Aung, T T Mar, Transactions of the Royal Society of Tropical Medicine and Hygiene. 102Aung MK and Mar TT (2008) Re-emergence of melioidosis in Myanmar. Transactions of the Royal Society of Tropical Medicine and Hygiene 102, 10-11.
Standard Operating Procedure for isolation of Burkholderia pseudomallei from clinical samples. Wellcome Trust-Mahidol University Oxford Tropical Medicine Research ProgramWellcome Trust-Mahidol University Oxford Tropical Medicine Research Program. Standard Operating Procedure for isolation of Burkholderia pseudomallei from clinical samples, 2015. Available at https://www.melioidosis.info/info.aspx?pageID=104&contentID=1040206.
Microbiology Investigation Criteria for Reporting Objectively (MICRO): a framework for the reporting and interpretation of clinical microbiology data. P Turner, BMC Medicine. 1770Turner P et al. (2019) Microbiology Investigation Criteria for Reporting Objectively (MICRO): a framework for the reporting and interpretation of clinical microbiology data. BMC Medicine 17, 70.
Interpreting Burkholderia pseudomallei disc diffusion susceptibility test results by the EUCAST method. Dab Dance, 10.1016/j.cmi.2021.02.017Clinical Microbiology and Infection. 27Dance DAB et al. (2021) Interpreting Burkholderia pseudomallei disc dif- fusion susceptibility test results by the EUCAST method. Clinical Microbiology and Infection 27, 827-829. doi: 10.1016/j.cmi.2021.02.017.
Performance standards for antimicrobial susceptibility testing. CLSI supplement M100, 27th Edn. Wayne, PAClinical and Laboratory Standards Institute ; Clinical and Laboratory Standards InstituteClinical and Laboratory Standards Institute (2017) Performance stan- dards for antimicrobial susceptibility testing. In CLSI supplement M100, 27th Edn. Wayne, PA: Clinical and Laboratory Standards Institute.
Development and evaluation of a real-time PCR assay targeting the type III secretion system of Burkholderia pseudomallei. R T Novak, Journal of Clinical Microbiology. 44Novak RT et al. (2006) Development and evaluation of a real-time PCR assay targeting the type III secretion system of Burkholderia pseudomallei. Journal of Clinical Microbiology 44, 85-90.
Evaluation of molecular methods to improve the detection of Burkholderia pseudomallei in soil and water samples from Laos. M Knappik, Applied and Environmental Microbiology. 81Knappik M et al. (2015) Evaluation of molecular methods to improve the detection of Burkholderia pseudomallei in soil and water samples from Laos. Applied and Environmental Microbiology 81, 3722-3727.
Using BOX-PCR to exclude a clonal outbreak of melioidosis. B J Currie, BMC Infectious Diseases. 768Currie BJ et al. (2007) Using BOX-PCR to exclude a clonal outbreak of melioidosis. BMC Infectious Diseases 7, 68.
Myanmar Burkholderia pseudomallei strains are genetically diverse and originate from Asia with phylogenetic evidence of reintroductions from neighbouring countries. J R Webb, Nature Scientific Reports. 1016260Webb JR et al. (2020) Myanmar Burkholderia pseudomallei strains are genetically diverse and originate from Asia with phylogenetic evidence of reintroductions from neighbouring countries. Nature Scientific Reports 10, 16260.
The cost-effectiveness of the use of selective media for the diagnosis of melioidosis in different settings. Dab Dance, PLoS Neglected Tropical Diseases. 137598Dance DAB et al. (2019) The cost-effectiveness of the use of selective media for the diagnosis of melioidosis in different settings. PLoS Neglected Tropical Diseases 13, e0007598.
Misidentification of Burkholderia pseudomallei as Acinetobacter species in northern Thailand. R C Greer, Transactions of the Royal Society of Tropical Medicine and Hygiene. 113Greer RC et al. (2019) Misidentification of Burkholderia pseudomallei as Acinetobacter species in northern Thailand. Transactions of the Royal Society of Tropical Medicine and Hygiene 113, 48-51.
Global burden of melioidosis in 2015: a systematic review and data synthesis. E Birnie, The Lancet Infectious Diseases. 19Birnie E et al. (2019) Global burden of melioidosis in 2015: a system- atic review and data synthesis. The Lancet Infectious Diseases 19, 892-902.
Clinical epidemiology of 7126 melioidosis patients in Thailand and the implications for a national notifiable diseases surveillance system. V Hantrakun, 10.1093/ofid/ofz498Open Forum Infectious Diseases 6. Hantrakun V et al. (2019) Clinical epidemiology of 7126 melioidosis patients in Thailand and the implications for a national notifiable diseases surveillance system. Open Forum Infectious Diseases 6. doi: 10.1093/ofid/ ofz498.
A case of melioidosis. S Sen, Indian Medical Gazette. 83Sen S (1948) A case of melioidosis. Indian Medical Gazette 83, 186-187.
Melioidosis in Myanmar. M M Win, 10.3390/tropicalmed3010028Tropical Medicine and Infectious Diseases. 3Win MM et al. (2018) Melioidosis in Myanmar. Tropical Medicine and Infectious Diseases 3. doi: 10.3390/tropicalmed3010028.
A prospective study of bloodstream infections among febrile adolescents and adults attending Yangon General Hospital. T O Myat, PLoS Neglected Tropical Diseases. 148268Myat TO et al. (2020) A prospective study of bloodstream infections among febrile adolescents and adults attending Yangon General Hospital, Yangon, Myanmar. PLoS Neglected Tropical Diseases 14, e0008268.
Melioidosis in the Lao People's Democratic Republic. Dab Dance, doi: 10.3390/ tropicalmed3010021Tropical Medicine and Infectious Disease. 3Dance DAB et al. (2018) Melioidosis in the Lao People's Democratic Republic. Tropical Medicine and Infectious Disease 3. doi: 10.3390/ tropicalmed3010021.
Melioidosis in Thailand: present and future. S Hinjoy, 10.3390/tropicalmed3020038Tropical Medicine and Infectious Disease. 3Hinjoy S et al. (2018) Melioidosis in Thailand: present and future. Tropical Medicine and Infectious Disease 3. doi: 10.3390/tropicalmed3020038.
A report from the Cambodia training event for awareness of melioidosis (C-TEAM). S Bory, 10.3390/tropicalmed3010023Tropical Medicine and Infectious Disease. 3Bory S et al. (2018) A report from the Cambodia training event for aware- ness of melioidosis (C-TEAM), October 2017. Tropical Medicine and Infectious Disease 3. doi: 10.3390/tropicalmed3010023.
Measurement of diabetes, prediabetes and their associated risk factors in Myanmar. T S Latt, Diabetes. Metabolic Syndrome and Obesity: Targets and Therapy. 12Latt TS et al. (2019) Measurement of diabetes, prediabetes and their asso- ciated risk factors in Myanmar 2014. Diabetes. Metabolic Syndrome and Obesity: Targets and Therapy 12, 291-298.
Contact investigation of melioidosis cases reveals regional endemicity in Puerto Rico. T J Doker, Clinical Infectious Diseases. 60Doker TJ et al. (2015) Contact investigation of melioidosis cases reveals regional endemicity in Puerto Rico. Clinical Infectious Diseases 60, 243-250.
Epidemiology and investigation of melioidosis, Southern Arizona. T Stewart, Emerging Infectious Diseases. 17Stewart T et al. (2011) Epidemiology and investigation of melioidosis, Southern Arizona. Emerging Infectious Diseases 17, 1286-1288.
Trimethoprim/sulfamethoxazole resistance in Burkholderia pseudomallei. Dab Dance, International Journal of Antimicrobial Agents. 44Dance DAB et al. (2014) Trimethoprim/sulfamethoxazole resistance in Burkholderia pseudomallei. International Journal of Antimicrobial Agents 44, 368-369.
Survey of antimicrobial resistance in clinical Burkholderia pseudomallei isolates over two decades in Northeast Thailand. V Wuthiekanun, Antimicrobial Agents and Chemotherapy. 55Wuthiekanun V et al. (2011) Survey of antimicrobial resistance in clinical Burkholderia pseudomallei isolates over two decades in Northeast Thailand. Antimicrobial Agents and Chemotherapy 55, 5388-5391.
| Melioidosis is known to occur in Bangladesh, but there are few reports about the condition in the published international literature. We set out to review all known cases of melioidosis in the country to date, using both retrospective and prospective data. A web-based literature search was conducted to identify all published case reports, original articles and conference abstracts. Cases were also included from a prospective study conducted in 2017. Fifty-one cases were identified between 1961 and 2017. Cases have been reported from sixteen out of the 64 districts of Bangladesh. The median age of the patients at presentation was 45 years (IQR 37–52), with a significant male (77%) predominance. Many patients (14/39; 36%) were farmers and 83% had diabetes mellitus. A skin/soft tissue abscess was the most common primary clinical presentation (13/49; 27%), followed by septic arthritis (10/49; 20%), pneumonia, and a deep-seated abscess/organ abscess (7/49; 14%). The major challenges to the diagnosis and treatment of melioidosis in Bangladesh are the lack of resources and the lack of awareness of melioidosis. Capacity development programs are urgently required to define the burden of disease and to tackle the mortality rates. | A 43-year-old farmer presented with acute onset pneumonia, septicaemia and peripheral facial nerve palsy (left side). Burkholderia pseudomallei was isolated from the blood culture of the patient. The patient was successfully treated with intravenous meropenem and oral cotrimoxazole for 2 weeks followed by maintenance therapy with cotrimoxazole. The case is reported to increase awareness among the clinicians and microbiologists regarding melioidosis. | Melioidosis, an infectious disease caused by Burkholderia pseudomallei, is endemic in the Northern Australia and South-East Asia. It is an emerging disease in the Indian subcontinent. Melioidosis tends to run a potentially lethal course in immunocompromised individuals and data in renal transplantation are scarce. The clinical presentation of melioidosis is diverse, mimicking several other infectious diseases. Diagnosis could be delayed in transplant recipients. Choice and duration of antimicrobial therapy, management of immunosuppression, and patient and graft outcomes are other issues to be addressed. We report septicemic melioidosis with pulmonary involvement in a 32-year old renal transplant recipient that caused acute allograft dysfunction. | Melioidosis is a tropical bacterial infection, rarely encountered, and poorly known by clinicians. In non-endemic areas, a misdiagnosis can lead to a fatal outcome. This study aims to identify the main characteristics of imported and diagnosed melioidosis cases in Europe to increase clinician’s awareness of this diagnosis. A literature review of imported and diagnosed human melioidosis cases in Europe was performed. PubMed and Web of Science search engines were used for retrieving articles from 2000 to November 2018. Seventy-seven cases of imported melioidosis into Europe described in the literature were identified. More than half of the cases were acquired in Thailand (53%) by men (73%). Patients were usually exposed to Burkholderia pseudomallei during a holiday stay (58%) of less than 1 month (23%) and were hospitalized during the month following their return to Europe (58%). Among travelers, melioidosis is less often associated with risk factor (16%), diabetes being the most frequently comorbidity related (19%). The clinical presentation was multifaceted, pneumonia being the most common symptom (52%), followed by cardiovascular form (45%) and skin and soft tissues damages (35%). The diagnosis was obtained by culture (92%), often supplemented by morphological, biochemical, and molecular identification (23%). Misdiagnoses were common (21%). Over half of the patients received a complete and adapted treatment (56%). Mortality is lower for returning traveler (6%). Imported melioidosis cases into Europe have their own characteristics. This possibility should be considered in patients with pneumonia, fever, and/or abscess returning from endemic areas even years after. | Background ::: Culture is the gold standard for the diagnosis of melioidosis, an infection caused by Burkholderia pseudomallei. Here we evaluate a lateral flow immunoassay (LFI) to detect B. pseudomallei capsular polysaccharide (CPS) in serum samples. ::: ::: ::: Methods ::: Patients with culture from any clinical specimen positive for B. pseudomallei were selected as cases. Patients who were blood culture positive for Staphylococcus aureus, Escherichia coli or Klebsiella pneumoniae as well as those who were malaria or dengue polymerase chain reaction assay positive were selected as controls. ::: ::: ::: Results ::: The sensitivity of the LFI was 31.3% (60/192 case patients [95% confidence interval {CI} 24.8 to 38.3]) and the specificity was 98.8% (559/566 control patients [95% CI 97.4 to 99.5]) in serum samples. ::: ::: ::: Conclusions ::: Although LFI may have limited sensitivity in serum, it can rapidly diagnose melioidosis in resource-limited settings. | India is among the countries at high risk from melioidosis, a difficult to diagnose, deadly bacterial disease, says a new study published in Nature Microbiology .1 ::: ::: The disease, which is caused by the Gram negative Burkholderia pseudomallei bacterium, which is commonly found in soil and water in south and southeast Asia and northern Australia, is highly resistant to antibiotics and much more prevalent than previously thought. ::: ::: It is difficult to diagnosis because it mimics other diseases. In the first evidence based estimate of the global extent … | 1,999,926 |
Introduction
Melioidosis is endemic in Southeast Asia. It has been documented to be prevalent in India. Burkholderia pseudomallei, the causative agent, is a saprophyte found in the soil and surface water. [1,2] Human infection occurs when the organism gains entry through broken skin, by inhalation, and perhaps ingestion. Following an incubation period lasting a few days to many years. Melioidosis may present as an acute, sub-acute or chronic illness. [3] Abscess formation is the commonest surgical presentation. This usually occurs in the skin and subcutaneous tissues but it has also been reported at unusual sites such as the liver, spleen, lung, brain, prostate, bone and joints, lymph nodes, muscles, and eye. [4] The mortality of those diagnosed with Melioidosis ranges from 15-25%. [5] Early diagnosis and initiation of early surgical and medical treatment can decrease mortality. [5] Methods All patients from CMC Hospital, Vellore, Tamil Nadu, India, were recruited, either from the outpatient, inpatient departments or from the emergency medicine department. Our hospital is a referral center for most of the country and other Southeast Asian countries. Hospital numbers from the department of clinical microbiology database were used for data collection. All data were entered into an Excel format and were analyzed with SPSS 21.
Results
There were 153 patients recruited over a period of 10 consecutive years (2007)(2008)(2009)(2010)(2011)(2012)(2013)(2014)(2015)(2016)(2017). During this period all diagnosed cases of Melioidosis were included. The age of affected patients ranges from 16 to 80 years. 79% of the patients had medical reasons for hospitalization, and the rest were surgical. 86% (133) were males and 14% (20) were females. 21% of patients were farmers or agricultural workers. The most common risk factor is type 2 Diabetes Mellitus.
There are various presentations of Melioidosis as mentioned below. Most commonly, they present as intra-abdominal abscesses, septic arthritis/osteomyelitis, pneumonia, genitourinary Table 6 tract infections, intracranial involvement followed by bacteremia without an obvious focus. They are mostly associated with diabetes mellitus. Chronic alcohol abuse and chronic lung disease are relative risk factors. (Table 1) The spleen was the most common organ involved (39%). Splenic involvement was associated with CNS, Septic arthritis, Liver, peripheral soft tissue, Kidney, Prostate and Bone involvement. The involvement of the intraabdominal organs and lung involvement was up to 10%. Other organs involved were prostate and Kidney. Patients presenting with bacteremia and shock were associated with lung/thorax involvement (26%), intra-abdominal abscesses (15%) and septic arthritis or osteomyelitis (10%). (Table 2) There was a 2-10% risk of having abscesses located in the thorax with abscesses initially detected in the abdomen or within the soft tissues.
Septic arthritis/bone involvement was the most common presentation followed by intra-abdominal abscesses and bacteremia with septic shock. (Table 3) Interventional radiological procedures such as abscess drainage by ultrasound-guided pig tailing and aspirations were common. Peripheral soft tissue abscess drainage was common and simple to perform. This was followed by open drainage for septic arthritis. Splenectomy was the least common procedure performed for an abscess. (Table 4) The mortality is 14.7% (Table 5) and is significantly associated with patients presenting with bacteremia and sepsis. 92% of patients who underwent surgical intervention were discharged alive. (Table 5)
Discussion
Once the diagnosis of Melioidosis is confirmed through culture, the following algorithm (Table 6) can be followed based on our experience. Radiological imaging has been advised if the association is more than 10%. Risk factors, mortality and effectiveness of surgical procedures to the outcomes were considered in designing the flow chart. The worldwide mortality ranges from 15-25%. [5] In our review, we had a 15% mortality rate. In view of such a high mortality rate, early diagnosis and intervention are important. In our series, nearly 50 percent of patients underwent surgical intervention. The outcomes following a surgical intervention are good. In those diagnosed with bacteremia and sepsis, the mortality rates were significant, and also it is the same group that has the least surgical interventions are performed. In spite of a high incidence of association with intra-abdominal abscesses, septic arthritis/osteomyelitis, and lung involvement, the surgical interventions performed are the least. This could be due to various reasons, either patient in ICU on a ventilator, with inotropic supports or delayed diagnosis. Various hospitals have implemented an upfront CT abdomen and thorax. [5] Following surgical management treatment usually consisted of an intensive phase (at least 14 days) of IV antibiotics-primarily ceftazidime but, more recently, meropenem or imipenem for critically ill patients. This was followed by an eradication phase of oral antibiotics, which usually consisted of monotherapy with doxycycline (adult dosage, 200 mg/day) or TMP-SMZ (adult dosage, 320 mg of TMP b.i.d. and 1600 mg of SMZ b.i.d.) for at least 3 months. [2,7]
Conclusion
Early surgical consultation would be ideal. Early surgical intervention could reduce mortality. Further studies can be done to follow up on patients with bacteremia and sepsis who undergo a surgical procedure. Melioidosis mimics various common Others -DJ stenting, extra ventricular drainage, etc. pathogens and should be considered high on the differential diagnosis to obtain an early diagnosis and appropriate treatment.
Copyright © 2020 by the Bulgarian Association of Young Surgeons DOI:10.5455/IJMRCR.Surgical-management-Melioidosis First Received: February 02, 2020 Accepted: March 16, 2020 Manuscript Associate Editor: Ivan Inkov (BG)
Table 1
1Risk Factors.Risk factor
Number of cases Percentage
Diabetes mellitus
107
68.6
Hazardous alcohol use
14
9.6
Table 2
2Percentage of presentation of illness requiring surgical procedures.Presentation of illness
N (%)
Surgical Intervention
N (%)
No Surgical
intervention
N (%)
Total
Pneumonia
12(7.7)
2(18.2)
9(81.8)
11
Genitourinary
11(7.1)
6(55)
5(45)
11
Bacteremia without focus
5(3.2)
0
5(100)
5
Septic arthritis/osteomyelitis
29(18.6)
23(79)
6(21)
29
CNS
5(3.2)
4(80)
1(20)
5
Bacteremia with septic shock
17(10.9)
2(12.5)
14(87.5)
16
Abdominal Abscess
24(15.4)
17(71)
7(29)
24
Peripheral Soft tissue abscess
13(8.3)
7(54)
6(46)
13
Miscellaneous
35(22.4)
14(40)
21(60)
35
TOTAL
75(50.3)
74(49.7)
149
Missing
Data: 4
Table 3
3The other location of abscesses was subdivided into subsites.Frequency
Associated with lung
Spleen
15
1
Spleen & liver
16
1
Spleen & peripheral
soft tissue
13
2
Soft tissue
31
4
Bone
17
Others
21
1
Only lung
2
Total
115
Table 4
4Surgical intervention.Frequency Percentage
Splenectomy
4
5.2
Incision and drainage
24
31.2
Interventional radiology 25
32.5
Orthopaedic procedures 16
20.8
Other
8
10.4
Total
77
Table 5
5Patient outcomes with or without surgical intervention.Patient outcome
Surgical
intervention
No surgical
intervention
Total
Alive (76.3%)
69 (92%)
49 (64.5%)
118
Dead (14.7%)
5 (6.7%)
17 (22.4%)
22
DAMA
1 (1.3%)
7 (9.2%)
8
Chi square test: p=0.0024
Assistant professor, [email protected] +91 9894064580; Department of Surgery Unit 1, CMC Hospital, Vellore, Tamilnadu, India, 632004; ORCid: 0000-0001-7015-5794.
Ajith John George et al./ International Journal of Medical Reviews and Case Reports (2020) 4(6):34-37
AcknowledgementWe would like to acknowledge the Department of Medicine, Infectious diseases and Microbiology for the accessibility of the database. We would like to thank the CMC Vellore IRB for their approval.FundingNone.Ethics committee approvalI hereby declare that this article has full compliance with consent committee. The approval was taken before submission of the manuscript.Conflict of interestThe authors declare no conflict of interest.
Melioidosis: Epidemiology, Pathophysiology, and Management. A C Cheng, B J Currie, Clin Microbiol Rev. 182Cheng AC, Currie BJ. Melioidosis: Epidemiology, Patho- physiology, and Management. Clin Microbiol Rev. 2005 Apr 1;18(2):383-416.
Melioidosis of the parotid: The tip of the iceberg. Otolaryngol Head Neck Surg. J Rajinikanth, V Balaji, P Gaikwad, J C Muthusami, 139Rajinikanth J, Balaji V, Gaikwad P, Muthusami JC. Melioido- sis of the parotid: The tip of the iceberg. Otolaryngol Head Neck Surg. 2008 Nov 1;139(5):731-2.
The histopathology of human melioidosis. K T Wong, S D Puthucheary, J Vadivelu, Histopathology. 261Wong KT, Puthucheary SD, Vadivelu J. The histopathol- ogy of human melioidosis. Histopathology. 1995 Jan 1;26(1):51-5.
Epidemiology, clinical manifestations, and diagnosis of melioidosis -UpToDate. Epidemiology, clinical manifestations, and diagnosis of me- lioidosis -UpToDate
Endemic Melioidosis in Tropical Northern Australia: A 10-Year Prospective Study and Review of the Literature. B J Currie, D A Fisher, D M Howard, Jnc Burrow, D Lo, S Selvanayagam, Clin Infect Dis. 314Currie BJ, Fisher DA, Howard DM, Burrow JNC, Lo D, Sel- vanayagam S, et al. Endemic Melioidosis in Tropical North- ern Australia: A 10-Year Prospective Study and Review of the Literature. Clin Infect Dis. 2000 Oct 1;31(4):981-6.
Melioidosis: Epidemiology, Pathophysiology, and Management. A C Cheng, B J Currie, Clin Microbiol Rev. 182Cheng AC, Currie BJ. Melioidosis: Epidemiology, Patho- physiology, and Management. Clin Microbiol Rev. 2005 Apr 1;18(2):383-416.
Melioidosis in Southern India: Epidemiological and Clinical Profile. Southeast Asian J Trop Med Public Health Bangk. K Saravu, C Mukhopadhyay, S Vishwanath, R Valsalan, M Docherla, K E Vandana, 41Saravu K, Mukhopadhyay C, Vishwanath S, Valsalan R, Docherla M, Vandana KE, et al. Melioidosis in Southern In- dia: Epidemiological and Clinical Profile. Southeast Asian J Trop Med Public Health Bangk. 2010 Mar;41(2):401-9.
| Melioidosis is an infection caused by Burkholderia pseudomallei. It is an important human pathogen in the tropical area. The clinical manifestations are protean with multisystem involvement. Septic arthritis and prostatic abscess are rare but well-recognized forms of the disease. Herein we report a case of melioidosis presenting with a rare combination of septic arthritis, prostatic abscess, and septicemia. | Abstract Melioidosis is a rare infectious disease that is very prevalent in certain areas of the world, namely Thailand and certain parts of Northern Australia. There are only 29 cases being reported in the UK since 1988. With air transport industry getting more and more readily available and affordable, it is important to recognise this disease especially those who have recently travelled to those endemic regions. We report a case of a man who presented with pulmonary melioidosis after recent travel to Thailand. | how many cases of melioidosis have been found in the uk | Burkholderia pseudomallei is an important causative organism of fatal ::: community bacteremia especially in Southeast Asia and northern Australia. ::: Outbreaks of melioidosis have been reported post-floods and -typhoons. A cross ::: sectional study was conducted in January 2015, following a major flood in Kelantan, ::: Malaysia to detect presence of B. pseudomallei from soil. A total of 89 soil ::: samples were cultured for B. pseudomallei on Ashdown agar. Putative colonies ::: underwent further staining and biochemical testing prior to confirmation by ::: PCR. Rate of detection was 1%, although low, it nevertheless indicated a risk for ::: melioidosis among flood victims in Kelantan. Flood affected individuals should ::: be made aware of symptoms of melioidosis and healthcare providers must have ::: a high index of suspicion of patients presenting with fever. Such subjects should ::: be screened for the possibility of melioidosis and given prompt treatment to avoid ::: preventable death. | To investigate the current epidemiology of melioidosis in Yangon, Myanmar, between June 2017 and May 2019 we conducted enhanced surveillance for melioidosis in four tertiary hospitals in Yangon, where the disease was first discovered in 1911. Oxidase-positive Gram-negative rods were obtained from the microbiology laboratories and further analysed at the Department of Medical Research. Analysis included culture on Ashdown agar, the three disc sensitivity test (gentamicin, colistin and co-amoxiclav), latex agglutination, API 20 NE, antibiotic susceptibility testing, and a subset underwent molecular confirmation with a Burkholderia pseudomallei specific assay. Twenty one of 364 isolates (5.7%) were confirmed as B. pseudomallei and were mostly susceptible to the antibiotics used in standard therapy for melioidosis. Ten patients were from Yangon Region, nine were from Ayeyarwaddy region, and one each was from Kayin and Rakhine States. A history of soil contact was given by seven patients, five had diabetes mellitus and one had renal insufficiency. The patients presented with septicaemia (12 cases), pneumonia (three cases), urinary tract infection (two cases) and wound infection (four cases). Eighteen patients survived to hospital discharge. This study highlights the likelihood that melioidosis may be far more common, but underdiagnosed, in more rural parts of Myanmar as in other countries in SE Asia. | The cost-effectiveness of the use of selective media for the diagnosis of melioidosis in different settings | The indirect hemagglutination assay (IHA) is the most frequently used serological test to confirm exposure to Burkholderia pseudomallei. Patients with culture-confirmed disease often have a nonreactive IHA at presentation and occasionally fail to seroconvert on serial testing. We investigated whether using antigens derived from the cultured isolates of persistently IHA-nonreactive patient sera improved the sensitivity of the IHA. In addition, we assessed the antigen-specific lymphocyte response in this group of patients to a panel of B. pseudomallei antigens, including those derived from their own cultured isolates. Eleven patients with cultureproven melioidosis were identified as having persistently IHA-nonreactive sera. A modified IHA using erythrocytes sensitized with patient isolate-derived antigen tested against convalescent-phase serum was performed. The majority (82%) of sera showed a negative (<1:5) result, one was borderline (1:20), and one was positive at the cutoff value (1:40). IHA-nonreactive sera were also tested by enzyme immunoassay (EIA), with 73% (8/11) demonstrating IgG positivity. In addition, lymphocytes isolated from persistently IHA-nonreactive patient sera demonstrated significantly increased proliferation in response to B. pseudomallei antigens compared to controls. These studies demonstrate the presence of B. pseudomallei-specific antibody by EIA and B. pseudomalleispecific lymphocytes in patient sera categorized as persistently nonreactive according to the IHA. New immunoassays are required and should incorporate B. pseudomallei antigens that are immunoreactive for this subset of IHA-nonreactive patient sera. | Infection with Burkholderia pseudomallei has been described, albeit rarely, patients in Bangladesh. Infection usually follows percutaneous inoculation or inhalation of the causative bacterium, which is present in soil and surface water in the endemic region. A 35-year-young male farmer presented with prolonged fever and significant weight loss. Patient gradually deteriorated despite getting different antibiotics including intravenous ceftriaxone and metronidazole. Panels of investigations were done which revealed no diagnostic confirmation except uncontrolled diabetes and multiple abscesses in different organs. Melioidosis was suspected and serum samples were positive for Burkholderia pseudomallei antibody. The case illustrates the importance of non-specific nature of the clinical presentation and high index of suspicion of uncommon diseases like melioidosis where the disease has not been considered as an endemic. |
1,999,927 | How come memes have become so popular in the recent year? | Most will agree that 2016 was THE high point for memes, with Trump, Harambe, e.t.c. all being quality material to work with. The great success of the meme economy in 2016 has created a massive deluge of memes unlike anything seen before. There is a reason why memes don't last as long as they used to, as the meme market is exceedingly oversaturated. Meme investors these days are too willing to throw their GPB at literally any ironic meme that crosses their path, creating an endless stream of highly overvalued normie-tier memes. The most obvious example of meme overvaluation is Pepe, which is still heavily invested in by 4chan despite it being as common as dirt by this point. This is the same kind of shit that happened in the normie economy in the time leading up to the Great Depression.
In addition, innovation in the meme economy is at an all time low; the blackpeopletwitter-esque aesthetic that most memes today use has seen very little change over the past 3 years. Sure, there have been some interesting takes on the current meme format, but the general theme that most memes follow has remained practically unchanged. This is essentially the same reason why advice animals and rage comics fell out of fashion around 2013, as their formats had grown old and tired after multiple years of usage. Along with the oversaturation of the meme market, this is another reason why the meme economy seems ripe for a crash.
I predict that the bubble will burst sometime in mid-2017, perhaps even in the same timeframe as the release (and almost certain critical failure) of the Emoji Movie. Given the fact that trends are cyclical, I think we may see a possible resurgence of the 2000s-era meme aesthetic as a response to today's ironic memes. | I feel like the memes of early 2018 were peak asf (Ugandan knuckles, VR chat, DDLC, Logan Paul, "Pictures preceding unfortunate events," Spaget and more) But then after that shit just became ironic deep-fried messes after that. Like you'll get an occasional funny video or trend but it was never as consistent or original as 2018 and prior.
Feel free to debate this tho, I'd love to be wrong. | Might be a confusing question so I'll elaborate more in here. I've noticed that in the past few years (I'd say 2014/2015) memes have completely changed (and yes I do realise this has happened before). Whereas before image macros were the norm, its been completely replaced by those memes where theres text decription then a picture at the bottom.
(example:
In addition, it seems like 4chan is no longer the meme powerhouse as it was before, I've noticed that most memes are coming from blacktwitter, and 4chan even copies their stuff now (i.e saying stuff like fam, tbh, even copying brain meme). Facebook also seems to be dominated by these memes (most of my newsfeed is just friends being tagged in memes). When and why did this happen? | I'm going to go out and say that the Surprised Pikachu meme was pretty dank. There were so many clever usages of the meme and some of them were genuinely funny. Of course, it has a shelf life, like all memes, before people start making much lower quality memes of it, what we call "normie-ification", that's bound to happen to any good meme. Even now, we still use the Drake format though it's old af and has very low quality ones, just because the format has the potential to create much more good memes because you can just slap another person (or object) in the picture and have it still work, quite similar to the Pikachu meme. One major reason we hate it is because it was an excellent method to farm Karma with low effort memes.
As an afterthought, what seperates long lasting memes (Drake, Lisa) from others that die and end up being hated by the community? | almost every scene is a meme if we make memes it will get popular! | These memes don't necessarily have to be exclusive to (or have begun on) Reddit, just ones that are/were the most popular. The ones with the most upvotes will be the ones that were the biggest. | Now it's just /r/creepy lite. Compare this]( "2spooky classic" post to [this recent post. It's sad that spooky memes are no longer popular year round. | As in are we gonna be getting more normie memes like the ugandan knuckles one? Because I hope not. I fear the day when they discover our sub and join us here.
2007scape has a unique identity and is at the forefront of developing high-tech innovative memes. And I dont want to lose that. | 1,999,927 | I don't think I've ever seen memes used or referenced so much outside the internet until recently. | in which country did the internet meme little fatty originate | what type of phenomenon is the term meme | It has become an internet meme . | Reddit is the only place on the internet where I read comments anymore. | What kind of memes are we going to get once mobile hits? | a meme that has a higher popularity peak is not generally expected to survive unless | Question about memes/shitposting | IsItBullshit: The 10 year challenge and other social media memes such as this are a way for companies like google and facebook to make their AI smarter. |
1,999,928 | [Discussion] Randomly bought a TPB on one of my local comic book stores. Got home and found out that the inner cover was signed! Is it rare for this to happen? | My copy came today and I was appalled that the cover was two pieces of cardboard and not a plastic case. For the price should have been better protected. Very cheap on your part. | I just got the Symbiote Spider-Man: Alien Reality TPB and there is not a single variant cover that has its own page.
One page had six variants fit into it, the next had seven, and the final had nine variants. Most trades I have has at most four per page which I can tolerate. But it really does the artwork from these cover artists a disservice. And most of these covers are BEAUTIFUL.
I'd be fine if the story was long (ex: HOX/POX would've been like $100 if each cover had their own page) but the main story was like 100-110 pages. It doesn't hurt to throw in a few more pages to showcase the beauty of some of these covers. The idea of a TPB collecting all the variant covers *can* be a draw to readers like myself.
I hope Marvel doesn't continue this in the future. Let each cover shine. | My GOF copy was without a cover within a year of my purchasing, and many of the pages fell out. I thought perhaps I was too rough with it, but then about 5 of my friends said this happened to them too!
What about you guys? I assume it was a rush print job or something? Australian copies, first release (year 2000) ? | Hi, in 2017 i was at dreamcatcher fansign in brazil and i got this signed Prequel. Now i think it deserve a new owner so im here to look for it.
Since its a out of press and signed item, im taking the highest offers!
* Its signed by all members on the photobook (JiU was the only one who signed the cover idk why lol)
* I have a lot of positive feedbacks on facebook that i can show you
* I can send more pics if you need
* SuA post-it is not included, im keeping it to myself
* I can send to worldwide with tracking number
&#x200B;
&#x200B;
&#x200B;
&#x200B;
&#x200B;
&#x200B;
&#x200B;
&#x200B;
&#x200B;
| CAME WITH EVERYTHING THEY SHOWED AND DESCRIBED. THE COVER WAS RIPPED, BUT IT IS USED AND IT IS 16 YEARS OLD. | I initially posted this to r/kpophelp but was redirected here so I hope this is allowed! I really want to buy an album signed by Mina from Twice and found this one]( but was wondering if someone could help me figure out whether or not the signature is legitimate. I compared it to [this person's copy]( and it seems similar but I'm not an expert! [Here's the link to the seller]( if anyone knows anything about them. They're also selling [this signed copy of Page Two but I'm somewhat skeptical since I'm not sure if the members included "Twice" when signing mwave albums. Thank you for the help! | Im looking for a second soldier 76 on Ebay for my desk. I found one for $5. What is the best way to tell if its a fake or a real one?? | The fact that it came in a paper cover has an enormous let down, it wasn't mentioned as far as I know. The entire reason I chose to buy the physical copy was to have it to where I could stack it and add it to my collection - Not Impressed. | 1,999,928 | Alright, so I was supposed to be buying school supplies but I managed to discover a local comic book shop that I've never been to. Really nice to know that I now have two local comic book shops to browse through on occasion. Looked around for a bit and decided to get this Transformers Spotlight Omnibus vol.2 tucked inconspicuously in a bookshelf on impulse. Didn't initially find it on my other comic book shop and it was the only copy left in the store so I just figured what the hell. Bought it for normal price.
Later after I went home, I unwrapped the plastic and, to my surprise, found out that the inner cover was signed by Shaun Knowler. I usually just read comics for fun and don't really obsess about signed copies or limited collector's edition comics so this was pretty much the only comic-related thing that I have a signature on. Either way I was pretty ecstatic when I first found the sig.
So do you guys think this a rare find for this book? How about TPBs in general? Is it rare to find signed TPBs randomly with a normal price tag on it or is it a fairly common occurrence? | [For Sale] Ghoulish Goblin Red Variant (Suspiria/Dawn Of The Dead Live) W/ The Art Of Ghoulish Gary Pullin Book & Autograph | How much is a 1977 comic book worth? | What is the value of Action COMICS No.1 June, 1938 reprint sealed from dc with Certificate of authenticity. | who partnered with collectabillia to sell autographed memorabilia | Marvel reprinted omnibuses | Does anyone know why the new Danny Cates Thor series Volume 2 is so expensive and hard to find? | WoW 15th Collectors Edition, not complete. | Signed book for pickup at the shows |
1,999,929 | School library: damaged/lost book policy? | The investigators if I recall correctly seemed to stress a local connection. This is probably not a crime committed by an out of state trucker, for example.
Could the perp or his or her siblings have been a student at the school and the book was something never returned? It can be easy to end up with school books at ones home. If they dont get returned sometimes one pays a fine or sometimes nothing happens. The book might not have even been checked out officially.
Could the perp or a relative of the perp worked at the school and occasionally taken books after hours for whatever reason?
Could someone have ended up with books for the above reason but later sold them at a garage sale or Goodwill, etc.? Thus, it seems likely to me that the person had a connection to the elementary school where Asha went or was a least from the Shelby area.
What do you think? | Obviously the book is intact enough to utilize but the spine is ripped to pieces and hanging on by the jacket which leaves me to wonder if I will be held accountable for this damage that was present when I received it. Apparently a rental textbook doesn't have to have appearance standards. | I rented a textbook for 200 for a 6 week summer course, the full price was 260. I was verbally discouraged from buying on-line by the school store staff because this was a "new edition" and couldn't be found anywhere else but the school store.. you know, they change a paragraph or two chapter 4 becomes chapter 8 ect. so they can print and sell a "new" version of the same book.
Anyway, I payed with a debit card that later became void because of a new, bank issued, chip and pin card that was issued in the meantime.
A week and a half later I found the same hard cover new edition of the book I'm using is on amazon for $56, buy to own.
Later I completed the course and out of spite decided not to return the rented textbook.
Now its been a few weeks since its been overdue and they've tried to contact me 3 times by email, the last email informing me that this was the final attempt and that the open rental will be passed to collections.
Should I be worried? I'm not one to steal, I have never done this with college books, when I rent I always return the day of the exam. Seeing the book for 80&#37; cheaper makes college book store seem like a scam, and I did pay 200 dollars, not a deposit, that is their money now. Whats the worst that can happen if I don't return it and it goes to collections?
Also I have completed my degree requirements and am post grad, this course was taken for personal/professional enrichment. | Books came damaged, beyond that a great book that should be a staple in everyone's music libraries. | Its a rented textbook so of course there will be damage to it. However, everything was legible and no pages missing | I used to be in the book club of my old school (basically we were a group of students responsible for keeping an eye on the students in the library and borrowing books to students.) Anyways, shortly before I changed schools, I borrowed a book to read. I really enjoyed it and didn't want to bring it back as it really helped me to get through a dark time in my life.
So when it was my turn to sit at the front desk again, I deleted to book out of the system and took out the Barcode. I still have that book and haven't touched it since. Oops. | Another waste of paper and print. To the trash can this one went.
That's the BEAUTY of Amazon Used Book Dept. When the books are priced so reasonably, you can buy a a lot of books and not feel guilty throwing away the bad one's. | National Library of Sweden At least 62 books were stolen and only a few have been recovered, some with the aid of FBI. Some of the books still missing are works by Johannes Kepler, Thomas Hobbes, and Christiaan Huygens. The library maintains a list of the missing books. At first, the royal book collections were kept in the Royal Palace (Tre Kronor), which burned down in 1697. The National Library moved into its current building in Humlegården in December/January 1877/1878. The building was designed by Gustaf Dahl and built using cast iron. Two wings were added in 1926-27. The National Library was reopened in | 1,999,929 | My apologies if this question has been asked before, but I'm wondering:
School librarians, what's your policy for when a patron has damaged or lost a book?
We don't charge late fees anymore and I've noticed some patrons have become more irresponsible with their library books because they see no significant consequences for their carelessness.
I'm open to any suggestions/comments/ideas.
Thanks! | Book damaged when received | No more late night dumpster runs – recycle and upcycle unwanted library books | Local books disappearing from library | TV fell off a desk that malfunctioned Is it covered by your renters insurance? | Does Barnes & Noble exchange damaged merchandise? | Discussion on Doctrine of Liability Fixation in College Students' Injury Accidents | If you accidentally destroy something in the store do you have to pay for it? | what should a party be awarded for damages |
1,999,930 | It is a very nice piece, easy to set up and use | Very Attractive, Easy Setup. Similar to many other units except this one is especially attractive, IMHO. Great unit at a great price. | Easy to set up and it is very helpful when my ill husband needs my help. Even if I'm upstairs he can ring for me. It's great. | Overall great quality of product can't wait to install. Like that it comes mostly put together. Will be installing it next weekend. Thanks Goofit for the kit I will write more info once I've installed it. | I love it! It was very easy to set up. I looks beautiful. | It is a very pretty piece, however, not big enough to place kitchen utensils in, which is what I purchased it for. | Not as nice as pictured. Looks cheap. Not as nice as other pieces I bought from other sellers. | very cool set, the dinosaur is the easiest part to put together. all over its a very easy set and fun to play with. | Easy to set up and does what it needs to do. The price is right. Can't believe I didn't order this years ago! | 1,999,930 | It is a very nice piece, easy to set up and use. Takes up very little room when stored. | It is a perfect piece for a small apartment | This is nice, sturdy enough and easy to set up (by ... | Just needed a basic space saver in my daughter's room and this is fine. Pretty easy to assemble | Nice piece. Easy to put together | It is very compact and easy to use | its really portable and easy to set up and it is VERY durable | Perfect for my room it was super easy to put ... | Easy to set up and very spacious |
1,999,931 | What is your favorite Robin/Nightwing cover? | Do you have a favorite out of all the cover art they’ve used over the years, and if so, which is it? | Mine is dawnstar due to it pretty much always snowing their, and because it's a nice little hold with a great daedric questline | I was going to do a poll but there are so many great covers and the poll only allows 6 choices. I decided it would be more fun to just post our favorites. | For me, it is Kitana's "The Finale" which is unlocked in the boss towers:
It is very simple, yet so realistic. They nailed Kitana's posture and model-esque walk. What what you choose as the sexiest taunt in the game? | Purchased this off the spinner rack when it was first published. Not only love Michael Golden/terry Austin but I think that is the most beautifully-drawn issue of that entire first series with the exception of Al Williamson/Carlos Garzon's extraordinary adaptations of Empire Strike Back (#39-44). And Return of The Jedi, which was done outside the run as a mini-series and Marvel Super Special. | mines "Something Secret Steers Us" from hl2
&#x200B;
Leave your favorites here, I am just wanna know :D | Have found three so far that I like:
Lisa Hannigan - Martha
Agatha & Fine - Green grass
Tori Amos - Time
Suggestions for very poor covers are also welcome. | Really like the Dick Grayson and Robin character but really struggling with the Bat-verse in New 52. There's just way to many Bat-people, it's super distracting.
Is the first run of Nightwing any good? I'm also interested in the older iterations of Young Justice and Teen Titans, so recommendations in that regard would be cool. | 1,999,931 | Decorating my newborn son’s bedroom, and my wife agreed to my Robin theme. (Kid’s name is Grayson Richard!). I have a few TTG plushies, a nightlight that projects the “R” onto the ceiling, and my mother in law is currently stitching a baby blanket modeled after the classic Robin shirt. But I want to put up some comics in the walls too. What are your favorite Robin covers that would look good hanging up? Kid comes home from the NICU in February, so I have time to get everything done. Thanks in advance. | when was the robin's nest house built | A good place to start with Robin? | who played robin's father in robin's nest | [FEATURE] #3 - October '15 - Robin's Design | Album covers for wall decoration. | VERY simple text accompanies life cycle of a robin...good pick for little bird lovers | the robin flies at dawn was a special edition of which british tv series | Is there any Robin Hood type Rangers? |
1,999,932 | Which countries not in the un? | Non member country in un? | Which country does not have a permanent seat on the UN security council? | How many UN member nations? | Just as the title says, I'm wondering if there are different established groups and the UN server. Territories? | What are the countries that support India for a permanent seat in the UN? | What is the name of the country which recently joined UN? | How many countries are there under uno? | Each member nation of the United Nations? | 1,999,932 | What countries not in un? | List the non democratic countries in the world? | Who does not belong to United Nations? | Latest country to join the un? | What nation is in the united nations? | are the us part of the un? | How many un nations in 2001? | How do international non-governmental organizations select countries for naming and shaming? | which countries are not included in schengen visa? |
1,999,933 | Modified importance-performance analysis: an application to hospitals. | The Importance-Performance Analysis: An Evaluation and Marketing Tool |
Introduction
Health system performance refers to improving a patient's overall health while achieving business goals. Health systems are continuously faced with key issues such as inefficiency, the challenge of meeting patient needs, and increased costs. 1 Improving the performance of hospitals is thus essential to appropriately respond to such challenges and adapt to social changes in modern society. 2 To this end, health managers and policymakers need a specific framework to evaluate the performance of hospitals. 1 Performance evaluation is a key success factor for any organization and a persistent challenge facing managers and stakeholders. 3 Performance evaluation systems allow identification of the current organizational status and quality of activities, especially in complex and dynamic environments. Without such a system, an organization may not survive in the long run. For the first time, in 1859, Florence Nightingale evaluated hospital performance using parameters such as mortality and infection rates. 4 However, it is only since 2000 that certain activities have been initiated to develop tools to measure health system performance. 5 Key performance indicators (KPIs) are performancebased decision-making tools used by policymakers and managers. [6][7][8] These indicators are used to monitor, evaluate, and manage health systems to improve the quality, efficiency, and effectiveness of health care and to plan and develop organizational goals. 9 Given the increasing complexity of hospital management, there is a need for tools to evaluate hospital performance based on scientific knowledge. 10 Such tools must include appropriate indicators that adequately reflect the performance of hospitals. 11 In addition, taking into account possible changes in hospital performance over time, there should be enough flexibility to adapt performance indicators, as new evidence comes to light. 12 Additionally, it is inevitable that hospitals will have to deal with performance indicators that are at times contradictory, e.g., safety versus satisfaction or cost of goods versus treatment cost. Consequently, it is essential to identify and prioritize indicators in terms of quality and quantity. For this purpose, multi-criteria decisionmaking (MCDM) is one of the methods used to explicitly evaluate multiple conflicting criteria in decision making. 13 Another method is the bestworst method (BWM), developed by Rezaei in 2015. 14 This method is proposed to solve MCDM problems by comparing the best/worst criterion against all other identified criteria. In comparison with other algorithms, the advantage of BWM is that it requires fewer comparative data and leads to more consistent and stable results. 15 In addition, it uses pairwise comparison and thus less likelihood of inconsistencies by comparing too many criteria. The results of various case studies that implemented BWM indicated that it outperforms other methods in terms of consistency ratio, minimum violation, total deviation, and conformity. 14 Although the BWM has been widely used in various industries, its implementation in the health system is scarce. To the best of our knowledge, only a few studies in Iran have implemented the BWM for decision-making. Abadi and colleagues used the BWM to develop a strategic planning framework for expanding the medical tourism industry in Yazd (Iran). 16 In another study, Rowshan and colleagues used this method to identify and prioritize factors influencing outsourcing in Zeinabieh Hospital in Shiraz (Iran). 17 In the present study, the BWM is used to identify and prioritize KPIs of public hospitals in Iran.
Materials and Methods
The present study was approved by the Ethics Committee of Shiraz University of Medical Sciences, Shiraz, Iran (IR.SUMS.REC.1396. S274). A cross-sectional study was conducted during 2016-2019 to identify and prioritized KPIs in Iranian public hospitals using the BWM. Initially, the best and worst criteria for decisionmaking were determined and compared. Then, the problem was optimized, and the weight of each criterion was determined based on two features, namely the probability and the effect. Finally, using the obtained weights, alternatives resulting in a set of criteria were calculated, and the best alternative was selected. We also calculated the inconsistency rate. The BWM consists of six steps:
Step 1: Define a set of decision-making criteria. In this step, a set of indicators required for decision-making is defined as {c 1 , c 2 , …, c n }. In addition, factors affecting the performance of public hospitals were extracted based on a previous study. 8 Because of the large number of factors and indicators, the content validity ratio (CVR) was used for screening purposes. CVR was quantitatively calculated based on the opinion of an expert panel. The experts were requested to rate each item on a threepoint scale, namely "effective", "effective but not necessary" and "not effective". Since the expert panel comprised 32 members, CVR>0.29 was considered acceptable. 18 where NE: The number of the experts who rated an item as "necessary", N: The total number of the experts.
Step 2: Define the best (most important) and the worst (least important) criteria. The selection was made by the panel based on their Step 3: Define the priority of the best criterion among all other criteria by assigning a score from one to nine. The comparison was performed by the experts using the pairwise comparison method. The priority vector of the best indicator compared to others was expressed as A B =(a B1 , a B2 ,…, a Bn ).
Step 4: Define the priority of the worst criterion among all other criteria in the same manner as in step 3. The priority vector of all indicators compared to the worst indicator was expressed as Aw= (a w1 , a w2 , …, a wn ) T Step 5: Modeling the research problem with a linear programming formula. In this stage, for each pairwise comparison of the best criterion with the other criteria (W b /W j ), a technical coefficient of the best comparison (α bj ) was obtained. Similarly, for each pairwise comparison of the worst criterion with the other criteria (W j /W w ), a technical coefficient of the worst comparison (α jw ) was obtained. These were expressed as:
The maximum difference between the equations was minimized.
The result of minimizing the equations was the formation of a function with restrictions.
such that To solve the equation, a linear programming formula was developed: min ε such that
Step 6: Solving the linear programming formula to determine the final weights of each criterion. In this stage, indicators were evaluated and prioritized using the obtained weights.
Data were analyzed using LINGO software version 18.0.44 (Lindo Systems, IL, USA).
Results
Based on the opinion of the expert panel, out of 58 external and 33 internal factors affecting the performance of public hospitals, 18 and 11 factors were selected based on the CVR value, respectively. Internal factors were categorized into two dimensions, namely efficiency, and effectiveness. Indicators associated with efficiency were mainly related to financial factors. External factors were categorized into seven dimensions, namely economic, legal, social, environmental, political, technological, and healthcare megatrends. Among these, economic, legal, and political were the most prominent factors negatively affected by budgeting policies and the payment system. A megatrend was also identified in the form of a national health insurance system as well as a shift from employer-based to governmentsubsidized insurance coverage (table 1).
Among all factors affecting the performance of public hospitals, economic and social dimensions (external factors) received the highest and lowest ranks with the weights of 0.27 and 0.05, respectively. Efficiency and effectiveness (internal factors) were ranked third and fifth, respectively (table 2).
In the "economic factor" category, the highest-ranking indicators were the structure of the payment system, the inflation rate in the health sector, and patient out-of-pocket contribution. Similarly, the hospital budgeting system and mandatory implementation of guidelines were the highest-ranking indicators in the "legal factors" category. In the category of "social factors", changes in disease patterns and equity in utilization of hospital services were the most important indicators. Of all indicators, privatization in line with Article 44 of the Constitution of the I.R. Iran (political factor) ranked first followed by advancement in health information technology (technological factor) and increased risk of illnesses due to environmental pollution (environmental factor). In the category of "healthcare megatrends", a paradigm shift from quantity to quality health service provision, national health insurance, and a shift from employer-based to governmentsubsidized insurance coverage were the most important items. Among all indicators of internal factors, the most important indicators affecting the performance of public hospitals were emergency care waiting time, the cost revenue ratio, the percentage of doctors using guidelines, and the cost-effectiveness ratio of health care services (table 2)
Discussion
The results of the BWM showed that the economic factor (weight: 0.27099) was the most contributing factor affecting the performance of public hospitals in Iran. Among all indicators of the economic factor, the structure of the payment system had the greatest impact on the performance of public hospitals. The payment system has been reported to be one of the major issues, because it is designed to promote competition between hospitals and increase the number of services to attract more patients. 19 This model is referred to as the pay-for-service approach, whereby payments are made based on the intensity (volume, frequency, duration, and type) of the provided services. In recent years, however, a new megatrend has been observed in which a shift from a pay-for-service to a payfor-performance model has taken place, whereby higher quality of care has become the basis for the payment system. [20][21][22] This is indicative of a paradigm shift from quantity to quality provision of health services. The importance of this paradigm shift was also reflected in our results, as it ranked fifth among all indicators. Implementation of pay-for-performance will eventually lead to the provision of higher quality services and reduced costs. 23 In addition, one of the consequences of this approach is the development of a value-based purchasing program. 22,24,25 Accordingly, the Iranian health macro policies also emphasize topics such as a quality-based payment system, efficiency improvement, fair salary, and incentives for healthcare providers to improve health care. 22 Unquestionably, hospital performance will markedly improve if healthcare managers and policymakers pro-actively reform the current payment system.
The political factor (weight: 0.151799) was also found to be an important criterion affecting the performance of public hospitals. Based on the opinion of the expert panel, privatization (in line with Article 44 of the Constitution of the I.R. Iran) was the key indicator affecting hospital performance. This approach is an essential component of health system reform, 26 as it will improve hospital performance through cost reduction, faster provision of health care services, higher efficiency, improving the skills of health care workers, and direct focus on key hospital processes. 27 The most important factor for the success of this approach is the collaboration between public and private health sectors in synchronizing their services to increase added value. Additionally, streamlining the structure and organization of hospitals and better evaluating the performance of management teams provide greater adaptability. Furthermore, it gives more flexibility and functional autonomy to hospitals due to their financial dependence on the state budget. [28][29][30] However, Kavosi and colleagues warned against outsourcing public health services to the private sector, as it involves complex and multi-criteria decisions. 31 Among all factors affecting hospital performance, efficiency and effectiveness ranked third and fifth, respectively. The main indicators associated with these factors were emergency care waiting time (total rank: 6) and cost revenue ratio (total rank: 10). The latter is indicative of the impact of financial conditions on efficiency as an internal factor. In line with our findings, Rahimi and colleagues used a balanced scorecard to determine the performance indicators identified in Iranian public hospitals. They concluded that the cost revenue ratio is one of the key performance indicators. They also showed that this ratio was causally related to as many as 16 different indicators (73%). Another study also reported that financial indicators significantly affected hospital performance and had a causal relationship with other performance indicators. 3 The results of our study showed that emergency care waiting time (total rank: 6) had a great impact on the effectiveness of hospital performance. In a meta-analysis study, Fazel Hashemi and colleagues reported that waiting time in the emergency departments of Iranian hospitals is well above national and international standards. 32 The longer the emergency care waiting time, the less efficient the hospital process. 33 It is therefore essential to address this indicator not only for its positive contribution to effectiveness, but also for its impact on several other hospital performance factors. Rahimi and colleagues showed that emergency care waiting time has a causal relationship with at least eight other indicators, namely cost revenue ratio, the average length of stay, bed occupancy rate, withdrawal of consent for treatment, hospital infection rate, patient satisfaction, and the number of patient complaints. 3 A triage system is an effective method to reduce waiting time in an emergency department. Choi and colleagues investigated the effect of triage rapid initial assessment by a doctor (TRIAD) on waiting time in an emergency department. 34 They reported that the average waiting time and processing time were reduced by 38% and 23%, respectively. Some other studies have applied different techniques to reduce emergency care waiting time. Based on the quality function deployment technique, Rahimi and colleagues proposed a model to improve the quality of emergency services. 35 In another study, Vashi and colleagues applied lean principles to reduce emergency care waiting times and reported a reduction of doorto-doctor time by 12.6 minutes. 36 The main strength of the present study is the inclusion of both internal and external performance factors affecting public hospitals in Iran. This approach differs from previous studies that solely focused on internal factors. The main limitation of the present study was caused by the COVID-19 pandemic, which hindered the data collection process and negatively affected the completion of the BWM questionnaire. It is recommended that further studies apply the improved version of BWM such as rough BWM or fuzzy BWM. This overcomes uncertainty and ambiguity issues associated with the opinion of the panel of experts. Due to the potential causal relationship between indicators and the complex nature of the topic, the use of soft operational research methods is recommended.
Conclusion
The results showed that external factors (economic and political) had a greater impact on the performance of public hospitals in Iran than internal factors (efficiency and effectiveness). In assessing the effectiveness of interventions and the performance of hospitals, these external factors should be considered.
Acknowledgment
The present manuscript is submitted in partial fulfillment of the requirements for the PhD degree of K. Pourmohammadi (research proposal: 95-01-07-13769). The authors express their gratitude to the Research Council of Shiraz University of Medical Sciences (Shiraz, Iran) for their support.
Authors' Contribution
P.S: Designed the study, finalized the data synthesis and its overall methodology and revised the manuscript critically for important intellectual content; K.P and R.H: Retrieved and interpreted the data and prepared the initial draft of the article; P.B: Contributed to data analysis and revised the article; N.H: Cooperated in data analysis, improved the structure and conclusion of the paper and revised the manuscript critically for important intellectual content. The study was supervised by PS. All authors read and approved the final manuscript and are responsible for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.
Conflict of Interest: None declared.
Table 1 :
1Internal and external factors and the corresponding indicators affecting hospital performanceDimensions
Indicators
Table 2 :
2Final weights of the factors and indicators affecting the performance of Iranian public hospitalsFactors
Weight (rank) Indicators
Local
weight 1
Incompatibility
rate
Global
weight 2
Final
rank
Economic
0.27099 (1)
Structure of payment system
0.233
0.058
0.063
4
Tariff structure
0.078
0.021
18
Structure of procurement system (medicine
and supplies)
0.049
0.013
23
Inflation rate in the health sector
0.107
0.029
11
Increase in costs
0.098
0.026
14
Global inflation rate
0.053
0.014
21
Structure of financial system
0.097
0.026
15
Timely payment of hospital claims by
insurers
0.099
0.026
13
Patient out-of-pocket contribution
0.103
0.027
12
Economic sanctions
0.036
0.009
28
The share of health sector of the national
budget
0.043
0.011
24
Political
0.151799 (2)
Privatization in line with Article 44 of the
Constitution of the I.R. Iran
0.151
0.041
0.151
1
Efficiency
0.108386 (3)
Daily costs per patient
0.108
0.073
0.011
25
Ratio of payroll expenses to total revenue
per day
0.097
0.010
26
Ratio of the costs of medication and health
care products to total allocated budget
0.071
0.007
33
Ratio of the costs of medication and health
care products to total costs
0.070
0.007
34
Ratio of total cost to available beds
0.091
0.009
29
Cost revenue ratio
0.278
0.030
10
Cost-effectiveness ratio of health care
services
0.171
0.018
20
Duration of hospital stay
0.058
0.006
39
Maintenance of human resources
0.052
0.005
40
Healthcare
megatrends
0.093363 (4)
General health insurance and a shift from
employer-based to government-subsidized
insurance coverage
0.390
0.047
0.036
7
A paradigm shift from quantity to quality
health service provision
0.431
0.040
5
Aging population affecting the health system 0.103
0.009
31
Emergence of genomic medicine for
prognostic and diagnostic purposes
0.075
0.007
37
Effectiveness
0.090758 (5)
Availability of a system to review and analyze
mortality data
0.083
0.052
0.007
35
Number of developed guidelines in the hospital 0.080
0.007
36
Treatment compatibility with patient needs
0.110
0.010
27
Percentage of doctors using guidelines
0.125
0.018
19
Emergency care waiting time (triage, admission
and discharge process, surgery, etc.)
0.204
0.039
6
Collaboration between management team,
doctors, and staff in quality improvement
programs
0.435
0.006
38
Legal
0.083651 (6)
Fair salary scale
0.116
0.030
0.009
30
Hospital budgeting system
0.392
0.032
8
Health technology assessment
0.111
0.009
32
Mandatory implementation of guidelines
0.379
0.031
9
Technological
0.080386 (7)
Advancement in health information technology 0.080
0.027
0.080
2
Environmental 0.063281 (8)
Increased risk of illnesses due to
environmental pollution
0.063
0.033
0.063
3
Social
0.05724 (9)
Changes in disease burden pattern
0.374
0.022
0.021
16
Improving education level and access to
information resources
0.254
0.014
22
Equity in utilization of hospital care
0.371
0.021
17
1: Weight of indicator, 2: Weight of dimension×weight of indicator
Ranking the Healthcare Resource Factors for Public Satisfaction with Health System in China-Based on the Grey Relational Analysis Models. X Peng, X Tang, Y Chen, J H Zhang, 10.3390/ijerph1803099533498645Int J Environ Res Public Health. 187908117PubMed Central PMCIDPeng X, Tang X, Chen Y, Zhang JH. Rank- ing the Healthcare Resource Factors for Public Satisfaction with Health System in China-Based on the Grey Relational Analy- sis Models. Int J Environ Res Public Health. 2021;18. doi: 10.3390/ijerph18030995. PubMed PMID: 33498645; PubMed Central PMCID: PMCPMC7908117.
Future of health care delivery in iran, opportunities and threats. F Rajabi, H Esmailzadeh, N Rostamigooran, R Majdzadeh, L Doshmangir, 23865012Iran J Public Health. 423712596PubMed Central PMCIDRajabi F, Esmailzadeh H, Rostamigooran N, Majdzadeh R, Doshmangir L. Future of health care delivery in iran, opportunities and threats. Iran J Public Health. 2013;42:23-30. PubMed PMID: 23865012; PubMed Central PMCID: PMCPMC3712596.
Developing a strategy map to improve public hospitals performance with balanced scorecard and dematel approach. H Rahimi, J Bahmaei, P Shojaei, Z Kavosi, M Khavasi, 10.5812/semj.64056JOURNAL DEMO NEOSCRIBER V3 single. 1964056Rahimi H, Bahmaei J, Shojaei P, Kavosi Z, Khavasi M. Developing a strategy map to improve public hospitals performance with balanced scorecard and dematel approach. JOURNAL DEMO NEOSCRIBER V3 single. 2018;19:e64056. doi: 10.5812/semj.64056.
Selecting Hospital's Key Performance Indicators, Using Analytic Hierarchy Process Technique. Gholamzadeh Nikjoo, R , Jabbari Beyrami, H Jannati, A , Asghari Jaafarabadi, M , Journal of Community Health Research. 2Gholamzadeh Nikjoo R, Jabbari Beyrami H, Jannati A, Asghari Jaafarabadi M. Select- ing Hospital's Key Performance Indicators, Using Analytic Hierarchy Process Technique. Journal of Community Health Research. 2013;2:30-8.
The Dutch Health Care Performance Report: seven years of health care performance assessment in the Netherlands. M J Van Den Berg, D S Kringos, L K Marks, N S Klazinga, 10.1186/1478-4505-12-124405849Health Res Policy Syst. 123896735PubMed Central PMCIDvan den Berg MJ, Kringos DS, Marks LK, Klazinga NS. The Dutch Health Care Per- formance Report: seven years of health care performance assessment in the Neth- erlands. Health Res Policy Syst. 2014;12:1. doi: 10.1186/1478-4505-12-1. PubMed PMID: 24405849; PubMed Central PMCID: PMCPMC3896735.
The Production Function of the Hospitals in Iran: A Systematic Review. M Kazemi, M S Karimi, 10.5812/ijhls.102179International Journal of Health and Life Sciences. 6102179Kazemi M, Karimi MS. The Production Function of the Hospitals in Iran: A System- atic Review. International Journal of Health and Life Sciences. 2020;6:e102179. doi: 10.5812/ijhls.102179.
Indicators of hospital performance evaluation: a systematic review. H Rahimi, M Khammar-Nia, Z Kavosi, M Eslahi, International Journal of Hospital Research. 3Rahimi H, Khammar-nia M, Kavosi Z, Eslahi M. Indicators of hospital performance evalu- ation: a systematic review. International Jour- nal of Hospital Research. 2014;3:199-208.
A comprehensive map of the evidence on the performance evaluation indicators of public hospitals: a scoping study and best fit framework synthesis. K Pourmohammadi, N Hatam, P Shojaei, P Bastani, 10.1186/s12962-018-0166-z.PubMed30534009Cost Eff Resour Alloc. 166282321PubMed Central PMCIDPourmohammadi K, Hatam N, Shojaei P, Bastani P. A comprehensive map of the evi- dence on the performance evaluation indica- tors of public hospitals: a scoping study and best fit framework synthesis. Cost Eff Resour Alloc. 2018;16:64. doi: 10.1186/s12962-018- 0166-z. PubMed PMID: 30534009; PubMed Central PMCID: PMCPMC6282321.
Conceptual frameworks for health systems performance: a quest for effectiveness, quality, and improvement. O A Arah, N S Klazinga, D M Delnoij, A H Ten Asbroek, T Custers, 10.1093/intqhc/mzg04914527982Int J Qual Health Care. 15Arah OA, Klazinga NS, Delnoij DM, ten Asbroek AH, Custers T. Conceptual frame- works for health systems performance: a quest for effectiveness, quality, and improve- ment. Int J Qual Health Care. 2003;15:377- 98. doi: 10.1093/intqhc/mzg049. PubMed PMID: 14527982.
Using MCDA to evaluate the performance of the logistics process in public hospitals: the case of a Brazilian teaching hospital. A Longaray, L Ensslin, S Ensslin, G Alves, A Dutra, P Munhoz, 10.1111/itor.12387International Transactions in Operational Research. 25Longaray A, Ensslin L, Ensslin S, Alves G, Dutra A, Munhoz P. Using MCDA to evalu- ate the performance of the logistics process in public hospitals: the case of a Brazilian teaching hospital. International Transactions in Operational Research. 2018;25:133-56. doi: 10.1111/itor.12387.
Constructing a strategy map for banking institutions with key performance indicators of the balanced scorecard. Eval Program Plann. H Y Wu, 2241016335Wu HY. Constructing a strategy map for bank- ing institutions with key performance indica- tors of the balanced scorecard. Eval Pro- gram Plann. 2012;35:303-20. doi: 10.1016/j. evalprogplan.2011.11.009. PubMed PMID: 22410163.
Selection of indicators for hospital performance measurement: a report on the 3rd and the 4th workshop. W H Organization, Barcelona, SpainCopenhagen: WHO Regional Office for EuropeOrganization WH. Selection of indicators for hospital performance measurement: a report on the 3rd and the 4th workshop, Barcelona, Spain, June and September 2003. Copenha- gen: WHO Regional Office for Europe, 2004.
Evaluating the health system financing of the Eastern Mediterranean Region (EMR) countries using Grey Relation Analysis and Shannon Entropy. K Pourmohammadi, P Shojaei, H Rahimi, P Bastani, 10.1186/s12962-018-0151-630237754Cost Eff Resour Alloc. 166142403PubMed Central PMCIDPourmohammadi K, Shojaei P, Rahimi H, Bas- tani P. Evaluating the health system financ- ing of the Eastern Mediterranean Region (EMR) countries using Grey Relation Analy- sis and Shannon Entropy. Cost Eff Resour Alloc. 2018;16:31. doi: 10.1186/s12962-018- 0151-6. PubMed PMID: 30237754; PubMed Central PMCID: PMCPMC6142403.
Best-worst multi-criteria decisionmaking method. J Rezaei, 10.1016/j.omega.2014.11.009Omega. 53Rezaei J. Best-worst multi-criteria decision- making method. Omega. 2015;53:49-57. doi: 10.1016/j.omega.2014.11.009.
Best-worst multi-criteria decisionmaking method: Some properties and a linear model. J Rezaei, 10.1016/j.omega.2015.12.001Omega. 64Rezaei J. Best-worst multi-criteria decision- making method: Some properties and a linear model. Omega. 2016;64:126-30. doi: 10.1016/j.omega.2015.12.001.
Application of best-worst method in evaluation of medical tourism development strategy. F Abadi, I Sahebi, A Arab, A Alavi, H Karachi, Decision Science Letters. 7Abadi F, Sahebi I, Arab A, Alavi A, Karachi H. Application of best-worst method in evalu- ation of medical tourism development strat- egy. Decision Science Letters. 2018;7:77-86.
Providing an Outsourcing Pattern of Selected Departments of Shiraz zeynabiye Hospital by Using Multi-Criteria Decision-Making Technniques Shiraz University. M Rowshan, Rowshan M. Providing an Outsourcing Pat- tern of Selected Departments of Shiraz zey- nabiye Hospital by Using Multi-Criteria Deci- sion-Making Technniques Shiraz University. 2018.
Critical values for Lawshe's content validity ratio: revisiting the original methods of calculation. Measurement and evaluation in counseling and development. C Ayre, A J Scally, 10.1177/074817561351380847Ayre C, Scally AJ. Critical values for Law- she's content validity ratio: revisiting the original methods of calculation. Mea- surement and evaluation in counseling and development. 2014;47:79-86. doi: 10.1177/0748175613513808.
Identifying enablers of technological innovation for Indian MSMEs using best-worst multi criteria decision making method. H Gupta, M K Barua, 10.1016/j.techfore.2016.03.028Technological Forecasting and Social Change. 107Gupta H, Barua MK. Identifying enablers of technological innovation for Indian MSMEs using best-worst multi criteria decision making method. Technological Forecasting and Social Change. 2016;107:69-79. doi: 10.1016/j.techfore.2016.03.028.
Fee-for-service will remain a feature of major payment reforms, requiring more changes in Medicare physician payment. Health Aff (Millwood). P B Ginsburg, 10.1377/hlthaff.2012.03502294944631Ginsburg PB. Fee-for-service will remain a feature of major payment reforms, requiring more changes in Medicare physician pay- ment. Health Aff (Millwood). 2012;31:1977- 83. doi: 10.1377/hlthaff.2012.0350. PubMed PMID: 22949446.
The impact of hospital pay-for-performance on hospital and Medicare costs. G B Kruse, D Polsky, E A Stuart, R M Werner, 10.1111/1475-6773.1200323088391Health Serv Res. 47Kruse GB, Polsky D, Stuart EA, Werner RM. The impact of hospital pay-for-performance on hospital and Medicare costs. Health Serv Res. 2012;47:2118-36. doi: 10.1111/1475- 6773.12003. PubMed PMID: 23088391;
. Pubmed Central, Pmcid , 3523367PubMed Central PMCID: PMCPMC3523367.
The effect of pay-for-performance in hospitals: lessons for quality improvement. R M Werner, J T Kolstad, E A Stuart, D Polsky, 10.1377/hlthaff.2010.127721471490Health Aff (Millwood). 30Werner RM, Kolstad JT, Stuart EA, Polsky D. The effect of pay-for-performance in hospitals: lessons for quality improvement. Health Aff (Millwood). 2011;30:690-8. doi: 10.1377/hlthaff.2010.1277. PubMed PMID: 21471490.
Megatrend analaysis of the health policies of IR Iran. I Nabipour, ISMJ. 17Nabipour I. Megatrend analaysis of the health policies of IR Iran. ISMJ. 2014;17:1007-30.
Transforming Health Care From Volume to Value. AAACN Viewpoint. Lois Stauffer, M , 3910Lois Stauffer M. Transforming Health Care From Volume to Value. AAACN Viewpoint. 2017;39:10.
Qualitative analysis of national documents on health care services and pharmaceuticals` purchasing challenges: evidence from Iran. P Bastani, M Samadbeik, R Dinarvand, S Kashefian-Naeeini, S Vatankhah, 10.1186/s12913-018-3261-029871679BMC Health Serv Res. 185989418PubMed Central PMCIDBastani P, Samadbeik M, Dinarvand R, Kashefian-Naeeini S, Vatankhah S. Quali- tative analysis of national documents on health care services and pharmaceuticals` purchasing challenges: evidence from Iran. BMC Health Serv Res. 2018;18:410. doi: 10.1186/s12913-018-3261-0. PubMed PMID: 29871679; PubMed Central PMCID: PMCPMC5989418.
Pharmaceutical strategic purchasing requirements in Iran: Price interventions and the related effective factors. P Bastani, R Dinarvand, M Samadbeik, K Pourmohammadi, 10.4103/2279-042X.17655326985434J Res Pharm Pract. 54776545PubMed Central PMCIDBastani P, Dinarvand R, SamadBeik M, Pourmohammadi K. Pharmaceutical strate- gic purchasing requirements in Iran: Price interventions and the related effective fac- tors. J Res Pharm Pract. 2016;5:35-42. doi: 10.4103/2279-042X.176553. PubMed PMID: 26985434; PubMed Central PMCID: PMCPMC4776545.
The level of propensity to outsource Study: Based on hospital services features by managers and staff perspective in hospitals Kavousi Z Abstract: of Shiraz University of Medical Science. Z Kavousi, F Setoudehzade, E Kharazmi, R Khabiri, R Ravangard, H Rahimi, Journal of Hospital. 11Kavousi Z, Setoudehzade F, Kharazmi E, Khabiri R, Ravangard R, Rahimi H. The level of propensity to outsource Study: Based on hospital services features by managers and staff perspective in hospitals Kavousi Z Abstract: of Shiraz University of Medical Science, 2010. Journal of Hospital. 2012;11:9-18.
Contracting but not without caution: experience with outsourcing of health services in countries of the Eastern Mediterranean Region. S Siddiqi, T I Masud, B Sabri, 17143460Bull World Health Organ. 84Siddiqi S, Masud TI, Sabri B. Contracting but not without caution: experience with out- sourcing of health services in countries of the Eastern Mediterranean Region. Bull World Health Organ. 2006;84:867-75. doi: 10.2471/ blt.06.033027. PubMed PMID: 17143460;
. Pubmed Central, Pmcid , 2627537PubMed Central PMCID: PMCPMC2627537.
Outsourcing in Turkish hospitals: a systematic review. Y Akbulut, G Terekli, T Yildirim, Akbulut Y, Terekli G, Yildirim T. Outsourcing in Turkish hospitals: a systematic review.
. Ankara Sağlık, Hizmetleri Dergisi, 10.1501/Ashd_00000000802012Ankara Sağlık Hizmetleri Dergisi. 2012:25- 33. doi: 10.1501/Ashd_0000000080.
Experiences of selected countries in the use of public-private partnership in hospital services provision. A Sadeghi, O Barati, P Bastani, D D Jafari, M Etemadian, 27812056J Pak Med Assoc. 66Sadeghi A, Barati O, Bastani P, Jafari DD, Etemadian M. Experiences of selected coun- tries in the use of public-private partnership in hospital services provision. J Pak Med Assoc. 2016;66:1401-6. PubMed PMID: 27812056.
A Public-Private Partnership Improves Clinical Performance In A Hospital Network In Lesotho. N Mcintosh, A Grabowski, B Jack, E L Nkabane-Nkholongo, T Vian, 10.1377/hlthaff.2014.094526056200Health Aff (Millwood). 34McIntosh N, Grabowski A, Jack B, Nka- bane-Nkholongo EL, Vian T. A Public-Pri- vate Partnership Improves Clinical Perfor- mance In A Hospital Network In Lesotho. Health Aff (Millwood). 2015;34:954-62. doi: 10.1377/hlthaff.2014.0945. PubMed PMID: 26056200.
Public-Private Partnership in Infrastructure Development-Case Studies from Asia and Europe. H W Alfen, S N Kalidindi, S Ogunlana, S Wang, M P Abednego, A Frank-Jungbecker, VerlagWeimarAlfen HW, Kalidindi SN, Ogunlana S, Wang S, Abednego MP, Frank-Jungbecker A, et al. Public-Private Partnership in Infra- structure Development-Case Studies from Asia and Europe. Weimar: Verlag der
. Iran J Med Sci. 47557Iran J Med Sci November 2022; Vol 47 No 6 557
. Bauhaus-Universität, Bauhaus-Universität; 2009.
Factors influencing decision making for healthcare services outsourcing: A review and Delphi study. Z Kavosi, H Rahimi, S Khanian, P Farhadi, E Kharazmi, 10.14196/mjiri.32.5630175082Med J Islam Repub Iran. 326113583PubMed Central PMCIDKavosi Z, Rahimi H, Khanian S, Farhadi P, Kharazmi E. Factors influencing decision making for healthcare services outsourcing: A review and Delphi study. Med J Islam Repub Iran. 2018;32:56. doi: 10.14196/mjiri.32.56. PubMed PMID: 30175082; PubMed Central PMCID: PMCPMC6113583.
Identifying Key Performance Indicators for Holistic Hospital Management with a Modified DEMATEL Approach. S L Si, X Y You, H C Liu, J Huang, 10.3390/ijerph1408093428825613Int J Environ Res Public Health. 145580636PubMed Central PMCIDSi SL, You XY, Liu HC, Huang J. Identifying Key Performance Indicators for Holistic Hos- pital Management with a Modified DEMATEL Approach. Int J Environ Res Public Health. 2017;14. doi: 10.3390/ijerph14080934. PubMed PMID: 28825613; PubMed Central PMCID: PMCPMC5580636.
Patient waiting time in hospital emergency departments of Iran: A systematic review and meta-analysis. Fazl Hashemi, Sme , Sarabi Asiabar, A Rezapour, A Azami-Aghdash, S , Hosseini Amnab, H Mirabedini, S A , 10.14196/mjiri.31.7929445707Med J Islam Repub Iran. 315804420PubMed Central PMCIDFazl Hashemi SME, Sarabi Asiabar A, Rezapour A, Azami-Aghdash S, Hosseini Amnab H, Mirabedini SA. Patient waiting time in hospital emergency departments of Iran: A systematic review and meta-analy- sis. Med J Islam Repub Iran. 2017;31:79. doi: 10.14196/mjiri.31.79. PubMed PMID: 29445707; PubMed Central PMCID: PMCPMC5804420.
Quality management: reduction of waiting time and efficiency enhancement in an ENT-university outpatients' department. M Helbig, S Helbig, H A Kahla-Witzsch, May A , 10.1186/1472-6963-9-21PMC2655294BMC Health Serv Res. 921PubMed PMID. PubMed CentralHelbig M, Helbig S, Kahla-Witzsch HA, May A. Quality management: reduction of waiting time and efficiency enhancement in an ENT-university outpatients' depart- ment. BMC Health Serv Res. 2009;9:21. doi: 10.1186/1472-6963-9-21. PubMed PMID: 19183496; PubMed Central PMCID: PMCPMC2655294.
| Improving health is the fundamental goal of all health systems, and with an evident gap between the potential of the public health system and its performance, bettering the services that provide care is critical to achieving this goal. This gap creates a need to identify and understand what drives performance so as to be able to assess how the potential can be reached. Thus, this research investigates the key inputs into a performance assessment framework and develops a core set of performance dimensions that is inclusive of all the factors that affect performance. | This paper proposes a method of deriving a hospital quality performance indicator using mortality outcome measures. The method aggregates any number of mortality outcome measures observed over several years into a single indicator. We begin with the supposition that there exists an abstract quality index which drives all observed mortality outcomes in each hospital. This abstract index is not directly observable but manifested via the observed mortality outcomes, which we make use of to provide an estimate of the abstract index. The method is applied to a sample of heart disease episodes extracted from hospital administrative data from the state of Victoria, Australia. Using the quality estimates, we show that teaching hospitals and large regional hospitals perform better than other hospitals and this superior performance is related to hospital size. | The performance of an Intensive Care unit (ICU) has different aspects. For many years, the performance was synonymous with the standard mortality ratio (SMR). But nowadays, other aspects of performance are considered: from the patients, families, nurses, doctors and provider’s points of view. Several studies, on the other hand, have demonstrated the relationship between organisation and performance. | The Spillover Effects of Hospital Closures on the Efficiency and Quality of Other Hospitals | Hospital standardised mortality ratios are fairly easy to produce and, as the example of Mid Staffordshire shows, can help identify hospitals with poor performance. However, they are not without problems | Intangible assets valuation and hospital equipment valuation should be paid attention to in hospital resource optimization,through offering examples to explain assets valuation standard and methods,this paper describes the significance and methods of medical equipment valuation. | 1,999,933 | This paper seeks to investigate the reasons why, in an increasingly competitive health care milieu, patients choose certain hospitals over others. It introduces the modified importance-performance analysis technique and presents the method and findings of an empirical study which applied importance-performance analysis in a health care setting. The strategies derived from the study findings are discussed. | Decision making on various approaches to Importance-Performance Analysis (IPA) | WHO'S ASSESSMENT OF HEALTH CARE INDUSTRY PERFORMANCE: RATING THE RANKINGS | Series of Studies of Benefits Analysis of China's Medical and Health Industry:Benefits Analysis of the Hospital on Beijing, Tianjin, Shanghai, Chongqing in 2005-2009 | Assessing efficiency in hospitals of Shahid Beheshti University of Medical Sciences using Data Envelopement Analysis Method | Implementation of performance management to optimize the quality of the hospital operation | A Conceptual Framework for the Analysis of Health Care Organizations' Performance | Implementation of Performance Assessment with Hospital Management in Western | Working with key performance indicators gives the hotel an opportunity to evaluate the implementation of your strategy. KPIs allow to monitor work activity of staff, departments and enterprises as a whole. |
1,999,934 | High-spin structure in Er-157 up to and above band termination | High-spin states in {sup 165}Er have been studied experimentally using the {sup 160}Gd({sup 9}Be, 4n) reaction at beam energies of 42 and 45 MeV. The previously known bands based on the 5/2{sup +}[642], 5/2{sup -}[523], and 11/2{sup -}[505] configurations are extended to (49/2{sup +}), (45/2{sup -}), and (31/2{sup -}) states, respectively. The rotational bands in {sup 165}Er generally show gradual alignment processes, indicating strong band interactions associated with the i{sub 13/2} neutron alignments. The band properties are compared with those in the neighboring nuclei and discussed within the framework of the cranked shell model. | High spin states in 174 Re have been studied via the ~159 Tb (~20Ne, 5nγ) ~174 Re reaction through excitation function, X-γ and γ-γ coincidence measurements. A stretched E2 cascade has been identified and assigned to be the doubly decoupled band band on the л1/2-[541] v1/2- [ 521 ] configuration. Other two bands with semidecoupled and strongly coupled characters have been found and their quasiparticle configurations are qualitatively discussed. | The high-spin states of Eu-147 have been studied in the reaction The high-spin states of Eu-147 have been studied in the reaction | Spin arrangement diagrams for Er2-xRxFe14B (R = Y, Ce) obtained with Mössbauer spectroscopy and phenomenological model | Abstract The level structure of 156 Dy has been investigated with the (p, t) reaction at E p = 29.9 MeV. A strong (7.7% of ground-state strength) transition is observed to a state at 1520 keV, assigned J π = 2 + . It is suggested that this state is the two-phonon βγ-vibration predicted by the theory of Davydov. Possible connections to the “super-band” in 156 Dy are discussed. | The positive-parity states of 131,133Xe are studied in the Spin(6) limit of the interacting boson-fermion model. It is found that the main structures in the spectrum and the E2 data can be described in this dynamical symmetry. | High spin states of the odd proton-nucleus 169Ta have been populated in the reaction 155Gd(19F,5n) with beam energies of 97 MeV. Rotational band based on d3/2 proton 1/2[411] Nilsson state has been pushed up to 39/2+ in the α = 1/2 decay sequence. Its signature partner, the α = -1/2 decay sequence with four link transitions has been established and 1/2[411] band in 169Ta was reassigned to be a semi-decoupled band. The systematics of the signature splitting in the K = 1/2 bands in the rear-earth region and the accidental degeneracy conclusion given by the angular projection shell model were discussed. | High spin studies of A ≈ 60 nuclei have been carried out with EUROBALL. The nuclei of interest were populated in the fusion‐evaporation reaction with a 125 MeV 16O beam bombarding a thin 56Fe target. The use of the Recoil Filter Detector and the charged particle detector EUCLIDES resulted in a significant reduction of γ‐line widths and facilitated a reaction channel selection. In this article, several new linking transitions of the previously known terminating band in 64Zn are reported. Such bands are also observed in 61Cu and 63Cu. New SD bands identified in 61,63Cu are discussed. | 1,999,934 | The high-spin structure of Er-157 has been greatly expanded using the Gammasphere spectrometer to investigate the Cd-114(Ca-48,5n) reaction at 215 MeV. Many new transitions have been placed in a greatly augmented level scheme up to spin 40h with many collective rotational sequences established. With increasing angular momentum, this nucleus undergoes a Coriolis-induced shape transition from a deformed state of collective rotation to a noncollective configuration. This transition manifests itself as favored band termination near I=45h in three rotational structures. Many weakly populated states lying at high excitation energy that decay into the terminating states have been discovered. Cranked-Nilsson-Strutinsky calculations suggest that the levels that feed the terminating states arise from weakly collective configurations that break the Z=64 semimagic core. (Less) | Structure of eight superdeformed bands in the nucleus 151 Tb is analyzed using the results of the Hartree-Fock and Woods-Saxon cranking approaches. It is demonstrated that far going similarities between the two approaches exist and predictions related to the structure of rotational bands calculated within the two models are nearly parallel. An interpretation scenario for the structure of the superdeformed bands is presented and predictions related to the exit spins are made. Small but systematic discrepancies between experiment and theory, analyzed in terms of the dynamical moments, J (2) , are shown to exist. The pairing correlations taken into account by using the particle-numberprojection technique are shown to increase the disagreement. Sources of these systematic discrepancies are discussed -they are most likely related to the yet not optimal parametrization of the nuclear interactions used. | Nuclear structure effects of the nuclei 152,154,156Dy at high excitation energy and large angular momentum. | Selective studies of the excited rotational bands in the superdeformed nucleusTb151 | Transverse Transition Form Factors from the Nucleon to Nucleonic Excitation States Δ(1232), N*(1535) and N*(1680)* | High spin states in the transitional nucleus $sup 156$Er | The rare earth region of the nuclear landscape is characterized by a large collectivity observed. The microscopic studies are difficult to perform in the region due to the enormous size of the valence spaces. The use of symmetries based models avoids that problem, because the symmetry allows to choose the most relevant degrees of freedom for the system under consideration. We present theoretical results for electromagnetic properties in 160−168 Dy isotopes employing the pseudo-SU(3) model. In particular, we study the B(E2) inter-band transition strengths between the ground state, γ and β-bands. The model succesfully describes in a systematic way rotational features in these nuclei and allows to extrapolate toward the midshell nucleus 170 Dy. | A cranked shell model approach for the description of rotational bands in N ≈ Z nuclei is formulated. The isovector neutron-proton pairing is taken into account explicitly. The concept of spontaneous breaking and subsequent restoration of the isospin symmetry turns out to be crucial. The general rules to construct the near yrast-spectra for rotating nuclei are presented. For the model case of particles in a j-shell, it is shown that excitation spectra and the alignment processes are well described as compared to the exact shell model calculation. Realistic cranked shell model calculations are able to describe the experimental spectra of 72,73 Kr and 74 Rb isotopes. | The low-energy structure of 231 Ac has been investigated by means of γ ray spectroscopy following the β − decay of 231 Ra. Multipolarities of 28 transitions have been established by measuring conversion electrons with a mini-orange electron spectrometer. The decay scheme of 231 Ra → 231 Ac has been constructed for the first time. The Advanced Time Delayed βγγ(t) method has been used to measure the half-lives of five levels. The moderately fast B(E1) transition rates derived suggest that the octupole effects, albeit weak, are still present in this exotic nucleus. |
1,999,935 | Secure group communications is the basis for many recent multimedia and Web technologies. In order to maintain secure and efficient communications within a dynamic group, it is essential that the generation and management of group key(s) be secure and efficient with realtime response. Typically, a logical key hierarchy is used for distribution of group keys to users so that whenever users leave or join the group, new keys are generated and distributed using the key hierarchy. In this paper, we propose well-populated multicast key tree (WPMKT), an efficient technique to handle group dynamics in the key tree and maintain the tree balanced with minimal cost. In WPKT, subtrees are swapped in a way that keeps the key tree balanced and well populated. A t the same time, rekeying overhead due to reorganization is kept at a minimum. Another advantage of WPKT is that rebalancing has no effect on the internal key structure of the swapped subtrees. Results from simulation studies show that under random user deletion, our approach achieves one order of magnitude in overhead less than existing approaches. Under clustered sequential user deletion, our approach achieves almost a linear growth with tree size under individual rebalancing. For periodic rebalancing, we achieved almost half the overhead introduced by other approaches. | Multicast is broadly applied with the development of the Internet and group key management will become a critical issue in secure multicast. Some existing schemes were analyzed and the focus is put on the logical key hierarchy (LKH) gained extensive attention and a new key management scheme-R-LKH-is proposed, and its algorithm is designed. Analyses show that it lowers the key storage costs observably and possesses a good communication efficiency, thus is scalable to large dynamic groups, through the comparison of communication costs, key storage and computation complexity between the scheme presented in this paper and other schemes. | This paper proposes a "minimum redundancy tree" (MRT) for key distribution in secure multicast. The MRT is optimal in terms of minimum rekeying costs by keeping the minimum average number of keys to be updated for each member and maintaining minimum average tree height for each member. We also propose to combine MRT and subgrouping to generate multiple MRTs such that the rekeying costs can be further minimized when compared to that of other key management schemes. | To provide communication confidentiality in multicasting applications, traffic data in secure multicast is encrypted with a session key known only by certificated group members. Whenever there is a change in the group membership, the session key must be updated dynamically. Previous work has been focused on individual rekeying, there are two problems with individual rekeying: inefficiency and an out of sync problem between keys and data. This paper devises a batch rekeying scheme based on iterated hash function which can improve efficiency of the key server,and analyzes the key server's processing cost for batch rekeying.The simulation results show that our batch scheme,which is based on iterated hash function, compared to individual rekeying, saves server cost efficiently. | We prove a tight lower bound for generic protocols for secure multicast key distribution where the messages sent by the group manager for rekeying the group are obtained by arbitrarily nested application of a symmetric-key encryption scheme, with random or pseudorandom keys. Our lower bound shows that the amortized cost of updating the group key for a secure multicast protocol (measured as the number of messages transmitted per membership change) is log 2 (n) + o(1). This lower bound matches (up to a small additive constant) the upper bound of Canetti, Garay, Itkis, Micciancio, Naor and Pinkas (Infocomm 1999), and is essentially optimal. | Abstract: While a vast number of solutions to multicast group rekeying were published in the last years, a common base to evaluate these solutions and compare them with each other is still missing. This paper presents a unified and comprehensive way to evaluate the performance of different rekeying algorithms. A rekeying benchmark estimates rekeying costs from a system point of view, which allows a reliable comparison between different rekeying algorithms. For this purpose, two metrics are defined: the Join Rekeying Time (JRT) and the Disjoin Rekeying Time (DRT). By means of four simulation modes, these metrics are estimated in relation to both the group size and the group dynamics. A benchmark prototype, implemented in Java, demonstrates the merit of this unified assessment method by means of two comprehensive case studies. | Group communication oriented applications such as multimedia streaming, distant learning, networked gaming, distributed information storage and file sharing can benefit from the community oriented nature of Wireless Mesh Networks (WMNs). However, providing secure group communication services on a WMN platform can be challenging because of the inherent vulnerabilities in wireless broadcasting, distributed network architecture, multi-hop communication and the mobility of mesh clients. Direct implementation of group key management (GKM) schemes developed for wired or other wireless platforms is difficult, if not impossible. Despite these challenges, this paper proposes a symmetric multivariable polynomial based hierarchical GKM with efficient re-keying capabilities. Efficiency in re-keying is achieved by allowing members of the secure communication group to renew the shared traffic encryption key individually and independently upon membership changes. Using the information delivered to the group members during the initial key distribution phase, this renewal process can continue during a group communication session as long as the total number of membership does not reach beyond or fall below a configurable threshold. | Critical networking issues in group communication involve security, scalability and dynamic membership changes. Security provides confidentiality, authenticity, and integrity of messages exchanged between group members. Tree Group Diffie Hellman is an efficient key agreement protocol for peer groups. But, it is not scalable beyond 100 members. On the other hand, large multicast groups don't support dynamic membership changes. In this Paper, we propose a new framework, which addresses the problems of scalability and dynamic membership change. | Key management is very crucial in a secure multicast system. The key storage of the group controller and group members, the communication cost and computation cost caused by joining/leaving members, are the determining factors for the performance of the key management system. A scheme is high-performed, if it has the optimal rekeying cost and the lower storage requirements. In order to get the high efficiency and security, a novel scheme (TOFT) based on threshold-based one-way function tree is proposed in this paper. The quad-tree and the threshold-key-mechanism are used in the scheme, which improves the performance of the key management system. We present the design principle, the realization protocols including keys generation and distribution, dynamic membership management. The TOFT scheme is compared with other protocols from the following four aspects: computation cost, communication cost, storage requirements, and security. Finally, we conclude that our scheme is more efficient than others. | 1,999,935 | In many secure group communication models, there exists a group manager that creates the group key and distributes it to every group member. Such group manager is responsible for changing and re-distributing (rekeying) the group key whenever it deems necessary. Many applications will require very fast rekeying so that it is not disruptive to their performance. In this paper, we present a generic software model for secure group key management. We present the main components along with their functionality and interactions. With emphasis on the rekey manager, we discuss two issues that critically impact the rekey time: establishment and maintenance of the logical key hierarchy (LKH), and the key packet construction for a changed key. We show that our novel idea of maintaining balanced LKH as B/sup +/ search tree greatly reduces the number of changed keys compared to an unbalanced LKH. In addition, we show that a rekey packet construction using simple XOR operations between keys instead of the usual encryption technique substantially reduces rekey time. We preformed experiments that demonstrate the effectiveness and feasibility of our approaches. | Analyses of several recently proposed group key management schemes | Security and efficiency of rekeying are crucial requirements for secure communication in dynamic groups. Aiming at the drawbacks of traditional distributed batch rekeying algorithms, which are a waste of resources and vulnerable to collusions attack, DBRM marking algorithm is designed, which creates a subtree consisting of joining members. Based on DBRM algorithm, a secure batch rekeying algorithm named SDBR is proposed. SDBR is resistant to collusions attack by changing the blinded keys known to the leaving members and it can also avoid a renewed node to be rekeyed more than once. Mathematical models of communication cost and computation cost are presented by theoretical analysis, and the performance of SDBR algorithm is validated by simulation experiment. Analysis results show SDBR is an algorithm suitable for large dynamic collaborative group. | GROK: A Practical System for Securing Group Communications | Secure Distributed Key Generation on Vector Space Access Structures in Bilinear Groups | how are group keys distributed in cyberspace | keybase will undoubtedly destroyed by Zoom. What alternatives are out there for free yet private team communication? | Options for encrypted group messaging | A Secure and Scalable Framework for Group Communication |
1,999,936 | It is so great to catch up with Nikki and Damien | Read it now I know for sure that u will luv it. Nikki and Brandon omg they are prefect together. I think Brandon likes Nikki proof is basically in every book. | audra and norm, phil, nikki and josh. a really nice refreshed look at this gem. | Brie Bella to the Red Carpet" in February 2016. In 2016, Brie and Nikki were voted as Choice Female Athletes for the 2016 Teen Choice Awards. On November 21, 2016, Brie and Nikki unveiled their new YouTube channel, "The Bella Twins." The sisters' channel features daily fashion, beauty, travel, fitness, relationship, and health videos, along with daily video blogs, created by the twins themselves. On August 21, 2017, Brie and Nikki launched their own wine label called Belle Radici in collaboration with Hill Family Estates and Gauge Branding. On November 1, 2017, Brie and Nikki launched Birdiebee, a lifestyle intimates and activewear | I love this family! Bella has delivered another winner! Way to go! | Michel is the black, gay friend, there is Lane and Mrs. Kim the strict, Korean mother. But nobody else!
