query_id
int64 0
355k
| query
stringlengths 2
25.6k
| neg_doc_0
stringlengths 13
360k
| neg_doc_1
stringlengths 9
301k
| neg_doc_2
stringlengths 9
364k
| neg_doc_3
stringlengths 13
347k
| neg_doc_4
stringlengths 14
562k
| neg_doc_5
stringlengths 13
589k
| neg_doc_6
stringlengths 14
293k
| neg_doc_7
stringlengths 11
403k
| doc_id
int64 0
355k
| positive
stringlengths 1
679k
| neg_query_0
stringlengths 3
23.4k
| neg_query_1
stringlengths 2
47.3k
| neg_query_2
stringlengths 3
47.3k
| neg_query_3
stringlengths 3
37.6k
| neg_query_4
stringlengths 2
64.1k
| neg_query_5
stringlengths 3
64.1k
| neg_query_6
stringlengths 2
21.3k
| neg_query_7
stringlengths 3
64.1k
|
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1,999,800 | Relaxation and Dephasing in a Two-electron 13C Nanotube Double Quantum Dot | We analyze decoherence of an electron in a double dot due to the interaction with acoustic phonons. For large tunneling rates between the quantum dots, the main contribution to decoherence comes from the phonon emission relaxation processes, while for small tunneling rates, the virtual-phonon, dephasing processes dominate. Our results show that in common semiconductors, such as Si and GaAs, the latter mechanism determines the upper limit for the double-dot charge qubit performance measure. | The resonance energy transfer between exciton states in a system comprised of two semiconductor quantum dots is studied theoretically. A model Hamiltonian is constructed to describe the influence of the laser pulse, Coulomb interaction, the static Stark effect, and the relaxation of exciton states on the dynamics of the system. Specific calculations of the efficiency of energy transfer under different excitation conditions and different positions of energy levels are exemplified. It is shown that the transfer process can be controlled by shifting the levels in a constant electric field. | This paper examines mechanisms of relaxation and dephasing of electrons in double-dot nanostructures due to inter- action with acoustic phonon modes. The effect of temperature of phonon bath on decay on electron quantum evolution is obtained. Our results set the temperature ranges outside of which the quantum dynamics of electrons will be significantly suppressed. Index Terms—Nanotechnology, phonons, quantum dots, quantum theory. |
We observe an experimental signature of the role of the phonons in spin relaxation between triplet and singlet states in a two-electron quantum dot. Using both the external magnetic field and the electrostatic confinement potential, we change the singlet-triplet energy splitting from 1.3 meV to zero and observe that the spin relaxation time depends non-monotonously on the energy splitting. A simple theoretical model is derived to capture the underlying physical mechanism. The present experiment confirms that spin-flip energy is dissipated in the phonon bath. Relaxation properties of a quantum system are strongly affected by the reservoir where energy is dissipated. This has been seen clearly for electron spins embedded in nanostructures. Spin relaxation times T 1 up to a few ns have been observed for free electrons in a two dimensional electron gas (2DEG) where energy is easily given to the motion [1]. In quantum dots, the discrete orbital energy level spectrum imposes other energy transfer mechanisms. Near zero magnetic field, the electron spin can directly flip-flop with the surrounding nuclear spins, inducing short T 1 's of the order of µs [2]. When a small magnetic field is applied, direct spin exchange with nuclei is suppressed. Lattice vibrations, i.e. phonons, are expected to become the dominant reservoir in which spin-flip energy can be dissipated. This dissipative mechanism is inefficient and very long spin relaxation times follow [2,3,4,5,6].
For spin relaxation involving phonons, two physical processes are important. The coupling between electron orbitals and phonons is responsible for dissipation of energy and the spin-orbit interaction provides the essential mixing between different spin states so the spin states are coupled through electron-phonon interaction [7,8,9]. Energy conservation requires that the phonon energy corresponds to the energy separation between the excited and the ground spin state. Changing the energy separation affects the efficiency of the electron spin relaxation in two ways. First, since the phonon density of states increases with energy, the relaxation rate is expected to increase with energy as well. Furthermore, since the electron-phonon interaction is highly dependent on the matching between the size of the dot and the phonon wavelength [10,11], we expect a suppression of relaxation for very large and for very small phonon wavelengths in comparison to the dot size. Mapping the relaxation time T 1 as a function of the energy splitting between the two spin states will provide insight in both the electronphonon interaction and the spin-orbit coupling as well as an understanding of the limitations on T 1 . This is of and a QPC. Gate P is used to apply fast voltage pulses that rapidly change the electrochemical potentials of the dot. We tune the dot to the few-electron regime [15], and completely pinch off the tunnel barrier between gates L and T , so that it is only coupled to one electron reservoir at a time [16]. A voltage bias of 0.7 mV induces a current through the QPC, IQP C , of about 30 nA. Tunneling of an electron on or off the dot gives steps in IQP C of 300 pA [17,18]. The QPC measurement bandwidth is 100 kHz. particular relevance in the context of both spintronic and spin-based quantum information processing devices [12].
Here, we study the spin relaxation time from triplet to singlet states for different energy separations in a single quantum dot containing two electrons. Singlet and triplet states have respectively two electrons in the lowest orbital and one electron each in the lowest and in the first excited orbital. In the experiment, the energy splitting ∆E S,T between these two-electron spin states could be tuned from 0.9 meV to zero with a perpendicular magnetic field and from 0.9 meV to 1.3 meV by deforming the dot potential [13,14].
All the experiments are performed in a dilution refrig- Voltage pulses applied to gate ′ P ′ for the relaxation measurement. The starting point is a dot with one electron in the ground state (initialization). During the pulse, the singlet and triplet electrochemical potentials are below the Fermi energy and a second electron tunnels into the dot. Due to the difference in tunnel rates [6], most likely a triplet state will be formed. We allow relaxation to occur during a waiting time that we vary. After the pulse, both electrochemical potentials are moved back above the Fermi energy and an electron tunnels out. This last step allows us to read-out the spin state. (b) Schematic of the ∆IQP C induced by the voltage pulse on gate ′ P ′ . If the state was singlet, a step from a slow tunneling event is added to the QPC response just after the read-out pulse. If the state was triplet, the tunneling event is too fast to be observed. (c) After averaging over many single traces, a dip is observed and its amplitude is proportional to the probability of having singlet present in the dot. (d) Relaxation curve obtained for B = 1.02 T constructed by plotting the dip amplitude of the averaged traces at a pre-defined time after the read-out pulse. The relaxation time, T1 = 0.79 ± 0.05 ms, is extracted from an exponential fit to the data (all the data are taken with a 100 kHz lowpass filter). Inset : curve resulting from the averaging over 500 individual traces for the longest waiting time (20 ms) and for the shortest waiting time (300 µs), offset by 100 µs and 0.2 nA for clarity. erator with a quantum dot and a quantum point contact (QPC) defined in a 2DEG (see inset of Fig. 1(b)). The conductance of the QPC is tuned to about e 2 /h, making it very sensitive to the charge on the dot [19]. The sample is mounted at an angle φ = 68 • ± 5 • with respect to the direction of the magnetic field B where φ is derived from Shubnikov-deHaas oscillations. The magnetic field component perpendicular to the 2DEG is equal to B cos φ (∼ 0.38B). The electron temperature was measured to be 180 mK from the width of the Coulomb peaks. The lattice temperature was 50 mK.
We extract experimentally the energy splitting ∆E S,T between the singlet and the triplet states as a function of both magnetic field B and the confinement potential using a pulse spectroscopy technique [16]. The dependence of ∆E S,T on B is presented in Fig. 1(a). Up to 0.4 T, ∆E S,T does not vary significantly with magnetic field which we relate to the elliptic nature of the dot at zero magnetic field [20]. For B larger than 0.4 T, ∆E S,T decreases, to a good approximation, linearly with mag-netic field. For energy separations below 100 µeV, the thermal broadening of the reservoir prevents us to measure ∆E S,T . From extrapolation of the data, we can determine the magnetic field needed for singlet and triplet energy levels to cross: 2.82 ± 0.07 T.
We measure the relaxation time for varying ∆E S,T . To be able to measure T 1 close to the degeneracy point, we use a tunnel-rate selective read-out procedure (TRRO) [6] (see Fig. 2). The measured spin relaxation time T 1 as a function of B is presented in Fig. 3. The shape of the T 1 dependence on magnetic field exhibits a striking nonmonotonous behavior. From 0.4 T to ∼ 2 T, corresponding to a decrease in the energy splitting from 0.8 meV to 0.2 meV, the relaxation time first decreases, reaching a minimum of 180 µs. In between 2 T and the degeneracy point (2.82 T), T 1 increases whereas the energy splitting continues to decrease.
As a complementary study, we change ∆E S,T in a different way by controlling the electrostatic potential of the dot via the voltage V T applied to gate 'T' and again look at T 1 . The dependence of ∆E S,T on V T is presented in Fig. 1(b). With this second experimental knob, ∆E S,T can be varied from 0.8 meV to 1.3 meV. We interpret the change in the observed energy splitting as a consequence of a change in the dot ellipticity. A more positive V T implies a more circular dot and a larger energy splitting. We observe that T 1 further increases with ∆E S,T as V T is varied at B = 0 T (see the inset of Fig. 3). The maximum energy splitting reached at -530 mV, 1.3 meV, corresponds to a maximum of T 1 = 2.3 ms. With both experimental knobs, we observe that when ∆E S,T is constant, T 1 is constant too (respectively for V T < −650 mV and B < 0.4 T). These observations clearly indicate that the most important parameter for the variation in the triplet-singlet relaxation time is their energy separation.
The observed minimum in T 1 is precisely what one would expect for energy relaxation mediated by the electron-phonon interaction [8,11]. Indeed, the energy splitting ∆E S,T determines the relevant acoustic phonon energy (acoustic phonons are the only available phonons for the explored energy range). At B ∼ 2 T, ∆E S,T ∼ 0.3 meV, the associated half-wavelength, approximately 30 nm (the group velocity for acoustic phonons c s ∼ 4000 m/s), is comparable to the expected size of the dot and therefore the coupling of the electrons in the dot to phonons is strongest. For energy separations smaller (larger) than 0.3 meV, the phonon wavelength is larger (smaller) than the size of the dot, the coupling to the orbitals becomes smaller and T 1 increases. Taken together, all these observations strongly suggest that the phonon bath is the dominant reservoir for dissipating the spin-flip energy during relaxation.
In order to get more insight in the role of the phonon wavelength, we present a simplified model of the energy relaxation process between triplet and singlet as a function of their energy splitting ∆E S,T . From Fermi's golden rule, the relaxation rate between the triplet and the singlet states with energy separation ∆E S,T is proportional to their coupling strength through electron-phonon interaction and to the phonon density of states at the energy ∆E S,T [11]. To obtain a simple analytical expression, we assume that the only effect of the perpendicular magnetic field, the Coulomb interaction between electrons and the modification of the potential landscape is to change the energy splitting. Especially, their effects on the spatial distribution of the wavefunctions are neglected and we neglect the Zeeman energy. Furthermore, we restrict the state space of the analysis to |T − , |T + , |T 0 and |S constructed from the lowest energy orbital and the first excited orbital (even though the contributions to tripletsinglet relaxation from higher orbitals can in fact be important [21]). In the notation |T − , |T + , |T 0 and |S , both the orbital part (assuming Fock-Darwin states) and the spin part are present. Finally, we also neglect higher order (e.g. two-phonon) processes, which are important at small magnetic field [22].
In contrast to the one electron case [7,9], the spin-orbit interaction admixes directly the first excited states |T ± with the ground state |S . Due to the selection rules of the spin-orbit interaction, it does not affect |T 0 in lowest order [23]. As a consequence, the spin relaxation time of |T 0 can be much longer than |T ± [24]. However, we do not observe any signature of a slowly relaxing component in the experiment [25]. Since the spin-orbit coupling strength M SO is small in comparison with ∆E S,T (in the range accessed in the experiment), we can approximate the new eigenstates of the system as:
|S ′ = |S − MSO ∆ES,T (|T + + |T − ) |T ′ ± = |T ± + MSO ∆ES,T |S
In general, M SO is dependent on the magnetic field, but to simplify the discussion, we neglect this dependence [21,22]. Since the electron-phonon interaction preserves the spin, the coupling between |T ′ ± and |S ′ has the following form:
T ′ ± |H e,p |S ′ = M SO ∆E S,T ( S|H e,p |S − T ± |H e,p |T ± )
where H e,p ∼ e iq.r1 +e iq.r2 is the interaction Hamiltonian between electrons and phonons, q the phonon wavevector and r i the positions of the electrons. One can then interpret the coupling between |T ′ ± and |S ′ as the difference of the electron-phonon interaction strength for the corresponding unperturbed states |T ± and |S . If the phonon wavelength is much larger than the dot size, the coupling to the phonons is the same for both states and the two terms will cancel. If the phonon wavelength is much shorter than the dot size, the coupling is small for each state separately.
To provide a quantitative comparison to the data, we need to model the electron-phonon interaction. Following [8,11], we assume bulk-like 3D phonons. For the energy separations discussed in our experiment, only acoustic phonons are relevant. The Hamiltonian H e,p has then the following expression:
H e,p = j,q F z (q z ) 2ρqc j /h (e iq r1 + e iq r2 )(eβ j,q − iqΞ j,q )
where (q, j) denotes an acoustic phonon with wave vector q = (q , q z ), j the phonon branch index and ρ = 5300 kg/m 3 is the density of lattice atoms. The factor F z (q z ) depends on the quantum well geometry and is assumed to be 1 in our model [11]. The speed of sound for longitudinal and transverse phonons are respectively c l = 4730 m/s and c t = 3350 m/s. We consider both piezo-electric and deformation potential types of electron-phonon interaction. In the considered crystal, the deformation potential interaction is non-zero only for longitudinal phonons (with a coupling strength Ξ = 6.7 eV). In contrast, all phonon polarizations j are important for piezo-electric coupling. The coupling strength depends on θ, defined as the angle between the wavevector and the growth axis, and varies for different polarizations as eβ j,q = A j (θ)eβ where eβ = 1.4 × 10 9 eV/m [8,26]. Due to the different dependence on q for both mechanisms ( √ q for deformation potential interaction, 1/ √ q for piezo-electric interaction), the piezo-electric (the deformation potential) coupling between electrons and phonons is dominant for energy separations below (above) 0.6 meV. From direct application of Fermi's golden rule, we derive the following analytical expression for the spin relaxation rate 1/T 1 :
1/T 1 = M 2 SO α 4 32πρh 6 Ξ 2 ∆E 5 S,T h 2 c 9 l π/2 0 dθ sin 5 θ e − ∆E 2 S,T α 2 sin 2 θ 2h 2 c 2 l + j e 2 β 2 ∆E 3 S,T c 7 j π/2 0 dθ|A j (θ)| 2 sin 5 θ e − ∆E 2 S,T α 2 sin 2 θ 2h 2 c 2 j
where α is the dot radius (in our model α is independent of ∆E S,T and is estimated to be 23nm, from the measured single particle level spacing). This simple model reproduces the most important feature in the measurements, which is that the coupling to the phonons vanishes for large and small energy separations and is strongest when the phonon wavelength matches the dot size (see Fig. 4). The spin-orbit strength M SO appears in the expression of 1/T 1 only as a scaling factor. With a value M SO = 0.4 µeV (corresponding to a spin-orbit length equal toh/2αm * M SO ≈ 50 µm), the model reproduces the peak amplitude of the data quite well (Fig. 4, solid line). However, this value for M SO is about six times smaller than the values reported in [27,28] (the dotted line in Fig. 4 corresponds to the relaxation rate using this value of M SO in the model). The discrepancy could be the result of the exclusion of higher orbitals and the magnetic field dependence of M SO in our model [21,22]. Again, we emphasize that both curves have a maximum corresponding to a phonon wavelength matching the dot size.
For single electron spin states, comparable variations of T 1 with the energy splitting are expected although direct spin-orbit coupling between Zeeman sublevels of the same orbital is zero. To maximize the relaxation time of electron spin qubits, one needs then to choose an energy separation between the spin states such that the corresponding phonon wavelength is different from the dot size. To complete our study of spin relaxation, it will be interesting to rotate the sample with respect to the magnetic field since the spin-orbit coupling strength depends on the angle between the crystallographic axis and the magnetic field [7,8,29].
PACS numbers: 03.65.w, 03.67.Mn, 42.50.Dv
FIG
. 1: a) Dependence of the energy splitting ∆ES,T on total magnetic field B. (b) Dependence of the energy splitting ∆ES,T on the voltage VT applied on gate 'T' at B= 0. Inset: Scanning electronic micrograph showing the sample design. The 2DEG, located 90 nm below the surface of a GaAs/AlGaAs heterostructure, has an electron density of 1.3 · 10 15 m −2 . By applying negative voltages to gates L, M , T and Q we define a quantum dot (white dotted circle)
FIG. 2: (a) Voltage pulses applied to gate ′ P ′ for the relaxation measurement. The starting point is a dot with one electron in the ground state (initialization). During the pulse, the singlet and triplet electrochemical potentials are below the Fermi energy and a second electron tunnels into the dot. Due to the difference in tunnel rates [6], most likely a triplet state will be formed. We allow relaxation to occur during a waiting time that we vary. After the pulse, both electrochemical potentials are moved back above the Fermi energy and an electron tunnels out. This last step allows us to read-out the spin state. (b) Schematic of the ∆IQP C induced by the voltage pulse on gate ′ P ′ . If the state was singlet, a step from a slow tunneling event is added to the QPC response just after the read-out pulse. If the state was triplet, the tunneling event is too fast to be observed. (c) After averaging over many single traces, a dip is observed and its amplitude is proportional to the probability of having singlet present in the dot. (d) Relaxation curve obtained for B = 1.02 T constructed by plotting the dip amplitude of the averaged traces at a pre-defined time after the read-out pulse. The relaxation time, T1 = 0.79 ± 0.05 ms, is extracted from an exponential fit to the data (all the data are taken with a 100 kHz lowpass filter). Inset : curve resulting from the averaging over 500 individual traces for the longest waiting time (20 ms) and for the shortest waiting time (300 µs), offset by 100 µs and 0.2 nA for clarity.
FIG. 3 :
3The spin relaxation time T1 as a function of the total magnetic field. The magnetic field where singlet and triplet states are degenerate is indicated by the dashed line. A minimum in T1 is observed around 2.2 T. The error bars represent 70% confidence intervals. For energy separations close to degeneracy, the sensitivity of the measurement is reduced and the uncertainty in T1 increases. Inset: dependence of the relaxation time T1 on VT at B = 0 T.
FIG. 4 :
4Relaxation rate as a function of the energy splitting ∆ES,T deduced from the experimental data. The circles and the triangles correspond to the experiment where we vary respectively the magnetic field and the dot potential. The solid (dotted) line is the curve for MSO = 0.37 µeV (MSO = 2.31 µeV) obtained from the simplified model.
We thank V. Golovach and D. Loss for drawing our attention to the role of the phonon wavelength in spin relaxation and for useful discussions; R. Schouten, B. van der Enden and W. den Braver for technical assistance.
. Y Ohno, Phys. Rev. Lett. 834196Y. Ohno et al., Phys. Rev. Lett. 83, 4196 (1998).
. A C Johnson, Nature. 435925A. C. Johnson et al., Nature 435, 925 (2005).
. T Fujisawa, Nature. 419278T. Fujisawa et al., Nature 419, 278 (2002).
. J M Elzerman, Nature. 430431J.M. Elzerman et al., Nature 430, 431 (2004).
. M Kroutvar, Nature. 43281M. Kroutvar et al., Nature 432, 81 (2004).
. R Hanson, Phys. Rev. Lett. 94196802R. Hanson et al., Phys. Rev. Lett. 94, 196802 (2005).
. A V Khaetskii, Y V Nazarov, Phys. Rev. B. 6112639A.V. Khaetskii and Y.V. Nazarov, Phys. Rev. B 61, 12639 (2000).
. V N Golovach, A V Khaetskii, D Loss, Phys. Rev. Lett. 9316601V.N. Golovach, A.V. Khaetskii, D. Loss, Phys. Rev. Lett. 93, 016601 (2004)
. D V Bulaev, D Loss, Phys. Rev. B. 71205324D. V. Bulaev and D. Loss, Phys. Rev. B 71, 205324 (2005)
. T Fujisawa, Science. 282932T. Fujisawa et al., Science 282, 932 (1998).
. U Bockelmann, Phys. Rev. B. 5017271U. Bockelmann, Phys. Rev. B 50, 17271 (1994)
. D Loss, D P Divincenzo, Phys. Rev. A. 57120D. Loss and D.P. DiVincenzo, Phys. Rev. A 57, 120 (1998).
. L P Kouwenhoven, D G Austing, S Tarucha, Rep. Prog. Phys. 646701L. P. Kouwenhoven, D. G. Austing, and S. Tarucha, Rep. Prog. Phys. 64 (6), 701 (2001).
. Jordan Kyriakidis, Phys. Rev. B. 6635320Jordan Kyriakidis et al., Phys. Rev. B 66, 035320 (2002)
. M Ciorga, Phys. Rev. B. 6116315M. Ciorga et al., Phys. Rev. B 61, R16315 (2000)
. J M Elzerman, Appl. Phys. Lett. 844617J. M. Elzerman et al., Appl. Phys. Lett. 84, 4617 (2004).
. R Schleser, Appl. Phys. Lett. 852005R. Schleser et al., Appl. Phys. Lett. 85, 2005 (2004).
. L M K Vandersypen, Appl. Phys. Lett. 854394L.M.K. Vandersypen et al., Appl. Phys. Lett. 85, 4394 (2004).
. M Field, Phys. Rev. Lett. 701311M. Field et al., Phys. Rev. Lett. 70, 1311 (1993).
. D G Austing, Phys. Rev. B. 6011514D. G. Austing et al., Phys. Rev. B 60, 11514 (1999)
. V N Golovach, A V Khaetskii, D Loss, preprintV.N. Golovach, A.V. Khaetskii, D. Loss, preprint.
. P San-Jose, Phys. Rev. Lett. 9776803P. San-Jose et al., Phys. Rev. Lett., 97, 076803, (2006)
. S Dickmann, P Hawrylak, JETP Lett. 7730S. Dickmann and P. Hawrylak, JETP Lett., 77, 30 (2003)
. S Sasaki, Phys. Rev. Lett. 9556803S. Sasaki et al., Phys. Rev. Lett. 95, 056803 (2005).
At relatively high magnetic fields, the dot loses its elliptical nature and then the measurement loses visibility. Another possible explanation is related to the slow spin-orbit decay from |T0 to |S in comparison with the longest waiting time we explored. we observe experimentally a reduction of the read-out visibility (the contrast between the signal for short and long waiting time) when ∆ES,T is varied. Several reasons can be considered to explain the reduction of visibility observed in the experiment. 20 ms). Therefore, the T0 population does not contribute to the visibility unless |T0 gets first mixed with |T± . As B increases the mixing between triplets gets suppressed and the visibility goes downBy applying the complete relaxation measurement proto- col presented in Fig. 2(a,b), we observe experimentally a reduction of the read-out visibility (the contrast between the signal for short and long waiting time) when ∆ES,T is varied. Several reasons can be considered to explain the reduction of visibility observed in the experiment. At zero magnetic field, the difference between the singlet and triplet tunnel rates can be increased as the dot is some- what elliptical. At relatively high magnetic fields, the dot loses its elliptical nature and then the measurement loses visibility. Another possible explanation is related to the slow spin-orbit decay from |T0 to |S in comparison with the longest waiting time we explored (20 ms). Therefore, the T0 population does not contribute to the visibility unless |T0 gets first mixed with |T± . As B increases the mixing between triplets gets suppressed and the visibility goes down.
For longitudinal phonons, the piezo-electric constant A l (θ) = 3 √ 2/4 sin 2 (θ) cos θ. For the two transverse polarizations. At1(θ) = √ 2/4 sin 2θ and At2(θ) =For longitudinal phonons, the piezo-electric constant A l (θ) = 3 √ 2/4 sin 2 (θ) cos θ. For the two transverse polarizations, At1(θ) = √ 2/4 sin 2θ and At2(θ) =
. D M Zumbuhl, Phys. Rev. Lett. 89276803D. M. Zumbuhl et al., Phys. Rev. Lett. 89, 276803 (2002)
. S Amasha, cond-mat/0607110S. Amasha et al., cond-mat/0607110
. V I Fal'ko, B L Altshuler, O Tsyplyatyev, Phys. Rev. Lett. 9576603V.I. Fal'ko, B.L. Altshuler, and O. Tsyplyatyev, Phys. Rev. Lett. 95, 076603 (2005)
| We have studied the low temperature conductance fluctuations in double-dot systems. The electron wave coupling between ballistic quantum dots has been investigated in a pair of coupled quantum dots defined by several independently-tunable quantum-point-contacts (QPCs). Reproducible conductance fluctuations are observed in the low temperature magneto-conductance at low magnetic fields and a clear difference between weak and strong couplings has been identified as the gap of the QPC corresponding to the inter-dot coupling is varied. This suggests clear evidence for a specific spread of the coupling orbit over the whole dot region. | Abstract We propose a nanostructure design which can significantly suppress longitudinal-acoustic-phonon–electron scattering in double-quantum-dot based quantum gates for quantum computing. The calculated relaxation rates vs. bias voltage exhibit a double-peak feature with a minimum approaching 10 5 s −1 . In this matter, the energy conservation law prohibits scattering contributions from phonons with large momenta; furthermore, increasing the barrier height between the double quantum dots reduces coupling strength between the dots. Hence, the joint action of the energy conservation law and the decoupling greatly reduces the scattering rates. The degrading effects of temperatures can be reduced simply by increasing the height of the barrier between the dots. | Quantum dots have been fabricated with single-wall carbon nanotubes (SWCNTs), and their transport properties have been measured at low temperatures. The single-electron transport measurements revealed the artificial atom characteristics with a shell structure and the Zeeman splitting of single particle states. They have been observed with the metallic SWCNT that includes many electrons, in striking contrast to the case of semiconductor artificial atoms that have a few electrons. The unique features in the SWCNT artificial atom are discussed in terms of the energy scales associated with the quantum dot. | We analyze dephasing in single and double quantum dot systems. The decoherence is introduced by the B\"{u}ttiker model with current conserving fictitious voltage leads connected to the dots. By using the non-equilibrium Green function method, we investigate the dephasing effect on the tunneling current. It is shown that a finite dephasing rate leads to observable effects. The result can be used to measure dephasing rates in quantum dots. | 1,999,800 | We use charge sensing of Pauli blockade (including spin and isospin) in a two-electron 13C nanotube double quantum dot to measure relaxation and dephasing times. The relaxation time, T1, first decreases with parallel magnetic field then goes through a minimum in a field of 1.4 T. We attribute both results to the spin-orbit-modified electronic spectrum of carbon nanotubes, which suppresses hyperfine mediated relaxation and enhances relaxation due to soft phonons. The inhomogeneous dephasing time, T2*, is consistent with previous data on hyperfine coupling strength in 13C nanotubes. | Study of Molecular Motion in Liquids by the Multiplet Effect in the Spin-Lattice Carbon-13 Relaxation | Imaging of the Schottky Barriers and Charge Depletion in Carbon Nanotube Transistors | Single-walled carbon nanotubes as anisotropic relaxation probes for magnetic resonance imaging | Spin gap and Luttinger liquid description of the NMR relaxation in carbon nanotubes | Spin-orbit coupling is ubiquitous in quantum dot quantum computing architectures, and makes spin qubits susceptible to charge noise. We derive a Hamiltonian describing the effect of spin-orbit and noise on a single-spin qubit in a quantum dot. Relaxation is due to noise coupling different orbital levels and is dominated by screened whole charge defects near the dot. Dephasing stems from noise causing relative fluctuations between orbital levels, and is driven by screened whole charge defects and unscreened dipole defects in the substrate. Dephasing times are vastly different between common materials such as Si and GaAs. They can be enhanced by increasing gate fields, choosing materials with weak spin-orbit such as Si, making dots narrower, or using accumulation dots. | Spin relaxation in charge tunable InP quantum dots | Sensitive electrochemical sensing platform for microRNAs detection based on shortened multi-walled carbon nanotubes with high-loaded thionin | One and two-phonon processes of the spin-flip relaxation in quantum dots: Spin-phonon coupling mechanism |
1,999,801 | Estimated presence or absence of sidewalks and conditions of sidewalks in northeastern New Jersey. The map depicts an index of sidewalk walkability estimated from virtual street audits at 11,282 locations using Google Street View and spatial interpolation techniques. Levels of walkability ranged from low (no sidewalk or poor condition) to moderate (fair condition) to high (good condition). Precise measures of sidewalk conditions can help identify barriers to walking-based physical activity and key areas for intervention to maintain and modify sidewalk conditions. | Abstract Even though assessing sidewalks is an integral component of walkability assessment tools, no single study exists that adequately covers the relevance of existing walkability audits for sidewalk assessment. In this paper, an in-depth review of walkability audit tools is conducted. The primary objective of this study is to determine whether the existing tools consider factors such as safety, attractiveness, disability issues and path conditions that are essential for sidewalk assessment. This review shows that a limited number of audit tools consider disability issues, safety, and attractiveness. The tools reviewed mainly use path condition factors. In conclusion, recommendations are made for future walkability audits that focus on accessibility factors, as well as micro-scale design factors. | Walkability is the basis of sustainable city. Walking is the socially equitable mode that is most accessible to the masses. However, the advent of transportation technology, such as automobile and superhighway has degraded the pedestrian environment. The aim of the paper is to examine the characteristics or attributes that could promote walking activity via people's perception. This paper combines survey questionnaire and walkability audit to gauge perception of the urban walking environment. Findings indicate that the proximity of destinations, good weather condition, safety and well-designed pedestrian facilities can significantly contribute to better perceptions of the walking environment. | PURPOSE ::: Studies on how the interaction of psychological and environmental characteristics influences walking are limited, and the results are inconsistent. Our aim is to examine how the attitude toward walking and neighborhood environments interacts to influence walking. ::: ::: ::: DESIGN ::: Cross-sectional phone and mail survey. ::: ::: ::: SETTING ::: Participants randomly sampled from 6 study sites including Los Angeles, Chicago, Baltimore, Minneapolis, Manhattan, and Bronx Counties in New York City, and Forsyth and Davidson Counties in North Carolina. ::: ::: ::: PARTICIPANTS ::: The final sample consisted of 2621 persons from 2011 to 2012. ::: ::: ::: MEASURES ::: Total minutes of walking for travel or leisure, attitude toward walking, and perceptions of the neighborhood environments were self-reported. Street Smart (SS) Walk Score (a measure of walkability derived from a variety of geographic data) was obtained for each residential location. ::: ::: ::: ANALYSIS ::: Linear regression models adjusting for age, gender, race/ethnicity, education, and income. ::: ::: ::: RESULTS ::: Attitude toward walking was positively associated with walking for both purposes. Walking for travel was significantly associated with SS Walk Score, whereas walking for leisure was not. The SS Walk Score and selected perceived environment characteristics were associated with walking in people with a very positive attitude toward walking but were not associated with walking in people with a less positive attitude. ::: ::: ::: CONCLUSION ::: Attitudes toward walking and neighborhood environments interact to affect walking behavior. | This study examined the reliability of the block walk method (BWM) for observing physical activity on suburban sidewalks/streets. Trained observers simultaneously walked 40 sidewalk/street segments each 1525 m in length at a pace of 30.5 m/min while recording the number of individuals walking/bicycling/jogging and the address where the activity occurred. An activity was observed at 2.9% of the 1020 addresses walked passed. In all 41 individuals were seen walking, 4 jogging, and 3 bicycling during 400 observation minutes. Agreements were 80%, 90%, and 86.7% for address, activity type, and number of individuals. The BWM is reliable for assessing activity on suburban sidewalks/streets. | Walkability Walkability is a measure of how friendly an area is to walking. Walkability has health, environmental, and economic benefits. Factors influencing walkability include the presence or absence and quality of footpaths, sidewalks or other pedestrian rights-of-way, traffic and road conditions, land use patterns, building accessibility, and safety, among others. Walkability is an important concept in sustainable urban design. One proposed definition for walkability is: "The extent to which the built environment is friendly to the presence of people living, shopping, visiting, enjoying or spending time in an area". Factors affecting walkability include, but are not limited to: Major infrastructural |
Introduction
Walking is the most primitive and obvious way of moving in space and on an urban scale. It has numerous social and individual benefits with positive health improvements and social equity and reduces greenhouse gas emissions. Moreover, it has been reduced to use as a general type of travel mode for different purposes such as day-to-day travelling or leisure. The promotion of vehicular traffic is due to the spatial spread of cities. The expansion of cities and growing urban sprawl leads to more vehicle use, which in turn increases car dependency and vehicle transportation leading ultimately to a degraded space.
On the other hand, liveability is the quality of living in a city and is determined by many elements. One of these is to create a walkable environment in order to achieve liveability in an urban environment. The examination of the built environment for the appropriateness and attractiveness of walking has been significant for many decades in various scientific fields such as urban planning, psychology, geography and public health (Brownson et al., 2009). In each field, walking is introduced by individual definitions.
For instance, according to Ewing and Handy (2009), urban planners defined walking as a factor in decreasing vehicle travel, urban sprawl and greenhouse gas emissions. Moreover, public health researchers are interested in walking as an essential factor in reducing obesity, cancer and chronic diseases as a result of daily exercise.
One of the main research questions of this study is how to assess the liveable environment and walking behaviour to find the relationship between them and walking. To investigate walkability's influence on liveability, we need to understand the meaning of walking and the walkability concept, the relationship between urban environments and walking behaviour, and describe the environmental features influencing walkability.
Definition and aims of walking
Walkability is defined as the extent to which a safe and convenient environment encouraging walking is provided for pedestrians (Southworth, 2005). A walkable environment provides a variety of destinations that are accessible within a logical amount of time and effort and offers visual interest in walking throughout the network. Walking is one of the natural and fundamental human features. People walk for transportation, entertainment and even sports. Walking leads to more social interaction and maintains physical and mental health. The society in which most people walk instead of using cars is more sustainable in terms of natural resources and economically. Medical practitioners have continuously argued that walking can play a positive role in human health. Reducing crime, other societal problems and improving social cohesion are other benefits of walking (Duffy, 2009).
A walkable society can have various benefits like community liveability, improved fitness and public health, basic mobility, efficient land use, consumer cost savings, external cost savings (road and parking facilities, traffic congestion, crash risk, and environmental damage), and economic development. The advantages of a more walkable society are also essential for vulnerable groups, including the elderly, disabled people, children and those with low incomes (Litman, 2011).
Social roles of walking
Walking is the keystone of the community. One of the most significant ways to enhance the liveability of a society is to increase walkable streets. Streets are the main places providing people with the opportunity to meet each other and socialise. Walking improves community liveability, including security and public health, safety, local environmental quality, social cohesion and entertainment. In this way, streets are a major part of the public realm. They are places where people interact with their community. Therefore, more attractive, safe and walkable streets increase community liveability (Litman, 2010).
According to urban planners, one of the most crucial benefits of walking and walkability is increasing social interactions. Walking through the streets of a city allows people to get to know their neighbourhood and develop a closer relationship with other people on the street. Jane Jacobs defines it as 'eyes on the street'; she believes that the more people on the streets, the greater the neighbourhood's well-being and safety (Jacobs, 1961).
People walk on streets based on their needs (transportation or recreation); in doing so, it provides an active and lively street, leading to a positive public sense of society. Due to these significant social impacts, many urban designers have recently been drawn to designing compact and walkable neighbourhoods. New transportation and land use policies are being implemented for pedestrians, claiming that street-connected communities can increase spontaneous meetings and provide better and more enjoyable travel in higher quality areas (Duffy, 2009).
Walking as a transportation mode
Walking is the most basic means of transportation, whether we go from one room to another or a far destination. Even for those with cars, walking is essential. Whatever form of transportation, we use walking as a component of our transportation as every journey begins and ends with a walk. Whether we walk to most of our destinations, walk to a public transport point, or walk to our car, we still rely on our feet to get us where we want to go (Duffy, 2009).
Walking is also the cheapest form of transportation. Moreover, creating a walkable community can provide a more affordable transportation system. Since 5-10 % of car trips are unnecessary, they can be replaced by non-motorised transportation, including walking, as the most important mode of non-motorised travel (Mackett, 2000). Alongside its various benefits, driving has many disincentives in today's cities. Traffic congestion, air pollution, parking problems and environmental damage are some of the disadvantages of vehicle overuse.
Impacts of car-dependency
The accessibility of vehicles after World War II revolutionised cities and changed the role of walking in human life. Following the widespread use of private cars, cities were formed according to the requirements of car access. During the post-World War II reconstruction process, cities were designed for cars. The automobile has been considered as one of the most significant inventions of the 19 th century and influenced urban design due to the various perceived advantages that it presented. At the time, it created less noise and pollution than the rail system. It also occupied less space than carts and was considered a suitable solution for reducing the chaos that existed in many cities.
Cars provided access to places that seemed impossible before, and their affordability resulted in ready access to any location around the city, resulting in the sprawl of urban spaces (Newman and Kenworthy, 1999). The decentralisation of cities was one of the consequences of automobile use since the connection between land use and transportation in cities had been broken, and car dependency became an important phenomenon.
In general, walking and cycling allow people to experience the places they cross. As cities began to develop according to car access, a strong disconnect between pedestrians and motorised vehicles occurred. Excessive use of automobiles has turned places into destinations or movement corridors. It has been forgotten that transportation can be more than just a means of getting to a place; it can be the experience of the place itself (Engwicht, 1993).
Diverse aspects of walking and walkability
In recent decades, many researchers have addressed the issue of increasing walking and in urban areas. Walkability literature deals with various aspects of sustainability and the factors contributing to it from diverse perspectives.
In this part of the research, walkability in literature is grouped according to their domains to effectively understand the factors and criteria of walkability suggested by various researchers over recent decades. Environmental and behavioural issues are the most influential factors affecting walking, whether as a means of transportation or socialising and communicating.
Behavioural factors affecting walking
A recent urban design study attempted to provide researchers with the subjective quality of urban street environments to provide operational definitions to measure street environments and test key relationships with walking behaviour ( Fig. 1; Ewing and Handy, 2009).
There is no easy solution as many areas were established prior to policymaking, and it has become attractive for architects, planners and the government to plan new areas and enhance the existing areas. However, the real problem is the lack of awareness among the public, which is strengthened by the lack of government support to encourage citizens to walk within city centres. Stricter measures are needed to change attitudes and may only be modified by the design of the city centre environment itself. Further research is suggested to assess the effectiveness of policies in encouraging people to walk in city centres as this may influence why there is still a lack of interest among citizens to walk.
Environmental factors affecting walking
The connection between the built environment and human travel behaviour (especially walking and cycling) has been an exciting and challenging issue for urban planners. The built environment includes the following fields:
• The design of a city and the arrangement of its physical elements (urban design) • Distribution of various activities in an urban space (land use) • Transportation system including streets, sidewalks, and bicycle paths. • The built environment also includes diverse human activities within the physical environment (Handy et al., 2002).
Changes in the physical environment affect the cost of travel and utility. The design features and physical element of a walkable urban space proposed by New Urbanists and many other urban researchers, such as high-density mixed land-uses, well-connected streets and improved sidewalks, aim to reduce the distance and time of trips and the travel cost. The travel experience must be improved to increase walking and cycling by enhancing understanding of convenience, aesthetic qualities, and safety (Handy and Clifton, 2001). There are approximately 50 perceptual qualities of the urban environment in literature reviews (Handy et al., 2002). Of these, six (Imageability, Legibility, Enclosure, Human scale, Transparency and Complexity) were selected for further study based on their importance in the literature.
Walking as a mode of transportation
Providing a suitable environment for walking has become a fundamental challenge in urban design and transportation. Walking and cycling, previously accepted as recreational activities, have attracted planners and designers' attention in recent decades as a means of transportation. Southworth (2005) considers pedestrian requirements in urban and suburban areas with respect to maintaining essential criteria for a walkable city. He defines walkability to the extent to which a safe and convenient environment encouraging walking is provided for pedestrians. A walkable environment provides a variety of destinations that are accessible within a logical amount of time and effort and offers visual interest in walking throughout the network. The walkability criteria for an urban environment are: 1. Connectivity of a path network, both locally and in the larger urban setting 2. Linkage with other transportation modes such as bus and subway 3. Fine-grained and varied land use patterns, particularly for serving local uses 4. Safety from traffic and criminal activities 5. Path quality, including the width of paths, paving, landscape, signing, and lighting 6. Path context, including visual interest of the built environment, landscape, street design, transparency, spatial definition, and general "explore-ability" (Southworth, 2005).
Walking for socialisation
Social interactions and social conflict have a positive effect on the physical and mental health of individuals. Leyden (2003) explored the impacts of mixed and pedestrian-oriented neighbourhoods on the level of social interaction. To this end, he examined the relationship between neighbourhood design and individual level of social capital. Social capital refers to "social networks and interactions that inspire trusted reciprocity in citizens". A high level of social capital in society encourages members to participate in voluntary activities and be more willing to gather with other people. In his studies, Leyden indicates that walkable neighbourhoods have a high level of social capital compared to car-oriented suburban neighbourhoods. This study shows that those living in walkable neighbourhoods have more social relationships with others and have a greater sense of trust and participation in political and social activities. Accordingly, a high level of neighbourhood walkability and mixed-use design create more social capital and improve people's physical and mental health (Leyden, 2003).
Liveability
Liveability is the social and environmental quality of the area perceived by residents, employees, customers and visitors (Lambert, 2005). The main features of liveability can be considered from different aspects, including environmental conditions such as air and water quality, cleanliness, dust and noise levels. Other factors include personal security, public health and traffic safety, and refers to the quality of social interactions such as neighbourhood, fairness and respect, and community identity. Finally, aesthetics, recreational opportunities, and environmental elements such as historic structures and the preservation of traditional local architectural styles are other aspects of liveability in an urban space (VTPI, 2014).
Walkability is considered a sub-heading of the notion of liveability. Therefore, theories of liveability would help to understand walkability and its importance better.
Liveability became important in the 1960s when the adverse effects of motorised cities and urban sprawl were recognised as a significant problem in urban areas. These problems have reduced the vitality of cities (Engelke et al., 2003).
Walkability and factors contributing to walkability
Walkability has become one of the most controversial and fast-growing concepts in urban planning and urban design. Walkability is such that the environment created with people's presence for shopping, visiting, enjoying or spending leisure time is more friendly. Walkability, which can be considered a relatively new phenomenon in urban design, has many social, economic and health benefits. One of the best ways to determine whether a block, corridor or neighbourhood is walkable is to "count the number of people walking, lingering and engaging in optional activities within a space" (Gehl, 1998). The presence of people, especially children, the elderly and the disabled, in an urban space, is a good indicator of walkability (Zehner, 2012). Based on the literature criteria, this research has developed four groups of factors that effectively increase the walking rate and the walkability in urban space.
Lifestyle factors
According to Saelens et al. (2003) studies, the lifestyle circumstances influencing the walkability of urban space is divided into three different groups (see also in Table 1):
• Individual issues: Individual lifestyles that influence walking behaviour in an area are mainly related to "ecologic models of behaviour". Self-efficacy, a positive perspective about walking as a significant physical activity and social support are the main features influencing individuals' desires for walking. • Group issues: A high degree of social connections positively affects both physical and mental health. People with high social engagement with others live longer and have higher levels of health. People with high social capital also exhibit more kindness and trust towards other people. • Regional and environmental issues: Proximity and connectivity are two significant factors that directly impact urban design, discourage people from driving, and encourage them to walk to short-distance destinations. Proximity refers to closeness between activity points and optimum distance of travel routinely accepted by people. Connectivity refers to directness or ease of travel between two activity points that is causally related to the characteristics of street design.
Locational factors 5.2.1 Mixed land-use and neighbourhood public spaces
Mixed land use refers to the proper integration of the various types of physical space uses in each urban area. The most important and essential uses required for a qualified mixeduse urban area are official, residential, retail and commercial uses, with a variety of public spaces. Walkable streets or neighbourhoods should have high access to various urban activities, especially those needed for everyday life, including shops, grocery stores, banks, schools, and cafes within 10 to 20 minutes on foot. A mixed land-use neighbourhood can encourage students to walk to schools and to the neighbourhood parks to play, provided that high-speed vehicles are highly restricted and a high level of safety from both traffic and criminal danger is retained in the neighbourhood.
Pathway characteristics, continuity and connectivity
A well-designed pedestrian path provides all pedestrians, including children, the elderly and the disabled, with an ideal level of safety and comfort. A walkable pathway should have a standard width that two or three people can walk easily beside each other without interrupting others.
A well-designed path should also have a relatively smooth surface; the continuity of a pathway and its connectivity are also significant factors in increasing walkability. Moreover, topography is a crucial factor affecting path quality and level of walkability. For instance, steep pathways, particularly in regions with snowy climates where the surface is covered by ice during several months of the year, can decrease pedestrians' safety and restrict their mobility. With steep pathways, utilising steps or railings can help make walking easier. Moreover, providing high connectivity and linking walking paths to other modes of public transportation, including subway and bus, is very significant in their contribution to high walkability. Sufficient public transport stations are required to permit pedestrian access between residential and commercial areas, usually within 10 to 20 minutes walking distance.
Quality of built environment and architecture
The built environment is another influential factor in urban space walkability because of its important role in increasing legibility, aesthetics, convenience, and many other accepted features of a city. The form and placement of various urban elements should be precisely chosen, and their particular qualities should be considered both in design and implementation processes. Successful urban design and an appropriate combination of urban elements encourage people to walk. The architectural style of buildings and urban design styles define a particular identity for a given street and create a sense of place and belongingness in pedestrians. Qualified architecture and urban design are mainly concerned with attractiveness, comfort, legibility, green space and a sense of place.
Urban design factors
The third group of walkability attributes are urban design factors. Although design factors affecting walkability can encompass a wide range of criteria, this research concentrates on the following design factors:
• Imageability is the quality of a place that makes it distinct, recognisable and memorable. A place has high imageability when specific physical elements and their arrangement capture attention, evoke feelings and create an impression. • Legibility is defined as the ease with which a city's parts can be recognised and organised into a coherent pattern. There are five essential components for a legible city: paths (routes along which people move throughout the city), nodes (unforgettable places or strategic points that are majorly significant for orientation), edges (elements that separate two regions), districts (distinguished by homogeneity, functionality and repetition of physical images) and landmarks (defined physical object such as a particular building, sign, symbol or even a hill or mountain, which is observable from various distances). (Lynch, 1960) • Enclosure refers to the degree to which streets and other public spaces are visually defined by buildings, walls, trees and other vertical elements. Spaces where the height of vertical elements are in proportion and related to the width of the space between them; having a room-like quality. • Human scale refers to the size, texture and articulation of physical elements that match the size and proportions of humans and, equally important, correspond to the speed at which humans walk. Building details, pavement texture, street trees, and furniture are physical elements contributing to human scale. • Transparency refers to how people can see or perceive what lies beyond the edge of a street. Physical elements that influence transparency include walls, windows, doors, fences, landscaping and openings into mid-block spaces. • Complexity refers to the visual richness of a place.
The complexity of a place depends on the variety of the physical environment, specifically the numbers and types of buildings, architectural diversity, landscape elements, street furniture, and human activity. It is one perceptual quality that has been measured in visual assessment studies and is related to changes in texture, width, height and setback of buildings.
Personal factors 5.4.1 Sense of safety
The safety of urban space has two aspects: actual safety and perceived safety. Actual safety means a safety that can be achieved through physical properties in urban spaces. As a street is a three-dimensional entity including various elements such as sidewalks, vehicular path, buildings and street furniture, actual safety in an urban space should be achieved in different ways.
Perceived safety refers to maintaining pedestrians' security from the perception or negative feelings of criminal activities or dangers from traffic in an urban area. Controlling excessive traffic noise, which generates anxiety in people, is also a concern of perceptual safety. Moreover, proper arrangement of buildings that minimises dark and hidden spaces between buildings can be considered one of the factors that enhance perceived safety (Jaskiewicz, 2000).
Jane Jacobs (1961), in his book "The Death and Life of Great American Cities", defined three important qualities for perceptual safety:
1. A clear delimit between public and private space 2. Buildings oriented towards the street to provide "eyes on the street." 3. Common use facilities to add more "eyes on the street."
Level of interest
Level of interest analyses the aesthetic level that attracts people to an urban space using Gestalt principles (shape, form, pattern or configuration). Despite that discussion about aesthetic or attraction is a debatable and complicated issue, these principles can help us to evaluate whether an urban space is attractive or not.
According to Gestalt psychology, we perceive the environment through four steps:
• Detection of simple features such as colours, curvatures and end of lines. • Parsing of the scene in a way that shapes can be recognised from the background. This step of visual perception is called 'perceptual segregation'. In this step, the mind separates the objects from their background; therefore, the object is observed as a coherent whole, distinct from its background. This is called the 'figure-ground' relation in Gestalt. • Perceptual organisation in which the mind groups the parts into one single object. • Pattern recognition that determines what the object is (McWilliams, 2015).
Lighting and visibility
The quality of lighting along a street has a considerable influence on pedestrians and drivers. Appropriate lighting systems enhance visibility. Although the lighting system of a street is a factor being handled in the design process, the impact of light on the feelings of safety and comfort depends on pedestrians' perceptions and attitudes regarding lighting levels and fear of darkness.
Conclusion
The origin of the walking behaviour harks back to the basic human behaviours where walking is the most primitive and obvious way of moving in space, also on an urban scale.
During the recent century, with the advent of advanced technology, walking has been replaced by motorisation, which has generated several livability problems, such as increased air pollution and human dependence on cars. To achieve a sustainable environment, scientists (urban planners, designers, environmentalists, health care.) started to explore the relationship between walking behaviour and liveability by transforming cities into more walkable communities. The results show that walking and the social life generated through pedestrian space usage and liveability are directly correlated. Previously, scientists have focused more on physical factors of sustainability that have a significant impact on walking behaviour and walkability. Various sorts of influential factors in increasing walkability and encouraging people to walk through urban spaces are proposed in a wide range of research concerning this issue. The scope and suggested walkability factors were collected in this study, and these factors were selected and categorised into four main groups: lifestyle factors, locational factors, urban design factors and personal factors. To fully understand the value of the statistical studies on walkability and to understand why there are differences in the results and the factors that are considered important in urban design literature, we need to consider the context of the different studies and what aspects they are capturing within the complex mechanism of walkability. Most correlational studies on walkability have been conducted in highly car-dependent, problematic (from the perspective of walkability) contexts (e.g., residential neighbourhoods in the USA, Canada, or Australia). These studies often deal with situations that do not allow or prevent the transformation of environmental conditions. They are capturing the effect, or rather the absence, of the route and its destination and providing an aspect of walkability; its unliveability. Although walkability research is often referred to as walking encouragement, these studies deal with the condition where the environment prohibits walking.
Fig. 1
1Conceptual framework for the influences on walking behaviour(Ewing and Handy, 2009).
Table 1
1The factor of lifestyle circumstances influencing walkability ofurban space (Saelens et al., 2003)
Individual
factors
Psychological or
cognitive factors
Subjective norms
Perceived behavioural control
Level of behavioural intention
Habitual behaviour
Self-efficacy
Physical activity enjoyment
levels
Attitudes and Awareness
Demographic factors Age / Gender
Education
Marital status
Biological factors
Weight
Group
factors
Sociological factors Levels of social support
Social reinforcement
Social modelling
Sport membership, recreational
activities, and outdoor clubs
Regional
factors
Cultural factors
Informal "culture" of
neighbourhoods
Climate Topography Coastal neighbourhoods
Measuring the Built Environment for Physical Activity: State of the Science. R C Brownson, C M Hoehner, K Day, A Forsyth, J F Sallis, American Journal of Preventive Medicine. 364Brownson, R. C., Hoehner, C. M., Day, K., Forsyth, A., Sallis, J. F. (2009) "Measuring the Built Environment for Physical Activity: State of the Science", American Journal of Preventive Medicine, 36(4), pp. S99-S123.E12.
. 10.1016/j.amepre.2009.01.005https://doi.org/10.1016/j.amepre.2009.01.005
Indoor Recreational Walking in Semi-Public Spaces: Assessing Demand and Design Standards. C Duffy, Massachusetts Institute of TechnologyAcademic ThesisDuffy, C. (2009) "Indoor Recreational Walking in Semi-Public Spaces: Assessing Demand and Design Standards", Academic Thesis, Massachusetts Institute of Technology.
Health and Community Design: The Impact of The Built Environment on Physical Activity. P O Engelke, T L Schmid, L D Frank, Island PressWashington, DC, USAEngelke, P. O., Schmid, T. L., Frank, L. D. (2003) "Health and Community Design: The Impact of The Built Environment on Physical Activity", Island Press, Washington, DC, USA.
Reclaiming Our Cities and Towns: Better Living with Less Traffic. D Engwicht, New Society PublishingPhiladelphia, PA, USAEngwicht, D. (1993) "Reclaiming Our Cities and Towns: Better Living with Less Traffic", New Society Publishing, Philadelphia, PA, USA.
Measuring the Unmeasurable: Urban Design Qualities Related to Walkability. R Ewing, S Handy, Journal of Urban Design. 141Ewing, R., Handy, S. (2009) "Measuring the Unmeasurable: Urban Design Qualities Related to Walkability", Journal of Urban Design, 14(1), pp. 65-84.
. 10.1080/13574800802451155https://doi.org/10.1080/13574800802451155
Public Spaces, Public Life submitted by Royal Danish Academy of Fine Arts. J Gehl, Places. 12Gehl, J. (1998) "Public Spaces, Public Life submitted by Royal Danish Academy of Fine Arts", Places, 12(1), pp. 27-28. [online] Available at: http://escholarship.org/uc/item/17q591xt [Accessed 14 May 2020]
How the built environment affects physical activity: Views from urban planning. S L Handy, M G Boarnet, R Ewing, R E Killingsworth, American Journal of Preventive Medicine. 232Handy, S. L., Boarnet, M. G., Ewing, R., Killingsworth, R. E. (2002) "How the built environment affects physical activity: Views from urban planning", American Journal of Preventive Medicine, 23(2), pp. 64-73.
. 10.1016/S0749-3797(02)00475-0https://doi.org/10.1016/S0749-3797(02)00475-0
Local shopping as a strategy for reducing automobile travel. S L Handy, K J Clifton, Transportation. 284Handy, S. L., Clifton, K. J. (2001) "Local shopping as a strategy for reducing automobile travel", Transportation, 28(4), pp. 317-346.
. 10.1023/A:1011850618753https://doi.org/10.1023/A:1011850618753
The Death and Life of Great American Cities. J Jacobs, New York, NY, USARandom HouseJacobs, J. (1961) "The Death and Life of Great American Cities", Random House, New York, NY, USA.
Pedestrian Level of Service Based on Trip Quality. F Jaskiewicz, TRB Circular E-C019: Urban Street Symposium. Dallas, TX, USA1/14. [online] Available atJaskiewicz, F. (2000) "Pedestrian Level of Service Based on Trip Quality", In: TRB Circular E-C019: Urban Street Symposium, Dallas, TX, USA, pp. G-1/1-G-1/14. [online] Available at: http:// onlinepubs.trb.org/onlinepubs/circulars/ec019/Ec019_g1.pdf [Accessed: 14 May 2020]
A critical evaluation of liveability in Garrison Woods. K Lambert, 10.11575/PRISM/1238University of CalgaryUnpublished Master's ThesisLambert, K. (2005) "A critical evaluation of liveability in Garrison Woods", Unpublished Master's Thesis, University of Calgary. https://doi.org/10.11575/PRISM/1238
Social Capital and the Built Environment: The Importance of Walkable Neighbourhoods. K M Leyden, American Journal of Public Health (AJPH). 939Leyden, K. M. (2003) "Social Capital and the Built Environment: The Importance of Walkable Neighbourhoods", American Journal of Public Health (AJPH), 93(9), pp. 1546-1551.
. 10.2105/AJPH.93.9.1546https://doi.org/10.2105/AJPH.93.9.1546
Quantifying the Benefits of Nonmotorized Transportation, For Achieving Mobility Management Objectives. T Litman, Victoria, CanadaVictoria Transport Policy InstituteLitman, T. (2010) "Quantifying the Benefits of Nonmotorized Transportation, For Achieving Mobility Management Objectives", [pdf] Victoria Transport Policy Institute, Victoria, Canada. Available at: http://www.indiaenvironmentportal.org.in/files/nmt- tdm.pdf [Accessed 14 May 2020]
Economic Value of Walkability. T Litman, Victoria, Canada. AvailableVictoria Transport Policy InstituteLitman, T. (2011) "Economic Value of Walkability", [pdf] Victoria Transport Policy Institute, Victoria, Canada. Available at: http:// www.vtpi.org/walkability.pdf [Accessed 14 May 2020]
Non-Motorized Transportation Planning: Identifying Ways to Improve Pedestrian and Bicycle Transport. T Litman, Victoria Transport Policy, Institute, Litman, T., Victoria Transport Policy Institute (2012) "Non-Motorized Transportation Planning: Identifying Ways to Improve Pedestrian and Bicycle Transport", [online] Available at: https://www.vtpi. org/tdm/tdm25.htm [Accessed 14 May 2020]
Evaluating Active (Non-Motorised) Transport: Techniques for Measuring Walking and Cycling Activity and Conditions. T Litman, Victoria Transport Policy, Institute, Litman, T., Victoria Transport Policy Institute (2014) "Evaluating Active (Non-Motorised) Transport: Techniques for Measuring Walking and Cycling Activity and Conditions", [online] Available at: https://www.vtpi.org/tdm/tdm63.htm [Accessed 14 May 2020]
Sirjani and Szabó Period. K Lynch, Polytech. Arch. 52153The M. I. T. PressThe Image of the CityLynch, K. (1960) "The Image of the City", The M. I. T. Press, Massachusetts Institute of Technology, Cambridge, MA, USA. Sirjani and Szabó Period. Polytech. Arch., 52(1), pp. 46-53, 2021 |53
Reducing the Number of Short Trips by Car. R L Mackett, AET European Transport Conference (ETC). Cambridge, UKMackett, R. L. (2000) "Reducing the Number of Short Trips by Car", presented at AET European Transport Conference (ETC), 1999, Cambridge, UK, September 27 1999. [online] Available at: https:// www.researchgate.net/publication/330554508_Reducing_the_
Psychology, History of (Twentieth Century). S A Mcwilliams, International Encyclopedia of the Social & Behavioral Sciences. Wright, J. D.Amsterdam, The NetherlandsElsevierMcWilliams, S. A. (2015) "Psychology, History of (Twentieth Century)", In: Wright, J. D. (ed.) International Encyclopedia of the Social & Behavioral Sciences, Elsevier, Amsterdam, The Netherlands, pp. 412-417.
. 10.1016/B978-0-08-097086-8.03046-4https://doi.org/10.1016/B978-0-08-097086-8.03046-4
Sustainability and Cities, Overcoming Automobile Dependence. P Newman, J R Kenworthy, Island PressWashington, DC, USANewman, P., Kenworthy, J. R. (1999) "Sustainability and Cities, Overcoming Automobile Dependence", Island Press, Washington, DC, USA.
Designing the Walkable City. M Southworth, Journal of Urban Planning and Development. 1314Southworth, M. (2005) "Designing the Walkable City", Journal of Urban Planning and Development, 131(4), pp. 246-257.
. 10.1061/(ASCE)0733-9488(2005)131:4(246)ASCEhttps://doi.org/10.1061/(ASCE)0733-9488(2005)131:4(246)
Environmental correlates of walking and cycling: Findings from the transportation, urban design, and planning literatures. B E Saelens, J F Sallis, L D Frank, Annals of Behavioral Medicine. 252Saelens, B. E., Sallis, J. F., Frank, L. D. (2003) "Environmental correlates of walking and cycling: Findings from the transportation, urban design, and planning literatures", Annals of Behavioral Medicine, 25(2), pp. 80-91.
. 10.1207/S15324796ABM2502_03https://doi.org/10.1207/S15324796ABM2502_03
Community Liveability: Helping to Create Attractive, Safe, Cohesive Communities. Victoria Transport Policy Institute (VTPIVictoria Transport Policy Institute (VTPI) (2014) "Community Liveability: Helping to Create Attractive, Safe, Cohesive Communities", [online] Available at: http://www.vtpi.org/tdm/ tdm97.htm [Accessed 14 May 2020]
Green Illusions: The Dirty Secrets of Clean Energy and the Future of Environmentalism. O Zehner, 10.2307/j.ctt1d9nqbcUniversity of Nebraska PressLincoln City, OR, USAZehner, O. (2012) "Green Illusions: The Dirty Secrets of Clean Energy and the Future of Environmentalism", University of Nebraska Press, Lincoln City, OR, USA. https://doi.org/10.2307/j.ctt1d9nqbc
| Neighborhood walkability has been associated with increased physical activity, but only a few studies have explored the association between walkability and health outcomes related to physical activity, such as type 2 diabetes. The aim of this study was to investigate the association between objectively assessed neighborhood walkability and the 4-year incidence of type 2 diabetes in a sample of 512,061 Swedish adults aged 18 years and older. Neighborhoods were defined by 408 administratively defined geographical areas in the city of Stockholm. We found a negative association between walkability and type 2 diabetes (OR=1.33, 95% CI=1.13-1.55) that remained significant after adjusting for neighborhood deprivation. This association, however, no longer remained statistically significant after adjusting for individual socio-demographic factors. These results were also confirmed using a co-sibling design. Future studies are encouraged to further explore the potential effect of a broader array of the neighborhood built environment on health outcomes related to physical activity. | Great item, looks great on by honey, nice item and will buy again in another color. I don't think it will work for walking outside, but for dress up, cosplay or foreplay...it's perfect. | 1,999,801 |
Background
Morbidity and mortality from chronic conditions such as obesity, diabetes, heart disease, and depression among the US population are a critical public health issue (1,2). Substantial evidence indicates that aerobic physical activity, including walking, can reduce the risk of numerous physical and mental health conditions (3,4). Walking is an excellent way to achieve the recommended amount of aerobic physical activity (≥150 minutes per week) (5). According to the Behavioral Risk Factor Surveillance System, 48.7% of US adults in 2015 did not attain the recommended amount of weekly aerobic physical activity (6).
Various built environment characteristics, including sidewalk characteristics (eg, connectivity, continuity, width, barriers, condition), could influence walkability and physical activity (7). Although street audits that observe built environment characteristics in communities are common, few studies have assessed differences in observed characteristics at the sidewalk level or address level across large, generalizable geographic areas (8). The objective of this study was to describe, in map format, sidewalk characteristics at the address level in densely populated urban and suburban areas of northeastern New Jersey, where 51.7% of adults do not participate in at least 150 minutes of weekly aerobic physical activity (6).
Methods
We characterized sidewalks during virtual street audits via the Google Street View application, Computer Assisted Neighborhood Visual Assessment System (CANVAS) (9). Virtual street audits have been validated and demonstrated to be more cost-effective than in-person audits because of lower travel time and costs (9). We used CANVAS to assess several sidewalk characteristics, including 2 items within the 360° view at each audited location: sidewalk presence (yes or no) and sidewalk condition (poor [numerous breaks, uneven sidewalk], fair [some unevenness], or good [even, no breaks]).
We selected audited locations from non-highway roads in 6 counties in New Jersey. We selected locations approximately 150 m apart in densely populated Essex County (which encompasses Newark) and locations elsewhere approximately 600 m apart. The higher-density sampling allowed for investigation of the spatial autocorrelation structure of sidewalk characteristics and motivated the less dense sampling scheme of the 5 counties other than Essex. CANVAS auditors completed a 4-hour training session to collect data consistently for the presence or absence of sidewalks and the condition of sidewalks. Auditors were trained to report the worst sidewalk condition if sidewalks of different conditions were present at the same location. Of the 8,100 audited sidewalks observed in Essex County, 405 (5%) were rerated by each of all the auditors to provide estimates of test-retest and inter-rater agreement reliability (9). Auditors performed ratings on computers that had 2 monitors: one monitor displayed data input forms and the second monitor displayed the Google Street View scene. We downloaded and analyzed data on completed ratings; 11,282 locations were available for analysis.
Data on sidewalk presence and condition were combined into a sidewalk walkability variable with the following possible ordinal values: 0 (no sidewalk), 1 (poor sidewalk condition), 2 (fair sidewalk condition), and 3 (good sidewalk condition). Test-retest and inter-rater reliability were high in the reliability subsample (all intraclass correlation coefficients ≥0.89). Spatial analyses indicated that measured sidewalk walkability values correlated with other values at locations separated up to 4,200 m (2.6 miles). We used ordinary kriging to estimate sidewalk walkability values across the study area (9). Kriging models are spatial interpolation methods that predict sidewalk walkability at nonaudited locations based, in part, on the observed similarity between walkability values assessed at audited locations. Ordinary kriging results in continuous predictions, and we plotted these continuous predictions on a map as a range of walkability, from low (no sidewalk or poor condition) to moderate (fair condition) to high (good sidewalk condition). We analyzed concurrent validity of the sidewalk walkability construct through a census tract-level Spearman correlation coefficient (ρ = 0.22, P < .001) of the relationship between average sidewalk walkability in each tract and proportion of commuters in that tract who reported walking to work in the 2012-2016 American Community Survey (10). We used SAS version 9.4 (SAS Institute Inc) and ArcGIS version 10.5 (Esri) in all analyses.
Main Findings
We found several geographic patterns in sidewalk walkability in northern New Jersey. The presence of any sidewalk and the presence of sidewalks in fair or good condition were more common in urban cores (Newark, East Orange, Passaic, and Hoboken) than outside these cores and occurred less frequently as distance from these cores increased (for example, in northern West Milford Township, northern Mahwah Township, and southern Manalapan Township). However, we found heterogeneity in sidewalk walkability at a smaller geographic scale, which was subtle in the urban cores but more apparent in the western suburbs of Newark and East Orange (for example, in Roseland Borough). Generally, sidewalks were absent or in poor condition along major roads in otherwise walkable urban cores.
Action
We used virtual street audits and spatial interpolation techniques to construct a detailed high-resolution map of sidewalk conditions in northeastern New Jersey. Such high-resolution maps can be informative and powerful tools, offering finer-grain detail on sidewalk conditions than would be available in tabular format or a choropleth map. We demonstrated that the use of innovative, spatially based sampling and estimation methods, publicly available Google Street View scenery, and the CANVAS application can allow for large-scale, routine, and standardized collection of variables related to sidewalk characteristics. Such information can be useful both for research and practice. For researchers, precise measures of sidewalk conditions can help identify barriers to walking-based physical activity. For practitioners, this map may help identify key areas for intervention to maintain and modify sidewalk conditions (11). Improvements made to walkability may be one of the most cost-effective strategies for increasing physical activity and reducing disparities in chronic disease, particularly among populations that do not achieve recommended amounts of physical activity (4). A map indicating regions for improvement in walkability may facilitate identification of regions in need of sidewalk improvements to support walking-based physical activity. Future research should extend this measure across all of New Jersey and further explore potential correlates of sidewalk conditions, such as race/ethnicity and socioeconomic status.
AcknowledgmentsThis study was supported by funds from the Cancer Institute of New Jersey Cancer Prevention and Control pilot award (P30CA072720-19) and National Cancer Institute (K07CA222158-01). This study was also partly supported by the Columbia Population Research Center (P2CHD058486) and the Eunice Kennedy Shriver National Institute of Child Health & Human Development of the National Institutes of Health (1R01HD087460-01).
Multiple chronic conditions among US adults: a 2012 update. B W Ward, J S Schiller, R A Goodman, Prev Chronic Dis. 1162Ward BW, Schiller JS, Goodman RA. Multiple chronic conditions among US adults: a 2012 update. Prev Chronic Dis 2014;11:E62.
Depression and obesity in the U.S. adult household population. L A Pratt, D J Brody, NCHS Data Brief. 167Pratt LA, Brody DJ. Depression and obesity in the U.S. adult household population, 2005-2010. NCHS Data Brief 2014; (167):1-8.
US Department of Health and Human Services. Physical Activity Guidelines Advisory Committee scientific report. US Department of Health and Human ServicesUS Department of Health and Human Services. 2018 Physical Activity Guidelines Advisory Committee scientific report. Washington (DC): US Department of Health and Human Services; 2018.
Step it up! The Surgeon General's call to action to promote walking and walkable communities. Office of the Surgeon General. US Department of Health and Human ServicesUS Department of Health and Human Services. Step it up! The Surgeon General's call to action to promote walking and walkable communities. Washington (DC): Office of the Surgeon General; 2015.
American College of Sports Medicine position stand. Quantity and quality of exercise for developing and maintaining cardiorespiratory, musculoskeletal, and neuromotor fitness in apparently healthy adults: guidance for prescribing exercise. C E Garber, B Blissmer, M R Deschenes, B A Franklin, M J Lamonte, I M Lee, Med Sci Sports Exerc. 437Garber CE, Blissmer B, Deschenes MR, Franklin BA, Lamonte MJ, Lee IM, et al. American College of Sports Medicine position stand. Quantity and quality of exercise for developing and maintaining cardiorespiratory, musculoskeletal, and neuromotor fitness in apparently healthy adults: guidance for prescribing exercise. Med Sci Sports Exerc 2011;43(7):1334-59.
Behavioral Risk Factor Surveillance System prevalence and trends data. Centers for Disease Control and Prevention. Centers for Disease Control and Prevention. Behavioral Risk Factor Surveillance System prevalence and trends data: 2015. https://www.cdc.gov/brfss/brfssprevalence. Accessed August 7, 2018.
Neighborhood Environment Walkability Scale: validity and development of a short form. E Cerin, B E Saelens, J F Sallis, L D Frank, Med Sci Sports Exerc. 389Cerin E, Saelens BE, Sallis JF, Frank LD. Neighborhood Environment Walkability Scale: validity and development of a short form. Med Sci Sports Exerc 2006;38(9):1682-91.
Obesity, physical activity, and the urban environment: public health research needs. R P Lopez, H P Hynes, Environ Health. 5125Lopez RP, Hynes HP. Obesity, physical activity, and the urban environment: public health research needs. Environ Health 2006;5(1):25.
Street audits to measure neighborhood disorder: virtual or in-person?. S J Mooney, Mdm Bader, G S Lovasi, J O Teitler, K C Koenen, A E Aiello, Am J Epidemiol. 1863Mooney SJ, Bader MDM, Lovasi GS, Teitler JO, Koenen KC, Aiello AE, et al. Street audits to measure neighborhood disorder: virtual or in-person? Am J Epidemiol 2017; 186(3):265-73.
. US Census Bureau. American Community Survey. US Census Bureau. American Community Survey, 2012-2016.
American Community Survey 5-year estimates; using American FactFinder. American Community Survey 5-year estimates; using American FactFinder. 2018. http://factfinder2.census.gov. Accessed August 30, 2018.
Do inequalities in neighborhood walkability drive disparities in older adults' outdoor walking?. R Zandieh, J Flacke, J Martinez, P Jones, M Van Maarseveen, Int J Environ Res Public Health. 147740Zandieh R, Flacke J, Martinez J, Jones P, van Maarseveen M. Do inequalities in neighborhood walkability drive disparities in older adults' outdoor walking? Int J Environ Res Public Health 2017;14(7):E740.
| Understanding the role of the built environment on physical activity behavior among older adults is an important public health goal, but evaluating these relationships remains complicated due to the difficulty of measuring specific attributes of the environment. As a result, there is conflicting evidence regarding the association between perceived and objectively measured walkability and physical activity among urban-dwelling older adults. This suggests that both actual environmental features and perceptions of these attributes influence walking behavior. The purpose of this pilot project is to create an Objective Walkability Index (OWI) by census block using a Geographic Information System (GIS) and supplement the results with resident perceptions thus more accurately characterizing the context of walkability. Computerized Neighborhood Environment Tracking (ComNET) was used to systematically assess environmental risks impacting activity patterns of older adults in two New York City neighborhoods. In addition, the Senior Center Evaluation of the Neighborhood Environment (SCENE) survey was administered to older adults attending two senior centers located within the target neighborhoods. The results indicate that there is substantial variation in OWI score both between and within the neighborhoods suggesting that residence in some communities may increase the risk of inactivity among older adults. Also, low walkability census blocks were clustered within each neighborhood providing an opportunity for targeted investigation into localized threats to walkability. A lack of consensus regarding the association between the built environment and physical activity among older adults is a consequence of the problems inherent in measuring these determinants. Further empirical evidence evaluating the complex relationships between the built environment and physical activity is an essential step towards creating active communities.AbstractUnderstanding the role of the built environment on physical activity behavior among older adults is an important public health goal, but evaluating these relationships remains complicated due to the difficulty of measuring specific attributes of the environment. As a result, there is conflicting evidence regarding the association between perceived and objectively measured walkability and physical activity among urban-dwelling older adults. This suggests that both actual environmental features and perceptions of these attributes influence walking behavior. The purpose of this pilot project is to create an Objective Walkability Index (OWI) by census block using a Geographic Information System (GIS) and supplement the results with resident perceptions thus more accurately characterizing the context of walkability. Computerized Neighborhood Environment Tracking (ComNET) was used to systematically assess environmental risks impacting activity patterns of older adults in two New York City neighborhoods. In addition, the Senior Center Evaluation of the Neighborhood Environment (SCENE) survey was administered to older adults attending two senior centers located within the target neighborhoods. The results indicate that there is substantial variation in OWI score both between and within the neighborhoods suggesting that residence in some communities may increase the risk of inactivity among older adults. Also, low walkability census blocks were clustered within each neighborhood providing an opportunity for targeted investigation into localized threats to walkability. A lack of consensus regarding the association between the built environment and physical activity among older adults is a consequence of the problems inherent in measuring these determinants. Further empirical evidence evaluating the complex relationships between the built environment and physical activity is an essential step towards creating active communities. | Observing physical activity in suburbs | This study builds upon the current literature investigating the relationship between individuals' physical activity and the built environment. This prospective study of two lifestyle interventions in adults explores the moderating effect of the built environment measured both objectively and by self-report. Results show that overweight men in an intervention group increased their walking significantly more if they lived in less walkable neighborhoods. Overweight women were more likely to increase their physical activity over time if they perceived better safety from traffic. This study suggests that psychosocial interventions can help men overcome environmental barriers to walking. | The role of neighborhood characteristics in promoting physical activity and sedentary behaviors (SB) has not been extensively studied in university students. The study purpose was to analyze the associations of neighborhood built environment and neighborhood socioeconomic status (SES) with active commuting, leisure-time physical activity (LTPA), and SB among university students. This is a cross-sectional study of 308 undergraduate students from two urban universities in Valencia, Spain. Participants' residential neighborhoods were classified according to walkability and SES levels. Walkability was defined as an index of three built environment attributes (i.e., residential density, land-use mix, and street connectivity) based on geographical information system data. Active commuting to and from university (ACU), active commuting in the neighborhood, LTPA, and SB were evaluated through a questionnaire. Mixed model regression analyses were performed. There were no significant SES-walkability interactions for any of the outcomes analyzed. However, university students living in more walkable areas reported two more ACU trips per week compared to those living in less walkable neighborhoods (p < 0.01). University students living in lower-SES neighborhoods reported more ACU trips per week than those living in higher-SES neighborhoods (p < 0.05). Regarding LTPA, there were no significant SES or walkability main effects. Neighborhood SES was negatively related to active commuting in the neighborhood and to time spent in SB (all p < 0.05). Participants living in lower-SES neighborhoods reported more active commuting per week and had the highest average minutes spent in SB. This study highlights the relevance of assessing university's residential environment when active transportation and SB are analyzed. | BACKGROUND ::: Sedentary behavior (too much sitting) has deleterious health consequences that are distinct from lack of physical activity (too little exercise). ::: ::: ::: PURPOSE ::: This study aimed to examine the associations of neighborhood walkability and sociodemographic factors with adults' self-reported and objectively assessed sedentary time. ::: ::: ::: METHODS ::: This Belgian cross-sectional study was conducted between May 2007 and September 2008. Twenty-four neighborhoods were stratified on GIS-based walkability and neighborhood SES. In all, 1200 adults (aged 20-65 years; 50 per neighborhood; 42.7 [SD=12.6] years; 47.9% men) completed a sociodemographic survey and the International Physical Activity Questionnaire. They also wore an accelerometer for 7 days: Sedentary time was identified as accelerometer counts of less than 100 per minute. Statistical analyses were performed in 2009, using multilevel regression models, adjusted for physical activity levels and individual SES. ::: ::: ::: RESULTS ::: Residents of high-walkable neighborhoods reported more sitting time than those of low-walkable neighborhoods (439.8 vs 403.4 minutes/day of daily sitting time, p<0.05). Living in high-walkable versus low-walkable neighborhoods was also associated with 2.9% more accelerometer-measured overall sedentary time (p<0.001). Being male, younger, unemployed, more highly educated, having a white-collar job (analysis for employed adults only), and living without children were all significantly associated with more sitting time. ::: ::: ::: CONCLUSIONS ::: Contrary to expectations, living in a high-walkable neighborhood was associated with higher levels of sedentary time. If future studies in other contexts confirm these associations, environmental and policy innovations aiming to promote physical activity may need to address the potential negative health impact of sedentary behavior. | The pattern of pedestrian crashes varies greatly depending on lighting circumstances, emphasizing the need of examining pedestrian crashes in various lighting conditions. Using Louisiana pedestrian fatal and injury crash data (2010)(2011)(2012)(2013)(2014)(2015)(2016)(2017)(2018)(2019), this study applied Association Rules Mining (ARM) to identify the hidden pattern of crash risk factors according to three different lighting conditions (daylight, dark-withstreetlight, and dark-no-streetlight). Based on the generated rules, the results show that daylight pedestrian crashes are associated with children (<15 years), senior pedestrians (>64 years), older drivers (>64 years), and other driving behaviors such as 'failure to yield', 'inattentive/distracted', 'illness/fatigue/asleep'. Additionally, young drivers (15-24 years) are involved in severe pedestrian crashes in daylight conditions. This study also found pedestrian alcohol/drug involvement as the most frequent item in the dark-withstreetlight condition. This crash type is particularly associated with pedestrian action (crossing intersection/midblock), driver age (55-64 years), speed limit (30-35 mph), and specific area type (business with mixed residential area). Fatal pedestrian crashes are found to be associated with roadways with highspeed limits (>50 mph) during the dark without streetlight condition. Some other risk factors linked with 'high-speed limit' related crashes are pedestrians walking with/against the traffic, presence of pedestrian dark clothing, pedestrian alcohol/drug involvement. The research findings are expected to provide an improved understanding of the underlying relationships between pedestrian crash risk factors and specific lighting conditions. Highway safety experts can utilize these findings to conduct a decision-making process for selecting effective countermeasures to reduce pedestrian crashes strategically. | Planning research has shown correlations between urban sprawl and obesity. Additional work has correlated higher walkability with increased walking behavior and improved population health independent of race, education, income, or lifestyle preferences. Presumably, people with access to a walkable neighborhood might improve their total well-being; however, housing research suggests that walkability is not equitably allocated and that price, sorting, discrimination and individual preferences may pose barriers to walkable neighborhoods as a health resource.As such, this work evaluates the inclusiveness of walkable neighborhoods in the San Francisco Bay Area, with the primary question of whether or not those with lower income can afford to live in walkable neighborhoods. Based on exploratory analysis and mapping, while the study finds no evidence of a positive association between income and walkable neighborhoods, the analysis does suggest a negative correlation between race and walkability for the most concentrated populations. Specifically, neighborhoods that are more Black, in locations with a higher share of the total regional population, appear correlated with less walkability. This pattern leads to the hypotheses that affordability and socio-cultural factors may be contributing to Black clustering in less walkable neighborhoods - that there may be barriers for these individuals to live in the most walkable areas and that many of these individuals may be either, 1) moving to less walkable suburban areas, or 2) left in less-walkable urban pockets. Interviews inform these hypotheses, suggesting that walkability may not factor in to housing decisions and that more research is needed to analyze whether or not income is a barrier to accessing a walkable neighborhood. Given the possibility that barriers exist, policies are suggested to improve streets, increase affordability, influence behavior, and to change the type of housing and financial tools available - with the goal of encouraging inclusiveness, and better ensuring that more individuals have access to walkable neighborhoods and the health benefits associated with walking. | Small Area and Individual Level Predictors of Physical Activity in Urban Communities: A Multi-Level Study in Stoke on Trent, England |
1,999,802 | Negative tunnelling magnetoresistance in spin filtering magnetic junctions with spin—orbit coupling | Magnetic tunnel junction (MTJ) is an important device element for many practical spintronic systems. In this paper, we propose and theoretically investigate a very attractive MTJ Fe(001)/O/NaCl(001)/O/Fe(001) as a two-terminal transport junction. By density functional theory total energy methods, we establish two viable device models: one with and the other without mirror symmetry across the center plane of the structure. Large tunnel magnetoresistance ratio (TMR) is predicted from first principles, at over 1800% and 3600% depending on the symmetry. Microscopically, a spin filtering effect is responsible for the large TMR. This effect essentially filters out all the minority spin channels (spin-down) from contributing to the tunnelling current. On the other hand, transport of the majority spin channel (spin-up) having Δ1 and Δ5 symmetry is enhanced by the FeO buffer layer in the MTJ. | We present some unusual spin-polarized transport phenomena in asymmetric double barrier magnetic tunneling junctions (ADBMTJs) with CoFe/AlOx/ferromagnetic nanoparticle (FM-NPs)/AlOx/Ta structures. The conductance curves and the magnetoresistance ratio clearly oscillate with applied bias voltage, indicating the presence of Coulomb blockade effects due to isolated ferromagnetic nanoparticles in the parallel configuration in the ADBMTJ. The oscillation period is about 1.5 mV at 2 K. | Angular Dependence of Magnetoresistance During Magnetization Reversal on Magnetic Tunnel Junction Ring | We investigate tunneling magnetoresistance (TMR) properties in ballistic spin field-effect transistors (SFETs) by taking into account the Rashba spin-orbit coupling (SOC), interface scattering, the presence of an in-plane magnetic field, band mismatch, and spin polarization in the ferromagnetic electrodes. It is shown that, for high potential barriers at the contact/channel interfaces, as the band mismatch is varied, the magnitude, amplitude, phase, and sign of the TMR are significantly modulated by the Rashba SOC, whereas the presence of the magnetic field makes the TMR oscillate between positive and negative values. Likewise, in an SFET with ohmic-contact interfaces, the Rashba SOC affects the band mismatch dependence of the TMR in a completely different fashion from the magnetic field. We also study the variation in the TMR when either the Rashba SOC strength or the magnitude or direction of the magnetic field is varied. Our theoretical results may be useful in analyzing experimental data of relevant devices. | Using a simple quantum-mechanical model, we explore a tunneling anisotropic magnetoresistance (TAMR) effect in ferroelectric tunnel junctions (FTJs) with a ferromagnetic electrode and a ferroelectric barrier layer, which spontaneous polarization gives rise to the Rashba and Dresselhaus spin-orbit coupling (SOC). For realistic parameters of the model, we predict sizable TAMR measurable experimentally. For asymmetric FTJs, which electrodes have different work functions, the built-in electric field affects the SOC parameters and leads to TAMR dependent on ferroelectric polarization direction. The SOC change with polarization switching affects tunneling conductance, revealing a new mechanism of tunneling electroresistance (TER). These results demonstrate new functionalities of FTJs which can be explored experimentally and used in electronic devices. | This paper investigates the effect of Dresselhaus spin-orbit coupling on the spin-transport properties of ferromagnet/insulator/semiconductor/insulator/ferromagnet double-barrier structures. The influence of the thickness of the insulator between the ferromagnet and the semiconductor on the polarization is also considered. The obtained results indicate that (i) the polarization can be enhanced by reducing the insulator layers at zero temperature, and (ii) the tunnelling magnetoresistance inversion can be illustrated by the influence of the Dresselhaus spin–orbit coupling effect in the double-barrier structure. Due to the Dresselhaus spin–orbit coupling effect, the tunnelling magnetoresistance inversion occurs when the energy of a localized state in the barrier matches the Fermi energy EF of the ferromagnetic electrodes. | The electronic reconstruction occurring at oxide interfaces may be the source of interesting device concepts for future oxide electronics. Among oxide devices, multiferroic tunnel junctions are being actively investigated as they offer the possibility to modulate the junction current by independently controlling the switching of the magnetization of the electrodes and of the ferroelectric polarization of the barrier. In this Letter, we show that the spin reconstruction at the interfaces of a La_{0.7}Sr_{0.3}MnO_{3}/BaTiO_{3}/La_{0.7}Sr_{0.3}MnO_{3} multiferroic tunnel junction is the origin of a spin filtering functionality that can be turned on and off by reversing the ferroelectric polarization. The ferroelectrically controlled interface spin filter enables a giant electrical modulation of the tunneling magnetoresistance between values of 10% and 1000%, which could inspire device concepts in oxides-based low dissipation spintronics. | Spin polarized tunneling in MgO-based tunnel junctions with superconducting electrodes | 1,999,802 | We present theoretical calculations of spin transport in spin filtering magnetic tunnelling junctions based on the Landauer—Buttiker formalism and taking into account the spin—orbit coupling (SOC). It is shown that spin-flip scattering induced by SOC is stronger in parallel alignment of magnetization of the ferromagnet barrier (FB) and the ferromagnetic electrode than that in antiparallel case. The increase of negative tunnelling magnetoresistance with bias is in agreement with recent experimental observation. | The influence of the Dresselhaus spin–orbit coupling on the tunnelling magnetoresistance in ferromagnet/insulator/semiconductor/insulator/ferromagnet tunnel junctions | Effect of interfacial spin–orbit coupling on spin-dependent tunnelling | Spin-dependent conductance minima in magnetic tunnel junctions | Competing spin-dependent conductance channels in underoxidized tunnel junctions | Based on the coherent quantum transport theory, the spin polarization and tunneling magnetoresistance for polarized electrons through ferromagnetic/semiconductor/ferromagnetic (FM/SM/FM) heterostructure are studied theoretically within the Landauer framework of ballistic transport. The significant quantum size, quantum coherent, angle between the magnetic moments of the left and right ferromagnets, and Rashba spin-orbit interaction are considered simultaneously. The results indicate that the spin polarization and tunneling magnetoresistance are periodic functions of the semiconductor channel length, quasiperiodic functions of the Rashba spin-orbit coupling strength, and depend on the relative orientation of the two magnetizations in the left and right ferromagnets. A moderate angle, semiconductor channel length, and Rashba spin-orbit coupling strength allow a giant spin polarization or tunneling magnetoresistance. The results may be of relevance for the implementation of quasi-one-dimensional spin-transis... | We explore electrically injected, spin polarized transport in a ballistic two-dimensional electron gas. We augment the Büttiker-Landauer picture with a simple, but realistic model for spin-selective contacts to describe multimode reservoir-to-reservoir transport of ballistic spin 1/2 particles. Clear and unambiguous signatures of spin transport are established in this regime, for the simplest measurement configuration that demonstrates them directly. These new effects originate from spin precession of ballistic carriers; they exhibit strong dependence upon device geometry and vanish in the diffusive limit. Our results have important implications for prospective "spin transistor" devices. | Spin transport in lateral ferromagnetic/nonmagnetic hybrid structures | Theory and Simulation of Spin Transport in Antiferromagnetic Semiconductors: Application to MnTe |
1,999,803 | Online school work and possible repercussions? | What are cons for online schooling? | I haven't yet seen anyone talk about the potential impacts of classes going online. For UBC staff (building operations, food services, etc), is this likely to affect you adversely? Are there layoffs? Is there anything the student community can do to advocate for you? My hope is that UBC will be supportive of its workers during this time but wouldn't be surprised if this wasn't the case. | As the title says I was expelled from school when I was younger. Something trivial, just some young-person mischief. Would I still be able to work as a public school teacher? | i am looking into online school options for next year and was wondering if anyone knew of any online schools that have a debate team that competes on the national level. I currently do policy debate but would be open to switching. if anyone knows of any groups of kids that debate together from various small schools, that would also work probably. | I know that the self-discipline aspect of online learning can be difficult, but in my case online learning turned my grades around. When I went from in-class to online school I immediately went from c and d grades to straight A. Part of this was learning to hyper focus, and the great thing about online school is when your brain decides “I want to think” then you can do school. But another big part is I walked out of every college class because I could not stay still, and ended up missing a lot of material as a result. I’ll often take my laptop all over the house, half of my degree was finished while pooping :)
Anyway wanted to share in case it was encouraging to anyone. | I'm doing high school online (bc I moved to China) and read a lot about how the work load at U of T is way higher than High school. If I try to cram my courses would that help me get used to it? I've noticed that online school has far less busywork like textbook questions than real high school but I think the contents are still the same. | I work for a small private school. My contract is for a set salary, which will be paid out bi-weekly for a 12 month period. Like everyone else, our school has been closed since around March 13th.