When I noticed this, I started taking notes.
Form season 5 episode 7-17 there were 5!!! people.
A maid, a back guest at the wedding, a person in the background...
There is no POC, not even people without lines, or passing by or sitting in the background.
I really like Gilmore Girls, it's my favorite show, but this really bothers me.
And not even in the revival. | There’s a lot of talk of who we’d like to see our EN girls collab with which senpai but what about outside of the Hololive family? Who do you think the girls would have a great collab? Which pairs would you like to see? | This was such a wonderful surprise read for me! I loved the synopsis and found so much more than a quirky, sweet and sexy romance. Geena Dennis is smart, friendly, and warm but also impulsive. She is about to lose her business, so she talks successful businessman, Damien Courtney into helping her reorganize and make it successful. In turn she will help give him an image overhaul. Damien is hated in the community for tearing down a beloved local historical landmark for very personal reasons. He wants to build something better for the community but needs to repair his image to get the approval he needs from the council. While they work to help each other, Geena discovers that Damien is actually very smart, funny, and kind, behind his surly public persona. Their chemistry is off the charts but they live such utterly different lives, would they ever truly fit together? Geena and Damien were so opposite which is what drew them to each other. They challenged each other, their banter was witty and fun and they helped to make each other better. This story is fast paced, well developed, and multi-layered. Ms Hunter expertly weaved a tale of love, laughter, heartbreak and healing. I had not read any of her work previously, so I didn't know what to expect. What I found was a brilliant, sweet and sexy romance, and an exciting new author for me. | Wow. This really is the most complicated couple, but I still can't wait to find out what happens! Who all will get their comeuppance? Is Claire going to survive in the end? Will anybody?! I cannot wait!
E.W. | 1,999,936 | Minor spoilers. It is so great to catch up with Nikki and Damien! I love how Kenner keeps us connected with these characters. It was a short, quick read but was filled with so much heart and just enough heat. I also love that Kenner keeps true to her story and that she revisits Nikki's issues. The need to cut is not something that ever just goes away and the fact that Kenner addresses that in this installment speaks volumes about how much she understands.
I'm also obsessed with Lara. What a cutie! | who falls off the cliff in being nikki | The storyline was great. Loved the developing relationship between Mason and Ava | [SPOILERS] Anyone else starting to like the future segments of the show? | [EXTREME END GAME AND COMIC SPOILERS] Does anyone feel like Desmond's sections... | Loved the story of Nicole and Oliver | (Spoilers All) Who do you think is going to survive the whole thing? | [spoilers all] What plot points are you excited about being cut from the show? | Chasing Clovers Review |
1,999,937 | What is required for DLSS 2.0 support? | Under the not compatible list there is a spot blanked out on the picture accompanying this product. The package lists 2.0 non compatibility but the online pic doesn't. | I'm playing BL2 from Handsome collection on PS4. I was kind of expecting to see many DLC:s to download in the "Downloadable content" menu. But it says nothing to download. What's up? | Although the back cover lists audio as 2.0 Stereo and 5.1 Dolby the actual blu ray disc has both HD audio options for 5.1 and 2.0 DTS Master Audio. The Bonus Features are also in HD audio!
This is for the Made in Italy disc sold by Amazon. It plays perfectly on my Region A BD player.
A keeper concert for me. | 2.0 specification includes support for GLSL. "Release date": July 2, 2006 OpenGL 2.1 required implementations to support version 1.20 of the OpenGL Shading Language. Before the release of OpenGL 3.0, the new revision had the codename Longs Peak. At the time of its original announcement, Longs Peak was presented as the first major API revision in OpenGL's lifetime. It consisted of an overhaul to the way that OpenGL works, calling for fundamental changes to the API. The draft introduced a change to object management. The GL 2.1 object model was built upon the state-based design of OpenGL. That is, to | Came into the stream late so I wasn't sure if he was just talking about them or was saying it was being added to 2.2. | Full disclosure: I thought I had released this a few months ago but apparently I didn't actually make it public but I've released it now. You can find most of the same information from the GDScript Release Thread]( and here is the release [WAT Mono 5.0.
There might be a few issues where you need to restart after enabling or build the project first but nothing should be broken broken. | I Was Just Wondering If There Was Some .dll Exploits because I have a dll injector that I would like to use. | Hey guys, short question how does the unlocker work? Do you still need dlcs for some faction or? As it doesn't say dlcs required | 1,999,937 | I have decided to buy an RTX 2060 because I have hope for the future of DLSS 2.0. I want to learn if these hopes are realistic.
* In order for a game to get DLSS 2.0 support, what has to happen? How do the developers implement this feature into their game?
* What can this tells us about any games that could get DLSS 2.0 support in the future? Are there certain games that we already know just won't get supported by DLSS because they don't meet a certain requirement/have a certain system in place that prevents DLSS support?
* Should I buy the RTX 2060 because of my optimism for the future of DLSS? In other words, is my hope for the future of DLSS 2.0 realistic? | Is .NET Framework MVC still relevant in 2020? | I think the hype for Cyberpunk 2077 is completely unsustainable and will lead to disappointment | What are peoples thoughts on DLCs? | what will the future availability of dual screen games be? | Something to note: If the DLC releases tomorrow on all platforms, consoles will probably get it first. | Is RTX 2060 Good For Fortnite? | DLCs required for multiplayer ? | Should I buy used RTX 2070 Super now or wait? |
1,999,938 | Which type of incurance coverage allows the insured to puches more incurance after a specified perioed of time? | The coverage includede in an automobile insurance policy that covers property damage is what? | The coverage included in a automobile insurance policy that covers property damage is what insurance? | Which of these statements describes the elements of long-term care insurance? | In the US as the title says. I work at Company A and spouse works at Company B. My company A offers a better health plan so we both use my insurance.
My position is being eliminated at the end of December so we will need new coverage on Jan 1, 2020. My spouse's open enrollment has started for Company B and selections have to be made in 10 days. My company A's enrollment will start later.
However, there is also a chance that in 3 weeks time I will land another job at my current Company A. If that happens I would much rather keep current insurance.
Question:
If my spouse declines coverage now from Company B, can we still avail of it later on Jan 1, 2020 due to a loss of coverage (If I do lose my job?). Best case scenario I have a job and Company A coverage continues. | If you have two insurances will the second one pay? | Long term care can also cover benefits from what other insurance? | Mercury General aspects of a business. The most common policy coverages include liability, medical, building coverage, business personal property and business income. Mechanical Protection – Commonly referred to as extended warranty coverage, Mercury’s mechanical protection pays for covered vehicle repairs after the vehicle manufacturer’s warranty expires. Certain benefits are also available during the vehicle manufacturer’s warranty period. Ride-Hailing Insurance – An endorsement to Mercury’s personal auto policy that covers the gaps between auto insurance and the Transportation Network Company’s commercial insurance coverage when the driver working for a TNC turns on the ride-hailing app. Service Line Protection – An endorsement to a | When should you have a commercial insurance policy on your automobile? | 1,999,938 | Which type of insurance coverage allows the insured to purchase more insurance after a specifies period of time? | Insurance policy: can I change from monthly to quarterly, etc? | what is the additional insured in a policy called | THE PROBLEM OF DUPLICATE COVERAGE AND OVERINSURANCE | Who is covered as an additional insured? | how long has the insurance cycle been understood | What are upper limits that are in insurance? | What are upper limits that are in insurance? | Should car insurance be purchased before the car? |
1,999,939 | Very pleased with these subs,, | Pretty good subs ive been using them for over 3 months and no problems and it hits pretty hard, worth the money | Was pleasantly surprised. They are way better than I expected. | So far, so good . Lots of nice comments. I like them. | I’ve alerted A couple of the developers about the excistance of this new sub and I’d be very helpfull if we collect all the suggestions and feedback in a sticky on top of the sub. | Were as I expected, work great. Very satisfied. | Theses guys are fabulous. Contact was prompt and totally perfect | They perform as advertised. Were pleased with them. | Its been a great year for r/Cascadia! We've seen our subs up almost 1200 over the past year, and we've increased our content and discussion quite tremendously.
Thanks to everyone for making this an awesome subreddit! | 1,999,939 | very fast shipping package arrived in excellent condition,,I wanted to wait a couple of days before I wrote a review of these subs I was very skeptical bt i been listening and breaking them in they hit hard and low and getting better I've got them on a kicker 2400 watt amp with the gain about a 1/4 way up and I'm very impressed with them not even broke in they flex my whole car I'm surprised I have a windshield left they hit so hard and they beg for more power,,I will and definitely purchase again just to have these around hopefully they keep these in stock lets just say I'm one happy bass head and keep the ground shaking,, | ... bought this subwoofer for my dorm room and expected great things. It shipped fast and the packaging was ... | Speedy delivery and good product. I love these speakers so far (2 ... | Kicker Comp 10" 05C104 Subwoofer - Are they shit? | Strong and good. Fast shipping | So far they seem great. Shipping was very very fast | They were delivered super fast and are well worth the cost | First Drop shipping site (woocommerce), What do you think so far? | The shipping was fast but the headphones are pretty terrible in y opinion |
1,999,940 | KODAK G100 NEW & UNOPENED FROM UK | Kodak today announced 600 UK job losses and the closure of a Nottingham factory as the world's largest photography company continued to shift its focus towards digital cameras. | So I found this old Kodak instant camera still in great shape that I thought would be a great gift for my SS giftee. The film that it's designed to take is Kodak PR-144, which was discontinued ages ago after a legal scuffle between Kodak and Polaroid, but I managed to find an unopened and sealed pack on eBay. The expiration date on it is 1986, but I thought since it was still sealed it might work. The exposures are developing pitch-black, and I've verified that the shutter is opening, so I can only assume the film has gone bad.
I've read that Fuji FI-800GT packs can be modified to fit this camera, but I can't find any online. I know it's a long shot but does anybody have any laying around? Or knowledge about instant cameras and maybe a solution to my problem? Or PR-144 film that's been stored well? HALP! | A friend of mine had emailed me some pictures he had taken with his old Kodak C315 digital camera. I was amazed at the picture quality. I looked on eBay and found one like new for $ 22.41. It takes SD cards so I ordered a 2GB card from Amazon and it was rejected by the camera. Turns out the camera has a 1GB SD card maximum. So I wanted a 1GB card ASAP. Being an Amazon Prime member and wanting a card fast meant Amazon was the only place worth looking. This card was the best price at $ 9.95 with free two day shipping and it had good reviews. Amazon did not disappoint and neither did Sandisk. The card arrived on time and works like a dream in my new/old camera. <a data-hook="product-link-linked" class="a-link-normal" href="/Kodak-Easyshare-C315-5-0MP-5x-Digital-Zoom-Camera/dp/B000EXWJ66/ref=cm_cr_arp_d_rvw_txt?ie=UTF8">Kodak Easyshare C315 5.0MP 5x Digital Zoom Camera</a> | Ordered this from South Korea! Was terribly worried but the camera arrived in perfect condition and works like a charm! :) From Utah. | Kodak Heights Kodak Mount Dennis Campus, also known as Kodak Heights, was an industrial park in the Mount Dennis neighbourhood of Toronto, Ontario, Canada. It was owned and operated by the Eastman Kodak Company as a major camera manufacturing factory since its opening in 1912, peaking at 900 employees in 1925, 3,000 in the 1970s, falling to about 800 before it ceased the plant's operations in 2006. Kodak had opened its Canadian operations on 8 November 1899, first on Colborne Street and then King Street in the downtown core. By 1912 the company was growing so rapidly that a new | Kodak Heights Kodak Mount Dennis Campus, also known as Kodak Heights, was an industrial park in the Mount Dennis neighbourhood of Toronto, Ontario, Canada. It was owned and operated by the Eastman Kodak Company as a major camera manufacturing factory since its opening in 1912, peaking at 900 employees in 1925, 3,000 in the 1970s, falling to about 800 before it ceased the plant's operations in 2006. Kodak had opened its Canadian operations on 8 November 1899, first on Colborne Street and then King Street in the downtown core. By 1912 the company was growing so rapidly that a new | McCurry, a National Geographic photographer. McCurry had asked Kodak for the last roll in stock, then went out on his own to use that roll. Although McCurry retains ownership of the slides, prints of the 36 slides are permanently housed at the George Eastman House in Rochester, New York and most of the pictures have been published on the Internet by "Vanity Fair" magazine. After announcing the return of Ektachrome at the beginning of 2017, Eastman Kodak CMO Steven Overman told "The Kodakery" podcast, "we are investigating Kodachrome, looking at what it would take to bring that back.". Although the | For my birthday, my wife gave me the Led Zep Promo 1969
Camera Upload | 1,999,940 | Printer Kit for either the Kodak G600 or G610 Printers.
Easy to use Cartridge which produces 100 Photos exactly.
Comes with Cartridge and 25 x 4 Individually wrapped Photo Paper.
New and Unopened.. | Do you need special paper to get the best quality in photo printings? | ... purchasing name brand products for the printer I would recommend it. Amazon has a good price for Canon ... | The image forming apparatus, image forming method and a printing system | Need a good Photo Printer for Professinal Design | Can anyone find me a printer that meets these requirements? | This little printer is awesome. Easy set up and great quality photos | Best photo paper for home printing. | Great printer, but the "ink bundle" DOES NOT include a full set of ink cartridges |
1,999,941 | [Uncategorized] We still have no new patron saint -> OpSec Flaw! | Alright, so after 2 years with the game, I decided to make a smurf account. I love the Void champs, but I've never really played them too much aside from Kog'Maw, and I dig his spittle, so I decided that I would learn the SHIT out of ALL of the Void champs, and main them, so I can go any role whenever I get into a game. Now, I wanted some help with a clever summoner name, since I'm terrible at picking names. Any help guys?
TL;DR - Title.
EDIT: I got DoctorVoidBerg! If you guys wanna play some games, I'd love to whenever. See you in the Rift! :) | who is the closest thing to an antithesis of Asmodeus master of the nine hells? | I have this card and would like to use it, however almost every priest list doesn't have it. Is it really that bad? Can't you just sub it for a Vulpera Scoundrel or an Imprisoned Vilefiend (in HL Priest)? Is there really no space for it?
Thanks in advance! | There will also be some beers involved on my end and making new words up about assholeness.
And everyone is welcome. Regardless of level.
EDIT: I'd really like to find a goblin mage named Rédrum that was giving my baby druid hassles last night. I want him dead. Repeatedly. | Nearly a year after release the launch page still features devs using unobtainable items. Not necessarily a salt post but mildly annoying. Can we get this in game (for free, it's in Fallout 4) please?
| Please post all issues and bugs with this patch in here.
---
Patch notes]( :: [Patch Discussion
Cat cat cat. | so i was curious if the trick to get to monster still works and it does it still uses the old lemon demon sprites to | This came up when I was trying to figure out a way for Ugin not to exile all my other planeswalkers.
The card of course will never be printed (and the text above would need to be templated to "All instances of all on cards, spells and permanents your opponents control" I assume?), but it's fun to try and find THE most broken card in combo with this. Blood Moon? Wrath of God? Kederekt Leviathan? | 1,999,941 | I don't feel secure browsing this reddit anymore, without the watchful eyes of bailey jay watching over us we are easy prey for evil spirits and law enforcement.
Every day no new patron saint is on the bottom of this page we risk that ~~innocent~~ people come to harm.
Mods don't forsake us, summon a new patron saint with your chants of CSS. | I got security called on aggressive street preachers today | which saint is known as the 'pardon of the poor' | Who is the patron saint to protect from evil? | I hate to blame a Saint | Spiritual Warfare 301: Into The Danger Zone | Actions of abusing mods of other subs against members of /r/thr_donald | Everyone mistook a [Dominican] priest for a KKK member?! | who is the patron saint of the baclaran church |
1,999,942 | Why did the vietminh form? | Who did the vietminh front fight? | Explain briefly how Vietnam came to be divided in two? | Define vietcony in vietnam war? | What were the living conditions for the soilder in the vietnam war? | One important reason for the abrupt decline and fall of the qing dynasty? | Who were the vietcong and why were they in the vietnam war? | Why did vietnamese communist forces invade cambodia? | Who was the vietcong's leader? | 1,999,942 | Why did the vietminh initially form in vietnam? | What was the Vietminh front? | How did the Vietnam War start wikianswerscomQHow did the Vietnam War start? | What country ruled vietnam from 1883-1945? | Who was on the vietcongs side in the vietnam war? | Why was vietnam divided into to two countries? | Why did the US enter war in Vietnam? | What was the name of the North Vietnamese Vietcong leader? | What event lead to the creation of north and south vietnam? |
1,999,943 | Anyway to set an autorestart when GPU has an error NHOS | We’re mostly migrated and I’m looking at what I need to do to move our primary mail flow to point to Exchange Online vs. the current Internet > Proofpoint > Exchange On-prem. Sure there’s DNS MX TXT and SPF, proper configuration of Exchange EOP/ATP to consider.
A question came up about moving ‘autodiscover’.
This is the current autodiscover process – I think:
User logs into their workstation with their samaccountname > open Outlook and it would query AD for the autodiscover URLs and also pass along information in the ‘mail’ AD attribute of [email protected]](mailto:[email protected]) \> AutoDiscover would point to an On-prem Exchange Server > Exchange would see you have a ‘targetaddress’ of “SMTP:[[email protected]” > get punted to the Cloud.
At a certain point, do you move what you point to for AutoDiscover so that it goes directly to Exchange Online? If so, it seems like you’d have to update the ‘mail’ AD attribute for the User from the On-prem ‘[email protected]](mailto:[email protected])’ to the Exchange Online ‘[[email protected]’.
Thanks
EDIT: I missed this in the 'Office 365 for IT Pros' - Looks like I should read Chapter 13.
Either set it to a value of * or make sure your internal DNS record for the Autodiscover SCP resolves to autodiscover.outlook.com. | So here's what I want: a list of auto-completion sources that are prioritized. The problem I have with auto-complete right now is that it includes results from all sources, and a useful one is words-in-same-mode-buffer. If you've typed something before, it shows up. It _is_ useful, _except_ if the mode in question has a nifty compiler/interpreter based auto-completion source. Because if those return results, I want to see _only_ those results.
So the logic I'd like is: if the first source has results, use only those. Else, go to next source. Hence "cascading". Is there a way to do this in auto-complete or an alternative? Thanks. | After trying to boot up open core installer and selecting macOS base the kernel starts to load until it gets to the IOGraphics dependency then automatically reboots my laptop to windows. I was able to stop rebooting using **debug=0x100** boot-arg so I noticed the last dependency was the one mentioned above.
I have an HP i7 - 7200u laptop with integrated HD 620 graphics and no dGPU with HP specific kernel configurations applied to config.plist using ProperTree. | So o'vesa is an independent character riptide if i take him and aun va (as battle brothers detachment) as he is a unit of 3 (himself and 2 guards) i should be able to attach an IC to aun va's unit
Would that include an IC riptide with 2 drones? (The rules say ICs cannot join units with monstrous creatures but in this case the IC is the monstrous creature)
Cause it's some pretty nasty cheese (aun va's paradox of bullshit save on a riptide) that i saw in the last edition | Hey,
I have currently set all my dashboard sizes to automatic and was wondering if there are many drawbacks of using the automatic size.
If I set the size to fixed, I fear that my users will feel like tableau is less intuitive due to not adapting to their internet window size.
Anyone here using Automatic in a big company? Currently tableau is only used on PC for us. No view on phone or tablet
Ty | Autostability is the watchword of this tandem monoplane. The tandem design causes a natural flat flight pattern. It can also land and take off from very short runways. | Hello there!
I have an Acer Nitro 5 laptop and I've been wondering if it is possible to temporarily passthrough my dGPU to a Windows VM-as in a single-GPU passthrough-and in the meanwhile still have a functioning host with x11 being rendered by my iGPU.
I'm meaning to use my VM mostly for gaming. I could just install Discord-or any other app-on the VM, but if possible I'd like to still be able to interact with my host OS so to make my experience more seamless. | In the BIOS of my AB350M-G3 there are some settings where I can choose between auto, manual and advanced manual. Auto and manual are self explanatory, but what is advanced manual? | 1,999,943 | My 4gb cards are erroring out after a few hours. Is there a way to autorestart the rig if that happens ? I am tired of having to do it manually all the time. | Case Problems, too much card, not enough space! | anyone with the 3000 series cards do you have issues of your card freeing not fully being utilized? | have a samsung s4 and these cards got corrupted for ... | External Memory Card troubles | I have already filled my 16 gig sd card | Sandisk 4gb card for Canon | This is the perfect remedy to keep all my SD cards together | Would suddenly crash and make all files on the card ... |
1,999,944 | when was the church of our lady of loreto constructed | Cathedral Basilica of Our Lady of Peace too costly for the apostolic vicariate to complete other phases. The Gothic dream died with Boeynaems. When Stephen Peter Alencastre assumed the episcopacy of the Hawaiian Islands, he stripped the Cathedral of Our Lady of Peace of all vestiges of its Gothic experiment. The Gothic porch was torn down, and the walls were covered in plaster and painted white. Red Spanish terra cotta tiles covered the cathedral roof. In anticipation for the celebration of the centennial of the arrival of the first Roman Catholic missionaries to the Hawaiian Islands, the Italian government presented a gift of new white marble altar | Cathedral of Our Lady of the Annunciation, Jerusalem The Cathedral of the Annunciation of the Virgin, also called Greek Catholic Melkite Cathedral of the Annunciation of the Virgin or simply Church of Our Lady of the Annunciation, is a Melkite Greek Catholic cathedral located in the Christian Quarter of the Old City of Jerusalem. It is dedicated to Our Lady of the Annunciation. It serves as the headquarters of the Melkite Catholic Patriarchate of Antioch and All the East ("Archieparchia Hierosolymitana Melchitarum"), whose patriarch since 1772 is responsible for the Jerusalem Melkites by the encyclical "Orientalium dignitas" of Pope Leo | Church of Our Lady of Hope Age of Discovery, the Roman Catholic Church established a number of Missions in the New World in order to spread Christianity. The missionaries of the different orders (Franciscans, Dominicans, Jesuits, Augustinians, etc.) flocked out and began at once to build churches along the coast districts wherever the Portuguese power made itself felt. This church was built by the Portuguese missionaries and blessed in 1605 A.D by , the then Bishop of Cochin The Dutch who conquered Cochin in 1663, destroyed all Catholic buildings in Cochin. Only the St. Francis Church, Santa Cruz Basilica, and St. Louis Church Mundamveli (2nd Parish | Our Lady, Queen of Heaven Church Our Lady, Queen of Heaven Church is a Roman Catholic church in Oreana, Idaho. The church was built c. 1883 and originally served as Oreana's general store. When the building was constructed, it was part of a corner which included Oreana's saloon, hotel, and school; the general store building is the only surviving structure from this set. The lava rock building features a false front and a wooden cornice atop its parapet roofline. In addition to serving as a general store, the building also house Oreana's first post office, which opened in 1885. In | Basilica of Our Lady, Maastricht The Basilica of Our Lady (; Limburgish/Maastrichtian [colloquial]: "Slevrouwe") is a Romanesque church in the historic center of Maastricht, Netherlands. The church is dedicated to Our Lady of the Assumption () and is a Roman Catholic parish church in the Diocese of Roermond. The church is often referred to as the "Star of the Sea" (), after the church's main devotion, Our Lady, Star of the Sea. The present-day church is probably not the first church that was built on this site. However, since no archeological research has ever been carried out inside the building, | The Our Lady of Victories Cathedral () is a religious building belonging to the Catholic Church and serves as the cathedral of the metropolitan archdiocese of Yaoundé (Archidioecesis Yaundensis or L'archidiocèse métropolitain de Yaoundé) in Cameroon. It is located in the center of the city in the rotunda of the central post office.
It has a stunning architecture, and a large number of seats, with space for around 5,000 worshippers, and an interior cross-shaped. After more than 50 years of existence, the construction of the Cathedral of Our Lady of Victories in Yaounde is not over yet. This is one of the most significant places in the capital, and was consecrated in 1955.
See also
Roman Catholicism in Cameroon
References
Roman Catholic cathedrals in Cameroon
Buildings and structures in Yaoundé
Roman Catholic churches completed in 1955
1955 establishments in the French colonial empire
20th-century Roman Catholic church buildings in Cameroon | Bellarmine University "Our Lady of the Woods" in Catholic tradition. The statue in the chapel is actually Our Lady of Grace. Bellarmine College's earliest administrators had a particular devotion to Mary and suggested the chapel be named for her. Because of its setting, the chapel committee chose the name "Our Lady of the Woods." The Siena Complex is composed of four residence halls: Siena Primo, Siena Secondo, Siena Terzo and Siena Quarto. The complex is modeled after the Piazza del Campo, the main town center of Siena, Italy. Bellarmine's namesake, St. Robert Bellarmine, was a native of Tuscany, where Siena is. The | Church of the Immaculate Conception (Saint Mary-of-the-Woods, Indiana) in the Italian Renaissance Revival style. Following the general trends of Cathedral architecture of Western Europe, the church at Saint Mary-of-the-Woods has a basic cruciform architectural plan with a nave intersecting its transept. Although the church slightly varying from absolute coordinates, it is generally oriented along an east/west axis. A tall bell tower provide vertical emphasis on the west side of the church's front façade. Architect Oscar D. Bohlen explained that the church was designed in an "Italian Renaissance style with a French sentiment." Our Lady of Sorrows Chapel was erected in 1905 in the crypt beneath the church. The | 1,999,944 | Church of Our Lady of Loreto of the baroque church was laid in the presence of King Sigismund III Vasa. The St. Andrew's church was constructed between 1628 and 1638. The Loreto Chapel was built between 1640 and 1642, in the southern part of the shrine. The construction was financially supported by King Władysław IV Vasa and Queen Cecilia Renata. Other members of the royal family, especially king's brothers, also participated in the construction. The chapel was built according to design by Royal architect Constantino Tencalla and modelled after Basilica della Santa Casa by Donato Bramante and Andrea Sansovino. Tencalla adjusted the original renaissance design to | what type of architecture is the cathedral of our lady | who built the first shrine to our lady of the rosary | when was the trinity chapel built in canterbury | where is our lady queen of heaven church | Basilica of Our Lady of the Angels (disambiguation) | in which country is the basilica of our lady of the rosary | what type of architecture does the peterhouse chapel have | when did st james and our lady of the pillar cathedral start construction |
1,999,945 | [USA-GA] [H] PayPal, cash, Venmo [W] 1070 or 1080 | Looking for USA PSN credit. Paying 85% via PayPal/Circlepay/CashApp/Venmo. Happy to go first if you have more confirmed trades. Thanks.
| [H] 30$ venmo [W] 30$ paypal or cash app
Comment and pm if interested | I have $100 in BTC that I want to trade for $107 in Venmo, CashApp, or Google-Pay. Don't bother PMing me if you're not posting a comment. Willing to do smaller amounts, although I don't want to do any trades worth less than $50 in BTC. Thanks everyone! | Hey guys I have paypal and I'm interested in gmk 9009 let me know what you guys have and how much were you looking for thanks! | [USA - PA]
[H] PayPal
[W] Sapphire R9 290x Tri-X
I'm especially looking for the New Edition. Thanks! | GCX Rep (1,133 Trades)
GCT Rep (49 Trades)
&#x200B;
|GC|BTC|PayPal G&S Rate|PayPal F&F Rate|Cashapp/Venmo/Zelle|
|:-|:-|:-|:-|:-|
|Amazon|75%|83%|80%|80%|
|eBay|75%|83%|80%|80%|
&#x200B;
* The stated rate does not include any fees that may be incurred (International F&F)
Please post before PMing (I don't respond to chats) - **prices are FIRM** | Have paypal and want a puffco peak
Edit: am open to things comparable to Puffco | Looking for verification. Will pay after done. PayPal or Venmo preferred. | 1,999,945 | I prefer local, in the Atlanta area.
Looking to buy a 1070 or a 1080. Also willing to trade a reference XFX 8gb RX 480 + $$. | Looking for a good server to put a GTX 1080 in | Trying to decide on a 1070ti @ $570. | I decided instead to buy a 1070 rather than rx480. I got store credit, need help deciding. | GTX 1070 , 1070 ti or 1080 , best value for me? | Looking to buy a new TV for my room. Budget Around $600 | 1070, 1070 Ti and 1080, if they are all within 50$ range in price, is the 1080 the clear choice? | The only GTX 1080ti available around my area is the MSI GTX 1080ti GAMING 11G, should I buy asap? | 1070 best option for 1080p gaming right now? |
1,999,946 | Analysis and Comparison of Time Replica and Time Linear Interpolation for Pilot Aided Channel Estimation in OFDM Systems | In this study, the effect of three different techniques that used for interpolation on OFDM system with pilot based comb type channel estimation is investigated and results are given in terms of BER (Bit Error Rate). The estimation of channel at pilot subcarriers is done by LS (Least Square), and interpolation of channel at data subcarriers are obtained by low pass (LP) interpolation algorithm, ANFIS (Adaptive Network Based Fuzzy Inference Systems) and GRNN (Generalized Regression Neural Networks) artificial neural network (ANN) structures. The results show that there is a relationship between the number of used pilot bits and interpolation technique's performance. If the aim is to get high bandwidth efficiency over a given bandwidth LP algorithm should be used for interpolation, to get the lowest BER ANFIS or GRNN can be used. | A new channel estimation algorithm is proposed based on comb-type pilot in OFDM systems,which employs data-flipping in the frequency or time domain interpolation based on zero-padding and DFT/IDFT.This algorithm can significantly reduce the Gibbs phenomenon caused by DFT/IDFT,so that it can improve the OFDM estimation accuracy by optimizing the interpolation accuracy of periphery.Simulation result shows that this algorithm has a better performance compared with other classic methods. | In wireless orthogonal frequency division multiplexing (OFDM) systems in order to reduce channel impairments, and increase system performance channel estimation must be implemented. This paper investigates; the impact on channel estimation mean squared error (MSE) performance of pilot density and placement for the channels that have different time variant transfer function. The time and frequency intervals between the pilots that give the lowest MSE determined as the optimum pilot intervals. Then these intervals are related to channels' coherence time and bandwidth at 0,9 correlation respectively. It is seen from the results that by using approximately 2, 8 pilot symbols per Bc, 0.9, and 2, 6 pilot symbols per Tc, 0.9 the optimum pilot interval can be calculated easily. Therefore with the use of this relationship the optimum pilot placement is determined with reduced computational complexity. | Recently, wideband orthogonal frequency-division multiplexing (OFDM)-based systems such as Long-Term Evolution (LTE) have been proposed for future railway communication systems. In such high-speed situations, Doppler phenomena, related to the terminal's high speed, affects the use of OFDM systems by producing a loss of orthogonality between different carriers. Thus, the channel estimation and equalization become a challenging problem, particularly when the number of pilot carriers is limited. This paper investigates the use of time-domain channel estimation for OFDM systems in high-speed scenarios and for a sparse pilot distribution. A time-domain linear minimum mean square error (TD-LMMSE) filter is designed for channel estimation. The TD-LMMSE emulates the effect of a sliding window and takes into consideration the interference caused by the data field. The expression of the MSE of linear estimators is also developed. Furthermore, a simple technique for the estimation of the second-order channel statistics is proposed. Simulation results, showing a significant gain in terms of MSE and bit error rate, compared with other state-of-the-art algorithms, are reported over a wide signal-to-noise ratio (SNR) range. | Channel estimation for OFDM systems is usually carried out in frequency domain by the least-squares (LS) method using known pilot symbols. The LS estimator has a merit of low complexity but may suffer from noise because it does not consider any noise effect in obtaining its solution. To enhance the noise immunity of the LS estimator, we consider the estimation noise in time domain named discrete Fourier transform (DFT)-based channel estimation. Residual noise existing at the estimated channel coefficients in time domain could be reduced by reasonable selection of a threshold value. To achieve this, we propose a channel-estimation method based on a time-domain threshold which is a standard deviation of noise obtained by wavelet decomposition. Computer simulation shows that the estimation performance of the proposed method approaches to that of the known-channel case in terms of bit-error rates after the Viterbi decoder in overall SNRs. | Starting from channel estimation,this paper studies many kinds of algorithm of channel estimation in OFDM system,analyzes and compares in detail the performances of four channel estimation algorithms:minimum mean square error(MMSE),least square(LS),pilot symbol assised modulation(PSAM) and single value decomposition(SVD) channel estimation methods in the aspects such as estimation error,realizing complexity,tracking speed and band efficiency,etc. | In this work, a Bayesian framework for OFDM channel estimation is proposed. Using the maximum entropy principle to exploit prior system information at the receiver, we successively derive channel estimates in situations when (i) the channel delay spread and (ii) the channel time correlation statistics are a priori unknown. More generally, this framework allows to derive MMSE channel estimates under any state of knowledge at the receiver. Simulations are provided that confirm the theoretical claims and show the novel results to perform as good or better than classical estimators. | Three different sampling clock frequency offset and residual frequency offset estimation methods were developed to improve their estimation accuracy in internet protocol-orthogonal frequency division multiple access(IP-OFDMA)system,and the characteristics of the pilot structure in IP-OFDMA system was considered.The influence of low frequency noise on estimation performance was restrained by excluding the discrete pilots in low frequency domain,therefore the estimation accuracy was improved.Theoretical analysis and simulation results under AWGN and COST207 channels with two bandwidths reveal the difference of the three estimation methods in respect of complexity and estimation accuracy,and the selection principle to the three methods is given. | 1,999,946 | This paper analyzes and compares two time interpolators, i.e., time replica and time linear interpolator, for pilot aided channel estimation in orthogonal frequency division multiplexing (OFDM) systems. The mean square error (MSE) of two interpolators is theoretically derived for the general case. The equally spaced pilot arrangement is proposed as a special platform for these two time interpolators. Based on this proposed platform, the MSE of two time interpolators at the virtual pilot tones is derived analytically; moreover, the MSE of per channel estimator at the entire OFDM symbol based on per time interpolator is also derived. The effectiveness of the theoretical analysis is demonstrated by numerical simulation in both the time-invariant frequency-selective channel and the time varying frequency-selective channel. | In pilot-aided OFDM systems, the minimum mean-square-error (MMSE) interpolator provides the optimum performance based on the channel statistics. And symbol timing offset (STO) introduces a linear phase rotation to data modulated on individual subcarriers. A MMSE channel estimator designed only using the wireless channel statistics performs only sub-optimally when subcarrier phase rotations due to STO are present. In this paper, we show that the performance of the channel estimation can be retained by using the modified MMSE interpolator when the STO exists. Simulation results show that the bit error rate (BER) performance degradation due to STO can be neglectable by the reform interpolation technique. | An Improved Channel Estimation Algorithm Based on Comb-type Pilot in OFDM Systems | In this paper we present an analytical approach to evaluate the M-QAM bit error rate and carrier frequency dependent throughput of OFDM systems subject to various receiver impairments and mobile channel characteristics. Specifically we model the following effects: residual carrier frequency offset, outdated channel state information due to user mobility, channel estimation errors and flat receiver I/Q imbalance in Rayleigh time and frequency selective fading channels. We provide a numerical tool to evaluate the uncoded bit error rate as well as mutual information in the case of scattered pilot designs used for pilot-aided linear channel estimation and linear channel interpolation. | Performance evaluation of ANN based channel interpolation for OFDM system | Modeling and Estimation of Wireless OFDM Channels by Using Time-Frequency Analysis | Iterative pilot symbol assisted channel estimation in turbo OFDM system [mobile wireless channels] | A Simplified Channel Estimation Algorithm Based on Pilots Design for MIMO-OFDM System | Wireless multimedia has created boom in today's era. It is just a fraction of seconds to get information at any time anywhere. All these because of the development of multicarrier communication system, OFDM, which provides high data rate as well as high speed. With that channel estimation becomes more challenging. In such multicarrier systems the time varying channel is often estimated based on different algorithms. These algorithms are basically categorised as blind and non-blind channel estimation techniques. Due to the limitations of blind algorithms such as requirement of the statistical knowledge of received signal, the non-blind i.e. pilot aided channel estimation have become more popular. In such techniques known symbols to the receiver called pilots are inserted in the OFDM data symbols and they should be close enough to fulfil the Nyquist sampling theorem for pilot spacing (1). This paper shows the simulation results to prove the sampling theorem based on the channel estimation in the multipath fading scenario. |
1,999,947 | We de ne a new model of automata for the description of bidirectional parsing strategies for tree adjoining grammars and a tabulation mechanism that allow them to be executed in polynomial time. This new model of automata provides a modular way of describing bidirectional parsing strategies for TAG, separating the description of a strategy from its execution.Tree Adjoining GrammarsA Context-Free Grammar (CFG) is a tuple (V N ; V T ; S; P), where V N is a nite set of non-terminal symbols, V T a nite set of terminal symbols, S 2 V N is the axiom of the grammar, and P is a nite set of productions (rewriting rules) of the form A ! with A 2 V N and 2 (V T V N ) . Tree AdjoiningGrammars 7] are an extension of context-free grammars that use trees instead of productions as the primary representing structure. Formally, a TAG is a tuple (V N ; V T ; S; I;A), where V N , V T and S 2 V N are de ned as for CFG, I a nite set of initial trees and A is a nite disjoint set of auxiliary trees. I A is the set of elementary trees. Internal nodes are labeled by non-terminals and leaf nodes by terminals or the empty string , except for just one leaf per auxiliary tree (the foot) which is labeled by the same non-terminal used as the label of its root node. The path in an auxiliary tree from the root node to the foot node is called the spine of the tree. |
Introduction
Tree adjoining grammars (TAG) were invented in (Joshi et al. 1975) in order to better characterize the string sets of natural languages 1 . One of TAG's important features is the ability to introduce two related syntactic units in a single rule, then push those two units arbitrarily far apart in subsequent derivation steps. For machine translation (MT) between two natural languages, each being generated by a TAG, the derivations of the two TAG may be synchronized (Abeille et al., 1990;Shieber and Shabes, 1990) in the spirit of syntaxdirected transductions (Lewis and Stearns, 1968); this results in synchronous TAG (STAG). Recently, in (Nesson et al., 2005(Nesson et al., , 2006 probabilistic synchronous tree insertion grammars (pSTIG) were discussed as model of MT; a tree insertion grammar is a particular TAG in which the parsing problem is solvable in cubic-time (Schabes and Waters, 1994). In (DeNeefe, 2009;DeNeefe and Knight 2009) a decoder for pSTIG has been proposed which transforms source-language strings into (modifications of) derivation trees of the pSTIG. Nowadays, large-scale linguistic STAG rule bases are available.
In an independent tradition, the automatatheoretic investigation of the translation of trees * financially supported by NSF STAGES project, grant #IIS-0908532. † financially supported by DFG VO 1011/5-1. 1 see (Joshi and Shabes, 1997) for a survey led to the rich theory of tree transducers Steinby, 1984, 1997). Roughly speaking, a tree transducer is a finite term rewriting system. If each rewrite rule carries a probablity or, in general, a weight from some semiring, then they are weighted tree transducers (Maletti, , 2006aFülöp and Vogler, 2009). Such weighted tree transducers have also been used for the specification of MT of natural languages (Yamada and Knight, 2001;Knight and Graehl, 2005;Graehl et al., 2008;Knight and May 2009). Martin and Vere (1970) and Schreiber (1975) established the first connections between the two traditions; also Shieber (2004Shieber ( , 2006 and Maletti (2008Maletti ( , 2010 investigated their relationship.
The problem addressed in this paper is the decoding of source-language strings into targetlanguage trees where the transformation is described by a pSTIG. Currently, this decoding requires two steps: first, every source string is translated into a derivation tree of the underlying pSTIG (DeNeefe, 2009;DeNeefe and Knight 2009), and second, the derivation tree is transformed into the target tree using an embedded tree transducer (Shieber, 2006). We propose a transducer model, called a bottom-up tree adjoining transducer, which performs this decoding in a single step and, simultaneously, computes the probabilities of its derivations. As a basis of our approach, we present a formal definition of pSTIG.
Preliminaries
For two sets Σ and A, we let U Σ (A) be the set of all (unranked) trees over Σ in which also elements of A may label leaves. We abbreviate U Σ (∅) by U Σ . We denote the set of positions, leaves, and non-leaves of ξ ∈ U Σ by pos(ξ) ⊆ N * , lv(ξ), and nlv(ξ), resp., where ε denotes the root of ξ and w.i denotes the ith child of position w; nlv(ξ) = pos(ξ) \ lv(ξ). For a position w ∈ pos(ξ), the label of ξ at w (resp., subtree of ξ at w) is denoted by ξ(w) (resp., ξ| w ). If additionally ζ ∈ U Σ (A), then ξ[ζ] w denotes the tree which is obtained from ξ by replacing its subtree at w by ζ. For every ∆ ⊆ Σ ∪ A, the set pos ∆ (ξ) is the set of all those positions w ∈ pos(ξ) such that ξ(w) ∈ ∆. Similarly, we can define lv ∆ (ξ) and nlv ∆ (ξ). The yield of ξ is the sequence yield(ξ) ∈ (Σ ∪ A) * of symbols that label the leaves from left to right.
If we associate with σ ∈ Σ a rank k ∈ N, then we require that in every tree ξ ∈ U Σ (A) every σlabeled position has exactly k children.
Probabilistic STAG and STIG
First we will define probabilistic STAG, and second, as a special case, probabilistic STIG.
Let N and T be two disjoint sets of, resp., nonterminals and terminals. A substitution rule r is a tuple (ζ s , ζ t , V, W, P r adj ) where • ζ s , ζ t ∈ U N (T ) (source and target tree) and
|lv
N (ζ s )| = |lv N (ζ t )|, • V ⊆ lv N (ζ s )×lv N (ζ t ) (substitution sites), V is a one-to-one relation, and |V | = |lv N (ζ s )|, • W ⊆ nlv N (ζ s ) × nlv N (ζ t ) (potential adjoin-
ing sites), and • P r adj : W → [0, 1] (adjoining probability). An auxiliary rule r is a tuple (ζ s , ζ t , V, W, * , P r adj ) where ζ s , ζ t , W , and P r adj are defined as above and • V is defined as above except that |V | = |lv N (ζ s )| − 1 and • * = ( * s , * t ) ∈ lv N (ζ s ) × lv N (ζ t ) and neither * s nor * t occurs in any element of V ; moreover, ζ s (ε) = ζ s ( * s ) and ζ t (ε) = ζ t ( * t ), and * s = ε = * t ; the node * s (and * t ) is called the foot-node of ζ s (resp., ζ t ). An (elementary) rule is either a substitution rule or an auxiliary rule. The root-category of a rule r is the tuple (ζ s (ε), ζ t (ε)), denoted by rc(r).
A probabilistic synchronous tree adjoining grammar (pSTAG) is a tuple G = (N, T, (S s , S t ), S, A, P ) such that N and T are two disjoint sets (resp., of nonterminals and terminals), (S s , S t ) ∈ N × N (start nonterminal), S and A are finite sets of, resp., substitution rules and auxiliary rules, and P : S ∪ A → [0, 1] such that for every (A, B) ∈ N × N , assuming that in each case the number of summands is not zero. In the following, let G always denote an arbitrary pSTAG.
S s α A↓ A α a r1 ⇐⇒ S t B β B↓ β a P (r 1 ) = 1 P r1 adj (a) = .9 A A γ b,c * r2 ⇐⇒ B B δ B b c * P (r 2 ) = .4 P r2 adj (b) = .2 P r2 adj (c) = .6 A A A λ d * e r3 ⇐⇒ B µ B d,e * P (r 3 ) = .6 P r3 adj (d) = .3 P r3 adj (e) = .8 A α r4 ⇐⇒ B β P (r 4 ) = .1 A γ r5 ⇐⇒ B δ P (r 5 ) = .9
Figure 1: The running example pSTAG G.
In Fig. 1 we show the rules of our running example pSTAG, where the capital Roman letters are the nonterminals and the small Greek letters are the terminals. The substitution site (in rule r 1 ) is indicated by ↓, and the potential adjoining sites are denoted 2 by a, b, c, d, and e. For instance, in formal notation the rules r 1 and r 2 are written as follows: where ↓ = (2, 2) and a = (3, 1), and where b = (ε, ε), c = (ε, 1), and * = (1, 2).
In the derivation relation of G we will distinguish four types of steps:
1. substitution of a rule at a substitution site (substitution), 2. deciding to turn a potential adjoining site into an activated adjoining site (activation), 3. deciding to drop a potential adjoining site, i.e., not to adjoin, (non-adjoining) and 4. adjoining of a rule at an activated adjoining site (adjoining). In the sentential forms (defined below) we will maintain for every adjoining site w a two-valued flag g(w) indicating whether w is a potential (g(w) = p) or an activated site (g(w) = a).
The set of sentential forms of G is the set SF(G) of all tuples κ = (ξ s , ξ t , V, W, g) with
• ξ s , ξ t ∈ U N (T ), • V ⊆ lv N (ξ s ) × lv N (ξ t ) is a one-to-one rela- tion, |V | = |lv N (ξ s )| = |lv N (ξ t )|, • W ⊆ nlv N (ξ s ) × nlv N (ξ t ), and • g : W → {p, a}. The derivation relation (of G) is the binary relation ⇒ ⊆ SF(G) × SF(G) such that for every κ 1 = (ξ 1 s , ξ 1 t , V 1 , W 1 , g 1 ) and κ 2 = (ξ 2 s , ξ 2 t , V 2 , W 2 , g 2 )
we have κ 1 ⇒ κ 2 iff one of the following is true:
1. (substitution) there are w = (w s , w t ) ∈ V 1 and r = (ζ s , ζ t , V, W, P r adj ) ∈ S such that -(ξ 1 s (w s ), ξ 1 t (w t )) = rc(r), -ξ 2 s = ξ 1 s [ζ s ] ws and ξ 2 t = ξ 1 t [ζ t ] wt , -V 2 = (V 1 \ {w}) ∪ w.V , 3 -W 2 = W 1 ∪ w.W ,
and g 2 is the union of g 1 and the set of pairs (w.u, p) for every u ∈ W ; this step is denoted by κ 1
w,r =⇒ κ 2 ; 2. (activation) there is a w ∈ W 1 with g 1 (w) = p and (ξ 1 s , ξ 1 t , V 1 , W 1 ) = (ξ 2 s , ξ 2 t , V 2 , W 2 )
, and g 2 is the same as g 1 except that g 2 (w) = a; this step is denoted by κ 1
w =⇒ κ 2 ; 3. (non-adjoining) there is w ∈ W 1 with g 1 (w) = p and (ξ 1 s , ξ 1 t , V 1 ) = (ξ 2 s , ξ 2 t , V 2 ), W 2 = W 1 \ {w}, and g 2 is g 1 restricted to W 2 ; this step is denoted by κ 1 ¬w =⇒ κ 2 ; 4. (adjoining) there are w ∈ W 1 with g 1 (w) = a, and r = (ζ s , ζ t , V, W, * , P r adj ) ∈ A such that, for w = (w s , w t ), -(ξ 1 s (w s ), ξ 1 t (w t )) = rc(r), -ξ 2 s = ξ 1 s [ζ ′ s ] ws where ζ ′ s = ζ s [ξ 1 s | ws ] * s , ξ 2 t = ξ 1 t [ζ ′ t ] wt where ζ ′ t = ζ t [ξ 1 t | wt ] * t , -V 2 is the smallest set such that (i) for every (u s , u t ) ∈ V 1 we have (u ′ s , u ′ t ) ∈ V 2 where u ′ s = u s if w s is not a prefix of u s , w s . * s .u if u s = w s .u for some u;
and u ′ t is obtained in the same way from u t , w t , and * t , and (ii) V 2 contains w.V ; -W 2 is the smallest set such that (i) for every
(u s , u t ) ∈ W 1 \ {w} we have (u ′ s , u ′ t ) ∈ W 2 where u ′
s and u ′ t are obtained in the same way as for V 2 , and g 2 (u ′ s , u ′ t ) = g 1 (u s , u t ) and (ii) W 2 contains w.W and g 2 (w.u) = p for every u ∈ W ; this step is denoted by κ 1 Fig. 2 we show a derivation of our running example pSTAG where activated adjoining sites are indicated by surrounding circles, the other adjoining sites are potential.
w,r =⇒ κ 2 . 3 w.V = {(ws.vs, wt.vt) | (vs, vt) ∈ V } InS s ↓ ⇐⇒ S t ↓ substitution of r 1 at (ε, ε) =⇒ P (r 1 ) = 1 S s α A↓ A α a ⇐⇒ S t B β B↓ β a substitution of r 4 at (2, 2) =⇒ P (r 4 ) = .1 S s α A α A α a ⇐⇒ S t B β B β β a activation at a = (3, 1) =⇒ P r1 adj (a) = .9 S s α A α A α a ⇐⇒ S t B β B β β a adjoining of r 2 at a = (3, 1) =⇒ P (r 2 ) = .4 S s α A α A A α γ b,c ⇐⇒ S t B B δ B β B β β b c non-adjoining at c = (3, 1.1) =⇒ 1 − P r2 adj (c) = .4 S s α A α A A α γ b ⇐⇒ S t B B δ B β B β β b non-adjoining at b = (3, 1) =⇒ 1 − P r2 adj (b) = .8 S s α A α A A α γ ⇐⇒ S t B B δ B β B β β Figure 2: An example derivation with total proba- bility 1 × .1 × .9 × .4 × .4 × .8 = .01152. The only initial sentential form is κ in = (S s , S t , {(ε, ε)}, ∅, ∅). A sentential form κ is final if it has the form (ξ s , ξ t , ∅, ∅, ∅). Let κ ∈ SF(G).
A derivation (of κ) is a sequence d of the form κ 0 u 1 κ 1 . . . u n κ n with κ 0 = κ in and n ≥ 0, κ i−1 u i ⇒ κ i for every 1 ≤ i ≤ n (and κ n = κ). We denote κ n also by last(d), and the set of all derivations of κ (resp., derivations) by D(κ) (resp., D).
We call d ∈ D successful if last(d) is final. The tree transformation computed by G is the relation τ G ⊆ U N (T ) × U N (T ) with (ξ s , ξ t ) ∈ τ G iff there is a successful derivation of (ξ s , ξ t , ∅, ∅, ∅).
Our definition of the probability of a derivation is based on the following observation. 4 Let d ∈ D(κ) for some κ = (ξ s , ξ t , V, W, g). Then, for every w ∈ W , the rule which created w and the corresponding local position in that rule can be retrieved from d. Let us denote this rule by r(d, κ, w) and the local position by l(d, κ, w). Now let d be the derivation κ 0 u 1 κ 1 . . . u n κ n . Then the probability of d is defined by
P (d) = 1≤i≤n P d (κ i−1 u i ⇒ κ i ) where 1. (substitution) P d (κ i−1 w,r =⇒ κ i ) = P (r) 2. (activation) P d (κ i−1 w =⇒ κ i ) = P r ′ adj (w ′ ) where r ′ = r(d, κ i−1 , w) and w ′ = l(d, κ i−1 , w) 3. (non-adjoining) P d (κ i−1 ¬w =⇒ κ i ) = 1 − P r ′ adj (w ′ )
where r ′ and w ′ are defined as in the activation case 4. (adjoining)
P d (κ i−1 w,r =⇒ κ i ) = P (r)
. In order to describe the generative model of G, we impose a deterministic strategy sel on the derivation relation in order to obtain, for every sentential form, a probability distribution among the follow-up sentential forms. A deterministic derivation strategy is a mapping sel :
SF(G) → (N * × N * ) ∪ {⊥} such that for every κ = (ξ s , ξ t , V, W, g) ∈ SF(G), we have that sel(κ) ∈ V ∪ W if V ∪ W = ∅, and sel(κ) = ⊥ otherwise.
In other words, sel chooses the next site to operate on. Then we define ⇒ sel in the same way as ⇒ but in each of the cases we require that w = sel(κ 1 ). Moreover, for every derivation d ∈ D, we denote by next(d) the set of all derivations of the form duκ where last(d) u ⇒ sel κ. The generative model of G comprises all the generative stories of G. A generative story is a tree t ∈ U D ; the root of t is labeled by κ in . Let w ∈ pos(t) and t(w) = d. Then either w is a leaf, because we have stopped the generative story at w, or w has |next(d)| children, each one represents exactly one possible decision about how to extend d by a single derivation step (where their order does not matter). Then, for every generative story t, we have that w∈lv(t) P (t(w)) = 1 .
We note that (D, next, µ) can be considered as a discrete Markov chain (cf., e.g. (Baier et al., 2009)) where the initial probability distribution µ : D → [0, 1] maps d = κ in to 1, and all the other derivations to 0.
A probabilistic synchronous tree insertion grammar (pSTIG) G is a pSTAG except that for every rule r = (ζ s , ζ t , V, W, P r adj ) or r = (ζ s , ζ t , V, W, * , P r adj ) we have that • if r ∈ A, then |lv(ζ s )| ≥ 2 and |lv(ζ t )| ≥ 2, • for * = ( * s , * t ) we have that * s is either the rightmost leaf of ζ s or its leftmost one; then we call r, resp., L-auxiliary in the source and R-auxiliary in the source; similarly, we restrict * t ; the source-spine of r (target-spine of r) is the set of prefixes of * s (resp., of * t )
• W ⊆ nlv N (ζ s )×{L, R}×nlv N (ζ t )×{L, R}
where the new components are the directiontype of the potential adjoining site, and • for every (w s , δ s , w t , δ t ) ∈ W , if w s lies on the source-spine of r and r is L-auxiliary (Rauxiliary) in the source, then δ s = L (resp., δ s = R), and corresponding restrictions hold for the target component. According to the four possibilities for the footnode * we call r LL-, LR-, RL-, or RR-auxiliary. The restriction for the probability distribution P of G is modified such that for every (A, B) ∈ N ×N and x, y ∈ {L, R}:
r∈A, rc(r)=(A,B)
r is xy−auxiliary P (r) = 1 .
In the derivation relation of the pSTIG G we will have to make sure that the direction-type of the chosen adjoining site w matches with the type of auxiliarity of the auxiliary rule. Again we assume that the data structure SF(G) is enriched such that for every potential adjoining site w of κ ∈ SF(G) we know its direction-type dir(w).
We define the derivation relation of the pSTIG G to be the binary relation ⇒ I ⊆ SF(G)×SF(G) such that we have κ 1 ⇒ I κ 2 iff (i) κ 1 ⇒ κ 2 and (ii) if adjoining takes place at w, then the used auxiliary rule must be dir(w)-auxiliary. Since ⇒ I is a subset of ⇒, the concepts of derivation, successful derivation, and tree transformation are defined also for a pSTIG.
In fact, our running example pSTAG in Fig. 1 is a pSTIG, where r 2 and r 3 are RL-auxiliary and every potential adjoining site has direction-type RL; the derivation shown in Fig. 2 is a pSTIGderivation.
Bottom-up tree adjoining transducer
Here we introduce the concept of a bottom-up tree adjoining transducer (BUTAT) which will be used to formalize a decoder for a pSTIG.
A BUTAT is a finite-state machine which translates strings into trees. The left-hand side of each rule is a string over terminal symbols and statevariable combinations. A variable is either a substitution variable or an adjoining variable; a substitution variable (resp., adjoining variable) can have an output tree (resp., output tree with foot node) as value. Intuitively, each variable value is a translation of the string that has been reduced to the corresponding state. The right-hand side of a rule has the form q(ζ) where q is a state and ζ is an output tree (with or without foot-node); ζ may contain the variables from the left-hand side of the rule. Each rule has a probability p ∈ [0, 1].
In fact, BUTAT can be viewed as the stringto-tree version of bottom-up tree transducers (Engelfriet, 1975;Gecseg andSteinby, 1984,1997) in which, in addition to substitution, adjoining is allowed.
Formally, we let X = {x 1 , x 2 , . . .} and F = {f 1 , f 2 , . . .} be the sets of substitution variables and adjoining variables, resp. Each substitution variable (resp., adjoining variable) has rank 0 (resp., 1). Thus when used in a tree, substitution variables are leaves, while adjoining variables have a single child.
A bottom-up tree adjoining transducer (BU-TAT) is a tuple M = (Q, Γ, ∆, Q f , R) where • Q is a finite set (of states),
• Γ is an alphabet (of input symbols), assuming that Q ∩ Γ = ∅, • ∆ is an alphabet (of output symbols), • Q f ⊆ Q (set of final states), and • R is a finite set of rules of the form
γ 0 q 1 (z 1 ) γ 1 . . . q k (z k ) γ k p → q(ζ) ( †)
where p ∈ [0, 1] (probability of ( †)), k ≥ 0, γ 0 , γ 1 , . . . , γ k ∈ Γ * , q, q 1 , . . . , q k ∈ Q, z 1 , . . . , z k ∈ X ∪ F , and ζ ∈ RHS(k) where RHS(k) is the set of all trees over ∆ ∪ {z 1 , . . . , z k } ∪ { * } in which the nullary * occurs at most once. The set of intermediate results of M is the set
IR(M ) = {ι | ι ∈ U ∆ ({ * }), |pos { * } (ι)| ≤ 1} and the set of sentential forms of M is the set SF(M ) = (Γ ∪ {q(ι) | q ∈ Q, ι ∈ IR(M )}) * .
The derivation relation induced by M is the binary relation ⇒ ⊆ SF(M ) × SF(M ) such that for every ξ 1 , ξ 2 ∈ SF(M ) we define ξ 1 ⇒ ξ 2 iff there are ξ, ξ ′ ∈ SF(M ), there is a rule of the form ( †) in R, and there are ζ 1 , . . . , ζ k ∈ IR(M ) such that:
• for every 1 ≤ i ≤ k: if z i ∈ X, then ζ i does not contain * ; if z i ∈ F , then ζ i contains * exactly once, • ξ 1 = ξ γ 0 q 1 (ζ 1 ) γ 1 . . . q k (ζ k ) γ k ξ ′ , and • ξ 2 = ξ q(θ(ζ)) ξ ′ where θ is a function that replaces variables in a right-hand side with their values (subtrees) from the left-hand side of the rule. Formally, θ : RHS(k) → IR(M ) is defined as follows:
(i) for every ξ = δ(ξ 1 , . . . , ξ n ) ∈ RHS(k), δ ∈ ∆, we have θ(ξ) = δ(θ(ξ 1 ), . . . , θ(ξ n )), (ii) (substitution) for every z i ∈ X, we have θ(z i ) = ζ i , (iii) (adjoining) for every z i ∈ F and ξ ∈ RHS(k), we have θ(z i (ξ)) = ζ i [θ(ξ)] v where v is the uniquely determined position of * in ζ i , and (iv) θ( * ) = * . Clearly, the probablity of a rule carries over to derivation steps that employ this rule. Since, as usual, a derivation d is a sequence of derivation steps, we let the probability of d be the product of the probabilities of its steps.
The string-to-tree transformation computed by M is the set τ M of all tuples (γ, ξ) ∈ Γ * ×U ∆ such that there is a derivation of the form γ ⇒ * q(ξ) for some q ∈ Q f .
Decoder for pSTIG
Now we construct the decoder dec(G) for a pSTIG G that transforms source strings directly into target trees and simultaneously computes the probability of the corresponding derivation of G. This decoder is formalized as a BUTAT.
Since dec(G) is a string-to-tree transducer, we have to transform the source tree ζ s of a rule r into a left-hand side ρ of a dec(G)-rule. This is done similarly to (DeNeefe and ) by traversing ζ s via recursive descent using a mapping ϕ (see an example after Theorem 1); this creates appropriate state-variable combinations for all substitution sites and potential adjoining sites of r. In particular, the source component of the direction-type of a potential adjoining site determines the position of the corresponding combination in ρ. If there are several potential adjoining sites with the same source component, then we create a ρ for every permutation of these sites. The right-hand side of a dec(G)-rule is obtained by traversing the target tree ζ t via recursive descent using a mapping ψ ρ and, whenever a nonterminal with a potential adjoining site w is met, a new position labeled by f w is inserted. 5 If there is more than one potential adjoining site, then the set of all those sites is ordered as in the left-hand side ρ from top to bottom. Apart from these main rules we will employ rules which implement the decision of whether or not to turn a potential adjoining site w into an activated adjoining site. Rules for the first purpose just pass the already computed output tree through from left to right, whereas rules for the second purpose create for an empty left-hand side the output tree * .
We will use the state behavior of dec(G) in order to check that (i) the nonterminals of a substitution or potential adjoining site match the rootcategory of the used rule, (ii) the direction-type of an adjoining site matches the auxiliarity of the chosen auxiliary rule, and (iii) the decisions of whether or not to adjoin for each rule r of G are kept separate.
Whereas each pair (ξ s , ξ t ) in the translation of G is computed in a top-down way, starting at the initial sentential form and substituting and adjoining to the present sentential form, dec(G) builds ξ t in a bottom-up way. This change of direction is legitimate, because adjoining is associative (Vijay-Shanker and Weir, 1994), i.e., it leads to the same result whether we first adjoin r 2 to r 1 , and then align r 3 to the resulting tree, or first adjoin r 3 to r 2 , and then adjoin the resulting tree to r 1 .
In Fig. 3 we show some rules of the decoder of our running example pSTIG and in Fig. 4 the 5 We will allow variables to have structured indices that are not elements of N. However, by applying a bijective renaming, we can always obtain rules of the form ( †). derivation of this decoder which correponds to the derivation in Fig. 2. Theorem 1. Let G be a pSTIG over N and T . Then there is a BUTAT dec(G) such that for every (ξ s , ξ t ) ∈ U N (T ) × U N (T ) and p ∈ [0, 1] the following two statements are equivalent:
1. there is a successful derivation of (ξ s , ξ t , ∅, ∅, ∅) by G with probability p, 2. there is a derivation from yield(ξ s ) to [S s , S t ](ξ t ) by dec(G) with probability p.
PROOF. Let G = (N, T, [S s , S t ], S, A, P ) be a pSTIG. We will construct the BUTAT dec(G) = (Q, T, N ∪ T, {[S s , S t ]}, R) as follows (where the mappings ϕ and ψ ρ will be defined below):
• Q = [N × N ] ∪ [N × {L, R} × N × {L, R}] ∪{[r, w] | r ∈ A,
w is an adjoining site of r}, • R is the smallest set R ′ of rules such that for every r ∈ S ∪ A of the form (ζ s , ζ t , V, W, P r adj ) or (ζ s , ζ t , V, W, * , P r adj ): -for every ρ ∈ ϕ(ε), if r ∈ S, then the main rule
ρ P (r) → [ζ s (ε), ζ t (ε)] ψ ρ (ε)
is in R ′ , and if r ∈ A and r is δ s δ tauxiliary, then the main rule
ρ P (r) → [ζ s (ε), δ s , ζ t (ε), δ t ] ψ ρ (ε)
is in R ′ , and -for every w = (w s , δ s , w t , δ t ) ∈ W the rules
q w f w P r adj (w) −→ [r, w] f w ( * ) with q w = [ζ(w s ), δ s , ζ t (w t ), δ t ]
for activation at w, and the rule
ε 1−P r adj (w) −→ [r, w]( * )
for non-adjoining at w are in R ′ . We define the mapping ϕ : pos(ζ s ) → P((T ∪ Q(X ∪ F )) * )
with Q(X ∪ F ) = {q(z) | q ∈ Q, z ∈ X ∪ F } inductively on its argument as follows. Let w ∈ pos(ζ s ) and let w have n children.
(a) Let ζ s (w) ∈ T . Then ϕ(w) = {ζ s (w)}.
(b) (substitution site) Let ζ s (w) ∈ N and let w ′ ∈ pos(ζ t ) such that (w, w ′ ) ∈ V . Then
ϕ(w) = {[ζ s (w), ζ t (w ′ )] x (w,w ′ ) }.
(c) (adjoining site) Let ζ s (w) ∈ N and let there be an adjoining site in W with w as first component. Then, we define ϕ(w) to be the smallest set such that for every permutation (u 1 , . . . , u l ) (resp., (v 1 , . . . , v m )) of all the Ladjoining (resp., R-adjoining) sites in W with w as first component, the set 6 inductively on its argument as follows. Let w ∈ pos(ζ t ) and let w have n children.
J • ϕ(w.1) • . . . • ϕ(w.n) • K is a subset of ϕ(w), where J = {u ′ 1 . . . u ′ l } and K = {v ′ m . . . v ′ 1 } and u ′ i = [r, u i ] f u i and v ′ j = [r, v j ] f v j for 1 ≤ i ≤ l and 1 ≤ j ≤ m. (d) Let ζ s (w) ∈ N , w = * ,
(a) Let ζ t (w) ∈ T . Then ψ ρ (w) = ζ t (w).
(b) (substitution site) Let ζ t (w) ∈ N and let w ′ ∈ pos(ζ s ) such that (w ′ , w) ∈ V . Then ψ ρ (w) = x (w ′ ,w) . (c) (adjoining site) Let ζ t (w) ∈ N and let there be an adjoining site in W with w as third component. Then let {u 1 , . . . , u l } ⊆ W be the set of all potential adjoining sites with w as third component, and we define
ψ ρ (w) = f u 1 (. . . f u l (ζ) . . .)
where ζ = ζ t (w)(ψ ρ (w.1), . . . , ψ ρ (w.n)) and the u i 's occur in ψ ρ (w) (from the root towards the leaves) in exactly the same order as they occur in ρ (from left to right). (d) Let ζ t (w) ∈ N , w = * , and let w be neither the second component of a substitution site in V nor the third component of an adjoining site in W . Then ψ ρ (w) = ζ t (w)( ψ ρ (w.1), . . . , ψ ρ (w.n)). 6 using the usual concatenation • of formal languages (e) Let w = * . Then ψ ρ (w) = * .
With dec(G) constructed as shown, for each derivation of G there is a corresponding derivation of dec(G), with the same probability, and vice versa. The derivations proceed in opposite directions. Each sentential form in one has an equivalent sentential form in the other, and each step of the derivations correspond. There is no space to present the full proof, but let us give a slightly more precise idea about the formal relationship between the derivations of G and dec(G).
In the usual way we can associate a derivation tree d t with every successful derivation d of G. Assume that last(d) = (ξ s , ξ t , ∅, ∅, ∅), and let E s and E t be the embedded tree transducers (Shieber, 2006) associated with, respectively, the source component and the target component of G. Then it was shown in (Shieber, 2006) that τ Es (d t ) = ξ s and τ Et (d t ) = ξ t where τ E denotes the tree-to-tree transduction computed by an embedded tree transducer E. Roughly speaking, E s and E t reproduce the derivations of, respectively, the source component and the target component of G that are prescribed by d t . Thus, for
κ = (ξ ′ s , ξ ′ t , V, W, g), if κ in ⇒ * G κ and κ is a prefix of d, then there is exactly one subtree d t [(w, w ′ )] of d t associated with every (w, w ′ ) ∈ V ∪ W ,
which prescribes how to continue at (w, w ′ ) with the reproduction of d. Having this in mind, we obtain the sentential form of the dec(G)-derivation which corresponds to κ by applying a modification of ϕ to κ where the modification amounts to replacing x (w,w ′ ) and f (w,w ′ ) by τ Et (d t [(w, w ′ )]); note that τ Et (d t [(w, w ′ )]) might contain * .
As illustration of the construction in Theorem 1 let us apply the mappings ϕ and ψ ρ to rule r 2 of Fig. 1, i.e., to r 2 = (ζ s , ζ t , ∅, {b, c}, * , P r 2 adj ) with ζ s = A(A, γ), ζ t = B(B(δ), B), b = (ε, R, ε, L), c = (ε, R, 1, L), and * = (1, 2).
Let us calculate ϕ(ε) on ζ s . Due to (c),
ϕ(ε) = J • ϕ(1) • ϕ(2) • K.
Since there are no L-adjoinings at ε, we have that J = {ε}. Since there are the R-adjoinings b and c at ε, we have the two permutations (b, c) and (c, b). which is also shown in Fig. 3.
r∈S rc(r)=(A,B) P (r) = 1 and r∈A rc(r)=(A,B) P (r) = 1
r1 = (Ss(α, A, A(α)), St(B(β), B, β), {↓}, {a}, P r 1 adj )
r2 = (A(A, γ), B(B(δ), B), ∅, {b, c}, * , P r 2 adj )
and let w be neither the first component of a substitution site in V nor the first component of an adjoining site in W . Then ϕ(w) = ϕ(w.1) • . . . • ϕ(w.n) .(e) Let w = * . Then we define ϕ(w) = {ε}.For every ρ ∈ ϕ(ε), we define the mapping ψ ρ : pos(ζ t ) → U N ∪F ∪X (T ∪ { * })
(v 1
1, v 2 ) = (b, c): K = {[r 2 , c](f c )[r 2 , b](f b )} (v 1 , v 2 ) = (c, b): K = {[r 2 , b](f b )[r 2 , c](f c )}Due to (e) and (a), we have that ϕ(1) = {ε} and ϕ(2) = {γ}, resp. Thus, ϕ(ε) is the set:{γ [r 2 , c](f c ) [r 2 , b](f b ), γ [r 2 , b](f b ) [r 2 , c](f c )}.
Figure 3 :
3Some rules of the running example decoder.Now let ρ = γ [r 2 , b](f b ) [r 2 , c](f c ). Let us calculate ψ ρ (ε) on ζ t . ψ ρ (ε) (c) = f b (B(ψ ρ (1), ψ ρ (2))) (c) = f b (B(f c (B(ψ ρ (1.1))), ψ ρ (2))) (a) = f b (B(f c (B(δ)), ψ ρ (2))) (e) = f b (B(f c (B(δ)), * ))Hence we obtain the ruleγ [r 2 , b](f b ) [r 2 , c](f c ) → [A, R, B, L](f b (B(fc (B(δ)), * )))
Figure 4 :
4Derivation of the decoder corresponding to the derivation inFig. 2.
Their placement (as left or right index) does not play a role yet, but will later when we introduce pSTIG.
We note that a different definition occurs in(Nesson et al., 2005(Nesson et al., , 2006.
Using lexicalized TAGs for machine translation. A Abeille, Y Schabes, A K Joshi, Proceedings of the 13th International Conference on Computational Linguistics. the 13th International Conference on Computational LinguisticsHelsinki, Finland3A. Abeille, Y. Schabes, A.K. Joshi. Using lexicalized TAGs for machine translation. In Proceedings of the 13th International Conference on Computational Linguistics, volume 3, pp. 1-6, Helsinki, Finland, 1990.
Model checking linear-time properties of probabilistic systems. C Baier, M Größer, F Ciesinski, Handbook of Weighted Automata. Springer13C. Baier, M. Größer, F. Ciesinski. Model checking linear-time properties of probabilistic systems. In Handbook of Weighted Automata, Chapter 13, pp. 519-570, Springer, 2009.
Tree adjoining machine translation. S Deneefe, Univ. of Southern CaliforniaPh.D. thesis proposalS. DeNeefe. Tree adjoining machine translation. Ph.D. thesis proposal, Univ. of Southern California, 2009.
Synchronous tree adjoining machine translation. S Deneefe, K Knight, Proc. of Conf. Empirical Methods in NLP. of Conf. Empirical Methods in NLPS. DeNeefe, K. Knight. Synchronous tree adjoining machine translation. In Proc. of Conf. Empirical Methods in NLP, pp. 727-736, 2009.
Bottom-up and top-down tree transformations -a comparison. J Engelfriet, Math. Systems Theory. 93J. Engelfriet. Bottom-up and top-down tree transfor- mations -a comparison. Math. Systems Theory, 9(3):198-231, 1975.
Tree transducers and syntax-directed semantics. J Engelfriet, CAAP 1982. Lille, FranceJ. Engelfriet. Tree transducers and syntax-directed se- mantics. In CAAP 1982: Lille, France, 1982.
Spinal-formed context-free tree grammars. Theory of Computing Systems. A Fujiyoshi, T Kasai, 33A. Fujiyoshi, T. Kasai. Spinal-formed context-free tree grammars. Theory of Computing Systems, 33:59- 83, 2000.
Weighted tree automata and tree transducers. Z Fülöp, H Vogler, Handbook of Weighted Automata. SpingerZ. Fülöp, H. Vogler. Weighted tree automata and tree transducers. In Handbook of Weighted Automata, Chapter 9, pp. 313-403, Spinger, 2009.
. F Gécseg, M Steinby, Tree Automata. Akadémiai Kiadó. F. Gécseg, M. Steinby. Tree Automata. Akadémiai Kiadó, Budapest, 1984.
Tree languages. F Gécseg, M Steinby, Handbook of Formal Languages. Springer-Verlag3F. Gécseg, M. Steinby. Tree languages. In Handbook of Formal Languages, volume 3, chapter 1, pages 1-68. Springer-Verlag, 1997.
Training tree transducers. J Graehl, K Knight, J , Computational Linguistics. 343J. Graehl, K. Knight, J. May. Training tree transducers. Computational Linguistics, 34(3):391-427, 2008
Tree adjunct grammars. A K Joshi, L S Levy, M Takahashi, Journal of Computer and System Sciences. 101A.K. Joshi, L.S. Levy, M. Takahashi. Tree adjunct grammars. Journal of Computer and System Sci- ences, 10(1):136-163, 1975.
Tree-adjoining grammars. A K Joshi, Y Schabes, Handbook of Formal Languages. Springer-VerlagA.K. Joshi, Y. Schabes. Tree-adjoining grammars. In Handbook of Formal Languages. Chapter 2, pp. 69- 123, Springer-Verlag, 1997.
An overview of probabilistic tree transducers for natural language processing. K Knight, J Graehl, Computational Linguistics and Intelligent Text Processing. Springer3406CICLing 2005K. Knight, J. Graehl. An overview of probabilis- tic tree transducers for natural language processing. In Computational Linguistics and Intelligent Text Processing, CICLing 2005, LNCS 3406, pp. 1-24, Springer, 2005.
Applications of Weighted Automata in Natural Language Processing. K Knight, J , Handbook of Weighted Automata. SpringerK. Knight, J. May. Applications of Weighted Au- tomata in Natural Language Processing. In Hand- book of Weighted Automata, Chapter 14, pp. 571- 596, Springer, 2009.
Syntax-directed transductions. P M Lewis, R E Stearns, Journal of the ACM. 15P.M. Lewis, R.E. Stearns. Syntax-directed transduc- tions. Journal of the ACM, 15:465-488, 1968.
Compositions of tree series transformations. A Maletti, Theoret. Comput. Sci. 366A. Maletti. Compositions of tree series transforma- tions. Theoret. Comput. Sci., 366:248-271, 2006.
The Power of Tree Series Transducers. A Maletti, Dresden, GermanyTUPh.D. thesisA. Maletti. The Power of Tree Series Transducers. Ph.D. thesis, TU Dresden, Germany, 2006.
Compositions of extended top-down tree transducers. Information and Computation. A Maletti, 206A. Maletti. Compositions of extended top-down tree transducers. Information and Computation, 206:1187-1196, 2008.
Why synchronous tree substitution grammars. A Maletti, Proc. 11th Conf. North American Chapter of the Association of Computational Linguistics. 11th Conf. North American Chapter of the Association of Computational LinguisticsA. Maletti. Why synchronous tree substitution gram- mars? in Proc. 11th Conf. North American Chap- ter of the Association of Computational Linguistics. 2010.
On syntax-directed transductions and tree transducers. D F Martin, S A Vere, Ann. ACM Symposium on Theory of Computing. D.F. Martin and S.A. Vere. On syntax-directed trans- ductions and tree transducers. In Ann. ACM Sympo- sium on Theory of Computing, pp. 129-135, 1970.
Induction of probabilistic synchronous tree-insertion grammars. R Nesson, S M Shieber, A Rush, TR-20-05Cambridge, MassachusettsComputer Science Group, Harvard UniveristyTechnical ReportR. Nesson, S.M. Shieber, and A. Rush. Induction of probabilistic synchronous tree-insertion gram- mars. Technical Report TR-20-05, Computer Sci- ence Group, Harvard Univeristy, Cambridge, Mas- sachusetts, 2005.
Induction of probabilistic synchronous tree-inserting grammars for machine translation. R Nesson, S M Shieber, A Rush, Proceedings of the 7th Conference of the Association for Machine Translation in the Americas. the 7th Conference of the Association for Machine Translation in the AmericasR. Nesson, S.M. Shieber, and A. Rush. Induction of probabilistic synchronous tree-inserting grammars for machine translation. In Proceedings of the 7th Conference of the Association for Machine Transla- tion in the Americas (AMTA 2006), 2006.
Tree insertion grammars: a cubic-time, parsable formalism that lexicalizes context-free grammar without changing the trees produced. Y Schabes, R C Waters, Computational Linguistics. 21Y. Schabes, R.C. Waters. Tree insertion grammars: a cubic-time, parsable formalism that lexicalizes context-free grammar without changing the trees produced. Computational Linguistics, 21:479-513, 1994.
Tree-transducers and syntax-connected transductions. P P Schreiber, Automata Theory and Formal Languages. Springer33P.P. Schreiber. Tree-transducers and syntax-connected transductions. In Automata Theory and Formal Languages, Lecture Notes in Computer Science 33, pp. 202-208, Springer, 1975.
Synchronous grammars and tree transducers. S M Shieber, Proc. 7th Workshop on Tree Adjoining Grammars and Related Formalisms. 7th Workshop on Tree Adjoining Grammars and Related FormalismsS.M. Shieber. Synchronous grammars and tree trans- ducers. In Proc. 7th Workshop on Tree Adjoin- ing Grammars and Related Formalisms, pp. 88-95, 2004.
Unifying synchronous tree-adjoining grammars and tree transducers via bimorphisms. S M Shieber, Proc. 11th Conf. European Chapter of ACL, EACL 06. 11th Conf. European Chapter of ACL, EACL 06S.M. Shieber. Unifying synchronous tree-adjoining grammars and tree transducers via bimorphisms. In Proc. 11th Conf. European Chapter of ACL, EACL 06, pp. 377-384, 2006.
Synchronous tree-adjoining grammars. S M Shieber, Y Schabes, Proceedings of the 13th International Conference on Computational Linguistics. the 13th International Conference on Computational LinguisticsHelsinki, Finland3S.M. Shieber, Y. Schabes. Synchronous tree-adjoining grammars. In Proceedings of the 13th Interna- tional Conference on Computational Linguistics, volume 3, pp. 253-258, Helsinki, Finland, 1990.
The equivalence of four extensions of context-free grammars. K Vijay-Shanker, D J Weir, Mathematical Systems Theory. 27K. Vijay-Shanker, D.J. Weir. The equivalence of four extensions of context-free grammars. Mathematical Systems Theory, 27:511-546, 1994.
A syntax-based statistical translation model. K Yamada, K Knight, Proc. of 39th Annual Meeting of the Assoc. Computational Linguistics. of 39th Annual Meeting of the Assoc. Computational LinguisticsK. Yamada and K. Knight. A syntax-based statistical translation model. In Proc. of 39th Annual Meeting of the Assoc. Computational Linguistics, pp. 523- 530, 2001.
| Connections between Tree Automata and Term Rewriting are now well known. Whereas tree automata can be viewed as a subclass of ground rewrite systems, tree automata are successfully used as decision tools in rewriting theory. Furthermore, applications, including rewriting theory, have influenced the definition of new classes of tree automata. ::: ::: In this talk, we will first present a short and not exhaustive reminder of some fruitful applications of tree automata in rewriting theory. Then, we will focus on extensions of tree automata, specially tree automata with local or/and global (dis-)equality constraints: we will emphasize new results, compare different extensions, and sketch some applications. | An abstract context-free grammar can be viewed as a system of polynomial functors. The initial algebra of this functor coincides with its least fixed-point; and this fixed-point can be computed by a method of substitution using Bek\`{\i}c theorem. By doing so the system of polynomial functors is transformed into a related system of regular functors. We introduce a splitting operation on algebras producing an algebra for the resulting system of regular functors from an algebra of the original system of polynomial functors. This transformation preserves the interpretation function (catamorphism). The end result is a class of (extended) abstract context-free grammars, associated with regular functors. This class seems to be well-adapted to the modular design of domain-specific embedded languages. | Abstract Context-free graph-grammars are considered such that, in every generated graph G , a derivation tree of G can be constructed by means of monadic second-order formulas that specify its nodes, its labels, the successors of a node etc. A subset of the set of graphs generated by such a grammar is recognizable iff it is definable in monadic second-order logic, whereas, in general, only the “if” direction holds. | Massively parallel algorithms are described for parsing with Tree Adjoining Grammar (TAG), a formalism for describing natural language. Sequential parsing algorithms for TAGs run in time quadratic in the grammar size, which is impractical for the very large grammars currently being developed for natural language. This paper presents two parallel algorithms, one running in time nearly linear in the grammar size, and the other running in time logarithmic in the grammar size. Both parallel algorithms were implemented on a Connection Machine CM-2 and performance measurements were obtained for varying grammar sizes. |
INTRODUCTION
XTAG is a large on-going project to develop a widecoverage grammar for English, based on the l,exicalized Tree Adjoining Grammar (I 3"AG) tbrmalism. LTAG is a lexicalized mildly-context sensitive tree rewriting system [Joshi et al., 1975;Schabes, 1990] that is closely related to Dependency Grammars and Categorial Grammars. Elementary trees in 13~AG provicle a larger domain of locality over which syntactic and semantic (predicate-argument) constraints are specified. XTAG also serves as an LTAG grammar development system consisting of a predictive left-to-right parser, an X-window interface, a roof phological analyzer, and a part-of-speech tagger (also referred to as simply 'tagger'). Figure 1 shows the overall llow of the system when parsing a sentence. The input sentence is submitted to the Morphological Analyzer and the 3hgger. The morphological analyzer retrieves the morphological information for each individual word from the morphological database. This output is tiltered in the P.O.S Blender using the output of the trigram tagger to reduce the part-of-speech ambiguity of the
SYSTEM DESCRIPTION
Part-of-Speech Tagger
A trigram part-of-speech tagger [Church, 19881, trained on the Wall Street Jotlrilal Corpus, is incorporated in XTAG. The trigraln tagger has been extended to output the N-best parts-of-speech sequences [Soong and Huang, 1990]. XTAG uses this infer mat|on Io reduce the number of specious parses by filtering the possible parts-of-speech provided by the morphological analyzer for each word. The tagger decreases tile time to parse a sentence by an average of 93%.
Parser
Tim system uses an Ea,'ley-style parser which has been extended to handle feature structures associated with trees [Schabes, 19901. The parser uses a general two-pass parsing s|rategy for 'lexicalized' gramlnars ISchabes, 19881. In the tree-selection pass, the parser uses tile syntactic database entry [or each lexical item in the sentence to select a set of elementary structures from the tree database. The tree-grafting pass composes the selected trees using substitution and ad-junct|on operations to obtain the parse of the sentence. The output of tile parser for tile sentence I had a map yesterday is illustrated in l;igure 2. The parse tree I represents the surface constituent structure, while the derivation tree represents the deriwttion history of tile parse. The nodes of the derivation tree are the tree names anchored by tile lexical items. The composition operation is indicated by the nature of Ihe arcs; a dashed line is used for substitution and a bold line for adjunct|on. The number beside each tree name is the address of the node at which the operation took place. Tile deriwltion tree can also be interpreted as a dependency graph with unlabeled arcs hetween words of the sentence. lleuristics that take advantage of 12FAGs have been implemented to improve the performance of tile parser. For instance, the span of the tree and the position of the anchor in the tree are used to weed out unsuitable trees in the first pass of the parser. (1) l)erivation Tree Figure 2: Output structures from the Parser has been acquired by parsing corpora. This information has been compiled into a statistical database (tile l,ex Prob DB) that is used by the parser. These methods speed the runt|me by approxmmtely 87%. J
lleuristics for Ranking the 1 arses
The parser generates the parses in a rank order. This ranking is determined using a combination of heuristics, which are expressed as structural preferences for deriwttion, e..g. attachment sites of adjuncts, right-vs. left-branching structures, topicalized sentences, etc. Similar hem'istics have been used for other parsers. See recent work by IHobbs and Bear, 199411, [Mc-Cord, 19931,and [Nagao, 1994t. A partial list el ~ the heuristics used in XTAG follows:
1. Prefer argument positions to adjunct positions (here, this amotmts Io preferring fewer adjunc-t|on operations).
2. For PPs other Ihan o/', attach to nearest site that is llOt a proper noun.
3. Prefer right-branching structtu'e for sequences of adiectives adverbs and PPs.
4.
5.
Prefer left-branching structure for sequences of norms.
Prefer high attachment (wide-scope) for a moditier and a sequence of modifees of the same type (i.e. a PP following or preceding a coordinate NP, an adjective or determiner preceding a coordinate NP or sequence of Ns, an N preceding coordinate Ns).
These rankings are used to control the number of sentences passed on to further levels of processing. In applications emphasizing speed, only the highest ranked parse will be considered, in applications emphasizing accuracy, the top N parses can be considered.
Syntactic Database
The syntactic database associates lexical items with the appropriate trees and tree families based on selectional information. The syntactic database entries were originally extracted from the Oxford Advanced Learner's Dictionary and Oxford Dictionary for Contemporary Idiomatic English; and then modified and augmented by hand. There are more than 37,000 syntactic database entries. Selected entries from this database are shown in Table 1. Each syntactic entry consists of an INDEX feld, the uninflected form under which the entry is compiled in the database, an ENTRY field, which contains all of the lexical items that will anchor the associated tree(s), a pos field, which gives the part-of-speech for the lexical item(s) in the ENTRY feld, and then either (but not both) a TREES or FAM field. The TREES field indicates a list of individual trees to be associated with the entry, while the FAM field indicates a list of tree families. A tree family, which corresponds to a subcategorization frame (see section 2.3.3), may contain a number of trees. A syntactic entry may also contain a list of feature templates (Fs) which expand out to feature equations to be placed in the specified tree(s). Any number of EX felds may be provided for example sentences. Note that lexical items may have more than one entry and may select the same tree more than once, using different features to capture lexical idiosyncrasies (e.g. have).
Tree Database
Trees in the English [;FAG framework fall into two conceptual classes. The smaller class consists o1' individual trees such as trees (a), (d), and (e) in Figure 3. These trees are generally anchored by non-verbal lexical items. The larger class consists of trees that are
Statistics Database
The statistics database contains trec tmigram frequencies which have been collected by parsing lhe Wall Street Jourllal, the IBM manttal, and the ATIS corptts using the XTAG English grammar. The parser, augmented with the statistics database [Joshi and Srinivas, 1994], assigns each word of the input sentence the top three inost frequently used trees given the part-of-speech o1' the word. On failure the parser retries using all the trees suggested by the syntactic database liar each word. The augmented parser has been observed to have a success rate of 50% without retries.
X-Interface
XTAG provides a graphical interface for manipulating TAGs. The interface offers the following:
Menu-based facility for creating and modifying tree liles and loading grammar files. The production of postscript files corresponding to elementary and parsed trees.
Graphical displays of trec and feature data structures, including a scroll 'web' for large tree structures.
Mouse-based tree editor for crca|ing and modifying trees and feature shuctures.
Hand combination of trees by adjunction or substitution for use in diagnosing grallunar problems. Figure 4 shows tile X window interface after a number of sentences have becll pat'sed.
ENGLISH GRAMMAR
The morphology, syntactic, and tree databases together comprise the English grammar. Lexical items not in the databases are handled by default mechanisms. The range of syntactic phenomena that can be handled is large and includes auxiliaries (including inversion), copula, raising and small clause constructions, topicalization, relative clauses, infinitives, gerunds, passives, adjuncts, it-clefts, wh-clefts, PRO constructions, noun-noun modifications, extraposition, determiner phrases, genitives, negation, nounverb contractions and imperatives. Analyses for sentential adjuncts and time NP adverbials are currently being implemented. The combination of large scale lexicons and wide phenomena coverage result in a robust system.
CORPUS PARSING AND EVALU-ATION
XTAG has recently been used to parse the Wall Street Journal 2, IBM manual, and ATIS corpora as a means of evaluating the coverage and correctness of XTAG parses. For this evaluation, a sentence is considered to have parsed correctly if XTAG produces parse trees. Verifying the presence of the correct parse among the parses generated is done manually at present. Table 2 shows the preliminary results. We will present more complete and rigorous results by the time of the conference and compare them with other 2Sentences of length <= 15 words
Comparison with IBM Parser
A more detailed experiment to measure the crossing bracket accuracy of the XTAG-parsed IBM-manual sentences has been performed. Of the 1600 IBM sentences that have been parsed (those available from the Penn Treebank [Marcus et al., 19931), only 67 overlapped with the IBM-manual treebank that was bracketed by University of Lancaster. 3 The XTAGparses for these 67 sentences were compared 4 with the Lancaster IBM-manual treebank. Table 3 shows the results obtained in this experiment. It also shows the crossing bracket accuracy of the latest IBM statistical parser [Jelinek el al., 1994] on the same genre of sentences. Recall is a measure of the number of bracketed constituents the system got right divided by the number of constituents in the corresponding Treebank sentences. Precision is the number of bracketed constituents the system got right divided by the number of bracketed constituents in the system's parse.
Based on the present data, we believe our" results will be consistent for the complete XTAO-parsed IBM corpus; we plan to evaluate the XTAG parses against the Penn Treebank. In addition, we are parsing the Lancaster sentences, and adding those to the XTAG IBM corpus.
While the crossing-brackets measure is useful for comparing the output of different parsers, we believe that it is a somewhat inadequate method for" evaluating a parser like XTAG for" two main reasons. First, 3The treebank was obtained through Salim Roukos ([email protected]) at IBM. ~We used the parseval program written by Phil llarison (phil @atc.boeing.com). tile parse generated by the XTAG system is nnich richer in its representation of the internal structure of certain phrases thari those present in manually created treebanks. Even though the Lancaster treebank is 1nero detailed in terins of bracketing than the Pemi Treebank, it is not complete in its bracketing of the internal structure of notln phlases. As a result oFcomparing the XTAG parse with a skeletal representation, the precision score is misleadingly low for the XTAG system. a seColld i'eaSOll tliat lhe crossing brackcl IlleaSlll'e is inadequate for ewlhiafing XTA(I is thai the priiriary strtlcturo in XTAG is the doriwition tl'oo ['rOlll whicll the bracketed hee is deriwtd. Two identical bracketings for a sentellCO Ci[ll [laVe coinpletely tlil:forent deriwition trees. A iliore direcl ilieasuro oF the tlorlornlanco oil' file XTAG parser would evahiale the deriwition structtlre, which captures the dependencies between word;;.
Sysl:em
CoiliparisOll with Alvey
We also colnpared the XTt\G parser to the Alvey Nal:tlral kailgtlage Tools (ANI ;l') t)alser, and louild that the two perfornled coniparably. We parsed the sol of I~DOCI'2 Noltn Pluases presented in Appendix l:l of the teciinical report IC, arroll, 1903 ], using Iho XTAG parser. The lechnical report presenls the ranking of tile correct parse and also gives the Ioial iillillber of doriwitions for each liOtill phrase. In this experhnenl, we have conlparod lhe total nuinber o[' doriwliions obtained |'rent X'I'A(I with lhai oblainod front the ANUF parser. It would be interesting lo see if the two systems perfornied similarly on a wider range of dala. In ICarroll, 1993 ], only tile IA)OCE NPs are annotated with tile nunlber of deriwltions; we are interested in getting nlore data annolated with Ihis inforimition, in order to lllake further conlparisons.
COMPUTER PI,ATFORM
XTAG was developed Oll the Still SI-'ARC station soties, and has been tested on the Still 4 and lip BOIL CATs series 9000. It is awlihlble through allonymotlS flp, and requires 20MB of space. Please send nlail to xtag-requesl(,~linc.cis.upenn.edu for I'tp instructions or inore hllormaliOll. XTAG Fequh'es lhe following sollware to rtll/: u k niachiile runnhlg UNIX and X t IR4. Prt'vious releases o[ X will ilol work. X1 tR4 is free software available [rolli MIT.
Ii A COllllllOll l,isp conipiler which supports tile latest deliniiit)n of Ct)llllllOn I,isp (Steele's (701nmen Lisp, second edition). XTAG has been lesled wiih Lucid Commoli l,is I) 4.0 and Allegro 4.0.1.
ii (]l,X versioll 4 or hi.gher. C],X is the lisp etluiv. alent to tile Xlib package wrilten in C.
• Mark Kalllrowilz's l,isp [Jlilities fronl CMIJ: logical-pathnalnes and dolsystenl.
The latest version o1' CLX (RS.0) and tile CMU l,isp Utilities are provided in our flp directory for your convenience, ltowevcr, we ask that you refer to the approl~riate source for updates.
The nlorpllology database colnponentl Kar l) el al.,
Figure 3 :
3Natnple trees frolll the Tree 1)atabase 2.3.4
User controlled parser parameters, including the parsing of categories (S, embedded S, NP, l)etP), and the use of the tagger (on/o flTrctry on failure), Storage/,etriewfl facilities for elementary and t)arsed hces as text liles.
Figure 4 :
4XTAG Interface
*currently at BBN, Cambridge, MA, USAInput Sentence
~'ph Analy~
l_ 'l'~ger ,,__
_
_
~[
p.0.S Blender ~<
1
¸ . . . . . . .
i
i
__
/i ~-1%~
TteeSdection ,,~NynOB~
. . . . . . . . . .
. . . . . . . . . .
Derivation Structure
Figure I : Overview of XTAG system
words. The sentence, now annotated with part-of-
speech tags and morphological information for each
word, is input to the Parser, which consults the syn-
tactic database and tree database to retrieve the appro-
priate tree structures for each lexical item. A variety
o[' heuristics arc used to reduce the number of trees
selected. The parsertitan composes the structures to
obtain the parse(s) of the sentence.
2.1 Morphological Analyzer
The morphology database [Karp et al., 19921 was
originally exlracted from 1979 edition of the Collins
English Dictionary and Oxford Adwmced Learner's
l)ictionary of Current English, and then cleaned up
and auglnentcd by hand. It consists of approximately
317,000 inltected items, along with their root forms
and intlectional intbrmalion (such as case, num-
bet, tense). Thirteen parts of speech are difleren-
tiated: Noun, Proper Noun, Pronoun, Verb, Verb
Particle, Adverb, Adjective, Preposition, Comple-
mentizer, Determiner, Conjunction, lntmjection, and
Noun/Verb Contraction. Notms and Verhs are the
largest categories, with approximately 213,000 and
46,500 inflected forms, respectively. '['he access time
for a given inflected entry is 0.6 msec.
Exits Bttffers Oranmuar Parsers Parsingderived-tree-889 Bill w'oJttod to go to Washh~oaderived-tree-140368
derived-tree-140369
derived-tree-140370
I eoul~t't understmul him
derived-tree-140449
Go to your room
derived-tree-140420
derlved-tree-140621
derived-tree-140622
derived-tree-140763
derived-tree-140764
derived-tree-140768
derived-tt~-140766
parsers in the same class as XqAG. Although XTAG
is being extended to handle sentence fragments, they
are not included at present, and are thereby not re-
flected in the data in Table 2. Statistical information
ti'om the parsed corpora described in Section 2.3.4 is
presently used only for' speeding the parser but not to
tune the grammar to parse any specilic corpus. Note
then, thai the data below does not involve any corpus
training.
Corpus
WSJ
IBM Manual
ATIS
nts~
Av. # of
% Parsed parses/sent
39.09%
7.53
75.42%
6.14
74.42%
6.0
Table 2 :
2Performance of XTAG on various corpora
Table 3 :
3Performailco O[ XTAG on II}Mqnalnlal sen~fences
Table 4
4sulnlnarizos the results of lhis cxperhlleilt. A iolal of 143 lloun i)luasos were parsed. The NPs whicll did nol have a correct parse in the top lhroo derivations for tile ANLT parser were considered as faihlres for AN[]'. Tile maxinitlnl and average iluniher of derivations cohnnns show Ihe highesl and lhe average lillnlbc;r o[ derivations produced for tile NPs that tiave a correct derivation hi the top tinco deriwitlons, l:or tile XTAG systeiii, porloriilallce rcsulls with alid without ihe P()S lagger are siR)wit. 5 5BcCatlSt? tilt? NPs {11o, eli {ivol'~l~O, silorit',f Ihall ihc.' St?lltcnt?os on which il was lrahi~;d, the perforlnanco of Iho POS la~ggt?r is syswni 7iparsed % parsed ANi:ri'armr-; 71 127-M Si~.Sl% X'IAG with I <,7 1 65.(/3%XTAG wilhout /
127l [-86.7i%
_!~osj~i~ ,
L _
2
v ,x T xu I
32 1 4. 7 d
28 [ 3.45 /
Table 4 :
4Conlparison of XTAG and ANIfI" Parser
I, no longer under Iicenshlg restrictions, is available as a separate syslolll frolil the XTA(i system. Igp hislrtiotioils alld iilore iiifornlatiOll can bc obtahled by inailing requosls 1o lcx-request(a)lhlc.cis.upenn.odu. signilit?antly degraded. [:or this i'oflSOll, the table contains illJi)rlliatioil abotlt lilt? pc:rlorlliant?t? of XTA(I both with and wilhout Ihe tagger.
. Carroll, Carroll, 199311
. J Carroll, Carroll, J. (1993).
A Stochastic Parts Program and Noun Phrase Parser for Unrestricted Text. K Church, 2nd Applied Natural lxmguage Processing ConJerence. Cambridge, EnglandPractical Unification-based Parsing of Natural Language. University of Cambridge, Computer LaboratoryPractical Unification-based Parsing of Natural Lan- guage. University of Cambridge, Computer Laboratory, Cambridge, England. [Church, 1988] Church., K. (1988). A Stochastic Parts Program and Noun Phrase Parser for Unre- stricted Text. In 2nd Applied Natural lxmguage Processing ConJerence.
Two principles of parse preference. Bear ; Ihobbs, J Hobbs, J Bear, Current Issues in Natural Language Processing: In Honour of Don Walker. Giardini with Kluwer. IHobbs and Bear, 199411 Hobbs, J. and Bear, J. (1994). Two principles of parse preference. In Current Issues in Natural Language Process- ing: In Honour of Don Walker. Giardini with Kluwer.
Decision tree parsing using a hidden derivation model. Ijelinek, ARPA Workshop on Human Language Technology. IJelinek et al., 199411 Jelinek, E, Lafferty, J., Mager- man, D., Mercel, R., Ratnaparkhi, A., and Roukos, S. (1994). Decision tree parsing using a hidden derivation model. ARPA Workshop on Human Language Technology, pages 260-265.
T1ee adjunct grammars. [ Joshi, Journal of Computer and System Sciences. [Joshi et al., 197511 Joshi, A.J., Levy, L., and Taka- hashi, M. (1975). T1ee adjunct grammars. In Journal of Computer and System Sciences.
Disambiguation of Super Parts of Speech (or Suptertags): Almost Parsing. [ Joshi, Srinivas ; Joshi , A J Srinivas, B ; I) Schabes, Y Zaidel, M , Egedi , Proceedings of the 15 ~/~ International Conference on Computational Linguistics (COLING '92). the 15 ~/~ International Conference on Computational Linguistics (COLING '92)Kyoto, Japan; Nantes, France1Proceedings of the 15 t/~ hzternational Conference on Computational Linguistics (COLING '92[Joshi and Srinivas, 1994] Joshi, A.J. and Srinivas, B. (1994). Disambiguation of Super Parts of Speech (or Suptertags): Almost Parsing. In Proceedings of the 15 ~/~ International Confer- ence on Computational Linguistics (COLING '92), Kyoto, Japan, August. [Karp et al., 1992] Kaq), I)., Schabes, Y., Zaidel, M., and Egedi, 1). (I 992). A Freely Available Wide Coverage Morphological Analyzer for English. In Proceedings of the 15 t/~ hzternational Confer- ence on Computational Linguistics (COLING '92) Nantes, France, August.
Building a large annotated corpus of English: The Penn Treebank. [ Marcus, Computational Linguistics. 19I 993[Marcus et al., 1993] Marcus, M., Santorini, B., and Malvinkiewicz, M.A. (I 993). Building a large annotated corpus of English: The Penn Tree- bank. Computational Linguistics, 19.2:313-- 330, June.
Heuristics for broad-coverage natural language processing. M Mccord ; Mccord, DARPA Human Language Teehnology Workshop. McCord, 1993] McCord, M. (1993). Heuristics for broad-coverage natural language process- ing. In DARPA Human Language Teehnology Workshop, March.
A Fast Tree-Trellis Search for Finding the N-Best Sentence Hypothesis in Continuous Speech Recognition. M Nagao, Y Schabes, A Abeill6, A K Joshi, Y Schabes, E K Soong, E Huang, Current Issues in Natural Language Processing: In Honour of Don Walker. Giardini with Kluwer. Budapest, Ilungary; Philadelphia, PA, AugustSoong and HuangUniversity of PennsylvaniaJournal o/ Acoustic Society, AM.INagao, 1994] Nagao, M. (1994). Varieties of heuristics in sentence processing. In Current Is- sues in Natural Language Processing: In Hon- our of Don Walker. Giardini with Kluwer. [Schabes, 198811 Schabes, Y., Abeill6, A., and Joshi, A.K. (1988). Parsing strategies with 'lex- icalized' grammars: Application to tree adjoin- ing grammars. In Proceedings of the 12 zh bzter- national Conference on Comt)utational Linguis- tics (COLING'88), Budapest, Ilungary, August. [Schabes, 1990] Schabes, Y. (1990). Mathemati- cal and Computational Aspects c~f Lexicalized Grammars. Ph.1). thesis, University of Penn- sylvania, Philadelphia, PA, August. Awlil- able as technical report (MS-CIS-90-48, LINC LAB179) fi'om the Department of Computer Science. [Soong and Huang, 199011 Soong, EK. and Huang, E. (1990). A Fast Tree-Trellis Search for Finding the N-Best Sentence Hypothesis in Continuous Speech Recognition. In Journal o/ Acoustic Society, AM., May.
| Chapter 1 Polynomial Tree Substitution Grammars: Characterization and New Examples | We propose the model of nested words for representation of data with both a linear ordering and a hierarchically nested matching of items. Examples of data with such dual linear-hierarchical structure include executions of structured programs, annotated linguistic data, and HTML/XML documents. Nested words generalize both words and ordered trees, and allow both word and tree operations. We define nested word automata—finite-state acceptors for nested words, and show that the resulting class of regular languages of nested words has all the appealing theoretical properties that the classical regular word languages enjoys: deterministic nested word automata are as expressive as their nondeterministic counterparts; the class is closed under union, intersection, complementation, concatenation, Kleene-*, prefixes, and language homomorphisms; membership, emptiness, language inclusion, and language equivalence are all decidable; and definability in monadic second order logic corresponds exactly to finite-state recognizability. We also consider regular languages of infinite nested words and show that the closure properties, MSO-characterization, and decidability of decision problems carry over. The linear encodings of nested words give the class of visibly pushdown languages of words, and this class lies between balanced languages and deterministic context-free languages. We argue that for algorithmic verification of structured programs, instead of viewing the program as a context-free language over words, one should view it as a regular language of nested words (or equivalently, a visibly pushdown language), and this would allow model checking of many properties (such as stack inspection, pre-post conditions) that are not expressible in existing specification logics. We also study the relationship between ordered trees and nested words, and the corresponding automata: while the analysis complexity of nested word automata is the same as that of classical tree automata, they combine both bottom-up and top-down traversals, and enjoy expressiveness and succinctness benefits over tree automata. | 1,999,947 |
Introduction
Bidirectional parsing strategies for Tree Adjoining Grammars (TAG) show a good performance, particularly when applied to linguistically motivated grammars 5]. These strategies are usually implemented as tabular parsers 8,14,6], sharing as common characteristics the use of items to represent traces of derivations and the use of inference rules to derive new items from existing ones. Regrettably, for most parsers it is di cult to separate the tabulation strategy from the parsing strategy.
A promising way of simplifying the task of designing correct and e cient parsing algorithms is to apply well-known techniques from the realm of context-free parsing, which allow tabulation to be seen separately from the parsing strategy: the actual parsing strategy can be described by means of the construction of a non-deterministic pushdown automaton, and tabulation is introduced by means of some generic mechanism such as memoization. The construction of parsers in this way allows more straightforward proofs of correctness and makes parsing strategies easier to understand and to implement.
This approach has been successfully applied to the design of parsing algorithms for TAG that read the input string left-to-right 1, 3, 10,11]. In this paper, we de ne new models of automata which can start reading the input string in any position, spanning to the left and to the right to include substrings which were themselves read in the same bidirectional way. Tabulation techniques are provided in order to execute e ciently these automata. This paper is outlined as follows. The rest of the introduction is a presentation of tree adjoining grammars. Section 2 introduces bidirectional push-down automata, showing how they can be used to de ne bidirectional parsers for context-free grammars. Section 3 extends the model of automata developed in the previous section to de ne a new model of automata suitable for de ning bidirectional parsing strategies for TAG. Section 4 presents nal conclusions. New trees are derived by adjoining: let be a tree containing a node N labeled by A and let be an auxiliary tree whose root and foot nodes are also labeled by A. Then, the adjoining of at the adjunction node N is obtained by excising the subtree of with root N , attaching to N and attaching the excised subtree to the foot of .
The operation of substitution does not increase the generative power of the formalism but it is usually considered when we are dealing with lexicalized tree adjoining grammars. In this case, nonterminals can also label leaf nodes (called substitution nodes) of elementary trees. An initial tree can be substituted at a substitution node if its root is labeled by the same non-terminal that labels the substitution node.
Bidirectional Push-Down Automata
Push-Down Automata (PDA) are the operational devices for parsing context-free grammars. Following 4], we de ne a PDA as a tuple (V T ; V S ; ; $ 0 ; $ f ) where V T is a nite set of terminal symbols, V S is a nite set of stack symbols, $ 0 2 V S is the initial stack symbol, $ f 2 V S is the nal stack symbol and is a nite set of SWAP, PUSH and POP transitions. A con guration of a PDA is usually de ned as a pair ( ; a l : : : a n ), where 2 V S is the stack attained and a l : : : a n the part of the input string a 1 : : : a n to be read. We consider an alternative and equivalent de nition in which the position l is stored in the top element of . Thus, a con guration is given by the contents of^ , a stack of pairs in V S N. 1 The initial con guration is ($ 0 ; 0). Other con gurations are attained by applying transitions as follows:
The application of a SWAP transition of the form C a 7 ! F to a con guration^ (C; l) yields a con guration^ (F; l + jaj) as a result of replacing C by F and scanning the terminal a = a l+1 or the empty string a = .
The application of a PUSH transition of the form C 7 ! C F to a con guration^ (C; l) yields a con guration^ (C; l)(F; l) as a result of pushing F onto C.
The application of a POP transition of the form CF 7 ! G to a con guration^ (C; l)(F; m) yields a con guration^ (G; m) as a result of popping C and F, which are replaced by G. where C; F; G 2 V S and a 2 V T f g. An input string a 1 : : : a n is successfully recognized by a PDA if the nal con guration ($ 0 ; 0)($ f ; n) is attained. Only SWAP transitions can scan elements from the input string. This is not a limitation, as a scanning push transition C a 7 ! C F could be emulated by the consecutive application of two transitions C 7 ! C F 0 and F 0 a 7 ! F, while a scanning pop transition C F a 7 ! G could be emulated by C F 7 ! G 0 and G 0 a 7 ! G, where F 0 and G 0 are fresh stack symbols. We call transitions SWAP, PUSH and POP r-transitions as they can only read the input string from the left to the right. Thus, push-down automata can only be used to implement unidirectional parsing strategies that read the input string in the same way.
Bidirectional parsing strategies can start computations at any position of the input string and can span to the right and to the left to include substrings which were scanned in a bidirectional way by some subcomputations. As a rst step towards the de nition of a Bidirectional Push-Down Automata (BPDA), we must adapt con gurations in order to be able to represent the discontinuous recognition of the input string. Thus, con gurations of a BPDA will be given by the contents of , a stack of triples in V S N N. The initial con guration is ($ 0 ; 0; 0). Other con gurations are attained by applying transitions as follows:
The application of a SWAP R transition of the form C a 7 ! R F to a con guration (C; k; l) yields a con guration (F; k; l + jaj) as a result of replacing C by F and scanning the terminal a = a l+1 or the empty string a = to the right of the substring spanned by C.
The application of a SWAP L transition of the form C a 7 ! L F to a con guration (C; k; l) yields a con guration (F; k jaj; l) as a result of replacing C by F and scanning the terminal a = a k or the empty string a = to the left of the substring spanned by C.
The application of a PUSH R transition of the form C 7 ! R C F to a con guration (C; k; j) yields a con guration (C; k; l)(F; l; l). It is expected that F will span a substring inmediatly to the right of the substring spanned by C.
The application of a PUSH L transition of the form C 7 ! L C F to a con guration (C; k; j) yields a con guration (C; k; l)(F; k; k). It is expected that F will span a substring inmediatly to the left of the substring spanned by C.
The application of a PUSH U transition of the form C a 7 ! U C F to a con guration (C; k; j) yields a con guration (C; k; l)(F; m; m + jaj) as a result of pushing F onto C and scanning the terminal a = a m+1 or the empty string a = . PUSH U transitions are undirected in the sense that the substring spanned by F is not necessarily adjacent to the substring spanned by C.
The application of a POP R transition of the form CF 7 ! R G to a con guration (C; k; l)(F; l; m) yields a con guration (G; k; m). The substring spanned by F is adjacent to the right of the substring spanned by C.
The application of a POP L transition of the form CF 7 ! L G to a con guration (C; k; l)(F; m; k) yields a con guration (G; m; l). The substring spanned by F is adjacent to the left of the substring spanned by C. Table 1: Compilation schema for a bottom-up bidirectional strategy An input string a 1 : : : a n is successfully recognized by a PDA if the nal con guration ($ 0 ; 0; 0)($ f ; 0; n) is attained. SWAP R , PUSH R and POP R transitions are the r-transitions corresponding to unidirectional PDA. SWAP L , PUSH L and POP L transitions are l-transitions that advance \to the left" in the reading of the input string. However, the union of r-transitions and l-transitions is not su cient to implement bidirectional parsers, we need PUSH U transitions of the form C a 7 ! U C F to start subcomputations at any position of the input string. In any computation recognizing the input string, we guarantee that each terminal in the input string is read only once by means of the de nition of SWAP R and SWAP L transitions (they can not re-read elements which are in the span of the top element of the stack) and the de nition of POP R and POP L transitions (they can not pop stack elements spanning overlapping substrings). Thus, BPDA accept exactly the class of context-free languages.
INIT]
$ 0 7 ! R $ 0 (S ! ) SCAN a ] (A ! 1 2 3 ) a 7 ! U (A ! 1 2 3 ) (B ! a !) SCAN ] (A ! 1 2 3 ) 7 ! U (A ! 1 2 3 ) (B ! ) CONC-R] (A ! 1 2 !) (A ! 1 2 !) 7 ! R (A ! 1 2 !) CONC-L] (A ! 1 2 !) (A ! 1 2 !) 7 ! L (A ! 1 2 !) INC] (B ! ) 7 ! R (A ! B !)
We de ne a Bidirectional Push-Down Automata (BPDA) as a tuple (V T ; V S ; BPDA ; $ 0 ; $ f ) with BPDA containing SWAP R , SWAP L , PUSH R , PUSH L , POP R , POP L and PUSH U transitions. As an example of the kind of parsers that can be implemented using BPDA, a compilation schema 2 of a context-free grammar into a bidirectional push-down automaton implementing a bottom-up bidirectional parsing strategy is derived. In the resulting automaton, V T is equal to the set of terminals of the source grammar, V S is the union of f$ 0 ; $ f g and a set of dotted productions, 3 the initial element $ 0 is used to start computations, the nal element $ f is (S ! ) and BPDA contains the set of transitions derived by the compilation rules shown in table 1. SCAN a ] and SCAN ] transitions are in charge of recognizing terminals and epsilon productions, respectively. CONC-R] and CONC-L] transitions concatenate a new part of a production to the right and to the left of the part already recognized, respectively. Once a production having B on its left-hand side has been completely recognized, a INC] transition continues with the recognition of a production having B on its right-hand side
The direct execution of a BPDA may be exponential with respect to the length of the input string and may even loop. To get polynomial complexity, we must avoid duplicating computations by tabulating traces of con gurations called items. To determine the right amount of information to keep in an item is the crucial point to get e cient executions. From 4] we know that extensions of push-down automata can be tabulated using S 2 items that store the two elements on the top of the con guration stack. Therefore, we can use S 2 items B; i; j; C; k; l], indicating the part of the input string a k+1 : : : a l recognized by the top element C and the part a i+1 : : : a j recognized by the element B placed immediately under C, to design a tabular framework for BPDA. 4 New items are derived from existing items by means of inference rules of the form antecedents consequent conditions similar to those used in grammatical deduction systems 12], meaning that if all antecedents are present and conditions are satis ed then the consequent item should be generated. Conditions usually refer to transitions of the automaton and to terminals from the input string.
The set of inference rules for S 2 items is the following: B; i; j; C; k; l] B; i; j; F; k; l + jaj]
Bidirectional Linear Indexed Automata
Linear Indexed Automata (LIA) 1,11] are an extension of push-down automata in which each stack symbol has been associated with a list of indices. Right-oriented Linear Indexed Automata (R-LIA) 10] are a subclass of linear indexed automata that can be used to implement parsing strategies for TAG in which adjunctions are recognized in a bottom-up way. As bidirectional parsing strategies for TAG described in literature recognize adjunctions bottom-up 8, 14, 6], we take R-LIA as the starting point for the development of a bidirectional automata for TAG.
We de ne Bidirectional Right-oriented Linear Indexed Automata (BR{LIA) as an extension of BPDA in which each stack symbol has been associated with a list of indices. Formally, a BR-LIA is a tuple (V T ; V S ; V I ; BR LIA ; $ 0 ; $ f ) where V T is a nite set of terminal symbols, V S is a nite set of stack symbols, V I is a nite set of indices, BR LIA is a nite set of transitions, $ 0 2 V S is the initial stack symbol, and $ f 2 V S is the nal stack symbol. A con guration of a BR{LIA is given by the contents of , a stack of triples in V S V I ] N N. The initial con guration is ($ 0 ]; 0; 0). Other con gurations are attained by applying the following set of transitions in BR LIA as follows:
The application of a SWAP R ] transition of the form C p] a 7 ! R F q] to a con guration (C p]; k; l) yields a con guration (F q]; k; l + jaj) as a result of replacing C p] by F q] and scanning the terminal a = a l+1 or the empty string a = to the right of the substring spanned by C.
The application of a SWAP L ] transition of the form C p] a 7 ! L F q] to a con guration (C p]; k; l) yields a con guration (F q]; k jaj; l) as a result of replacing C p] by F q] and scanning the terminal a = a l+1 or the empty string a = to the left of the substring spanned by C.
The application of a PUSH R ] transition of the form C ] 7 ! R C ] F ] to a con guration (C ]; k; l) yields a con guration (C ]; k; l) (F ]; l; l) as a result of pushing F ] onto C ]. It is expected that F ] will span a substring inmediatly to the right of the substring spanned by C ].
The application of a PUSH L ] transition of the form C ] 7 ! L C ] F ] to a con guration (C ]; k; l) yields a con guration (C ]; k; l) (F ]; k; k). It is expected that F ] will span a substring inmediatly to the left of the substring spanned by C ].
The application of a PUSH U ] transition of the form C ] a 7 ! U C ] F ] to a con guration (C ]; k; l) yields a con guration (C ]; k; l) (F ]; m; m+jaj) as a result of pushing F ] onto C ] and scanning the terminal a = a m+1 or the empty string a = . PUSH U transitions are undirected in the sense that the substring spanned by F ] is not necessarily adjacent to the string spanned by C ].
The application of a POP R ] transition of the form C ] F ] 7 ! R G ] to a con guration (C ]; k; l) (F ]; l; m) yields a con guration (G ]; k; m) as a result of popping C ] and F ], which are replaced by G ]. The substring spanned by F ] is adjacent to the right of the substring spanned by C ].
The application of a POP L ] transition of the form C ] F ] 7 ! L G ] to a con guration (C ]; k; l) (F ]; m; k) yields a con guration (G ]; m; l). The substring spanned by F ] is adjacent to the left of the substring spanned by C ].
The application of a POP R ] transition of the form C ] F ] 7 ! R G ] to a con guration (C ]; k; l) (F ]; l; m) yields a con guration (G ]; k; m) as a result of popping C ] and F ], which are replaced by G. The substring spanned by F ] is adjacent to the right of the substring spanned by C ].
The application of a POP L ] transition of the form C ] F ] 7 ! L G ] to a con guration (C ]; k; l) (F ]; m; k) yields a con guration (G ]; m; l). The substring spanned by F ] is adjacent to the left of the substring spanned by C ]. where C; F; G 2 V S , a 2 V T f g, 2 V I and represent any list of indices. In the case of SWAP R ] and SWAP L ] transitions, p; q 2 V I f g and either p or q, or both, must be the empty string. An input string a 1 : : : a n is successfully recognized by a BR{LIA if the nal con guration ($ 0 ]; 0; 0)($ f ]; 0; n) is attained.
As an example of the kind of parsers that can be implemented using BR-LIA, a compilation schema of a tree adjoining grammar into a bidirectional right-oriented linear indexed automata implementing a bottom-up bidirectional parsing strategy is derived. We consider each elementary tree of a TAG as formed by a set of context-free productions P( ): a node N and its g children N 1 : : : N g are represented by a production N ! N 1 : : : N g . The elements of the productions are the nodes of the tree, except for the case of elements belonging to V T f"g in the right-hand side of a production. such nodes labeled by a terminal with that terminal. We use 2 adj(N ) to denote that a tree 2 A may be adjoined at node N . If adjunction is not mandatory at N , then nil 2 adj(N ). If a tree 2 I may be substituted at node N , then 2 subs(N ). We consider the additional productions > ! R , > ! R and F ! ? for each initial tree and each auxiliary tree , where R is the root node of and R and F are the root node and foot node of , respectively.
In the resulting automata, V T is equal to the set of terminals of the source grammar, V S is the union of f$ 0 ; $ f g and a set of dotted productions, V I is the set of adjunction nodes, the initial element As in the case of BPDA, the direct execution of a BR-LIA may be exponential and even loop. To get polynomial complexity, we can extend the tabular interpretations based on S 2 and S 1 items developed for BPDA. Towards this aim, we need to extend items to store information about the indices lists. Instead of storing a list in each item, we obtain a better sharing by storing only the top element and a logical pointer to other items 10]. Following the chains of pointers it is possible to retrieve the entire lists of indices. Therefore, S 2 items are of the form B; i; j; C; k; l j p j D; r; s; E; t; u], where p is the top element of the list of indices associated with C, and (D; r; s; E; t; u) is the logical pointer. In the case that C is associated with an empty list of indices, we let p be the dummy index , D = E the dummy stack symbol and r = s = t = u the dummy input position .
To the best of our knowledge, all bidirectional parsing algorithms for TAG presented in the literature perform a bottom-up traversal of trees 14,6,9], which can be combined with an Earley-like traversal of some parts of a tree 8]. Therefore, a tabular interpretation based on S 1 items of the form C; k; l j p j E; t; u] is sound and complete for these strategies. The set of inference rules is the following one: C; k; l j p j E; t; u] F; k; l + jaj j p j E; t; u] C ] a 7 ! R F ] a = a l+1 or a = C; k; l j p j E; t; u] F; k jaj; l j p j E; t; u] C ] a 7 ! L F ] a = a k or a = C; k; l j p j E; t; u] F; k; l + jaj j q j C; k; l] C ] a 7 ! R F q] a = a l+1 or a = C; k; l j p j E; t; u] F; k jaj; l j q j C; k; l] C ] a 7 ! L F q] a = a k or a = C; k; l j p j E; t; u] E; t; u j q j E 0 ; t 0 ; u 0 ] F; k; l + jaj j q j E 0 ; t 0 ; u 0 ] C p] a 7 ! R F ] a = a l+1 or a = C; k; l j p j E; t; u] E; t; u j q j E 0 ; t 0 ; u 0 ] F; k jaj; l j q j E 0 ; t 0 ; u 0 ] C p] a 7 ! L F ] a = a k or a = C; k; l j p j E; t; u] F; l; l j j ; ; ] C ] 7 ! R C ] F ] C; k; l j p j E; t; u] F; k; k j j ; ; ] C ] 7 ! L C ] F ] C; k; l j p j E; t; u] F; m; m + jaj j j ; ; ] C ] a 7 ! U C ] F ] a = a m+1 or a = F; l; m j j ; ; ] C; k; l j p j E; t; u] G; k; m j p j E; t; u] C ] F ] 7 ! R G ] F; m; k j j ; ; ] C; k; l j p j E; t; u] G; m; l j p j E; t; u] C ] F ] 7 ! L G ] F; l; m j p j E; t; u] C; k; l j j ; ; ] G; k; m j p j E; t; u] C ] F ] 7 ! R G ] F; m; k j p j E; t; u] C; k; l j j ; ; ] G; m; l j p j E; t; u] C ] F ] 7 ! L G ] The worst-case time complexity with respect to the length n of the input string is the standard O(n 6 ) complexity for TAG parsing. 7 This set of inference rules, when applied to the set of transitions described by the previous compilation schema, gives as a result the parsing schema dVH for TAG ADJ] > ! R ; k; l j M j M ! ; t; u] M ! ; t; u j q j E 0 ; t 0 ; u 0 ] N ! M !; k; l j q j E 0 ; t 0 ; u 0 ] SUBS] > ! R ; k; l j p j E; t; u] N ! M !; k; l j p j E; t; u] Antecedent N ! 1 2 3 ; k; l j p j E; t; u] in SCAN a ] and SCAN ] can be ltered out as it does not restrict the application of these steps. Steps CONC-R] and SCONC-L] can be collapsed into a single step, and CONC-L] and SCONC-R] can also be collapsed into a single step, as the predictive head-corner parsing algorithm for TAG, such as an extension of the predictive head-corner algorithm proposed in 13, chapter 11] for context-free grammars. order of antecedents is not important in a parsing schema. In the step SUBS] it can be shown that p = , E = and t = u = since is an initial tree.
It is interesting to remark that some components of items are redundant. This fact is clear when we observe the ADJ] step. The element M ! of the item > ! R ; k; l j M j M ! ; t; u] is redundant, because it is the production associated to M , already present in the item. The element M is itself redundant, as the item is valid for all node M of an elementary tree such that can be adjoined at M . With this re nement of items, we obtain exactly the schema dVH for TAG proposed in 6].
Conclusions
In order to provide a common framework for the description of bidirectional parsing algorithms for TAG, we have de ned a new class of bidirectional automata which works in polynomial time and we have shown how tabular parsing algorithms can be derived from the automaton describing the parsing strategy and the tabulation technique associated to the automata model. As illustration, we have considered the case of the bottom-up bidirectional strategy for TAG proposed in 6] but the approach can be applied to the other bidirectional strategies de ned in the literature. A study of the performance of this strategy and a comparison with other uni-and bidirectional strategies for TAG can be found in 5]. The use of bidirectional automata to de ne parsers allowed us to concentrate on the parsing strategy itself, abstracting for details of implementation such as the input positions spanned by the elements in a production.
case complexity with respect to the length n of the input string is O(n 5 ). 5 This complexity can be reduced by considering more compact kinds of items. From 4] we know that if the results of the non-deterministic computation are constrained only by bottom-up propagation of computed facts (e.g. bottom-up and Earley strategies, but not pure top-down strategies) S 1 items storing only the top element of the con guration stack can be used to derive a sound and complete tabular interpretation.In the case of BPDA, S 1 items are of the form C; k; l]. The set of inference rules for S 1 items is derived from the previous set, obtaining the following one:
Those elements may not have children and are not candidates to be adjunction nodes, so we
$ 0 starts computations, the nal element $ f is (> ! R ) such that 2 I and S = label(R ), and BR LIA contains the set of transitions derived by the compilation rules shown in table 2. The function of the transitions produced by the compilation rules is as follows. A INIT] transition is used to start the computation; SCAN a ] and SCAN ] transitions start the recognition of terminals and epsilon productions, respectively; CONC-R] and CONC-L] transitions concatenate a new part of a production to the right and to the left of the part already recognized, respectively, such that the new part does not include nodes in the spine; SCONC-R] and SCONC-L] transitions deal with nodes in the spine; INC] transitions continue the bottom-up traversal of an elementary tree once a subtree has been completely recognized; FOOT] transitions start the bottom-up traversal of an elementary tree at the foot node; ADJ] transitions nish an adjunction when the bottom-up traversal of an elementary tree has been completed; SUBS] transitions deal with completed substitutions.
table 1, is equivalent to the set of deduction steps of the parsing schema 6 dVH1 de ned in 13], corresponding to a bidirectional parsing strategy:SCAN a ] and SCAN ] steps can be ltered out as it does not restrict their application, and that steps CONC-L] and CONC-R] can be collapsed into a single one, as order of antecedents is not relevant in a parsing schema.SCAN a ]
A ! 1 2 3 ; k; l]
a; m; m + 1]
B ! a !; m; m + 1]
SCAN ] A ! 1 2 3 ; k; l]
B ! ; m; m]
CONC-R]
A ! 1 2 !; l; m]
A ! 1 2 !; k; l]
A ! 1 2 !; k; m]
CONC-L]
A ! 1 2 !; m; k]
A ! 1 2 !; k; l]
A ! 1 2 !; m; l]
INC] B ! ; k; l]
A ! B !; k; l]
considering that in the parsing schemata framework 13], the antecedent A ! 1 2 3 ; k; l] in
Table 2 :
2Compilation schema for TAG
de ned in 6], corresponding to a bottom-up bidirectional parsing strategy: SCAN a ] N ! 1 2 3 ; k; l j p j E; t; u] a; m; m + 1] M 0 ! a !; m; m + 1 j j ; ; ] SCAN ] N ! 1 2 3 ; k; l j p j E; t; u] M 0 ! ; m; m j j ; ; ] CONC-R] N ! 1 2 !; l; m j j ; ; ] N ! 1 2 !; k; l j p j E; t; u] N ! 1 2 !; k; m j p j E; t; u] CONC-L] N ! 1 2 !; m; k j j ; ; ] N ! 1 2 !; k; l j p j E; t; u] N ! 1 2 !; m; l j p j E; t; u] SCONC-R] N ! 1 2 !; l; m j p j E; t; u] N ! 1 2 !; k; l j j ; ; ] N ! 1 2 !; k; m j p j E; t; u] SCONC-L] N ! 1 2 !; m; k j p j E; t; u] N ! 1 2 !; k; l j j ; ; ] N ! 1 2 !; m; l j p j E; t; u] INC] M ! ; k; l j p j E; t; u] N ! M !; k; l j p j E; t; u] FOOT] M ! ; k; l j p j E; t; u] F ! ? ; k; l j M j M ! ; k; l]
This pairs are called modes in 2].
A compilation schema is a set of rules indicating how to construct an automaton according to a given grammar and parsing strategy.3 Dotted productions A ! 1 2 3 are used to indicate that the part 2 has been recognized.
For unidirectional push-down automata working with r-transitions, only positions j and l need to be considered. For unidirectional PDA working with l-transitions only positions i and k are relevant. For BPDA the four positions i, j, k and l are needed.5 This is the complexity of some tabular predictive bidirectional algorithms. See for example the predictive headcorner parsing algorithm for context-free grammars described in13, chapter 11].
In brief, a parsing schema is a deductive parsing system where inference rules are called deduction steps and conditions on the existence of a given terminal a m+1 are represented by means of special antecedent items of the form a; m; m + 1] called hypothesis.
Using S 2 items, the worst-case complexity increases to O(n 12 ), which should be the complexity of a hypothetical
AcknowledgmentsThis research has been partially supported by Plan Nacional de Investigaci on Cient ca, Desarrollo e Innovaci on Tecnol ogica (Grant TIC2000-0370-C02-01), FEDER of EU (Grant 1FD97-0047-C04-02) and Xunta de Galicia (Grants PGIDT99XI10502B and PGIDT01PXI10506PN).
Tabulation of Automata for Tree Adjoining Languages. Miguel A Alonso, Mark-Jan Nederhof, Eric De La Clergerie, Grammars. 32/3Miguel A. Alonso, Mark-Jan Nederhof, and Eric de la Clergerie. Tabulation of Automata for Tree Adjoining Languages. Grammars, 3(2/3):89{110, 2000.
The structure of shared forest in ambiguous parsing. Sylvie Billot, Bernard Lang, Proc. of the 27th Annual Meeting of the Association for Computational Linguistics. of the 27th Annual Meeting of the Association for Computational LinguisticsVancouver, British Columbia, CanadaACLSylvie Billot and Bernard Lang. The structure of shared forest in ambiguous parsing. In Proc. of the 27th Annual Meeting of the Association for Computational Linguistics, pages 143{151, Vancouver, British Columbia, Canada, June 1989. ACL.
A tabular interpretation of a class of 2-Stack Automata. Eric De, La Clergerie, Miguel A Alonso, COLING-ACL'98, 36th Annual Meeting of the Association for Computational Linguistics and 17th International Conference on Computational Linguistics, Proceedings of the Conference. Montreal, Quebec, CanadaACLIIEric de la Clergerie and Miguel A. Alonso. A tabular interpretation of a class of 2-Stack Automata. In COLING-ACL'98, 36th Annual Meeting of the Association for Computational Linguistics and 17th International Conference on Computational Linguistics, Proceedings of the Conference, volume II, pages 1333{1339, Montreal, Quebec, Canada, August 1998. ACL.
LPDA: Another look at tabulation in logic programming. Eric De, La Clergerie, Bernard Lang, Proc. of the 11th International Conference on Logic Programming (ICLP'94). Van Hentenryckof the 11th International Conference on Logic Programming (ICLP'94)MIT PressEric de la Clergerie and Bernard Lang. LPDA: Another look at tabulation in logic programming. In Van Hentenryck, editor, Proc. of the 11th International Conference on Logic Programming (ICLP'94), pages 470{486. MIT Press, June 1994.
Comparing tabular parsers for Tree Adjoining Grammars. J V Ctor, Miguel A Alonso, Proc. of Second International Workshop on Tabulation in Parsing and Deduction (TAPD 2000). David S. Warren, Manuel Vilares, Leandro Rodr guez Liñares, and Miguel A. Alonsoof Second International Workshop on Tabulation in Parsing and Deduction (TAPD 2000)Vigo, SpainV ctor J. D az and Miguel A. Alonso. Comparing tabular parsers for Tree Adjoining Grammars. In David S. Warren, Manuel Vilares, Leandro Rodr guez Liñares, and Miguel A. Alonso, editors, Proc. of Second International Workshop on Tabulation in Parsing and Deduction (TAPD 2000), pages 91{100, Vigo, Spain, September 2000.
Bidirectional parsing of TAG without heads. J V Ctor, Miguel A Alonso, Vicente Carrillo, Proc. of 5th International Workshop on Tree Adjoining Grammars and Related Formalisms (TAG+5). of 5th International Workshop on Tree Adjoining Grammars and Related Formalisms (TAG+5)Paris, FranceV ctor J. D az, Miguel A. Alonso, and Vicente Carrillo. Bidirectional parsing of TAG with- out heads. In Proc. of 5th International Workshop on Tree Adjoining Grammars and Related Formalisms (TAG+5), pages 67{72, Paris, France, May 2000.
Tree-Adjoining Grammars. K Aravind, Yves Joshi, Schabes, Grzegorz Rozenberg and Arto Salomaa. Berlin/Heidelberg/New YorkSpringer-Verlag3Aravind K. Joshi and Yves Schabes. Tree-Adjoining Grammars. In Grzegorz Rozenberg and Arto Salomaa, editors, Handbook of Formal Languages. Vol 3: Beyond Words, chapter 2, pages 69{123. Springer-Verlag, Berlin/Heidelberg/New York, 1997.
Bidirectional parsing of lexicalized tree adjoining grammars. Alberto Lavelli, Giorgio Satta, Proceedings of the 5th Conference of the European Chapter of the Association for Computational Linguistics (EACL'91). the 5th Conference of the European Chapter of the Association for Computational Linguistics (EACL'91)Berlin, GermanyACLAlberto Lavelli and Giorgio Satta. Bidirectional parsing of lexicalized tree adjoining grammars. In Proceedings of the 5th Conference of the European Chapter of the Association for Computational Linguistics (EACL'91), Berlin, Germany, April 1991. ACL.
Extended partial parsing for lexicalized tree grammars. Patrice Lopez, Proc. of the Sixth International Workshop on Parsing Technologies (IWPT 2000). of the Sixth International Workshop on Parsing Technologies (IWPT 2000)Trento, ItalyPatrice Lopez. Extended partial parsing for lexicalized tree grammars. In Proc. of the Sixth International Workshop on Parsing Technologies (IWPT 2000), pages 159{170, Trento, Italy, February 2000.
Linear indexed automata and tabulation of TAG parsing. Mark-Jan Nederhof, Proc. of First Workshop on Tabulation in Parsing and Deduction (TAPD'98). of First Workshop on Tabulation in Parsing and Deduction (TAPD'98)Paris, FranceMark-Jan Nederhof. Linear indexed automata and tabulation of TAG parsing. In Proc. of First Workshop on Tabulation in Parsing and Deduction (TAPD'98), pages 1{9, Paris, France, April 1998.
Models of tabulation for TAG parsing. Mark-Jan Nederhof, Proc. of the Sixth Meeting on Mathematics of Language (MOL 6). of the Sixth Meeting on Mathematics of Language (MOL 6)Orlando, Florida, USAMark-Jan Nederhof. Models of tabulation for TAG parsing. In Proc. of the Sixth Meeting on Mathematics of Language (MOL 6), pages 143{158, Orlando, Florida, USA, July 1999.
Principles and implementation of deductive parsing. M Stuart, Yves Shieber, Fernando C N Schabes, Pereira, Journal of Logic Programming. 241{2Stuart M. Shieber, Yves Schabes, and Fernando C. N. Pereira. Principles and implementation of deductive parsing. Journal of Logic Programming, 24(1{2):3{36, July-August 1995.
Parsing Schemata | A Framework for Speci cation and Analysis of Parsing Algorithms. Klaas Sikkel, Texts in Theoretical Computer Science | An EATCS Series. Springer-VerlagKlaas Sikkel. Parsing Schemata | A Framework for Speci cation and Analysis of Parsing Algorithms. Texts in Theoretical Computer Science | An EATCS Series. Springer-Verlag, Berlin/Heidelberg/New York, 1997.
Head-corner parsing for TAG. Gertjan Van Noord, Computational Intelligence. 104Gertjan van Noord. Head-corner parsing for TAG. Computational Intelligence, 10(4):525{534, 1994.
| In this article, we introduce eXtensible MetaGrammar (XMG), a framework for specifying tree-based grammars such as Feature-Based Lexicalized Tree-Adjoining Grammars (FB-LTAG) and Interaction Grammars (IG). We argue that XMG displays three features that facilitate both grammar writing and a fast prototyping of tree-based grammars. Firstly, XMG is fully declarative. For instance, it permits a declarative treatment of diathesis that markedly departs from the procedural lexical rules often used to specify tree-based grammars. Secondly, the XMG language has a high notational expressivity in that it supports multiple linguistic dimensions, inheritance, and a sophisticated treatment of identifiers. Thirdly, XMG is extensible in that its computational architecture facilitates the extension to other linguistic formalisms. We explain how this architecture naturally supports the design of three linguistic formalisms, namely,FB-LTAG, IG, and Multi-Component Tree-Adjoining Grammar (MC-TAG). We further show how it permits a straightforward integration of additional mechanisms such as linguistic and formal principles. To further illustrate the declarativity, notational expressivity, and extensibility of XMG, we describe the methodology used to specify an FB-LTAG for French augmented with aComputational Linguistics Volume 39, Number 3 unification-based compositional semantics. This illustrates both how XMG facilitates the modeling of the tree fragment hierarchies required to specify tree-based grammars and of a syntax/semantics interface between semantic representations and syntactic trees. Finally, we briefly report on several grammars for French, English, and German that were implemented using XMG and compare XMG with other existing grammar specification frameworks for tree-based grammars. | This paper presents the XTAG system, a grammar development tool based on the Tree Adjoining Grammar (TAG) formalism that includes a wide-coverage syntactic grammar for English. The various components of the system are discussed and preliminary evaluation results from the parsing of various corpora are given. Results from the comparison of X3AG against the IBM statistical parser and the Alvey Natural Language Tool parser are also given. | OBJECTIVEThe main objective is basic research and system development leading to (1) characterization of information carried by (a) syntax, semantics, and discourse structure, (h) their relation to information carried by intonation, and (c) development of methods for using this information for generation and understanding; (2) development of architectures for integration of utterance planning with lexical, syntactic and intonational choice; (3) development of incremental strategies for using syntactic, semantic, and pragmatic knowledge in understanding and generating language.RECENT ACCOMPLISHMENTS• Developed a new weakly supervised learning algorithm that can bracket text using a simple distributional error-correcting technique, which performs as well as recent applications of the I-O algorithm while using an order of magnitude less training data. A similar technique has been applied successfully to the problem of prepositional phrase attachment.• Developed techniques that combine WordNet and corpus-based lexical statistics acquired from the Penn Treebank. These techniques are being applied to the resolution of syntactic ambiguity.• The Penn Treebank project has released the results of its first three year phase as a CDROM through the Linguistic Data Consortium, consisting of 4.5 million words of part-of-speech tagged text and 3 million words of skeletally parsed text, including a parsed version of the Brown corpus.• A categorial grammar based theory of intonation structure and its discourse meaning has been developed and implemented in a database query system which takes as input an orthographic representation of spoken questions including intonational annotations, and yields as output a synthesized spoken response as a speech wave bearing an intonation contour that is appropriate to the context established by the question.Developed an environment, Design World, for simulating interactive task-oriented dialogue between two agents, that allows us to explore a number of key issues in inter-agent coordination.Investigated the way in which dialogue processing is cued by patterns of spoken language in taskoriented interactions between multiple agents. Results show that the redundancy that makes communication more robust is typically marked by prosodic destressing or broad focus.PLANS FOR THE COMING YEAR• Explore statistical morphology induction, lexical disambiguation, and language modeling with stochastic dependency grammars.• Extend the use of WordNet and lexical statistics to the resolution of a broader set of syntactic ambiguities, and to apply these techniques to the construction of stochastic language models.• Contribute to a model of limited processing for discourse, using corpora collected by the Linguistic Data Consortium as the basis for a corpus-based analysis of bottom-up cues to discourse structure, such as variation in the forms of referring expressions, and prosodic marking by topline and baseline variation.• Extend the part-of-speech disambiguation strategies to the disambiguation of lexical tree assignments to words in a lexicalized tree-adjoining grammar.• Develop a minimal-response part-of-speech tagger for conversational German without the use of online dictionaries and with minimal human resources.• Investigate the acquisition of lexical information about novel verbs by combining information about syntactic contexts with information about semantic relationships acquired using WordNet.• Develop the 'strategic' or discourse-planning component of the spoken reply system.419 | The REQUEST System is an experimental n a t u r a l language query system based on r. large transfo~ational grammar of English. In the original implementation of the system the process of computing the underlying sLructures of input queries involved a sequence of three steps: (1) preprocessing (including dictionary lookup), (2) surface phrase structure parsing, and (3) transformational parsing. This scheme has since been modified to permit transformational operations not only on the full trees available after completion of surface parsing, but also on the strings of lexical trees which are the output of the preprocessing phase. Transformational rules of this latter type which are invoded prior to surface parsing, are k n o~n as string transformations. | Issues related to parsing based on parallel communicating pushdown automata systems | SemTAG: a platform for specifying Tree Adjoining Grammars and performing TAG-based Semantic Construction | lntroductionThe Prague Dependency Treebank (PDT, as described, e.g., in (Hajic, 1998) or more recently in (Hajic, Pajas and Vidova Hladkä, 2001 )) is a project of linguistic annotation of approx. 1.5 million word corpus of natuially occurring written Czech on three levels ("layers") of complexity and depth: morphological, analytical, and tectogrammatical. The aim of the project is to have a reference corpus annotated by using the accumulated findings of the Prague School as much as possible, wbile simultaneously showing (by experiments, mainly of statistical nature) that such a framework is not only theoretically interesting but possibly also ofpractical use.In this contribution we want to show that the deepest (tectogrammatical) layer of representation of sentence structure we use, which represents "linguistic meaning" as described in (Sgall, Hajieova and Panevova, 1986) and which also records certain aspects of discourse structure, has certain properties tbat can be effectively used in machine translation 1 for languages of quite different nature at the transfer stage. We believe that such representation not only minimizes the "distance" between languages at this Iayer, but also delegates individual language phenornena where they belong to -whether it is the analysis, transfer or generation processes, regardless of methods used for perfotming these steps.The Prague Dependency TreebankThe Prague Dependency Treebank is a manually annotated corpus of Czech. The corpus size is approx. 1.5 million words (tokens). Three main groups ("layers") of annotation are used:• the morphological layer, where lernmas and tags are being annotated based on their context;• the analytical layer, which roughly corresponds to the surface syntax oftbe sentence,• the tectogrammatical layer, or linguistic meaning ofthe sentence in its context.In general, unique annotation for every sentence (and thus within the sentence as weil, i.e. for every token) is used on all three layers. Human judgment is required to interpret the text in question; in case of difficult decisf ons, certain "tie-breaking" rules are in effect ( of rather technical nature); no attempt has been made to define what type of disambiguation is "proper" or "improper" at what level.Technically, the PDT is distributed in text fonn, with an SGML markup throughout. Tools are provided for viewing, searching and editing the corpus, together with some basic Czech analysis tools (tokenization, morphology, tagging) suitable for various experiments. The data in the PDT are organized in such a way tbat statistical experiments can be easily compared between various systems -the data have been pre-divided into training and two sets oHest data.In the present section, we describe briefly the Prague Dependency Treebank structure and its history.BriefHistory ofthe PDTThe Prague Dependency Treebank project has started in 1996 formally as two projects, one for specification of the annotation scheme, and another one for its immediate "validation" (i.e., the actual treebanking) in the | 1.In this paper, the following conception of languageis used.A l~guage is an ordered triple L = (V, C, f) where V and C are two disjoint, non-empty, finite sets and f is sn application of C into the set of all subsets of the free semigroup F(~ generated by ¥. The set V is called the vocabulary (in Chomsky ~1~, terminalvocabulary), its elements are called word_____~s, those of F(V) Ford strings.The elements of C (which corresponds to the auxiliary vocabulary in Chomsky [i~) are called ~smmatieal) categories.For any category c ~ C, the elements of f~)~ F~) are called the word strings belonging to the category c.The usual conception of language, viz. a subset S of F~V), is S particular case in which C = ~s} contains a single element s ~the category of sentences, a sentence, i. e. a word string belonging to the category s, being an element of S~ However, both for natural and formsl languages, the above, more general conception seems to be more appropriate, for we are not only interested, in the ease of a natural language, in ~hat are the sentences, and, for a programming language, say, what are the programs, but also, what are the noun phrases, verbal phrases, etc., and, what are the declsrations, Statements, expressions, etc., respectively.Another advantage of our more general conception is that for a generative grammar of L, we can use the set.C of categories (but of course, we can use any superset of C as wel~ as auxiliary vocabulary.Accordingly, we define a context-free grammar as an ordered triple G = (V, C, R~ where V and C ar~ two disjoint, non-empty, finite sets and R is s subset of the Cartesian product of C with the free semigroup P(VU C) generated by the union of V and C. V and C are called the vocabulary and set of cste6ories (or terminal and auxiliary vocabulary), respectively; the elements r of R, which are of the form (c,~ with c ~ C and ~ E F(V ~ ~, are called (production) rules. A rule (c, ~> will be written in the sequel as "c:d" as in the presentation of ALGOL 68 [2], rather than "c,~" as in Chomsky or "c: :=d', |
1,999,948 | what type of elements are in les joueurs de football | Adidas Jabulani The Jabulani is a football manufactured by Adidas. It was the official match ball for the 2010 FIFA World Cup. The ball is made from eight spherically moulded panels and has a textured surface intended to improve aerodynamics. Nevertheless, the ball received extensive criticism from players and coaches before and during the World Cup who said that the path of the ball through the air was unpredictable. The ball was consequently developed into the Adidas Tango 12 series of footballs. The ball was constructed consisting of eight (down from 14 in the 2006 World Cup) thermally bonded, three-dimensional | Adidas Beau Jeu The Adidas Beau Jeu is one of the official match balls of the UEFA Euro 2016 tournament. It was used for the group stage of the tournament, after which it was replaced by the Adidas Fracas (a design variant of the "Beau Jeu") for the knockout stage, marking the first time in the tournament's history that two styles of official ball were used. The French phrase "Beau Jeu" translates to "Beautiful Game" or "Beautiful Play". In the group match between Switzerland and France on 19 June, the ball burst during a challenge between Antoine Griezmann and Valon | La jolie parfumeuse 1874, Berlin, New York, Birmingham and Milan in 1875, Mexico in 1876 and Stockholm in 1891, but did not remain in the repertory during the 20th century, despite broadcasts on French radio and a run at the Royal Academy of Music in 1973. The Neighbor's Chorus ""Soyez donc bon homme"" at the opening of act 3 remains a favorite of choral societies, however. Setting: Paris, 18th century "The first act is set in a garden cabaret of Les Porcherons, with a band stand and a sign which reads ‘Noces et Festins, Salon de 100 Couverts’. In the background, shrubs and | Football Club Les Lilas is a French football club based in Les Lilas, Seine-Saint-Denis. It was founded in 1947. The club currently plays in the Championnat de France Amateurs 2, the fifth tier of the French football league system.
Honours
Champions DH Paris: 1995
External links
Soccerway profile
Football clubs in France
Association football clubs established in 1947
1947 establishments in France | 20:00 UK time at Stade De France
Game kicks off .
Stream
First row
**France** team lineup
1 Hugo Lloris 2 Mathieu Debuchy 3 Patrice Evra
7 Franck Ribery 8 Mathieu Valbuena 9 Olivier Giroud 11 Samir Nasri 14 Blaise Matuidi 19 Paul Pogba 21 Laurent Koscielny 22 Eric Abidal
**Finland** Team Line up
Niki Maenpaa 1
Kari Arkivuo 13
Markus Halsti 15
Petri Pasanen 2
Kasper Hamalainen 21
Veli Lampi 5
Roman Eremenko 7
Perparim Hetemaj 8
Teemu Tainio 16
Alexander Ring 19
Teemu Pukki 10
0'
. On form . What a strike !
45' First Half ends . France 1- 0 Finland . What a game of football from the French . Especially Ribery,Valbuena and Nasri have been fantastic .
45' Second Half gets under way
GAME OVER . France 3 -0 Finland . Great game . | CFL 2.0 has me looking into possible international locations for a game. After careful consideration of locations like Mexico City, London, various Australian locations, and Germany, I've come to my final conclusion on the best option. Paris.
Why Paris?
•Stadium
Obviously fitting a CFL field in an international stadium is difficult with Australia and Japan being the obvious exceptions. But here's the thing, Parc Des Princes was designed with rugby in mind. As a result it has very deep endzones that are long enough to fit a full CFL field. I'm not sure why they left as much room past the rugby lines as they did, but the space is there for the longer CFL endzones. Cool fact: Parc Des Princes was designed by Roger Taillibert, the French architect that also designed Olympic Stadium in Montreal. Capacity: 47,929
•Demographics
The Montreal Allouettes are the only major professional football team in a French majority city. Seeing that the Montreal broadcasts are already available in French (maybe not their French), Simulcasting is an incredibly affordable option to promote the Allouette brand. It sure doesn't hurt that Boris Bede plays for the team. And don't be surprised if the Allouettes make a push to pick up Anthony Mahoungou. The Allouette jerseys are also identical to the PSG colours. I'm honestly wondering if this was intentional.
•Ligue 1 fans can relate to the CFL
I'm a big soccer fan, and it's my second favourite sport to watch and play. Ligue 1 is ranked to be the 5th best international soccer league in the world. Despite this, it's consistently mocked by English Premier League fans (EPL is the 2nd best league in the world). League 1 is called a "farmers league" and can't seem to shake the stigma. Does that sound familiar?
•The NFL doesn't seem to know how to approach France
This is probably the only advantage the CFL has over the NFL internationally. Like I mentioned in my first point, they do not have effective French marketing. And who could blame them? Marketing an anglo team and league to the French must be understandably difficult. But like it or not, our country and league are bilingual. We also have a TON of French natives playing in the RSEQ.
Let me know what your thoughts are on this. My idea of a game would be Montreal vs Toronto. Montreal because they would be the obvious favourite team and Toronto because "Toronto" looks very good on a press release. Plus the argos losing a home game isn't exactly a tragedy.
Thank you. Now give me some ice cream. | Schauvliege rejected the application from client Ghelamco for an environmental permit. Eurostadium Eurostadium was a proposed stadium in Grimbergen, Belgium, just north of Brussels. It would have a capacity of 62,613. In June 2015, the building deadline was set for 2019. It would have hosted UEFA Euro 2020 matches and would have become the home ground of the national football team of Belgium and of RSC Anderlecht. In contrast to the current stadium at the Heysel Plateau, the King Baudouin Stadium, it would no longer contain an athletics track. In March 2015, the City of Brussels council chose the Ghelamco/BAM | Schauvliege rejected the application from client Ghelamco for an environmental permit. Eurostadium Eurostadium was a proposed stadium in Grimbergen, Belgium, just north of Brussels. It would have a capacity of 62,613. In June 2015, the building deadline was set for 2019. It would have hosted UEFA Euro 2020 matches and would have become the home ground of the national football team of Belgium and of RSC Anderlecht. In contrast to the current stadium at the Heysel Plateau, the King Baudouin Stadium, it would no longer contain an athletics track. In March 2015, the City of Brussels council chose the Ghelamco/BAM | 1,999,948 | Les Joueurs de football are holding on to the player with the ball (blue jersey) as if a tackle is imminent. In contrast to the impending violence of the sport, Gleizes has painted flowers along with some cubic shapes toward the bottom right of the picture. On the bottom left is a man, possibly a fallen player, holding what appears to be a round shaped item in his hand. Spectators are seen toward the upper right, while to the left, in the background, Gleizes has painted a town, a bridge and bellowing clouds or smoke. The rich juxtaposition of divers elements present within the | what does les champs magnétiques mean in english | what river does javert drown in in les miserables | what is the only visible feature of the background in the painting hope by george f | Luzajic creates collages that are special in that they are beautiful, layered with symbolism | what number shirt does jorginho play for chelsea | fc twente play their home games at de grolsch vere in which | What is that noise at the soccer games? | what number shirt does jorginho wear for chelsea |
1,999,949 | [EXPANSION] Uniting the people of Ob | Yoruba culture group and subgroup having a system that varies, but in general, government begins within the immediate family. The next level is the clan, or extended family, with its own head known as a Baálé. This chief will be subject to town chiefs, and these chiefs are usually themselves subject to their Oba, who may or may not be subject to another Oba himself. Most of what survived of this legal code has been assimilated into the customary laws of the sovereign nations that the Yoruba inhabit. Yoruba written literature begins with the formation of its grammar published in 1843. The | UNESCO Intangible Cultural Heritage Lists Names and spellings used for the elements were based on the official List as published. B. A total of three Proclamations of Masterpieces of the Oral and Intangible Heritage of Humanity were made in 2001, 2003 and 2005. The proclamation was superseded in 2008 when the Representative List of the Intangible Cultural Heritage of Humanity was established. C. The 90 elements that were previously proclaimed as Masterpieces have been inscribed onto the Representative List of the Intangible Cultural Heritage of Humanity as per the Convention for the Safeguarding of Intangible Cultural Heritage. D. Grouping of member states by region is | Obaala (or in Yoruba orthography Ọbaálá) is a senior title in the royal council of many kingdoms of the Central Yoruba subgroups, namely: the Igbomina, Ijẹṣa and Ekiti sub-ethnics.
Ọbaálá literally means "mighty king" or "senior king" and is almost always next in rank to the high king or paramount king of the areas where the title is used. The Ọbaálá is often designated as the automatic regent on the demise of any reigning king or paramount king.
The most famous Ọbaálá in recent Yoruba history is easily Ogedengbe, the Ijẹṣa war commander who co-led the "Ekiti Parapọ", a clan confederation which stood to oppose the imperialism of 19th century Ibadan.
Yoruba culture
Yoruba royal titles | Okun people Until the advent of the Nupes in the 19th century, each of the Okun subgroups lacked any form of central government but were organised into small city states. Each 'state' was governed by leadership rotated amongst the constituent lineages or clans. The central kingship system has led to the establishment of royal stools such as Obaro of Kabba, Olubunu of Bunu, Olujumu of Ijumu, Agbana of Isanlu, Olu of Ọwọrọ. The Obaro of Kabba, Oba Micheal Olobayo (Obaro Ero Il), is the chairman of the Okun traditional council. In the early 20th century the Olu of Ọwọrọ (and head of | My wife and I play a lot of boardgames but prefer the kind where you don't directly attack each other (it is a lose/lose proposition for me).
We recently picked up Eclipse and really enjoyed the base game, however, mid to late game our militaries are often substantially stronger than the Ancients or GCDS and we easily squash them. That often results in a late game where there isn't much left to do but try to take each others territories.
I was wondering if the Rise of the Ancients expansion introduces more challenging Ancients that would allow us to focus on defeating/defending against them rather than attacking each other? | deals with the Economic and Social Council of Benin. It contains three articles. Title VIII deals with the High Commission of Audio-Visuals and Communications. It contains two articles. Title IX deals with treaties and international agreements. It contains six articles. Title X deals with the territorial divisions of Benin. It contains four articles. Title XI deals with revisions to the constitution. It contains three articles. Title XII deals with final transitional provisions. It contains four articles. Constitution of Benin The Constitution of Benin was adopted by referendum 23 December 1956. The constitution is made up of a preamble, twelve titles, | The contemporary paradigm of education preaches among others requirements the international experience as one of the important skills in the formation of the new engineer. These discussions have been enriched by ASIBEI that is the Iberian American Association of Engineering Education Institutions bringing proposals for a more cooperation between the Iberia Peninsula countries engineering education institutions and the ones of Latin America. The internationalization of engineering education has become one of the main goals for next decade. Mercosul as the result of the expansion of world capitalism over Latin America and the globalization has an important role helping to promote a narrowing of relations between both sides of Atlantic countries. The meetings and discussions of ASIBEI have generated what has been named the "Rio Declaration", which consists in some guidelines for future conversations about collaborative programs and similar education system for the acquisition of international diplomas. | Identity Politics, Democratisation and State Building in Ethiopia's Federal Arrangement | 1,999,949 | >The leader of the people of Ob continues to unite settlements in the region. Heading north, he travels from clearing to clearing, leaving flags to rise over the tallest huts and treehouses.
Expansionmap | Research background:The globalization processes are not only of an economic and cultural nature -but they also unify trends in the organization and management of administration, including at the local level. The idea of economization of administration was promoted in the broad stream of reforms described as New Public Management. It was often expressed as a postulate of the territorial reorganization of local governments. The reforms of these structures, motivated by the economies of scale, were to lead to the elimination of their allegedly too fragmented nature.Purpose of the article:The questions about the global scale and effectiveness of these reforms resulted in the objectives of the study, which were formulated as follows: -identification of the scope and scale of territorial reforms and assessment of their global character; -evaluation of the real impact of these reforms in terms of economies of scale. Methods: Methodologically, the work is the critical meta-analysis of the research results of consolidation reforms from many countries of the world.Findings & Value added:The results lead to the conclusion that consolidation is a global trend. However, they do not unequivocally confirm the successes in achieving economies of scale in the provision of public services. The added value of this research is to draw attention to the fact that uncritical implementation of global trends does not automatically bring the assumed effects. It is necessary to apply in practice glocalization, i.e. critical adaptation of global solutions to local institutional conditions. | New PwC report has sought out the best cities for investors in Africa .
North African capitals dominate, but there are signs that sub-Saharan cities will come into their own in the near future . | Plows, prosperity, and cooperation at Agbassa : the change from hoes to plows on a government-sponsored land settlement project in Northern Togo | north dum is a part of which urban agglomeration | ON THE LINK-UP OF A CITY'S OVERALL PLAN AND ITS GENERAL ARRAGEMENT OF LAND | A Semantic Region Growing Algorithm: Extraction of Urban Settings | A B S T R A C TLand ownership is given little attention in scholarly accounts of how and why new city visions are mobilised and implemented in Africa. In this paper we examine the evolution of Accra City Extension Project (ACEP) -an urban strategy to modernise and respond to urbanisation pressures in the Greater Accra Region, Ghana. We trace the origins and rationale of the ACEP, the actors involved, resources, institutional capacities and their relations. Drawing on the concept of relational complexity and urban policy mobilities literature, we argue that the emergence of ACEP can be explained in two ways: as a consequence of the desire to improve the qualities of an urban area at the local level and as a product of multiple interactions and relations, which produce knowledge, specific interests, resources and constraints. The findings suggest that contemporary urban policymaking in specific places is a complex and emergent socio-political process that draws on both local and learned ideas from 'elsewhere'. Therefore, we submit that it is more helpful to transcend the focus on what is circulating (a policy and the networks through which it is set in motion) and instead, examine how policymakers in specific contexts 'arrive at' their ideas through multiple influences. The project brings together diverse actors such as local and central governments, international planning consultants, UN Habitat and traditional authorities, with varying degrees of expertise, power and agendas. We find that issues around land ownership significantly structured and limited the range of visions that could be implemented. | Empowering Metropolitan Regions Through New Forms of Cooperation |
1,999,950 | what is the data warehouse architecture? | In this paper,aimed at data warehousing technology through a brief analysis,leads to data warehouse technology applications in the aviation industry. Detailed analysis of the aviation industry the demand for data warehouse design development for the airline data warehouse technology applications,of data warehouse and data mining technology in the aviation industry applications. | Data warehousing, coupled with solutions around data analytics and big data processing, allows businesses gather, quantify, and actually analyze its information and take its information to an entirely new level by helping you create data visualization to make better decisions around your business and the market.
Unlike databases and other systems which simply ‘store’ data, data warehousing takes an entirely different approach, it normally use a denormalized data structure, which uses fewer tables because it groups data and doesn’t exclude data redundancies. Denormalization offers better performance when reading data for analytical purposes. On that note, data warehouses are used for business analysis, data and market analytics, and business reporting. Data warehouses typically store historical data by integrating copies of transaction data from disparate sources and can also use real-time data feeds for reports that use the most current, integrated information.
The following overview defines data warehousing, look at some use-cases, and discuss a few best practices: Defining The Data Warehouse: Applications In The Real World | Today for compliance reasons as well as for optimization of business processes companies need to store runtime data of processes. However, creating and adapting an analytics infrastructure using data warehousing is a cumbersome task. In previous work we introduced the aPro architecture in order to enable companies with heterogeneous infrastructures to create near real-time monitoring and analytics infrastructures. Creation and deployment of monitoring infrastructure is provided as a fully automatic service. In this work we add a model-driven data warehouse to aPro, using the existing monitoring model to automatically configure and deploy a data warehouse. We show how a near real-time monitoring infrastructure can be utilized to simplify Extract-Transform-Load processes for filling data warehouses. We describe a prototypical implementation and evaluate it with a real-world process. | The Dataupia Satori Server provided all aspects of the data warehouse appliance in a single product. The company has headquarters in Cambridge, Massachusetts, with additional offices in Binghamton, United Kingdom. The company was privately-held. Dataupia's name is a portmanteau of the words "data", in reference to the data warehousing industry, and "utopia". The combination of words is used by the company to imply ideal access to data. The Dataupia flagship product, Satori Server, is a network-attached data warehouse appliance announced in 2007. As an appliance, it includes an embedded copy of Linux, a database engine, an aggregation engine, built-in storage, | Requirements Engineering for Data Warehouses. | Data architecture In information technology, data architecture is composed of models, policies, rules or standards that govern which data is collected, and how it is stored, arranged, integrated, and put to use in data systems and in organizations. Data is usually one of several architecture domains that form the pillars of an enterprise architecture or solution architecture. A data architecture should set data standards for all its data systems as a vision or a model of the eventual interactions between those data systems. Data integration, for example, should be dependent upon data architecture standards since data integration requires data interactions | Data warehouse is a new architecture concerning the data storing emerged rapidly in recent years. Considering the forming and the technical characteristics of the data warehouse environment, this paper discusses the design of loan information managing system of bank. | The data warehouse technique is an importance development direction of the database technique.According to the application environmental and different, expatiated two kinds of methods that establish the data warehouse logic model:According to the third the type of Fang sets up the mold to set up the mold with the star type mode. | 1,999,950 | Data warehouse architecture refers to the design of an organization's data collection and storage framework. | what is the name of the architecture of data | The research on marine multidimensional data warehouse construction | On the Aviation Industry Data Warehouse Technology and Applications | Data Architecture: The Information Paradigm | What is data structure and its needs? | Enterprises are dealing with ever increasing volumes of data, reaching into the petabyte scale. With many of our customer engagements, we are observing an emerging trend: They are using Hadoop-based solutions in conjunction with their data warehouses. They are using Hadoop to deal with the data volume, as well as the lack of strict structure in their data to conduct various analyses, including but not limited to Web log analysis, sophisticated data mining, machine learning and model building. This first stage of the analysis is off-line and suitable for Hadoop. But, once their data is summarized or cleansed enough, and their models are built, they are loading the results into a warehouse for interactive querying and report generation. At this later stage, they leverage the wealth of business intelligence tools, which they are accustomed to, that exist for warehouses. In this paper, we outline this use case and discuss the bidirectional connectors we developed between IBM DB2 and IBM InfoSphere BigInsights. | Data Warehouses: Next Challenges | Application of Medical Records Data Analysis Based on Data Warehouse Technology |
1,999,951 | who built booker t washington state park tn | Booker T. Washington State Park (Tennessee) Booker T. Washington State Park is a park situated on the shores of Chickamauga Lake. It was built largely by African-American units of the Civilian Conservation Corps. It was originally designated under segregation as one of two Tennessee State Parks for use by blacks (the other being T. O. Fuller State Park near Memphis) until discrimination in public accommodations in the United States was banned under the Civil Rights Act of 1964. The park has facilities that are suited to accommodate all its visitors. Facilities on site include three separate picnic shelters that can | Booker's Place: A Mississippi Story Booker's Place: A Mississippi Story is a 2012 documentary film about Booker Wright, an African-American waiter who worked in a restaurant for whites only. In 1965, Wright appeared in "", a short NBC television documentary about racism in the American South. During his interview with producer Frank De Felitta, he spoke openly about racism, and his treatment as a waiter in an all-white restaurant. The broadcast of his remarks had catastrophic consequences for Wright. "Booker's Place: A Mississippi Story" was directed by the son of Frank De Felitta, Oscar-nominated, independent filmmaker Raymond De Felitta, and | Orange Mound, Memphis a population of approximately 14,400 of which 95 percent are of African-American heritage. Orange Mound stands on the site of the former John Deaderick plantation. Between 1825 and 1830, Deaderick (whose family donated the land in Nashville on which the Tennessee State Capitol was built) purchased 5,000 acres (20 km²) of land (from Airways to Semmes) and built a stately house there (at what is now the east side of Airways, between Carnes and Spottswood). In 1890, a developer named Elzey Eugene Meachem purchased land from the Deaderick family and began developing a subdivision for African-Americans, selling lots for less | Orange Mound, Memphis a population of approximately 14,400 of which 95 percent are of African-American heritage. Orange Mound stands on the site of the former John Deaderick plantation. Between 1825 and 1830, Deaderick (whose family donated the land in Nashville on which the Tennessee State Capitol was built) purchased 5,000 acres (20 km²) of land (from Airways to Semmes) and built a stately house there (at what is now the east side of Airways, between Carnes and Spottswood). In 1890, a developer named Elzey Eugene Meachem purchased land from the Deaderick family and began developing a subdivision for African-Americans, selling lots for less | state parks. The TBI maintains state-of-the-art investigative facilities and is the primary state-level criminal investigative department. Tennessee State Park Rangers are responsible for all activities and law enforcement inside the Tennessee State Parks system. Local law enforcement is divided between County Sheriff's Offices and Municipal Police Departments. Tennessee's Constitution requires that each County have an elected Sheriff. In 94 of the 95 counties the Sheriff is the chief law enforcement officer in the county and has jurisdiction over the county as a whole. Each Sheriff's Office is responsible for warrant service, court security, jail operations and primary law enforcement in | Pickett CCC Memorial State Park Pickett Civilian Conservation Corps Memorial State Park (also known simply as Pickett State Park or Pickett CCC Memorial State Park) is a Tennessee state park in the upper Cumberland Mountains. It is located in Pickett County, northeast of the city of Jamestown, and is adjacent to the Big South Fork National River and Recreation Area. The park is located on of wilderness including caves, natural bridges, and other rock formations. About are managed by the Tennessee Department of Environment and Conservation as a state park, and the remainder of the property is managed by the | Tennessee State Archives is slightly damaged. Other than this the document is intact and legible. The Cumberland Compact was composed and signed by 256 colonists. One colonist, James Patrick of Virginia, was illiterate and marked his name with an "X". This constitution called for a governing council of 12 judges who would be elected by the vote of free men 21 years of age or older. Unique to the times, the Compact included a clause that these judges could be removed from office by the people. Government salaries were to be paid in goods. Governors are paid 1,000 deer skins, | Big Bone Cave (Big) Bone Cave is a cave located in Van Buren County, Tennessee, in the community of Bone Cave that is named after it. It is notable both for its history and current recreational use. It is listed on the National Register of Historic Places and a designated National Natural Landmark. It is a State Natural Area managed by Rock Island State Park. It is named for the discovery of the bones of a giant ground sloth in 1811. The cave was operated as a saltpeter mine, notably during the War of 1812 and the American Civil War. | 1,999,951 | Booker T. Washington State Park (Tennessee) Booker T. Washington State Park is a park situated on the shores of Chickamauga Lake. It was built largely by African-American units of the Civilian Conservation Corps. It was originally designated under segregation as one of two Tennessee State Parks for use by blacks (the other being T. O. Fuller State Park near Memphis) until discrimination in public accommodations in the United States was banned under the Civil Rights Act of 1964. The park has facilities that are suited to accommodate all its visitors. Facilities on site include three separate picnic shelters that can | what lake is booker t washington state park on | what is the largest park in memphis tennessee | who operates black rock state park in connecticut | where is boulder park in washington state located | in which us state is indian mary park located | what act created the tennessee department of environment and conservation | what is the state park in bear lake idaho | who commissioned the statue of sam davis in nashville tennessee |
1,999,952 | where did the game of mall take its name | Oak Court Mall Oak Court Mall is an enclosed shopping mall located in Memphis, Tennessee, United States. Opened in 1988, the mall features Macy's and both Women's and Men's Dillard's as its anchor stores. The mall began as a freestanding, 3-story Goldsmith's, a Memphis-based department store, in 1961. In the early 1970s, Goldsmith's constructed a 3-story structure immediately to the west of the existing store. The upper two levels of this structure served as parking, while the bottom level was connected to the first floor of the existing store and served as additional retail space. In the late 1970s, Goldsmith's | court was eventually converted to a children's play area in order to give some use to what was formerly a large public space with food options. In 2012, Memorial Mall was sold at a foreclosure auction. Bank of America, the lender to the mall, bought the property at a sheriff's auction for about $2.1 million. Prior to the auction, the mall was owned by a group of 17 New York-based limited liability companies and had been in foreclosure since 2009, after falling rental rates and a lack of new tenants left owners owing far more on the property than what | This randomly came up in conversation with a friend the other day, and neither of us can remember for the life of us. The tour was fine, but the thing that's really sticking with us is that the mall had a really rad comic book store that's probably long gone. | the Eastern Section of the mall, representing the Great Lakes mostly of East Africa and has calm and gentle materials used. The Desert Court is located in the Southern Section of the mall, representing the Sahara Desert of North Africa and has calm motifs used in traditional Berber carpets. The Oleum Court is located in the Western Section of the mall, representing West Africa's Oil wealth. The Forest Walk Court is in the center of the shopping mall, representing Central Africa and its rain forests. Mall of Africa Mall of Africa is a shopping mall located in Waterfall City, Midrand, | What are some names of stores in a mall? | What are the problems of Shopping mall? | Westroads Mall Westroads Mall is an enclosed shopping mall in Omaha, Nebraska at the intersection of 100th and Dodge Streets (U.S. Route 6). It is the largest mall in Nebraska. Designed by real estate developer John Wiebe, Westroads Mall opened n 1967. In May 1991, a food court opened; it was demolished and replaced in 2015. Prudential Financial purchased the mall from Wiebe for $45 million in 1977. In 1997, General Growth Properties acquired the mall from Prudential. The mall was owned by both General Growth (51% share) and Canadian property development company Ivanhoe Cambridge (49% share); it was managed | to shop, eat, and socialize within the boundaries of privately owned malls. See "Pruneyard Shopping Center v. Robins". Shopping mall A shopping mall is a modern, chiefly North American, term for a form of shopping precinct or shopping center (also spelled shopping centre), in which one or more buildings form a complex of shops representing merchandisers with interconnecting walkways that enable customers to walk from unit to unit. A shopping arcade is a specific type of shopping precinct which is usually distinguished in English for mall shopping by the fact that connecting walkways are not owned by a single proprietor | 1,999,952 | to be observed, that there are two of these arches, that is one at either end of the alley. The game of mall was a fashionable amusement in the reign of Charles the Second, and the walk in Saint James's Park, now called the Mall, received its name from having been appropriated to the purpose of playing at mall, where Charles himself and his courtiers frequently exercised themselves in the practice of this pastime." While the name "pall-mall" and various games bearing this name also appeared elsewhere (France and Italy), the description above suggests that the croquet-like games in particular | what is the name of the new princes mall in edinburgh | what is the name of the sporting goods store in governor's square mall | when did prince georges mall change its name | in which city is the mall of louisiana located | who was the developer of the boulevard mall | when was regency mall built in augusta georgia | what is the new name of citadel mall charleston | what was the mall in huntsville alabama before parkway place |
1,999,953 | Can't create supergens - 404 error? | I used the superrepo and installed kissanime but when I use it the interface is invisible and it doesn't work for some reason on super repo for me. Helpp | What does super mean in prefixses? | Supernormal the insect world... and a weakness for porch lights! And Eric Normal. An ordinary boy with no superpowers whatsoever. Yet through a combination of sheer good luck and a little dash of common sense, he was able to get through the school’s combination obstacle course/entrance exam. It's here that brave, enthusiastic and earnest Eric Normal and his friends will learn what it really means to be heroes, with or without superpowers! Eric Normal, the world's first superhero without superpowers! Eric Normal may wear a Spandex suit and a home made cape, but the only thing super about him is his | Think about it. The Supersoldaten don't really say anything, neither does Max aside from his name. Max Hass is much bigger and stronger than anyone else in the Kreisau Circle. I've seen other things saying that the Supersoldaten's have serious brain damage, just like Max. I think that Max didn't want to do his job (killing people) resulting in him running away (maybe with Klaus Kreutz, adding to their friendship). This is just my theory though. What do you guys think? I would love feedback! | Have there been supercontinents? | Does anyone have any advice dealing with a terrible terrible super? Moving in, this guy wasn’t the super, but within the last month he is? no idea how. The guy in the building refuses to do his actual job, steals our packages, won’t wear a mask indoors/doing maintenance, basically just a useless asshole who also harasses us. I’ve lived here a couple years and never had a live-in super so I don’t know our rights. | Abstract : SUPERTOG is a program to generate fine-group parameters and group-to-group scattering matrices using basic ENDF/B cross section data. A calculation to generate resonance data which uses single level Breit-Wigner resonance parameters is included in the code. The energy group structure, the order of cross section expansion, and the spectral weighting function are arbitrary and can be specified by the user. Data can be generated in forms for use in the GAM-I, GAM-II, ANISN, and DOT programs. Auxiliary programs are available for obtaining library tapes for XSDRN. (Author) | anyone free to help me with the Superfood Elite contract? code is superdupereggs
Thanks so much!
&#x200B;
current progress - 3 days left | 1,999,953 | Has anyone else had trouble creating supergens? When I submit the request, the window pops up, but each individual generator displays a 404 error. I am a monthly donor.
Tried this on Firefox and Chrome on Ubuntu. | The admin header is pushing my page down... | Sky Factory 4 Sky Orchards mod not working | Already experiencing connection issues, BUMMER! i had hopes ... | sl007 Strange...looking into it... it is working ... | This was the most flawless application I have ever had ... | Setup Gooninator2 to work with local files! Instructions inside... | [Want] someone to pm me telling me how they got the ksweb hack working with the new update. | I submitted a tab to ultimate-guitar.com, now I cant access the page unless i use a proxy |
1,999,954 | how many pylons are there on askøy bridge | over represents a multispan extradosed structure of 49.5 + 77 + 5 × 110 + 77 + 49.5 metres with six traffic lanes. The total length of the bridge is 803 metres. The width is 34.28 metres. There are six pylons, each at a height 13.33 metres above the roadway pavement. Each pylon has eight pairs of cables. The first extradosed bridge in Scandinavia is the Harpe Bridge crossing the Norwegian river Gudbrandsdalslågen as part of the highway E6. The bridge was opened for traffic December 17, 2016. It is 324 meters long and carries four lanes of traffic. Pakistan | The Herøy Bridge () is a cantilever bridge that connects the islands of Gurskøya and Leinøya in the municipality of Herøy in Møre og Romsdal county, Norway. It is part of a bridge network which connects all of the main islands of the municipality together. It is about southeast of Fosnavåg.
The bridge is long, the longest span is , and the maximum clearance to the sea is . Herøy Bridge was opened by King Olav V on 4 September 1976.
See also
Remøy Bridge
Runde Bridge
Nerlandsøy Bridge
List of bridges in Norway
List of bridges in Norway by length
List of bridges
List of longest bridges in the world
References
External links
Road Viaducts & Bridges in Norway
Sunnmøre
Herøy, Møre og Romsdal
Bridges in Møre og Romsdal
Bridges completed in 1976
Cantilever bridges
1976 establishments in Norway | Skarnsund Bridge place on the Mosvik side. Following the opening, it won several awards: Betongtavlen (1992); Beautiful Roads Award (1994); and the international FIP Award (1994). In 2008, the Norwegian Directorate for Cultural Heritage listed the bridge as a protected cultural heritage. In 2010, the bridge came in second in a competition held by "Teknisk Ukeblad" to declare Norway's most beautiful road bridge. The bridge is one of the world's longest cable-stayed bridges, with a length of . The span is , while the two towers are above sea level. The deck is deep, and wide, with two lanes for automobiles and | Bidford Bridge control. The Heart of England Way walking route uses the bridge. In June 2015, a farm vehicle passing over the bridge struck the parapet, resulting in "significant damage to the... stone parapet, spandrel wall and central pier" and the bridge's closure to all but cyclists and pedestrians. Following inspection of the cut-water (nose of pier) at river level, further damage to the sandstone blockwork was identified at this low level. Approximately 15 courses of White Hollington stone have been rebuilt, integrating new stone in and around existing. The temporary access scaffold required to complete the works had to consider the | Sommarøy Bridge () is a cantilever bridge connecting the islands of Kvaløya and Sommarøy in the Hillesøy area of Tromsø Municipality in Troms og Finnmark county, Norway. The prestressed concrete bridge is long and the longest span on the bridge is .
Sommarøy Bridge has traffic lights to prevent accidents on the narrow bridge, although it has been reported that the traffic lights malfunction in windy weather.