I received my paycheck last Friday, but today got a letter from the school board stating that as tuition payments are no longer being made, they cannot meet the payroll and the teachers should file for unemployment.
I don’t understand how this works. And I’m still being encouraged to email resources to my students’ parents, even though they are apparently not paying me anymore.
Wouldn’t tuition payments for a private school be a contractual thing? How was I to be paid over the summer if we aren’t receiving tuition payments then?
I guess I’m not really looking for any kind of help or explanation, just wanted to vent. I’m just stressing out a bit over it right now.
Is this happening to any other teachers? | Abstract This study investigates the in-class and out-of-class cyberloafing activities of students in China, and tests the relationship between those activities and academic performance. A sample of 1,050 undergraduate students at a large University in China reported their in-class (N = 548) and out-of-class (N = 502) cyberloafing activities, which were tested against the students' academic performance. The test results show a negative relationship between in-class cyberloafing and academic performance, but an inverted U-shaped relationship between out-of-class cyberloafing and academic performance. The results support our propositions that cyberloafing is a harmful distraction in the classroom, but can have positive effects when performed in moderation outside the classroom as a means of effort recovery. | 1,999,803 | I really wanna know what schools are going to do about the absurd amount of people not doing their online classwork!
In my class of 29 students (30 including me) only 7 of us are actually doing are work (this trend also applies to my other classes) which made me start thinking about the actions the school could take, could they actually hold students back? (I feel like there is to many students for that)
what do y'all think could actually happen to the students that don't do their online classwork? | College Students' Improper Behaviors on the Internet and the Countermeasures | How do you feel about online classes? | Revising Online Assignments and the Impact on Student Performance at a Community College | Anyone else bitter about online classes that require weekly Zoom meetings as opposed to the traditional online class format? | Online Schooling Grows, Setting Off a Debate | Unpopular Opinion: Online classes have actually made the college application process and senior year a lot less stressful | Work great for online classes | Shoutout to all of the professors putting in the effort to accommodate for online classes |
1,999,804 | How long have you been with your dom? | Experienced sub/Little with an experienced Dom/Daddy Dom just under twice my age. BDSM | I've been having pretty intense flashbacks of when I first met my Dom and how enamored I was with him. I remember all the little gestures and details and it makes me so happy to be where I am with him today. He recently reviewed our shared spreadsheet of fetishes and limits and commented on how far we've been able to come together. Things that were soft limits before (nipple torture, pussy spanking) are all part of our play now.
So for all of you in a D/s relationships: how did you meet and how did you enter into a D/s dynamic? What was your courtship like? How has your relationship and/or kinks evolved? What advice can you offer those of us in new relationships?
Edit: For those interested, here's a public link to the spreadsheet that my Dom and I use: | I was the dom. He was the sub. It was just beautiful. I got a pair of my tights and tied them around his head. I slowly tortured him with my mouth. I told him not to kiss me or touch me. I kissed him and he kissed back so I slapped the shit out of him. He loved it. I also sat on his face and made him eat me until I came. I am completely in love with it. The power, the feeling of being on top was just amazing. The best sex I ever had. Just had to tell someone! XD also made a throwaway for it. | I have been a sub my whole life but only recently have been vetting Dom's. My husband was never super into bdsm. I had a lot of had experiences and have been hurt badly by fake Dom's trying to take advantage of me. It's been hard. My husband is sick of watching me be in so much pain from these shitty men and wants to close off our relationship to be monogamous and he wants to be my Dom. He took the bdsm test and to my surprise he got really high scores on everything and has been watching some videos on youtube to try and learn more. However I'm nervous about his inexperience since I myself am very inexperienced and was hoping to find a very experienced Dom to help me through everything.
Has anyone worked with their long-term significant other to become their Dom? Is there any advice you have? I want a 24/7 D/s relationship. Something fully involved and my husband has no problem with this. He is very loving and I know he would take care of me and never hurt me in ways I don't want to be hurt. We've been together so long that he can read my like a book and that can easily work in our favor. He's got natural Dom energy but I'm nervous about his inexperience. Thank you guys for the help! | Too many relationship questions in here. So tell us when was the last time you felt like a real manly man, show off and boast! | As the title states, it has been a while, hasn't it? Life has been busy, and I've not had much privacy to record at all, since my last post. But I found a sliver of time this morning, and I used it to fuck you, good. Yes, YOU. Have you ever wanted to be pounded by Aural? This is your chance..
Come lie with me, and let me take you until I fill you
-----
PM's and comments are always welcome - I love them. Don't be shy, let me know your thoughts <3 | I recently engaged in my first ever explicit D/s relationship, and I was wondering what it was that people enjoyed most about being a dom or a sub? | I created this account to sincerely ask this question. What do doms get out of being a dom? I’ve been exploring my submissive sexuality more and more with my boyfriend and the intense feelings of release and shifts of consciousness I experience in subspace are so subliminal, refreshing and rewarding that I feel I am selfish. My BF assures me he is getting something out of our play, that he enjoys dominating me. But he has a hard time explaining. Often he says he enjoys seeing my pleasure and being the source of that pleasure. But, to me that seems like I am being self centered. I want to please him, not just have him please me. I suspect that I am, only I have not been able to grasp his explanations. So will YOU tell me? Please? In your own words, what YOu get out of being a dom? It seems like a lot of work to me. | 1,999,804 | How long has everyone been with their dom (daddy, sir, master), and what other types of relationships do you have with them? | What do you think is a 'normal' relationship? | Who does the cooking in your relationship? (x-post AskMen) | Examples of Healthy Master/Slave Relationships | If you could control or change everything about your partner would you be happy with them? | Great development of a DD relationship. | Anything stand out in this composite chart? (mine and my BF's, together over 4 years and both want marriage) | Sad that this is what relationships have turned into | what is your professional relationship? |
1,999,805 | in what millennium did the indigenous inhabitants of mainland greece begin to change | Who were the first people to live in the area where greece is today? | When did ancient Greece rise? | How did geography of greece influence where people settled and how they made living? | As far as i can tell, the Greek inhabitants of the Eastern Roman Empire, for most of its 1000 year duration, identified themselves as Romans. But despite that 1000 year proud (should be) Roman/Byzantine history, the people there at some point started identifying themselves as Greeks and wanting an Independent Greece.
When and why did that transition from Roman to Greek happen?
When the 1821 Independence war happened, and the new nation emerged, it wasn't referred to as Roman or Byzantine (the name the Eastern Roman Empire was being identified by that point from most people if i am not mistaken), but instead Greek.
And what confuses me even more is that the "Megali Idea" concept that dominated greek politics for the next century, was all about restoring the old Byzantine territory and re-establishing Constantinople as a capital (thus resurrect the old empire if i understand correctly).
And please excuse in advance any potential ignorance of mine. | What where citizens in ancient greece? | Demographics of Greece fled to other European nations or to geographically isolated areas (i.e. mountains and heavily forested territories) in order to escape foreign rule. For those reasons, the population decreased in the plains, while increasing on the mountains. The population transfers with Bulgaria and Turkey that took place in the early 20th century, added in total some two million Greeks from to the demography of the Greek Kingdom. According to the 2001 census the population of Greece was 10,964,020. Eurostat estimations as of January 2008 gave the number of 11,214,992 inhabitants in the Greek peninsula. According to the official 2011 census, which | Greek government-debt crisis the crisis. (Venizelos replaced Papakonstantinou on 17 June). 75% of those polled had a negative image of the IMF, while 65% felt it was hurting Greece's economy. 64% felt that sovereign default was likely. When asked about their fears for the near future, Greeks highlighted unemployment (97%), poverty (93%) and the closure of businesses (92%). Polls showed that the vast majority of Greeks are not in favour of leaving the Eurozone. Nonetheless, other 2012 polls showed that almost half (48%) of Greeks were in favour of default, in contrast with a minority (38%) who are not. Greek GDP's worst decline, | What were some of the dangers to travel in Greece? | 1,999,805 | History of Greece assumed last common ancestor of all known varieties of Greek, including the Mycenaean language. The transition from the Greek Neolithic to the Early Bronze Age (or Early Helladic I–II) occurred gradually when Greece's agricultural population began to import bronze and copper and used basic bronze-working techniques. During the end of the 3rd millennium BC (circa 2200 BC; Early Helladic III), the indigenous inhabitants of mainland Greece underwent a cultural transformation attributed to climate change, local events and developments (e.g., destruction of the "House of the Tiles"), as well as to continuous contacts with various areas such as western Asia Minor, | when did the bronze age begin in europe | when were the first traces of aegean civilizations found | what is another name for the period of african prehistory between the early stone age | What changes occurred in Greece during the Dark Age? | Recent radiocarbon ( 14 C) research demonstrates that the urban culture of Early-Bronze III in the southern Levant ends around 2500 BC, and not around 2300 BC as was widely assumed. This should extend the Intermediate Bronze Age by 200 years. Charred olive pits from Intermediate Bronze Age contexts in the site of Khirbat el-'Alya Northeast in the Judean Shephelah region (Israel) were 14 C dated, resulting in calibrated dates around 2500 BC. The date range of Khirbat el-'Alya Northeast samples is an indication that in the Mediterranean parts of the southern Levant, the Intermediate Bronze Age material culture appeared around the time of the decline of the preceding culture of Early-Bronze III-around 2500 BC or somewhat earlier. Possible Intermediate Bronze settlement pattern and the site's relation to the nearby Early-Bronze city of Tel Yarmuth are discussed based on previous Intermediate Bronze and Early-Bronze related research in the surrounding area. | What marked the end of the mesazoic era? | The Aegean Bronze Age in relation to the Wider European Context: Papers from a session at the Eleventh Annual Meeting of the European Association of Archaeologists, Cork, 5-11 September 2005 | when did the neolithic 2 begin |
1,999,806 | Background: Estrogens, environmental chemicals with carcinogenic potential, as well as oxidative and carbonyl stresses play a very important role in breast cancer (BC) genesis and progression. Therefore, polymorphisms of genes encoding enzymes involved in estrogen biosynthesis pathway and in the metabolic activation of pro-carcinogens to genotoxic intermediates, such as cytochrome P450C17α (CYP17), endogenous free-radical scavenging systems, such as glutathione S-transferase (GSTP1) and paraoxonase 1 (PON1), and anti-glycation defenses, such as glyoxalase I (GLO1), could influence individual susceptibility to BC. In the present case-control study, we investigated the possible association of CYP17 A1A2, GSTP1 ILE105VAL, PON1 Q192R or L55M, and GLO1 A111E polymorphisms with the risk of BC.Methods:The above-said five polymorphisms were characterized in 547 patients with BC and in 544 healthy controls by PCR/RFLP methods, using DNA from whole blood. To estimate the relative risks, Odds ratios and 95% confidence intervals were calculated using unconditional logistic regression after adjusting for the known risk factors for BC.Results: CYP17 polymorphism had no major effect in BC proneness in the overall population. However, it modified the risk of BC for certain subgroups of patients. In particular, among premenopausal women with the A1A1 genotype, a protective effect of later age at menarche and parity was observed. As to GSTP1 and PON1 192 polymorphisms, the mutant Val and R alleles, respectively, were associated with a decreased risk of developing BC, while polymorphisms in PON1 55 and GLO1 were associated with an increased risk of this neoplasia. However, these findings, while nominally significant, did not withstand correction for multiple testing.Conclusion: Genetic polymorphisms in biotransformation enzymes CYP17, GSTP1, PON1 and GLO1 could be associated with the risk for BC. Although significances did not withstand correction for multiple testing, the results of our exploratory analysis warrant further studies on the above mentioned genes and BC. | Introduction ::: CYP17 is the second most important enzyme in estradiol synthesis. Epidemiological studies have shown the associations between CYP17 polymorphisms and cancer risk. We conducted a case-control study to evaluate the relationship between CYP17 polymorphisms (rs743572 and rs2486758) and breast cancer (BC) risk. ::: ::: ::: Patients and methods ::: This case-control study included 560 BC patients and 583 age-matched healthy controls from Northwest China. Two polymorphisms (rs743572 and rs2486758) of CYP17 were genotyped by using Sequenom MassARRAY. ORs and 95% CIs were used to evaluate the relationship. ::: ::: ::: Results ::: Compared with the wild genotype of rs743572, we found a significantly reduced risk of BC associated with the variant genotypes (heterozygote model: OR=0.69, 95% CI=0.53-0.89; homozygote model: OR=0.68, 95% CI=0.49-0.95; dominant model: OR=0.69, 95% CI=0.54-0.87; overdominant model: OR=0.78, 95% CI=0.62-0.98; allele model: OR=0.79, 95% CI=0.66-0.93). For rs2486758 polymorphism, we did not find any difference in any of the genetic models. Further stratification analysis by clinical characteristics showed rs743572 was associated with estrogen receptor status (heterozygote model: OR=2.13, 95% CI=1.47-3.08; homozygote model: OR=3.29, 95% CI=1.94-5.58; dominant model: OR=2.39, 95% CI=1.69-3.37) and progesterone receptor status (homozygote model: OR=3.17, 95% CI=1.82-5.55), but there was no association between rs2486758 and clinical characteristics of BC. Haplotype analysis showed that Grs743572Crs2486758 haplotype was a protective factor of BC (OR=0.52, 95% CI=0.40-0.67). Survival analysis did not find that CYP17 rs743572 polymorphism was associated with triple-negative BC, either in terms of overall survival or progression-free survival. ::: ::: ::: Conclusion ::: Our results suggest that CYP17 polymorphisms may reduce the susceptibility to BC in Chinese women. |
Introduction
According to GLOBOCAN 2018 (Cancer database), there are about 2.1 million newly diagnosed female breast cancer cases worldwide each year, making up 11.6% of all cancer diagnoses. In 2018, breast cancer was the cause of 626,679 (6.6%) deaths, accounting for almost 1 in 4 cancer cases among women [2]. Thus, breast cancer is the most common cause of cancer mortality in women, and it constitutes an important health problem [2]. Research has suggested that risk factors for breast cancer are environmental, genetic, nutritional (diet), and hormonal. Several well-known risk factors for breast cancer development are family history of breast cancer, advanced age, early puberty, late menopause, nulliparity, obesity and hereditary transmission of certain predisposition genes, including the BRCA1 and BRCA2 genes (involved in 5-10% of breast cancer cases) and the CHEK2, TP53, ATM and PTEN genes [1,3,4]. In Burkina Faso, previous studies have described the distribution of breast cancer risk factors in a population [5] and shown that multiparity is associated with a decreased risk of breast cancer [6]. Genetic analyses targeting relevant exons in BRCA1 genes have also been performed [7]. Furthermore, environmental factors have been well-reported in many breast cancers studies. These environmental factors include carcinogens, xenoestrogens and chemical mutagens [3]. In chemical carcinogenesis, three enzyme systems -namely cytochrome P450 (CYP), antioxidant enzymes (AOEs), and glutathione S-transferases (GSTs) --play an important role [8]. GSTs play a key role in the detoxification of electrophiles and potentially carcinogenic compounds by glutathione conjugation [9,10]. In mammalian tissues, seven common classes of cytosolic GST enzymes have been identified (GST classes alpha(α), mu(μ), pi(π), omega(ω), theta(θ), sigma(σ) and zeta(ζ) ), and each class is encoded by a separate gene or gene family (respectively, GSTA, GSTM, GSTP, GSTO, GSTS, GSTT and GSTZ genes) [9,[11][12][13].
Many GST genes are polymorphic; thus, particular allelic variants are associated with altered risk (or outcome) of a variety of diseases [10]. These polymorphic variants in GST genes have been reported in different populations [4].
It has been demonstrated that GSTP protein level and GST activity in tumor tissue are significantly higher than in normal breast tissue [14,15]. GSTs are also cancer chemotherapeutic agents, and thus contribute to tumor resistance to these agents [16]. Therefore, GSTs may be of clinical value in the case of some malignant cancers [17]. The μ (GSTM1:chromosome1p13.3) and θ (GSTT1: chromosome 22q11.23) members of this multigene family are candidate cancer susceptibility genes because of their ability to regulate the conjugation of carcinogenic compounds to excretable hydrophilic metabolites [8,18]. GSTM1-null or GSTT1-null might then increase risk for deleterious effects of exposure to a wide range of environmental carcinogens [19]. Both variants are homozygous deletions (null genotype) and are therefore associated with the loss of enzyme activity and increased vulnerability to cytogenetic damage [16]. Previous findings have provided evidence that variants with GSTP1 and GSTM1 polymorphisms could influence breast cancer risk, response to chemotherapy, and overall survival in breast cancer patients treated with chemotherapy [20]. Rebbeck et al., (1997) have demonstrated that GSTM1 and GSTT1 are associated with variability in age at first breast cancer diagnosis in BRCA1 mutation carriers, with 22% difference across the observed age range (25-40 years) explained by the GSTT1 genotype [4]. Studies on polymorphisms in GSTM1 and GSTT1 showed a prevalence of 27.8% of GSTM1-null and 46.8% of GSTT1-null in Cameroun , 48.8% of GSTM1-null and 37.3% of GSTT1-null in Ethiopia , 49.2% of GSTM1-null and 28.3% of GSTT1null in Italy, and 55.3% of GSTM1-null and 27.7% of GSTT1null in Spain [21]. Other research has found that GSTM1null individuals may have an increased risk of recurrent pregnancy loss [22], and an Indian meta-analysis found that female carriers of GSTT1 and GSTM1-null genotypes have a higher frequency of pregnancy loss [23].
Based on studies investigating the association of GSTT1 and GSTM1 variants with breast cancer risk, as well as on the role of GSTs in inactivating endogenous metabolites during oxidative stress and its influence on the normal functions of mammalian tissues, we investigated the distribution of GSTM1 and GSTT1 variants in patients with histologically diagnosed breast cancer in comparison to controls to explore the possible association of GST genotypes and risk of breast cancer development. The present case-control study is based on data acquired from a population in Burkina Faso.
Materials and methods
Study population and sample collection
This cross-sectional study was conducted from October 2017 to June 2018 in Burkina Faso. We enrolled 80 subjects with histologically diagnosed breast cancer (Services of Oncology and Gynecology, University Hospital Center (CHU-Yalgado OUEDRAOGO) and 100 healthy subjects without breast cancer (Service Gynecology). All female patients with breast tumors confirmed by anatomopathological test were included as cases, and all female subjects without any breast anomaly (as confirmed by mammography) were included as controls. Familial cases were defined as patients with first or second-degree relatives in the same familial branch who had been diagnosed with breast cancer at any age.
All patients included in the study freely consented to their participation Bedridden patients and control cases with family cancer history were excluded from the study. Fasting state was not part of our inclusion or exclusion criteria. Sampling was performed using two types of tubes, a 5ml violet EDTA tube and a 5ml red dry tube. After patients provided informed consent, approximately 10 mL of venous blood was collected into both the EDTA tube and the dry tube. Whole blood was used immediately for genomic DNA extraction. The samples were then centrifuged at 3500 g for 15 minutes to collect the plasma and serum, which were then stored at -20°C at the Pietro Annigoni Biomolecular Research Center (CERBA) for further processing.
Breast cancer patients were noted as having a "family history of breast cancer" if at least one member of their family (niece, sister, mother, cousin, etc.) had or currently has breast cancer. Breast cancer patients were considered to have a "family history of other cancer type" if at least one member of their family had or currently has any cancer other than breast cancer. Breast cancer patients were classified as "sporadic breast cancer cases" if no one in their family had or currently has breast cancer.
Collection of epidemiological and clinical data
Sociodemographic data including clinical examination and medical follow-up of patients was collected on an individual sheet.
Extraction of genomic DNA and Characterization of deletions of GSTM1 and GSTT1 genes by multiplex PCR.
Genomic DNA was extracted from whole blood using the "DNA Rapid Salting-Out" method described by [24] and stored at -80°C until use. Multiplex PCR was performed on the GeneAmp PCR system 9700 (Applied Biosystem, USA) according to the method described by [25] with a reaction volume of 25 μL, including 10 μL of Maxter Mix Ampli Taq Gold® (Applied Biosystems, USA), 1 μL of each primer pair (20 μM) (Applied Biosystems, USA) GSTM1 ( Forward5'-GAACTCCCTGAAAAGCTAAAGC-3'; Reverse 5'GTTGGGCTCAAATATACGGTGG-3') GSTT1 (Forward 5' TTCCTTACTGGTCCTCACATCTC-3', Reverse 5'-TCACCGGATCATGGCCAGCA-3'), 7μL of nuclease-free water, and 2 μL of DNA. All reagents were purchased from Applied Biosystem (ABI, Appleura International Inc., Foster City, CA, USA). The amplification program was as follows: an activation phase at 94°C for 5 min; 40 cycles of a series of denaturation at 94°C for 1 min, hybridization at 57°C for 1 min, elongation at 72°C for 1 min; and extension at 72°C for 7 min. The PCR products were subjected to 2% agarose gel electrophoresis and visualized under UV light at 312 nm using the Gene Flash rRevelation (Syngenge Bio Imaging, USA) PCR amplification was considered successful if the sample had a band corresponding to b-globin gene fragment (5'-CAACTTCATCCACGTTCACC-3', 5'-GAAGAGCCAAGGACAGGTAC-3') ( Figure 1).
Ethical approval: The research related to human use has been complied with all the relevant national regulations, institutional policies and in accordance the tenets of the Helsinki Declaration, and has been approved by the Burkina Faso Health Research Ethics Committee.
Informed consent: Informed consent has been obtained from all individuals included in this study
Statistical analysis
Data were analyzed using the standard Statistical Package for Social Sciences (SPSS) software version 20.0 for Windows and EPI Info software version 7.1.
The χ2 test was used to calculate the difference in the genotype distributions. Relative risk was estimated with Odds Ratio (OR) and the Cornfield 95% confidence interval (95%CI). P values below 0.05 or Odds Ratios with a 95%CI were considered statistically significant.
The quantitative variables were expressed as mean ± standard deviation, and comparisons between groups were made with the Student's t-test.
Associations between allelic variants and cancer were established by comparing frequencies between cases and controls using the χ2 test.
Results
In this study, we examined the influence of two GST genes, GSTM1 and GSTT1, in breast cancer susceptibility. The study is cross-sectional, including breast cancer patients and healthy females without breast cancer as controls.
General data on study subjects
The control group had an average age of 25.12 ± 8.30 years with a range of 16-37 years, and 100% were female and urban. In contrast, the mean age of cases was 48.20 ± 12.40 years (range: 28-80 years). The cases include 87.50% urban and 12.50% rural. According to the criteria of the US National Institute of Health/National Heart Lung and Blood Institute (NCI/NHLBI), 38.75% of cases were classified as obese or overweight (
Breast cancer risk and GSTM1 or GSTT1
Genotype distributions of GSTM1 and GSTT1 in cases and controls are summarized in Table 2. GSTM1-null was found in 28.75% and 18.00% of the cases and the controls, respectively. The GSTM1-null genotype was not significantly more common among breast cancer cases as compared to controls (OR=1.83; 95%CI 0.90-3.71; p = 0.10). In contrast, the GSTT1-null genotype was significantly more frequent in cases (30.00%) than in controls (15.00%) (OR=2.42; 95%CI 1.17-5.02; p = 0.01). Lastly, we did not find any significant increase in breast cancer risk associated with GSTM1/ GSTT1 double null genotypes (OR= 2.52; 95%CI 0.75-8.45; p = 0.20), with 14.89% of cases and 6.49% of controls having GSTM1/GSTT1 double null genotypes.
Disease stage and GSTM1/GSTT1
The association between presumed risk factors and the disease stage of familial/sporadic breast cancer cases is shown in Table 3. Data was analyzed using logistic regression analysis, which found no association between GSTM1-null or GSTT1-null genotypes and the disease stage of familial breast cancer patients (GSTM1-null OR =1.12; 95%CI 0.08-15.50; p = 1.00 and GSTT1-null OR = 1.71; 95%CI 0.13-22.5; p = 1.00) or sporadic breast cancer patients (GSTM1-null OR = 0.40; 95%CI 0.12-1.32; p = 0.20 and GSTT1-null OR = 1.41; 95%CI 0.39-5.12 ; p= 0.75) ( Table 3). Likewise, the GSTM1/GSTT1double null genotype was not associated with any differences in disease stage; thus, all genotypes lacked any association with the stage of disease in either familial (OR=0.5; 95%CI 0.02-11.08; p =1.00) or sporadic breast cancer patients (OR=0.29; 95%CI 0.04-1.77; p =0.31).
Body mass index (BMI) and GSTM1/GSTT1
BMI was not associated with either significantly increased or significantly decreased breast cancer risk. Table 4 shows the risk of breast cancer in combination with GSTM1-null and GSTT1-null genotypes. The respective frequencies in overweight/obese (BMI between 25 and 30 kg/m 2 ; BMI ≥30 kg/m 2 ) and normal/lean (BMI < 25 kg/ m 2 ) were 57.89% and 69.57% for GSTM1-null (OR=0.60; 95%CI 0. 21
Discussion
The relationship between GSTM1-and GSTT1-null genotypes and breast cancer risk was examined in a population-based case-control study in Burkina Faso. (2004) found the frequency of the GSTM1-null genotype to be 42-60% among Caucasians, 42-54% among Asians, 16-36% among Africans, and 54.6% among Arabs. They also found that the frequency of the GSTT1-null genotype was 13-26% for Caucasians, 35-52% for Asians, 15-26% for Africans, and 25% for Arabs. The frequency of the GSTM1/ GSTT1 double null genotype was 10.4% in Caucasians, 24.6% in Asians, and 12.6% in Africans) [13,26]. Indeed, our proportions of the GSTM1-null, GSTT1-null and GSTM1/ GSTT1 double null genotypes are relatively close to the reported prevalence in African populations. Furthermore, these two GST variants have been investigated for their association with susceptibility to human cancers such as breast cancer. Often, such studies have resulted in low penetrance or high prevalence associations between cancer risk and the GSTM1/GSTT1 double null variant [9]. In our study, GSTM1 and GSTT1-null genotypes were not associated with increased breast cancer risk. Indeed, on the strong association between GSTM1-and GSTT1-null genetic variants and breast cancer, study results have not yet converged [27][28][29]. Thus, in a meta-analysis of 10,067 cancer cases and 12,276 controls, GSTM1-null and GSTT1-null variants are associated with an increased risk of breast cancer in Asians [30]. Also, the GSTM1-null genotype was associated with increased breast cancer risk, but no associations between the GSTT1-null genotype and neoplasia risk were found in populations in Mexico [28]. Likewise, in a Portuguese population, researchers found an increased breast cancer risk associated with GSTM1-null and GSTT1-null genotypes both alone and in combination with GSTP1 valine alleles (rs1695/rs1138272) [31]. Another study has shown an increased breast cancer risk associated with the GSTM1-null genotype, while no association was found between the GSTT1-null genotype and overall breast cancer risk. These results suggest that variants in low penetrance genes ,such as GSTM1, GSTT1 and GSTP1, are associated with an increased breast cancer risk [32]. Indeed in a Turkish study, neither the GSTT1null nor GSTM1-null genotype were associated with a significantly increased risk of developing breast cancer, but a combined genetic variability in members of the GST gene family may be associated with an increased susceptibility to breast cancer [33]. A meta-analysis from China provides strong support for earlier studies, showing no overall association for the GSTM1 and GSTT1 deletion variants [34]. In contrast, in an Indian population, the GSTT1/GSTM1 double null genotype was found to be protective against the development of carcinoma breast and did not show any association with response to chemotherapy. However, tumors more than 5 cm in size were associated with increased GSTM1 gene expression [35]. Thus our study, which does not find an association between breast cancer risk and these variants, is consistent with some of the results of previous studies. No association was found between GSTM1-(OR =1.12; 95%CI 0.08-15.50) or GSTT1-(OR = 2.28; 95%CI 0. 18-28.18) null genotypes and the disease stage of familial breast cancer patients or sporadic breast cancer patients (GSTM1, OR = 0.40; 95%CI 0.12-1.32) and (GSTT1, OR = 1.41; 95%CI 0.39-5.12). High penetrance genes and certain low penetrance genes may also play a role in the familial inheritance of breast cancer [29]. In previously conducted studies, no significant associations between GSTM1 or GSTT1 variants and disease stage were observed [19]. GSTM1 deletion was found to be significantly associated only with familial breast cancer; GSTT1 was associated only with sporadic breast cancer. However, familial breast cancer patients with a GSTM1-null genotype had a relatively higher risk of advanced disease stage [29].
In a previous study, the association with breast cancer were also null for GSTM1-null and GSTT1-null in pre-and postmenopausal women, or for early versus advanced stage breast cancer [34]. In the Carolina Breast Cancer Study for women with a history of breast cancer in one or more first-degree relatives, odds ratios were 2.1 (95% confidence interval, 1.0-4.2) for GSTM1-null and 1.9 (0.8-4.6) for GSTT1null genotypes. Among these women with family histories, age at diagnosis was significantly earlier for those with the GSTM1-null genotype [19]. Furthermore, it has been noted that none of the allelic variants associated with sporadic breast cancer were associated with familial breast cancer [29]. Finally, there were no associations found between GSTM1-null (OR=0.60; 95%CI 0.21-1.68) and GSTT1-null (OR=0.60; 95%CI 0.21-1.68) genotypes in overweight/ obese or normal/lean individuals with susceptibility to breast cancer. Few studies have directly addressed the relationship between GSTM1-null and GSTT1-null variants with breast cancer. Nevertheless, previous research has observed relationships between GSTM1 and BMI.
Postmenopausal women null for GSTM1 and having a BMI above 24.47 kg/m 2 have a sevenfold increase in breast cancer risk, while women null for GSTM1 and having a BMI less than 24.47 kg/m 2 were not at increased risk of breast cancer [36]. Our results contradict this data, but corroborate the results of Vogl et al., (2004) who found no association between those GST allelic variants, BMI, and the occurrence of breast cancer [19].
Conclusion
Our results suggest that no strong association exists between GSTM1-null, GSTT1-null, or GSTM1/GSTT1 double null genotypes and susceptibility to breast cancer development. The association studies between breast cancer risk and GSTM1 or GSTT1 variants could be investigated further, in agreement with most previous studies. The absence of positive associations for GSTM1null and GSTT-null genotypes in women with either a family history of breast cancer or sporadic breast cancer and BMI indicate that further investigation is required to confirm a potential role for GST genotypes in both breast cancer prognosis and response to treatment.
Author's contributions: ITK, AAZ, PAS and ATY designed this study. AAZ, AHB and AYS recruited patients. PAS,
Figure 1 :
1PCR-multiplex electrophoresis gel. M = Molecular weight marker (100 bp); 1; 7 et 14 = Double present genotypes of GSTM1 and GSTT1; 2; 5; 10; 12 et 13 = Genotypes of GSTM1 present and GSTT1 null; 3; 4; 11= Double genotypes null of GSTM1 and GSTT1; 6; = invalid; 8 GSTM1 null and GSTT1 present.
Table 1 )
1Table 1). A proportion of 18.75% and 16.25% of the study cases reported a family history of. Clinical
Table 1 :
1General Characteristics of the case group.Variable
N=80 (%)
Variable
N 2 =80 (%)
Age
Body mass index(BMI)
Mean
48.20± 12.40 years
Normal/lean < 25 kg/m 2
49 (61.25%)
Range
28-80 years
Overweight between 25 and 30 kg/m 2
21 (26.25%)
Obese ≥30 kg/m 2
10 (12.50%)
Histological type
Stage
Ductal IDC
75 (93.75%)
I
5 (6.25%)
Lobular ILC
1 (1.25%)
IIA/IIB
35 (43.75%)
Others
4 (5%)
IIIA/IIIB
23 (28.75%)
IV
17 (21.25%)
Family history of
breast cancer
Family history of other cancer type
Yes
15 (18.75%)
Yes
13 (16.25%)
No
65 (81.25%)
No
67 (83.75%)
IDC: Invasive Ductal Carcinoma; ILC: Invasive Lobular Carcinoma
-1.68; p =0.44), 45.83% and 54.17% for GSTT1null (OR=0.60; 95%CI 0.21-1.68; p =0.45), and 42.86% and 57.14% for GSTM1/GSTT1 double null (OR=1.80; 95%CI 0.35-9.14; p=0.63).
Table 2 :
2ORs for GSTM1 and GSTT1 breast cancer.Genotype
Control
N = 100 (%)
Breast cancer
N = 80 (%)
OR (95%CI)
P value
GSTM1
Present
82(82.00%)
57(71.25%)
1
0.10
Null
18(18.00%)
23(28.75%)
1.83 (0.90-3.71)
GSTT1
Present
85(85.00%)
56(70.00%)
1
0.01 *
Null
15(15.00%)
24(30.00%)
2.42 (1.17-5.02)
GSTM1/ GSTT1
Double Present
72(93.51%)
40(85.11%)
1
0.20
Double Null
5(6.49%)
7(14.89%)
2.52 (0.75-8.45)
p-value<0.05. ORs (odds ratio); CI (confidence interval) from conditional logistic regression.
Table 3 :
3Association of GSTM1 and GSTT1 genotypes with the disease stage of familial and sporadic breast cancer patients.Genotype
Familial breast cancer cases
Sporadic breast cancer cases
Stage I&II
Stage III&IV
OR (95%CI) P value Stage I& II
Stage III& IV
OR (95%CI)
P value
GSTM1
Present
3(27.27%)
8(72.73%)
1
1.00
8(17.78%)
37(82.22%)
1
0.20
Null
1(25.00%)
3(75.00%)
1.12(0.08-
15.50)
7(35.00%)
13(65.00%)
0.40(0.12-
1.32)
GSTT1
Present
3(30%)
7(70%)
1
1.00
11(25.00%)
33(75.00%)
1
0.75
Null
1(20.00%)
4(80.00%)
1.71(0.13-
22.51)
4(19.05%)
17(80.95%)
1.41(0.39-
5.12)
GSTM1/ GSTT1
Double
Present
3(33.33%)
6(66.67%)
1
1.00
7(28.58%)
24(77.42%)
1
0.31
Double Null
1(50.00%)
1(50.00%)
0.5(0.02-
11.08)
3(50.00%)
3(50.00%)
0.29(0.04-
1.77)
Table 4 :
4Association of GSTM1 and GSTT1 genotypes with the body mass index (BMI) in breast cancer patients.Genotype
Normal/lean
Overweight/Obese
OR (95%CI)
p-value
GSTM1
Present
33(42.11%)
24(57.89%)
1
0.44
Null
16(69.57%)
7(30.43%)
0.60 (0.21-1.68)
GSTT1
Present
36(64.29%)
20(35.71%)
1
0.45
Null
13(54.17%)
11(45.83%)
1.52 (0.57-4.02)
GSTM1/GSTT1
Double Present
23(57.50%)
17(42.50%)
1
0.63
Double Null
3(57.14%)
4(42.86%)
1.80 (0.35-9.14)
ATY, ITK, FWD, AKO, HKS, TF and ETY recruited controls cases. ITK, PAS and AAZ carried out the manipulations, statistical analyses and wrote the manuscript. YB and JS revised the manuscript. All authors have read and corrected the manuscript.Conflict of interest: Authors state no conflict of interest
Genome-wide association study in BRCA1 mutation carriers identifies novel loci associated with breast and ovarian cancer risk. F J Couch, X Wang, L Mcguffog, A Lee, C Olswold, K B Kuchenbaecker, PLoS Genet. 91003212Couch FJ, Wang X, McGuffog L, Lee A, Olswold C, Kuchenbaecker KB, et al. Genome-wide association study in BRCA1 mutation carriers identifies novel loci associated with breast and ovarian cancer risk. PLoS Genet. 2013;9:e1003212.
Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. F Bray, J Ferlay, I Soerjomataram, R L Siegel, L A Torre, A Jemal, CA Cancer J Clin. 68Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;68:394-424.
Molecular epidemiology of sporadic breast cancer. The role of polymorphic genes involved in oestrogen biosynthesis and metabolism. K Mitrunen, A Hirvonen, Mutat Res. 544Mitrunen K, Hirvonen A. Molecular epidemiology of sporadic breast cancer. The role of polymorphic genes involved in oestrogen biosynthesis and metabolism. Mutat Res. 2003;544:9-41.
Genetic and hormonal risk factors in breast cancer. A M Martin, B L Weber, J Natl Cancer Inst. 92Martin AM, Weber BL. Genetic and hormonal risk factors in breast cancer. J Natl Cancer Inst. 2000;92:1126-35.
Breast cancer: descriptive profile of 80 women attending breast cancer care in the Department of General and Digestive Surgery of CHU-YO. H A Bambara, A A Zoure, A Y Sawadogo, A K Ouattara, Nlm Ouedraogo, S S Traore, Pan Afr Med J. 28314Bambara HA, Zoure AA, Sawadogo AY, Ouattara AK, Ouedraogo NLM, Traore SS, et al. Breast cancer: descriptive profile of 80 women attending breast cancer care in the Department of General and Digestive Surgery of CHU-YO. Pan Afr Med J. 2017;28:314.
Multiparity and Breast Cancer Risk Factor among Women in Burkina Faso. A A Zoure, A H Bambara, A Y Sawadogo, A K Ouattara, M Ouedraogo, S S Traore, Asian Pac J Cancer Prev. 17Zoure AA, Bambara AH, Sawadogo AY, Ouattara AK, Ouedraogo M, Traore SS, et al. Multiparity and Breast Cancer Risk Factor among Women in Burkina Faso. Asian Pac J Cancer Prev. 2016;17:5095-5099.
BRCA1 c.68_69delAG (exon2), c.181T>G (exon5), c.798_799delTT and 943ins10 (exon11) mutations in Burkina Faso. A A Zoure, M Slaoui, H A Bambara, A Y Sawadogo, T R Compaore, Nlm Ouedraogo, J Public Health Afr. 9663Zoure AA, Slaoui M, Bambara HA, Sawadogo AY, Compaore TR, Ouedraogo NLM, et al. BRCA1 c.68_69delAG (exon2), c.181T>G (exon5), c.798_799delTT and 943ins10 (exon11) mutations in Burkina Faso. J Public Health Afr. 2018;9:663.
Molecular epidemiology of the human glutathione S-transferase genotypes GSTM1 and GSTT1 in cancer susceptibility. T R Rebbeck, Cancer Epidemiol Biomarkers Prev. 6Rebbeck TR. Molecular epidemiology of the human glutathione S-transferase genotypes GSTM1 and GSTT1 in cancer susceptibility. Cancer Epidemiol Biomarkers Prev. 1997;6:733- 43.
Detoxification of electrophilic compounds by glutathione S-transferase catalysis: determinants of individual response to chemical carcinogens and chemotherapeutic drugs?. B F Coles, F F Kadlubar, Biofactors. 17Coles BF, Kadlubar FF. Detoxification of electrophilic compounds by glutathione S-transferase catalysis: determinants of individual response to chemical carcinogens and chemotherapeutic drugs? Biofactors. 2003;17:115-30.
Glutathione-S-transferase family of enzymes. R C Strange, M A Spiteri, S Ramachandran, A A Fryer, Mutat Res. 482Strange RC, Spiteri MA, Ramachandran S, Fryer AA. Glutathione-S-transferase family of enzymes. Mutat Res. 2001;482:21-6.
Characterization of a human class-Theta glutathione S-transferase with activity towards 1-menaphthyl sulphate. A J Hussey, J D Hayes, Biochem J. 286Pt 3Hussey AJ, Hayes JD. Characterization of a human class-Theta glutathione S-transferase with activity towards 1-menaphthyl sulphate. Biochem J. 1992;286 ( Pt 3):929-35.
Does glutathione S-transferase Pi (GST-Pi) a marker protein for cancer?. S Aliya, P Reddanna, K Thyagaraju, Molecular and Cellular Biochemistry. 253Aliya S, Reddanna P, Thyagaraju K. Does glutathione S-transferase Pi (GST-Pi) a marker protein for cancer? Molecular and Cellular Biochemistry. 2003;253:319-327.
Deletion polymorphism of glutathione S-transferases M1 and T1 in the Tunisian population. S Gara, M Abessi, K Bendjemena, M Abdennebi, F Guemira, Tunis Med. 88Gara S, Abessi M, Bendjemena K, Abdennebi M, Guemira F. Deletion polymorphism of glutathione S-transferases M1 and T1 in the Tunisian population. Tunis Med. 2010;88:700-2.
Glutathione S-transferases mu 1, theta 1, pi 1, alpha 1 and mu 3 genetic polymorphisms and the risk of colorectal and gastric cancers in humans. C Martinez, F Martin, J M Fernandez, E Garcia-Martin, J Sastre, M Diaz-Rubio, Pharmacogenomics. 7Martinez C, Martin F, Fernandez JM, Garcia-Martin E, Sastre J, Diaz-Rubio M, et al. Glutathione S-transferases mu 1, theta 1, pi 1, alpha 1 and mu 3 genetic polymorphisms and the risk of colorectal and gastric cancers in humans. Pharmacogenomics. 2006;7:711-8.
BANCR: a cancer-related long non-coding RNA. X Yu, H Zheng, M T Chan, Wkk Wu, Am J Cancer Res. 7Yu X, Zheng H, Chan MT, Wu WKK. BANCR: a cancer-related long non-coding RNA. Am J Cancer Res. 2017;7:1779-1787.
Glutathione S-transferase polymorphisms and their biological consequences. J D Hayes, R C Strange, Pharmacology. 61Hayes JD, Strange RC. Glutathione S-transferase polymorphisms and their biological consequences. Pharmacology. 2000;61:154-66.
Glutathione and its metabolizing enzymes in patients with different benign and malignant diseases. A H Abou Ghalia, I M Fouad, Clin Biochem. 33Abou Ghalia AH, Fouad IM. Glutathione and its metabolizing enzymes in patients with different benign and malignant diseases. Clin Biochem. 2000;33:657-62.
Glutathione S-transferase M1 (GSTM1) and T1 (GSTT1) null polymorphisms and the risk of hypertension: a meta-analysis. B Ge, Y Song, Y Zhang, X Liu, Y Wen, X Guo, PLoS One. 10118897Ge B, Song Y, Zhang Y, Liu X, Wen Y, Guo X. Glutathione S-transferase M1 (GSTM1) and T1 (GSTT1) null polymorphisms and the risk of hypertension: a meta-analysis. PLoS One. 2015;10:e0118897.
Glutathione S-transferases M1, T1, and P1 and breast cancer: a pooled analysis. F D Vogl, E Taioli, C Maugard, W Zheng, L F Pinto, C Ambrosone, Cancer Epidemiol Biomarkers Prev. 13Vogl FD, Taioli E, Maugard C, Zheng W, Pinto LF, Ambrosone C, et al. Glutathione S-transferases M1, T1, and P1 and breast cancer: a pooled analysis. Cancer Epidemiol Biomarkers Prev. 2004;13:1473-9.
Predictive potential role of glutathione S-transferases polymorphisms on prognosis of breast cancer. J Liu, J Luo, Y Wang, L Li, S Yang, Int J Clin Exp Pathol. 7Liu J, Luo J, Wang Y, Li L, Yang S. Predictive potential role of glutathione S-transferases polymorphisms on prognosis of breast cancer. Int J Clin Exp Pathol. 2014;7:8935-40.
GSTT1 and GSTM1 gene polymorphisms in European and African populations. S Piacentini, R Polimanti, F Porreca, C Martinez-Labarga, De Stefano, G F Fuciarelli, M , Mol Biol Rep. 38Piacentini S, Polimanti R, Porreca F, Martinez-Labarga C, De Stefano GF, Fuciarelli M. GSTT1 and GSTM1 gene polymorphisms in European and African populations. Mol Biol Rep. 2011;38:1225-30.
Glutathione S-transferase M1 and T1 polymorphisms and the risk of recurrent pregnancy loss. F Sata, H Yamada, T Kondo, Y Gong, S Tozaki, G Kobashi, Mol Hum Reprod. 9Sata F, Yamada H, Kondo T, Gong Y, Tozaki S, Kobashi G, et al. Glutathione S-transferase M1 and T1 polymorphisms and the risk of recurrent pregnancy loss. Mol Hum Reprod. 2003;9:165- 9.
Association of GSTT1 and GSTM1 polymorphisms with early pregnancy loss in an Indian population and a meta-analysis. R R Nair, A Khanna, K Singh, Reprod Biomed Online. 26Nair RR, Khanna A, Singh K. Association of GSTT1 and GSTM1 polymorphisms with early pregnancy loss in an Indian population and a meta-analysis. Reprod Biomed Online. 2013;26:313-22.
A simple salting out procedure for extracting DNA from human nucleated cells. S A Miller, D D Dykes, H F Polesky, Nucleic Acids Res. 161215Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1988;16:1215.
Higher frequency of glutathione S-transferase deletions in black children with acute lymphoblastic leukemia. C L Chen, Q Liu, C H Pui, G K Rivera, J T Sandlund, R Ribeiro, Blood. 89Chen CL, Liu Q, Pui CH, Rivera GK, Sandlund JT, Ribeiro R, et al. Higher frequency of glutathione S-transferase deletions in black children with acute lymphoblastic leukemia. Blood. 1997;89:1701-7.
Polymorphisms of cytochrome P450 1A1, glutathione S-transferases M1 and T1 in a Turkish population. A O Ada, S H Suzen, M Iscan, Toxicol Lett. 151Ada AO, Suzen SH, Iscan M. Polymorphisms of cytochrome P450 1A1, glutathione S-transferases M1 and T1 in a Turkish population. Toxicol Lett. 2004;151:311-5.
Prospective Case-Control Study to Evaluate the Role of Glutathione S Transferases (GSTT1 and GSTM1) Gene Deletion in Breast Carcinoma and Its Prognostic Significance. V K Bansal, K Rajan, A Sharma, P Paliwal, G Chaubal, V Jindal, Indian J Surg. 77Bansal VK, Rajan K, Sharma A, Paliwal P, Chaubal G, Jindal V, et al. Prospective Case-Control Study to Evaluate the Role of Glutathione S Transferases (GSTT1 and GSTM1) Gene Deletion in Breast Carcinoma and Its Prognostic Significance. Indian J Surg. 2015;77:1067-72.
Polymorphisms in GSTM1, GSTT1, GSTP1, and GSTM3 genes and breast cancer risk in northeastern Mexico. G Jaramillo-Rangel, M Ortega-Martinez, R M Cerda-Flores, H A Barrera-Saldana, Genet Mol Res. 14Jaramillo-Rangel G, Ortega-Martinez M, Cerda-Flores RM, Barrera-Saldana HA. Polymorphisms in GSTM1, GSTT1, GSTP1, and GSTM3 genes and breast cancer risk in northeastern Mexico. Genet Mol Res. 2015;14:6465-71.
Influence of germline polymorphisms of GSTT1, GSTM1, and GSTP1 in familial versus sporadic breast cancer susceptibility and survival. V S Syamala, L Sreeja, V Syamala, P B Raveendran, R Balakrishnan, R Kuttan, Fam Cancer. 7Syamala VS, Sreeja L, Syamala V, Raveendran PB, Balakrishnan R, Kuttan R, et al. Influence of germline polymorphisms of GSTT1, GSTM1, and GSTP1 in familial versus sporadic breast cancer susceptibility and survival. Fam Cancer. 2008;7:213-20.
Association of glutathione S-transferase T1, M1, and P1 polymorphisms in the breast cancer risk: a meta-analysis. Z Song, C Shao, C Feng, Y Lu, Y Gao, C Dong, Ther Clin Risk Manag. 12Song Z, Shao C, Feng C, Lu Y, Gao Y, Dong C. Association of glutathione S-transferase T1, M1, and P1 polymorphisms in the breast cancer risk: a meta-analysis. Ther Clin Risk Manag. 2016;12:763-9.
Glutathione S-transferase M1, T1, and P1 genotypes and breast cancer risk: a study in a Portuguese population. A C Ramalhinho, J A Fonseca-Moutinho, L Breitenfeld, Mol Cell Biochem. 355Ramalhinho AC, Fonseca-Moutinho JA, Breitenfeld L. Glutathione S-transferase M1, T1, and P1 genotypes and breast cancer risk: a study in a Portuguese population. Mol Cell Biochem. 2011;355:265-71.
Detection and relevance of germline genetic polymorphisms in glutathione S-transferases (GSTs) in breast cancer patients from northern Indian population. A Saxena, V S Dhillon, M Raish, M Asim, S Rehman, N K Shukla, Breast Cancer Res Treat. 115Saxena A, Dhillon VS, Raish M, Asim M, Rehman S, Shukla NK, et al. Detection and relevance of germline genetic polymorphisms in glutathione S-transferases (GSTs) in breast cancer patients from northern Indian population. Breast Cancer Res Treat. 2009;115:537-43.
Relation of glutathione S-transferase T1, M1 and P1 genotypes and breast cancer risk. A Unlu, N A Ates, L Tamer, C Ates, Cell Biochem Funct. 26Unlu A, Ates NA, Tamer L, Ates C. Relation of glutathione S-transferase T1, M1 and P1 genotypes and breast cancer risk. Cell Biochem Funct. 2008;26:643-7.
Genetic polymorphisms in GSTM1, GSTP1, and GSTT1 and the risk for breast cancer: results from the Shanghai Breast Cancer Study and meta-analysis. K M Egan, Q Cai, X O Shu, Jin F Zhu, T L Dai, Q , Cancer Epidemiol Biomarkers Prev. 13Egan KM, Cai Q, Shu XO, Jin F, Zhu TL, Dai Q, et al. Genetic polymorphisms in GSTM1, GSTP1, and GSTT1 and the risk for breast cancer: results from the Shanghai Breast Cancer Study and meta-analysis. Cancer Epidemiol Biomarkers Prev. 2004;13:197-204.
Prospective Case-Control Study to Evaluate the Role of Glutathione S Transferases (GSTT1 and GSTM1) Gene Deletion in Breast Carcinoma and Its Prognostic Significance. V K Bansal, K Rajan, A Sharma, P Paliwal, G Chaubal, V Jindal, Indian Journal of Surgery. 77Bansal VK, Rajan K, Sharma A, Paliwal P, Chaubal G, Jindal V, et al. Prospective Case-Control Study to Evaluate the Role of Glutathione S Transferases (GSTT1 and GSTM1) Gene Deletion in Breast Carcinoma and Its Prognostic Significance. Indian Journal of Surgery. 2015;77:1067-1072.
Association Between Glutathione S-Transferase M1, P1, and T1 Genetic Polymorphisms and Development of Breast Cancer. K J Helzlsouer, H-Y Huang, S Hoffman, A J Alberg, G W Comstock, P T Strickland, JNCI: Journal of the National Cancer Institute. 90Helzlsouer KJ, Huang H-Y, Hoffman S, Alberg AJ, Comstock GW, Strickland PT, et al. Association Between Glutathione S-Transferase M1, P1, and T1 Genetic Polymorphisms and Development of Breast Cancer. JNCI: Journal of the National Cancer Institute. 1998;90:512-518.
|
Introduction
Acute leukemia, a malignant tumor of the hematopoietic system, is characterized by a rapid increase in the numbers of immature blood cells. The disease can be subdivided into two major groups according to the cell affected as acute lymphoblastic leukemia (ALL) and acute myeloid leukemia (AML), respectively. ALL is the most common type of leukemia in young children while AML occurs more commonly in adults than in children [1,2]. The mechanisms for acute leukemia genesis are not fully understood. Previous evidence suggests that radiation, smoking, obesity and exposure to chemical carcinogens are considered as its risk factors [3]. Nevertheless, though individuals are exposed to these environmental and lifestyle risk factors, acute leukemia develops only in a small proportion of the exposed people, indicating that the host genetic factors might play an important role in the genesis of leukemia.
Several genetic variations have been evaluated as possible risk factors for leukemia by meta-analyses. Polymorphisms of GSTM1, GSTT1, MTHFR C677T and XRCC1 Arg399Gln have been indicated to increase leukemia risk [4,5,6]. However, significant associations of polymorphic MTR A2756G with decreased acute leukemia susceptibility were found [7]. Thus, different genetic polymorphisms exert different effects on acute leukemia risk. Nevertheless, only a few gene polymorphisms associated with leukemia susceptibility have been identified. To explore the roles of other genetic polymorphisms on the risk is required.
Previous evidence indicates that carcinogen-metabolizing genes may play critical roles in determining individual susceptibility to malignancies [8,9]. Genetic variations in these genes may change the activities of their encoded enzymes, possibly by altering their expression and function. Cytochrome P450 enzymes catalyze Phase I metabolism reaction. Cytochrome P450 1A1 (CYP1A1) is a member of the CYP1 family that participates in the metabolism of xenobiotics and endogenous compounds, particularly polycyclic aromatic hydrocarbons (PAHs) such as benzo[a]pyrene [10]. A commonly investigated single nucleotide polymorphism (SNP) in the CYP1A1 gene has been suggested to have a correlation with cancer risk. The SNP leads to a base substitution of isoleucine with valine at codon 462 in exon7 (Ile462Val or CYP1A1*2C polymorphism, rs1048943). Thus, the exon7 restriction site polymorphism results in three genotypes: a predominant homozygous Ile/Ile, the heterozygote Ile/Val and a rare homozygous Val/Val [11].
A number of published studies have been conducted on the relationship between CYP1A1 Ile462Val polymorphism and acute leukemia risk. However, the results are inconclusive. The issue of whether the CYP1A1 Ile462Val polymorphism is a risk factor for acute leukemia has not been clearly addressed. Thus, in this study we aimed to derive a more precise estimation of the relationship by performing a quantitative meta-analysis that increases statistical power to reach more convincible results.
Materials and Methods
Literature search Strategy
To obtain eligible literature, we carried out a search in the Medline, EMBASE, OVID, Sciencedirect, Google Scholar and Chinese National Knowledge Infrastructure (CNKI) without a language limitation, covering published publications up to Apr 2012, with a combination of the following keywords: Cytochrome P450 1A1, CYP1A1, Ile462Val, exon7, acute leukemia, hematology, malignancy, neoplasm, cancer, variation and polymorphism. All searched studies were retrieved and the bibliographies were checked for other relevant publications. Review articles and bibliographies of other relevant studies identified were electric/hand searched to find additional eligible studies.
Inclusion and Exclusion Criteria
The following criteria were used for the literature selection: first, studies should concern the association of CYP1A1 Ile462Val polymorphism with acute leukemia risk; second, studies must be observational studies (Case-control or cohort); third, papers must offer the sample size, odds ratios (ORs) and their 95% confidence intervals (CIs), the genetic distribution or the information that can help infer the needed results. Accordingly, the following criteria for exclusion were also used: first, the design and the definition of the experiments were obviously different from those of the selected articles; second, the source of cases and controls and other essential information were not offered; third, reviews and duplicated publications. After rigorous searching, we reviewed all papers in accordance with the criteria defined above for further analysis.
Data Extraction
Data were carefully extracted from all eligible publications independently by two of the authors (Zhuo and Zhang) according to the inclusion criteria mentioned above. For conflicting evaluations, an agreement was reached following a discussion. If a consensus could not be reached, another author was consulted to resolve the dispute and then a final decision was made by the majority of the votes. The extracted information was entered into a database.
Statistical Analysis
The odds ratio (OR) of CYP1A1 Ile462Val polymorphisms and acute leukemia risk was estimated for each study. The pooled ORs were performed for a homozygote comparison model (Val/Val versus Ile/Ile), a dominant model (Val/Val+Val/Ile versus Ile/Ile) and a recessive model (Val/Val versus Val/Ile+Ile/Ile), respectively. To detect any possible sample size biases, the OR and its 95% confidence interval (CI) to each study was plotted against the number of participants respectively. I 2 value was applied to evaluate heterogeneity between the included studies (I 2 = 0-25%, no heterogeneity; I 2 = 25-50%, moderate heterogeneity; I 2 .50%, large heterogeneity) [12]. In addition, a Chisquare based Q statistic test was conducted to assess the heterogeneity. If the result of the Q-test was P.0.1, ORs were pooled according to the fixed-effect model (Mantel-Haenszel), Otherwise, the random-effect model (DerSimonian and Laird) was used. The significance of the pooled ORs was determined by Ztest. The Hardy-Weinberg equilibrium (HWE) was assessed by Fisher's exact test. Publication bias was assessed by visual inspection of funnel plots [13], in which the standard error of log (OR) of each study was plotted against its log (OR). An asymmetric plot indicates a possible publication bias. The symmetry of the funnel plot was further evaluated by Egger's linear regression test [14]. Statistical analysis was undertaken using the program STATA 11.0 software (Stata Corporation, Texas, USA).
Results
Study Characteristics
Relevant publications were retrieved and screened carefully. A total of ninety-six publications were identified, of which seventythree irrelevant papers were excluded. As shown in Figure 1, twenty-three publications were preliminary eligible, of which two review articles [15,16] and one publication without detailed subtypes of leukemia [17] were then excluded. Next, three publications not being case-control studies [18,19,20] and one article without sufficient data [21] were discarded. As a result, sixteen publications were selected for data extraction. However, three duplicate publications [16,22,23] which concerned the same research with one selected study [24] were further excluded. Moreover, an included article provided two separated groups of data regarding childhood leukemia and adult leukemia, respectively [25]. Thus, each group was considered as a separate study for analysis. Lastly, thirteen publications containing fourteen case-control studies were selected [24,25,26,27,28,29,30,31,32,33,34,35,36].
Of the selected publications, one publication was written in Chinese [26] while the remaining twelve were in English. The relevant information was listed in Table 1. According to this table, the first author and the number and characteristics of cases and controls for each study as well as other necessary information were presented. There were three groups of Caucasians [24,27,34], five of Asians [26,29,31,32,36] and six of mixed ethnicities [25,28,30,33,35] in this meta-analysis. As shown in Table 1, five groups of AML [25,27,31,33,36] and nine of ALL [24,25,26,28,29,30,32,34,35] were included in this study. As for age groups, there were eight childhood ALL [24,25,26,29,30,32,34,35] and one adult ALL [28] groups in this study. All AML studies concerned adult AML.
The distributions of CYP1A1 Ile462Val genotypes as well as the genotyping methods of the included studies were presented in Table 2. The genetic distributions of the control groups in all studies were consistent with HWE except for one study [35].
Test of Heterogeneity
As shown in Table 3, evident heterogeneities were observed for the overall data in the dominant model (P = 0.049 for Q-test; I 2 = 42.1%), except for the homozygote comparison (P = 0.171 for Q-test; I 2 = 27.9%) and the recessive models (P = 0.247 for Q-test; I 2 = 20.1%). However, when subgroup analyses on ethnicity, clinical types and source of controls were further conducted, we found diminished heterogeneities in some of the subgroups under the dominant model.
Meta-analysis Results
The main results of the meta-analysis were listed in Table 3. For the overall data containing 2164 cases and 4160 controls, significant associations of CYP1A1 Ile462Val polymorphism with acute leukemia risk were shown under the homozygote comparison (OR = 1.49; 95%CI = 1.11-1.98), the dominant (OR = 1.26; 95%CI = 1.05-1.51) ( Figure 2) and the recessive (OR = 1.38; 95%CI = 1.04-1.83; P = 0.247 for heterogeneity) models, indicating that individuals carrying the variant Val allele may have an increased acute leukemia risk compared with those bearing the wild-type Ile allele.
Considering the potential impact of the confounding factors on the overall results, we further conducted subgroup analyses. In the primary literature, only the detailed information on ethnicity, clinical types and source of controls were sufficient for analysis. Therefore, subgroup analyses on these issues were performed. In subgroup analysis according to ethnicity, increased leukemia risks were observed in the three genetic models among mixed ethnicities (homozygote comparison: OR = 2.36; 95%CI = 1.46-3.82; dominant: OR = 1.37; 95%CI = 1.01-1.86; recessive: OR = 2.20; 95%CI = 1.37-3.53) but not Caucasians or Asians (Figure 3). In subgroup analyses regarding clinical types, increased risks for ALL were found under the homozygote comparison (OR = 2.06; 95%CI = 1.42-3.01) and the recessive models (OR = 1.91; 95%CI = 1.32-2.76), respectively. When the data regarding ALL were separated by age groups, significant increased risk could be observed in both adult ALL and childhood ALL. No significant associations were shown in subgroup regarding AML under the three genetic models (Figure 4). In subgroup analysis on source of controls, elevated risks were observed in the population-based subgroup (homozygote comparison: OR = 1.44; 95%CI = 1.05-1.96; dominant: OR = 1.23; 95%CI = 1.04-1.46) rather than the hospital-based subgroup ( Figure 5).
Sensitivity Analysis
When the effect-models were changed, the significance of the overall data for the three models was not statistically altered (data not shown). Then, we discarded one study whose genetic distributions in controls exhibited significant deviation from HWE [35], given that the deviation might lead to any bias [37]. The significances of the overall data in the three models, respectively, were also not statistically changed. Then, one-way sensitivity analysis [38] was carried out to assess the stability of the meta-analysis. The statistical significance of the results was not changed when any single study was deleted (data not shown), indicating the credibility of the results.
Bias Diagnostics
Funnel plots were created to assess the publication bias. Then, Egger's linear regression tests were used to assess the symmetries of the plots. The funnel plots seemed symmetrical for the overall data of the three genetic models (Figure 6a). Additionally, the data of the Egger's tests also indicate the absence of the publication bias in the three models, respectively (homozygote comparison model: t = 0.68, P.0.05; dominant model: t = 0.98, P.0.05; recessive model: t = 0.58, P.0.05) (Figure 6b), suggesting that the results of the meta-analyses are relatively stable and the potential publication bias might not have an evident influence on the results.
Discussion
For the overall data, the results showed that CYP1A1 Ile462Val might have a marked correlation with increased acute leukemia risk. Moreover, in subgroup analyses stratified by ethnicity, the data failed to reveal an association among either Asians or Caucasians, but mixed ethnicities. In subgroup analysis according to clinical types, the results indicated that Val/Val alleles might increase susceptibility to ALL.
The relations of CYP1A1 Ile462Val variations with cancer risk have been evaluated by several meta-analyses. CYP1A1 Ile462Val polymorphism might have a correlation with increased risks of lung cancer, cervical cancer, colorectal cancer, esophageal cancer and breast cancers [39,40,41,42,43]. Nevertheless, for gastric cancer, prostate cancer and laryngeal cancers [44,45,46], such associations were not significant. Thus, CYP1A1 Ile462Val polymorphism might have different influences on different types of malignancies. Recently, a meta-analysis regarding the association of CYP1A1 MspI variation with childhood acute leukemia failed to reveal a significant association [47]. However, this metaanalysis focused on CYP1A1 MspI variation but not exon7 (Ile462Val) polymorphism. To our knowledge, the present metaanalysis for the first time shed light on the association between CYP1A1 Ile462Val polymorphism and acute leukemia risk.
In the subgroup analysis according to ethnicity, significant increased leukemia risk was found in the mixed races subgroup but not Asian and Caucasian subgroups, suggesting that CYP1A1 Ile462Val genetic variation may not confer acute leukemia risk among either Asians or Caucasians. Nevertheless, since we could not obtain the data regarding separate ethnicities from the mixed ethnicities subgroup, the possible effects of ethnicity variations on the results could not be precisely evaluated. Evidence suggested that gene polymorphisms could result in ethnic-specific susceptibility to leukemia [35]. In addition, environmental factors such as birth place and socioeconomic status may also play critical roles in Table 1. Characteristics of studies included in the meta-analysis. the genesis of leukemia [48]. Therefore, possible racial disparities might exist. Further investigations regarding different ethnicities are needed to clarify this issue.
In the subgroup analysis stratified by clinical types, increased risk for ALL was shown under the homozygote comparison and the recessive models, suggesting that the homozygous Val/Val allele carriers might have an increased ALL risk relative to those of When the data about ALL were further divided by age groups, similar results were obtained in the two subgroups. However, only one study provided the information about adult ALL; thus, the results should be interpreted with care. As for AML, no associations could be observed. The disparity may be due to the different precise mechanisms involved in the genesis of different types of leukemia. ALL is a common childhood leukemia with poor outcomes [49], characterized by cytogenetic abnormalities, such as translocations and changes in ploidy. Parental exposure to specific chemicals and widely spread carcinogens may increase risk of childhood ALL [50,51]. Hence, variations of CYP1A1 Ile462Val may result in altered activities of the enzymes and the effects of carcinogens on the blood could thus be strengthened. Consequently, ALL risk might be increased.
Smoking and alcohol consumption are also important risk factors for leukemia. Evidence indicates that maternal smoking and drinking prior to and during pregnancy may increase risk of childhood leukemia, particularly ALL [52]. We tried to extract relevant information regarding smoking and drinking from the primary literature. However, insufficient data were obtained. Hence, relevant subgroup analyses have not been performed and further investigations concerning the interactions of smoking, drinking and gene variations on leukemia are required.
In the subgroup analysis according to source of controls, significance increased leukemia risk were observed in the population-based subgroup but not the hospital-based group. Since hospital-based controls might not be always truly representative of the general population, any biases might exist and the results should be interpreted with care. Therefore, use of proper control participants with strict matching criteria and large sample sizes are important for reducing such selection bias in future investigations.
In the present meta-analysis, both Q-tests and I-squared values were used to assess the heterogeneities. Evident between-study heterogeneities for overall data were observed in the dominant genetic model, and thus the random-effect models were utilized in this model. However, as shown in Table 3, in the subgroup analyses, removed or reduced heterogeneities were found in the relevant subgroups, implying that the heterogeneities may result from multi-factors; in addition to ethnicity and clinical types of leukemia, other factors such as selection of controls, gender, and prevalence of lifestyle factors might also lead to the heterogeneities.
Publication bias is an important factor that should be considered in a meta-analysis. We used funnel plots to evaluate the potential publication bias. Then, Egger's linear regression test was also used as an approach for assessment of the symmetries. The results failed to suggest evident bias in the three genetic models, suggesting little influences of the bias on the results and demonstrating the robustness and credibility of the present metaanalysis.
Several limitations should be addressed. First, in this metaanalysis, the primary articles only provided data about Caucasians, Asians and mixed ethnicities. Separate data regarding other ethnicities such as African should be concerned. Second, only studies written in English and Chinese were searched and included in this meta-analysis. Thus, any selection bias should be noted. Third, subgroup analyses regarding age, gender and other factors such as smoking, drinking and radiation exposure have not been conducted in the present study because relevant sufficient data were not available in the primary articles. Furthermore, among the fourteen included studies, only three studies provided the adjusted ORs [31,32,35]. We did not pool the adjusted ORs because the included studies either did not adjust for confounders, or the adjustments were not comparable among them. As the adjusted ORs are much more accurate than crude ORs but not available for most included studies, and adjusted factors differed across these studies, residual confounding might have affected the analysis. Therefore, the results should be interpreted with caution. Additionally, gene-gene and gene-environment interactions should also be considered in the further investigations.
In summary, the results of the present meta-analysis suggest that variant Val allele of CYP1A1 Ile462Val polymorphism might have an association with excess acute leukemia risk. Moreover, subgroup analyses indicate that homozygous Val/Val might modify the susceptibility to ALL. Further well-designed investigations in view of the confounding factors are needed reach a more convincible conclusion.
Author Contributions
Figure 1 .
1The flow diagram of included/excluded studies. doi:10.1371/journal.pone.0046974.g001
not available; AML, acute myeloid leukemia; ALL, acute lymphocytic leukemia; PB: population-based; HB: hospital-based. doi:10.1371/journal.pone.0046974.t001
Figure 2 .
2Meta-analysis for the association of acute leukemia risk with CYP1A1 Ile462Val polymorphism for the overall data (Val/ Val+Val/Ile versus Ile/Ile). doi:10.1371/journal.pone.0046974.g002
Figure 3 .
3Meta-analysis for the association of acute leukemia risk with CYP1A1 Ile462Val polymorphism (Val/Val+Val/Ile versus Ile/ Ile; stratified by ethnicity). doi:10.1371/journal.pone.
Figure 4 .
4Meta-analysis for the association of acute leukemia risk with CYP1A1 Ile462Val polymorphism stratified by clinical types. (a) Val/Val versus Ile/Ile; (b) Val/Val+Val/Ile versus Ile/Ile; AML, acute myeloid leukemia; ALL, acute lymphocytic leukemia. doi:10.1371/journal.pone.0046974.g004 CYP1A1 Ile462Val Polymorphism and Acute Leukemia PLOS ONE | www.plosone.org the wild-type Ile carriers.
Figure 5 .
5Meta-analysis for the association of acute leukemia risk with CYP1A1 Ile462Val polymorphism stratified by source of controls (Val/Val+Val/Ile versus Ile/Ile). PB: population-based; HB: hospital-based. doi:10.1371/journal.pone.0046974.g005
Figure 6 .
6Publication bias tests for the overall data (Val/Val+Val/Ile versus Ile/Ile). (a): Funnel plot; (b) Egger's linear regression test. doi:10.1371/journal.pone.0046974.g006
Table 2 .
2Distribution of CYP1A1 Ile462Val genotype among acute leukemia cases and controls included in the meta-analysis.First Author
Year
Genotyping
method
Cases
Controls
HWE (control)
Val/Val
Val/Ile
Ile/Ile
Val/Val Val/Ile
Ile/Ile
Chi-squre
P
Krajinovic
1999
PCR-RFLP
1
11
158
0
24
275
0.523
.0.05
Gao
2003
ASA
10
44
24
11
59
42
2.226
.0.05
D'Alo
2004
PCR-RFLP
0
14
179
0
25
248
0.629
.0.05
Gallegos-Arreola
2004
PCR
22
65
49
8
59
69
1.010
.0.05
Joseph
2004
PCR-RFLP
10
34
74
3
20
95
2.168
.0.05
Selvin
2004
Not determined
5
39
131
4
44
127
0.007
.0.05
Majumdar
2008
PCR-RFLP
1
24
85
3
18
105
3.687
.0.05
Lee
2009
SNaPshot
6
39
60
9
65
85
0.567
.0.05
Yamaguti
2009
PCR-RFLP
4
54
75
2
39
92
0.891
.0.05
Yamaguti
2010
PCR-RFLP
3
36
60
3
29
67
0.004
.0.05
Razmkhah (Adult)
2011
PCR-RFLP
1
38
66
1
18
76
0.003
.0.05
Razmkhah (Childhood) 2011
PCR-RFLP
0
13
72
0
14
80
0.609
.0.05
Swinney
2011
Golden gate assay 14
40
188
18
118
505
10.693
,0.05
Kim
2012
PCR-RFLP
17
173
225
87
654
959
3.311
.0.05
doi:10.1371/journal.pone.0046974.t002
Table 3 .
3Main results of the pooled data in the meta-analysis.No. (cases/
controls)
Val/Val vs Ile/Ile
(Val/Val+Val/Ile) vs Ile/Ile
Val/Val vs (Val/Ile+Ile/Ile)
OR (95%CI) P
P (Q-
test)
I 2
OR (95%CI)
P
P (Q-
test)
I 2
OR (95%CI) P
P (Q-
test)
I 2
Total
2164/4160
1.49 (1.11-1.98) 0.007 0.171
27.9% 1.26 (1.05-1.51) 0.011 0.049
42.1% 1.38 (1.04-1.83) 0.025 0.247
20.1%
Clinical types
ALL
1208/1833
2.06 (1.42-3.01) 0.000 0.448
0.0% 1.22 (0.96-1.54) 0.098 0.097
40.5% 1.91 (1.32-2.76) 0.001 0.601
0.0%
AML
956/2327
0.89 (0.55-1.44) 0.633 0.603
0.0% 1.35 (0.97-1.89) 0.076 0.061
55.6% 0.83 (0.51-1.34) 0.439 0.672
0.0%
Age group (ALL)
Adult ALL
136/136
3.87 (1.59-9.41) 0.003 -
-
1.83 (1.13-2.97) 0.015 -
-
3.09 (1.32-7.21) 0.009 -
-
Childhood ALL
1072/1697
1.76 (1.15-2.69) 0.009 0.638
0.0% 1.15 (0.91-1.45) 0.258 0.179
31.2% 1.68 (1.11-2.53) 0.015 0.701
0.0%
Ethnicity
Caucasian
462/671
1.60 (0.39-6.55) 0.512 0.400
0.0% 1.01 (0.69-1.48) 0.945 0.418
0.0%
1.47 (0.37-5.95) 0.586 0.362
0.0%
(ALL)
269/398
1.60 (0.39-6.55) 0.512 0.400
0.0% 1.14 (0.72-1.79) 0.571 0.344
0.0%
1.47 (0.37-5.95) 0.586 0.362
0.0%
(AML)
193/273
-
-
-
-
0.78 (0.39-1.53) 0.466 -
-
-
-
-
Asian
826/2215
1.09 (0.74-1.61) 0.646 0.173
37.2% 1.29 (0.94-1.76) 0.115 0.072
53.6% 1.02 (0.70-1.49) 0.901 0.247
26.2%
(ALL)
301/389
1.73 (0.94-3.21) 0.080 0.221
33.8% 1.40 (0.76-2.59) 0.286 0.029
71.9% 1.57 (0.87-2.83) 0.138 0.327
10.6%
(AML)
525/1826
0.80 (0.47-1.35) 0.403 0.556
0.0% 1.13 (0.92-1.38) 0.256 0.393
0.0%
0.76 (0.45-1.27) 0.298 0.533
0.0%
Mixed
876/1274
2.36 (1.46-3.82) 0.000 0.642
0.0% 1.37 (1.01-1.86) 0.041 0.064
52.0% 2.20 (1.37-3.53) 0.001 0.791
0.0%
(ALL)
638/1046
2.41 (1.45-4.01) 0.001 0.323
11.6% 1.16 (0.85-1.60) 0.348 0.182
38.4% 2.28 (1.38-3.77) 0.001 0.523
0.0%
(AML)
238/228
2.00 (0.47-8.53) 0.348 0.651
0.0% 1.95 (1.31-2.90) 0.001 0.457
0.0%
1.64 (0.39-6.92) 0.502 0.628
0.05
Source of controls
PB
1941/3883
1.44 (1.05-1.96) 0.022 0.207
25.7% 1.23 (1.04-1.46) 0.015 0.178
27.2% 1.33 (0.98-1.81) 0.064 0.247
21.3%
(ALL)
985/1556
2.14 (1.39-3.29) 0.001 0.600
0.0% 1.17 (0.96-1.43) 0.118 0.424
0.0%
1.96 (1.29-2.97) 0.002 0.661
0.0%
(AML)
956/2327
0.89 (0.55-1.44) 0.633 0.603
0.0% 1.35 (0.97-1.89) 0.076 0.061
55.6% 0.83 (0.51-1.34) 0.439 0.672
0.0%
HB
223/277
1.83 (0.83-4.02) 0.132 0.083
66.7% 1.44 (0.51-4.01) 0.489 0.008
85.9% 1.74 (0.80-3.82) 0.164 0.144
53.1%
(ALL)
223/277
1.83 (0.83-4.02) 0.132 0.083
66.7% 1.44 (0.51-4.01) 0.489 0.008
85.9% 1.74 (0.80-3.82) 0.164 0.144
53.1%
( A M L )
-
-
-
-
-
-
-
-
-
-
-
-
-
AML, acute myeloid leukemia; ALL, acute lymphocytic leukemia; PB: population-based; HB: hospital-based.
doi:10.1371/journal.pone.0046974.t003
PLOS ONE | www.plosone.org
October 2012 | Volume 7 | Issue 10 | e46974
Acute leukaemia: making sense of a complex blood cancer. T Meenaghan, M Dowling, M Kelly, Br J Nurs. 21Meenaghan T, Dowling M, Kelly M (2012) Acute leukaemia: making sense of a complex blood cancer. Br J Nurs 21: 76, 78-83.
Acute leukemia in adolescents and young adults. A S Advani, S P Hunger, A K Burnett, Semin Oncol. 36Advani AS, Hunger SP, Burnett AK (2009) Acute leukemia in adolescents and young adults. Semin Oncol 36: 213-226.
Risk factors and primary prevention of acute leukemia. G Ilhan, S Karakus, N Andic, Asian Pac J Cancer Prev. 7Ilhan G, Karakus S, Andic N (2006) Risk factors and primary prevention of acute leukemia. Asian Pac J Cancer Prev 7: 515-517.
A metaanalysis of MTHFR C677T and A1298C polymorphisms and risk of acute lymphoblastic leukemia in children. J Yan, M Yin, Z E Dreyer, M E Scheurer, K Kamdar, Pediatr Blood Cancer. 58Yan J, Yin M, Dreyer ZE, Scheurer ME, Kamdar K, et al. (2012) A meta- analysis of MTHFR C677T and A1298C polymorphisms and risk of acute lymphoblastic leukemia in children. Pediatr Blood Cancer 58: 513-518.
Glutathione s-transferase polymorphisms (GSTM1, GSTP1 and GSTT1) and the risk of acute leukaemia: a systematic review and meta-analysis. Z Ye, H Song, Eur J Cancer. 41Ye Z, Song H (2005) Glutathione s-transferase polymorphisms (GSTM1, GSTP1 and GSTT1) and the risk of acute leukaemia: a systematic review and meta-analysis. Eur J Cancer 41: 980-989.