References
External links
A picture of Sommarøy Bridge
Road bridges in Troms og Finnmark
Buildings and structures in Tromsø | Most of the bridges which cross the river are movable, to allow shipping to pass. There are six swing bridges; four bascule bridges, two of which have twin leaves, one for each carriageway of the roads which they carry; and three Scherzer lift bridges, which are a type of rolling bascule bridge. Scott Street Bridge, which is now permanently raised, was originally powered from a high pressure water main maintained by the first public power distribution company in the world. The source of the River Hull is in the Yorkshire Wolds. It rises from a series of springs to the | Carrick-a-Rede Rope Bridge Carrick-a-Rede Rope Bridge (locally pronounced carrick-a-reedy) is a famous rope bridge near Ballintoy in County Antrim, Northern Ireland. The bridge links the mainland to the tiny island of Carrickarede (). It spans and is above the rocks below. The bridge is mainly a tourist attraction and is owned and maintained by the National Trust. In 2009, it had 247,000 visitors. By 2016, that had increased to 440,000 visitors. The bridge is open all year round (subject to weather) and people may cross it for a fee. It is thought salmon fishermen have been building bridges to the | Fairy Bridge (Isle of Man) the location was on the boundaries of the land of the nearby Rushen Abbey, and the greeting is a folk memory of crossing oneself at the sight of the crucifix marking the boundary of the monastery's land. This superstition may possibly have arisen at this location during the 19th century in response to the large number of tourists visiting the Island. The now commonly known '"Real" Fairy Bridge', shown as the "Fairy Bridge" on old Ordnance Survey maps, is located in the parish of Braddan across the Middle River near the footpath from Oakhill to Kewaigue. Fairy Bridge (Isle of | 1,999,954 | Askøy Bridge of . It has two concrete pylons, each , albeit tall when including the mounts for the suspension cable. The pylons are wide and vary in width between at the top to at the bottom. They pylons have three horizontal connectors, one under the deck at , one at and one at the top. The bridge has seven spans, with all but the main spans being concrete viaducts, and thus not connected to the suspension cable. The aerodynamic closed bridge girder has a vertical radius of , a height of and a width of . The bridge deck is wide; | Sommarøy Bridge | Herøy Bridge | Kjøllsæter Bridge | Bridges in Kyiv | what is the height of the andreyevsky bridge | what is the tie of the alviksbron bridge | how many cables are on each side of the nordhordland bridge | how were the wires connected to the bømla bridge system |
1,999,955 | Which tv show did the children's television workshop introduce in 1969? | What TV show did the Children's Television? | What was the first kid TV show? | What shows stopped airing on pbs kids? | Words and Pictures (TV programme) Words and Pictures is a British children's literacy television programme which aired as part on BBC as part of BBC Schools, starting in 1970. The series began in 1970 as a spin-off from the BBC schools programme, Look and Read, which was already providing the same type of practice and encouragement for older children. The first series was presented by Gabriel Woolf and set in an attic full of toys, who have adventures related to phonics. Two episodes aired each week, one ("Programme A") at the start and the other ("Programme B") at the end. | Words and Pictures (TV programme) Words and Pictures is a British children's literacy television programme which aired as part on BBC as part of BBC Schools, starting in 1970. The series began in 1970 as a spin-off from the BBC schools programme, Look and Read, which was already providing the same type of practice and encouragement for older children. The first series was presented by Gabriel Woolf and set in an attic full of toys, who have adventures related to phonics. Two episodes aired each week, one ("Programme A") at the start and the other ("Programme B") at the end. | Children's Film Foundation The Children's Film Foundation (CFF) was a non-profit-making organisation which made films for children in the United Kingdom, typically running for about 55 minutes. It was founded in 1951. For 30 years it was subsidised by the Eady Levy - a tax on box office receipts, but this was abolished in 1985. It made a few further films in the mid-1980s, by which time it had been renamed the Children's Film and Television Foundation. Many of its films, dating back to the 1960s, were shown on the BBC in the 1980s, in the "Friday Film Special" strand. | The ABC, the Australian Children's Television Foundation and the Emergence of Digital Children's Television in Australia | On in the 90s or early 00s. Might have been a cartoon? The teacher was a head on a tv on a cart in the classroom and could still interact with the students, answer questions and such. I vaguely remember it was as though she could see out of the tv too. Sort of like Skype, but before that was a common technology, and it was a box tv. | 1,999,955 | What show did the childrens workshop create in? | What is the first kid show on pbskids? | how many film festivals did children of invention go to | on which channel did the children's programme doodle do first air | children and art is the 55th episode of which us television series | Designing a Programming Workshop for Girls | Not really "Kid" projects. Very advanced | This was so awesome! The kids had a blast with all of ... | Does anyone actually watch the show for the kids? |
1,999,956 | On multiplicity of solutions in quasi-brittle fracture computations | Characteristics of dynamic brittle fracture captured with peridynamics | A geometrically nonlinear phase field theory of brittle fracture | Abstract The cracking elements (CE) method is a recently presented self-propagating strong discontinuity embedded approach with the statically optimal symmetric (SDA-SOS) formulation for simulating the fracture of quasi-brittle materials. CE uses disconnected cracking segments to represent cracks, and the crack openings are condensed locally; hence, this method does not require remeshing, a cover algorithm or nodal enrichment. Furthermore, local criteria for determining the crack orientations are presented, thus making crack tracking unnecessary. In this paper, we propose a CE numerical procedure for dynamic fractures. Several benchmark tests regarding irregular discretizations are performed, and the results indicate that the CE method is capable of naturally capturing complicated crack patterns in dynamic fractures, including crack branchings. | To simulate fracture behaviors in concrete more realistically, a theoretical analysis on the potential question in the quasi-static method is presented, then a novel algorithm is proposed which takes into account the inertia effect due to unstable crack propagation and meanwhile requests much lower computational efforts than purely dynamic method. The inertia effect due to load increasing becomes less important and can be ignored with the loading rate decreasing, but the inertia effect due to unstable crack propagation remains considerable no matter how low the loading rate is. Therefore, results may become questionable if a fracture process including unstable cracking is simulated by the quasi-static procedure excluding completely inertia effects. However, it requires much higher computational effort to simulate experiments with not very high loading rates by the dynamic method. In this investigation which can be taken as a natural continuation, the potential question of quasi-static method is analyzed based on the dynamic equations of motion. One solution to this question is the new algorithm mentioned above. Numerical examples are provided by the generalized beam (GB) lattice model to show both fracture processes under different loading rates and capability of the new algorithm. | In this article we outline the basic principles of a new approach to the solution of the problem of brittle fracture of solids. The kinetic theory of long-time strength formulated by S. N. Zhurkov et al. is analyzed and generalized. | Propagation of mode-I cracks in a three-dimensional model quasicrystal is studied by molecular dynamics simulations. The samples are endowed with an atomically sharp crack and subsequently loaded by linear scaling of the displacement field. The response of the system is then monitored during the simulation. In particular, the crack surface morphology is investigated in dependence of the orientation of the fracture plane. For this purpose, fracture surfaces perpendicular to two- and fivefold axes are compared. For both directions, brittle fracture with rough fracture surfaces is observed. | A higher-order phase-field model for brittle fracture: Formulation and analysis within the isogeometric analysis framework | The macroscopic nature of brittle fracture has been examined based on simple micromechanism based statistical models. Based on the examination the following conclusions can be drawn regarding the macroscopic nature of brittle fracture: -The fracture toughness has, in the case of brittle fracture a specific scatter distribution which can be described by the cumulative failure probability distribution Pf=1-exp-{const.*B*(K-Kmin) 4 }. -The specific scatter distribution indicate a distinct specimen size (crack front length) effect | 1,999,956 | The analysis of quasi-brittle fracture processes is formulated as a linear complementarity problem either in finite increments or in rates. Some time-stepping solution procedures and mathematical programming algorithms are discussed as for their ability to capture the whole set of possible alternative equilibrium paths. Potentialities and limitations of the proposed approach and of the relevant procedures are pointed out also by means of a numerical example. | A quasi-static model for numerical solution of initiation and propagation of cracks along interfaces or inside materials is developed. The two types of cracks are modelled by the material damage theory with two independent damage parameters introduced. For cracks at the interface, in fact represented by contact of construction components, cohesive or adhesive contact is considered, for which several computational relationships based on energetic formulation exist. Accordingly, the appropriate modelling of bulk damage also includes energy consideration. In terms of cracks, it leads to so called diffuse cracks. The computational approach is referred to as phase field models. These will cause damage in a very narrow band representing the actual crack. The computational analysis provides stress-strain quantities and the damage variables to simulate both interface and material cracks. The proposed mathematical approach has a variational form based on an energetic formulation looking for a kind of weak solution. The solution is approximated by a time stepping procedure, a finite element code, and it utilizes quadratic programming algorithms. | Failure of quasi-brittle materials such as concrete needs a proper description of strain softening due to progressive micro-cracking and the introduction of an internal length in the constitutive model in order to achieve non zero energy dissipation. This paper reviews the main results obtained with the non local damage model, which has been among the precursors of such models. In most cases up to now, the internal length has been considered as a constant. There is today a consensus that it should not be the case as models possess severe shortcomings such as incorrect averaging near the boundaries of the solid considered and non local transmission across non convex boundaries. An interaction-based model in which the weight function is constructed from the analysis of interaction has been proposed. It avoids empirical descriptions of the evolution of the internal length. This model is also recalled and further documented. Additional results dealing with spalling failure are discussed. Finally, it is pointed out that this model provides an asymptotic description of complete failure, which is consistent with fracture mechanics.2010 Mathematics Subject Classification. 74A45, 74R05. | Timber beams with holes have been analyzed with linear elastic fracture mechanics. The energy release rate corresponding to the beginning of the crack growth is set equal to the external work done by the loading of the beam. Further, this fracture energy is partitioned into a mode I and a mode II component. Stress intensities at the hole corner are calculated from the strain energy release rates, and the orthotropicity of the material is taken into account. If the hole is near to the support or the point load, a correction term is given for the basic solution. The equations are derived for a rectangular hole, but a circular hole can be modeled with a rectangular one. Solutions for special cases as beam with cracks are given. The method can be extended to other load and support conditions, crack sources, and other orthotropic materials. The analytical solution was experimentally evaluated. Wu's fracture criterion was found to be applicable for beams with known material properties. For small clear beams, th... | Inverse problem on crack reconstruction in the elastic half-space: anti-plane case | Reconstruction of Parallel Cracks by ECT | Brittleness research on complex system based on brittle link entropy | Interaction between parallel EDGE cracks | Constructive statistical cracks mechanics |
1,999,957 | when was the movie veguli penn made | Veer! Veer! (stylized as "VEER!") is a 2012 American independent film directed by Patrick Barry, and written by Barry and Jesse Gay. The film premiered at the Jacksonville Film Festival for its hometown screening, and went on to tour regional film festivals around the country, including the PollyGrind Film Festival, where it won the "Skate or Die Award", and the Sunscreen Film Festival, where it won "Best Florida Film". The film was released theatrically on March 1, 2013. The film focuses primarily on Jesse Sorensen, played by co-writer Jesse Gay, a washed-up professional skateboarding star now six years past his | was conducted in Punjab, Pakistan for Pakistani audiences. Apart from that, it was screened at the Berlin Film Festival, where it was received well. On 26 April 2006, "Veer-Zaara" had its French premiere at The Grand Rex, the biggest theatre in Paris. It is the first Hindi film to premiere in such a large and luxe venue. It was released in 60 prints in the United Kingdom. It was released in the United States in 88 prints. In 2017, "Veer-Zaara" was restrained at the Best of Bollywood series in the United States. On 6 June 2005 Yash Raj Films released | Larry Elkins entertainment business." He spent ten months renovating parts of Robert Duvall's horse farm in Virginia and took the actor all over Texas to research accents for his 1983 movie "Tender Mercies". When Duvall won the Oscar the movie that year, Elkins was there as his special guest. Duvall also asked him to find him the voice and character of Augustus McRae in Lonesome Dove. Elkins introduced himto the legendary quarterback, Sammy Baugh, who was retired to his ranch in Rotan, Texas. Elkins said he also rubbed shoulders with Gene Hackman, Robert De Niro, Meryl Streep, and Robert Redford during those | Chamberlain. The film is presumed lost. The Actor and the Rube The Actor and the Rube is a 1915 American silent short film produced by the Thanhouser Company under the Falstaff brand. Written by Philip Lonergan and directed by Arthur Ellery, this was the first Falstaff release. The production was supervised by Edwin Thanhouser and produced at the New Rochelle studios. The plot of the film is about a cranky farmer, who, disliked by his entire town, decides to head to New York City. An actor disguises himself as the farmer and returns to the farmer's village and makes him | Penn of Pennsylvania Penn of Pennsylvania is a 1941 British historical drama film directed by Lance Comfort and starring Deborah Kerr, Clifford Evans, Dennis Arundell, Henry Oscar, Herbet Lomas and Edward Rigby. The film depicts the life of the Quaker founder of Pennsylvania, William Penn. It portrays his struggle to be granted a colonial charter in London and attracting settlers to his new colony as well as his adoption a radical new approach with regard to the treatment of the Native Americans. It is also known by the alternative title Courageous Mr. Penn. The idea of a film about Penn | John Paul Jones (film) John Paul Jones is a Technicolor 1959 biographical epic film in Technirama about John Paul Jones. The film, shot in Spain (Denia city), was made by Samuel Bronston Productions and released by Warner Bros. It was directed by John Farrow and produced by Samuel Bronston from a screenplay by John Farrow, Ben Hecht, and Jesse Lasky Jr. from the story "Nor'wester" by Clements Ripley. The music score was by Max Steiner, the cinematography by Michel Kelber. It was the final film directed by Farrow. The film starred Robert Stack in the title role, Marisa Pavan, Charles | Punahou School Crabbe ('27), who had won a gold medal in the 1932 Olympics, portrayed Tarzan, Flash Gordon, and Buck Rogers in film. Gerry Lopez ('66) is well known for surfing, but is also known as Subotai in "Conan the Barbarian". Teri Ann Linn ('79) provided the beauty in "The Bold and the Beautiful" for over eight years. Scott Coffey ('81) appeared in "Ferris Bueller's Day Off" and was in two films with Naomi Watts ("Tank Girl", "Mulholland Drive") before writing and directing her indie bio pic, "Ellie Parker". Amanda Schull ('96) had the lead role as an aspiring ballerina in "Center | Lucky Lady part." Reynolds' fee was reportedly $500,000, Seagal's $750,000. Reynolds said it was "very important" the film was a success "since my last three films went down the tubes." Segal later dropped out of the project and was quickly replaced with Hackman. Gene Hackman initially did not want to do the film, but 20th Century Fox kept offering him more and more money. Finally, Fox offered him $1.25 million, and according to talent agent Sue Mengers, "it was almost obscene for him not to do the film." "I was seduced," said Hackman. Filming began in Guaymas, Mexico in February 1975 and | 1,999,957 | Veguli Penn Veguli Penn () is a 1971 Indian Tamil-language drama film, directed by S. S. Devadoss and produced by S. M. Abdul Gaffar. It is based on the stage play "Vellikizhamai" by Kalaignanam and stars Gemini Ganesan and Devika. The film was released on 2 July 1971 to critical and commercial success. It also won the National Film Award for Best Feature Film in Tamil at the 19th National Film Awards. The film was S. S. Devadoss's first film, he handled the direction deftly and scored it. Inspector Ramu (Gemini Ganesan) and Janaki (Devika) are married for ten years | where was the movie velainu vandhutta vellaikaaran shot | who does the production of velyki perehony | when did the movie engal veettu mahalakshmi come out | who produced the movie pillaiyar kadaisi veedu | when was the movie neengadha ninaivu made | who wrote the screenplay of neerali movie in hindi | when was the movie idhaya veenai made | when was the movie neerparavai made |
1,999,958 | Marc Ostrofsky estimated he spends $60 - 70,000 on each girl every year . | How much money make off of birth control pills? | Imagine Mark Zuckerberg tries OSRS. He quickly becomes addicted, and his penchant for control rears its ugly head. He must own the OSRS economy. How many bonds does he need to buy? | How much does it cost for a couple to live a decent life? | How much money did terry raise up to this date? | How much is Marc zuckerberg worth? | Some shows, such as Friends, had each actor eventually being paid $1 million per episode plus all the other costs. How much do companies have to spend to get an ad on tv? | How much do males spend on clothes? | How much does a sitcom star make? | 1,999,958 | By . Daily Mail Reporter . PUBLISHED: . 19:28 EST, 17 May 2012 . | . UPDATED: . 19:28 EST, 17 May 2012 . A father with five daughters has spent $1.5 million paying for his girls' college education. Marc Ostrofsky, an Internet tycoon and best-selling author, tallied up the bill after spending $60,000 to $70,000 on each child every year. The entrepreneur, from Houston, will travel between three different states at opposite ends of the country this week to watch three of his daughters' graduation ceremonies. Scroll down for video . Happy family: Mr Ostrofsky, from Houston, Texas at his wedding to wife Beverley with their five daughters . High fliers: Mr Ostrofsky's five daughters will all attend colleges across the U.S. He begins in North Carolina to watch Kelly, 22, graduated from Duke before heading back to Texas to see his youngest daughter, 18-year-old Mary Grace's high school graduation. She will go on to attend Boston University. Along with his wife Beverley, he then flies to Washington University in St Louis to watch Shelly graduate. Twins Shelly and Kelly took the advice of George W. Bush, also the father of twins Jenna and Barbara, when they decided to go to different schools during a meeting with the former president. Jenna Bush attended the University of Texas while Barbara went to Yale. Advice: Twin daughters Shelly and Kelly took advice from former president George Bush when he told them to go to different colleges like his own twin daughters . Proud father: Mr Ostrofsky and his twine daughters who were crowned joint valedictorian at their school . Meanwhile another of Mr Ostrofsky's daughters Tracy, 20, is at the University of Denver and 23-year-old Maddy graduated last year from Berklee School of Music in Boston. The entrepreneur, from Houston, believes that in the future to be able to afford further education, students will follow a mixture of studies online and in the classroom. Success story: 23-year-old Maddy (blonde hair) graduated last year from Berklee School of Music in Boston . He told KHOU-TV: 'I think in the future it is going to be different. Not a lot of people are going to play that game.' Mr Ostrofsky made his millions in the telecoms and dot.com business along with starting and selling on magazines, trade shows and market research studies to earn a fortune. He sold Business.com for $7.5 million which earned him the title of most expensive domain name ever sold in The Guinness Book of World Records. He is also the bestselling author of Get Rich Click!: The Ultimate Guide to Making Money Online. Mr Ostrofsky graduated from the University of Texas with a degree in business administration and marketing. He beamed with pride when he told the local TV station about his daughters' achievements but when asked about the cost, added: 'Be careful what you wish for.' And the pricey studies may not end there after daughter Kelly decided she may want to pursue a PHD. According to FinAid.org in 2011, two-thirds of students graduating with four-year degrees were left with debt of around $23,186. Clever girls: Tracy, 20 (left) is studying at the University of Denver while Mary Grace, 18, graduates from high school this week and will head to Boston . Like minds: Mr Ostrofsky with real estate mogul Donald Trump (left) and Facebook founder Mark Zuckerberg . Friends in high places: The Internet entrepreneur meets with President Obama . | This may have been discussed before, but I've always wondered what Kimmy's parents did for a living | what are the daughters names of ted cruz and carol | are steve wozniak and scott wozniak related? | who is tendo's daughter in lifesigns | how old was jeb bush when he went to high school | What school obama daughters attend? | who was kenny mckinley roommate in college | WHat george W bush's daughters namse? |
1,999,959 | what did calvert vaux want to be | Penn–Calvert boundary dispute Pennsylvania should be and how the size of the Twelve Mile Circle should be judged. This meeting marked the beginning of the long legal dispute. Penn wanted his new colony to have access to the Chesapeake Bay, while Calvert was adamant that the 40th parallel should serve as the southernmost border of Pennsylvania and he insisted the lands on the Delaware Bay were included in the original 1632 charter for Maryland. Because the two could not agree, Penn decided to go to court. Both Penn and Calvert returned to England to participate in the case. By this time, the Duke | Anthony Calvert Anthony Calvert (1735–1809) was an English entrepreneur of the eighteenth century particularly noted for his activity as a slave trader. He was a partner of Camden, Calvert and King, one of the most prominent slave trading enterprises in London. They imported tea from China and cotton from India. He also became involved in the transportation of English convicts first to Africa and later to Australia. The partnership was also involved in South Sea whaling late in the 18th century. The firm had at least six vessels active in the trade in the years between 1782 and 1796. They | was most likely a gift from his father, Lord Baltimore, who had ensured that Calvert would be provided with lands and revenues. Calvert began construction on the house at Mount Airy in 1751, expanding it considerably, to create the house which still survives today. Building continued in spite of a fire, rumored to be arson, in 1752. By the 1770s Benedict Swingate Calvert controlled a large and profitable estate of around , with upwards of 150 slaves. He was also an enthusiastic horse breeder, training thoroughbreds and running them in competitions in Maryland and Virginia. According to the writer Abbe | was most likely a gift from his father, Lord Baltimore, who had ensured that Calvert would be provided with lands and revenues. Calvert began construction on the house at Mount Airy in 1751, expanding it considerably, to create the house which still survives today. Building continued in spite of a fire, rumored to be arson, in 1752. By the 1770s Benedict Swingate Calvert controlled a large and profitable estate of around , with upwards of 150 slaves. He was also an enthusiastic horse breeder, training thoroughbreds and running them in competitions in Maryland and Virginia. According to the writer Abbe | George Calvert, 1st Baron Baltimore pounds in the second Virginia Company in 1609, and a few months later a more substantial sum in the East India Company, which he increased in 1614. In 1620, Calvert purchased a tract of land in Newfoundland from Sir William Vaughan (1575–1641), a Welsh writer and colonial investor, who had earlier failed to establish a colony on the large subarctic island off the eastern coast of North America. He named the area of the peninsula as Avalon, after the legendary spot where Christianity was supposedly introduced to Roman Britain in ancient times. The plantation lay on what is now called | George Calvert (planter) date from 1795 to 1821, and illuminate the life of the Calverts' plantation household during the events leading up to and during the War of 1812. George Calvert was born at his father's plantation home of Mount Airy, Maryland, on February 2, 1768, the youngest son of Benedict Swingate Calvert, who was himself the illegitimate son of Charles Calvert, 5th Baron Baltimore, the penultimate Lord Proprietor of the Province of Maryland. George Calvert lived at the Riversdale plantation, also known as the Calvert Mansion, a five-part, large-scale late Georgian mansion with superior Federal interior, built between 1801 and 1807. Also | Which colonies did roger william and cecil calvert found? | What was the colony of Virginia named for? | 1,999,959 | Calvert Vaux Cottingham until the age of 26, becoming a skilled draftsman. In 1851, Vaux exhibited in London a collection of landscape watercolors made on a tour to the Continent, an exhibit that captured the attention of the American landscape designer and writer Andrew Jackson Downing, who many consider "The Father of American Landscape Architecture." Downing had traveled to London in search of an architect who would complement his vision of what a landscape should be. Downing believed that architecture should be visually integrated into the surrounding landscape, and he wanted to work with someone who had as deep an appreciation of | calvert vaux and frederick law olmsted designed which plan | Reflections of Calvert | how old was william blake richmond when he started his art career | who designed the mansion grouseland | when did george calvert live on the calverts | when was the first whitehall house built in maryland | where did the architect peter harrison come from | Subsoils and Foundation Design in Richmond, VA |
1,999,960 | what is the newest metal gear game | was toyed with, as Hideo Kojima said on 29 April 2013 that he always wanted to make one during "Metal Gear Solid V"s development, and Kojima reportedly requested to Platinum Games that the sequel to "" have Gray Fox fighting against nanomachine-empowered zombies. The game's development was hinted at on 17 December 2015, when Konami started recruiting for a new "Metal Gear" development staff. The game uses the Fox Engine. Konami Europe president Tomotada Tashiro described "Metal Gear Survive" as a "fresh take on the series' famed stealth elements", with a "unique co-op setting that is designed for a truly | when one of the event players by the name of "REDWINGS" took part in the tournament but cheated in order to win the prize. Many EU players have said he is the reason there hasn't been any tournaments since EC 2010 as he wasn't the only person to play unfairly. "Metal Gear Arcade" is a reworked arcade version of "Metal Gear Online" developed by Kojima Productions and released on December 20, 2010 in Japan. It features head controls and stereoscopic 3D rendering. On June 13, 2013, Hideo Kojima confirmed that a new "Metal Gear Online" would be included with "". | Kojima is off of Metal Gear now and I hope he creates another narrative that can match it, but the Metal Gear series is my all time favorite video game series and I'm really sad to see it go.
While Kojima hopefully gets back on his feet when his Konami contract is over, I'm looking for another game series to help me fill the void Metal Gear left behind.
The reason I loved Metal Gear so much is because of:
-The great overarching story that built upon itself
-The mix of seriousness and humor which created an unmatched charm
-Fantastic world building and interesting environments
And most importantly,
-The full cast of weird af characters all with their own quirks
I know that there wont be anything that will meet all these points, but anything close would be great.
At the moment I have Deadly Premonition and D4 on standby, but after that I dont know of any other game series that match these points.
After some searching though, I found the Yakuza series. I vaguely remember playing a bit of Yakuza 2 years ago, but that's it. So any Yakuza fans out there, I was wondering if the Yakuza series meets any of the strides that made Metal Gear stand out.
I've heard good things about the Yakuza series, but there's really not that much buzz around the series in the west. So basically, would a fan of Metal Gear enjoy the Yakuza series? | Metal Gear Acid , stylized as METAL GEAR AC!D, is a turn-based collectible card tactical RPG video game developed by Konami Computer Entertainment Japan for the PSP handheld game console. The game was first unveiled at E3 in May 2004, and was released in Japan on December 16, 2004, in North America on March 22, 2005, and in Europe on September 1, 2005. It was the first game in the "Metal Gear" series for the PSP. A Java ME version for mobile phones was released by Glu Mobile in titled "Metal Gear Acid Mobile". "Acid" focuses on turn-based tactics, using | than "", and 5% of copies sold by "". As of 2018, Konami's earnings report did not mention "Survive"s total sales, unlike the previous entries in the series and other games made by the company. Critics ultimately deemed the game as having underperformed in sales. Metal Gear Survive Metal Gear Survive is an action-adventure survival game developed and published by Konami. It was released worldwide for Microsoft Windows, PlayStation 4, and Xbox One in February 2018. It is the first "Metal Gear" game to be developed following the series' creator Hideo Kojima's departure from Konami in late 2015, and the | Metal Gear Solid Metal Gear Solid is an action-adventure stealth video game developed by Konami Computer Entertainment Japan and released for the PlayStation in 1998. The game was directed, produced, and written by Hideo Kojima, and serves as a sequel to the MSX2 video games "Metal Gear" and "", which Kojima also worked on. The game was in development since 1994, and had gameplay demos revealed in 1996 and 1997, before eventually releasing in 1998. The game follows Solid Snake, a soldier who infiltrates a nuclear weapons facility to neutralize the terrorist threat from FOXHOUND, a renegade special forces unit. | I’ve been thinking about this for a while now so I thought I’d put it out there. What would you guys think about a metal gear fighting game. It probably wouldn’t be like a classic fighting game like street fighter but probably something closer to eyes of heaven. | Metal Saga Metal Saga, known in Japan as , is a post-apocalyptic role-playing video game developed by Success and published by Atlus and Success. "Metal Saga" is the fourth game in the "Metal Max" series, the first one to reach the United States. Like previous games in the series, it follows an open, non-linear style of gameplay. The game received a mixed reception for its unconventional gameplay and dated graphics. The game mechanics are similar to that of most role-playing video games. Players travel between points of interest on an overworld map, during which point in time they can be | 1,999,960 | 360, and Xbox One. Ground Zeroes was much shorter than previous games and served as an introduction to the next game, "". The latest game in the series is "The Phantom Pain", which was released on September 1, 2015 for PlayStation 3, PlayStation 4, PC, Xbox 360, and Xbox One. Expanded re-releases of games in the series were produced as well, such as "Integral" ("Metal Gear Solid"), "Substance" ("Metal Gear Solid 2: Sons of Liberty"), and "Subsistence" (""). The series' portable installments are usually set outside the main storyline. "" was released for the Game Boy Color, and several games | Can I play Phantom Pain without Ground Zeroes? | The phantom pain on Xbox one | how many phantoms home games are there | what console was mega man zero 3 made for | what console did mega man zero 3 come out for | [Help] Which Phantom 2 do I have? | [PS1][unknown year]A 3d sci-fi shooter action game in which you collect crystals | Phantom Forces XBOX ONE Insight / Call Of Duty Robloxia at War release assumptions. |
1,999,961 | Major broadcasting stations making changes after popularity of cable dramas | Cable TV networks are using YouTube/social media and other streaming services to get more eyes than ever before on their content. It’s the easiest way to watch as many sports as you want, which is a huge audience. As well as getting millions of views during the original broadcast, some cable networks are putting all of their content on streaming services (e.g. ABC, Freeform, FX, Fox, and more are put right on Hulu). Shows like America’s Got Talent, SNL, and talk shows get millions of views on YouTube every day. Because of all of these extra eyes (which means extra revenue), I don’t think cable TV is going to die. Plus, it’s extremely easy and cheap to get cable TV nowadays with services like YouTube TV and Hulu with live TV. Traditional TV will always just be changing with the times. | by nearly 12 million viewers in the United States, most of which were in rural markets. Its rural audience share has ranked in the 30s, an extremely high number for any series, broadcast or cable. In 2014, "Entertainment Weekly" and "Variety" again noted a stagnation in reality television programs' ratings in the U.S., which they attributed to "The diminishing returns of cable TV's sea of reality sameness". They noted that a number of networks that featured reality programming, including Bravo and E!, were launching their first scripted shows, and others, including AMC, were abandoning plans to launch further reality programs; | How close are we to there being no need for traditional cable? The internet seems like a much more logical place for tv to be watched. Local stations could still be broadcasting over the air and satellite could be used in areas without fast internet.
EDIT: Or if they are not yet, will they be in the near future? | Market Competition, Station Ownership, and Local Public Affairs Programming on Broadcast Television | This is why you needn't be scared to invest yourself in a cable tv show. Because broadcast tv is FREE. Therefore, the producers have to get some kind of compensation for the time, effort, and money they invest into a new show. They are paid by the advertisers to show commercials during their broadcast, which is the majority, if not all, of their income. They are a slave to the advertisers. And if not enough people are actually watching a show regularly, those people are not being exposed to the advertising, which means that the advertisers have then lost money, which means they seek out better shows to invest in, which means that the shows get no funding or attention from the network (who pays the show's producers from the revenue from the advertisers) and therefore get cancelled to make room for shows that will get the viewers. Now, some shows are so good, that ballsy network execs will take a chance on them in the hopes that they will eventually grow into a big hit, with a lot of viewers, and therefore a lot of exposures to the advertisers that pay their salaries.\n\nWith cable, you don't have as much of a conflict of interest (yes, advertisers provide some of the revenue), but another part of their revenue comes from the cable companies, who charge the viewers monthly to be able to view certain networks. Because of this, those shows aren't necessarily such a slave to viewers, and can also afford to be a little more ballsy with their programming (and not be scared of the more timid advertisers disassociating with that kind of content). So cable shows can swear a little more, show a little more violence, etc. Not that broadcast shows can be just as good, if not better, without this kind of content (Lost, House); but imagine watching a broadcast-version of Rescue Me. I don't think it would be half the show it is without the allowance of the content that FX allows.\n\nSo keep all of this in mind and invest in shows wisely. Keep along with the ratings, because they almost always predict the future of a show. And you can't blame the networks as much as the American people for not also watching the show and keeping it alive. | The difference is that network television uses radio waves to carry the signal whereas cable television uses cables to carry radio frequency signals. | How were the current network TV stations decided? What if for example ABC went out of business and no longer broadcasted how would a new station be picked? Could a cable station become a network station? | Receives more channels than I expected. Good way for me to cut back on watching sports and allow me to save money but cutting cable. | 1,999,961 | SBS and MBC, two of the major terrestrial broadcasting stations, are changing the way they commission and broadcast dramas. This is reportedly in response to the increased competition from popular cable dramas.
*SBS’s new drama “The Fiery Priest” is scheduled to air on Fridays and Saturdays at 10 p.m. KST. This broadcast schedule necessitated moving “Law of the Jungle” to Saturdays at 9 p.m. KST. This was a big move for SBS, as “Law of the Jungle” has aired on Friday nights for 6 years. Moreover, this will be SBS’s first time airing a Friday-Saturday drama.*
This is thought to be in response to the fact that tvN and JTBC have been airing Friday-Saturday dramas for a long time. “Goblin” and “SKY Castle” were both Friday-Saturday dramas and topped 20 percent in viewership ratings. Viewers have now become accustomed to dramas airing in the Friday-Saturday time slot.
The three major terrestrial stations (KBS, SBS, MBC) have long been interested in the Friday-Saturday drama time slot, and SBS’s decision to implement this change now will likely affect the way that dramas on these stations air next year.
*Meanwhile, MBC has also ramped up its drama department with a focus on acquiring proven talent. They have chosen to air the next project of producing director Ahn Pan Suk, who hit it out of the park last year with “Pretty Noona Who Buys Me Food.” The drama will air sometime in May on MBC and both Jung Hae In and Son Ye Jin have been reported to be in talks to star.*
*MBC has also acquired “The Item,” which is Joo Ji Hoon‘s long-awaited return to the small screen. They have also chosen to shift away from the typical romantic comedy storyline and air projects like “The Banker,” starring Kim Sang Joong, Chae Si Ra, and Yoo Dong Geun, and “Lee Mong,” an ambitious period drama set during the Japanese colonial occupation.*
On the other hand, MBC has decided to reduce their amount of weekend dramas and are considering abolishing the Sunday drama time slot entirely in order to focus their resources on competing with cable dramas in other time slots.
What do you think of these changes?
Soompi | [2018-10-09] Discussion about TVB dramas of 2018. | what day of the week is dubbed on mbc max | when did sbs start being broadcast in australia | what is the name of the sbs sports channel | how many new hd channels were announced by the bbc in 2013 | how long does it take for world movies to air on sbs | what language does mbc 3 broadcast in | IPTV applications in the NGN environment |
1,999,962 | good book - made me go looking for more but ... | I could not put this book down, kept me intrigued the entire time. Would like to find more books like it. | Great book! I want to know more...need a sequel to this one! | Book was perfect and exactly what I was looking for. Will continue to search for more book like this. Thank you | I loved this book and have told everyone to get it. I'm looking for more of by this other. | Another excellent book by Willaim Kent Krueger. Hard to put down! | Exactly what I was looking for. Amazing book. Thank you | Book for a college class. Well written and came in good shape. | This was a good book but not good enough for me to look into the second book unless it's free. | 1,999,962 | good book - made me go looking for more but this is the 1st book with this character/story. I will keep watch for more adventures! | Amazing book. A lot of interesting characters that help ... | This book is such a fun read, filled with interesting and entertaining characters and ... | This was a great book! Enjoyed the characters | This book is very good. The characters are very interesting and the story ... | First book I've read from author and loved it! | This book was an awesome read. The characters are great and interesting | Loved this book and its characters | Excellent book - Interesting storyline with great characters |
1,999,963 | Design and kinematic characterization of a surgical manipulator with a focus on treating osteolysis | Nowadays robotic-based surgery is most promising one in medical field. Since the Total Knee Replacement (TKR) and Total Hip Replacement (THR) are increasing in numbers therefore it is a need for using the robots in these types of surgeries. Also, more precise bone removal rate is required in TKR and THR to fix the implants; therefore robots are needed to incorporate to remove the bone precisely. Lot of existing systems are based on industrial manipulators and also having high cost. Hence, there is a need for exclusively designing a robot for orthopaedic-related surgery with low cost and also by analyzing all the parameters involved in bone removal. So, this paper aims to design an orthopaedic surgical robot arm manipulator. The modeling results are presented and it showed reasonable matched outcome with the phantom models. Also the results are showing an encouraging trend in furthering this research. |
Introduction
Minimally invasive surgery (MIS) is featured by small trauma, less bleeding, light pain, and quick recovery [1]. As the second generation surgical robot, SPSR needs only one wound on patient's body instead of 3 to 5 wounds necessarily in traditional MIS. The limitation of wound reduces the injuries to people, but innovative manipulators need to be designed to perform essential motion [2]. Mainstream SPSRs can be divided into two types, one contains traditional discrete joint arm, and the other one adopts novel continuum manipulator. The first type has high positional accuracy and easy to control, but it needs relatively large wound. Wortman [3] devised an in vivo robot which contains two operation arms, whose motors are on the joints. Petroni [4] developed the SPRINT surgical platform including image system. Quaglia [5] presented SPRINT 2.0 with motors installed outside and tendons adopted to transmit force. The second type has miniature size and flexible movement, but control is complex and laden capacity is limited. Webster [6] and Wu [7] proposed the snake robots made of concentric pre-curved tubes. Xu [8] and Li [9] introduced a kind of manipulator in which the backbone is a continuous elastic structure in the centre and drivers are tendons distributed uniformly around. Du [10] and Gao [11] built continuum manipulators with different notches. Continuum manipulators have excellent flexibility and biocompatibility, but the existing ones still have the problem of poor control accuracy and insufficient laden capability. This paper designs a continuum manipulator with high rigidity, and a relatively precise kinematics model is established for control.
Overall design of the continuum manipulator
Analysing of existing SPSRs, this section presents a novel structure, a notched flexible continuum manipulator driven by tendons.
Design of the structure
Flexible hinges have many advantages such as no back, friction, gap and wear, small size and so on, which is widely used in many fields [12]. These features are also expected for the manipulator of SPSR, so this paper designs SFR based on the idea of flexible hinge. The crossed notches are fabricated on hyperelastic nitinol tube through wire cut electrical discharge machining (WEDM), and the continuum manipulator is a combination of several crossed SFRs whose bending planes are perpendicular to each other. The continuum manipulator is driven by two sets of drive tendons, each consisting of two tendons, which uniformly distribute in the tube. Each set of tendons controls forward and reverse bending on a plane. Combination of two sets can realize universal bending. The tendons are fixed at the top of the continuum manipulator and the flexible skeleton is installed internally to fit tendons, as shown in Figure 1.
Features of the continuum manipulator
The notched continuum manipulator achieves overall processing, and no connection friction extends the service life span. The manipulator has good flexibility and biocompatibility, which can avoid unnecessary damage to organs and issues during surgery. The tendons minimize the size, weight, and volume of the manipulator. Compared with our previous design, the crossed SFRs make one manipulator achieve two DOF, which improves control and movement dexterity. Also, according to the first-order natural frequency, the proposed manipulator overcomes insufficient rigidity which causes low capability. Figure 2 shows the results of finite element analysis by ANSYS, and each structure has four deformation units and similar key parameters.
Mechanics modelling of continuum manipulator
The mechanical properties of continuum manipulator are deduced. A SFR is divided into rigid region and elastic region. Stiffness characteristics are built using the theory of cantilever beam, and deformation for SFR is calculated by the iterative algorithm.
Analysis of SFR stiffness characteristics
Because of the complex shape of SFR, the following assumptions are put forward: deformation mainly concentrates on the rounded straight flexible part, and deformation outside this part is ignored; interference between different SFRs can be neglected because deformation is very small; the SFR is assumed to be fixed at one end and subjected to torque and force on the other end. The flat projection and structural parameters of SFR are shown in Figure 3. R is the outer radius of tube, b is the wall
1234567890''""
International Conference on Robotics and Mechantronics (ICRoM 2017) IOP Publishing IOP Conf. Series: Materials Science and Engineering 320 (2018) 012005 doi:10.1088/1757-899X/320/1/012005 thickness, t is the minimal width of flexible hinge, l is the length of straight hinge, r is the radius of rounded circle and h is the vertical distance between two SFRs. According to the actual loading situation, the main external forces on SFR are exerted by tendons. To describe stiffness characters, two variables are introduced: bending stiffness K θ is defined as the ratio of bending moment to corresponding bending angle; tension/compression stiffness K l is defined as the ratio of the tension/compression force to corresponding translation displacement [13]. E is the elastic modulus, which of nitinol is affected by the processing method, so actual elastic modulus is obtained by parameter identification. According to statics, K θ and K l of FNR can be calculated as follows. 3 3
Using calculus theory, the comparison between bending deformation and translation displacement under the same force is calculated, and the results show that the former one is much bigger than the latter one. To simplify the model, the following calculation assumes that the deformation only occurs on the bending plane.
Angle deformation of SFR
Angle deformation for the ith notch θ i is calculated using the iterative algorithm, and the computing process is as follows: for initial calculation, assume that there is no lateral pressure, then the bending angle θ i (0) for SFR is obtained; at this time lateral pressure F Ni (0) and friction force F fi (0) can be calculated; because of the aforementioned two forces, new deformation is derived, which is written as θ i (n) for the nth calculation; the difference between two adjacent calculations is viewed as objective functions; repeat the above process until the objective function tends to zero so the final angle deformation θ i is calculated. Here μ is the friction coefficient which is given by experience. The force diagram of SFR is shown in Figure 4. Equivalent bending moment equals to:
( )
x y y x M n F L F L (3)
Where F X and F Y are the decomposition of all the forces in Cartesian coordinate system, L X and L Y are the corresponding force arm, all of these related to deformation. The bending angle for the nth iterative algorithm can be calculated according to M(n) and K θ . Due to frictional forth and lateral pressure,
1234567890''""
International
Kinematics modelling of continuum manipulator
The kinematics model of continuum manipulator proposed in this paper regards the whole manipulator as a series robot, which divides the manipulator into several equivalent rigid links and joints. The initial subcoordinate system is established at the end of base SFR, the final subcoordinate system is established at the top of tip SFR, and other subcoordinate systems are established at the intersection of two tangents of adjacent SFRs. The coordinate system is shown in Figure 5. Table 1. α i is the twist angle of the link, l i is the length of the link, d i is the offset of the link, and β i is the rotation angle of the link.
α i π/2 -π/2 π/2 … π/2 -π/2 l i l 1 l 2 l 3 … l 2n-1 l 2n d i 0 0 0 … 0 0 β i θ 1 θ 2 θ 3 … θ 2n-1 θ 2n
Where β i is equal to the angle deformation θ i of the ith SFR, and l i can be calculated as follows: ( 2 ) tan( / 2) 1
( 2 ) tan( / 2) ( 2 ) tan( / 2) 1 2
( 2 ) tan( / 2) 2 1 i i i i i i i i i h l r i l h l r l r i n l r i n (4)
The transformation matrix between adjacent equivalent rigid joints can be expressed as:
i i i i i i i i i i i i i i i i i i i l d d (5)
The overall transformation matrix of the continuum manipulator from base coordinate system {0} to tip coordinate system {2n} can be written as:
0 0 1 2 1 2 1 2 3 T T T T i n i T (6)
The end position of the continuum manipulator can be obtained by equation (6). Calculated working space is shown in Figure 6.
Experiments and results
The test bed was constructed as shown in Fig.7. A prototype was machined for experiment, which had 8 notches in one bending direction (16 notches in total), and the effective length is 87.6mm. The multiple strand tendon adopted in experiment has a diameter of 0.45mm. The loading was exerted by the counterweight. Two CCD cameras were used in the experiment to take photos, and then angle deformation and spatial position were obtained by image processing using MATLAB software. Figure 6. Working space. Figure 7. Establishment of test bed.
Validation of mechanics model
One tendon was loaded each time, so the bending occurred in the plane. The load was applied from 0 to 2 kg by an increase of 0.2 kg, and then from 2 kg to 0 kg by a decrease of 0.2 kg. The actual bending angles under different loads were the average value of 5 cycles. The result between theoretical value and actual value is shown in Figure 8. The maximum deviation is 3.41%, which comes from model error, manufacturing error and image processing error.
Validation of kinematics model
Two tendons of different sets were loaded each time, so the bending occurs in the space. Different combinations of two tendons were applied. Each position two photos from different cameras were needed and the actual deformation displacement was obtained. The result between theoretical value and actual value is shown in Figure 9. The maximum deviation is 3.72%, which also comes from model error, manufacturing error and image processing error.
Conclusion
The tendon-driven continuum manipulator with crossed notches proposed in this paper is tractable, small, light, safe, and dexterous which can be used in SPSR. The mechanics model describes the manipulator as a variable curvature tube, while the kinematics model considers the manipulator as an equivalent series robot. Both of two models are relatively accurate when depict mechanical and kinematic properties characteristics respectively, and verified experimentally. Future study should focus on increasing accuracy and optimization. Inverse kinematics, force feedback and other issue also need to be considered in the future.
Acknowledgments
In this paper, the research was supported by the National Nature Science Foundation of China under Grant No. 61673139.
Figure 1 .
1Prototype.
Figure 2 .
2Results of stiffness analysis.
Figure 3 .
3Flat projection of SFR.
Figure 4 .
4Force diagram of SFR.
Figure 5 .
5Coordinate system of the continuum manipulator.The deformation angle of each SFR can be obtained according to the mechanics model in section 3, and` the D-H method can be applied to build kinematics model. This paper uses the Craig rule and D-H parameters are shown in
Figure 8 .
8Bending angel under one-direction load.
Figure 9 .
9Deformation displacement under two-direction load.
International Conference on Robotics and Mechantronics (ICRoM 2017) IOP Publishing IOP Conf. Series: Materials Science and Engineering 320 (2018) 012005 doi:10.1088/1757-899X/320/1/012005
Series: Materials Science and Engineering 320 (2018) 012005 doi:10.1088/1757-899X/320/1/012005 tendon force varies in different segments. Angle deformation for all SFRs can be obtained according to the varied equivalent tendon forces.Conference on Robotics and Mechantronics (ICRoM 2017)
IOP Publishing
IOP Conf.
Table 1 .
1D-H parameter table.Parameters
Number of notches
1
2
3
…
2n-1
2n
. B ; P I Mech Davies, Eng H, 214Davies B 2000 P I MECH ENG H 214 129-40
. M Gettman, EUR UROL. 59Gettman M T et al. 2011 EUR UROL 59 231-4
. T D Wortman, J M Mondry, S Farritor, D ; Ieee T Bio-Med Oleynikov, Eng, 60Wortman T D, Mondry J M., Farritor S M and Oleynikov D 2013 IEEE T BIO-MED ENG 60 926-29
. G Petroni, M Niccolini, S Caccavaro, C Quaglia, A Menciassi, S Schostek, G Basili, O Goletti, M Schurr, Dario P , SURG ENDOSC. 27Petroni G, Niccolini M, Caccavaro S, Quaglia C, Menciassi A, Schostek S, Basili G, Goletti O, Schurr M O and Dario P 2013 SURG ENDOSC 27 1932-7
. C Quaglia, G Petroni, M Niccolini, S Caccavaro, Dario P Menciassi, A , J MECH DESIGN. 136105001Quaglia C, Petroni G, Niccolini M, Caccavaro S, Dario P and Menciassi A 2014 J MECH DESIGN 136 105001
R J Webster, A Okamura, N J Cowan, IEEE/RSJ Int. Conf. on Intelligent Robots and Systems(Beijing). Webster R J, Okamura A M and Cowan N J 2007 IEEE/RSJ Int. Conf. on Intelligent Robots and Systems(Beijing) pp2857-63
. W Liao, S Shuang, K Wu, C Lim, H M And Ren, MED BIOL ENG COMPUT. 55Liao W, Shuang S, Wu K, Lim C M and Ren H 2017 MED BIOL ENG COMPUT 55 403-17
. K Xu, N Simaan, IEEE T ROBOT. 24Xu K and Simaan N 2008 IEEE T ROBOT 24 576-87
. Z Li, R Du, INT J ADV ROBOT SYST. 10Li Z and Du R 2013 INT J ADV ROBOT SYST 10 209-20
. Z Du, W Yang, W Dong, J MECH ROBOT. 741017Z Du, W Yang and W Dong 2015 J MECH ROBOT 7 041017
. A Gao, R Murphy, H Liu, I Iordachita, M Armand, IEEE-ASME T MECH. 22Gao A, Murphy R, Liu H, Iordachita I. and Armand M 2016 IEEE-ASME T MECH 22 465-75
Compliant mechanisms: design of flexure hinges. N Lobontiu, CRC press chapterLobontiu N 2002 Compliant mechanisms: design of flexure hinges CRC press chapter 1 pp 1-16
. Wu Y, Zhou Z, ENG MECH. 626WU Y and ZHOU Z 2002 ENG MECH 6 026
| Manipulator (device) assist the ability to pitch, roll, or spin the part for appropriate placement. An example would be removing a part from a press in the horizontal and then pitching it up for vertical placement in a rack or rolling a part over for exposing the back of the part. One of the types of manipulators is balanced manipulator type MSP-250, controlled by the operator's hand. Such manipulators are used in various industries. Where there are special requirements to protect against fire and explosion, they may be driven by compressed air. A welding manipulator can be either open arc or submerged | A statistical analysis of biomechanical manipulators is presented. The approach presented stems from studies of the properties of joint-actuated manipulators. Motivated by the kinesiological aspects of the human arm, it is demonstrated that biomechanical structures have better performances than standard manipulators. In fact, joint-actuated robotic structures are non-optimal because they have to support the direct impact of the operational requirements, while muscle-actuated arms are superior because they have anatomic levers and actuators more adapted to the transients required by the operational tasks. Therefore, these results are a step towards the design of a new generation of better mechanical manipulators. > | Robotics enables a variety of unconventional actuation strategies to be used for endoscopes, resulting in reduced trauma to the GI tract. For transmission of force to distally mounted endoscopic instruments, robotically actuated tendon sheath mechanisms are the current state of the art. Robotics in surgical endoscopy enables an ergonomic mapping of the surgeon movements to remotely controlled slave arms, facilitating tissue manipulation. The learning curve for difficult procedures such as endoscopic submucosal dissection and full-thickness resection can be significantly reduced. Improved surgical outcomes are also observed from clinical and pre-clinical trials. The technology behind master-slave surgical robotics will continue to mature, with the addition of position and force sensors enabling better control and tactile feedback. More robotic assisted GI luminal and NOTES surgeries are expected to be conducted in future, and gastroenterologists will have a key collaborative role to play. | The present invention relates to a robot system including high degree of freedom and the precision control procedure is surgical robot arm structure is improved, and so this possible. And the surgical robot arm according to the invention is surgical operation part is provided to be the procedure of one of the grip and the cut for the tissue at the surgical site, the driving unit providing a driving force to the sub-surgical operation and, between the operative working part and the drive unit arrangement is arranged between the translational motion independently by the driving force supplied from the driving unit surgical operation portion pitch (pitch) and a yaw (yaw) movement load unit and the surgical operating portion and a driving unit which in and by the driving force supplied from the driving unit the rotational motion is characterized in that it comprises a rotation unit for operating parts of surgical operation. | From the Publisher: ::: This unique book provides the fundamental knowledge needed for understanding the mechanics of both serial and parallel manipulators. Presenting fresh and authoritative material on parallel manipulators that is not available in any other resource, it offers an in-depth treatment of position analysis, Jacobian analysis, statics and stiffness analysis, and dynamical analysis of both types of manipulators, including a discussion of industrial and research applications. Robot Analysis is a first-rate text for upper-level undergraduate and graduate students in mechanical engineering, electrical engineering, and computer studies, as well as an excellent desktop reference for robotics researchers working in industry or in government. | This paper firstly described the technical performances required for the robot that could be used in the micro-surgery. Then it made a simple introduction to the prototype of Robot Assistant Micro-Surgery (RAMS) system. After an analysis to the typical operations of micro-surgeries, we developed a simple and practical motion planning algorithm based on S-curve. Both kinematical and dynamical simulations were carried out as verifications to its validity and efficiency. At last, the article presented the results of micro-surgical experiment with animal. | 1,999,963 | This paper presents a cable-driven dexterous manipulator with a large, open lumen. One specific application for the manipulator is the treatment of the degeneration of bone tissue (osteolysis) during a less-invasive hip revision surgery. Rigid tools used in traditional approaches limit the surgeons' ability to comprehensively treat the osteolysis due to the complex geometries of the lesion. The surgical scenario, testing, kinematic modeling, and image-based inverse kinematics are described. Testing shows 94% coverage of a lesion wall; the kinematic model describes manipulator notch positions within 0.15 mm, while the image-based inverse kinematics has 0.36 mm error. This manipulator is potentially useful in treating osteolytic lesions through (1) effective lesion exploration compared to conventional techniques, and (2) rapidly performing inverse kinematics from visual feedback. | Open reduction of congenital dislocation of the hip by Ludloff's method. | Single port surgical robot (SPSR) is a giant leap in the development of minimally invasive surgical robot. An innovative manipulator with high control accuracy and good kinematic dexterity can reduce wound, expedite recovery, and improve the success rate. This paper presents a tendon-driven continuum manipulator with crossed notches. This manipulator has two degrees of freedom (DOF), which possesses good flexibility and high capacity. Then based on cantilever beam theory, a mechanics model is proposed, which connects external force and deformation of a single flexible ring (SFR). By calculating the deformation of each SFR, the manipulator is considered as a series robot whose joint numbers is equal to SFR numbers, and the kinematics model is established through Denavit-Hartenberg (D-H) procedure. In this paper, the total manipulator is described as a curve tube whose curvature is increased from tip to base. Experiments were conducted and the comparison between theoretical and actual results proved the rationality of the models. | A popular design choice in current surgical robotics is to use mechanical cables to transmit mechanical energy from actuators located outside of the body, through a minimally invasive port, to instruments on the inside of the body. These cables enable high performance surgical manipulations including high bandwidth control, precision position control, and high force ability. However, cable drives become less efficient for longer distances, for paths that involve continuous curves, and for transmissions involving multiple degrees of freedom. In this paper, we consider the design tradeoffs for two methods of transmitting power through an access port with limited cross sectional area and curved paths -tendon/sheath mechanical transmissions and electrical wire transmissions. We develop a series of analytic models examining fundamental limits of efficiency, force and power as constrained by access geometry, material properties, and safety limits of heat and electrical hazards for these two transmission types. These models are used to investigate the potential of achieving the required mechanical power requirements needed for surgery with smaller access ports and more difficult access pathways. We show that an electrical transmission is a viable way of delivering more than sufficient power needed for surgery, highlighting the opportunity for next-generation actuators to enable more minimally invasive surgical devices. | A review of master-slave robotic systems for surgery | Error range in proximal femoral osteotomy using computer tomography-based navigation | The present paper describes a nonlinear optimization process to estimate the single cutting plane of an oblique osteotomy in the hip. This kind of osteotomy was introduced and practised by Charit (Research report 81, University of Witwaters brand, Johannesburg, 1981). We calculate the cutting plane in such a way that the postoperative coverage of the resulting two parts of the femur are as great as possible whereby some anatomical constraint conditions are fulfilled. Additionally a simplified preoperative planning is described by using a sphere lying on the femoral head and determined by a least-squares method. | Servo-controlled stepped and ramped mechanical tissue algometry. | Spinal anatomy is complex and in close vicinity of vulnerable anatomical structures, such as nerve roots, spinal cord, and blood vessels, requiring high precision in surgical procedures, while the surgical exposure is limited and even more limited in percutaneous procedures. A high risk of misplaced implants and/or high intraoperative radiation exposure are the consequences. Spinal navigation techniques have been introduced to alleviate these problems. The majority of reports on navigation document its role in increasing implant-placement accuracy and reducing intraoperative radiation. The technology is increasingly finding acceptance amongst spinal surgeons. This however does not yet present the end of the road. Robotic applications could be regarded as a coherent continuation of spinal navigation. We reviewed the literature pertaining to spinal navigation, as well as novel and upcoming robotic applications for spinal surgery. For this purpose, a Medline search using the terms "robot" and "spine" and extensive cross-reference analysis (using Medline, Ovid, and Web of Science data banks) were performed. The goal was to provide an overview of present achievements and novel developments in this fast-growing research area. While a number of robotic techniques are under investigation, mainly to aid navigated screw placement, the SpineAssist/Renaissance system has cleared US Food and Drug Administration approval and is in relatively wide clinical use. Another robotic system, the da Vinci, is currently applied in an increasing number of cases under research protocols. |
1,999,964 | what term refers to the way the tax rate moves from low to high | What type of tax is one that takes a smaller percetage of income from high-income people than from low-income people? | those with a higher ability-to-pay. The opposite of a progressive tax is a regressive tax, where the relative tax rate or burden decreases as an individual's ability to pay increases. The term is frequently applied in reference to personal income taxes, in which people with lower income pay a lower percentage of that income in tax than do those with higher income. It can also apply to adjustments of the tax base by using tax exemptions, tax credits, or selective taxation that creates progressive distribution effects. For example, a wealth or property tax, a sales tax on luxury goods, or | What would be the expected effect on the unemploment rate if the US goverment were to increase personal income tax rate? | The effect of tax cuts. Lower income tax rates increase the spending power of consumers and can increase aggregate demand, leading to higher economic growth (and possibly inflation). On the supply side, income tax cuts may also increase incentives to work – leading to higher productivity. | Economy of Ohio on new investment," provides a state-by-state comparison of tax liabilities. The top five states ranked with the lowest effective tax rate on new investment are: (1) Maine (3.0%); (2) Oregon (3.8%); (3) Ohio (4.4%); (4) Wisconsin (4.5%); and (5) Illinois (4.6%). According to the Small Business & Entrepreneurship Council, Ohio's top personal income tax rate ranks #25 . The rate has been steadily declining since the 2005 tax reform, dropping from $11,506.20 + 7.5% of excess over $200,000 in 2004 to $8,671.63 + 5.421% of excess over $208,500 in 2013. Ohio has replaced its corporate income tax with a gross | Deficit reduction in the United States taxes grew their economy 8.2%, all states with an income tax grew 6.3%, and the nine states without an income tax grew 5.2%. During 2012, Warren Buffett proposed establishing a minimum effective tax rate of 30% on taxpayers earning over $1 million. This became known as the Buffett Rule. Many high income taxpayers face lower effective tax rates because a significant portion of their income is derived from capital, which is taxed at a lower level than labor. The Tax Policy Center estimated that 217,000 households would be subject to the Buffett rule, with the average tax burden increasing $190,000, | I think the logic goes something like this. If you raise taxes for the rich, the rich are still going to find a way to make that money. The way they do that is by cutting jobs in order to make up for the loss they will take (happens all the time, the easiest way to cut costs is by not paying someone to work and divide his work among everyone else still employed). So by lowering their (big companies/the 1%) taxes, they will be able to employ more people under the assumption that 1) they have more money to do so 2) by having more money to do so they should also be able to get more work done aka put even more money into their pockets instead of having to cut down to make sure they are making the same as what they used to. | Domestic policy of the Ronald Reagan administration 1981 tax cut (-3% of GDP) and the revenue-gaining effects of the 1982 tax hike (~+1% of GDP), while subsequent bills were more revenue-neutral. However, tax revenue itself nominally increased massively by 103.1% from 1981 through 1989, largely as a result of more loopholes abolished than tax rates lowered. During the Reagan Administration, federal receipts grew at an average rate of 8.2% (2.5% attributed to higher Social Security receipts), and federal outlays grew at an annual rate of 7.1%. Reagan's administration is the only one not to have raised the minimum wage by its conclusion. Along with these, Reagan reappointed | 1,999,964 | Progressive tax A progressive tax is a tax in which the tax rate increases as the taxable amount increases. The term "progressive" refers to the way the tax rate progresses from low to high, with the result that a taxpayer's average tax rate is less than the person's marginal tax rate. The term can be applied to individual taxes or to a tax system as a whole; a year, multi-year, or lifetime. Progressive taxes are imposed in an attempt to reduce the tax incidence of people with a lower ability to pay, as such taxes shift the incidence increasingly to | what type of goods are taxed progressive tax on | social security is an example of a progressive tax? | what is the progressive tax rate for medicare | How would you design a progressive consumption tax? | From a pure fairness standpoint, is progressive tax not fair? | The traditional view of tax holds that consumption taxes fail to tax the yield to capital, whereas income taxes do, leading to John Stuart Mill's criticism of the income tax as a "double tax" on wealth that is saved. A better analytic understanding illustrates that there are two types of consumption taxes. A prepaid consumption or (equivalently) wage tax indeed ignores the yield to capital. But a consistent progressive postpaid consumption tax gets at such yield, at the individual level, when but only when the returns to capital are used to elevate lifestyles in material terms. Such a tax allows "ordinary" savings that move around labor earnings, in constant dollar terms, to different periods of an individual's life, such as times of retirement or heightened medical or educational needs. Because a progressive postpaid consumption tax falls on the yield to capital at the right time - when its use at the individual level becomes manifest - all other taxes on capital, such as capital gains, gift and estate, and corporate income taxes, can and should be repealed, in the name of fairness. | what is the term for the fixed sums of tax revenue paid by the farmer | what is the slope of progressive tax |
1,999,965 | An Android Systrace Extension for Tracing Wakelocks | My text messaging app has the notifications set to urgent and I've fiddled with many settings. However, the app still fails to wake my lock screen when I get a notification. I see it on my AOD, but have to manually wake my lock screen to view the message.
I know this sounds like a silly problem, but it's much more convenient for me to be able to look over at my phone when I hear a notification when I'm cooking or gaming rather than having to take my hands away from my task to wake my phone.
I know there may be other apps that can help with this problem, but I am wondering if there is a native solution.
My other apps, such as Whatsapp, works fine with waking the screen.
&#x200B;
I hope someone can offer me a solution. Thank you | Android provides native development kit through JNI for developing high-performance applications (or simply apps). Although recent years have witnessed a considerable increase in the number of apps employing native libraries, only a few systems can examine them. However, none of them scrutinizes the interactions through JNI in them. In this paper, we conduct a systematic study on tracking information flows through JNI in apps. More precisely, we first perform a large-scale examination on apps using JNI and report interesting observations. Then, we identify scenarios where information flows uncaught by existing systems can result in information leakage. Based on these insights, we propose and implement NDroid, an efficient dynamic taint analysis system for checking information flows through JNI. The evaluation through real apps shows NDroid can effectively identify information leaks through JNI with low performance overheads. | (the graph)
Last night I installed the app Sleep Cycle for Android. I'm always tired, sluggish, so I thought I might try using a tracker alarm app.
I look at all the other graphs posted and they have a peak and then a dip 5 or so times. I've only got one peak and the rest is apparently deep sleep?
Thanks all | An earlier Tasker solution had been implemented by triggering on the presence or absence of your home WiFi. Based on the results one would set the **lock\\\_screen\\\_lock\\\_after\\\_timeout** value to a long time at home (say 12 Hours) or a short time away (say 5 minutes). This worked very well.
Now—based only on a Stock Moto X Pure V7.0 and Galaxy S9 Oreo, Galaxy s10+ Pie— setting a long value results in the phone not honoring that value. Reading back the **lock\\\_screen\\\_lock\\\_after\\\_timeout** value shows the same value as was set.
&#x200B;
On the S10, the "Settings=>Secure lock Settings=>Lock automatically settings" range from Immediately to 30 minutes. If , in Tasker, you write a timeout value of 1800001 (30 Minutes and 1 msec) or higher, the real life timeout will generally be 30 minutes. Your mileage may vary—the Moto X behavior when not using one of the default timeout settings was interesting. Anyway writing values of 45 minutes, 1h, or 12Hours just don't work!
&#x200B;
In any event, I have tried to reset the timeout clock by periodically forcing display on, wait a few seconds, then turn display off. No luck. It seems to me that something with Wake Locks could solve this, but I haven't been able to "grok" the whole wake, light sleep, deep sleep, lock, partial unlock, etc.
&#x200B;
Can someone point me in the right direction. Google searches have led me down a lot of rabbit holes. In some, less than proficient way, I can use Android studio, do some, Java ,HTML-CSS-Javascript, and more so I am willing to dig in!!
&#x200B;
Thanks for listening, Jim
\[Help\] | Android represents an ever-increasing share of the worldwide smart device market. The platform's ubiquity and open nature make Android a prime target for malicious actors. Unfortunately, device fragmentation among manufacturers makes maintaining cyber security difficult, invoking the need for third party security software. We present a framework for detecting and countering deceptive user interface attacks on the Android platform via inspection and analysis of inter-process communication transactions in the operating system. We evaluate our proof of concept implementation on a known class of malware that exploits the Android display system, allowing a malicious application to control the screen and mimic any application launched by the user. We achieve 100% detection rate of this malicious behavior with no false alarms. | Did anybody write a desktop app that can detect when you walk away (because the Mi Band goes out of range or something) and locks the screen?
I'm using OS X, but any pointers on this subject will be appreciated. | Not sure of this is the place to add this, I like what you guys have done so far, but one big suggestion that would keep me in the official app rather than RIF would be adding AMOLED support in the dark/night mode on Android devices. Otherwise, great job! | This annoyed me for ages but I found a way to do it. If you already know, that's great... but I was frustrated with this problem for years and there isn't any info if you search.
To trigger your lifx lights with your native android clock alarm app you just use the app notifications as a trigger. If android application "clock" sends notification "alarm" then blink lifx red 15 times.
Applet ID 96108459d
Thanks. | 1,999,965 | Most of Android users have experienced issues with the battery life. One cause of battery drainage is the usage of the Wakelocks, which keep the CPU in working mode to enable applications to perform work in the background, such as communicating with their servers or collecting GPS information. Without acquiring the Wakelocks, the application might degrade its user experience. For instance, an SNS application might receive messages from other users with delay. However, the improper usage of Wakelocks could result in poor battery life. Being aware of the behavior and the usage of Wakelocks in particular applications in real-time can help Android developers to solve the problem of improper Wakelock usage. This paper introduces a tool for fine-grain tracing of both application and kernel Wakelocks by extending the Android Systrace. This tool enables developers to have a more detailed view of their application Wakelocks as well as the system Wakelocks so that they can achieve better power optimization. | diagnostics.client.wakelock destroying battery life | Noninvasive Fine-Grained Sleep Monitoring Leveraging Smartphones | Sleep deprivation is a public health concern that significantly impacts one's well-being and performance. Sleep is an intimate experience, and state-of-the-art sleep monitoring solutions are highly-personalized to individual users. With a motivation to expand sleep monitoring at a large-scale and contribute sleep data to public health understanding, we present WiSleep, a sleep monitoring and analytics platform using smartphone network connections that are passively sensed from WiFi infrastructure. We propose an unsupervised ensemble model of Bayesian change point detection to predict sleep and wake-up times. Then, we validate our approach using ground truth from a user study in campus dormitories and a private home. Our results find WiSleep outperforming established methods for users with irregular sleep patterns while yielding comparable accuracy for regular sleepers with an average 79.5% accuracy. This is comparable to client-side based methods, albeit utilizing only coarse-grained information. Finally, we show that WiSleep can process data from 20,000 users on a single commodity server, allowing it to scale to large campus populations with low server requirements. | I have a problem with android system and play service wakelocks | [Help] Launching app while device is sleeping | Android is becoming ubiquitous and currently has the largest share of the mobile OS market with billions of application downloads from the official app market. It has also become the platform most targeted by mobile malware that are becoming more sophisticated to evade state-of-the-art detection approaches. Many Android malware families employ obfuscation techniques in order to avoid detection and this may defeat static analysis based approaches. Dynamic analysis on the other hand may be used to overcome this limitation. Hence in this paper we propose DynaLog, a dynamic analysis based framework for characterizing Android applications. The framework provides the capability to analyse the behaviour of applications based on an extensive number of dynamic features. It provides an automated platform for mass analysis and characterization of apps that is useful for quickly identifying and isolating malicious applications. The DynaLog framework leverages existing open source tools to extract and log high level behaviours, API calls, and critical events that can be used to explore the characteristics of an application, thus providing an extensible dynamic analysis platform for detecting Android malware. DynaLog is evaluated using real malware samples and clean applications demonstrating its capabilities for effective analysis and detection of malicious applications. | Wake Lock Burning through battery | Automated Testing of Energy Hotspots and Defects for Android Applications |
1,999,966 | who is the duke electric car club president | Benjamin Newton Duke in 1890 became vice-president of the American Tobacco Company. In 1892, the Duke family opened their first textile business in Durham, North Carolina, with Benjamin Duke at its head. In 1905, he and his brother James founded the Southern Power Company, which later became known as Duke Energy. The company initially supplied electrical power to the Duke textile factory. Within two decades, their power facilities had been greatly expanded, and they were supplying electricity to more than 300 cotton mills and other industrial companies through an electrical grid that supplied cities and towns in the Piedmont Region of North and | First president to ride in car on his inaugral? | Simon Garber Simon Garber is President and CEO of several taxi cab companies including Yellow Cab SLS Jet Management Corp in New York City and Chicago Carriage Cab Company in Chicago. Garber's companies are estimated to have the highest number of medallions in both Long Island City and Chicago, earning Garber the nickname of "Taxi King". Garber's cab companies have been involved in several scandals including the illegal use of salvaged police cars in the Chicago fleet and overcharging cab drivers in New York for leasing a medallion. In 2009, Garber founded the International Polo Club of Colts Neck near | he and his longtime manager, Mel Krupin, were no longer friends, for Mr. Krupin had decided to open his own version of "Duke's" down the street, called "Mel Krupin's" and complete with pickles and onion rolls. As Mr. Krupin told it, he had been led to believe that Mr. Zeibert would never reopen. The Restaurant Association Metropolitan Washington (RAMW) has named an annual award after Duke Zeibert, who was its first recipient in 1994. The Duke Zeibert Capital Achievement Award is presented at the Annual Restaurant Awards Gala, THE RAMMYS to a member of the community whose dedication and leadership | first president; Charles Alexander, Baron de Cosson, (from a family of French Revolution emigrees) born in Durham 28 August 1846. Vice-President was Robert Alexander Hillingford, (1825–1904) with Joseph Grego as its Secretary. It was limited to 20 members, whose meetings were held at members' homes. Members are known to include Sir Richard Burton; Egerton Castle; Sir Walter Pollock; John Camden Hotten; Arthur Charles Fox-Davies; John Forster; and Edward McDermott. A Kernoozers Club meeting was featured in the Magazine of Art (1889; Cassell & Co,) also referred to as ""a club of armour virtuosi"," by "The New York Times"; Identical arm | Is Thomas Jefferson a vice president? | Who invented ford vehicles? | James Buchanan Duke partners and shareholders. In 1906, the American Tobacco Company was found guilty of antitrust violations, and was ordered to be split into four separate companies: American Tobacco Company, Liggett and Myers, R.J. Reynolds, and the P. Lorillard Company. In 1892, the Dukes opened their first textile firm in Durham, North Carolina, that was run by his brother Benjamin. At the turn of the century, Buck organized the American Development Company to acquire land and water rights on the Catawba River. In 1904, he established the Catawba Power Company and the following year he and his brother founded the Southern Power | 1,999,966 | Duke Electric Vehicles at the 2018 Shell Eco-Marathon Americas at Sonoma, CA. The innovations in Gemini's electrical system and fuel cell research also earned it a technical innovation award at the 2018 Shell Eco-Marathon Americas. Research and implementation of the new powertrain was led by Gerry Chen and Shomik Verma, under the supervision of club president Patrick Grady. Experimental schematics of the system were made available online. = Guinness World Record = On July 21, 2018, Duke Electric Vehicle's "Maxwell" hydrogen fuel cell vehicle achieved the world record for the most fuel efficient prototype vehicle. The vehicle's efficiency is recorded as 0.01614 liters | Many railway vehicles use diesel as their energy source but exhaust emissions and concerns about economical fuel supply demand alternatives. Railway electrification is not cost effective for some routes, particularly low-traffic density regional lines. The journey of a regional diesel–electric train is simulated over the British route Birmingham Moor Street to Stratford-upon-Avon and return to establish a benchmark for the conceptual design of a hydrogen-powered and hydrogen-hybrid vehicle. A fuel cell power plant, compressed hydrogen at 350 and 700 bar, and metal-hydride storage are evaluated. All equipment required for the propulsion can be accommodated within the space of the original diesel–electric train, while not compromising passenger-carrying capacity if 700 bar hydrogen tanks are employed. The hydrogen trains are designed to meet the benchmark journey time of 94 min and the operating range of a day without refuelling. An energy consumption reduction of 34% with the hydrogen-powered vehicle and a decrease of 55% with the hydrogen-hybrid train are achieved compared with the original diesel–electric. The well-to-wheel carbon dioxide emissions are lower for the conceptual trains: 55% decrease for the hydrogen-powered and 72% reduction for the hydrogen-hybrid assuming that the hydrogen is produced from natural gas. | Development of fuel cell technology for vehicular applications. Annual report, October 1, 1977-September 30, 1978 | Vacuum booster unit and electric motor car | what is the planned efficiency of the electromagnetic aircraft launch system | This product is remarkable! it has improved fuel mileage ... | Market prospects, design features, and performance of a fuel cell-powered scooter | ECON330 as my Upper Level Econ Elective? | The likelyhood of an OEM electric booster in the 2018 BRZ |
1,999,967 | who gave uqba ibn nafi the title conqueror of africa | Utba ibn Abi Sufyan ibn Harb () was a member of the Umayyad ruling family and served as the Umayyad governor of Egypt in 664–665, during the reign of his brother, Caliph Mu'awiya I.
Life
Utba was a son of Abu Sufyan ibn Harb of the Banu Umayya and Hind bint Utba ibn Rabi'a ibn Abd Shams. Under Caliph Umar ibn al-Khattab (), he was charged with collecting the sadaqat (tribute) from the Kinanah tribe based around Mecca. He sought to use the money collected from them towards trade. He fought alongside most of the Quraysh led by the Islamic prophet Muhammad's wife A'isha against Muhammad's cousin, Caliph Ali (), in the Battle of the Camel near Basra in 656. In the immediate aftermath of Ali's victory, Utba took refuge with A'isha and avoided giving allegiance to Ali. He soon after managed to escape to Damascus, where his brother, Mu'awiya ruled as governor of Syria. In the alliance negotiations between Mu'awiya and Amr ibn al-As, Utba pressed his brother to accept Amr's offer of receiving the lifetime governorship of Egypt in return for his support against Ali. Utba was later part of Mu'awiya's retinue during the Battle of Siffin against Ali in 657. Mu'awiya became caliph in 661 and appointed Utba to lead the annual Hajj pilgrimage to Mecca in March 662.
Following the death of Amr in 664, Utba was appointed governor of Egypt. He strengthened the Muslim Arab presence and elevated the political status of Alexandria by attaching 12,000 Arab troops to the city and constructing a Dar al-Imara (governor's palace). The Dar al-Imara was intended to serve as the residence of the Arab governor of the province, who was based in Fustat. Utba was the first Arab governor of Egypt recorded to have visited Alexandria by the Arabic sources, though Amr is implicitly said to have entered the city as governor, according to al-Baladhuri. Nonetheless, Utba remained concerned that troop numbers in Alexandria remained insufficient and vulnerable to the large, local Christian population there. Utba died in office in 665, and was succeeded by the muleteer of Muhammad, Uqba ibn Amir. According to the 9th-century historian al-Tabari, however, Utba led the Hajj in February 667, and he or his brother Anbasa led it again the following year, in January 668.
Utba's son al-Walid went on to serve as governor of Medina under Mu'awiya and his son and successor, Caliph Yazid I (). A descendant of Utba, Abd Allah ibn Muhammad al-Utbi was recorded as a source of information in the history of al-Tabari.
References
Bibliography
660s deaths
7th-century Arabs
7th-century Umayyad governors of Egypt
Year of birth unknown
Umayyad dynasty | Utbah ibn Ghazwan Utbah ibn Ghazwan (عُتبة بن غَزْوان) (c.582-639) was a well-known companion of the Islamic prophet Muhammad. He was the seventh person to convert to Islam and participated in the "hijra" to Abyssinia, but returned to stay with Muhammad in Mecca before making the second "hijrah" to Medina. He fought at the battle of Badr (624), the battle of Uhud (625), the Battle of the Trench (627) and many others, including the battles of Yamamah. During the caliphate of Umar (r. 634–644), Utbah commanded a force of 2,000 men in a campaign against Ubullah which lasted from June | Utbah ibn Ghazwan Utbah ibn Ghazwan (عُتبة بن غَزْوان) (c.582-639) was a well-known companion of the Islamic prophet Muhammad. He was the seventh person to convert to Islam and participated in the "hijra" to Abyssinia, but returned to stay with Muhammad in Mecca before making the second "hijrah" to Medina. He fought at the battle of Badr (624), the battle of Uhud (625), the Battle of the Trench (627) and many others, including the battles of Yamamah. During the caliphate of Umar (r. 634–644), Utbah commanded a force of 2,000 men in a campaign against Ubullah which lasted from June | Abu Abdallah al-Shi'i Abu Abdallah al-Husayn ibn Ahmad ibn Zakariyya al-Shi'i (, "Abū ʿAbd Allāh ash-Shi'ī"; died 28 February 911) was a "Da'i" for the Isma'ilis in Yemen and North Africa, mainly active among the Kutama Berbers, whose teachings and conquest of Ifriqiya gave rise to the Fatimid Caliphate. He was born in Kufa in Iraq (or Sanaa, according to some accounts) and was active in the administration of the Abbasid Caliphate, before he began to associate with Ismaili teachers. At first he proselytised under the guidance of Ibn Hawshab in Yemen and Mecca. During a pilgrimage to Mecca in | tradition and also another tradition in which Muhammad has said, 'Ali and I are the father of this People[ i.e., Muslims ]' as the following,<br> Abu Turab Abu Turab () or "Father of Soil", is a title attributed to Imam Ali ibn Abi Talib, the fourth Caliph. According to narrations the title was given to Ali by Muhammad, when he found Ali sleeping while covered with soil. Abu Turab means "Father of Soil". There is a verse in Quran that says,' Indeed, We have warned you of a near punishment on the Day when a man will observe what his | Fromherz, drawing on medieval Arabic and Berber sources, analyses the myths and history surrounding the origins and rise of the Almohad Empire. He shows how Muhammad Ibn Tumart, the son of a minor Berber tribal chief, set off on his mission to reform Islam, then at a low point in its history, battered by the crusades, having lost Jerusalem and been undermined by weak spiritual and political leadership. Muhammad Ibn Tumart was proclaimed Mahdi - one who would herald the golden age of Islam - provided charismatic leadership, unwavering adherence to a fundamentalist monotheistic Islam enforced by holy war, established tribal unity, effective administration and a formidable military force. Ibn Tumart and his legacy were to prove the launch pad for empire, leading to Almohad domination of the western Mediterranean from Tunisia to Morocco and Andalusia. | of consensus for this reason in high esteem. Modern scholarship has suggested that this interest was motivated by the desire of Shi'ite theoligans to impugn the character of the first three leaders of the Rashidun Caliphate, Abu Bakr, Umar and Uthman. Ibrahim an-Nazzam Abū Isḥāq Ibrāhīm Ibn Sayyār Ibn Hāni‘ an-Naẓẓām () (c. 775 – c. 845) was a Mu'tazilite theologian and poet. He was a nephew of the Mu'tazilite theologian Abu al-Hudhayl al-'Allaf, and al-Jahiz was one of his students. His theological doctrines were not accepted by his contemporaries and his works are lost except for a few fragments. | al-Hazmi (, ) is an Arabic family name.
People
Nawaf al-Hazmi (1976–2001), Saudi hijacker of American Airlines Flight 77
Salem al-Hazmi (1981–2001), Saudi hijacker of American Airlines Flight 77
Arabic-language surnames | 1,999,967 | not prevented me, I would have galloped on for ever like Alexander the Great, upholding your faith and fighting the unbelievers!" Edward Gibbon, referring to Uqba ibn Nafi as "Akbah", gives him the title "conqueror of Africa," beginning his story when he "marched from Damascus at the head of ten thousand of the bravest Arabs; and the genuine force of the Moslems was enlarged by the doubtful aid and conversion of many thousand Barbarians." He then marched into North Africa. Gibbon continues: "It would be difficult, nor is it necessary, to trace the accurate line of the progress of Akbah." | Ultimately , the superiority of the Egyptian troops and firearms ensured the defeat of the Shaigiya and the subsequent conquest of the Sudan . | who was the warlord executed by gengshi | [DIPLOMACY]Muslim missionaries sent to Madagascar by order of Imam Muhammad ibn Ismail! | who wrote the book on human sacrifice in benin | ibrahim ibn al-ashtar fought for which ruler | Can someone tell me a little something about "Abu'l Misk Kafur, a black ex-slave, a eunuch of fabled ugliness, who had ruled Egypt with skill and vision for 22 years(946-68)"? | who provided camel support during the egyptian conquest of sudan | how much camels were captured in the expedition of dhu qarad |
1,999,968 | Compact finite difference relaxation method for chaotic and hyperchaotic initial value systems | In the present paper the variation of parameters method for the N -th-order non-homogeneous linear ordinary difference equations with constant coefficient is introduced by means of the delta exponential function \( e_p(t,s)\) . Thanks to this new advantageous approach, one can investigate the solution of higher-order difference equations which can be considered important for many mathematical models. Moreover, we bring forth the method with three difference eigenvalue problems involving the second-order Sturm-Liouville problem, called one-dimensional Schrodinger equation, with Coulomb potential, hydrogen atom equation and the fourth-order relaxation difference equation. Sum representations of the solutions of the second-order discrete Sturm-Liouville problem having Coulomb potential and hydrogen atom equation are found out. In addition, we get analytical solution of the fourth-order discrete relaxation problem by the variation of parameters method via delta exponential and delta trigonometric functions. | We present a higher order generalization for relaxation methods in the framework pre- sented by Jin and Xin in (10). The schemes employ general higher order integration for spatial dis- cretization and higher order implicit-explicit (IMEX) schemes or Total Variation diminishing (TVD) Runge-Kutta schemes for time integration of relaxing or relaxed schemes, respectively, for time inte- gration. Numerical experiments are performed on various test problems, in particular, the Burger's and Euler equations of inviscid gas dynamics in both one and two space dimensions. In addition, uniform convergence with respect to the relaxation parameter is demonstrated. | In this paper, we analyze finite difference schemes for Benjamin-Ono equation, u_t = uu_x + Hu_{xx}, where H denotes the Hilbert transform. Both the decaying case on the full line and the periodic case are considered. If the initial data are sufficiently regular, fully discrete finite difference schemes shown to converge to a classical solution. Finally, the convergence is illustrated by several examples. | Sufficient conditions for the oscillation of some nonlinear difference equations are established. |
Introduction
Difference equations have played an important role in analysis of mathematical models of biology, physics and engineering. Recently, there has been a great interest in studying properties of nonlinear and rational difference equations. One can see [3,7,9,10,11,12,13,14,16,17] and the references therein.
In [8], E.M. Elsayed determined the solutions to some difference equations. He obtained the solution to the difference equation (1.1) x n+1 = x n−3 1 − x n−1 x n− 3 , n = 0, 1, ...
where the initial conditions are arbitrary nonzero positive real numbers. But he didn't point to any constraints on the initial conditions. In fact, if we start with initial conditions x 0 = 2, x −1 = 1, x −2 = 1, x −3 = 0.5 in equation (1.1), then undefined value for x 3 will be obtained. Therefore, additional information about the initial conditions must be given for any solution of equation (1.1) to be well-defined.
In [4], M. Aloqeili discussed the stability properties and semicycle behavior of the solutions of the difference equation
x n+1 = x n−1 a − x n x n−1 , n = 0, 1, . . .
with real initial conditions and positive real number a.
In [1], we have discussed the oscillation, boundedness and the global behavior of all admissible solutions of the difference equation
x n+1 = Ax n−1 B − Cx n x n−2 , n = 0, 1, . . .
where A, B, C are positive real numbers.
In [2], we have also discussed the oscillation, periodicity, boundedness and the global behavior of all admissible solutions of the difference equation
x n+1 = Ax n−2r−1 B − C ∏ k i=l x n−2i , n = 0, 1, . . .
where A, B, C are positive real numbers.
In [5], the authors investigated the asymptotic behavior of solutions of the equation
x n+1 = ax n−1 b + cx n x n−1 , n = 0, 1, . . .
with positive parameters a and c, negative parameter b and nonnegative initial conditions. In [6], they also used the explicit formula for the solutions of the equation
x n+1 = ax n−1 b + cx n x n−1 , n = 0, 1, . . .
with positive parameters and nonnegative initial conditions in investigating their behavior.
In [15], H. Sedaghat determined the global behavior of all solutions of the rational difference equations
x n+1 = ax n−1 x n x n−1 + b , x n+1 = ax n x n−1 x n + bx n−2 , n = 0, 1, . . .
where a, b > 0. In this paper, we introduce an explicit formula and discuss the global behavior of solutions of the difference equation
(1.2) x n+1 = ax n−3 b − cx n−1 x n−3 , n = 0, 1, . . .
where a, b, c are positive real numbers and the initial conditions x −3 , x −2 , x −1 , x 0 are real numbers.
Solution of Equation (1.2)
We define α i = x −2+i x −4+i , i = 1, 2. Theorem 2.1. Let x −3 , x −2 , x −1 and x 0 be real numbers such that for any i ∈ {1, 2}, α i ̸ = b c ∑ n k=0 ( a b ) k for all n ∈ N. If a ̸ = b, then the solution {x n } ∞ n=−3 of equation (1.2) is (2.1) x n = x −3 ∏ n−1 4 j=0 ( b a ) 2j θ1−c ( b a ) 2j+1 θ1−c , n = 1, 5, 9, ... x −2 ∏ n−2 4 j=0 ( b a ) 2j θ2−c ( b a ) 2j+1 θ2−c
, n = 2, 6, 10, ...
x −1 ∏ n−3 4 j=0 ( b a ) 2j+1 θ1−c ( b a ) 2j+2 θ1−c , n = 3, 7, 11, ... x 0 ∏ n−4 4 j=0 ( b a ) 2j+1 θ2−c ( b a ) 2j+2 θ2−c , n = 4, 8, 12, ... where θ i = a−b+cαi αi , α i = x −2+i x −4+i , and i = 1, 2.
Proof. We can write the given solution as
x 4m+1 = x −3 m ∏ j=0 ( b a ) 2j θ 1 − c ( b a ) 2j+1 θ 1 − c , x 4m+2 = x −2 m ∏ j=0 ( b a ) 2j θ 2 − c ( b a ) 2j+1 θ 2 − c , x 4m+3 = x −1 m ∏ j=0 ( b a ) 2j+1 θ 1 − c ( b a ) 2j+2 θ 1 − c , x 4m+4 = x 0 m ∏ j=0 ( b a ) 2j+1 θ 2 − c ( b a ) 2j+2 θ 2 − c , m = 0, 1, . . .
It is easy to check the result when m = 0. Suppose that the result is true for m > 0. Then
x 4(m+1)+1 = ax 4m+1 b − cx 4m+1 x 4m+3 = ax −3 ∏ m j=0 ( b a ) 2j θ1−c ( b a ) 2j+1 θ1−c b − cx −3 ∏ m j=0 ( b a ) 2j θ1−c ( b a ) 2j+1 θ1−c x −1 ∏ m j=0 ( b a ) 2j+1 θ1−c ( b a ) 2j+2 θ1−c = ax −3 ∏ m j=0 ( b a ) 2j θ1−c ( b a ) 2j+1 θ1−c b − cx −3 ( ∏ m j=0 ( b a ) 2j θ 1 − c)x −1 ∏ m j=0 1 ( b a ) 2j+2 θ1−c = ax −3 ∏ m j=0 ( b a ) 2j θ1−c ( b a ) 2j+1 θ1−c b − cx −1 x −3 (θ 1 − c)( 1 ( b a ) 2m+2 θ1−c ) = ax −3 (( b a ) 2m+2 θ 1 − c) ∏ m j=0 ( b a ) 2j θ1−c ( b a ) 2j+1 θ1−c b(( b a ) 2m+2 θ 1 − c) − cα 1 (θ 1 − c) = ax −3 (( b a ) 2m+2 θ 1 − c) ∏ m j=0 ( b a ) 2j θ1−c ( b a ) 2j+1 θ1−c b(( b a ) 2m+2 θ 1 − c) − c(a − b) = x −3 (( b a ) 2m+2 θ 1 − c) ∏ m j=0 ( b a ) 2j θ1−c ( b a ) 2j+1 θ1−c b a (( b a ) 2m+2 θ 1 − c) − c a (a − b) =x −3 ( b a ) 2m+2 θ 1 − c) (( b a ) 2m+3 θ 1 − c) m ∏ j=0 ( b a ) 2j θ 1 − c ( b a ) 2j+1 θ 1 − c =x −3 m+1 ∏ j=0 ( b a ) 2j θ 1 − c ( b a ) 2j+1 θ 1 − c .
Similarly we can show that
x 4(m+1)+2 = x −2 m+1 ∏ j=0 ( b a ) 2j θ 2 − c ( b a ) 2j+1 θ 2 − c , x 4(m+1)+3 = x −1 m+1 ∏ j=0 ( b a ) 2j+1 θ 1 − c ( b a ) 2j+2 θ 1 − c and x 4(m+1)+4 = x 0 m+1 ∏ j=0 ( b a ) 2j+1 θ 2 − c ( b a ) 2j+2 θ 2 − c .
This completes the proof.
Global Behavior of Equation (1.2)
In this section, we investigate the global behavior of equation (1.2) with a ̸ = b, using the explicit formula of its solution.
We can write the solution of equation (1.2) as
x 4m+2t+i = x −4+2t+i m ∏ j=0 ζ(j, t, i), where ζ(j, t, i) = ( b a ) 2j+t θi−c ( b a ) 2j+t+1 θi−c , t ∈ {0, 1} and i ∈ {1, 2}. Theorem 3.1. Let {x n } ∞ n=−3 be a solution of equation (1.2) such that for any i ∈ {1, 2}, α i ̸ = − b c ∑ n k=0 ( a b ) k for all n ∈ N. If α i = b−a c for all i ∈ {1, 2}, then {x n } ∞ n=−3 is periodic with prime period 4. Proof. Assume that α i = b−a c for all i ∈ {1, 2}. Then θ i = 0 for all i ∈ {1, 2}. Therefore, x 4m+2t+i = x −4+2t+i m ∏ j=0 ζ(j, t, i) = x −4+2t+i , m = 0, 1, ...
This completes the proof.
In the following Theorem, suppose that
α i ̸ = b−a c for all i ∈ {1, 2}. Theorem 3.2. Let {x n } ∞ n=−3 be a solution of equation (1.2) such that for any i ∈ {1, 2}, α i ̸ = b c ∑ n k=0 ( a b ) k for all n ∈ N.(t, i) ∈ N such that, | ζ(j, t, i) |< ϵ for all j ≥ j 0 (t, i). If we set j 0 = max 0≤t≤1,1≤i≤2 j 0 (t, i), then for all t ∈ {0, 1} and i ∈ {1, 2} we get | x 4m+2t+i | =| x −4+2t+i || m ∏ j=0 ζ(j, t, i) | =| x −4+2t+i || j0−1 ∏ j=0 ζ(j, t, i) || m ∏ j=j0 ζ(j, t, i) | <| x −4+2t+i || j0−1 ∏ j=0 ζ(j, t, i) | ϵ m−j0+1 .
As m tends to infinity, the solution {x n } ∞ n=−3 converges to 0.
x 4m+2t+i = x −4+2t+i m ∏ j=0 ζ(j, t, i) = x −4+2t+i j1−1 ∏ j=0 ζ(j, t, i) exp ( m ∑ j=j1
ln(ζ(j, t, i))).
We shall test the convergence of the series ∑ ∞ j=j1 | ln(ζ(j, t, i)) |. Since for all t ∈ {0, 1} and i ∈ {1, 2} we have lim j→∞ | ln (ζ(j+1,t,i) ln (ζ(j,t,i) |= 0 0 , using L'Hospital's rule we obtain
lim j→∞ | ln ζ(j + 1, t, i) ln ζ(j, t, i) |= ( b a ) 2 < 1.
It follows from the ratio test that the series ∑ ∞ j=j1 | ln ζ(j, t, i) | is convergent. This ensures that there are four positive real numbers µ ti , t ∈ {0, 1} and i ∈ {1, 2} such that
lim m→∞ x 4m+2t+i = µ ti , t ∈ {0, 1} and i ∈ {1, 2} where µ ti = x −4+2t+i ∞ ∏ j=0 ( b a ) 2j+t θ i − c ( b a ) 2j+t+1 θ i − c , t ∈ {0, 1} and i ∈ {1, 2}.
This completes the proof.
Case a = b
In this section, we investigate the behavior of the solution of the difference equation
(3.1) x n+1 = ax n−3 a − cx n−1 x n−3 , n = 0, 1, . . .(3.2) x n = x −3 ∏ n−1 4 j=0 a−(2j)cα1 a−(2j+1)cα1
, n = 1, 5, 9, ...
x −2 ∏ n−2 4 j=0 a−(2j)cα2 a−(2j+1)cα2
, n = 2, 6, 10, ...
x −1 ∏ n−3 4 j=0 a−(2j+1)cα1 a−(2j+2)cα1
, n = 3, 7, 11, ...
x 0 ∏ n−4 4 j=0 a−(2j+1)cα2 a−(2j+2)cα2
, n = 4, 8, 12, ...
Proof.
The proof is similar to that of Theorem (2.1) and will be omitted. 2
We can write the solution of equation (3.1) as
x 4m+2t+i = x −4+2t+i m ∏ j=0 γ(j, t, i), where γ(j, t, i) = a−(2j+t)cαi a−(2j+t+1)cαi , t ∈ {0, 1} and i ∈ {1, 2}.x 4m+2t+i = x −4+2t+i m ∏ j=0 γ(j, t, i) = x −4+2t+i j2−1 ∏ j=0 γ(j, t, i) exp (− m ∑ j=j2 ln 1 γ(j, t, i)
).
We shall show that
∑ ∞ j=j2 ln 1 γ(j,t,i) = ∑ ∞ j=j2 ln a−(2j+t+1)cαi a−(2j+t)cαi = ∞, by consid- ering the series ∑ ∞ j=j2 −cαi a−(2j+t)cαi . As lim j→∞ ln(1/γ(j, t, i)) −cα i /(a − (2j + t))cα i = lim j→∞ ln ((a − (2j + t + 1)cα i )/(a − (2j + t)cα i )) −cα i /(a − (2j + t)cα i ) = 1,
using the limit comparison test, we get ∑ ∞ j=j2 ln 1 γ(j,t,i) = ∞.Then
x 4m+2t+i = x −4+2t+i j2−1 ∏ j=0 γ(j, t, i) exp (− m ∑ j=j2 ln 1 γ(j, t, i) )
converges to 0 as m → ∞. Therefore, {x n } ∞ n=−3 converges to 0. 2
Case a = b = c
In this section, we investigate the behavior of the solution of the difference equation
(3.3) x n+1 = x n−3 1 − x n−1 x n−3 , n = 0, 1, . . . Theorem 5.1. Let x −3 , x −2 , x −1 and x 0 be real numbers such that for any i ∈ {1, 2}, α i ̸ = 1 n+1 for all n ∈ N. Then the solution {x n } ∞ n=−3 of equation (3.3) is (3.4) x n = x −3 ∏ n−1 4 j=0 1−(2j)α1 1−(2j+1)α1
, n = 1, 5, 9, ...
Proof.
The proof is similar to that of Theorem (2.1) and will be omitted.
2 .
2If a > b, then ζ(j, t, i) → 1 as j → ∞, t ∈ {0, 1} and i ∈ {1, 2}. This implies that, for every pair (t, i) ∈ {0, 1} × {1, 2}, there exists j 1 (t, i) ∈ N such that ζ(j, t, i) > 0 for all t ∈ {0, 1} and i ∈ {1, 2}. If we set j 1 = max 0≤t≤1,1≤i≤2 j 1 (t, i), then for all t ∈ {0, 1} and i ∈ {1, 2} we get
2 Example ( 1 )Figure 2 :
212Figure 1. shows that if a = 2, b = 3, c = 1 (a < b), then the solution {x n } ∞ n=−3 of equation (1.2) with initial conditions x −3 = 0.2, x −2 = 2, x −1 = −2 and x 0 = 0.4 converges to 0. Example (2) Figure 2. shows that if a = 3, b = 1, c = 0.8 (a > b), then the solution {x n } ∞ n=−3 of equation (1.2) with initial conditions x −3 = 0.2, x −2 = 2, x −1 = −2 and x 0 = 0.4 converges to a period-4 solution. x n+1 = 3x n−3 1−0.8x n−1 x n−3
Theorem 4. 1 .
1Let x −3 , x −2 , x −1 and x 0 be real numbers such that for any i ∈ {1, 2}, α i ̸ = a c(n+1) for all n ∈ N. Then the solution {x n } ∞ n=−3 of equation (3.1) is
Theorem 4 . 2 .
42Let {x n } ∞ n=−3 be a nontrivial solution of equation (3.1) such that for any i ∈ {1, 2}, α i ̸ = a c(n+1) for all n ∈ N. If α i = 0 for all i ∈ {1, 2}, then {x n } ∞ n=−3 is periodic with prime period 4. Proof. Assume that α i = 0 for all i ∈ {1, 2}. Then γ(j, t, i) = 1 for all t ∈ {0, 1} and i ∈ {1, 2}. Therefore, x 4m+2t+i = x −4+2t+i m ∏ j=0 γ(j, t, i) = x −4+2t+i , m = 0, 1, ...This completes the proof. 2In the following Theorem, suppose that α i ̸ = 0 for all i ∈ {1, 2}.
Theorem 4. 3 .
3Let {x n } ∞ n=−3 be a solution of equation (3.1) such that for any i ∈ {1, 2}, α i ̸ = a c(n+1) for all n ∈ N. Then {x n } ∞ n=−3 converges to 0. Proof. It is clear that γ(j, t, i) → 1 as j → ∞, t ∈ {0, 1} and i ∈ {1, 2}. This implies that, for every pair (t, i) ∈ {0, 1} × {1, 2} there exists j 2 (t, i) ∈ N such that, γ(j, t, i) > 0 for all t ∈ {0, 1} and i ∈ {1, 2}. If we set j 2 = max 0≤t≤1,1≤i≤2 j 2 (t, i), then for all t ∈ {0, 1} and i ∈ {1, 2} we get
12, ...
2 Theorem 5. 2 .Example ( 3 )
223Let {x n } ∞ n=−3 be a nontrivial solution of equation (3.3) such that for anyi ∈ {1, 2}, α i ̸ = − b c ∑ n k=0 ( a b ) k for all n ∈ N. If α i = 0 for all i ∈ {1, 2}, then {x n } ∞ n=−3 is periodic with prime period 4. Proof. Assume that α i = 0 for all i ∈ {1, 2}. Then x 4m+2t+i = x −4+2t+i , m = 0, 1, ...This completes the proof. 2In the following Theorem, suppose that α i ̸ = 0 for all i ∈ {1, 2}.Theorem 5.3. Let {x n } ∞ n=−3 be a solution of equation (3.3) such that for any i ∈ {1, 2}, α i ̸ = 1 n+1 for all n ∈ N. Then {x n } ∞ n=−3 converges to 0. Figure 3. shows that if a = b = 1, c = 1.5, then the solution {x n } ∞ n=−3 of equation (3.1) with initial conditionsx −3 = 5, x −2 = −1, x −1 = 1.3 and x 0 = −1.1 converges to 0. Example (4) Figure 4. shows that if a = b = c, then the solution {x n } ∞ n=−3 of equation (3.3) with initial conditions x −3 = 5, x −2 = 1, x −1 = 1.3 and x 0 = −1.1 converges to 0.
2}. So, for every pair (t, i) ∈ {0, 1} × {1, 2} we have for a given 0 < ϵ < 1 that, there exists j 0Then the following statements are true.
1. If a < b, then {x n } ∞
n=−3 converges to 0.
2. If a > b, then {x n } ∞
n=−3 converges to a period-4 solution.
Proof.
1. If a < b, then ζ(j, t, i) converges to a
b < 1 as j → ∞, for all t ∈ {0, 1}
and i ∈ {1,
R Abo-Zeid, C Cinar, Global behavior of the difference equation xn+1 = Ax n−1. R. Abo-Zeid and C. Cinar, Global behavior of the difference equation xn+1 = Ax n−1
. B−cxnx N−2, Bol. Soc. Paran. Mat. 311B−Cxnx n−2 , Bol. Soc. Paran. Mat.31(1)(2013), 43-49.
Global Attractivity of a Higher-Order Difference Equation, Discrete Dyn. R Abo-Zeid, Nat. Soc. Article. 930410PagesR. Abo-Zeid, Global Attractivity of a Higher-Order Difference Equation, Discrete Dyn. Nat. Soc. Article ID930410(2012), 11 Pages.
R P Agarwal, Difference Equations and Inequalities, First Edition. R. P. Agarwal, Difference Equations and Inequalities, First Edition, Marcel Dekker, 1992.
Dynamics of a rational difference equation. M Aloqeili, Appl. Math. Comput. 176M. Aloqeili, Dynamics of a rational difference equation, Appl. Math. Comput., 176(2006), 768-774.
A Andruch-Sobi, M Migda, Further properties of the rational rercursive sequence xn+1 = ax n−1. A. Andruch-Sobi, M. Migda, Further properties of the rational rercursive sequence xn+1 = ax n−1
. Opuscula Math. 261b+cxnx n−1 , Opuscula Math., 26(3)(2006), 387-394.
On the rational recursive sequence xn+1 =. A Andruch-Sobi, M Migda, A. Andruch-Sobi, M. Migda, On the rational recursive sequence xn+1 =
Dynamics of Third-Order Rational Difference Equations. E Camouzis, G Ladas, E. Camouzis and G. Ladas, Dynamics of Third-Order Rational Difference Equations;
With Open Problems and Conjectures. Boca RatonWith Open Problems and Conjectures, Chapman and Hall/HRC Boca Raton, 2008.
On the solution of some difference equations. E M Elsayed, Eur. J. Pure Appl. Math. 4E. M. Elsayed, On the solution of some difference equations, Eur. J. Pure Appl. Math., 4(2011), 287 − 303.
E A Grove, G Ladas, Periodicities in Nonlinear Difference Equations. Chapman and Hall/CRCE. A. Grove and G. Ladas, Periodicities in Nonlinear Difference Equations, Chapman and Hall/CRC, 2005.
Convergence of a difference equation via the full limiting sequences method. G Karakostas, Diff. Eq. Dyn. Sys. 14G. Karakostas, Convergence of a difference equation via the full limiting sequences method, Diff. Eq. Dyn. Sys., 1(4)(1993), 289-294.
Global Behavior of Nonlinear Difference Equations of Higher Order with Applications. V L Kocic, G Ladas, Kluwer AcademicDordrechtV. L. Kocic, G. Ladas, Global Behavior of Nonlinear Difference Equations of Higher Order with Applications, Kluwer Academic, Dordrecht, 1993.
Global asymptotic stability in some discrete dynamical systems. N Kruse, T Nesemann, J. Math. Anal. Appl. 2531N. Kruse and T. Nesemann, Global asymptotic stability in some discrete dynamical systems, J. Math. Anal. Appl., 253(1)(1999), 151-158.
Dynamics of Second Order Rational Difference Equations; With Open Problems and Conjectures. M R S Kulenović, G Ladas, Chapman and Hall/HRCBoca RatonM. R. S. Kulenović and G. Ladas, Dynamics of Second Order Rational Difference Equations; With Open Problems and Conjectures, Chapman and Hall/HRC Boca Raton, 2002.
H Levy, F Lessman, Finite Difference Equations. Dover, New York, NY, USAH. Levy and F. Lessman, Finite Difference Equations, Dover, New York, NY, USA, 1992.
Global behaviours of rational difference equations of orders two and three with quadratic terms. H Sedaghat, J. Diff. Eq. Appl. 153H. Sedaghat, Global behaviours of rational difference equations of orders two and three with quadratic terms, J. Diff. Eq. Appl., 15(3)(2009), 215-224.
On positive solutions of a (k +1)th order difference equation. S Stevic, Appl. Math. Let. 195S. Stevic, On positive solutions of a (k +1)th order difference equation, Appl. Math. Let., 19(5)(2006), 427-431.
More on a rational recurrence relation. S Stevic, Appl. Math. E-Notes. 4S. Stevic, More on a rational recurrence relation, Appl. Math. E-Notes, 4(2004), 80-84.
| Abstract We present the Finite Difference Non-Intrusive Least Squares Shadowing (FD-NILSS) algorithm for computing sensitivities of long-time averaged quantities in chaotic dynamical systems. FD-NILSS does not require tangent solvers, and can be implemented with little modification to existing numerical simulation software. We also give a formula for solving the least-squares problem in FD-NILSS, which can be applied in NILSS as well. Finally, we apply FD-NILSS for sensitivity analysis of a chaotic flow over a 3-D cylinder at Reynolds number 525, where FD-NILSS computes accurate sensitivities and the computational cost is in the same order as the numerical simulation. | This paper presents an existence-comparison theorem and an iterative method for a nonlinear finite difference system which corresponds to a class of semilinear parabolic and elliptic boundary-value problems. The basic idea of the iterative method for the computation of numerical solutions is the monotone approach which involves the notion of upper and lower solutions and the construction of monotone sequences from a suitable linear discrete system. Using upper and lower solutions as two distinct initial iterations, two monotone sequences from a suitable linear system are constructed. It is shown that these two sequences converge monotonically from above and below, respectively, to a unique solution of the nonlinear discrete equations. This formulation leads to a well-posed problem for the nonlinear discrete system. Applications are given to several models arising from physical, chemical and biological systems. Numerical results are given to some of these models including a discussion on the rate of convergence of the monotone sequences. | In this paper the asymptotic and oscillatory properties of solutions to the first order neutral difference inclusion of the [email protected](x"n-r"nx"n"-"@t)@?p"nF(x"n"-"@s"""1,x"n"-"@s"""2,...,x"n"-"@s"""s),n=0,1,2,...are discussed, where F:R^s->2^R^^^1 is a compact convex upper semicontinuous multifunction. Some examples are given to illustrate main theorems. | 1,999,968 | In this paper, we present a new application of higher order compact finite differences to solve nonlinear initial value problems exhibiting chaotic behaviour. The method involves dividing the domain of the problem into multiple sub-domains, with each sub-domain integrated using higher order compact finite difference schemes. The nonlinearity is dealt using a Gauss–Seidel-like relaxation. The method is, therefore, referred to as the multi-domain compact finite difference relaxation method (MD-CFDRM). In this new application, the MD-CFDRM is used to solve famous chaotic systems and hyperchaotic systems. The main advantage of the new approach is that it offers better accuracy on coarser grids which significantly improves the computational speed of the method. The results are compared with spectral-based multi-domain method. | A new staggered grid finite difference scheme optimised in the space domain for the first order acoustic wave equation | Improving the accuracy of subgridding scheme in finite differences method based on Legendre polynomials expansion | Stability theory and numerical experiments are presented for a finite difference method that directly discretizes the Neumann problem for the second order wave equation. Complex geometries are discretized using a Cartesian embedded boundary technique. Both second and third order accurate approximations of the boundary conditions are presented. Away from the boundary, the basic second order method can be corrected to achieve fourth order spatial accuracy. To integrate in time, we present both a second order and a fourth order accurate explicit method. The stability of the method is ensured by adding a small fourth order dissipation operator, locally modified near the boundary to allow its application at all grid points inside the computational domain. Numerical experiments demonstrate the accuracy and long-time stability of the proposed method. | Gridless Type Solver - Generalized Finite Difference Method - | Three-Dimensional Finite Difference Discrete Formulation in Frequency Domain for Mur's Absorbing Boundary Condition | In this paper, we consider the development and analysis of a new explicit compact high-order finite difference scheme for acoustic wave equation formulated in divergence form, which is widely used to describe seismic wave propagation through a heterogeneous media with variable media density and acoustic velocity. The new scheme is compact and of fourth-order accuracy in space and second-order accuracy in time. The compactness of the scheme is obtained by the so-called combined finite difference method, which utilizes the boundary values of the spatial derivatives and those boundary values are obtained by one-sided finite difference approximation. An empirical stability analysis has been conducted to obtain the Currant-Friedrichs-Lewy (CFL) condition, which confirmed the conditional stability of the new scheme. Four numerical examples have been conducted to validate the convergence and effectiveness of the new scheme. The application of the new scheme to a realistic wave propagation problem with Perfect Matched Layer boundary condition is also validated in this paper as well. | Finite difference method for solving boundary initial value problem of a system hyperbolic equations in a class of discontinuous functions | One-node coarse-mesh finite difference algorithm for fine-mesh finite difference operator |
1,999,969 | Dynamical properties of superconducting superlattices | Abstract A model of an extended weak-link between superconducting grains, described by a nonlocal governing fluxon equation, assuming newtonian dissipation, is presented and studied analytically as well as numerically. From a ballistic trial solution based on an exact limiting form, the average macroscopic voltage across the weak-link due to a regular array of Josephson vortices moving uniformly along it is derived. Whereas the current–voltage characteristic predominantly exhibits monostability when nonlocality is weak and dissipation high, a transition to bistability and associated formation of filaments of different current densities can occur when nonlocality is strong and dissipation low. | High-frequency properties of semiconductors with superlattices | We consider the properties of a superconductor with a joint mechanism. One involves, otherwise unspecified, high-energy excitations and is modelled with a BCS pairing potential. The other is of low energy, presumably involving phonons. When the second contribution is significant, the resulting properties can differ greatly from BCS, and for most but not all properties, in a direction opposite to that expected for conventional strong coupling systems. | An analytical approach to the thermal instability of superconducting films under high current densities | A BCS model incorporating the orbital effect of the magnetic induction and the paramagnetic effect of the exchange field is used to investigate the conditions for the formation of an infinitesimal superconducting nucleus localized at domain walls in ferromagnets. It is shown that a solution of this type always exists in reentrant ferromagnetic superconductors, at least in the metastability region of the FN (ferromagnetic normal) phase. The existence of superconducting domain walls in the stable FN phase of ideal ferromagnets remains an open question, since the transition to this state is apparently of first order and the transition parameters are unknown. From the standpoint of realizing superconducting domain walls it seems more promising to consider reentrant superconductors possessing an irregular magnetic subsystem without a coexistence phase and having a small exchange contribution to the magnetic energy, i.e., compounds such as Ho/sub 1-x/Y/sub x/Mo/sub 6/S/sub 8/. | I need a brief description of what superconductivity is and how it works in order to help my fiancé write out a paper for school. He needs help editing his final draft (he's bad at English ) but I'm going to need a quick run down before I can help him choose relevant information for his specific topic. | A general discussion is given of the role of fluctuations in introducing new effects in a superconductor at temperatures just above its transition temperature. In this region the BCS theory of superconductivity, a type of mean-field theory, does not predict any variation from normal state behavior until the critical point is reached. But the close analogy between the superconducting phase transition and other phase transitions requires the appearance of deviations from normal state behavior. The existence of a strong rise in the electrical conductivity, or “paraconductivity,” has been verified by Glover. A review of the phenomenological Landau-Ginzburg theory describing this effect is presented, as well as a calculation of the critical variation in the specific heat. A measurement of the latter effect would constitute an important check on the theory. | Hi! I'd just like some clarification on some phenomena involved. So the Meissner effect and quantum locking explain why levitation occurs as a superconductor is cooled below its critical temp. However, BCS theory and flux pinning explain why a superconducting material possesses its superconducting abilities? Also, when talking about BCS and flux pinning do I assume it's only applicable when the superconductor is in its cold state? Thanks! | 1,999,969 | Dynamic processes in 1D superconducting superlattices (SSLs) with a period substantially higher than the coherence length are investigated theoretically. The dynamic resistive state and the nonlinear response to laser irradiation are studied. The results presented indicate that, even in large-period SSLs, a number of promising HF nonlinear phenomena may occur, which can serve as the basis for novel superconducting devices. | Technical fluctuations of radiation intensity of a laser with a nonlinearly absorbing cell | Generation of Supercontinuum in a Waveguide with Slow Nonlinearity Related to Shock Formation | Low frequency plasma oscillations in superconducting tubes are considered. The emergence of two different dimensionality regimes of plasma oscillations in tubes, exhibiting a crossover from one-dimensional to two-dimensional behavior, depending on whether kR ≪ 1 or kR ≫ 1, where k is the plasmon wave vector and R is the radius of the tube, is discussed. The Aharonov-Bohm effect pertaining to plasma oscillations in superconducting tubes and rings, resulting in an oscillatory behavior of the plasmon frequency as a function of the magnetic flux, with a flux quantum period hc/2e (analog of the Little-Parks effect), is studied. The amplitude of the oscillations is proportional to (ξ/R) 2 , where ξ is the superconducting coherence length. | Size-dependent optical properties of periodic arrays of semiconducting nanolines. | Highly non-linear phenomena and coherent effects in 1500 nm QD lasers and amplifiers | Sensitivity enhancement by increasing the nonlinear crystal length in second-order autocorrelators for ultrashort laser pulses measurement | On the design of experiments for the study of relativistic nonlinear optics in the limit of single-cycle pulse duration and single-wavelength spot size | Self-oscillations in terahertz laser discharge: Nature, parameters, and suppression |
1,999,970 | [US, US] [H] GRI GX cards [W] Paypal at 70% TCGplayer |
This is some binder pics plus outside of the binder. If you have any questions about any specific cards let me know. Most are LP-NM. All e-reader era cards are NM. I also have non-holo/reverse holo e-reader cards and energies.
Looking to do 5% off of TCGPlayer prices to start with room to haggle.
$15 and up will ship with tracking.
Thanks for looking :) | Hello!
I'm looking for a total of $65 worth of tcgplayer.com gift cards.
If you want to sell, please reply with your GCX profile BEFORE you PM me, if you do not reply, I will not answer your messages. If you continue to send messages, I will find myself in the need to report you to the mods.
You will go first if you have less rep than me. Also, please be sure that your account is secure when you send me a message. Provide proof of where you got the GC from if possible. Looking forward to trading, cheers!
GCX Rep: | Hello! Looking to sell some extra cards from my collection. Prices are 10% off Tcgplayer low. Shipping is $4, unless it is a purchase over $30-then I provide free tracking.
GXs, EXs, FAs, Srs-
Rayquaza & Celebi-
I am currently looking for....
LP/NM+ Gold Stars
LP/NM+ SL from Call of legends
LP/NM+ SH Milotic
NM+ GMAX Pikachu RR
NM+ Blastoise RR
NM+ Flygon RR
Binders | If trading Target or Walmart GC, unused cards only, please. Rate: 80-85%. Thanks! | Binder
Feedback
**Guidelines**
* **MAKE SURE TO LOOK AT EVERY PAGE!**
* **I am not buying cards at this time. I am willing to trade though. Just send me your binder. Do not expect me to only trade though.**
* **Trying to build casual DM and Toon decks.**
* **If buying cards from me with PayPal, I'll take \~10-15% off lowest appropriate TCGPlayer price (negotiable). Buyer will cover PayPal fees.**
* **My end will be mailed First Class USPS in a rigid CD or bubble mailer with tracking ONLY IF:**
* **trade/buy value is >= \~$20 OR**
* **volume of cards is large enough.**
* **Otherwise, my end will be sent First Class USPS in an envelope without tracking.**
* **I will cover any shipping fees in either case.**
* **Try to keep \~$10 minimum.**
* **US ONLY! Feel free to ask about rarity/set/condition of any of my cards.**
**Edit: DM Core, Toon Core (apparently can't spell tonight)**
**I will keep an updated list of all the cards that have been sold as well.**
**SOLD:**
* Ice Bell
* Ghost Reaper
* Martial Metal Marcher
* Twin Twisters
* Isolde
* Afterburner
* 2x Widow Anchor
* Ogre
* Cyber Emergency
* Drident
* Herz
* Brilliant
* 1x Union hangar | I received a $17.25 prepaid AMEX card, but as I live outside the USA I can't use it. **Will go first.** Only trading with people, who have 3+ confirmed trades.
&#x200B;
Even though I'm new to GCX I own a modding business and I have modded 100's of people with only happy customers. Website for modding rep ( ([
&#x200B;
Balance photo: | I'm looking for $40 PayPal for my $50 Amazon gift card (80% exchange rate).
I prefer trading an 'Experienced Trader' or anyone I have traded in the past.
Here's my GCXRep profile]( and [pre-GCXRep trade confirmations.
Comment here before PMing. | I have been going to USPS weekly to purchase MO with GC. Went today and cards were declined. Confirmed balances on cards, but no luck. | 1,999,970 | I am selling the whole thing as a set. selling it all for 70% of TCGPlayer
REPS
I also have a bunch of other cards from GRI (bought 2 boxes on release) let me know if you are looking for any staples from it. I can probably drop some in for free. | Hello! Selling huge lot of MTG cards (Old ones, foils,etc) | [Store]<<<Ryfg Level Up Service>>> <<<Best Prices>>> Selling Card Sets at 18:1 [Tf2] | 18:1[CS] | 350:1 Gems || Looking for Suppliers @21:1 | Ways to sell Foils KTK set on MTGO | MTGO Commander staples (cheap)? | Sale on Decks and more - Tulsa arcade | Does anyone know a good priced place online that sells eshop cards? | Selling My Yugioh Card Collection | Any Card Game Players Know a Store That Sells Japanese (Yu-Gi-Oh!, Vanguard) Sized Card Sleeves? |
1,999,971 | Modified Jeans instability of collisional dusty magnetoplasma in presence of radiative cooling and dust charge fluctuation | Abstract A self-consistent theory for dust cloud motions in a partially ionized nonuniform magnetoplasma is presented, taking into account collisional interactions between the plasma particles, pressure gradient and electromagnetic forces. It is found that dust cloud motions in the radial and azimuthal directions (with respect to the direction of a vertical DC magnetic field) occur owing to the combined effects of dust–ion and dust–neutral collisions as well as due to forces associated with a radial electric field and the gradients of the plasma and magnetic pressures. The relevance of our investigation to laboratory and astrophysical plasmas is pointed out. | Fluid Simulation of the Ion Temperature Effects on a Collisional Magnetized Sheath of a Dusty Plasma | The phenomenon of Debye shielding in dusty plasmas is investigated within the framework of nonextensively distributed electrons and ions. The effects of dust grain charge fluctuation are considered. It shows that the increase of the nonextensive parameters of electrons and ions will lead to the decrease of the shielding distance and it is due to that the effective temperature of nonextensively distributed particles drops with the increase of nonextensive parameters. There is a rather interesting result that the Debye shielding effects may vanish in a certain condition when the fluctuation of the dust grain charges is taken into account. | Recent experimental findings on the transverse forces acting on dust particles in a discharge under moderate magnetic fields [Puttscher and Melzer, Phys. Plasmas (1994–present) 21, 123704 (2014)] are compared to model calculations. Using the sheath model of Pandey et al. [Phys. Plasmas 18, 053703 (2011)], Mehdipour et al. [Phys. Plasmas 17, 123708 (2010)], and Foroutan et al. [Phys. Plasmas 16, 103703 (2009)], first, the plasma parameters of a magnetized sheath are calculated. From that, the horizontal forces on dust particles along or opposite to the E → × B → direction are determined. The experiments show a complex dependence of these forces on gas pressure in the discharge, magnetic field strength, and particle size. From the model, this complex behavior of the dust particles can be recovered with good agreement with the experimental findings. | The properties of magnetized dusty plasma sheath with finite ion temperature are studied using a fluid model. Hot electrons, fluid ions, neutral particles and cold fluid dust grains are taken into account in this system. Considering the cross section for collisions between the dust and neutrals has a power law dependence on the dust flow velocity, the fluid model is then solved numerically to obtain detailed sheath information under different ion temperatures. A significant change is observed in the quantities characterizing the sheath with respect to the cold ion assumption. In addition, the result reveals that the effect of ion temperature is more obvious on the dust dynamics in collisional sheath with constant cross section. | The effects of thermal motions on the cyclotron radiation from test particles gyrating in a homogeneous magnetoplasma are studied. These effects take care of all singularities that exist in the theory of cyclotron radiation in cold magneto- plasma, e.g. the divergence in energy loss for small particle energies. Around the hybrid frequencies thermal corrections become of dominant importance. At these frequencies cold-plasma theory breaks down. Thermal effects arise in two ways: by modifying the wave modes known from cold plasma theory, and by the introduction of a new longitudinal wave mode, known as the Bernstein mode. All wave modes are damped (in stable plasmas), the damping increasing rapidly with the product ( V/v| ) (ω - s), where the wave frequency ω is measured in units of the gyro frequency; V is the thermal velocity; v| the parallel component of the particle velocity, and s is an integer. | Using the “rotodust” experimental setup [1] at the Hypervelocity Impacts and Dusty Plasmas Lab (HIDPL) of the Center for Astrophysics, Space Physics, and Engineering Research (CASPER) at Baylor University we have realized effective magnetization of single layer dusty plasma systems in the strongly coupled state up to thousands of Teslas of magnetic induction. The self-diffusion in these ensembles of 300 to 400 particles was derived by measuring the cage correlation function [2] in the central region and utilizing the recently found connection between the variation of particle environments (cages) and the diffusion coefficient [3]. Systems parameters (Γ coupling and κ screening in the Yukawa OCP model) were determined using the pair distribution and the velocity autocorrelation functions [4]. | Electromagnetic modes in dusty plasmas are studied for polydisperse dust grains with a distribution in charge and mass. Owing to the different charge and mass weightings of the velocities, there occurs an infinite chain of equations of motion, coupled through the magnetic part of the Lorentz force. Depending on the frequency and associated convergence regimes, one has to close the chain in ascending or in descending order. Both series together lead to the polydisperse dispersion law that is a generalization of monodisperse or size distributed dust. Power-law distributions typical for heliospheric plasmas are discussed as an application. | 1,999,971 | We have investigated the modifications in the self-gravitational instability of magnetized collisional dusty plasma, arising from the radiative effects of electrons and ions, and charge fluctuation of dust. The electron and ion dynamics are described by their radiative effects and considering the full dynamics of dust and neutrals, the general dispersion relation is derived. The properties of the general dispersion relation are discussed in the absence and presence of dust charge fluctuation. The results of these two cases are further reduced for parallel and perpendicular modes of propagation. The consequences of magnetic field, collisions, dust charge fluctuation, and radiative condensation on the growth rate of self-gravitational instability are discussed analytically and graphically. We found that the radiative effects and dust charge variation increase the growth rate of self-gravitational instability while the presence of magnetic field and collisions shows the stabilizing behavior. The findings are... | Fluid dynamical instabilities in magnetized partially ionized dense dusty plasma are studied by taking into account relative flow between dust and neutral gas. Following Hurwitz criterion, the onset criteria for instabilities are derived for different densities of the neutral gas and dust components across the interface. It is found that in case of no significant magnetic field stabilization occurs not only due to dust neutral gas collisions but due to relative flow also. Our result might be useful in many situations of astrophysical magnetized dusty plasma namely comets and circumsteller dusty disk e.g. T-Tauri stars. | A quantitative analysis is presented of the dust acoustic wave instability driven by the solar and stellar winds. This is a current-less kinetic instability which develops in permeating plasmas, i.e.., when one quasi-neutral electron-ion wind plasma in its propagation penetrates through another quasi-neutral plasma which contains dust, electrons and ions. | Charging properties of a dust grain in collisional plasmas | The Hall-diffusion–driven shear instability of a magnetized collisional dusty plasma | Collisional drift-type instability of a weakly ionized magneto-plasma with no axial drift | Equilibrium configuration of self-gravitating charged dust clouds: Particle approach | WAVES AND INSTABILITIES IN MAGNETIZED DUSTY PLASMAS | The adiabatic invariance of the magnetic moment during particle motion is of fundamental importance to the dynamics of magnetized plasma. The related rate of pitch angle scattering is investigated here for fast particles that thermally stream through static magnetic perturbations. For a uniform magnetic field with a localized perturbation it is found that the curvature parameter κ 2 = min(R c /ρ L ) does not predict the level of pitch angle scattering. Instead, based on numerical integration of particle orbits in prescribed magnetic fields, we derive predictions for the particle scattering rates, which can be characterized by the relative perturbation amplitude A δ B/B, and the particle Larmor radius normalized by the field-aligned wavelength of the perturbations, ρ L /λ . Particles with ρ L /λ 1, are subject to strong pitch angle scattering, while the level of scattering vanishes for both the limits of ρ L /λ 1 and ρ L /λ 1. The results are summarized in terms of a scattering operator, suitable for including the described scattering in basic kinetic models.Fundamental properties of magnetized collisionless plasma are directly linked to the magnetic moment, µ = mv 2 ⊥ /2B, being an adiabatic invariant of the particle motion. By way of examples, the confinement times of particles in the Earth's radiation belts 1 as well plasmas in magnetic mirror machines 2 are governed directly by the time scales at which µ for the individual particles can be assumed to be constant. During compression and rarefaction of solar wind plasma, dynamics related to the adiabatic invariance of µ is the cause of pressure anisotropy 3 . This anisotropy can drive both the mirror and firehose instabilities, which, in turn, can scatter the particle magnetic moments regulating the anisotropy towards the boundaries of marginal instability 4 . At the Earth's bow shock in situ spacecraft observations demonstrate directly how strong magnetic perturbations are the driver of electron pressure anisotropy and how bursts of Whistler waves can break the invariance of µ leading to pitch angle scattering, which in turn moderates the anisotropy 5 . Generally for wave-particle interactions, the particles with orbit motions that by some measure are in phase with the wave dynamics will interact most strongly with the wave electric and magnetic fields and pitch angle scatter most efficiently. In contrast to wave-particle interaction, the adiabatic invariance of µ may also be destroyed during orbit motion in static magnetic configurations. The renowned study by Buchner 6 considers a static current sheet geometry relevant to the Earth's magnetotail and introduces the adiabatic parameter κ 2 = min(R c /ρ L ). Here R c is the radius of curvature for the magnetic field and ρ L = mv ⊥ /(qB) is the particle gyro (Larmor) radius. For a given particle orbit, the value of κ 2 is evaluated at the location where R c /ρ L is at its minimum, and the magnetic moment is generally well conserved for κ 2 > 25. For 10 < κ 2 < 25, moderate changes in µ are typically observed, whereas κ 2 < 10 is associated with chaotic particle motion and complete loss of µ as an adiabatic invariant for both electrons and ions. For magnetic reconnection, κ 2 has proven effective for understanding the electron dynamics, 7 yielding a range of regimes for the structure of the electron diffusion region 8 .The present study is motivated in part by results for magnetic pumping 9 . In particular, it has recently been shown that strong Alfvénic magnetic perturbations δ B/B 1 at the Earth's bow shock 10 have the ability to trap electrons, rendering magnetic pumping effective for heating superthermal electrons 11 . As is the case also for other Fermi heating models 12,13 , the electron energization here requires a steady level of pitch angle scattering of superthermal electrons 11,14 beyond scattering related to resonant whistler wave interactions 5 . Similar to the analysis by Buchner 6 we will consider static magnetic configurations. In our configurations of magnetic perturbations, however, the overall direction of the magnetic field does not change and likely for this reason the numerical results presented are not well described by the κ 2 -parameter.We first explore the magnetic configurations as outlined by the dashed lines inFig. 1(a). Here a straight and uniform magnetic field in the x-direction is perturbed by a single localized and sinusoidal perpendicular pulse in the y-direction. More specifically, the magnetic field is given by the formwhere F(x/L) = (cos(πx/L) + 1)/2 provides the functional form of the perturbation applied in the y direction with dimensionless amplitude, A. As observed inFig. 1(a), across the interval −L ≤ x ≤ L the field lines are offset in the ydirection by the distance ∆y = A L −L F(x)dx = AL. In this configuration, numerical particle trajectories are initialized with identical initial speeds and pitch angles θ i = ∠(B, v i ) = arccos(B · v i /Bv i ) = 20 • , but variable azimuthal angles φ with respected to the x-direction. The initial spatial location with x/L = −2 are inFigs. 1(a,b)arranged on a circle of radius ρ L /L = 0.1 in the yz-plane, such that all the particles share the same initial guiding center location. InFigs. 1(a,b)it is appar- |
1,999,972 | Great Technique and Safety Review | Safe, stury and easy to use. Much safer than the Rapala type, which are unsteady | Pro: Sounds like a great idea. It Does it the right spots once you find it...but the cons outweigh the pros.
Cons: The material the item is made of somehow rejects lube. This leads to a very uncomfortable situation.
I expected magic, and instead had more fun by taking the bullet out and using it on my wife. | Use it all the time to train kicks. Very durable and great for practice. | I like the idea of this I just don't know how well it works but I put it in my gun safe. So hopefully it works well. | Good vision and protection. When on your back working overhead, the headband adjustment knob hits the floor and loosens and the shield falls off your head or moves around and is a real annoyance. Not a good tool for lying on your back on the floor. Knob is in the wrong place. Otherwise I like it. | So far been using for while. I like it (definitely safer than steel ones too!). | Improvement on the stock safety. Still not quite as easy to flip on and off as I would like while keeping a firing grip. | Not as informative as I thought it would be. I was looking for new technique and it just seemed to be same old, same old | 1,999,972 | This is really great reading for new and also seasoned riders. It reminds all of us to remove the bad habits and instill and develop the good ones. Terrific technique review. | Great book! I love this sensible approach to training | A Fun Read For Dressage Lovers Comes With Excellent Riding Descriptions | This is a great book. I have been riding for years and ... | The best book I've found on the forward system of riding! | one of the best reads on biking cross country! | and the lessons from the author's life and impressive experience are both useful and fascinating -- this is a book for athletes | Anyone else not digging the cheesy motivational phrases the trainers use so much? | Must read for all sane riders |
1,999,973 | Standard individual cognitive behaviour therapy for paediatric obsessive-compulsive disorder: a systematic review of effect estimates across comparisons. | Cognitive-Behavioral Therapy of Obsessive-Compulsive Disorder in Children and Adolescents | Obsessive–compulsive disorder a suitably qualified cognitive–behavioral therapist has been carried out. Therapeutic treatment may be effective in reducing ritual behaviors of OCD for children and adolescents. Similar to the treatment of adults with OCD, CBT stands as an effective and validated first line of treatment of OCD in children. Family involvement, in the form of behavioral observations and reports, is a key component to the success of such treatments. Parental interventions also provide positive reinforcement for a child who exhibits appropriate behaviors as alternatives to compulsive responses. In a recent meta-analysis of evidenced-based treatment of OCD in children, family-focused individual CBT was | The Effectiveness of Cognitive Analytic Therapy on the Severity of Symptoms in Patients with Obsessive-Compulsive Disorder | For the use of psychosocial treatments for severe mental illness, there is a high evidence level. Obsessive-compulsive disorders are accompanied by severe disabilities in one third of the cases, however, there is little scientific research on the use of psychosocial therapies in patients with obsessive-compulsive disorders. In the following, the concept of an outreaching multi-professional treatment based on the assertive community treatment (ACT) method for severe compulsive illnesses is presented and discussed based on two case studies. There was an obvious reduction in clinically rated severity of obsessive-compulsive disorder symptoms, as measured by the Yale-Brown obsessive-compulsive scale (Y-BOCS), over the course of ACT. Comparison between pre- and post-treatment states demonstrated a reduction in the total Y-BOCS score after the treatment (case 1: total Y-BOCS score 37 versus 26; case 2: total Y-BOCS score 36 versus 16). | The last decade has seen a noticeable increase in the number of treatment outcome studies for pediatric obsessive-compulsive disorder (OCD). The present article describes a meta-analysis of this literature with the aim of quantifying treatment effects and examining the extent to which various patient or treatment variables are related to outcome. Results showed that pharmacotherapy with serotonergic antidepressants and cognitive-behavioral therapy involving exposure and response prevention are each effective in reducing OCD symptoms. Cognitive-behavioral therapy produced larger effect sizes and greater rates of clinically significant improvement compared to medication, although there were methodological differences between medication and psychotherapy studies. | Deep Brain Stimulation for Refractory Obsessive-Compulsive Disorder: Towards an Individualized Approach | We carried out a double-blind, randomized, parallel-groups clinical trial of fluoxetine (20-40 mg/day) and placebo in 11 children with Tourette's syndrome (TS) and associated obsessive-compulsive symptoms (OCS). The treatment period lasted 4 months. No significant differences between treatment groups were observed for measures of OCS. Fluoxetine therapy, however, was associated with a trend toward some improvement in tic severity, attentional abilities, and social functioning. Given these observations and the limitations of this pilot study, which include selection biases, small sample size, and significant placebo effects, the efficacy of fluoxetine in children with TS deserves further larger-scale investigation. | Transcranial Direct Current Stimulation for Obsessive-Compulsive Disorder: A Systematic Review | 1,999,973 | AbstractBackground: Previous meta-analyses of paediatric obsessive–compulsive disorder (OCD) have shown much higher effect size for standard individual cognitive behaviour therapy (SI-CBT) compared with control conditions than for serotonin reuptake inhibitors (SRIs) compared with placebo. Other factors, such as systematic differences in the provided care or exposure to factors other than the interventions of interest (performance bias) may be stronger confounders in psychotherapy research than in pharmacological research. Aims: These facts led us to review SI-CBT studies of paediatric OCD with the aim to compare the effect estimates across different comparisons, including active treatments. Method: We included only randomized controlled trials (RCTs) or cluster RCTs with treatment periods of 12–16 weeks. Outcome was post-test score on the Children's Yale–Brown Obsessive Compulsive Scale (CYBOCS). Results: Thirteen papers reporting from 13 RCTs with 17 comparison conditions were included. SI-CBT was super... | The effectiveness of treatment for pediatric obsessive-compulsive disorder: A meta-analysis | A B S T R A C TObsessive-compulsive disorder (OCD) is a treatable condition that often requires specialist care, particularly when comorbid with autism spectrum disorder (ASD). However, specialist clinics are few and typically located in large medical centers. To increase availability of evidence-based treatment for OCD in individuals with ASD, we adapted an internet-delivered cognitive behavior therapy (ICBT) protocol to suit the needs of these individuals and conducted a feasibility study (N = 22). The primary outcome was the clinician-rated Children's Yale-Brown Obsessive-Compulsive Scale (CY-BOCS), administered at pre-and post-treatment as well as 3 months after treatment. ICBT was deemed acceptable and was associated with clinically significant improvements in CY-BOCS scores, corresponding to a large within-group effect size (Cohen's d = 1.33). Similarly, significant improvements were observed in most of the secondary parent-and self-rated measures. Approximately 60% of the participants were classed as treatment responders and 50% were in remission from their OCD at the 3-month follow-up. To provide a meaningful benchmark, we also analyzed data from a specialist clinic that regularly treats individuals with comorbid OCD and ASD (N = 52). These analyses indicated that specialized in-person CBT produced significantly larger effects (d = 2.69) while being markedly more resource demanding, compared to ICBT. To conclude, ICBT can be successfully adapted to treat OCD in youth with ASD and may be a viable alternative for those who do not have direct access to highly specialized treatment. Further improvements of the treatment protocol based on participant and therapist feedback are warranted, as is a formal test of its efficacy and costeffectiveness in a randomized controlled trial. | During the last two decades, effective psychotherapeutic interventions have been developed and proven successful in treating patients with Obsessive-Compulsive Disorder (OCD). Behavior therapy, using exposure to anxiety-evoking stimuli and response prevention directed toward rituals, provides lasting benefit for most patients who engage in and comply with treatment. A recent study indicated that, for certain OCD patients, these interventions could be applied successfully in a group therapy context. This article describes the general procedures used in this study to treat obsessive-compulsives with exposure and response prevention in a group context. | Interoception is impaired in different psychiatric disorders and is also associated with emotions. Only one study could show a higher interoceptive accuracy (IAcc) in patients with obsessive-compulsive disorder (OCD). Based on the predictive coding system we assume contrary results, indicating a decreased IAcc in patients with OCD. So far, there is no study investigating the effect of cognitive-behavioral therapy on IAcc in patients with OCD. Therefore, we hypothesize that patients with OCD improve their IAcc during the time course of therapy compared to healthy controls. Twenty-six patients with OCD from the Psychosomatic Clinic in Windach were examined in the time course of cognitive-behavioral therapy. They were compared to 26 matched healthy controls. IAcc via the heartbeat perception task as well as questionnaire data (OCD-, depression-and anxiety symptoms) were assessed. Results showed that IAcc, OCD-, depression-and anxiety symptoms were attenuated in patients with OCD. Patients recovered in the time course of therapy regarding OCD-, depression-and anxiety symptoms. Interoceptive deficits did not change in the time course of cognitive-behavioral therapy. We demonstrated that IAcc is affected in patients with OCD and this deficit does not change during the time course of a standardized therapy. Future studies should investigate, whether an inaccuracy in perceiving one's bodily signals constitutes a risk factor for relapse. Further, it could be examined if IAcc can be increased via selfand body focus interventions in patients with OCD. | Case Study: Behavioral Treatment of Obsessive‐Compulsive Disorder in a Boy With Comorbid Disruptive Behavior Problems | Intensive residential treatment for severe obsessive-compulsive disorder: Characterizing treatment course and predictors of response | [Assertive community treatment in patients with severe obsessive-compulsive disorders]. | Obsessive-compulsive disorder (OCD) is an intriguing, difficult problem characterized by anxiety-producing intrusive thoughts and performance of anxiety-reducing rituals. Current evidence suggests that OCD may be associated with dysregulation of serotonin and dopamine neurotransmission. Numerous early studies involving the serotonin-specific reuptake inhibitor clomipramine led to the formulation of this hypothesis. Positive results with clomipramine initiated further research with other serotonin-specific reuptake inhibitors, such as fluoxetine, fluvoxamine, sertraline, and serotonergic agents such as buspirone and trazodone. Findings from a number of clinical trials suggest that drugs that inhibit serotonin reuptake or affect serotonergic transmission in other ways are of clear benefit in the treatment of OCD. These drugs may be more effective for obsessive thoughts than for compulsive rituals. Effective pharmacotherapy can dramatically decrease obsessive-compulsive symptoms and improve the patient's quality of life. |
1,999,974 | Cumulative learnings and conservation implications of a long-term study of the endangered Carnaby's Cockatoo Calyptorhynchus latirostris | The loss and modification of freshwater ecosystems has led to high rates of imperilment for freshwater species. The Giant Gartersnake (Thamnophis gigas) is among the species that have suffered declines in abundance and spatial distribution and is currently listed as a threatened species by the U.S. government and the State of California. Conservation and management of populations of T. gigas are hampered by a lack of information on its demography. Without estimates of demographic parameters, the status of the population is difficult to characterize, and identifying the parameters to target in management planning is problematic. We used capture–recapture data from two populations in the Great Central Valley of California to estimate annual survival probability. We also evaluated hypothesized causes of variation in survival probability among individuals and among years. Model-selection results for the population in the American Basin indicated that females have a higher survival probability than males and t... | Carnaby's black cockatoo nest sites, and poaching. Since European settlement, 56% of its habitat has been cleared, mainly for agriculture. Furthermore, 54% of its habitat on the Swan Coastal Plain—an important area outside the breeding season—has been lost. Much of this area lies within the Perth metropolitan area, and the city's population is predicted to increase 70% by 2050. The Western Australian State Government has produced a "Green Growth Plan" to manage this expansion; conservation groups are concerned the cockatoo (along with other species) could suffer further loss of habitat. In particular, the loss of pine plantations north of Perth could jeopardise the | Critical Assessment of the Conservation Status of Red-tailed Black-Cockatoos in South-eastern Australia With Special Reference to Nesting Requirements | Abstract. We estimated Capercaillie Tetrao urogallus population dynamics in Augustow Forest (NE Poland) based on spring counts of males on leks. During the 15-year study, the number of active leks decreased from 12 to 6 only, despite establishing 4 new leks. In 1996, the mean Nearest Neighbor Distance between leks was 4.06 km and varied from 0.95 to 9.25 km, and in 2010, the NND increased to 7.51 km (range 2.60–18.30). In 1996–1998, the number of males (cocks) per lek varied from 1 to 16. In 2010, the number of displaying cocks declined to 1–5 per lek. The mean number of cocks per lek declined from 4.9 in 1996 to 2.7 in 2010. Our censuses recorded a decline in the total numbers of displaying males from 59 in 1996 to 16 in 2010. During the study, the mean rate of extinction was 3.14 males per year. Historical data about population dynamic and causes of bird mortality is also discussed. | Ecological and Reproductive Relationships of Black-Capped and Carolina Chickadees | For the first time in the history of life, a biodiversity extinction crisis is being driven by a single species – humans. Humans also have unprecedented control over both the threats and conservation actions that influence this crisis. When prioritising conservation actions, innate human bias often favours endothermic vertebrates over other fauna. Reptiles are the least popular terrestrial vertebrate class, and consequently are particularly disadvantaged in terms of being listed as threatened and receiving conservation management. Despite 30 years of formally evaluating and listing threatened vertebrates in the Australian State of Victoria, there is a strong worsening trend in the conservation status of all faunal groups. The deteriorating status of Victorian reptiles mirrors worrying documented trends in reptile conservation status around the world. I review the history of listing threatened reptiles in Victoria, detail worsening trends in their conservation status, and suggest that, as in other parts of the world, the threats common to most listed taxa are climate change, habitat loss and degradation, and elevated rates of predation by exotic predators. I also identify poor advice and planning as a considerable threat to Victorian reptiles; this threat is rarely reported, but may be more pervasive than currently recognised. I argue that what is needed for most reptiles to have the greatest chance of persisting in the long term is prevention of habitat loss and degradation, research to underpin listing and management, improved policy so that unproven management strategies are not sanctioned, and vetting of consultant’s reports so that unproven ‘mitigation’ strategies and inadequate preimpact surveys do not mask the true cost of loss and degradation of habitat. | A Population Model for the Diamondback Terrapin: Implications for Conservation Management | The conservation requirements of an endangered hoverfly, Hammerschmidtia ferruginea (Diptera, Syrphidae) in the British Isles | 1,999,974 | ABSTRACT The endangered Western Australian endemic Carnaby's Cockatoo Calyptorhynchus latirostris was studied by Denis Saunders from 1968 to 1996, and by Rick Dawson and Denis Saunders from 2009 to... | where is the australian cockroach found in the united states | Unique mid-tract loss of a primary remex in male broadbills of the Southeast Asian genus Calyptomena: timing and possible implications | what kind of animal is a caribou | Interspecific Competition,Population Structure and Growth Dynamics of Endangered Calocedrus macrolepis | Extraction without tooling around - The first comprehensive description of the foraging- and socio-ecology of wild Goffin’s cockatoos (Cacatua goffiniana) | what do the calamariine snakes eat | Terrestrial bird or dinosaur phalanx from the New Zealand cretaceous | when does the velvety lumps appear in boreal caribou |
1,999,975 | Absolutly the best value on Amazon | AmazonBasics, great quality at a great price. What more is there to say? | Always dependable. Great price with Amazon. | I am very happy with all the things I Bought so far from amazon. Really good quality always on time. They have the best price compare to all the big expensive stores out there. | Can't beat it for the price.
There are better ones but at a much higher cost. | value for money, its an amazon basic, cant get cheaper than this, so you don't have many reasons to complain either | The title. Any recommendations for a site that’s reliable and not price gauging that makes good prebuilts? | Never disappointed with Amazon products. Some work better then other for personal use but all other have been excellent. | AMAZON BASICS - YOU WIN AGAIN .... BIG QUALITY BIG VALUE - LOW PRICE | 1,999,975 | Absolutly the best value on Amazon. Buy this, and don't look back. This unit is sooo cheap, and packs much smaller than any of my other burners.
I could't be happier. Only wish that I had trusted the review and bought this sooner and not wasted time, can't wait to get outisde and on the trail with this one | Excellent BD Burner at a reasonable price | great external burner | Great burner but only 1000w | This is a great little burner | 1 Burner Electrical Heater | This tower is awsome i love the economy feature n only one burner work less ... | Good Burner. Fluctuating Amazon price? | This is the best gas cooker i have ever had |
1,999,976 | Adjustments and Other Special Problems under the General Ceiling Price Regulation | How is a price floor differant from a price ceiling? | Find case study where price ceiling has been used? | We examine the effect of guaranteed lowest price clauses (G.L.P.). First, we correct the proof of Logan and Lutter’s main result that it is the unique equilibrium outcome for firms adopting... | Professor Joglekar is to be thanked for his generally insightful Comments 1988 concerning my paper Monahan [Monahan, J. P. 1984. A quantity discount pricing model to increase vendor points. Management Sci.306, June 720-726.. He has in my view correctly assessed the limitations of two important production assumptions I made, assumptions which need to be rethought in any quantity-discount pricing models of the future. Yet, although I find myself in general agreement with Joglekar's comments, I wish to clarify some points concerning the model and its potential applicability. | This paper examines the effects of various price-cap rules on peakload pricing. The issue recently gains practical importance in regulated network industries. The formal approach reveals that efficiency properties of various price-cap rules are, notwithstanding some problems, fairly good. A discussion of some practically relevant objections suggests that these objections may be not sufficiently convincing to prohibit (or restrict) peak-load pricing. Overall, a strong case can be made for allowing price-cap regulated firms the flexibility to apply peak-load pricing, if the alternatives are to have either no peak-load pricing or have the regulator prescribe the peak-load structure. | Since the 1990s, local exchange telecommunications carriers (LECs) have been subject to incentive regulation plans. This paper discusses theoretical and practical aspects of the evolution of price regulation as retail competition increases and as regulators mandate extensive availability of wholesale services. Particular issues include (1) adjusting price change/productivity expectations as the proportion of services subject to price regulation decreases, (2) whether earnings sharing is compatible with more limited price regulation, and (3) compatibility among wholesale and retail price and quality regulation. The paper concludes by describing recent developments in specific jurisdictions and recommends directions for future incentive regulation. | Thegovernment sets a price floor in order to protect what? | The Effects of Price on Alcohol Consumption and Alcohol-Related Problems | 1,999,976 | The GCPR itself contained only one provision for the adjustment of ceiling prices under the freeze. This applied to processors and resellers of agricultural commodities selling below parity and was provided to conform to the provisions of the Defense Production Act relating to such commodities.1 The GCPR contained no general adjustment provision. Within a few months of the freeze, however, the need | Economic consequences of mandatory GAAP changes: The case of SFAS No. 158 | [Final remarks] Our findings suggest that the decentralization reform of the MW setting mechanism accelerated the growth of the wage floor for Russian workers and narrowed the variation in the minima between regions. At the same time, the coexistence of the federal and regional minimum wages has led to new imbalances. All these mean that the reform of the minimum wage setting mechanism in Russia cannot be considered final and further steps are required for better functioning of this institute. | Decoupled payment compensation in EU agro-food industry ∗ | The goverment sets a price floor in order to protect what? | are fixed costs always fixed? | The Haryana government on Thursday announced to increase the minimum wage of an unskilled worker to Rs 186 per day and that of highly skilled to Rs 211.42 per day in the state. | This paper highlights relative price adjustments taking place in the global economy as important sources of the lower levels of inflation rates observed in the recent decades. Using a markup model, it shows substantial effects from declines in wage costs and import prices relative to consumer prices. Out of the 5 percentage point decline in the inflation rates in eight OECD countries from 1970-1989 to 1990-2006, global shocks to two relative prices account for more than 1.5 percentage points, while a monetary policy shock accounts for another 1 percentage point. | Wish FreedomPop offered more competitive rates |
1,999,977 | Which multiplayer game version should I get? Spellforce 1 or Spellforce 3? | Recently I got a chance to play P3 For myself and want to know which version is best for a first playthrough, I already know bits here and there about it from other people talking about it and just kinda looking up stuff about the game, but portable or FES, which one do I pick? | Which Fibbage is better? Are the other games better in Jackbox 1 or 2?
Also if someone could explain how these games work (as in how do other people play) that'd be great, thanks! | Been playing new light with my D1 friends was wondering which dlc I should buy for the best D2 experience | I'm going to be playing on the PC and I want to know if I should start the singleplayer (which is what I always did in previous Mass Effect games) or start with multiplayer and play singleplayer later.
I feel like I missed the majority of the multiplayer boom when I played ME3 on xbox because I played the singleplayer first and dibble dabbled in multiplayer to get the max EMS, then went back to multiplayer.
Thoughts? | Hi everyone, I’m looking for a multiplayer first person shooter with an active player base. I have a pc that can play games like Overwatch and rainbow six seige but can’t play newer than 2016 games like battlefront2. I don’t care what platform or cost it is. If you guys know black ops or Ravenfield (on steam) | Number of Players: Usually 2. Could go up to 4
Game Length: ~1 hour
Complexity of Game: Lighter
Your budget: $35
Games I Own/Like: Stone Age, Lords of Waterdeep, Village, Takenoko, Keyflower
Please don't suggest any other games then these two. I really just want to know which of these if any plays well with two players. | So I'm a big fan of soulsborne and after finishing bloodborne (stuck on orphan of Kos) and Nioh 1 I'm wondering which sequel i should get?
I've beat DS 1 and 3 and Adored them but skipped over 2 due to me hearing that the game had many,many flaws.
Nioh 1 I bought last Christmas but never finished due to me buying dark souls 1 at the same time (both were quite cheap) and am only going back to now after finishing Bloodborne but the sequel looks like it improves on issues I had with the original.
Both games look good but which would be better for me to spend my money on? | So I finally got my gf to play some games and she liked kf2 but we are so bad when it’s just us playing. Need some advise on which 2 classes complement each other and best for 2 players. Appreciate it and thanks in advance. | 1,999,977 | Hello, me and my brother used to play spellforce 1 together on LAN previously but never completed it (we're talking over 10 years ago). As we don't live together anymore, I was wondering if online multiplayer is functioning at all for SpellForce 1? if not then does SpellForce 3 still have the character creation and playing together just like spellforce 1?
&#x200B;
and if I do get either game, which DLC expansion should I even get? if not all? | (ME:A) Are people going to be playing single player or multiplayer first? | Question about multiplayer | Integrating multiplayer into the singleplayer campaign like Dark Souls? | borderlands 2, single or multiplayer? | Ranked online multiplayer, is there any balancing at all? (details in the post) | What is the state of the multiplayer currently? | how will multiplayer work? | when was multiplayer support added to civilization revolution |
1,999,978 | how many drivers signed up for rally finland in 1988 | Scottish Rally Championship The Scottish Rally Championship is a rallying series run throughout Scotland over the course of a year, that comprises seven gravel rallies. Points are awarded to the top placed drivers and the driver scoring the highest number of points over the season is declared Champion. The championship has always been a breeding ground for many World Rally Championship drivers, including Colin & Alister McRae, Robbie Head and Barry Clark. Notable previous champions have included Mitsubishi Ralliart founder Andrew Cowan, who won the championship in 1976 in a Colt Lancer, and former World Rally Champion, Colin McRae who | The 2008 Swedish Rally, officially 57th Uddeholm Swedish Rally, was the second round of 2008 World Rally Championship season. It was the season's first and only event held on snow- and ice-covered gravel roads. The rally took place during February 7–10, beginning with Super Special Stage placed in rallybase, Karlstad. The rally was also the first round of Production Car World Rally Championship this season.
Even though it snowed before the rally, eliminating the threat of calling the event off, the mild temperatures caused cancellation of stages 12 and 18, shortening the overall competitive kilometers count.
The rally was won by BP Ford World Rally Team's 22-year-old Jari-Matti Latvala. With his debut win, Latvala became the youngest winner in the history of the World Rally Championship, breaking Henri Toivonen's record from the 1980 RAC Rally. Latvala's teammate and compatriot Mikko Hirvonen was second and Stobart VK M-Sport Ford's Gigi Galli completed an all-Ford podium. Subaru World Rally Team's Petter Solberg was fourth, followed by Andreas Mikkelsen, Dani Sordo, Toni Gardemeister, Juho Hänninen, Mads Østberg and Jari Ketomaa. Fifth-placed Matthew Wilson ran into technical problems with throttle on the penultimate stage and had to retire. Sébastien Loeb crashed out and rolled his car while running third, then retired again, after restarting under SupeRally and winning two stages, because of the damaged engine. Henning Solberg inherited the third place, but later suffered a puncture causing him to slip further down and then crashed while running fourth and was forced to retire for the second day; after rejoining the fight under SupeRally format Norwegian was the fastest driver on day three, winning all the remaining stages.
Results
Special stages
All dates and times are CET (UTC+1).
Championship standings after the event
Drivers' championship
Manufacturers' championship
Production championship
Points table:
References
External links
Results at eWRC.com
Swedish Rally, 2008
Swedish Rally
Rally | of the event's success, it was voted the SCCA's ProRally of the Year in 1992 and again in 2001. In 2007, the name of the event was changed to the New England Forest Rally to better reflect the continued growth of the event by expanding to include stages in the city of Berlin, New Hampshire. The 1999 event saw 1984 World Rally Champion Stig Blomqvist drive the late Carl Merrill's Ford Escort Cosworth to victory over 83 National and Divisional teams. In 2007, freestyle motocross star turned rally driver Travis Pastrana drove a Subaru Rally Team USA WRX STi to | Rally Finland the Monte Carlo Rally, leading to a demand for a Monte Carlo type of rally in Finland. In July 1951, Pentti Barck's proposal for an annual competition in Jyväskylä was accepted. The first-ever rally began on 1 September 1951 as Jyväskylän Suurajot (Jyväskylä Grand Prix). 26 entrants tackled the 1,700 kilometre (1,060 mi) route that stretched to Rovaniemi in Lapland, through Kokkola and Oulu, and back to the rally headquarters in Jyväskylä. The winner Arvo Karlsson, driving an Austin Atlantic, had accumulated the least penalty points and had been the closest to the target times throughout the route and the | Tomi Tuominen (born 8 November 1971) is a Finnish former rally co-driver. Past drivers include Toni Gardemeister and Juho Hänninen.
References
External links
Profile at ewrc-results.com
1971 births
Finnish rally co-drivers
Living people
World Rally Championship drivers
World Rally Championship co-drivers | virtue of having been faster than Brookes on the opening stage. Hannu Mikkola Hannu Olavi Mikkola (born 24 May 1942 in Joensuu, Finland) is a Finnish retired world champion rally driver. He was a seven-time winner of the 1000 Lakes Rally in Finland and won the RAC Rally in Great Britain four times. Mikkola's rally career spanned 31 years, starting with a Volvo PV544 in 1963, but his most successful period was during the 1970s and 1980s. The 1970s saw Mikkola a frontrunner in many international events, usually in a Ford Escort. He became the first overseas driver to win | variety of menu options for customizing the game, calling it "a virtual role model for games of this type." A 1984 review in "Hi-Res" magazine called "Rally Speedway" "graphically gorgeous" but criticized the top-down perspective for being less exciting than a behind-the-car view." Rally Speedway Rally Speedway (also known as John Anderson's Rally Speedway) is a top-down racing game developed by John Anderson for the Atari 8-bit family and released by Adventure International in 1983. It was ported to the Commodore 64 and published by Commodore in 1985. The game includes an editor allowing players to create and save their | Ed Ordynski (born 21 July 1957) is an Australian former rally driver. He served as Chairman of the Australian Rally Commission (ARCom) in 2007.
Ordynski is best known for his exploits driving Mitsubishi cars. Driving a Galant VR-4, he won the Australian Rally Championship in 1990. He also won the Group N category that year, and went on to win that category three more times (1993, 1994, 1995), driving a Lancer Evolution.
Ordynski won the 1995 Mobil 1 Round Australia Trial driving a Holden Commodore (VR) entered by the Mobil Bridgestone Rally Team. He also drove 5.0 Litre Touring Cars in 1995, recording a tenth place in the 1995 Sandown 500, and a retirement in the 1995 Tooheys 1000 at Bathurst in a Holden Commodore (VP).
Away from rallying and motorsport, Ed Ordynski was a high school teacher.
See also
Confederation of Australian Motor Sport (CAMS)
References
Australian rally drivers
World Rally Championship drivers
Supercars Championship drivers
Racing drivers from South Australia
1957 births
Living people | 1,999,978 | Rally Finland route was modified to bring the average speeds closer to the FISA limit of 110 km/h. The top drivers exceeded the limit almost regularly, but FISA had given the organisers a 10 percent flexibility. Combined with their dislike for the slower Group A cars, drivers were highly critical of the organisers for artificially slowing the rally in 1987. A record 214 drivers signed up for the 1988 event and 200 were qualified to start by the organisers. Albert II, Prince of Monaco arrived to follow the event and was scheduled to drive a few stages in an ex-Alén Lancia. In | who organized the first rally in finland in 1951 | Dirt Rally: Can a second real person be the co-driver? | 2020 Rally Finland | who made the first car to go over 200 mph | who was the first finnish driver to win formula one | who drove the first 15 lap race of romano we84 | daniel ricciardo and max verstappen are drivers in which formula one | Unable to drive my formula drift cars |
1,999,979 | IAmA chilean student who has been participating in ocupations, protests and riots during the last months . AMA. | Ricardo Poma (born 1946) is the chief executive officer of the family-owned conglomerate Grupo Poma, based in San Salvador, El Salvador.
Poma obtained an industrial engineering degree from Princeton University in 1967 and an MBA from Harvard Business School in 1970. When he returned to El Salvador, Ricardo joined the family business; he took the reins of the conglomerate from his father Luis Poma in the 1980s.
Ricardo Poma dedicates a significant amount of his time to social projects and institutions, such as the Salvadoran Foundation for Health and Human Development (FUSAL), the Advanced School of Business and Economics (ESEN) and Fundacion Poma, focusing on culture, education and health programs in El Salvador and Central America. He is also a member of the President's Leadership Council of the Inter-American Dialogue.
Poma was an early investor in Bain Capital.
Notes
1947 births
Living people
Princeton University alumni
Harvard Business School alumni
Salvadoran businesspeople
Bain Capital
Salvadoran chief executives
Salvadoran people of Spanish descent
Members of the Inter-American Dialogue | Student activism Student activism is work by students to cause political, environmental, economic, or social change. Although often focused on schools, curriculum, and educational funding, student groups have influenced greater political events. Modern student activist movements vary widely in subject, size, and success, with all kinds of students in all kinds of educational settings participating, including public and private school students; elementary, middle, senior, undergraduate, and graduate students; and all races, socio-economic backgrounds, and political perspectives. Some student protests focus on the internal affairs of a specific institution; others focus on broader issues such as a war or dictatorship. Likewise, | "On September 26th, 2014, 43 students were disappeared in Ayotzinapa, Mexico and the whole world heard their story. Protests took place across the country and even news outlets outside of Mexico began covering the violence that was rocking the country. But one year later, those 43 male students still make up a small percentage of the estimated 25,000 people reported missing in Mexico since 2007, many — if not a majority — of them women."
And when a few hundred school girls were kidnapped not even killed by Hoko Haram I didn't hear the feminists say that we need to talk about the few hundred boys slaughtered by Boko Haram. No demands for investigations. Nothing. The world cared about men in one instance and that tees them off. | Who is amnesty international? | There are many risks that students face while abroad; from tragic accidents, illness, and disease to becoming victims of violent crimes. Human trafficking is an international threat facing everyone. While victims of human trafficking come from all walks of life, in particular, individuals belonging to vulnerable populations are often targeted for this method of exploitation. Cultural competency, language barriers, and ignorance as to resources are all factors which contribute to the increased vulnerability of students studying abroad. An institution providing opportunities for international study should develop an effective approach to mitigate the risk of human trafficking through programs designed to enable students to protect themselves and others effectively. This paper comments on best practices for risk management, and explores different avenues and relevant law for increased transparency in study abroad risk. | Dominican Civil War firefights and sniper fire. A day later, OAS members established the Inter-American Peace Force (IAPF) with the goal of serving as a peacekeeping formation in the Dominican Republic. IAPF consisted of 1,748 Brazilian, Paraguayan, Nicaraguan, Costa Rican, Salvadoran and Honduran troops; it was headed by Brazilian general Hugo Panasco Alvim, with U.S. Army General Bruce Palmer serving as his deputy commander. On 26 May, U.S. forces began gradually withdrawing from the island. On June 15, the Constitutionalists launched a second and final attempt to expand the boundaries of their stronghold. In the bloodiest battle of the intervention, the rebels began | Andrés Aylwin Azócar (20 June 1925 – 20 August 2018) was a Chilean lawyer, activist and politician who served as a Deputy representing the Christian Democratic Party from 1965 to 1973 and from 1990 to 1998. His older brother was Patricio Aylwin.
Activities
During the military dictatorship (1973–1990) Andrés_Aylwin defended many of victims arrested by the government of Augusto Pinochet.
Andre Aylwin wrote a few books including, "Simply what i saw" and " Eight days of a relegated".
References
1925 births
2018 deaths
Chilean lawyers
Chilean human rights activists
Christian Democratic Party (Chile) politicians
Members of the Chamber of Deputies of Chile
Aylwin family
20th-century Chilean lawyers
21st-century Chilean lawyers
University of Chile alumni
Chilean people of Welsh descent
People from Viña del Mar | Interview with the professor of Chicano/Latino Studies at the University of California (Irvine), Alejandro Morales, a true pioneer in Chicano literature and one of the most outstanding, powerful and innovative writers on the Chicano experience. | 1,999,979 | Well, there are a few links explaining the situation in Chile, we've been striking since May, we took over the university in the same month and we've been occupating it since then.
The number of people in demonstrations goes from 20k to 110k in Santiago. There have been almost 40 student's demonstrations in Santiago this year.
Currently in the Uni with some mates, bored, waiting for any questions.
very good report from "the real news":
al jazeera english report:
student's video explaining why we are fighting (english subs):
pictures:
#34
riots:
#p/u/1/Q68Ht3DvJiQ (my favourite, was after police attacked the concentration with horses and tear gas, this is when we are winning)
edit: sorry about my english, but you know, shitty education equals shitty english. | Student resistance to neoliberalism in Chile | where did the student protests take place in the uk | what did rioters spray on topshop in london during the uk student protests | how many points are there in the chart of demands of nepal student protests | what is the name of the massacre in santiago in 1993 | number of protesters at the 3rd summit of the americas | [EVENT] The Galician Patriot Movement | Trump International Protest: view from the trenches. AMA. |
1,999,980 | Can a CEO live in a different state than their company is located in? | Is hawaii the only us state where coffee is grown? | Do you put a comma after a city and before the state in a sentence? | Which states offer tenancy by the entirety? | organization with a social objective which a public function. Hivos' headquarters is in The Hague. The regional offices are six offices located in Jakarta (Indonesia), San Jose (Costa Rica), Harare (Zimbabwe), Nairobi (Kenya), La Paz (Bolivia) and Bangalore (India). Hivos has also 6 local/national offices in Ecuador, Guatemala, Nicaragua, Tanzania, South Africa, Timor Leste. By the end of 2011, Hivos consists of over 300 employees, of whom about 120 reside at its headquarters in The Hague. The Executive Board of Hivos is owned by the statutory board, namely Edwin Huizing (Managing Director) and Ben Witjes (Director of Programs and Projects). | I am trying to find shapefile with township and range data for Texas.
I can find most states here:
But not Texas and New York, and these are 2 states that I need info for. | What states can you see from the empire state building? | Which state is the world trade center? | Where is the home state of sam houston? | 1,999,980 | This question is PURELY hypothetical. Let's say I became a very very successful entrepeneur with a small business that turns into a major corporation. Money is not an object. Do you think a CEO can efficiently lead a company while living in, say, Hawaii, when the company is located mainland? Are there enough technological resources available that would allow such a thing in your opinion? I know I'm a complete dreamer, but my all time life's ambition is to expand my company to the point that it is an industry leader, and of course I would like to remain the CEO. However, I've always dreamed of living in Hawaii, and the company will definitely be located in the midwest. I just wanted to know what your input would be with such a crazy crazy idea. Thanks in advance. | Potentially moving, beed help with cost of living | Localization factors in decision making of location of selected enterprises | I thought about partnering with someone in the US to sell the items in european market. I would do all the work overseas. Thoughts? | Would you go abroad and make your startup or stay in your third world country and start a startup | Institutional ownership and corporate social responsibility:The effect of geographic proximity | Literature Review of Regional Innovation Network:an Economic Geographical Perspective | Is it possible to move to the United States from Europe? | Critical success factors when going global : Agribusiness co-operative growth |
1,999,981 | Changing OEM steering wheel for another OEM wheel | It was the exact equivalent to the OEM wheel, came quickly, was less money and I only needed to buy one. | Just found out my wheel is bent.
Dealership wants $400-$500 for a new one. However, I see sites like this that sell significantly cheaper wheels, sometimes without a cap. This site sells it for $250 and claims it is OEM.
**Do you guys generally stick with direct-from-bmw for OEM rims? Or are the 3rd party ones truly the same?**
This is for a 2011 535i xDrive and this is the type of wheel I have.
Also, if you guys have any go-to websites for wheels please let me know, I would highly appreciate it. | My car is a DD first, always. So I’d like to preserve some OEM qualities, while also adding some off-road capability and aesthetic.
My logic for keeping the OEM wheel size is to be able to maintain the use of my spare tire since I’m not in a position to buy 5 wheels, plus it will make the transition from stock easier on my wallet (buying wheels separately from tires as opposed to a set all at once).
So, anyone who has this, can I see your setup? | Hey everyone, I'm looking for OEM wheels from an EX/EX-L to replace the fugly wheel covers that the 9th Gen LX models come with. What's the best source to get new/gently used wheels for the low? | How do you adjust steering wheel in Dodge ram? | I replaced the steering box at the same time but this worked perfectly and took the slop out of my wheel. The old one when turning the steering back and fourth it had a lot of slop before it started turning the steering box. Installed it on a 97 Chevy K1500. Make sure when you install the bottom before you put it over the steering box spline to pull the boot down as far as you can but leave enough space so you can put the bolt in. Mine got stuck when I pushed it up out of the way. | How do you remove an steering wheel air bag in a golf make 4? | Hi all,
I'm looking for DIY power steering belt replacement. Anyone has idea or diagram can help me out? Search google and youtube but all the results is how to change Alternator belt. Is it worth to go to mechanics to let them do it?
Thanks so much. | 1,999,981 | So the title basically says it. My friend has an 86 rx7 with an oem wheel and he wants to get a new wheel. But instead of getting an after market wheel like a Nardi or a Persona wheel, we're wondering if you can attach a wheel from a newer car. What would go into trying to attach an M sport wheel from a BMW? Would it be easier if we got a wheel from a newer Mazda? Or is this idea just not worth it. | Custom Hot Wheels cars...? | Is there any way to upgrade/modify a car while still having it considered stock? | Fellas, accept this truth, even you may hate to believe it - Gaijin will continue to add new vehicles to "Germany Tech Tree". (Also: "How to get the SK-105 to France") | what was the name of the bmw sports car introduced in 1995 | I never recommend aftermarket parts for BMWs | Probably getting a 2019 Ford EcoSport Titanium, bad idea? | what is the name of the american racing wheel | Can ATV rims be reversed? |
1,999,982 | how long were the trams in jakarta | as if it were a double-ended tram, except that the operator must exit one vehicle and enter the other, when reversing at the end of the run. Articulated trams, invented and first used by the Boston Elevated Railway in 1912–13 at a total length of about twelve meters long (40 ft) for each pioneering example of twin-section articulated tram car, have two or more body sections, connected by flexible joints and a round platform at their pivoting midsection(s). Like articulated buses, they have increased passenger capacity. In practice, these trams can be up to long (such as CAF Urbos 3 | Trams in Amsterdam The Amsterdam Tram () is a tram network in Amsterdam, Netherlands. The network dates back to 1875. Since 1943, it has been operated by municipal public transport operator GVB, which also runs the Amsterdam metro and the city bus and ferry services. The Amsterdam Tram is the largest tram network in the Netherlands and one of the largest in Europe. The trams on the network run on standard gauge track. Since 1900, they have been powered by electricity, at 600 V DC. At the terminus station of almost every tram route is a turning loop, so that | Mandalay Bay Tram other provides an express link between the two end stations. Each system consists of one train with five cars. The individual cars carry 32 passengers each, thus each train has a total capacity of 160 passengers. System 1 carries 1,300 passengers per hour per direction (pphpd) and has four stations; system 2 carries 1,900 pphpd, and has two stations (and four passengers per square meter). The trains run back empty in the opposite direction between each passenger-carrying run. In the first year of operation, the system carried approximately 21 million passengers. The train cars are firmly attached to a haul | please” phrase was used on the Atlantic City trams until a lawsuit was filed. This resulted in the trams receiving the new phrase, “Step aside or enjoy a ride”. Tramcar (Wildwood, New Jersey) The Sightseers Tram Car (commonly referred to as the Tramcar) is a trackless train service running on the Boardwalk in the Cape May County, New Jersey communities of Wildwood and North Wildwood. The service, which began on June 11, 1949, takes passengers along the two-mile long Wildwood boardwalk. Service is available at all points along the boardwalk, from the beginning at Cresse Avenue to the end at | Hey everyone. I am an American who has been to Amsterdam twice, and both times I basically walked everywhere I wanted to go.
I'll be back for a couple nights in early March, and I want to get out to some neighborhoods beyond the center. But the tram system and maps confuse the heck out of me, and believe me, I've tried reading about it. I guess the main challenge for me is visualizing the route of any single tram number.
Kind of feeling like a dunce here, what's the trick to this? Anyone got a link or a comment that is going to help me out? Thanks in advance. | Pyongyang Tram is a public tram system in Pyongyang, the capital of the Democratic People's Republic of Korea (North Korea). The first line of the current system opened in 1989. There are currently four lines in operation.
Overview
Before the Korean War from 1950 to 1953, there were three tramway systems in the entire Korean Peninsula: one each in Seoul, Busan and Pyongyang. However, the system in Pyongyang was discontinued after the war, largely due to the significant destruction of the city by US/UN bombing attacks. The remaining two in Seoul and Busan survived the war but were eventually discontinued too when motorcars became more common and a larger means of transport in South Korea in 1968, thus leaving no tramway networks on the peninsula.
During the North Korean famine, the service of tram lines became sparse, and often trams would not run due to the lack of drivers and shortage of electricity.
Unlike South Korea, personal ownership of automobiles in North Korea is very rare. North Koreans, especially those living in Pyongyang and other major cities, rely mainly on public transport. In Pyongyang, there are trolleybuses (the Pyongyang trolleybus system) and subways (the Pyongyang Metro), with these two serving as its main forms of public transport. However, as trolleybus lines became gradually overcrowded, the city decided to re-open tram-lines. The first line was built and opened in 1989.
A number of Tatra T4 trams and its trailer B4 were bought from Dresden, Magdeburg and Leipzig in 1997–1998.
In 2003, however, the section of Line 1 between P'yŏngyang-yŏk and Songyo was closed, as the bridge over Taedong River started to deteriorate, splitting Line 1 into two parts divided by the Taedong River. The section from Songyo to Songsin was eventually replaced by a trolleybus in 2014. The part crossing the bridge was replaced by a bus service.
In 2008, the City Transportation Company of Prague sold 20 used T3s to Pyongyang Public Transportation Enterprise together with a shipment of tram-rails. These trams were built ranging from 1967 for the Tatra T3 in original modification, to 1987 for the T3SUCS modification. According to Ondřej Pečený, a spokesman for the City Transportation Company of Prague, these trams are in very good condition, and can run for at least two years without the need of a service.
The tram cars were made by Tatra, a Czechoslovak company, during that nation's socialist era. Various types are used, but there are currently no low-floor tram cars.
Foreign tourists were previously not permitted to ride the tram lines, but some recent tours have started to include tramway rides (though rides are not shared with locals and are instead chartered, unlike the Pyongyang Metro).
Due to the need for transport, tram drivers cannot afford to relax, even on holidays.
Lines
There are currently three lines in operation plus a meter gauge line operated by the military.
As of 2006, the fare is ₩5 for any section. There are also coupon tickets (; sinae ch'ap'yo) issued in the form of tickets inserted into the fare box.
Rolling stock
Prior to 2018, the rolling stock used were the Czechoslovakian ČKD Praha Tatra T6B5K, Tatra T3/SUCS, Tatra T4D and B4D and KT8D5K in either red/white livery or blue/white. The Kŭmsusan line uses VBZ Be 4/4 Type Ib rolling stock on a different gauge of 1,000 mm, rather than 1,435 mm for lines 1–3. The Shenyang ST4 had been retired in 1999 due to their failing articulation joint and subsequently converted into Chollima-961/971 trolleybuses while it is possible others were sent to the Chongjin tram system where they received a new body at the Chongjin Bus Factory.
For the full list, see Trams and trolleybuses in North Korea
In August 2018, following the introduction of new trolleybuses and metro cars, new partially domestically-produced tram cars were introduced in Pyongyang for the first time in about twenty years. The bodies were manufactured by Pyongyang's Bus Repair Factory and named Tongil, on the chassis of the Tatra KT8D5K.
See also
Pyongyang Metro
Trams and trolleybuses in North Korea
Transport in North Korea
List of tram and light rail transit systems
Trolleybuses in Pyongyang
References
Further reading
Hayato Kokubu, Shōgun-sama no Tetsudō: Kitachōsen Tetsudō Jijō (; "Railway of the Dear Leader: The Railway Situation in North Korea"), 2007. ()
External links
Pyongyang Tram 360 degree Virtual Tour
Map and aerial photos
Transport in Pyongyang
Tram transport in North Korea
Metre gauge railways in North Korea
Pyongyang | British Malaya. The city's first tram system, originally powered by steam, began operations in the 1880s. Although the tram lines have since been disused, another colonial legacy, the trishaw, still plies the city's streets, albeit catering primarily for tourists.Buses now form the backbone of public transportation within Penang. Public bus services are mainly provided by Rapid Penang, which operates 56 routes within Greater Penang, including interstate routes into Kedah and Perak. Among the routes are free-of-charge transit services such as the Central Area Transit, the Congestion Alleviation Transport and the Pulau Tikus Loop. In addition, the "Hop-On Hop-Off" bus service, | GSP Belgrade () is a public transit company in the city of Belgrade. As of 2018, it operates with 170 lines and has 1,611 active vehicles.
Name
The acronym "GSP" stands for Gradsko saobraćajno preduzeće ().
History
Its history dates back to 14 October 1892 when the first horse tram line began operating in Belgrade between Slavija and Terazije. It was known under the name Beogradska varoška železnica (). The first bus line was opened in 1925 and in 1947 the first trolleybuses appeared in Belgrade.
1940–1990
In 1940, the tram traffic took place on 10 lines. Belgrade has disposed of 104 trams, 60 trailers and 87 buses. The following year, in the bombing of Belgrade was destroyed 38 trams, 36 trailers and 10 buses. In 1945, company changed its name to the Department of traffic lights and the Executive Committee of the City of Belgrade. In Belgrade Radio 4 tram and bus lines 3 with a total of 58 vehicles. In 1947, the first trolley was introduced to the line Kalemegdan – Slavija.
In 1955, in Belgrade was 8 tram lines with 162 trams, three trolley lines with 42 trolley buses and 14 bus routes with 148 buses. In 1956, he was released into operation first trolleybus domestic production - "Goša FOM". Belgrade and Zemun are associated trolley lines. As of 1960, there was 38 lines (7 tram, 6 trolleybus and 14 bus). Number of vehicles in inventory stood at 467. In 1961, 160 Leyland buses were purchased.
In 1962, cab vehicles were introduced, a total of 63 vehicles. In 1970, 144 new vehicles were purchased for the transport of Belgrade. The total number of vehicles has increased to 806. In 1975, new zonal tariff system was introduced and number of vehicles rose to 995. By 1985, the total number of vehicles was 1380, and the average number of vehicles in traffic in operation was, on weekdays was 779. In 1989, an integrated system of unified tariff system, in addition to Lasta and GSP in the system is turned on and ZTP Beograd and ATP Pancevo.
1990–2000
By the decision of the Assembly of Belgrade, GSP "Belgrade" in 1990 became a public utility company, founded by the city. In 1991, with a total of 1,393 vehicles, with average age of 4.5 years, the streets of Belgrade was at the peak was about 1,130 vehicles a day carrying about 2.5 million passengers. The crisis in the former Yugoslavia, which escalated in the second half of 1991, led to the introduction of economic sanctions by UN Security Council to Federal Republic of Yugoslavia, and the influx of a large number of displaced persons in Belgrade. Investments in the purchase of new vehicles, spare parts and maintenance of the infrastructure was minimal. During 1993, due to the inability of continuous maintenance of the public transport problems in the procurement of oil and tires, price growth, transport declined in the number of vehicles in traffic, so that at the end of the year only 400 vehicles were in operation. Some lines were eliminated or shortened. The function of public transport in Belgrade had been damaged.
During 1994 and 1995, the GSP managed to raise the level of transportation, revitalize the fleet to an average of 909 vehicles on weekdays. At the beginning of 1998, in public transport private transporters were included. Compared to the previous year, it had 127 vehicles less, along with a tendency of further decline. The unified tariff system ceased to existand passed on ticketing in vehicles by the conductor. After the start of NATO bombing of Yugoslavia on 24 March 1999, GSP "Beograd" transferred to work in the war environment, which meant the abolition or curtailment of a large number of lines. In the aftermath of the NATO bombing, the problem was lack of vehicles. The unfavorable situation continued in 2000. The outdated fleet, low technical condition of vehicles, lack of spare parts, frequent reduction of traffic due to fuel shortages are only part of the problem that led to the introduction of emergency measures by the Republic government. Significant changes have taken place after the events of October 2000, when the city's new government has opted for the revitalization of the GSP, as a holder of public transport system in Belgrade. A goal that was set before GSP "Belgrade" was to reach the level of the enterprise from the beginning of the 1990s. By the end of the year, most of former lines were reestablished.
2011–present
In 2011, GSP Belgrade began with the acquisition of new CAF Urbos 3 trams. By the end of 2012, it supplied 30 trams of this model. The new trams are commonly referred to as Španac (Spaniard) by Belgrade's residents.
GSP Belgrade introduced BusPlus on 1 February 2012. BusPlus is an electronic payment method where commuters load fares on a thin plastic card. Also, the private carriers were introduced and integrated in tariff system – Integrated Tariff System (ITS). There are 145 lines, out of which 12 are tram, 8 are trolleybus and 125 are bus lines. Service operates daily between 4am and midnight, with a limited night bus system. GSP also operates school bus lines, and transportation for the disabled. The entire traffic grid is divided in two zones.
As of 2017, GSP Belgrade has 1,582 vehicles in operation. Most of GSP's revenue is still generated through subsidies by the city of Belgrade; in 2017, that amount stood at 65 million euros.
In April 2019, GSP along with the city of Belgrade signed a contract to purchase 244 new buses, of which 70 are manufactured by Turkish BMC and 174 by Chinese Higer.
Vehicle coloring
Until the beginning of the 1960s, the vehicles have been colored by cream and red color scheme (buses have been colored until 1961. trolleybuses and trams are colored until 1964). From the beginning of the 1960s, the vehicles have been colored by Mussolini livery – light and dark green color scheme (for buses from 1961 to 1967, for trolleybuses and trams from 1964 to 1970).
From the end of the 1960s, the vehicles have been colored by cream and green color scheme (for trams and trolleybuses from 1970 to 1979, for buses from 1967 to 1987). From the end of the 1970s, the vehicles have been colored by cream and red color scheme again (for trams and trolleybuses from 1979 to 2003, for buses from 1987 to 2004).
From the beginning of 2000s, the vehicles are coloring by three color schemes with blue bottom (trams are colored by red and blue color scheme from 2002, trolleybuses are colored by orange and blue color scheme from 2003 (for some units, but their current color scheme is red from 2010), and buses are colored by yellow and blue color scheme from 2004 (in future, their color scheme will be red from 2015)). Some vehicles have been colored by cream and blue color scheme (like the private buses in the end of the 1990s, for example: one trolleybus ZiU-9 and one tram ČKD-Tatra KT4YU have been colored in cream and blue color scheme in 1993 (in collaboration with Mašinska Industrija Niš - MIN), and two trams ČKD-Tatra KT4YU have been coloured in cream and blue colour scheme in 2001).
Vehicle fleet
Current fleet
Buses
BMC
Procity 12 – solo
Higer
KLQ6129GQ2
Ikarbus
IK-101 (from 1997) – solo
IK-103 (from 1998) – solo
IK-106 (from 1997) – solo
IK-112.3 (from 2006) – solo
IK-112N (from 2008) – solo
IK-201 (from 1997) – articulated
IK-202 (from 1998) – articulated
IK-203 (from 1999) – articulated
IK-218 (from 2011) – articulated
IK-218.3 (from 2007) – articulated
IK-218N (from 2009) – articulated
IK-218M (from 2012) – articulated
Mercedes-Benz
O305 – donation from Berlin (Germany) (from 1997) – solo
O345 Conecto (from 2003) – solo
MAN
SG313 – donation from Japan (from 2003) – articulated
SL283 – donation from Japan (from 2003) – solo
MAZ/BIK
BIK-203 CNG (from 2010) – solo
Solaris
Urbino 18 (from 2013) – articulated
Trolleybuses
ZiU/TrolZa
TrolZa-62052.01 (from 2000) – articulated
Belkommunmash
AKSM-321.00S (from 2005) – solo
AKSM-333.04 (from 2004) – articulated
Trams
ČKD Tatra
Tatra KT4YUB/YUBM (from 1980) – articulated
Duewag
GT6 (Be 4/6) – donation from Basel (Switzerland) (from 2001) – articulated
CAF
CAF Urbos 3 (from 2011) – low floor articulated
Unique trams
Čičica – originally remaining Đuro Đaković TMK 101 (from 1994) – solo
ČKD T4D – donation from Halle (Germany) (from 2002) – solo
SWP Be 4/4 – donation from Basel (Switzerland) (from 2001) – solo
Vehicles used in the past
Buses
Past buses
Mercedes-Benz O317K FAS "11 Oktomvri" Skoplje (1973–1990) – solo – 17 years
Mercedes-Benz O305G (2000–2003) – donation from Germany – articulated – 3 years
Mercedes-Benz O405 (2000-2019) - donation from Germany - solo - 19 years
Mercedes-Benz O405N (2000-2017) - donation from Germany - solo - 17 years
Mercedes-Benz O405G (2000–2012) – donation from Germany – articulated – 12 years
FAS-Sanos S115 (1987–2013) – solo – 26 years
FAS-Sanos S200 (2000–2003) – donation from Ljubljana (Slovenia) – articulated – 3 years
MAN Avtomontaža 890 UO (1974–1986) – solo – 12 years
MAN Avtomontaža 890 UG (1970–1981) – articulated – 11 years
MAN 890 UO Ikarus Zemun IK-6B (1970–1987) – solo – 18 years
MAN 890 UG Ikarus Zemun IK-5B (1975–1994) – articulated – 19 years
MAN Avtomontaža SU 220 (1981–2008) – solo – 27 years
MAN Avtomontaža SG 220 (1987–2003) – articulated – 16 years
Ikarus IK-4B (1971–1990) – solo – 19 years
Ikarus IK-105B (1982–2000) – solo – 18 years
Ikarus IK-102 (1988–2014) – solo – 24 years
Ikarus IK-110B (1984–2013) – solo – 29 years
Ikarus IK-111B (1989–2017) - solo - 20 years
Ikarus IK-111 (1990–2000) – donation from Timișoara (Romania) – solo – 10 years
Ikarus IK-160B (1984–2013) – articulated – 28 years
Ikarus IK-161 (1986–2014) – articulated – 28 years
Ikarus IK-166 (1991–2014) – articulated – 23 years
Ikarus IK-166 (1994–2013) – donation from Istanbul (Turkey) – articulated – 19 years
Ikarus IK-167 (1990–2003) – articulated – 13 years
FAP-Leyland Kokarus (1963–1982) – solo – 19 years
FAP G100 (1965–1981) – solo – 16 years
FAP G160 (1967–1980) – articulated – 13 years
FAP A537 (2001–2020) – solo – 19 years
TAM AS 3500 (1968–1981) – solo – 13 years
Leyland Worldmaster (1961–1977) – solo – 16 years
MAN NL202 (2000–2013) – donation from Germany – solo – 13 years
Fiat Iveco (2000–2009) – donation from Trieste (Italy) – solo – 9 years
Graf-Stift GU 230 (2000–2004) – donation from Austria – articulated – 4 years
Ikarus 260 (2000–2002) – donation from Greece – solo – 2 years
Karosa B932E (2000-2020) - donation from Czech Republic - solo - 20 years
Trolleybuses
Past trolleybuses
Alfa Romeo / Goša (1962–1984) – solo – 22 years
Goša Fages (1956–1981) – solo – 25 years
Goša Prototype (1987–1995) – solo – 8 years
Fiat CGE (1949–1980) – solo – 31 years
Tatra T400 (1947–1961) – solo – 14 years
ZiU 9 (1979–2012) – solo – 33 years
ZiU 682G (1989–2015) - solo - 26 years
ZiU 682B-10 (2005–2010) – donation from Athens (Greece) – solo – 5 years
Trolza 5275-05 (2003–2010) – solo – 7 years
VMZ 5298(375) (2000–2010) – solo – 10 years
Belkommunmash AKSM 201.01 (2001–2016) - solo – 15 years
Graf-Stift OE112 M11 (2001–2007) – donation from Austria – solo – 6 years
Graf-Stift OE112 M16 (2001–2010) – donation from Austria – articulated – 9 years
Trams
Past trams
Đuro Đaković TMK 101 (1964–1980) – solo – 16 years
Đuro Đaković TMK 201 Prototype (1967–1983) – solo – 16 years
Đuro Đaković TMK 201 (1970–1991) – solo – 21 years
ČKD Tatra T4D Prototype (1967–1983) – solo – 16 years
ČKD Tatra T4YUB (1972–1991) – solo – 19 years
Breda I (1940–1970) – solo – 30 years
Breda II (1949–1974) – solo – 25 years
Breda III 5300 (1960–1985) – solo – 25 years
PCC I (700) – from Belgium (1952–1981) – solo – 29 years
PCC II (B6) – from Belgium (1960–1985) – solo – 25 years
Jasenica – from Goša or Đuro Đaković (1936–1980) – solo – 44 years
Duewag T4 – Hagen (1977–1986) – solo (bi-directional) – 9 years
Duewag GT6 – Hagen (1978–1987) – articulated (bi-directional) – 9 years
Goša (1956–1968) – solo – 12 years
MAN-Siemens Shuckert (1923–1960) – solo – 37 years
AEG (1923–1971) – solo – 48 years
Škoda / Kolben Ringhofer (1927–1967) – solo – 40 years
BBC – Brown, Boveri & Cie (1927–1964) – solo – 37 years
References
External links
1892 establishments in Serbia
Companies based in Belgrade
Public transport in Serbia
Public transport operators
Transport companies established in 1892
Transport companies of Serbia
Transport in Belgrade | 1,999,982 | Trams in Jakarta The Jakarta tram system was a transport system in Jakarta, Indonesia. Its first-generation tram network first operated as a horse tram system, and was eventually converted to electric trams in the early twentieth century. Jakarta tramway served the city for almost a century until its closing in 1962. Jakarta tramlines started its life on April 20, 1869 as "Bataviasche Tramweg-Maatschappij" or BTM (Dutch "Batavia Tramway Company"). The first line of Jakarta tramway ran north-south from Old Batavia (close to the Amsterdam Gate), through the Molenvliet West, and ended at Harmonie. Later in the same year, the second | when did the first tram stop in batavia | who established the first tram in india | when did the new city of jakarta begin | how many stops are there in the hague tram network | batavia became the capital of indonesia in 1949. what is its current name | who developed the first tram in america | when did the trams stop on the boardwalk | in which canadian city was the first tram system built |
1,999,983 | The characteristics of bed agglomeration during fluidized bed combustion of eucalyptus bark | The bed agglomeration characteristics resulting from the combustion of 11 mixtures of rapeseed cake and spruce bark were studied in a bench-scale bubbling fluidized-bed reactor (5 kW). The objectiv ... | Abstract The behaviour of relatively deep beds of a spodumene concentrate air-fluidised at reduced pressure has been investigated at room temperature in a cylindrical column 5.72 cm bore over a range of top-pressure between 67 and 400 Pa absolute. These conditions gave a bed pressure drop for complete fluidisation at least an order of magnitude larger than the top pressure. A fluidisation front was seen to extend downwards through the bed with increasing gas flow rate. In this intermediate fluidisation regime, increasing gas velocity along the pressure gradient produces a range of behaviour within a bed that extends from settled conditions at the base towards slugging at the top. The increasing gas velocity creates a strong differential elutriation which was accompanied by a shift in the minimum fluidisation velocity as the mean bed particle size increased. Metallurgical applications and operational effects are considered. | In this work a numerical investigation of wall to bed heat transfer, and the related flow characteristics, was conducted along a conical fluidized bed combustor with a height of 0.8 m and a cone angle of 30°. A two-fluid Eulerian-Eulerian model was used while applying Kinetic Theory for Granular Flow (KTGF) to a wall-to-bed FB reactor. The heat transfer coefficient and hydrodynamics are discussed for two different drag models, namely the Gidaspow and Syamlal-O’Brien models. Furthermore, computational calculations were carried out for a variety of inlet velocities(1.4Umf~4 Umf) and different particle sizes. The heat transfer coefficient in the bed region was evaluated and compared with that calculated by penetration theory. The bed expansion for the two models was compared with that calculated using correlations from literature in order to validate the numerical calculations. The heat transfer coefficient was found to be increasing with increasing gas velocity and decreasing with increasing particle diameter. | Abstract Scale-up and commercialization of any chemical process is an inexact science and the scale-up of fluidized bed processes is especially so. The problem of gas bypassing and poor contact with bed particles has been recognized as a major scaling consideration for a generation. More recently, especially in circulating fluidized beds, the issues of particle flow patterns and density profiles have become appreciated as important unknowns in scale-up. Equally important scale-up difficulties occur outside the realm of reaction engineering, having to do with the physical nature of solid particles. The importance of all these factors will be discussed with reference to the commercialization of several fluid bed processes. | Abstract This paper presents a phenomenologically based mathematical model for biomass fast pyrolysis process in a bubbling fluidized-bed. The model was developed in transient state, is one-dimensional and is based on the two-phase theory. A semi-global reaction mechanism in two stages was used, considering the primary formation of products and the secondary reactions of the vapors. Also, population balances for the density/temperature distribution of the particles and distribution of the bubble size were proposed. The model can predict the temperature of the phases, the distribution and yields of the products, the heating rate of particles, and the residence time of gases. Finally, a solution algorithm for the model was proposed, which was programmed in MATLAB 7.0, being able to find a good fit between simulation results and the experimental data. | Effect of Different Types of Promoters on Bed Expansion in a Gas-Solid Fluidized Bed with Varying Distributor Open Areas | A thermal energy balance equation has been obtained for the flue gases of a fluidized bed operating on high moisture fuels. With bark, lignite and bituminous coal of grade 1 serving as fuels analyzed was the effect of heat absorption during the water evaporation of unburned fuel in the fluidized bed on two factors. The latter are the quantity of heat absorbed by a submerged tube and the temperature of the fluidized bed. The results of calculation and analysis indicate that when high moisture fuels are burned, the heat quantity needed for water evaporation related heat absorption is relatively great. In view of this, the latter should be taken into account in the thermal energy balance for the flue gases of a fluidized bed. | Monitoring particle fluidization in a fluidized bed granulator with an acoustic emission sensor | 1,999,983 | Investigating Agglomeration Tendency of Co-Gasification between High Alkali Biomass and Woody Biomass in a Bubbling Fluidized Bed System | Fragmentation and attrition phenomena occurring to lignite char particles during fluidized bed gasification by CO2 have been studied in a lab-scale apparatus. The influence of bed temperature, fluidizing velocity and inlet CO2 concentration on attrition and carbon conversion was investigated. Secondary fragmentation and attrition by abrasion of char particles during gasification were significant, suggesting a gasification-assisted attrition enhancement effect. This mechanism, associated to the low reactivity of the generated fines, made the loss of carbon by fines elutriation during char gasification more significant than that typically found under combustion conditions. Up to 10% of the carbon initially fed was lost in the elutriated fines. The carbon loss by elutriation increased with the fluidization velocity, and when the bed temperature and CO2 concentration decreased. The effect of these last two variables was connected to their influence on the char gasification rate. | The research and utilization on biomass gasification | One of the most important issues in biomass biocatalytic gasification is the correct prediction of gasification products, with particular attention to the Topping Atmosphere Residues (TARs). In this work, performedwithin the European 7FP UNIfHY project, we develops and validate experimentally a model which is able of predicting the outputs,including TARs, of a steam-fluidized bed biomass gasifier. Pine wood was chosen as biomass feedstock: the products obtained in pyrolysis tests are the relevant model input. Hydrodynamics and chemical properties of the reacting system are considered: the hydrodynamic approach is based on the two phase theory of fluidization, meanwhile the chemical model is based on the kinetic equations for the heterogeneous and homogenous reactions. The derived differentials equations for the gasifier at steady state were implemented MATLAB. Solution was consecutively carried out using the Boubaker Polynomials Expansion Scheme by varying steam/biomass ratio (0.5-1) and operating temperature (750-850°C).The comparison between models and experimental results showed that the model is able of predicting gas mole fractions and production rate including most of the representative TARs compounds | Survey of biomass gasification. Volume II. Principles of gasification | Studies on Auto-gasification of Bio-residues | Wood gasification system for electricity production | Trace elements partitioning during co-firing biomass with lignite in a pilot-scale fluidized bed combustor. | Steam gasification of biomass in dual fluidized bed gasifiers: A review |
1,999,984 | Successful Treatment of Intracranial Hemorrhage with Recombinant Activated Factor VII in a Patient with Newly Diagnosed Acute Myeloid Leukemia: A Case Report and Review of the Literature | Activated Recombinant Human Coagulation Factor VII Therapy for Intracranial Hemorrhage in Patients with Hemophilia A or B with Inhibitors | Recombinant activated factor VII has been Food and Drug Administration approved to treat hemorrhages in hemophiliac patients with inhibitors and in acquired hemophilia patients. Recombinant activated factor VII use has also been considered for the management of uncontrolled bleeding in a number of congenital and acquired hemostatic abnormalities. The myeloproliferative disorders are a group of clonal hematologic diseases where, frequently, abnormal platelet function is considered a hallmark. This is the first case report addressing the clinical benefit of off-label use of recombinant activated factor VII in an attempt to control intractable bleeding in a patient with a myeloproliferative disorder after splenectomy. | The Effect of Intravenous Administration of Active Recombinant Factor VII on Postoperative Bleeding in Cardiac Valve Reoperations; A Randomized Clinical Trial | Risk score model for fatal intracranial hemorrhage in acute leukemia | BACKGROUND Chronic subdural hematoma (CSDH) is a common neurosurgical condition that is treated using a cranial burr hole evacuation procedure, but recurrence is common. The use of anticoagulant therapy can increase the risk of developing a recurrent subdural hematoma. We present a challenging case of a patient on long-term anticoagulant therapy following previous aortic and aortic valve surgery who had CSDH with multiple recurrences and was ultimately treated with tranexamic acid as an adjunct to surgery. CASE REPORT A male patient in his mid-sixties presented with a headache and bilateral CSDH. Apart from a mechanical heart valve, he was otherwise healthy. A standard burr hole evacuation was performed, but the left hematoma and symptoms recurred after three months, and he presented with additional symptoms of aphasia and right-hand weakness. He had an additional three procedures followed by recurrences over a period of six weeks. Following his fifth and final surgical procedure, he was given postoperative intravenous tranexamic acid 10 mg/kg four times during the first 24 hours with dalteparin sodium 9,500 international units (IU) twice daily. His symptoms resolved, and after nine months he had no residual hematoma, and no thromboembolic complications occurred. CONCLUSIONS This case has demonstrated that tranexamic acid can be used as an adjunctive treatment to surgery when dealing with recurring CSDH, even in patients who require concomitant anticoagulant therapy. Although clinical trials are underway to evaluate tranexamic acid as a medical treatment for CSDH, this case report may support further studies that include patients with risk factors for thromboembolic disease. |
INTRODUCTION
Chronic subdural hematoma (cSDH) is a common complication of acute myeloid leukemia (AML). [20] e incidence of cSDH is estimated to be 1.7-20.6 patients/100,000 patients/year and commonly presents with cognitive and behavioral symptoms. [3,30,35] e most common treatment for cSDH for patients is surgical drainage with burr hole trephination, craniotomy, and decompressive craniectomy. [6] However, 5-30% of cases will experience recurrence of their hematoma, [7] and one of the factors that increase the risk of recurrence is comorbid coagulopathy, such as in patients with leukemia. [23] Treatments for acute myeloid leukemia (AML) like chemotherapy and hypomethylating agents put patients at increased risk for thrombocytopenia and intracranial hemorrhage, [15] and, the mainstay of treatment for thrombocytopenia continues to be platelet transfusions. [11] Increased risk for spontaneous bleeding occurs with platelet counts <20,000/µL, and a threshold platelet count of >10,000/ µL is recommended for prophylactic platelet transfusion in patients receiving therapy for hematologic malignancies. [26,36] Higher platelet counts of >20,000/µL are recommended in the setting of hemorrhage as well as in settings of expectant invasive procedures. [36] reshold platelet counts 40-50,000/µL are recommended before performing any major invasive procedure and platelet counts >100,000/µL before neurosurgery. [36] According to the World Health Organization, nonfatal cerebral bleeding with neurological signs and symptoms is considered Grade 4 bleeding with a recommended maintenance platelet goal of 100,000/µL. [11] However, there are limited evidence-based recommendations in cases of transfusion-refractory thrombocytopenia and case reports have shown patient survival at much lower platelet levels. [2,11,43] Middle meningeal artery embolization (eMMA) for cSDH is an emerging treatment modality. [9,19,21,27,28,33,38] e efficacy of eMMA is centered around the theory that cSDHs are, in part, caused by repeated membranous vessel rupture that is supplied by the MMA, so eMMA works by devascularizing these ruptured membranes. [13] It decreases the likelihood of hematoma recurrence and can be used as the sole treatment for patients with high surgical risk. In a recent meta-analysis of nine case series, Srivatsan et al. demonstrated a robust effect of eMMA as a sole therapy or as an adjunct to prevent rebleeding with eMMA having significantly lower rates of hematoma recurrence compared to the conventional surgery group (2.1% vs. 27.7%; P < 0.001). [39] Moreover, this meta-analysis found the procedural complication rates to be similar between eMMA and conventional surgery (2.1% vs. 4.4%; P = 0.497). [39] Two of the largest case series using eMMA for the management of cSDH (Link et al. [28] and Ban et al. [4] ) found no complications related to eMMA. In addition, a recent meta-analysis of 54,083 cerebral angiography cases found a procedural complication rate of 3.60%. [16] ese complications include transient ischemic attack, ischemic stroke, contrast-induced nephropathy, and contrast-induced allergic reaction. [16,32,37] Several large prospective randomized trials are underway investigating patient selection and the combination of surgery and embolization. [8,13] To the best of our knowledge, there has been no report of a patient with AML, symptomatic cSDH, and transfusionrefractory thrombocytopenia treated with eMMA. We present a case of improving chronic SDH in the setting of AML-related thrombocytopenia by eMMA without surgical evacuation. We also performed a systematic review of the literature to identify management strategies for cSDH with severe thrombocytopenia.