X-Ray Repair Cross-Complementing Group 1 (XRCC1) Genetic Polymorphisms and Risk of. L Wang, F Yin, X Xu, X Hu, D Zhao, Wang L, Yin F, Xu X, Hu X, Zhao D (2012) X-Ray Repair Cross- Complementing Group 1 (XRCC1) Genetic Polymorphisms and Risk of
. Childhood Acute Lymphoblastic Leukemia: A Meta-Analysis. PLoS One. 734897Childhood Acute Lymphoblastic Leukemia: A Meta-Analysis. PLoS One 7: e34897.
Methionine synthase A2756G polymorphism and cancer risk: a meta-analysis. K Yu, J Zhang, C Dou, S Gu, Y Xie, Eur J Hum Genet. 18Yu K, Zhang J, Dou C, Gu S, Xie Y, et al. (2010) Methionine synthase A2756G polymorphism and cancer risk: a meta-analysis. Eur J Hum Genet 18: 370-378.
Biomarkers in cancer epidemiology: an integrative approach. P Boffetta, Carcinogenesis. 31Boffetta P (2010) Biomarkers in cancer epidemiology: an integrative approach. Carcinogenesis 31: 121-126.
Oxidative stress and oxidative damage in carcinogenesis. J E Klaunig, L M Kamendulis, B A Hocevar, Toxicol Pathol. 38Klaunig JE, Kamendulis LM, Hocevar BA (2010) Oxidative stress and oxidative damage in carcinogenesis. Toxicol Pathol 38: 96-109.
Activation of procarcinogens by human cytochrome P450 enzymes. F P Guengerich, T Shimada, Mutat Res. 400Guengerich FP, Shimada T (1998) Activation of procarcinogens by human cytochrome P450 enzymes. Mutat Res 400: 201-213.
Polymorphism of human cytochrome P450 enzymes and its clinical impact. S F Zhou, J P Liu, B Chowbay, Drug Metab Rev. 41Zhou SF, Liu JP, Chowbay B (2009) Polymorphism of human cytochrome P450 enzymes and its clinical impact. Drug Metab Rev 41: 89-295.
Measuring inconsistency in meta-analyses. J P Higgins, S G Thompson, J J Deeks, D G Altman, BMJ. 327Higgins JP, Thompson SG, Deeks JJ, Altman DG (2003) Measuring inconsistency in meta-analyses. BMJ 327: 557-560.
Assessing publication bias in genetic association studies: evidence from a recent meta-analysis. M R Munafo, T G Clark, J Flint, Psychiatry Res. 129Munafo MR, Clark TG, Flint J (2004) Assessing publication bias in genetic association studies: evidence from a recent meta-analysis. Psychiatry Res 129: 39-44.
Bias in meta-analysis detected by a simple, graphical test. M Egger, Davey Smith, G Schneider, M Minder, C , BMJ. 315Egger M, Davey Smith G, Schneider M, Minder C (1997) Bias in meta-analysis detected by a simple, graphical test. BMJ 315: 629-634.
Candidate gene association studies and risk of childhood acute lymphoblastic leukemia: a systematic review and metaanalysis. J Vijayakrishnan, R S Houlston, Haematologica. 95Vijayakrishnan J, Houlston RS (2010) Candidate gene association studies and risk of childhood acute lymphoblastic leukemia: a systematic review and meta- analysis. Haematologica 95: 1405-1414.
Genetic susceptibility to childhood acute lymphoblastic leukemia. D Sinnett, M Krajinovic, D Labuda, Leuk Lymphoma. 38Sinnett D, Krajinovic M, Labuda D (2000) Genetic susceptibility to childhood acute lymphoblastic leukemia. Leuk Lymphoma 38: 447-462.
Multi-factor dimensionality reduction applied to a large prospective investigation on gene-gene and gene-environment interactions. M Manuguerra, G Matullo, F Veglia, H Autrup, A M Dunning, Carcinogenesis. 28Manuguerra M, Matullo G, Veglia F, Autrup H, Dunning AM, et al. (2007) Multi-factor dimensionality reduction applied to a large prospective investigation on gene-gene and gene-environment interactions. Carcinogenesis 28: 414-422.
Polymorphisms in genes encoding drugs and xenobiotic metabolizing enzymes, DNA repair enzymes, and response to treatment of childhood acute lymphoblastic leukemia. M Krajinovic, D Labuda, G Mathonnet, M Labuda, A Moghrabi, Clin Cancer Res. 8Krajinovic M, Labuda D, Mathonnet G, Labuda M, Moghrabi A, et al. (2002) Polymorphisms in genes encoding drugs and xenobiotic metabolizing enzymes, DNA repair enzymes, and response to treatment of childhood acute lymphoblastic leukemia. Clin Cancer Res 8: 802-810.
CYP1A1 polymorphisms modify overall survival in acute myeloid leukemia patients. L A Pelloso, Da Silva, I D , De Souza, N C Yamamoto, M Botelho, C A , Leuk Lymphoma. 48Pelloso LA, Da Silva ID, De Souza NC, Yamamoto M, Botelho CA, et al. (2007) CYP1A1 polymorphisms modify overall survival in acute myeloid leukemia patients. Leuk Lymphoma 48: 1211-1215.
A case-only study of interactions between metabolic enzyme polymorphisms and industrial pollution in childhood acute leukemia. Y Yang, Y Tian, Jin X Yan, C Jiang, F , Environ Toxicol Pharmacol. 28Yang Y, Tian Y, Jin X, Yan C, Jiang F, et al. (2009) A case-only study of interactions between metabolic enzyme polymorphisms and industrial pollution in childhood acute leukemia. Environ Toxicol Pharmacol 28: 161-166.
Parental smoking, CYP1A1 genetic polymorphisms and childhood leukemia. C Infante-Rivard, M Krajinovic, D Labuda, D Sinnett, Cancer Causes Control. 11Infante-Rivard C, Krajinovic M, Labuda D, Sinnett D (2000) Parental smoking, CYP1A1 genetic polymorphisms and childhood leukemia (Quebec, Canada). Cancer Causes Control 11: 547-553.
Genetic polymorphisms of N-acetyltransferases 1 and 2 and gene-gene interaction in the susceptibility to childhood acute lymphoblastic leukemia. M Krajinovic, C Richer, H Sinnett, D Labuda, D Sinnett, Cancer Epidemiol Biomarkers Prev. 9Krajinovic M, Richer C, Sinnett H, Labuda D, Sinnett D (2000) Genetic polymorphisms of N-acetyltransferases 1 and 2 and gene-gene interaction in the susceptibility to childhood acute lymphoblastic leukemia. Cancer Epidemiol Biomarkers Prev 9: 557-562.
Role of DNA mismatch repair genetic polymorphisms in the risk of childhood acute lymphoblastic leukaemia. G Mathonnet, M Krajinovic, D Labuda, D Sinnett, Br J Haematol. 123Mathonnet G, Krajinovic M, Labuda D, Sinnett D (2003) Role of DNA mismatch repair genetic polymorphisms in the risk of childhood acute lymphoblastic leukaemia. Br J Haematol 123: 45-48.
Susceptibility to childhood acute lymphoblastic leukemia: influence of CYP1A1, CYP2D6, GSTM1, and GSTT1 genetic polymorphisms. M Krajinovic, D Labuda, C Richer, S Karimi, D Sinnett, Blood. 93Krajinovic M, Labuda D, Richer C, Karimi S, Sinnett D (1999) Susceptibility to childhood acute lymphoblastic leukemia: influence of CYP1A1, CYP2D6, GSTM1, and GSTT1 genetic polymorphisms. Blood 93: 1496-1501.
Frequency of CYP1A1*2C polymorphism in patients with leukemia in the Iranian population. F Razmkhah, V Pazhakh, F Zaker, F Atashrazm, M Sheikhi, Lab Med. 42Razmkhah F, Pazhakh V, Zaker F, Atashrazm F, Sheikhi M (2011) Frequency of CYP1A1*2C polymorphism in patients with leukemia in the Iranian population. Lab Med 42: 220-223.
Relationship between genetic polymorphisms of CYP1A1 and ALL. J Gao, Y Huang, J Liang, X Fang, Chin J Birth Health & Heredity. 11Gao J, Huang Y, Liang J, Fang X (2003) Relationship between genetic polymorphisms of CYP1A1 and ALL. Chin J Birth Health & Heredity 11: 21- 24.
Polymorphisms of CYP1A1 and glutathione S-transferase and susceptibility to adult acute myeloid leukemia. F D'alo, M T Voso, F Guidi, G Massini, A Scardocci, Haematologica. 89D'Alo F, Voso MT, Guidi F, Massini G, Scardocci A, et al. (2004) Polymorphisms of CYP1A1 and glutathione S-transferase and susceptibility to adult acute myeloid leukemia. Haematologica 89: 664-670.
Cytochrome P4501A1 polymorphism is associated with susceptibility to acute lymphoblastic leukemia in adult Mexican patients. M P Gallegos-Arreola, C M Batista-Gonzalez, J L Delgado-Lamas, L E Figuera, A M Puebla-Perez, Blood Cells Mol Dis. 33Gallegos-Arreola MP, Batista-Gonzalez CM, Delgado-Lamas JL, Figuera LE, Puebla-Perez AM, et al. (2004) Cytochrome P4501A1 polymorphism is associated with susceptibility to acute lymphoblastic leukemia in adult Mexican patients. Blood Cells Mol Dis 33: 326-329.
Genetic polymorphism of CYP1A1, CYP2D6, GSTM1 and GSTT1 and susceptibility to acute lymphoblastic leukaemia in Indian children. T Joseph, P Kusumakumary, P Chacko, A Abraham, Radhakrishna Pillai, M , Pediatr Blood Cancer. 43Joseph T, Kusumakumary P, Chacko P, Abraham A, Radhakrishna Pillai M (2004) Genetic polymorphism of CYP1A1, CYP2D6, GSTM1 and GSTT1 and susceptibility to acute lymphoblastic leukaemia in Indian children. Pediatr Blood Cancer 43: 560-567.
Cytochrome P450 1A1 polymorphism and childhood leukemia: an analysis of matched pairs case-control genotype data. S Selvin, Cancer Epidemiol Biomarkers Prev. 13Selvin S (2004) Cytochrome P450 1A1 polymorphism and childhood leukemia: an analysis of matched pairs case-control genotype data. Cancer Epidemiol Biomarkers Prev 13: 1371-1374.
Association of cytochrome P450, glutathione S-transferase and N-acetyl transferase 2 gene polymorphisms with incidence of acute myeloid leukemia. S Majumdar, B C Mondal, M Ghosh, S Dey, A Mukhopadhyay, Eur J Cancer Prev. 17Majumdar S, Mondal BC, Ghosh M, Dey S, Mukhopadhyay A, et al. (2008) Association of cytochrome P450, glutathione S-transferase and N-acetyl transferase 2 gene polymorphisms with incidence of acute myeloid leukemia. Eur J Cancer Prev 17: 125-132.
Paternal smoking, genetic polymorphisms in CYP1A1 and childhood leukemia risk. K M Lee, M H Ward, S Han, H S Ahn, H J Kang, Leuk Res. 33Lee KM, Ward MH, Han S, Ahn HS, Kang HJ, et al. (2009) Paternal smoking, genetic polymorphisms in CYP1A1 and childhood leukemia risk. Leuk Res 33: 250-258.
High risk of 'de novo' acute myeloid leukaemia in individuals with cytochrome P450 A1 (CYP1A1) and NAD(P)H:quinone oxidoreductase 1 (NQO1) gene defects. G G Yamaguti, G J Lourenco, F F Costa, C S Lima, Eur J Haematol. 83Yamaguti GG, Lourenco GJ, Costa FF, Lima CS (2009) High risk of 'de novo' acute myeloid leukaemia in individuals with cytochrome P450 A1 (CYP1A1) and NAD(P)H:quinone oxidoreductase 1 (NQO1) gene defects. Eur J Haematol 83: 270-272.
Increased risk for acute lymphoblastic leukemia in children with cytochrome P450A1 (CYP1A1)-and NAD(P)H:quinone oxidoreductase 1 (NQO1)-inherited gene variants. G G Yamaguti, G J Lourenco, V S Silveira, L G Tone, L F Lopes, Acta Haematol. 124Yamaguti GG, Lourenco GJ, Silveira VS, Tone LG, Lopes LF, et al. (2010) Increased risk for acute lymphoblastic leukemia in children with cytochrome P450A1 (CYP1A1)-and NAD(P)H:quinone oxidoreductase 1 (NQO1)-inherited gene variants. Acta Haematol 124: 182-184.
Polymorphisms in CYP1A1 and ethnic-specific susceptibility to acute lymphoblastic leukemia in children. R M Swinney, J Beuten, A B Collier, T T Chen, N J Winick, Cancer Epidemiol Biomarkers Prev. 20Swinney RM, Beuten J, Collier AB, 3rd, Chen TT, Winick NJ, et al. (2011) Polymorphisms in CYP1A1 and ethnic-specific susceptibility to acute lympho- blastic leukemia in children. Cancer Epidemiol Biomarkers Prev 20: 1537-1542.
Association of GSTT1 polymorphism with acute myeloid leukemia risk is dependent on smoking status. H N Kim, N Y Kim, L Yu, H T Tran, Y K Kim, Leuk Lymphoma. 53Kim HN, Kim NY, Yu L, Tran HT, Kim YK, et al. (2012) Association of GSTT1 polymorphism with acute myeloid leukemia risk is dependent on smoking status. Leuk Lymphoma 53: 681-687.
A method for meta-analysis of molecular association studies. A Thakkinstian, P Mcelduff, D 'este, C Duffy, D Attia, J , Stat Med. 24Thakkinstian A, McElduff P, D'Este C, Duffy D, Attia J (2005) A method for meta-analysis of molecular association studies. Stat Med 24: 1291-1306.
Assessing the influence of a single study in the meta-analysis estimate. A Tobias, Stata Techn Bull. 8Tobias A (1999) Assessing the influence of a single study in the meta-analysis estimate. Stata Techn Bull 8: 15-17.
Association studies of CYP1A1 and GSTM1 polymorphisms with esophageal cancer risk: evidence-based meta-analyses. W L Zhuo, Y S Zhang, Y Wang, X L Zhuo, B Zhu, Arch Med Res. 40Zhuo WL, Zhang YS, Wang Y, Zhuo XL, Zhu B, et al. (2009) Association studies of CYP1A1 and GSTM1 polymorphisms with esophageal cancer risk: evidence-based meta-analyses. Arch Med Res 40: 169-179.
Cytochrome P450 1A1 (CYP1A1) gene polymorphisms and cervical cancer risk: a meta-analysis. T N Sergentanis, K P Economopoulos, S Choussein, N F Vlahos, Mol Biol Rep. Sergentanis TN, Economopoulos KP, Choussein S, Vlahos NF (2012) Cytochrome P450 1A1 (CYP1A1) gene polymorphisms and cervical cancer risk: a meta-analysis. Mol Biol Rep.
CYP1A1 MspI and exon7 gene polymorphisms and lung cancer risk: an updated meta-analysis and review. P Zhan, Q Wang, Q Qian, S Z Wei, L K Yu, J Exp Clin Cancer Res. 3099Zhan P, Wang Q, Qian Q, Wei SZ, Yu LK (2011) CYP1A1 MspI and exon7 gene polymorphisms and lung cancer risk: an updated meta-analysis and review. J Exp Clin Cancer Res 30: 99.
Association between CYP1A1 polymorphism and colorectal cancer risk: a meta-analysis. Y Zheng, J J Wang, L Sun, H L Li, Mol Biol Rep. 39Zheng Y, Wang JJ, Sun L, Li HL (2012) Association between CYP1A1 polymorphism and colorectal cancer risk: a meta-analysis. Mol Biol Rep 39: 3533-3540.
Four polymorphisms in cytochrome P450 1A1 (CYP1A1) gene and breast cancer risk: a meta-analysis. T N Sergentanis, K P Economopoulos, Breast Cancer Res Treat. 122Sergentanis TN, Economopoulos KP (2010) Four polymorphisms in cytochrome P450 1A1 (CYP1A1) gene and breast cancer risk: a meta-analysis. Breast Cancer Res Treat 122: 459-469.
Polymorphisms of CYP1A1 and GSTM1 and laryngeal cancer risk: evidence-based meta-analyses. W L Zhuo, Y Wang, X L Zhuo, B Zhu, Y Zhu, J Cancer Res Clin Oncol. 135Zhuo WL, Wang Y, Zhuo XL, Zhu B, Zhu Y, et al. (2009) Polymorphisms of CYP1A1 and GSTM1 and laryngeal cancer risk: evidence-based meta-analyses. J Cancer Res Clin Oncol 135: 1081-1090.
CYP1A1 polymorphisms and risk of prostate cancer: a meta-analysis. A P Shaik, K Jamil, P Das, Urol J. 6Shaik AP, Jamil K, Das P (2009) CYP1A1 polymorphisms and risk of prostate cancer: a meta-analysis. Urol J 6: 78-86.
Quantitative assessment of the associations between CYP1A1 polymorphisms and gastric cancer risk. R Guo, X Guo, Tumour Biol. Guo R, Guo X (2012) Quantitative assessment of the associations between CYP1A1 polymorphisms and gastric cancer risk. Tumour Biol.
Meta-analysis of cytochrome P4501A1 MspI gene polymorphism and childhood acute leukemia. Y D Zhang, L N Tan, X L Zhang, H Y Wei, H Xiong, Biomed Environ Sci. 24Zhang YD, Tan LN, Zhang XL, Wei HY, Xiong H, et al. (2011) Meta-analysis of cytochrome P4501A1 MspI gene polymorphism and childhood acute leukemia. Biomed Environ Sci 24: 683-687.
Racial and ethnic differences in survival of children with acute lymphoblastic leukemia. S Bhatia, H N Sather, N A Heerema, M E Trigg, P S Gaynon, Blood. 100Bhatia S, Sather HN, Heerema NA, Trigg ME, Gaynon PS, et al. (2002) Racial and ethnic differences in survival of children with acute lymphoblastic leukemia. Blood 100: 1957-1964.
Improving outcomes for high-risk ALL: translating new discoveries into clinical care. S P Hunger, E A Raetz, M L Loh, C G Mullighan, Pediatr Blood Cancer. 56Hunger SP, Raetz EA, Loh ML, Mullighan CG (2011) Improving outcomes for high-risk ALL: translating new discoveries into clinical care. Pediatr Blood Cancer 56: 984-993.
Parental exposure to carcinogens and risk for childhood acute lymphoblastic leukemia, Colombia. M A Castro-Jimenez, L C Orozco-Vargas, Prev Chronic Dis. 8106Castro-Jimenez MA, Orozco-Vargas LC (2011) Parental exposure to carcino- gens and risk for childhood acute lymphoblastic leukemia, Colombia, 2000- 2005. Prev Chronic Dis 8: A106.
Parental exposure to medications and hydrocarbons and ras mutations in children with acute lymphoblastic leukemia: a report from the Children's Oncology Group. X O Shu, J P Perentesis, W Wen, J D Buckley, E Boyle, Cancer Epidemiol Biomarkers Prev. 13Shu XO, Perentesis JP, Wen W, Buckley JD, Boyle E, et al. (2004) Parental exposure to medications and hydrocarbons and ras mutations in children with acute lymphoblastic leukemia: a report from the Children's Oncology Group. Cancer Epidemiol Biomarkers Prev 13: 1230-1235.
Risk of childhood leukemia associated with parental smoking and alcohol consumption prior to conception and during pregnancy: the cross-Canada childhood leukemia study. A C Macarthur, M L Mcbride, J J Spinelli, S Tamaro, R P Gallagher, Cancer Causes Control. 19MacArthur AC, McBride ML, Spinelli JJ, Tamaro S, Gallagher RP, et al. (2008) Risk of childhood leukemia associated with parental smoking and alcohol consumption prior to conception and during pregnancy: the cross-Canada childhood leukemia study. Cancer Causes Control 19: 283-295.
| Tobacco use is causally associated with cancers of the lung, larynx, mouth, esophagus, kidneys, urinary tract, and possibly, breast. Major classes of carcinogens present in tobacco and tobacco smoke are converted into DNA-reactive metabolites by cytochrome P450 (CYP)-related enzymes, several of which display genetic polymorphism. Individual susceptibility to cancer is likely to be modified by the genotype for enzymes involved in the activation or detoxification of carcinogens in tobacco and repair of DNA damage. We summarize here the results of case-control studies published since 1990 on the effects of genetic variants of CYP1A1, 1A2, 1B1, 2A6, 2D6, 2E1, 2C9, 2C19, 17, and 19 alone or in combination with detoxifying enzymes as modifiers of the risk for tobacco-related cancers. The results of studies on gene-gene interactions and the dependence of smoking-related DNA adducts on genotype were also analyzed. Some CYP variants were associated with increased risks for cancers of the lung, esophagus, and head and neck. The risk was often increased in individuals who also had GSTM1 deficiency. For breast cancer in women, a few studies suggested an association with CYPs related to metabolism of tobacco carcinogens and steroidal hormones. The overall effects of common CYP polymorphisms were found to be moderate in terms of penetrance and relative risk, with odds ratios ranging from 2 to 10. Some CYP1A1/GSTM1 0/0 genotype combinations seem to predispose the lung, esophagus, and oral cavity of smokers to an even higher risk for cancer or DNA damage, requiring, however, confirmation. Future strategies in molecular cancer epidemiology for identifying such susceptible individuals are discussed with emphasis on well-designed larger studies. |
Background
Genome-wide association studies have identified a substantial number of common genetic variants that are associated with risk, for each of several diseases. However, most such associations are weak and account for only a small fraction of familial disease aggregation [1]. In the case of breast cancer, seven reproducible genetic susceptibility alleles were estimated to explain about 5% of heritability [2]. Studies of low frequency genetic variants, gene-gene interactions, genotype by environment interaction, and shared environment have been suggested [1] as means to identify the 'missing heritability' for complex diseases, along with more thorough study of variants within genomic regions of interest.
Closely related to this is the role of genetic variants in model discrimination and disease risk prediction. A recent multiple-cohort analysis of ten common genetic variants that reliably associate with breast cancer concluded that 'the level of predicted breast cancer risk among most women changed little' when these SNPs were added to existing risk assessment models [3]. In response, an accompanying editorial [4] pointed out that cellular networks within which the SNPs operate may associate more strongly with risk than do tagging SNPs alone, that gene-gene and gene-environment interactions are 'likely to be profoundly important', and that associations with breast cancer subtypes may be more impressive.
A challenge to pursuing the gene-environment concept is the typical difficulty in assessing key environmental exposures. For example, given the wellestablished association between obesity and post-menopausal breast cancer risk, one might expect that total energy consumption and other dietary factors may influence breast cancer risk, possibly in a manner that depends on genetic factors that relate to hormone metabolism, growth factors, or inflammation. However, dietary data are attended by random and systematic assessment biases that may seriously attenuate and distort estimated associations [5].
Randomized controlled intervention trials can provide highly desirable settings for the incorporation of genotype by environment interactions into genetic association analyses. First, the intervention group assignment is known with precision, and secondly, this assignment is statistically independent of underlying genotype by virtue of randomization. This latter feature also allows highly efficient case-only test statistics [6][7][8] to be used for genotype by intervention interaction testing.
The Women's Health Initiative (WHI) randomized controlled trial included four randomized and controlled comparisons among postmenopausal women in a partial factorial design [9,10]. Specifically, it comprised a postmenopausal hormone therapy component that involved two non-overlapping trials: estrogen versus placebo (Ealone trial) among women who were post-hysterectomy, and estrogen plus progestin versus placebo (E+P trial) among women with a uterus; a low-fat dietary modification (DM) versus usual diet component, and a calcium and vitamin D (CaD) versus placebo supplementation component.
An elevation of breast cancer risk triggered the early stopping of the E+P trial in 2002 [11,12]. In the E-alone trial, which was stopped early in 2004 primarily due to an elevation of stroke risk [13], there was a surprising suggestion of a reduction in breast cancer risk in the intervention group, as well as apparent interactions of the E-alone hazard ratio with several other breast cancer risk factors [14]. The DM trial continued to its planned termination in 2005. While overall it provided non-significant evidence of a breast cancer reduction over its 8.1-year average follow-up period, the breast cancer hazard ratio was significantly lower in the quartile of women who had a comparatively high fat content in their diet at baseline [15]. These women made a larger dietary change if assigned to the low-fat diet intervention. The CaD trial did not yield evidence of an effect on breast cancer risk [16].
We studied 4,988 SNPs in relation to breast cancer incidence and clinical trials intervention effects during the intervention phase of the WHI clinical trial. Nearly all of these SNPs were selected as the topranked SNPs according to significance level for association with breast cancer in the NCI Cancer Genetic Markers of Susceptibility (C-GEMS) genome-wide association study [17], while the remaining 244 were selected based on published data from the Breast Cancer Association Consortium genome-wide association study [18]. These SNPs were scattered throughout the genome. In fact, they arise from 3,224 distinct loci when a squared pairwise correlation (r 2 ) between adjacent regions of less than 0.2 is used to define new loci. We ranked SNPs according to a null hypothesis test that combined evidence of overall breast cancer association with evidence of interaction with one or more of the randomized clinical trial intervention assignments.
Materials and methods
Study design and population
Enrollees in WHI trials were postmenopausal women aged 50 to 79 years who met component-specific eligibility criteria [19]. Women were randomized to a hormone therapy component, or a DM component, or both. At the one-year anniversary from enrollment, participating women could be further randomized into a CaD supplementation component. A total of 68,132 women were enrolled into the trials between 1993 and 1998, among which there were 10,739 in E-alone, 16,608 in E+P, 48,835 in DM, and 36,282 in CaD components. Details about distributions of demographic variables and breast cancer risk factors in the study cohort were published previously [19]. For the DM trial we chose to focus interaction testing on the subset of 12,208 women having baseline percentage of energy from fat in the upper quartile, and we denote the DM intervention in this sub-cohort by DMQ.
Case and control selection
All 2,242 invasive breast cancer cases that developed between randomization and the end of the trial intervention phase (31 March 2005) were considered for inclusion, among which a total of 2,166 (96.6%) cases had adequate quantity and quality of DNA. This leads to analyses based on 247 cases for E-alone, 471 cases for E+P, 428 cases for DMQ, 1,049 cases for CaD (cases arising after CaD randomization only), and corresponding controls that were one-to-one matched to cases on baseline age, self-reported ethnicity, participation in each trial component, years since randomization, and baseline hysterectomy status.
Laboratory methods
Genotyping and data cleaning methods at Perlegen Sciences (Mountain View, CA, USA) have been described [20]. The average call rate for these SNPs was 99.8%, and the average concordance rate for 157 blind duplicate samples was also 99.8%.
Principal component analysis was used to characterize population structure and to identify genotyping artifacts. The top 20 principal components did not associate with common sources of experimental variability (for example, date of sample processing or hybridization performance for either chip design). The first ten principal components were found to account for 86% of the total SNP genotype variation, while the first four principal components provided good separation among the major self-reported 'ethnicities' (white, black, Hispanic, Asian/ Pacific Islander, northern versus southern European ancestry).
Statistical methods
A five-component test statistic was used for each SNP to test association with breast cancer. The first 'main effect' component arose as score test from a standard logistic regression of case (1) versus control (0) status on number of minor SNP alleles and potential confounding factors. The logistic regression model included the (log transformed) Gail 5-year breast cancer risk score [21], previous hormone use (indicators for < 5, 5 to 10, and ≥10 years for each of estrogen and estrogen plus progestin), and (log transformed) body mass index. Also included are variables used for matching controls to cases in control selection. In addition, eigenvectors from the first ten principal components from correlation analysis of the genotype data were included to adjust for population stratification [22]. The other four test statistic components were case-only tests for dependence of intervention odds ratios on SNP genotype for each of Ealone, E+P, DMQ, and CaD. These statistics arise as score tests in logistic regression of active (1) versus placebo or usual diet (0) randomization assignment on the number of minor SNP alleles with logistic regression location parameter offset by log q/(1 -q), where q is the fraction of women assigned to active intervention for the pertinent clinical trial component. The main effect test statistic is asymptotically independent of each of the case-only test statistics [23], and the interaction tests for E-alone and E+P are independent since they are based on non-overlapping sets of women. A 'sandwich' variance estimator was used to allow for possible correlations among the other pairs of case-only test statistics. A chi-square test with five degrees of freedom was then used to test SNP association with breast cancer, for each of the SNPs. Further details about this joint test procedure are included here as Additional file 1.
SNPs of interest in these association tests were subsequently examined for evidence of main effect and interaction effects separately. The latter once again employed case-only analyses, and for descriptive purposes, intervention odds ratios were estimated separately at zero, one, and two minor SNP alleles. A likelihood ratio test with two degrees of freedom assessed SNP by intervention interaction in these analyses.
The potential of SNP by clinical trial interactions to contribute to the ability to discriminate between breast cancer cases and controls was evaluated by estimating areas under the receiver operating characteristic curves (AUC), and associated confidence intervals.
Some further analyses were carried out with breast cancers classified according to either the estrogen receptor status or the progesterone receptor status of the breast tumor. All significance levels (P-values) are twosided.
Ethics approval
This research conforms to the Helsinki Declaration and pertinent legislation, and has been approved by the Institutional Review Board of the Fred Hutchinson Cancer Research Center. All women included in this report provided informed consent that permitted their biospecimens and data to be used in the present research project. Table 1 presents the top 20 SNPs ranked by P-value of the combined test of main effect and interaction. Among the 4,988 SNPs evaluated, six SNPs have the joint test Pvalue less than 10 -6 and a false discovery rate (FDR) less than 0.0005, all in the FGFR2 (fibroblast growth factor receptor 2) region in chromosome region 10q16. Immediately following are several SNPs from the MRPS30 (mitochondrial ribosomal protein S30) region in chromosome region 5p12. Of these SNPs, rs7705343 is included in the set of SNPs having FDR < 0.05, while close-by SNP rs13159598 is also among SNPs having FDR < 0.10. Table 1 also shows P-values and rankings for these SNPs under the main effect association test alone. While P-values for FGFR2 SNPs tend to be somewhat diluted by the inclusion of the interaction information in the test statistic, the ordering of these SNPs is rather different under the two-testing procedures. For example, SNP rs3750817, which is in a somewhat separate linkage disequilibrium bin from tagging SNP rs2981582 [18], has a comparatively higher ranking with the combined test. We have previously reported suggestive evidence of interaction of rs3750817 with E-alone and E+P [24], and DMQ [25].
Results
Simultaneous tests of main effect and interaction with clinical trial interventions
SNPs in the MRPS30 region of chromosome 5p12 have a higher ranking overall with the combined versus the main effect test. Moreover, the ordering of SNPs within this region is considerably altered by the inclusion of the interaction information. These analyses point to the genomic region in proximity of rs7705343 as relevant to breast cancer risk. Figure 1 shows squared pairwise correlations (r 2 ) among SNPs in the MRPS30 region of chromosome 5p12. The combined test rankings tend to decrease as one moves from rs7705343 to the tagging SNP rs4415084 at the opposite end of this genomic region of approximately 230 kb. Table 2 shows P-values individually for the five components of the combined test, for the eight SNPs in the MRPS30 region. Most of the association information derives from the main effect test, but the intervention interaction tests have rather different P-values across these SNPs, with rs7705343 having nominally significant (P < 0.05) interactions with each of E-alone, DMQ, and CaD, while interactions in relation to rs4415084 are not significant for any of the interventions. Table 3 shows estimated intervention odds ratios and 95% confidence intervals as a function of the number of minor alleles of rs7705343 for each of the four interventions. The GG genotype is associated with lower intervention ORs for each of E-alone, DMQ, and CaD. Additional file 2 provides corresponding information with breast cancers classified according to estrogen receptor or progesterone receptor positivity. No clear variations by tumor receptor status were suggested, through statistical power for detecting moderate variations with tumor type is limited.
The majority (86%) of the case-control samples are from European-ancestry populations. In Additional files 3 and 4 we provide P-values for interaction between trial components and SNPs in the MRPS30 region, and the estimated intervention odds ratios and 95% confidence intervals as a function of the number of minor alleles of rs7705343 among women of European ancestry specifically. The patterns that we observe are quite similar to the overall patterns.
We also examined the joint associations of these FGFR2 and MRPS30 SNPs with hormonal and dietary intervention effects, using case-only analysis. Based on logistic regression applied to cases in DMQ, where the indicator for active treatment is regressed on genotypes of rs3750817 and rs7705343 together, both SNPs showed nominally significant interactions. The P-values for rs3750817 and rs7705343 were 0.0059 and 0.037. When E-alone was similarly considered, rs3750817 and rs7705343 had P-values of 0.053 and 0.043 in the joint interaction model.
The AUC was calculated from logistic regression analyses that included clinical trial randomization
Discussion
We evaluated the association between 4,988 SNPs and invasive breast cancer incidence in the WHI clinical trial through the use of a statistic that combines SNP main effect information with SNP by intervention interaction information for each of four randomized interventions. This view of the data provided a clear focus on two genomic regions, the FGFR2 region of chromosome 10 q, which has a very strong main effect along with suggestive evidence for interaction, and the MRPS30 region of chromosome 5 p, which shows evidence of a comparatively smaller main effect and suggestive evidence for interaction. The inclusion of the clinical trial interventions in this testing procedure leads to interest in subregions containing FGFR2 SNP rs3750817 and MRPS30 SNP rs7705343 that are some distance from their associated tagging SNPs, possibly suggesting more than one regulatory element in these non-coding genomic regions.
We have previously [9,10] discussed these data in relation to FGFR2. The eight MRPS30 SNPs considered here fall in a linkage disequilibrium region of approximately 230 kb from downstream of fibroblast growth factor 10 (FGF10) to downstream of MRPS30, with a minimum squared correlation among SNPs of 0.80 (Figure 1). FGF10/FGFR2 signaling [26][27][28][29] could be relevant to these associations, though there is a recombination hotspot between the FGF10 gene and the 5p12 SNPs studied here.
Our analyses suggest that interactions of these two SNPs with WHI clinical trial interventions lead to a detectable increase in the ability to distinguish breast cancer cases from controls. Note, however, that AUC values in this context may be optimistic in view of our procedure for identifying SNPs of interest. Moreover, since the interactions identified in the study have yet to be confirmed by replication studies, the increase in AUC detected here is of exploratory nature as well. Also note that AUCs estimated here tend to be somewhat low due to age matching in the case-control sample. When our combined test is separated into its constituents, one observes nominally significant evidence of interaction of MRPS30 SNP rs7705343 with three of the four WHI interventions. Given the manner in which we ranked SNPs, these analyses (Tables 2 and 3) should be regarded as exploratory and such interactions will need to be confirmed separately. Unfortunately, other clinical trial data are not available for this purpose, and confirmation in observational study settings will involve the challenge of reliable ascertainment of the relevant hormonal or dietary exposures, and will need to be carried out in a case-control rather than case-only model. Hence, quite large numbers of cases and controls will be needed, as may be accessible through cohort consortia.
It is interesting to see a significant interaction of rs7705343 with E-alone with the estimated intervention OR below 1.0 for the GG genotype, and an insignificant interaction of rs7705343 with E+P with the estimated intervention OR greater than 1 for the GG genotype. Few interactions with study subject characteristics have been suggested for E+P [12], with FGFR2 SNP rs3750817 as a possible exception [24]. In contrast, interactions with several subject characteristics have been identified for E-alone, including family history of breast cancer, benign breast disease [14], and again FGFR2 SNP rs3750817 [24]. A possible explanation is that the progestin in E+P tends to overwhelm the minor variations in hormone therapy hazard ratios that would otherwise occur, giving rise to a strong and fairly uniform risk elevation.
Study strengths include its nesting within the randomized controlled WHI clinical trial, implying randomization assignments that are known and that are statistically independent of genotype and the related ability to use case-only analyses for intervention testing. Other strengths of the study include the use of pre-diagnostic blood specimens, collected and stored according to a standardized protocol, and quality-controlled SNP genotyping.
A limitation of the study is that the average age at enrollment was 63 years in the WHI controlled trials, with many women well past menopause at enrollment.
We have reported, in combined clinical trials and observational studies analyses, higher breast cancer hazard ratios for E+P and E-alone among women who first use these preparations soon after the menopause, compared to those using them later [30,31]. Hence, the magnitude of the odds ratios shown here may be lower than would apply to typical hormone therapy users.
Conclusions
Simultaneous consideration of overall association and intervention interaction point to genomic regions in the vicinity of FGFR2 and MRPS30 genes as relevant to breast cancer risk among postmenopausal women. Moreover, subregions that were not otherwise the focus of interest, in the vicinity of SNPs rs3750817 and rs7705343, were identified as worthy of further study by virtue of suggestive interactions with hormonal and dietary interventions. These analyses represent an early step in assessing the role of genotype by 'environment' interactions to help explain familial breast cancer patterns, or as a contributor to risk discrimination.
Additional material
Additional file 1: Joint test of main and interaction effects.
Additional file 2: Table S1. Odds ratios for four clinical trial interventions by genotype of rs7705343 in the MRPS30 region according to tumor receptor status.
Additional file 3: Table S2. Significance levels (P-values) for testing interaction with WHI trial interventions among women with European ancestry for SNPs in the MRPS30 region.
Additional file 4: Table S3. Breast cancer odds ratio for WHI trial interventions among women of European ancestry by genotype of the MRPS30 SNP rs7705343.
Figure 1
1Pairwise r 2 for SNPs within the MRPS30 region in chromosome 5p12, where r is the allelic correlation between SNPs.
Abbreviations AUC: area under the receiver operating characteristic curve; CaD trial: calcium and vitamin D versus placebo supplementation component; DM trial: low-fat dietary modification versus usual diet component; DMQ: low-fat dietary modification trial in the subset of women having baseline percentage of energy from fat in the upper quartile; E-alone trial: estrogen versus placebo; E+P trial: estrogen plus progestin versus placebo; FDR: false discovery rate; FGF10: fibroblast growth factor 10; FGFR2: fibroblast growth factor receptor 2; MRPS30: mitochondrial ribosomal protein S30; SNP: single nucleotide polymorphism; WHI: Women's Health Initiative.
Table 1
1Top 20 SNPs identified by combined test for main effect and interaction with clinical trial interventionsRank, rank of SNPs based on combined test P-value; b Rs number, SNP identification (rs) number in dbSNP database; c MAF, minor allele frequency in the study population; d Allele, minor/major allele; e Combined test P-value, P-value based on the simultaneous test with 5 df; f Combined test FDR, FDR based on the simultaneous test with 5 df; g Main effect P-value, P-value based on main effect test only; h Main effect rank, rank of SNPs based on main effect P-value.Rank a Rs
number b
Chromosome Position MAF c Allele d Combined test
P-value e
Combined
test FDR f
Main effect test
P-value g
Main effect
test rank h
Gene
1
rs1219648
10q26
123336180 0.42
G/A
6.45E-09
3.21E-05
3.90E-10
1
FGFR2
2
rs2981579
10q26
123327325 0.44
A/G
7.76E-09
1.94E-05
2.78E-09
2
FGFR2
3
rs3750817
10q26
123322567 0.37
T/C
5.61E-08
9.32E-05
9.02E-08
5
FGFR2
4
rs11200014
10q26
123324920 0.41
A/G
1.08E-07
0.000135
3.40E-09
3
FGFR2
5
rs2420946
10q26
123341314 0.42
T/C
1.56E-07
0.000156
1.49E-08
4
FGFR2
6
rs2981582
10q26
123342307 0.41
A/G
5.25E-07
0.000437
9.99E-08
6
FGFR2
7
rs7705343
5p12
44915334 0.42
G/A
5.88E-05
0.0419
0.000355
11
MRPS30
8
rs13159598
5p12
44841683 0.42
G/A
0.000136
0.0846
0.000425
13
MRPS30
9
rs11746980
5p12
44935642 0.43
C/T
0.000240
0.133
0.000511
16
MRPS30
10
rs9790879
5p12
44813635 0.43
A/G
0.000244
0.122
0.000963
19
MRPS30
11
rs2330572
5p12
44776746 0.43
C/A
0.000294
0.133
0.00129
22
MRPS30
12
rs7555040
1p33
47641903 0.13
G/A
0.000336
0.140
0.002483
26
Unknown
13
rs4415084
5p12
44698272 0.43
T/C
0.000400
0.153
0.000436
14
MRPS30
14
rs994793
5p12
44779004 0.43
G/A
0.000417
0.148
0.00184
23
MRPS30
15
rs2218080
5p12
44750087 0.44
C/T
0.000446
0.148
0.00274
30
MRPS30
16
rs7795554
7p21
12159269 0.36
C/T
0.000498
0.155
0.00353
40
Unknown
17
rs7519783
1q32
198951680 0.27
G/A
0.000904
0.265
0.229
1160
Unknown
18
rs1499111
4q28
129691789 0.22
T/C
0.00115
0.318
0.0736
431
Unknown
19
rs719278
3q11
98887302 0.40
A/G
0.00122
0.320
0.238
1204
EPHA6
20
rs1232355
3q26
88073313 0.05
C/T
0.00132
0.329
0.179
942
Unknown
a
Table 2
2Significance levels (P-values) for testing interaction with WHI trial interventions for SNPs in the MRPS30 regionRs number a
Chromosome
Position
Minor/major allele
MAF b
OR c
p.main d
E-alone e
E+P f
DMQ g
CaD h
7705343
5p12
44915334
G/A
0.40
1.18
0.000355
0.043
0.863
0.042
0.046
13159598
5p12
44841683
G/A
0.41
1.17
0.000425
0.056
0.920
0.057
0.048
11746980
5p12
44813635
A/G
0.41
1.16
0.000511
0.064
0.790
0.043
0.095
9790879
5p12
44935642
C/T
0.41
1.17
0.000963
0.117
0.762
0.042
0.047
2330572
5p12
44776746
C/A
0.42
1.16
0.00129
0.042
0.880
0.043
0.106
4415084
5p12
44698272
T/C
0.41
1.17
0.000436
0.242
0.944
0.127
0.146
994793
5p12
44779004
G/A
0.42
1.15
0.00184
0.084
0.798
0.041
0.080
2218080
5p12
44750087
C/T
0.43
1.15
0.00274
0.273
0.933
0.025
0.069
a
Rs number, SNP identification (rs) number in dbSNP database; b MAF, minor allele frequency in the study population; c OR, estimated minor allele odds ratio
under additive allelic effects model; d p.main, significance level for SNP association with breast cancer in additive allele effects model; e E-alone, P-value for
dependence (interaction) of E-alone odds ratio on SNP from case-only analyses; f E+P and h CaD, corresponding interaction P-values for the other interventions;
g DMQ, interaction P-value for DM among women with baseline percentage energy from fat in the upper quartile. Entries in bold are interaction effects significant
at the nominal (0.05) level. WHI, Women's Health Initiative.
Table 3
3Breast cancer odds ratio for WHI trial interventions by genotype of MRPS30 SNP rs7705343 OR, estimated intervention odds ratio; b P-value, significance level for SNP interaction with clinical trial intervention. CI, confidence interval; WHI, Women's Health Initiative.SNP genotype
GG
GA
AA
Intervention
Number of cases
OR a
95% CI
OR a
95% CI
OR a
95% CI
P-value b
E-alone
247
0.484
(0.306, 0.766)
0.974
(0.684, 1.387)
0.969
(0.508, 1.846)
0.043
E+P
471
1.404
(1.003, 1.965)
1.248
(0.966, 1.613)
1.303
(0.858, 1.980)
0.863
DMQ
428
0.524
(0.360, 0.761)
0.862
(0.651, 1.141)
1.023
(0.643, 1.627)
0.042
CaD
1,049
0.763
(0.613, 0.951)
1.071
(0.902, 1.271)
1.049
(0.791, 1.391)
0.046
a
Huang et al. Genome Medicine 2011, 3:42 http://genomemedicine.com/content/3/6/42
AcknowledgementsDecisions concerning study design, data collection and analysis, interpretation of the results, the preparation of the manuscript, or the decision to submit the manuscript for publication resided with committees composed of WHI investigators that included NHLBI representatives. Program Office: (National Heart, Lung, and Blood Institute, Bethesda, MD, USA) Jacques Rossouw Competing interests RTC reports receiving consulting fees from AstraZeneca, Novartis, Pfizer, and Eli Lilly, lecture fees from AstraZeneca and Novartis, and grant support from Amgen. No other potential conflict of interest relevant to this article was reported.Authors' contributionsAll authors were involved in development and/or critical review and revision of the manuscript. Additionally, DB, DH, DC, and EB had primary responsibility for project genotyping; YH, DH and RP had primary responsibility for data analysis; RC, JR, AM, TR and RP had responsibility for clinical data; and DB, UP and RP had primary administrative responsibility for this research project.Submit your next manuscript to BioMed
Finding the missing heritability of complex diseases. T A Manolio, F S Collins, N J Cox, D B Goldstein, L A Hindorff, D J Hunter, M I Mccarthy, E M Ramos, L R Cardon, A Chakravarti, J H Cho, A E Guttmacher, A Kong, L Kruglyak, E Mardis, C N Rotimi, M Slatkin, D Valle, A S Whittemore, M Boehnke, A G Clark, E E Eichler, G Gibson, J L Haines, Tfc Mackay, S A Mccarroll, P M Visscher, Nature. 461Manolio TA, Collins FS, Cox NJ, Goldstein DB, Hindorff LA, Hunter DJ, McCarthy MI, Ramos EM, Cardon LR, Chakravarti A, Cho JH, Guttmacher AE, Kong A, Kruglyak L, Mardis E, Rotimi CN, Slatkin M, Valle D, Whittemore AS, Boehnke M, Clark AG, Eichler EE, Gibson G, Haines JL, Mackay TFC, McCarroll SA, Visscher PM: Finding the missing heritability of complex diseases. Nature 2009, 461:747-753.
Polygenes, risk prediction, and targeted prevention of breast cancer. Pdp Pharoah, A C Antoniou, D F Easton, Baj Ponder, N Engl J Med. 358Pharoah PDP, Antoniou AC, Easton DF, Ponder BAJ: Polygenes, risk prediction, and targeted prevention of breast cancer. N Engl J Med 2008, 358:2796-2803.
Performance of common genetic variants in breast-cancer risk models. S Wacholder, P Hartge, R Prentice, M Garcia-Closas, H S Feigelson, W R Diver, M J Thun, D G Cox, S E Hankinson, P Kraft, B Rosner, C D Berg, L A Brinton, J Lissowska, M E Sherman, R Chlebowski, C Kooperberg, R D Jackson, D W Buckman, P Hui, R Pfeiffer, K B Jacobs, G D Thomas, R N Hoover, M H Gail, S J Chanock, D J Hunter, N Engl J Med. 362Wacholder S, Hartge P, Prentice R, Garcia-Closas M, Feigelson HS, Diver WR, Thun MJ, Cox DG, Hankinson SE, Kraft P, Rosner B, Berg CD, Brinton LA, Lissowska J, Sherman ME, Chlebowski R, Kooperberg C, Jackson RD, Buckman DW, Hui P, Pfeiffer R, Jacobs KB, Thomas GD, Hoover RN, Gail MH, Chanock SJ, Hunter DJ: Performance of common genetic variants in breast-cancer risk models. N Engl J Med 2010, 362:986-993.
A tiny step closer to personalized risk prediction for breast cancer. P Devilee, M A Rookus, N Engl J Med. 362Devilee P, Rookus MA: A tiny step closer to personalized risk prediction for breast cancer. N Engl J Med 2010, 362:1043-1045.
Biomarker-calibrated energy and protein consumption and increased cancer risk among postmenopausal women. R L Prentice, P A Shaw, S A Bingham, S A Beresford, B Caan, M L Neuhouser, R E Patterson, M L Stefanick, S Satterfield, C A Thomson, L Snetselaar, A Thomas, L F Tinker, Am J Epidemiol. 169Prentice RL, Shaw PA, Bingham SA, Beresford SA, Caan B, Neuhouser ML, Patterson RE, Stefanick ML, Satterfield S, Thomson CA, Snetselaar L, Thomas A, Tinker LF: Biomarker-calibrated energy and protein consumption and increased cancer risk among postmenopausal women. Am J Epidemiol 2009, 169:977-989.
On estimating HLA/disease association with application to a study of aplastic anemia. S G Self, G Longton, K J Kopecky, K Y Liang, Biometrics. 47Self SG, Longton G, Kopecky KJ, Liang KY: On estimating HLA/disease association with application to a study of aplastic anemia. Biometrics 1991, 47:53-61.
Non-hierarchical logistic models and case-only designs for assessing susceptibility in population-based case-control studies. W W Piegorsch, C R Weinberg, J A Taylor, Stat Med. 13Piegorsch WW, Weinberg CR, Taylor JA: Non-hierarchical logistic models and case-only designs for assessing susceptibility in population-based case-control studies. Stat Med 1994, 13:153-162.
Case-only analysis of treatment-covariate iterations in clinical trials. E Vittinghoff, D C Bauer, Biometrics. 62Vittinghoff E, Bauer DC: Case-only analysis of treatment-covariate iterations in clinical trials. Biometrics 2006, 62:769-776.
The Women's Health Initiative Study Group: Design of the Women's Health Initiative clinical trial and observational study. Control Clin Trials. 19The Women's Health Initiative Study Group: Design of the Women's Health Initiative clinical trial and observational study. Control Clin Trials 1998, 19:61-109.
The Women's Health Initiative: lessons learned. Ann Rev Public Health. R L Prentice, G L Anderson, 29Prentice RL, Anderson GL: The Women's Health Initiative: lessons learned. Ann Rev Public Health 2007, 29:131-150.
Writing Group for the Women's Health Initiative Investigators: Risks and benefits of estrogen plus progestin in healthy postmenopausal women: principal results from the Women's Health Initiative randomized controlled trial. J E Rossouw, G L Anderson, R L Prentice, A Z Lacroix, C Kooperberg, M L Stefanick, R D Jackson, S A Beresford, B V Howard, K C Johnson, J M Kotchen, J Ockene, JAMA. 288Rossouw JE, Anderson GL, Prentice RL, LaCroix AZ, Kooperberg C, Stefanick ML, Jackson RD, Beresford SA, Howard BV, Johnson KC, Kotchen JM, Ockene J, Writing Group for the Women's Health Initiative Investigators: Risks and benefits of estrogen plus progestin in healthy postmenopausal women: principal results from the Women's Health Initiative randomized controlled trial. JAMA 2002, 288:321-333.
Influence of estrogen plus progestin on breast cancer and mammography in healthy postmenopausal women: the Women's Health Initiative randomized trial. R T Chlebowski, S L Hendrix, R D Langer, M L Stefanick, M Gass, D Lane, R J Rodabough, M A Gilligan, M G Cyr, C A Thomson, J Khandekar, H Petrovitch, A Mctiernan, Investigators, JAMA. 289Chlebowski RT, Hendrix SL, Langer RD, Stefanick ML, Gass M, Lane D, Rodabough RJ, Gilligan MA, Cyr MG, Thomson CA, Khandekar J, Petrovitch H, McTiernan A, WHI Investigators: Influence of estrogen plus progestin on breast cancer and mammography in healthy postmenopausal women: the Women's Health Initiative randomized trial. JAMA 2003, 289:3243-3253.
. G L Anderson, M Limacher, A R Assaf, T Bassford, S A Beresford, H Black, D Bonds, R Brunner, R Brzyski, B Caan, R Chlebowski, D Curb, M Gass, J Hays, G Heiss, S Hendrix, B V Howard, J Hsia, A Hubbell, R Jackson, Huang, Genome Medicine. 342Anderson GL, Limacher M, Assaf AR, Bassford T, Beresford SA, Black H, Bonds D, Brunner R, Brzyski R, Caan B, Chlebowski R, Curb D, Gass M, Hays J, Heiss G, Hendrix S, Howard BV, Hsia J, Hubbell A, Jackson R, Huang et al. Genome Medicine 2011, 3:42
Women's Health Initiative Steering Committee, et al: Effects of conjugated equine estrogen in postmenopausal women with hysterectomy: the Women's Health Initiative randomized controlled trial. K C Johnson, H Judd, J M Kotchen, L Kuller, A Z Lacroix, D Lane, R D Langer, N Lasser, C E Lewis, J Manson, JAMA. 291Johnson KC, Judd H, Kotchen JM, Kuller L, LaCroix AZ, Lane D, Langer RD, Lasser N, Lewis CE, Manson J, Women's Health Initiative Steering Committee, et al: Effects of conjugated equine estrogen in postmenopausal women with hysterectomy: the Women's Health Initiative randomized controlled trial. JAMA 2004, 291:1701-1712.
Effects of conjugated equine estrogens on breast cancer and mammography screening in postmenopausal women with hysterectomy. M L Stefanick, G L Anderson, K L Margolis, S L Hendrix, R J Rodabough, E D Paskett, D S Lane, F A Hubbell, A R Assaf, G E Sarto, R S Schenken, S Yasmeen, L Lessin, R T Chlebowski, Investigators, JAMA. 295Stefanick ML, Anderson GL, Margolis KL, Hendrix SL, Rodabough RJ, Paskett ED, Lane DS, Hubbell FA, Assaf AR, Sarto GE, Schenken RS, Yasmeen S, Lessin L, Chlebowski RT, WHI Investigators: Effects of conjugated equine estrogens on breast cancer and mammography screening in postmenopausal women with hysterectomy. JAMA 2006, 295:1647-1657.
Low-fat dietary pattern and risk of invasive breast cancer: the Women's Health Initiative randomized controlled dietary modification trial. R L Prentice, B Caan, R T Chlebowski, R Patterson, L H Kuller, J K Ockene, K L Margolis, M C Limacher, J E Manson, L M Parker, E Paskett, L Phillips, J Robbins, J E Rossouw, G E Sarto, J M Shikany, M L Stefanick, C A Thomson, L Van Horn, M Z Vitolins, J Wactawski-Wende, R B Wallace, S Wassertheil-Smoller, E Whitlock, K Yano, L Adams-Campbell, G L Anderson, A R Assaf, S A Beresford, H R Black, JAMA. 295Prentice RL, Caan B, Chlebowski RT, Patterson R, Kuller LH, Ockene JK, Margolis KL, Limacher MC, Manson JE, Parker LM, Paskett E, Phillips L, Robbins J, Rossouw JE, Sarto GE, Shikany JM, Stefanick ML, Thomson CA, Van Horn L, Vitolins MZ, Wactawski-Wende J, Wallace RB, Wassertheil- Smoller S, Whitlock E, Yano K, Adams-Campbell L, Anderson GL, Assaf AR, Beresford SA, Black HR, et al: Low-fat dietary pattern and risk of invasive breast cancer: the Women's Health Initiative randomized controlled dietary modification trial. JAMA 2006, 295:629-642.
Women's Health Initiative Investigators: Calcium plus vitamin D supplementation and the risk of breast cancer. R T Chlebowski, K C Johnson, C Kooperberg, M Pettinger, J Wactawski-Wende, T Rohan, J Rossouw, D Lane, M J O'sullivan, S Yasmeen, R A Hiatt, J M Shikany, M Vitolins, J Khandekar, F A Hubbell, J Natl Cancer Inst. 100Chlebowski RT, Johnson KC, Kooperberg C, Pettinger M, Wactawski- Wende J, Rohan T, Rossouw J, Lane D, O'Sullivan MJ, Yasmeen S, Hiatt RA, Shikany JM, Vitolins M, Khandekar J, Hubbell FA, Women's Health Initiative Investigators: Calcium plus vitamin D supplementation and the risk of breast cancer. J Natl Cancer Inst 2008, 100:1581-1591.
A genome-wide association study identifies alleles in FGFR2 associated with risk of sporadic postmenopausal breast cancer. D J Hunter, P Kraft, K B Jacobs, D G Cox, M Yeager, S E Hankinson, S Wacholder, Z Wang, R Welch, A Hutchinson, J Wang, K Yu, N Chatterjee, N Orr, W C Willett, G A Colditz, R G Ziegler, C D Berg, S S Buys, C A Mccarty, H S Feigelson, E E Calle, M J Thun, R B Hayes, M Tucker, D S Gerhard, J F FraumeniJr, R N Hoover, G Thomas, S J Chanock, Nat Genet. 39Hunter DJ, Kraft P, Jacobs KB, Cox DG, Yeager M, Hankinson SE, Wacholder S, Wang Z, Welch R, Hutchinson A, Wang J, Yu K, Chatterjee N, Orr N, Willett WC, Colditz GA, Ziegler RG, Berg CD, Buys SS, McCarty CA, Feigelson HS, Calle EE, Thun MJ, Hayes RB, Tucker M, Gerhard DS, Fraumeni JF Jr, Hoover RN, Thomas G, Chanock SJ: A genome-wide association study identifies alleles in FGFR2 associated with risk of sporadic postmenopausal breast cancer. Nat Genet 2007, 39:870-874.
Genome-wide association study identifies novel breast cancer susceptibility loci. D F Easton, K A Pooley, A M Dunning, P D Pharoah, D Thompson, D G Ballinger, J P Struewing, J Morrison, H Field, R Luben, N Wareham, S Ahmed, C S Healey, R Bowman, K B Meyer, C A Haiman, L K Kolonel, B E Henderson, Le Marchand, L Brennan, P Sangrajrang, S Gaborieau, V Odefrey, F Shen, C Y Wu, P E Wang, H C Eccles, D Evans, D G Peto, J , Nature. 447Easton DF, Pooley KA, Dunning AM, Pharoah PD, Thompson D, Ballinger DG, Struewing JP, Morrison J, Field H, Luben R, Wareham N, Ahmed S, Healey CS, Bowman R, SEARCH collaborators, Meyer KB, Haiman CA, Kolonel LK, Henderson BE, Le Marchand L, Brennan P, Sangrajrang S, Gaborieau V, Odefrey F, Shen CY, Wu PE, Wang HC, Eccles D, Evans DG, Peto J, et al: Genome-wide association study identifies novel breast cancer susceptibility loci. Nature 2007, 447:1087-1093.
The women's health initiative recruitment methods and results. J L Hays, J R Hunt, F A Hubbell, G L Anderson, M Limacher, C Allen, J E Rossouw, Ann Epidmiol. 139Hays JL, Hunt JR, Hubbell FA, Anderson GL, Limacher M, Allen C, Rossouw JE: The women's health initiative recruitment methods and results. Ann Epidmiol 2002, 13(9 Supp):S18-S77.
Cholinergic nicotinic receptor genes implicated in a nicotine dependence association study targeting 348 candidate genes with 3713 SNPs. S S Saccone, A L Hinrich, N L Saccone, G A Chase, K Konvicka, P A Madden, N Breslau, E O Johnson, D Hatsukami, O Pomerleau, G E Swan, A M Goate, J Rutter, S Bertelsen, L Fox, D Fugman, N G Martin, G W Montgomery, J C Wang, D G Ballinger, J P Rice, L J Bierut, Hum Mol Genet. 16Saccone SS, Hinrich AL, Saccone NL, Chase GA, Konvicka K, Madden PA, Breslau N, Johnson EO, Hatsukami D, Pomerleau O, Swan GE, Goate AM, Rutter J, Bertelsen S, Fox L, Fugman D, Martin NG, Montgomery GW, Wang JC, Ballinger DG, Rice JP, Bierut LJ: Cholinergic nicotinic receptor genes implicated in a nicotine dependence association study targeting 348 candidate genes with 3713 SNPs. Hum Mol Genet 2006, 16:36-49.
Weighing the risks and benefits of tamoxifen treatment for preventing breast cancer. M H Gail, J P Constantino, J Bryant, R Croyle, L Freedman, K Helzlsouer, V Vogel, J Natl Cancer Inst. 91Gail MH, Constantino JP, Bryant J, Croyle R, Freedman L, Helzlsouer K, Vogel V: Weighing the risks and benefits of tamoxifen treatment for preventing breast cancer. J Natl Cancer Inst 1999, 91:1829-1846.
Principal component analysis corrects for stratification in genome-wide association studies. A L Price, N J Patterson, R M Plenge, M E Weinblatt, N A Shadick, D Reich, Nat Genet. 38Price AL, Patterson NJ, Plenge RM, Weinblatt ME, Shadick NA, Reich D: Principal component analysis corrects for stratification in genome-wide association studies. Nat Genet 2006, 38:904-909.
On Two-stage Hypothesis Testing Procedures via Asymptotically Independent Statistics University of Washington Biostat Working Paper Series 366. J Dai, M Leblanc, C Kooperberg, R L Prentice, Dai J, LeBlanc M, Kooperberg C, Prentice RL: On Two-stage Hypothesis Testing Procedures via Asymptotically Independent Statistics University of Washington Biostat Working Paper Series 366; 2010 [http://www.bepress. com/uwbiostat/].
Variation in the FGFR2 gene and the effects of postmenopausal hormone therapy on invasive breast cancer. R L Prentice, Y Huang, D A Hinds, U Peters, M Pettinger, D R Cox, E Beilharz, R T Chlebowski, J E Rossouw, B Caan, D G Ballinger, Cancer Epidemiol Biomarkers Prev. 18Prentice RL, Huang Y, Hinds DA, Peters U, Pettinger M, Cox DR, Beilharz E, Chlebowski RT, Rossouw JE, Caan B, Ballinger DG: Variation in the FGFR2 gene and the effects of postmenopausal hormone therapy on invasive breast cancer. Cancer Epidemiol Biomarkers Prev 2009, 18:3079-3085.
Variation in the FGFR2 gene and the effects of a low-fat dietary pattern on invasive breast cancer. R L Prentice, Y Huang, D A Hinds, U Peters, D R Cox, E Beilharz, R T Chlebowski, J E Rossouw, B Caan, D G Ballinger, Cancer Epidemiol Biomarkers Prev. 19Prentice RL, Huang Y, Hinds DA, Peters U, Cox DR, Beilharz E, Chlebowski RT, Rossouw JE, Caan B, Ballinger DG: Variation in the FGFR2 gene and the effects of a low-fat dietary pattern on invasive breast cancer. Cancer Epidemiol Biomarkers Prev 2010, 19:74-79.
FGF10 is an oncogene activated by MMTV insertional mutagenesis in mouse mammary tumors and overexpressed in a subset of human breast carcinomas. V Theodorou, M Boer, B Weigelt, J Jonkers, M Van Der Valk, J Hilkens, Oncogene. 23Theodorou V, Boer M, Weigelt B, Jonkers J, van der Valk M, Hilkens J: FGF10 is an oncogene activated by MMTV insertional mutagenesis in mouse mammary tumors and overexpressed in a subset of human breast carcinomas. Oncogene 2004, 23:6047-6055.
Cancer genomics and genetics of FGFR2 (Review). M Katoh, Int J Oncol. 33Katoh M: Cancer genomics and genetics of FGFR2 (Review). Int J Oncol 2008, 33:233-237.
Identification of FGF10 targets in the embryonic lung epithelium during bud morphogenesis. J Lü, K I Izvolsky, J Qian, W V Cardoso, J Biol Chem. 280Lü J, Izvolsky KI, Qian J, Cardoso WV: Identification of FGF10 targets in the embryonic lung epithelium during bud morphogenesis. J Biol Chem 2005, 280:4834-4841.
FGF10/FGFR2 signal induces cell migration and invasion in pancreatic cancer. S Nomura, H Yoshitomi, S Takano, T Shida, S Kobayashi, M Ohtsuka, F Kimura, H Shimizu, H Yoshidome, A Kato, M Miyazaki, Br J Cancer. 99Nomura S, Yoshitomi H, Takano S, Shida T, Kobayashi S, Ohtsuka M, Kimura F, Shimizu H, Yoshidome H, Kato A, Miyazaki M: FGF10/FGFR2 signal induces cell migration and invasion in pancreatic cancer. Br J Cancer 2008, 99:305-313.
Conjugated equine estrogens and breast cancer risk in the Women's Health Initiative clinical trial and observational study. R L Prentice, R T Chlebowski, M L Stefanick, J E Manson, R D Langer, M Pettinger, S L Hendrix, F A Hubbell, C Kooperberg, L H Kuller, D S Lane, A Mctiernan, M J O'sullivan, J E Rossouw, G L Anderson, Am J Epidemiol. 167Prentice RL, Chlebowski RT, Stefanick ML, Manson JE, Langer RD, Pettinger M, Hendrix SL, Hubbell FA, Kooperberg C, Kuller LH, Lane DS, McTiernan A, O'Sullivan MJ, Rossouw JE, Anderson GL: Conjugated equine estrogens and breast cancer risk in the Women's Health Initiative clinical trial and observational study. Am J Epidemiol 2008, 167:1407-1415.
Estrogen plus progestin therapy and breast cancer in recently postmenopausal women. R L Prentice, R T Chlebowski, M L Stefanick, J E Manson, M Pettinger, S L Hendrix, F A Hubbell, C Kooperberg, L H Kuller, D S Lane, A Mctiernan, O' Jo, M Sullivan, J E Rossouw, G L Anderson, 10.1186/gm258Am J Epidemiol. 167Prentice RL, Chlebowski RT, Stefanick ML, Manson JE, Pettinger M, Hendrix SL, Hubbell FA, Kooperberg C, Kuller LH, Lane DS, McTiernan A, Jo O'Sullivan M, Rossouw JE, Anderson GL: Estrogen plus progestin therapy and breast cancer in recently postmenopausal women. Am J Epidemiol 2008, 167:1207-1216. doi:10.1186/gm258
Genetic variants in the MRPS30 region and postmenopausal breast cancer risk. Huang, Genome Medicine. 342Cite this article asCite this article as: Huang et al.: Genetic variants in the MRPS30 region and postmenopausal breast cancer risk. Genome Medicine 2011 3:42.
|
Background
Genome-wide association studies have identified a substantial number of common genetic variants that are associated with risk, for each of several diseases. However, most such associations are weak and account for only a small fraction of familial disease aggregation [1]. In the case of breast cancer, seven reproducible genetic susceptibility alleles were estimated to explain about 5% of heritability [2]. Studies of low frequency genetic variants, gene-gene interactions, genotype by environment interaction, and shared environment have been suggested [1] as means to identify the 'missing heritability' for complex diseases, along with more thorough study of variants within genomic regions of interest.
Closely related to this is the role of genetic variants in model discrimination and disease risk prediction. A recent multiple-cohort analysis of ten common genetic variants that reliably associate with breast cancer concluded that 'the level of predicted breast cancer risk among most women changed little' when these SNPs were added to existing risk assessment models [3]. In response, an accompanying editorial [4] pointed out that cellular networks within which the SNPs operate may associate more strongly with risk than do tagging SNPs alone, that gene-gene and gene-environment interactions are 'likely to be profoundly important', and that associations with breast cancer subtypes may be more impressive.
A challenge to pursuing the gene-environment concept is the typical difficulty in assessing key environmental exposures. For example, given the wellestablished association between obesity and post-menopausal breast cancer risk, one might expect that total energy consumption and other dietary factors may influence breast cancer risk, possibly in a manner that depends on genetic factors that relate to hormone metabolism, growth factors, or inflammation. However, dietary data are attended by random and systematic assessment biases that may seriously attenuate and distort estimated associations [5].
Randomized controlled intervention trials can provide highly desirable settings for the incorporation of genotype by environment interactions into genetic association analyses. First, the intervention group assignment is known with precision, and secondly, this assignment is statistically independent of underlying genotype by virtue of randomization. This latter feature also allows highly efficient case-only test statistics [6][7][8] to be used for genotype by intervention interaction testing.
The Women's Health Initiative (WHI) randomized controlled trial included four randomized and controlled comparisons among postmenopausal women in a partial factorial design [9,10]. Specifically, it comprised a postmenopausal hormone therapy component that involved two non-overlapping trials: estrogen versus placebo (Ealone trial) among women who were post-hysterectomy, and estrogen plus progestin versus placebo (E+P trial) among women with a uterus; a low-fat dietary modification (DM) versus usual diet component, and a calcium and vitamin D (CaD) versus placebo supplementation component.
An elevation of breast cancer risk triggered the early stopping of the E+P trial in 2002 [11,12]. In the E-alone trial, which was stopped early in 2004 primarily due to an elevation of stroke risk [13], there was a surprising suggestion of a reduction in breast cancer risk in the intervention group, as well as apparent interactions of the E-alone hazard ratio with several other breast cancer risk factors [14]. The DM trial continued to its planned termination in 2005. While overall it provided non-significant evidence of a breast cancer reduction over its 8.1-year average follow-up period, the breast cancer hazard ratio was significantly lower in the quartile of women who had a comparatively high fat content in their diet at baseline [15]. These women made a larger dietary change if assigned to the low-fat diet intervention. The CaD trial did not yield evidence of an effect on breast cancer risk [16].
We studied 4,988 SNPs in relation to breast cancer incidence and clinical trials intervention effects during the intervention phase of the WHI clinical trial. Nearly all of these SNPs were selected as the topranked SNPs according to significance level for association with breast cancer in the NCI Cancer Genetic Markers of Susceptibility (C-GEMS) genome-wide association study [17], while the remaining 244 were selected based on published data from the Breast Cancer Association Consortium genome-wide association study [18]. These SNPs were scattered throughout the genome. In fact, they arise from 3,224 distinct loci when a squared pairwise correlation (r 2 ) between adjacent regions of less than 0.2 is used to define new loci. We ranked SNPs according to a null hypothesis test that combined evidence of overall breast cancer association with evidence of interaction with one or more of the randomized clinical trial intervention assignments.
Materials and methods
Study design and population
Enrollees in WHI trials were postmenopausal women aged 50 to 79 years who met component-specific eligibility criteria [19]. Women were randomized to a hormone therapy component, or a DM component, or both. At the one-year anniversary from enrollment, participating women could be further randomized into a CaD supplementation component. A total of 68,132 women were enrolled into the trials between 1993 and 1998, among which there were 10,739 in E-alone, 16,608 in E+P, 48,835 in DM, and 36,282 in CaD components. Details about distributions of demographic variables and breast cancer risk factors in the study cohort were published previously [19]. For the DM trial we chose to focus interaction testing on the subset of 12,208 women having baseline percentage of energy from fat in the upper quartile, and we denote the DM intervention in this sub-cohort by DMQ.
Case and control selection
All 2,242 invasive breast cancer cases that developed between randomization and the end of the trial intervention phase (31 March 2005) were considered for inclusion, among which a total of 2,166 (96.6%) cases had adequate quantity and quality of DNA. This leads to analyses based on 247 cases for E-alone, 471 cases for E+P, 428 cases for DMQ, 1,049 cases for CaD (cases arising after CaD randomization only), and corresponding controls that were one-to-one matched to cases on baseline age, self-reported ethnicity, participation in each trial component, years since randomization, and baseline hysterectomy status.
Laboratory methods
Genotyping and data cleaning methods at Perlegen Sciences (Mountain View, CA, USA) have been described [20]. The average call rate for these SNPs was 99.8%, and the average concordance rate for 157 blind duplicate samples was also 99.8%.
Principal component analysis was used to characterize population structure and to identify genotyping artifacts. The top 20 principal components did not associate with common sources of experimental variability (for example, date of sample processing or hybridization performance for either chip design). The first ten principal components were found to account for 86% of the total SNP genotype variation, while the first four principal components provided good separation among the major self-reported 'ethnicities' (white, black, Hispanic, Asian/ Pacific Islander, northern versus southern European ancestry).
Statistical methods
A five-component test statistic was used for each SNP to test association with breast cancer. The first 'main effect' component arose as score test from a standard logistic regression of case (1) versus control (0) status on number of minor SNP alleles and potential confounding factors. The logistic regression model included the (log transformed) Gail 5-year breast cancer risk score [21], previous hormone use (indicators for < 5, 5 to 10, and ≥10 years for each of estrogen and estrogen plus progestin), and (log transformed) body mass index. Also included are variables used for matching controls to cases in control selection. In addition, eigenvectors from the first ten principal components from correlation analysis of the genotype data were included to adjust for population stratification [22]. The other four test statistic components were case-only tests for dependence of intervention odds ratios on SNP genotype for each of Ealone, E+P, DMQ, and CaD. These statistics arise as score tests in logistic regression of active (1) versus placebo or usual diet (0) randomization assignment on the number of minor SNP alleles with logistic regression location parameter offset by log q/(1 -q), where q is the fraction of women assigned to active intervention for the pertinent clinical trial component. The main effect test statistic is asymptotically independent of each of the case-only test statistics [23], and the interaction tests for E-alone and E+P are independent since they are based on non-overlapping sets of women. A 'sandwich' variance estimator was used to allow for possible correlations among the other pairs of case-only test statistics. A chi-square test with five degrees of freedom was then used to test SNP association with breast cancer, for each of the SNPs. Further details about this joint test procedure are included here as Additional file 1.
SNPs of interest in these association tests were subsequently examined for evidence of main effect and interaction effects separately. The latter once again employed case-only analyses, and for descriptive purposes, intervention odds ratios were estimated separately at zero, one, and two minor SNP alleles. A likelihood ratio test with two degrees of freedom assessed SNP by intervention interaction in these analyses.
The potential of SNP by clinical trial interactions to contribute to the ability to discriminate between breast cancer cases and controls was evaluated by estimating areas under the receiver operating characteristic curves (AUC), and associated confidence intervals.
Some further analyses were carried out with breast cancers classified according to either the estrogen receptor status or the progesterone receptor status of the breast tumor. All significance levels (P-values) are twosided.
Ethics approval
This research conforms to the Helsinki Declaration and pertinent legislation, and has been approved by the Institutional Review Board of the Fred Hutchinson Cancer Research Center. All women included in this report provided informed consent that permitted their biospecimens and data to be used in the present research project. Table 1 presents the top 20 SNPs ranked by P-value of the combined test of main effect and interaction. Among the 4,988 SNPs evaluated, six SNPs have the joint test Pvalue less than 10 -6 and a false discovery rate (FDR) less than 0.0005, all in the FGFR2 (fibroblast growth factor receptor 2) region in chromosome region 10q16. Immediately following are several SNPs from the MRPS30 (mitochondrial ribosomal protein S30) region in chromosome region 5p12. Of these SNPs, rs7705343 is included in the set of SNPs having FDR < 0.05, while close-by SNP rs13159598 is also among SNPs having FDR < 0.10. Table 1 also shows P-values and rankings for these SNPs under the main effect association test alone. While P-values for FGFR2 SNPs tend to be somewhat diluted by the inclusion of the interaction information in the test statistic, the ordering of these SNPs is rather different under the two-testing procedures. For example, SNP rs3750817, which is in a somewhat separate linkage disequilibrium bin from tagging SNP rs2981582 [18], has a comparatively higher ranking with the combined test. We have previously reported suggestive evidence of interaction of rs3750817 with E-alone and E+P [24], and DMQ [25].
Results
Simultaneous tests of main effect and interaction with clinical trial interventions
SNPs in the MRPS30 region of chromosome 5p12 have a higher ranking overall with the combined versus the main effect test. Moreover, the ordering of SNPs within this region is considerably altered by the inclusion of the interaction information. These analyses point to the genomic region in proximity of rs7705343 as relevant to breast cancer risk. Figure 1 shows squared pairwise correlations (r 2 ) among SNPs in the MRPS30 region of chromosome 5p12. The combined test rankings tend to decrease as one moves from rs7705343 to the tagging SNP rs4415084 at the opposite end of this genomic region of approximately 230 kb. Table 2 shows P-values individually for the five components of the combined test, for the eight SNPs in the MRPS30 region. Most of the association information derives from the main effect test, but the intervention interaction tests have rather different P-values across these SNPs, with rs7705343 having nominally significant (P < 0.05) interactions with each of E-alone, DMQ, and CaD, while interactions in relation to rs4415084 are not significant for any of the interventions. Table 3 shows estimated intervention odds ratios and 95% confidence intervals as a function of the number of minor alleles of rs7705343 for each of the four interventions. The GG genotype is associated with lower intervention ORs for each of E-alone, DMQ, and CaD. Additional file 2 provides corresponding information with breast cancers classified according to estrogen receptor or progesterone receptor positivity. No clear variations by tumor receptor status were suggested, through statistical power for detecting moderate variations with tumor type is limited.
The majority (86%) of the case-control samples are from European-ancestry populations. In Additional files 3 and 4 we provide P-values for interaction between trial components and SNPs in the MRPS30 region, and the estimated intervention odds ratios and 95% confidence intervals as a function of the number of minor alleles of rs7705343 among women of European ancestry specifically. The patterns that we observe are quite similar to the overall patterns.
We also examined the joint associations of these FGFR2 and MRPS30 SNPs with hormonal and dietary intervention effects, using case-only analysis. Based on logistic regression applied to cases in DMQ, where the indicator for active treatment is regressed on genotypes of rs3750817 and rs7705343 together, both SNPs showed nominally significant interactions. The P-values for rs3750817 and rs7705343 were 0.0059 and 0.037. When E-alone was similarly considered, rs3750817 and rs7705343 had P-values of 0.053 and 0.043 in the joint interaction model.
The AUC was calculated from logistic regression analyses that included clinical trial randomization
Discussion
We evaluated the association between 4,988 SNPs and invasive breast cancer incidence in the WHI clinical trial through the use of a statistic that combines SNP main effect information with SNP by intervention interaction information for each of four randomized interventions. This view of the data provided a clear focus on two genomic regions, the FGFR2 region of chromosome 10 q, which has a very strong main effect along with suggestive evidence for interaction, and the MRPS30 region of chromosome 5 p, which shows evidence of a comparatively smaller main effect and suggestive evidence for interaction. The inclusion of the clinical trial interventions in this testing procedure leads to interest in subregions containing FGFR2 SNP rs3750817 and MRPS30 SNP rs7705343 that are some distance from their associated tagging SNPs, possibly suggesting more than one regulatory element in these non-coding genomic regions.
We have previously [9,10] discussed these data in relation to FGFR2. The eight MRPS30 SNPs considered here fall in a linkage disequilibrium region of approximately 230 kb from downstream of fibroblast growth factor 10 (FGF10) to downstream of MRPS30, with a minimum squared correlation among SNPs of 0.80 (Figure 1). FGF10/FGFR2 signaling [26][27][28][29] could be relevant to these associations, though there is a recombination hotspot between the FGF10 gene and the 5p12 SNPs studied here.
Our analyses suggest that interactions of these two SNPs with WHI clinical trial interventions lead to a detectable increase in the ability to distinguish breast cancer cases from controls. Note, however, that AUC values in this context may be optimistic in view of our procedure for identifying SNPs of interest. Moreover, since the interactions identified in the study have yet to be confirmed by replication studies, the increase in AUC detected here is of exploratory nature as well. Also note that AUCs estimated here tend to be somewhat low due to age matching in the case-control sample. When our combined test is separated into its constituents, one observes nominally significant evidence of interaction of MRPS30 SNP rs7705343 with three of the four WHI interventions. Given the manner in which we ranked SNPs, these analyses (Tables 2 and 3) should be regarded as exploratory and such interactions will need to be confirmed separately. Unfortunately, other clinical trial data are not available for this purpose, and confirmation in observational study settings will involve the challenge of reliable ascertainment of the relevant hormonal or dietary exposures, and will need to be carried out in a case-control rather than case-only model. Hence, quite large numbers of cases and controls will be needed, as may be accessible through cohort consortia.
It is interesting to see a significant interaction of rs7705343 with E-alone with the estimated intervention OR below 1.0 for the GG genotype, and an insignificant interaction of rs7705343 with E+P with the estimated intervention OR greater than 1 for the GG genotype. Few interactions with study subject characteristics have been suggested for E+P [12], with FGFR2 SNP rs3750817 as a possible exception [24]. In contrast, interactions with several subject characteristics have been identified for E-alone, including family history of breast cancer, benign breast disease [14], and again FGFR2 SNP rs3750817 [24]. A possible explanation is that the progestin in E+P tends to overwhelm the minor variations in hormone therapy hazard ratios that would otherwise occur, giving rise to a strong and fairly uniform risk elevation.
Study strengths include its nesting within the randomized controlled WHI clinical trial, implying randomization assignments that are known and that are statistically independent of genotype and the related ability to use case-only analyses for intervention testing. Other strengths of the study include the use of pre-diagnostic blood specimens, collected and stored according to a standardized protocol, and quality-controlled SNP genotyping.
A limitation of the study is that the average age at enrollment was 63 years in the WHI controlled trials, with many women well past menopause at enrollment.
We have reported, in combined clinical trials and observational studies analyses, higher breast cancer hazard ratios for E+P and E-alone among women who first use these preparations soon after the menopause, compared to those using them later [30,31]. Hence, the magnitude of the odds ratios shown here may be lower than would apply to typical hormone therapy users.
Conclusions
Simultaneous consideration of overall association and intervention interaction point to genomic regions in the vicinity of FGFR2 and MRPS30 genes as relevant to breast cancer risk among postmenopausal women. Moreover, subregions that were not otherwise the focus of interest, in the vicinity of SNPs rs3750817 and rs7705343, were identified as worthy of further study by virtue of suggestive interactions with hormonal and dietary interventions. These analyses represent an early step in assessing the role of genotype by 'environment' interactions to help explain familial breast cancer patterns, or as a contributor to risk discrimination.
Additional material
Additional file 1: Joint test of main and interaction effects.
Additional file 2: Table S1. Odds ratios for four clinical trial interventions by genotype of rs7705343 in the MRPS30 region according to tumor receptor status.
Additional file 3: Table S2. Significance levels (P-values) for testing interaction with WHI trial interventions among women with European ancestry for SNPs in the MRPS30 region.
Additional file 4: Table S3. Breast cancer odds ratio for WHI trial interventions among women of European ancestry by genotype of the MRPS30 SNP rs7705343.
Figure 1
1Pairwise r 2 for SNPs within the MRPS30 region in chromosome 5p12, where r is the allelic correlation between SNPs.
Abbreviations AUC: area under the receiver operating characteristic curve; CaD trial: calcium and vitamin D versus placebo supplementation component; DM trial: low-fat dietary modification versus usual diet component; DMQ: low-fat dietary modification trial in the subset of women having baseline percentage of energy from fat in the upper quartile; E-alone trial: estrogen versus placebo; E+P trial: estrogen plus progestin versus placebo; FDR: false discovery rate; FGF10: fibroblast growth factor 10; FGFR2: fibroblast growth factor receptor 2; MRPS30: mitochondrial ribosomal protein S30; SNP: single nucleotide polymorphism; WHI: Women's Health Initiative.