CASE PRESENTATION
A 74-year-old man with a history of AML presented to the emergency department (ED) for a complaint of nonresolving throbbing headache with nausea and vomiting after a witnessed fall without head trauma. He was on his second cycle of therapy with venetoclax and a hypomethylating agent.
At presentation to the ED, he had left upper extremity and left lower extremity drift with 4/5 left upper and lower extremity weakness, and scattered ecchymoses with a petechial rash. Laboratory studies were significant for severe thrombocytopenia of <2000/µL in the ED. Computed tomography of the head (hCT) revealed a right sided, mixed density 12 mm SDH with a 12 mm leftward midline shift and patchy acute subarachnoid hemorrhages [ Figure 1a]. e patient received an initial infusion of 2 units of platelets with an increase to 11,000/µL. Neurosurgery was consulted and patient was subsequently admitted to the intensive care unit (ICU) with a platelet goal of 100,000/ µL. Patient received regular platelet transfusions; however, platelet levels remained <50,000/µL [ Table 1]. Given his refractory thrombocytopenia, neurologically intact status, and stable SDH on repeat hCT; conservative management was chosen over neurosurgical intervention. On hospital day 4, he was transferred out of the ICU and liberalized to a platelet goal of 50,000/µL and transfusion threshold of 40,000/µL. After receiving a total of 17 units of platelets, the patient underwent right eMMA with 150 µm of polyvinyl alcohol particles on hospital day 8 [ Figure 1b]. Repeat hCT on hospital day 17 demonstrated a decreasing SDH [ Figure 1c]. Patient received an additional 6 units of platelets for refractory thrombocytopenia, a course of levetiracetam for seizure prophylaxis and was discharged 24 days after admission with a platelet count of 19,200/µL. Discharge plans included a systolic blood pressure goal of <140 mmHg Figure 2: Graphical depiction of patient's platelet counts following initial presentation. e patient's platelet count ranged from <2000/mm 3 at initial presentation up to 48,000 5 days after presentation following multiple platelet transfusions. He underwent eMMA 7 days after presentation with platelet count of 20,000. He was discharged on 23 days after presentation and received outpatient platelet transfusions 3 times a week with a platelet goal of 20,000. His average platelet count was 14,000.
Figure 3:
Head magnetic resonance imaging 54 days after initial presentation of subdural hematoma (SDH). Sagittal and axial views of the right-sided hyperintense with patchy hypointense areas consistent with acute on chronic SDH. and a platelet count goal >10,000/µL. He continued to have platelet transfusions 3 times a week with an average platelet count of 14,000/µL [ Figure 2]. A hCT 30 days after discharge demonstrated a stable, panhemispheric acute on chronic SDH that was 15 mm in size with a 5 mm leftward midline shift [ Figure 3].
Fifty days after his initial presentation, the patient was readmitted for acute kidney injury secondary to severe tumor lysis syndrome, acute colitis, acute left pyelonephritis, anemia with hemoglobin of 7.8 g/dL, and thrombocytopenia with platelet count of 9000/µL. On hospital day 2, hCT showed a grossly stable SDH. He was considered a poor candidate for hemodialysis due to AML, discharged to hospice on hospital day 7, and passed 4 days later.
Systematic review
e optimal management of cSDHs in patients with concurrent thrombocytopenia remains obscure. In this review, we sought to find case reports or series similar to our patient to identify management strategies and treatment efficacy for cSDH with severe thrombocytopenia currently documented in the literature. e preferred reporting items for systematic reviews and meta-analyses (PRISMA) reporting guideline were implemented for this review. A systematic search of PubMed and Web of Science data was conducted on October 13, 2021. e following search terms were utilized: thrombocytopenia OR pancytopenia; subdural; hematoma OR hemorrhage OR bleed*. Inclusion criteria required detection of isodense or hypodense areas in the subdural space on CT and report of individual patient data on platelet counts at intracranial cSDH confirmation, management of cSDH, platelet count following management, and outcome. Patients <18 years old and patients taking anticoagulants before cSDH presentation were excluded from the study. Reviews, editorials, and non-English articles were also excluded from the study. Two independent authors assessed the articles for inclusion and exclusion criteria.
Individual patient data on the following were collected: age, sex, risk factors/etiology of thrombocytopenia, location of SDH, size of SDH, presence of midline shift, platelet counts at the time of SDH confirmation and after management, management of SDH and thrombocytopenia, platelet goal for management, complications, recurrence of SDH, and outcome at last follow-up. ese data were collected by one author and reviewed by another author.
Seven out of 242 studies met inclusion criteria. [2,17,24,25,29,40,43] e PRISMA flow chart for the search strategy is depicted in [ Figure 4]. ere was a total of seven patients whose data were extracted. A summary of these data is shown in [Tables 2 and 3]. e most common etiology of thrombocytopenia was immune thrombocytopenic purpura (ITP; 71.4%). Other etiologies included human immunodeficiency virus (14.3%) and acute lymphoblastic leukemia (ALL) (14.3%). Location of SDH was in the frontoparietal region in 4 patients (57.1%), frontotemporal in 1 (14.3%), and hemispheric in 2 (28.6%). Four patients also had a midline shift on imaging (57.1%), with the majority having a shift to the right (75%). All seven patients had severe thrombocytopenia with a platelet count <5000/ µL at cSDH discovery. Five patients received medical management followed by surgical evacuation (71.4%), while one patient was managed conservatively (14.3%). Surgical evacuation included partial craniotomy (1; 20%) and craniotomy evacuation (4; 80%). ree cases reported a platelet goal of 2000/µL for management (42.9%). e final platelet counts were all above 20,000/µL, and all cSDHs were stable or completely resolved following treatment.
DISCUSSION
Previous studies on safe platelet ranges for surgical management of SDHs focused on platelet transfusions for achieving platelet goals. [1,11,12] However, a small subset of patients remains thrombocytopenic despite platelet transfusions. ere is limited knowledge on contingent management options for these patients. is case report demonstrated the usefulness of eMMA as a minimally invasive treatment for cSDH in the setting of refractory thrombocytopenia. Each of the seven patients reported in this systematic review had final platelet counts >20,000/µL, and all cSDHs were stable or completely resolved following medical or surgical treatment. While current guidelines suggest a platelet count >100,000/µL before performing neurosurgery (level 1C evidence), there are no current platelet thresholds for patients needing surgery complicated by platelet refractoriness. [11,22,34] e medical and surgical management varied widely among cases. Complications varied with two of the seven cases (Patient 1 and 4) having recurrence of the SDH after treatment. Patient 1 was diagnosed with concurrent ITP with the left-sided SDH and underwent left frontoparietal craniotomy with IV methylprednisolone and IVIG. Patient 4 had philadelphia chromosome positive ALL with bilateral SDH while receiving imatinib and dasatinib therapy and underwent trephination. rombocytopenia induced by hematologic disorders, such as ITP and ALL predisposed these patients to higher risk of recurrence after initial surgical management for SDH. Circulating autoantibodies due to Once thought to be due to a singular event, the central pathology of SDHs is now being recognized as a cerebrovascular event with a cycle of hemorrhage, fibrosis, and angiogenesis. [5] While the shearing of bridging veins may remain an inciting factor to the formation of a SDH, it is the inflammatory response to the extravasation of blood into the subdural space that accounts for the chronic and remittent nature of the hemorrhage. [5] Mild head injury causes an insidious bleed that activates fibroblasts to migrate toward the site of the clot. [10,18] Once activated, these fibroblasts initiate fibrosis and neovascularization through the release of vascular endothelial growth factor and other proinflammatory signaling molecules. [5,10,18] ese newly formed vessels are frail and prone to rebleeding, causing the cycle to repeat. While resorption of extravasated fluid may initially be maintained, eventually the rate of hemorrhage overwhelms the rate of resorption leading to increased intracranial pressure and focal neurological deficits. [5,10,18] e MMA is believed to supply the outer membrane of a SDH, [41,42] and a more recent study by Mureb et al. proposed that the MMA contributes to not only the outer membrane but the entire hematoma complex. [31] erefore, eMMA is proposed to occlude the distal branches of the MMA decreasing the neovascularization of the hematoma. is is thought to prevent fluid leakage and shift the balance back toward resorption. [14] Although the exact mechanism of eMMA remains unclear, our findings support its use in populations with persistent refractory thrombocytopenia to prevent further bleeding. In this case, the patient's cSDH was stable enough to be managed outside the hospital, so he spent his last moments with his loved ones as per his advanced directive. e overall treatment benefit among patients with substantial disease burden should also be emphasized in the management of cSDH.
CONCLUSION
Our case has shown the success of eMMA without surgical evacuation in successfully treating symptomatic cSDH in a high-risk surgical patient with refractory thrombocytopenia. Based on this case and a systematic review of seven cases of cSDH with comorbid thrombocytopenia, a platelet goal of 20,000/mm 3 prior to any surgical intervention may be sufficient and more attainable than current platelet goals of 40,000-50,000/mm 3 . ough all patients included in this review had stable or resolving cSDH, further investigations are required to determine the utility of lowering the platelet threshold prior to neurosurgical intervention.
Figure 1 :
1Evolution of subdural hematoma (SDH) from presentation to 45 days later via head computed tomography (CT). (a) Head CT at initial presentation revealed a right-sided, mixed density 12 mm SDH with 12 mm midline shift to the left. (b) Cerebral angiogram visualizing middle meningeal artery. (c) Repeat head CT on hospital day 17 showing stable right SDH with resolving midline shift (5 mm to left).
Figure 4 :
4Preferred reporting items for systematic reviews and meta-analyses flow chart of systematic review conducted in October 2021. A total of 242 unique records were identified using PubMed and Web of Science databases. Initial title and abstract screening excluded 97 articles. Full-text screening found seven articles meeting inclusion criteria, n: Number.
Table 1 :
1Summary of platelet counts and interventions throughout hospital course.Hospital day Platelet count (×10 3 /µL) Units of platelets transfused Comments1
<2
2
Initial head CT with 12 mm R SDH
and 12 mm R to L midline shift; admitted to ICU
2 (AM)
11
Platelet goal 100,000/µL
2 (PM)
24
1
Repeat head CT with stable R SDH
3 (AM)
28
2
Levetiracetam started
3 (PM)
31
2
4 (AM)
29
2
Repeat head CT with 10 mm R SDH and 8 mm R to L
midline shift. Platelet goal >50,000/µL
4 (PM)
42
Transferred out of ICU
5
33
2
6
47
2
7 (AM)
25
1
7 (PM)
21
1
8 (AM)
20
1
8 (PM)
24
1
R MMA embolization with 150 µm of PVA
9 (AM)
15
1
9 (PM)
28
10
18
11
9
2
12
15
13
8
2
14
8
2
15
25
16
14
17
9
2
Repeat head CT with 12 mm R SDH and 5 mm R to L
midline shift.
IV dexamethasone and IVIG started.
18
19
19
13
20
8
2
21
28
22
18
23
11
2
Underwent bone marrow biopsy
24
9
2
25
19
Discharged with home health
CT: Computed tomography, SDH: Subdural hematoma, ICU: Intensive care unit, PVA: Polyvinyl alcohol, IV: Intravenous, IG: Immunoglobulins, L: Left,
R: Right, mm: Millimeter, MMA: Middle meningeal artery
Table 2 :
2Summary of included case reports and general characteristics of patients with cSDH.Patient
number
Title
Author(s)
Year Age Sex Risk
factors/
Etiology
Location of
SDH
Size of
SDH
Midline
shift
1
Emergency Surgical Intervention
to Treat a Wide Septated
Subdural Hematoma in a Patient
with ITP: A Case Report. [2]
Asan, Z; Kilitci, A 2019 54
F ITP
L frontoparietal 60 mm R 20 mm
2
Successful treatment of
idiopathic thrombocytopenic
purpura by Chinese herbal
medicine EK-49 and ascorbic
acid in an elderly patient
developing chronic subdural
hematoma. [17]
Hirano, A;
Ueoka, H
2007 88
F ITP
R hemispheric
NR
NR
3
Conservative Treatment
of Chronic Subdural
Hematoma in HIV-Associated
rombocytopenia with
Tranexamic Acid. [25]
Kutty RK;
Peethambaran
AK; Sunilkumar;
Anilkumar M
2017 42
F HIV
L
frontotemporal
parietal
8.5 mm R 12 mm
4
Bilateral subdural
hemorrhage as a serious
adverse event of dasatinib in
a patient with Philadelphia
chromosome-positive acute
lymphoblastic leukemia. [43]
Yhim HY; Kim
HS; Lee NR;
Song EK; Kwak
JY; Yim CY
2012 58
F Ph(+) ALL
w/imatinib
and dastinib
therapy
L frontoparietal
and R frontal
NR
NR
5
Subdural hematoma secondary
to immune thrombocytopenic
purpura: case report. [24]
Kolluri VR;
Reddy DR;
Reddy PK; Naidu
MR; Kumari CS
1986 18
M ITP
R hemispheric
NR
NR
6
Spontaneous subdural
hematoma in the setting of
immune thrombocytopenia
complicated by ischemic
infarcts. [29]
Mathews MS; Yu
W; Chappell ET
2007 38
F ITP
R frontoparietal 11 mm
L 8 mm
7
erapeutic Suggestions for
Chronic Subdural Hematoma
Associated with Idiopathic
rombocytopenic Purpura:
A Case Report and Literature
Review. [40]
Takase H;
Tatezuki J;
Ikegaya N;
Yamamoto D;
Hashimoto M;
Takagi M;
Mochimatsu Y;
Kawahara N
2015 66
F ITP
L frontoparietal
NR
R
cSDH: Chronic subdural hematoma, SDH: Subdural hematoma, ITP: Immune thrombocytopenic purpura, HIV: Human immunodeficiency virus, Ph(+)
ALL: Philadelphia positive acute lymphoblastic leukemia, L: Left, R: Right, NR: Not reported, mm: Millimeter
Table 3 :
3Summary of management, complications, and outcomes of patients with cSDH secondary to thrombocytopenia. Platelet level=n/mm 3 . cSDH: Chronic subdural hematoma, PC: Platelet count, IV: intravenous, IVIG: Intravenous immunoglobulins, HAART: Highly active antiretroviral therapy, TXA: Tranexamic acid, FFP: Fresh frozen plasma, RBCs: Red blood cells, PCA: Posterior cerebral artery, L: Left, R: Right, NR: Not reported, NA: Not applicable, mg: Milligramthe ITP present in Patient 1 led to a diminished recovery rate in endogenous platelet counts. ALL is known to lead to marrow failure contributing to decreased platelet count, making it difficult to recover adequate platelet numbers to prevent recurrent bleeding. is is the first report of eMMA for stabilization of cSDH without recurrence in the setting of refractory thrombocytopenia.Patient
number
PC at
confirmed
SDH
Initial management PC after
initial
management
Other management Platelet
goal
Complications
Recurrence Outcome
1
5
IV
methylprednisolone,
IVIG, L
frontoparietal
craniotomy
18
Levetiracetam
20
Recurrence
Yes
Resolution
2
5
Prednisolone
(50 mg/day) +
azathioprine
(50 mg/day)
20
Methylprednisolone,
Chinese herbal
medicine EK-49 +
ascorbic acid
20
Severe
thrombocytopenia
on readmission;
bronchopneumonia
No
Resolution
3
17
Platelet transfusion,
HAART, TXA and
mannitol
68
Twist drill
craniostomy and
evacuation under
local anesthesia, 6
week course of TXA
+ HAART
NR Intraoperative
seizure
No
Resolution
4
42
Discontinued
dasatinib +
trephination of L
parietal bone
38
Intermittent platelet
infusions
>20 Recurrence
Yes
Improved
headache
5
30
Surgical evacuation
under local
anesthesia +
perioperative
platelet
transfusions
Normal
Steroids
NR None
No
Resolution
6
7
Platelets, FFP,
packed RBCs,
steroids, IVIG,
mannitol
205
Bedside twist
drill drainage and
subsequent burr
hole evacuation
after worsening
neurological
symptoms
NR Expansion of SDH;
R PCA infarct 5
days following burr
hole
No
Resolution
except L
homonymous
hemianopia
7
3
15 units of
platelets and IV
prednisolone, IVIG
210
NA
NR None
No
Resolution
Morden, et al.: eMMA for cSDH in severe thrombocytopenia Surgical Neurology International • 2023 • 14(223) | 4
Acknowledgments e authors would like to acknowledge Andrea Siu for facilitating the logical aspects of this study. ank you to the medical institution for assistance with data retrieval.Declaration of patient consente authors certify that they have obtained all appropriate patient consent.Financial support and sponsorshipNil.Conflicts of interestere are no conflicts of interest.
Management of chronic subdural hematoma in patients with intractable thrombocytopenia. M Abdelfatah, Turk Neurosurg. 28Abdelfatah M. Management of chronic subdural hematoma in patients with intractable thrombocytopenia. Turk Neurosurg 2016;28: 400-4.
Emergency surgical intervention to treat a wide septated subdural hematoma in a patient with ITP: A case report. Z Asan, A Kilitci, Cyprus J Med Sci. 4Department of Pathology, Ahi Evran University School of MedicineAsan Z, Kilitci A, Department of Pathology, Ahi Evran University School of Medicine, Kirsehir, Turkey. Emergency surgical intervention to treat a wide septated subdural hematoma in a patient with ITP: A case report. Cyprus J Med Sci 2019;4:63-5.
Actual and projected incidence rates for chronic subdural hematomas in United States Veterans Administration and civilian populations. D Balser, S Farooq, T Mehmood, M Reyes, U Samadani, J Neurosurg. 123Balser D, Farooq S, Mehmood T, Reyes M, Samadani U. Actual and projected incidence rates for chronic subdural hematomas in United States Veterans Administration and civilian populations. J Neurosurg 2015;123:1209-15.
Middle meningeal artery embolization for chronic subdural hematoma. S P Ban, G Hwang, H S Byoun, T Kim, S U Lee, J S Bang, Radiology. 286Ban SP, Hwang G, Byoun HS, Kim T, Lee SU, Bang JS, et al. Middle meningeal artery embolization for chronic subdural hematoma. Radiology 2018;286:992-9.
Paradigms in chronic subdural hematoma pathophysiology: Current treatments and new directions. M T Bounajem, R A Campbell, F Denorme, R Grandhi, J Trauma Acute Care Surg. 91134Bounajem MT, Campbell RA, Denorme F, Grandhi R. Paradigms in chronic subdural hematoma pathophysiology: Current treatments and new directions. J Trauma Acute Care Surg 2021;91:e134.
Surgical management of acute subdural hematomas. M R Bullock, R M Chesnut, J M Ghajar, D M Gordon, R M Hartl, D W Newell, Neurosurgery. 583SupplBullock MR, Chesnut RM, Ghajar JM, Gordon DM, Hartl RM, Newell DW, et al. Surgical management of acute subdural hematomas. Neurosurgery 2006;58(3 Suppl): S16-24;
. discussion Si-iv. discussion Si-iv.
Recurrence of chronic subdural haematomata with and without post-operative drainage. J G Carlsen, S Cortnum, J C Sørensen, Br J Neurosurg. 25Carlsen JG, Cortnum S, Sørensen JC. Recurrence of chronic subdural haematomata with and without post-operative drainage. Br J Neurosurg 2011;25:388-90.
Middle meningeal artery embolization for chronic subdural hematoma. J S Catapano, C L Nguyen, A A Wakim, F C Albuquerque, A F Ducruet, Front Neurol. 11557233Catapano JS, Nguyen CL, Wakim AA, Albuquerque FC, Ducruet AF. Middle meningeal artery embolization for chronic subdural hematoma. Front Neurol 2020;11:557233.
Middle meningeal artery embolization and the treatment of a chronic subdural hematoma. L L Désir, D ' Amico, R Link, T Silva, D Ellis, J A Doron, O , Cureus. 1318868Désir LL, D' Amico R, Link T, Silva D, Ellis JA, Doron O, et al. Middle meningeal artery embolization and the treatment of a chronic subdural hematoma. Cureus 2021;13:e18868.
Pathophysiology of chronic subdural haematoma: Inflammation, angiogenesis and implications for pharmacotherapy. E Edlmann, S Giorgi-Coll, P C Whitfield, K L Carpenter, P J Hutchinson, J Neuroinflammation. 14108Edlmann E, Giorgi-Coll S, Whitfield PC, Carpenter KL, Hutchinson PJ. Pathophysiology of chronic subdural haematoma: Inflammation, angiogenesis and implications for pharmacotherapy. J Neuroinflammation 2017;14:108.
Guidelines for the use of platelet transfusions. L J Estcourt, J Birchall, S Allard, S J Bassey, P Hersey, J P Kerr, Br J Haematol. 176Estcourt LJ, Birchall J, Allard S, Bassey SJ, Hersey P, Kerr JP, et al. Guidelines for the use of platelet transfusions. Br J Haematol 2017;176:365-94.
Platelet transfusions for patients with haematological malignancies: Who needs them?. L J Estcourt, S J Stanworth, M F Murphy, Br J Haematol. 154Estcourt LJ, Stanworth SJ, Murphy MF. Platelet transfusions for patients with haematological malignancies: Who needs them? Br J Haematol 2011;154:425-40.
Updates in chronic subdural hematoma: Epidemiology, etiology, pathogenesis, treatment, and outcome. J Feghali, W Yang, J Huang, World Neurosurg. 141Feghali J, Yang W, Huang J. Updates in chronic subdural hematoma: Epidemiology, etiology, pathogenesis, treatment, and outcome. World Neurosurg 2020;141:339-45.
Middle meningeal artery embolization for the management of chronic subdural hematoma. D Fiorella, A S Arthur, J NeuroInterv Surg. 11Fiorella D, Arthur AS. Middle meningeal artery embolization for the management of chronic subdural hematoma. J NeuroInterv Surg 2019;11:912-5.
Incidence and risk of hematologic toxicities with hypomethylating agents in the treatment of myelodysplastic syndromes and acute myeloid leukopenia: A systematic review and meta-analysis. C Gao, J Wang, Y Li, H Zhao, R Li, L Hou, Medicine. 9711860Gao C, Wang J, Li Y, Zhao H, Li R, Hou L, et al. Incidence and risk of hematologic toxicities with hypomethylating agents in the treatment of myelodysplastic syndromes and acute myeloid leukopenia: A systematic review and meta-analysis. Medicine 2018;97:e11860.
Transradial versus transfemoral approaches in diagnostic and therapeutic neuroendovascular interventions: A meta-analysis of current literature. A K Ghaith, K El Naamani, W Mualem, M Ghanem, R Rajjoub, A Sweid, World Neurosurg. 164Ghaith AK, El Naamani K, Mualem W, Ghanem M, Rajjoub R, Sweid A, et al. Transradial versus transfemoral approaches in diagnostic and therapeutic neuroendovascular interventions: A meta-analysis of current literature. World Neurosurg 2022;164:e694-705.
Successful treatment of idiopathic thrombocytopenic purpura by Chinese herbal medicine EK-49 and ascorbic acid in an elderly patient developing chronic subdural hematoma. A Hirano, H Ueoka, Geriatr Gerontol Int. 7Hirano A, Ueoka H. Successful treatment of idiopathic thrombocytopenic purpura by Chinese herbal medicine EK-49 and ascorbic acid in an elderly patient developing chronic subdural hematoma. Geriatr Gerontol Int 2007;7:83-8.
Pathophysiology and nonsurgical treatment of chronic subdural hematoma: From past to present to future. D C Holl, V Volovici, C M Dirven, W C Peul, F Van Kooten, K Jellema, World Neurosurg. 116e2Holl DC, Volovici V, Dirven CM, Peul WC, van Kooten F, Jellema K, et al. Pathophysiology and nonsurgical treatment of chronic subdural hematoma: From past to present to future. World Neurosurg 2018;116:402-11.e2.
Chronic subdural hematoma recurrence due to contralateral neovascularization following middle meningeal artery embolization. Z S Hubbard, Al Kasab, S Porto, G B Spiotta, A , Interv Neuroradiol. 28Hubbard ZS, Al Kasab S, Porto GB, Spiotta A. Chronic subdural hematoma recurrence due to contralateral neovascularization following middle meningeal artery embolization. Interv Neuroradiol 2021;28:639-43.
Unexpected high incidence of intracranial subdural haematoma during intensive chemotherapy for acute myeloid leukaemia with a monoblastic component. Jourdan E Dombret, H Glaisner, S Micléa, J M Castaigne, S Degos, L , Br J Haematol. 89Jourdan E, Dombret H, Glaisner S, Micléa JM, Castaigne S, Degos L. Unexpected high incidence of intracranial subdural haematoma during intensive chemotherapy for acute myeloid leukaemia with a monoblastic component. Br J Haematol 1995;89:527-30.
Efficacy and safety of middle meningeal artery embolization in the management of refractory or chronic subdural hematomas: A systematic review and meta-analysis. F Jumah, M Osama, A I Islim, A Jumah, D P Patra, J Kosty, Acta Neurochir (Wien). 162Jumah F, Osama M, Islim AI, Jumah A, Patra DP, Kosty J, et al. Efficacy and safety of middle meningeal artery embolization in the management of refractory or chronic subdural hematomas: A systematic review and meta-analysis. Acta Neurochir (Wien) 2020;162:499-507.
Platelet transfusion: A clinical practice guideline from the AABB. R M Kaufman, B Djulbegovic, T Gernsheimer, S Kleinman, A T Tinmouth, K E Capocelli, Ann Intern Med. 162Kaufman RM, Djulbegovic B, Gernsheimer T, Kleinman S, Tinmouth AT, Capocelli KE, et al. Platelet transfusion: A clinical practice guideline from the AABB. Ann Intern Med 2015;162:205-13.
Clinical analysis of risk factors related to recurrent chronic subdural hematoma. B S Ko, J K Lee, B R Seo, S J Moon, J H Kim, S H Kim, J Korean Neurosurg Soc. 43Ko BS, Lee JK, Seo BR, Moon SJ, Kim JH, Kim SH. Clinical analysis of risk factors related to recurrent chronic subdural hematoma. J Korean Neurosurg Soc 2008;43:11-5.
Subdural hematoma secondary to immune thrombocytopenic purpura: Case report. S V Kolluri, R D Reddy, K P Reddy, M R Naidu, S C Kumari, Neurosurgery. 19Kolluri SV, Reddy RD, Reddy KP, Naidu MR, Kumari SC. Subdural hematoma secondary to immune thrombocytopenic purpura: Case report. Neurosurgery 1986;19:635-6.
Conservative treatment of chronic subdural hematoma in HIV-associated thrombocytopenia with tranexamic acid. R K Kutty, A K Peethambaran, Sunilkumar, M Anilkumar, J Int Assoc Provid AIDS Care. 16Kutty RK, Peethambaran AK, Sunilkumar, Anilkumar M. Conservative treatment of chronic subdural hematoma in HIV-associated thrombocytopenia with tranexamic acid. J Int Assoc Provid AIDS Care 2017;16:211-4.
Challenges and advances in managing thrombocytopenic cancer patients. A Leader, L Hofstetter, G Spectre, J Clin Med. 101169Leader A, Hofstetter L, Spectre G. Challenges and advances in managing thrombocytopenic cancer patients. J Clin Med 2021;10:1169.
Middle meningeal artery embolization for chronic subdural hematoma in cancer patients with refractory thrombocytopenia. S Lee, A Srivatsan, V M Srinivasan, S R Chen, J K Burkhardt, J N Johnson, J Neurosurg. 136Lee S, Srivatsan A, Srinivasan VM, Chen SR, Burkhardt JK, Johnson JN, et al. Middle meningeal artery embolization for chronic subdural hematoma in cancer patients with refractory thrombocytopenia. J Neurosurg 2021;136:1273-7.
Middle meningeal artery embolization as treatment for chronic subdural hematoma: A case series. T W Link, S Boddu, J Marcus, B I Rapoport, E Lavi, J Knopman, Operat Neurosurg. 14Link TW, Boddu S, Marcus J, Rapoport BI, Lavi E, Knopman J. Middle meningeal artery embolization as treatment for chronic subdural hematoma: A case series. Operat Neurosurg 2018;14:556-62.
Spontaneous subdural hematoma in the setting of immune thrombocytopenia complicated by ischemic infarcts. M S Mathews, W Yu, E T Chappell, Neuroradiol J. 20Mathews MS, Yu W, Chappell ET. Spontaneous subdural hematoma in the setting of immune thrombocytopenia complicated by ischemic infarcts. Neuroradiol J 2007;20:224-7.
Middle meningeal artery embolization in chronic subdural hematoma: Implications of pathophysiology in trial design. P Moshayedi, D S Liebeskind, Front Neurol. 11923Moshayedi P, Liebeskind DS. Middle meningeal artery embolization in chronic subdural hematoma: Implications of pathophysiology in trial design. Front Neurol 2020;11:923.
DynaCT enhancement of subdural membranes after middle meningeal artery embolization: Insights into pathophysiology. M C Mureb, D Kondziolka, M Shapiro, E Raz, E Nossek, J Haynes, World Neurosurg. 139Mureb MC, Kondziolka D, Shapiro M, Raz E, Nossek E, Haynes J, et al. DynaCT enhancement of subdural membranes after middle meningeal artery embolization: Insights into pathophysiology. World Neurosurg 2020;139:e265-70.
Complications and risk factors after digital subtraction angiography: 1-year single-center study. H H Nam, D K Jang, B R Cho, J Cerebrovasc Endovasc Neurosurg. 24Nam HH, Jang DK, Cho BR. Complications and risk factors after digital subtraction angiography: 1-year single-center study. J Cerebrovasc Endovasc Neurosurg 2022;24:335-40.
Middle meningeal artery embolization for chronic subdural hematoma: A national database study of 191 patients in the United States. A M Nia, V M Srinivasan, R R Lall, P Kan, World Neurosurg. 153Nia AM, Srinivasan VM, Lall RR, Kan P. Middle meningeal artery embolization for chronic subdural hematoma: A national database study of 191 patients in the United States. World Neurosurg 2021;153:e300-7.
Overview Blood Transfusion Guidance. NICELast accessed on 2022 Mar 02NICE. Overview Blood Transfusion Guidance. Available from: https://www.nice.org.uk/guidance/ng24 [Last accessed on 2022 Mar 02].
e incidence of chronic subdural hematomas from 1990 to 2015 in a defined Finnish population. M Rauhala, T M Luoto, H Huhtala, G L Iverson, T Niskakangas, J Öhman, J Neurosurg. 132Rauhala M, Luoto TM, Huhtala H, Iverson GL, Niskakangas T, Öhman J, et al. e incidence of chronic subdural hematomas from 1990 to 2015 in a defined Finnish population. J Neurosurg 2019;132:1147-57.
of Clinical Oncology clinical practice guideline update. C A Schiffer, K Bohlke, M Delaney, H Hume, A J Magdalinski, J J Mccullough, J Clin Oncol. 36American SocietyPlatelet transfusion for patients with cancerSchiffer CA, Bohlke K, Delaney M, Hume H, Magdalinski AJ, McCullough JJ, et al. Platelet transfusion for patients with cancer: American Society of Clinical Oncology clinical practice guideline update. J Clin Oncol 2018;36:283-99.
Complications associated with diagnostic cerebral angiography: A retrospective analysis of 644 consecutive cerebral angiographic cases. J Shen, M Karki, T Jiang, B Zhao, Neurol India. 66Shen J, Karki M, Jiang T, Zhao B. Complications associated with diagnostic cerebral angiography: A retrospective analysis of 644 consecutive cerebral angiographic cases. Neurol India 2018;66:1154-8.
Usefulness of middle meningeal embolization to prevent recurrent spontaneous chronic subdural hemorrhage. S Sirh, H R Park, S Q Park, J Cerebrovasc Endovasc Neurosurg. 20Sirh S, Park HR, Park SQ. Usefulness of middle meningeal embolization to prevent recurrent spontaneous chronic subdural hemorrhage. J Cerebrovasc Endovasc Neurosurg 2018;20:40-6.
Middle meningeal artery embolization for chronic subdural hematoma: Meta-analysis and systematic review. A Srivatsan, A Mohanty, F A Nascimento, M U Hafeez, V M Srinivasan, A omas, World Neurosurg. 122Srivatsan A, Mohanty A, Nascimento FA, Hafeez MU, Srinivasan VM, omas A, et al. Middle meningeal artery embolization for chronic subdural hematoma: Meta-analysis and systematic review. World Neurosurg 2019;122:613-9.
erapeutic suggestions for chronic subdural hematoma associated with idiopathic thrombocytopenic purpura: A case report and literature review. H Takase, J Tatezuki, N Ikegaya, D Yamamoto, M Hashimoto, M Takagi, NMC Case Rep J. 2Takase H, Tatezuki J, Ikegaya N, Yamamoto D, Hashimoto M, Takagi M, et al. erapeutic suggestions for chronic subdural hematoma associated with idiopathic thrombocytopenic purpura: A case report and literature review. NMC Case Rep J 2015;2:118-22.
Superselective angiographic findings of ipsilateral middle meningeal artery of chronic subdural hematoma in adults. T Tanaka, S Fujimoto, K Saitoh, S Satoh, K Nagamatsu, H Midorikawa, No Shinkei Geka. 26Tanaka T, Fujimoto S, Saitoh K, Satoh S, Nagamatsu K, Midorikawa H. Superselective angiographic findings of ipsilateral middle meningeal artery of chronic subdural hematoma in adults. No Shinkei Geka 1998;26:339-47.
Histological study of vascular structure between the Dura mater and the outer membrane in chronic subdural hematoma in an adult. T Tanaka, M Kaimori, No Shinkei Geka. 27Tanaka T, Kaimori M. Histological study of vascular structure between the Dura mater and the outer membrane in chronic subdural hematoma in an adult. No Shinkei Geka 1999;27:431-6.
Middle meningeal artery embolization for symptomatic chronic subdural hematoma in the setting of severe transfusion-refractory thrombocytopenia: A case study and review of literature. F C Morden, C Caballero, M Abella, A Conching, H Gang, T Noh, Surg Neurol Int. 14223How to cite this article: Morden FC, Caballero C, Abella M, Conching A, Gang H, Noh T. Middle meningeal artery embolization for symptomatic chronic subdural hematoma in the setting of severe transfusion-refractory thrombocytopenia: A case study and review of literature. Surg Neurol Int 2023;14:223.
Disclaimer e views and opinions expressed in this article are those of the authors and do not necessarily reflect the official policy or position of the Journal or its management. e information contained in this article should not be considered to be medical advice; patients should consult their own physicians for advice as to their specific medical needs. H Y Yhim, H S Kim, N R Lee, E K Song, J Y Kwak, C Y Yim, Int J Hematol. 43Bilateral subdural hemorrhage as a serious adverse event of dasatinib in a patient with Philadelphia chromosomepositive acute lymphoblastic leukemiaDisclaimer e views and opinions expressed in this article are those of the authors and do not necessarily reflect the official policy or position of the Journal or its management. e information contained in this article should not be considered to be medical advice; patients should consult their own physicians for advice as to their specific medical needs. 43. Yhim HY, Kim HS, Lee NR, Song EK, Kwak JY, Yim CY. Bilateral subdural hemorrhage as a serious adverse event of dasatinib in a patient with Philadelphia chromosome- positive acute lymphoblastic leukemia. Int J Hematol 2012; 95:585-7.
| Recombinant factor VIIa in the management of surgery and acute bleeding episodes in children with haemophilia and high responding inhibitors | Objective To investigate the prognosis-related factors of delayed traumatic intracranial hematoma(DTICH).Methods Data of 227 cases with DTICH were retrospectively analyzed.Results The fectors of deceleration injury,extensive brain contusion,tSAH,skull fracture,surgery,hypotension and coagulopathy before surgery were closely related to the development of DTICH(P0.05).Low GCS score at admission,multiple injuries and lung injury were the main factors for DTICH patients to have lower prognosis.Conclusion A prediction of the prognosis should be made in the patients with the factors related to DTICH.Early completely removal of hemorrhage and prevention of complications are effective in the treatment of DTICH. | 1,999,984 | Intracranial hemorrhage (ICH) is a common complication in acute myeloid leukemia (AML) patients with an incidence rate of 6.3% [1]. Bleeding disorders related to disseminated intravascular coagulation (DIC) are common complications in AML cases [2]. Recombinant activated Factor VII (rFVIIa [NovoSeven®]) is approved for the treatment of bleeding complications with FVIII or FIX inhibitors in patients with congenital FVII deficiency. Use of rFVIIa for the treatment of acute hemorrhage in patients without hemophilia has been successful [3,4]. Herein, we describe the successful use of rFVIIa in a patient with acute ICH in the setting of newly diagnosed AML. | Background/purpose The pharmacokinetic (PK) study of recombinant human factor IX (rFIX) has been done in patients with hemophilia B in areas other than Taiwan. However, wide patient-related variability in recovery is noted and there is no PK study of rFIX in Taiwanese patients with hemophilia B. The purpose of this study is to evaluate the PKs of the rFIX in Taiwanese patients with hemophilia B. Methods A PK study of rFIX was performed in 10 previously treated Taiwanese patients with hemophilia B. Nine of them had severe hemophilia B and the other one had moderately severe hemophilia B. The mean age of our patients was 24.7 ± 8.6 years (mean ± SD) with a range of 15.5-47.0 years. Results The infusion of 75 IU/kg of rFIX in our patients resulted in a mean FIX activity increase of 1.08 ± 0.27 IU/dL per IU/kg with a range of 0.3-1.49 IU/dL per IU/kg, and a mean in vivo recovery of 44.0 ± 9.5% with a range of 31.4-60.4%. The mean elimination half-life was 24.4 ± 6.4 hours with a range of 14.1-35.3 hours. The mean values of area under the curve, total body clearance, volume of distribution at steady state were 1363 ± 166 IU × hour/dL, 4.84 ± 1.03 mL/hour/kg, and 144.3 ± 41.8 mL/kg, respectively. In addition, rFIX was well tolerated in our patients. Only two patients experienced mild treatment-related adverse events, including fever and feeling sleepy, respectively. Both of them resolved spontaneously without any sequences, and there was no thrombosis formation or inhibitor development in the following 6 months after rFIX infusion. Conclusion The results of PK study of rFIX in our previously treated Taiwanese patients with hemophilia B are comparable to the reported results from other related studies conducted in different geographical areas. [ J Formos Med Assoc 2007;106(4):281-287] | Recombinant factor VIIa for the correction of coagulopathy before emergent craniotomy in blunt trauma patients. | Factors and inhibitors of blood coagulation and fibrinolysis in acute nonlymphoblastic leukaemia | Case report on recombinant coagulation factor VIIa in the treatment of three haemophilia A patients with inhibitors in Si ngapore | Effect of recombinant human FVIIA on warfarin-induced bleeding in rats | ObjectivesThe first non-vitamin K antagonist oral anticoagulant (NOAC) introduced to the market in Japan was dabigatran in March 2011, and three more NOACs, rivaroxaban, apixaban, and edoxaban, have since become available. Randomized controlled trials of NOACs have revealed that intracranial hemorrhage (ICH) occurs less frequently with NOACs compared with warfarin. However, the absolute incidence of ICH associated with NOACs has increased with greater use of these anticoagulants, and we wanted to explore the incidence, clinical characteristics, and treatment course of patients with NOACs-associated ICH.MethodsWe retrospectively analyzed the characteristics of symptomatic ICH patients receiving NOACs occurrence of ICH during NOAC therapy is possible even when there is acceptable mean systolic blood pressure control (137.8 ± 15.9 mmHg) and HAS-BLED score 2. Even stricter blood pressure lowering and control within the acceptable range may be advisable to prevent ICH during NOAC therapy. Symptomatic Intracranial Hemorrhage during NOAC Therapy PLOS ONE | | The Hemostasis and Thrombosis Research Society Registry was used to monitor the postapproval use and safety of recombinant activated factor VII (rFVIIa). The objective of this article is to evaluate the data from the Hemostasis and Thrombosis Research Society Registry related to rFVIIa-treated bleeding episodes in patients with acquired hemophilia. For each rFVIIa-treated bleeding episode, the initial dose, total dose, average infused dose, number of doses, and treatment duration were calculated. Efficacy was assessed on a three-point scale. Out of the 166 registered patients with acquired hemophilia, 110 patients were treated for 237 bleeding episodes (139 rFVIIa treated); the majority (70%) were in patients older than 60 years. The most frequently reported bleeding locations were subcutaneous (40%) and mucosal (32%). Subcutaneous bleeding episodes were more commonly reported in women (55% vs. 40% men) and white patients (44 vs. 27% black). Of the 139 rFVIIa-treated bleeding episodes, rFVIIa was used as first-line treatment in 127 bleeding episodes. The median initial dose was 90 μg/kg; the median total dose per episode was 333.5 μg/kg. Physician-rated efficacy of rFVIIa for each bleeding episode was reported as 'bleeding stopped' in 85% of bleeding episodes, 'bleeding slowed' in 11% of bleeding episodes, 'no improvement' in 4% of bleeding episodes, and was not documented in 1 bleeding episode. One thromboembolic event was reported; transient neurologic symptoms were reported in a 31-year-old postpartum patient after 110 doses of rFVIIa. Adequate hemostasis was provided for most rFVIIa-treated bleeding episodes at doses largely conforming to the package insert. No major safety concerns were reported. | Recombinant factor VIIa use in cardiac surgery--expanding the arsenal therapy for intractable bleeding? |
1,999,985 | Where is the freon jack located on the oldsmobile intrigue 1998? | How do you add freon to 1997 Oldsmobile Cutlass Supreme? | Where is starter on a 2000 oldsmobile intrigue? | Where is the flasher on a 2000 olds intrigue? | How do you change a air filter on a 1999 oldsmobile intrigue? | Why does 1998 oldsmobile intrigue overheat? | Where is the jack point on a 2002 pontiac grand am? | Repair manual 2001 olds intrigue? | Where is the oxygen sensors on a oldsmobile intrigue? | 1,999,985 | Where is the freon hose in a 99 oldsmobile intrigue? | Where is the computer on 99 oldsmobile intrigue? | What type freon for 97 f150 pu? | Location of starter in 1999 oldsmobile Intrigue? | Where is the valve to add freon to on a 2001 Ford Focus? | Where is freon added to 1996 olds cutlass? | How do you chance ac compressor in 1996 jeep? | Where do you add freon to ac on 1992 camry? | Tcc valve location 98 olds intrigue? |
1,999,986 | why do i keep having chemical pregnancies? | Causes of early menopause Early menopause can happen naturally if a woman's ovaries stop making normal levels of certain hormones, particularly the hormone oestrogen. This is sometimes called premature ovarian failure, or primary ovarian insufficiency. | Taurine, a non-protein sulfur amino-acid, is the most abundant free amino-acid in the body and plays an important role in several essential biological processes. Apart from its role in cholesterol degradation, it acts as neurotransmitter, and has a function as osmoregulator and antioxidant in most body tissues. During pregnancy, taurine accumulates in the maternal tissues, to be released in the perinatal period to the fetus via the placenta and to the newborn via the maternal milk. It is accumulated especially in the fetal and neonatal brain. Low maternal taurine levels result in low fetal taurine levels. Taurine-deficiency in the mother leads to growth retardation of the offspring, and to impaired perinatal development of the central nervous system and of the endocrine pancreas. The adult offspring of taurine-deficient mothers display signs of impaired neurological function, impaired glucose tolerance and vascular dysfunction; they may develop gestational diabetes and transmit the effects to the next generation. This transgeneration effect of taurine-deficiency in the perinatal period fits into the concept of fetal origin of adult disease. | contain blood or cause itching. The pH of the vaginal discharge in pregnancy tends to be more acidic than normal due to increased production of lactic acid. This acidic environment helps to provide protection from many infections, though conversely it also makes women more susceptible to vaginal yeast infections. With the drop in estrogen levels that comes with menopause, the vagina returns to a state similar to pre-puberty. Specifically, the vaginal tissues thin, become less elastic; blood flow to the vagina decreases; the surface epithelial cells contain less glycogen. With decreased levels of glycogen, the vaginal flora shifts to contain | Industrial and consumer product chemicals are widely used, leading to ubiquitous human exposure to the most common classes. Because these chemicals may affect developmental milestones, exposures in pregnant women and developing fetuses are of particular interest. In this review, we discuss the prevalence of chemical exposures in pregnant women, the chemical class-specific relationships between maternal and fetal exposures, and the major sources of exposures for six chemical classes of concern: phthalates, phenols, perfluorinated compounds (PFCs), flame retardants, polychlorinated biphenyls (PCBs), and organochlorine pesticides (OCs). Additionally, we describe the current efforts to characterize cumulative exposures to synthetic chemicals during pregnancy. We conclude by highlighting gaps in the literature and discussing possible applications of the findings to reduce the prevalence of cumulative exposures during pregnancy. |
Introduction
Several reports [reviewed in 1 & 2] show that human health globally, is influenced by exposures to toxic chemicals. Many diseases including infertility are on the rise in recent years and mirror the increase in toxic chemical production, use, and release into the environment [3]. Delicately coordinated neuro-endocrine regulated physiological events that lead to the production of mature spermatozoa must occur to ensure the fertilization of mature ova, the development of normal embryos and eventually, the delivery of viable offspring. The perturbation of any one segment of this delicate sequence of events leads to infertility or abnormal fetal development if spermatozoa carrying genetic defect(s) fertilize normal mature ova. In the United States, approximately 15% of couples experience some difficulties when trying to conceive and in roughly 50% of these couples, male factor is partially responsible for failure to conceive [4]. For 25% of men evaluated, no identifiable cause of their abnormal semen analyses can be found, hence the diagnosis of idiopathic male factor infertility [4], probably due to exposure(s) to environmental/occupational xenobiotics that act as reproductive endocrine disruptors. Reproductive endocrine disruptors can alter the hypothalamic/pituitary and testicular hormones that regulate spermatogenesis. As a consequence of exposures to endocrine disruptive compounds, hypogonadism and/or infertility can ensue. One such xenobiotic that is prevalent in the environment and depresses circulating plasma testosterone and sperm motility is benzo(a)pyrene (BaP; [5]).
Benzo(a)pyrene is a semi-volatile, lipophilic, high molecular weight compound that belongs to the polycyclic aromatic hydrocarbon (PAH) family. Benzo(a)pyrene and other PAHs are products of combustion and can accumulate in crops via absorption from contaminated soils [6]. Exclusive sources for BaP contamination of the environment and consequently human exposures include industrial and automobile emissions, hazardous waste sites, cigarette smoke, biomass burning, municipal incinerators, volcanic eruptions, home heating, and consumption of charcoal broiled and smoked foods [6,7]. Food ingestion and inhalation are the major routes of entry into the human body for a large section of the general population exposed to PAHs (reviewed in [8]).
The biological effects of BaP are mediated by the aryl hydrocarbon receptor (AhR)-mediated cytochrome P-450 (CYP) genes [9]. Biotransformation of BaP by microsomal epoxide hydrolase and CYP are necessary for this prototypical PAH to elicit toxicity [10]. The initial step in the BaP metabolic pathway is the formation of epoxides, catalyzed by CYP-dependent monooxygenases [11]. Further metabolism involves hydration by microsomal epoxide hydrolase to the dihydrodiols, isomerization to phenols or conjugation with glutathione by glutathione transferase. The phenols and dihydrodiols are further metabolized by conjugation with glucuronic acid or sulphuric acid by glucuronyltransferases and sulfotransferases, respectively to facilitate excretions. During the process of metabolism, reactive metabolites such as BaP-7,8-dihydrodiol 9,10-epoxide (BPDE) are formed that may damage cellular macromolecules including DNA, thus, resulting in the alteration of cell function and cancer. Biotransformation of BaP also leads to production of BaP quinones that may arise from autooxidation of metabolites such as 6-hydroxy BaP. These compounds undergo one electron redox cycling with their semiquinone radicals resulting in the formation of reactive oxygen species (ROS; [12]). The formation of ROS has been associated with altered cell signaling, cell damage and apoptosis [13][14][15]. Interactions of these reactive oxygen species with cellular nucleophiles such as DNA in the compartments of the testis have the potential to alter transcriptional events required for the production of mature spermatozoa.
The hormonal control of spermatogenesis is based on the action of the pituitary gonadotropins, luteinizing hormone (LH) and follicle stimulating hormone (FSH), on the testis. LH stimulates the Leydig cells in the testes to produce testosterone (T). Intratesticular T (ITT) mediates its effects within the testes through the androgen receptor that is found on Leydig cells, Sertoli cells, and peritubular cells [16]. Follicle stimulating hormone activity is also important for quantitatively normal spermatogenesis [17,18]. Withdrawal of LH and FSH stimulation of the testis reduces sperm production. Suppression of LH levels results in a decrease in ITT [19,20], which in turn suppresses sperm production in men (World Health Organization; WHO, [21]) and rats [22]. Intratesticular testosterone is believed to stimulate spermatogenesis directly in rats [22] and men [17] although not to quantitatively normal levels in men. We have shown that a 10 day exposure of male rats to inhaled BaP (75μg/kg) causes a significant reduction and increase in plasma testosterone and LH concentrations, respectively [5], suggesting a lack of direct effect of BaP on LH secretion. This reduction in circulating testosterone could be due to: 1) BaP-induced reduction in Leydig cell testosterone synthesis and release or 2) to a higher metabolism of testosterone by the liver due to a higher induction of liver phase II metabolic enzymes by BaP or 3) both. It is likely that the reduction in circulating testosterone by BaP is contributed to by reduced intratesticular testosterone based on the fact that sperm motility was reduced significantly in BaP-exposed rats compared to controls [5]. Motility is acquired in the epididymides under the regulation of high testosterone concentrations contributed to this organ by testicular fluid that aids in the transport of spermatozoa from the testis into the epididymides.
The objective of this study was to determine the effect of a 60 day exposure to inhaled BaP on intratesticular function.
Materials and Methods
Animals and Exposure
Adult male Fisher-344 rats, approximately 12-13 weeks of age and weighing approximately 340-360g, were purchased from Harlan Sprague Dawley (Indianapolis, IN). Animals were housed in pairs, in polyethylene cages and allowed to acclimatize to the animal care facilities for one week prior to initiation of studies. Rats were maintained in an environmentally controlled room with a 14 hour light: 10 hour dark cycle (lights on at 6.0 AM.), 22 º C and humidity range of 50-60% and allowed ad libitum access to commercial rat chow (5001 Lab meal, Ralston Purina Co., MO, USA) and water. Before initiation of animal exposures to BaP via inhalation, all rats were acclimated to 52 port Cannon nose-only exposure chambers, 4 hrs a day for 3 days. Subsequently, rats were randomly assigned to a treatment and a control group (N = 10 per group). Treatment consisted of exposure of rats to 75 μg BaP/m 3 (98% pure, Sigma Chemical Co., St. Louis, MO) via nose-only inhalation, 4 hrs daily for 60 days, using a state-of-the-art dualcomponent aerosol generator developed in our laboratory [23]. Carbon black (CB) was used as a carrier for BaP because it adsorbs and strongly binds to PAHs [24] and was not known to be mutagenic or carcinogenic in mammalian systems [25]. Rats in the control group served as unexposed controls (UNC). We did not control for the carrier of BaP (CB) because of the lack of effect of 10and 60-days exposure to CB on the endocrine and reproductive characteristics of rats [5,25,26]. Even though rats in the UNC group were unexposed, they were subjected to conditions of restraint similar to those imposed on rats exposed to BaP via inhalation. Details on the design, fabrication, installation, and characterization of the exposure system are reported in Hood et al. [23]. The methods for aerosol generation, preparation of carbon black cakes and impactor substrates as well as the characterization and quantitation of BaP aerosol and substrate extraction, analysis and quality assurance/control are detailed in our previous study [5].
Rats in the BaP and UNC group were weighed prior to initiation of exposures, followed subsequently by weekly weight monitoring throughout the duration of the study to determine whether BaP affected thriftiness among treated animals.
Post-exposure Processing Of Tissue Samples
Blood samples were collected via sinus orbital puncture using heparinized pulled Pasteur pipettes, between 17:00 and 18:00 h immediately following the last day of exposure (on day 60; 0 hr) and at 24, 48 and 72 hrs post initial sampling. Subsequently, plasma was harvested post centrifugation at 2000-x g at 4°C for 10 minutes from each sample and stored at -20°C until assayed for testosterone and luteinizing hormone (LH). Following the last blood sampling, animals were sacrificed by CO 2 asphyxiation, testes immediately harvested and weighed. The right testes from UNC and BaP-exposed rats (N = 6/group) were used for the determination of daily sperm production and intra-testicular testosterone (ITT) concentrations while the left testes were prepared for histological evaluation according to the modified method of Weibel [27] by Lunstra et al [28]. Briefly, fixed testis pieces from UNC and exposed rats were washed in PBS (1 x 1 h), dehydrated through graded ethanol (50, 70, 80, 90, 100; 2 x 1 hr each), cleared in xylene (2 x 1 h; Sigma, St. Louis, MO), infiltrated with paraffin wax (60°C; 4 x 1 hr), and embedded in paraffin wax. Serial sections (5 µm) were cut from the middle of each testis preparation. Sections were dried overnight onto glass slides at 37°C and stored at room temperature until processed for histology. For staining and morphometric evaluation, sections were deparaffinized in Microclear (2 x 5min; Micron Environmental Industries, Fairfax, VA) and rehydrated through graded ethanol (2 x 100%, 2 x 95%, 1 x 70%). Sections were rinsed thoroughly in water, stained with haematoxylin, dehydrated, cleared in Microclear and mounted using DPX mounting media (Sigma-Aldrich, Milwaukee, WI). Stained sections were stored at room temperature (26 + 2°C) until morphometric analysis was conducted.
Morphometry & Histopathology
Stained sections were evaluated at 50x magnification using a Zeiss Axioplan-2 Photomicroscope equipped with planaphotochromat objectives for DIC microscopy, coupled to a computerized morphometric planimetry system (Bioquant Nova 2000 Advanced Image Analysis, R&M Biometrics, Nashville, TN) to obtain tubule diameters and area percentages (volume percentages) occupied by seminiferous tubules and interstitium. Two full cross-sections from near the middle of each testis were used in these evaluations. Four areas randomly selected to represent each quadrant on each section were evaluated. Briefly, images from an Optronics DEI-750 triple-CCD color camera attached to the microscope were displayed on a high resolution (1600 lines/inch) color video monitor and the tubular components of the parenchyma were measured by tracing outlines of whole seminiferous tubules (about 60 tubules per rat) using a computer mouse connected to a high-resolution digital pad.
Thus, approximately 10 x 10 6 μm 2 was evaluated per testis (approximately 1.2 x 10 6 μm 2 evaluated per quadrant). For all morphometric calculations, specific gravity of the testicular tissue was assumed to be 1.0, and area percentages were assumed equal to volume percentages [28]. No correction factor for shrinkage was applied, since the samples used for comparison were fixed and processed into paraffin blocks using identical conditions. Morphometric assessments included the evaluation of the percentage tubular volume, percentage interstitial volume, average tubule diameter, and percentage tubules displaying elongated spermatids (i.e., full spermatogenesis), as described previously [27,29]. The volume percentage of seminiferous tubules was multiplied by testicular volume (i.e., testis weight) per paired testes to obtain total tubular volume, and then divided by average area per round tubule profile, using the formula for volume of a cylinder, to obtain total length of seminiferous tubules per paired testes [30].
Determination of Daily Sperm Production (DSP)
The number of homogenization-resistant testicular spermatids was determined according to the method of Goyal et al. [31]. Briefly, testes from BaP-exposed and UNC rats were decapsulated, weighed and each testicular parenchyma was homogenized in 50 ml of PBS using a motorized homogenizer (Brinkmann Instruments, Westbury, NY). The homogenate was filtered through a metal sieve, and an aliquot of the filtrate was mixed with PBS and 0.6% trypan blue in a ratio of 2:1:2, respectively. An 8.5 µl aliquot of the latter mixture was then used to determine the average number of homogenization-resistant spermatids in each sample in duplicate, by hemocytometric counting. Daily sperm production was calculated by dividing the total number of spermatids per gram of testicular parenchyma (testis weight minus weight of the capsule) by 6.1 days, the duration of step 19 spermatids in the seminiferous epithelial cycle [32].
Plasma and Intratesticular Testosterone and Plasma LH Determination
Testosterone was extracted from testis homogenates with ether followed by evaporation of ether and reconstitution of extracted testosterone in 0.1% gel PBS. Subsequently, testis homogenate extracts and plasma samples from UNC and BaP-exposed rats were analyzed for total testosterone by radioimmunoassay while analysis for LH was conducted in plasma samples using the same assay method previously validated in our laboratory [5,26]. The sensitivity of testosterone assay was 2 pg/tube and the intra-assay coefficient of variation was 8%. The inter-assay coefficient of variation for this assay is not available because testosterone in all samples was measured in a single assay. The sensitivity of LH assay was 0.08 ng/tube and the intra-and inter-assay coefficients of variation were 6.5 and 10.9%, respectively.
Statistical Analyses
Data on weekly body weights, total plasma testosterone and LH concentrations were analyzed by ANOVA with repeated measures and the differences among means were tested with orthogonal contrasts. Those on testis weight, ITT concentrations and daily sperm production were compared by unpaired t-test. Data on morphometric assessments of testicular histologies were analyzed by GLM procedure of SAS Version 6.12 (SAS/STAT User's Guide, [33]).
Results
Weekly body weights of UNC and BaP-exposed rats were similar during the nine weeks of this study (complete data not shown), suggesting that the exposure concentration of BaP used in this study, the route of administration and duration of exposures per day for 60 days did not affect body weights in rats. Mean weekly weights (Mean + SE) of rats increased from 356.1 + 8 to 430.3 + 7 and from 351.4 + 11 to 433.7 + 8 gm for UNC and BaP-exposed rats, respectively.
Testes recovered from rats exposed to BaP weighed less than those from their UNC counterparts ( Fig. 1; P < 0.025).
Figure 1:
Mean testis weight of BaP-exposed versus UNC rats. Table 1 depicts the morphometric characteristics of rat testis exposed to BaP via inhalation versus UNC. Testes from BaP-exposed rats weighed 34% less (P < 0.025) than those recovered from their UNC counterparts. Tubule diameter (µM) and percentage of tubules exhibiting elongated spermatids were similar between UNC and BaPexposed rats. However, exposure to BaP caused a reduction in total tubular volume (P < 0.002), total weight of tubules (P < 0.002) and total tubular length (P < 0.01) per paired testes compared with those of their control counterparts.
Similarly, both total volume and total weight of interstitium per paired testes were reduced by approximately 12% due to exposure of rats to BaP compared with those of testes recovered from control rats (P < 0.05). Collectively, these morphometric data suggest that exposure of rats to inhaled BaP contributed significantly to the reduction in testis weight (Fig. 1). Some of the above mentioned pathological changes are depicted in the photomicrographs of BaP and UNC testis histologies (Fig. 2).
A. Control rat B. BaP-treated rat Though the seminiferous tubules appear qualitatively similar, the size of tubular lumens and length decreased in BaP-exposed rats, compared with controls. This indicates a reduction in spermatogenic activity and loss of fluid in the seminiferous tubules due to decreased testosterone production, thus the observed decreased testis size.
Daily sperm production was reduced (P <0.025) in rats exposed to inhaled BaP for 60 days compared with rats in the UNC group (Fig. 3). Intratesticular testosterone concentrations per gram of testicular tissue harvested on day 60 of BaP exposures were also reduced (P < 0.025; Fig. 4) as well as plasma testosterone concentrations (P < 0.05; Fig. 5) on the last day of exposures (day 60) and at 24, 48 and 72hr later compared with controls. However, LH concentrations in plasma samples of BaP-exposed rats were elevated throughout the above mentioned four time periods studied compared with controls (P < 0.05; Fig. 6).
Figure 3:
Effect of inhaled BaP on daily sperm production per gram of testis in F-344 male rats exposed to 75 μg BaP/m 3 for 60 days; n = 10 per treatment or control group. Results are expressed as mean + SE (UNC = unexposed control; BaP = BaP-inhaled rats. Asterisks indicate a significant difference from controls (P < 0.05).
Figure 4:
Effect of inhaled BaP on ITT concentrations in F-344 male rats exposed to 75 μg BaP/m 3 for 60 days; n = 10 per treatment or control group. Results are expressed as mean + SE (UNC = unexposed control; BaP = BaPinhaled rats. Asterisks indicate a significant difference from controls (P < 0.05).
Plasma LH
Concentrations (ng/ml) * * * p < 0.05 Figure 6: Effect of inhaled BaP on plasma LH concentrations in F-344 male rats exposed to 75 μg BaP /m 3 on the last day of exposures (day 60) and at 24, 48 and 72hr later; n = 10 per treatment or control group. Results are expressed as mean + SE (UNC = unexposed control; BaP = BaP-inhaled rats. Asterisks indicate a significant difference from controls (P < 0.05).
Discussion
The exposure concentration of BaP (75μg/m 3 ) used in this study is one that adversely affected reproductive phenomena in our previous studies in both adult male and female rats [5,26] and is within the range (10μg-2 mg/m 3 ) present in a variety of sources in the environment. Some of these sources include: aluminum smelter and coke industries [7]; ambient air of highly polluted industrial cities [34]; cooking oil and wood combustion fumes [35]; home heating with coal-gas [7]. Furthermore, the exposure concentration of BaP to which rats in this study were exposed, is close to the legally enforceable limit of 100μg/m 3 established for PAHs by the Occupational Safety and Health Administration [36].
Rats exposed to BaP in this study had similar weekly weight gains compared with UNC rats, suggesting that the exposure of animals to 75μg/m 3 BaP, daily exposure durations and method of restraint, did not impede growth through undue stress compared with controls.
Mean testis weight among BaP-exposed rats was significantly reduced compared with their UNC counterparts. Similar observation was made by Blazak et al. [37] for adult rats and by Singh and Tate [38] in adult hamsters, indicating toxicity by this PAH on the testis [39]. Testicular morphometric data obtained in this study indicate that BaP exposure reduced components of both the steroidogenic and spermatogenic compartments of the testis. However, more of the BaP-influenced reduction was brought to bear on the spermatogenic compartment compared with controls (12% reduction in both total volume and total weight of interstitium per paired testis [steroidogenic compartment] versus 20% reduction in both tubular volume and tubular weight and 40% reduction in tubular length [spermatogenic compartment]). This is not surprising in as much as the testis bulk (85%; [40]) is involved in sperm production; consequently, when seminiferous tubular cells such as Sertoli cells undergo apoptosis due to exposure to BaP [41], paracrine mediators involved in the regulation of spermatogenesis [42] are reduced, leading to a reduction in spermatogenetic support and testicular mass.
The morphometric data on the effects of BaP on spermatogenic and steroidogenic compartments of the testis were predictive of the functions of these testicular compartments. We observed a significant reduction in DSP per gram of testicular tissue in BaP exposed rats compared with their control counterparts, probably due to BaP-induced dysfunction of exposed Sertoli cells. Raychoudhury and Kubinski [41] reported that in vitro exposure of isolated rat Sertoli cells to BaP resulted in cellular changes characteristic of apoptosis. Although Sertoli cells were not enumerated in this study, the dramatic reduction (39%) of total tubular length in BaP-treated rats implies that a significant reduction in Sertoli cell numbers also occurred during BaP exposure. Sertoli cells initiate, support, maintain and regulate spermatogenesis in mammals by (1) providing structural and functional barrier that regulate the movement of extratubular blood-borne components into the seminiferous tubular environment; (2) synthesizing and secreting various nutrients utilized by developing germ cells; and (3) synthesizing and secreting paracrine mediators proposed to be involved in the regulation of spermatogenesis [42]. Thus, the reduced DSP per gram testis observed in this study may have been due to reduced spermatogenesis resulting from BaP-induced DNA damage and apoptosis in Sertoli cells [41,43].
High ITT concentrations are required for the regulation of spermatogenesis [44], the reduction of which results in fewer mature sperm produced by the testis [45]. Our data demonstrate that reduced DSP was accompanied by approximately 20% reduction in ITT concentrations per gram of testicular tissue. Our data also indicate that the effect of BaP on testicular testosterone synthesis was a direct effect on the Leydig cells. This conclusion is based on increased plasma LH concentrations observed in this study due to the abrogation of the negative feedback on this pituitary gonadotropin by decreased plasma concentrations of testosterone in BaP exposed versus controls during the four time periods studied. The reduction in intratesticular synthesis of testosterone may have resulted from the exposure of Leydig cells to sequestered BaP in high-density lipoproteins that are essential for steroid hormone biosynthesis [46]. Mandal et al. [47] have demonstrated that DMBA inhibits the ability of Leydig cells to synthesize and release testosterone.
Furthermore, it could be surmised that the metabolism of BaP by Leydig cells or BaP metabolites produced elsewhere in the body and transported to the testis may have adversely affected Leydig cell function. In this context, it is worth mentioning that the tissues in the male reproductive organs and the Leydig cells in particular extensively metabolize PAHs including BaP [48][49][50][51]. Consequently, the metabolites of BaP may have significantly reduced the ability of the Leydig cell to synthesize and release testosterone in this study, due to ROS-induced aging [47,52]. Peltola et al. [53] have shown that ROS can damage critical components of the steroidogenic pathway in Leydig cells, including steroidogenic acute regulatory (StAR) protein [54]. The reduction in the synthesis and release of testosterone could also be exacerbated by a reduction in the population of Leydig cells via apoptosis as exemplified in data generated on Leydig cells from rats exposed to cigarette smoke [55]. A reduction in ITT normally results in reduced spermatogenesis [56] and could explain the reduced DSP per gram of testicular tissue among BaP-exposed rats compared with controls in this study. Additionally, decreased circulating testosterone levels similar to that observed in the present study upon prolonged exposure to BaP may have implications on successful mating of females by exposed males [57]. It is also very likely that the reduction in the circulating testosterone concentrations by BaP is primarily contributed to by reduced ITT synthesis and release and secondarily by the heightened induction of the liver cytochrome P450s that are necessary for detoxification of BaP [10].
Our data raise the awareness that exposure to BaP contributes to the declining fertility in men due to declining sperm production and altered endocrine regulated events that lead to sperm maturation, gamete interaction, embryo development and the delivery of viable young. The adverse effect of this endocrine disruptor on reproduction will not abate in as much as exposures of men to this xenobiotic continue. It is important therefore, for healthcare givers to advise patients during infertility counseling sessions, to curtail exposures to BaP in order to reduce the risk to infertility, should the patients fall within 'at risk' category for BaP exposure. This 'at risk' category includes smokers; workers in coke oven, coal tar, distillery, iron foundry, aluminum, bitumen, creosote and carbon electrode manufacturing industries; thermo-electric power plants; roofers; ship builders; painters; fire fighters; auto and aircraft mechanics; incineration plant workers; restaurant cooks, and individuals that live near hazardous waste sites.
Figure 2 :
2Photomicrographs of testes histologies from A) unexposed control F-344 rat; B) F-344 rat exposed to 75 μg BaP /m 3 for 60 days. Magnification bar = 250 μm.
Figure 5 :
5Effect of inhaled BaP on plasma testosterone concentrations in F-344 male rats exposed to 75 μg BaP/m 3 on the last day of exposures (day 60) and at 24, 48 and 72hr later; n = 10 per treatment or control group. Results are expressed as mean + SE (UNC = unexposed control; BaP = BaP-inhaled rats. Asterisks indicate a significant difference from controls (P < 0.05).
Table 1 :
1Testicular morphometric data of BaP (75ug/kg)exposed rats after 60 daysParameter
Control
BaP-exposed
Tubule diameter (µm)
250 + 8.5
230 + 8.2
Tubules with elongated
spermatids (%)
99 + 1.0
99 + 1.0
Tubular volume (X 10 9 µm 3 ) 2.0 + 0.7
1.6 + 0.004 ***
Total weight of tubules (gm) 2.20 + 0.7 1.6 + 0.004 ***
Total tubular length (µm)
55 + 1.0
33 + 1.0 **
Total volume of interstitium
per paired testis (μm 3 )
0.43 + 0.01
0.38 + 0.01 *
Total weight of interstitium
per paired testis (gm)
0.45 + 0.01
0.37 + 0.01 *
*
p < 0.05; ** p < 0.01; *** p < 0.002
Exposure to hazardous substances and male reproductive health: a research framework. J M Moline, A L Golden, N Bar-Chama, E Smith, M E Rauch, R E Chapin, S D Perreault, S M Schrader, W A Suk, P J Landrigan, Environ Health Perspect. 108Moline, J. M.; Golden, A. L.; Bar-Chama, N.; Smith, E.; Rauch, M. E.; Chapin, R. E.; Perreault, S. D.; Schrader, S. M.; Suk, W. A.; Landrigan, P.J.: Exposure to hazardous substances and male reproductive health: a research framework. Environ Health Perspect. 2000 108, 803-813.
Environment and health: 6. Endocrine disruption and potential human health implications. G M Solomon, T Schettler, CMAJ. 163Solomon, G.M.; Schettler, T.: Environment and health: 6. Endocrine disruption and potential human health implications. CMAJ 2000 163, 1471-1476.
Endocrine-modulating substances in the environment:estrogenic effects of pharmaceutical products. L D Arcand-Hoy, A C Nimrod, W H Benson, Int. J. Toxicol. 17Arcand-hoy, L. D.; Nimrod, A. C.; Benson, W. H.: Endocrine-modulating substances in the environment:estrogenic effects of pharmaceutical products. Int. J. Toxicol. 1998 17, 139 -158.
The androgen microenvironment of the human testis and hormonal control of spermatogenesis. J P Jarow, B Zirkin, Ann NY Sci. 1061Jarow, J. P.; Zirkin, B.: The androgen microenvironment of the human testis and hormonal control of spermatogenesis. Ann NY Sci 2005, 1061, 208-220.
Disruption of testicular steroidogenesis and epididymal function by inhaled benzo(a)pyrene. F Inyang, A Ramesh, P Kopsombut, M S Niaz, D B Hood, A M Nyanda, Reprod Toxicol. 17Inyang, F.; Ramesh, A.; Kopsombut, P.; Niaz, M.S.; Hood, D.B.; Nyanda, A.M.; et al.: Disruption of testicular steroidogenesis and epididymal function by inhaled benzo(a)pyrene. Reprod Toxicol 2003, 17, 527-537.
Toxicological profile for Polycyclic Aromatic Hydrocarbons (PAHs). 458Atlanta, GeorgiaUS Department of Health & Human ServicesAgency for Toxic Substances and Disease Registry (ATSDR). Toxicological profile for Polycyclic Aromatic Hydrocarbons (PAHs). US Department of Health & Human Services: Atlanta, Georgia; 1995, 458pp.
Selected non-heterocyclic polycyclic aromatic hydrocarbons. Environmental Health Criteria 202. World Health Organization. WHO. Geneva883WHO. Selected non-heterocyclic polycyclic aromatic hydrocarbons. Environmental Health Criteria 202. World Health Organization, Geneva, 1998, 883pp.
Bioavailability and risk assessment of orally ingested polycyclic aromatic hydrocarbons. A Ramesh, S A Walker, D B Hood, M D Guillen, H Schneider, E H Weyand, Int. J. Toxicol. 23Ramesh, A.; Walker, S. A.; Hood, D. B.; Guillen, M. D.; Schneider, H.; Weyand, E. H.: Bioavailability and risk assessment of orally ingested polycyclic aromatic hydrocarbons. Int. J. Toxicol. 2004, 23, 301- 333.
. D Nebert, A L Roe, M Z Dieter, W Solis, Nebert, D. W; Roe, A. L.; Dieter, M. Z.; Solis, W. A;
Role of the aromatic hydrocarbon receptor and [Ah] gene battery in the oxidative stress response, cell cycle control, and apoptosis. Y Yang, T P Dalton, Biochem. Pharmacol. 59Yang, Y.; Dalton, T. P.: Role of the aromatic hydrocarbon receptor and [Ah] gene battery in the oxidative stress response, cell cycle control, and apoptosis. Biochem. Pharmacol. 2000, 59, 65-85.
Inhibition of cytochrome P450 1A1-, 1A2-, and 1B1-mediated activation of procarcinogens to genotoxic metabolites by polycyclic aromatic hydrocarbons. T Shimada, F P Guengerich, Chem. Res. Toxicol. 19Shimada, T.; Guengerich, F. P.: Inhibition of cytochrome P450 1A1-, 1A2-, and 1B1-mediated activation of procarcinogens to genotoxic metabolites by polycyclic aromatic hydrocarbons. Chem. Res. Toxicol. 2006, 19, 288-294.
P450 genes: structure, evolution, and regulation. D Nebert, F J Gonzalez, Annu Rev Biochem. 56Nebert, D. W; Gonzalez, F. J.: P450 genes: structure, evolution, and regulation. Annu Rev Biochem. 1987, 56, 945-993.
DNA strand scission by polycyclic aromatic hydrocarbon oquinones: role of reactive oxygen species, Cu (II)/Cu (I) redox cycling, and o-semiquinone anion radicals. L Flowers, S Ohnishi, T M Penning, Biochemistry. 36Flowers, L.; Ohnishi, S.; Penning, T. M.: DNA strand scission by polycyclic aromatic hydrocarbon o- quinones: role of reactive oxygen species, Cu (II)/Cu (I) redox cycling, and o-semiquinone anion radicals. Biochemistry, 1997, 36, 8640-8648.
Free radicals in toxicology. S D Aust, C F Chignell, T M Bray, B Kalyanaraman, R P Mason, Toxicol. Appl. Pharmacol. 120Aust, S. D.; Chignell, C. F.; Bray, T. M.; Kalyanaraman, B.; Mason, R.P. Free radicals in toxicology. Toxicol. Appl. Pharmacol. 1993, 120, 168-178.
Role of quinones in toxicology. J L Bolton, M A Trush, T Penning, G Dryhurst, T J Monks, Chem. Res. Toxicol. 13Bolton, J. L.; Trush, M. A.; Penning, T. M; Dryhurst, G; Monks, T. J.: Role of quinones in toxicology. Chem. Res. Toxicol. 2000, 13, 135-160.
Signaling by environmental polycyclic aromatic hydrocarbons in human lymphocytes. S W Burchiel, M I Luster, Clin. Immunol. 98Burchiel, S. W.; Luster, M. I.: Signaling by environmental polycyclic aromatic hydrocarbons in human lymphocytes. Clin. Immunol. 2001, 98, 2-10.
Effects of testosterone plus medroxyprogesterone acetate on semen quality, reproductive hormones, and germ cell populations in normal young men. R I Mclachlan, L Donnell, P G Stanton, G Balourdos, M Frydenberg, D M De Kretser, D M Robertson, J Clin Endocrinol Metab. 87McLachlan, R. I.; O'Donnell, L.; Stanton, P. G.; Balourdos, G.; Frydenberg, M.; de Kretser, D. M.; Robertson, D. M.: Effects of testosterone plus medroxyprogesterone acetate on semen quality, reproductive hormones, and germ cell populations in normal young men. J Clin Endocrinol Metab. 2002 87: 546 -556.
Stimulation of sperm production by human chorionic gonadotropin after prolonged gonadotropin suppression in normal men. A M Matsumoto, W J Bremner, J Androl. 6Matsumoto, A. M.; Bremner, W. J.; Stimulation of sperm production by human chorionic gonadotropin after prolonged gonadotropin suppression in normal men. J Androl. 1985 6,137-143.
Effects of chronic testosterone administration in normal men: safety and efficacy of high dosage testosterone and parallel dose-dependent suppression of luteinizing hormone, folliclestimulating hormone, and sperm production. A M Matsumoto, J Clin Endocrinol Metab. 70Matsumoto, A. M.: Effects of chronic testosterone administration in normal men: safety and efficacy of high dosage testosterone and parallel dose-dependent suppression of luteinizing hormone, follicle- stimulating hormone, and sperm production. J Clin Endocrinol Metab.1990 70, 282-287.
Testosterone concentrations in testes of normal men: Effects of testosterone propionate administration. H C Morse, N Horike, M J Rowley, C G Heller, J Clin Endocrinol Metab. 37Morse, H. C.; Horike, N.; Rowley, M. J.; Heller, C. G.: Testosterone concentrations in testes of normal men: Effects of testosterone propionate administration. J Clin Endocrinol Metab. 1973, 37, 882 -886.
Pituitarytesticular function of prostatic cancer patients during treatment with a gonadotropin-releasing hormone agonist analog. I. Circulating hormone levels. I Huhtaniemi, H Nikula, S Rannikko, J Androl. 8Huhtaniemi, I.; Nikula, H.; Rannikko, S.: Pituitary- testicular function of prostatic cancer patients during treatment with a gonadotropin-releasing hormone agonist analog. I. Circulating hormone levels. J Androl. 1987, 8, 355 -362.
Contraceptive efficacy of testosterone-induced azoospermia in normal men. Lancet. 336WHO. Contraceptive efficacy of testosterone-induced azoospermia in normal men. Lancet. 1990, 336, 995- 999.
Intratesticular androgen levels, androgen receptor localization, and androgen receptor expression in adult rat Sertoli cells. C M Hill, M D Anway, B R Zirkin, T R Brown, Biol. Reprod. 71Hill, C. M.; Anway, M. D.; Zirkin, B. R.; Brown, T. R.: Intratesticular androgen levels, androgen receptor localization, and androgen receptor expression in adult rat Sertoli cells. Biol. Reprod. 2004, 71, 1348- 1358.
Modulation in the developmental expression profile of Sp1 subsequent to transplacental exposure of fetal rats to desorbed benzo(a)pyrene following maternal inhalation. D B Hood, T Nayyar, A Ramesh, M Greenwood, F Inyang, Inhal Toxicol. 12Hood, D. B.; Nayyar, T.; Ramesh, A.; Greenwood, M.; Inyang, F.: Modulation in the developmental expression profile of Sp1 subsequent to transplacental exposure of fetal rats to desorbed benzo(a)pyrene following maternal inhalation. Inhal Toxicol, 2000, 12, 511-535.
Reinterpreting literature sorption data considering both absorption into organic carbon and adsorption onto black carbon. A Accardi-Dey, P M Gschwend, Environ Sci Technol. 37Accardi-Dey, A.; Gschwend, P. M.: Reinterpreting literature sorption data considering both absorption into organic carbon and adsorption onto black carbon. Environ Sci Technol, 2003; 37, 99-106.
Carbon black users guide. Safety, health and environmental information, International Carbon Black Association. Anon, Anon. Carbon black users guide. Safety, health and environmental information, International Carbon Black Association, 2004.
Alteration of pregnancy related hormones and fetal survival in F-344 rats by inhaled benzo(a)pyrene. A E Archibong, F Inyang, A Ramesh, M Greenwood, T Nayyar, P Kopsombut, Reprod Toxicol. 16Archibong, A. E.; Inyang, F.; Ramesh, A.; Greenwood, M.; Nayyar, T.; Kopsombut, P.; et al.: Alteration of pregnancy related hormones and fetal survival in F-344 rats by inhaled benzo(a)pyrene. Reprod Toxicol, 2002, 16, 801-808.
Stereological techniques for electron microscopic morphometry. E R Weibel, Hayat, M. A.: ed. Principles and Techniques of Electron Microscopy. New YorkVan Nostrand Reinhold Co3Weibel, E. R.; Stereological techniques for electron microscopic morphometry. In: Hayat, M. A.: ed. Principles and Techniques of Electron Microscopy, Vol 3, Biological Applications. Van Nostrand Reinhold Co., New York; 1973: pp.237-296.
Changes in Leydig cell ultrastructure and function during pubertal development in the boar. D D Lunstra, J J Ford, R K Christenson, R D Allrich, Biol Reprod. 34Lunstra, D. D.; Ford, J. J.; Christenson, R. K.; Allrich, R. D.: Changes in Leydig cell ultrastructure and function during pubertal development in the boar. Biol Reprod, 1986, 34, 145-158.
Testicular development of Zebu bulls after chronic treatment with a gonadotropin-releasing hormone agonist. H Jiménez-Severiano, M L Mussard, L A Fitzpatrick, M J ; D'occhio, J J Ford, D D Lunstra, J. Anim Sci. 83Jiménez-Severiano, H.; Mussard, M. L.; Fitzpatrick, L. A.; D'Occhio, M. J.; Ford, J. J.; Lunstra D. D.; et al.: Testicular development of Zebu bulls after chronic treatment with a gonadotropin-releasing hormone agonist. J. Anim Sci, 2005, 83, 2111-2122.
Sertoli cell number and function, spermatogonial number and yield and daily sperm production in three breeds of boars. O E Okwun, G Igboeli, J J Ford, D D Lunstra, L Johnson, J. Reprod Fertil. 107Okwun, O. E.; Igboeli, G.; Ford, J. J.; Lunstra, D. D.; Johnson, L.: Sertoli cell number and function, spermatogonial number and yield and daily sperm production in three breeds of boars. J. Reprod Fertil 1996, 107, 137-149.
Diethylstilbestrol-treated adult rats with altered epididymal sperm numbers and sperm motility parameters, but without alterations in sperm production and sperm morphology. H O Goyal, T D Braden, M Mansour, C S Williams, A Kamaleldin, K K Srivastava, Biol Reprod. 64Goyal, H. O.; Braden, T. D.; Mansour, M.; Williams, C. S.; Kamaleldin, A.; Srivastava, K. K.: Diethylstilbestrol-treated adult rats with altered epididymal sperm numbers and sperm motility parameters, but without alterations in sperm production and sperm morphology. Biol Reprod. 2001, 64, 927-934.
Daily sperm production and epididymal sperm reserves of pubertal and adult rats. G W Robb, R P Amann, G J Killian, J Reprod Fertil. 54Robb, G. W.; Amann, R. P.; Killian, G. J.: Daily sperm production and epididymal sperm reserves of pubertal and adult rats. J Reprod Fertil. 1978, 54, 103-107.
Sas/Stat, SAS Institute SAS/STAT Statistical Analysis System User's Guide. 65SAS/STAT. SAS Institute SAS/STAT Statistical Analysis System User's Guide (Version 6, 5th
. North Cary, EditionCarolina, EditionStatistical Analysis System Institute, IncEdition). Cary, North Carolina: Statistical Analysis System Institute, Inc. 1990, pp.113-709.
Ambient air pollutants in Upper Silesia: partial chemical composition and biological activity. M Chorazy, J Szeliga, M Strozyk, B Cimander, Chorazy, M.; Szeliga, J.; Strozyk, M.; Cimander, B.: Ambient air pollutants in Upper Silesia: partial chemical composition and biological activity.
. Environ Health Perspect. 102Suppl 4Environ Health Perspect. 1994, 102 (Suppl 4), 61-66.
Indoor exposure to polycyclic aromatic hydrocarbons and carbon monoxide in traditional houses in Burundi. C Viau, G Hakizimana, M Bouchard, Int Arch Occup Environ Health. 73Viau, C.; Hakizimana, G.; Bouchard, M.: Indoor exposure to polycyclic aromatic hydrocarbons and carbon monoxide in traditional houses in Burundi. Int Arch Occup Environ Health, 2000, 73, 331-338.
Occupational Safety and Health Standards, Toxic and Hazardous Substances. Code of Federal Regulations. 29 CFR 1910.1000Occupational Safety and Health Administration (OSHA)Occupational Safety and Health Administration (OSHA). Occupational Safety and Health Standards, Toxic and Hazardous Substances. Code of Federal Regulations. 29 CFR 1910.1000. 1998.
Potential indicators of reproductive toxicity: testicular sperm production and epididymal sperm number, transit time, and motility in Fischer 344 rats. W F Blazak, T L Ernst, B E Stewart, Fundam Appl Toxicol. 5Blazak, W. F.; Ernst, T. L.; Stewart, B. E.: Potential indicators of reproductive toxicity: testicular sperm production and epididymal sperm number, transit time, and motility in Fischer 344 rats. Fundam Appl Toxicol 1985, 5, 1097-1103.
Antispermatogenic effects of ethylmethanesulfonate and benzo(a)pyrene in PD4 Lakeview hamsters. H Singh, F Tate, J. Toxicol. Environ. Health. 8Singh, H.; Tate, F.: Antispermatogenic effects of ethylmethanesulfonate and benzo(a)pyrene in PD4 Lakeview hamsters. J. Toxicol. Environ. Health, 1981, 8: 929-937.
Progressive testicular atrophy in the varicocele patient. L I Lipshultz, J Corriere, Jr, J Urol. 117Lipshultz, L. I.; Corriere, J. N Jr.: Progressive testicular atrophy in the varicocele patient. J Urol 1977, 117, 175-176.
Infertility, a practical guide for the physician. L I Lipshultz, M A Witt, Blackwell Scientific Publications. Hammond, M. G, Talbert L MInfertility in the maleLipshultz, L. I.; Witt, M. A.: Infertility in the male. In: Hammond, M. G, Talbert L M, editors. Infertility, a practical guide for the physician. Blackwell Scientific Publications, Boston; pp. 26-55, 1993.
Polycyclic aromatic hydrocarbon induced cytotoxicity in cultured rat sertoli cells involves differential apoptotic response. S S Raychoudhury, D Kubinski, Environ. Hlth. Perspect. 111Raychoudhury, S. S.; Kubinski, D.: Polycyclic aromatic hydrocarbon induced cytotoxicity in cultured rat sertoli cells involves differential apoptotic response. Environ. Hlth. Perspect, 2003, 111, 33-38.
Preparation and use of Sertoli cell-enriched cultures from 18-Day -old rat. W W Ku, R E Chapin, R E Chapin, J J Heindel, Male Reproductive Toxicology. San DiegoAcademic Press3Ku, W. W.; Chapin, R. E.: Preparation and use of Sertoli cell-enriched cultures from 18-Day -old rat. In: Chapin, R. E.; Heindel, J. J.: ed. Male Reproductive Toxicology, Methods in Toxicology, Academic Press, San Diego: 1993, Vol. 3, pp. 210-229.
Resveratrol, a natural aryl hydrocarbon receptor antagonist, protects sperm from DNA damage and apoptosis caused by benzo(a)pyrene. A Revel, H Roanani, E Younglai, J Xu, R Han, J-F Savouret, Reprod. Toxicol. 15Revel, A.; Roanani, H.; Younglai, E.; Xu, J.; Han, R.; Savouret, J-F et al. Resveratrol, a natural aryl hydrocarbon receptor antagonist, protects sperm from DNA damage and apoptosis caused by benzo(a)pyrene. Reprod. Toxicol. 2001, 15, 479-486.
The functional significance of FSH in spermatogenesis and the control of its secretion in male primates. T M Plant, G R Marshall, Endocrine Reviews. 22Plant, T. M.; Marshall, G. R.: The functional significance of FSH in spermatogenesis and the control of its secretion in male primates. Endocrine Reviews, 2001, 22, 764-786.
Intratesticular androgens and spermatogenesis during severe gonadotropin suppression induced by male hormonal contraceptive treatment. S T Page, T F Kalhorn, W J Bremner, B D Anawalt, A M Matsumoto, J K Amory, J. Androl. 28Page, S. T.; Kalhorn, T. F.; Bremner, W. J.; Anawalt, B. D.; Matsumoto, A. M.; Amory, J. K.: Intratesticular androgens and spermatogenesis during severe gonadotropin suppression induced by male hormonal contraceptive treatment. J. Androl, 2007, 28, 734-741.
Binding and transport of benzo(a)pyrene by blood plasma lipoproteins: the possible role of apolipoprotein B in this process. L M Polyakov, M I Chasovskikh, L E Panin, Bioconjugate Chem. 7Polyakov, L. M.; Chasovskikh, M. I.; Panin, L. E.: Binding and transport of benzo(a)pyrene by blood plasma lipoproteins: the possible role of apolipoprotein B in this process. Bioconjugate Chem 1996, 7, 396-400.
(a)anthracene inhibition of steroid production in MA-10 mouse Leydig tumor cells is not directly linked to induction of CYP1B1. P K Mandal, L R Mcdaniel, R A Prough, B J Clark, Toxicol Appl Pharmacol. 7Mandal, P. K.; McDaniel, L. R.; Prough, R. A.; Clark, B. J.: 7, 12-Dimethlbenz(a)anthracene inhibition of steroid production in MA-10 mouse Leydig tumor cells is not directly linked to induction of CYP1B1. Toxicol Appl Pharmacol., 2001, 175, 200-208.
Aryl hydrocarbon hydroxylase activity in F-344 rats subchronically exposed to benzo(a)pyrene and fluoranthene through diet. A Ramesh, F Inyang, D B Hood, M E Knuckles, J Biochem Mol Toxicol. 14Ramesh, A.; Inyang, F.; Hood, D. B.; Knuckles, M. E.: Aryl hydrocarbon hydroxylase activity in F-344 rats subchronically exposed to benzo(a)pyrene and fluoranthene through diet. J Biochem Mol Toxicol., 2000, 14, 155-161.
Comparative metabolism, bioavailability and toxicokinetics of benzo(a)pyrene in rats after acute oral, inhalation, and intravenous administration. A Ramesh, D B Hood, F Inyang, M Greenwood, A E Archibong, M E Knuckles, Polycyclic Aromatic Compounds. 22Ramesh, A.; Hood, D. B.; Inyang, F.; Greenwood, M.; Archibong, A.E.; Knuckles, M. E et al.: Comparative metabolism, bioavailability and toxicokinetics of benzo(a)pyrene in rats after acute oral, inhalation, and intravenous administration. Polycyclic Aromatic Compounds, 2002, 22: 969-980.
Metabolism of benzo(a)pyrene by the isolated perfused rat testis. I P Lee, J Nagayama, Cancer Res. 40Lee, I. P.; Nagayama, J.: Metabolism of benzo(a)pyrene by the isolated perfused rat testis. Cancer Res., 1980, 40, 3297-3303.
Metabolic activation of carcinogens and expression of various cytochromes P450 in human prostate tissue. J A Williams, F C Martin, G H Muir, A Hewer, P L Grover, D H Phillips, Carcinogenesis. 21Williams, J. A.; Martin, F. C.; Muir, G. H.; Hewer, A.; Grover, P. L.; Phillips, D. H.: Metabolic activation of carcinogens and expression of various cytochromes P450 in human prostate tissue. Carcinogenesis, 2000, 21, 1683-1689.
Mitochondrial reactive oxygen production is dependent on the aromatic hydrocarbon receptor. A P Senft, T P Dalton, D W Nebert, M B Genter, A Puga, R J Hutchinson, Free Radic Biol Med. 33Senft, A. P.; Dalton, T. P.; Nebert, D. W.; Genter, M. B.; Puga, A.; Hutchinson, R. J, et al.: Mitochondrial reactive oxygen production is dependent on the aromatic hydrocarbon receptor. Free Radic Biol Med, 2002, 33, 1268-1278.
Induction of lipid peroxidation during steroidogenesis in the rat testis. V Peltola, I Huhtaniemi, T Metsa-Ketela, M Ahotupa, Endocrinology. 137Peltola, V.; Huhtaniemi, I.; Metsa-Ketela, T.; Ahotupa, M.: Induction of lipid peroxidation during steroidogenesis in the rat testis. Endocrinology 1996, 137, 105-112.
Reactive oxygen disrupts mitochondriain MA-10 tumor Leydig cells and inhibits steroidogenic acute regulatory (StAR) protein and steroidogenesis. T Diemer, J A Allen, K H Hales, D B Hales, Endocrinology. 144Diemer, T.; Allen, J. A.; Hales, K. H.; Hales, D. B.: Reactive oxygen disrupts mitochondriain MA-10 tumor Leydig cells and inhibits steroidogenic acute regulatory (StAR) protein and steroidogenesis. Endocrinology, 2003, 144, 2882-2891.
Long-term effects of cigarette-smoke exposure on plasma testosterone, luteinizing hormone and follicle-stimulating hormone levels in male rats. S Yardimci, A Atan, T Delibasi, K Sunguroglu, M C Guven, Yardimci, S.; Atan, A.; Delibasi, T.; Sunguroglu, K.; Guven, M. C.: Long-term effects of cigarette-smoke exposure on plasma testosterone, luteinizing hormone and follicle-stimulating hormone levels in male rats.
. Br J Urol. 79Br J Urol., 1997, 79, 66-69.
Altered bioavailability of testosterone in androgen-binding protein-transgenic mice. D A Jeyaraj, G Grossman, P Petrusz, Steroids. 70Jeyaraj, D. A.; Grossman, G.; Petrusz, P.: Altered bioavailability of testosterone in androgen-binding protein-transgenic mice. Steroids, 2005, 70, 704-714.
Benzpyrene treatment decreases the sexual activity of adult rats, what is reversed in neonatally allylestrenol treated animals. C S Karabelyos, G Csaba, Acta Physiol Hung. 84Karabelyos, C. S.; Csaba, G.: Benzpyrene treatment decreases the sexual activity of adult rats, what is reversed in neonatally allylestrenol treated animals. Acta Physiol Hung, 1996, 84, 131-137.
| Corticosteroids were used during seventy pregnancies in 55 asthmatic patients. In this series there was one spontaneous abortion and 71 live births (including two sets of twins). There were no maternal, fetal, or neonatal deaths. On the basis of recorded gestation, slightly more premature births were noted in this series than would be expected in the general population. However, there was no increased incidence of toxemia, uterine hemorrhage, or congenital malformations when compared to the general population, Corticosteroids, when indicated for the treatment of severe asthma, do not appear to noticeably increase the risk of maternal or fetal complications, and thus should not be contraindicated in pregnancy. ( JAMA 233:804-807, 1975) | ABSTRACTBackground: Increasing rates of opioid use in the United States have created a national public health crisis. Substance use in pregnancy increases risk for poor birth outcomes. National adv... |
Introduction
Exposure to environmental toxicants and pharmaceutical chemicals is common across the human lifespan; thus, understanding the potentially negative impact of exposure to bioactive chemicals is paramount to protecting our reproductive health [1]. Of particular concern, recent animal models have shown that developmental exposure of a single generation to endocrine disrupting environmental toxicants can negatively impact reproductive capacity trangenerationally, likely due to epigenetic inheritance (reviewed by [2]). The tragic history of exposure to the pharmacologic agent diethylstilbestrol (DES) provides clear evidence that developmental exposure to an endocrine disrupting chemical can have multi-generational effects on human health (reviewed by [3]). Given this background, the rapidly emerging concept that the environmental exposure history of paternal and maternal ancestors may negatively affect an individual's current reproductive health demands a shift in our medical assessments and treatments of infertility. More specifically, since ancestral toxicant exposures cannot be changed, it is imperative that we begin to identify core reproductive processes that are negatively impacted by familial toxicant exposure such that targeted therapies to preserve male and female fertility and avoid adverse pregnancy outcomes can be designed.