Table 1
1Top 20 SNPs identified by combined test for main effect and interaction with clinical trial interventionsRank, rank of SNPs based on combined test P-value; b Rs number, SNP identification (rs) number in dbSNP database; c MAF, minor allele frequency in the study population; d Allele, minor/major allele; e Combined test P-value, P-value based on the simultaneous test with 5 df; f Combined test FDR, FDR based on the simultaneous test with 5 df; g Main effect P-value, P-value based on main effect test only; h Main effect rank, rank of SNPs based on main effect P-value.Rank a Rs
number b
Chromosome Position MAF c Allele d Combined test
P-value e
Combined
test FDR f
Main effect test
P-value g
Main effect
test rank h
Gene
1
rs1219648
10q26
123336180 0.42
G/A
6.45E-09
3.21E-05
3.90E-10
1
FGFR2
2
rs2981579
10q26
123327325 0.44
A/G
7.76E-09
1.94E-05
2.78E-09
2
FGFR2
3
rs3750817
10q26
123322567 0.37
T/C
5.61E-08
9.32E-05
9.02E-08
5
FGFR2
4
rs11200014
10q26
123324920 0.41
A/G
1.08E-07
0.000135
3.40E-09
3
FGFR2
5
rs2420946
10q26
123341314 0.42
T/C
1.56E-07
0.000156
1.49E-08
4
FGFR2
6
rs2981582
10q26
123342307 0.41
A/G
5.25E-07
0.000437
9.99E-08
6
FGFR2
7
rs7705343
5p12
44915334 0.42
G/A
5.88E-05
0.0419
0.000355
11
MRPS30
8
rs13159598
5p12
44841683 0.42
G/A
0.000136
0.0846
0.000425
13
MRPS30
9
rs11746980
5p12
44935642 0.43
C/T
0.000240
0.133
0.000511
16
MRPS30
10
rs9790879
5p12
44813635 0.43
A/G
0.000244
0.122
0.000963
19
MRPS30
11
rs2330572
5p12
44776746 0.43
C/A
0.000294
0.133
0.00129
22
MRPS30
12
rs7555040
1p33
47641903 0.13
G/A
0.000336
0.140
0.002483
26
Unknown
13
rs4415084
5p12
44698272 0.43
T/C
0.000400
0.153
0.000436
14
MRPS30
14
rs994793
5p12
44779004 0.43
G/A
0.000417
0.148
0.00184
23
MRPS30
15
rs2218080
5p12
44750087 0.44
C/T
0.000446
0.148
0.00274
30
MRPS30
16
rs7795554
7p21
12159269 0.36
C/T
0.000498
0.155
0.00353
40
Unknown
17
rs7519783
1q32
198951680 0.27
G/A
0.000904
0.265
0.229
1160
Unknown
18
rs1499111
4q28
129691789 0.22
T/C
0.00115
0.318
0.0736
431
Unknown
19
rs719278
3q11
98887302 0.40
A/G
0.00122
0.320
0.238
1204
EPHA6
20
rs1232355
3q26
88073313 0.05
C/T
0.00132
0.329
0.179
942
Unknown
a
Table 2
2Significance levels (P-values) for testing interaction with WHI trial interventions for SNPs in the MRPS30 regionRs number a
Chromosome
Position
Minor/major allele
MAF b
OR c
p.main d
E-alone e
E+P f
DMQ g
CaD h
7705343
5p12
44915334
G/A
0.40
1.18
0.000355
0.043
0.863
0.042
0.046
13159598
5p12
44841683
G/A
0.41
1.17
0.000425
0.056
0.920
0.057
0.048
11746980
5p12
44813635
A/G
0.41
1.16
0.000511
0.064
0.790
0.043
0.095
9790879
5p12
44935642
C/T
0.41
1.17
0.000963
0.117
0.762
0.042
0.047
2330572
5p12
44776746
C/A
0.42
1.16
0.00129
0.042
0.880
0.043
0.106
4415084
5p12
44698272
T/C
0.41
1.17
0.000436
0.242
0.944
0.127
0.146
994793
5p12
44779004
G/A
0.42
1.15
0.00184
0.084
0.798
0.041
0.080
2218080
5p12
44750087
C/T
0.43
1.15
0.00274
0.273
0.933
0.025
0.069
a
Rs number, SNP identification (rs) number in dbSNP database; b MAF, minor allele frequency in the study population; c OR, estimated minor allele odds ratio
under additive allelic effects model; d p.main, significance level for SNP association with breast cancer in additive allele effects model; e E-alone, P-value for
dependence (interaction) of E-alone odds ratio on SNP from case-only analyses; f E+P and h CaD, corresponding interaction P-values for the other interventions;
g DMQ, interaction P-value for DM among women with baseline percentage energy from fat in the upper quartile. Entries in bold are interaction effects significant
at the nominal (0.05) level. WHI, Women's Health Initiative.
Table 3
3Breast cancer odds ratio for WHI trial interventions by genotype of MRPS30 SNP rs7705343 OR, estimated intervention odds ratio; b P-value, significance level for SNP interaction with clinical trial intervention. CI, confidence interval; WHI, Women's Health Initiative.SNP genotype
GG
GA
AA
Intervention
Number of cases
OR a
95% CI
OR a
95% CI
OR a
95% CI
P-value b
E-alone
247
0.484
(0.306, 0.766)
0.974
(0.684, 1.387)
0.969
(0.508, 1.846)
0.043
E+P
471
1.404
(1.003, 1.965)
1.248
(0.966, 1.613)
1.303
(0.858, 1.980)
0.863
DMQ
428
0.524
(0.360, 0.761)
0.862
(0.651, 1.141)
1.023
(0.643, 1.627)
0.042
CaD
1,049
0.763
(0.613, 0.951)
1.071
(0.902, 1.271)
1.049
(0.791, 1.391)
0.046
a
Huang et al. Genome Medicine 2011, 3:42 http://genomemedicine.com/content/3/6/42
AcknowledgementsDecisions concerning study design, data collection and analysis, interpretation of the results, the preparation of the manuscript, or the decision to submit the manuscript for publication resided with committees composed of WHI investigators that included NHLBI representatives. Program Office: (National Heart, Lung, and Blood Institute, Bethesda, MD, USA) Jacques Rossouw Competing interests RTC reports receiving consulting fees from AstraZeneca, Novartis, Pfizer, and Eli Lilly, lecture fees from AstraZeneca and Novartis, and grant support from Amgen. No other potential conflict of interest relevant to this article was reported.Authors' contributionsAll authors were involved in development and/or critical review and revision of the manuscript. Additionally, DB, DH, DC, and EB had primary responsibility for project genotyping; YH, DH and RP had primary responsibility for data analysis; RC, JR, AM, TR and RP had responsibility for clinical data; and DB, UP and RP had primary administrative responsibility for this research project.Submit your next manuscript to BioMed
Finding the missing heritability of complex diseases. T A Manolio, F S Collins, N J Cox, D B Goldstein, L A Hindorff, D J Hunter, M I Mccarthy, E M Ramos, L R Cardon, A Chakravarti, J H Cho, A E Guttmacher, A Kong, L Kruglyak, E Mardis, C N Rotimi, M Slatkin, D Valle, A S Whittemore, M Boehnke, A G Clark, E E Eichler, G Gibson, J L Haines, Tfc Mackay, S A Mccarroll, P M Visscher, Nature. 461Manolio TA, Collins FS, Cox NJ, Goldstein DB, Hindorff LA, Hunter DJ, McCarthy MI, Ramos EM, Cardon LR, Chakravarti A, Cho JH, Guttmacher AE, Kong A, Kruglyak L, Mardis E, Rotimi CN, Slatkin M, Valle D, Whittemore AS, Boehnke M, Clark AG, Eichler EE, Gibson G, Haines JL, Mackay TFC, McCarroll SA, Visscher PM: Finding the missing heritability of complex diseases. Nature 2009, 461:747-753.
Polygenes, risk prediction, and targeted prevention of breast cancer. Pdp Pharoah, A C Antoniou, D F Easton, Baj Ponder, N Engl J Med. 358Pharoah PDP, Antoniou AC, Easton DF, Ponder BAJ: Polygenes, risk prediction, and targeted prevention of breast cancer. N Engl J Med 2008, 358:2796-2803.
Performance of common genetic variants in breast-cancer risk models. S Wacholder, P Hartge, R Prentice, M Garcia-Closas, H S Feigelson, W R Diver, M J Thun, D G Cox, S E Hankinson, P Kraft, B Rosner, C D Berg, L A Brinton, J Lissowska, M E Sherman, R Chlebowski, C Kooperberg, R D Jackson, D W Buckman, P Hui, R Pfeiffer, K B Jacobs, G D Thomas, R N Hoover, M H Gail, S J Chanock, D J Hunter, N Engl J Med. 362Wacholder S, Hartge P, Prentice R, Garcia-Closas M, Feigelson HS, Diver WR, Thun MJ, Cox DG, Hankinson SE, Kraft P, Rosner B, Berg CD, Brinton LA, Lissowska J, Sherman ME, Chlebowski R, Kooperberg C, Jackson RD, Buckman DW, Hui P, Pfeiffer R, Jacobs KB, Thomas GD, Hoover RN, Gail MH, Chanock SJ, Hunter DJ: Performance of common genetic variants in breast-cancer risk models. N Engl J Med 2010, 362:986-993.
A tiny step closer to personalized risk prediction for breast cancer. P Devilee, M A Rookus, N Engl J Med. 362Devilee P, Rookus MA: A tiny step closer to personalized risk prediction for breast cancer. N Engl J Med 2010, 362:1043-1045.
Biomarker-calibrated energy and protein consumption and increased cancer risk among postmenopausal women. R L Prentice, P A Shaw, S A Bingham, S A Beresford, B Caan, M L Neuhouser, R E Patterson, M L Stefanick, S Satterfield, C A Thomson, L Snetselaar, A Thomas, L F Tinker, Am J Epidemiol. 169Prentice RL, Shaw PA, Bingham SA, Beresford SA, Caan B, Neuhouser ML, Patterson RE, Stefanick ML, Satterfield S, Thomson CA, Snetselaar L, Thomas A, Tinker LF: Biomarker-calibrated energy and protein consumption and increased cancer risk among postmenopausal women. Am J Epidemiol 2009, 169:977-989.
On estimating HLA/disease association with application to a study of aplastic anemia. S G Self, G Longton, K J Kopecky, K Y Liang, Biometrics. 47Self SG, Longton G, Kopecky KJ, Liang KY: On estimating HLA/disease association with application to a study of aplastic anemia. Biometrics 1991, 47:53-61.
Non-hierarchical logistic models and case-only designs for assessing susceptibility in population-based case-control studies. W W Piegorsch, C R Weinberg, J A Taylor, Stat Med. 13Piegorsch WW, Weinberg CR, Taylor JA: Non-hierarchical logistic models and case-only designs for assessing susceptibility in population-based case-control studies. Stat Med 1994, 13:153-162.
Case-only analysis of treatment-covariate iterations in clinical trials. E Vittinghoff, D C Bauer, Biometrics. 62Vittinghoff E, Bauer DC: Case-only analysis of treatment-covariate iterations in clinical trials. Biometrics 2006, 62:769-776.
The Women's Health Initiative Study Group: Design of the Women's Health Initiative clinical trial and observational study. Control Clin Trials. 19The Women's Health Initiative Study Group: Design of the Women's Health Initiative clinical trial and observational study. Control Clin Trials 1998, 19:61-109.
The Women's Health Initiative: lessons learned. Ann Rev Public Health. R L Prentice, G L Anderson, 29Prentice RL, Anderson GL: The Women's Health Initiative: lessons learned. Ann Rev Public Health 2007, 29:131-150.
Writing Group for the Women's Health Initiative Investigators: Risks and benefits of estrogen plus progestin in healthy postmenopausal women: principal results from the Women's Health Initiative randomized controlled trial. J E Rossouw, G L Anderson, R L Prentice, A Z Lacroix, C Kooperberg, M L Stefanick, R D Jackson, S A Beresford, B V Howard, K C Johnson, J M Kotchen, J Ockene, JAMA. 288Rossouw JE, Anderson GL, Prentice RL, LaCroix AZ, Kooperberg C, Stefanick ML, Jackson RD, Beresford SA, Howard BV, Johnson KC, Kotchen JM, Ockene J, Writing Group for the Women's Health Initiative Investigators: Risks and benefits of estrogen plus progestin in healthy postmenopausal women: principal results from the Women's Health Initiative randomized controlled trial. JAMA 2002, 288:321-333.
Influence of estrogen plus progestin on breast cancer and mammography in healthy postmenopausal women: the Women's Health Initiative randomized trial. R T Chlebowski, S L Hendrix, R D Langer, M L Stefanick, M Gass, D Lane, R J Rodabough, M A Gilligan, M G Cyr, C A Thomson, J Khandekar, H Petrovitch, A Mctiernan, Investigators, JAMA. 289Chlebowski RT, Hendrix SL, Langer RD, Stefanick ML, Gass M, Lane D, Rodabough RJ, Gilligan MA, Cyr MG, Thomson CA, Khandekar J, Petrovitch H, McTiernan A, WHI Investigators: Influence of estrogen plus progestin on breast cancer and mammography in healthy postmenopausal women: the Women's Health Initiative randomized trial. JAMA 2003, 289:3243-3253.
. G L Anderson, M Limacher, A R Assaf, T Bassford, S A Beresford, H Black, D Bonds, R Brunner, R Brzyski, B Caan, R Chlebowski, D Curb, M Gass, J Hays, G Heiss, S Hendrix, B V Howard, J Hsia, A Hubbell, R Jackson, Huang, Genome Medicine. 342Anderson GL, Limacher M, Assaf AR, Bassford T, Beresford SA, Black H, Bonds D, Brunner R, Brzyski R, Caan B, Chlebowski R, Curb D, Gass M, Hays J, Heiss G, Hendrix S, Howard BV, Hsia J, Hubbell A, Jackson R, Huang et al. Genome Medicine 2011, 3:42
Women's Health Initiative Steering Committee, et al: Effects of conjugated equine estrogen in postmenopausal women with hysterectomy: the Women's Health Initiative randomized controlled trial. K C Johnson, H Judd, J M Kotchen, L Kuller, A Z Lacroix, D Lane, R D Langer, N Lasser, C E Lewis, J Manson, JAMA. 291Johnson KC, Judd H, Kotchen JM, Kuller L, LaCroix AZ, Lane D, Langer RD, Lasser N, Lewis CE, Manson J, Women's Health Initiative Steering Committee, et al: Effects of conjugated equine estrogen in postmenopausal women with hysterectomy: the Women's Health Initiative randomized controlled trial. JAMA 2004, 291:1701-1712.
Effects of conjugated equine estrogens on breast cancer and mammography screening in postmenopausal women with hysterectomy. M L Stefanick, G L Anderson, K L Margolis, S L Hendrix, R J Rodabough, E D Paskett, D S Lane, F A Hubbell, A R Assaf, G E Sarto, R S Schenken, S Yasmeen, L Lessin, R T Chlebowski, Investigators, JAMA. 295Stefanick ML, Anderson GL, Margolis KL, Hendrix SL, Rodabough RJ, Paskett ED, Lane DS, Hubbell FA, Assaf AR, Sarto GE, Schenken RS, Yasmeen S, Lessin L, Chlebowski RT, WHI Investigators: Effects of conjugated equine estrogens on breast cancer and mammography screening in postmenopausal women with hysterectomy. JAMA 2006, 295:1647-1657.
Low-fat dietary pattern and risk of invasive breast cancer: the Women's Health Initiative randomized controlled dietary modification trial. R L Prentice, B Caan, R T Chlebowski, R Patterson, L H Kuller, J K Ockene, K L Margolis, M C Limacher, J E Manson, L M Parker, E Paskett, L Phillips, J Robbins, J E Rossouw, G E Sarto, J M Shikany, M L Stefanick, C A Thomson, L Van Horn, M Z Vitolins, J Wactawski-Wende, R B Wallace, S Wassertheil-Smoller, E Whitlock, K Yano, L Adams-Campbell, G L Anderson, A R Assaf, S A Beresford, H R Black, JAMA. 295Prentice RL, Caan B, Chlebowski RT, Patterson R, Kuller LH, Ockene JK, Margolis KL, Limacher MC, Manson JE, Parker LM, Paskett E, Phillips L, Robbins J, Rossouw JE, Sarto GE, Shikany JM, Stefanick ML, Thomson CA, Van Horn L, Vitolins MZ, Wactawski-Wende J, Wallace RB, Wassertheil- Smoller S, Whitlock E, Yano K, Adams-Campbell L, Anderson GL, Assaf AR, Beresford SA, Black HR, et al: Low-fat dietary pattern and risk of invasive breast cancer: the Women's Health Initiative randomized controlled dietary modification trial. JAMA 2006, 295:629-642.
Women's Health Initiative Investigators: Calcium plus vitamin D supplementation and the risk of breast cancer. R T Chlebowski, K C Johnson, C Kooperberg, M Pettinger, J Wactawski-Wende, T Rohan, J Rossouw, D Lane, M J O'sullivan, S Yasmeen, R A Hiatt, J M Shikany, M Vitolins, J Khandekar, F A Hubbell, J Natl Cancer Inst. 100Chlebowski RT, Johnson KC, Kooperberg C, Pettinger M, Wactawski- Wende J, Rohan T, Rossouw J, Lane D, O'Sullivan MJ, Yasmeen S, Hiatt RA, Shikany JM, Vitolins M, Khandekar J, Hubbell FA, Women's Health Initiative Investigators: Calcium plus vitamin D supplementation and the risk of breast cancer. J Natl Cancer Inst 2008, 100:1581-1591.
A genome-wide association study identifies alleles in FGFR2 associated with risk of sporadic postmenopausal breast cancer. D J Hunter, P Kraft, K B Jacobs, D G Cox, M Yeager, S E Hankinson, S Wacholder, Z Wang, R Welch, A Hutchinson, J Wang, K Yu, N Chatterjee, N Orr, W C Willett, G A Colditz, R G Ziegler, C D Berg, S S Buys, C A Mccarty, H S Feigelson, E E Calle, M J Thun, R B Hayes, M Tucker, D S Gerhard, J F FraumeniJr, R N Hoover, G Thomas, S J Chanock, Nat Genet. 39Hunter DJ, Kraft P, Jacobs KB, Cox DG, Yeager M, Hankinson SE, Wacholder S, Wang Z, Welch R, Hutchinson A, Wang J, Yu K, Chatterjee N, Orr N, Willett WC, Colditz GA, Ziegler RG, Berg CD, Buys SS, McCarty CA, Feigelson HS, Calle EE, Thun MJ, Hayes RB, Tucker M, Gerhard DS, Fraumeni JF Jr, Hoover RN, Thomas G, Chanock SJ: A genome-wide association study identifies alleles in FGFR2 associated with risk of sporadic postmenopausal breast cancer. Nat Genet 2007, 39:870-874.
Genome-wide association study identifies novel breast cancer susceptibility loci. D F Easton, K A Pooley, A M Dunning, P D Pharoah, D Thompson, D G Ballinger, J P Struewing, J Morrison, H Field, R Luben, N Wareham, S Ahmed, C S Healey, R Bowman, K B Meyer, C A Haiman, L K Kolonel, B E Henderson, Le Marchand, L Brennan, P Sangrajrang, S Gaborieau, V Odefrey, F Shen, C Y Wu, P E Wang, H C Eccles, D Evans, D G Peto, J , Nature. 447Easton DF, Pooley KA, Dunning AM, Pharoah PD, Thompson D, Ballinger DG, Struewing JP, Morrison J, Field H, Luben R, Wareham N, Ahmed S, Healey CS, Bowman R, SEARCH collaborators, Meyer KB, Haiman CA, Kolonel LK, Henderson BE, Le Marchand L, Brennan P, Sangrajrang S, Gaborieau V, Odefrey F, Shen CY, Wu PE, Wang HC, Eccles D, Evans DG, Peto J, et al: Genome-wide association study identifies novel breast cancer susceptibility loci. Nature 2007, 447:1087-1093.
The women's health initiative recruitment methods and results. J L Hays, J R Hunt, F A Hubbell, G L Anderson, M Limacher, C Allen, J E Rossouw, Ann Epidmiol. 139Hays JL, Hunt JR, Hubbell FA, Anderson GL, Limacher M, Allen C, Rossouw JE: The women's health initiative recruitment methods and results. Ann Epidmiol 2002, 13(9 Supp):S18-S77.
Cholinergic nicotinic receptor genes implicated in a nicotine dependence association study targeting 348 candidate genes with 3713 SNPs. S S Saccone, A L Hinrich, N L Saccone, G A Chase, K Konvicka, P A Madden, N Breslau, E O Johnson, D Hatsukami, O Pomerleau, G E Swan, A M Goate, J Rutter, S Bertelsen, L Fox, D Fugman, N G Martin, G W Montgomery, J C Wang, D G Ballinger, J P Rice, L J Bierut, Hum Mol Genet. 16Saccone SS, Hinrich AL, Saccone NL, Chase GA, Konvicka K, Madden PA, Breslau N, Johnson EO, Hatsukami D, Pomerleau O, Swan GE, Goate AM, Rutter J, Bertelsen S, Fox L, Fugman D, Martin NG, Montgomery GW, Wang JC, Ballinger DG, Rice JP, Bierut LJ: Cholinergic nicotinic receptor genes implicated in a nicotine dependence association study targeting 348 candidate genes with 3713 SNPs. Hum Mol Genet 2006, 16:36-49.
Weighing the risks and benefits of tamoxifen treatment for preventing breast cancer. M H Gail, J P Constantino, J Bryant, R Croyle, L Freedman, K Helzlsouer, V Vogel, J Natl Cancer Inst. 91Gail MH, Constantino JP, Bryant J, Croyle R, Freedman L, Helzlsouer K, Vogel V: Weighing the risks and benefits of tamoxifen treatment for preventing breast cancer. J Natl Cancer Inst 1999, 91:1829-1846.
Principal component analysis corrects for stratification in genome-wide association studies. A L Price, N J Patterson, R M Plenge, M E Weinblatt, N A Shadick, D Reich, Nat Genet. 38Price AL, Patterson NJ, Plenge RM, Weinblatt ME, Shadick NA, Reich D: Principal component analysis corrects for stratification in genome-wide association studies. Nat Genet 2006, 38:904-909.
On Two-stage Hypothesis Testing Procedures via Asymptotically Independent Statistics University of Washington Biostat Working Paper Series 366. J Dai, M Leblanc, C Kooperberg, R L Prentice, Dai J, LeBlanc M, Kooperberg C, Prentice RL: On Two-stage Hypothesis Testing Procedures via Asymptotically Independent Statistics University of Washington Biostat Working Paper Series 366; 2010 [http://www.bepress. com/uwbiostat/].
Variation in the FGFR2 gene and the effects of postmenopausal hormone therapy on invasive breast cancer. R L Prentice, Y Huang, D A Hinds, U Peters, M Pettinger, D R Cox, E Beilharz, R T Chlebowski, J E Rossouw, B Caan, D G Ballinger, Cancer Epidemiol Biomarkers Prev. 18Prentice RL, Huang Y, Hinds DA, Peters U, Pettinger M, Cox DR, Beilharz E, Chlebowski RT, Rossouw JE, Caan B, Ballinger DG: Variation in the FGFR2 gene and the effects of postmenopausal hormone therapy on invasive breast cancer. Cancer Epidemiol Biomarkers Prev 2009, 18:3079-3085.
Variation in the FGFR2 gene and the effects of a low-fat dietary pattern on invasive breast cancer. R L Prentice, Y Huang, D A Hinds, U Peters, D R Cox, E Beilharz, R T Chlebowski, J E Rossouw, B Caan, D G Ballinger, Cancer Epidemiol Biomarkers Prev. 19Prentice RL, Huang Y, Hinds DA, Peters U, Cox DR, Beilharz E, Chlebowski RT, Rossouw JE, Caan B, Ballinger DG: Variation in the FGFR2 gene and the effects of a low-fat dietary pattern on invasive breast cancer. Cancer Epidemiol Biomarkers Prev 2010, 19:74-79.
FGF10 is an oncogene activated by MMTV insertional mutagenesis in mouse mammary tumors and overexpressed in a subset of human breast carcinomas. V Theodorou, M Boer, B Weigelt, J Jonkers, M Van Der Valk, J Hilkens, Oncogene. 23Theodorou V, Boer M, Weigelt B, Jonkers J, van der Valk M, Hilkens J: FGF10 is an oncogene activated by MMTV insertional mutagenesis in mouse mammary tumors and overexpressed in a subset of human breast carcinomas. Oncogene 2004, 23:6047-6055.
Cancer genomics and genetics of FGFR2 (Review). M Katoh, Int J Oncol. 33Katoh M: Cancer genomics and genetics of FGFR2 (Review). Int J Oncol 2008, 33:233-237.
Identification of FGF10 targets in the embryonic lung epithelium during bud morphogenesis. J Lü, K I Izvolsky, J Qian, W V Cardoso, J Biol Chem. 280Lü J, Izvolsky KI, Qian J, Cardoso WV: Identification of FGF10 targets in the embryonic lung epithelium during bud morphogenesis. J Biol Chem 2005, 280:4834-4841.
FGF10/FGFR2 signal induces cell migration and invasion in pancreatic cancer. S Nomura, H Yoshitomi, S Takano, T Shida, S Kobayashi, M Ohtsuka, F Kimura, H Shimizu, H Yoshidome, A Kato, M Miyazaki, Br J Cancer. 99Nomura S, Yoshitomi H, Takano S, Shida T, Kobayashi S, Ohtsuka M, Kimura F, Shimizu H, Yoshidome H, Kato A, Miyazaki M: FGF10/FGFR2 signal induces cell migration and invasion in pancreatic cancer. Br J Cancer 2008, 99:305-313.
Conjugated equine estrogens and breast cancer risk in the Women's Health Initiative clinical trial and observational study. R L Prentice, R T Chlebowski, M L Stefanick, J E Manson, R D Langer, M Pettinger, S L Hendrix, F A Hubbell, C Kooperberg, L H Kuller, D S Lane, A Mctiernan, M J O'sullivan, J E Rossouw, G L Anderson, Am J Epidemiol. 167Prentice RL, Chlebowski RT, Stefanick ML, Manson JE, Langer RD, Pettinger M, Hendrix SL, Hubbell FA, Kooperberg C, Kuller LH, Lane DS, McTiernan A, O'Sullivan MJ, Rossouw JE, Anderson GL: Conjugated equine estrogens and breast cancer risk in the Women's Health Initiative clinical trial and observational study. Am J Epidemiol 2008, 167:1407-1415.
Estrogen plus progestin therapy and breast cancer in recently postmenopausal women. R L Prentice, R T Chlebowski, M L Stefanick, J E Manson, M Pettinger, S L Hendrix, F A Hubbell, C Kooperberg, L H Kuller, D S Lane, A Mctiernan, O' Jo, M Sullivan, J E Rossouw, G L Anderson, 10.1186/gm258Am J Epidemiol. 167Prentice RL, Chlebowski RT, Stefanick ML, Manson JE, Pettinger M, Hendrix SL, Hubbell FA, Kooperberg C, Kuller LH, Lane DS, McTiernan A, Jo O'Sullivan M, Rossouw JE, Anderson GL: Estrogen plus progestin therapy and breast cancer in recently postmenopausal women. Am J Epidemiol 2008, 167:1207-1216. doi:10.1186/gm258
Genetic variants in the MRPS30 region and postmenopausal breast cancer risk. Huang, Genome Medicine. 342Cite this article asCite this article as: Huang et al.: Genetic variants in the MRPS30 region and postmenopausal breast cancer risk. Genome Medicine 2011 3:42.
| Evaluation of CYP17A1 and CYP1B1 polymorphisms in male breast cancer risk |
Introduction
Colorectal cancer (CRC) is the third most common type of cancer in the western world and is responsible for approximately 50,000 deaths per year [1]. Family-based studies have suggested that the disease has a significant genetic component, with a large twin study conducted in Scandinavian countries suggesting that as many as 35% of colorectal cancers may be due to inherited susceptibility [2]. However, the recognized Mendelian predisposition syndromes, such as hereditary nonpolyposis colorectal cancer and adenomatus polyposis coli, account for less than 5% of the overall incidence of colorectal cancer [3]. Therefore, common, low-penetrance polymorphisms may confer a substantial part of the genetic risk, but given that the estimated effect of each polymorphism is expected to be small, large studies are necessary to reduce the size-related uncertainty of effects and provide robust evidence of association.
Specific components of the western diet including meat consumption (particularly red and/or well-done meat) and dietary fat (particularly polyunsaturated fatty acids) have been proposed as risk factors which influence susceptibility to colorectal cancer [4][5]. It has been suggested that this may be due to carcinogenic polycyclic aromatic hydrocarbons (PAH) and heterocyclic amines (HCA) produced when meat is cooked at high temperatures. Data from both in vitro and in vivo studies suggest that exposure to PAH significantly increase colorectal cancer risk [6,7]. Cytochrome P450 2C9 (CYP2C9) is a key P450 enzyme which plays an important role in the metabolism and bioactivation of many dietary and environmental mutagens [8]. A variety of studies have demonstrated that the metabolism of PAH and other procarcinogens through CYP2C9 may well lead to the activation of the carcinogenic compounds [9,10]. CYP2C9 enzyme activity in man is modulated by genetic polymorphisms. The variant alleles CYP2C9*2 (R144C) and *3 (I359L) produce slow-metabolizing enzymes compared with wild-type CYP2C9*1 [11,12]. Hence, CYP2C9 gene may be a good candidate for genetics studies on CRC.
Over the past few years, considerable efforts have been devoted to exploring the relationships between the CYP2C9 polymorphisms and CRC risk among various populations. But the results are not always consistent. There are several possible explanations for this discordance, such as small sample size, ethnic background, uncorrected multiple hypothesis testing, and publication bias. Meta-analysis is a statistical procedure for combining the results of several studies to produce a single estimate of the major effect with enhanced precision. It has become important in cancer genetics because of rapid increases in the number and size of datasets. The aim of the present study is to perform a comprehensive meta-analysis to evaluate the association between the CYP2C9 *2 and *3 polymorphism and CRC.
Materials and Methods
Literature search strategy
We searched the PubMed, Embase, and ISI Web of Science for all articles on the association between CYP2C9 polymorphisms and CRC risk published before the end of May 2012. The following keywords were used: ''colorectal'' or ''colo*,'' ''cancer'' or ''tumor'' or ''carcinoma,'' and ''CYP2C9'' or ''cytochrome P450 2C9''. Additional studies were identified by a hand search of references of original studies and review articles on the association between the CYP2C9 polymorphism and CRC. No language restrictions were applied.
Inclusion and exclusion criteria
We reviewed abstracts of all citations and retrieved studies. The following criteria were used to include published studies: (i) identification of colorectal cancer cases was confirmed histologically or pathologically, (ii) case-control or cohort studies to evaluate the association between CYP2C9 *2 or *3 polymorphism and CRC risk and (iii) genotype distribution information in cases and controls or odds ratio (OR) with its 95% confidence interval (CI) and P-value. Major reasons for exclusion of studies were (i) review, or editorial, or comment; (ii) duplicated studies; (iii) no sufficient data were reported.
Data abstraction
Two investigators extracted information from all eligible publications independently according to the inclusion criteria listed above. Disagreements were resolved by discussion with coauthors. For each included study, the following information was extracted from each report according to a fixed protocol: first author's surname, publication year, definition and numbers of cases and controls, diagnostic criterion, frequency of genotypes, source of controls, gender, age, Hardy-Weinberg equilibrium (HWE) status, ethnicity and genotyping method.
Statistical methods
We first assessed HWE in the controls for each study using goodness-of-fit test (chi-square or Fisher's exact test) and a P,0.05 was considered as significant disequilibrium. The strength of the association between CRC and the CYP2C9 *2 and *3 polymorphism was estimated using ORs, with the corresponding 95% CIs. For the *2 polymorphism, we first estimated the risks of the *2 heterozygous and *2 homozygote genotypes on CRC, compared with the wild-type *1 homozygote. The risk of *2 carrier versus *1 on cancers was then evaluated in dominant model. The same evaluation was carried out for the *3 polymorphism.
Both the Cochran's Q statistic [13] to test for heterogeneity and the I 2 statistic to quantify the proportion of the total variation due to heterogeneity [14] were calculated. Random-effects and fixedeffect summary measures were calculated as inverse-varianceweighted average of the log odds ratio. The results of randomeffects summary were reported in the text because it takes into account the variation between studies. The significance of the overall OR was determined by the Z-test. Subsidiary analyses included subgroup analyses or random-effects meta-regression with restricted maximum likelihood [15]. Ethnicity (Caucasian vs Asian), HWE status among control (yes or no), diagnostic criterion (ICD-9 vs. others), sample size ($500 cases or ,500 cases) and sex were pre-specified as characteristics for the assessment of heterogeneity. Ethnicity, sample size, HWE status, and sex distribution in cases and controls were analyzed as covariates in meta-regression.
In order to assess the stability of the results, one-way sensitivity analyses were performed by removing each individual study in turn from the total and re-analyzing the remainder. Egger's regression test and funnel-plot analysis were used to assess publication bias [16,17]. Analyses were performed using the STATA software version 10.0 (Stata Corporation, College Station, TX, USA). All P values are two-sided at the P = 0.05 level.
Results
Characteristics of studies
There were 63 papers relevant to the searching terms. The study selection process is shown in Figure S1. A total of 13 studies examined the association between the CYP2C9 polymorphism and CRC were included in the current meta-analysis [18][19][20][21][22][23][24][25][26][27][28][29][30]. Among them, 12 studies were identified for the CYP2C9 *2 polymorphism, including a total of 9154 cases and 10900 controls, and for the *3 polymorphism 12 studies were identified covering a total of 7701 cases and 9287 controls. Characteristics of studies included in the current meta-analysis are presented in Table 1.
CYP2C*2 and CRC risk
The pooled estimate for CRC risk of CYP2C9 *2 polymorphism is shown in Figureô 1. The comparison between CRC cases and controls was investigated in 15 data sets. Overall, there was no significant heterogeneity among the studies concerning CRC risk of CYP2C9 *2 polymorphism (P.0.05). The combined OR from the fixed-effects model was not significant with OR of 0.94 (95% CI: 0.87-1.03, P = 0.18) for the variant carriers. Similarly, no significant associations were found for heterozygous (OR = 0.92, 95% CI: 0.85-1.00, P = 0.06) and homozygous (OR = 1.19, 95% CI: 0.98-1.45, P = 0.07) when compared with wild genotype. Subgroup analysis for CRC risk of CYP2C9 *2 was also performed to explore the sources of heterogeneity. In the subgroup analyses by ethnicity, sample size, HWE status, diagnostic criteria and sex, no significant results were found in almost all genetic models ( Table 2).
Although the formal test for heterogeneity was not significant, we conducted meta-regression as there were also grounds for considering the ethnicity, sample size, HWE status, and sex distribution among cases and controls as potential sources of heterogeneity. However, the meta-regression showed that none of
CYP2C9 *3 and CRC risk
Overall, the variant genotypes of the CYP2C9 *3 were not associated with CRC risk when compared with the wild-type *1 homozygote (*3 heterozygous: OR = 1.00, 95% CI = 0.86-1.17, P = 0.99; *3 homozygous: OR = 0.87, 95% CI = 0.43-1.74, P = 0.69). Similarly, no associations were observed in the dominant genetic model (OR = 1.00, 95% CI = 0.86-1.16, P = 0.99; Figureô 2). On the basis of the potential underestimation of the true effect of the polymorphism on the CRC risk, we stratified these studies according to ethnicity, sample size, HWE status, diagnostic criteria and sex. In stratified analyses, the variant genotypes had no significant relationship with CRC in all of the subgroups, compared with wild-type. Similar results were observed in the dominant genetic model (Table 3) In meta-regression analysis, sample size (p = 0.93), gender of cases (P = 0.34) and controls (P = 0.37), diagnostic criteria (P = 0.91) and the status of Hardy-Weinberg equilibrium (p = 0.05) did not significantly explained such heterogeneity. By contrast, ethnicity (P = 0.001) were significantly correlated with the magnitude of the genetic effect.
Sensitivity analyses and Publication bias
A single study involved in the meta-analysis was deleted each time to reflect the influence of the individual dataset to the pooled ORs, and the corresponding pooled ORs were not qualitatively altered, suggesting that the results of this meta-analysis are stable ( Figure S2 and S3). In addition, when excluding the studies that were not in HWE, the results were persistent and robust (Table 2 and 3). The shape of the funnel plot did not indicate any evidence of obvious asymmetry ( Figure S4 and S5), thus suggesting no publication bias among the studies included. The statistical results still did not show preferential publication of positive findings in smaller studies (Egger test, P = 0.96 for *2 carrier; P = 0.95 for *3 carrier).
Discussion
A number of factors predict CRC; however, detailed mechanisms of CRC remain a matter of speculation. However, accumulative evidences have suggested an important role for genetics in determining risk for CRC [2]. Association studies are appropriate for searching susceptibility genes involved in CRC [31]. CYP2C9 is a key P450 enzyme implicated in the metabolism of exogenous and endogenous substrates. A variety of studies have demonstrated that the metabolism of polycyclic aromatic hydro- carbons and other procarcinogens through CYP2C9 may well lead to the activation of the carcinogenic compounds [19,27]. CYP2C9 is a polymorphic gene in the human population; the genetic variations have been studied with respect to a variety of cancer types. In recent years, a number of molecular epidemiologic studies have been conducted to evaluate the role of *2 and *3 polymorphisms in the CYP2C9 gene on CRC risk; however, the results remain conflicting rather than conclusive. As a powerful statistical method, meta-analysis can provide a quantitative approach for pooling the results of different research on the same topic, and thus a quantitative assessment of association between CYP2C9 polymorphism and CRC risk was of great value. The present meta-analysis, including 9463 cases and 11416 controls from 13 case-control studies, explored the association between the *2 and *3 polymorphism of CYP2C9 gene and CRC risk. To the best of our knowledge, this is the first comprehensive meta-analysis concerning the relationship between CYP2C9 polymorphism and CRC susceptibility. Overall, we did not find any significant association between CYP2C9 *2, *3 polymorphism and CRC susceptibility. In the stratified analysis by ethnicity, sample size, HWE status, diagnostic criteria and sex, significant associations were still not observed in all genetic models. CYP2C9 genotype was not found to be a determinant of colorectal cancer susceptibility according to the results of present meta-analysis.
Although CYP2C9 is active in the metabolism of several commonly prescribed drugs, including warfarin, phenytoin and non-steroidal anti-inflammatory drugs (NSAIDs) [32], its role in xenobiotic and carcinogen metabolism is less well defined, although it has been shown to metabolize the carcinogen benzo[a]pyrene (B[a]P) to the highly mutagenic metabolite B[a]P-7,8diol-9,10-epoxide [33]. CYP2C9*3 encodes a protein with approximately 5-30% of the activity of the common reference allele [34], and it could therefore be hypothesized that CYP2C9*3 allele carriers have reduced carcinogen activating ability and thus reduced disease risk. However, the increased CRC risk associated with CYP2C9*2 genotype in earlier studies suggests that the enzyme may play a more important role in detoxification of carcinogens.
Epidemiological data indicated the use of NSAID is inversely associated with the risk of developing colorectal cancer [35]. Metabolism of NSAIDs involves oxidation by CYP enzymes and/ or conjugation, particularly glucuronidation by phase II enzymes. The major enzymes involved are CYP2C9 and UGT1A6, both enzymes have variant forms [26]. The modulation of chemoprevention of NSAIDs on CRC risk by the genotype of CYP2C9 and UGT1A6 has been reported among Caucasian population [26,36]. Recently, the interaction between UGT1A6 and CYP2C9, aspirin or ibuprofen use, and CRC risk were determined in 2295 CRC cases and 2903 controls. Their data showed the enhanced effect of slower-metabolizing CYP2C9 variants on the chemopreventive activity of ibuprofen against CRC, and CYP variants were more effective in individuals with wild-type rather than variant UGT1A6 [25]. Therefore, the contribution of gene -gene interaction as well as gene -medication interaction should be considered in future study in elucidating the contribution of CYP2C9 polymorphism to CRC etiology.
Although there is no association between CYP2C9 *2, *3 polymorphism and the risk of CRC, the associations between CYP2C9 polymorphism and CRC risk might be modified when exposed to some factors such as tobacco smoking [29]. Chan et al [29] reported that CYP2C9 genotypes modified the CRC risk associated with smoking status. Women with variant genotypes who smoked .20 pack-years had a 2.5-fold greater odds of adenoma compared with women with wild-type genotypes who smoked #20 pack-years. Because of limited data in primary studies, we could not quantitatively analyze the modification Table 3. Meta-analysis of the CYP2C9 *3 polymorphism on colorectal cancer susceptibility. effects of smoking on the relationships between CYP2C9 polymorphisms and CRC risk.
Limitations also inevitably existed in this meta-analysis. Firstly, most studies were conducted in Caucasian population. Therefore, it could be under powered to detected the interaction among Asian population in subgroup analysis. Hence, further studies including a wider spectrum of subjects should be carried to investigate the role of these variants in different populations. Secondly, our results were based on unadjusted estimates since we did not have original data. Therefore, we were not able to take into account other factors like obesity, inflammation, aspirin/NSAID use, vitamin D and vitamin E intake, which may modify the risk estimates, as reported in previous publications. Thus, assessment of the association between CYP2C9 polymorphism and these covariates and CRC is needed in order to determine clearly the impact of CYP2C9 polymorphism on the etiology of CRC. Thirdly, metaanalysis is a type of retrospective study, and the recall and selection bias might exist. In spite of these, our meta-analysis also had some advantages. First, substantial numbers of cases and controls were pooled from different studies, which significantly increased the statistical power of the analysis. Second, no publication bias was detected; indicating that the whole pooled result may be unbiased.
In conclusion, this meta-analysis evaluates the relation-ship between genetic polymorphism and CRC risk and reveals that CYP2C9 *2 and *3 polymorphism is not associated with altered susceptibility to CRC. As studies among other populations are currently limited, further studies including a wider spectrum of subjects should be carried to investigate the role of these variant in these populations, which should lead to better, comprehensive understanding of the association between the CYP2C9 polymorphism and CRC.
This meta-analysis is guided by the PRISMA statement (Checklist S1). Figure S1 The association study selection process. (TIF) Figure S2 Result of sensitivity analyses for CYP2C9*2 carrier and CRC risk. (TIF) Figure S3 Result of sensitivity analyses for CYP2C9*3 carrier and CRC risk. (TIF) Figure S4 Funnel plot for the association between and CYP2C9 *2 carrier and colorectal cancer risk; Egger's test was also performed to investigate the symmetry of the funnel plot (P = 0.96). (TIF) Figure S5 Funnel plot for the association between and CYP2C9 *3 carrier and colorectal cancer risk; Egger's test was also performed to investigate the symmetry of the funnel plot (P = 0.95).
Supporting Information
(TIF)
Checklist S1 PRISMA 2009 Checklist.
(DOC)
Author Contributions
Figure 1 .
1Forest plot (random effects model) of colorectal cancer risk associated with the CYP2C9 *2 carrier of the R144C polymorphism. doi:10.1371/journal.pone.0060607.g001
Figure 2 .
2Forest plot (random effects model) of colorectal cancer risk associated with the CYP2C9 *3 carrier of the I359L polymorphism. doi:10.1371/journal.pone.0060607.g002
Table 1 .
1Characteristics of the studies included in the meta-analysis.Reference
Year
Ethnicity
Case
Control
No. of case
No. of
control
Sex in case/control (male%) MAF in controls
Genotyping method
CYP2C9*2
CYP2C9*3
Sainz [18]
2011
German
ICD-10
Healthy
1768
1783
58.6/59.8
0.12
0.06
KASPar assay
Cleary [19]
2010
Canadian
ICD-9
Healthy
1165
1292
41.0/56.0
0.14
0.07
Taqman
Northwood [20]
2010
British
Colonoscopy
confirmed
Healthy
308
296
71.3/58.8
0.11
0.07
Taqman
Buyukdogan [21]
2009
Turkish
CRC patients
Healthy
77
78
52.0/53.0
0.11
0.05
RT-PCR
Cotterchio [22]
2008
Canadian
ICD-9
Healthy
834
1249
NA/NA
0.14
0.07
Taqman
Liao [23]
2007
Chinese
CRC patients
Healthy
284
483
54.5/53.6
/
0.03
Sequencing
Kü ry [24]
2007
French
CRC patients
Healthy
1013
1118
62.0/54.0
0.14
/
Taqman
Samowitz [25]
2006
American
ICD-9
Healthy
2295
2903
57.1/54.6
0.18
0.02
RFLP, TaqMan
McGreavey [26]
2005
British
ICD-9
Healthy
490
592
61.0/54.0
0.14
0.07
Taqman
Tranah [27]
2005
American
CRC patients
Healthy
416
825
0/0
0.17
0.08
Taqman
Landi [28]
2005
Spanish
CRC patients
Cancer free
364
324
NA/NA
0.13
0.08
Sequencing
Chan [29]
2004
American
Histology confirmed Healthy
339
350
0/0
0.09
0.08
Taqman
Martínez [30]
2001
Spanish
Histology confirmed Healthy
110
123
53.0/53.0
0.19
0.20
RFLP
ICD: International Classification of Diseases, HB: hospital-based, PB: population-based, MAF: minor allele frequency, NA: not available.
doi:10.1371/journal.pone.0060607.t001
Table 2 .
2Meta-analysis of the CYP2C9 *2 polymorphism on colorectal cancer susceptibility.Sub-group
analysis
No. of
data sets
No. of case/
control
Heterozygous
Homozygous
Variant carrier
OR (95%CI)
P(Z) P(Q) I 2
OR (95%CI) P(Z) P(Q) I 2
OR (95%CI)
P(Z) P(Q) I 2
Total
15
9154/10900
0.92 (0.85-1.00)
0.06 0.12 31% 1.19 (0.98-1.45) 0.07 0.50 0%
0.94 (0.87-1.03) 0.18 0.09 35%
Ethnicity
Caucasian
14
9077/10822
0.92 (0.85-1.01)
0.07 0.09 35% 1.20 (0.99-1.46) 0.06 0.46 0%
0.95 (0.87-1.03) 0.21 0.07 39%
Asian
1
77/78
0.72 (0.28-1.82)
0.48 NA
NA
0.64 (0.10-3.94) 0.63 NA
NA
0.70 (0.30-1.64) 0.41 NA
NA
Sample size
,500
8
2093/2566
0.93 (0.76-1.14)
0.50 0.06 48% 1.40 (0.86-2.29) 0.18 0.18 31% 0.97 (0.78-1.20) 0.77 0.03 55%
$500
7
7061/8334
0.92 (0.85-0.99)
0.03 0.35 10% 1.13 (0.91-1.42) 0.27 0.88 0%
0.93 (0.87-1.00) 0.05 0.48 0%
HWE status
Yes
14
9077/10822
0.92 (0.85-1.01)
0.07 0.09 35% 1.20 (0.99-1.46) 0.06 0.46 0%
0.95 (0.87-1.03) 0.21 0.07 39%
No
1
77/78
0.72 (0.28-1.82)
0.48 NA
NA
0.64 (0.10-3.94) 0.63 NA
NA
0.70 (0.30-1.64) 0.41 NA
NA
Diagnostic
criterion
ICD criterion
7
6538/7808
0.90 (0.83-0.98)
0.01 0.38 6%
1.11 (0.88-1.40) 0.37 0.92 0%
0.92 (0.85-0.99) 0.03 0.54 0%
Other criterion
8
2616/3092
0.95 (0.79-1.15)
0.62 0.07 47% 1.44 (0.90-2.29) 0.13 0.19 30% 0.99 (0.81-1.20) 0.92 0.03 54%
Sex
Male
2
1273/1455
0.79 (0.52-1.18)
0.25 0.06 71% 1.27 (0.77-2.11) 0.35 0.60 0%
0.83 (0.59-1.18) 0.31 0.09 66%
Female
3
1238/1492
1.11 (0.85-1.44)
0.46 0.17 44% 0.92 (0.34-2.45) 0.86 0.10 57% 1.09 (0.79-1.51) 0.60 0.06 64%
NA: not available.
doi:10.1371/journal.pone.0060607.t002
NA: not available. doi:10.1371/journal.pone.0060607.t003Sub-group
analysis
No. of
data sets
No. of case/
control
Heterozygous
Homozygous
Variant carrier
OR (95%CI)
P(Z) P(Q) I 2
OR (95%CI)
P(Z) P(Q) I 2
OR (95%CI)
P(Z)
P(Q) I 2
Total
15
7701/9287
1.00 (0.86-1.17)
0.99 0.007 54% 0.87 (0.43-1.74)
0.69 0.32 14% 1.00 (0.86-1.16) 0.99
0.008 53%
Ethnicity
Caucasian
13
7343/8734
0.96 (0.85-1.08)
0.49 0.18 26% 0.87 (0.43-1.74)
0.69 0.32 14% 0.96 (0.85-1.07) 0.45
0.20
24%
Asian
2
358/553
1.92 (0.87-4.25)
0.11 0.16 50% NA
NA
NA
NA
1.92 (0.87-4.25) 0.11
0.16
50%
Sample size
,500
9
2314/2933
0.99 (0.74-1.33)
0.95 0.001 69% 1.44 (0.49-4.19)
0.51 0.56 0%
1.00 (0.75-1.33) 0.99
0.002 68%
$500
6
5387/6354
1.00 (0.88-1.13)
0.97 0.46 0%
0.65 (0.25-1.66)
0.37 0.23 27% 0.98 (0.87-1.11) 0.76
0.40
2%
HWE status
Yes
13
7443/8786
1.05 (0.90-1.22)
0.52 0.02 49% 0.87 (0.43-1.74)
0.69 0.32 14% 1.05 (0.90-1.21) 0.54
0.02
49%
No
2
258/521
0.65 (0.42-1.01)
0.05 0.25 25% NA
NA
NA
NA
0.65 (0.42-1.01) 0.05
0.25
25%
Diagnostic
criterion
ICD criterion 7
5877/6946
1.01 (0.90-1.14)
0.85 0.53 0%
0.66 (0.31-1.38)
0.27 0.33 13% 0.99 (0.89-1.11) 0.91
0.48
0%
Other
criterion
8
1824/2341
0.97 (0.69-1.36)
0.85 0.0007 72% 3.32 (0.67-16.49) 0.14 0.92 0%
0.98 (0.70-1.38) 0.92
0.001 71%
Sex
Male
2
1257/1391
0.84 (0.67-1.06)
0.15 0.66 0%
0.67 (0.11-4.02)
0.66 NA
NA
0.84 (0.67-1.06) 0.14
0.65
0%
Female
3
1199/1437
1.14 (0.88-1.49)
0.32 0.27 24% 2.10 (0.52-8.43)
0.29 0.94 0%
1.15 (0.88-1.52) 0.30
0.25
29%
PLOS ONE | www.plosone.org
April 2013 | Volume 8 | Issue 4 | e60607
A Jemal, R Siegel, J Xu, E Ward, Cancer statistics. 60Jemal A, Siegel R, Xu J, Ward E (2010) Cancer statistics, 2010. CA Cancerô Jô Clin 60:277-300.
Environmental and heritable factors in the causation of cancer-analyses of cohorts of twins from. P Lichtenstein, N V Holm, P K Verkasalo, A Iliadou, J Kaprio, Nô Englô Jô Med. 343Lichtenstein P, Holm NV, Verkasalo PK, Iliadou A, Kaprio J, et al. (2000) Environmental and heritable factors in the causation of cancer-analyses of cohorts of twins from Sweden, Denmark, and Finland. Nô Englô Jô Med 343:78-85.
The genetics of colorectal cancer. P M Calvert, H Frucht, Ann Intern Med. 137Calvert PM, Frucht H (2002) The genetics of colorectal cancer. Ann Intern Med 137:603-612.
Dietary polyunsaturated fatty acids and cancers of the breast and colorectum: emerging evidence for their role as risk modifiers. H Bartsch, J Nair, R W Owen, Carcinogenesis. 20Bartsch H, Nair J, Owen RW (1999) Dietary polyunsaturated fatty acids and cancers of the breast and colorectum: emerging evidence for their role as risk modifiers. Carcinogenesis 20: 2209-2218.
Meat, cooking methods and colorectal cancer: a case-referent study in Stockholm. M De Verdier, U Hagman, R K Peters, G Steineck, E Overvik, Intô Jô Cancer. 49de Verdier M, Hagman U, Peters RK, Steineck G, Overvik E (1991) Meat, cooking methods and colorectal cancer: a case-referent study in Stockholm. Intô Jô Cancer 49: 520-525.
Carcinogenic factors in food with relevance to colon cancer development. M Nagao, T Sugimura, Mutat Res. 90Nagao M, Sugimura T (1993) Carcinogenic factors in food with relevance to colon cancer development. Mutat Res 90: 43-51.
Nutrition and dietary carcinogens. T Sugimura, Carcinogenesis. 21Sugimura T (2000) Nutrition and dietary carcinogens. Carcinogenesis 21: 387- 395.
Clinical relevance of genetic polymorphisms in the human CYP2C9 gene. U I Schwarz, Eurô Jô Clin Invest. 2SupplSchwarz UI (2003) Clinical relevance of genetic polymorphisms in the human CYP2C9 gene. Eurô Jô Clin Invest (Suppl 2):23-30.
Food-derived heterocyclic amine mutagens: variable metabolism and significance to humans. N J Gooderham, S Murray, A M Lynch, M Yadollahi-Farsani, K Zhao, Drug Metab Dispos. 29Gooderham NJ, Murray S, Lynch AM, Yadollahi-Farsani M, Zhao K, et al. (2001) Food-derived heterocyclic amine mutagens: variable metabolism and significance to humans. Drug Metab Dispos 29: 529-534.
Metabolic activation of heterocyclic amines and other procarcinogens in Salmonella typhimurium umu tester strains expressing human cytochrome P4501A1, 1A2, 1B1, 2C9, 2D6, 2E1 and 3A4 and human NADPH-P450 reductase and bacterial O-acetyltransferase. Y Oda, P Aryal, T Terashita, E M Gillam, F P Guengerich, Mutat Res. 492Oda Y, Aryal P, Terashita T, Gillam EM, Guengerich FP, et al. (2001) Metabolic activation of heterocyclic amines and other procarcinogens in Salmonella typhimurium umu tester strains expressing human cytochrome P4501A1, 1A2, 1B1, 2C9, 2D6, 2E1 and 3A4 and human NADPH-P450 reductase and bacterial O-acetyltransferase. Mutat Res 492: 81-90.
The role of the CYP2C9-Leu 359 allelic variant in the tolbutamide polymorphism. T H Sullivan-Klose, B I Ghanayem, D A Bell, Z Y Zhang, L S Kaminsky, Pharmacogenetics. 6Sullivan-Klose TH, Ghanayem BI, Bell DA, Zhang ZY, Kaminsky LS, et al. (1996) The role of the CYP2C9-Leu 359 allelic variant in the tolbutamide polymorphism. Pharmacogenetics 6: 341-349.
The effect of genetic polymorphisms in CYP2C9 on sulphamethoxazole Nhydroxylation. H J Gill, J F Tjia, N R Kitteringham, M Pirmohamed, D J Back, Pharmacogenetics. 9Gill HJ, Tjia JF, Kitteringham NR, Pirmohamed M, Back DJ, et al. (1999) The effect of genetic polymorphisms in CYP2C9 on sulphamethoxazole N- hydroxylation. Pharmacogenetics 9: 43-53.
The combination of estimates from different experiments. W G Cochran, Biometrics. 10Cochran WG (1954) The combination of estimates from different experiments. Biometrics 10:101-129.
Measuring inconsistency in meta-analyses. J P Higgins, S G Thompson, J J Deeks, D G Altman, BMJ. 327Higgins JP, Thompson SG, Deeks JJ, Altman DG (2003) Measuring inconsistency in meta-analyses. BMJ 327:557-560
Explaining heterogeneity in meta-analysis: a comparison of methods. S G Thompson, S J Sharp, Stat Med. 18Thompson SG, Sharp SJ (1999) Explaining heterogeneity in meta-analysis: a comparison of methods. Stat Med 18:2693-2708.
Operating characteristics of a rank correlation test for publication bias. C B Begg, M Mazumdar, Biometrics. 50Begg CB, Mazumdar M (1994) Operating characteristics of a rank correlation test for publication bias. Biometrics 50: 1088-1101.
Bias in meta-analysis detected by a simple, graphical test. M Egger, Davey Smith, G Schneider, M , BMJ. 315Egger M, Davey Smith G, Schneider M (1997) Bias in meta-analysis detected by a simple, graphical test. BMJ 315:629-34.
Association of genetic polymorphisms in ESR2, HSD17B1, ABCB1, and SHBG genes with colorectal cancer risk. J Sainz, A Rudolph, R Hein, M Hoffmeister, S Buch, Endocr Relat Cancer. 18Sainz J, Rudolph A, Hein R, Hoffmeister M, Buch S, et al. (2011) Association of genetic polymorphisms in ESR2, HSD17B1, ABCB1, and SHBG genes with colorectal cancer risk. Endocr Relat Cancer 18: 265-276.
Cigarette smoking, genetic variants in carcinogen-metabolizing enzymes, and colorectal cancer risk. S P Cleary, M Cotterchio, E Shi, S Gallinger, P Harper, Amô Jô Epidemiol. 172Cleary SP, Cotterchio M, Shi E, Gallinger S, Harper P (2010) Cigarette smoking, genetic variants in carcinogen-metabolizing enzymes, and colorectal cancer risk. Amô Jô Epidemiol 172: 1000-1014.
Polymorphisms in xenobiotic metabolizing enzymes and diet influence colorectal adenoma risk. E L Northwood, F Elliott, D Forman, J H Barrett, M J Wilkie, Pharmacogenet Genomics. 20Northwood EL, Elliott F, Forman D, Barrett JH, Wilkie MJ, et al. (2010) Polymorphisms in xenobiotic metabolizing enzymes and diet influence colorectal adenoma risk. Pharmacogenet Genomics 20: 315-326.
Frequency of Cytochrome 450 (CYP2C9 and CYP2C19) Genetic Polimorphisms in Patients with Colorectal Carsinoma. M Buyukdogan, M C Boruban, M Artac, S Demirel, International Journal of Hematology and Oncology. 19Buyukdogan M, Boruban MC, Artac M, Demirel S (2009) Frequency of Cytochrome 450 (CYP2C9 and CYP2C19) Genetic Polimorphisms in Patients with Colorectal Carsinoma. International Journal of Hematology and Oncology 19: 134-139.
Red meat intake, doneness, polymorphisms in genes that encode carcinogenmetabolizing enzymes, and colorectal cancer risk. M Cotterchio, B A Boucher, M Manno, S Gallinger, A B Okey, Cancer Epidemiol Biomarkers Prev. 17Cotterchio M, Boucher BA, Manno M, Gallinger S, Okey AB, et al. (2008) Red meat intake, doneness, polymorphisms in genes that encode carcinogen- metabolizing enzymes, and colorectal cancer risk. Cancer Epidemiol Biomarkers Prev 17: 3098-3107.
The association of CYP2C9 gene polymorphisms with colorectal carcinoma in Han Chinese. L H Liao, H Zhang, M P Lai, K W Lau, A K Lai, Clin Chim Acta. 380Liao LH, Zhang H, Lai MP, Lau KW, Lai AK, et al. (2007) The association of CYP2C9 gene polymorphisms with colorectal carcinoma in Han Chinese. Clin Chim Acta 380: 191-196.
Combinations of cytochrome P450 gene polymorphisms enhancing the risk for sporadic colorectal cancer related to red meat consumption. S Küry, B Buecher, S Robiou-Du-Pont, C Scoul, V Sébille, Cancer Epidemiol Biomarkers Prev. 16Küry S, Buecher B, Robiou-du-Pont S, Scoul C, Sébille V, et al. (2007) Combinations of cytochrome P450 gene polymorphisms enhancing the risk for sporadic colorectal cancer related to red meat consumption. Cancer Epidemiol Biomarkers Prev 16: 1460-1467.
Interactions between CYP2C9 and UGT1A6 polymorphisms and nonsteroidal anti-inflammatory drugs in colorectal cancer prevention. W S Samowitz, R K Wolff, K Curtin, C Sweeney, K N Ma, Clin Gastroenterol Hepatol. 4Samowitz WS, Wolff RK, Curtin K, Sweeney C, Ma KN, et al. (2006) Interactions between CYP2C9 and UGT1A6 polymorphisms and nonsteroidal anti-inflammatory drugs in colorectal cancer prevention. Clin Gastroenterol Hepatol 4: 894-901.
No evidence that polymorphisms in CYP2C8, CYP2C9, UGT1A6, PPARdelta and PPARgamma act as modifiers of the protective effect of regular NSAID use on the risk of colorectal carcinoma. L E Mcgreavey, F Turner, G Smith, K Boylan, Timothy Bishop, D , Pharmacogenet Genomics. 15McGreavey LE, Turner F, Smith G, Boylan K, Timothy Bishop D, et al. (2005) No evidence that polymorphisms in CYP2C8, CYP2C9, UGT1A6, PPARdelta and PPARgamma act as modifiers of the protective effect of regular NSAID use on the risk of colorectal carcinoma. Pharmacogenet Genomics 15: 713-721.
Epoxide hydrolase and CYP2C9 polymorphisms, cigarette smoking, and risk of colorectal carcinoma in the Nurses' Health Study and the Physicians' Health Study. G J Tranah, A T Chan, E Giovannucci, J Ma, C Fuchs, Mol Carcinog. 44Tranah GJ, Chan AT, Giovannucci E, Ma J, Fuchs C, et al. (2005) Epoxide hydrolase and CYP2C9 polymorphisms, cigarette smoking, and risk of colorectal carcinoma in the Nurses' Health Study and the Physicians' Health Study. Mol Carcinog 44: 21-30.
A comprehensive analysis of phase I and phase II metabolism gene polymorphisms and risk of colorectal cancer. S Landi, F Gemignani, V Moreno, L Gioia-Patricola, A Chabrier, Pharmacogenet Genomics. 15Landi S, Gemignani F, Moreno V, Gioia-Patricola L, Chabrier A, et al. (2005) A comprehensive analysis of phase I and phase II metabolism gene polymorphisms and risk of colorectal cancer. Pharmacogenet Genomics 15: 535-546.
A prospective study of genetic polymorphisms in the cytochrome P-450 2C9 enzyme and the risk for distal colorectal adenoma. A T Chan, G J Tranah, E L Giovannucci, D J Hunter, C S Fuchs, Clin Gastroenterol Hepatol. 2Chan AT, Tranah GJ, Giovannucci EL, Hunter DJ, Fuchs CS (2004) A prospective study of genetic polymorphisms in the cytochrome P-450 2C9 enzyme and the risk for distal colorectal adenoma. Clin Gastroenterol Hepatol 2: 704-712.
Association of CYP2C9 genotypes leading to high enzyme activity and colorectal cancer risk. C Martínez, E García-Martín, J M Ladero, J Sastre, F Garcia-Gamito, Carcinogenesis. 22Martínez C, García-Martín E, Ladero JM, Sastre J, Garcia-Gamito F, et al. (2001) Association of CYP2C9 genotypes leading to high enzyme activity and colorectal cancer risk. Carcinogenesis 22: 1323-1326.
The future of genetic studies of complex human diseases. N Risch, K Merikangas, Science. 273Risch N, Merikangas K (1996) The future of genetic studies of complex human diseases. Science 273:1516-1517.
CYP2C9 genotype as a predictor of drug disposition in humans. C R Lee, Methods Find Exp Clin Pharmacol. 26Lee CR (2004) CYP2C9 genotype as a predictor of drug disposition in humans. Methods Find Exp Clin Pharmacol 26:463-472.
The role of 12 cDNA-expressed human, rodent, and rabbit cytochromes P450 in the metabolism of benzo. M Shou, K R Korzekwa, C L Crespi, F J Gonzalez, H V Gelboin, Mol Carcinog. 10and benzo[a]pyrene trans-7,8-dihydrodiolShou M, Korzekwa KR, Crespi CL, Gonzalez FJ, Gelboin HV (1994) The role of 12 cDNA-expressed human, rodent, and rabbit cytochromes P450 in the metabolism of benzo[a]pyrene and benzo[a]pyrene trans-7,8-dihydrodiol. Mol Carcinog 10:159-168.
Comparisons between in-vitro and in-vivo metabolism of (S)-warfarin: catalytic activities of cDNA-expressed CYP2C9, its Leu359 variant and their mixture versus unbound clearance in patients with the corresponding CYP2C9 genotypes. H Takahashi, T Kashima, S Nomoto, K Iwade, H Tainaka, Pharmacogenetics. 8Takahashi H, Kashima T, Nomoto S, Iwade K, Tainaka H, et al. (1998) Comparisons between in-vitro and in-vivo metabolism of (S)-warfarin: catalytic activities of cDNA-expressed CYP2C9, its Leu359 variant and their mixture versus unbound clearance in patients with the corresponding CYP2C9 genotypes. Pharmacogenetics 8:365-373.
Nonsteroidal anti-inflammatory drugs and cancer prevention. J A Baron, R S Sandler, Annu Rev Med. 51Baron JA, Sandler RS (2000) Nonsteroidal anti-inflammatory drugs and cancer prevention. Annu Rev Med 51:511-523.
Allelic variants of human cytochrome P450 2C9: baculovirus-mediated expression, purification, structural characterization, substrate stereoselectivity, and prochiral selectivity of the wild-type and I359L mutant forms. R L Haining, A P Hunter, M E Veronese, W F Trager, A E Rettie, Arch Biochem Biophys. 333Haining RL, Hunter AP, Veronese ME, Trager WF, Rettie AE (1996) Allelic variants of human cytochrome P450 2C9: baculovirus-mediated expression, purification, structural characterization, substrate stereoselectivity, and prochiral selectivity of the wild-type and I359L mutant forms. Arch Biochem Biophys 333:447-558.
| 1,999,806 |
Background
Breast cancer (BC) is both the prevailing malignancy and the most common cause of cancer death among women in Western countries [1]. Estrogens, dietary factors, lifestyle, environmental chemicals with carcinogenic potential, as well as oxidative and carbonyl stresses, play a very important role in BC pathogenesis and progression [2][3][4][5][6][7][8]. It is, therefore, plausible that polymorphisms of genes encoding enzymes involved in estrogen biosynthesis pathway or metabolic activation of pro-carcinogens to genotoxic intermediates, endogenous free-radical scavenging systems and anti-glycation defenses, may influence individual susceptibility to BC.
Much interest has long been addressed to cytochrome P450c17α (CYP17) and glutathione S-transferase 1 (GSTP1) genes, encoding enzymes involved in estrogen biosynthesis and metabolism [9] or in environmental carcinogens detoxification and exo-and endogenous xenobiotic transformation [10], respectively. Despite some studies have confirmed a link between CYP17 [11][12][13][14] or GSTP1 [15][16][17][18] gene polymorphisms and the risk of BC, others have failed to find such an association [19][20][21][22][23][24][25][26][27] and conflicting results have been obtained. Hence, the clinical relevance of these polymorphic genes remains to be fully elucidated and needs further investigation.
Moreover, the search for additional metabolizing polymorphic genes as potential susceptibility factors in BC, is needed. In particular, paraoxonase 1 gene (PON1), encodes a serum high-density lipoproteins (HDL)-associated enzyme [28], playing an important role in lipid metabolism as an antioxidant molecule, through (a) hydrolyzation of active oxidized phospholipids, (b) destruction of lipid hydroperoxides and H 2 O 2 (peroxidase-like activity), (c) preservation of HDL integrity and function and, finally, (d) prevention of LDL oxidation. Additionally, paraoxonase 1 is consistently implicated in the elimination of carcinogenic lipid-soluble radicals from lipid peroxidation [29]. Therefore, it is reasonable to expect that the activity of such an enzyme may influence BC development. In particular, loss of the paraoxonase 1 care-take function could play an important role in increasing the breast vulnerability to genomic damage caused by inflammatory oxidants, dietary carcinogens, as well as in estrogen-lipidic metabolism, that may modulate the progression of breast tumor. The main paraoxonase-encoding gene, PON1, is polymorphic in human populations and the expression of such a gene widely varies in human populations [30]. Two common single-base mutation polymorphisms (SNP) have been described in the encoding region of human PON1, which lead to glutamine → arginine substitution at 192 (Q192R) or a leucine → methionine substitution at 55 (L55M). Both these polymorphisms influence PON1 activity [31,32]. So far, very few information is available about the association of PON1/192 and 55 polymorphisms with BC risk and only in selected populations [33,34]. It was, therefore, aim of the present study also to analyze the relationships of PON1 allelic variants with the risk of BC and to clarify the question whether both gene variations might be useful genetic markers of breast tumor.
Glyoxalase I (GLO1) gene encodes an anti-glycation defence enzyme that decreases the concentration of dicarbonyl compounds (alpha-oxoaldehydes), such as methylglyoxal (MG), the most reactive glycation precursor [35]. Since substantial evidence exists on the role of carbonyl stress and DNA/protein glycation in relation to BC pathogenesis [7,8], it is possible that allele variants in GLO1 gene may predispose to the risk of developing BC and affect the course of the disease. A single nucleotide polymorphism in GLO1 gene, C419A, causing an Ala111Glu (A111E) change in the protein sequence, has been recently identified [36]. Therefore, since there are no existing data in this connection, we finally evaluated the distribution of GLO1 A111E polymorphism among BC patients as well as controls, to point out a possible association with the risk of BC.
We would also like to highlight that all these four genes have been simultaneously considered in the present study because all related to the control of oxidative stress. In fact, they encode for enzymes that detoxify free radicals or reduce potential substrates for their production. As well known, there is evidence that oxidative stress, resulting from either an excess of reactive oxygen species (ROS) or a deficiency in antioxidant capabilities, may play a role in the etiology of BC [4,37]. In particular, CYP17 is responsible for catecholestrogens (CEs) formation via estrogen biosynthesis [38]. CEs can be oxidized to the corresponding ortho-quinone derivatives with concomitant formation of ROS [39]. From this aspect, estrogens have been proposed to trigger BC development via an initiating mechanism involving CEs [38]. GSTP1 and PON1 encode enzymes that carry out well known cellular mechanisms of antioxidant defence, playing a key role in the removal or detoxification of ROS, which is essential for preventing oxidative damage [40]. Finally, GLO1 encodes an enzyme that removes methylglyoxal (MG), a potent oxidative stress precursor. Free radical generation given by MG involves ROS, reactive nitrogen species (RNS), as well as organic radicals like MG radial or cross-linked protein radicals [41].
Methods
Patients
The study protocol followed the guidelines of our local ethics committee and the investigation was conducted with the ethical requirements defined in the Helsinki Declaration. All patients gave their informed consent to participate in the study. Women with BC were identified via the Regional Cancer Registry, to which reporting of all malignant tumors is mandatory, and contacted via their doctors. In total, 547 women agreed to participate in the study, representing 89% of those who were contacted and found to be eligible. Histological staging of breast carcinoma was performed according to the current classification of the International Union Against Cancer [42]. Women showing axillary lymph node-positive disease (n = 190) or metastatic BC (stage IV; n = 19) at diagnosis were considered "advanced" cases. Women diagnosed with a tumor confined to the breast, either in situ (n = 46) or invasive (n = 292), were designated as "local". The age at diagnosis of BC was 55.3 ± 10.5 (SD) years and the patients had no previous history of BC or any other cancer. Control women (n = 544) were healthy Caucasian Italian women as well, randomly selected from the Umbrian Registry of Total Population, matched by age (55.0 ± 10.2 years; P = 0.11). The participation rate among controls was 87%. All these subjects were asked to complete a self-administered questionnaire on demographic factors, anthropometric measures, menstrual, reproductive, and breast feeding histories, use of contraceptives and exogenous hormones, medical and screening histories, first-degree family history of BC, occupational exposure, smoking history and alcohol consumption. All subjects were asked to provide a blood sample, to be used for genotyping. The median time between diagnosis and interview for BC cases was 2 months.
Primers and Polymerase Chain Reaction (PCR)
Genomic DNA was extracted from heparinized peripheral whole blood, using the QIAamp Blood Mini Kit (Qiagen, Milan, Italy). The nucleotide sequence of primers is shown in Table 1. PCR amplification was carried out in a final volume of 50 μl, containing 20 ng of DNA, 20 pmoles of each primer, 100 mM of each dNTP, 1.5 mM MgCl 2 , 10 mM Tris-HCl pH 8.3, 50 mM KCl, and 1 U of Taq DNA polymerase. DNA amplification was performed conventionally; samples were subjected to 35 cycles of amplification consisting of 40 sec. denaturation, 30 sec. annealing, and 30 sec. extension. The final extension step at 72°C was extended to 10 min. The annealing temperature was optimized for each primer set.
Genotyping
SNPs detection was based upon Restriction fragment length polymorphism (RFLP) analysis after PCR amplification. CYP17 gene maps to chromosome 10. A single T (A1 allele) to C (A2 allele) nucleotide substitution in the 5'-untranslated region of CYP17 creates a recognition site for the MspA1 restriction enzyme. GSTP1 gene has been mapped to a small region of chromosome 11. The region of genomic DNA flanking exon 5 of GSTP1 gene was amplified. The A to G substitution in GSTP1 leads to the creation of a recognition site for the Alw261 restriction enzyme. PON1 gene is located at chromosome 7. Singlebase substitutions, which lead to a change of a glutamine residue into arginine at amino acid position 192, and a change of leucine to methionine affecting amino acid 55 of the paraoxonase protein encoded by human PON1, create recognition sites for Alw1 (PON1/192) and NlaIII (PON1/55), respectively. GLO1 gene maps to chromosome 6. A C to A substitution in GLO1 exon 4, which changes Ala111Glu in the encoded protein, leads to the loss of a recognition site for the SfaNI restriction enzyme. PCR products were, therefore, digested for 3 hr at 37°C using either MspA1, Alw261, Alw1, NlaIII, or SfaNI, respectively, and separated by electrophoresis in 12% polyacrylamide gels. The band patterns were developed by silver staining to identify the single base pair change. All genotyping was carried out by laboratory personnel blinded to case-control status of the samples, which included quality control samples for validation. Concordance for quality control samples was 100%.
Statistical Analysis
The obtained results were analyzed with the MedCalc statistical package (MedCalc, Mariakerke, Belgium). The associations between CYP17, GSTP1, PON1, GLO1 alleles and breast cancer (BC) were evaluated using unconditional logistic regression. All Odds ratio (ORs) and 95% confidence intervals (CIs) were adjusted for potential modifying factors, including age at menarche (continuous, log transformed), age at first full-term pregnancy (FFTP) (continuous, log transformed), history of benign breast disease (yes, no), first-degree family history of breast cancer (yes, no), waist-hip ratio (WHR) (continuous, log transformed), use of oral contraceptive (yes, no), alcohol consumption (ever, never), smoking habits (ever, never), level of education (low, medium/high) and postmenopausal use of estrogens (ever, never). Covariates as body mass index (BMI), breast cysts and physical activity were not included in the logistic model, because they did not alter the OR by > 5%, either separately or in combination. Since risk factors for BC significantly vary depending on menopausal status, we performed our analysis not only in the overall population, but also in premenopausal and postmenopausal subsets of women. Women who reported natural menopause or had undergone bilateral oophorectomy were classified as postmenopausal. Hysterectomized women with intact ovaries/ovary and women for whom the details of the operation were unknown were also classified postmenopausal, if they were no longer menstruating and were older than 50 years (median for menopause in Italian women). All of the others were classified premenopausal. WHR, BMI, and age at FFTP were dichotomized on the basis of the median values for population controls. Estimates of statistical significance were calculated by standard χ 2 analysis, or by Fisher's exact test, where cell numbers were < 5. We used Bonferroni correction to account for multiple comparisons, and a twotailed P value < 0.000862 was considered statistically significant.
Descriptive analysis included determination of standard deviation (SD) for cases and controls as well as Student's t-test to evaluate differences between means. A two sided probability value of less than 0.05 was considered to indicate statistical significance. For each group (controls and cases), allele frequencies were calculated by direct gene counting. Deviations from Hardy-Weinberg equilibrium (HWE) were tested by χ 2 test.
Results
Patients characteristics
The main characteristics of the study subjects (cases, n = 547; controls, n = 544) and potential risk factors for breast cancer (BC) are shown in Table 2. The occurrence of premenopausal women was higher among population controls (
CYP17 polymorphism and BC risk
The distribution of CYP17 genotypes and the ORs associated with BC are shown in Table 3. The A2 allele did not significantly affect BC risk, either in the overall population or when women were grouped according to menopausal status. No statistically significant differences were observed either when case patients were considered by tumor stage (Table 4). Conversely, we observed a protective effect of later age at menarche (≥ 13 years) among premenopausal women with the A1A1 genotype (OR, 0.28; 95% CI, 0.10-0.71, P for interaction = 0.11) and for premenopausal women with at least one child and the A1A1 genotype (OR, 0.26; 95% CI, 0.10-0.60, P for interaction = 0.12) ( Table 5). In contrast, an increased risk of BC with borderline significance was observed for postmenopausal women with A1A2 or A2A2 genotype and BMI > 25,4 Kg/ m 2 (Table 5).
GSTP1 polymorphism and BC risk
The distribution of GSTP1 genotypes and the ORs associated with BC are shown in Table 6. We found that the frequency of the Val allele was significantly lower in the BC population than in the control group; 42% of the cases and 76% of controls carried at least one Val allele. Patients with the Ile/Val genotype and Val/Val genotype had a significant decrease for BC risk compared with the Ile/Ile genotype. Results were similar in pre-(46% of cases and 75% of controls were carriers of at least one Val allele) and postmenopausal (40% of cases and 78% of controls were carriers of at least one Val allele) women. No significant association was found between GSTP1 polymorphism and BC risk, according to tumor stage or potential hormone-related BC risk factors (age at menarche, postmenopausal use of estrogens, use of oral contraceptives, parity, age at FFTP, BMI or WHR) (data not shown).
PON1 polymorphisms and BC risk
The associations between the Q192R or L55M polymorphisms and BC risk are shown in Table 7. As to PON1 Q192R, 11.5% of cases and 37.5% of controls were carriers of at least one R allele. QR heterozygotes and mutant RR homozygotes had a lower risk of the breast disease compared to the QQ homozygotes. In particular, there was a trend in decreasing the risk with the number of R alleles. Results stratified by menopausal status at diagnosis, confirmed the OR of the general analysis only in the case of postmenopausal group, where the association was even more pronounced. In contrast, no significant association was observed in the premenopausal group.
Concerning PON1 L55M, this polymorphism was associated with a significantly increased risk of BC. Eighty percent of cases and 65% of controls were carriers of at least one M allele. When stratified by menopausal status, the frequency of the M allele was higher among both premenopausal (84%) and postmenopausal (79%) cases compared with the respective frequencies (66% and 65%) in the control subjects. Premenopausal women with the MM genotype had a significant increase for BC risk compared with the LL genotype. Postmenopausal women with the LM and MM genotype had a significant increase for BC risk compared with the LL genotype. PON1 Q192R and L55M genotypes were then analyzed according to tumor stage ( Table 8). As to PON1 Q192R in the premenopausal group, such a genotype was associated with a lower risk of only advanced BC, compared with controls, while no significant correlation was found for local BC. In particular, premenopausal patients having advanced disease were less frequently carriers of the R allele (16%) compared with controls (37%). Heterozygotes QR and homozygotes RR had a significant decrease for BC risk, compared with the QQ genotype, resembling the ORs trend obtained for the analysis in the overall population. In contrast, in premenopausal women with local disease no such tendency was observed. Thirty-six percent of cases and 37% of controls carried at least one R allele. In the postmenopausal group, association between PON1 Q192R genotypes and BC risk was found for both local and advanced cases. We found that significant decreases in the frequencies of the R allele occurred for local as well as advanced BC. About 3% of cases and 38% of controls carried at least one R allele in both local and advanced postmenopausal group. By contrast, an increase was observed in the frequencies of the PON1 55 M allele in both local and advanced premenopausal BC groups, with respect to the control cohort, thus suggesting an increased risk of BC. In particular, 85% of cases and 66% of controls were carriers of at least one R allele, in the local premenopausal group, and 82% of cases and 66% of controls were carriers of at least one R allele, in the advanced premenopausal group. A similar trend was observed in postmenopausal women. In particular, individuals with the PON1 55 LM and MM genotypes showed an increased risk of advanced BC. Potential hormone-related BC risk factors (age at menarche, postmenopausal use of estrogens, use of oral contraceptives, parity, age at FFTP, BMI or WHR) did not modify the association of either Q192R or L55M SNPs with BC (data not shown).
GLO1 polymorphism and BC risk
The distribution of GLO1 genotypes and the ORs associated with BC are shown in Table 9. We found that 78% of cases and 42% of controls were carriers of at least one E allele. When stratified by menopausal status, the frequency of the E allele was higher among both premenopausal (79%) and postmenopausal (78%) cases compared with the respective frequencies (55% and 32%) in the control subjects. Patients with the AE genotype and (Table 9) and according to tumor stage (Table 10) confirmed the ORs of the general analysis. No significant association was found between GLO1 polymorphism and BC risk according to potential hormonerelated BC risk factors (age at menarche, postmenopausal use of estrogens, use of oral contraceptives, parity, age at FFTP, BMI or WHR) (data not shown).
Combination of CYP17, GSTP1, PON1-192, PON1-55 and GLO1 polymorphisms as predictive factor for BC risk
The analysis of a single polymorphism alone is often not indicative for the association to the risk of BC. We believe that the combination of them all in each single case may be a more predictive factor for the risk of this neoplasia. Therefore, since these genes are all related to the control of oxidative stress-inducing mechanisms, we would like to emphasize that the detection of the GSTP1IleVal-PON1/ 192QR-PON1/55LM-GLO1AE or GSTP1IleIle-PON1/ 192QQ-PON1/55MM-GLO1EE genotype combination at individual level, might lead to the identification of patients with intermediate and high risk for BC, respectively (Table 11), compared to the GSTP1ValVal-PON1/ 192RR-PON1/55LL-GLO1AA genotype combination.
None of the SNPs was significantly associated with the risk of BC after controlling for multiple testing by Bonferroni analysis (data not shown).
Discussion
The aetiological factors implicated in breast carcinogenesis are unclear, but estrogen levels [2], lifestyle factors, especially diet [43], oxidative and carbonyl stresses [4][5][6][7][8] have all been suggested to influence breast cancer (BC) risk. The human body has a number of enzyme systems protecting from genotoxic damage, acting either indirectly, via reduction of potential substrates giving free radicals production, such as cytochrome P450c17α (CYP17) [38,39] or, directly, via free radical detoxification, such as glutathione S-transferase (GSTP1), paraoxonase (PON1) [40] and glyoxalase 1 (GLO1) [41]. Polymorphisms of these genes are believed to be key factors in determining cancer susceptibility to toxic or environmental chemicals [29,44,45]. Therefore, in an effort to increase our understanding of the interaction between potential carcinogenic environmental exposure and genetic factors in the pathogenesis and predisposition to BC disease risk, we determined the frequencies and the relative risks (ORs) of CYP17, GSTP1, PON1 and GLO1 gene polymorphisms in a control population and in a population of patients with breast tumor. In agreement with the majority of studies [19][20][21]23,24] on CYP17 polymorphism and BC risk, our results did not reveal any significant association between the CYP17 A2 allele and the risk of BC. Conversely, the present study revealed that CYP17 polymorphism may lower the risk of BC in premenopausal women with the A1A1 genotype and later age at menarche or with at least one child, in accordance with the results obtained by others [19][20][21]. Our observations may be compatible with the hypothesis that the protection against BC is reduced among women with the A2 allele containing genotypes, because of elevated baseline levels of circulating steroid hormones. In addition, results from a previous study indicate that nulliparous women with the A2A2 genotype have higher mean levels of serum estradiol than those with the A1A1 genotype [46]. Moreover, the fact that the observed associations were mainly confined to premeno- pausal women, could reflect differences in the nature of premenopausal and postmenopausal BC etiology [47] and suggest that CYP17 gene polymorphism may play a different role in later onset of the disease.