More than 80,000 chemicals have been released into our environment since the Toxic Substance Control Act (TSCA) of 1976, however; only a limited number of these potentially harmful compounds have been investigated under controlled experimental conditions [4,5]. In the absence of sufficient safety information, the recognition that natural and manufactured chemicals are capable of disrupting reproductive success has recently prompted the American Society of Reproductive Medicine and the American College of Obstetrics and Gynecology to release guidelines designed to raise awareness of environmental toxicants among clinical caregivers of reproductive age women [6]. Although the safety profile of many chemicals remains to be determined, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) is known to impair male and female fertility due to the ability of this toxicant to not only disrupt endocrine signaling [7] but also modulate critical aspects of immune cell function [8] [9]. The principal mechanism of action of TCDD is related to the binding of this toxicant to the aryl hydrocarbon receptor (AhR) [8], an orphan nuclear receptor which is expressed in the reproductive tract of both humans and rodents [10][11][12]. In addition to TCDD, other structurally related toxicants also bind the AhR, including polychorinated dibenzodioxins (PCDDs), polychlorinated dibenzofurans (PCDFs) and coplanar (non-ortho-substituted) polychlorinated biphenyls (PCBs; [13][14][15]). Importantly, whereas AhR-binding toxicants frequently act as disruptors of reproductive function, male and female AhR knockout mice also exhibit altered reproductive tract development and reduced adult fertility [16,17], implicating endogenous ligands for this receptor as necessary for normal reproduction.
Utilizing TCDD as a prototypical AhR agonist, our laboratory demonstrated that a single exposure of pregnant mice to TCDD reduced the fertility of female offspring for multiple generations whereas identically exposed animals able to achieve pregnancy as adults exhibited an elevated risk of spontaneous preterm birth (PTB) [18]. Suggesting that both endocrine and immune disruption had occurred, female offspring with a direct (F1-F2) or indirect (F3) TCDD exposure exhibited a doubling of the incidence of spontaneous PTB in the presence of either a viral infection or following a low-dose challenge with lipopolysaccharide (LPS). Significantly, exposure of control mice to the same viral or bacterial challenge did not lead to pregnancy loss, demonstrating that female mice with a history of toxicant exposure have an increased sensitivity or reactivity to a second inflammatory challenge [18]. In follow-up studies, we examined the fertility of male mice with a history of TCDD exposure as well as their contribution to successful pregnancy outcomes. In agreement with data from other groups (reviewed by [19]), we found that developmental toxicant exposure of male mice (F1) negatively impacted adult fertility. However, it was somewhat unexpected that mating fertile F1 males to control female mice resulted in a similar rate of PTB as observed with toxicant exposed females mated to control males [20]. Significantly, multiple studies have demonstrated that paternally expressed genes predominate within the placenta [21][22][23]. Additionally, recent evidence suggests that the timing of parturition is regulated by placental inflammatory signals [24]. Therefore, we next examined the influence of a preconception anti-inflammatory diet on pregnancy outcomes. Providing a fish oil supplemented diet to F1 males prior to conception improved male fertility, placental function and normalized gestation length in their female mating partners [25]. Taken together, our prior studies suggested that TCDD-mediated disruption of preconception testicular health may be biologically linked to the altered placental function that we associated with the paternal-derived risk of PTB. Therefore, the primary goal of the current study was to examine the effect(s) of early life TCDD exposure on testicular health, sperm quality and the reproductive performance of male mice (F1 generation). Equally significant, since TCDD is a known epigenetic modifier [18,26], we also examined the F3 generation, the first without a direct toxicant exposure, for the same reproductive endpoints. Clearly, the ability of a toxicant to induce inheritable changes to the epigenome is dependent upon exposure during a brief developmental window that is sensitive to reprogramming. The Skinner laboratory has demonstrated a transgenerational, negative effect of TCDD on adult reproductive function following exposure during the time of sex determination in rats [26,27]. Our results indicate that a single, acute TCDD exposure given during pregnancy after sex determination is also capable of altering reproductive performance in adult offspring (F1 males). Furthermore, these same parameters were adversely affected in the indirectly exposed F3 males, which is indicative of transgenerational inheritance of the phenotype. Finally, we demonstrate that biomarkers of inflammation within the testis of toxicant exposed mice are a signature of ancestral toxicant exposure and appear to be predictive of a risk for adverse pregnancy outcomes in unexposed female mating partners.
Materials and Methods
Animals
Young adult (8-10 weeks) male and female C57bl/6 mice were purchased from Harlan Spraque-Dawley Laboratories (Indianapolis, IN). Animals were housed in Vanderbilt University's Barrier Animal Care Facility (free of mouse pathogens including MPV and MNV) according to National Institutes of Health and institutional guidelines for laboratory animals. All animals received low phytoestrogen rodent chow (Picolab 5VO2, Purina TestDiets, Richmond, IN) and water ad libitum. Animal rooms were maintained at a temperature of 22-24uC and a relative humidity of 40-50% on a 12-hour light:dark schedule. Animals were acclimated at least one week prior to initiation of studies. Experiments described herein were approved by Vanderbilt University's Institutional Animal Care and Use Committee in accordance with the Animal Welfare Act.
Chemicals TCDD (99%) in nonane solution was obtained from Cambridge Isotope Laboratories (Andover, MA). All other chemicals were obtained from Sigma-Aldrich (St. Louis, MO).
In utero TCDD Exposure
Virgin C57bl/6 females (N = 20), aged 10-12 weeks, were mated with intact males of similar age. Upon observation of a vaginal plug, females were separated and denoted as day 0.5 of pregnancy (E0.5). Pregnant mice (F0) were exposed to TCDD (10 mg/kg) in corn oil or vehicle alone by gavage at 1100 hours CST on E15.5 (when organogenesis is complete). This in utero plus lactational exposure paradigm results in direct exposure of the feti (F1 mice) as well as direct exposure of the fetal germ cells, which have the potential to become the F2 generation. This dose of TCDD reflects the more rapid clearance of this toxicant in mice compared to humans and is well below the LD50 for adult mice of this strain (230 mg/kg) [28]. TCDD given at this time and dose is not overtly teratogenic and gestation length was not affected in the F0 animals; pups (F1 mice) were typically born on E20.
Monitoring Pregnancy
A single control female was placed with a single male (with or without a direct/ancestral TCDD exposure) and monitored for the presence of a vaginal plug (E0.5) each morning. Following the identification of a plug, the male was removed. Females were weighed prior to mating and again on E16.5, when they were examined for signs of pregnancy (weight gain, nipple prominence). Beginning at this time, pregnant females were monitored daily until delivery. Male partners of females in which a plug was observed, but which did not demonstrate signs of pregnancy were mated to a different female. Males which produced 3 positive vaginal plugs, but no pregnancy were considered infertile.
Parturition in C57bl/6 mice normally occurs 19.5 days after identification of a vaginal plug [29]; therefore, term parturition is considered E20. For our studies, pups are considered preterm if born prior to E19 [20,25], a more stringent definition than that used by other groups (ie [30,31]).
Euthanasia of Males, Collection of Testes and Analysis of Sperm Concentration
Following a minimum of 72 hrs after mating, males were euthanized by cervical dislocation under isoflurane anesthesia. Testes were excised, weighed and epididymal caudal sperm was collected and quantified by standard methodology [32]. Briefly, caudal sperm were collected into 2 mL prewarmed PBS. Cells were diluted 1:20 and 10 uL of the dilution counted using a hemocytometer. Two counts were taken for each sample and the average used to determine sperm concentration for each animal using the following equation: Sperm number = (mean count6dilution factor)/cauda weight (mg). After removal of the epididymis, the remainder of one testis was formalin-fixed and subjected to paraffin-embedding and sectioning (5 um). The remainder of the second testis was processed for prostaglandin E 2 (PGE 2 ) analysis as described below.
Assessment of Sperm Morphology
Sperm smears were methanol fixed and stained using Stat III Andrology Stain (Mid-Atlantic Diagnostics, Mt. Laurel, NJ) which meets the Kruger Strict Criteria for analysis of Sperm Morphology. Sperm morphologies were assessed by standard methods [33,34] by three individuals (KBT, AA and KBY) blinded to the treatment groups. Briefly, smears were prepared on histological slides and allowed to dry. After staining, 200 spermatozoa/mouse were analyzed under oil immersion (10006 magnification) using an Olympus BX51 microscope system. Morphological abnormalities were classified by careful examination of the head, tail, acrosome and mid-piece ( Figure 1).
Lipopolysaccharide Exposure
LPS (1 mg/mL; Enzo Life Sciences, E. coli serotype 055:B5 Sform, TLR grade) was diluted in sterile PBS immediately prior to intraperitoneal injection (25 g needle) at a dose of 200 ug/kg.
Immunohistochemistry
Immunohistochemical localization of selected proteins was conducted in our laboratory using commercially available antibodies and the Vectastain Elite ABC kit (Vector Laboratories Inc, Burlingame, CA) according to the manufacturer's protocol. Antibodies and concentrations used were: prostaglandin dehydrogenase (PGDH; Cayman Chemicals #160615; used at 1:500); F4/ 80 (a macrophage specific marker; eBioscience #14-4801-85; used at 1:400); cleaved Caspase-3 (a marker of apoptosis; Cell Signaling Technologies #9661; used at 1:100) and Aryl Hydrocarbon Receptor (AhR; Santa Cruz sc-8089; used at 1:500). Commercially available, species-specific biotinylated secondary antibodies were used per the manufacturer's recommendation. All slides were viewed using an Olympus BX51 microscope system and images captured using an Olympus DP71 digital camera.
TUNEL Staining
In addition to immunostaining for cleaved caspase-3, apoptosis was evaluated by detection of DNA fragmentation using TUNEL assay as previously described [35]. Briefly, a commercially available kit (DeadEnd Colorimetric TUNEL System; Promega) was used according to manufacturer's instructions. The assay involves identification of nicks in the DNA, which are identified by terminal deoxynucleotidyl transferase.
Testicular PGE 2 Extraction and Analysis by ELISA
Intracellular PGs from whole testis were extracted as described by others [36,37]. Fresh whole testis samples were homogenized in ice-cold Tris-buffer (pH 7.4) containing indomethacin (100 mM) using a polytron homogenizer on ice. The homogenate was centrifuged at 50,0006g for 1 h at 4uC using a floor model Sorvall Discovery M150 ultracentrifuge. Supernatants were collected and the PGE 2 concentration analyzed using a commercially available ELISA kit (Cayman Chemicals) according to the manufacturer's instructions. Intra-and interassay coefficients of variation (CVs) were determined at multiple time points on the standard curve as described by the manufacturer in each assay and compared between assays. For the PGE 2 assay, the sensitivity or minimal detection limit was 7.8 pg/ml; intra-assay CV was 4.2% and interassay CV 12.4%.
Radioimmunoassay of Free Testosterone
Serum samples were analyzed for testosterone concentrations by RIA in the Center for Research in Reproduction Ligand Assay and Analysis Core at the University of Virginia. The sensitivity of testosterone assay was 5 ng/dL and the intra-and inter-assay coefficients of variation were 4.4 and 6.4%, respectively.
Computer-Assisted Assessment of AhR Staining Intensity
AhR intensity was semi-quantitatively measured using Meta-Morph Microscopy Automation & Image Analysis Software. Briefly, the maximum color threshold for AhR staining was determined across all slides, then individual sperm were analyzed and the integrated intensity of the region was configured and measured.
Assessment of Leukocyte Infiltrates
After staining with F4/80 as described above, macrophage infiltrates within the testes were enumerated by two individuals (KBT, KBY) in five high power fields (HPF) per group (4006 magnification) using a method similar to that described by others for assessment of immune cell populations in tumors [38]. Fields were selected after low power scanning to identify the most highly stained areas on each slide. The same 5 fields from each group were enumerated by both observers and the resulting 10 numbers were averaged in order to semi-quantitatively determine the number of macrophages present within control and F1/F3 mice.
Semi-quantitative Assessment of TUNEL and PDGH staining
For calculation of H-score, a minimum of 5 slides per sample were selected at random and 2 fields from each slide photographed at 6200 magnification. Staining intensity within spermatocytes was independently scored as 0, 1, 2 or 3, corresponding to the presence of negative, weak, intermediate or intense staining, respectively. The same fields from each group were enumerated by two observers and the average of percent positive cells at each level of intensity was determined, and the H-score calculated based on the formula: H-score = (% of cells stained at level 1 intensity 6 1)+ (% of cells stained at level 2 intensity 6 2) + (% of cells stained at level 3 intensity 63). In this manner, an H-score of between 0 and 300 is obtained where a score of 300 is equivalent to 100% of cells exhibiting maximum staining.
Statistical Analysis
Analyses were performed with GraphPad Prismß5 software and presented as mean6SEM. The statistical difference between samples was determined using one-way analysis of variance (ANOVA) followed by Tukey's post-hoc test. P,0.05 were considered significant.
Results
TCDD Exposure is Associated with Reduced Fertility and Preterm Birth
We previously reported that adult male mice with a history of developmental TCDD exposure exhibited reduced fertility and conferred an increased risk of delivering preterm to their control mating partners [20]. Extending these earlier observations, herein we demonstrate that male mice with either a direct (F1-F2) or indirect (F3 via the paternal germline) TCDD exposure exhibit a significant reduction in both fertility (p#0.001) and gestation length (p#0.0001) compared to control mice ( Table 1). Specifically, approximately 50% of all F1-F3 males were unable to impregnate their mating partner while those partners that became pregnant frequently (33-38%) experienced spontaneous delivery prior to E19.0 ( Table 1). In contrast to mice with a toxicant exposure history, infertility was rare in control mating pairs and PTB was never observed among these animals (Table 1). Similarly, descendants of control mating pairs did not exhibit either infertility or PTB (data not shown).
Assessment of Sperm Number and Morphology
Based on the transgenerational observations of both infertility and PTB described above, we next determined whether reduced sperm quantity and/or quality was a factor in the infertility rate of toxicant-exposed males and/or the poor pregnancy outcomes in their unexposed mating partners. The overall success rate for control mating pairs was 95% ( Table 1) and control males in our study exhibited normal sperm numbers (Figure 2) with the percent of morphologically normal sperm within the range reported by others for adult C57bl/6 mice [39,40] (Figure 3). Regardless of exposure (or lack of exposure), tail defects were the most common morphological abnormality. In contrast to control males, the pregnancy success rate and sperm number were significantly reduced in F1 males (Table 1 and Figure 2). Interestingly, the average sperm number for F2 and F3 males was similar to control males; however, there was considerable variation in the sperm concentration in individual mice within these groups ( Figure 2). Although the percent of morphologically normal sperm was lower in F2 and F3 males compared to F1 males, the fertility rate was similar across all exposure groups ( Table 1; Figure 3). The average gestation length of pregnant control females mated to F1-F3 males increased incrementally with each successive paternal generation; however this improvement did not reach significance ( Table 1).
AhR Expression in Spermatocytes
Although the AhR is expressed throughout the male reproductive tract and appears necessary for normal sperm development, spermatocytes themselves normally express only low levels of this protein [40]. Relevant to the current study, increased spermatocyte AhR expression has been linked to infertility in humans [10] and toxicant exposure in adult rats [40]. We therefore subjected caudal sperm smears to immunolocalization of the AhR. In agreement with data described by Hansen et al [40], sperm from control animals exhibited minimal AhR expression, which was localized to the acrosome and mid-piece ( Figure 4A). However, sperm obtained from mice with a direct (F1-F2) or indirect (F3) TCDD exposure history had significantly (p#0.001) increased immunolocalization of AhR compared to control cells (Figure 4B-D).
TCDD Exposure is Associated with a Hyper-Inflammatory Testicular Phenotype
We have previously demonstrated a TCDD-associated loss of prostaglandin dehydrogenase (PGDH) within the placenta arising from F1 males [25]. Since PGDH is the enzyme which catabolizes PGE 2 to its inactive form, reduced expression of this enzyme is associated with increased local inflammation [41]. Therefore, we next examined the expression of PGDH and PGE 2 within the testis of control and toxicant exposed male mice. Immunohistochemical localization of PGDH expression revealed a near absence of this protein in testis obtained from F1 and F2 males compared to unexposed animals ( Figure 5A-C). Testes from F3 males exhibited only minimal immunolocalization of PGDH ( Figure 5D). Quantitative assessment of PGE 2 in whole testicular samples of testis of control animals revealed a low level of this enzyme in all control animals while testes from mice with a history of TCDD exposure exhibited variable PGE 2 levels ( Figure 6). Although changes in PGE 2 levels among toxicant exposed mice did not reach statistical significance, a clear trend of increased PGE 2 production was observed and correlated with reduced expression of PGDH. Additionally, among individual animals, mice with the lowest sperm number exhibited the highest level of testicular PGE 2 . Altered prostaglandin catabolism in mice with a history of toxicant exposure suggests that regulation of inflammatory processes within the testis is also disrupted in these animals. Since inflammatory conditions of the testis have previously been associated with apoptosis of germ cells leading to subfertility/ infertility (reviewed by [42]), we conducted TUNEL staining and immunolocalization of cleaved caspase-3 in the testis of all animals. As shown in Figure 7, TUNEL staining was minimal in control testis, while staining was prominent in tissues from F1-F3 males. Caspase-3 immunohistochemistry revealed a similar pattern of staining (data not shown), demonstrating that the reduced sperm number in these animals correlates with increased apoptotic activity. Since testicular inflammation has also previously been associated with impaired steroidogenesis in men [43], we next examined serum levels of testosterone in our animals. As shown in Figure 8, compared to control animals, circulating levels of testosterone were consistently lower in all mice with a direct (F1-F2) or indirect (F3) TCDD exposure, although the decrease did not reach statistical significance.
Testicular Response to a Systemic Inflammatory Challenge
In our previously published study of pregnant female mice with a history of developmental TCDD exposure (F1 females), we observed a doubling of the PTB rate in the presence of a systemic viral infection (parvovirus) and a 100% PTB rate in virus-free females following an inflammatory challenge with a single lowdose (200 ug/kg) peritoneal injection of LPS [18]. Control animals in this study never exhibited PTB, despite identical viral and bacterial challenges, suggesting that F1 females exhibit a heightened sensitivity to an inflammatory challenge. Significantly, this hyper-inflammatory phenotype was also present in F3 females, strongly suggesting germline epigenetic changes had occurred. Thus, in the current study, we examined whether alterations in sensitivity to infection-related inflammatory signals also affect the preconception testicular physiology of the F1 males. Equally important, we examined the same parameters in indirectly exposed F3 males in order to determine if a hyper-inflammatory testicular phenotype could be transmitted across multiple generations. Since altered macrophage numbers have specifically been shown to be associated with poor testicular health (reviewed by [44]), we used immunolocalization of F4/80 to examine the number of macrophages present in the testes of control, F1 and F3 males. As shown in Figure 9A, under non-stimulatory conditions, testicular immune cells are rare in control males and limited to the interstitial space containing the leydig cells. As expected, males with either a direct or indirect history of TCDD exposure exhibit enhanced numbers of resident macrophages compared to control animals (p,0.001); however, unexpectedly, F1 males, with a direct TCDD exposure, exhibited fewer resident macrophages compared to F3 males (with only an indirect TCDD exposure) ( Figure 9B-D). Following an inflammatory challenge mediated by a single, low dose peritoneal injection of LPS, macrophages were present in all animals; however, semi-quantitative assessment revealed the numbers of macrophages present was significantly greater (p#
Discussion
As a consequence of industrialization, human populations are exposed to an astonishing array of natural and synthetic chemicals, many of which have the biological potential to negatively impact our reproductive health. In addition to industrial sources of TCDD and dioxin-like compounds, cigarette smoke, automobile exhaust and even grilled meats can add other AhR-binding toxicants, including benzo(a)pryrene, to our daily exposome [45]. It is difficult to accurately determine the combinatorial reproductive effects of the numerous environmental agents we are exposed to at various stages of our lives; however, studies in experimental models clearly demonstrate the ability of various, individual endocrine disrupting toxicants to negatively affect fertility [18,26,46,47]. Epidemiologic data of accidentally exposed human populations demonstrates that fertility in humans can be similarly, adversely affected [48,49].
Relevant to the current study, infertility is common among humans, with an estimated incidence of 10% in reproductive age women [50] and a 12% occurrence among men [51]. Although multiple studies have indicated a decline in human sperm counts in recent decades (ie, [52,53]), the heavy reliance of these studies on patients attending fertility clinics left open the possibility that the data was not representative of the general public [54]. However, a recent report from the European Union examining healthy young men has largely eliminated any doubt that sperm counts are declining in human populations [55]. Although the question remains regarding a potential relationship between declining sperm numbers and subsequent health of progeny in humans, several recent animal studies demonstrated that early life exposures to TCDD not only negatively affected the F1 offspring's individual fertility, but the health and reproductive capacity of future offspring as well [7,18,26].
The specific role(s) that toxicant exposure during development versus adulthood plays in either male or female reproductive health remains speculative. Nevertheless, a recent epidemiology study of women living within 4 kilometers of a municipal solid waste incinerator identified a significant increased risk for PTB [56], suggesting exposure to airborne toxicants adversely affected pregnancy outcomes. Presumably, the male partners of the women in this study also resided near the incinerator; however, the potential role of his exposure on pregnancy outcomes was not considered. Furthermore, while numerous epidemiologic studies support the relevance of a man's developmental exposure history to his adult sperm quality [57][58][59], these studies did not additionally assess the partner's pregnancy outcome. However, our murine studies revealed that early life TCDD exposure of male mice impacts inflammatory signaling at the maternal-fetal interface during late pregnancy, resulting in an elevated risk of spontaneous PTB [18,20,25]. To our knowledge, our studies were the first to identify a previous, developmental paternal TCDD exposure to a subsequent enhanced risk of PTB in his control mating partner. Further studies revealed inflammatory signaling within the largely paternally-derived placenta as a primary contributor to the paternal influence on PTB in our model [20,25].
Since the contribution of the male to the placenta of pregnancy is delivered via the sperm, the current study was designed to examine whether adverse pregnancy outcomes in unexposed female mice could be traced to the preconception health of the testes in which the sperm developed. To this end, we utilized adult control males and adult males which were exposed to TCDD in utero on E15.5 (F1 males) in order to assess sperm number and morphology relative to the testicular environment and his partner's pregnancy outcome. Additionally, we examined two generations of the F1 male offspring in order to determine if either multi-generational or transgenerational effects occur following developmental TCDD exposure after sex determination. As shown in Table 1, we confirmed our previous studies that F1 male mice both exhibit infertility and, when fertile, present their unexposed female partners with a risk for PTB. Herein, we additionally examined the fertility and pregnancy outcomes of F2 and F3 males. It is interesting to note that F2 males exhibited the poorest reproductive health compared to other TCDD exposed groups. These data are consistent with our published observations in F2 females [18] and likely reflects an increased sensitivity of germ cells residing within the developing testes of the F1 fetus to direct TCDD exposure. Additionally, germ cells destined to become the F2 generation are also exposed to the secondary influence of the inflammatory testicular environment of the adult F1 males, which may further negatively impact the reproductive health of the adult F2 males.
Our current study additionally extends our previous observations by demonstrating a transgenerational, male germline-derived phenotype in the F3 generation, which included both sub-fertility and transmission of PTB risk ( Table 1). Incremental improvements in fertility and gestation length were noted in each subsequent generation of mice examined, but these improvements did not reach significance. Reduced fertility and PTB risk likely persisted in F3 mice due to both the continued presence of significant morphological defects as well as biochemical abnormalities, such as the alteration in AhR expression identified herein ( Figure 4). Our data is consistent with studies from others indicating heightened expression of spermatocyte AhR in association with infertility in men [10] and enhanced AhR expression in the spermatocytes of rats exposed in vivo to another environmental endocrine disruptor, BaP [60].
The testicular environment clearly impacts sperm development; therefore, in addition to examination of sperm, we also examined the expression of selected inflammatory biomarkers within the testis of control males and males with a direct or indirect toxicant exposure history. We found a near absence of PGDH expression in males with a history of toxicant exposure which correlated with a non-significant trend of increased PGE 2 expression ( Figures 5 and 6). These changes were associated with an increase in germ cell apoptosis (Figure 7), which was consistent with reduced sperm density in toxicant-exposed mice ( Figure 2). Compared to unexposed mice, adult males with a direct (F1-F2) or indirect (F3) exposure also exhibited a non-significant reduction in serum levels of testosterone (Figure 8), a recognized consequence of chronic inflammation in men [43].
Finally, in our previous studies we demonstrated a transgenerational infertility phenotype in female mice of maternal lineage associated with a hyper-sensitivity to LPS-mediated PTB [18]. In Figure 9. Assessment of macrophage number in adult murine testis of control, F1 and F3 males. The presence of testicular macrophages was assessed in the absence (A-D) and presence (E-H) of a low dose LPS challenge. Macrophages were rare in control males in the absence of LPS (Panel A), but were commonly found following the LPS challenge (Panel E). In contrast, macrophages were abundant in F1 males exposed only to PBS (Panel B) and were further increased by exposure to the LPS challenge (Panel F). Within the testis of F3 males, macrophages were abundant regardless of whether or not the mice had been challenged with LPS (Panels C and G). Semi-quantitative analysis of macrophage infiltrates is shown in Panels D and H. Results are representative of at least 6 animals per group and from $3 more litters/group. Inset: Primary antibody omitted using the same tissue shown in Panel C. Original magnification, 1000x. *p,0.05; **p,0.01 ***p,0.001. doi:10.1371/journal.pone.0105084.g009 the current study we found a similar transgenerational impact of development TCDD exposure in male mice, inherited through the paternal germ line. In addition to the paternal derived risk for PTB in control mating partners (Table 1), our current study also demonstrated that F1 and F3 male mice exhibit a hyperresponsiveness to an inflammatory challenge with LPS, most likely as a consequence of increased numbers of resident macrophages (Figure 9). While an acute challenge with LPS promoted the inflammatory testicular response regardless of the exposure history, F1 and F3 males exhibited elevated levels of resident macrophages and poor sperm morphology even in the absence of LPS challenge. Thus, while the ''baseline'' inflammatory and fertility profile in F1 and F3 animals was variable, all animals with a history of TCDD exposure exhibited a phenotype poised to exhibit an exaggerated inflammatory response following an exogenous challenge. These results are intriguing, as they raise the possibility that humans may also exhibit a varying ability to appropriately respond to common inflammatory/infectious agents which can have minimal or devastating effects depending on an individual's lifestyle and exposure history. Thus, individuals with a chronic hyper-inflammatory testicular phenotype would be at the greatest risk of reduced sperm quality and infertility. Furthermore, fertile individuals with an inflammatory testicular phenotype may be at greater risk of producing a hyper-inflammatory placental phenotype, thereby leading to adverse pregnancy outcomes in his partner.
Although the translation of our murine model to the human condition remains to be demonstrated, reducing male-derived PTB risk receives little or no attention during common fertility procedures such as intrauterine sperm injection (IUI) or intracytoplasmic sperm injection (ICSI). Nevertheless, the findings of our murine study clearly demonstrate that the testicular health of the male is fully capable of not only compromising his fertility but also the timing of birth in his female partner. Stated another way, our data suggest that the preconception health of the father may be indicative of the risk of PTB in his pregnant partner. If our studies hold true in men, intervention in the paternal partner designed to reduce preconception testicular inflammation may be a valuable tool to reduce the overall incidence of PTB in women. Equally important, our data suggests that optimizing the preconception health of the sperm may be particularly valuable as an adjunct therapy prior to ICSI or IUI.
Figure 1 .
1Light microscopy of normal and abnormal murine spermatozoa. All spermatozoa were classified by standard morphologic assessment. Normal spermatozoan (A); common tail defects (B-E); acrosome defect (F); misshapen head (G); mid-piece defects (H, I) and decapitated sperm (J). Magnification, 1000x. doi:10.1371/journal.pone.0105084.g001
Figure 2 .
2Analysis of sperm concentration in control and toxicant-exposed mice. Box plot of sperm number/mg caudal weight. Center lines indicate the median number. Columns and vertical bars indicate the 25-75 percentiles and 10-90 percentiles, respectively. Data from multiple animals per group is presented (Control, N = 7; F1, N = 6; F2, N = 8; F3, N = 13). One additional F1 male was azoospermic and was excluded from the data presented. *p = 0.001. doi:10.1371/journal.pone.0105084.g002
Figure 3 .
3Analysis of sperm morphology of control C57bl/6 mice, F1 males and two generations of descendants. Unexposed control mice exhibited the highest number of morphologically normal sperm (53%). There was a significant reduction in the number of morphologically normal sperm in males with a direct toxicant-exposure history (F1: 36%; p = 0.01 and F2: 20%; p = 0.0001, compared to control). Mice with only an indirect exposure also exhibited significant reductions in morphologically normal sperm (F3: 31%; p = 0.0001, compared to control). Tail defects were the most common abnormality in all groups, while spermatocytes from mice with a history of TCDD exposure (direct or indirect) exhibited a slight increase in head, mid-piece and acrosome defects compared to control mice. A minimum of 200 cells were analyzed per animal. N$6 for all groups. doi:10.1371/journal.pone.0105084.g003
Figure 4 .
4Immunolocalization of AhR protein in caudal sperm smears from adult control, F1, F2 and F3 males. AhR protein expression was minimal in control animals (A), but this protein was highly expressed in F1 (B) F2 (C) and F3 (D) sperm. Computer assisted AhR intensity (E) was determined using a minimum of 10 individual sperm from each of 6 animals per group. Original magnification, 1000x. Inset: Primary antibody omitted using sperm from a control male. Compared to control, *p = 0.001; **p = 0.0006. doi:10.1371/journal.pone.0105084.g004
Figure 5 .
5Immunolocalization of PGDH in adult testis of control, F1, F2 and F3 males. PGDH was abundant in testis from control males (A), but markedly reduced in F1 (B) and F2 (C) males. PGDH immunolocalization remained low in the testis of F3 males (D). Semi-quantitative analysis of PGDH staining is shown in Panel E. Compared to control samples, p,0.001 for all toxicant exposed mice. Results are representative of at least 6 animals per group and from $3 more litters/group. Original magnification, 400x. Inset: Primary antibody omitted using the same tissue shown in Panel D. doi:10.1371/journal.pone.0105084.g005
Figure 6 .
6ELISA of PGE 2 in whole testis of adult control, F1, F2 and F3 males. Only low levels of PGE 2 were detected in the testis of all control animals. In mice with a toxicant exposure history, there was a clear trend toward increased expression of PGE 2 ; however, production of this prostaglandin was highly variable and did not reach significance (compared to control: F1, p = 0.07; F2, p = 0.10; F3, p = 0.16). N = 6 for all groups. doi:10.1371/journal.pone.0105084.g006 0.05) in mice with a TCDD exposure background compared to control testes (Figure 9E-H).
Figure 7 .
7TUNEL staining in adult testis of control, F1, F2 and F3 males. TUNEL staining was minimal in control testis (A), but prominent in tissues from F1, F2 and F3 males (B-D). Semi-quantitative analysis of TUNEL staining is shown in E. Compared to control samples, p,0.01 for all toxicant exposed mice. Results are representative of at least 6 animals per group and from $3 more litters/group. Original magnification, 200x. Inset: Primary antibody omitted using the same tissue shown in Panel D. doi:10.1371/journal.pone.0105084.g007
Figure 8 .
8Radioimmunoassay of Free Testosterone. Free testosterone was measured in serum from control (N = 10), F1 (N = 14), F2 (N = 6) and F3 (N = 10) males. All samples were examined in duplicate and the results are presented as the mean6standard deviation. Levels of testosterone in experimental groups (F1-F3) was lower compared to control animals, but changes did not reach significance. doi:10.1371/journal.pone.0105084.g008
Table 1 .
1Impact of Direct (F1-F2) or Indirect (F3) Paternal TCDD Exposure on Pregnancy.MALE EXPOSURE
PREGNANCY RATE*
LENGTH
OF
GESTATION
(days)
PT PT
FT
FT FT
FT
Avg
p**
17.5 18.5
19.0
19.5 20.0
20.5
p**
Control
38/40 (95%)
5% 90%
5%
20
TCDD
F1
29/62 (47%)
,0.001
14% 24%
62%
18.6
,0.0001
F2
12/25 (48%)
,0.001
33%
67%
18.8
,0.0001
F3
14/28 (50%)
,0.001
7% 28%
28%
28% 7%
19.0
,0.0001
*Mice achieving 3 vaginal plugs, but no pregnancy, were considered infertile.
**compared to control mating pairs.
PT = preterm; FT = Full-term.
doi:10.1371/journal.pone.0105084.t001
PLOS ONE | www.plosone.org
August 2014 | Volume 9 | Issue 8 | e105084
AcknowledgmentsWe gratefully acknowledge the technical assistance of Dana R Glore, MLI, Melinda E. McConaha, MS and Juan Gnecco, BS. We also acknowledge resources and assistance provided by VUMC Cell Imaging Shared Resource, The Vanderbilt Brain Institute Equipment Resource Core and the Vanderbilt Histology Core Laboratory. We additionally acknowledge the University of Virginia Center for Research in Reproduction Ligand Assay and Analysis Core which is supported by the Eunice Kennedy Shriver NICHD/NIH (SCCPIR) Grant U54-HD28934.Author Contributions
Role of exposure to environmental chemicals in the developmental basis of reproductive disease and dysfunction. J J Heindel, Semin Reprod Med. 24Heindel JJ (2006) Role of exposure to environmental chemicals in the developmental basis of reproductive disease and dysfunction. Semin Reprod Med 24: 168-177.
Environmentally induced epigenetic transgenerational inheritance of phenotype and disease. C Guerrero-Bosagna, M K Skinner, Mol Cell Endocrinol. 354Guerrero-Bosagna C, Skinner MK (2012) Environmentally induced epigenetic transgenerational inheritance of phenotype and disease. Mol Cell Endocrinol 354: 3-8.
Diethylstilboestrol-a long-term legacy. R M Harris, R H Waring, Maturitas. 72Harris RM, Waring RH (2012) Diethylstilboestrol-a long-term legacy. Maturitas 72: 108-112.
A replacement-first approach to toxicity testing is necessary to successfully reauthorize TSCA. P A Locke, D B MyersJr, ALTEX. 28Locke PA, Myers DB Jr (2011) A replacement-first approach to toxicity testing is necessary to successfully reauthorize TSCA. ALTEX 28: 266-272.
In the arc of history: AIHA and the movement to reform the Toxic Substances Control Act. M P Wilson, J Occup Environ Hyg. 9Wilson MP (2012) In the arc of history: AIHA and the movement to reform the Toxic Substances Control Act. J Occup Environ Hyg 9: D87-94.
Exposure to toxic environmental agents. Acog, Fertil Steril. 100ACOG (2013) Exposure to toxic environmental agents. Fertil Steril 100: 931- 934.
The Role of Endocrine Disruptors in the Epigenetics of Reproductive Disease and Dysfunction: Potential Relevance to Humans. K L Bruner-Tran, D Resuehr, T Ding, J A Lucas, K G Osteen, Curr Obstet Gynecol. 1Bruner-Tran KL, Resuehr D, Ding T, Lucas JA, Osteen KG (2012) The Role of Endocrine Disruptors in the Epigenetics of Reproductive Disease and Dysfunction: Potential Relevance to Humans. Curr Obstet Gynecol Rep 1: 116-123.
Use of natural AhR ligands as potential therapeutic modalities against inflammatory disorders. P B Busbee, M Rouse, M Nagarkatti, P S Nagarkatti, Nutr Rev. 71Busbee PB, Rouse M, Nagarkatti M, Nagarkatti PS (2013) Use of natural AhR ligands as potential therapeutic modalities against inflammatory disorders. Nutr Rev 71: 353-369.
New insights into the aryl hydrocarbon receptor as a modulator of host responses to infection. B P Lawrence, B A Vorderstrasse, Semin Immunopathol. 35Lawrence BP, Vorderstrasse BA (2013) New insights into the aryl hydrocarbon receptor as a modulator of host responses to infection. Semin Immunopathol 35: 615-626.
Association between testicular Aryl hydrocarbon Receptor levels and idiopathic male infertility: a case-control study in Iran. S A Bidgoli, M Karimi, Z Asami, H Baher, Djamali Zavarhei, M , Sci Total Environ. 409Bidgoli SA, Karimi M, Asami Z, Baher H, Djamali Zavarhei M (2011) Association between testicular Aryl hydrocarbon Receptor levels and idiopathic male infertility: a case-control study in Iran. Sci Total Environ 409: 3267-3273.
Estradiol regulates aryl hydrocarbon receptor expression in the rat uterus. G Kretzschmar, A Papke, O Zierau, F J Moller, S Medjakovic, Mol Cell Endocrinol. 321Kretzschmar G, Papke A, Zierau O, Moller FJ, Medjakovic S, et al. (2010) Estradiol regulates aryl hydrocarbon receptor expression in the rat uterus. Mol Cell Endocrinol 321: 253-257.
Responsiveness of the adult male rat reproductive tract to 2,3,7,8-tetrachlorodibenzo-p-dioxin exposure: Ah receptor and ARNT expression, CYP1A1 induction, and Ah receptor downregulation. B L Roman, R S Pollenz, R E Peterson, Toxicol Appl Pharmacol. 150Roman BL, Pollenz RS, Peterson RE (1998) Responsiveness of the adult male rat reproductive tract to 2,3,7,8-tetrachlorodibenzo-p-dioxin exposure: Ah receptor and ARNT expression, CYP1A1 induction, and Ah receptor down- regulation. Toxicol Appl Pharmacol 150: 228-239.
Developmental exposure of mice to TCDD elicits a similar uterine phenotype in adult animals as observed in women with endometriosis. T Nayyar, K L Bruner-Tran, D Piestrzeniewicz-Ulanska, K G Osteen, Reprod Toxicol. 23Nayyar T, Bruner-Tran KL, Piestrzeniewicz-Ulanska D, Osteen KG (2007) Developmental exposure of mice to TCDD elicits a similar uterine phenotype in adult animals as observed in women with endometriosis. Reprod Toxicol 23: 326-336.
Environmental dioxins and endometriosis. S Rier, W G Foster, Toxicol Sci. 70Rier S, Foster WG (2002) Environmental dioxins and endometriosis. Toxicol Sci 70: 161-170.
Polychlorinated biphenyls (PCBs): environmental impact, biochemical and toxic responses, and implications for risk assessment. S H Safe, Crit Rev Toxicol. 24Safe SH (1994) Polychlorinated biphenyls (PCBs): environmental impact, biochemical and toxic responses, and implications for risk assessment. Crit Rev Toxicol 24: 87-149.
Disruption of aryl hydrocarbon receptor (AhR) induces regression of the seminal vesicle in aged male mice. T Baba, Y Shima, A Owaki, J Mimura, M Oshima, Sex Dev. 2Baba T, Shima Y, Owaki A, Mimura J, Oshima M, et al. (2008) Disruption of aryl hydrocarbon receptor (AhR) induces regression of the seminal vesicle in aged male mice. Sex Dev 2: 1-11.
Adverse reproductive outcomes in the transgenic Ah receptor-deficient mouse. B D Abbott, J E Schmid, J A Pitt, A R Buckalew, C R Wood, Toxicol Appl Pharmacol. 155Abbott BD, Schmid JE, Pitt JA, Buckalew AR, Wood CR, et al. (1999) Adverse reproductive outcomes in the transgenic Ah receptor-deficient mouse. Toxicol Appl Pharmacol 155: 62-70.
Developmental exposure to TCDD reduces fertility and negatively affects pregnancy outcomes across multiple generations. K L Bruner-Tran, K G Osteen, Reprod Toxicol. 31Bruner-Tran KL, Osteen KG (2011) Developmental exposure to TCDD reduces fertility and negatively affects pregnancy outcomes across multiple generations. Reprod Toxicol 31: 344-350.
The male reproductive system and its susceptibility to endocrine disrupting chemicals. S Pflieger-Bruss, H C Schuppe, W B Schill, Andrologia. 36Pflieger-Bruss S, Schuppe HC, Schill WB (2004) The male reproductive system and its susceptibility to endocrine disrupting chemicals. Andrologia 36: 337-345.
Developmental dioxin exposure of either parent is associated with an increased risk of preterm birth in adult mice. T Ding, M Mcconaha, K L Boyd, K G Osteen, K L Bruner-Tran, Reprod Toxicol. 31Ding T, McConaha M, Boyd KL, Osteen KG, Bruner-Tran KL (2011) Developmental dioxin exposure of either parent is associated with an increased risk of preterm birth in adult mice. Reprod Toxicol 31: 351-358.
Role of paternal and maternal genomes in mouse development. S C Barton, M A Surani, M L Norris, Nature. 311Barton SC, Surani MA, Norris ML (1984) Role of paternal and maternal genomes in mouse development. Nature 311: 374-376.
Androgenetic origin of hydatidiform mole. T Kajii, K Ohama, Nature. 268Kajii T, Ohama K (1977) Androgenetic origin of hydatidiform mole. Nature 268: 633-634.
Paternally expressed genes predominate in the placenta. X Wang, D C Miller, R Harman, D F Antczak, A G Clark, Proc Natl Acad Sci U S A. 110Wang X, Miller DC, Harman R, Antczak DF, Clark AG (2013) Paternally expressed genes predominate in the placenta. Proc Natl Acad Sci U S A 110: 10705-10710.
The association between intrauterine inflammation and spontaneous vaginal delivery at term: a cross-sectional study. M L Houben, P G Nikkels, G M Van Bleek, G H Visser, M M Rovers, PLoS One. 46572Houben ML, Nikkels PG, van Bleek GM, Visser GH, Rovers MM, et al. (2009) The association between intrauterine inflammation and spontaneous vaginal delivery at term: a cross-sectional study. PLoS One 4: e6572.
Preconception omega-3 fatty acid supplementation of adult male mice with a history of developmental 2,3,7,8-tetrachlorodibenzo-p-dioxin exposure prevents preterm birth in unexposed female partners. M E Mcconaha, T Ding, J A Lucas, J A Arosh, K G Osteen, Reproduction. 142McConaha ME, Ding T, Lucas JA, Arosh JA, Osteen KG, et al. (2011) Preconception omega-3 fatty acid supplementation of adult male mice with a history of developmental 2,3,7,8-tetrachlorodibenzo-p-dioxin exposure prevents preterm birth in unexposed female partners. Reproduction 142: 235-241.
Dioxin (TCDD) induces epigenetic transgenerational inheritance of adult onset disease and sperm epimutations. M Manikkam, R Tracey, C Guerrero-Bosagna, M K Skinner, PLoS One. 746249Manikkam M, Tracey R, Guerrero-Bosagna C, Skinner MK (2012) Dioxin (TCDD) induces epigenetic transgenerational inheritance of adult onset disease and sperm epimutations. PLoS One 7: e46249.
Pesticide and insect repellent mixture (permethrin and DEET) induces epigenetic transgenerational inheritance of disease and sperm epimutations. M Manikkam, R Tracey, C Guerrero-Bosagna, M K Skinner, Reprod Toxicol. 34Manikkam M, Tracey R, Guerrero-Bosagna C, Skinner MK (2012) Pesticide and insect repellent mixture (permethrin and DEET) induces epigenetic transgenerational inheritance of disease and sperm epimutations. Reprod Toxicol 34: 708-719.
The use of c-src knockout mice for the identification of the main toxic signaling pathway of TCDD to induce wasting syndrome. C F Vogel, Y Zhao, P Wong, N F Young, F Matsumura, J Biochem Mol Toxicol. 17Vogel CF, Zhao Y, Wong P, Young NF, Matsumura F (2003) The use of c-src knockout mice for the identification of the main toxic signaling pathway of TCDD to induce wasting syndrome. J Biochem Mol Toxicol 17: 305-315.
Biology of the laboratory mouse. Roscoe B Jackson Memorial Laboratory, E L Green, Dover Publications706New YorkRoscoe B Jackson Memorial Laboratory, Green EL (1975) Biology of the laboratory mouse. New York: Dover Publications. 706 p.
Preterm birth without progesterone withdrawal in 15-hydroxyprostaglandin dehydrogenase hypomorphic mice. J D Roizen, M Asada, M Tong, H H Tai, L J Muglia, Mol Endocrinol. 22Roizen JD, Asada M, Tong M, Tai HH, Muglia LJ (2008) Preterm birth without progesterone withdrawal in 15-hydroxyprostaglandin dehydrogenase hypomor- phic mice. Mol Endocrinol 22: 105-112.
Loss of cannabinoid receptor CB1 induces preterm birth. H Wang, H Xie, S K Dey, PLoS One. 33320Wang H, Xie H, Dey SK (2008) Loss of cannabinoid receptor CB1 induces preterm birth. PLoS One 3: e3320.
Epididymal Sperm Counts. Y Wang, 16.16.11-16.16.15Current Protocols in Toxicology. G CJohn Wiley & Sons, IncWang Y (2002) Epididymal Sperm Counts. In: G C, editor. Current Protocols in Toxicology. Hoboken, NJ: John Wiley & Sons, Inc. pp. 16.16.11-16.16.15.
Methods for evaluation of rat epididymal sperm morphology. R Filler, Male Reproductive Toxicology. Heindel JJ CRNew York, USAAcademic PressFiller R (1993) Methods for evaluation of rat epididymal sperm morphology. In: Heindel JJ CR, editor. Male Reproductive Toxicology. New York, USA: Academic Press. pp. 334-343.
Adverse effects of a clinically relevant dose of hydroxyurea used for the treatment of sickle cell disease on male fertility endpoints. K M Jones, M S Niaz, C M Brooks, S I Roberson, M P Aguinaga, Int J Environ Res Public Health. 6Jones KM, Niaz MS, Brooks CM, Roberson SI, Aguinaga MP, et al. (2009) Adverse effects of a clinically relevant dose of hydroxyurea used for the treatment of sickle cell disease on male fertility endpoints. Int J Environ Res Public Health 6: 1124-1144.
Resveratrol inhibits development of experimental endometriosis in vivo and reduces endometrial stromal cell invasiveness in vitro. K L Bruner-Tran, K G Osteen, H S Taylor, A Sokalska, K Haines, Biology of Reproduction. 84Bruner-Tran KL, Osteen KG, Taylor HS, Sokalska A, Haines K, et al. (2011) Resveratrol inhibits development of experimental endometriosis in vivo and reduces endometrial stromal cell invasiveness in vitro. Biology of Reproduction 84: 106-112.
Intraluteal prostaglandin biosynthesis and signaling are selectively directed towards PGF2alpha during luteolysis but towards PGE2 during the establishment of pregnancy in sheep. J Lee, J A Mccracken, J A Stanley, T K Nithy, S K Banu, Biology of Reproduction. 87Lee J, McCracken JA, Stanley JA, Nithy TK, Banu SK, et al. (2012) Intraluteal prostaglandin biosynthesis and signaling are selectively directed towards PGF2alpha during luteolysis but towards PGE2 during the establishment of pregnancy in sheep. Biology of Reproduction 87: 1-14.
Deficiency of either cyclooxygenase (COX)-1 or COX-2 alters epidermal differentiation and reduces mouse skin tumorigenesis. H F Tiano, C D Loftin, J Akunda, C A Lee, J Spalding, Cancer Res. 62Tiano HF, Loftin CD, Akunda J, Lee CA, Spalding J, et al. (2002) Deficiency of either cyclooxygenase (COX)-1 or COX-2 alters epidermal differentiation and reduces mouse skin tumorigenesis. Cancer Res 62: 3395-3401.
Cancertestis antigens and immunosurveillance in human cutaneous squamous cell and basal cell carcinomas. A Walter, M J Barysch, S Behnke, P Dziunycz, B Schmid, Clin Cancer Res. 16Walter A, Barysch MJ, Behnke S, Dziunycz P, Schmid B, et al. (2010) Cancer- testis antigens and immunosurveillance in human cutaneous squamous cell and basal cell carcinomas. Clin Cancer Res 16: 3562-3570.
Semen quality parameters and embryo lethality in mice deficient for Trp53 protein. A Golas, T Lech, M Janula, D Bederska, M Lenartowicz, Reprod Biol. 11Golas A, Lech T, Janula M, Bederska D, Lenartowicz M, et al. (2011) Semen quality parameters and embryo lethality in mice deficient for Trp53 protein. Reprod Biol 11: 250-263.
The aryl hydrocarbon receptor is important for proper seminiferous tubule architecture and sperm development in mice. D A Hansen, P Esakky, A Drury, L Lamb, K H Moley, Biology of Reproduction. 908Hansen DA, Esakky P, Drury A, Lamb L, Moley KH (2014) The aryl hydrocarbon receptor is important for proper seminiferous tubule architecture and sperm development in mice. Biology of Reproduction 90:8; 1-12.
Loss of 15-hydroxyprostaglandin dehydrogenase increases prostaglandin E2 in pancreatic tumors. H Pham, M Chen, A Li, J King, E Angst, Pancreas. 39Pham H, Chen M, Li A, King J, Angst E, et al. (2010) Loss of 15- hydroxyprostaglandin dehydrogenase increases prostaglandin E2 in pancreatic tumors. Pancreas 39: 332-339.
Dual role of immune cells in the testis: Protective or pathogenic for germ cells. C V Perez, M S Theas, P V Jacobo, S Jarazo-Dietrich, V A Guazzone, Spermatogenesis. 323870Perez CV, Theas MS, Jacobo PV, Jarazo-Dietrich S, Guazzone VA, et al. (2013) Dual role of immune cells in the testis: Protective or pathogenic for germ cells? Spermatogenesis 3: e23870.
Interaction of the endocrine system with inflammation: a function of energy and volume regulation. R H Straub, Arthritis Res Ther. 16203Straub RH (2014) Interaction of the endocrine system with inflammation: a function of energy and volume regulation. Arthritis Res Ther 16: 203.
Age, the environment and our reproductive future: bonking baby boomers and the future of sex. R J Aitken, Reproduction. 147Aitken RJ (2014) Age, the environment and our reproductive future: bonking baby boomers and the future of sex. Reproduction 147: S1-S11.
Endocrine disruptive actions of inhaled benzo(a)pyrene on ovarian function and fetal survival in fisher F-344 adult rats. A E Archibong, A Ramesh, F Inyang, M S Niaz, D B Hood, Reprod Toxicol. 34Archibong AE, Ramesh A, Inyang F, Niaz MS, Hood DB, et al. (2012) Endocrine disruptive actions of inhaled benzo(a)pyrene on ovarian function and fetal survival in fisher F-344 adult rats. Reprod Toxicol 34: 635-643.
Low doses of bisphenol A promote human seminoma cell proliferation by activating PKA and PKG via a membrane G-protein-coupled estrogen receptor. A Bouskine, M Nebout, F Brucker-Davis, M Benahmed, P Fenichel, Environ Health Perspect. 117Bouskine A, Nebout M, Brucker-Davis F, Benahmed M, Fenichel P (2009) Low doses of bisphenol A promote human seminoma cell proliferation by activating PKA and PKG via a membrane G-protein-coupled estrogen receptor. Environ Health Perspect 117: 1053-1058.
Hydrocarbons (jet fuel JP-8) induce epigenetic transgenerational inheritance of obesity, reproductive disease and sperm epimutations. R Tracey, M Manikkam, C Guerrero-Bosagna, M K Skinner, Reprod Toxicol. 36Tracey R, Manikkam M, Guerrero-Bosagna C, Skinner MK (2013) Hydrocar- bons (jet fuel JP-8) induce epigenetic transgenerational inheritance of obesity, reproductive disease and sperm epimutations. Reprod Toxicol 36: 104-116.
Serum dioxin concentrations and time to pregnancy. B Eskenazi, M Warner, A R Marks, S Samuels, L Needham, Epidemiology. 21Eskenazi B, Warner M, Marks AR, Samuels S, Needham L, et al. (2010) Serum dioxin concentrations and time to pregnancy. Epidemiology 21: 224-231.
Dioxin exposure, from infancy through puberty, produces endocrine disruption and affects human semen quality. P Mocarelli, P M Gerthoux, D G PattersonJr, S Milani, G Limonta, Environ Health Perspect. 116Mocarelli P, Gerthoux PM, Patterson DG Jr, Milani S, Limonta G, et al. (2008) Dioxin exposure, from infancy through puberty, produces endocrine disruption and affects human semen quality. Environ Health Perspect 116: 70-77.
Lifestyle factors and reproductive health: taking control of your fertility. R Sharma, K R Biedenharn, J M Fedor, A Agarwal, Reprod Biol Endocrinol. 1166Sharma R, Biedenharn KR, Fedor JM, Agarwal A (2013) Lifestyle factors and reproductive health: taking control of your fertility. Reprod Biol Endocrinol 11(66): 1-15.
Prevalence of infertility in the United States as estimated by the current duration approach and a traditional constructed approach. M E Thoma, A C Mclain, J F Louis, R B King, A C Trumble, Fertil Steril. 99Thoma ME, McLain AC, Louis JF, King RB, Trumble AC, et al. (2013) Prevalence of infertility in the United States as estimated by the current duration approach and a traditional constructed approach. Fertil Steril 99: 1324-1331 e1321.
Evidence for decreasing quality of semen during past 50 years. E Carlsen, A Giwercman, N Keiding, N E Skakkebaek, BMJ. 305Carlsen E, Giwercman A, Keiding N, Skakkebaek NE (1992) Evidence for decreasing quality of semen during past 50 years. BMJ 305: 609-613.
Have sperm densities declined? A reanalysis of global trend data. S H Swan, E P Elkin, L Fenster, Environ Health Perspect. 105Swan SH, Elkin EP, Fenster L (1997) Have sperm densities declined? A reanalysis of global trend data. Environ Health Perspect 105: 1228-1232.
Declining worldwide sperm counts: disproving a myth. H Fisch, Urol Clin North Am. 35Fisch H (2008) Declining worldwide sperm counts: disproving a myth. Urol Clin North Am 35: 137-146, vii.
Decline in semen concentration and morphology in a sample of 26,609 men close to general population between. M Rolland, Le Moal, J Wagner, V Royere, D De Mouzon, J , Hum Reprod. 28Rolland M, Le Moal J, Wagner V, Royere D, De Mouzon J (2013) Decline in semen concentration and morphology in a sample of 26,609 men close to general population between 1989 and 2005 in France. Hum Reprod 28: 462- 470.
Air pollution from incinerators and reproductive outcomes: a multisite study. S Candela, A Ranzi, L Bonvicini, F Baldacchini, P Marzaroli, Epidemiology. 24Candela S, Ranzi A, Bonvicini L, Baldacchini F, Marzaroli P, et al. (2013) Air pollution from incinerators and reproductive outcomes: a multisite study. Epidemiology 24: 863-870.
Perinatal exposure to low doses of dioxin can permanently impair human semen quality. P Mocarelli, P M Gerthoux, L L Needham, D G PattersonJr, G Limonta, Environ Health Perspect. 119Mocarelli P, Gerthoux PM, Needham LL, Patterson DG Jr, Limonta G, et al. (2011) Perinatal exposure to low doses of dioxin can permanently impair human semen quality. Environ Health Perspect 119: 713-718.
Is prenatal exposure to tobacco smoking a cause of poor semen quality? A follow-up study. C H Ramlau-Hansen, A M Thulstrup, L Storgaard, G Toft, J Olsen, Am J Epidemiol. 165Ramlau-Hansen CH, Thulstrup AM, Storgaard L, Toft G, Olsen J, et al. (2007) Is prenatal exposure to tobacco smoking a cause of poor semen quality? A follow-up study. Am J Epidemiol 165: 1372-1379.
Associations of in utero exposure to perfluorinated alkyl acids with human semen quality and reproductive hormones in adult men. A Vested, C H Ramlau-Hansen, S F Olsen, J P Bonde, S L Kristensen, Environ Health Perspect. 121Vested A, Ramlau-Hansen CH, Olsen SF, Bonde JP, Kristensen SL, et al. (2013) Associations of in utero exposure to perfluorinated alkyl acids with human semen quality and reproductive hormones in adult men. Environ Health Perspect 121: 453-458.
Cigarette smoke condensate induces aryl hydrocarbon receptor-dependent changes in gene expression in spermatocytes. P Esakky, D A Hansen, A M Drury, K H Moley, Reprod Toxicol. 34Esakky P, Hansen DA, Drury AM, Moley KH (2012) Cigarette smoke condensate induces aryl hydrocarbon receptor-dependent changes in gene expression in spermatocytes. Reprod Toxicol 34: 665-676.
| 1,999,986 | “A chemical pregnancy might also occur because the uterus or endometrial lining is inadequate to support full pregnancy development,” Herbert says. A chemical pregnancy from natural conception documents the ability of the sperm to fertilize an egg and early embryo attachment, or implantation. | CHEMICALS AND REPRODUCTIVE HEALTH | Effects of melamine on pregnant dams and embryo-fetal development in rats. | [Birth environmental modification: needs of mother and child in modern obstetrics]. | What would happen if an embryo was transferred into the uterus of an already pregnant woman? | Effect of an intrauterine device on the evolution of pregnancy. Experimental study in the rat | Cumulative Chemical Exposures During Pregnancy and Early Development | Congenital heart disease (CHD) is the most common class of human birth defects, with a prevalence of 0.9% of births. However, two-thirds of cases have an unknown cause, and many of these are thought to be caused by in utero exposure to environmental teratogens. Here we identify a potential teratogen causing CHD in mice: maternal iron deficiency (ID). We show that maternal ID in mice causes severe cardiovascular defects in the offspring. These defects likely arise from increased retinoic acid signalling in ID embryos. The defects can be prevented by iron administration in early pregnancy. It has also been proposed that teratogen exposure may potentiate the effects of genetic predisposition to CHD through gene-environment interaction. Here we show that maternal ID increases the severity of heart and craniofacial defects in a mouse model of Down syndrome. It will be important to understand if the effects of maternal ID seen here in mice may have clinical implications for women. | What hormone prepares the body for pregnancy? |
1,999,987 | Looking for an inexpensive dual-probe temperature data logger to use with Artisan? | If you're looking for the cheapest sensor for temp and humidity, here's your device. However it is terribly inaccurate for what I needed them for as +- 2C is a huge disparity for controlling a central air system | I'm controlling coolant temperature with a PID right now and would like to add data logging. I'm currently using a type K thermocouple.
The temperature range is in between 18 and 19 C. I'd ideally like to move the entire thing onto a microcontroller but I'm having trouble finding a thermocouple amp that has better resolution that .25 C. I need .1 C.
Can anyone recommend either a PID controller that can output temperature and on/off data or a thermocouple amp that has better resolution than .1 C?
Id really prefer to use an amp and have a software PID on an Arduino or Raspberry Pi but any suggestions are greatly appreciated.
Edit: Only really been able to find the MAX31855 as far as thermocouple amps go. | It works well for monitoring food. However, I assumed that both probes could be used at once, one for food and one for ambient temperature in the smoker. It can't. You basically have a spare. Only one probe can be used at a time.
It does that part well, but not what I was looking for. | Very economically priced indoor/outdoor thermometer that does the job as described. | A computer-adjustable laser diode temperature control system yielding +or-2 mK temperature stability is described. An integrated circuit temperature sensor and a Peltier heater/cooler are used as the basis of this arrangement. Rather than a conventional bridge, a 16-bit A/D converter is incorporated to determine the temperature to high accuracy. The system is designed primarily to generate rapid temperature scans but is also capable of maintaining a set point temperature for long periods. | Commercially available silicon diodes are suitable as temperature sensors over a wide range of temperature. Despite their robustness, abundance and very low cost, they are seldom used in high school or junior undergraduate laboratories as temperature sensors. Here we describe a simple circuit based on an inexpensive quad operational amplifier that permits a direct reading temperature instrument to be constructed using silicon diodes, thereby encouraging their use in introductory thermal experiments. | Our server room is quite small, about 2 x 4 m max. Intermittently the air con will go on timer mode and turn off and I'm not sure why (could be that it needs a clean). The current temperature monitor is like 20 years old, and I need one that has WiFi capabilities / can send notifications to a phone or can be configured to do so with a bit of programming. Does anyone have a suggestion for a temperature monitor/sensor that would suit my need? | The key features and interface of the new generation digital temperature sensors were introduced. Meanwhile, some technical issues of the digital temperature sensor in the application of distributed temperature measuring system, such as fieldbus and data communication network, were described. The system was used in practice. | 1,999,987 | This is not my auction, so I hope this is allowed... just thought others might be interested.
According to this old Artisan page one of the many Dual Channel Temperature Data Loggers compatible with Artisan is the Mastech MS6514. One benefit of that unit seems to be that it has a built-in USB to serial converter.
I hope that current versions of Artisan are still compatible with that temperature data logger, because a seller on ebay has complete kits (New) available for $44.54.
If anything I've said here needs correcting, feel free to correct! | A digital twin approach to develop a new autonous system able to operate in high temperature environments within industrial plants | Problem with "Convert to Fahrenheit" on Artisan Software | Integrated temperature controller DS56 and its application | Fiber up-taper assisted Mach-Zehnder interferometer for high sensitive temperature sensing | Temp controller for homebrewing | KISERENA DIGITAL FOOD THEMOMETER GIVES THE CORRECT TEMP | The Marley thermostat worked perfectly as a replacement. The ... | Storing apparatus for using adaptive clock on temperature change and broadcast receiving apparatus using the same |
1,999,988 | how many guy cars were used in india in 1928 | (FY 2016). With passenger transportation options ranging from 10 seaters to 74 seaters (M&HCV = LCV), Ashok Leyland is a market leader in the bus segment. In the trucks segment Ashok Leyland primarily concentrates on the 16 to 25-ton range. However, Ashok Leyland has a presence in the entire truck range, from 7.5 to 49 tons. Ashok Motors was founded in 1948 by Raghunandan Saran, He is an Indian freedom fighter from Punjab. After Independence, he was persuaded by India's first Prime Minister Nehru to invest in a modern industrial venture. Ashok Motors was incorporated in 1948 as a company | 1928 24 Hours of Le Mans put up at all the spectator access areas and the public address system now also covered all those areas. After the previous year's short entry list, the ACO was gratified to have a far healthier entry list this year. No doubt motivated by the excitement of 1927, and a prize for an overall winner, there were more cars in the large-engine classes, although Ariès was still the only French manufacturer in that category. Indeed, foreign cars outnumbered French cars for the first time, including new entries from Lagonda, Alvis and Aston Martin from Great Britain, Alfa Romeo and Itala from | Taxicab livery the executive taxi was Nissan Cedric Y31 diesel. Now they are using Toyota Camry, Toyota Alphard, Toyota Vellfire, and different models of Mercedes-Benz. In India, most taxicabs, especially those in Delhi and Mumbai, have distinctive black and yellow liveries with the bottom half painted black and upper half painted yellow. In Kolkata, most taxis are painted yellow with a blue strip in the middle (earlier in Kolkata it used to be yellow and black). However taxicabs are more common in Mumbai and Kolkata and not so much in Delhi (where autorickshaws are a more common sight). Private companies operating taxis | Taxicab livery the executive taxi was Nissan Cedric Y31 diesel. Now they are using Toyota Camry, Toyota Alphard, Toyota Vellfire, and different models of Mercedes-Benz. In India, most taxicabs, especially those in Delhi and Mumbai, have distinctive black and yellow liveries with the bottom half painted black and upper half painted yellow. In Kolkata, most taxis are painted yellow with a blue strip in the middle (earlier in Kolkata it used to be yellow and black). However taxicabs are more common in Mumbai and Kolkata and not so much in Delhi (where autorickshaws are a more common sight). Private companies operating taxis | This is the best tl;dr I could make, original
*****
> The Indian government has announced it is allocating 100 billion rupees for its first manned space mission, set to be launched by 2022.
> India&#039;s Mars Mission cost less than the budget of the Hollywood space blockbuster &quot;Gravity&quot;.
> The Indian Space Research Organisation has said it hopes to deploy its biggest rocket, the Geosynchronous Satellite Launch Vehicle Mark III to transport the three Indians into space.
> &quot;A manned space mission is a natural progression in a country&#039;s space journey. Commercial market space conservation is an important factor for India to develop its space capabilities. But over the last decade or so, India has attempted to make changes to its space policy,&quot; Rajeswari Pillai Rajagopalan, the head of the Nuclear and Space Policy Initiative at the Observer Research Foundation, told Al Jazeera.
> &quot;India has its own interests in space, beyond economics and development. Increasingly, there are military and security-related aspects driving India&#039;s space programme. For instance, China&#039;s anti-satellite test in 2007 had given rise to new debate within India as to how it should develop its own deterrence measures,&quot; she added.
> New Delhi&#039;s space programme was launched in the early 1960s but it remains a small player in the global space industry.
*****
**Summary Source**]( | [FAQ]( "345129 summaries so far.") | [Feedback | *Top* *keywords*: **space**^#1 **India**^#2 **mission**^#3 **Indian**^#4 **manned**^#5
Post found in /r/Futurology]( [/r/space]( [/r/india]( [/r/AutoNewspaper]( [/r/betternews]( [/r/AlJazeera]( and [/r/ALJAZEERAauto.
*NOTICE*: This thread is for discussing the submission topic. Please do not discuss the concept of the autotldr bot here. | De Dietrich-Bugatti The Type 2 was a prototype automobile designed by Ettore Bugatti in 1901. It won an award at the Milan Trade Fair that year and gained the notice of the Baron de Dietrich. De Dietrich managed an automobile factory in Niederbronn in Alsace, France, and contracted Bugatti to develop new models for him under the De Dietrich-Bugatti marque. Approximately 100 Types 3, Type 4 and Type 5 De Dietrich-Bugatti automobiles were produced from 1902 through 1904. In 1904, Ettore Bugatti and Émile Mathis designed a new car, the Type 5 or Hermes. It was a prototype of a | Taxis in India the destinations are always the CBD in South Mumbai." Motorcycle taxicabs are a licensed form of transport in Goa, India. They are much cheaper than other taxis, although the lone passenger can only carry a backpack as luggage. Motorcycle taxis in Goa are driven by men called 'pilots'. By law, in some parts of the state, the rider is expected to wear a helmet, but the pillion-rider is not. These motorcycle taxis can normally be identified by their yellow-and-black coloured paint. The fare should be fixed in advance, and the rides are not metered. Taxicabs arrived in 1911 to complement | I have a bug where the same cars seem to spawn in the roads, rather than random cars. This means I'll see 20 cars and 18 of them will be the same. I do use mods, having replaced several of the in-game cars with their real-life counterparts, but I have no idea if this is related or not. Doing a google search, I saw some old posts about the problem from like 2015, but couldn't find a fix, so I was wondering if anyone else had a similar issue, and what was done to correct it.
As mentioned in the title, this is on PC. | 1,999,988 | Guy Motors first 6-wheeled double decker buses and 6 wheeled trolleybuses in 1926. Guy double decker buses and trolleybuses would prove popular with a fleet of double deckers sold to the London Public Omnibus Company and exports supplied all around the world. Exports served as a major source of income for Guy with sales to South Africa, Pakistan, India and the Netherlands, their armoured vehicles proving particularly popular for covering difficult terrain with 100 supplied to the Indian government in 1928. In 1928 Guy took control of fellow Wolverhampton manufacturer the Star Motor Company, who had seen declining sales throughout the decade, | what kind of trucks do owner-operators drive | who invented the wheeled garbage truck in 1937 | when were motor omnibuses introduced in london | Watch out for guy in black car saying hes your uber. | prior to world war ii, who was the owner of crane packer | what was the first compact car produced by nash motors | which car company was known as the old man's car | where are man diesel engines manufactured in the world |
1,999,989 | Pyrohydrolysis of ammonium fluoroferrates | As the by-product of phosphate fertilizer industry, fluosilicic acid reacts with ammonia to produce white carbon black, the ammonium fluoride in the filtrate solution can be processed into ammonium bifluoride through vaporizing, concentrating, decomposing and crystallizing operations. The processes of ammonium bifluoride production from ammonium fluoride in the both atmosphere and vacuum conditions are studied,with comparison of vaporization effects in each condition. | A rapid pyrohydrolytic method, with simple apparatus, is described for the determination of fluorine in rocks and minerals. The sample is heated with a three-component flux in a stream of moist air, and the liberated hydrogen fluoride is absorbed into an alkaline solution. The recovered fluorine is determined either colorimetrically or by means of a fluoride-specific electrode. The method is suitable for determining fluorine at concentrations down to about 50 p.p.m. | Pyrolysis of tetrafluorosuccinic anhydride over potassium fluoride at 410° gives trifluoroacryloyl fluoride in 95% yield. Lower yields of the acryloyl fluoride are obtained by the pyrolysis of tetrafluorosuccinc anhydride over an inert surface and by the pyrolysis of disodium tetrafluorosuccinate. | A procedure for the calculation of the vapor pressure of hydrogen fluoride over NH 4 F-HF melts is presented. The calculated and experimental data correlate well. The obtained degree of dissociation of HF (0.32 to 0.33) suggests the good electrolytic properties of the NH 4 F-HF melts. | Ammonium dihydrogen phosphate that it contains 12% by weight of elemental nitrogen and (nominally) 61% of phosphorus pentoxide , or 27% of elemental phosphorus. The compound is also a component of the ABC powder in some dry chemical fire extinguishers. Monoammonium phosphate is a widely used crystal in the field of optics due to its birefringence properties. As a result of its tetragonal crystal structure, this material has negative uniaxial optical symmetry with typical refractive indices and at optical wavelengths. Monoammonium phospate crystals are piezoelectric, a property required in some active sonar transducers (the alternative being transducers that use magnetostriction). In the 1950s | Fluorine process for aluminium extraction; replenishment is necessitated by their occasional reactions with the smelting apparatus. Each metric ton of aluminium requires about 23 kg (51 lb) of flux. Fluorosilicates consume the second largest portion, with sodium fluorosilicate used in water fluoridation and laundry effluent treatment, and as an intermediate en route to cryolite and silicon tetrafluoride. Other important inorganic fluorides include those of cobalt, nickel, and ammonium. Organofluorides consume over 20% of mined fluorite and over 40% of hydrofluoric acid, with refrigerant gases dominating and fluoropolymers increasing their market share. Surfactants are a minor application but generate over $1 billion | Abstract The use of elemental fluorine as a reagent over the period 1997–2006 for carbon–fluorine bond formation in organic synthesis is reviewed. Recent advances in the exhaustive fluorination of ethers and esters to give perfluorinated systems, selective direct fluorination of aliphatic, aromatic, heterocyclic and carbonyl systems and the application of microreactor techniques to direct fluorination are discussed. | Reactions of N-fluorobis(phenylsulfonyl)amine with naphthalene, 1-methylnaphthalene, phenanthrene, anthracene, and pyrene without solvent were investigated. Sometimes the fluorination of aromatic compounds with N-fluorobis(phenylsulfonyl)amine without solvent proceeded more selectively than at the use of fluorinating reagents in solution. | 1,999,989 | The interaction of nonstoichiometric ammonium fluoroferrates (NH 4 ) x Fe(OH) 3 - x F 2 x (2.6 ≤ x ≤ 3) (I) and NH 4 H 2 x FeO x F 3 (0.2 ≤ x ≤ 0.4) (II) with steam in the isothermal mode from 165 to 400°C was studied. The earlystages of the process involve thermolysis of the starting complexes to yield intermediate ammonium fluoroferrates in the case of compound I and FeF 2 in the case of compound II. The pyrohydrolysis of ammonium fluoroferrate(II) is complicated by iron(II) oxidation. The ultimate product of both reactions is α-Fe 2 O 3 . The rates were calculated and the apparent activation energies were determined for the processes in the range of the specified temperatures. | Mössbauer spectroscopic studies of Fe2F5·7H2O related compounds and their thermal decomposition products | Thermal and mass analyses of fluorination process with ammonium bifluoride | Fluorination of Sr2CuO3 by NH4HF2 | Particle Size Dependence of Iron on the Fe16N2 Formation by Low Temperature Nitridation | Ternary and quaternary Si(H)F-O, Si(H)F-N, and SiF(-O)-N compounds, derivatives substituted at O and N, and fluorosilicate salts of O- and N-based cations | Calculation of the constant of the electrolytic dissociation of hydrogen fluoride in NH4F-HF melts variable composition of over the temperature range from 360 to 420 K | Study on new process for ammonium bifluoride production | Calculation of Thermodynamic Functions of Fluorammonium Complexes of 4f Elements |
1,999,990 | Introduction: Repetitive transcranial magnetic stimulation (TMS) is increasingly used to treat neurocognitive symptoms in mood disorders. Intermittent theta burst stimulation (iTBS) is a brief version of TMS that may preferentially target cognitive functions. This study evaluated whether iTBS leads to cognitive improvements and associated increased hippocampal volumes in bipolar depression. Methods: In a two-site double-blind randomised sham controlled trial (NCT02749006), 16 patients received active iTBS to the Left Dorsolateral Prefrontal Cortex (DLPF) and 15 patients received sham stimulation across four weeks. A composite neuropsychological score and declarative memory scores served as the cognitive outcomes. Hippocampal volumes were derived from T1 weighted MRI scans using the longitudinal ComBat method to harmonise data across sites. Results: No significant improvements were observed in any cognitive variables in the active relative to the sham group; however, there was a trend for increased left hippocampal volume in the former. Left hippocampal volume increases were associated with improvements in nonverbal memory in the active group. Conclusions: Although cognitive improvements were not associated with iTBS, the finding that hippocampal volume increases were associated with memory improvement suggests there may be some level of prefrontal-temporal neuroplasticity that could support cognitive change in future studies of iTBS in bipolar disorder.ARTICLE HISTORY |
Introduction
The clinical parameters of repetitive transcranial magnetic stimulation (rTMS) in stress-related psychiatric disorders are evolving rapidly [1,2]. Intermittent theta-burst stimulation (iTBS), a more recent form of rTMS, has increasingly gained attention [3] as iTBS can significantly shorten treatment duration and in depressed patients it produces comparable clinical outcomes compared to conventional high frequency rTMS protocols [4]. Considering that the FDA-approved once-daily iTBS treatments quickly extends to six weeks, this imposes a considerable logistic burden on patients and caregivers and could delay therapeutic effects. Hence twice-daily or double-dose stimulation has gained popularity [5]. However, the neuro-endocrinological effects of a single and repeated/second session remains to be determined.
Of interest, given that the dorsolateral prefrontal cortex (DLPFC), the most frequently stimulated target of rTMS, plays an essential role in regulating the hypothalamic-pituitary-adrenal (HPA) system [6], here we focused on the neuro-endocrinological effects of double-dose iTBS on the stress response after a stressful event. We hypothesized that a second iTBS-session would reinforce the effects on cortisol secretion compared to a single session, and sham iTBS (single or double) would not show this pattern. We did not expect that mood would be influenced by active or sham iTBS.
Methods & materials
Thirty-eight healthy right-handed females (mean age = 23.53 years, SD = 3.00, age-range = 18-28 years), all taking hormonal contraceptives, were invited to participate in the study on two separate experimental days. At baseline, all participants were randomly assigned to an active-first or sham-first condition following simple randomization procedures using computerized random numbers to 1 of 2 stimulation groups. Except for the stimulation part (active vs. sham), the protocol on both days was identical (see Fig. 1).
There was at least a one-week interval between the two experimental days. Since circadian rhythm influences cortisol levels, the sessions were carried out in the afternoon (between 14:00 and 20:00), and every individual participant started both sessions at the same time.
To provoke an acute response of the HPA axis to stress, before being stimulated, participants performed a modified version of the Trier Social Stress Test (TSST; see Ref. [7] for a detailed description). In the first part (preparation phase), participants have 3 min to prepare a 5-min presentation. During the second part, the presentation itself, the participants were asked to convince a jury to hire them for the job of their choosing. During the third part, participants performed a challenging arithmetic test for another 5 min. Cortisol and mood were measured before and after a single iTBS session (i.e., T 1 and T 2 respectively) and before and after a second iTBS session (i.e., T 3 and T 4 respectively) and before and after both sessions (i.e., T 1 and T 4 respectively).
To evaluate the endocrinological stress responses, we collected saliva samples using an insert containing a sterile polyester swab for collecting saliva, yielding a clear and particle-free sample. The salivettes were used according to the instructions provided by the manufacturer (Sarstedt, Germany). Saliva cortisol levels (μg/L) were determined by Cortisol Saliva luminescence immunoassay (IBL International GmbH, Germany).
The limit of Quantification was 0.12 μg/L, and the within-run and between-run variation coefficients were less than 5%.
To evaluate potential influences on mood, participants rated six feelings ('fatigued', 'vigorous', 'angry', 'tensed', and 'cheerful') on a 100-mm line. Positive mood scales were reversed, therefore high scores on all the subscales indicate more negative affect.
The stimulation was applied using a Magstim Rapid2 Plus1 magnetic stimulator (Magstim Company Limited, Minneapolis, USA) connected to a 70 mm "figure-of-eight" shaped coil. We used a special designed coil for the sham condition that looks identical to the coil for active stimulation and imitates feeling and sound delivering a very shallow magnetic field to mimic the sensation of the active magnetic stimulation. The region of interest, the left DLPFC, was identified with the Brainsight neuronavigation system (BrainsightTM, Rogue Research, Inc) using visual identification of the area in the center of the mid-prefrontal gyrus [Brodmann 9/46] based on individual neuroanatomical data. For each session, the following parameters were used: frequency 50Hz, burst frequency 5Hz, 1620 pulses in total a spread over 54 cycles in which each cycle includes 10 bursts of 3 pulses each, with a train duration of 2 s and an inter-train interval of 6 s (7 min and 12 s for one session), with a power output of 110% of the resting motor threshold. On both experimental days, the participants received a block of either two active stimulation or two sham stimulations. Given that the stress-induced cortisol increases after TSST can be observed usually 5-20 min after stress-induction, with a peak after 10-30 min [8], we left a time interval between both iTBS sessions of 5 min.
Statistical analyses were performed using SPSS 24.0 (IBM SPSS Statistics 24.0). The significance level was set at p < 0.05, two-tailed, for all analyses. The iTBS effects on HPA-functioning and mood were analyzed using the balanced two-period cross-over design described by Ref. [9] used in relatively small samples (to test for stimulation-by-period (order) and group interactions). The two treatment, two-period cross-over design overcomes the difficulty of potential carry-over effects by having half of the subjects receive treatment A followed by treatment B while the other half receive B followed by A. Carryover (or residual) effects may occur when the effect of a stimulation condition given in the first time period persists into the second period and distorts the effect of the second [10]. Using the balanced two-period cross-over design, the order of stimulation is incorporated, so any temporal change that might favour B over A in one group will favour A over B in the other group and cancel out the stimulation comparison. Stimulation (active and sham) are compared by combining the difference between A and B from within each group. Periods (order) are compared by looking at the difference between the measurements in period one and those made in period two. Importantly, if period effects are present, they do not influence the comparison of stimulation. Moreover, given that we directly compare the effects on changes in cortisol levels between the first and second stimulation sessions and between both days, the effects of stimulation around the cortisol peak are observed during the first sham/active session, and the effects of stimulation after the cortisol peak are observed during the second sham/active session.
The [9] approach was also used for the mood analysis. Of note, for mood analyses, a total mood score was calculated, making a weighted average of all subscales. Positive mood scales were reversed, with higher scores indicating more negative affect.
Results
The effect of iTBS on mood
The balanced two-period cross-over design showed no significant stimulation-by-visit (order) and group interactions (p's > 0.05). This indicates that there was no influence of iTBS on mood after a single or a double dose of iTBS. An overview of mood scores can be found in Table 1.
The effect of iTBS on HPA-functioning
We refer to Table 1 for an overview of all cortisol concentrations. After the single stimulation session, using the Hills and Armitage approach, we found a significant period effect, indicating that the first visit significantly influenced the second visit (p < 0.01), with as a result less cortisol output at the second visit. However, the interaction effect between stimulation and visit was not significant (p = 0.12). Furthermore, stimulation (active vs sham) was not significant (p = 0.94).
After the second stimulation session, using this balanced two-period cross-over analysis, we observed once more a significant period effect, again implying that the first visit influenced the second (p < 0.01), resulting in less cortisol output at the second visit. Crucially, the Fig. 1. Overview of the protocol. Abbreviations: iTBS, intermittent theta burst stimulation; TSST, Trier Social Stress Test, T1-T2-T3-T4: timepoint 1-2-3-4, C&M: cortisol and mood. All participants were randomly divided into two groups, X and Y. Those in group X received a block of two active iTBS stimulation sessions (condition A) on the first day (i.e., visit 1) and a block of two sham stimulation sessions (condition B) on the second day (i.e., visit 2). In contrast, in group Y, the order was reversed. Cortisol and mood were measured before and after a single iTBS session (i.e., T 1 and T 2 ), before and after a second iTBS session (i.e., T 3 and T 4 ) and before and after both sessions (i.e., T 1 and T 4 ).
interaction effect between stimulation and visit was not significant (p > 0.05). However, stimulation was significant (p < 0.01), indicating that the second active iTBS as compared to sham led to a significantly lesser decrease in salivary cortisol output.
When examining both stimulation sessions together, similar to both iTBS sessions separately, we found a significant period effect, showing again that the first visit influenced the second (p < 0.01), yielding less cortisol concentrations at the second visit. However, the interaction effect between stimulation and visit was not significant (p > 0.05). Importantly, stimulation was significant (p < 0.01), showing that active iTBS led to a significantly lesser decrease in salivary cortisol responses immediately after both simulations, as compared to sham.
Discussion
This study examined the effect of a single and a following second iTBS session on salivary cortisol in healthy female volunteers after being stressed. As expected, mood was not differentially altered after active or sham stimulation throughout the protocol. This agrees with previous research examining the effect of single and multiple rTMS sessions on mood in non-stressed healthy participants [11] indicating that the effects of iTBS after being stressed was also not influenced by changes in self-reported mood.
Concerning the effects of iTBS on cortisol secretion, we found a significant period effect, indicating that independently of stimulation type (active or sham) participants display less cortisol output during the second experimental visit. This is in line with previous research looking into the repeated use of TSST on psychophysiological responses without the use of non-invasive brain stimulation [12,13]. Boesh and colleges (2014) observed a smaller increase in cortisol levels when performing the TSST for the second time. Importantly, since period effects in the [9] approach do not influence the comparison of stimulation, this does not influence our results.
One session of active or sham iTBS applied to the left DLPFC, preceded by the TSST, showed no differential effects on the HPA-system. This is in line with previous healthy volunteers studies examining the impact of one session of high frequency rTMS on cortisol secretion, however, this was without stress induction [14].
When adding a second (double dose) iTBS session 5 min later, this resulted in a significantly less attenuation in salivary cortisol output in the active condition only. This suggests that instead of a faster stress recovery by double dose iTBS, applying this second active iTBS session after only 5 min may hamper the stress recovery after being stressed. Although speculative, these results could be explained by mechanisms of homeostatic metaplasticity, where the alteration of synaptic plasticity of the targeted neurons during a second iTBS session is dependent on the prior activity, (which has been altered due to the first iTBS session) [15]. Alternatively, short intervals between two sessions might lead to null-effects or to opposite results [16]. For instance, previous motor evoked potential (MEP) research showed that when using two consecutive iTBS sessions applied to the motor cortex, with either a 5 min interval or no interval (i.e. iTBS session two starts directly after session one, creating one session with the double number of pulses); this may lead to a decrease in excitability [16]. In contrast, two iTBS sessions with an interval of 15 min or longer led to similar or enhanced effects on MEP when compared to only a single session [17]. Although we did not introduce MEP measurements into our protocol, it may be possible that the relatively short time between our two active iTBS sessions might have led to inhibition -instead of excitation -of the DLPFC, resulting in a significantly slower stress recovery compared to sham stimulation. At this point, we can only conclude that stimulation protocols applying iTBS twice daily with only a short time of intersession interval may produce rather inhibitory effects on stress regulation instead of a facilitation to stress recovery. However, research giving 10 sessions of iTBS using 1800 pulses/session (i.e., giving three sessions of 600 pulses without a break) to depressed patients, show a significant drop in depressive symptoms [4].
Even though this study has several strengths, some limitations should be discussed. First, only healthy young women using hormonal contraceptives were included, so these results cannot be generalized to a broader population. Secondly, since the participants received stimulation after being stressed, the stimulation effects could only be assessed during the stress recovery. Thirdly, because we only used two active and two sham stimulations to evaluate the difference between a single or double dose of (active/sham) iTBS on salivary cortisol, we did not evaluate possible placebo effects in the HPA-system in relation to active iTBS or vice versa.
In conclusion, the application of double dose iTBS with only a 5 min intersession interval significantly delayed stress recovery in healthy female volunteers after being stressed, irrespective of mood influences. Our results suggest that double dose iTBS with short session intervals might result in an inhibitory effect on the HPA-system, delaying stress recovery.
Declaration of interests
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Table 1
Mean ratings and standard error for the change in salivary cortisol (expressed in mg/L) and mood after a single session (T1-T2), a second session (T3-T4), and double sessions (T1-T4) for the active and sham group during the first and second visit.
AcknowledgmentsThis study was supported by Grant BOF16/GOA/017 for a Concerted Research Action of Ghent University, by a Grant BOFSTA2017002501 of
Repetitive transcranial magnetic stimulation treatment for depressive disorders: current knowledge and future directions. C Baeken, A K Brem, M Arns, A R Brunoni, I Filipčić, A Ganho-Ávila, D Bennabi, 10.1097/YCO.0000000000000533Curr. Opin. Psychiatr. 325C. Baeken, A.K. Brem, M. Arns, A.R. Brunoni, I. Filipčić, A. Ganho-Ávila, D. Bennabi, Repetitive transcranial magnetic stimulation treatment for depressive disorders: current knowledge and future directions, Curr. Opin. Psychiatr. 32 (5) (2019) 409-415, https://doi.org/10.1097/YCO.0000000000000533.
Stanford accelerated intelligent neuromodulation therapy for treatment-resistant depression. E J Cole, K H Stimpson, B S Bentzley, M Gulser, K Cherian, C Tischler, N R Williams, 10.1176/appi.ajp.2019.19070720Am. J. Psychiatr. 1778E.J. Cole, K.H. Stimpson, B.S. Bentzley, M. Gulser, K. Cherian, C. Tischler, N. R. Williams, Stanford accelerated intelligent neuromodulation therapy for treatment-resistant depression, Am. J. Psychiatr. 177 (8) (2020) 716-726, https:// doi.org/10.1176/appi.ajp.2019.19070720.
Ten years of theta burst stimulation in humans: established knowledge, unknowns and prospects. A Suppa, Y Z Huang, K Funke, M C Ridding, B Cheeran, V Di Lazzaro, J C Rothwell, 10.1016/j.brs.2016.01.006Brain Stimul. 93A. Suppa, Y.Z. Huang, K. Funke, M.C. Ridding, B. Cheeran, V. Di Lazzaro, J. C. Rothwell, Ten years of theta burst stimulation in humans: established knowledge, unknowns and prospects, Brain Stimul. 9 (3) (2016) 323-335, https:// doi.org/10.1016/j.brs.2016.01.006.
Antidepressant efficacy of prolonged intermittent theta burst stimulation monotherapy for recurrent depression and comparison of methods for coil positioning: a randomized, double-blind, sham-controlled study. C T Li, C M Cheng, M H Chen, C H Juan, P C Tu, Y M Bai, J S Jeng, W C Lin, S J Tsai, T P Su, 10.1016/j.biopsych.2019.07.03131563272Biol. Psychiatr. 875C.T. Li, C.M. Cheng, M.H. Chen, C.H. Juan, P.C. Tu, Y.M. Bai, J.S. Jeng, W.C. Lin, S. J. Tsai, T.P. Su, Antidepressant efficacy of prolonged intermittent theta burst stimulation monotherapy for recurrent depression and comparison of methods for coil positioning: a randomized, double-blind, sham-controlled study, Biol. Psychiatr. 87 (5) (2020) 443-450, https://doi.org/10.1016/j. biopsych.2019.07.031. Epub 2019 Aug 9. PMID: 31563272.
Number of pulses or number of sessions? An open-label study of trajectories of improvement for once-vs. twice-daily dorsomedial prefrontal rTMS in major depression. L Schulze, K Feffer, C Lozano, P Giacobbe, Z J Daskalakis, D M Blumberger, J Downar, 10.1016/j.brs.2017.11.002Brain Stimul. 112L. Schulze, K. Feffer, C. Lozano, P. Giacobbe, Z.J. Daskalakis, D.M. Blumberger, J. Downar, Number of pulses or number of sessions? An open-label study of trajectories of improvement for once-vs. twice-daily dorsomedial prefrontal rTMS in major depression, Brain Stimul. 11 (2) (2018) 327-336, https://doi.org/ 10.1016/j.brs.2017.11.002.
Can the effects of noninvasive brain stimulation alleviating neuropsychiatric symptoms result from a common beneficial regulation of the hypothalamic-pituitary-adrenal axis?. J Brunelin, S Fecteau, 10.1016/j.brs.2014.11.021Brain Stimul. 82J. Brunelin, S. Fecteau, Can the effects of noninvasive brain stimulation alleviating neuropsychiatric symptoms result from a common beneficial regulation of the hypothalamic-pituitary-adrenal axis? Brain Stimul. 8 (2) (2015) 173-176, https:// doi.org/10.1016/j.brs.2014.11.021.
The 'trier social stress test' -a tool for investigating psychobiological stress responses in a laboratory setting. C Kirschbaum, K.-M Pirke, D H Hellhammer, https:/www.karger.com/DOI/10.1159/000119004Neuropsychobiology. 281-2C. Kirschbaum, K.-M. Pirke, D.H. Hellhammer, The 'trier social stress test' -a tool for investigating psychobiological stress responses in a laboratory setting, Neuropsychobiology 28 (1-2) (1993) 76-81. Retrieved from, https://www.karger. com/DOI/10.1159/000119004.
Acute HPA axis responses, heart rate, and mood changes to psychosocial stress (TSST) in humans at different times of day. B M Kudielka, N C Schommer, D H Hellhammer, C Kirschbaum, 10.1016/j.psyneuen.2003.08.009Psychoneuroendocrinology. 298B.M. Kudielka, N.C. Schommer, D.H. Hellhammer, C. Kirschbaum, Acute HPA axis responses, heart rate, and mood changes to psychosocial stress (TSST) in humans at different times of day, Psychoneuroendocrinology 29 (8) (2004) 983-992, https:// doi.org/10.1016/j.psyneuen.2003.08.009.
The two-period cross-over clinical trial. M Hills, P Armitage, 10.1111/j.1365-2125.1979.tb05903.xBr. J. Clin. Pharmacol. 81M. Hills, P. Armitage, The two-period cross-over clinical trial, Br. J. Clin. Pharmacol. 8 (1) (1979) 7-20, https://doi.org/10.1111/j.1365-2125.1979. tb05903.x.
The Computer-Aided Analysis of Crossover Studies Gerard E. Dallal, Ph.D. Retrieved from Dallal Website. Dallal, Dallal, The Computer-Aided Analysis of Crossover Studies Gerard E. Dallal, Ph.D. Retrieved from Dallal Website, 2009. http://www.statisticalpractice.com.
Does a single neurostimulation session really affect mood in healthy individuals? A systematic review. J Remue, C Baeken, R De Raedt, 10.1016/j.neuropsychologia.2016.03.012Neuropsychologia. 85J. Remue, C. Baeken, R. De Raedt, Does a single neurostimulation session really affect mood in healthy individuals? A systematic review, Neuropsychologia 85 (2016) 184-198, https://doi.org/10.1016/j.neuropsychologia.2016.03.012.
Mood and autonomic responses to repeated exposure to the trier social stress test for groups. M Boesch, S Sefidan, U Ehlert, H Annen, T Wyss, A Steptoe, R La Marca, 10.1016/j.psyneuen.2014.02.003Psychoneuroendocrinology. 43M. Boesch, S. Sefidan, U. Ehlert, H. Annen, T. Wyss, A. Steptoe, R. La Marca, Mood and autonomic responses to repeated exposure to the trier social stress test for groups (TSST-G), Psychoneuroendocrinology 43 (2014) 41-51, https://doi.org/ 10.1016/j.psyneuen.2014.02.003, 2014.
Stability and test-retest reliability of different hormonal stress markers upon exposure to psychosocial stress at a 4-month interval. A Kexel, B Kluwe-Schiavon, M Visentini, L Soravia, C Kirschbaum, B Quednow, 10.1016/j.psyneuen.2021.105342Psychoneuroendocrinology. 135105342A. Kexel, B. Kluwe-Schiavon, M. Visentini, L. Soravia, C. Kirschbaum, B. Quednow, Stability and test-retest reliability of different hormonal stress markers upon exposure to psychosocial stress at a 4-month interval, Psychoneuroendocrinology 135 (2021) 105342, https://doi.org/10.1016/j.psyneuen.2021.105342.
Baseline "state anxiety" influences HPA-axis sensitivity to one sham-controlled HF-rTMS session applied to the right dorsolateral prefrontal cortex. C Baeken, M A Vanderhasselt, R De Raedt, 10.1016/j.psyneuen.2010.06.006Psychoneuroendocrinology. 361C. Baeken, M.A. Vanderhasselt, R. De Raedt, Baseline "state anxiety" influences HPA-axis sensitivity to one sham-controlled HF-rTMS session applied to the right dorsolateral prefrontal cortex, Psychoneuroendocrinology 36 (1) (2011) 60-67, https://doi.org/10.1016/j.psyneuen.2010.06.006.