As to GSTP1, we found that the major risk for BC was associated with individuals homozygotes for the Ile allele, while the Val allele appeared to be a protective factor against BC. A similar trend was presumably related with an activation of the enzyme at tissue level. Besides, experimental evidences showed that the Val variant may have either lower or higher specific activity and affinity depending on the substrate [48]. On this aspect, our findings may differ from those of other studies showing an increased risk for women carrying the Val allele, due to different environmental exposure and/or dietary habits. Our results are instead consistent with other studies where a tendency of decreased risk could be seen for the GSTP1 Val allele [25,26]. As well known, oxidative stress and free radicals induced by environmental and/or endogenous carcinogens have been associated with increased risk of BC [4][5][6].
Regarding PON1, we found that women with PON1-192/ QR and RR genotype had a lower risk of BC in comparison to women with the PON1-192/QQ genotype. This might be explained since, as expected, the Q to R substitution lead to the production of an enzyme with a higher detoxification activity against potentially carcinogenic products of oxidative stress and lipid peroxidation. This is supported by a quite recent study showing that individuals [33]. On the contrary, with regard to L55M SNP, our data are in agreement with those of Stevens et al. [34].
Regarding GLO1 polymorphism, our results indicate that the presence of the GLO1 E allele significantly increases BC risk. This might be explained by the fact that the A to E substitution, due to the SNP, may determine a conformational modification in the enzyme, leading to an isoenzyme with a lower detoxification capacity [36]. As well known, glyoxalase 1 is an efficient antiglycation defence that decreases the concentration of reactive carbonyl compounds, such as methylglyoxal (MG), one of the most potent precursors of carbonyl stress-related advanced glycation end-products (AGEs). Consequently, a decrease in the activity of this enzyme may result in an accumulation of AGEs in human breast tissues. Since AGEs, resulting from sugar-derived protein modifications, are known to play a role in BC pathogenesis and progression [7,8], it would be expected that the presence of a lower activity form of GLO1 -the GLO1 allele -may be predictive about severe consequences for an individual's BC risk. Indeed, accumulations of AGEs in the serum of BC patients [7,8] has been recently described. In addition, we found that the risk of BC associated with the GLO1 E allele significantly tended to increase according to tumour stage, thus suggesting a possible role of this polymorphism, not only in the development of this neoplasia but also in progression of local to advanced BC. Since this is the first study to examine the association between GLO1 A111E polymorphism and the risk of BC, additional research is required to confirm these findings.
The single SNP associations found in this study did not withstand correction for multiple testing by Bonferroni method. Additional data are therefore needed to corroborate our findings. These may be derived by replication in other genetic-epidemiological studies, preferably in combination with studies on the functional role of gene products that provide biological plausibility.
We also determined the genotypic and allelic frequencies of CYP17, GSTP1, PON1-192 and-55 as well as GLO1 polymorphisms for each considered group (control and patients). When tested for HWE, the genotypic frequencies were in agreement with those predicted under HWE only for CYP17 polymorphism. Conversely, there were statistically significant deviations among the controls between the observed and expected genotypic frequencies for all the other polymorphisms. Such deviations, in literature, have been attributed primarily to a possibility of genotyping error [50]. We have ruled out this possibility by inclusion of samples of known genotypes, as positive RFLP controls and three independent operators confirmed genotypes. In addition, the frequencies of the mutant allele among controls for most of the SNPs under consideration were not significantly different from those one observed among Caucasian women in other published studies [20,33,51]. Other possible reasons for the observed deviations could be either genetic drift, migration, inbreeding, cultural parameters based on religion beliefs and socio-economic requirements, recent origin/ introduction of the polymorphism, absence of random mating, and/or a stratification bias. The last possibility can be ruled out since our sample collection included individuals of known ethnicity. However, the other factors cannot be ruled out, since our current sample set is not appropriate to comment on the selection forces operating on the population.
Conclusion
In conclusion, the results of this report suggest that polymorphisms of genes involved in the oxidative stress control may play a significant role in the development of BC.
In particular, CYP17 polymorphism may modify the risk of BC only for certain subgroups, while GSTP1, PON1-192, PON1-55 and GLO1 polymorphisms appear to be common genetic traits likely associated with the risk of BC. However, the results of our exploratory analysis, while nominally significant, did not withstand correction for multiple testing. Therefore, further studies are needed to confirm our findings and to explore the exact molecular basis of our observations.
Caucasian Italian women with a clinical and histological diagnosis of breast cancer (BC) (ductal carcinoma, 78.6%; lobular carcinoma, 15.9%; papilla tubular carcinoma, 1.3%; other, 4.2%) were enrolled in this study between June 2003 and July 2007 from the Breast Unit, Surgical Department of the University of Perugia, Umbria, Italy.
Table 1 :
1Oligonucleotide primer sequences used for genotypingGene
Oligonucleotides
Sequence
(5'-3')
Expected amplicon size (bp)
CYP17
230F
CATTCGCACTTCTGGAGTC
459
642R
GGCTCTTGGGGTACTTG
GSTP1
P105F
ACCCCAGGGCTCTATGGGAA
176
P105R
TGAGGGCACAAGAAGCCCCT
PON1 192
PON192F
TATTGTTGCTGTGGGACCTGAG
99
PON192R
CACGCTAAACCCAAATACATCTC
PON1 55
PON55F
GAAGAGTGATGTATAGCCCCAG
170
PON55R
TTTAATCCAGAGCTAATGAAAGCC
GLO1
GLO1F
TCAGAGTGTGTGATTTCGTG
700
GLO1R
CATGGTGAGATGGTAAGTGT
Table 2 :
2Selected characteristics of the study subjects and potential risk factors for breast cancer Low: none or primary school; medium: middle school; high: high school, trade school or university. b Adjusted for age. OR: odds ratio; CI: confidencial intervals; FFTP: first full-term pregnancy; WHR: waist-hip ratio; BMI: body mass index.Cases (n = 547) (%)
Controls (n = 544) (%)
OR b (95% CI)
Table 3 :
3Associations between CYP17 genotype and breast cancer according to menopausal statusA1A1
A1A2
A2A2
A1A2 and A2A2
All
Cases, n (%)
229 (41.9)
258 (47.1)
60 (11.0)
318 (58.1)
Controls, n (%)
227 (41.7)
249 (45.8)
68 (12.5)
317 (58.3)
OR (95% CI) a
1.0
0.95 (0.72-1.24)
0.77 (0.51-1.20) b
0.90 (0.70-1.18)
Menopausal status at diagnosis
Premenopausal
Cases, n (%)
88 (47.1)
81 (43.3)
18 (9.6)
99 (52.9)
Controls, n (%)
100 (43.5)
99 (43.0)
31 (13.5)
130 (56.5)
OR (95% CI) a
1.0
0.88 (0.56-1.36)
0.66 (0.33-1.29) b
0.83 (0.55-1.25)
Postmenopausal
Cases, n (%)
141 (39.2)
177 (49.2)
42 (11.6)
219 (60.8)
Controls, n (%)
127 (40.4)
150 (47.8)
37(11.8)
187 (59.5)
OR (95% CI) a
1.0
0.98 (0.68-1.41)
0.94 (0.53-1.68) b
0.97 (0.69-1.38)
Table 4 :
4Associations between CYP17 genotype and breast cancer according to menopausal status and tumor stageA1A1
A1A2
A2A2
A1A2 and A2A2
Premenopausal
Controls, n (%)
100 (43.5)
99 (43.0)
31 (13.5)
130 (56.5)
Cases by stage
Local, n (%)
48 (43.6)
50 (45.5)
12 (10.9)
62 (56.4)
OR (95% CI) a
1.0
1.02 (0.61-1.71)
0.76 (0.35-1.66) b
0.96 (0.58-1.56)
Advanced, n (%)
41 (53.2)
30 (39.0)
6 (7.8)
36 (46.8)
OR (95% CI) a
1.0
0.63 (0.35-1.25)
0.43 (0.16-1.16) c
0.57 (0.32-1.01)
Postmenopausal
Controls, n (%)
127 (40.4)
150 (47.8)
37(11.8)
187 (59.6)
Cases by stage
Local, n (%)
93 (40.8)
105 (46.0)
30 (13.2)
135 (59.2)
OR (95% CI) a
1.0
1.01 (0.65-1.52)
1.07 (0.57-2.16) d
1.02 (0.68-1.53)
Advanced, n (%)
47 (35.6)
73 (55.3)
12 (9.1)
85 (64.4)
OR (95% CI) a
1.0
0.98 (0.59-1.64)
0.87 (0.37-2.05) e
0.97 (0.62-1.53)
a Adjusted for age, age at menarche, age at FFTP, number of full term pregnancies, first-degree family history of breast cancer, history of benign
breast disease, use of oral contraceptives, WHR, alcohol consumption, smoking habits, level of education and postmenopausal use of estrogen. b P
for trend = 0.591; c P for trend = 0.061; d P for trend = 0.835; e P for trend = 0.829.
Table 5 :
5Associations between CYP17 genotypes and breast cancer risk stratified by selected characteristicsPremenopausal
Postmenopausal
A1A1
A1/A2 and A2A2
A1A1
A1/A2 and A2A2
Case/Control OR a (95% CI) Case/Control OR a (95% CI) Case/Control OR a (95% CI) Case/Control OR a (95% CI)
Age at
menarche
< 13 yr
25/11
1.0
23/26
1.0
19/25
1.0
32/25
1.0
≥ 13 yr
64/89
0.28
(0.10-0.71)
75/104
0.77
(0.39-1.53)
119/103
1.31
(0.63-2.72)
190/161
0.84
(0.44-1.61)
Postmenopaus
al use of
estrogen
Never
100/89
1.0
154/119
1.0
Ever
39/40
1.15
(0.63-2.12)
67/66
0.86
(0.52-1.41)
Use of oral
contraceptives
Never
28/27
1.0
33/32
1.0
106/86
1.0
192/130
1.0
Ever
64/74
1.01
(0.45-2.27)
62/97
0.55
(0.29-1.03)
32/41
0.83
(0.41-1.74)
30/57
0.52
(0.29-0.98)
Parity
Nulliparous
21/9
1.0
14/15
1.0
30/16
1.0
51/25
1.0
Parous
68/91
0.26
(0.10-0.60)
84/115
0.77
(0.32-1.94)
109/109
0.53
(0.25-1.08)
170/164
0.97
(0.36-1.17)
Age at FFTP
for parous
women
≤ 25 yr
48/47
1.0
51/66
1.0
65/64
1.0
105/119
1.0
> 25 yr
22/35
0.83
(0.45-1.55)
33/43
1.34
(0.61-2.89)
43/42
0.92
(0.53-1.65)
64/63
0.59
(0.28-1.47)
BMI
≤ 25,4
63/67
1.0
51/76
1.0
53/51
1.0
76/77
1.0
> 25,4
28/35
0.60
(0.27-1.34)
45/52
1.05
(0.57-1.93)
86/76
1.43
(0.75-2.72)
145/110
1.64
(0.97-2.78)
WHR
< 0,91
41/58
1.0
42/72
1.0
47/58
1.0
86/82
1.0
≥ 0,91
47/40
1.61
(0.83-3.17)
57/60
1.52
(0.85-2.75)
91/68
1.68
(0.95-2.99)
136/106
1.12
(0.70-1.97)
Table 6 :
6Associations between GSTP1 genotype and breast cancerIle/Ile
Ile/Val
Val/Val
Ile/Val and Val/Val
All
Cases, n (%)
315 (57.6)
217 (39.7)
15 (2.7)
232 (42.4)
Controls, n (%)
128 (23.5)
340 (62.5)
76 (14.0)
416 (76.5)
OR (95% CI) a
1.0
0.22 (0.14-0.30)
0.04 (0.01-0.09) b
0.15 (0.07-0.25)
Menopausal status at diagnosis
Premenopausal
Cases, n (%)
101 (54.0)
76 (40.6)
10 (5.4)
86 (46.0)
Controls, n (%)
58 (25.2)
140 (60.9)
32 (13.9)
172 (74.8)
OR (95% CI) a
1.0
0.27 (0.17-0.38)
0.14 (0.06-0.22) b
0.23 (0.16-0.35)
Postmenopausal
Cases, n (%)
214 (59.4)
141 (39.2)
5 (1.4)
146 (40.6)
Controls, n (%)
70 (22.3)
200 (63.7)
44 (14.0)
244 (77.7)
OR (95% CI) a
1.0
0.23 (0.14-0.35)
0.09 (0.02-0.10) b
0.36 (0.24-0.55)
a Adjusted for age, age at menarche, age at FFTP, number of full term pregnancies, first-degree family history of breast cancer, history of benign
breast disease, use of oral contraceptives, WHR, alcohol consumption, smoking habits, level of education and postmenopausal use of estrogen. b P
for trend = 0.001.
Table 7 :
7Association of genotypes for the PON1 Q192R and PON1 L55M SNPs and breast cancerQQ
QR
RR
QR and RR
PON1 Q192R
All
Cases, n (%)
484 (88.5)
50 (9.1)
13 (2.4)
63 (11.5)
Controls, n (%)
340 (62.5)
152 (28.0)
52 (9.5)
204 (37.5)
OR (95% CI) a
1.0
0.58 (0.32-0.99)
0.45 (0.18-0.88) b
0.55 (0.30-0.95)
Menopausal status at diagnosis
Premenopausal
Cases, n (%)
135 (72.2)
41 (21.9)
11 (5.9)
52 (27.8)
Controls, n (%)
144 (62.6)
64 (27.8)
22 (9.6)
86 (37.4)
OR (95% CI) a
1.0
0.73 (0.51-1.43)
0.64 (0.40-1.44) b
0.68 (0.47-1.47)
Postmenopausal
Cases, n (%)
349 (96.9)
9 (2.5)
2 (0.6)
11 (3.1)
Controls, n (%)
196 (62.4)
88 (28.0)
30 (9.6)
118 (37.6)
OR (95% CI) a
1.0
0.12 (0.01-0.33)
0.08 (0.01-0.14) b
0.05 (0.02-0.12)
PON1 L55M
LL
LM
MM
LM and MM
All
Cases, n (%)
107 (19.6)
115 (21.0)
325 (59.4)
440 (80.4)
Controls, n (%)
188 (34.6)
125 (23.0)
231 (42.4)
356 (65.4)
OR (95% CI) a
1.0
1.80 (1.36-2.56)
2.81 (1.95-3.64) c
2.42 (1.73-2.99)
Menopausal status at diagnosis
Premenopausal
Cases, n (%)
30 (16.1)
33 (17.6)
124 (66.3)
157 (83.9)
Controls, n (%)
78 (33.9)
70 (30.4)
82 (35.7)
152 (66.1)
OR (95% CI) a
1.0
1.26 (0.66-2.39)
3.83 (2.15-5.87) c
2.67 (1.62-4.15)
Postmenopausal
Cases, n (%)
77 (21.4)
82 (22.8)
201(55.8)
283 (78.6)
Controls, n (%)
110 (35.0)
55 (17.5)
149 (47.5)
204 (65.0)
OR (95% CI) a
1.0
2.23 (1.39-3.40)
2.06 (1.30-2.97) c
2.59 (1.35-3.06)
Table 8 :
8Associations between PON1 Q192R and L55M genotypes and breast cancerPON1 Q192R
QQ
QR
RR
QR and RR
Premenopausal
Controls, n (%)
144 (62.6)
64 (27.8)
22 (9.6)
86 (37.4)
Cases by stage
Local, n (%)
70 (63.6)
30 (27.3)
10 (9.1)
40 (36.4)
OR (95% CI) a
1.0
0.96 (0.55-1.60)
0.94 (0.32-2.17) b
0.95 (0.60-1.62)
Advanced, n (%)
65 (84.4)
11 (14.3)
1 (1.3)
12 (15.6)
OR (95% CI) a
1.0
0.42 (0.23-0.86)
0.23 (0.06-0.85) c
0.33 (0.14-0.60)
Postmenopausal
Controls, n (%)
196 (62.4)
88 (28.0)
30 (9.6)
118 (37.6)
Cases by stage
Local, n (%)
221 (96.9)
6 (2.6)
1 (0.50)
7 (3.1)
OR (95% CI) a
1.0
0.06 (0.01-0.12)
0.04 (0.00-0.23) d
0.05 (0.00-0.10)
Advanced, n (%)
128 (96.9)
3 (2.3)
1 (0.8)
4 (3.1)
OR (95% CI) a
1.0
0.04 (0.01-0.16)
0.02 (0.00-0.25) e
0.05 (0.01-0.11)
PON1 L55M
LL
LM
MM
LM and MM
Premenopausal
Controls, n (%)
78 (33.9)
70 (30.4)
82 (35.7)
152 (66.1)
Cases by stage
Local, n (%)
16 (14.6)
25 (22.7)
69 (62.7)
94 (85.4)
OR (95% CI) a
1.0
1.71 (0.78-2.99)
4.12 (2.13-7.98) f
3.05 (1.63-5.78)
Advanced, n (%)
14 (18.2)
8 (10.4)
55 (71.4)
63 (81.8)
OR (95% CI) a
1.0
0.62 (0.22-1.70)
3.71 (1.80-7.53) g
2.28 (1.12-4.49)
Postmenopausal
Controls, n (%)
110 (35.0)
55 (17.5)
149 (47.5)
204 (65.0)
Cases by stage
Local, n (%)
49 (21.5)
52 (22.8)
127 (55.7)
179 (78.5)
OR (95% CI) a
1.0
2.15 (1.28-3.75)
1.94 (1.26-2.98) h
1.88 (1.20-2.59)
Advanced, n (%)
28 (21.2)
30 (22.7)
74 (56.1)
104 (78.8)
OR (95% CI) a
1.0
2.16 (1.15-4.22)
1.98 (1.19-3.36) i
2.00 (1.18-3.29)
a Adjusted for age, age at menarche, age at FFTP, number of full term pregnancies, first-degree family history of breast cancer, history of benign
breast disease, use of oral contraceptives, WHR, use of non-steroidal anti-inflammatory drugs (NSAID), alcohol consumption, smoking habits, level
of education and postmenopausal use of estrogen. b P for trend = 0.31; c P for trend = 0.02; d, e , f, g, h, i P for trend = 0.003.
Table 9 :
9Associations between GLO1 genotype and breast cancerwith a higher PON1 activity had a higher frequency of genotypes containing the R and L alleles[28,49]. When the analysis was carried out in subgroups of women according to their menopausal status at diagnosis, the PON 192R variant was associated with a decreased risk of developing BC only among postmenopausal women. Similarly, the PON 192R variant was associated with a decreased risk of BC only among premenopausal women with advanced BC and among postmenopausal patients with both local and advanced BC when compared to controls. As for CYP17 SNP, our results suggest that also PON1 Q192R polymorphism may play a different role in premenopausal and postmenopausal BC etiology. In addition, exogenous factors, environmental conditions, dietary habits and life-style other than genetic compo-nents alone may play a role in determining paraoxonase enzyme activity. Moreover, findings from the present study about the association of PON1-192R variant and BC risk are consistent with those of Gallicchio et al.AA
AE
EE
AA and AE
Table 10 :
10Associations between GLO1 genotype and breast cancer according to menopausal status and tumor stage Adjusted for age, age at menarche, age at FFTP, number of full term pregnancies, first-degree family history of breast cancer, history of benign breast disease, use of oral contraceptives, WHR, alcohol consumption, smoking habits, level of education and postmenopausal use of estrogen. b, c, d, e P for trend = 0.001.AA
AE
EE
AE and EE
Premenopausal
Controls, n (%)
104 (45.2)
88 (38.3)
38 (16.5)
126 (54.8)
Cases by stage
Local, n (%)
26 (23.6)
50 (45.4)
34 (31.0)
84 (76.4)
OR (95% CI) a
1.0
2.17 (1.16-4.0)
3.58 (1.82-7.08) b
2.66 (1.58-4.57)
Advanced, n (%)
13 (16.9)
34 (44.1)
30 (39.0)
64 (83.1)
OR (95% CI) a
1.0
3.05 (1.35-6.65)
6.29 (2.78-14.34) c
4.08 (2.02-4.20)
Postmenopausal
Controls, n (%)
213 (67.8)
71 (22.6)
30 (9.6)
101 (32.2)
Cases by stage
Local, n (%)
55 (24.1)
98 (43.0)
75 (32.9)
173 (75.9)
OR (95% CI) a
1.0
5.31 (3.39-8.25)
9.64 (5.59-16.82) d
6.63 (4.43-9.95)
Advanced, n (%)
25 (19.0)
79 (59.8)
28 (21.2)
107 (81.0)
OR (95% CI) a
1.0
9.44 (5.40-16.55)
7.99 (3.95-16.30) e
8.66 (4.89-15.20)
a
Table 11 :
11Risk's level according to genotypes combination Adjusted for age, age at menarche, age at FFTP, number of full term pregnancies, first-degree family history of breast cancer, history of benign breast disease, use of oral contraceptives, WHR, alcohol consumption, smoking habits, level of education and postmenopausal use of estrogen. ORs are calculated relative to subjects with the reference genotype. Reference genotype GSTP1ValVal-PON1/192RR-PON1/55LL-GLO1AA. Intermediate risk: GSTP1IleVal-PON1/192QR-PON1/55LM-GLO1AE. High risk: GSTP1IleIle-PON1/192QQ-PON1/55MM-GLO1EE.Cases Controls
Genotype
n
n
OR a
95% CI
P
Reference genotype
254
633
1.0
Intermediate risk
643
776
2.32 1.79-2.54 < 0.001
High risk
1291
767
4.22 3.55-5.02 < 0.001
a
(page number not for citation purposes)
a Adjusted for age, age at menarche, age at FFTP, number of full term pregnancies, first-degree family history of breast cancer, history of benign breast disease, use of oral contraceptives, WHR, alcohol consumption, smoking habits, level of education and postmenopausal use of estrogen. b P for trend: all, 0.221; premenopausal, 0.389; postmenopausal, 0.954.
a Adjusted for age, age at menarche, age at FFTP, number of full term pregnancies, first-degree family history of breast cancer, history of benign breast disease, use of oral contraceptives, WHR, alcohol consumption, smoking habits, level of education and postmenopausal use of estrogen.
a Adjusted for age, age at menarche, age at FFTP, number of full term pregnancies, first-degree family history of breast cancer, history of benign breast disease, use of oral contraceptives, WHR, alcohol consumption, smoking habits, level of education and postmenopausal use of estrogen. b P for trend: all, 0.01; premenopausal, 0.29; postmenopausal, 0.001. c P for trend: all, premenopausal, postmenopausal, 0.001.
a Adjusted for age, age at menarche, age at FFTP, number of full term pregnancies, first-degree family history of breast cancer, history of benign breast disease, use of oral contraceptives, WHR, alcohol consumption, smoking habits, level of education and postmenopausal use of estrogen. b P for trend: all, 0.01; premenopausal, 0.03; postmenopausal, 0.01.
AcknowledgementsThe authors thank the Umbrian Voluntary Association "Conoscere per vincere" and Mrs. Roberta Frosini for the excellent technical assistance.Competing interestsThe authors declare that they have no competing interests.Authors' contributionsCA participated in the design of the study and its coordination. Performed the statistical analysis and drafted the manuscript. CDB carried out the burden of the molecular assays (PCRs and RFLP). VL and SG participated in the design of the study and in carrying out the initial phases of the molecular assays (DNA extraction). AR and FB participated in the design of the study and recruited all patients and collected all clinical data. VT conceived of the study and helped to draft the manuscript. All authors read and approved the final manuscript.Pre-publication historyThe pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2407/9/115/pre pub
Time trends of breast cancer survival in Europe in relation to incidence and mortality. M Sant, S Francisci, R Capocaccia, A Verdecchia, C Allemani, F Berrino, Int J Cancer. 11910Sant M, Francisci S, Capocaccia R, Verdecchia A, Allemani C, Berrino F: Time trends of breast cancer survival in Europe in relation to incidence and mortality. Int J Cancer 2006, 119(10):2417-22.
Estrogens and breast cancer. Carcinogenesis. H S Feigelson, B E Henderson, 17Feigelson HS, Henderson BE: Estrogens and breast cancer. Car- cinogenesis 1996, 17(11):2279-84.
Estrogen and its metabolites are carcinogenic agents in human breast epithelial cells. J Russo, M Hasan Lareef, G Balogh, S Guo, I H Russo, J Steroid Biochem Mol Biol. 871Russo J, Hasan Lareef M, Balogh G, Guo S, Russo IH: Estrogen and its metabolites are carcinogenic agents in human breast epi- thelial cells. J Steroid Biochem Mol Biol 2003, 87(1):1-25.
Oxidants and antioxidants in breast cancer. C B Ambrosone, Antioxid Redox Signal. 24Ambrosone CB: Oxidants and antioxidants in breast cancer. Antioxid Redox Signal 2000, 2(4):903-17.
Lipid peroxidation and antioxidant status in blood and tissue of malignant breast tumor and benign breast disease. A Gönenç, D Erten, S Aslan, M Akinci, B Simşek, M Torun, Cell Biol Int. 304Gönenç A, Erten D, Aslan S, Akinci M, Simşek B, Torun M: Lipid per- oxidation and antioxidant status in blood and tissue of malig- nant breast tumor and benign breast disease. Cell Biol Int 2006, 30(4):376-80.
Lipid peroxidation and total antioxidant status in patients with breast cancer. D E Sener, A Gonenc, M Akinci, M Torun, Cell Biochem Funct. 254Sener DE, Gonenc A, Akinci M, Torun M: Lipid peroxidation and total antioxidant status in patients with breast cancer. Cell Biochem Funct 2007, 25(4):377-82.
Carbonyl and oxidative stress in patients with breast cancer -is there a relation to the stage of the disease? Neoplasma. P Tesarová, M Kalousová, B Trnková, J Soukupová, S Argalásová, O Mestek, L Petruzelka, T Zima, 54Tesarová P, Kalousová M, Trnková B, Soukupová J, Argalásová S, Mestek O, Petruzelka L, Zima T: Carbonyl and oxidative stress in patients with breast cancer -is there a relation to the stage of the disease? Neoplasma 2007, 54(3):219-24.
Receptor for advanced glycation end products (RAGE)-soluble form (sRAGE) and gene polymorphisms in patients with breast cancer. P Tesarová, M Kalousová, M Jáchymová, O Mestek, L Petruzelka, T Zima, Cancer Invest. 258Tesarová P, Kalousová M, Jáchymová M, Mestek O, Petruzelka L, Zima T: Receptor for advanced glycation end products (RAGE)-soluble form (sRAGE) and gene polymorphisms in patients with breast cancer. Cancer Invest 2007, 25(8):720-5.
Cloning and sequence of the human gene for P450c17 (steroid 17 alpha-hydroxylase/ 17,20 lyase): similarity with the gene for P450c21. J Picado-Leonard, W L Miller, DNA. 19875Picado-Leonard J, Miller WL: Cloning and sequence of the human gene for P450c17 (steroid 17 alpha-hydroxylase/ 17,20 lyase): similarity with the gene for P450c21. DNA 1987, 6(5):439-48.
Human glutathione S-transferases. Semin Liver Dis. R Whalen, T D Boyer, 18Whalen R, Boyer TD: Human glutathione S-transferases. Semin Liver Dis 1998, 18(4):345-58.
A polymorphism in the CYP17 gene increases the risk of breast cancer. H S Feigelson, G A Coetzee, L N Kolonel, R K Ross, B E Henderson, Cancer Res. 576Feigelson HS, Coetzee GA, Kolonel LN, Ross RK, Henderson BE: A polymorphism in the CYP17 gene increases the risk of breast cancer. Cancer Res 1997, 57(6):1063-5.
Building a multigenic model of breast cancer susceptibility: CYP17 and HSD17B1 are two important candidates. H S Feigelson, R Mckean-Cowdin, G A Coetzee, D O Stram, L N Kolonel, B E Henderson, Cancer Res. 612Feigelson HS, McKean-Cowdin R, Coetzee GA, Stram DO, Kolonel LN, Henderson BE: Building a multigenic model of breast can- cer susceptibility: CYP17 and HSD17B1 are two important candidates. Cancer Res 2001, 61(2):785-9.
CYP17 gene polymorphism and its association with high-risk north Indian breast cancer patients. A Chakraborty, N S Murthy, C Chintamani, D Bhatnagar, R S Mohil, P C Sharma, S Saxena, J Hum Genet. 522Chakraborty A, Murthy NS, Chintamani C, Bhatnagar D, Mohil RS, Sharma PC, Saxena S: CYP17 gene polymorphism and its asso- ciation with high-risk north Indian breast cancer patients. J Hum Genet 2007, 52(2):159-65.
Estrogen-biosynthesis gene CYP17 and its interactions with reproductive, hormonal and lifestyle factors in breast cancer risk: results from the Long Island Breast Cancer Study Project. Y Chen, M D Gammon, S L Teitelbaum, J A Britton, M B Terry, S Shantakumar, S M Eng, Q Wang, I Gurvich, A I Neugut, R M Santella, H Ahsan, Carcinogenesis. 294Chen Y, Gammon MD, Teitelbaum SL, Britton JA, Terry MB, Shanta- kumar S, Eng SM, Wang Q, Gurvich I, Neugut AI, Santella RM, Ahsan H: Estrogen-biosynthesis gene CYP17 and its interactions with reproductive, hormonal and lifestyle factors in breast cancer risk: results from the Long Island Breast Cancer Study Project. Carcinogenesis 2008, 29(4):766-71.
Breast cancer: role of polymorphisms in biotransformation enzymes. J Sarmanová, S Sůsová, I Gut, M Mrhalová, R Kodet, J Adámek, Z Roth, P Soucek, Eur J Hum Genet. 1210Sarmanová J, Sůsová S, Gut I, Mrhalová M, Kodet R, Adámek J, Roth Z, Soucek P: Breast cancer: role of polymorphisms in biotrans- formation enzymes. Eur J Hum Genet 2004, 12(10):848-54.
Polymorphisms in CYP1B1, GSTM1, GSTT1 and GSTP1, and susceptibility to breast cancer. B O Van Emburgh, J J Hu, E A Levine, L J Mosley, N D Perrier, R I Freimanis, G O Allen, P Rubin, G B Sherrill, C S Shaw, L A Carey, L R Sawyer, M S Miller, Oncol Rep. 195Van Emburgh BO, Hu JJ, Levine EA, Mosley LJ, Perrier ND, Freimanis RI, Allen GO, Rubin P, Sherrill GB, Shaw CS, Carey LA, Sawyer LR, Miller MS: Polymorphisms in CYP1B1, GSTM1, GSTT1 and GSTP1, and susceptibility to breast cancer. Oncol Rep 2008, 19(5):1311-21.
Association between glutathione S-transferase M1, P1, and T1 genetic polymorphisms and development of breast cancer. K J Helzlsouer, O Selmin, H Y Huang, P T Strickland, S Hoffman, A J Alberg, M Watson, G W Comstock, D Bell, J Natl Cancer Inst. 907Helzlsouer KJ, Selmin O, Huang HY, Strickland PT, Hoffman S, Alberg AJ, Watson M, Comstock GW, Bell D: Association between glu- tathione S-transferase M1, P1, and T1 genetic polymor- phisms and development of breast cancer. J Natl Cancer Inst 1998, 90(7):512-8.
Genetic polymorphism at the glutathione Stransferase (GST) P1 locus is a breast cancer risk modifier. C M Maugard, J Charrier, A Pitard, L Campion, O Akande, L Pleasants, F Ali-Osman, Int J Cancer. 913Maugard CM, Charrier J, Pitard A, Campion L, Akande O, Pleasants L, Ali-Osman F: Genetic polymorphism at the glutathione S- transferase (GST) P1 locus is a breast cancer risk modifier. Int J Cancer 2001, 91(3):334-9.
Steroid metabolism gene CYP17 polymorphism and the development of breast cancer. K Mitrunen, N Jourenkova, V Kataja, M Eskelinen, V M Kosma, S Benhamou, H Vainio, M Uusitupa, A Hirvonen, Cancer Epidemiol Biomarkers Prev. 912Mitrunen K, Jourenkova N, Kataja V, Eskelinen M, Kosma VM, Ben- hamou S, Vainio H, Uusitupa M, Hirvonen A: Steroid metabolism gene CYP17 polymorphism and the development of breast cancer. Cancer Epidemiol Biomarkers Prev 2000, 9(12):1343-8.
CYP17 5'-UTR MspA1 polymorphism and the risk of premenopausal breast cancer in a German population-based case-control study. E Verla-Tebit, S Wang-Gohrke, Chang-Claude , J , Breast Cancer Res. 74Verla-Tebit E, Wang-Gohrke S, Chang-Claude J: CYP17 5'-UTR MspA1 polymorphism and the risk of premenopausal breast cancer in a German population-based case-control study. Breast Cancer Res 2005, 7(4):R455-64.
CYP17 genetic polymorphism, breast cancer, and breast cancer risk factors. C B Ambrosone, K B Moysich, H Furberg, J L Freudenheim, E D Bowman, S Ahmed, S Graham, J E Vena, P G Shields, Breast Cancer Res. 52Ambrosone CB, Moysich KB, Furberg H, Freudenheim JL, Bowman ED, Ahmed S, Graham S, Vena JE, Shields PG: CYP17 genetic pol- ymorphism, breast cancer, and breast cancer risk factors. Breast Cancer Res 2003, 5(2):R45-51.
The CYP17 MspA1 polymorphism and breast cancer risk: a meta-analysis. Z Ye, J M Parry, Mutagenesis. 172Ye Z, Parry JM: The CYP17 MspA1 polymorphism and breast cancer risk: a meta-analysis. Mutagenesis 2002, 17(2):119-26.
Estrogen-metabolizing gene polymorphisms in the assessment of breast carcinoma risk and fibroadenoma risk in Caucasian women. L A Hefler, C B Tempfer, C Grimm, A Lebrecht, E Ulbrich, G Heinze, S Leodolter, C Schneeberger, M W Mueller, A Muendlein, H Koelbl, Cancer. 1012Hefler LA, Tempfer CB, Grimm C, Lebrecht A, Ulbrich E, Heinze G, Leodolter S, Schneeberger C, Mueller MW, Muendlein A, Koelbl H: Estrogen-metabolizing gene polymorphisms in the assess- ment of breast carcinoma risk and fibroadenoma risk in Cau- casian women. Cancer 2004, 101(2):264-9.
Genetic susceptibility to breast cancer in French-Canadians: role of carcinogen-metabolizing enzymes and gene-environment interactions. M Krajinovic, P Ghadirian, C Richer, H Sinnett, S Gandini, C Perret, A Lacroix, D Labuda, D Sinnett, Int J Cancer. 922Krajinovic M, Ghadirian P, Richer C, Sinnett H, Gandini S, Perret C, Lacroix A, Labuda D, Sinnett D: Genetic susceptibility to breast cancer in French-Canadians: role of carcinogen-metaboliz- ing enzymes and gene-environment interactions. Int J Cancer 2001, 92(2):220-5.
Glutathione S-transferase M1, M3, P1, and T1 genetic polymorphisms and susceptibility to breast cancer. K Mitrunen, N Jourenkova, V Kataja, M Eskelinen, V M Kosma, S Benhamou, H Vainio, M Uusitupa, A Hirvonen, Cancer Epidemiol Biomarkers Prev. 103Mitrunen K, Jourenkova N, Kataja V, Eskelinen M, Kosma VM, Ben- hamou S, Vainio H, Uusitupa M, Hirvonen A: Glutathione S-trans- ferase M1, M3, P1, and T1 genetic polymorphisms and susceptibility to breast cancer. Cancer Epidemiol Biomarkers Prev 2001, 10(3):229-36.
Glutathione S-transferases M1, T1, and P1 and breast cancer. R Millikan, G Pittman, C K Tse, D A Savitz, B Newman, D Bell, Cancer Epidemiol Biomarkers Prev. 96Millikan R, Pittman G, Tse CK, Savitz DA, Newman B, Bell D: Glu- tathione S-transferases M1, T1, and P1 and breast cancer. Cancer Epidemiol Biomarkers Prev 2000, 9(6):567-73.
Glutathione S-transferases M1, T1, and P1 and breast cancer: a pooled analysis. F D Vogl, E Taioli, C Maugard, W Zheng, L F Pinto, C Ambrosone, F F Parl, V Nedelcheva-Kristensen, T R Rebbeck, P Brennan, P Boffetta, Cancer Epidemiol Biomarkers Prev. 139Vogl FD, Taioli E, Maugard C, Zheng W, Pinto LF, Ambrosone C, Parl FF, Nedelcheva-Kristensen V, Rebbeck TR, Brennan P, Boffetta P: Glutathione S-transferases M1, T1, and P1 and breast can- cer: a pooled analysis. Cancer Epidemiol Biomarkers Prev 2004, 13(9):1473-9.
Human serum paraoxonase. B Mackness, P N Durrington, M I Mackness, Gen Pharmacol. 313Mackness B, Durrington PN, Mackness MI: Human serum paraox- onase. Gen Pharmacol 1998, 31(3):329-36.
Mice lacking serum paraoxonase are susceptible to organophosphate toxicity and atherosclerosis. D M Shih, L Gu, Y R Xia, M Navab, W F Li, S Hama, L W Castellani, C E Furlong, L G Costa, A M Fogelman, A J Lusis, Nature. 3946690Shih DM, Gu L, Xia YR, Navab M, Li WF, Hama S, Castellani LW, Fur- long CE, Costa LG, Fogelman AM, Lusis AJ: Mice lacking serum paraoxonase are susceptible to organophosphate toxicity and atherosclerosis. Nature 1998, 394(6690):284-7.
Furlong CE: The molecular basis of the human serum paraoxonase activity polymorphism. R Humbert, D A Adler, C M Disteche, C Hassett, C J Omiecinski, Nat Genet. 31Humbert R, Adler DA, Disteche CM, Hassett C, Omiecinski CJ, Fur- long CE: The molecular basis of the human serum paraoxo- nase activity polymorphism. Nat Genet 1993, 3(1):73-6.
Molecular basis for the polymorphic forms of human serum paraoxonase/arylesterase: glutamine or arginine at position 191, for the respective A or B allozymes. S Adkins, K N Gan, M Mody, La Du, B N , Am J Hum Genet. 523Adkins S, Gan KN, Mody M, La Du BN: Molecular basis for the polymorphic forms of human serum paraoxonase/aryleste- rase: glutamine or arginine at position 191, for the respec- tive A or B allozymes. Am J Hum Genet 1993, 52(3):598-608.
Decreased stability of the M54 isoform of paraoxonase as a contributory factor to variations in human serum paraoxonase concentrations. I Leviev, S Deakin, R W James, J Lipid Res. 424Leviev I, Deakin S, James RW: Decreased stability of the M54 iso- form of paraoxonase as a contributory factor to variations in human serum paraoxonase concentrations. J Lipid Res 2001, 42(4):528-35.
Body mass, polymorphisms in obesity-related genes, and the risk of developing breast cancer among women with benign breast disease. L Gallicchio, M A Mcsorley, C J Newschaffer, H Y Huang, L W Thuita, S C Hoffman, K J Helzlsouer, Cancer Detect Prev. 312Gallicchio L, McSorley MA, Newschaffer CJ, Huang HY, Thuita LW, Hoffman SC, Helzlsouer KJ: Body mass, polymorphisms in obes- ity-related genes, and the risk of developing breast cancer among women with benign breast disease. Cancer Detect Prev 2007, 31(2):95-101.
Association of polymorphisms in the paraoxonase 1 gene with breast cancer incidence in the CPS-II Nutrition Cohort. Cancer Epidemiol Biomarkers Prev. V L Stevens, C Rodriguez, A L Pavluck, M J Thun, E E Calle, 15Stevens VL, Rodriguez C, Pavluck AL, Thun MJ, Calle EE: Associa- tion of polymorphisms in the paraoxonase 1 gene with breast cancer incidence in the CPS-II Nutrition Cohort. Can- cer Epidemiol Biomarkers Prev 2006, 15(6):1226-8.
The glyoxalase system: towards functional characterisation and a role in disease processes. P J Thornalley, Glutathione Metabolism and Physiological Functions. Boca RatonCRC PressThornalley PJ: The glyoxalase system: towards functional char- acterisation and a role in disease processes. In Glutathione Metabolism and Physiological Functions Boca Raton: CRC Press; 1990:135-143.
Proteomic studies identified a single nucleotide polymorphism in glyoxalase I as autism susceptibility factor. M A Junaid, D Kowal, M Barua, P S Pullarkat, Sklower Brooks, S Pullarkat, R K , Am J Med Genet A. 1311Junaid MA, Kowal D, Barua M, Pullarkat PS, Sklower Brooks S, Pullar- kat RK: Proteomic studies identified a single nucleotide poly- morphism in glyoxalase I as autism susceptibility factor. Am J Med Genet A 2004, 131(1):11-7.
Gene-nutrient interactions in cancer etiology. S A Nowell, J Ahn, C B Ambrosone, Nutr Rev. 62Nowell SA, Ahn J, Ambrosone CB: Gene-nutrient interactions in cancer etiology. Nutr Rev 2004, 62:427-38.
Breast cancer risk associated with genotype polymorphism of the estrogen-metabolizing genes CYP17, CYPA1, and COMT: a multigenis study on cancer susceptibility. C S Huang, H D Chern, K J Chang, C W Cheng, S M Hsu, C Y Shen, Cancer Research. 59Huang CS, Chern HD, Chang KJ, Cheng CW, Hsu SM, Shen CY: Breast cancer risk associated with genotype polymorphism of the estrogen-metabolizing genes CYP17, CYPA1, and COMT: a multigenis study on cancer susceptibility. Cancer Research 1999, 59:4870-4875.
Catecholestrogens induce oxidative stress and malignant transformation in human endometrial glandular cells: protective effect of catechol-O-methyltransferase. S A Salama, M Kamel, M Awad, A H Nasser, A Al-Hendy, S Botting, C Arrastia, Int J Cancer. 1236Salama SA, Kamel M, Awad M, Nasser AH, Al-Hendy A, Botting S, Arrastia C: Catecholestrogens induce oxidative stress and malignant transformation in human endometrial glandular cells: protective effect of catechol-O-methyltransferase. Int J Cancer 2008, 123(6):1246-54.
Cellular defenses against damage from reactive oxygen species. B P Yu, Physiol Rev. 741Yu BP: Cellular defenses against damage from reactive oxy- gen species. Physiol Rev 1994, 74(1):139-162.
The tandem of free radicals and methylglyoxal. M P Kalapos, Chem Biol Interact. 1713Kalapos MP: The tandem of free radicals and methylglyoxal. Chem Biol Interact 2008, 171(3):251-271.
Revision of the American Joint Committee on Cancer staging system for breast cancer. S E Singletary, C Allred, P Ashley, L W Bassett, D Berry, K I Bland, P I Borgen, G Clark, S B Edge, D F Hayes, L L Hughes, R V Hutter, M Morrow, D L Page, A Recht, R L Theriault, Thor A Weaver, D L Wieand, H S Greene, F L , J Clin Oncol. 2017Singletary SE, Allred C, Ashley P, Bassett LW, Berry D, Bland KI, Bor- gen PI, Clark G, Edge SB, Hayes DF, Hughes LL, Hutter RV, Morrow M, Page DL, Recht A, Theriault RL, Thor A, Weaver DL, Wieand HS, Greene FL: Revision of the American Joint Committee on Cancer staging system for breast cancer. J Clin Oncol 2002, 20(17):3628-36.
Association for Cancer Research Diet and Cancer: One View at the Start of the Millennium. Willett Walter, C , Cancer Epidemiology Biomarkers & Prevention. 10AmericanWillett Walter C: American Association for Cancer Research Diet and Cancer: One View at the Start of the Millennium. Cancer Epidemiology Biomarkers & Prevention 2000, 10:3-8.
Human drug-metabolizing enzyme polymorphisms: effects on risk of toxicity and cancer. D W Nebert, R A Mckinnon, A Puga, DNA and Cell Biology. 15Nebert DW, McKinnon RA, Puga A: Human drug-metabolizing enzyme polymorphisms: effects on risk of toxicity and can- cer. DNA and Cell Biology 1996, 15:273-280.
The glutathione S-transferase supergene family: regulation of GST and the contribution of the enzyme to cancer chemoprotection and drug resistance. J D Hayes, D J Pulford, Crit Rev Biochem Mol Biol. 30Hayes JD, Pulford DJ: The glutathione S-transferase supergene family: regulation of GST and the contribution of the enzyme to cancer chemoprotection and drug resistance. Crit Rev Biochem Mol Biol 1995, 30:445-60.
Henderson BE: Cytochrome P450c17alpha gene (CYP17) polymorphism is associated with serum estrogen and progesterone concentrations. H S Feigelson, L S Shames, M C Pike, G A Coetzee, F Z Stanczyk, Cancer Res. 584Feigelson HS, Shames LS, Pike MC, Coetzee GA, Stanczyk FZ, Hend- erson BE: Cytochrome P450c17alpha gene (CYP17) polymor- phism is associated with serum estrogen and progesterone concentrations. Cancer Res 1998, 58(4):585-7.
Genetic polymorphism in catechol-o-metyltransferase, menopausal status and breast cancer risk. P A Thompson, P G Shields, J L Freudenheim, A Stone, J E Vena, J R Marshall, S Graham, R Laughlin, T Nemoto, F F Kadlubar, C B Ambrosone, Cancer Res. 58Thompson PA, Shields PG, Freudenheim JL, Stone A, Vena JE, Mar- shall JR, Graham S, Laughlin R, Nemoto T, Kadlubar FF, Ambrosone CB: Genetic polymorphism in catechol-o-metyltransferase, menopausal status and breast cancer risk. Cancer Res 1998, 58:2107-2110.
Molecular cloning, characterization, and expression in Escherichia coli of full-length cDNAs of three human glutathione S. F Ali-Osman, O Akande, G Antoun, J X Mao, J Buolamwini, Ali-Osman F, Akande O, Antoun G, Mao JX, Buolamwini J: Molecu- lar cloning, characterization, and expression in Escherichia coli of full-length cDNAs of three human glutathione S-
transferase Pi gene variants. Evidence for differential catalytic activity of the encoded proteins. J Biol Chem. 27215transferase Pi gene variants. Evidence for differential cata- lytic activity of the encoded proteins. J Biol Chem 1997, 272(15):10004-12.
Regulation of Serum Paraoxonase Activity by Genetic, Nutritional, and Lifestyle Factors in the General Population. N Ferrè, J Camps, J Fernandez-Ballart, V Arija, M M Murphy, S Ceruelo, E Biarnés, E Vilella, M Tous, J Joven, Clin Chem. 499Ferrè N, Camps J, Fernandez-Ballart J, Arija V, Murphy MM, Ceruelo S, Biarnés E, Vilella E, Tous M, Joven J: Regulation of Serum Paraoxonase Activity by Genetic, Nutritional, and Lifestyle Factors in the General Population. Clin Chem 2003, 49(9):1491-1497.
Hardy-Weinberg equilibrium in genetic association studies: an empirical evaluation of reporting, deviations, and power. G Salanti, G Amountza, E E Ntzani, J P Ioannidis, Eur J Hum Genet. 137Salanti G, Amountza G, Ntzani EE, Ioannidis JP: Hardy-Weinberg equilibrium in genetic association studies: an empirical eval- uation of reporting, deviations, and power. Eur J Hum Genet 2005, 13(7):840-8.
Chenevix-Trench G: Polymorphisms at the glutathione S-transferase GSTM1, GSTT1 and GSTP1 loci: risk of ovarian cancer by histological type. A B Spurdle, P M Webb, D M Purdie, X Chen, A Green, Carcinogenesis. 221Spurdle AB, Webb PM, Purdie DM, Chen X, Green A, Chenevix- Trench G: Polymorphisms at the glutathione S-transferase GSTM1, GSTT1 and GSTP1 loci: risk of ovarian cancer by histological type. Carcinogenesis 2001, 22(1):67-72.
| Breast cancer is the most common cancer and the second most frequent cause of cancer mortality in women in the United States (1, 2). Exercise reduces the risk of breast cancer. Therefore, moderate physical activity or exercise is important in breast cancer risk reduction (3). Cytochrome P450 (CYP450) enzymes are hemecontaining proteins that mediate drug biotransformation (4). CYP450 enzymes perform Phase I metabolism of xenobiotic drugs and toxins. There is a relationship between CYP450 and breast cancer (5), but there have been fewer studies of CYP450 and exercise in this disease. Therefore, the purpose of this study was to determine whether breast cancer is differentially affected by CYP450 and exercise could play an important role in breast cancer reduced and CYP450 enzymes within this liver. Fifteen female BALB/C nude mice (10 wk old) in Chungju-si in 2014 were randomly divided into control (n=5), exercise (n=5, 18 m/min treadmill for 30 min, 5 d/wk for 12 wk), and drug treatment (n=5, Taxol 16 mg/kg, 5 d/wk for 12 wk) groups. This study was approved by the local university and all rules by Helsinki declaration were observed exactly. The MCF-7 human breast adenocarcinoma cell line was used as a model of human breast cancer (ATCC; NIH: MCF-7, Catalog #HTB-22). Cells were maintained in RPMI-1640 supplemented with 10% FBS at 37 °C in 5% CO2. Cells were collected and suspended at 25 × 10 6 cells/mL in a mixture of Matrigel (BD Biosciences; Chicago, IL: Lot #005002, 14.6 mg/mL). Mice were injected with 0.2 mL of the cell suspension for a final dose of 5 × 10 6 cells. The cell suspensions were injected subcutaneously on the ventral side of the abdomen using a 23-gauge needle. Beginning approximately 14 d post-implantation, palpable tumors were measured with electronic calipers (Fowler Instruments; Newton, MA) across two perpendicular dimensions. Mice were randomly sorted into groups of three, based on tumor volume. Livers were obtained, weighed, homogenized in 0.1 M potassium phosphate buffer, PH 7.4, containing 0.125 M potassium chloride, 1.0 mM EDTA, and a protease inhibitor mixture (Sigma), and centrifuged at 13000 gr for 25 min. The postmitochondrial fraction was ultra-centrifuged for 45 min at 250000 gr to obtain microsomes. The pellets were suspended in 10 mM Tris-acetate buffer, pH 7.4, containing 0.1 mM EDTA and 23% glycerol and stored at -80 °C. Protein concentrations were measured using the bicinchoninic acid (BCA) protein assay kit (ThermoFisher Scientific, Rockport, IL) with bovine serum albumin. | Exemestane (EXE) is an endocrine therapy commonly used by postmenopausal women with hormone-responsive breast cancer due to its potency in inhibiting aromatase-catalyzed estrogen synthesis. Preliminary in vitro studies sought to identify phase I EXE metabolites and hepatic cytochrome P450s (CYP450s) that participate in EXE biotransformation. Phase I metabolites were identified by incubating EXE with HEK293-overexpressed CYP450s. CYP450s 1A2, 2C8, 2C9, 2C19, 2D6, 3A4, and 3A5 produce 17b-dihydroexemestane (17b-DHE), an active major metabolite, as well as two inactive metabolites. 17b-DHE formation in pooled human liver microsomes subjected to isoform-specific CYP450 inhibition was also monitored using tandem mass spectrometry. 17b-DHE production in human liver microsomes was unaffected by isoform-specific inhibition of CYP450s 2A6, 2B6, and 2E1 but decreased 12-39% following inhibition of drug-metabolizing enzymes from CYP450 subfamilies 1A, 2C, 2D, and 3A. These results suggest that redundancy exists in the EXE metabolic pathway with multiple hepatic CYP450s catalyzing 17b-DHE formation in vitro. To further expand the knowledge of phase I EXE metabolism, the impact of CYP450 genetic variation on 17b-DHE formation was assessed via enzyme kinetic parameters. Affinity for EXE substrate and enzyme catalytic velocity were calculated for hepatic wild-type CYP450s and their common nonsynonymous variants by monitoring the reduction of EXE to 17b-DHE. Several functional polymorphisms in xenobiotic-metabolizing CYP450s 1A2, 2C8, 2C9, and 2D6 resulted in deviant enzymatic activity relative to wild-type enzyme. Thus, it is possible that functional polymorphisms in EXE-metabolizing CYP450s contribute to inter-individual variability in patient outcomes by mediating overall exposure to the drug and its active metabolite, 17b-DHE.Abbreviations 17a-DHE, 17a-dihydroexemestane; 17b-DHE, 17b-dihydroexemestane; 6-HME, 6-Hydroxymethylandrosta-1,4,6-triene-3,17-dione; AKR, aldo-keto reductasecarbonyl reductase 1; CBR1, CYP450, cytochrome P450; EXE, exemestane; HLM, human liver microsomes; UGT2B17, uridine diphosphate glucose glucuronosyltransferase family 2 member B17 (UGT2B17); UPLC/MS/MS, ultra-performance liquid chromatography coupled to tandem mass spectrometry. | Cytochrome P450-C17 enzyme (CYP17) is an important component of the androgen synthesis pathway, a pathway that is dysfunctional in polycystic ovary syndrome (PCOS). Variation in 11-beta hydroxysteroid dehydrogenase (HSD11B1) is associated with cor- tisone reductase deficiency, a condition with a phenotype similar to PCOS. Both CYP17 and HSD11B1 genes have been previously studied for their possible relationship with PCOS, yielding inconsistent results. In this study, we evaluated the association between variation in these genes and PCOS. Two-hundred and eighty-seven Caucasian PCOS women and 187 Caucasian controls were genotyped for single nucleotide polymorphisms (SNPs) that were specifically chosen to allow full coverage of CYP17 and HSD11B1, including four SNPs in CYP17 and eight SNPs in HSD11B1. SNP and haplotype association analyses were conducted. Our results indicate that variants in the two genes are not associated with PCOS, or with the quantitative traits characteristic of PCOS, suggesting that these genes are not major risk factors for the syndrome. | Background ::: Combination of metabolomics and epidemiological approaches opens new perspectives for ground-breaking discoveries. The aim of the present study was to investigate for the first time whether plasma untargeted metabolomic profiles, established from a simple blood draw from healthy women, could contribute to predict the risk of developing breast cancer within the following decade and to better understand the aetiology of this complex disease. ::: ::: ::: Methods ::: A prospective nested case-control study was set up in the Supplémentation en Vitamines et Minéraux Antioxydants (SU.VI.MAX) cohort, including 206 breast cancer cases diagnosed during a 13-year follow-up and 396 matched controls. Untargeted nuclear magnetic resonance (NMR) metabolomic profiles were established from baseline plasma samples. Multivariable conditional logistic regression models were computed for each individual NMR variable and for combinations of variables derived by principal component analysis. ::: ::: ::: Results ::: Several metabolomic variables from 1D NMR spectroscopy were associated with breast cancer risk. Women characterized by higher fasting plasma levels of valine, lysine, arginine, glutamine, creatine, creatinine and glucose, and lower plasma levels of lipoproteins, lipids, glycoproteins, acetone, glycerol-derived compounds and unsaturated lipids had a higher risk of developing breast cancer. P-values ranged from 0.00007 [odds ratio (OR)T3vsT1=0.37 (0.23-0.61) for glycerol-derived compounds] to 0.04 [ORT3vsT1=1.61 (1.02-2.55) for glutamine]. ::: ::: ::: Conclusion ::: This study highlighted associations between baseline NMR plasma metabolomic signatures and long-term breast cancer risk. These results provide interesting insights to better understand complex mechanisms involved in breast carcinogenesis and evoke plasma metabolic disorders favourable for carcinogenesis initiation. This study may contribute to develop screening strategies for the identification of at-risk women for breast cancer well before symptoms appear. | Background and objective: Breast cancer remains the most common cause of cancer mortality in women. The aim of this study was to investigate associations between genetic variability in GSTM1 and GSTT1 and susceptibility to breast cancer.Methods: Genomic DNA was extracted from blood samples for 80 cases of histologically diagnosed breast cancer and 100 control subjects. Genotyping analyses were performed by PCR-based methods. Associations between specific genotypes and the development of breast cancer were examined using logistic regression to calculate odds ratios [1] and 95% confidence intervals (95%CI).Results: No correlation was found between GSTM1null and breast cancer (OR = 1.83; 95%CI 0.90-3.71; p = 0.10), while GSTT1-null (OR = 2.42; 95%CI 1.17-5.02; p= 0.01) was associated with increased breast cancer risk. The GSTM1/GSTT1 double null was not associated with an increased risk of developing breast cancer (OR = 2.52; 95%CI 0.75-8.45; p = 0.20). Furthermore, analysis found no association between GSTM1-null (OR =1.12; 95%CI 0.08-15.50; p = 1.00) or GSTT1-null (OR = 1.71; 95%CI 0.13-22.51; p = 1.00) and the disease stage of familial breast cancer patients or sporadic breast cancer patients (GSTM1 (OR = 0.40; 95%CI 0.12-1.32; p = 0.20) and GSTT1 (OR = 1.41; 95%CI 0.39-5.12; p = 0.75)). Also, body mass index (BMI) was not associated with increased or decreased breast cancer risk in either GSTM1-null (OR = 0.60; 95%CI 0.21-1.68; p = 0.44) or GSTT1-null (OR = 0.60; 95%CI 0.21-1.68; p =0.45).Conclusion: Our results suggest that only GSTT1-null is associated with increased susceptibility to breast cancer development. | Breast cancer (BC) is a common type of tumor. Numerous patients are diagnosed and treated in the early stages of the disease; however, the recurrence rate remains high. Therefore, identifying sensitive and specific tumor markers to prevent and treat BC is essential. c-Myc promoter binding protein 1 (MBP1) is a regulatory molecule located in the cell nucleus. It targets and regulates the expression of various cell proliferation-, apoptosis-and tumor-associated genes. MBP1 expression in BC tissues was detected using immunohistochemistry and further validated in BC and normal human cell lines using RT-qPCR and western blot analysis. Low MBP1 expression, in clinical samples of BC, was associated with a poor prognosis of BC (n=50). MBP1 overexpression effectively inhibited the growth and metastasis of xenograft tumors in vivo. Cell counting kit-8 assays confirmed that the proliferation of the BC cell lines was significantly increased following knockdown of MBP1 expression, while overexpression of MBP1 could significantly inhibit the proliferation of the BC cell lines. Mechanistically, a dual-luciferase assay was used to confirm that MBP1 was the key transcriptional regulator of β-catenin. In addition, MBP1 transcription and hypoxia-inducible factor (HIF-1α) induction were associated. By regulating the hypoxic microenvironmental state in the MDA231 and MCF7 cell lines, it was demonstrated that MBP1 served as a hypoxia-responsive factor and could be a new target for tumor therapy. Taken together, these results suggested that MBP1, as a potential tumor marker associated with prognosis of BC and may serve as a therapeutic target for BC. Moreover, MBP1 plays a critical role in inhibiting the growth and progression of BC cell lines. | Breast cancer is the common cancer and one of the leading causes of death among women worldwide, including Thailand. In 2018, the GLOBOCAN project reported that there were 2,088,849 new cases and 626,679 deaths of breast cancer among women worldwide(Bray et al., 2018). In Thailand, according to the National Cancer Institute (NCI)' s report, breast cancer was the most leading new cancer among Thai women follow by cervix uteri cancer in 2015(Imsamran et al.,2015).As we know glutathione S-transferase M1 and T1 are the enzymes in a supergene family that involved in phase II biotransformation and play a key role in the detoxification of a broad range of xenobiotics. GSTM1 and GSTT1 enzymes catalyze the conjugation of glutathione to electrophilic compounds, resulting in less reactive and more immediately for excretion. Substrates of GST-catalyzed reactions include pre-carcinogens, such as polycyclic aromatic hydrocarbons, pharmacological drugs such as paracetamol, chemotherapeutic agents and free Abstract Objective: Glutathione S-transferase M1 and T1 (GSTM1 and GSTT1) are the key detoxification enzymes of xenobiotics, including chemotherapeutic drugs. The deletion polymorphisms of GSTM1 and GSTT1 genes are associated with reduced enzyme activity that influenced clinical outcomes of chemotherapeutic agents in breast cancer. However, there is limited information among Thai patients. This research aims to explore the frequency and role of GSTM1 and GSTT1 polymorphisms on survival among Thai patients with breast cancer. Methods: The retrospective cohort study was performed. Demographic data and clinicopathology characteristics were collected from hospital base registry data and medical records. A multiplex qualitative real-time PCR method was used to detect the presence or absence of the GSTM1 and GSTT1 gene in the genomic DNA samples of the participants. Results: The frequencies of the GSTM1 and GSTT1 null genotypes in 198 breast cancer patients were 65.70% and 33.30%, respectively. The overall survival at 1, 3 and 5 years were 95.00%, 83.00%, 71.00% respectively. The log rank test and Cox proportional hazards revealed a significant different in the 5-years overall survival according to lymph node metastasis and tumor stage (P = 0.014 and P < 0.001). No associations between overall survival and GSTM1 or GSTT1 genotype were found in single or combined genotypes analyses (P = 0.76 and P= 0.15). Conclusion: The results of our study provided the epidemiological information for prognostic of survival in breast cancer patients treated with chemotherapy. | MicroRNAs (miRNAs) play an important role as regulators of tumor suppressors and oncogenes in cancer-related processes. Single nucleotide polymorphisms (SNPs) in miRNAs have been shown to be relevant to various different cancers, including breast cancer (BC). The aim of this study was to estimate the associations between miRNArelated gene polymorphisms (miR-196a2, miR-499, and miR-608) and the risk of BC in a Chinese population.Gene polymorphisms were analyzed in 1143 subjects (controls ¼ 583; BC ¼ 560). The 3 SNPs were genotyped using the Sequenom Mass-ARRAY platform. The associations between the SNP frequencies and BC were assessed by computing odds ratios (ORs) and 95% confidence intervals (95% CIs), as well as by applying Chisquare tests.The miR-196a2 (rs11614913) T allele was associated with a decreased risk of BC based on results from dominant (OR ¼ 0.67, 95% CI ¼ 0.52-0.86), recessive (OR ¼ 0.65, 95% CI ¼ 0.48-0.86), and allele models (OR ¼ 0.73, 95% CI ¼ 0.62-0.86). In contrast, the miR-499 (rs3746444) AG/GG genotypes were associated with an increased risk of BC (OR ¼ 1.45, 95% CI ¼ 1.10-1.91), and miR-608 (rs4919510) was not significantly associated with BC risk.Our study suggested that the polymorphisms of rs11614913 and rs3746444 may be associated with BC risk in Chinese individuals.(Medicine 95(7):e2826)Abbreviations: BC = breast cancer, BMI = body mass index, CI = confidence interval, ER = estrogen receptor, HER-2 = human epidermal growth factor receptor-2, HWE = Hardy-Weinberg equilibrium, OR = odds ratio, PR = progesterone receptor, SBR = Scarff, Bloom and Richardson, SNP = single-nucleotide polymorphism.Editor: Xiaoxiang Guan. |
1,999,807 | PC Freezing After Upgrading to RTX 2080 | Hey everyone,
Today i upgraded my GPU from a GTX EVGA 970 to a AORUS GTX 1080Ti, but ever since my pc has been freezing.
Screen stays on but the pc just full freezes.
I have reinstalled the driver, tried both through nvidia experience and from their website.
A few things that may tell you more:
I've had a few times it got stuck at start up
i've had a very low resolution start screen
it happens randomly (from what i can see
I can't find anything in the event logg.
My specs are:
AORUS GTX 1080ti 11gb - #kf
Intel i7-6700k (not overclocked)
MSI Z270 Gaming pro carbon motherboard -
16gb corsair memory (cant find exactly which one)
1x Crucial CT480BX200SSD1 (SSD)
2x 2TB SAMSUNG HD204UI (SATA)
Corsair 850rm power supply
Thankyou for your time :) | So, I have a Lenovo Yoga C930 paired with a Visiontek eGFX enclosure with an RTX 2060. For months now it's worked flawlessly and been awesome. Then this week I was out of town an didn't bring the eGPU with me. I was on a metered connection while I was out, so Windows update didn't run. When I got back, despite my Windows settings prohibiting updates without my explicit permission, a bunch of updates ran, and next thing I knew, I was stuck with random freezes whenever my eGPU is connected.
Now, I've helped others on this subreddit fix random freezes with their eGPUs, so I'm pretty familiar with the basic methods of dealing with this problem. But this time I'm coming up short.
I've tried:
* Using DDU in safe mode to clean and reinstall both Intel and NVIDIA GPU drivers... twice.
* Installing older drivers
* Uninstalling Windows updates from the day things broke (unfortunately, Windows had disabled system restore, so that's not an option)
* Checking Event Viewer for errors (nothing is logged at the time of freezing)
* `sfc /scannow`
Is anyone else having issues with recent updates, or any other ideas to diagnose the issue? | freezing\*
&#x200B;
a month ago i got my evga rtx 3070 from microcenter and lately when i'm browsing my PC freezes up i have heard its a pcie gen 4 issue but i'm not sure if it is because others are saying its a driver issue but cyberpunk with ray tracing on ultra runs just fine so i'm not sure if its just a issue with the 3000 series cards in general or the drivers let me know if your having this issue or found a way to resolve it | I recently upgraded my GPU with the gigabyte RTX 2080 OC 8G. And it's sadly sagging for some reason. I just wanted to know some good ways to fix this issue. | ###Troubleshooting Help:
**What is your parts list? Consider formatting your parts list.**
PC Specs:
PSU: CX750
Motherboard: ASRock Z68 Pro3 Gen3
CPU: Intel Core i5 2500k
Memory: 4x8GB Corsair DDR3
GPU: RTX 2080
**Describe your problem. List any error messages and symptoms. Be descriptive.**
So I just bought a RTX 2080 and this is the second time this exact sequence of events happened to me (I ordered a replacement after the first time). What happened was I installed the GPU, it turned on fine and I was getting an output from it (I had a dual monitor setup and one of my monitors is plugged into my motherboard hdmi port). I installed geforce experience and the game drivers through that which went fine. Then I restarted my computer after playing some games for a few hours after which my graphics card was no longer recognized by my computer.
**List anything you've done in attempt to diagnose or fix the problem.**
I have tried:
Using DDU to uninstall all nvidia (and my old amd) drivers
Updating windows 10
Updating my BIOS
Reseating the GPU
Reinstalling the nvidia drivers (which it won't let me do because it doesn't think there's a graphics card installed in the motherboard)
Upgrading my PSU (Was a CX600 when I first restarted and got the original problem, replaced with CX750M, but didn't help)
**Provide any additional details you wish below.**
I really don't want to send this card back a third time. I contacted both nvidia and evga support and neither were very helpful. The only thing I haven't tried yet is checking the gpu on a different pc, which I'm going to try tomorrow.
Please tell me anything I can try, I would very much appreciate it. Thanks!
Edit: To anyone who stumbles across this post in the future. After spending a whole weekend on the phone with Nvidia and EVGA and trying everything I could possibly think of, I ended up just replacing my motherboard. Everything seems to be working now so I guess that was the problem. Good luck. | If you have bought an rtx card ie 2060, 2070, 2080, 2080ti can you comment which card and if it’s been fine so far or had issues? Seen so many reviews with rtx cards failing this should be interesting. | My parents' outdated Dell desktop is freezing at the screen where you select which XP profile you want to use. The computer starts up fine until this screen, at which the mouse is unresponsive. I tried using MouseKeys, but LAlt+LShift+Numlock doesn't enable it. I can't seem to find any keyboard response either, but I'm not entirely sure this screen enables this anyway. I've tried multiple mice, and none work. Any help is appreciated.
*screen in title | So on my windows 10 pc with an rx 570 a ryzen 3 2800 (I think) and 8 GB or ram I have my pc freezing when I play games, go on YouTube or literally anything. I overclocked my ram to 2666 and it freezes less when I play games but anything else like chrome or discord just freezes. And when my games freeze they still run.
I did a hard drive corruption test, all good I defragmented my ssd and hdd. To no avail. Idk what to do.
My mobo burned a fan cable once when I was building it and fan1 dosent work only fan2.
Help. Thanks | 1,999,807 | Hey friends, I am about at my wits end with an issue I have had with my new build. I bought a used RTX 2080 from Facebook Marketplace about a month ago. Seller was a nice guy and provided proof of the card working in his build. I have installed the card and for a week things were going great. The card seems to run fine and nice and cool my only issue is my pc is freezing randomly. It is a strange freeze though, basically everything stops working for the most part but I can move my mouse, drag windows and even CTRL, ALT, DEL and get the task bar up.
The more I move stuff around though the more it breaks till eventually everything is frozen but the mouse. Before I installed the card and was using my old RX 480 8gb I never had this issue. The freezes occur while playing games but have also happened just using power point. Drivers are up to date besides maybe the motherboard BIOS.
I thought it was the power supply (500w EVGA gold) so I switched it for a 750w Bequite PS but the freeze just happened again.
I will attach a video of the freezing below, any help is appreciated. Thank you.
Current Specs:
AMD r5 3600
RTX 2080 EVGA XC
Gigabyte b450m ds3h motherboard
16gb (2x8) Corsair RGB 3000 mhz ram
750w BeQuite PS Gold Rated
1tb 7200 rpm HD
120gb SSD
320 gb old shitty hard drive from an old laptop to put COD on
VIDEO:
EDIT FIX: Found this thread on LTT forums. Turns out it was most likely NZXT CAM fan monitoring software interacting with my new EVGA Precision X1 (for new RTX 2080). This forum has tons of pages of people with the same issue.
| New Computer Freezing, Please Help | Troubleshooting help, 6x RX 580 rig freezing up | PC keeps freezing, no error messages, need help! | Computer/Laptop keeps freezing whenever I don't move my mouse. | experiencing freezing for 2-3 seconds sometimes lately?! | Been having extremely random freezing in many games that I play for 2 years now. Literally at my wit's end and need help. | Freezing while playing Naxx only? | Computer getting very hot and and freezing during gaming |
1,999,808 | The Interpolated Tales in "Joseph Andrews" Again | The current revival of interest in both Jonathan Edwards and eschatology points up the fact that there has been no deliberate effort to bring these two subjects together. The only previous attempt to treat Edwards' doctrine of the last things is that by Frank Hugh Foster, in a series of articles on “The Eschatology of the New England Divines.” 1 Unfortunately, the title promises more than the discussions afford; because Foster's interest is confined almost entirely to the problem of Universalism, his section on Edwards treats only of the doctrine of eternal punishment and serves to perpetuate the common notion that the great Puritan was little more than a preacher of damnation. | A collection of fascinating musical curios by little-known British composers (Sir William Walton is the closest to a major "name" here) in recordings from the 1920's to the 1950's, expertly rehabilitated by Michael Dutton. Ironically, the best tracks are inspired by the plays of Sir James M. Barrie -- Walton's "The Boy David" cues (judging from the numbers on the records -- 21, 22A and 29 -- he wrote a lot more for this play and it's a pity the rest of it is lost!) and Norman O'Neill's "Mary Rose," a fascinating piece of music that, as Alfred Hitchcock (who in the 1960's co-wrote a film script based on the play) said, sounds like Debussy's haunting nocturne "Sirnes." Also especially noteworthy are the ballet music from Eugene Goossens' opera "Judith" and Billy Mayerl's "Sennen Cove," which sounds a good deal like the light-classical pieces Ferde Grof wrote for Paul Whiteman. If this CD has a flaw, it's that too many of the pieces sound similar even though nine different composers are represented; they tend to fall into the quiet, pastoral mode so beloved of British composers of the period. But much of this music is worth hearing. | The historical background miller includes in yhe crucible is? | Three resons for Arthur Miller writing The Crucible? | Sybil Andrews thrill of action. Andrews furthermore portrays the vibrancy found in typical English social imagery, which ranged from rural life, farmlands, manual work, and the various intricacies of city life. Additionally, during the 1930s, Andrews created seven linocuts based on the drama of the life of Christ. Formally, Andrews’ works utilizes the principles of modernist design: simplified, geometric forms combined with vibrant, flat colors, and dramatic arrangements – suggesting the dynamism of modern life. Another common technique employed by Andrews is the retention of the paper, which functions as its own color resulting in sharp definition and high contrast between forms. | Transgressive Transformations: Representations of Maid Marian in Robin Hood Retellings | Samuel Jackson Pratt War of Independence, and, secondly, that it was the first English novel to address the subject of the American Revolution. As well as his poems, novels and 'miscellanies', Pratt drew upon his theatre experience to write ten plays, although three were never performed or published. His first play, "Joseph Andrews", was an adaptation of Henry Fielding's novel of the same name, and was acted at Theatre Royal, Drury Lane on 20 April 1778, with the role of Fanny being played by Mary Robinson. Pratt would eventually write the epitaph for Mary Robinson's tombstone. The play has never been published. His | This wonderful version of the Great American Legend-John Henry really comes to life with beautiful illustrations, fun songs and tall tales. A great addition to any child's library. | 1,999,808 | T IS only recently that we have come to recognize the thematic function often fulfilled by the digressive episode, and Homer Goldberg's article, "The Interpolated Stories in Joseph Andrews or 'The History of the World in General' Satirically Revised,"1 must rank as the most penetrating discussion we have so far been offered of Fielding's handling of the device in his first novel. Nevertheless, we still lack an adequate account of the relationship of two of these tales, that of "The Unfortunate Jilt" (Book II, chaps. iv and vi) and "The History of two Friends" (IV, x), to the surrounding narrative, and since Goldberg has reopened the matter, I should like to take the opportunity of attempting such an account here.2 | As one of the writers analyzed in Story Craft, ... | Reader, Critic, and the Form of John Hawkes's: The Cannibal | Theory about the story of the WRLD EP. | An alternate history that is interesting and mildly plausible under ... | It jumped between the past and present quite a bit ... | The Humour of Homer and Other Essays | where was the true story of aq published | Thrilling historical account. |
1,999,809 | How is a worm different from a typical virus? | What the difference between a bacteria and a virus? | Define and explain the differences between viruses worms logic bombs and trojans horses? | The best-known types of malware, viruses and worms, are known for the manner in which they spread, rather than any specific types of behavior. A computer virus is software that embeds itself in some other executable software (including the operating system itself) on the target system without the user's knowledge and consent and when it is run, the virus is spread to other executables. On the other hand, a "worm" is a stand-alone malware software that "actively" transmits itself over a network to infect other computers. These definitions lead to the observation that a virus requires the user to run | What is the difference between viruses worms logic bombs? | What are similarities of viruses and living organisms? | What distinguishes viruses from other microorganisms? | What can worms do to a computer? | What is the class of the worm? | 1,999,809 | What is the difference between a virus and a worm? | what is the difference between malware and virus? | Difference between bacteria and virus? | What makes a virus different from other Microbes? | ELI5: What is the difference between Anti-Malware and Anti-Virus? | Define the difference of viruseswormslogic bombstrojan horses? | What is the difference between anti-virus and internet security ? | Is generic host process a virus? | How are viruses and cell alike? |
1,999,810 | what is the exponential value of solid argon | Electron affinity In chemistry and atomic physics, the electron affinity ("E") of an atom or molecule is defined as the amount of energy "released" or "spent" when an electron is added to a neutral atom or molecule in the gaseous state to form a negative ion. In solid state physics, the electron affinity for a surface is defined somewhat differently (see below). This property is measured for atoms and molecules in the gaseous state only, since in a solid or liquid state their energy levels would be changed by contact with other atoms or molecules. A list of the electron | I have a valence electron question. In school, I learned about elements having up to 8 valence electrons, and once they have 8 their shell is satisfied. But I am confused by n=3 being able to have up to 18 electrons in its shell. I can't reconcile this concept in my brain, why those elements with an n=3 shell still only need 8 electrons and not the full 18. I understand there are orbitals but something is missing for me. Can anyone help explain it? Thank you | Whatm is the value od pi? | Just curious as to why atoms always tend towards eight outer electrons for stability, no matter how many the shell can actually hold. What is so fundamentally desirable about it? | results on the imaginary axis. Plotted in the complex plane, the entire sequence spirals to the limit , which could be interpreted as the value where is infinite. Such tetration sequences have been studied since the time of Euler, but are poorly understood due to their chaotic behavior. Most published research historically has focused on the convergence of the infinitely iterated exponential function. Current research has greatly benefited by the advent of powerful computers with fractal and symbolic mathematics software. Much of what is known about tetration comes from general knowledge of complex dynamics and specific research of the exponential | How many electron are their in titanium? | If I have the problem set up:
2.73=Ea/8.314(4.8214x10^-4)
How do I solve for the activation energy? | How many electrons are there in the outermost shell of nitrogen? | 1,999,810 | Virial expansion which requires that the Gibbs free energy of liquid phase and that of solid phase must be equal under the triple point temperature and pressure. To produce a solid phase in argon, the exponential value n must be very large, larger than 20; otherwise, the PVT isotherm would not bend to an S-shape between liquid and solid. The best estimation is that "n" = 30, formula_85, formula_86, and formula_87. The isotherm is shown in the right figure, in which three virial terms are plotted separately for clarity: In this figure, formula_92 represents the sum of the first three virial terms, | A differential Burnett apparatus: virial coefficients for argon and neopentane at various temperatures☆ | Elastic-constant measurements in solid argon at the melting point | Properties of solid argon under pressure | The second virial coefficients of some gas mixtures | Mean-square torque of CO2 mixed with argon. interpretation in terms of intermolecular potentials | Geometric Thermodynamic Description of the Congruent-Melting Points of Solid Solutions in Binary | The gas-liquid transition for 12-6 argon: a grand ensemble Monte Carlo calculation | Temperature, pressure and volume dependence of the Grüneisen parameter of dense gaseous and liquid argon |
1,999,811 | Sterile endophthalmitis appears as an infrequent complication of intravitreal injections and seems to develop mainly in the context of the off-label use of drugs that have not been conceived for intravitreous administration. The aetiology of sterile endophthalmitis, independently of the administered drug, remains uncertain and a multifactorial origin cannot be discarded. Sterile inflammation secondary both to intravitreal triamcinolone acetonide and to intravitreal bevacizumab share many characteristics such as the acute and painless vision loss present in the big majority of the cases. Dense vitreous opacity is a common factor, while anterior segment inflammation appears to be mild to moderate. In eyes with sterile endophthalmitis, visual acuity improves progressively as the intraocular inflammation reduces without any specific treatment. If by any chance the ophthalmologist is not convinced by the sterile origin of the inflammation, this complication must be treated as an acute endophthalmitis because of the devastating visual prognosis of this intraocular infection in the absence of therapy. | AIMS ::: The aim of this study was to evaluate the rate of infectious and noninfectious endophthalmitis after an intravitreal injection of bevacizumab. ::: ::: ::: METHODS ::: This clinical interventional case-series study included 1218 intravitreal injections of 1.5 mg of bevacizumab consecutively performed for 684 eyes with exudative age-related macular degeneration. Among the injections were 534 reinjections. Follow-up after each injection was at least 4 weeks. ::: ::: ::: RESULTS ::: One (1) eye developed an infectious endophthalmitis 3 days after a second injection. In none of the other eyes, were signs of an infectious or noninfectious endophthalmitis observed with the cellular infiltration or amorphous opacification of the vitreous as marked by the Tyndall phenomenon in the anterior chamber, retinal infiltration, or pain. ::: ::: ::: CONCLUSIONS ::: The rate of infectious endophthalmitis after an intravitreal injection of 1.5 mg bevacizumab may be approximately 1:1000, similar to injections of other drugs available thus far. |
Background
Endogenous endophthalmitis is an infection due to fungi or bacteria that enter the eye through the circulating blood, causing inflammation of intraocular tissues such as the vitreous body and retina. Endogenous endophthalmitis accounts for 2 to 15% of all cases of endophthalmitis [1,2]. Herein we report one cases of Unilateral Endogenous Fungal Endophthalmitis After Esophageal Cancer Surgery.
Case presentation
A 63-year-old man visited our hospital's outpatient clinic on August 1, 2016, reporting a month-long loss of vision in his left eye; he was admitted with the tentative diagnosis of uveitis. He had been treated at another hospital a month earlier with no improvement, and his vision continued to deteriorate. As for the patient's medical history, he had surgery for esophageal cancer 2 months earlier. The results of the eye examination were as follows: his visual acuity was only light perception in the left eye, respectively. In the left eye, we observed a transparent cornea, mild aqueous flare, partial posterior synechia, nondilating pupil, and pigment deposits on the anterior lens capsule (Fig. 1a). In addition, the part of lens behind the pupil was highly turbid, and the fundus could not be seen. B-scan ultrasonography showed pronounced vitreous opacities and macular retinal thickening in the left eye (Fig. 1b). On August 3, 2016, under local anesthesia, the patient underwent cataract surgery (by phacoemulsification) in the left eye combined with 25-gauge vitrectomy and silicone oil tamponade. During the surgery, we noticed vitreous opacities that looked like floccose white balls as well as flocculent vitreous opacities; part of the vitreous was therefore aspirated for bacterial and fungal culture. After the turbid vitreous body was removed, we observed a flat retina and a many beaded or yeast-like white plaques and spots in retina. We also found that the ciliary body was coated with a white film-like substance (Fig. 1c). So, a pus sample was collected from his vitreous body for routine microbial cultivation. After incubation for 24 h, cream white colonies without hemolytic reaction were detected. Gram staining showed the presence of Gram-positive spore morphology clusters. The strain was identified with YST card by Vitek 2 Compact system (bioMérieux, USA) as Candida albicans. In addition, antibiotic susceptibility tests were determined using the ATB™ fungns 3 kit (bioMérieux, USA), and the strain was found to be susceptible to fluconazole, itraconazole, amphotericin B, voriconazole, and 5-fluorocytosine. At the meantime, we had collected a sample for blood culture; after two days, the patient refused to collect another blood samples for culture again. So it's very regret that we couldn't obtained a positive result for blood culture. Subsequently the patient received antifungal treatment via an intravenous infusion comprising 0.1 g of fluconazole once daily for 3 days followed by the oral administration of 100 mg of itraconazole once daily for 1 month. At 3-month follow-up, the unaided visual acuity of left eye was 0.02 and corrected visual acuity was 0.2. The color fundus photograph showed that the vitreous cavity of the left eye was filled with silicone oil, the retina was flat, and there were no white exudates in retina (Fig. 1d). These results indicated a good recovery. In addition, there was no recurrence of the endophthalmitis within 1 year of the surgery.