Consensus paper: probing homeostatic plasticity of human cortex with non-invasive transcranial brain stimulation. A Karabanov, U Ziemann, M Hamada, M S George, A Quartarone, J Classen, H R Siebner, 10.1016/j.brs.2015.06.017Brain Stimul. 85A. Karabanov, U. Ziemann, M. Hamada, M.S. George, A. Quartarone, J. Classen, H. R. Siebner, Consensus paper: probing homeostatic plasticity of human cortex with non-invasive transcranial brain stimulation, Brain Stimul. 8 (5) (2015) 993-1006, https://doi.org/10.1016/j.brs.2015.06.017.
The effect of stimulation interval on plasticity following repeated blocks of intermittent theta burst stimulation. N Y Tse, M R Goldsworthy, M C Ridding, J P Coxon, P B Fitzgerald, A Fornito, N C Rogasch, 10.1038/s41598-018-26791-wSci. Rep. 81N.Y. Tse, M.R. Goldsworthy, M.C. Ridding, J.P. Coxon, P.B. Fitzgerald, A. Fornito, N.C. Rogasch, The effect of stimulation interval on plasticity following repeated blocks of intermittent theta burst stimulation, Sci. Rep. 8 (1) (2018) 1-10, https:// doi.org/10.1038/s41598-018-26791-w.
Prolonged corticomotor homeostatic plasticity -effects of different protocols and their reliability. P G Wittkopf, D B Larsen, L Gregoret, T Graven-Nielsen, 10.1016/j.brs.2021.01.017Brain Stimul. 142P.G. Wittkopf, D.B. Larsen, L. Gregoret, T. Graven-Nielsen, Prolonged corticomotor homeostatic plasticity -effects of different protocols and their reliability, Brain Stimul. 14 (2) (2021) 327-329, https://doi.org/10.1016/j.brs.2021.01.017.
| Repetitive transcranial magnetic stimulation (rTMS) is currently emerging as one of the first fundamentally new treatments in psychiatric practice for a considerable number of years. Research into the use of rTMS for the treatment of patients with depression has now been conducted for over 15 years. The aim of this article was to review the development of rTMS treatment for depression and the current state of evidence supporting its use. The vast majority of the trials conducted on the technique have evaluated the efficacy of high-frequency rTMS applied to the left dorsolateral prefrontal cortex using a set of parameters very similar to those originally described in the mid-1990s. This ‘standard’ form of rTMS clearly appears to have antidepressant efficacy, and its effects have now been confirmed in several large-scale clinical trials and a number of meta-analyses: response is better than that of sham stimulation, although the number of responders to treatment is relatively modest. A wide range of alterna... | Transcranial magnetic stimulation (TMS) is a patient-friendly stimulation technique of the brain with interesting perspectives. In clinical psychiatry, limited data are available on activity in psychosis and anxiety, but much research has been done in depression. Major concerns on published papers are the inconsistency of used parameter settings, the restraint numbers of patients in randomised trials, the lack of real sham controlled studies and the quasi inexistent reproducibility of results. The most stringent meta-analysis of TMS in affective disorders found a modest, statistically significant antidepressant effect after 2 weeks of daily treatment of high frequency repetitive left dorsolateral prefrontal cortex stimulation. Although most results are rather weak and not convincing enough to promote TMS as evidence-based antidepressive therapy, they show a measurable action that should not be ignored. Preclinical and clinical effects were observed analysing heterogeneous data, and results comparing TMS t... | Objective:Daily left prefrontal repetitive transcranial magnetic stimulation (rTMS) recently received Food and Drug Administration (FDA) approval for the treatment of depression and offers an alternative to traditional approaches. This approval was based on a study using 3000 stimuli per day (15,000 | Twelve patients with comorbid posttraumatic stress disorder (PTSD) and major depression underwent repetitive transcranial magnetic stimulation (rTMS) to left frontal cortex as an open-label adjunct to current antidepressant medications. rTMS parameters were as follows: 90% of motor threshold, 1 Hz or 5 Hz, 6,000 stimuli over 10 days. Seventy-five percent of the patients had a clinically significant antidepressant response after rTMS, and 50% had sustained response at 2-month follow-up. Comparable improvements were seen in anxiety, hostility, and insomnia, but only minimal improvement in PTSD symptoms. Left frontal cortical rTMS may have promise for treating depression in PTSD, but there may be a dissociation between treating mood and treating core PTSD symptoms. | In Japan, approximately one million patients currently receive medical treatment for mood disorders. However, there are only a few available treatments for patients with treatment-resistant depression or bipolar depression. Repetitive transcranial magnetic stimulation (rTMS), a neuromodulation technique, has proven to be effective for treatment-resistant depression, and also has a potential therapeutic efficacy in patients with bipolar depression who do not respond to medication. Magnetic seizure therapy (MST) is an experimental technique for introducing a seizure by using rTMS, which demonstrates a therapeutic efficacy similar to that of electroconvulsive therapy (ECT), but with fewer cognitive side effects. | Transcranial magnetic stimulation (TMS)/repetitive TMS in mild cognitive impairment and Alzheimer's disease | The dorsolateral prefrontal cortex (DLPFC) plays a key role in working memory. Evidence indicates that transcranial magnetic stimulation (TMS) over the DLPFC can interfere with working memory performance. Here we investigated for how long continuous theta-burst stimulation (cTBS) over the DLPFC decreases working memory performance and whether the effect of cTBS on performance depends on working memory load. Forty healthy young subjects received either cTBS over the left DLPFC or sham stimulation before performing a 2-, and 3-back working memory letter task. An additional 0-back condition served as a non-memory-related control, measuring general attention. cTBS over the left DLPFC significantly impaired 2-back working memory performance for about 15 min, whereas 3-back and 0-back performances were not significantly affected. Our results indicate that the effect of left DLPFC cTBS on working memory performance lasts for roughly 15 min and depends on working memory load. | 1,999,990 |
Introduction
Repetitive transcranial magnetic stimulation (TMS) is commonly used to treat depressive symptoms, but its role in cognitive enhancement is increasingly recognised in both healthy and clinical populations (Martin et al. 2017;Jiang et al. 2019;Begemann et al. 2020). Not surprisingly, TMS has been applied to primary cognitive disorders and dementias as a tool to assist with diagnosis, prediction/prognosis, and treatment of cognitive impairments associated with these illnesses (Di Lazzaro et al. 2021). Given the recognition that cognitive impairments are also highly prevalent among a wide range of psychiatric illnesses (Abramovitch et al. 2021), the use of non-invasive brain stimulation techniques has major relevance to many psychiatric populations. One of these illnesses is bipolar disorder, which is associated with cognitive impairments (Torres et al. 2007) that have a detrimental impact on daily functioning (Depp et al. 2012;Tse et al. 2014).
Theta-burst stimulation (TBS) is a variant of TMS which achieves short-term facilitation and inhibition with shorter stimulation protocols (Huang et al. 2005). Intermittent TBS (iTBS) is delivered in short trains, typically of 2 s duration every 10 s, and due to its facilitatory effect, iTBS exhibits strong cognitive enhancing potential (Demeter 2016;Ngetich et al. 2020).
Given the extensive involvement of the dorsolateral prefrontal cortex (DLPFC) and related brain networks in a range of cognitive abilities, prior studies investigating pro-cognitive effects of TBS have frequently targeted this region (Ngetich et al. 2020). However, few studies have evaluated the potential cognitive benefits following multi-session iTBS treatments in clinical populations (Demeter 2016). Our group and others observed left DLPFC iTBS related cognitive improvements in patients with major depression (Cheng et al. 2016;Gregory et al. 2022), and similar findings have been reported in several neurological populations (Trung et al. 2019;Tsai et al. 2020). Moreover, cognitive improvements may be more than transient, persisting beyond one-month post-treatment in some studies (Trung et al. 2019;Lang et al. 2020).
Despite the fact that cognitive deficits are highly prevalent in bipolar disorder, few TMS trials have focussed on cognitive improvement in this population. A recent review of this literature by Sciortino et al. (2021) revealed mixed findings, with evidence of both positive and negative findings. However, none of these previous studies employed iTBS, which as stated previously, may have enhanced potential to improve cognition.
In addition to modulating prefrontal cortical regions that underlie various cognitive executive abilities (Lowe et al. 2018), TMS delivered to the left DLPFC may also influence regions that are not directly targeted, such as the hippocampus, which is involved in memory and learning (Kim et al. 2019). For example, ipsilateral hippocampal volume increases have been reported after left DLPFC stimulation (Hayasaka et al. 2017;Noda et al. 2018), although the degree to which these changes impact cognitive functions is less clear (Furtado et al. 2013). Because bipolar disorder is characterised by reduced hippocampal volumes (Haukvik et al. 2022) and diminished memory functioning (Bourne et al. 2013), neurostimulation therapies that can also induce changes in medial temporal brain regions may be clinically beneficial (Ott et al. 2019).
The present study is the first to investigate potential cognitive improvements of iTBS in bipolar disorder, as well as to explore whether changes in cognitive functioning might be associated with iTBS induced increase in hippocampal volumes. The study was a secondary analysis of cognitive and hippocampal volume outcomes in a completed iTBS trial in bipolar depression that failed to show improvements in depressive symptoms (McGirr et al. 2021). This presented an opportunity to evaluate whether a course of iTBS delivered to the left DLPFC could improve cognition in the absence of confounding change in depressive symptoms. We hypothesised that relative to sham, iTBS treated patients would show improvements in cognitive, and particularly declarative memory functioning, and that these improvements would be associated with hippocampal volume increases.
Materials and methods
The data for this secondary analysis was collected as a part of the iTBS trial for bipolar depression (McGirr et al. 2021), conducted in accordance with IFCN recommendations (Rossini et al. 2015
Participants
Participants were recruited by referral from outpatient clinics and online and community advertisements. Inclusion criteria included: adult 18-70 years old; primary DSM-5 diagnosis of bipolar disorder Type I or II confirmed with the MINI International Neuropsychiatric Interview (Sheehan et al. 1998); experiencing a major depressive episode with score !18 on the 17-item Hamilton Depression Rating Scale (HDRS-17;Hamilton 1960); failure to achieve sufficient clinical response with at least one CANMAT (Yatham et al. 2018) first-line treatment for an acute bipolar major depressive episode. Participants were required to have been on a stable pharmacological regimen for two weeks prior to screening. Treatment was required to include a mood stabiliser (lithium >0.6mEq/L, valproate >350mM/L, or Lamotragine > 100mg), an atypical antipsychotic, or both. Exclusion criteria included: acute suicidality; current psychosis; substance use disorder within the past 3 months; seizure history; unstable medical condition; comorbid psychiatric condition deemed to be primary. Participants were also excluded if they had previous non-response to rTMS, current use of more than three antipsychotics, previous failure to respond to ECT in the current episode, or had initiated psychotherapy within the previous three months.
Neurostimulation protocol
Eligible participants were enrolled consecutively and a stratified random number sequence was generated by an independent statistician for each site, according to treatment with mood stabilisers, atypical antipsychotics, or their combination. Randomisation occurred with allocation concealment via the envelope method to ensure that patients and investigators remained blind to treatment condition during the study.
Each site utilised a MagPro X100 stimulator (MagVenture, Denmark), with the UBC site utilising a dual active/sham Cool-B65 A/P coil and the UofC site a COOL-B70 or MCF-P-B70 placebo coil. Both sites utilised anatomical MRIs and neuronavigation (Visor2, ANT Neuro, the Netherlands). Resting motor threshold (rMT) was determined by visual inspection at the UBC site and by using EMG electrodes at the UofC site placed over the first dorsal interosseous muscle, with threshold determined as the stimulus intensity required to elicit 5/10 EMG responses >50mV.
Patients were randomised to sham-or active-iTBS, consisting of a total of 600 pulses per session delivered as triplets at 50 Hz repeated at 5 Hz (2s on 8s off) at 120% rMT, which had been shown to improve depressive symptoms in MDD . The left DLPFC was targeted using neuronavigation or the BeamF3 method (Beam et al. 2009) if participants could not tolerate an MRI (one participant). Daily treatments (five per week) were administered over four weeks.
Neuropsychological assessment
Because the initial primary outcome measure of the trial was efficacy for depressive symptoms, patients were not pre-selected for demonstrating cognitive deficits. The International Society for Bipolar Disorders-Battery for Assessment of Neurocognition (ISBD-BANC) was used to assess cognitive functioning in patients in the areas of attention, processing speed, verbal and nonverbal learning/memory, working memory, and executive function (Yatham et al. 2010). The ISBD-BANC overlaps considerably with subtests comprising the MATRICS Consensus Cognitive Battery (MCCB; Nuechterlein et al. 2008), but further includes more complex verbal learning and executive function measures tailored to the cognitive impairments in BD.
The ISBD-BANC was administered by a research coordinator trained by the clinical neuropsychologist on the research team (IJT), both at baseline prior to neurostimulation, and at completion of the fourweek trial. At follow-up, alternate forms for the California Verbal Learning Test -2nd Edition (CVLT-2) (Delis et al. 2000) and Brief Visuospatial Memory Test-Revised version (BVMT-R) (Benedict 1997) were utilised. All test scores were converted to demographics-corrected T-scores. The following cognitive outcomes were used:
Primary outcome measure Global Cognition: As in our previous pharmacological cognitive trial (Yatham et al. 2017), the primary measure was the global cognition score which is a composite score of the mean t-score value of the following measures: CVLT-II trial 1-5; CVLT-II delayed free recall; BVMT-R trial 1-3; BVMT-R delayed recall; Trail Making Test (Reitan and Wolfson 1985)
Secondary outcome measures
Verbal memory: (mean t-score of the two CVLT-2 scores).
Nonverbal memory: (mean t-score of the two BVMT-R scores).
Total memory: (average of the Verbal and Nonverbal memory scores).
Neuroimaging data acquisition and analysis
Three-dimensional T1-weighted MRI images were collected at baseline and four-week follow-up at the UBC MRI Research Centre on a Philips Achieva 3.0 T scanner and UofC on a GE 3.0 T MR750w scanner. The scanning parameters of the Philips Achieva scanner were: number of axial slices ¼ 155; repetition time (TR) ¼ 6.6 ms; echo time (TE) ¼ 3.0 ms; flip angle (FA) ¼ 8 degrees; field of view (FOV) ¼ 240 mm  240 mm  155 mm; slice thickness ¼ 1 mm. The scanning parameters of the GE scanner were: number of axial slices ¼ 176; TR ¼ 8.1 ms; TE ¼ 3.2 ms; FA ¼ 16 degrees; FOV ¼ 256 mm  256 mm  176 mm; slice thickness ¼ 1 mm.
The FreeSurfer image analysis suite (version 7.1.0, http://surfer.nmr.mgh.harvard.edu/) was used to segment the whole brain and the hippocampus from the T1-weighted images using a longitudinal pipeline. Specifically, data from two time points were longitudinally processed to generate an unbiased withinsubject template, and all further processing steps were initialised using this template (Reuter et al. 2012).
Hippocampal segmentation was carried out on the longitudinal processed output data using the longitudinal hippocampal segmentation tool in FreeSurfer (Iglesias et al. 2016), which uses a subject-specific atlas and treats all time points the same way to avoid processing bias, increasing the robustness of segmentation and measurement of subfield volumes. Total hippocampus volume was extracted for each hemisphere. Quality assurance involved visual inspection and outlier detection, defined as the volumes of more than three standard deviations of the mean. The FreeSurfer-derived measures of hippocampal and the total gray matter volumes were site harmonised using the longitudinal Combat method (Beer et al. 2020) implemented as per https://github.com/jcbeer/ longCombat. This is a multistep method that progresses from data standardisation, to empirical Bayes estimation of scanner effects and linear mixed-effects models.
Statistical analysis
Demographic and clinical variables were compared between groups using independent t-tests and chisquare tests. The analyses for the primary efficacy measure (global cognition) and secondary cognitive measures (verbal memory, nonverbal memory, total memory) were conducted using repeated measure ANOVA with time (baseline vs. follow-up) as a repeated measure and group (active vs. sham) as a between-subjects factor, with particular attention to the time by group interaction which would indicate differential change in cognitive performance between the two groups. Similar analyses were conducted for all individual test scores. In a supportive set of analyses we also used ANCOVA to evaluate cognitive group differences (active vs. sham) at follow-up after covarying for baseline cognitive score and change in mood symptoms (follow-up minus baseline MADRS and YMRS). For the cognitive analyses above, alpha values were adjusted based on the number of cognitive outcomes (alpha ¼ .05/4 ¼ .0125). The relationship between change in cognitive variables and change in mood symptoms was assessed using Spearman correlations. Time by group repeated measure analyses were also used to evaluate group differences in hippocampal volumes and in total brain grey matter volume, again with an emphasis on the group by time interactions. We evaluated the association between change in hippocampal volume and change in cognitive functioning in the active group using Pearson correlations, as well as partial correlations removing the effect of change in depressive symptoms.
Results
Group differences in demographic and clinical variables
Of 37 initial participants, two receiving active-iTBS and four receiving sham-iTBS dropped out of the study. One participant receiving active-iTBS completed three weeks of treatment before institutional COVID-19 closure required discontinuation; however, cognitive data was collected at the three week time point for this person and was included in the analyses. Overall, 31 participants (16 active, 15 sham) received cognitive testing, and their clinical and demographic characteristics are provided in Table 1. One person in the active group declined BVMT-R testing at baseline and followup, and therefore was missing nonverbal memory scores. Two patients in each group were left-handed. Patients in both groups were well matched demographically and clinically, with the exception that patients in the sham group had a higher number of prior depressive episodes than those in the active group. Additionally, although baseline YMRS scores were well within the euthymic range at follow-up for both groups, they were significantly higher in the sham group.
Cognitive changes across groups
Baseline and follow-up cognitive data for active and sham groups, as well as the results from the repeated measure ANOVAs are summarised in Table 2. After correction for multiple comparisons there was a significant time effect for the global cognition score [F(1,29) ¼ 12.1, p ¼ .002]. There were no significant group effects (all p > .20) nor significant group by time interactions for the primary or any of the secondary cognitive outcome measures (Table 2; all p > .40). There were also no significant group by time interactions for any of the individual test scores that made up the global cognition score (all p > .05, data not shown).
In the supportive ANCOVAs, there were similarly no significant differences between active and sham groups on any of the primary or secondary cognitive variables at follow-up after covarying for baseline cognition and change in mood symptoms (all p > 0.35).
There were no significant correlations between change in any of the cognitive variables and change in depression or mania symptoms, both within each group and when groups were combined (all p>.20).
Hippocampal volume change across groups
Hippocampal data were available for 12 patients in the active group (3 had metal implants, 1 was not scanned due to COVID-19 closure) and 14 in the sham group (1 was claustrophobic). There was no significant difference in the proportion of patients from each site between the active and sham groups (X 2 ¼ .25, p ¼ .62). The brain volume data are presented in Table 2 and visually in Supplementary Figure 1
Correlations between cognitive change and hippocampal volume change
In the active group (n ¼ 11), increase in left hippocampal volume was associated with improved nonverbal memory (r ¼ .60, p ¼ .05) (Supplementary Figure 2). This association remained unchanged after controlling for change in depressive symptoms (r ¼ .62, p ¼ .06). There were no other significant correlations between change in any hippocampal volumes and change in global cognition or memory variables (all p >.15).
Discussion
The present study was a secondary analysis of an initial pilot trial investigating the efficacy of iTBS in bipolar depression, and the first to evaluate potential cognitive improvement with iTBS in bipolar disorder, as well as to explore whether cognitive changes were associated with increased hippocampal volumes. Overall, there was no evidence of cognitive improvement with iTBS delivered to the left DLPFC on global or specific cognitive domains. However, there was a non-significant trend for a modest increase in left hippocampal volume in the iTBS compared to the sham group, and this volume increase was associated with improved nonverbal memory functioning.
This study contributes to the mixed findings reported in studies investigating possible TMS-related cognitive improvements in bipolar disorder. Our results are in line with two prior TMS studies that also failed to observe cognitive improvements (Hu et al. 2016;Myczkowski et al. 2018), but at odds with two other studies reporting positive findings (Yang et al. 2019;McIntyre et al. 2021). Supplementary Table 3 provides a comparison of these studies with regard to several key patient, treatment, and methodological variables that could potentially influence findings (Miskowiak et al. 2017). With the exception of mood state, none of the variables in Supplementary Table 3 appear to clearly distinguish studies with positive cognitive findings from those with negative findings. Regarding mood state, all the studies that failed to observe cognitive improvements were conducted in acutely depressed patients, while the positive studies were conducted on patients who were symptomatically stable or remitted. It is possible that acute mood effects may influence baseline and/or follow-up cognitive performances in an unpredictable manner, such that the added 'noise' stemming from the cognitive effects of acute mood symptoms may confound the ability to detect TMS-related cognitive improvements if they are present. In contrast, in the studies investigating euthymic patients, it may be easier to detect treatment related effects in the absence of noise arising from acute mood symptomatology and associated cognitive variation.
Although we failed to observe cognitive improvements associated with iTBS, patients in the active group did exhibit a trend towards the expected finding of increased ipsilateral hippocampal volumes relative to the sham group. Hippocampal volume increases have also been observed in a previous iTBS trial in bipolar disorder (Baeken et al. 2020). Additionally, in the active group, left hippocampal volume increases were associated with improvements in nonverbal memory performance, and this occurred independent of change in mood state. Although it may have been expected that left hippocampal volume increases might be more closely associated with verbal rather than nonverbal memory changes, prior volumetric studies have also reported an association between left hippocampal volumes and nonverbal memory abilities (Shavitt et al. 2020). Overall, the presence of hippocampal volume increase in conjunction with improvement in memory functioning may reflect iTBS induced neuroplasticity within prefrontal-temporal lobe networks. Furthermore, our data suggest that such possible neuroplastic changes may be apparent only when structure and function are measured concurrently, as opposed to when only cognitive outcomes are assessed.
The current findings provide some support for the hypothesis that iTBS induces neuroplasticity within prefrontal-temporal networks. However, DLPFC stimulation alone may not be the most efficient and direct means of modulating hippocampal function. Previous studies in healthy participants reveal that by virtue of the strong connections between parietal cortex and medial temporal lobe regions, TMS of the former may serve as a form of 'hippocampal-targeted' TMS that induces strong effects on hippocampal based memory functions (Wang et al. 2014;Tambini et al. 2018). Furthermore, patients with major depression who received iTBS to DLPFC in conjunction with parietal stimulation augmentation demonstrated increased functional connectivity between hippocampus and DLPFC, increased hippocampal response, and a stronger correlation between hippocampal response and cognitive function relative to patients receiving DLPFC stimulation only (Mielacher et al. 2020). These findings suggest that in order to optimise modulation of hippocampal cognitive/memory functions, future iTBS studies in bipolar disorder should target these parietal cortical regions. Future neurostimulation studies in bipolar disorder should also aim to enhance the modulation of complex synaptic mechanisms such as metaplasticity, which is likely to be an important determinant underlying learning, memory, and other functions (Cantone et al. 2021). For example, modulation of metaplasticity may be achieved through the use of accelerated iTBS protocols at appropriately spaced intervals, with the aim of improving clinical outcomes (Thomson and Sack 2020).
Several strengths of this study included the utilisation of an iTBS TMS protocol, investigation of underlying hippocampal volumetric biomarkers of cognitive change, and assessment of multiple cognitive domains. However, several study limitations may have contributed to the negative cognitive findings reported herein. Although the sample size was modest, it was in line with the prior positive studies (Yang et al. 2019;McIntyre et al. 2021) that also assessed similar cognitive domains, arguing against the point that our study was clearly underpowered. Additionally, because our trial was initially designed to evaluate symptomatic rather than cognitive outcomes, we did not pre-select participants for cognitive impairment, and this may have contributed to possible ceiling effects that could have masked treatment-related cognitive improvements. This may have been particularly salient given that our participants were on average highly educated and showed above average intellectual functioning. Our randomisation was also stratified along the lines of medication use, and may have been different if the initial clinical trial was designed to target cognition. Nevertheless, the groups were well matched according to basic demographic and clinical variables such age, sex, and depressive severity, which decreases the likelihood that these variables served as confounds. A final limitation was the use of different coils and MRI scanners at the two sites; however, the fact that there was a comparable proportion of patients from each site in the active and sham groups minimises the likelihood of this potential confound. In keeping with recommendations for procognitive trials in bipolar disorder (Miskowiak et al. 2017), future studies investigating cognitive enhancing effects of iTBS should be sufficiently powered to detect clinically meaningful cognitive change, pre-select patients for cognitive impairments, and include participants in a euthymic mood state. Also, the use of parietal lobe or accelerated iTBS protocols may maximise the ability to promote memory and cognitive improvement in patients with bipolar disorder.
trial A (TMT-A) time; TMT-B time; Continuous Performance Test-Identical Pairs (CPT-IP) trial 1-3; Animal Fluency; Letter-Number Sequencing; Spatial Span; Symbol Coding; Stroop (Golden and Freshwater 2002) Word; Stroop Colour; and Stroop Colour-Word.
. There was a trend for a time effect for right hippocampal volume [F(1,24) ¼ 4.2, p ¼ .05], and a trend for a left hippocampal group by time interaction [F(1,24) ¼ 3.9, p ¼ .06]. No other significant group by time interactions were noted for other hippocampal volumes (all p>.20) or for total brain gray matter volume [F(1,24) ¼ 0.15, p ¼ .70].
). The study was conducted across two Canadian centres (University of British Columbia [UBC], British Columbia, and University of Calgary [UofC], Alberta) and the data collection spanned from October 2016 to March 2020. The original trial was registered with clinicaltrials.gov (NCT02749006) and was approved by UBC Clinical Research Ethics Board of the University of British Columbia and Conjoint Health Ethical Review Board of UofC. Written informed consent was obtained from all participants.
Table 1 .
1Demographics and clinical characteristics of participants in the active and sham groups. a Notes: NAART active n ¼ 12, sham n ¼ 11; illness length active n ¼ 14, sham n ¼ 11; number manic episodes active n ¼ 15, sham n ¼ 13; medication data active n ¼ 15, sham n ¼ 13. a MADRS ¼ Montgomery Asberg Depression Rating Scale (10-item); Premorbid-IQ ¼ North American Adult Reading Test full scale IQ; YMRS ¼ Young Mania Rating Scale. b Rating scales done at baseline. c Illness length based on age at baseline minus age when first mood episode occurred (diagnosed manic or depressed episode). Ã p < .05.Characteristics
Active (N ¼ 16) Sham (N ¼ 15)
Continuous variables
Mean
SD
Mean
SD
p
Age
46.4
13.6
48.1
11.4 .71
Education
15.4
3.6
15.4
2.2 .97
Premorbid-IQ
112.1
8.7 112.9
5.6 .79
YMRS b -baseline
2.0
1.5
2.2
1.8 .73
YMRS b -follow-up
1.1
1.6
2.3
1.3 .04 Ã
MADRS b -baseline
32.0
4.0
31.7
3.9 .85
MADRS b -follow-up
24.5
10.8
22.0
10.0 .52
Illness length (years) c
19.2
14.3
23.1
10.5 .46
No. manic episodes
2.1
3.6
2.5
3.6 .73
No. depressive episodes
8.6
11.5
23.9
25.1 .04 Ã
Categorical variables
N
%
N
%
p
Female
9
56.3
9
60.0 .83
Caucasian
16
100
15
100
.99
Mood Stabilizer
8
53.3
4
30.8 .28
Antipsychotic
1
6.7
3
23.1 .31
Mood Stabiliser and Antipsychotic
6
40
6
46.2 1.0
Table 2 .
2Repeated measure ANOVA results for cognitive variables and hippocampal volumes (mm 3 ). a Group ¼ Group Effect; Time ¼ Time Effect; Group à Time ¼ Group by Time Interaction. b Active n ¼ 16, sham n ¼ 15; Nonverbal Memory active n ¼ 15. c Active n ¼ 12, sham n ¼ 14. Ãà p < .01, à p < .05.Active baseline
Sham baseline
Active follow-up
Sham follow-up
Group
Time
Group à time
Cognitive variables b
M
SD
M
SD
M
SD
M
SD
F
F
F
Global cognition
47.0
9.0
44.7
7.6
49.20
10.1
46.4
6.4
0.74
12.1 ÃÃ
0.21
Verbal memory
47.3
13.8
43.4
6.8
46.4
14.8
40.0
9.8
1.7
1.7
0.62
Nonverbal memory
54.7
12.2
51.1
12.5
57.6
10.1
53.8
9.3
0.93
4.9 Ã
0.00
Total memory
50.1
12.5
47.2
8.4
50.8
13.2
46.9
8.5
0.81
0.04
0.22
Brain volumes c
M
SD
M
SD
M
SD
M
SD
F
F
F
Left hippocampus
3474
277
3506
539
3515
317
3465
520
0.00
0.00
3.9
Right hippocampus
3469
298
3498
574
3498
293
3541
558
0.04
4.2
0.14
Total hippocampus
6943
548
7005
1103
7013
581
7006
1060
0.01
1.7
1.6
Total brain gray
636,716
52,856
629,064
81,182
635,693
53,500
629,269
81,854
0.07
0.07
0.15
a
Disclosure statement IJT has received consulting fees from Lundbeck Canada, Sumitomo Dainippon, and Community Living British Columbia. AM has served on an advisory board for Allergan Canada. FVR receives research support from CIHR, Brain Canada, Michael Smith Foundation for Health Research, Vancouver Coastal Health Research Institute, and Weston Brain Institute for investigator-initiated research. Philanthropic support from Seedlings Foundation. In-kind equipment support for this investigator-initiated trial from MagVenture. He has received honoraria for participation in an advisory board for Janssen. RWL has received funds for speaking/consulting or research from: Allergan, Asia-Pacific Economic Cooperation, BC Leading Edge Foundation, Canadian Institutes of Health Research, Canadian Network for Mood and Anxiety Treatments, Healthy Minds Canada, Janssen, Lundbeck, Lundbeck Institute, Michael Smith Foundation for Health Research, MITACS, Myriad Neuroscience, Ontario Brain Institute, Otsuka, Unity Health, Vancouver Coastal Health Research Institute, Viatris, and VGH-UBCH Foundation. LNY is a consultant and/or has received speaker fees and/or sits on the advisory board and/or receives research funding from Abbvie, Alkermes, Allergan, Canadian Network for Mood and Anxiety Treatments (CANMAT), Canadian Institutes of Health Research (CIHR), Dainippon Sumitomo Pharma, Gedeon Richter, Intracellular Therapies, Lundbeck, Merck, Otsuka, Sanofi and Sunovion over the past three years. All other authors have no conflicts to declare. This work was supported by a philanthropic donation to LNY. Ivan J. Torres http://orcid.org/0000-0001-5107-3339 Fidel Vila-Rodriguez http://orcid.org/0000-0002-8273-8820Funding
ORCID
The C Factor: cognitive dysfunction as a transdiagnostic dimension in psychopathology. A Abramovitch, T Short, A Schweiger, Clin Psychol Rev. 86102007Abramovitch A, Short T, Schweiger A. 2021. The C Factor: cognitive dysfunction as a transdiagnostic dimension in psychopathology. Clin Psychol Rev. 86:102007.
Accelerated iTBS treatment applied to the left DLPFC in depressed patients results in a rapid volume increase in the left hippocampal dentate gyrus, not driven by brain perfusion. C Baeken, G Wu, H A Sackeim, Brain Stimul. 135Baeken C, Wu G, Sackeim HA. 2020. Accelerated iTBS treat- ment applied to the left DLPFC in depressed patients results in a rapid volume increase in the left hippocampal dentate gyrus, not driven by brain perfusion. Brain Stimul. 13(5):1211-1217.
An efficient and accurate new method for locating the F3 position for prefrontal TMS applications. W Beam, J J Borckardt, S T Reeves, M S George, Brain Stimul. 21Beam W, Borckardt JJ, Reeves ST, George MS. 2009. An effi- cient and accurate new method for locating the F3 position for prefrontal TMS applications. Brain Stimul. 2(1): 50-54.
Alzheimer's Disease Neuroimaging Initiative. 2020. Longitudinal ComBat: a method for harmonizing longitudinal multi-scanner imaging data. J C Beer, N J Tustison, P A Cook, C Davatzikos, Y I Sheline, R T Shinohara, K A Linn, Neuroimage. 220117129Beer JC, Tustison NJ, Cook PA, Davatzikos C, Sheline YI, Shinohara RT, Linn KA, Alzheimer's Disease Neuroimaging Initiative. 2020. Longitudinal ComBat: a method for har- monizing longitudinal multi-scanner imaging data. Neuroimage. 220:117129.
Efficacy of non-invasive brain stimulation on cognitive functioning in brain disorders: a meta-analysis. M J Begemann, B A Brand, B Curcic-Blake, A Aleman, I E Sommer, Psychol Med. 5015Begemann MJ, Brand BA, Curcic-Blake B, Aleman A, Sommer IE. 2020. Efficacy of non-invasive brain stimulation on cog- nitive functioning in brain disorders: a meta-analysis. Psychol Med. 50(15):2465-2486.
Brief visuospatial memory test -revised: professional manual. R Benedict, Psychological Assessment Resources, IncLutz (FLBenedict R. 1997. Brief visuospatial memory test -revised: professional manual. Lutz (FL): Psychological Assessment Resources, Inc.
Effectiveness of theta burst versus high-frequency repetitive transcranial magnetic stimulation in patients with depression (THREE-D): a randomised non-inferiority trial. D M Blumberger, F Vila-Rodriguez, K E Thorpe, K Feffer, Y Noda, P Giacobbe, Y Knyahnytska, S H Kennedy, R W Lam, Z J Daskalakis, Lancet. 391Blumberger DM, Vila-Rodriguez F, Thorpe KE, Feffer K, Noda Y, Giacobbe P, Knyahnytska Y, Kennedy SH, Lam RW, Daskalakis ZJ, et al. 2018. Effectiveness of theta burst versus high-frequency repetitive transcranial magnetic stimulation in patients with depression (THREE-D): a randomised non-inferiority trial. Lancet. 391(10131): 1683-1692.
Neuropsychological testing of cognitive impairment in euthymic bipolar disorder: an individual patient data meta-analysis. C Bourne, O Aydemir, V Balanza-Martinez, E Bora, S Brissos, J T Cavanagh, L Clark, Z Cubukcuoglu, V V Dias, S Dittmann, Acta Psychiatr Scand. 1283Bourne C, Aydemir O, Balanza-Martinez V, Bora E, Brissos S, Cavanagh JT, Clark L, Cubukcuoglu Z, Dias VV, Dittmann S, et al. 2013. Neuropsychological testing of cognitive impairment in euthymic bipolar disorder: an individual patient data meta-analysis. Acta Psychiatr Scand. 128(3): 149-162.
Editorial: non-invasive brain stimulation in the study and modulation of metaplasticity in neurological disorders. M Cantone, G Lanza, F Ranieri, G M Opie, C Terranova, Front Neurol. 12721906Cantone M, Lanza G, Ranieri F, Opie GM, Terranova C. 2021. Editorial: non-invasive brain stimulation in the study and modulation of metaplasticity in neurological disorders. Front Neurol. 12:721906.
Different forms of prefrontal theta burst stimulation for executive function of medication-resistant depression: evidence from a randomized sham-controlled study. C M Cheng, C H Juan, M H Chen, C F Chang, H J Lu, T P Su, Y C Lee, C T Li, Prog Neuropsychopharmacol Biol Psychiatry. 66Cheng CM, Juan CH, Chen MH, Chang CF, Lu HJ, Su TP, Lee YC, Li CT. 2016. Different forms of prefrontal theta burst stimulation for executive function of medication-resistant depression: evidence from a randomized sham-controlled study. Prog Neuropsychopharmacol Biol Psychiatry. 66: 35-40.
California verbal learning test. D C Delis, J H Kramer, E Kaplan, B A Ober, The Psychological CorporationSan Antonio (TX2nd ed., adult versionDelis DC, Kramer JH, Kaplan E, Ober BA. 2000. California ver- bal learning test. 2nd ed., adult version. San Antonio (TX): The Psychological Corporation.
Enhancing cognition with theta burst stimulation. E Demeter, Curr Behav Neurosci Rep. 32Demeter E. 2016. Enhancing cognition with theta burst stimulation. Curr Behav Neurosci Rep. 3(2):87-94.
Meta-analysis of the association between cognitive abilities and everyday functioning in bipolar disorder. C A Depp, B T Mausbach, A L Harmell, G N Savla, C R Bowie, P D Harvey, T L Patterson, Bipolar Disord. 143Depp CA, Mausbach BT, Harmell AL, Savla GN, Bowie CR, Harvey PD, Patterson TL. 2012. Meta-analysis of the associ- ation between cognitive abilities and everyday function- ing in bipolar disorder. Bipolar Disord. 14(3):217-226.
Diagnostic contribution and therapeutic perspectives of transcranial magnetic stimulation in dementia. Di Lazzaro, V Bella, R Benussi, A Bologna, M Borroni, B Capone, F Chen, K S Chen, R Chistyakov, A V Classen, J , Clin Neurophysiol. 13210Di Lazzaro V, Bella R, Benussi A, Bologna M, Borroni B, Capone F, Chen KS, Chen R, Chistyakov AV, Classen J, et al. 2021. Diagnostic contribution and therapeutic perspectives of transcranial magnetic stimulation in dementia. Clin Neurophysiol. 132(10):2568-2607.
An investigation of medial temporal lobe changes and cognition following antidepressant response: a prospective rTMS study. C P Furtado, K E Hoy, J J Maller, G Savage, Z J Daskalakis, P B Fitzgerald, Brain Stimul. 63Furtado CP, Hoy KE, Maller JJ, Savage G, Daskalakis ZJ, Fitzgerald PB. 2013. An investigation of medial temporal lobe changes and cognition following antidepressant response: a prospective rTMS study. Brain Stimul. 6(3): 346-354.
Stroop color and word test: A manual for clinical and experimemtal uses. C J Golden, S M Freshwater, Stoetling CompanyWood Dale (ILGolden CJ, Freshwater SM. 2002. Stroop color and word test: A manual for clinical and experimemtal uses. Wood Dale (IL): Stoetling Company.
Repetitive transcranial magnetic stimulation shows longitudinal improvements in memory in patients with treatment-resistant depression. E C Gregory, I J Torres, D M Blumberger, J Downar, Z J Daskalakis, F Vila-Rodriguez, Neuromodulation. 254Gregory EC, Torres IJ, Blumberger DM, Downar J, Daskalakis ZJ, Vila-Rodriguez F. 2022. Repetitive transcranial mag- netic stimulation shows longitudinal improvements in memory in patients with treatment-resistant depression. Neuromodulation. 25(4):596-605.
A rating scale for depression. M Hamilton, 10.1136/jnnp.23.1.56J Neurol Neurosurg Psychiatry. 231Hamilton M. 1960. A rating scale for depression. J Neurol Neurosurg Psychiatry. 23(1):56-62. 10.1136/jnnp.23.1.56. 14399272
In vivo hippocampal subfield volumes in bipolar disorder-A mega-analysis from the enhancing neuro imaging genetics through meta-analysis bipolar disorder working group. U K Haukvik, T P Gurholt, S Nerland, T Elvsashagen, T N Akudjedu, Alda M Alnaes, D Alonso-Lana, S Bauer, J Baune, B T , Hum Brain Mapp. 431Haukvik UK, Gurholt TP, Nerland S, Elvsashagen T, Akudjedu TN, Alda M, Alnaes D, Alonso-Lana S, Bauer J, Baune BT, et al. 2022. In vivo hippocampal subfield volumes in bipo- lar disorder-A mega-analysis from the enhancing neuro imaging genetics through meta-analysis bipolar disorder working group. Hum Brain Mapp. 43(1):385-398.
Lateralized hippocampal volume increase following high-frequency left prefrontal repetitive transcranial magnetic stimulation in patients with major depression. S Hayasaka, M Nakamura, Y Noda, T Izuno, T Saeki, H Iwanari, Y Hirayasu, Psychiatry Clin Neurosci. 7111Hayasaka S, Nakamura M, Noda Y, Izuno T, Saeki T, Iwanari H, Hirayasu Y. 2017. Lateralized hippocampal volume increase following high-frequency left prefrontal repetitive transcranial magnetic stimulation in patients with major depression. Psychiatry Clin Neurosci. 71(11):747-758.
Efficacy of repetitive transcranial magnetic stimulation with quetiapine in treating bipolar II depression: a randomized, doubleblinded. S H Hu, J B Lai, D R Xu, H L Qi, B S Peterson, A M Bao, C C Hu, M L Huang, J K Chen, N Wei, control study. Sci Rep. 630537Hu SH, Lai JB, Xu DR, Qi HL, Peterson BS, Bao AM, Hu CC, Huang ML, Chen JK, Wei N, et al. 2016. Efficacy of repeti- tive transcranial magnetic stimulation with quetiapine in treating bipolar II depression: a randomized, double- blinded, control study. Sci Rep. 6:30537.
Theta burst stimulation of the human motor cortex. Y Z Huang, M J Edwards, E Rounis, K P Bhatia, J C Rothwell, Neuron. 452Huang YZ, Edwards MJ, Rounis E, Bhatia KP, Rothwell JC. 2005. Theta burst stimulation of the human motor cortex. Neuron. 45(2):201-206.
Bayesian longitudinal segmentation of hippocampal substructures in brain MRI using subject-specific atlases. J E Iglesias, K Van Leemput, J Augustinack, R Insausti, B Fischl, M Reuter, Neuroimage. 141Alzheimer's Disease Neuroimaging InitiativeIglesias JE, Van Leemput K, Augustinack J, Insausti R, Fischl B, Reuter M, Alzheimer's Disease Neuroimaging Initiative. 2016. Bayesian longitudinal segmentation of hippocampal substructures in brain MRI using subject-specific atlases. Neuroimage. 141:542-555.
Effects of high-frequency transcranial magnetic stimulation for cognitive deficit in schizophrenia: a metaanalysis. Front Psychiatry. Y Jiang, Z Guo, G Xing, L He, H Peng, F Du, M A Mcclure, Q Mu, 10135Jiang Y, Guo Z, Xing G, He L, Peng H, Du F, McClure MA, Mu Q. 2019. Effects of high-frequency transcranial magnetic stimulation for cognitive deficit in schizophrenia: a meta- analysis. Front Psychiatry. 10:135.
Cognitive enhancement in neurological and psychiatric disorders using transcranial magnetic stimulation (TMS): a review of modalities, potential mechanisms and future implications. T D Kim, G Hong, J Kim, S Yoon, Exp Neurobiol. 281Kim TD, Hong G, Kim J, Yoon S. 2019. Cognitive enhance- ment in neurological and psychiatric disorders using transcranial magnetic stimulation (TMS): a review of modalities, potential mechanisms and future implications. Exp Neurobiol. 28(1):1-16.
Theta-burst stimulation for cognitive enhancement in Parkinson's disease with mild cognitive impairment: a randomized, double-blind, sham-controlled trial. S Lang, L S Gan, E J Yoon, A Hanganu, M Kibreab, J Cheetham, T Hammer, I Kathol, J Sarna, D Martino, Front Neurol. 11584374Lang S, Gan LS, Yoon EJ, Hanganu A, Kibreab M, Cheetham J, Hammer T, Kathol I, Sarna J, Martino D, et al. 2020. Theta-burst stimulation for cognitive enhancement in Parkinson's disease with mild cognitive impairment: a randomized, double-blind, sham-controlled trial. Front Neurol. 11:584374.
The effects of theta burst stimulation (TBS) targeting the prefrontal cortex on executive functioning: a systematic review and meta-analysis. C J Lowe, F Manocchio, A B Safati, P A Hall, Neuropsychologia. 111Lowe CJ, Manocchio F, Safati AB, Hall PA. 2018. The effects of theta burst stimulation (TBS) targeting the prefrontal cortex on executive functioning: a systematic review and meta-analysis. Neuropsychologia. 111:344-359.
Cognitive enhancing effects of rTMS administered to the prefrontal cortex in patients with depression: a systematic review and meta-analysis of individual task effects. D M Martin, S M Mcclintock, J J Forster, T Y Lo, C K Loo, Depress Anxiety. 3411Martin DM, McClintock SM, Forster JJ, Lo TY, Loo CK. 2017. Cognitive enhancing effects of rTMS administered to the prefrontal cortex in patients with depression: a systematic review and meta-analysis of individual task effects. Depress Anxiety. 34(11):1029-1039.
Efficacy of active vs sham intermittent theta burst transcranial magnetic stimulation for patients with bipolar depression: a randomized clinical trial. A Mcgirr, F Vila-Rodriguez, Cole J Torres, I J Arumugham, S S Keramatian, K Saraf, G Lam, R W Chakrabarty, T Yatham, L N , JAMA Netw Open. 43210963McGirr A, Vila-Rodriguez F, Cole J, Torres IJ, Arumugham SS, Keramatian K, Saraf G, Lam RW, Chakrabarty T, Yatham LN. 2021. Efficacy of active vs sham intermittent theta burst transcranial magnetic stimulation for patients with bipolar depression: a randomized clinical trial. JAMA Netw Open. 4(3):e210963.
Repetitive transcranial magnetic stimulation for cognitive function in adults with bipolar disorder: a pilot study. R S Mcintyre, Y Lee, N B Rodrigues, F Nasri, G Lao, W Zeng, B Ye, R Li, J D Rosenblat, R B Mansur, J Affect Disord. 293McIntyre RS, Lee Y, Rodrigues NB, Nasri F, Lao G, Zeng W, Ye B, Li R, Rosenblat JD, Mansur RB, et al. 2021. Repetitive transcranial magnetic stimulation for cognitive function in adults with bipolar disorder: a pilot study. J Affect Disord. 293:73-77.
Individualized theta-burst stimulation modulates hippocampal activity and connectivity in patients with major depressive disorder. C Mielacher, J Schultz, M Kiebs, T Dellert, A Metzner, L Graute, H H€ Ogenauer, W Maier, C Lamm, R Hurlemann, Per Med Psychiatry. Mielacher C, Schultz J, Kiebs M, Dellert T, Metzner A, Graute L, H€ ogenauer H, Maier W, Lamm C, Hurlemann R. 2020. Individualized theta-burst stimulation modulates hippo- campal activity and connectivity in patients with major depressive disorder. Per Med Psychiatry. 23-24:100066.
Methodological recommendations for cognition trials in bipolar disorder by the international society for bipolar disorders targeting cognition task force. K W Miskowiak, K E Burdick, A Martinez-Aran, C M Bonnin, C R Bowie, A F Carvalho, P Gallagher, B Lafer, C Lopez-Jaramillo, T Sumiyoshi, Bipolar Disord. 198Miskowiak KW, Burdick KE, Martinez-Aran A, Bonnin CM, Bowie CR, Carvalho AF, Gallagher P, Lafer B, Lopez- Jaramillo C, Sumiyoshi T, et al. 2017. Methodological rec- ommendations for cognition trials in bipolar disorder by the international society for bipolar disorders targeting cognition task force. Bipolar Disord. 19(8):614-626.
Cognitive outcomes of TMS treatment in bipolar depression: safety data from a randomized controlled trial. M L Myczkowski, A Fernandes, M Moreno, L Valiengo, B Lafer, R A Moreno, F Padberg, W Gattaz, A R Brunoni, J Affect Disord. 235Myczkowski ML, Fernandes A, Moreno M, Valiengo L, Lafer B, Moreno RA, Padberg F, Gattaz W, Brunoni AR. 2018. Cognitive outcomes of TMS treatment in bipolar depres- sion: safety data from a randomized controlled trial. J Affect Disord. 235:20-26.
Assessing the effects of continuous theta burst stimulation over the dorsolateral prefrontal cortex on human cognition: a systematic review. R Ngetich, J Zhou, J Zhang, Jin Z Li, L , Front Integr Neurosci. 1435Ngetich R, Zhou J, Zhang J, Jin Z, Li L. 2020. Assessing the effects of continuous theta burst stimulation over the dorsolateral prefrontal cortex on human cognition: a sys- tematic review. Front Integr Neurosci. 14:35.
Enhanced theta-gamma coupling associated with hippocampal volume increase following high-frequency left prefrontal repetitive transcranial magnetic stimulation in patients with major depression. Y Noda, R Zomorrodi, Z J Daskalakis, D M Blumberger, M Nakamura, Int J Psychophysiol. 133Noda Y, Zomorrodi R, Daskalakis ZJ, Blumberger DM, Nakamura M. 2018. Enhanced theta-gamma coupling associated with hippocampal volume increase following high-frequency left prefrontal repetitive transcranial mag- netic stimulation in patients with major depression. Int J Psychophysiol. 133:169-174.
The MATRICS consensus cognitive battery, part 1: test selection, reliability, and validity. K H Nuechterlein, M F Green, R S Kern, L E Baade, D M Barch, J D Cohen, S Essock, W S Fenton, J M Gold, Am J Psychiatry. 1652Nuechterlein KH, Green MF, Kern RS, Baade LE, Barch DM, Cohen JD, Essock S, Fenton WS, Frese FJ 3rd, Gold JM, et al. 2008. The MATRICS consensus cognitive battery, part 1: test selection, reliability, and validity. Am J Psychiatry. 165(2):203-213.
Structural changes in the hippocampus as a biomarker for cognitive improvements in neuropsychiatric disorders: a systematic review. C V Ott, C B Johnson, J Macoveanu, K Miskowiak, Eur Neuropsychopharmacol. 293Ott CV, Johnson CB, Macoveanu J, Miskowiak K. 2019. Structural changes in the hippocampus as a biomarker for cognitive improvements in neuropsychiatric disorders: a systematic review. Eur Neuropsychopharmacol. 29(3): 319-329.
The halstead-reitan neuropsychological test battery. R M Reitan, D Wolfson, Neuropsychology PressTucson (AZReitan RM, Wolfson D. 1985. The halstead-reitan neuro- psychological test battery. Tucson (AZ): Neuropsychology Press.
Withinsubject template estimation for unbiased longitudinal image analysis. M Reuter, N J Schmansky, H D Rosas, B Fischl, Neuroimage. 614Reuter M, Schmansky NJ, Rosas HD, Fischl B. 2012. Within- subject template estimation for unbiased longitudinal image analysis. Neuroimage. 61(4):1402-1418.
Non-invasive electrical and magnetic stimulation of the brain, spinal cord, roots and peripheral nerves: basic principles and procedures for routine clinical and research application. An updated report from an I.F.C.N. Committee. P M Rossini, D Burke, R Chen, L G Cohen, Z Daskalakis, Di Iorio, R , Di Lazzaro, V Ferreri, F Fitzgerald, P B George, M S , Clin Neurophysiol. 1266Rossini PM, Burke D, Chen R, Cohen LG, Daskalakis Z, Di Iorio R, Di Lazzaro V, Ferreri F, Fitzgerald PB, George MS, et al. 2015. Non-invasive electrical and magnetic stimula- tion of the brain, spinal cord, roots and peripheral nerves: basic principles and procedures for routine clinical and research application. An updated report from an I.F.C.N. Committee. Clin Neurophysiol. 126(6):1071-1107.
Role of rTMS in the treatment of cognitive impairments in bipolar disorder and schizophrenia: a review of randomized controlled trials. D Sciortino, A Pigoni, G Delvecchio, E Maggioni, G Schiena, P Brambilla, J Affect Disord. 280Pt ASciortino D, Pigoni A, Delvecchio G, Maggioni E, Schiena G, Brambilla P. 2021. Role of rTMS in the treatment of cogni- tive impairments in bipolar disorder and schizophrenia: a review of randomized controlled trials. J Affect Disord. 280(Pt A):148-155.
Hippocampal formation volume, its subregions, and its specific contributions to visuospatial memory tasks. T Shavitt, Ins Johnson, M C Batistuzzo, e9481, 431x20209481. Epub. 53Shavitt T, Johnson INS, Batistuzzo MC. 2020. Hippocampal formation volume, its subregions, and its specific contri- butions to visuospatial memory tasks. Braz J Med Biol Res. 53(9):e9481, 431x20209481. Epub 2020 Jul 24.
The mini-international neuropsychiatric interview (M.I.N.I.): the development and validation of a structured diagnostic psychiatric interview for DSM-IV and ICD-10. D V Sheehan, Y Lecrubier, K H Sheehan, P Amorim, J Janavs, E Weiller, T Hergueta, R Baker, G C Dunbar, J Clin Psychiatry. 59Suppl 20):22, 33; quiz 34-57Sheehan DV, Lecrubier Y, Sheehan KH, Amorim P, Janavs J, Weiller E, Hergueta T, Baker R, Dunbar GC. 1998. The mini-international neuropsychiatric interview (M.I.N.I.): the development and validation of a structured diagnostic psychiatric interview for DSM-IV and ICD-10. J Clin Psychiatry. 59(Suppl 20):22, 33; quiz 34-57.
Hippocampal-targeted theta-burst stimulation enhances associative memory formation. A Tambini, D E Nee, D Esposito, M , J Cogn Neurosci. 3010Tambini A, Nee DE, D'Esposito M. 2018. Hippocampal-tar- geted theta-burst stimulation enhances associative mem- ory formation. J Cogn Neurosci. 30(10):1452-1472.
How to design optimal accelerated rTMS protocols capable of promoting therapeutically beneficial metaplasticity. A C Thomson, A T Sack, Front Neurol. 11599918Thomson AC, Sack AT. 2020. How to design optimal acceler- ated rTMS protocols capable of promoting therapeutically beneficial metaplasticity. Front Neurol. 11:599918.
Neuropsychological functioning in euthymic bipolar disorder: a meta-analysis. I J Torres, V G Boudreau, L N Yatham, Acta Psychiatr Scand. Suppl (434Torres IJ, Boudreau VG, Yatham LN. 2007. Neuropsychological functioning in euthymic bipolar disorder: a meta-analysis. Acta Psychiatr Scand. Suppl (434):17-26.
Transcranial magnetic stimulation improves cognition over time in Parkinson's disease. J Trung, A Hanganu, S Jobert, C Degroot, B Mejia-Constain, M Kibreab, M A Bruneau, A L Lafontaine, A Strafella, O Monchi, Parkinsonism Relat Disord. 66Trung J, Hanganu A, Jobert S, Degroot C, Mejia-Constain B, Kibreab M, Bruneau MA, Lafontaine AL, Strafella A, Monchi O. 2019. Transcranial magnetic stimulation improves cognition over time in Parkinson's disease. Parkinsonism Relat Disord. 66:3-8.
Highfrequency versus theta burst transcranial magnetic stimulation for the treatment of poststroke cognitive impairment in humans. P Y Tsai, W S Lin, K T Tsai, C Y Kuo, P H Lin, J Psychiatry Neurosci. 454Tsai PY, Lin WS, Tsai KT, Kuo CY, Lin PH. 2020. High- frequency versus theta burst transcranial magnetic stimulation for the treatment of poststroke cognitive impairment in humans. J Psychiatry Neurosci. 45(4): 262-270.
Meta-analysis of predictors of favorable employment outcomes among individuals with bipolar disorder. S Tse, S Chan, K L Ng, L N Yatham, Bipolar Disord. 163Tse S, Chan S, Ng KL, Yatham LN. 2014. Meta-analysis of pre- dictors of favorable employment outcomes among individuals with bipolar disorder. Bipolar Disord. 16(3): 217-229.
Targeted enhancement of cortical-hippocampal brain networks and associative memory. J X Wang, L M Rogers, E Z Gross, A J Ryals, M E Dokucu, K L Brandstatt, M S Hermiller, J L Voss, Science. 3456200Wang JX, Rogers LM, Gross EZ, Ryals AJ, Dokucu ME, Brandstatt KL, Hermiller MS, Voss JL. 2014. Targeted enhancement of cortical-hippocampal brain networks and associative memory. Science. 345(6200):1054-1057.
Improved Cognitive Promotion through Accelerated Magnetic Stimulation. X Wu, L Wang, Z Geng, L Wei, Y Yan, C Xie, X Chen, G-J Ji, Y Tian, K Wang, 10.1523/ENEURO.0392-20.2020eNeuro. 81Wu X, Wang L, Geng Z, Wei L, Yan Y, Xie C, Chen X, Ji G-J, Tian Y, Wang K. 2021. Improved Cognitive Promotion through Accelerated Magnetic Stimulation. eNeuro. 8(1): ENEURO.0392-20.2020 10.1523/ENEURO.0392-20.2020.
High-frequency repetitive transcranial magnetic stimulation (rTMS) improves neurocognitive function in bipolar disorder. L L Yang, D Zhao, L L Kong, Y Q Sun, Z Y Wang, Y Y Gao, N Li, L Lu, L Shi, X Y Wang, J Affect Disord. 246Yang LL, Zhao D, Kong LL, Sun YQ, Wang ZY, Gao YY, Li N, Lu L, Shi L, Wang XY, et al. 2019. High-frequency repeti- tive transcranial magnetic stimulation (rTMS) improves neurocognitive function in bipolar disorder. J Affect Disord. 246:851-856.
Lurasidone versus treatment as usual for cognitive impairment in euthymic patients with bipolar I disorder: a randomised, open-label, pilot study. L N Yatham, S Mackala, J Basivireddy, S Ahn, N Walji, C Hu, R W Lam, I J Torres, Lancet Psychiatry. 43Yatham LN, Mackala S, Basivireddy J, Ahn S, Walji N, Hu C, Lam RW, Torres IJ. 2017. Lurasidone versus treatment as usual for cognitive impairment in euthymic patients with bipolar I disorder: a randomised, open-label, pilot study. Lancet Psychiatry. 4(3):208-217.
The international society for bipolar disorders-battery for assessment of neurocognition (ISBD-BANC). L N Yatham, I J Torres, G S Malhi, S Frangou, D C Glahn, C E Bearden, K E Burdick, A Martinez-Aran, S Dittmann, J F Goldberg, Bipolar Disord. 124Yatham LN, Torres IJ, Malhi GS, Frangou S, Glahn DC, Bearden CE, Burdick KE, Martinez-Aran A, Dittmann S, Goldberg JF, et al. 2010. The international society for bipolar disorders-battery for assessment of neurocognition (ISBD-BANC). Bipolar Disord. 12(4):351-363.
Canadian network for mood and anxiety treatments (CANMAT) and international society for bipolar disorders (ISBD) 2018 guidelines for the management of patients with bipolar disorder. L N Yatham, S H Kennedy, S V Parikh, A Schaffer, D J Bond, B N Frey, V Sharma, B I Goldstein, S Rej, S Beaulieu, Bipolar Disord. 202Yatham LN, Kennedy SH, Parikh SV, Schaffer A, Bond DJ, Frey BN, Sharma V, Goldstein BI, Rej S, Beaulieu S, et al. 2018. Canadian network for mood and anxiety treatments (CANMAT) and international society for bipolar disorders (ISBD) 2018 guidelines for the management of patients with bipolar disorder. Bipolar Disord. 20(2):97-170.
| Background Modulation of the serotonergic system affects long-term potentiation (LTP) and long-term depression (LTD), the likely neurophysiologic derivates of learning and memory formation, in animals and slice preparations. Serotonin-dependent modulation of plasticity has been proposed as an underlying mechanism for depression. However, direct knowledge about the impact of serotonin on neuroplasticity in humans is missing. Here we explore the impact of the serotonin reuptake blocker citalopram on plasticity induced by transcranial direct current stimulation (tDCS) in humans in a single-blinded, placebo-controlled, randomized crossover study. Methods In 12 healthy subjects, anodal excitability-enhancing or cathodal excitability-diminishing tDCS was applied to the motor cortex under a single dose of 20-mg citalopram or placebo medication. Motor cortex excitability was monitored by single-pulse transcranial magnetic stimulation (TMS). Results Under placebo medication, anodal tDCS enhanced, and cathodal tDCS reduced, excitability for about 60–120 min. Citalopram enhanced and prolonged the facilitation induced by anodal tDCS, whereas it turned cathodal tDCS-induced inhibition into facilitation. Conclusions Serotonin has a prominent impact on neuroplasticity in humans, which is in favor for facilitatory plasticity. Taking into account serotonergic hypoactivity in depression, this might explain deficits of learning and memory formation. Moreover, the results suggest that for therapeutic brain stimulation in depression and other neuropsychiatric diseases (e.g., in neurorehabilitation), serotonergic reinforcement may enhance facilitatory aftereffects and thereby increase the efficacy of these tools. | Background: Repetitive transcranial magnetic stimulation (rTMS) is an established treatment for major depressive disorder (MDD), but its clinical efficacy remains rather modest. One reason for this could be that the propagation of rTMS effects via structural connections from the stimulated area to deeper brain structures (such as the cingulate cortices) is suboptimal. Methods: We investigated whether structural connectivity -derived from diffusion MRI data -could serve as a biomarker to predict treatment response. We hypothesized that stronger structural connections between the patient-specific stimulation position in the left dorsolateral prefrontal cortex (dlPFC) and the cingulate cortices would predict better clinical outcomes. We applied accelerated intermittent theta burst stimulation (aiTBS) to the left dlPFC in 40 patients with MDD. We correlated baseline structural connectivity, quantified using various metrics (fractional anisotropy, mean diffusivity, tract density, tract volume and number of tracts), with changes in depression severity scores after aiTBS. Results: Exploratory results (p < 0.05) showed that structural connectivity between the patient-specific stimulation site and the caudal and posterior parts of the cingulate cortex had predictive potential for clinical response to aiTBS. Limitations: We used the diffusion tensor to perform tractography. A main limitation was that multiple fibre directions within voxels could not be resolved, which might have led to missing connections in some patients. Conclusion: Stronger structural frontocingular connections may be of essence to optimally benefit from left dlPFC rTMS treatment in MDD. Even though the results are promising, further investigation with larger numbers of patients, more advanced tractography algorithms and classic daily rTMS treatment paradigms is warranted. Clinical trial registration: http://clinicaltrials.gov/show/NCT01832805 | Currently approved repetitive transcranial magnetic stimulation (rTMS) protocols for the treatment of major depressive disorder (MDD) involve once-daily (weekday) stimulation sessions, with 10 Hz or intermittent theta burst stimulation (iTBS) frequencies, over 4-6 weeks. Recently, accelerated treatment protocols (multiple daily stimulation sessions for 1-2 weeks) have beenThis is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). increasingly studied to optimize rTMS treatments. Accelerated protocols might confer unique advantages for adolescents and young adults but there are many knowledge gaps related to dosing in this age group. Off-label, clinical practice frequently outpaces solid evidence as rigorous clinical trials require substantial time and resources. Murine models present an opportunity for high throughput dose finding studies to focus subsequent clinical trials in humans. This project investigated the brain and behavioural effects of an accelerated low-intensity rTMS (LI-rTMS) protocol in a young adult rodent model of chronic restraint stress (CRS). Depression and anxietyrelated behaviours were induced in young adult male Sprague Dawley rats using the CRS model, followed by the 3-times-daily delivery of 10 Hz LI-rTMS, for two weeks. Behaviour was assessed using the Elevated Plus Maze and Forced Swim Test, and functional, chemical, and structural brain changes measured using magnetic resonance imaging techniques. CRS induced an agitated depression-like phenotype but therapeutic effects from the accelerated protocol were not detected. Our findings suggest that the age of rodents may impact response to CRS and LI-rTMS. Future studies should also examine higher intensities of rTMS and accelerated theta burst protocols. | Does repetitive transcranial magnetic stimulation have a positive effect on working memory and neuronal activation in treatment of negative symptoms of schizophrenia | Post-traumatic stress disorder (PTSD) is a psychiatric disorder that causes significant functional impairment and is related to altered stress response and reinforced learned fear behavior. PTSD has been found to impact three functional networks in the brain: default mode, executive control, and salience. The executive control network includes the dorsolateral prefrontal cortex (DLPFC) and lateral PPC. The salience network involves the anterior cingulate cortex, anterior insula, and amygdala. This latter network has been found to have increased functional connectivity in PTSD. Transcranial Magnetic Stimulation (TMS) is a technique used in treating PTSD and involves stimulating specific portions of the brain through electromagnetic induction. Currently, high-frequency TMS applied to the left dorsolateral prefrontal cortex (DLPFC) is approved for use in treating major depressive disorder (MDD) in patients who have failed at least one medication trial. In current studies, high-frequency stimulation has been shown to be more effective in PTSD rating scales posttreatment than low-frequency stimulation. The most common side effect is headache and scalp pain treated by mild analgesics. Seizures are a rare side effect and are usually due to predisposing factors. Studies have been done to assess the overall efficacy of TMS. However, results have been conflicting, and sample sizes were small. More research should be done with larger sample sizes to test the efficacy of TMS in the treatment of PTSD. Overall, TMS is a relatively safe treatment. Currently, the only FDA-approved to treat refractory depression, but with the potential to treat many other conditions. | Study design and methodology for a multicentre, randomised controlled trial of transcranial direct current stimulation as a treatment for unipolar and bipolar depression. | Introduction: Repetitive Transcranial magnetic stimulation (rTMS) is an FDA approved treatment for major depressive disorder (MDD). However, neural mechanisms contributing to rTMS effects on depressive symptoms, cognition, and behavior are unclear. Proton magnetic resonance spectroscopy (MRS), a noninvasive neuroimaging technique measuring concentrations of biochemical compounds within the brain in vivo, may provide mechanistic insights. Methods: This systematic review summarized published MRS findings from rTMS treatment trials to address potential neurometabolic mechanisms of its antidepressant action. Using PubMed, Google Scholar, Web of Science, and JSTOR, we identified twelve empirical studies that evaluated changes in MRS metabolites in a withinsubjects, pre-vs. post-rTMS treatment design in patients with MDD. Results: rTMS protocols ranged from four days to eight weeks duration, were applied at high frequency to the left dorsolateral prefrontal cortex (DLPFC) in most studies, and were conducted in patients aged 13-to-70. Most studies utilized MRS point resolved spectroscopy acquisitions at 3 Tesla in the bilateral anterior cingulate cortex and DLPFC. Symptom improvements were correlated with rTMS-related increases in the concentration of glutamatergic compounds (glutamate, Glu, and glutamine, Gln), GABA, and N-acetylated compounds (NAA), with some results trend-level. Conclusions: This is the first in-depth systematic review of metabolic effects of rTMS in individuals with MDD. The extant literature suggests rTMS stimulation does not produce changes in neurometabolites independent of clinical response; increases in frontal lobe glutamatergic compounds, N-acetylated compounds and GABA following high frequency left DLPFC rTMS therapy were generally associated with clinical improvement. Glu, Gln, GABA, and NAA may mediate rTMS treatment effects on MDD symptomatology through intracellular mechanisms. | Objective: Studies of the cognitive effects of electroconvulsive therapy (ECT) have resulted in controversial findings up to now, partly because researchers and reviewers have not always made a clear distinction among various aspects of cognition and because there are many parameters involved in the administration of ECT that have a potential impact on cognition. The present study focused on the impact of sine and pulse waveforms on anterograde memory and nonmemory cognitive functions. Methods: We assigned 18 patients with unipolar major depression or bipolar I or II disorder, most recent episode depressed, to receive sine wave or pulse wave ECT and assessed their cognitive function before and after ECT, using a neuropsychologic test battery that measured anterograde memory, attention, and executive functions. Outcomes were measured, on average, 8.2 days after the last ECT session. Results: Both waveforms were equally effective in alleviating depression. Those who received sine wave ECT showed statistically significant deterioration in attention and executive tasks, such as the Stroop test, which measures selective attention (P = 0.02), and the dual task, which taps divided attention (P = 0.01). On the other hand, those who received pulse wave ECT improved to a significant degree in certain memory tasks, such as visual memory (P = 0.01) and general memory (P = 0.01) of the Wechsler Memory Scale-Revised (WMS-R), as well as in the dual task (P = 0.01). The between-group comparison revealed robust superiority of the pulse wave over the sine wave in terms of the dual task (P = 0.004). Conclusions: Anterograde memory improved to a statistically significant or nonsignificant degree at 1 week post-ECT in comparison with pre-ECT regardless of waveforms. Attention/executive functions tended to deteriorate with sine wave ECT but improved with pulse wave ECT. |
1,999,991 | The Sons of Beasts is a great suspenseful story | Fantastic story. Tight. Well written. First person narrative from Owen Pitt's, our protagonist, viewpoint. Monsters are real and he joins a group that hunts them after a close encounter with a werewolf. Nobody does it better than Larry Correia. | Fun book & full of nostalgia. Not highly frightening although there IS a ghost or or two. It's not really a horror story though but it's a good read. | I liked the different tales of the animals. I especially liked the baboons raising a lion cub. The drama between the different groups of animals was intense and at times very sad. A very good read for animal lovers that want to see the inside world of wild animals. | Monsters in North America is a rather good read that is both fascinating and very interesting. It's not the greatest book on American Monsters but it is a fun read none the less. | Monster Zoo tells the story of Ty, a skinny high-schooler who's trip to the zoo takes an unexpected turn for the paranormal. Fighting back a zoo-load of monster-fied animals, Ty's courage, and bravery shine through his akward teenager exterior.
Okay, why did I like this book so much? First of all, it has believable-yet-unique characters. TenNapel gives depth to these characters through good dialogue, subtle and overt story moments, and solid artwork. The story telling is TIGHT! The story moves along at a good pace without feeling rushed or overworked. It's compelling and cinematic - a movie on paper. Lastly, TenNapel's artwork is outstanding. I love the imaginative designs of the monster-animals, and the clarity with which he lays out panels and pages. TenNapel's visual language crossbreeds Bill Watterson's loose, gestural brushwork with Mike Mignola's tight sense of composition.
In conclusion, I loved Monster Zoo. It's Jurassic Park meets Evil Dead. A blast to read! | The 21 tales gathered in this colleciton run the gamut of the Victorian Eras fascination with death, the supernatural and all things that cause fright in some way. From chilling ghost tales, including "The Ship That Saw A Ghost" by Frank Norris, "The Corpse Light" by Dick Donovan and "The Haunted Chair" by Richard Marsh to a potential mutiny in "Coolies" by W. Carlton Dawe, a unique foray in science fiction called "The Battle of the Monsters" by Morgan Robertson and an interesting way to end a marriage in "An Alpine Divorce" by Robert Barr. These stories highlight some of the best and sometimes overlooked writers -- both male and female -- including Guy de Maupassant, Ambrose Bierce, Rhoda Broughton, and Erckmann-Chatrian. Filled with rich descriptions and an almost palpable sense of terror, these tales will delight readers of Victorian literature and terror/horror fans alike. | A compelling thriller wonderfully written .you are brought into the world of elephants survival and the poachers who hunt them. | New twists on vampire mythology. Very clever with excellent historical elements. A satisfying read in this genre. | 1,999,991 | The Sons of Beasts is a great suspenseful story. I lived the story through the book. I was attempted to read the end to see the outcome, but I allowed myself to continue through the story. I would have given the book a five star rating but there are editorial flaw with in the book. If the author would correct the flaws and republish, it will be a great piece of fictional writing. For the asking price, it's a good read! | Fantastic Beasts. Read or not read? | Great read! Read the Beast Master series from the ... | The writing was good, but the stories aren't scary or spooky at ... | what is the name of the publisher of the novel of beasts and beasts by ian | Opinions of Seventh Son? (book and movie) | Great For Writers Andor Those Who Enjoyed Watching The Fantastic Beasts Film | A very good read. I enjoyed the book and the true history. The first 25% of the book wasnot as good as the last 75%. | Has anyone read "Last Days" by Adam Nevill? I'm interested in stories about fictitious cults. |
1,999,992 | How often do you get a colonoscopy? | I had a colonoscopy done when I was 22, there were two polyps that were removed. Last year, I got full blood work, scanning of my abdomen and stool sample done and everything was fine. I’m turning in a few months. But I’m just wondering if I should get a colonoscopy regularly, just to be sure?
My country has a testing program for 60+ people, where they get a kit at home to take a stool sample and they can send it to get tested. There was blood in it and he got a colonoscopy (he is fine), but this got me thinking. How many and how regular do you get colonoscopies? | Colonoscopy in octogenarians and older patients | What type of doctor performs a colonoscopy? | Q: How long do you poop after colonoscopy prep solution is taken? A: Most colonoscopy prep solutions begin working two to three hours after they are consumed, although this varies between products. Another dose may be needed if bowel movements do not occur when expected. | AbstractIntroduction: Reliable, valid, and feasible assessment tools are essential to ensure competence in colonoscopy. This study aims to provide an overview of the existing assessment methods and the validity evidence that supports them.Methods: A systematic search was conducted in October 2016. Pubmed, EMBASE, and PsycINFO were searched for studies evaluating assessment methods to ensure competency in colonoscopy. Outcome variables were described and evidence of validity was explored using a contemporary framework.Results: Twenty-five observational studies were included in the systematic review. Most studies were based on small sample sizes. The studies were categorized after outcome measures into five groups: Clinical process related outcome metrics (n = 2), direct observational colonoscopy assessment (n = 8), simulator based metrics (n = 11), automatic computerized metrics (n = 2), and self-assessment (n = 1). Validity score varied among the studies and only five studies presented sufficient evidence... | Objective: To assess the referral practice for surveillance colonoscopy amongst clinicians and to measure whether practice was inline with the current Association of Coloproctology of Great Britain and Ireland (ACPGBI) and the British Society of Gastroenterology (BSG) guidelines. Method: A questionnaire was sent to members of the ACPGBI. Results: A total of 195 (49%) clinicians responded, providing information on their referral habits with comments on where they deviated from the guidelines. Conclusions: The BSG and ACPGBI guidelines are well established amongst clinicians and generally accepted as best practice however the majority of clinicians deviate from the guidelines for particular clinical scenarios. In fact only 18% of respondents followed all recommendations for surveillance colonoscopy for patients with polyps, previous cancers and a family history. | My friend needed the standard Colonoscopy when he turned 40, but he was uninsured. Instead I suggested this product, and it worked magnificently! It was an interesting bonding experience, seeing a new side of my friend, but all in all, it was alright.
I DO RECOMMEND that weird juice stuff to clear out the colon though. First time we tried, we forgot the cleanse, and it was NOT able to get up in there. | I used to be on Linzess, but my insurance rolled over and now its $400 a month, even with their 'discount'. So I've resorted to laxatives about once every 3 weeks. I usually only poop normally once every 2 weeks without it, and it gets so backed up and uncomfortable! How often is it safe to take laxatives like dulcolax? Or should I resort to enemas once a month instead? Anyone have luck with colonics? How often are they safe? I doubt my insurance will cover them...
I dont have enough money to go see my GI doc right now. | 1,999,992 | I’m wondering how often do you get a colonoscopy? Is it once per year, etc.
I had an emergency colonoscopy when I was first diagnosed in 2016 and a follow-up in early 2017. Since then I came out of remission for the first time in 2018 and am wondering if i should ask for another one as a follow-up. | Afraid to get a colonoscopy | Findings at Follow-up Endoscopies in Subjects With Suspected Colorectal Abnormalities: Effects of Baseline Findings and Time to Follow-up | Hi! Question on how often I should be getting checked. | Scared of having a colonoscopy..any advice? | how often do you need to have a ct scan | How regularly should you get checked if you had polyps removed during the last colonoscopy? | Colonoscopy in the management of colon polyps. | Background. Colonoscopy for screening the population at an average risk of colorectal cancer (CRC) is recommended by many leading gastrointestinal associations. Objectives. The objective was to assess the quality, complications and acceptance rate of colonoscopy by patients. Methods. We prospectively gathered data from colonoscopies which were performed between October 2003 and September 2006. Patients were asked to return a follow-up form seven days after the procedure. Those who failed to do so were contacted by phone. Results. 6584 patients were included (50.4% males). The average age of subjects was 57.73 (SD 15.22). CRC screening was the main indication in 12.8%. Cecal intubation was achieved in 92% of patients and bowel preparation was good to excellent in 76.2%. The immediate outcome after colonoscopy was good in 99.4%. Perforations occurred in 3 cases-1 in every 2200 colonoscopies. Significant bleeding occurred in 3 cases (treated conservatively). 94.2% of patients agreed to undergo repeat colonoscopy in the future if indicated. Conclusions. The good quality of examinations, coupled with the low risk for complications and the good acceptance by the patients, encourages us to recommend colonoscopy as a primary screening test for CRC in Israel. |
1,999,993 | how long is the movie laplace's witch | This was a bizarre and freakishly creepy movie. The witches were visually disgusting. Just plain creepy. I was entertained, but it seemed to be predictable toward the end. I definitely wouldn't watch this with young kids in the room. A couple of funny one-liners. Not my favorite movie, but would probably watch it again if I didn't pick something else first. | So, I have a pretty specific itch to scratch.
Me and my girlfriend were talking about watching a movie about witches.
There’s a whole lot of them, if you include movies about quirky witch best friends in a modern setting. The Sabrina type witches are a genre unto itself, and while I don’t disregard them, they’re not what I’m looking for.
There’s also surely a couple movies in medieval setting that features the injustice and religious fervor surrounding witch burning, and I’ll gladly take tips about those as well.
What I’m looking for is a movie that may not even exist, witch is (pun intended), a movie about “witch culture” in a medieval setting or close to it.
Had a harder time than expected finding something like this, so if you got something please let me know!
Edit: Started watching a miniseries called “The mists of Avalon”. | She showed them a rough footage of the situation she wanted them to compose for, which was the last few sequences of the film. The trio used tabla and several other Indian musical instruments for the song, without any synth, to give it an ethnic feel. The song was sung by Shankar, accompanied by Richa Sharma and Jerry McCulley of "Celtic Instruments" described the song as "a sprightly duet", while "SoundtrackNet" said the "aforementioned upbeat vocal number "Gori Re"" is enjoyable in its own way for one who enjoys Indian musical styles. Vanity Fair (2004 film) Vanity Fair is a | The Worst Witch on them in different colours. Miss Hardbroom "transfers" Mildred to her room. Later, Mildred finds that the creature inside her cat basket, a tortoise called Speedy whom she had used her spell on, can still speak. She renames him Einstein and Einstein tells her that he overheard her conversation with Ethel inside the tree. After Mildred runs to tell Maud and Enid the good news, Mildred accidentally leaves her bedroom door open and Einstein escapes. While plodding along the corridor he is discovered by Drusilla Paddock, who takes him to Ethel's room. While Ethel and Drusilla talk, it is revealed | The Worst Witch on them in different colours. Miss Hardbroom "transfers" Mildred to her room. Later, Mildred finds that the creature inside her cat basket, a tortoise called Speedy whom she had used her spell on, can still speak. She renames him Einstein and Einstein tells her that he overheard her conversation with Ethel inside the tree. After Mildred runs to tell Maud and Enid the good news, Mildred accidentally leaves her bedroom door open and Einstein escapes. While plodding along the corridor he is discovered by Drusilla Paddock, who takes him to Ethel's room. While Ethel and Drusilla talk, it is revealed | money then quickly moves behind her and fires the tack-filled rifle into Mabel's posterior with stinging accuracy, then begins spanking her with the butt end of the rifle while calling her a "jezebel" as the two timer wails in agony. "Rusty Romeos" is a remake of 1952's "Corny Casanovas", using ample stock footage from the original. New footage was shot in two days on February 12–13, 1957. Director Jules White was known for including many violent jokes revolving around the buttocks. Many other Columbia directors felt this type of humor was crass, and often shied away from it. However, White | So my girlfriend wants us to watch a movie that she first saw somewhere between 2004 and 2007 based on Faust. She thinks that Rowan Atkinson may have been involved, but IMDB came up empty for me on that front. One of the main things that's sticking out to her is that the production used marionettes for a lot of the demons. It was a very visual film from what she remembers, but that's about it. Help! | Season of the Witch (2011 film) on its opening weekend in the United States and Canada. The film was released in 2,816 theaters in the two territories. It grossed , ranking third at the box office after "True Grit" and "Little Fockers", which were both released at the end of 2010. Relativity Media's exit polling showed that the audience was 52% male and that 61% were 25 years old and up. The "Los Angeles Times" reported that an "unusually high" 69% of the audience was nonwhite. "Entertainment Weekly" reported that the racial diversity of "Season of the Witch"s audiences was common for supernatural thrillers; the breakdown | 1,999,993 | that never quite develops its multiple story threads"and concluded that "at two hours the film long overstays its welcome." Laplace's Witch (film) When two people are poisoned with hydrogen sulfide, the police call in the aid of the geochemistry professor Shusuke Aoe to solve the mystery of their deaths. Filming began on March 16, 2017, and lasted until April 2017. The film received generally negative reviews, with most reviewers pointing out the difference in quality between it and Miike's other work. In a review for "Yahoo! Lifestyle", reviewer Marcus Goh stated that the main problem with the film "is that | Movie about witches, in medieval setting, but not entirely focused on witch burning. | Even in shows about witchcraft they still make pagans out to be the bad guys (the chilling adventures of Sabrina) (small rant) | what is mary warren attacking in the crucible 1996 | when does the worst witch season 2 start | what happened to the girl in forgiven not forgotten | what was the drug in not that kind of girl | Why does the witch cry in left 4 dead 2? | Unlike "Other" witch detective books that got boring in a short time |
1,999,994 | These were a nice fit and look great | These were very nice, especially considering the price. They fit as expected, maybe a little snug. Good material and they kept out the cold. | they were cheap (cost wise), they fit good, they look good. | Great fit and quality. I was apprehensive when I purchased as to how they would fit and the quality. It's very good and I will be buying more. | they fit good I like them very much thank you but I thought the price was a little high | They fit perfectly where I needed them, great quality construction, and easy to install. | Got my item a day before. They look great and fit perfectly
Thanks | Love them. Was kind of nervous if they would fit or not but I was not disappointment. The fit is great. | Perfect! Arrived on time, in great shape, excellent fit, they are exactly what I was looking for. Lightweight, easy to put on and look great for the office! | 1,999,994 | These were a nice fit and look great. After swimming daily in a chlorinated pool for a couple of months there has been no fading. | There has been no fading after several months and the fit was perfect! | These fit great and do not fade like the cheaper ones on ... | They fade quickly in the sunlight. I use these ... | -Colors haven't faded and I like the ones that I picked -Sturdy material and not ... | They feel a little snug when you first put them on but after using them 3 times now (about 120 lengths of the pool using a kick board) they feel fine. I really like these fins and will be ... | Terrible fading in 6 months of San Diego back yard | faded after being outdoors for less than 24 hours. ... | I've heard it faded easily. I do a lot of swim aerobics so ... |
1,999,995 | These are really nice magnetic labels | Labels were just as advertised. They are iron on and that I plan to sew them on, but the iron on keeps them in place while I sew. | These labels are great! They are also a huge savings off of the name brand! Will absolutely buy them again. | These labels are so cool. I love the different shapes! They're actually larger than I expected and I will be using them on jars given away as gifts (inside the jars are "mixes" for hot cocoa, cookies, etc.). So awesome! | I bought these for re-labeling our growing collection of ex-library books (mostly children's books). They're working great! Read more about it in my blog post: [...] | Great size with lots of labels. They are so functional that I ordered a second set. I read they had questionable magnetic strength. I have discovered that the closer you place them next to each other, the stronger they fix in place. | Great product, great shipping time. Manufacturer forgot to put "front" and "rear" labels on which makes it difficult to put on at night and or by yourself. Even the low dollar car covers have labels! | Very nice. Price is right and the magnets are very very strong as advertised by seller. I am very happy with them.
I bought these 2 years ago. I loved them then and I still think they are the most useful item to have on hand. I still have not used them for their intended purpose (holding a badge) but I have found so many creative ways to use them.
I do film/video and have used them to:
To attach Lav mics to my talent.
To attach Gels to my lights
To temporary hold together back drops and props
These are handy wonderful magnets to have on hand and I bet they even work for name tags. ;-) | Great magnets! These have excellent hold strength and are super easy to work with. Sometimes magnets from this company arrive as shown in the bubble packs. In this case they are a wee bit larger and have squared edges. Sometimes they arrive in a cardboard box, same quantity, with beveled edges. No difference in quality, and frankly I prefer the beveled ones that come in the plain packaging just for ease of use in making buttons. | 1,999,995 | These are really nice magnetic labels. I read the measurements and was expecting EACH label to 9 inches across. They are actually about 4 1/2 inches Each. They are very nice, I was wanting larger labels for subject objectives and these are to small for that. I'm sure I can find another use though. Love the chevron. | I like the size and shape of these little labels | 23 feet of label tape makes a lot of labels! | Nice larger sized labels. | The labels are adorable and are great sizes | Great for creating near small labels | These labels are so cool. I love the different shapes | WHY DON'T THEY LABEL THESE WITH MEASUREMENTS | Perfect spice labels for my 3 1/2 oz |
1,999,996 | Who were the three artists who influenced van gogh's work? | What influenced Vincent Van Gogh's art making? | What medium did vincent van gogh work with? | What was vincent van goghs techniques? | What media did van gogh prefer to work with? | Was vincent van gogh a impressionist painter? | How did Vincent Van Gogh got famous on his paint? | What are van goghs most famous paintings? | Why did van gogh paint the chair 1888? | 1,999,996 | Who are the three artists who influenced van Gogh's work? | Which artists influenced Vincent van goghs art? | How did Van Gogh change the art of today? | What is van gogh's most famouse paining? | 5 intresting facts about van gogh? | Was vincent van gogh an impressionest surrealest or a expressionist? | The Influence of Gardens on Van Gogh | What was Vincent Van Gogh art medium? | What was the media that was by van gogh? |
1,999,997 | This book provides objective data on how to tell when ... | How can information timely? | Providing a wide-ranging introduction to the use of linear models in analyzing data, this text presents a vector space and projections approach to the subject. The topics covered include ANOVA, estimation, hypothesis testing, multiple comparison, regression analysis, and experimental design. Also covered are: testing for lack of fit; models with singular covariance matrices; variance component estimation; best linear prediction; colinearity; and variable selection. | Analysis of the data is an important stage in any research project. Statistical analysis allows us to summarize data with easily understood concepts, such as rates, means, medians, or standard deviations. Statistical analysis also allows us to judge whether differences or associations identified in the sample are merely the result of the random error associated with sampling, and it often provides a measure of the strength of the associations identified. While appropriate statistical analysis is crucial to any research endeavor, the success or failure of the project is more dependent upon what has been done prior to beginning data analysis, not after. This article reviews concepts fundamental to any statistical analysis, the primary reasons to submit data to analysis, and selection of the appropriate statistical test. The discussion is brief of necessity, and readers are encouraged to consult standard statistical texts for more detailed information. | A question relevant for Federal Aviation Administration (FAA) certification of pilot workload in new commercial transport aircraft is whether subjective evaluation of workload should be conducted in-flight or postflight. This article examines the effect of probe timing (in-flight or postflight) for subjective assessment of flights containing both low and high levels of workload using the Subjective Workload Assessment Technique. The B-727, FAA Phase 2-certified, 6-dr, motion-base simulator, and air traffic control simulation at the Man-Vehicle System Research Facility at the NASA-Ames Research Center were used. Each pilot flew three different flights: (a) a nominal flight (30 rain); (b) a communication flight in which the pilot was instructed to tune in and talk on the command radio, in addition to normal duties (30 rain); and (c) a malfunction flight, including two diversions and an engine and "A" hydraulic system failures (1 hr 30 min). Sixteen B-727 qualified airline pilots flew the three flights on tw... | As a performance engineer; I am always looking for knowledge on the subject. Bob did a awesome job and gave me lots to think about and try!!! Highly recommend this book; not just to Perf Eng... but for those looking to understand Performance! | Collecting data based on observation is? | The best book I have read on this matter. The technical information is excellent and mixes well with the human aspects of the book. | Thorough and yet concise. In-depth readings for when you're studying but supplemented with concise and quick-hitting charts/tables when you just want to quickly look something up (e.g. surface anatomy for EMG, root innervation, etc.). Has really helped organize my NCS/EMG studying. | 1,999,997 | This book provides objective data on how to tell when a person is lying, and it is beneficial for anyone, in any field. | How can you tell when people are lying? | How can you tell scientifically if some one is lieing? | Looking for books on how to detect lies or liars | Info about the Lie Detector? | Looking for non-fiction book about lying | Nice book to start a conversation about lying | When does the lying stop? | Any recommendations for books on lie detectors? |
1,999,998 | What is the third required questions by UNC? | I've got 16 questions, I need at least 8 done. Around 100-200 words per question. I have examples of a 4/5 marked question with feed back.
Intro to management course so should be fairly easy. | can take an examination in the following year, but they're also available to students who have not completed year 11&12. In fact, they have no requirements but most education providers expect the knowledge of a year 10 student. The Senior External Examination offers the following 22 subjects. There are no examinations for Mathematics C which was a prerequisite for Engineering at many tertiary courses prior to 2010. The Mathematics C prerequisite however has been dropped by most institutions. Training for the Senior External Examination is non-compulsory. There exist four state schools and one private. There are alternative pathways to university | can take an examination in the following year, but they're also available to students who have not completed year 11&12. In fact, they have no requirements but most education providers expect the knowledge of a year 10 student. The Senior External Examination offers the following 22 subjects. There are no examinations for Mathematics C which was a prerequisite for Engineering at many tertiary courses prior to 2010. The Mathematics C prerequisite however has been dropped by most institutions. Training for the Senior External Examination is non-compulsory. There exist four state schools and one private. There are alternative pathways to university | taking the NSC (National Senior Certificate) or the NCV (National Certificate Vocational). Subjects are all taken on the same level - there is no higher or standard grade as in the past. There are three pass levels, each with different pass requirements.First is a pass with Higher certificate, one must obtain 40% in home language, 40% in two other subjects and must obtain 30% in three other subjects. A learner who passed matric with higher certificate level, cannot enroll for a University Degree nor a Diploma at an institute of higher learning. The mean mark in any subject is usually | I'm not looking for the SOA's MLC sample questions that are found easily on the LTAM webpage. I'm looking for questions (and their solutions) from Course 150, Part 4, and other pre-2000 exams. I can't find any of them on the SOA or CAS websites.
I know a lot of the questions I'm looking for are in the ASM Manual, but sometimes I think seeing the original solution helps me understand better than the solution in the manual.
Thanks in advance! | Need some assistance on a client that is asking for these Cyber Security Questions to be answered for their business. I never had to answer one of these before about them and was confused on some of what they were asking like live hosts etc. Is anyone able to help explain or give an example of these questions? Much appreciated in advance for any assistance on this.
**External Vulnerability Assessment and Penetration Test**
How many IP addresses are assigned to the company?
How many "live hosts"/IP addresses are to be included in the scope of testing?
Are any in-scope systems/IP addresses hosted by a third-party such as Azure, AWS/EC2? (requires written permission from hosting solution to test)
**Internal Vulnerability Assessment and Penetration Test**
How much address space is used internally? Class B or C subnets? How many subnets?
How many "live hosts" are on the internal network?
&#x200B;
Thank you! | Hi all,
I'm taking BEC on Saturday and was wondering if anyone has any last minute advice/areas to focus on? Also any advice on the written parts: how many paragraphs, how do you word it/structure it (personal email vs a memo). Also can I use acronyms like A/R or SOX or would I need to write out accounts receivable and Sarbanes-Oxley? | Does NUS prefer A-levels over other pre-u programme like Australian certificate(SACE, WACE)? I'm a Malaysian student btw. All answers are appreciated Tqvm. | 1,999,998 | The deadline is tomorrow yet I'm still figuring out where the the third university custom question is. | When could you enter the university? | University closed tomorrow | When do Ivy Interviews end? | Bidding question for third semester in BA | Shortcuts around and out of NTU Campus | Does anyone know when is the application for admission deadline for the University of Missouri Columbia? | Today (May 1) is an important deadline for incoming freshmen! | [Scholarship] when will PSC notify us if we are shortlisted or not? |
1,999,999 | Adds a nice richness of flavor to the gravy | What kind of roast would you think they use and how do they make their gravy/at jus so beefy and amazing? | How do you make onion gravy? | These are excellent! The gravy is just right and the chicken has just the right amount of batter. I will purchase these repeatedly. | I have not tried this yet but will update my review once I have. This package will make many cups of gravy so it will be worth having on hand if it is decent. I tried to make some chicken gravy from low sodium chicken broth and it bad! I hope the Trio is good since we enjoy roast chicken with gravy. | When making gravy or other sauces, the drippings or other ingredients often contain a lot of fat. While this adds a lot of flavor as it cooks, it's too much for the final product—and it's certainly not healthy. So the best way to make flavorful gravies and sauces that are lean is to remove the fat before serving. | I've been using Wondra Quick-Mixing Flour over 36 years, and will not make gravy without it. Prior to using this for a variety of my home-made gravies, I always had to deal with lumps, which was not only very frustrating, but also time-consuming. Since the first time I tried this, I've been using it ever since, and I use it frequently. I had to learn at a young age that the magic trick to perfect gravy, with no lumps or mess, was simply using Wondra Quick-Mixing Flour.
For several years, I've made chicken gravies, beef gravies & other gravies. By using this product, the gravy always comes out perfect, and I always stock up on it. Now, I won't try any other product, because this gives 100% satisfaction. My gravy is always lump-free, and I've even used this for baking. My gravy always turns out smooth & delicious, thanks to Wondra. Happy Amazon sells it, and at a good price. Highly recommended! | This really adds flavor to everything. Helps make vegetables really taste good! | In the spirit of U.S. Thanksgiving, where us Americans smother our turkey and mashed taters with creamy brown gravy, I am looking for the best "gravy" goal of all time.
This being when a game/series/cup was already clinched, and the winning team lathers on the steaming hot gravy of an added goal that causes the players/coaching staff/crowd to explode in ecstasy. | 1,999,999 | I use this at broth strength for making lamb gravy to accompany a roasted leg. Adds a nice richness of flavor to the gravy. | very good with chicken broth or ham bone broth add what ... | It adds a great depth to broths and sauces | Works well to separate gravy from grease and strains out ... | What substitute can you use for beef broth? | I prefer olive oil and salt with my Sunday Roast/Dinner over Gravy. | Might work great for simple broth | I used this to carve a 12 pound turkey. ... | Broth is nice and flavorful |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.