Discussion and conclusions
Endogenous fungal endophthalmitis is characterized by its low incidence, insidious onset, and high degree of destructiveness, which can lead to atrophy of the eyeball and permanent visual impairment. The risk factors for endogenous fungal endophthalmitis include systemic diseases (e.g., diabetes, liver cirrhosis, malignant tumors, and acquired immunodeficiency syndrome) and/or the presence of an infectious lesion (e.g., liver abscess, meningitis, and lung abscess) [2][3][4]. Among all cases of endogenous fungal endophthalmitis, endogenous C. albicans endophthalmitis is the most common type, representing 75 to 80% of the cases; Aspergillus is the second most common causative organism [5][6][7]. The effective treatment of endogenous fungal endophthalmitis rests on the combination of timely vitrectomy and systemic antifungal therapy. In addition, silicone oil has antimicrobial activity against Staphylococcus aureus, Pseudomonas aeruginosa, and C. albicans [8,9]. The patient reported here, who suffered from endogenous C. albicans endophthalmitis, had the risk factor of a malignant tumor. Before we operated on his eye, the endophthalmitis had progressed to stage III (vitreous opacity), and the eye could only perceive light. Following timely surgery and antifungal treatment, we were able to restore partial visual function to the affected eye. In general, the early diagnosis of endogenous fungal endophthalmitis is difficult, and the disease is very likely to be misdiagnosed as uveitis. Moreover, with the improper use of steroids or immunosuppressive agents, endogenous fungal endophthalmitis can rapidly progress. In recent years, in the context of the increased use of intravenous drugs and the application of immunosuppressive agents, the incidence of endogenous fungal endophthalmitis has tended to increase. It is therefore critical to improve awareness of this condition and to reduce the incidence of its misdiagnosis.
Fig 1 a
1Mixed conjunctival hyperemia, mild corneal edema, aqueous flare, posterior synechia, non-dilating pupil, and pigment deposits on the anterior lens capsule were observed in the left eye. b Pronounced vitreous opacity and macular retinal thickening was observed in the left eye. c A large amount of beaded or cheesy white exudates in the posterior pole and the peripheral retina was observed during the surgery. The lower right figure showed that the ciliary body was coated with a white film-like substance. d At the 1-month follow-up, the color fundus photograph showed that the vitreous cavity was filled with silicone oil, the retina was flat, and no white exudates was observed in retina
AcknowledgementsNot Applicable.FundingThis study is supported by the Natural Science Foundation of Ningbo City (2017A610237).and by the Projects of medical and health technology development program in Zhejiang province (2017KY619).Availability of data and materialsThe data supporting conclusions of this article are included within this article.Competing interestsThe authors declare that they have no competing interests.Publisher's NoteSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.Authors' contributions Q.Y. and W.L. were involved with the design of the research. Q.Y. performed the surgery. L.C. and Z.B. assembled and analyzed the data. All of the authors reviewed the data and participated in the writing of the manuscript. All authors read and approved the final manuscript.Ethics approval and consent to participate Not applicable.Consent for publicationWritten informed consent was obtained from the patient for publication of this Case Report and any accompanying images.
Endogenous endophthalmitis from the perspective of the Holistic Integrative Medicine. W Hong, W Wenbing, S Lin, Chin J Ophthalmol Med. 51Hong W, Wenbing W, Lin S. Endogenous endophthalmitis from the perspective of the Holistic Integrative Medicine. Chin J Ophthalmol Med. 2015;5(1):1-4.
Endogenous endophthalmitis: 10-year experience at a tertiary referral Centre. P P Connell, E C O'neill, D Fabinyi, F M Islam, R Buttery, M Mccombe, R W Essex, E Roufail, B Clark, D Chiu, Eye. 251Connell PP, O'Neill EC, Fabinyi D, Islam FM, Buttery R, McCombe M, Essex RW, Roufail E, Clark B, Chiu D, et al. Endogenous endophthalmitis: 10-year experience at a tertiary referral Centre. Eye. 2011;25(1):66-72.
Endogenous endophthalmitis in the Korean population: a six-year retrospective study. H W Lim, J W Shin, H Y Cho, H K Kim, S W Kang, S J Song, H G Yu, J R Oh, J S Kim, S W Moon, Retina. 343Lim HW, Shin JW, Cho HY, Kim HK, Kang SW, Song SJ, Yu HG, Oh JR, Kim JS, Moon SW, et al. Endogenous endophthalmitis in the Korean population: a six-year retrospective study. Retina. 2014;34(3):592-602.
Endogenous Endophthalmitis in the American and Korean population: an 8-year retrospective study. H Cho, Y U Shin, N H Siegel, H G Yu, L Sobrin, A Patel, M L Durand, J W Miller, D Husain, Ocul Immunol Inflamm. 264Cho H, Shin YU, Siegel NH, Yu HG, Sobrin L, Patel A, Durand ML, Miller JW, Husain D. Endogenous Endophthalmitis in the American and Korean population: an 8-year retrospective study. Ocul Immunol Inflamm. 2016: 26(4):496-503.
The diagnosis and treatment of candida endophthalmitis. S Xuguang, Z Jialiang, Chin J Infect Chemother. 112Xuguang S, Jialiang Z. The diagnosis and treatment of candida endophthalmitis. Chin J Infect Chemother. 2011;11(2):112-3.
Etiology and pathogens of fungal endophthalmitis. S Shiying, Z Ge, S Xiaoyan, W Qian, Y Bin, Chin J Ophthalmol Med. 5011Shiying S, Ge Z, Xiaoyan S, Qian W, Bin Y. Etiology and pathogens of fungal endophthalmitis. Chin J Ophthalmol Med. 2014;50(11):808-13.
Endogenous fungal endophthalmitis: causative organisms, management strategies, and visual acuity outcomes. K J Chen, W C Wu, M H Sun, C C Lai, A N Chao, Am J Ophthalmol. 1541Chen KJ, Wu WC, Sun MH, Lai CC, Chao AN. Endogenous fungal endophthalmitis: causative organisms, management strategies, and visual acuity outcomes. Am J Ophthalmol. 2012;154(1):213-4 author reply 214.
Outcomes of primary Transconjunctival 23-gauge vitrectomy in the diagnosis and treatment of presumed endogenous fungal Endophthalmitis. A William, M S Spitzer, C Deuter, G Blumenstock, M Partsch, B Voykov, F Ziemssen, K U Bartz-Schmidt, D Doycheva, Ocul Immunol Inflamm. 2016William A, Spitzer MS, Deuter C, Blumenstock G, Partsch M, Voykov B, Ziemssen F, Bartz-Schmidt KU, Doycheva D. Outcomes of primary Transconjunctival 23-gauge vitrectomy in the diagnosis and treatment of presumed endogenous fungal Endophthalmitis. Ocul Immunol Inflamm. 2016:1-7.
The role of early vitrectomy in the treatment of fungal endogenous Endophthalmitis. F A Birnbaum, G Gupta, Retin Cases Brief Rep. 103Birnbaum FA, Gupta G. The role of early vitrectomy in the treatment of fungal endogenous Endophthalmitis. Retin Cases Brief Rep. 2016;10(3):232-5.
|
Introduction
Intravitreal bevacizumab is now widely used to treat macular edema secondary to different pathological conditions including diabetic retinopathy, venous occlusive disease, and uveitis. However, infectious endophthalmitis can occur following any ocular surgical procedure including intravitreal injection. 1 Noninfectious endophthalmitis after intravitreal injection sometimes shows similar symptoms such as sudden decreased vision. Therefore, it is important to make a prompt differentiation between infectious and noninfectious endophthalmitis.
We report a case of endophthalmitis that developed after the third intravitreal injection of bevacizumab. The endophthalmitis was caused by Staphylococcus epidermidis, which was identified by using polymerase chain reaction (PCR). Although his best-corrected visual acuity was restored to 20/40 in the right eye, ophthalmoscopy and by optical coherence tomography showed that the macular edema had recurred two months after the vitreous surgery. The patient did agree to a third intravitreal bevacizumab injection, which was given on October 14, 2008. Two days later the patient returned to our hospital complaining of decreased vision in his right eye. Examination showed that his best-corrected visual acuity was 20/200 in the right eye with mild ciliary injection and moderate nongranulomatous inflammation of the anterior chamber. Slitlamp examination also showed hypopyon and mutton-fat keratic precipitates (KP). The fundus of the right eye was not visible because of corneal folds and a moderate anterior chamber inflammation.
Case report
He was immediately admitted into our hospital and received intravitreal ceftazidime and vancomycin, and subconjunctival vancomycin. He was started on topical levofloxacin and cefmenoxime hydrochloride, and intravenous cefpirome (CPR). The ocular inflammation gradually decreased, but the intravenous antibiotic was continued for two additional weeks and then replaced by oral therapy. At three months, his best-corrected visual acuity remained at 30/200. Although cultures and broad-range PCR failed to detect any bacterial pathogens, the DNA of S. epidermidis was detected in the aqueous humor sample by PCR using each specific primer against S. aureus and S. epidermidis.
Discussion
The development of infectious endophthalmitis after an intravitreal bevacizumab injection has been reported. Fintak and colleagues describe three cases of endophthalmitis following an intravitreal injection of bevacizumab, and the incidence was calculated to be 0.02%. 2 Two of their cases were caused by S. viridans and one by S. epidermidis. 2 The incidence of endophthalmitis following intravitreal bevacizumab injection in large case series was reported to be 0.019 and 0.099%. [3][4][5] Wickremasinghe et al reported the development of acute intraocular inflammation in 19 of 1278 (0.1%) cases who had had an intravitreal bevacizumab injection. 6 Five of the cases were severe, and cultures of the vitreous aspirate detected Propionbacterium acnes in two cases, coagulase-negative staphylococcus species in one case, and no microbial growth in two cases. Sterile endophthalmitis after repeated intravitreal injections of bevacizumab injection has also been reported. 7 In our department, a total of 413 intravitreal injections of bevacizumab were undertaken between March 2007 and November 2009. Of those, only this case developed bacterial endophthalmitis following bevacizumab intravitreal injections. No eyes had acute intraocular inflammation in our series. The incidence of endophthalmitis following intravitreal bevacizumab injection in our case series was 0.24%, which was slightly higher than other reports. In our case that developed endophthalmitis, the prompt identification of S. epidermidis in the aqueous humor aspirate by PCR could lead to appropriate management.
The risk of infectious endophthalmitis is always a concern when an intraocular procedure is performed. An improvement of the sterilizing procedures should help minimize the adverse event. This includes both pre-, intra-, and postoperative procedures. 8 In this instance, we supposed an inadequate sterilization as the possible source of infectious endophthalmitis. Thereafter special care is taken with the additional administration of topical antibiotics three days before the operation, the complete covering of eyelashes with a sterile drape, and the use of 5% povidone iodine for a few minutes before surgery. Our case demonstrates that endophthalmitis can develop after intravitreal injection of bevacizumab, and PCR is useful for differentiation from sterile endophthalmitis.
A 77 -
77year-old man had undergone uncomplicated phacoemulsification with implantation of a posterior chamber intraocular lens (IOL) in both eyes followed by Nd:YAG laser posterior capsulotomy in his right eye. He was referred to the Gifu University Graduate School of Medicine on May 24, 2007 with a complaint of blurred vision in his right eye. He had suffered from systemic hypertension and diabetes mellitus. Our This article was published in the following Dove Press journal: Clinical Ophthalmology 10 July 2010 Number of times this article has been viewed submit your manuscript | www.dovepress.com Dovepress Dovepress initial examination showed that his best-corrected visual acuity was 20/100 OD and 20/32 OS. Fundus examination revealed the scars of panretinal photocoagulation (PRP), and residual macular edema secondary to a central retinal vein occlusion in his right eye. He received two intravitreal injections of bevacizumab on May 31, 2007 and December 11, 2007, and underwent pars plana vitrectomy on March 5, 2008.
DisclosureThe authors report no proprietary or financial interest in any products used in this study.
Reducing the risk of endophthalmitis following intravitreal injections. I U Scott, Flynn HwJr, Retina. 271Scott IU, Flynn HW Jr. Reducing the risk of endophthalmitis following intravitreal injections. Retina. 2007;27(1):10-12.
Incidence of endophthalmitis related to intravitreal injection of bevacizumab and ranibizumab. D R Fintak, G K Shah, K J Blinder, Retina. 2810Fintak DR, Shah GK, Blinder KJ, et al. Incidence of endophthalmitis related to intravitreal injection of bevacizumab and ranibizumab. Retina. 2008;28(10):1395-1399.
Serratia marcescens endophthalmitis associated with intravitreal injections of bevacizumab. S H Lee, S J Woo, K H Park, Eye. 242Lee SH, Woo SJ, Park KH, et al. Serratia marcescens endophthalmitis associated with intravitreal injections of bevacizumab. Eye. 2010; 24(2):226-232.
Incidence and management of acute endophthalmitis after intravitreal bevacizumab (Avastin) injection. O Artunay, E Yuzbasioglu, R Rasier, A Sengül, H Bahcecioglu, Eye. 232Artunay O, Yuzbasioglu E, Rasier R, Sengül A, Bahcecioglu H. Incidence and management of acute endophthalmitis after intravitreal bevacizumab (Avastin) injection. Eye. 2009;23(2):2187-2193.
Key topics include: Optometry; Visual science; Pharmacology and drug therapy in eye diseases; Basic Sciences; Primary and Secondary eye care; Patient Safety and Quality of Care Improvements. This journal is indexed on PubMed Central and CAS, and is the official journal of The Society of Clinical Ophthalmology (SCO). The manuscript management system is completely online and includes a very quick and fair peer-review system. Mason, M F White, R M Feist, Retina. 284clinical-ophthalmology-journal Clinical Ophthalmology is an international, peer-reviewed journal covering all subspecialties within ophthalmologyMason JO 3rd, White MF, Feist RM, et al. Incidence of acute onset endophthalmitis following intravitreal bevacizumab (Avastin) injection. Retina. 2008;28(4):564-567. manuscript here: http://www.dovepress.com/clinical-ophthalmology-journal Clinical Ophthalmology is an international, peer-reviewed journal covering all subspecialties within ophthalmology. Key topics include: Optometry; Visual science; Pharmacology and drug therapy in eye diseases; Basic Sciences; Primary and Secondary eye care; Patient Safety and Quality of Care Improvements. This journal is indexed on PubMed Central and CAS, and is the official journal of The Society of Clinical Ophthalmology (SCO). The manuscript management system is completely online and includes a very quick and fair peer-review system, which is all easy to use. Visit http://www.dovepress.com/ testimonials.php to read real quotes from published authors.
. Clinical Ophthalmology. Clinical Ophthalmology 2010:4 submit your manuscript | www.dovepress.com
Acute intraocular inflammation after intravitreous injections of bevacizumab for treatment of neovascular age-related macular degeneration. S S Wickremasinghe, K Michalova, J Gilhotra, R H Guymer, C A Harper, T Y Wong, Ophthalmology. 11511Wickremasinghe SS, Michalova K, Gilhotra J, Guymer RH, Harper CA, Wong TY, et al. Acute intraocular inflammation after intravitreous injec- tions of bevacizumab for treatment of neovascular age-related macular degeneration. Ophthalmology. 2008(11);115:1911-1915.
A case of sterile endophthalmitis after repeated intravitreal bevacizumab injection. N M Yenerel, U A Dinc, E Gorgun, J Ocul Pharmacol Ther. 243Yenerel NM, Dinc UA, Gorgun E. A case of sterile endophthalmitis after repeated intravitreal bevacizumab injection. J Ocul Pharmacol Ther. 2008;24(3):362-363.
How to prevent endophthalmitis in cataract surgeries?. A Kelkar, J Kelkar, W Amuaku, Indian J Ophthalmol. 565Kelkar A, Kelkar J, Amuaku W, et al. How to prevent endophthalmitis in cataract surgeries? Indian J Ophthalmol. 2008;56(5):403-407.
|
Cataract surgery is the most common procedure in the field of ophthalmology and in the majority of local ophthalmologic clinics. There are many potential postoperative complications, the most serious of which is endophthalmitis. 1 The incidence of bacterial endophthalmitis was 0.57% 2 in the largest published series prior to 1973. Recently, the incidence was reported to be as low as 0.048% 3 in the experience of New Zealand ophthalmologists. While bacterial endophthalmitis is a treatable complication given appropriate medical and surgical intervention, postoperative fungal endophthalmitis is a rare complication that frequently carries a worse prognosis. [4][5][6] A 76 year-old woman was referred from a local ophthalmologic clinic for suspected delayed onset postoperative bacterial endophthalmitis following cataract and intraocular lens implantation three months prior to referral. Outside medi-cal records indicated that she had sustained iritis and that while the intraocular inflammation had been partially treated with antibiotics and steroid therapy (i.e. topical and subconjuntival triamcinolone injections), vision was decreased to hand movement only in her right eye. Upon referral, the eye showed signs of anterior uveitis, thick white precipitation on the intraocular lens and severe vitreous opacification. Intraocular lens removal, anterior vitrectomy and an intravitreal Vancomycin injection were administered the following day. Fungal culture revealed growth of Candida parapsilosis and systemic and topical Amphotericin B were subsequently administrated. Inflammation resolved within three months but later recurred, resulting in phthisis with total retinal detachment. The seven consecutive cases resembling the initial case had also been seen at the vitreoretinal section of our department within the local clinic. The authors presumed that all cases were secondary to fungal endophthalmitis as they presented with similar inflammatory findings to the preceding case and stemmed from the same environment. Extensive surgical and medical treatment was administered and favorable results occurred during the two-year follow-up period.
Materials and Methods
The present study is a retrospective observational case series of fungal endophthalmitis occurring within our institution after experiencing a preceding case of postoperative endophthalmitis which resulted in blindness. Extensive surgical intervention included complete vitrectomy and removal of the intraocular lens and capsule. All cases were eventually confirmed by fungal culture. Final corrected visual acuity and postoperative complications were evaluated over a period of greater than two years follow-up.
Three males and four females with ages ranging from the 5th to 9th decade (mean; 71.0 years), with no significant systemic disorders or eye pathology other than senile cataracts were included in this study. All patients demonstrated mild immediate postoperative inflammation, but experienced inflammatory relapse several times during the ensuing one to two months despite treatment with systemic and topical steroids. All received several subconjuntival triamcinolone injections but were ultimately referred for failure of inflammatory resolution.
On physical examination all seven cases presented with the same ocular findings. Conjunctivae were injected and inflammatory cells filled the anterior chamber. Whitish inflammatory material was attached to the periphery of the intraocular lens and lens capsule (Fig. 1). The fundus was blurred due to vitreous inflammation and ultrasonography revealed vitreous opacification (Fig. 1).
Within 24-48 hours, all seven patients underwent extensive surgery. In order to eliminate the inflammatory reservoir, the lens cortical remnant and lens capsule were removed thoroughly and a complete pars plana vitrectomy including vitreous base with scleral depression were performed. Operative findings revealed discrete, thick whitish inflammatory materials around the posterior lens capsule and vitreous base. Multiple fluff balls were observed in the vitreous in all cases and retinal infiltration was detected in four cases with subsequent laser photo-coagulation for retinal-pigment epithelium attachment stabilization. Any remaining triamcinolone was removed as thoroughly as possible.
During the vitrectomy, 1 mg of Amphotericin B was mixed with 500 ml of irrigation solution (Balanced Salt Solution, BSS plus) to comprise a vitreous concentration of 10 μ/5 ml. Cases 1, 2, 5 and 6 received intravitreal Amphotericin B injections postoperatively because the inflammatory cells in the vitreous had increased and the fundi were again blurred. Case 2 demonstrated persistent inflammation following the second intravitreal injection and thus vitreous cavity irrigation and Amphotericin B injection were performed a third time (Table 1). All patients received postoperative oral itraconazole until the inflammation subsided.
Results
The final corrected visual acuity in this series ranged from 20/20 to 40/200 on the Snellen chart. Five cases showed 20/40 or better while other two attained acuity of 60/200 and 40/200. The anterior segment of all patients was clear and fundoscopic findings were clear or revealed photocoagulation spots in some. Three cases demonstrated increased inflammation and decreased vision after the corrective surgery and required repeat vitrectomy and intraocular Amphotericin B injection. Any inflammatory materials attached to the peripheral retina and ciliary body were removed using scleral depression (Table 1).
Bullous retinal detachment with vitreous haze developed in case 6 ( Fig. 2). Upon secondary operation, scleral infiltration was found on the sclerotomy site and the authors were unable to identify any retinal tear. The detachment may have been exudative retinal detachment due to subretinal involvement. Internal drainage and silicone oil injection were performed to remove the remaining inflammatory dead space. One patient had optic disc involvement that persisted for two years during the follow-up period. Fluorescein angiography revealed hyperfluorescence of the disc (Fig. 2) that failed to improve with steroid pulse therapy, ultimately resulting in a final visual acuity of 60/200 on the Snellen chart. Five cases required secondary intraocular lens implantation after a lack of inflammatory signs for over six months. The other two patients refused secondary implantation. Fungal culture of the vitreous sampled during vitrectomy was positive in all seven cases. In the initial case, the culture grew Candida parapsilosis. Four cases (Cases 1, 2, 3, 6) also grew Candida parapsilosis while the other three grew Acremonium species, Candida tropicalis and Fusarium species respectively.
D iscussion
Previously published reports of postoperative fungal endophthalmitis have suggested that it results in poor visual prognosis and the majority of these cases report final visual acuity ranging from 20/200 to light perception ( Table 2). The most favorable reported results until the present study were of 15 consecutive cases of Candida parapsilosis endophthalmitis by Stern et al. 7 in 1985. In the report, only eight patients were left with visual acuity of 20/60 or better. Pflugfelder et al. 6 reported 19 cases of exogenous fungal endophthalmitis wherein only seven cases showed a final visual acuity over 20/200 despite performing vitrectomy and intraocular Amphotericin B injections. Recently, Narang et al. 8 reported 27 cases of fungal endophthalmitis that resulted in severe visual loss in 19 patients (70%). Compared to the aforementioned results, this study showed that all patients had 16/80 or better and five of seven cases had better than 20/40 visual acuity on the Snellen chart.
In the present study, the initial visual acuity ranged from finger count to 32/80 on the Snellen chart. In the initial case, visual acuity prior to cataract surgery had been hand movement only and improved to 20/40 in the middle of treatment. Unfortunately, however visual acuity ultimately declined to negative light perception. Therefore, the decision was made to perform extensive treatment despite the initial visual acuity of 32/80. The conventional treatment for exogenous fungal endophthalmitis is intravitreal injection of an antifungal agent and vitrectomy. However, this protocol may not result in satisfactory visual acuity. The reason for poor visual prognosis may be that the vitreous serves as a fungus media and there are dead-spaces, including the intraocular lens and lens capsular bag, where antifungal agents cannot penetrate. We suggest that the incom-plete vitrectomy left residual vitreous base allowing fungal growth. Another possible disadvantage with incomplete vitrectomy is in preserving the intraocular lens, which may allow the capsular bag to serve as in impenetrable dead-space to antifungal agents. Lastly, the fungal toxins may persist after conventional vitrectomy.
After experiencing the initial case of fungal endophthalmitis that resulted in blindness and phthisis despite improvement in visual acuity to 20/40 in the middle of treatment, we were able to assume that the seven subsequent cases were also due to fungal endophthalmitis prior to receiving the results of fungal stain and culture. The decision was then made to perform urgent extensive vitrectomy and antifungal therapy. It was hoped that extensive vitrectomy, including intraocular lens and lens capsule removal, would salvage visual acuity. Vitreous and inflammatory materials were removed completely through the vitreous base and pars plicata area using scleral depression. All seven cases except the initial case demonstrated 0.2 or more as the final corrected visual acuity. Moreover, there was no recurrence of endophthalmitis during the greater than 2 year follow-up period. Two cases had a final visual acuity of 0.3 and 0.2 on the Snellen chart. The causes of low vision were persistent granular keratic precipitates on the corneal center and chronic papillitis, respectively. During vitrectomy, four cases of retinal infiltration were identified; however, visual acuity improved all cases due to the lack of direct macular involvement.
Antifungal agents such as Amphotericin B have been proven safe for intravitreal injection. 9 In the present study, we used intravitreal Amphotericin B mixed with anirrigating solution (1 mg/500 ml) during vitrectomy. Postoperative oral itraconzole was administered according to a previous report. 10 As a post-vitrectomy complication, exudative retinal detachment occurred in case 4. Suspicion was high for retinal tear when bullous retinal detachment and a mildly hazy fundus examination were found, though none was ever identified. The patient received subretinal fluid aspiration and silicon oil injection and retinal elevation did not recur. Scleral infiltration was found in the site of previous sclerotomy in one case and the patient received silicon oil removal and secondary intraocular lens implantation. In this case, fungal exotoxin may have caused exudative retinal detachment.
Postoperative fungal endophthalmitis primarily develops in healthy, immunocompetent individuals. In this study, all patients were free from the immunocompromised state and lacked any significant chronic systemic disorder. All patients had received several subconjuntival triamcinolone injections at the local clinic prior to referral. We removed any remaining subconjunctival tramcinolone as thoroughly as possible. Coats et al. 11 asserted that there is no evidence that the addition of corticosteroids impairs antifungal activity or enhances fungal proliferation in the rabbit model. Another report stated that intravitreal steroids may be beneficial in promoting faster clearance of inflammation in fungal endophthalmitis. 12 In addition, corticosteroids are a well-known powerful anti-inflammatory agent. Therefore, the triamcinolone administered in the local clinics prior to referral may have played a role in reducing inflammation and preventing further retinal involvement.
Fungal culture was performed with vitreous and aqueous aspirated prior to the vitrectomy. Candida parapsilosis was cultured in the initial case as well as four subsequent cases. The other three cases demonstrated Candida tropicalis, Acremonium species and Fusarium species. All patients, including the initial case, likely had positive fungal cultures as no antifungal agent had been administered prior to complete vitrectomy.
In conclusion, complete vitrectomy including the vitreous base, removal of the intraocular lens and capsule, elimination of inflammatory materials in front of the ciliary body, with the addition of intravitreal antifungal injection and intraoperative irrigation may result in good visual prognosis incases of postoperative fungal endophthalmitis.
Fig. 1 .
1Preoperative findings of the anterior segment showed whitish inflammatory material around the intraocular lens (Left), and vitreous opacity and inflammatory materials throughout the entire vitreous (Right).
Fig. 2 .
2Following vitrectomy in case 6, bullous retinal detachment and vitreous inflammatory materials were seen on ocular ultrasound (Left). Fluorescent leaking surrounding the disc appeared on fluorescein angiography in case 7 (Right).
Table 1 .
1Preoperative findings, surgical treatment before and after referral, identified fungal organisms and complications in the initial case and seven consecutive casesAge/
Sex
V/A,
Initial, Final
Organism
Manipulations before
referral
Surgical and Medical Treatment.
after referral
PostOp Med,
Ampho
Complication &
Management
76/ F
*
HM(20/40)
†
,
LP(-)
Candida
Paraps.
Cataract/IOL
implantation. 4 times
Triamcinol.
Intravitreal Vancomycin injection,
vitrectomy and IOL explantation,
Antibiotics
antifungal agent
Phthisis
82/F
1/10,
48/80
Candida
Paraps.
Cataract/IOL
implantation. 6 times
Triamcinol.
Complete vitrectomy with IOL
explantation, Amphotericin B
irrigation
Intravitreal
Amphotericin
injection
none
75/F
1/100,
32/80
Candida
Paraps.
Cataract/IOL
implantation. 4 times
Triamcinol.
Complete vitrectomy with IOL
explantation, Amphotericin B
irrigation
Intravitreal
Amphotericin
injection
Recur
-vitrectomy,
Amphotericin
72/M
32/80,
40/40
Candida
Paraps.
Cataract/IOL
implantation, one time
Triamcinol.
Complete vitrectomy with IOL
explantation, Amphotericin B
irrigation, retinal photocoagulation
Antibiotics ,
antifungal agent
none
75/F
CF,
20/40
Acremonium
species
Cataract/IOL
implantation, 2 times
Triamcinol.
Complete vitrectomy with IOL
explantation, Amphotericin B
irrigation, retinal photocoagulation
Antibiotics ,
antifungal agent
none
62/F
32/80,
36/40
Candida
Tropicalis
Cataract/IOL
implantation, one time
Triamcinol.
Complete vitrectomy with IOL
explantation, Amphotericin B
irrigation
Antibiotics ,
antifungal agent
Recur-
vitrectomy,
Amphotericin
45/M
16/80,
20/40
Candida
Paraps.
Cataract/IOL
implantation, 2 times
Triamcinol.
Complete vitrectomy with IOL
explantation, Amphotericin B
irrigation, silicone oil injection
Antibiotics ,
antifungal agent
Postoperative
exudative RD
83/M
24.80,
24/80
Fusarium
species
Cataract/IOL
implantation, one time
Triamcinol.
Complete vitrectomy with IOL
explantation, Amphotericin B
irrigation
Intravitreal
Amphotericin
injection
Post op disc
swelling
IOL=intraocular lens; FC=finger count; HM=Hand movement; Paraps=Parapsilosis; Triamcinol.=subconjunctival triamcinolone injection.
* Initial case;
† best visual acuity in the middle of medical treatment of initial case.
Table 2 .
2Other reported results of cases series involving fungal endophthalmitisYear
Authors
No. of cases
Fungal species
Final visual acuity results
1980
Petit et al
13
Paecilomyces lilacinus
One case 20/25, another 20/80,
others -LP(+) or worse
1985
Stern et al
15
Candida parapsilosis
8 cases of 15 -20/60 or better
1988
Pflugfel-der et al
19
Filamentous fungi (17),
Fusarium (6), Acrem.(3)
7 cases of 19 -20/200
or better
1991
McGuire et al
17
Pseudallescheria boydii
Two cases -20/30, One case -20/200,
Others -blindness
2001
Narang et al
27
Aspergillus (20),
Candida (5), Others (2)
Less than H.M. 12 cases
11 cases -under 3/60
3 cases-6/60
2006
This study
7
Candida parapsilosis (5),
Fusarium, Acremonium
All cases -0.2 or better,
5 cases -0.5 or better
Bacterial endophthalmitis after cataract surgery; Incidence in 36,000 consecutive operations with special reference to preoperative topical antibiotics. H F Allen, A B Mangiaracine, Arch Ophthalmol. 91Allen HF, Mangiaracine AB. Bacterial endophthalmitis after ca- taract surgery; Incidence in 36,000 consecutive operations with special reference to preoperative topical antibiotics. Arch Oph- thalmol 1974;91:3-7.
Postoperative endophthalmitis following cataract surgery: Effects of subconjuntival antibiotics and other factors. N E Chirsty, P Lall, Arch Ophthalmol. 90Chirsty NE, Lall P. Postoperative endophthalmitis following cataract surgery: Effects of subconjuntival antibiotics and other factors. Arch Ophthalmol 1973;90:361-6.
Endophthalmitis after pars plana vitrectomy: A New Zealand experience. B C Joondeph, J P Blanc, P J Polkjnghorne, Retina. 25Joondeph BC, Blanc JP, Polkjnghorne PJ. Endophthalmitis after pars plana vitrectomy: A New Zealand experience. Retina 2005; 25:587-9.
Fungal endophthalmitis following intraocular lens. T H Pettit, R J Olson, R Y Foos, W J Martin, Arch Ophthalmol. 98Pettit TH, Olson RJ, foos RY, Martin WJ. Fungal endophthal- mitis following intraocular lens. Arch Ophthalmol 1980;98:1025- 39.
Fungal endophthalmitis; An experimental study with a Review of 17 human ocular cases. T W Mcguire, J D Bullock, J D Bullock, Jr, Arch Ophthalmol. 109McGuire TW, Bullock JD, Bullock JD Jr, et al. Fungal endoph- thalmitis; An experimental study with a Review of 17 human ocular cases. Arch Ophthalmol 1991;109:1289-96.
Exogenous Fungal Endophthalmitis. S C Pflugfelder, H W FlynnJr, T A Zwickey, Ophthalmology. 95Pflugfelder SC, Flynn HW Jr, Zwickey TA, et al. Exogenous Fungal Endophthalmitis. Ophthalmology 1988;95:19-30.
Epidemic Postsurgical Candida Prapsilosis Endophthalmitis: Clinical Findings and Management of 15 consecutive cases. W H Stern, E Tamura, R A Jacobs, Ophthalmolgy. 92Stern WH, Tamura E, Jacobs RA, et al. Epidemic Postsurgical Candida Prapsilosis Endophthalmitis: Clinical Findings and Ma- nagement of 15 consecutive cases. Ophthalmolgy 1985;92:1701-9.
A Fungal endophthalmitis following cataract surgery: clinical presentation, microbiological spectrum, and outcome. S Narang, A Gupta, V Gupta, Am J Ophthalmol. 132Narang S, Gupta A, Gupta V, et al. A Fungal endophthalmitis following cataract surgery: clinical presentation, microbiological spectrum, and outcome. Am J Ophthalmol 2001;132:609-17.
Vitrectomy in experimental endophthalmitis: Part I-Fungal infection. K Huang, G A Peyman, J Mcgetrick, Ophthalmic Surg. 10Huang K, Peyman GA, McGetrick J. Vitrectomy in experimental endophthalmitis: Part I-Fungal infection. Ophthalmic Surg 1979; 10:84-6.
Oral itraconazole for treatment of a candida parapsilosis endophthalmitis case. J D Torres Pérez, Olea Cascón, J , Crespo Ortiz, P , Arch Soc Esp Oftalmol. 9Torres Pérez JD, Olea Cascón J, Crespo Ortiz P, et al. Oral itra- conazole for treatment of a candida parapsilosis endophthalmitis case. Arch Soc Esp Oftalmol 2004;9:181-4.
Intravitreal corticosteroids in the treatment of exogenous fungal endophthalmitis. M L Coats, G A Peyman, Retina. 12Coats ML, Peyman GA. Intravitreal corticosteroids in the treatment of exogenous fungal endophthalmitis. Retina 1992;12:46-51.
Role of intravitreal dexamethasone in exogenous fungal endophthalmitis. A B Majji, S Jalali, T Das, U Gopinathan, Eye. 13Majji AB, Jalali S, Das T, Gopinathan U. Role of intravitreal dexa- methasone in exogenous fungal endophthalmitis. Eye 1999;13; 60-5.
| A reproducible animal model is necessary to examine the use of antimicrobial agents for prophylaxis and treatment of bacterial endophthalmitis. We determined the minimum inoculum size of S. aureus and P. aeruginosa that consistently produced endophthalmitis when injected into aphakic rabbit eyes immediately following surgery. Both anterior chamber and intravitreal injections were examined. For S. aureus, an intravitreal inoculum of 19.3 +/- 7.5 CFU and an anterior chamber inoculum of 50.5 +/- 4.0 CFU were required. For P. aeruginosa, an intravitreal inoculum of 5.5 +/- 2.6 CFU and an anterior chamber inoculum of 97.5 +/- 10.7 CFU consistently produced a fulminant infection. Lower inocula of both bacteria produced endophthalmitis in both locations, but the effect was inconsistent. | To report a case of acute bacterial endophthalmitis after antivascular endothelial growth factor injection with a rare presentation of vitreous hemorrhage. An 84-year-old woman presented with sudden painless vision loss in her left eye, 3 days after intravitreal ranibizumab injection for cystoid macular edema due to neovascular age-related macular degeneration. The patient was otherwise asymptomatic. Dense vitreous hemorrhage was observed. At follow-up the next day, the patient complained on severe left eye pain. After examination, acute endophthalmitis was diagnosed. Intravitreal injection of vancomycin, ceftazidime and dexamethasone was performed. Vitreous and aqueous cultures grew Enterococcus faecalis. After treatment, the inflammation subsided but it took 3 months for the vitreous hemorrhage to totally resorb. Visual acuity was reduced to light perception. Vitreous hemorrhage may be an atypical presentation of acute bacterial endophthalmitis occurring after intravitreal injection. | Therapeutic efficacy of intravitreal bevacizumab on posterior uveitis complicated by neovascularization. | Dexamethasone has proven void of toxic effects when 0.1 ml was injected into the vitreous of rabbits in doses up to 400μg. Within three hours after injection half the original dose was cleared from the vitreous. Residual concentrations (0.05μg/ml) remained for at least four days. Experimentally inducedPseudomonasendophthalmitis could be adequately treated when a combination of dexamethasone (360μg) and gentamicin sulfate (500μg) was injected intravitreally within five hours of inoculation. In eyes treated with dexamethasone and gentamicin, a significant reduction of the inflammatory response in the anterior and posterior chambers, vitreous, retina and choroid occurred as compared to eyes treated with gentamicin alone. However, when treatment was started ten hours after infection, the inflammatory reaction was so severe that the retina was destroyed even though the infection was controlled. | 1,999,811 |
Introduction
It was Rycroft in 1945 who first described the intravitreal injection of penicillin for the treatment of endophthalmitis [1]. Intravitreal injections give the opportunity of administering the drug straight where it is necessary. The vitreous cavity offers the great advantage of being a reservoir where high levels of drugs can be maintained for long periods, exceeding by far the concentrations obtained by the administration of drugs through other ways (i.e., topical, intravenous) and minimizing possible systemic side effects due to the small dose given and the little amount of drug that may escape from the eye into the systemic circulation. All these advantages and the presence of novel drugs designed specially for intravitreal use have produced an enormous increase in the number of intravitreal injections administered. The safety profile of intravitreal injections depends not only on the surgical technique, but also on the characteristics of the administered drug. Probably, the most feared and potentially devastating complication of intravitreal injections is endophthalmitis. Once the diagnosis of acute infectious endophthalmitis is suspected, vitreous tap for microbiological study and administration of intravitreal antibiotics must be done, while pars plana vitrectomy will be necessary in a subgroup of patients [2]. Prompt diagnosis and treatment of this entity are crucial for obtaining the best visual prognosis. On the other hand, certain intravitreal-administered therapies can produce an acute and sterile intraocular inflammation that can mimic a true endophthalmitis, but the former is related to good visual prognosis with resolution without the need of intravitreal antibiotics or surgical treatment. For the ophthalmologist it is crucial to know the potential inflammatory reaction that can be associated with the use of certain therapies, as well as to distinguish sterile endophthalmitis from infectious endophthalmitis in order to establish the adequate treatment. The purpose of this paper is to describe the clinical features of sterile endophthalmitis and to discuss the possible mechanisms involved in the development of inflammation after the administration of different drugs by intravitreal injection.
Definition of Sterile Endophthalmitis
For the purpose of this paper, we have defined sterile endophthalmitis as the acute intraocular inflammation of the vitreous cavity that resolves without the need of intravitreal antibiotics and/or vitreoretinal surgery. Necessarily, if vitreous microbiological study has been done, it needs to be negative culture proven. Patients treated with intravitreal antibiotics or vitrectomy, despite having negative cultures, were excluded from the analysis since an infectious origin of the inflammation cannot be ruled out [2]. The administration of topical antibiotics alone or in combination with intravenous antibiotics was not considered an exclusion criterion for being a sterile endophthalmitis since these treatments would not resolve by themselves a true acute infectious endophthalmitis. A review of the literature published in Pubmed between 1945 and June 2012, searching for keywords endophthalmitis, pseudoendophthalmitis, sterile endophthalmitis, and pseudohypopyon in combination with intravitreal injection, was done. Results were restricted to articles in English and Spanish. The search retrieved 334 articles that were analysed. Other articles referenced in the literature obtained through the initial search were also included.
Triamcinolone Acetonide
Triamcinolone acetonide is a white-colored, crystalline steroid. Almost insoluble in water, triamcinolone has an antiinflammatory power 5 times greater than hydrocortisone. Because of the antiangiogenic and antioedematous properties of triamcinolone acetonide, it has been widely used as an off-label treatment for numerous eye diseases that have new vessels or an alteration of the blood-eye barriers. The development of sterile endophthalmitis after intravitreal triamcinolone acetonide (IVTA) has been described by numerous authors [3][4][5][6][7][8][9][10][11][12], and it is supposed to occur between 0.20% and 6.73% of the injections [4][5][6][7]. However, these numbers need to be interpreted cautiously since most of the reports are based on retrospective studies or small case series; therefore distinguishing sterile endophthalmitis from endophthalmitis can be difficult. Some cases catalogued in the literature as sterile endophthalmitis were treated with intravitreal antibiotics or vitrectomy, making it impossible to discard a true endophthalmitis. Other cases have been catalogued as sterile endophthalmitis just because of negative cultures. In other occasions vitreous haze secondary to dispersion of triamcinolone particles is difficult to differentiate from a real inflammatory process affecting the vitreous [5].
Sterile endophthalmitis secondary to IVTA has been described as a decrease in visual acuity that occurs more frequently within the first 3 days from the injection. Patients usually do not complain of eye pain. Slit-lamp examination may show some signs of mild-to-moderate intraocular inflammation in the anterior chamber such as flare, cells, and keratic precipitates [3,4,6]. Usually, hypopyon is not present [3,4,10,11] and fundus examination typically reveals deep vitreous haze obscuring the retina. Nevertheless, it seems necessary to mention that, in the series described by Nelson et al. [5], eye pain was present in 4 cases while 7 cases had a severe inflammatory reaction in the anterior chamber with hypopyon. In the absence of specific treatment, vitreous haze can disappear between 2 weeks to 2 months [3,4,6]. Visual prognosis does not seem to be deteriorated and only some few cases have experienced a decrease of visual acuity despite clearing of the media. In these patients, visual decrease was most probably secondary to the underlying pathology than to the temporal inflammatory process.
The aetiology of sterile endophthalmitis is not fully understood. Contamination of triamcinolone vials with endotoxins has been postulated as a possible cause [4]. However, in the context of a cluster of sterile endophthalmitis, no endotoxins were found in the commercial vials of triamcinolone tested [12]. A toxic effect of the triamcinolone itself as well as the preservatives present in the vial (benzyl alcohol, polysorbate 80 and carboxymethylcellulose sodium) has been suggested. Retinal pigment epithelium and glial cells damage [13][14][15], together with an alteration in the morphology of rabbit photoreceptors, have been observed after the exposure to benzyl alcohol or commercial triamcinolone acetonide given at doses slightly higher than those used in human eyes [16,17]. On the other hand, other studies in rabbits have not observed signs of cellular toxicity on morphologic or electrophysiologic tests [18][19][20]. Removal of benzyl alcohol by filtering the commercially available triamcinolone has been proposed as a possible method to reduce the rate of sterile endophthalmitis [9], but a couple of cases have been described even though triamcinolone was filtered and benzyl alcohol almost completely removed before IVTA [11]. An immune response to triamcinolone or any of the preservatives of the commercial vial has been also suggested as a possible cause of sterile endophthalmitis due to the development of intraocular inflammation after a second intravitreal injection [4]. Allergic reactions to triamcinolone have been described, but most possibly these cases corresponded to a reaction to any of the preservatives [21][22][23]. We observed a repeated episode of sterile endophthalmitis in a patient treated in 2 consecutive occasions with combined photodynamic therapy with verteporfin and IVTA [10]. In that patient, systemic and cutaneous allergic tests were negative; therefore, hypersensitivity reaction type 1 and type 4 were ruled out. However, non-IgE-mediated reactions have been observed with polysorbate 80. Considering that there are no systemic allergic reactions that would be necessary to prevent in patients with sterile endophthalmitis secondary to IVTA, the performance of allergy tests is of doubtful utility. Furthermore, negative allergy tests do not discard a future episode of inflammation.
Pseudoendophthalmitis and Pseudohypopyon after Triamcinolone Acetonide
Pseudoendophthalmitis is an infrequent complication of IVTA and occurs in about 0.74-0.8% of the injections [6,24]. The term pseudoendophthalmitis has been used previously as synonymous of sterile endophthalmitis, but Mediators of Inflammation 3 most of the authors use it to the describe the dispersion of triamcinolone crystals and their passage from the vitreous cavity to the anterior chamber [25], more frequently in eyes with posterior capsule impairment or suspected zonular defect after being vitrectomized [8,24,[26][27][28][29]. The settling of the crystals in the inferior angle of the anterior chamber produces the appearance of a "pseudohypopyon." This has been observed to happen immediately after the intravitreal injection, but usually occurs within the first 3 days. Patients typically do not present eye pain, conjunctival hyperemia, or any sign of intraocular inflammation [6,24,26,[29][30][31][32][33][34]. Pseudohypopyon usually can be differentiated from true inflammatory hypopyon on the slit lamp. Chen et al. [26] recommend to distinguish pseudohypopyon from true inflammatory hypopyon by tilting the patient's head and observing the shifting of the crystals upon the new position.
Despite the amount of triamcinolone occupying the angle, no changes in the intraocular pressure have been associated with pseudohypopyon. Washout of the anterior chamber has been described in two cases of high-dose IVTA injections [29,33], while all other cases resolved spontaneously between 4 days and 2 months [6,24,27,[30][31][32]34]. No alterations of the anterior segment structures have been described once the triamcinolone reabsorbed.
Antivascular Endothelial Growth Factor Drugs
Bevacizumab (Avastin, Genentech, Inc., San Francisco, California, USA) is a full-length humanized monoclonal nonselective antibody against vascular endothelial growth factor approved by the Food and Drug Administration for the treatment of glioblastoma and of metastatic colorectal cancer, advanced nonsquamous non-small-cell lung cancer and metastatic kidney cancer in combination with chemotherapy. Rosenfeld et al. described for the first time the use of intravitreal bevacizumab (IVB) for the treatment of macular oedema secondary to retinal vein occlusion and exudative age-related macular degeneration [35,36].
Since then, several studies have described the off-label use of IVB for the treatment of numerous vascular and oedematous eye diseases. The incidence of acute cultured proven endophthalmitis appears to be very low, ranging from 0.02% to 0.16% [37][38][39], while the incidence of sterile endophthalmitis has been described between 0.09% and 1.1% of IVB injections [37,[40][41][42][43]]. An early and acute decrease in visual acuity appears as the most common symptom in patients with sterile endophthalmitis secondary to IVB. This can occur during the first 48 hours after the intravitreal injection and in all cases seems to be within the first week [40][41][42]44]. Despite the intraocular inflammation, ocular pain seems to be infrequent [42]. Of the 44 cases observed by Chong et al. [40] blurred vision was present in 73% of the patients, floaters in 43%, and pain in 34%. Most of the patients had signs of inflammation in vitreous cavity (80%) as well as in the anterior chamber (77%). Considering just those eyes of this series that presented signs of inflammation that did not receive intravitreal antibiotics/vitrectomy, inflammation was mild to moderate in the anterior chamber in 7 out of 9 cases and mild to moderate in the vitreous cavity in 8 out of 9 cases. Interestingly, Georgopoulos et al. [42] observed a "pseudogranulomatous" inflammation of the vitreous because of the presence of large cellular aggregates. None of the reported cases with sterile inflammation presented fibrin or hypopyon [40][41][42]44]. In the internet-based survey done by Fung et al. [41] all 10 cases of inflammation were catalogued as mild or moderate and lasted no longer than a week while sterile endophthalmitis cases reported by Chong et al. [40] resolved after 37 ± 5 days. These authors observed that mean time for visual acuity recovery was 53 ± 18 days and there was no difference between visual acuity observed at the end of the inflammatory process compared with pretreatment visual acuity [40]. A similar situation was observed in the 8 cases described by Georgopoulus et al. [42] where all patients but one recovered initial visual acuity.
It is necessary to mention that different degrees of acute anterior segment inflammation have been described after 0.25% of IVB injections [45]. Sterile intraocular inflammation has been described in patients with a severe inflammatory reaction in the anterior segment of the eye. Ocular pain and hypopyon were present in some of these patients, whereas vitreous inflammation was mild to moderate [46][47][48][49].
Diverse hypotheses have been proposed to explain the inflammatory response secondary to IVB. The solution of bevacizumab for intravenous administration comes in vials of 100 mg/4 mL or 400 mg/16 mL; therefore, obtaining different 0.1 mL or 0.05 mL doses for intravitreal use implies the manipulation and possible risk of contamination of the solution. As Wickremasinghe et al. mentioned in their report [43], although contamination of individual aliquots of bevacizumab with bacterial endotoxins during preparation may occur, this theoretical situation could explain clusters of sterile endophthalmitis in patients treated with injections coming from the same batch [44], but seems unlikely to be the cause of sporadic cases. Bacterial endotoxins are frequent and recalcitrant contaminants of antibody preparations during the production phase of the drug [50]. Preparations of bevacizumab that are originally designed for intravenous use may contain traces of endotoxin at levels that incite intravitreous inflammation, even though they are of no significance when the drug is administered systemically [43]. A specific immune reaction to the anti-VEGF antibody could also explain the development of sterile inflammation. Different authors have highlighted the presence of sterile endophthalmitis after repeated intravitreal bevacizumab injections [40,43]. However, sterile endophthalmitis can develop after the first IVB. Another important fact is that the manufacture of bevacizumab recommends to keep it refrigerated between 2 and 8 • C and protected from light [51]. Fluctuation of the temperature has been proposed as a factor that may increase immunogenic properties of bevacizumab [43]. Temperature fluctuation has been demonstrated to increase the immunogenicity of therapeutic proteins [52]. This may be due to protein degradation creating novel antigenic epitopes not found in the parent molecule [53].
Mediators of Inflammation
Ranibizumab (Lucentis, Novartis Pharma AG; Genentech USA Inc.) is a recombinant, humanized monoclonal antibody Fab that neutralises all active forms of VEGF-A. Ranibizumab is approved for the treatment of exudative age-related macular degeneration, diabetic macular oedema, and macular oedema secondary to retinal vein occlusion. Pseudoendophthalmitis was reported to occur in 1 out of 599 patients (0.16%) treated with ranibizumab in the CATT study [54]. Unfortunately, there is no detailed information regarding the characteristics of this episode. Fauser et al. described 2 consecutive episodes of intraocular inflammation in the same patient. It occurred 24-48 hrs after the injection and visual acuity decrease, eye pain, hypopyon, and moderate vitreous cells were present [55]. The first episode was treated with intravitreal antibiotics, but no specific treatment was given for the second episode. Interestingly, there was no recurrence of the inflammation after a subsequent injection of ranibizumab. Sharma et al. described 1 patient (1/891 injections, 0.11%) with mild anterior chamber inflammation together with mild vitritis 3 days after ranibizumab injection [56]. There was spontaneous resolution of the inflammation and improvement of visual acuity. As far as the authors are aware, there are no other cases in the literature describing the development of sterile endophthalmitis secondary to intravitreal ranibizumab. The very low frequency of this adverse event may be related to the characteristics of the molecule, but the ultimate cause remains to be elucidated.
Methotrexate
Sterile endophthalmitis has been also described after the intravitreal injection of methotrexate in patients with primary central nervous system lymphoma involving the eye. Usually, multiple intravitreal injections of 200-400 μg/0.1 mL of methotrexate are required to observe the remission of the disease. In the literature there are some few cases of acute intraocular inflammation that developed after intravitreal methotrexate, but the majority of these cases lack detailed description of the ocular signs and evolution. In a series of 16 patients treated with intravitreal methotrexate, 1 patient developed intraocular inflammation that was catalogued as sterile endophthalmitis [57]. Microbiologic cultures were negative and the inflammation remitted rapidly after the administration of intravitreal antibiotics in combination with topical and systemic corticosteroids. In another series of 44 eyes from 26 patients, 2 patients developed severe intraocular inflammation that responded to topical steroids; the first one was catalogued as sterile endophthalmitis while the second was assumed as a toxic anterior segment syndrome [58]. However, it is important to mention that this entity is characterized by an early and intense postoperative inflammation after anterior segment surgery accompanied by minimal or no pain, fibrin formation, corneal edema, and the absence of vitreous involvement [59]. The mechanism of inflammation after intravitreal methotrexate remains uncertain.
Conclusions
Sterile endophthalmitis appears as an infrequent complication of intravitreal injections and seems to develop mainly in the context of the off-label use of drugs that have not been conceived for intravitreous administration. Sterile inflammations secondary to IVTA and to IVB share many characteristics such as the acute and painless vision loss present in the big majority of the cases. Dense vitreous opacity is a common factor, while anterior segment inflammation appears to be mild to moderate. Hypopyon is a very infrequent sign in the context of sterile inflammation after intravitreal injections. In eyes with sterile endophthalmitis, visual acuity improves progressively as the intraocular inflammation reduces without any specific treatment. In this study eyes treated with intravitreal antibiotics or vitrectomy were not included. This may constitute a bias by excluding severe cases that presented signs such as ocular pain or hypopyon. If by any chance the ophthalmologist is not convinced by the sterile origin of the inflammation, this complication must be treated as an acute endophthalmitis because of the devastating visual prognosis of this intraocular infection in the absence of therapy. The aetiology of sterile endophthalmitis, independently of the administered drug, remains uncertain and a multifactorial origin cannot be discarded.
Conflict of InterestsThe authors declare that there is no competing/conflict of interests related to any topic of this paper.
Penicillin and the control of deep intra-ocular infection. B W Rycroft, British Journal of Ophthalmology. 292B. W. Rycroft, "Penicillin and the control of deep intra-ocular infection," British Journal of Ophthalmology, vol. 29, no. 2, pp. 57-87, 1945.
Results of the endophthalmitis vitrectomy study: a randomized trial of immediate vitrectomy and of intravenous antibiotics for the treatment of postoperative bacterial endophthalmitis, Endophthalmitis Vitrectomy Study Group. Archives of Ophthalmology. 11312Endophthalmitis Vitrectomy Study GroupEndophthalmitis Vitrectomy Study Group, "Results of the endophthalmitis vitrectomy study: a randomized trial of immediate vitrectomy and of intravenous antibiotics for the treatment of postoperative bacterial endophthalmitis, Endophthalmitis Vitrectomy Study Group," Archives of Oph- thalmology, vol. 113, no. 12, pp. 1479-1496, 1995.
Pseudo-endophthalmitis after intravitreal injection of triamcinolone. F K P Sutter, M C Gillies, British Journal of Ophthalmology. 878F. K. P. Sutter and M. C. Gillies, "Pseudo-endophthalmitis after intravitreal injection of triamcinolone," British Journal of Ophthalmology, vol. 87, no. 8, pp. 972-974, 2003.
Noninfectious endophthalmitis associated with intravitreal triamcinolone injection. D B Roth, J Chieh, M J Spirn, S N Green, D L Yarian, N A Chaudhry, Archives of Ophthalmology. 1219D. B. Roth, J. Chieh, M. J. Spirn, S. N. Green, D. L. Yarian, and N. A. Chaudhry, "Noninfectious endophthalmitis associated with intravitreal triamcinolone injection," Archives of Ophthalmology, vol. 121, no. 9, pp. 1279-1282, 2003.
Infectious and presumed noninfectious endophthalmitis after intravitreal triamcinolone acetonide injection. M L Nelson, M T S Tennant, A Sivalingam, C D Regillo, J B Belmont, A Martidis, Retina. 235M. L. Nelson, M. T. S. Tennant, A. Sivalingam, C. D. Regillo, J. B. Belmont, and A. Martidis, "Infectious and presumed non- infectious endophthalmitis after intravitreal triamcinolone acetonide injection," Retina, vol. 23, no. 5, pp. 686-691, 2003.
Complications of intravitreal injection of triamcinolone acetonide. A Özkiriş, K Erkiliç, Canadian Journal of Ophthalmology. 401A.Özkiriş and K. Erkiliç, "Complications of intravitreal injection of triamcinolone acetonide," Canadian Journal of Ophthalmology, vol. 40, no. 1, pp. 63-68, 2005.
Presumed sterile endophthalmitis following intravitreal triamcinolone acetonide injection. D M Moshfeghi, P K Kaiser, S J Bakri, Ophthalmic Surgery Lasers and Imaging. 361D. M. Moshfeghi, P. K. Kaiser, S. J. Bakri et al., "Presumed ster- ile endophthalmitis following intravitreal triamcinolone ace- tonide injection," Ophthalmic Surgery Lasers and Imaging, vol. 36, no. 1, pp. 24-29, 2005.
Sterile endophthalmitis following intravitreal injection of triamcinolone acetonide. L C Wang, C M Yang, Ocular Immunology and Inflammation. 134L. C. Wang and C. M. Yang, "Sterile endophthalmitis following intravitreal injection of triamcinolone acetonide," Ocular Immunology and Inflammation, vol. 13, no. 4, pp. 295-300, 2005.
Infectious and noninfectious endophthalmitis after intravitreal high-dosage triamcinolone acetonide. J B Jonas, I Kreissig, U H Spandau, B Harder, American Journal of Ophthalmology. 1413J. B. Jonas, I. Kreissig, U. H. Spandau, and B. Harder, "Infec- tious and noninfectious endophthalmitis after intravitreal high-dosage triamcinolone acetonide," American Journal of Ophthalmology, vol. 141, no. 3, pp. 579-580, 2006.
Repeated pseudoendophthalmitis after combined photodynamic therapy and intravitreal triamcinolone. J Marticorena, F Gomez-Ulla, M R Romano, I Luna, Clinical and Experimental Ophthalmology. 2459Graefe's Archive forJ. Marticorena, F. Gomez-Ulla, M. R. Romano, and I. Luna, "Repeated pseudoendophthalmitis after combined photo- dynamic therapy and intravitreal triamcinolone," Graefe's Archive for Clinical and Experimental Ophthalmology, vol. 245, no. 9, pp. 1403-1404, 2007.
Sterile endophthalmitis after benzyl alcohol-filtered triamcinolone acetonide injection. J L Carrero, M G Barcia, I P Flores, Archives of Ophthalmology. 1261J. L. Carrero, M. G. Barcia, and I. P. Flores, "Sterile endoph- thalmitis after benzyl alcohol-filtered triamcinolone acetonide injection," Archives of Ophthalmology, vol. 126, no. 1, pp. 142- 143, 2008.
Increased incidence of sterile endophthalmitis following intravitreal preserved triamcinolone acetonide. J Jonisch, J C Lai, V A Deramo, A J Flug, D M Fastenberg, British Journal of Ophthalmology. 928J. Jonisch, J. C. Lai, V. A. Deramo, A. J. Flug, and D. M. Fas- tenberg, "Increased incidence of sterile endophthalmitis fol- lowing intravitreal preserved triamcinolone acetonide," British Journal of Ophthalmology, vol. 92, no. 8, pp. 1051-1054, 2008.
Vehicle of triamcinolone acetonide is associated with retinal toxicity and transient increase of lens density. W Kai, J Yanrong, L Xiaoxin, Clinical and Experimental Ophthalmology. 2449Graefe's Archive forW. Kai, J. Yanrong, and L. Xiaoxin, "Vehicle of triamcinolone acetonide is associated with retinal toxicity and transient increase of lens density," Graefe's Archive for Clinical and Experimental Ophthalmology, vol. 244, no. 9, pp. 1152-1159, 2006.
The toxic and stress responses of cultured human retinal pigment epithelium (ARPE19) and human glial cells (SVG) in the presence of triamcinolone. C K Yeung, K P Chan, S W Y Chiang, C P Pang, D S C Lam, Investigative Ophthalmology and Visual Science. 4412C. K. Yeung, K. P. Chan, S. W. Y. Chiang, C. P. Pang, and D. S. C. Lam, "The toxic and stress responses of cultured human retinal pigment epithelium (ARPE19) and human glial cells (SVG) in the presence of triamcinolone," Investigative Ophthalmology and Visual Science, vol. 44, no. 12, pp. 5293- 5300, 2003.
Cytotoxicity of triamcinolone on cultured human retinal pigment epithelial cells: comparison with dexamethasone and hydrocortisone. C K Yeung, K P Chan, C K M Chan, C P Pang, D S C Lam, Japanese Journal of Ophthalmology. 483C. K. Yeung, K. P. Chan, C. K. M. Chan, C. P. Pang, and D. S. C. Lam, "Cytotoxicity of triamcinolone on cultured human retinal pigment epithelial cells: comparison with dexametha- sone and hydrocortisone," Japanese Journal of Ophthalmology, vol. 48, no. 3, pp. 236-242, 2004.
Intravitreal toxicity of the Kenalog vehicle (benzyl alcohol) in rabbits. V L Morrison, H J Koh, L Cheng, K Bessho, M C Davidson, W R Freeman, Retina. 263V. L. Morrison, H. J. Koh, L. Cheng, K. Bessho, M. C. Davidson, and W. R. Freeman, "Intravitreal toxicity of the Kenalog vehicle (benzyl alcohol) in rabbits," Retina, vol. 26, no. 3, pp. 339-344, 2006.
Retinal toxicity of intravitreal triamcinolone acetonide: a morphological study. S Y Yu, F M Damico, F Viola, D J . D'amico, L H Young, Retina. 265S. Y. Yu, F. M. Damico, F. Viola, D. J. D'Amico, and L. H. Young, "Retinal toxicity of intravitreal triamcinolone acetonide: a morphological study," Retina, vol. 26, no. 5, pp. 531-536, 2006.
The lack of toxicity of intravitreally administered triamcinolone acetonide. B W Mccuen, M Bessler, Y Tano, American Journal of Ophthalmology. 916B. W. McCuen, M. Bessler, and Y. Tano, "The lack of toxi- city of intravitreally administered triamcinolone acetonide," American Journal of Ophthalmology, vol. 91, no. 6, pp. 785- 788, 1981.
Experimental and clinical observations of the intraocular toxicity of commercial corticosteroid preparations. T Hida, D Chandler, J E Arena, R Machemer, American Journal of Ophthalmology. 1012T. Hida, D. Chandler, J. E. Arena, and R. Machemer, "Experi- mental and clinical observations of the intraocular toxicity of commercial corticosteroid preparations," American Journal of Ophthalmology, vol. 101, no. 2, pp. 190-195, 1986.
Electroretinographic effects of an intravitreal injection of triamcinolone in rabbit retina. D Dierks, B Lei, K Zhang, D P Hainsworth, Archives of Ophthalmology. 12311D. Dierks, B. Lei, K. Zhang, and D. P. Hainsworth, "Elec- troretinographic effects of an intravitreal injection of triam- cinolone in rabbit retina," Archives of Ophthalmology, vol. 123, no. 11, pp. 1563-1569, 2005.
Anaphylaxis to carboxymethylcellulose induced by injectable corticosteroids. E Beaudouin, G Kanny, J L Gueant, D A Moneret-Vautrin, Allergie et Immunologie. 249E. Beaudouin, G. Kanny, J. L. Gueant, and D. A. Moneret- Vautrin, "Anaphylaxis to carboxymethylcellulose induced by injectable corticosteroids," Allergie et Immunologie, vol. 24, no. 9, pp. 333-335, 1992.
Benzyl alcohol allergy: importance of patch testing with personal products. E J Curry, E M Warshaw, Dermatitis. 164E. J. Curry and E. M. Warshaw, "Benzyl alcohol allergy: impor- tance of patch testing with personal products," Dermatitis, vol. 16, no. 4, pp. 203-208, 2005.
Anaphylactic shock after intra-articular injection of carboxymethylcellulose. J Montoro, A Valero, A Elices, Allergologia et Immunopathologia. 28J. Montoro, A. Valero, A. Elices et al., "Anaphylactic shock after intra-articular injection of carboxymethylcellulose," Allergolo- gia et Immunopathologia, vol. 28, no. 6, pp. 332-333, 2000.
Pseudohypopyon after intravitreal triamcinolone acetonide injection for cystoid macular edema. A A Moshfeghi, I U Scott, H W Flynn, C A Puliafito, American Journal of Ophthalmology. 1383A. A. Moshfeghi, I. U. Scott, H. W. Flynn, and C. A. Puliafito, "Pseudohypopyon after intravitreal triamcinolone acetonide injection for cystoid macular edema," American Journal of Ophthalmology, vol. 138, no. 3, pp. 489-492, 2004.
Risks of intravitreous injection: a comprehensive review. R D Jager, L P Aiello, S C Patel, E T Cunningham, Retina. 245R. D. Jager, L. P. Aiello, S. C. Patel, and E. T. Cunningham, "Risks of intravitreous injection: a comprehensive review," Retina, vol. 24, no. 5, pp. 676-698, 2004.
Pseudohypopyon after intravitreal triamcinolone injection for the treatment of pseudophakic cystoid macular oedema. S D M Chen, J Lochhead, B Mcdonald, C K Patel, British Journal of Ophthalmology. 886S. D. M. Chen, J. Lochhead, B. McDonald, and C. K. Patel, "Pseudohypopyon after intravitreal triamcinolone injection for the treatment of pseudophakic cystoid macular oedema," British Journal of Ophthalmology, vol. 88, no. 6, pp. 843-844, 2004.
Steroid hypopyon following intravitreal triamcinolone acetonide injection in a pseudophakic patient. J E Amato, D H Lee, B A Santos, L Akduman, Ocular Immunology and Inflammation. 132-3J. E. Amato, D. H. Lee, B. A. Santos, and L. Akduman, "Steroid hypopyon following intravitreal triamcinolone acetonide injection in a pseudophakic patient," Ocular Immunology and Inflammation, vol. 13, no. 2-3, pp. 245-247, 2005.
A case of triamcinolone-induced pseudo-endophthalmitis after vitrectomy. G Garay-Aramburu, A Bilbao-Urtiaga, M Cuesta-García, A Larrauri-Arana, Archivos de la Sociedad Española de Oftalmología. 8010G. Garay-Aramburu, A. Bilbao-Urtiaga, M. Cuesta-García, and A. Larrauri-Arana, "A case of triamcinolone-induced pseudo-endophthalmitis after vitrectomy," Archivos de la Sociedad Española de Oftalmología., vol. 80, no. 10, pp. 615- 617, 2005.
Intravitreal injection of crystalline cortisone as adjunctive treatment of proliferative vitreoretinopathy. J B Jonas, J K Hayler, S Panda-Jonas, British Journal of Ophthalmology. 849J. B. Jonas, J. K. Hayler, and S. Panda-Jonas, "Intravitreal injection of crystalline cortisone as adjunctive treatment of proliferative vitreoretinopathy," British Journal of Ophthalmol- ogy, vol. 84, no. 9, pp. 1064-1067, 2000.
Pseudohypopyon following intravitreal triamcinolone acetonide injection. M C Sharma, W W Lai, M J Shapiro, Cornea. 234M. C. Sharma, W. W. Lai, and M. J. Shapiro, "Pseudohypopyon following intravitreal triamcinolone acetonide injection," Cornea, vol. 23, no. 4, pp. 398-399, 2004.
Leak of intravitreal triamcinolone to the anterior chamber. C Blanco Marchite, A Fagúndez, L Buznego, J López-Moya, Archivos de la Sociedad Espanola de Oftalmologia. 8212C. Blanco Marchite, A. Fagúndez, L. Buznego, and J. López- Moya, "Leak of intravitreal triamcinolone to the anterior chamber," Archivos de la Sociedad Espanola de Oftalmologia, vol. 82, no. 12, pp. 781-783, 2007.
Noninfectious hypopion after intravitreal triamcinolone acetonide injection for central retinal vein occlusion: a case report. Y T Chiu, Y Y Tsai, J M Lin, Kaohsiung Journal of Medical Sciences. 2110Y. T. Chiu, Y. Y. Tsai, and J. M. Lin, "Noninfectious hypopion after intravitreal triamcinolone acetonide injection for central retinal vein occlusion: a case report," Kaohsiung Journal of Medical Sciences, vol. 21, no. 10, pp. 466-469, 2005.
Anterior chamber transit of triamcinolone after intravitreal injection. J M Ruiz-Moreno, J A Montero, A Artola, S Barile, Archives of Ophthalmology. 1231J. M. Ruiz-Moreno, J. A. Montero, A. Artola, and S. Barile, "Anterior chamber transit of triamcinolone after intravitreal injection," Archives of Ophthalmology, vol. 123, no. 1, pp. 129- 130, 2005.
Intravitreal injection of crystalline cortisone as adjunctive treatment of proliferative diabetic retinopathy. J B Jonas, J K Hayler, A Söfker, S Panda-Jonas, American Journal of Ophthalmology. 1314J. B. Jonas, J. K. Hayler, A. Söfker, and S. Panda-Jonas, "Intravitreal injection of crystalline cortisone as adjunctive treatment of proliferative diabetic retinopathy," American Journal of Ophthalmology, vol. 131, no. 4, pp. 468-471, 2001.
Optical coherence tomography findings after an intravitreal injection of bevacizumab (Avastin) for macular edema from central retinal vein occlusion. P J Rosenfeld, A E Fung, C A Puliafito, Ophthalmic Surgery Lasers and Imaging. 364P. J. Rosenfeld, A. E. Fung, and C. A. Puliafito, "Optical coher- ence tomography findings after an intravitreal injection of bevacizumab (Avastin) for macular edema from central retinal vein occlusion," Ophthalmic Surgery Lasers and Imaging, vol. 36, no. 4, pp. 336-339, 2005.
Optical coherence tomography findings after an intravitreal injection of bevacizumab (Avastin) for neovascular age-related macular degeneration. P J Rosenfeld, A A Moshfeghi, C A Puliafito, Ophthalmic Surgery Lasers and Imaging. 364P. J. Rosenfeld, A. A. Moshfeghi, and C. A. Puliafito, "Optical coherence tomography findings after an intravitreal injection of bevacizumab (Avastin) for neovascular age-related macular degeneration," Ophthalmic Surgery Lasers and Imaging, vol. 36, no. 4, pp. 331-335, 2005.
Twelve-month safety of intravitreal injections of bevacizumab (Avastin): results of the pan-american collaborative retina study group (PACORES). L Wu, M A Martínez-Castellanos, H Quiroz-Mercado, Clinical and Experimental Ophthalmology. 2461Mediators of InflammationL. Wu, M. A. Martínez-Castellanos, H. Quiroz-Mercado et al., "Twelve-month safety of intravitreal injections of beva- cizumab (Avastin): results of the pan-american collaborative retina study group (PACORES)," Graefe's Archive for Clinical and Experimental Ophthalmology, vol. 246, no. 1, pp. 81-87, 2008. Mediators of Inflammation
Incidence of endophthalmitis related to intravitreal injection of bevacizumab and ranibizumab. D R Fintak, G K Shah, K J Blinder, Retina. 2810D. R. Fintak, G. K. Shah, K. J. Blinder et al., "Incidence of endophthalmitis related to intravitreal injection of beva- cizumab and ranibizumab," Retina, vol. 28, no. 10, pp. 1395- 1399, 2008.
Incidence and management of acute endophthalmitis after intravitreal bevacizumab (Avastin) injection. O Artunay, E Yuzbasioglu, R Rasier, A Sengül, H Bahcecioglu, Eye. 2312O. Artunay, E. Yuzbasioglu, R. Rasier, A. Sengül, and H. Bahce- cioglu, "Incidence and management of acute endophthalmitis after intravitreal bevacizumab (Avastin) injection," Eye, vol. 23, no. 12, pp. 2187-2193, 2009.
Characterization of sterile intraocular inflammatory responses after intravitreal bevacizumab injection. D Y Chong, R Anand, P D Williams, J A Qureshi, D G Callanan, Retina. 309D. Y. Chong, R. Anand, P. D. Williams, J. A. Qureshi, and D. G. Callanan, "Characterization of sterile intraocular inflam- matory responses after intravitreal bevacizumab injection," Retina, vol. 30, no. 9, pp. 1432-1440, 2010.
The International Intravitreal Bevacizumab Safety Survey: using the internet to assess drug safety worldwide. A E Fung, P J Rosenfeld, E Reichel, British Journal of Ophthalmology. 9011A. E. Fung, P. J. Rosenfeld, and E. Reichel, "The International Intravitreal Bevacizumab Safety Survey: using the internet to assess drug safety worldwide," British Journal of Ophthalmol- ogy, vol. 90, no. 11, pp. 1344-1349, 2006.
Characteristics of severe intraocular inflammation following intravitreal injection of bevacizumab (Avastin). M Georgopoulos, K Polak, F Prager, C Prünte, U Schmidt-Erfurth, British Journal of Ophthalmology. 934M. Georgopoulos, K. Polak, F. Prager, C. Prünte, and U. Schmidt-Erfurth, "Characteristics of severe intraocular inflammation following intravitreal injection of bevacizumab (Avastin)," British Journal of Ophthalmology, vol. 93, no. 4, pp. 457-462, 2009.
Acute intraocular inflammation after intravitreous injections of bevacizumab for treatment of neovascular age-related macular degeneration. S S Wickremasinghe, K Michalova, J Gilhotra, Ophthalmology. 11511S. S. Wickremasinghe, K. Michalova, J. Gilhotra et al., "Acute intraocular inflammation after intravitreous injections of bevacizumab for treatment of neovascular age-related macular degeneration," Ophthalmology, vol. 115, no. 11, pp. 1911.e1- 1915.e1, 2008.
Sterile endophthalmitis after intravitreal injection of bevacizumab obtained from a single batch. K Yamashiro, A Tsujikawa, K Miyamoto, Retina. 303K. Yamashiro, A. Tsujikawa, K. Miyamoto et al., "Sterile endophthalmitis after intravitreal injection of bevacizumab obtained from a single batch," Retina, vol. 30, no. 3, pp. 485- 490, 2010.
A systematic review of the adverse events of intravitreal anti-vascular endothelial growth factor injections. M I Van Der Reis, E C Heij, Y Jong-Hesse, P J Ringens, F Hendrikse, J Schouten, Retina. 318M. I. van der Reis, E. C. la Heij, Y. de Jong-Hesse, P. J. Ringens, F. Hendrikse, and J. Schouten, "A systematic review of the adverse events of intravitreal anti-vascular endothelial growth factor injections," Retina, vol. 31, no. 8, pp. 1449-1469, 2011.
Intraocular inflammation following intravitreal injection of bevacizumab. S J Bakri, T A Larson, A O Edwards, Clinical and Experimental Ophthalmology. 2465Graefe's Archive forS. J. Bakri, T. A. Larson, and A. O. Edwards, "Intraoc- ular inflammation following intravitreal injection of beva- cizumab," Graefe's Archive for Clinical and Experimental Oph- thalmology, vol. 246, no. 5, pp. 779-781, 2008.
Uveitis following intravitreal bevacizumab: a non-infectious cluster. C N Kay, R M Tarantola, K M Gehrs, Ophthalmic Surgery, Lasers and Imaging. 424C. N. Kay, R. M. Tarantola, K. M. Gehrs et al., "Uveitis following intravitreal bevacizumab: a non-infectious cluster," Ophthalmic Surgery, Lasers and Imaging, vol. 42, no. 4, pp. 292-296, 2011.
Severe intraocular inflammation after intravitreal injection of bevacizumab. T Sato, K Emi, T Ikeda, Ophthalmology. 1173T. Sato, K. Emi, T. Ikeda et al., "Severe intraocular inflamma- tion after intravitreal injection of bevacizumab," Ophthalmol- ogy, vol. 117, no. 3, pp. 512.e2-516.e2, 2010.
A case of sterile endophthalmitis after repeated intravitreal bevacizumab injection. N M Yenerel, U A Dinc, E Gorgun, Journal of Ocular Pharmacology and Therapeutics. 243N. M. Yenerel, U. A. Dinc, and E. Gorgun, "A case of ster- ile endophthalmitis after repeated intravitreal bevacizumab injection," Journal of Ocular Pharmacology and Therapeutics, vol. 24, no. 3, pp. 362-363, 2008.
Acute in vivo effects of human recombinant tumor necrosis factor. D G Remick, R G Kunkel, J W Larrick, S L Kunkel, Laboratory Investigation. 566D. G. Remick, R. G. Kunkel, J. W. Larrick, and S. L. Kunkel, "Acute in vivo effects of human recombinant tumor necrosis factor," Laboratory Investigation, vol. 56, no. 6, pp. 583-590, 1987.
Avastin Genetech, Highlights of Prescribing Information. Genetech, San Francisco, Calif, USAGenetech, Avastin (Bevacizumab): Highlights of Prescribing Information, Genetech, San Francisco, Calif, USA, 2011.
Interferon immunogenicity: technical evaluation of interferon-α2a. E Hochuli, Journal of Interferon and Cytokine Research. 171E. Hochuli, "Interferon immunogenicity: technical evaluation of interferon-α2a," Journal of Interferon and Cytokine Research, vol. 17, supplement 1, pp. S15-S21, 1997.
Immune responses to therapeutic proteins in humans-clinical significance, assessment and prediction. E Koren, L A Zuckerman, A R Mire-Sluis, Current Pharmaceutical Biotechnology. 34E. Koren, L. A. Zuckerman, and A. R. Mire-Sluis, "Immune responses to therapeutic proteins in humans-clinical signif- icance, assessment and prediction," Current Pharmaceutical Biotechnology, vol. 3, no. 4, pp. 349-360, 2002.
Ranibizumab and bevacizumab for neovascular age-related macular degeneration. Catt Research The, Group, The New England Journal of Medicine. 36420The CATT Research Group, "Ranibizumab and bevacizumab for neovascular age-related macular degeneration," The New England Journal of Medicine, vol. 364, no. 20, pp. 1897-1908, 2011.
Intraocular inflammation after intravitreal ranibizumab injections. S Fauser, S Schroeder, A Caramoy, B Kirchhof, A Lappas, Acta Ophthalmologica. 891S. Fauser, S. Schroeder, A. Caramoy, B. Kirchhof, and A. Lap- pas, "Intraocular inflammation after intravitreal ranibizumab injections," Acta Ophthalmologica, vol. 89, no. 1, pp. e98-e99, 2011.
Rate of serious adverse effects in a series of bevacizumab and ranibizumab injections. S Sharma, D Johnson, M Abouammoh, Canadian Journal of Ophthalmology. 473S. Sharma, D. Johnson, M. Abouammoh et al., "Rate of serious adverse effects in a series of bevacizumab and ranibizumab injections," Canadian Journal of Ophthalmology, vol. 47, no. 3, pp. 275-279, 2012.
Role of intravitreal methotrexate in the management of primary central nervous system lymphoma with ocular involvement. J R Smith, J T Rosenbaum, D J Wilson, Ophthalmology. 1099J. R. Smith, J. T. Rosenbaum, D. J. Wilson et al., "Role of intravitreal methotrexate in the management of primary central nervous system lymphoma with ocular involvement," Ophthalmology, vol. 109, no. 9, pp. 1709-1716, 2002.
Intravitreal methotrexate for treating vitreoretinal lymphoma: 10 years of experience. S Frenkel, K Hendler, T Siegal, British Journal of Ophthalmology. 923S. Frenkel, K. Hendler, T. Siegal et al., "Intravitreal methotrex- ate for treating vitreoretinal lymphoma: 10 years of experi- ence," British Journal of Ophthalmology, vol. 92, no. 3, pp. 383- 388, 2008.
Update on toxic anterior segment syndrome. S P Holland, D W Morck, T L Lee, Current Opinion in Ophthalmology. 181S. P. Holland, D. W. Morck, and T. L. Lee, "Update on toxic anterior segment syndrome," Current Opinion in Ophthalmol- ogy, vol. 18, no. 1, pp. 4-8, 2007.
| Abstract Objective To study the clinical presentation, microscopic and organismal culture correlation of vitreous, and species-specific outcome in Bacillus endophthalmitis Design Retrospective noncomparative case series. Intervention Thirty-one culture proven Bacillus endophthalmitis patients between January 1991 and February 1998 underwent vitrectomy and intravitreal antibiotic injection. Lensectomy was combined when considered essential, and on a few occasions intravitreal dexamethasone was added. The patients also received topical and systemic antibiotics. The undiluted vitreous biopsy was the source for microbiologic evaluation (microscopy and culture sensitivity). Main outcome measures The duration of symptoms, the presenting visual acuity, and influence of intravitreal dexamethasone with intravitreal antibiotics were examined for any statistical correlation with the final visual acuity. Results Trauma was the major cause of infection. Vitreous biopsy microscopy demonstrated gram-positive bacillus in 28 of 31 cases, and polymicrobial infection was seen in 12 instances. All Bacillus species were sensitive to gentamicin, followed by vancomycin and ciprofloxacin. Clinical treatment within 7 days of symptoms, use of intravitreal vancomycin, and absence of polymicrobial infection were associated with better visual outcome. Conclusions With appropriate treatment that essentially consists of vitrectomy and intravitreal antibiotics, patients with Bacillus endophthalmitis are likely to benefit in many instances. Gram-positive bacilli detected on vitreous microscopy should be empirically treated as Bacillus species unless otherwise proved. | Staphylococcus lugdunensis is a rare causative organism of endophthalmitis following intravitreal injections. It presents an aggressive disease course with potentially devastating outcomes. In this case, the patient presented late with a severely painful, red eye with a reduced visual acuity from 6/18 to light perception following bilateral intravitreal injections of anti-vascular endothelial growth factor. Strict adherence to the bilateral intravitreal injection protocol meant prevention of infection in the right eye. Intravitreal vancomycin was administered without delay and an emergency vitreous biopsy was performed, confirming S. lugdunensis as the causative organism. An intense course of oral and topical steroids was chosen due to the aggressiveness of this organism. Early vitreo-retinal opinion was sought but the patient was deemed not suitable for vitrectomy due to initial improvements in visual acuity to hand movements. The patient showed improvements in the visual acuity to 1/60, and remains on a weaning regime of oral and topical steroids with no further complications.Categories: OphthalmologyKeywords: pars plana vitrectomy (ppv), anti-vegf treatment, staphylococcus lugdunensis, intravitreal injections, acute endophthalmitis 1 1 1 | Endophthalmitis remains the main complication of intravitreal injections, especially because their repetition multiplicates the risks. Surgical antisepsis is required for the prevention of endophthalmitis, but the benefit/risk ratio of topical antibioprophylaxis has never been demonstrated. In contrast, the selection of resistant bacteria appears to be exponential with the wider use of topical antibioprophylaxis. It seems that more and more operators stop using anibioprophylaxis, provided that the antisepsis is surgical and that the injection is performed in accordance with the rules of good practice. | Background: To investigate clinical features of infectious endophthalmitis over five years in a South Korean population.Methods: Medical records of consecutive patients diagnosed with infectious endophthalmitis at eight institutions located in Gyeongsangnam-do and Pusan city between January 1, 2004 and July 31, 2010 were reviewed.Results: A total of 197 patients were diagnosed and treated. An average of 30.0 infectious endophthalmitis per year was developed. The annual incidence rate of postoperative endophthalmitis during 2006~2009 was 0.037%. The ratios of male to female and right to left were 50.2%: 49.8 % and 54.8%: 43.2%, respectively. Eighth decade and spring were the peak age (36.6%) and season (32.0%) to develop the infectious endophthalmitis. The most common past history in systemic disease was hypertension (40.4%), followed by diabetes (23.4%). Cataract operation (60.4%) was the most common cause, among which most of them was uneventful phacoemulsification (95.9%). Corneal laceration (51.6%) and liver abscess (42.9%) were the most common causes of traumatic and endogenous endophthalmitis, respectively. The percentages of patients with initial and final visual acuity less than counting fingers were 62.6% and 35.2%, respectively. Treatment with vitrectomy with or without intravitreal antibiotics injection was administered to 72.6% of patients, while 17.3% received intravitreal antibiotics only.Conclusions: Our study revealed that the development of infectious endophthalmitis was related with seasonal variation and increased during our study period. Pars plana vitrectomy was preferred for the treatment of infectious endophthalmitis in South Korea. | Intraocular injection of gentamicin. Single injection therapy of experimental bacterial endophthalmitis. | The clinical analysis of endogenous endophthalmitis | a b s t r a c tAntibiotics such as fluoroquinolones (FQLs) are commonly used to treat ocular infections but are also known to cause dermal melanocyte toxicity. The release of dispersed pigments from the iris into the aqueous humor has been considered a possible ocular side effect of the systemic administration of FQLs such as Moxifloxacin, and this condition is known as bilateral acute iris transillumination (BAIT). Bilateral acute depigmentation of iris (BADI) is a similar condition, with iris pigment released into the aqueous, but it has not been reported as a side effect of FQL. Iris pigments are synthesized by the melanogenic enzyme tyrosinase (TYR) and can be detected but not quantified by using slit-lamp biomicroscopy. The correlation between dispersed pigments in the aqueous and the extent of melanocyte toxicity due to topical antibiotics in vivo is not well studied. Here, we aimed to study the effect of topical FQLs on iris tissue, the pigment release in the aqueous humor and the development of clinically evident iris atrophic changes. We evaluated this process by measuring the activity of TYR in the aqueous humor of 82 healthy eyes undergoing cataract surgery following topical application of FQLs such as Moxifloxacin (27 eyes, preservative-free) or Ciprofloxacin (29 eyes, with preservative) or the application of non-FQL Tobramycin (26 eyes, with preservative) as a control. In addition, the patients were questioned and examined for ocular side effects in pre-and postoperative periods. Our data showed a significantly higher mean TYR activity in the aqueous humor of Ciprofloxacin-treated eyes compared to Moxifloxacin-(preservative free, p < 0.0001) or Tobramycin-treated eyes (p < 0.0001), which indicated that few quinolones under certain conditions are toxic to the iris melanocytes. However, the reduced TYR activity in the aqueous of Moxifloxacin-treated eyes was possibly due to the presence of a higher drug concentration, which inhibits TYR activity. Consistently, immunoblotting analysis of the aqueous humor from both Ciprofloxacin-and Moxifloxacin-treated eyes showed the presence of soluble TYR enzyme, thus reflecting its toxicity to iris melanocytes and corresponding to its activity in the aqueous humor. Intriguingly, none of these patients developed any clinically appreciable ocular side effects characteristic of BAIT or BADI. Overall, our results suggest that topical antibiotics cause different levels of iris melanocyte toxicity, releasing dispersed pigments into the aqueous humor, which can be measured through TYR enzyme activity. Hence, we conclude that topical FQLs may cause subclinical toxicity to the iris melanocytes but may not be the sole cause of the development of BAIT or BADI. | PURPOSE ::: The pharmacokinetics of ophthalmic biotherapeutics are difficult to determine in human vitreous humor. Because of the high transparency of living tissue to near-infrared (NIR) light, the temporal changes in vitreous concentrations of a biomolecule labeled with an NIR fluorescent probe can be monitored in situ with a scanning laser ophthalmoscope (SLO). ::: ::: ::: METHODS ::: A humanized IgG was labeled with the NIR probe IRDye800CW (CVX-4164). Rabbits were given CVX-4164 intravitreally, and NIR fluorescence intensity was measured in the central plane of the vitreous humor with an SLO. Fluorescence intensities were converted to concentrations by using standard curves. ::: ::: ::: RESULTS ::: Little background fluorescence was detected, and the minimum detectable concentration of CVX-4164 was <10 nM. Vitreal concentrations of CVX-4164 determined in situ declined with time, with C(max) ≈ 1 μM and t½ = 145 hours (112-μg dose). The t½ of CVX-4164 was approximately three times greater than that of the IRDye800CW alone, whereas the vitreal clearance (CL) and volume of distribution (V(ss)) of the native dye were approximately 2000- and 550-fold greater than that of the conjugate. CVX-4164 concentrations determined in situ were 2.6 to 4.4 times higher than those determined by ex vivo NIR fluorescence or ELISA in homogenized vitreous humor, reflecting the greater spatial resolution of in situ imaging. Moreover, vitreal concentrations determined in situ were >3 orders of magnitude greater than plasma concentrations of CVX-4164, as determined by ELISA, and had a different kinetic profile. ::: ::: ::: CONCLUSIONS ::: This study demonstrates the feasibility of determining the pharmacokinetics of intraocular biotherapeutics labeled with NIR fluorescent probes by in situ monitoring. |
1,999,812 | A radial-flow batch drier for maize | Since humans have been sowing seeds, a goal h as often been to maximize yield for the water available. This paper reviews the factors that infl uence the relationship between yield and water use, and then examines a solution that might contribute to a modest yield increase on a fix ed amount of water. The physics of gas exchange by leaves imposes a limit on the relationsh ip between plant growth and transpiration water loss. Both water uptake by the plant to support transpiration and the water loss as driven by atmosp heric vapor pressure deficit (VPD) play major roles in determining maximum crop yield in a given environment. There are no biological solutions to break this physical relationship no matter the sophistication of genetic approaches. However, there is the possibility to achieve m odest yield increases by developing plants to | The technology of haploid breeding in maize can significantly accelerate thebreeding process,it is the biotechnology and conventional breeding method are combined to produce a new breeding technology.The key technology of haploid breeding is described,including the identification of haploid haploid,and haploid doubling. | According to the practical situation in the countryside of China, a design principle of moving wheat dryer and cleaner is advanced. Its structure design is discussed and presented. Its characteristics,suitability and important effects of reducing loss of crops after harvest are also pointed out. | A large proportion of the Australian sugar crop is irrigated by travelling gun irrigation machines, including approximately 60% of the crop in the Bundaberg district. However, little is known of their performance in the field. To redress this deficiency, trials were conducted in the Bundaberg region to determine the performance of travelling irrigators under various conditions and to enable assessment of the opportunities for improving performance. Depths of water applied by one pass of the machines were measured using a linear array of catch cans in a single leg test. The Christiansen uniformity coefficient (CU) was used to benchmark the performance. The influence of wind speed and direction (relative to the travel direction of the machine), operating pressure, and nozzle size and type were determined. In all cases tested, the uniformity of applications was sub-optimal. Optimum lane spacings were calculated. | Dry gallon The dry gallon, also known as the corn gallon or grain gallon, is a historic British dry measure of volume that was used to measure grain and other dry commodities and whose earliest recorded official definition, in 1303, was the volume of 8 pounds of wheat. It is not used in the US customary system – though it implicitly exists since the US dry measures of bushel, peck, quart, and pint are still used – and is not included in the handbook that many states recognize as the authority on measurement law. The fluid gallon is another volume | Take orthogonal experiment to study the yields and growth of corn under the condition of different irrigation frequency,different irrigation water quota,different N/P and irrigation on film.Through range and covariance analysis,the result showed that the irrigation on film corn method reached higher yields when the irrigation frequency was 4,the irrigation water quota was 600 m3/hm2 and N/P was 2.5.The results of stem height and LAI of corn were analysed.A conclusion has been made that the irrigation water quota is the most influential factor among the above three factors,but the results of covariance analysis is not clear. | Tractor performance and corn crop development as a function of furrow opener and working depth in a Red Latosol | The fresh unriped maize is more and more popular due to its functions for human health.However, energy consumption in the frozen processing seriously effects the economic profit.In this paper,the procedure of frozen processing of the unriped maize was analyzed and energy conservation measures were suggested. | 1,999,812 | Abstract Design and construction of a New Zealand-made batch maize drier are described. The dner has a capacity of 102 t (100 tons) per day at 10% moisture content extraction. Details of performance testing are given, together with approximate heat and moisture balances for each test. | Screening Test of Maize Varieties Suitable for the Sandy Soil in Luan River Basin | Application of AMMI Model in Regional Experiment of Maize | Research and Analysis of Non-in-row Maize Harvest Technology | The goal of this study was to determine the vertical partition of corn stover components in eastern Canada, and to consider fractional harvest. Four corn hybrids in two climatic zones were monitored over a twelve-week period for stem length, ear height, total dry matter (DM) and moisture content (MC). Hybrids with low crop heat units (CHU) were shorter; their ears were at 0.96 m above the ground on average. Hybrids with high CHU were taller and their ears were 1.21 m above the ground. At the end of the study, the average DM yield partitioned in seven components was: 54% grain, 14% bottom stalk (below the ear), 6% top stalk , 5% bottom leaves, 7% top leaves, 5% husk and 9 % cob. During the harvest period, the total mass of fiber decreased from 8.9 to 6.6 t DM/ha for a low CHU hybrid and from 9.3 to 8.3 t DM/ha for a high CHU hybrid. Compared with U.S. data, the MC of stover was much higher in Quebec. At the end of October, stover MC remained at 60% in Quebec compared to 50% in Wisconsin and less than 20% in Tennessee. For industrial end-uses (pellets, wood paneling), the MC of fiber should be as low as possible to minimize artificial drying. This research suggests collecting stover later in the season and mainly from the upper half of the plant to reduce drying costs. Natural field drying to reduce stover MC should also be considered. | Research on Yield-increasing of Different Kinds of Maize | Performance of Drought Tolerant Maize Varieties under Water Harvesting Technologies in the Coastal Region of Kenya | The impact of weather on the scheduling of sweet corn for processing 2. Variation in crop duration with cultivar, season, time of planting and site | Increasing planting density is an important practice associated with increases in maize yield, but densely planted maize can suffer from poor light conditions. In our two-year field experiments, two morphologically different cultivars, ZD958 (less compact) and DH618 (more compact), were planted at 120,000 plants ha −1 and 135,000 plants ha -1 , respectively. We established different leaf area index (LAI) treatments by removing leaves three days after silking: (1) control, no leaves removed (D0); (2) the two uppermost leaves removed (D1); (3) the four uppermost leaves removed (D2); (4) the leaves below the third leaf below the ear removed (D3); (5) the leaves of D1 and D3 removed (D4); (6) the leaves of D2 and D3 removed (D5). Optimal leaf removal improved light distribution, increased photosynthetic capacity and the post-silking source-sink ratio, and thus the grain yield, with an average LAI of 5.9 (5.6 and 6.2 for ZD958 and DH618, respectively) for the highest yields in each year. Therefore, less-compact cultivars should have smaller or fewer topmost leaves or leaves below the ear that quickly senesce post-silking, so as to decrease leaf area and thus improve light distribution and photosynthetic capacity in the canopy under dense planting conditions. However, for more compact cultivars, leaves below the ear should senesce quickly after silking to reduce leaf respiration and improve the photosynthetic capacity of the remaining top residual leaves. In future maize cultivation, compact cultivars with optimal post-silking LAI should be adopted when planting densely. |
1,999,813 | James Baldwin-Webb | Bill Engvall. He's awesome. And I'm not using the word "awesome" wrong, either. I just wish it were longer. He is so clever! | Harrison Ford in AIR FORCE ONE.\n\nHe not only took back the plane he kicked some serious a$$ for a President. | Most famous actors in 2008? | Which celebrities support Trump? | Who is the most famous person on earth ever? | It could be a celebrity, a relative, a friend, anything. Who do you think has the most interesting life story? | Name two current senator of new york? | Gov. Arnold Schwarzenegger has named a new California poet laureate: Al Young. Born in Mississippi, the 65-year-old poet, teacher, novelist and screenwriter has spent most of his life in the San Francisco Bay Area. He reads his poem <EM>To Be The Perfect Fool</EM>. | 1,999,813 | Colonel James Baldwin-Webb TD (5 February 1894 – 18 September 1940) was a British Army officer, businessman, and Conservative Party politician who served in the House of Commons as a Member of Parliament (MP) for The Wrekin from 1931 to his death at sea in 1940.
Family background
He was born in Remenham, Berkshire, the only son of James Bertram Webb and his wife Elizabeth Anne Baldwin, of Wylde Green, Sutton Coldfield, Warwickshire. He was educated privately.
Business career
After leaving school, Baldwin-Webb worked in his maternal grandmother's family firm of Messrs Baldwin's(Birmingham) Ltd, then a firm of hardware merchants. He then joined the local staff of Lloyds Bank in Birmingham, where he passed all major banking examinations, but left the company when he joined the army at the outbreak of World War I in August 1914.
After the war, he returned to Baldwin's and worked as a representative, later becoming managing director. He was credited with guiding the firm in the 1920s to diversify into a major builders' merchants.
He later became a member of two City of London livery companies, the Worshipful Company of Coachmakers and Coach Harness Makers and of Pattenmakers.
Military career
At the outbreak of World War I, Baldwin-Webb enlisted in a Territorial Army (TA) unit, the 46th North Midland Divisional Train of the Royal Army Service Corps (RASC), becoming a commissioned officer in a few weeks.
From 1915 he served on the Western Front, took part in the Battle of the Somme attached to an artillery trench mortar battery, and later served on the staff of the Third and Fourth Armies of the British Expeditionary Force. As a result of his service in France, he was created a Chevalier of the Ordre du Mérite Agricole by the French Government in 1919.
After the war he continued to serve, part-time, with the Train and rose to lieutenant-colonel in its command, from 1925 to 1931. He was promoted full colonel in February 1932, and awarded the TD in 1934. In 1939 he was appointed Honorary Colonel of the 4th Anti-Aircraft Division R.A.S.C.
Political career
Baldwin-Webb was elected a member of Birmingham City Council in 1925 and served until his death, at one point chairing its Highways Committee.
He was elected as MP for The Wrekin at the General Election of October 1931, taking it from a Labour Member, Edith Picton-Turbervill, and held it at the 1935 general election.
It was a time of depression and at his maiden speech in the House of Commons, he moved a motion to urge the National Government of Ramsay MacDonald to help create employment by a progressive policy of carrying out public works where there was greatest need. He also gained concessions on unemployment insurance for workers in the sugar beet industry, one of the constituency's main seasonal employers. He was described by an unnamed source as "the best commercial traveller the Wrekin division has ever had" for his mainly successful efforts to gain orders for local industries.
He also became well known for organizing what became known as the "Baldwin-Webb trips" to London and seaside towns for the pleasure of constituents and to advertise the Wrekin area's industries. They attracted between 5,000 and 7,000 day trippers a year.
He was also appointed as a Deputy Lieutenant of Staffordshire in 1932.
Death
Although Baldwin-Webb did not see active service after the outbreak of World War II, continuing to appear in Parliament, he later became honorary secretary of the British Volunteer Ambulance Corps (originally called the Anglo-French Ambulance Corps). It was on a voyage to Canada to fund-raise for the Corps that he lost his life, as he was drowned when the SS City of Benares was torpedoed and sunk in the North Atlantic by a German submarine. Witnesses recalled that Baldwin-Webb helped women passengers out of the ship onto lifeboats, and tried to persuade the wife of fellow passenger Rudolf Olden to leave but she preferred to stay with her invalid husband. (German Nazi propagandists later claimed that he and Olden were sailing on a British government mission to persuade the then-neutral United States to enter the war.) He was last seen alive "standing by the Captain as the ship went down". He was unmarried.
He is commemorated in the House of Commons chamber by a heraldic shield.
A road, Baldwin-Webb Avenue, is named after him in the Donnington district of Telford in Shropshire.
References
External links
The Wrekin constituency – Shropshire Star
1894 births
1940 deaths
Conservative Party (UK) MPs for English constituencies
Members of the Parliament of the United Kingdom for constituencies in Shropshire
UK MPs 1931–1935
UK MPs 1935–1945
British civilians killed in World War II
Deaths by drowning
Royal Army Service Corps officers
Deputy Lieutenants of Staffordshire
British Army personnel of World War I
People from Remenham
Knights of the Order of Agricultural Merit
People lost at sea | James Ramsbotham, 2nd Viscount Soulbury | during which war did pilot james clark edgerton die | in which year was joseph bamford appointed a cbe for services to | when did major general james l baldwin die | what was abolished in new hampshire during thomson's tenure as governor | when did james webb become secretary of state | what was the name of the british army medical officer who served in the crime | when did albion howe serve in the freedmen's bureau |
1,999,814 | ... wanted (video editing and watching) but appears to be good value for those who won't mind certain speed limtations | If you need something that has the speeds for high quality video then this is great. | Good speed for video editing, us it with 4k videos and final cut and it performs to my needs, can seek and play back at ease compared to a slower drive. | As title states in the market for a camera mostly video for between 1500-2k. Have been researching canon 80D and Sony a7 but find it very confusing and complicated. 4K is not a deal breaker for me as I mostly do YouTube videos and family photos but image stabilization is very important. | Anyone got controlla in high quality or is it just at 128 bit rate | If you mean 150 KB/s (Kilobyte per Second) which equals 1.2 Mb/s, it's not very bad unless you don't want to stream HD videos or download big files. For casual stuff like email, browsing, chatting, music streaming etc, that speed will be more than enough. I would recommend minimum 250 KB/s for better experience. | Hi there
I have been wondering for a while, if getting into software like motec is worth, and if it actually improves your racing?
Do you guys use it? And for what do you mainly use it for? | What's a sweet spot for price/speed in InfiniBand?
Here's a chart of speeds:
#Performance
And given that the bandwidths of modern GPUs and CPUs are above 100GB/s generally I believe, even the fastest IBs seem reasonable.
However, the more speed, the more expensive.
For homelab use the fastest ones may not be feasible, due to them being too expensive for home use.
So what could be a sweet spot for price and speed? | The product is ok. The quality of the pictures is much lower than I had expected and the videos aren't that smooth to run. This is compared to the promotional videos they have around. | 1,999,814 | The tablet was a bit slow for what i wanted (video editing and watching) but appears to be good value for those who won't mind certain speed limtations.
I never recieved my refund. Never. | It's the best tablet on the market | this tablet is great. It is a bit heavy | Excellent PC tablet for the price definitely met my expectations | Can anyone recommend a tablet? | Good tablet but has its shortcomings | Great tablet, but not perfect | Great tablet. Only complaint is some of the buttons ... | my first tablet and I am finding it's a better option for so many things I previously did on ... |
1,999,815 | Des bons jeux online (navigateur) en multi ? | Je leur ai demandé de résilier mon contrat internet et mon numéro en raison d'un départ définitif il y a trois mois, mais je reçois encore les factures de mon numéro, par contre l'internet a été résilié.
Je ne peux pas appeler le 3900 depuis l'Amérique du Sud, et ça fait trois mois que je paie une facture pour un service que je n'utilise plus.
Y a-t-il des solutions possibles pour parler avec eux directement ? Envoyer un courrier est trop compliqué depuis où je suis, et je n'ai plus le mot de passe de mon compte orange. | sur la Home il y a possibilité de tri par prix croissant ou décroissant, cette page a pour l'url de la home plus un paramètre GET, ils ont bien pris le soin de mettre la canonical vers la Home, mais la page est quand même indexée et quand je fais la commande site:nom_du_site, elle est dans la première page, elle a quand même du poids non? faut il s'en soucier? | Postez de la musique française que vous écoutez en ce moment, plutôt avec un lien YouTube.
*Post French music that you're currently listening to, with links preferably from YouTube.* | Postez de la musique française que vous écoutez en ce moment, plutôt avec un lien YouTube.
*Post French music that you're currently listening to, with links preferably from YouTube.* | Bonjour la triple compagnie, j'aimerai créer un timer pour mon jeu mais version jour, heure, seconde, comment je fait ? Et est ce qu'il existe un site contenant le script? Merci beaucoup | Demain c'est le open beta de World of Warcraft Classic. Tout le monde peux essayer. Si quelqu'un ce cherche des Québécois pour jouer venez check notre discord.
| C'est un nouveau subreddit sur l'actualité au Sénégal
Langue : français
Thème: actualité général
Lien : |
Je voudrais bien ecouter a musique comme ca pour comprende beaucoup, mais je ne sais pas ou a commencer. | 1,999,815 | Depuis quelques temps je joue avec une amie en ligne à quelques jeux (reversi, tetris, échecs, dames ...) sur flyordie]( [Tetris Friends]( ou [Lichess.
J'aimerais bien jouer à d'autres jeux aussi, comme **Bomberman** (ou un ersatz de Bomberman), du **Démineur Flag** (comme sur MSN à la vieille époque) et pourquoi pas du **Boggle**, **Columns**, **Scrabble** ou autre :).
Vous connaissez des bons sites du genre ? (avec un tchat pour discuter en même temps), avec ou sans inscription, il faut juste que ça soit jouable dans le navigateur sans installer 50 trucs et dans lequel je peux jouer directement avec mon amie (pas juste un site multi dans lequel je ne peux jouer que contre des inconnus random).
Merci d'avance :) et bonne année. | Das Thema der Woche: Vor 10 Jahren - Eure Top10 aus 2009 | Quelques precisions sur le genre Trechomys Lartet | La NFL lance son site francais. Qu'en pensez-vous? | Je m’explique : je faisais un peu de musculation avant, mais deux tendinites aux épaules m’ont contraint à arrêter.\nAujourd’hui, j’aimerais bien reprendre la musculation, mais je ne veux surtout pas relancer ces tendinites.\nJ’ai donc pensé à commencer avec ces systèmes (sport elec, je crois) d’impulsions électriques pour stimuler les muscles.\nEst-ce efficace ? Est-ce douloureux ? Est-ce que ils peuvent poser des problèmes médicaux de n’importe quelle sorte ? Est-ce cher ? | Idées de sites web utiles pour les Québecois? | La "tempete" on fait des prévisions ? | Magasin d'instruments de musique sur Paris | Comment est-ce que le score du TEFAQ fonctionne? |
1,999,816 | Review and Prospect of Disaster Prevention of Urban Underground Space | Urban geological disaster has a great effect on urban construction. Geological disaster prevention and control planning provides scientific basis for urban general planning,and it is an important part of planning. The aims,contents and technique of this kind of planning were studied,meanwhile,function and performance of information management system of urban geological disaster prevention were also researched. | Catastrophe mechanism and control technology of ground collapse induced by urban tunneling | Urban underground space (UUS) resources, as an important part of urban space, should be properly and rationally treated, and the urban geological conditions must be taken into account. In this paper, the geological suitability evaluation model was focused on in the light of four subjects: the topography and landform, the engineering geology, hydrogeology and the site stability which, respectively, have their indexes. By making use of the analytical hierarchy process (AHP) and ArcGIS software, the development suitability for the urban underground space can be obtained. The above method was applied in the Changzhou's plan of urban underground space exploitation and utilization as an example. | To analyze the research in tunnel engineering at home and abroad, and summarize the research status and development prospects, 200 cases of the tunnel caving are analyzed according to the statistical data, which can be divided into four major categories, consisting of 11 kinds of factors in engineering geology, hydrogeology, and the construction about survey and design. In decomposing each of these, mountain tunnel collapse risk assessment system was established, and tunnel collapse risk was evaluated by using the Catastrophe Theory. This means that the model can be used to predict the caving risk for the tunnel project and the results can reflect the actual situation, and the research results can provide the foundation for the engineering caving risk management of the similar tunnels and offer the significant guiding for the safety management of the construction as well. | Underground space is increasingly regarded as an economic resource and a developmental opportunity, rather than a technology of last resort to be used when aboveground solutions fail. Geotechnical investigations are needed in early stages of industrial and urban planning to define opportunities and avoid difficulties and conflicts in the use of underground space. The need to manage conventional energy resources and capture wasted or renewable energy resources is creating new uses for underground space. The energy-related functions of underground space are fuel storage and management, energy capture and storage, energy conservation, and nuclear waste isolation. Fuel storage is a developed industry. Energy storage is rapidly developing. Geotechnical classifications of mined space and porous rock storage systems and functional classifications of fuel and energy storage systems are presented. | With the development and building of large cities in China,multi-utility tunnels are is constructed in many cities,but they are different in design and construction of fire control system from place to place.In this paper,the reasons and characteristics of fire accidents in multi-utility tunnel are figured out by analyzing the type and function of pipelines installed in it.Meanwhile,based on the comprehension of codes and the analysis of projects,the authors propose that,for the construction of multi-utility tunnel with small scale,small coverage or low voltage grade power,effective measures can be taken to avoid the installation of automatic fire extinguishing system,while,for the construction of multi-utility tunnel with large scale,large coverage or high voltage grade power,movable water spray fire extinguishing system is expected to be used besides the application of effective measures in construction. | The paper sums up the classification of underground continuous walls and their advantages and disadvantages,analyzes the construction difficulties of the underground continuous walls,and points out the respective measures for the construction difficulties,so as to improve the construction craft of the underground continuous walls and to extend its application in foundation pit projects. | Taking the Xujiahui Integrated Transportation Hub as an example,this paper discusses the safe evacuation of underground Urban Mass Transit complex,and proposes a design method with sharing emergency exit and comprehensive monitoring system,provides design ideas for similar projects. | 1,999,816 | Research on the method of fuzzy comprehensive evaluation to urban underground space study | Evaluation of Urban Underground Space Based on the Geological Conditions: A Feasibility Study | The Subway Engineering Risk Assessment Based on Fuzzy Comprehensive Evaluation | a b s t r a c tIn this study, the volume of dirty money in Iran was estimated. The data belonged to the period of 1997-2019, and was taken from the Central Bank of Iran (website: https://www.cbi.ir ). Fuzzy logic was used to estimate the underground economy. Fuzzy theory can mathematically formulate many variables that are imprecise and ambiguous concepts. This theory is appropriate for reasoning, inference, control, and decision-making under uncertainty. This approach works in conditions of uncertainty. In cases in which the variables are inaccurate, this method is used. Fuzzy set theory is a generalization of the set theory. The underground economy is important in estimating the amount of dirty money and has a positive effect on this amount. The effect of the underground economy was investigated using the vector autoregressive (VAR) and vector error correction (VECM) models.• In this article applied the fuzzy logic, to estimate the underground economy. • The method presented in this article can be useful for Researchers and managers in the monetary trend of economics. • The fuzzy method is the best way to estimate the size of the underground economy because it is a measure of uncertainty. | Research on Fuzzy Comprehensive Evaluation of the Earth Dam Safety | A fuzzy logic based classification for assessing of rock mass drillability | Application of Fuzzy Matter-element Model in Groundwater Quality Evaluation | A fuzzy logic approach to modelling the New Zealand underground economy | Research on Probability Distribution of Rock and Soil Based on Fuzzy BAYES Method |
1,999,817 | Pecking order theory | in that it is made up of two perches. If a single player controls both of the perches, he gains an additional 3 points (for a total of 19). The game ends when each player has played through their deck. Player tally their scores, and gain points for perches they control with birds. However, a perch controlled with a jaguar does not gain the player points. The player with the most points wins the round. Pecking Order (game) Pecking Order is a card game, where players try to claim the best feeding spots in the jungle by playing their birds | in that it is made up of two perches. If a single player controls both of the perches, he gains an additional 3 points (for a total of 19). The game ends when each player has played through their deck. Player tally their scores, and gain points for perches they control with birds. However, a perch controlled with a jaguar does not gain the player points. The player with the most points wins the round. Pecking Order (game) Pecking Order is a card game, where players try to claim the best feeding spots in the jungle by playing their birds | Bottom Feeder him to eat a rat and later a dog. He begins to mutate into a hybrid creature shortly thereafter. A group of salvage workers led by Vince Stoker (Tom Sizemore) arrive at an abandoned hospital, hoping to find old equipment they can sell for quick cash. Stoker's niece, Sam (Amber Cull), is with the team for the first time. As they explore the hospital, they reach the tunnels beneath the building, which are coincidentally where Leech is trapped. Having now fully mutated into a giant, rat-like monster, Leech begins stalking and killing the workers. As their numbers dwindle, they too | Emergent dynamics of Cucker–Smale flocking particles in a random environment | unison on the nest structure. Nests are constructed from dead sticks and leafy branches, with materials gathered from the ground or broken off trees and carried to the nest site in feet or beak. Nest dimensions have been measured at 1.2m long x 0.8m wide x 0.4m deep. Nest dimensions are larger than that of any other raptor species, including the larger-bodied wedge-tail eagle. The black-breasted buzzard lays its eggs from August to October, with breeding believed to be stimulated by increased day length, as well as by increased food availability often linked to rainfall events. A usual clutch comprises | a more pronounced numerical response to changes in host density since there is often a more direct connection (less time lag) between food and reproduction in that both needs are immediately satisfied by its interaction with the host. The aggregational response, as defined by Readshaw in 1973, is a change in predator population due to immigration into an area with increased prey population. In an experiment conducted by Turnbull in 1964, he observed the consistent migration of spiders from boxes without prey to boxes with prey. He proved that hunger impacts predator movement. Riechert and Jaeger studied how predator competition | work. This minimalist approach of the Buffet deprived it of improved consistency of intonation, ease of operation, and increased power, which is found in Heckel bassoons, but the Buffet is considered by some to have a more vocal and expressive quality. The conductor John Foulds lamented in 1934 the dominance of the Heckel-style bassoon, considering them too homogeneous in sound with the horn. The modern Buffet system has 22 keys with its range being about the same as the Heckel. Compared to the Heckel bassoon, Buffet system bassoons have a narrower bore and simpler mechanism, requiring different fingerings for many | What is the bottom up and top down approach? | 1,999,817 | In corporate finance, the pecking order theory (or pecking order model) postulates that the cost of financing increases with asymmetric information.
Financing comes from three sources, internal funds, debt and new equity. Companies prioritize their sources of financing, first preferring internal financing, and then debt, lastly raising equity as a "last resort". Hence: internal financing is used first; when that is depleted, then debt is issued; and when it is no longer sensible to issue any more debt, equity is issued. This theory maintains that businesses adhere to a hierarchy of financing sources and prefer internal financing when available, and debt is preferred over equity if external financing is required (equity would mean issuing shares which meant 'bringing external ownership' into the company). Thus, the form of debt a firm chooses can act as a signal of its need for external finance.
The pecking order theory is popularized by Myers and Majluf (1984) where they argue that equity is a less preferred means to raise capital because when managers (who are assumed to know better about true condition of the firm than investors) issue new equity, investors believe that managers think that the firm is overvalued and managers are taking advantage of this over-valuation. As a result, investors will place a lower value to the new equity issuance.
History
Pecking order theory was first suggested by Donaldson in 1961 and it was modified by Stewart C. Myers and Nicolas Majluf in 1984. It states that companies prioritize their sources of financing (from internal financing to equity) according to the cost of financing, preferring to raise equity as a financing means of last resort. Hence, internal funds are used first, and when that is depleted, debt is issued, and when it is not sensible to issue any more debt, equity is issued.
Theory
Pecking order theory starts with asymmetric information as managers know more about their company's prospects, risks and value than outside investors. Asymmetric information affects the choice between internal and external financing and between the issue of debt or equity. Therefore, there exists a pecking order for the financing of new projects.
Asymmetric information favours the issue of debt over equity as the issue of debt signals the board's confidence that an investment is profitable and that the current stock price is undervalued (were stock price over-valued, the issue of equity would be favoured). The issue of equity would signal a lack of confidence in the board and that they feel the share price is over-valued. An issue of equity would therefore lead to a drop in share price. This does not however apply to high-tech industries where the issue of equity is preferable due to the high cost of debt issue as assets are intangible.
Evidence
Tests of the pecking order theory have not been able to show that it is of first-order importance in determining a firm's capital structure. However, several authors have found that there are instances where it is a good approximation of reality. Zeidan, Galil and Shapir (2018) document that owners of private firms in Brazil follow the pecking order theory, and also Myers and Shyam-Sunder (1999) find that some features of the data are better explained by the pecking order than by the trade-off theory. Frank and Goyal show, among other things, that pecking order theory fails where it should hold, namely for small firms where information asymmetry is presumably an important problem.
Profitability and debt ratios
The pecking order theory explains the inverse relationship between profitability and debt ratios:
Firms prefer internal financing.
They adapt their target dividend payout ratios to their investment opportunities, while trying to avoid sudden changes in dividends.
Sticky dividend policies, plus unpredictable fluctuations in profits and investment opportunities, mean that internally generated cash flow is sometimes more than capital expenditures and at other times less. If it is more, the firm pays off the debt or invests in marketable securities. If it is less, the firm first draws down its cash balance or sells its marketable securities, rather than reduce dividends.
If external financing is required, firms issue the safest security first. That is, they start with debt, then possibly hybrid securities such as convertible bonds, then perhaps equity as a last resort. In addition, issue costs are least for internal funds, low for debt and highest for equity. There is also the negative signaling to the stock market associated with issuing equity, positive signaling associated with debt.
See also
Capital structure substitution theory
Corporate finance
Cost of capital
Market timing hypothesis
Trade-off theory of capital structure
References
Corporate finance
Asymmetric information
Debt
Finance theories | The Impact of Financing Surpluses and Large Financing Deficits on Tests of the Pecking Order Theory | Dynamic Relationship between Debt and Cash flow in Pecking Order Theory: Evidence from Panel GMM | Corporate Finance: Theory and Practice | Recently, there has been a flurry of activity in both the financial and political science literature discussing the possible merits of the German bank-based system over the market-based model of firm capital investment and financing. The debate in question can be characterized by "orthodox" and "revisionist" views, which seek to determine the importance of alternative institutional settings on the link between the real and financial decisions of the firm. The orthodox view holds that bank-based systems are better at overcoming asymmetrical information and principal-agent problems arising when ownership and control of firms are separated. The market-based model of firm investment finance, such as that which exists in the U.S. and the U.K. it is argued, often results in informational and incentive problems which lead to an increase in the external costs of investment finance to the firm. If the banks from which the firms borrow have less information about the firm than the | The choice between corporate and structured financing: evidence from new corporate borrowings | Investment, Capital Structure, and Complementarities Between Debt and New Equity | Privately-produced safe debt is designed so that there is no adverse selection in trade. This is because no agent finds it profitable to produce private information about the debt's backing and all agents know this (i.e., it is information-insensitive). But in some macro states, it becomes profitable for some agents to produce private information, and then the debt faces adverse selection when traded (i.e., it becomes information-sensitive). We empirically study these adverse selection dynamics in a very important asset class, collateralized loan obligations, a large symbiotic appendage of the regulated banking system, which finances loans to below investmentgrade firms. | This study aimed to measure the impact of the capital structure on the financial performance of basic materials companies listed on the Saudi Stock Exchange (Tadawul) during the period (2014-2021). The study relied on a number of independent variables to measure financial performance (the ratio of total debts to total assets, the ratio of Total debt to equity, the ratio of long-term debt to total assets), and ROE was used as an independent variable to measure financial performance. The study targeted all Saudi public shareholding basic materials companies listed in the Saudi financial market, a sample of (42) companies were selected, which represent the study population. To verify the acceptance or rejection of the study's hypotheses, the descriptive statistics method was followed, and the multiple linear regression model was used. The researcher concluded that there is a positive and statistically significant effect of the total debt to the equity of the study sample companies, and the absence of a significant effect of (total debt to total assets and long-term debt to total assets) on the financial performance. The study recommended that Saudi companies should use both short-term and long-term debt to finance their operations, which has a positive impact on financial performance. The study also recommended the Saudi Capital Market Authority to issue guidelines for Saudi public shareholding companies that contain the advantages that companies obtain from managing the capital structure with high efficiency and its repercussions on financial performance. |
1,999,818 | Modal analysis of unstable resonator semiconductor lasers with lateral waveguiding | The emission characteristics of unstable resonator semiconductor lasers were measured. The output of an 80-µm-wide laser consists of a diverging beam with a virtual source 5 µm wide located 50 µm behind the laser facet. A high degree of spatial coherence of the laser output was measured, indicating single lateral mode operation for currents I ~< 3 Ith. | Electromagnetic field inside a broad-area diode laser is considered as a system of counterpropagating waves. A study of the lateral field instability was performed by using a 6- wave mixing theory. It is shown that perturbation waves with the tilted angle (phi) <EQ 1.2 degrees inside the active region, and respectively, with the side lobes of the far-field pattern of less than 4 degrees, have the greatest growth increment. These waves produce lateral intensity modulation with the period 10 divided by 30 micrometers for the 0.85 micrometers lasing wavelength. The appearance of such waves corresponds to the instability threshold of a homogeneous lateral distribution of optical power in a diode laser. The calculation results explain an experimental observation of the chaos in lateral transversal intensity distribution in usual broad-area diode lasers. The theory allows a stability analysis of the homogeneous field distribution in diode lasers of a novel design. | Two-dimensional numerical analysis of lasing characteristics for self-aligned structure semiconductor lasers | We present theoretical and experimental evidence for a new type of multimode instability in a homogeneously broadened ring-laser system. The unstable behavior discussed in this paper is the result of multimode competition and can manifest itself either through self-pulsing or hysteretic behavior of the bistable type in the laser output intensity and operating frequency. We have verified some of our predictions with the help of a CO/sub 2/ laser whose observed bistable behavior is in good qualitative agreement with the theoretical predictions. | The dynamics properties of two modulated-coupling single-mode lasers system are analyzed by numerical simulation.Based on the modulated frequency of the spatially overlapping between two lasers, the relationship between the laser intensity and modulated frequency is discussed.The result shows that the intensities of such two lasers can reach the state of chaotic,synchronization in the suitable parameters, especially when the coupling strength is modulated in the range of frequency.Through the analysis of the power spectra and the Lyapunov exponent,it can be convinced that the laser system studied is in a chaotic state. | A Route to Chaos after Bifurcation in a Two-section Semiconductor Laser Using Opto-electronic Delayed Feedback at Each In-current | The dynamical properties of three spatially coupled multimode lasers are investigated theoretically. When the pump of the system is modulated, the total intensities of the first and the third lasers show perfect chaotic synchronization within certain parameter range. The intensities of the corresponding modes also show chaotic synchronization. While for different modes, the intensities are totally chaotic. There is no chaotic synchronization of intensities between the first(third) and the middle lasers.The intensities of the modes in the lasers show mode competition. From the Lyapunov exponent, it is shown that the laser system is chaotic. | Abstract : Work has continued on laser beam analysis, laser beam characterization, and laser beam quality. Unexpected analytical and numerical results have been developed, and experimental work on the development of quasi-monolithic diode-pumped unstable resonator lasers continues. A number of papers have been published or are in course of preparation, as detailed in the report. | 1,999,818 | Unstable resonator semiconductor lasers (URSL) have been demonstrated as a high power source with large mode volumes and the ability to defocus, and hence suppress, filamentation.1 A special feature of semiconductor lasers is that, regardless of longitudinal cavity configuration, the optical field is confined in both the lateral and transverse directions as a result of differences in the dielectric constant, and stable guided modes are produced. These waveguiding effects occur even in the ostensibly open-walled gain-guided devices due to the step in the complex dielectric constant at the edge of the gain region, in the case of URSL, an additional real-index waveguide may be incorporated to reduce the diffraction losses of the cavity and obtain a higher external quantum efficiency.2 | Based on a combination of high quality materials, advanced design considerations, and focused-ion-beam micromachining, unstable resonator semiconductor lasers (URSLs) have been fabricated in several material systems. GaAs/AlGaAs, InGaAs/GaAs, and GaInP/AlGaInP URSLs fabricated by FIBM have achieved brightness values of 100 to 400 MW/cm 2 /Sr which is one to two orders of magnitude greater than the brightness of commercial semiconductor lasers produced from the same material systems and with comparable dimensions. | Recent work has demonstrated high power, spatially coherent operation of on-the-chip unstable resonator diode lasers. The unstable resonators were fabricated in SQW-GRINSCH material using photolithography and a dry chemical etch technique. The unstable resonator design provides mode selectivity in broad area devices by suppressing higher order lateral modes. These devices demonstrated twice diffraction limited far fields with high average power and strong lateral coherence.© (1991) COPYRIGHT SPIE--The International Society for Optical Engineering. Downloading of the abstract is permitted for personal use only. | The first wavelength-stabilised external-cavity laser diode using a new generation of resonant grating filters called the cavity resonator integrated guided mode filter (CRIGF) is reported. The CRIGF combines high reflectivity and spectral selectivity for tightly focused beams allowing the simplified `cat's eye' external cavity to be used. Output powers of more than 10 mW together with a side mode suppression ratio larger than 35 dB for a drive current of 50 mA are achieved. CRIGF-controlled operation at a wavelength spanning a 20 nm range is also demonstrated, with a linear relationship between the CRIGF period and output wavelength. | High power diode lasers form a few Watts up to several Kilowatts have entered industrial manufacturing environment for materials processing applications. The technology has proven to show unique features, e.g. high efficiency, small size, low energy consumption and high reliability. This paper provides a description of high power diode laser technology and applications and evaluates the benefits and restrictions of this laser technology. As an outlook an ambitious research project, the five year National German 'MDS'-project is shortly described. New developments in the opto-semiconductor technology itself, but also in micro- optics and precision mounting technology will help to increase the beam quality by about one order of magnitude, so that the beam quality of today's lamp pumped high power Nd:YAG lasers can be reached. New type of laser applications are supported by the modular concept of the diode lasers.© (2001) COPYRIGHT SPIE--The International Society for Optical Engineering. Downloading of the abstract is permitted for personal use only. | Mode locking of semiconductor laser with curved waveguide and passive mode expander | FREQUENCY TUNING METHODS FOR HIGH SPECTRAL PURITY DIODE LASERS SELF-LOCKED ON CONFOCAL FABRY-PEROT CAVITIES. | 120 mW high-power low-noise GaAlAs multiple-quantum-well laser diodes with a new real refractive index guided self-aligned structure | Experimental performance of several different unstable resonators with annual cylindrical mode volumes is reported. Laser output beam quality and its sensitivity to resonator component misalignments and figure errors are described. Near diffraction-limited beam quality was obtained from an annular cylindrical He-Xe laser employing a half-symmetric unstable resonator with an intracavity axicon. |
1,999,819 | when was the last time the canadiana sailed | SS Canadiana The SS "Canadiana" was a passenger ferry that primarily operated between Buffalo, New York and the Crystal Beach Amusement Park at Crystal Beach, Ontario, Canada from 1910 to 1956. The "Canadiana" was also noted for being the last passenger vessel to be built in Buffalo, New York. After being sold in 1956 the "Canadiana" changed owners numerous times and by 1983 she was berthed in Ohio needing major restoration. A nonprofit group, the "Friends of the Canadiana", brought the ship back to Buffalo in 1984 with a hope of restoring her to service. When restoration efforts failed the | plans were not realized the remaining hull of the "Canadiana" was cut up for scrap in 2004 at Port Colbourne, Ontario. The ship's engine was salvaged and returned to Buffalo to be part of a planned exhibit. Much of the wooden superstructure was saved including the pilot house. Some of the salvaged wood has been manufactured into various memorabilia. SS Canadiana The SS "Canadiana" was a passenger ferry that primarily operated between Buffalo, New York and the Crystal Beach Amusement Park at Crystal Beach, Ontario, Canada from 1910 to 1956. The "Canadiana" was also noted for being the last passenger | CAA-Quebec respectively in 1940 for the Quebec City club and in 1953 for the Montreal club. This marked the beginning of Trip Tiks (customized planned routes) for members of the Quebec clubs. It is only in 1984 that the two clubs merged into one entity: the Automobile and Touring club of Quebec, later renamed CAA Quebec. In 2004, it celebrated its 100th year of existence. CAA Quebec has branches in most major Quebec cities, including Chicoutimi, Gatineau, Sherbrooke, Trois-Rivieres, Quebec City, Montreal and Laval. These locations offer services including travel services and membership services (Trip Tiks, Tour Books, etc.) All service | came with limited means, many leaving dole queues. From 1825 to 1900 some 500,000 Norwegians landed at Ville du Quebec in Canada (and other Canadian ports) for travelling through Canada was the shortest corridor to the United States' central states. In spite of efforts by the Government of Canada to retain these immigrants for Canada, very few remained because of Canada's somewhat restrictive land policies at that time and negative stories being told about Canada from U.S. land agents deterring Norwegians from going to Canada. Not until the 1880s did Norwegians accept Canada as a land of opportunity. This was | Canada–Australia salmon trade dispute to an agreement with Australia to bring the dispute to a close. The parties exchanged letters detailing the agreement. Under the agreement, "Canada would monitor closely Australia's commitment to implement the agreement" by June 1, 2000. The agreement became effective on schedule on June 1, 2000. The Canadian Food Inspection Agency (CFIA) verifies that exported foods and food products meet the Canadian standards just as an importing country would. Countries have their own requirements for foods and food products and the Canadian government understands this and respects those requirements. Canada has implemented the fish inspection act to help regulate the | Canada–Australia salmon trade dispute to an agreement with Australia to bring the dispute to a close. The parties exchanged letters detailing the agreement. Under the agreement, "Canada would monitor closely Australia's commitment to implement the agreement" by June 1, 2000. The agreement became effective on schedule on June 1, 2000. The Canadian Food Inspection Agency (CFIA) verifies that exported foods and food products meet the Canadian standards just as an importing country would. Countries have their own requirements for foods and food products and the Canadian government understands this and respects those requirements. Canada has implemented the fish inspection act to help regulate the | Historic Site in 1970. In 2001, Parks Canada constructed a new Visitor Centre and Museum dedicated to the rich history of these native people - the first ever to inhabit Newfoundland, dating back over 5000 years. In 2004, through the effort of the 2004 Society, an association of Basque Maritime Heritage, Itsas Begia ("The eye of the sea") from Ciboure (Northern Basque Country), came to Newfoundland and shared its ancestral knowledge with Newfoundlanders. Three "chaloupes" were built, here in Port au Choix, in Conche and in La Scie. The "chaloupe" is located on Forest Road, in the old Port au | Gary and Joanie McGuffin married in April 1983, the McGuffins went on the world's longest honeymoon a two-year canoe trip across Canada from the Gulf of the St. Lawrence to the Arctic Ocean. Preparations for this journey were extensive. They spent hours researching the route on maps and reading through historical journals. They sought out sponsors such as their major underwriter Labatt Breweries, and acquired equipment and clothing that would be tested along the journey. Thanks to both corporate and media support, this journey was well publicized. The McGuffins wrote regular articles for "The Toronto Star", "The London Free Press" and the "Bracebridge Herald | 1,999,819 | SS Canadiana its last year of service an "incident" happened on board the "Canadiana". While returning from Crystal Beach to Buffalo on the evening of May 30, 1956, violence erupted between several youths. The group of belligerents, made up of whites and African-Americans, left little doubt that racism was a factor in the incident. This incident, along with shrinking revenues, made continued operation of the ship uneconomical. The 1956 season proved to be the last for the "Canadiana" and she was sold. After being sold, the "Canadiana" was involved in an accident on July 30, 1958. While on her normal excursion trip | where is the canadiana being berthed | when did girls become allowed in the navy league of canada | who picked up the survivors of the british ship canadian | how many vacationers were stranded because of canadian 3000 | what act gave rise to the royal canadian navy | who sponsored the canadian arctic expedition 1913-1916 | how many canadians were the first to jump on d day | when was the women's royal canadian naval service revived |
1,999,820 | who defeated adina beg in 1755 | History of Cartagena, Colombia Spain the city had many new public works starting or ending like the new fort of San Fernando, the Hospital of the Obra Pía and the full paving of all the streets and the opening of new roads. In March 1741 the city endured a large-scale attack by British and American colonial troops led by Admiral Edward Vernon, (1684–1757), who arrived at Cartagena with a massive fleet of 186 ships and 23,600 men, including 12,000 infantry, against only 6 Spanish ships and less than 6,000 men, in an action known as the Battle of Cartagena de Indias. The siege was | revealed that these areas were previously occupied by a different ethnic group, who continued inhabiting the area after Kowoj achieved dominance of the region. At the time of Spanish contact the Yalain were allied with the Itza, an alliance cemented by intermarriage between the elites of both groups. The Itza used the Yalain as an eastern buffer against Spanish approach from the Belize. When the Spanish conquered the Petén lakes in 1697 under the command of Martín de Urzúa y Arizmendi, the Yalain were initially cooperative and assisted in the capture of the king of the Itza. At this time | and raided the mines, which remained closed until June 1909. By July the workmen were again attacked and several of them killed. Severe fighting between the Spaniards and the tribesmen followed, in the Second Melillan campaign. In 1910, with the Rif having submitted, the Spaniards restarted the mines and undertook harbor works at Mar Chica, but hostilities broke out again in 1911. In 1921 the Berbers under the leadership of Abd el Krim inflicted a grave defeat on the Spanish (see Battle of Annual), and were not defeated until 1926, when the Spanish Protectorate finally managed to control the area | Battle of Alfarrobeira fell on the regent Queen Leonor, hated by the people, and her daughter Beatrice, married to the Castilian King Juan I. Fernando's half-brother John, Master of Aviz, led a revolution against Queen and the Castilian King, defeating them with a smaller army in the battle of Aljubarrota. The battle became a turnpoint in Portuguese and the world's History, and King John I and his military aide, Constable Nuno Álvares Pereira, became immortal idols. King John I had a first illegitimate son, Afonso, and a daughter Beatrice; after marrying Philippa of Lancaster, John of Gaunt's daughter, and establishing the House of | the whole set is preserved at the Army Museum of Toledo. Battle of Lucena The Battle of Lucena, also called Battle of Martín González, was a war event in which Christian forces of the Crown of Castile were faced against the Muslim forces of the Nasrid Emirate of Granada. It took place in the month of April of the year 1483, in the course of the Granada War. During which the Christian forces took Muhammad XII of Granada as prisoner. It was fought very close to the city of Lucena, in the province of Córdoba, Andalusia, Spain, south of the | Tondo Conspiracy worth pointing out that the Indios tried to fight for their lost freedom only after quickly surrendering to the Spaniards. Thus, their uprising had them labelled as rebels as they were already subject under Spanish rule; this contrasted them from Muslims who never surrendered to the Spaniards. Furthermore, it was different from other uprisings in the seventeenth century because the primary goal was to overthrow the Spanish rule rather than to protest the oppression of a tribute collector, "alcalde", or friar. The chiefs sought to get rid of Spanish control rather than be satisfied with the death of a particular | km), let alone other smaller territorial gains, obtained during the battle of Belchite, battle of Ebro, battle of Teruel, battle of Guadalajara, battle of Brunete and battle of La Granja. Spanish coup of July 1936 in the Albacete province The 1936 coup in the Albacete province was part of a nationwide military-civilian revolt. On July 19–20, the rebels easily gained control of the entire province, but it remained an isolated island of insurgency surrounded by areas controlled by the loyalists. On July 21 the loyalist troops advancing from the Levantine coast made first incursions into the province and with little | Antonio Valero de Bernabé Spain, he took his family with him to Mexico and later South America. Valero de Bernabé had recently graduated from the military academy when Napoleon Bonaparte convinced King Charles IV of Spain to permit the French leader to pass through Spain with his army to attack Portugal. When Napoleon later refused to leave Spanish soil, the government declared war. Valero de Bernabé joined the Spanish Army and helped defeat Napoleon's army at the Siege of Saragossa (1808) in the Peninsular War, also known as the Spanish War of Independence. After this action, Valero de Bernabé was awarded many decorations and | 1,999,820 | Adina Beg his support to a campaign against the Sikhs in Jullundur as a means to dispel suspicions of his treachery during the Afghan invasions. In 1752, whilst travelling in Gurdaspur, he found the town of Adinanagar. On Mir Mannu's death on 3 November 1753, his two year old son was proclaimed Viceroy, with his mother Surayya Begum becoming de-facto ruler. Amid the political upheaval, Adina asserted independence from both the Durrani Empire and Mughal government at Delhi. In 1755, Adina drew the support of zamindars and an army of Sikhs to confront the threat of Qutb Khan who had seized Sirhind | where did adina beg defeat the afghanists in 1758 | where did jatindra nath das die in jail | who played the role of beggar in pettandarulu | when did adi shankara travel across the indian subcontinent to propagate | who was kidnapped by khalistan liberation force in 1991 in new delhi | who died in the movie in harihar nagar | How was Tenshinhan revived after the Saiyan attack? | what position did indira gandhi hold before she became president of india |
1,999,821 | This article investigates aesthetic learning processes from the perspective of three dancers working in a school context. It is based on our own experiences from Var Vrimmel -a dance project carried out by the dance group Landing at a Norwegian primary school in 2019, where three dancers were "artists in residence" at a primary school for four weeks. We present three different formats, each with a different relationship between the dancers and the fourth graders participating in the project. Our intention is to outline, describe and discuss how our practice can facilitate aesthetic processes at the intersection between art and education. Our theoretical framework is based on John Dewey's work, particularly his definition of aesthetic experience. Our aim is to contribute to understanding the notion of aesthetic learning processes and broaden perspectives on how artists could work in a school context and the roles they might have. 2 2 Aesthetic learning processes could be defined as follows: "The student must practice creativity, the ability to create, interact, reflect and communicate, using aesthetic tools. The student should be able to facilitate creative learning through various aesthetic expressions, communication and performances that help to develop students' self-confidence and identity." (Our translation). | The primary purpose of aesthetic education lies in developing an aesthetic attitude and life philosophy,coordinating people's emotional and psychological conflicts in society,breaking down anxiety and depression accumulated through materialized life,thus keeping them in an aesthetic state and attaining harmony between life and society. untill now,the aesthetic education in colleges of Science and Engineering has gradually been in a standardized and systematized stage. The author discussed the problems concerning aesthetic education in the following three aspects:firstly,the soul of aesthetic education is expected to include not only education of concinnity,but also education of loftiness; secondly,colleges of science and engineering should develop their unique style of aesthetic education; thirdly,the aesthetic education should be combined with students' campus life. | Aesthetic teaching is the important orientation of ancient poems teaching in primary school. In order to effectively develop aesthetic teaching in ancient poems of primary school, teacher should analyze types and stages of ancient poems selected in Chinese textbooks, explore aesthetic characteristics of each types and their teaching requirements, and freely use strategies of aesthetic teaching in ancient poems of primary school according to different students in different school stages. | Twenty sixteen year old fourth-graders of the School for Young Talent (School voor Jong Talent) in The Royal Academy of Fine Arts, Design, Music and Dance (Hogeschool van Beeldende Kunsten, Muziek en Dans) participated in a pilot project that combined music, dance and visual arts in a creative process. A group of six teachers from three different disciplines guided the young artists. This report shows how this process took place and indicates some of the issues that were encountered along the way. | The purpose of this research was to study on Visual Art Works of Primary school students; Grade 4 through the activities of CISST. The population used in the study was the visual art works of ten primary students who study in grade 4 in the second semester of 2008 academic year. According to the purpose of this study, the samples were selected from the approach of Purposive sampling, and they have been examined from ten periods during ten weeks. The instruments used in the study were as follows: - 1. The analysis form on Visual Art Works 2. The interview form that related to activities based on CISST The result of the study revealed that the students were able to do all ten activities based on CISST and able to develop their potential to create the Visual Art Works. So it is obviously related to CISST for three kinds of art that are Contemporary Art, Modern Art and Post-Modern Art. Keywords: Visual Art, Visual Art Works of Primary School, CISST | The use and mention of visual, literary and poetic works of art in school geography teaching materials have increasingly grown, but in a way that restricts them to illustrative instruments or mere thematic references. The question is, how can this interface in geography lessons be explored further than this pictorial and/or topic approach? A twist that can overcome such reductions is to pursue the appreciation of the aesthetic dimension in teaching geography, precisely that which allows art and geography to align. In fact, the aesthetic dimension is often forgotten or neglected within geography itself as both a science and an educational field. However, art is part of social subjects’ everyday life and sensitive and imaginative universe. This study seeks to make its importance evident in the teaching of geography and, at the same time, explore a broader sense for the use of its various languages as resources to be mediated by the teachers so that students can exercise their geographical imagination. | his article is a call for reasonableness in the field of art education. Surprisingly, most people working in art education do not consciously know what that involves, although many classroom teachers intuitively practice it regularly. Recently I received a book called Beyond Creating: The Place for Art in America's Schools. I was impressed with the quality of production, reputation of the contributors, and obvious resources available in its development. The cover title had done an excellent job of summary: Beyond Creating. Despite the claim that the book was introducing readers to a new concept for teaching art in America's schools, it was dealing with a movement in art education that has been around for at least twenty years. The book crusades for a shift from intuitive studio production to rigorous, rational study of art production, art history, art criticism, and aesthetics. Such education has been championed by many university art educators during that twenty year period. However, the book mentioned: | This paper draws from a collaboration between Rambert School of Dance, University of Kent, and University College London Institute of Education and an anthropological filmmaker. Together we took a creative and embodied approach to teaching reflective practice within a conservatoire to second year dance students. In this paper we explore where this somatically inspired pedagogy sits within dance training. We discuss the nature of reflection for dance training, and in particular consider embodied reflective practice. Finally we offer effective methodologies for drawing out and capturing embodied practice. | Practice aesthetics is based on Marxism practice philosophy. It regards practice as the link between human and nature, and the essence of beauty is boiled down to human's essence power to be object. On the base of practice, beauty is explained to be the results of practice. The idea of 'nature of human' and 'two scales of practice' are important conceptions to practice aesthetics. Nowadays traditional conception of practice does not accord with request of the era. Reinterpreting Chinese aesthetics of the time, switching its basis of theories from subjectivity format to intersubjectivity format, making practice aesthetic suit to developing current in the future, is a very important task. | 1,999,821 |
Introduction
What does an aesthetic learning process look like from the perspective of a dancer working in a school context? In this article we outline and describe what characterises situations at the intersection between art and education based on our experiences from the dance project Var Vrimmel. In this particular project, where three dancers were "artists in residence" at a primary school for four weeks, we initiated and explored situations that could be categorised as neither a performance nor a dance lesson but rather as something else, something in between. We present three different formats, each with a different relationship between us and the students, where we tried to facilitate these kinds of situations in slightly different ways. All of them consisted of moments which we experienced as situated between what we normally would categorise as either art or pedagogy. These aspects are what we will outline in the article, recognising that this is a work in progress which is to be continued.
An attempt to describe what characterises these situations is relevant first and foremost as a contribution to understanding the notion of aesthetic learning processes (estetiske laereprosesser) 2 , a term used by the Norwegian Ministry of Education and Research for processes that combine artistic and pedagogical dimensions. Second, we find it relevant for broadening perspectives on how artists could work and on what roles they could have in a school context beyond performing completed works (through The Cultural Schoolbag programme) or teaching art in line with a conventional understanding of primary school art education (as in practical aesthetic school subjects that are part of the established curriculum, such as literature, arts and crafts, and music).
The article starts with a brief presentation of the two authors' experience and views on dance and pedagogy, and of their collaborative work in the dance group Landing. We then give a brief account of our methodological perspective in this text and in general. In the next part of the article ("Frames"), we present the foundation for our discussion: the Var Vrimmel project and the theoretical framework we find in John
Landing's heteronomous performative practice
Landing is a contemporary dance group and production unit run by the authors, Ida Gudbrandsen and Venke Sortland. Through Landing we initiate, produce and carry out dance projects in collaboration with other artists and institutions as a part of the independent performing arts field in Norway. Our dance practice can best be characterised as contemporary dance, where improvisation and choreography are key aspects. In short, we tend to work on more or less clear movement tasks which we solve by improvising rather than by composing steps. And rather than understanding choreography as related solely to the composition of the dancer's movements in time and space, we operate with an "extended choreography" (Østern 2018). According to this term, choreography must be understood as an explorative and critical way of analysing and building up situations, inside or outside the traditional contexts of performing arts.
Landing works on a heteronomous attitude towards, and understanding of, art, meaning that we let our changing surroundings have a defining influence on our artistic work. In both processes and performance situations, we are interested in how structures, contexts and audiences influence the artwork itself as well as us as dancers. Landing understands the artwork as something that is realised through a meeting or interaction between the audience and the artistic expression. This has led us to situate our work outside conventional performance spaces and initiate projects with specific target groups. As a result, we are not necessarily interested in whether or not what we do looks like or is perceived as art to the audience we are addressing. Rather, we have found that knowing that a situation is part of an art project often limits rather than supports the aesthetic experience. Nevertheless, our abilities, knowledge and experience as dancers and choreographers (or rather as artists working on dance and choreography) always inform our starting point.
Since both of us are artists with pedagogical education (Venke holds a master's degree in educational theory and Ida holds a practical-pedagogical bachelor's degree), our practice reaches from teaching to creating and performing dance pieces. In many contexts these activities are perceived as two different fields of practice and knowledge, but in our practice we find that the two sides of our background feed each other in intriguing ways. Furthermore, we are interested in how our aesthetic experiences of working with dance could be shared with schoolchildren through practising together rather than through teaching them. Therefore, we constantly try to Venke Sortland & Ida Gudbrandsen. Exploring situations between art and pedagogy: The dance project Var Vrimmel.
Nordic Journal of Art and Research, Volume 10, Nr 2 (2021) 4 challenge ourselves to initiate projects where we can experiment with forms and formats in between art and pedagogy, performance and educational situations, where we operate with a wider understanding of quality than we find possible through artistic, or pedagogic, quality parameters alone.
Methodological and ethical reflections
Our practice as dance artists working on social art projects has many similarities with action research as a methodology used in social and pedagogical research. As in action research, we initiate and realise our projects in specific contexts, and we try to situate ourselves as close as possible to the relevant target group for a long period of time. We try to find a starting point that is relevant in and for this particular context, and testing our ideas over and over again with our target group is an important element of the process. Like action research, our practice is also normative in that it seeks to improve, develop or change practice in the direction of something we consider to be of good quality in a specific context. But as is often the case with social art projects like ours, Var Vrimmel was not initially defined as a research project, and the experiences we made were therefore not collected systematically. Thus, written documents, such as reports and notes on reflections on the process, and documentary material in the form of films and photographs, were not produced for research purposes.
In the absence of a large data material, the basis for the discussion in this article is mainly generated through retrospection; i.e., reflections on experiences gained during the process which elaborate and complement any (written) material that exists (Johansen, 2017). However, this presents us with some challenges when it comes to credibility. Does retrospection provide a credible ground for the discussion in this article? Will the reflections on the experiences we gained during the process be too easily be shaped by the argument we want to promote? Rather than rejecting retrospection due to a lack of credibility, however, we would argue that this way of generating a material must be seen in relation to the role and function this article has in our process as a whole. Rather than defining this article as an attempt to see our process from the "outside" by trying to take an observer's perspective on our own practice, we see our reflections on our own experiences as part of the Var Vrimmel project. Furthermore, the discussion must be seen in relation to a goal of improved practice, in this case a practice between art and pedagogy situated within a school context rather than as a way of analysing our practice. This is in line with what Olav Eikeland (2001) describes as action research generating practical knowledge. Unlike action research that generates poetic knowledge based primarily on intervention, i.e., "change social entities of which the knower-actor is not a sharing member", action Venke Sortland & Ida Gudbrandsen. Exploring situations between art and pedagogy:
The dance project Var Vrimmel.
research that generates practical knowledge is based on "communities of practice and inquiry, either within the same profession or the same organization, trying to perfect a collective skill or the understanding of practically shared, common points of reference" (Eikeland, 2001, p. 147). Since we are primarily interested in exploring and improving our own practice, the goal of the Var Vrimmel project was to generate practical knowledge; knowledge about and for our practice. Thus, retrospection should be seen as a crucial part of the process itself, and the descriptions we use when reflecting on our experiences must be seen as examples that provide us with a starting point for discussion rather than empirical data.
The distinction between action research that generates practical versus poetical knowledge is also important when it comes to ethical research perspectives. If we focused on the students' reactions, as is the case in action research generating poetic knowledge, the examples from Var Vrimmel would be problematic without a thorough reflection on who has the power to define what is experienced and on what measures are taken to reduce this power by, for example, including students' voices in the form of interviews. But since it is our own practice we try to explore, challenge and improve, using discussion as a tool, it should be implicit that we describe and speak about our own experiences, not those of the students. We have nevertheless chosen to remove the names of places, schools, staff and students, as this information has no relevance to the discussion.
Frames: Var Vrimmel as an aesthetic learning process
The Var Vrimmel project
In this section we will present the basis of our discussion: the dance project Var Vrimmel and the notion of aesthetic experience that we find in John Dewey's work.
Var Vrimmel was carried out by Landing at a Norwegian primary school in January and February 2019. The project was initiated by a regional production unit, an interest organisation for dance, and the local centre for culture and education, and received support from Arts Council Norway. In collaboration with the school, Landing was invited to create a project at the intersection of art and pedagogy, with and for students in the fourth grade, where citizenship should be the overall theme. Var Vrimmel took place as a kind of artistic residency where we, the authors of this article, together with dancer Maja Roel, moved our artistic practice into a primary school. Our artistic interest was intertwined with our pedagogical work, meaning that we wanted to explore how working within a pedagogical context and with the students would influence our artistic practice, and to create situations where we could Venke Sortland & Ida Gudbrandsen. Exploring situations between art and pedagogy:
The dance project Var Vrimmel.
include the students in our artistic work and/or use our artistic methods and skills in teaching situations.
In the initial contact with the school before the residency period, we agreed with the teachers, on a theme for the project: democracy and citizenship. We emphasised a processual understanding of democracy as a practice that must be maintained through participation. By involving the students in working on this through contemporary dance, we had an understanding that they would have the potential to experience it as a bodily and sensory experience; that being received when falling, providing a secure base on which a fellow student can climb or joining a group and working on the same physical task, but solving it individually, are experiences of democracy that can have a powerful impact.
Var Vrimmel lasted four weeks, and during that time we were present in the school building throughout the whole school day. In addition to the work we did together with the fourth graders, we (the three dancers) had our own daily dance routine that took place in different parts of the school area. And rather than work towards a large-scale final performance, we focused on the process, and created small performance-like situations several times a week. In these situations, the students were sometimes performers together with us, other times we performed small improvisations for them.
Theoretical perspective: Dewey's notion of experience
As mentioned in the introduction, the aim of Var Vrimmel was to initiate aesthetic learning processes. Aesthetic learning processes is a notion that is often used in the field of pedagogy and is highlighted in official documents as an important aspect in all school subjects (Kunnskapsdepartementet, 2019). Nonetheless, the term is perceived to be rather vague, and is used in different ways in different settings. 3 As stated in the introduction, we want to explore the field of aesthetic learning processes as something in between conventional formats such as dance lessons and performances. This means that we are not interested in the pedagogical potential in a dance performance, nor the aesthetic dimensions found in conventional pedagogical formats. Rather, we are drawn towards formats and roles which are more unclear, but which at the same time provide the students with safe and/or supportive boundaries. In our heteronomous art practice, as well as in this article, we find the American philosopher and educator John Dewey's notion of aesthetic experience helpful in understanding what aesthetic learning processes could be. According to Dewey (2005), aesthetic experience can be understood as the effect an art expression potentially can create in interaction with an individual; a period of heightened attention that has value in itself which leads to an educational process, a growth or transformation, and which thus forms the basis for new deeper and broader experiences. For Dewey (2005) an aesthetic experience is the ideal form of experience because it has no goal beyond itself. Furthermore, it is in the aesthetic experience that the interaction between the environment and the individual has the best quality.
One could ask whether Dewey's thinking is relevant when discussing contemporary pedagogical and artistic practice and challenges. Even though his descriptions of artworks and educational settings are clearly outdated, we still find his notion of experience and the anti-dualism that underlines his work -where he opposes clear distinctions between body and mind, praxis and theory -highly relevant. When using Dewey's work as a theoretical perspective in this article and in our practice in general, we try to narrow down the core principles while at the same time trying to relate (and attune) them to our experiences as artists and teachers. Nevertheless (or rather because of this), in our work we apply Dewey's notion of aesthetic experience to a wider spectrum of situations and practice than he himself did (in his work Art as Experience (2005), situations in between performance and dance lesson, where the students participate in the situations together with us. Support for this widening of the term "aesthetic experience" is derived from the American neo-pragmatic philosopher Richard Shusterman. According to Shusterman (2000), an individual can have an equally qualified aesthetic experience from a somatic practice or from different movement practices (for example, yoga or tai chi), as from an artistic expression in the conventional understanding of the notion. Shusterman thus opens for further exploration of what an "artistic expression", to use Dewey's term, could be.
At the same time, the experiences and processes we explore in this article are not necessarily "purely" aesthetic, but rather lie at the intersection between art and education. Dewey defines learning experiences as somewhat different from aesthetic experiences, even though they partly overlap and have no sharp boundaries. For Dewey, these types of experiences are different first and foremost in their anticipated outcome; a learning experience results in new skills or knowledge, while in the aesthetic experience the experience itself is the outcome. One could of course add several other aspects that separate education from art. One example we find relevant in this context is the art historian Claire Bishop's argument (2000) that the Venke Sortland & Ida Gudbrandsen. Exploring situations between art and pedagogy:
The dance project Var Vrimmel.
relationship between the artist and the student is different in an art context compared with an educational context, because in the former you also have one or another form of external audience to relate to. In projects like Var Vrimmel, where students and teachers are participants, working together with the artists, the external audience one has to relate to in an art context does not exist. But at the same time, playing at being an audience for each other, performing for one's classmates and teacher or for other groups of students in one's school, could help children find a mode and a concentration which in turn shifts the orientation of the experience from a learning outcome towards an experience in itself. It is nevertheless worth noting that Dewey's definition of experience, whether it be aesthetic or not, is founded on an educational process understood as a process of transformation with a subsequent growth. And in Var Vrimmel we were looking for both aesthetic and educational outcomes, and for them to arise simultaneously. This, we think, is in line with the type of processes and situations that are outlined in the notion of aesthetic learning processes. We are aware that, in this aspect, we choose an open, relational and dynamic understanding of how Dewey sees the borders between art and pedagogy. 4 No matter what educational or aesthetic outcomes the experience or process should have, it is important to underline that we, as artists or educators, can prepare and facilitate for them but we can never produce them with certainty; that happens to the individuals through interaction or co-creation (Dewey, 2005). This makes it no less important to ask how to facilitate these processes and experiences. We find this important when we do performances, but even more so when we want to create and explore situations in between the aesthetic and the educational, when we are interested in having an open understanding of both art and pedagogy, when we are experimenting with forms and formats outside performances and dance lessons, and when the interaction that constitutes the experience can involve everything from being an immersed spectator to actively participating in creating the artistic expression together with us.
Discussion: Situations between pedagogy and art
In this section we will use three examples from Var Vrimmel to outline and describe aspects which we think characterise situations in between art and pedagogy. First, we introduce our morning warm-up sessions with the students, the pedagogical format for which was the most conventional used in the project, one where we, the dancers, clearly took the lead. In this situation we tried to open up for and focus on the students' experience within a conventional pedagogical format where we instructed them. The second situation, the body chain, is from a format where we tried to create a task that made us and the students practice together, where we, in other words, tried to make the distance between the different roles (student and teacher) less prominent (without thinking that they could be totally levelled), and to minimise the need for oral instruction. The third situation is one where we were close to an art format (performance), where we worked on solo and group improvisations in the common areas of the school, and tried to allow the students to decide for themselves whether, how and when they wanted to relate to us and what we did, either as audience, directors or co-performers.
As a framework for discussing the situations, we will also present two parameters, namely interest/resistance and strong/weak, based on Dewey's notion of aesthetic experience. Dewey (1934Dewey ( /2005 writes that an experience begins with a sensation of resistance from one's surroundings that awakens the individual's interest. This dynamic between resistance and interest produces the elation and the emotional state an aesthetic experience can be said to be. The experience reaches its end when the resistance fades and the interest, accordingly, decreases (Dewey, 1934(Dewey, /2005. The idea that the dynamic between the individual's interest and the resistance of the environment is crucial in creating an experience becomes clear in Dewey's definition of pedagogy as a weighing between the child and the curriculum, or in other words as a matter of balancing the student's world of experience against the scientific disciplines' world (1902/2001). The same principle can be said to apply to an audience member's encounters with artistic expression, but here the emphasis between interest and resistance must be understood as a balance between the artists professional perspectives and the individual's experiential background. Therefore, we must, according to Dewey (1934Dewey ( /2005, meet the target group on their own terms, we must open ourselves to their interests, how they understand the world and their ways of being. At the same time we must give the interaction a specific direction by introducing a material, a content, an artistic resistance. In other words, when we see the relationship between the audience and the artistic expression as constitutive, an ongoing challenge that follows is to balance a specialised artistic focus against an understanding of the target group's perspective and their earlier experiences.
The parameter of resistance/interest
Venke Sortland & Ida Gudbrandsen. Exploring situations between art and pedagogy:
The dance project Var Vrimmel.
The parameter of weak/strong direction
In the process of writing this article using the parameter of interest/resistance, it became clear to us that it did not fully cover the challenges we experienced. We therefore added a supplementary parameter, inspired by Dewey's notion of experience.
To better show what the ideal quality of an experience should be, Dewey (1934Dewey ( /2005 makes the reader picture the difference between an interaction (between the individual and the surroundings) that is too purposeful and targetoriented, too oriented towards action, and one that is without connection and/or almost meaningless, too oriented towards perception. According to Dewey, the interaction should ideally be in between these two, neither too strong nor too weak, if the goal is to produce an aesthetic experience. This resonates with how we work both artistically and pedagogically. For as we, on the one hand, are interested in the potential we believe art holds to facilitate something we cannot (and/or should not) control -a potential for something different to unfold -we experience and acknowledge that a situation that is too open, where whatever can happen or everything could be the right answer, is often uninteresting and non-motivating for students (and for audiences in general). In this article we refer to this parameter as situations where we tentatively impose a weaker or stronger direction, and thereby facilitate a more purposeful or more meaningless interaction. As already mentioned, artists and educators can never (nor should they) guarantee that the situations they initiate produce the effect they hope for in the audience or the students. We still believe that being specific when formulating our intent for the interaction we initiate makes it easier for the students to relate to and to become interested in.
Morning warm-up sessions: Aesthetic learning processes in a dance-lesson format?
The first situation we want to reflect upon is the one which for us is the more conventional in a school context: joint physical warm-up sessions every morning. This was our daily ritual with the fourth graders. Here we tried to develop the students' bodily awareness and possibilities for movement. Our aim was to present the students with basic knowledge in dance through exercises which at the same time challenged them to take care of each other through working together. A common thought when working creatively or with creative dance is that "everyone can dance, they just forgot how to do it", and that contemporary dance is therefore quite intuitive for children. We do not believe in this, nor do we experience it when meeting children. The task "just create a movement" must be learned or developed through several experiences, in the same way as other skills. Furthermore, in most schools in Norway, dance is not an important part of the curriculum, and teachers seldom have the necessary competence in dance (Rustad, 2017).
Each morning session started with a massage, where the students worked together in pairs. The students had to listen to their partner through the oral and physical reactions they received on the massage they gave. The massage also became an opening and transition into more "advanced" partner work, with "giving and taking weight", providing physical support for one or more of the other students, or with different tasks and games where one should share physical contact points with another person. The morning sessions usually ended with a relaxation part, where the students were asked to lie completely still on the floor and relax their whole body. This exercise had two purposes: to provide an experience of relaxing and sinking down through the floor (a bodily experience and skill) and to concentrate on their own bodies without disturbing the person next to them, and thereby respect and make space for their fellow students' experiences (which could be connected to the theme of the project, i.e. democracy and citizenship).
Through the morning sessions we tried to facilitate an aesthetic learning process using a format the students were familiar with. We wanted to see if we could expand the format to include situations where the students' experiences were in the foreground and our instructions in the background. But, as any experienced teacher might have anticipated, it was perhaps easy for the students to act the way they usually did in other teaching situations, since this format and these roles (we were instructing while they were doing/solving the tasks) are very familiar to the students in their everyday lives. As a result, we had to spend time on aspects we find problematic with conventional teaching formats for dance education: instructing and disciplining rather than facilitating creativity and activity. We began to act more and more like conventional teachers and less like artists-teachers inviting the students into our artistic and creative processes.
Seeing this situation through Dewey's concept of aesthetic experience and the parameter of resistance/interest, we could say that lack of resistance in these formats probably made it hard(er) for the students to be interested in what we offered in the morning sessions. At the same time, even though the format -and teaching style -of the morning sessions were very familiar to the students, the content -contemporary dance -was foreign to most of them, meaning that the resistance in the content was perhaps too strong. In relation to both the format and the content, we lacked a balance between the familiar and the challenging, between interest and resistancewhich created a more challenging and less engaging situation, not only for the Venke Sortland & Ida Gudbrandsen. Exploring situations between art and pedagogy:
The dance project Var Vrimmel. students but also for us. When examining the morning sessions in retrospect, it is clear that we did not offer movements and tasks which we believe in artistically, or which we use when making art. Rather, we presented movement tasks which generally are considered to be basic knowledge when beginning to learn contemporary dance.
When looking at the morning sessions through the parameter of strong and weak direction, it is clear to us that the content we introduced had a very strong purpose: to give the fourth graders basic knowledge about contemporary dance. We presented this through oral and physical instruction, without allowing the students to relate to the material in their own way. The direction we inserted was, in other words, too strong, leaving inadequate space for the students' own imagination and creativity.
Nevertheless, looking back on these daily sessions, we see that we probably managed to give the students a good introduction to working on contemporary dance, something we consider to be an important factor in creating situations in between art and pedagogy later on in the project. We also found it interesting, on a conceptual level, to situate such dance lessons in the entrance hall of the school -as if we, through this, were making the kind of bodily experiences and knowledge that we promoted through the project more visible on a physical and discursive level, also for the students and teachers that were not directly involved in the project. However, these more conceptual aspects of the project were probably out of reach for the students.
One of the aspects that became clear from the morning sessions was the importance of finding a balance between the known and easily accessible on the one hand and the unknown and more demanding on the other. This applied not only to the students but also to us. In other words, when facilitating situations in between art and pedagogy, we find it important that we teach and share something we find artistically interesting, in such a way that we are genuinely curious about how the students will receive, relate to and use the tasks we give them, at the same time ensuring that the students perceive the tasks as relevant and doable to them.
The body chain: Teaching through practicing together
The experiences from the morning sessions led us to explore how we could move away from more conventional pedagogical formats and roles -not only in the way we behaved, but also in the exercises we suggested -and try to lead using a minimum of oral instruction. This made us look for and try out exercises where we had to listen and synchronise as a large group and be involved on the same level as the students.
Venke Sortland & Ida Gudbrandsen. Exploring situations between art and pedagogy:
The dance project Var Vrimmel.
One example of this was walking as slowly as possible from the outer edges of a space towards the centre, and paying attention to each other to make sure that we all met in the centre at the same time. We initiated many such situations with smaller or bigger groups of fourth graders in the common areas of the school, both indoors and outdoors, and although we were clearly leading them by initiating and knowing what the exercises were about, we felt closer to our practice as performers than as teachers.
One task where this became particularly clear was when we worked with what we called the body chain. In this exercise, each student created a position, the next student connected to that position and created his/her own position, and in this way the chain extended through the surroundings. When all the students were part of the chain, the student who made the first position ran to the front and created a new position, and the chain moved forward. We did this body chain as a happening that included all the students and teachers in the entire school. The respective student groups created a chain that slowly made its way through the school building, lasting for 20 minutes.
Several aspects of this situation are worth reflecting on when looking for what categorises situations in between art and pedagogy. First, one of the reasons we could make the distance between the different roles (student and teacher) less prominent when practising the body chain was that the fourth graders had already worked on this particular task under our guidance several times and in many different rooms earlier in the process. When the whole school was preparing for the happening, it was the fourth graders that visited each student group and taught them how the body chain worked. These students demonstrated a sense of ownership to it, adding their own personal touches to their explanations and demonstrations. Seeing the students' involvement and engagement, we saw no need to take a visible role as leaders or instructors. The result of the training and gradual sense of ownership led to a situation where we found we could practice together with the students, and where we could be "in the moment" in a way that resembles or is close to the way in which we are present on stage as performers, where we fully invest in the tasks and the execution of them as practitioners, not as guides or instructors. We see this type of concentration and presence as an important part of practising contemporary dance (at least as important as technical brilliance). A positive spiral effect may also have been in play here: the students had gained ownership to the task, which allowed us to invest in it as performers, a concentration which, in turn, would affect or even pass on to the students. All in all, we felt that in this situation we began to see a blurring of Venke Sortland & Ida Gudbrandsen. Exploring situations between art and pedagogy:
The dance project Var Vrimmel.
the boundaries between the pedagogical and the aesthetic dimensions of the project; the format felt closer to a performance.
The situation had another, related, effect. In this situation, the students were both performers and audience. This challenged the students to not only be aware of what they themselves were doing, but also of what was happening around them. The embodied listening skills they had practiced in the morning sessions (working together through for example giving each other massages and/or leaning weight into each other in pairs), were expanding, to include listening to their surroundings as well. While the students worked together to hold their positions as part of the chain of their own student group, they seemed to grow increasingly aware of having an outside audience to relate to (even if it only consisted of their teachers and fellow students) when doing this exercise outside their classroom. Furthermore, it seemed to us as if this two-way listening (at this moment in the process) actually made it easier for the students to invest in the work, perhaps because the group, when confronted with other individuals, became clearer to them. We find this type of twoway listening, to each other and to the surroundings, to be a key skill in our practice as contemporary dancers.
If we turn to the parameter of strong and weak direction, in the body chain the students were given more freedom to solve the task in the way they wanted, than in the morning sessions. We find that allowing such freedom is an important aspect of working on improvisation within contemporary dance, as it creates ownership of the movements and choices, and cultivates creativity. At the same time, the freedom to make one's own choices took place within strict limits, and we could easily foresee more or less what the outcome of the tasks would be.
Looking at the body chain from the perspective of the parameter of interest and resistance, we found this situation more balanced than what was the case in the morning sessions, maybe because the task was also formulated somewhat like a game, a game the students learned relatively fast and liked to play. At the same time, the game differed, in our experience, from what the students themselves played in their free time, as it challenged aspects such as their two-ways listening skills (as described above).
Characteristics of the situation with the body chain could be summed up as follows: the students took ownership of the task and how to solve it, we were teaching through practising together with the students rather than instructing them. We avoided controlling the students, and instead gave them the freedom to relate to and Venke Sortland & Ida Gudbrandsen. Exploring situations between art and pedagogy:
The dance project Var Vrimmel.
engage with the situation as they wanted to, though with clear direction from us. All in all, the body chain became an example of a situation where we actually felt we managed to work in between the artistic and pedagogical fields. Looking back on the performance which we, the whole school, performed together, we would even go so far as to say that this situation created a potential for aesthetic experience.
Our daily dance practice: Facilitating multiple ways of participating
Every day, the morning sessions with the students were followed by an hour where we, the three dancers, worked on movement material on our own. We gave ourselves and each other improvisational tasks and worked on them alone or as a trio, using different parts of the common areas in the school building as sites. We were in connection with our surroundings, wanting them to influence our improvisations, meaning that we met the context quite openly, without bringing too much to the table ourselves. During these sessions, most of the students were in their classrooms and were only able to catch glimpses of us through windows or on their way to the toilet or the locker rooms. Still, we considered this daily dance routine to be kind of a performance, and our way of being in it resembled the way we are on stage.
Initially the students often ignored us during these sessions, and did not seem to want to engage with us. But after working on our solos in different sites around the school building for many days, the students suddenly began to interact with us on their way in and out of the classrooms or while in the locker rooms. Some of them would stop and watch, some actually started moving together with us, and some would ask us what we were doing while we were doing it. The format of our improvisations made it possible for the students to interact with us in less structured ways than what would be possible in a dance lesson or performance. It also allowed students to interact with us in several different ways at the same time. In these situations, we let go of our control, and trusted that the students had enough information and interest to interact in ways that were not necessarily predictable or a result of their habitual way of interacting with each other and their surroundings, such as tossing themselves into a wall in the hallway together with one of us, or becoming part of a tight swarm of students and dancers moving slowly through the schoolyard. These eruptive meetings were almost impossible to calculate or plan, but to us they had great potential, and the fact that they occurred from time to time made us continue to explore and discuss them throughout the project.
If we look at these situations from the perspective of the parameter of resistance and interest, it is easy to assume that they give the students a relatively high resistance.
Venke Sortland & Ida Gudbrandsen. Exploring situations between art and pedagogy:
The dance project Var Vrimmel.
We are adults who behave in ways adults do not tend to in a school context, through an art form with aesthetics and conventions that are unknown to most of the students. It was, in other words, probably hard for the students to "understand" (or rather decipher) what we are doing and why. At the same time, we imagine that because this takes place in a familiar place (their own school) and over a relatively long period of time, the resistance will gradually be reduced. This correlated with our experience. It is also worth noting that the improvisations consisted of movements such as crawling on the floor, lying under benches or in lockers, jumping and falling, all things the students (can) do with their own bodies, and that were related and relevant to their world. In this situation there seemed to be a better balance between resistance and interest than we first feared.
From the perspective of strong and weak direction, it is obvious that we could have had clearer goals, concepts and directions for the artistic work we did in these sessions. On the other hand, we did not find that the students saw it as random or meaningless. This might have something to do with the repetition and persistence in these situations, working on the same tasks in the same places over time, repeating the situation (almost) every day of the residency. It might also have something to do with how we were present in these situations: we related openly with the students who passed us, and answered honestly when they asked us what we were doing, for example: "I'm pretending to be a rag that is being pushed down the hallway."
From these experiences we derive that when moving with and next to the students, it seems essential that we are fully invested as performers and dancers while also able to take in and relate to their impulses. This is in line with the argument promoted by Lisa Nagel and Lise Hovik (2018) that formats allowing for different types of contracts with the audience also demand different performer skills. Allowing the audience to be physically present and to interact with you on stage demands different skills from those required when communicating with an audience seated in an auditorium. Another aspect we find interesting in these situations, is that they unfold in ways we cannot really predict (which challenges us to take a certain risk), unlike the morning sessions and the body chain.
Summary and conclusion
The aim of this article has been to explore what an aesthetic learning process might look like by reflecting on our experiences from Var Vrimmel, a dance project carried out by the dance group Landing at a Norwegian primary school in the first two months of 2019. For our theoretical framework, we used John Dewey and his Venke Sortland & Ida Gudbrandsen. Exploring situations between art and pedagogy:
The dance project Var Vrimmel.
definition of aesthetic experience, as we considered it a relevant and interesting approach to understanding the notion of aesthetic learning processes.
We presented three different formats, each with a different relationship between us and the students, which we worked on in the Var Vrimmel project, namely the morning sessions with the students, the body chain, and our daily dance practice. We reflected on these formats, introducing the parameters of resistance/interest and what we have called weak/strong direction, with the intent of outlining and describing some of the aspects we consider characteristic of situations in between pedagogy and art. In the list that follows, we focus on how, through our artistic-pedagogical practice, we can facilitate for such processes. The list cannot, however, in any way be considered exhaustive, but rather a work in progress that will keep on growing and become more specific:
In facilitating for situations in between art and pedagogy, we should:
make sure that the content, movement tasks and formats are artistically interesting to us and relevant to the students.
find ways to be fully invested as performers and dancers, and at the same time be able to take in and relate to the students' impulses.
practice together with the students, working on the same task and finding ways to lead the explorations with a minimum of oral instruction.
give the students possibilities to gain ownership of the dance they do.
avoid controlling the students' reactions through predefined roles, and instead give them the freedom to relate to, and engage with, the situation in multiple ways.
allow situations to develop in ways we cannot really predict (which challenge us to take certain risks).
Even though the list is a work in progress, it could be seen as an example of how an aesthetic learning process could unfold and what aspects could be at play in such processes. One could say that these aspects are characteristic of such processual and explorative educational practices which Dewey represents more generally. But Venke Sortland & Ida Gudbrandsen. Exploring situations between art and pedagogy:
The dance project Var Vrimmel.
what makes them specific for an aesthetic learning process is, to our mind, that we base our work in an artistic practice and knowledge. In a future version of Var Vrimmel, we hope to find other ways to facilitate these situations, grounded in our practice and methods as dancers, allowing more risk and trying formats less familiar to us and the students. In extension of the aesthetic learning processes offered to the students through the practical aesthetic school subjects and The Cultural Schoolbag programme, we consider it important that artists contribute to exploring how to facilitate processes in between art and pedagogy and what these kinds of processes can produce. Through relatively short but intense "residencies" in schools, like the one we had, artists could also have a positive influence on the daily pedagogical work through boosting the aesthetic dimensions of an interdisciplinary working period (where the students work on one theme, such as democracy and citizenship), and inspire teachers to explore new teaching methods and formats. In a pedagogical context, exploring new types of formats for facilitating aesthetic learning processes could in the long run have a positive effect on artists' work towards better integration of artistic practice in society and a less elitist understanding of art.
As we mentioned in the introduction, critical reflection on our experiences is an integrated part of the way we work as artists and educators. This article is therefore a continuation of an already existing discussion on the Var Vrimmel project. At the same time, the writing process has challenged us to use theoretical frames, concepts and parameters like those we derive from Dewey in a more systemised way, and thus has given us the possibility to gain a more detailed perspective and deeper understanding. We hope and believe that the discussion will have value in the practice it generates, or in other words, in its potential for initiating more effective and/or different aesthetic learning processes, as well as in demonstrating what an aesthetic learning process could look like and open up this subject to further discussion outside the professional dance community.
About the authors
Venke Marie Sortland is an independent dancer, choreographer and writer, based in Oslo. She has her artistic training from Skolen for Samtidsdans in Oslo (now Høyskolen for Dansekunst) and has studied pedagogy and aesthetics at the University of Oslo. Sortland does her own artistic work with the constellations Landing and Bøler Samvirkelag. She is currently working as a program producer for Venke Sortland & Ida Gudbrandsen. Exploring situations between art and pedagogy:
The dance project Var Vrimmel.
children and youth at MUNCH and as a dance-consultant for Norsk Shakespearetidsskrift (The Norwegian Shakespeare Journal).
Ida Gudbrandsen works as an independent dancer, and has developed artistic projects with the constellations Landing, Supernova and Bøler Samvirkelag. She has a degree in dance and pedagogy from the Norwegian University College of Dance (Den Norske Ballethøyskole, now Norges Dansehøyskole), with a specialization in contemporary dance and cultural management. Gudbrandsen has been employed by the Alliance for Actors and Dancers (Skuespiller-og danseralliansen) since 2017.
Nordic Journal of Art and Research, Volume 10, Nr 2 (2021)
The vagueness and confusion associated with the term was the theme of a seminar initiated by DiS (Dans I Skolen) in November 2019: https://dramaogteater.no/debatt-hva-er-estetiske-laereprosesser/ Venke Sortland & Ida Gudbrandsen. Exploring situations between art and pedagogy: The dance project Var Vrimmel. Nordic Journal of Art and Research, Volume 10, Nr 2 (2021)
Other pedagogical thinkers, such as Hansjörg Hohr, choose to understand Dewey's division between art and pedagogy as less dynamic(Hohr, 2012).
Artificial Hells: Participatory Art and the Politics of Spectatorship. C Bishop, VersoLondon/New YorkBishop, C. (2012). Artificial Hells: Participatory Art and the Politics of Spectatorship. London/New York: Verso.
Barnet og laereplanen. J Dewey, Om utdanning. Klassiske tekster. E. L. DaleOsloGyldendal AkademiskDewey, J. (2001). Barnet og laereplanen. In E. L. Dale (Eds.), Om utdanning. Klassiske tekster (pp. 23-40). Oslo: Gyldendal Akademisk.
Utdanning til demokrati. Barnet, skolen og den nye pedagogikk. J Dewey, Abstrakt forlag. S. VaageOsloSkapende demokrati -oppgaven foran oss. John Dewey i utvalgDewey, J. (2000). Skapende demokrati -oppgaven foran oss. In S. Vaage (Eds.), Utdanning til demokrati. Barnet, skolen og den nye pedagogikk. John Dewey i utvalg (pp. 263-269). Oslo: Abstrakt forlag.
Art as Experience. J Dewey, Penguin BooksLondonDewey, J. (2005). Art as Experience. London: Penguin Books.
Action Research as the Hidden Curriculum of the Western Tradition. O Eikeland, Handbook of Action Research: Participative Inquiry and Practice. P. ReasonThousand OaksSAGE Publications LtdEikeland, O. (2000). Action Research as the Hidden Curriculum of the Western Tradition. In P. Reason (Eds.), Handbook of Action Research: Participative Inquiry and Practice (pp. 145-155). Thousand Oaks: SAGE Publications Ltd.
The Concept of Experience by John Dewey Revisited: Conceiving, Feeling and "Enliving. H Hohr, https:/link.springer.com/article/10.1007/s11217-012-9330-7Studies in Philosophy and Education. 32Hohr. H. (2012). The Concept of Experience by John Dewey Revisited: Conceiving, Feeling and "Enliving". Studies in Philosophy and Education, 32, 25-38. https://link.springer.com/article/10.1007/s11217-012-9330-7
Retrospeksjon som vitenskapelig forskningsmetode. Utdanningsforskning. J B Johansen, Johansen, J. B. (2017). Retrospeksjon som vitenskapelig forskningsmetode. Utdanningsforskning.no. https://utdanningsforskning.no/artikler/2017/retrospeksjon-som-vitenskapelig- forskningsmetode/
Skaperglede, engasjement og utforskertrang. Praktisk og estetisk innhold i barnehage, skole og laererutdanning. Kunnskapsdepartementet, Kunnskapsdepartementet. (2019). Skaperglede, engasjement og utforskertrang. Praktisk og estetisk innhold i barnehage, skole og laererutdanning. https://www.regjeringen.no/contentassets/c8bbb637891443fea7971ba8e936b ca4/skaperglede-engasjement--og-utforskertrang.pdf
En kritisk diskusjon av analytiske perspektiver i kunst for barn med eksempler fra scenekunst, bildebøker og bildebokapper. L & L Nagel, Hovik, Interaktiv scenekunst for barn -tyranni eller magi? In L. Nagel, Kunst for barn som hendelser. Doctoral dissertation, University of OsloNagel, L. & L. Hovik (2018). Interaktiv scenekunst for barn -tyranni eller magi? In L. Nagel, Kunst for barn som hendelser. En kritisk diskusjon av analytiske perspektiver i kunst for barn med eksempler fra scenekunst, bildebøker og bildebokapper [Doctoral dissertation, University of Oslo].
Dans og kroppsøvingsfaget. H Rustad, In Journal for Research in Arts and Sports Education. 1Rustad, H. (2011). Dans og kroppsøvingsfaget. In Journal for Research in Arts and Sports Education, Vol. 1, 2017 (pp. 61-74).
Pragmatist Aesthetics: Living Beauty, Rethinking Art. R Shusterman, Rowman & LittlefieldShusterman, R. (2000). Pragmatist Aesthetics: Living Beauty, Rethinking Art. Rowman & Littlefield.
Choreographic-Pedagogical Entanglements. T P Østern, S. Holte, A-C. Kongsness and V. SortlandØstern, T. P. (2018). Choreographic-Pedagogical Entanglements. In S. Holte, A-C. Kongsness and V. Sortland (Eds), KOREOGRAFI 2018. https://choreography.no/index.html
| IntroductionMany researchers claim that the interdisciplinary teaching of physical education could may be the answer to students' lack of interest in participating to the course. (Gotzaridis, Papaioannou, Antoniou, & Albanidis, 2007) and as consequence to their reduced effort during the course as well as to the absence satisfaction the gain from that (Diggelidis & Papaioannou, 1999).According to Placek and O' Sallivan (1997), the internal integration provide teachers with the opportunity to make their course within the field of physical education without the cooperation between other scientific fields, by teaching students specialized concepts like heart rate and health's improvement as well as special skills for the development of specific domains of students personality as personal and social responsibility and commitment. Furthermore, internal integration is still an innovative way for teaching executive skills that develop critical thinking and help to solve various problems (Placek & O' Sallivan, 1997).When it comes to traditional Greek dance, there are many differences of opinion about which is the appropriate educational method for his teaching. Basically, there are two current trends in the selection of Greek traditional dance's teaching method.The first one, represented by Serbezis (2012), argues that all the multiple skills and especially those which require great precision in their performance should be taught only with instructor-centered methods like is the method of giving orders. One of these skills is traditional dance, as which requires a combination of music and movement as well as he requires accuracy precise execution in every movement.The second trend approaches dance from two different angles, kinetic and culturally at the same time (holistic approach). The upcoming result is dance to affect equally all the three domains of students personality (bodily-kinetic, emotional and cognitive) (Pitsi, Diggelidis, & Filippou, 2013) and also to contribute the creation of attitudes and skills concerning to real life (Stivaktaki, Mountakis, Bournelli, 2009).If are comparative these two trends, welcome to the conclusion that the first one is exclusively focused on dancer's kinetic dimension, by ignoring some other basic functions of dance, such as communication, expression, aesthetic sensibility and by resulting in that way to dance's unilateral approach through different learning technique about steps and rhythmic movement .On the contrary, the second trend, through its holistic approach, exploits equally all the aspects of dance and emphasizes both his kinetic and conceptual-semantic side. Thereby, dance's inherent potential force is exploited as an important art form. Finally, the interdisciplinary approach is giving teachers the opportunity to use a variety of melodies and songs due to considerably improve student's musical listening, to increase their musical experiences and finally, to double the chances for students to be motivated about participatory learning.He motives generated in such processes lead student to set some goals in his life. According to Kostaridou-Efklidis (1999), goals in general are some already defined situation by the person itself and for the sake of which is willing to do everything possible in order to come to a wanted result. Similar to that is the view of Schunk (2012), according to whom as goal's achievement is defined the reason that forces a person to express the appropriate behaviour to an achievable environment.As for Ames (1992), achievement goals are nothing more than a grand total of ideas and beliefs which make students to try hard so that their effort to be succeeded. Ames' personal point of view as well as all the others' researchers' mentioned above, is focused not only on the reasons that make students to put a lot of effort to achieve the academic results they want to, but also to the criteria have chosen by the students themselves due to evaluate their successful or unsuccessful trying. … | Introduction:The actualization of crossover point design activities in modern artistic practice is due to the growing mass demand for entertainment. The musical and theater project involves the introduction of new technologies. Creation of synthesized art "crossover-projects" requires the efforts of a group of managers and performers, taking into account the demands of the art market, their complex perception by a wide audience, and non-traditional approaches to staging classical works, taking into account the peculiarities of the location. Purpose: The purpose of the paper is to characterize art "crossoverprojects" in the context of present culture and to reveal the method of preparation of future specialists to art design during getting university education. The article analyzes the methodology of training future specialists for art design in the process of their university education. The need for such an approach is due to the fact that the functioning of artistic culture in public practice is carried out in accordance with the laws of business, in which the commercial component is of decisive importance. Modern art projects have a high cost, as they involve the support and participation of creative individuals and groups. Results: The growing demand for modern cultural projects containing a creative search, creative component has made it necessary to introduce the corresponding disciplines into the KNUKiM (Kyiv National University of Culture and Arts) curriculum for master students of creative specialties (audiovisual art and production, theatrical art, musical art, choreographic art), as well as design protection of graduation work in the form of a master's creative project. The formation of a creative project within the framework of a master's program is an important element of the formation of skills of the theorist and the practice of artistic culture in their harmonious combination. Discussion: The phenomenon of design activity -"crossover point" and its distribution in modern artistic practice are characterized. Their polyfunctionalism, "manufacturability" and focus on mass character 147 induce to creative methods that are not burdened with the experience of the past. Indicative in this respect is the design activity of Filevskaya -art manager, sponsor of many projects dedicated to Ukrainian avant-garde art, founder of the public organization "Malevich Institute". Her work fits into the concept of "crossover projects". Conclusion: Preparation for art design within the framework of university education provides for the necessary lines of intersection of various art branches, specialties and specializations, encouraging students to create a synthetic artistic product at the intersection of various types of arts and aesthetic and artistic traditions, since the "purity" of art is no longer a criterion for creativity and professional success.Key words: design activity, "crossover point", art projects, synthesis of arts, design in the field of culture. | In the area of Dance Education particularly in a primary education context there are several publications on how to teach dance from a variety of philosophical standpoints (Stinson, 1997; Gough, 1999; Autard-Smith, 2002; Cone and Cone, 2005; McCutchen, 2006). Recent research into dance pedagogy analysed the concepts and approaches to creativity by three specialist dance teachers within a primary context in the United Kingdom (Chappell, 2007). Several dance researchers in New Zealand (Bolwell, 1998; Hong, 2000; Renner, 2006; Buck, 2007) have focused on Dance Education within a primary school context from the following angles: developing dance literacy, primary teachers’ voices in relation to teaching dance, approaches to curriculum dance, analysis of children’s reflections to live dance performance, and dance and interdisciplinary arts. However the issue of sustainable dance education for pre-service primary educators has not been examined. This paper explores some of the challenges facing dance educators working with pre-service primary teachers in the New Zealand context and reports on a particular cohort of student viewpoints. | Previous research has explored the intensity of dance class, rehearsal, and performance and attempted to document the body's physiological adaptation to these activities. Dance activity is frequently described as: complex, diverse, non-steady state, intermittent, of moderate to high intensity, and with notable differences between training and performance intensities and durations. Many limitations are noted in the methodologies of previous studies creating barriers to consensual conclusion. The present study therefore aims to examine the previous body of literature and in doing so, seeks to highlight important methodological considerations for future research in this area to strengthen our knowledge base. Four recommendations are made for future research. Firstly, research should continue to be dance genre specific, with detailed accounts of technical and stylistic elements of the movement vocabulary examined given wherever possible. Secondly, a greater breadth of performance repertoire, within and between genres, needs to be closely examined. Thirdly, a greater focus on threshold measurements is recommended due to the documented complex interplay between aerobic and anaerobic energy systems. Lastly, it is important for research to begin to combine temporal data relating to work and rest periods with real-time measurement of metabolic data in work and rest, in order to be able to quantify demand more accurately. | This essay highlights the presence and problems associated with the structure of a dialectic between materiality and virtuality in various discourses regarding body and performance art. I suggest that both the structures and interpretations of body and performance art practices located in various contexts with different relations to technology reproduce the material/virtual dialectic in problematic ways. I propose that an attention to ethical aesthetic engagement provides an escape from the dialectic's reproduction of the separation between the corporeal and the virtual. Through Bakhtin, I posit a framework for producing ethically engaged aesthetic acts. | Teaching at the interface of dance science and somatics. | The paper reveals the importance of non-institutional practices of polyartistic education (NPPE) for the realization of social and spiritual needs of a person. The influence of a number of factors on the NPPE revitalization has been substantiated: pandemic, self-isolation, the development of digital technologies, increasing interest in artistic culture, joint creative activity in the online format. Historical parallels of modern NPPE as a pedagogical phenomenon associated with the organization of everyday activity experience of being a human based on art have been revealed.The need for communication, being a basic human need (E. Ilyin, D. Leontiev, A. Maslow, K. Obukhovsky), especially clearly manifested itself in a pandemic and self-isolation. The forced decrease in social contacts and a pause in the institutionally organized cultural life of society (cancellation of performances, concerts, exhibitions, etc.) have revealed a problem: how to implement the social and spiritual needs of a person who is "closed" in the space of everyday life due to objective realities.Realizing the need for a person to fill his/her "gaps of being" (filling the events of everyday life with activities that meet interests and have vital meaning), public institutionslibraries, museums, theaters, philharmonic societies-respond by opening virtual halls, offering to view recordings of performances, concerts, creative meetings, and discussions, updating and deepening information on their websites.A person's immersion in the digital space of culture is carried out with pedagogical support. It is expressed in the creation of a variety of explanatory texts, in thematic collections of reference information, in virtual excursions, supplemented by dramatic and pedagogical stories about works of art and their authors, etc.Modern digital technologies have contributed to the close integration of culture and education, which, relying on pedagogical support, have shown a person new opportunities for satisfying spiritual needs-self-expression and self-realization in the process of mastering various types of art. Options for meeting these needs have been proposed by social media users as private initiatives.This socio-pedagogical phenomenon, related to non-institutional educational practice and having historical roots, has not yet been subjected to scientific reflection and it actualizes the | Approaching Knowledge, Research, Performance and the Arts |
1,999,822 | where does the throne and gallery portion of aachen originate from | Aachen Formation The Aachen Formation (; ) is a Cretaceous Period geologic formation in the southern Netherlands and northern Belgium, and adjacent Germany. It is part of the Chalk Group and named after the German city of Aachen. The formation crops out in southern Belgian and Dutch Limburg and adjacent areas in Germany. The formation can also be found in the subsurface of West-Flanders, where it forms an aquifer from which drinking water is won. The Aachen Formation consists of glauconite bearing sand. It was deposited during the Santonian and Campanian ages (85.8 - 70.6 million years ago) of the | Palatine Chapel, Aachen The Palatine Chapel in Aachen is an early medieval chapel and remaining component of Charlemagne's Palace of Aachen in what is now Germany. Although the palace itself no longer exists, the chapel was preserved and now forms the central part of Aachen Cathedral. It is Aachen's major landmark and a central monument of the Carolingian Renaissance. The chapel held the remains of Charlemagne. Later it was appropriated by the Ottonians and coronations were held there from 936 to 1531. As part of Aachen Cathedral, the chapel is designated as a UNESCO World Heritage Site. Charlemagne began the | Aachener Domchor (Aachen Cathedral choir) is the oldest boys' choir in Germany and one of the oldest in the world. It is based at the Aachen Cathedral in Aachen, a former capital of the Carolingian Empire. The year 782 is given for its founding by Charlemagne and Alcuin of York. Under a succession of directors, the choir gained an international reputation, benefiting from an associated school. Since 2000, the Domchor has been directed by Berthold Botzet.
History
The Aachener Domchor (Aachen Cathedral choir) is the oldest boys' choir in Germany and one of the oldest in the world. It is based at the Aachen Cathedral in Aachen, a former capital of the Carolingian Empire. The choir is sometimes also identified using its Latin name, Cappella Carolina. The choir dates back more that 1200 years, with the year 782 given for its founding. It served church music at the cathedral for the court of Charlemagne. The choir school (schola cantorum) was founded by the emperor and Alcuin of York, and was known then as the Schola Palatina, the "Palatinate Choir".
Under a succession of Kapellmeister (choir directors, literally: "chapel masters"), the Aachener Domchor gained an international reputation, benefiting musically and in terms of support from important individuals from close collaboration with the medieval monastic school, today the Aachen Cathedral Choir School (), and also from cooperation with the , founded in 1881, and the first school for organists in western Germany with boarding facilities (closed 2007).
Since 2000, the Domchor has been directed by . Botzet is assisted by the cathedral cantor, who is also in charge of the girls' choir at Aachen Cathedral: Marco Fühner was appointed to this post in July 2013.
The choir tours internationally, and has collaborated with other boys' choirs and youth choirs in Europe. It was awarded the Kaiser Karl IV Medal, an Aachen cultural prize, in 2013, together with the youth choir Svonky from Prague.
Kapellmeister
Leading directors of the music in stift and cathedral (kapellmeister) have included:
16th century: Johannes Mangon (1525–1578) (cantor and Stiftskapellmeister)
1745–1772 Anton Joseph Lacand
1835–1840 Anton Felix Schindler (muniicipal music director
1864–1891 (from 1881 director of the Gregoriushaus)
1891–1913
1913–1918
1918–1924 Leo Wachten
1924–1963 (1945–1946 interim municipal Generalmusikdirektor (GMD))
1964–1986 Rudolf Pohl
1986–2000
from 2000 Berthold Botzet
References
Further reading
Rudolf Pohl: Musik im Dom zu Aachen. 1200 Jahre Chorschule am Hofe Karls des Großen. Aachen 1981, pp. 3–18.
August Brecher: Musik im Aachener Dom in zwölf Jahrhunderten. Einhard, Aachen 1998, ISBN 3-930701-57-X (260 p., illustrated).
External links
German choirs
Choirs of children
Boys' and men's choirs
Musical groups established in the 9th century
Aachen Cathedral
German church music
Church choirs | Aachen Cathedral Aachen since 1802. Charlemagne began the construction of the Palatine Chapel around 796, along with the building of the rest of the palace structures. The construction is credited to Odo of Metz. The exact date of completion is unclear; however, a letter from Alcuin, in 798, states that it was nearing completion, and in 805, Leo III consecrated the finished chapel. A foundry was brought to Aachen near the end of the 8th century and was utilized to cast multiple bronze pieces, from doors and the railings, to the horse and bear statues. Charlemagne was buried in the chapel in | Palace of Aachen The Palace of Aachen was a group of buildings with residential, political and religious purposes chosen by Charlemagne to be the centre of power of the Carolingian Empire. The palace was located at the north of the current city of Aachen, today in the German Land of North Rhine-Westphalia. Most of the Carolingian palace was built in the 790s but the works went on until Charlemagne's death in 814. The plans, drawn by Odo of Metz, were part with the programme of renovation of the kingdom decided by the ruler. Today much of the palace is destroyed, | Palace of Aachen kings of West and East Francia. It was split several times and finally fell under the control of Germany under Henry I the Fowler (876–936). Yet the memory of Charlemagne's Empire remained fresh and became a symbol of German power: in the 10th century, Otto I (912–973) was crowned King of Germany in Aachen (936). The ceremony took place in three steps in several locations of the palace: first in the courtyard (election by the dukes), then in the chapel (handing of the insignia of the Kingdom), finally in the palace (banquet). During the ceremony, Otto had sat on Charlemagne's | Frankenberg Castle (Aachen) so that the formerly blocked fountain could again be made prominent. The castle grounds are located on a small, natural rocky outcropping and follow a three-corner building plan. On the east side of the compound, the three story residential structure contains a decorative façade, with the lower levels being made up of rough stone blocks, while the upper floors consist of brick masonry. The corners of the building, as well as its window and doorjambs, are emphasized by light-colored stone, and a staircase leads to the raised ground floor, which contains four embedded embrasures. Under the building’s eaves on the | Palace of Aachen idols. As soon as he came to power in 768, Charlemagne spent time in Aachen as well as in other villas in Austrasia. In the 790s, he decided to settle down in order to govern his kingdom, then his empire more efficiently. The site of Aachen was chosen by Charlemagne after careful consideration in a key moment of his reign. Since his advent as King of the Franks, Charlemagne had led numerous military expeditions that had both filled his treasury and enlarged his realm, most notably towards the East. He conquered pagan Saxony in 772–780, but this area resisted and | 1,999,822 | Aachen the chapel to compete with the Lateran Palace, both in quality and authority. It was originally built in the Carolingian style, including marble covered walls, and mosaic inlay on the dome. On his death, Charlemagne's remains were interred in the cathedral and can be seen there to this day. The cathedral was extended several times in later ages, turning it into a curious and unique mixture of building styles. The throne and gallery portion date from the Ottonian, with portions of the original opus sectile floor still visible. The 13th century saw gables being added to the roof, and after | what is the name of the chapel in aachen cathedral | who was charlemagne when he founded the palace of aachen | who appropriated charlemagne's palatine chapel in aachen | who designed the modern window in the aachen cathedral | in which country was the palace of aachen | who drew the plans for the palace of aachen | who designed the western window of aachen cathedral | how many neighbourhoods are there in aachen city |
1,999,823 | who directed the 1961 film 'teen kanya ' | Teen Kanya young man arrives from Calcutta as the postmaster of a small village. Ratan (Chandana Banerjee), a pre-adolescent orphan girl, is his housekeeper/maid. Though only a child herself, she cooks, cleans and cares for Nandalal. Nandalal, a city bred young man, is like a fish out of water in the village. He is bored. On an impulse and probably to kill time, he begins teaching her to read and write. She responds eagerly. A tender bond develops. Ratan is devoted and waits on him. For Nandalal, however, she is just a pastime. When Nandalal contracts malaria, Ratan nurses him back to | strain on relations and reveals the inner frustrations rising up in everyone's heart. Kande (film) Kande is an Indian Punjabi-language romantic action comedy movie directed by Kavi Raz and produced by VRV Production. The film stars Preet Baath opposite Kamal Virk. The movie will open worldwide on 11 May 2018. Jind Kaur as portrayed by Sunita Dhir is one of the most reputable woman in the society. Chandu Pehlwan on the other hand has made a name for himself with his notoriety. Both Chandu Pehlwan and Jind Kaur have had their differences in the past and those differences are heightened | Teen Patti (film) Teen Patti () is a 2010 Indian thriller film directed by Leena Yadav. It stars Amitabh Bachchan, Ben Kingsley, R. Madhavan, Raima Sen, Shraddha Kapoor and is produced by Ambika Hinduja under the banners Hinduja Ventures and Serendipity Films. The film is about a mathematics professor, played by Bachchan, who is trying to write a thesis on probability and relates it to the Indian card game of Teen Patti. The movie was based on the 2008 movie "21". The story begins with Venkat Subhramaniam (Amitabh Bachchan), an Indian professor of mathematics, software engineering, and a genius, teaching | Kan Kanda Deivam Kan Kanda Deivam ("Palpable God") is a 1967 Indian Tamil-language film written and directed by K. S. Gopalakrishnan, and produced by Kamal Brothers. It stars S. V. Ranga Rao, Padmini, S. V. Subbaiah and Nagesh. "Kan Kanda Deivam" was directed by K. S. Gopalakrishnan and produced by Kamal Brothers. S. V. Ranga Rao played the lead role of a wealthy landlord, and S. V. Subbaiah played the landlord's younger brother. Padmini played the latter's wife, and Kallapart Natarajan played one of the three spoilt sons of Subbaiah and Padmini. Nagesh played a lawyer given education by the | Kanyakumari (film) Kanyakumari is a 1974 Malayalam language film written by M. T. Vasudevan Nair and K. S. Sethumadhavan. It stars Kamal Haasan in the lead role of the protagonist and Rita Bhaduri in the female lead. This is the first adult role of Hassan in Malayalam language films after his appearance as a child artist in Kannum Karalum. He also received his first Filmfare award for this movie. The film set in Kanyakumari deals with the story of a man who makes sculptures where he meets a girl selling bangles and pearls on the sea shore and falls in | Kanyakumari (film) Kanyakumari is a 1974 Malayalam language film written by M. T. Vasudevan Nair and K. S. Sethumadhavan. It stars Kamal Haasan in the lead role of the protagonist and Rita Bhaduri in the female lead. This is the first adult role of Hassan in Malayalam language films after his appearance as a child artist in Kannum Karalum. He also received his first Filmfare award for this movie. The film set in Kanyakumari deals with the story of a man who makes sculptures where he meets a girl selling bangles and pearls on the sea shore and falls in | Diya (film) Diya in Tamil, Kanam in Telugu, is a 2018 Indian bilingual horror thriller drama film directed by A. L. Vijay and produced by Lyca Productions. The film stars Sai Pallavi and Veronika Arora in the lead role, while Naga Shourya portrays the male lead. The plot revolves around Thulasi (Sai Pallavi) and Krishna (Naga Shourya). Thulasi gets pregnant in her teens because of Krishna, but their family decides to abort the child. After 5 years, they get married, but Thulasi is not very happy because of their past. Later, Krishna explains to let go of the past, and | Diya Aur Toofan may refer to:
Diya Aur Toofan (1969 film), a 1969 Pakistani Urdu romantic comedy film
Diya Aur Toofan (1995 film), a 1995 Hindi language Indian film | 1,999,823 | it again". She is no longer a childish madcap but a grown woman in love. Teen Kanya Teen Kanya is a 1961 Indian Bengali anthology film directed by Satyajit Ray, and based upon short stories by Rabindranath Tagore. The title means "Three Girls", and the film's original Indian release contained three stories. However, the international release of the film contained only two stories, missing out the second ("Monihara: The Lost Jewels"). This version was released on VHS in 1997 under the title "Two Daughters". However, there are now DVD versions available that contain all three films. The Academy Film Archive | when was kan kanda deivam movie made | kanyakumari was the first child film of which film | what are kanyakumaris in the story girls | kannayya kittayya lost what in the encounter | when did the movie kanyakumari come out | who wrote the children's book samurai girl | who does kumar fall in love with in grama kanya | who is the mother of kana kanmani heroine |
1,999,824 | First centerfire rifle. Savage 111 or Winchester M70? | If you could only have one (and my goal is to have both eventually) would you get :
* Ruger Scout (6803) .308 16.10"
* Ruger Mini 14 Tactical (5819) 5.56 16.10"
The general application is zombie apocalypse (civil unrest, bug-out, home invasion, etc) and because of my current location NYC "Gray Man" is a compelling feature. The weapon will be used at the range but there's no plans for hunting or other target practice type use. This weapon's use will be its true intended purpose - make the thing I point it at stop trying to kill me.
So, which would you choose? | I've been doing .45 lc and .45 auto for about 6 months now and I'm looking at starting rifle now. I own 2 calibers, .223 and .30-06. In your opinion, which would be the best rifle round to start with out of those 2? | Winchester model 94 scope mount? | The .25-35 Winchester, or WCF (Winchester Center Fire) was introduced in 1895 by Winchester for the Winchester Model 1894. Together with the .30-30, it was one of the earliest smokeless cartridges designed in North America for a sporting rifle. Savage adopted it for its Savage Model 99 lever-action rifles. The case was based on the .30-30 cartridge.
Performance
The standard .25-35 load is about three times as powerful in muzzle energy as the .25-20 Winchester, a cartridge of similar bore size earlier introduced by Winchester. The .25-35 was valued for its speed, trajectory, and lower recoil. It was a popular round in the Winchester Model 1885 High Wall single-shot rifle. In the U.S. Winchester stopped general production of .25-35 rifles in 1955, but keeps producing ammunition. Hornady Ammunition produces a LEVERevolution .25-35 110-grain load with a MV of 2435 fps and a ME of 1436 fpe.
The .25-35 WCF can be used to hunt deer, though in common loadings only at close range because of their low energy levels. In standard loadings in a 20-inch barrel the cartridge retains only about 800 to 900 fpe at 100 yards, or about what its sister cartridge the .30-30 has at about 200 yards. Hornady's LEVERevolution load for the .25-35 (tested in a 24-inch barrel) lists about 900 fpe at 200 yards; and the manufacturer claims the load is suited for deer and antelope.
Grits Gresham tells of watching a father help his two sons to shoot their first mule deer bucks, at ranges of about 75 and 125 yards, with the same .25-35 rifle he had used years earlier to shoot his first deer. Charles Askins, who had used the .25-35 on whitetail deer, later wrote, "The fact that the .25-35 cartridge is now as obsolete as button shoes and coal oil lamps had utterly nothing to do with its lethality. So far as I could see it killed the 160-lb. Oklahoma bucks quite as devastatingly as the .30-30." Some consider it better suited, or suited also, for small predators such as coyotes.
As a matter of history, some hunters in Canada and the U.S. have used it on moose. Richard Mellon's grandfather, a trapper in northern Alberta, used a .25-35 to fire three shots for three kills on one hunt: two just seconds apart on a cow moose and a bull moose and a third moments later on a whitetail buck. He also used it on wolves. H. V. Stent tells of Howard Clarke, a Canadian guide, who used a .25-35 to finish off moose his clients had wounded. Olive Fredricksen, a widow living with her children in northern B.C., used her carbine to kill moose to feed her family decades ago.
It has also been used on elk: John Barsness repeats a story told by Francis Sell, who met a rancher who had just shot a 5-point bull elk with a .25-35 and said he had killed several others with the caliber. However, this cartridge is not recommended today on moose and elk for most hunters because of its low energy level, the hunting skills required to get close, and the shooting discipline needed to place the bullet well or refrain from firing. While much of this is true when using any sporting calibers on game, the need is reinforced when using a close-range, low-energy round on larger game.
Speaking of the .25-35 skillfully and successfully used by his grandfather in the 1930s to provide food for a household with eight children, Richard Mellon says, "I don't know what ever happened to Grandpa's .25-35. I do know I wish it could talk. We judge rifles and cartridges by seemingly irrelevant standards compared to the days when the difference between good and bad was life and death."
6.5×52mmR
The 6.5×52mmR is a European cartridge that is a close variant of the .25-35 Winchester. It should not be considered identical to the .25-35 Winchester and is not treated as such by the Commission Internationale Permanente pour l'Epreuve des Armes à Feu Portatives (CIP), which has released separate specifications for each cartridge. The 6.5x52mmR has its origins in Germany and was introduced by RWS and is chambered in many drilling and single-shot rifles. Any interchangeability between the two cartridges is solely dependent on individual chamber tolerances and should not be assumed.
See also
6 mm caliber
List of rifle cartridges
Winchester rifle
References
Winchester brings back the .25-35 at Gunblast
25 Caliber Cartridges by Chuck Hawks
Cartridge Dimensions at Steve's Pages
External links
The .25-35 Winchester by Chuck Hawks
Pistol and rifle cartridges
Winchester Repeating Arms Company cartridges
Weapons and ammunition introduced in 1895 | Are you sure about the make and model? Is this a pump or a semi? Are there any other markings on the receiver, barrel or stock? I find no listing for a Savage 773. There is a listing for a Savage 77E Trench Gun which is worth between $225 in 60% condition and $1000 in 98% condition. | Winchester model 70 264 mag? | Which is better m1 carbine or m16? | I recently went to the range to shoot a variety of center fire rifles and I like the .308 the best. Handguns are off limits due to how hard they are to obtain in Australia and I prefer rifles over handguns anyways.
tl:dr Looking at getting a .308 as my first firearm, advice? | 1,999,824 | I have a Marlin 795 and have been out shooting with it about once a month for the last year. I'm ready to buy my first centerfire rifle. It will be used in the fall for my first deer hunt, and also informal target shooting and other hunting as opportunities present themselves.
I've narrowed the guns down to a Savage 111 Lightweight Hunter or a Winchester M70 Featherweight (whichever one, chambered in .30-06) based on reviews online, holding several rifles in local stores and a very few shots with friends' rifles at a local range.
The Savage is obviously going to be a bit less expensive, but seems to get good reviews.
The Winchester is the classic "Rifleman's rifle".
I'm lucky in that money isn't a main factor in this purchase. I have plenty saved to buy either rifle, a nice scope, sling, case, ammo, etc. Still, I want to make sure I get a good value. This is likely to be my one and only - at least for a while.
My main questions: Is the Savage really as good as I've read? Will I regret not spending the bit extra for the Winchester?
Is the Winchester all its name promises? Will I regret not buying the Savage and spending a bit extra on the scope, a nicer case or a couple more boxes of cartridges?
I've been lurking here for a while. You all seem like smart folks. I'm just hoping for some good practical advice from the field.
Thank you. | Thoughts on the Winchester Wildcat? | Opinion on a few different options I have for a .22 savage Mark II | Savage B series 22 vs Savage Mark ii Heavy Barrel | Can you help me pick out an SKS to compliment my first rifle? | Gun idea: Winchester Model 70 | Will be thinking about purchasing a used shotgun today.. what do I look for? | Savage A17 Lightweight Synthetic Stock suggestions? | Shouldered vs Savage nut setup for multiple rifles/ multi barrel set up. |
1,999,825 | Hard Inquiry dropped my score y 29 points. Utterly Baffled. | I know I shouldn't expects good scores, although I do try my best but recently they have been extra low for me.. has this been happening to anyone else? | Kind of an odd question, I’ve been at 2649 feedback for about 2 weeks, I noticed today my score dropped to 2648 without a negative or anything like that.
Just wondering if anyone has come across his before?
Thanks | I got the scores for my ACT back a bit before Christmas. I managed to get a composite score of 32. The problem is my Maths score was 36 with my science and reading being 35 but my grammar section was a 23. I’m applying as an international student and I don’t think I’ll be able to get a significantly higher score on the grammar retaking it as I’m severely dyslexic. Any suggestions? | I know we aren't motivated by helping others in traditional ways such as a nurse, but how low on the scale would your average INTP be?
&#x200B;
I scored 0 on the Enneagram test for Helper which is so low, I scored at least something for every other section | I'm not sure how to phrase this question, but do you think for any section a scale score will be skipped? For example, on one of the past science tests -2 was 33 and -3 was 31. do you think any sections on this test were easy enough to cause this sort of scoring? | The questions were not expected, and i only got 21/30 = 118 on the non-verbal
27/30 = 137 on the verbal gives us (0.58(18+37) + 100) = 131.9
Quite disappointed with the non verbal score, since verbal intelligence seemed like a joke
| How good is an ACT score of 28? | Math: 750
Critical Reading: 730
There was latent consternation surrounding how I may fare on standardized tests after scoring a 30 at the beginning of the summer. However, after taking an SAT practice test, I scored a 1480 and my confidence in my test-taking ability was renewed. I added 70 points to my PSAT score from October, and my goal is 1530. | 1,999,825 | I couldn't find any explanation online as to why this would happen.
I contacted my credit card company get a greater line of credit on my credit score. I got an alert saying I had had a hard credit inquiry done. My Credit score dropped from 830 to 801.
I haven't had another hard inquiry for over a year. I have no outstanding debt. My credit history is 20+ years.
Does anyone have an explanation why it would drop so drastically? Any insight would be helpful, since everything I've read says it should be 5-10 points, and even less with great credit.
Thank you.
&#x200B;
Edit: Source is Experian | Why did my credit score just drop 80 points? | Why did my credit score drop for no reason?? | Credit score dropped 20 points after Christmas. Normal? | Why is my credit dropping? | Credit score keeps dropping as I pay off loans | Credit score stuck at 750. | Credit dropped twice, this has never happened before | My credit score decreased nearly 100pts, how? |
1,999,826 | Banking services, transaction costs and international remittance flows | Like the fabled Hermes American banks have undertaken the great trek, and have moved and extended their field of operations to service a global commerce and travel. This multi-nationalisation could not have proceeded as speedily nor as efficiently as it has in the past decade without resort to the overseas branch. The expansion in number of foreign branches, in number of U.S. banks with foreign branches, and in the assets and deposits held by these branches has been impressive. However, more impressive is the impact this overseas branching has had on the pattern of international bank expansion, the degree of competition, and the channels branching has provided for international short-term capital flows. Foreign branches of American banks provide major links between international financial centres, and permit a more efficient accommodation between the supply and demand for funds in regional sub-markets around the world. | Immigrant remittances are a significant source of income and finance for developing economies, representing about three times’ official development assistance and over half of foreign direct investment annually received. Major motivations to send remittances are for improving food, health, and education spending of families at home as well as for investing in entrepreneurial ventures. Economic policies to channel remittances into development finance should translate these motivations into measures to boost social investment and local and regional production, linking remittances policies to broader fiscal, financial and institutional policies. A national development bank can be a catalyser of public and private interests by supporting the scale up of remittances investment programmes and by building partnerships with regional and multilateral development institutions. | The paper deals with the foreign penetration in the capital of bank sector in the countries in Central and Eastern Europe. We start with some methodological issues regarding the real measure of foreign penetration, including both the physical presence of foreign banks in the region and cross-border operations of foreign banks. Then we analyze the foreign, international and local claims of all banks reporting to Bank for International Settlements in relation with Central and Eastern Europe, as well as the distribution of these claims: by the currency of claims denomination (local vs. foreign), by country of capital origin, by sector of destination (public sector, private sector, banks), by destination country. The paper ends with some considerations on the foreign banks’ presence in Central and Eastern Europe countries: evolution and present penetration level. | Abstract In providing financial services jointly, banks may reduce costs due to complementarities in production (cost economies of scope) or raise revenues from complementarities in consumption (revenue economies of scope). Cost economies of scope between bank deposits and loans have been found to be small. Revenue economies of scope are investigated here for the first time and found to be insignificant over 1978–1990 for both small and large banks and for those on or off the revenue-efficient frontier. The lack of complementarities between deposits and loans — where benefits are most likely to occur — suggests that claims of important synergies from an expansion of banking powers be taken with caution. | This paper looks into the remittance channels used by Bangladeshi labor migrants in Hong Kong and Malaysia and examines the reasons why they prefer particular modes of money transfer. Data were collected from 126 respondents (56 in Hong Kong and 70 in Malaysia) through a survey conducted during June 2004 to October 2005. An overwhelming majority of migrants preferred unofficial over official channels in transferring money. According to migrants, the informal channels are quicker in transferring money and the exchange rate is higher than the formal channels. They recognized though that there is a considerable amount of risk in remitting through informal channels. | money by accepting funds deposited on current accounts, by accepting term deposits, and by issuing debt securities such as banknotes and bonds. Banks lend money by making advances to customers on current accounts, by making installment loans, and by investing in marketable debt securities and other forms of money lending. Banks provide different payment services, and a bank account is considered indispensable by most businesses and individuals. Non-banks that provide payment services such as remittance companies are normally not considered as an adequate substitute for a bank account. Banks can create new money when they make a loan. New loans | This paper studies how interstate banking deregulation affects credit supply, focusing on distinguishing the balance sheet and bank competition channels. Using a regression discontinuity design, I find that interstate banking deregulation affects credit supply, not only by legally impacted commercial banks, but also by non-legally impacted non-bank lenders. Controlling for lender-year fixed effects to isolate the balance sheet effect, I find that credit supply by the same lender varies with interstate banking restrictions in different states. Overall, the results suggest that the impact of interstate banking deregulation is mostly driven by the bank competition channel. | I will get a remittance from Germany and I wonder what's the best service to use.
I read a lot about TransferWise and I guess I will use them. Reviews are great and they seem to be reliable, cheap and fast.
My question is; how much the japanese bank is charging for transferring the money from the TransferWise account to my local bank account. (I know they will) and how long does the transfer take?
&#x200B;
Anyone who has an experience with TransferWise receiving money (not sending) please let me know. | 1,999,826 | Revisiting the Effects of Remittances on Bank Credit: A Macro Perspective | How does the Flow of Remittances Affect the Trade Balance of the Middle East and North Africa | Credit mechanics: a precursor to the current money supply debate | Remittances and Macroeconomic Volatility in African Countries | Credit and business cycles: Causal effects in the frequency domain | Alternative central bank credit policies for liquidity provision in a model of payments | An empirical analysis of the impact of trade credit on bank debt restructuring | Fiscal stimulus in a credit crunch: the role of wage rigidity | Do remittances really attract foreign direct investments? Evidence from panel cointegration |
1,999,827 | Where is the oil drain plug located on a 2000 chevy suburban? | Where is the location of the oil drain plug in 2003 chevy s-10? | Where is the oil drain plug for a 99 chevy blazer? | Where is the oil plug on 2000 silverado? | Where is the oil drain plug on 1998 ford ranger? | Oil drain plug on 2005 chevy malibu? | Where is the ac drain on your 2002 chevy s10? | Where is the oil pan in 2002 chevy suburban? | Where is the oil drain plug on a 2000 camry? | 1,999,827 | Where is the oil drain plug for the 2000 suburban chevy? | Picture of oil plug in 2000 chevy silverado? | Where is the oil filter and oil drain plug located on a 2003 Chevy S10 4.3L V6 pickup? | Where is the oil drain plug on 2004 chevy malibu? | How do you open the oil drain plug 2005 chevy colorado? | Where is the oil drain plug on a 1999 chevy blazer? | Where is the ac drain on a 2001 Chevy s10? | Where is the oil drain plug 2007 sts? | Where is the radiator drain plug for a 1997 gmc yukon? |
1,999,828 | how many people visit the broward county library annually | Jacksonville Public Library The Jacksonville Public Library is the public library system of Jacksonville, Florida. It primarily serves Jacksonville and Duval County, and is also used by the neighboring Baker, Nassau, Clay, and St. Johns Counties. It is one of the largest library systems in Florida, with a collection of over three million items. A division of the city government, the library has the third largest group of city employees after the city's Fire Department and Sheriff's Office. There are twenty branches and a Main Library in the system. Located downtown near City Hall and Hemming Plaza, the Main Library | Library Worker Retirement Plans: A Large Survey Reveals New Findings | Escondido Public Library The Escondido Public Library is a public library system serving the city of Escondido, which is situated in San Diego County, California. The collection of the library contains 166,629 volumes, circulates 514,792 items per year and serves a population of 151,613 residents. The library system consists of the Main Branch and the Pioneer Room (the Escondido Public Library's local history and genealogy archive). The Library had its start when, in 1890, the Escondido Dramatic Club began to use its profits to purchase books and make them available at a local school "for the use of the pupils | Florida and Santa Fe College. The Alachua County Library District is an independent special taxing district and the sole provider of public library service to approximately 250,000 citizens of Alachua County, Florida. This includes all of the incorporated municipalities in the county. It maintains a Headquarters Library and four other branches in Gainesville. These locations include the Millhopper Branch in northwest Gainesville, the Tower Road Branch in unincorporated Alachua county southwest of Gainesville, the Library Partnership Branch in northeast Gainesville, and the Cone Park Branch in east Gainesville. The district also operates branches in the Alachua County municipalities of Alachua, | 16,568 - Public Libraries in the US. There are over 116,000 if you include academic, school, military, government, corporate, etc
14,606 - Starbucks stores in the U.S. in 2018
13,905 - McDonald's restaurants in the United States in 2018
Edit: This post got more traction than I was expecting. I’d really like to thank all of the librarians/tax-payers out there who got me to where I am. I grew up in a smallish town of 20k and moved to a bigger suburb later. From elementary school through medical school, libraries have helped me each step of the way.
They’ve had dramatic changes over the years. In high school, only the nerdy kids would go to the library (on top of the senior citizens and young families). A decade later, I can see that the the library has become a place to hang out. It’s become a sort of after school day care for high school kids. Many middle/high school kids have LAN parties. Smaller kids meet up together with their parents to read (and sometimes cry). My library has transformed from a quiet work space to more of a community center over the past decade.
Even though I prefer pin-drop silence, I have no issues with these changes. **It’s better that kids have a positive experience in an academically oriented community environment than be out on the streets, getting into trouble, etc. And putting younger children around books is always a great thing.**
Plus, they have a quiet study room for pin-drop silence people like me! | The Morgan County Public Library is located in Martinsville, Indiana, and has five branches in addition to the main library.
History
The Morgan County Public Library was founded in 1906 as the Martinsville Public Library in Martinsville, Indiana. Andrew Carnegie donated $12,500 for the library's construction, which was just sufficient to build a brick building. However, Martinsville city officials wanted a limestone structure, and raised as additional $2,400 through the sale of bonds. The library was built of Bedford limestone and opened in September 1908, with a collection of 1,500 books.
The Martinsville Public Library continued to operate, serving the citizens of Martinsville and the surrounding Washington Township, until 1971. In that year, the library merged with the Bookmobile service to become the Morgan County Contractual Library and expanded its operations to server the entire county except Brown Township (Moorseville). In 1976, the library again changed names to the current Morgan County Public Library.
In 1990, the library underwent a $1.7 million expansion and renovation. The main library is now more than four times larger than it was in 1908, and houses over 100,000 books. In addition, the library offers magazines, books on CD/cassette, DVD and movies, games, and public computers (as well as wireless connection). The main library has an extensive genealogy collection including digitized records, microfilm, local histories, yearbooks and other records in paper form. In all, there are over 180,000 items in circulation throughout the library system. The Library has an extensive digital collection as well, offering downloadable ebooks and audiobooks through the Overdrive platform, and downloadable music through Freegal Music.
Additional historic renovation began in 1996 and included roof repairs, tuckpointing, and lead paint removal. On the exterior, trim was repainted and leaded glass replaced. An extensive interior remodeling included ceramic tile in the basement, new carpeting in all public areas, wallpaper removal and repainting.
The Morgan County Public Library currently provides library services at the Main Library in Martinsville and five branch locations in the towns of Brooklyn, Eminence, Monrovia, Morgantown and Waverly. In 2009, the Library became part of the Evergreen Indiana consortium which allows patrons access to over eight million items and over 100 libraries statewide.
References
Library History Page
External links
Library Website
Morgan
Library buildings completed in 1908
Carnegie libraries in Indiana
Education in Morgan County, Indiana
Buildings and structures in Morgan County, Indiana
1908 establishments in Indiana | King Library (Miami University) university library. When King Library was completed in 1972, Alumni Library was changed to Alumni Hall. When the library opened in 1966, sixty volunteer fraternity men transferred 40,000 volumes, pushing book trucks up and down ramps across the quad from the old Alumni library. The building was named after Edgar Weld King, who funded the construction. Dedication to Edgar King and the library was held on February 17, 1973 at King Library, where he gave a speech in front of the university. In total, King Library cost $3,574,000 to build. The building was completed in two phases: the first phase, | The Hogwarts library is probably the largest library in Wizarding Britain, said to be containing most published academic books.
There's probably some darker books that exist in private collections and not in the library, but those would probably only add an additional bookshelf or two since there can't be that many dark wizards rich enough to have a private collection of books.
Considering that the Hogwarts library as a school library probably has multiple copies of many popular books used by students, the number of books in the library is probably larger than the number of unique english language books published by wizards.
So how large is it? As depicted in the movies it's a pretty large room, filled with very tall bookshelves, probably about 50 000 books, estimating from the size and number of shelves.
Compared to the US library of congress with about 16 million books, it is clear that the wizarding world has a lot less public knowledge available than the muggle one.
Magic makes many things much easier, but conducting research and publishing books appears to be something limited by brain power where magic only helps a little, which means that magic doesn't quite make up for the drastically lower population.
1000 years before, wizards were clearly superior to muggles. But since then muggles learned how to get things done without magic, and greater numbers mean that many more new things get figured out. By the time the events of the books take place, much of wizarding innovation seems to come from copying muggles, like the wizarding wireless or the knight bus. New independent innovation like wolfsbane potion seems pretty rare.
How long do you think it would take until the rapidly improving muggle technology is sufficiently advanced to be not indistinguishable, but superior to magic? | 1,999,828 | its history, the library operated on a budget in excess of $60 million, held more than three million items, and had over 10 million visitors a year. Ongoing construction, including that funded by a $139.9 million bond issue approved by voters in 1999, has yielded the current total of 38 branch libraries and the eight-story Main Library in downtown Fort Lauderdale. The Main Library houses a Patent and Trademark Depository, the Florida Center for the Book, the Bienes Museum of the Modern Book, and Gallery Six, and a public fine arts exhibition center. On February 1, 2007, Broward County Library | Describing the Economic Impacts and Benefits of Florida Public Libraries: Findings and Methodological Applications for Future Work. | when was the new tampa public library built | how big was the new tampa public library | how many libraries must have copies of publications from the government publishing office | what is the name of the largest library in tampa fl | How many libraries are there in the United States of America? | Which library is financial from the government funds? | how much money does the huntington library have |
1,999,829 | @param string $decrypted
@return string | public function encrypt($value, string $key, bool $base64 = false): string
{
$ret = $this->encryptBinary(serialize($value), $key);
return ($base64) ? base64_encode($ret) : $ret;
} | public static function decrypt(string $cipherText, string $key, string $iv, int $option = OPENSSL_RAW_DATA, $method = null): string
{
self::validateKey($key);
self::validateIv($iv);
return openssl_decrypt($cipherText, $method ?: self::getMode($key), $key, $option, $iv);
} | public function encryptString($algo, $string, $key = null)
{
if (!empty($algo) && !empty($string)) {
if ($key == null) {
$ctx = hash_init($algo);
} else {
$ctx = hash_init($algo, HASH_HMAC, $key);
hash_update($ctx, $string);
}
return hash_final($ctx);
}
return false;
} | function encrypt(PersonalData $data, CryptographicDetails $crypto): EncryptedPersonalData {
if ( ! $crypto->encryption() == 'libsodium') {
throw new CryptographicDetailsNotCompatibleWithEncryption("{$crypto->encryption()} received, expected 'libsodium'");
}
$dataString = $data->toString();
$secretKey = $crypto->key('secretKey');
$nonce = $crypto->key('nonce');
$encrypted = sodium_crypto_secretbox($dataString, $nonce, $secretKey);
return EncryptedPersonalData::fromString($encrypted);
} | public function decodeResponseFromMps($data_encrypted, $signature)
{
try {
$inputParams = [
'data_encrypted' => $data_encrypted,
'signature' => $signature,
];
$this->debug->info(__FUNCTION__, 'Input Params: ' . json_encode($inputParams));
$data = str_replace(' ', '+', $data_encrypted);
$this->debug->debug(__FUNCTION__, 'Data to Encrypt: ' . json_encode($data));
$verify = openssl_verify($data, base64_decode($signature), self::getViettelPublicKey(), OPENSSL_ALGO_SHA1);
$this->debug->debug(__FUNCTION__, 'OpenSSL Verify: ' . json_encode($verify));
//echo('verify: '.$verify. "\n");
openssl_private_decrypt(base64_decode($data), $data, self::getCpPrivateKey());
//echo 'value Decrypt with private key: ' .$data. "\n";
$arr = [];
parse_str($data, $arr);
//B7. Giai ma du lieu bang AES
$value_decrypt = self::decrypt(str_replace(' ', '+', $arr['VALUE']), $arr['KEY']);
$this->debug->debug(__FUNCTION__, 'Value to Decrypt: ' . json_encode($value_decrypt));
$array_response = [];
parse_str($value_decrypt, $array_response);
$this->debug->debug(__FUNCTION__, 'Response Array: ' . json_encode($array_response));
//var_dump($array_response); die;
//$array_response = explode("&", $value_decrypt);
$IP = new IP($this->options);
$phoneNumber = new Phone_number();
$phoneNumber->setDebugStatus($this->options['debugStatus']);
$phoneNumber->setLoggerPath($this->options['debugLoggerPath']);
$phoneNumber->__construct();
$IP->setHaProxy(TRUE);
$this->debug->debug(__FUNCTION__, 'IP Object: ' . json_encode($IP));
$this->debug->debug(__FUNCTION__, 'PhoneNumber Object: ' . json_encode($phoneNumber));
if (isset($array_response) && count($array_response) > 0) {
$resultMsisdn = trim($array_response["MOBILE"]);
$this->debug->info(__FUNCTION__, 'Result MSISDN: ' . json_encode($resultMsisdn));
if ($resultMsisdn == NULL || $resultMsisdn == "null") {
$msisdn = "GUEST";
} elseif (strpos($resultMsisdn, self::HIDDEN_STRING) || strpos($resultMsisdn, self::HIDDEN_STRING_2)) {
$msisdn = trim($resultMsisdn);
} else {
$msisdn = $phoneNumber->format($resultMsisdn);
}
$price = $array_response["PRICE"];
$source = $array_response["SOURCE"];
$command = $array_response["CMD"];
$response_id = $array_response["RES"];
$request_id = $array_response["REQ"];
$content_logs = "";
} else {
$msisdn = "";
$price = "";
$source = "";
$command = "";
$response_id = "";
$request_id = "";
$content_logs = "";
}
$outResult = [
'msisdn' => $msisdn,
'request_ip' => $IP->getIpAddress(),
'request_id' => $request_id,
'response_id' => $response_id,
'price' => $price,
'source' => $source,
'command' => $command,
'content_logs' => $content_logs,
];
$this->debug->info(__FUNCTION__, 'Final Result: ' . json_encode($outResult));
return $outResult;
}
catch (\Exception $e) {
$message = 'Error File: ' . $e->getFile() . ' - Line: ' . $e->getLine() . ' - Code: ' . $e->getCode() . ' - Message: ' . $e->getMessage();
$this->debug->error(__FUNCTION__, $message);
$outResult = [
'msisdn' => NULL,
'request_ip' => NULL,
'request_id' => NULL,
'response_id' => NULL,
'price' => NULL,
'source' => NULL,
'command' => NULL,
'content_logs' => NULL,
];
return $outResult;
}
} | public function decrypt($payload)
{
$payload = $this->getJsonPayload($payload);
// We'll go ahead and remove the PKCS7 padding from the encrypted value before
// we decrypt it. Once we have the de-padded value, we will grab the vector
// and decrypt the data, passing back the unserialized from of the value.
$value = base64_decode($payload['value']);
$iv = base64_decode($payload['iv']);
return unserialize($this->stripPadding($this->mcryptDecrypt($value, $iv)));
} | function decrypt($ciphertext)
{
if ($this->engine == CRYPT_ENGINE_OPENSSL) {
$temp = $this->key;
$this->key = $this->orig_key;
$result = parent::decrypt($ciphertext);
$this->key = $temp;
return $result;
}
return parent::decrypt($ciphertext);
} | public function fire( $job, $data )
{
$closure = unserialize( $this->crypt->decrypt( $data['closure'] ) );
$closure( $job );
} | 1,999,829 | public function encrypt(string $decrypted): string {
$status = openssl_public_encrypt($decrypted, $encrypted, $this);
if(!$status) {
throw new RuntimeException('Encrypt failed');
}
return $encrypted;
} | Decrypt the given value.
@param string $payload
@return string | Returns the name of the encryption mode to use.
:return:
A unicode string from one of the following: "cbc", "ecb", "ofb",
"cfb", "wrap", "gcm", "ccm", "wrap_pad" | Create an encryption string with a special algorithm and key
@param string $algo The algorithm to use
@param string $string The string to encrypt
@param string $key A salt to apply to the encryption
@return string Return encrypted key | Decrypts a message.
Mostly a wrapper for Crypt_Base::decrypt, with some additional OpenSSL handling code
@see self::encrypt()
@access public
@param string $ciphertext
@return string $plaintext | Decrypt string with defined password, algorithm and IV (init vector (salt)).
@param string {String} String to decrypt.
@return {String | Null} Decrypted string. | Encrypt a text using public key. The result is encoded to Base64.
@param text The plain text
@param key The public key
@return Encrypted string as base64
@throws MangooEncryptionException if encryption fails | // SetTargetEncryptionType sets the TargetEncryptionType field's value. | Run the mcrypt decryption routine for the value.
@param string $value
@param string $iv
@return string |
1,999,830 | Stroke Rehabilitation A Function Based Approach | The Functional Independence Measure-Function Related Groups (FIM-FRGs) classify stroke patients into five clinical categories that predict medical rehabilitation length of stay as a proxy for cost. The current payment system for inpatient rehabilitation does not adjust for clinical complexity, thus potentially leading to care inequities for individual patients and unequal distribution of resources among rehabilitation facilities. Designed for use as part of a payment system, the FIM-FRGs could operate within the Tax Equity and Fiscal Responsibility Act payment system or other payment systems to adjust for the clinical complexity of the patients actually treated. The article discusses the use of function-based classification schemes for the payment of stroke rehabilitation. | Thank you for reading stroke rehabilitation structure and strategy. Maybe you have knowledge that, people have look numerous times for their favorite books like this stroke rehabilitation structure and strategy, but end up in malicious downloads. Rather than reading a good book with a cup of tea in the afternoon, instead they are facing with some malicious virus inside their desktop computer. stroke rehabilitation structure and strategy is available in our digital library an online access to it is set as public so you can get it instantly. Our book servers hosts in multiple locations, allowing you to get the most less latency time to download any of our books like this one. Merely said, the stroke rehabilitation structure and strategy is universally compatible with any devices to read. | Assessment of individuals with stroke using reliable and valid outcome measures is a key component of the treatment planning process. Health care professionals may have difficulty selecting balance and mobility measures given the large number of measures to choose from. This article utilizes a case-based approach to describe the benefits of using a common set of outcome measures and a process for selecting optimal measures across body structure/function, activity, and participation domains of the International Classification of Functioning, Disability and Health (ICF) model and stages of stroke recovery. Specific measures for use in acute care, rehabilitation, outpatient, and home health care settings are discussed based on StrokEDGE task force recommendations by the Neurology Section of the American Physical Therapy Association. | Physical Therapy Interventions for Patients With Stroke in Inpatient Rehabilitation Facilities | Objective: To explore the effect of system rehabilitation on cognitive function, motor function and quality of life in patients with stroke. Methods: A total of 112 patients with stroke were enrolled in this study from June 2014 to June 2016. The patients were divided into control group and study group according to the time of admission. The patients in each group were treated with routine rehabilitation training. The patients in the study group were trained on the basis of routine rehabilitation training. The cognitive function, motor function and quality of life were compared between two groups. Results: The scores of cognitive function, motor function score and quality of life were significantly higher in the study group than those in the control group (P<0.05). Conclusion: Compared with the conventional nursing model, the systematic rehabilitation training model can better enhance the cognitive function and motor function of the patients, and can improve the quality of life of patients. | A novel approach to stroke rehabilitation: robot-aided sensorimotor stimulation. | Objective:To investigate the effect of psychological rehabilitation on the stroke prognosis. Methods:80 patients with acute stroke were randomly divided into two groups,40 cases in each group.The two group received the same rehabilitation treatment,but the psychosocial group was given psychological rehabilatation treatment.To observe for 4 weeks and to compare the limb motor function (clinical neurological functional defect scoring,CNFDS) and depression (Hamilton Depression Rating Scale score:HAMD) in 2,4 weeks between the two groups. Results:In the psychological group the effects of CNFDS,HAMD in 2,4 weeks were superior to the control group,with significant differene (P0.01). Conclusion:The psychological rehabilitation playes a significant role in limb function recovery and improving quality of life after stroke. | Stroke is one of the major causes of disability in the world. Due to the extended lifetime of the world's population, the number of people affected by stroke has increased substantially over the last years. Stroke may lead to sensorimotor deficits, usually causing hemiplegia or hemiparesia. In order to reduce motor deficits and accelerate functional recovery, MP combined with motor rehabilitation was introduced to the rehabilitation process of post-stroke patients. Evidence has shown that MP combining with motor rehabilitation based on activities of daily living was more effective than conventional motor rehabilitation used per se. This combination proved very useful and effective, with significant results in improvement of motor deficits in post-stroke patients. However, further studies must be conducted to determine specific parameters, such as type of imagery, frequency or duration. | 1,999,830 | stroke rehabilitation a function based approach is available in our book collection an online access to it is set as public so you can get it instantly. Our books collection spans in multiple locations, allowing you to get the most less latency time to download any of our books like this one. Kindly say, the stroke rehabilitation a function based approach is universally compatible with any devices to read. | Stroke Rehabilitation Structure And Strategy | Function-based classification for stroke rehabilitation and issues of reimbursement: Using patient classification systems to scale payment to patient complexity. | A Mechatronic Solution for Stroke Rehabilitation in a Reaching Task | There are 1.2 million stroke survivors living in the UK, of which approximately 77% have lost some upper limb function. Traditional mirror therapy (MT) uses repetition, motor priming, and action observation to promote motor recovery in stroke patients. Although a range of intense repetitive exposure to therapeutic interventions, such as exercises and mirror therapy, appear key in motor recovery, it can be difficult to keep patients motivated as change can be slow and therapy appears monotonous. Virtual reality (VR) systems offer the ability of tracking hand function, which could benefit MT as it may provide realistic feedback, in a game like environment to increase motivation. In addition, VR may increase the variety of therapeutic exercises needed for patients as it is not restricted by the physical barrier of the mirror box. This study aimed to develop and evaluate the feasibility and effectiveness of a Virtual Reality Mirror Therapy (VRMT) system, intended to improve finger dexterity in post-stroke patients. Ten post stroke participants with upper limb hemiparesis were recruited for this study, which was run virtually at the participants' home. Participants were randomly allocated into three groups: Group 1 used the VRMT intervention; Group 2 used the Ninehole peg (9HPT) test and Group 3 received no intervention (Control group). The results show that Groups 1 and 2 increased their 9HPT scores more than Group 3. Feedback from participants highlighted functional issues with the VR controller, which may have impacted on usability and motivation. The results of this study indicate that VRMT has the potential to improve finger function, can be used by post-stroke individuals and could increase engagement with therapeutic exercises post-conventional treatment.virtual reality, stroke, motor rehabilitation, mirror therapy | Despite the exponential growth in the evidence base for stroke rehabilitation, there is still a paucity of knowledge about how to consistently and sustainably deliver evidence-based stroke rehabili... | Stroke rehabilitation: benefits of educational initiatives. | Introduction. Diagnostics of motor functions plays an important role in the motor functions restoration after stroke. Synthesis of effective technologies for personalized assessment of motor functions disorders at different rehabilitation stages is an urgent scientific and applied task.The purpose of the paper is to develop information technology for diagnostics of motor functions deficit after stroke, that uses artificial intelligence tools to increase the effectiveness of the diagnostic process.Results. The theoretical and practical foundations to synthesize AI-technology for personal diagnostics of motor functions deficit, and the assessment of their restoration as a result of rehabilitation measures after stroke have been developed. For informational assistance to the physician in the diagnostic process, artificial intelligence is used. A new class of mobile digital medicine tools -the specialized software modules for motor functions diagnostics "Movement-TestStroke 1.1 (PC)" installed in the PC-structure, and "MovementTestStroke 1.1 (MD)" installed in mobile platforms running under Android operation system have been developed. Software implementation -Visual Studio 2019, C# programming language. Structural and functional models of user -software modules interaction, algorithms for motor function deficit diagnostics, and UML-diagrams of these modules are presented.Functional features of the technology: an expanded range of evidence criteria for personalized quantitative assessment of limb movements deficit, storage in the Database and display on the interface the results of deficit assessment, as well as the deficit dynamics during the rehabilitation course in a convenient form (tables, graphs) make it possible to reduce the physician's error, prevent complications, identify the disorders specifics, compare the rehabilitation effectiveness of the upper and lower limbs, their distal and proximal parts, including fine motor skills of the hand, restoration of which helps to restore speech in motor or motor and sensory aphasia.Conclusions. The usage of artificial intelligence tools to diagnose motor deficit will increase the diagnostic effectiveness, and, as a consequence, rehabilitation services for patients after stroke. | Rehabilitation training system and its implementation method of sense |
1,999,831 | Hierarchies for Relatively Hyperbolic Virtually Special Groups | Let G ⊂ SU(2, 1) be a non-elementary complex hyperbolic Kleinian group. If G preserves a complex line, then G is ℂ-Fuchsian; if G preserves a Lagrangian plane, then G is ℝ-Fuchsian; G is Fuchsian if G is either ℂ-Fuchsian or ℝ-Fuchsian. In this paper, we prove that if the traces of all elements in G are real, then G is Fuchsian. This is an analogous result of Theorem V.G. 18 of B. Maskit, Kleinian Groups, Springer-Verlag, Berlin, 1988, in the setting of complex hyperbolic isometric groups. As an application of our main result, we show that G is conjugate to a subgroup of S(U(1)×U(1, 1)) or SO(2, 1) if each loxodromic element in G is hyperbolic. Moreover, we show that the converse of our main result does not hold by giving a ℂ-Fuchsian group. | We describe the kernel of the canonical map from the Floyd boundary of a relatively hyperbolic group to its Bowditch boundary. We then prove that a finitely generated group H admitting a quasi-isometric map ' into a relatively hyperbolic group G is relatively hyperbolic with respect to a system of subgroups whose image under ' is situated within a uniformly bounded distance from the parabolic subgroups of G. |
Introduction
It is well know fact that hyperbolic dynamics has been one of the most sucessfull theory in dynamical systems. But soon was realized that there is an easy way to relax hyperbolicity, called partial hyperbolicity, which allows the tangent bundle to split into invariant subbundles T M = E s ⊕ E c ⊕ E u , such that the behavior of vectors in E s , E u is similar to the hyperbolic case, but vectors in E c may be neutral for the action of the tangent map. This notion arose in a natural way in the context of time one maps of Anosov flows, frame flows, group extensions and it was possible to show the existence of open set od partially hyperbolic diffeomorphisms which are not hyperbolic. See [BP], [Sh], [M1], [BD], [BV] for examples of these systems and [HP], [PS] for an overview.
However, until the results in [CP], partially hyperbolic systems where unknown in the context of geodesic flows induced by Riemannian metrics. In fact, in [CP] it was proved that for some compact locally symmetric space (M, g) whose sectional curvature takes values in the whole interval [−4a 2 , −a 2 ], there is a metric g * in M such that its geodesic flow is partially hyperbolic but not Anosov.
On the other hand, from the works of J. Lewowicz, qudratic forms have been a powerfull tool to characterize expansive dynamics in general and hyperbolic ones in particular (see [?, ?]); moreover, this approach have been extended to the context of geodesic flows (see for instance [L], [P], [R1] and [R2]) and billiards (see [Mar], [MPS]). Those techniques, using previous results by Potapov, have been extended and generalized in [W2].
In the present paper, we explore the use of quadratic forms for the particular context of partially hyperbolic geodesic flows. Moreover, we revisite the examples of partially hyperbolic geodesic flows provided in [CP] using quadratic forms and we relate the partially hyperbolicity with the curvature tensor.
In the second section, we give some definitions and the criteria we are going to apply to get partially hyperbolic examples.
In the thid section, we prove the main theorem with the help of the criteria and to get a corollary, which is going to be useful to prove that some examples are partially hyperbolic.
In the fourth and last section we present some examples of geodesic flows which are going to be partially hyperbolic.
Definitions
Before given the results, we need to introduce a few definitions.
A partially hyperbolic flow φ t : M → M in the manifold M generated by the vector field X : M → T M is a flow such that its quotient bundle T M/ X (assuming that X has not singularities) have an invariant splitting T M/ X = E s ⊕ E c ⊕ E u such that these subbundles are non trivial and with the following properties:
dφ t (x)(E s (x)) = E s (φ t (x)), dφ t (x)(E c (x)) = E c (φ t (x)), dφ t (x)(E u (x)) = E u (φ t (x)), ||dφ t (x)| E s || ≤ C exp(tλ), ||dφ −t (x)| E u || ≤ C exp(tλ), C exp(tµ) ≤ ||dφ t (x)| E c || ≤ C exp(−tµ), for λ < µ < 0 < C.
Let (M, g) be a Riemannian manifold, p : T M → M its tangent bundle, φ t : SM → SM be its geodesic flow. The geodesic flow is always a Reeb flow [P], i.e., given a 2n + 1dimensional manifold N, an one form τ such that τ ∧ dτ n is a volume form, the Reeb vector field Y is the vector field such that i Y τ = 1 and i Y dτ = 0, and its flow is a Reeb flow. The kernel of τ is called the contact structure of the contact manifold (N, τ ). It is allways invariant under the flow and transversal to the Reeb vector field [P].
The double tangent bundle T T M is isomorphic to the vector bundle E → T M, E = π * T M ⊕ π * T M, with fiber E v = T π(v) M ⊕ T π(v) M. We define the isomorphism as
I : T T M → E : Z → ((π • V ) ′ (0), DV dt (0)),
where V is a curve on T M such that V ′ (0) = Z. The Sasaki metric in the double tangent bundle is the pull-back of the metric g on E: [P].
g v ((η 1 , ς 1 ), (η 2 , ς 2 )) = g π(v) (η 1 , η 2 )+g π(v) (ς 1 , ς 2 ) where (η 1 , ς 1 ), (η 2 , ς 2 ) ∈ T π(v) M ⊕ T π(v) M. The contact structure ξ(SM) of the geodesic flow is identified with the vector bundle E ′ → SM, E ′ v ⊂ E v , for all v ∈ SM, whose fiber at v is v ⊥ ⊕ v ⊥ , where v ⊥ = {w ∈ T π(v) M : g(w, v) = 0}. The derivative of the geodesic flow, given the identification of T T M and E is d v φ t (η, ς) = (J(t), J ′ (t)), J(t) ∈ T φt(v) M such that J ′′ (t) + R(φ t (v), J(t))φ t (v) = 0 [Ba1],
Let π : ξ(SM) → SM be the contact structure of the geodesic flow of (M, g). Let Q : ξ(SM) → R be a nondegenerate quadractic form of constant signature (l, m). Let
C + (x, v) = {η ∈ ξ(x, v) : Q (x,v) (η) > 0} be its positive cone, C − (x, v) = {η ∈ ξ(x, v) : Q (x,v) (η) < 0} be its negative cone and C 0 (x, v) = {η ∈ ξ(x, v) : Q (x,v) (η) = 0} be their boundary.
The criteria says the following:
Lemma 2.1. If d dt Q(η, ς) > 0 for all (η, ς) ∈ C 0 (x, v), (x, v) ∈ SM, then the flow φ t is strictly Q-separated.
This criteria and reversibility of the geodesic flow imply it has a partially hyperbolic splitting
ξ = E s ⊕ E c ⊕ E u , dim(E σ ) = l, σ = s, u.
Proof. See the proof in [W1].
Main results
In this section we state the main theorem and a corollary which is going to be useful to prove that some geodesic flows are partially hyperbolicity. Let (M n , g) be a n-dimensional Riemannian manifold, ∇ its Levi-Civita connection.
Let R x : T x M × T x M × T x M → T x M be its curvature tensor. Let v ∈ T x M, then R x (v, ·)v : T x M → T x M is a symmetric linear operator. We can restrict it to v ⊥ , since R(v, v)v = 0. So R(v, ·)v : v ⊥ → v ⊥ is a symmetric linear operator. So we can diagonalize it: there are eigenvalues λ 1 ≥ λ 2 ≥ . . . ≥ λ n−1 and eigenvectors v 1 , v 2 , . . . , v n−1 such that R(v, v k )v = λ k v k . Suppose there is an 1 < r < n − 2 such that λ r (v) > λ r+1 (v) for each v ∈ T M. Then we are able to define A(v) = Rv 1 ⊕. . . ⊕Rv r and B(v) = Rv r+1 ⊕. . . ⊕Rv n−1 . It is easy to see that A(v) ⊕ B(v) = v ⊥ . Let Gr(r, T M) be the Grassmanian bundle of r-dimensional subbundles of T M. Then A, B : T M → Gr(r, T M). Also A(cv) = A(v), B(cv) = B(v) for all c ∈ R, c = 0. So we consider A, B : SM → Gr(r, T M), where SM is the unitary tangent bundle of M. Let P A(v) : T p(v) M → A(v) be the orthogonal projection to A(v). Let A ′ = P ′ A(v) = d dt | t=0 P A(φt(v)) . Let η A be P A η. Let K A be the restriction R(v, ·)v : A(v) → A(v) and K B be the restriction R(v, ·)v : B(v) → B(v).
Linearization of the derivative of the geodesic flow gives you the system of equations
η ′ = ς, ς ′ = −R(v, η)v, for (η, ς) ∈ T x M ⊕ T x M ∼ = T v T M. Theorem 3.1. Let (M, g) be a Riemannian manifold. Suppose A : SM → Gr(r, T M) : v → A(v) ⊂ T p(v)
M is a continuous function (smooth along geodesics). Let the quadractic
form be Q c (η, ς) = g(η A , ς A ) − c 2 g(η B , η B ) − g(ς B , ς B ), where c is a positive real number. If d dt Q c (η, ς) = g(S c (η, ς), (η, ς)) is positive for the following matrix S c = −K A 0 c 2 A ′ 1 2 A ′ 0 Id 1 2 A ′ A ′ c 2 A ′ 1 2 A ′ 0 −c 2 Id + K B 1 2 A ′ A ′ −c 2 Id + K B 0
and for all (η, ς) ∈ C + (x, v), (x, v) ∈ SM, then the geodesic flow of the Riemannian manifold (M, g) is partially hyperbolic dim(E σ ) = r, σ = s, u.
Proof. We have to calculate the following derivative:
d dt Q c (η, ς) = d dt (g(η A , ς A ) − c 2 g(η B , η B ) − g(ς B , ς B )) = g(ς A , ς A ) − g(R(v, η)v, η A ) + g(η A ′ , ς A ) + g(η A , ς A ′ ) − 2c 2 g(η B , ς B ) + 2g(R(v, η)v, ς B ) − 2c 2 g(η B ′ , η B ) − 2g(ς B ′ , ς B ). P A is the orthogonal projection to A, P B is the orthogonal projection to B, then P A (P A ) ′ = (P A ) ′ P B and P B (P A ) ′ = (P A ) ′ P A . It implies that d dt Q c (η, ς) = g(ς A , ς A ) − g(R(v, η)v, η A ) + g((P A ) ′ η B , ς A ) + g(η A , (P A ) ′ ς B ) − 2c 2 g(η B , ς B ) + 2g(R(v, η)v, ς B ) + 2c 2 g((P A ) ′ η A , η B ) + 2g((P A ) ′ ς A , ς B )).
Now suppose we are able to define two functions, α, β : SM → R + such that
i. −α(v) 2 > max{λ i } r i=1 , ii. −α(v) 2 < −β(v) 2 < λ i if i = r + 1, . . . , n − 1,
iii. there is a constant e ∈ R + such that β(v) < e < α(v) for all v ∈ SM, then we are able to fix c ∈ R + such that c := e.
Corollary 3.2. Under the hypothesis of theorem 3.1 and the hypothesis stated above, there is an ǫ : SM → R + which depends on the curvature tensor R and the real numbers c and d such that if A ′ (v) < ǫ(v) then geodesic flow of the Riemannian manifold (M, g) is partially hyperbolic dim(E σ ) = r, σ = s, u.
Proof. The proof is straightforward from the theorem 3.1, if one notices that if A ′ = 0 then d dt Q e = g(S e ·, ·) where
S e = −K A 0 0 0 0 Id 0 0 0 0 0 −e 2 Id + K B 0 0 −e 2 Id + K B 0 so for (η, ς) ∈ C + we have d dt Q e ≥ g(ς A , ς A ) + α 2 g(η A , η A ) − 2(e 2 + β 2 )g(η B , ς B ) and g(η A , ς A ) ≥ e 2 g(η B , η B ) + g(ς B , ς B ) ≥ 2eg(η B , ς B ). Then, d dt Q e ≥ g(ς A − αη A , ς A − αη A ) + 2αg(η A , ς A ) − 2(e 2 + β 2 )g(η B , ς B ) ≥ g(ς A − αη A , ς A − αη A ) + (2α − e − β 2 e )g(η A , ς A ) > 0
for (η, ς) ∈ C + , since 2α − e − β 2 e when e ∈ (β, α). Remark 3.3. So, if we look at the statements in the corollary, we see that at the moment we have to ask for the existence of an interval between the r-biggest eingenvalues of R(v, ·)v and the other eiganvalues (second hypothesis), and a non-oscillatory hypothesis for this interval, i.e., it has to have a constant e in the interval which does not depend on v ∈ SM. One good question would be if partial hyperbolicity still holds when there is no such constant.
Examples
In this section we show some examples. The first example, in subsection 4.1, is the Riemannian manifold of negative curvature. In the case of the Riemannian manifold of negative curvature the criteria is the same as the criteria for hyperbolicity of the geodesic flow. In the subsection 4.2.1 the example satisfies the criteria of partial hyperbolicity. It is also an hyperbolic example. In the subsection 4.2.2 the example does not satisfy the criteria and is not partially hyperbolic. In subsection 4.3 we show the last example. For the last example the criteria is satisfied out of a small set of vectors in the unit tangent bundle. The last example is non Anosov and partially hyperbolic [CP].
Negatively curved manifolds
In the negatively curved case, the theorem is trivial. In this case, A(v) = (Rv) ⊥ , and there is no need of a β function. Suppose K ≤ −α 2 , for a positive real number α. Since (P A ) ′ = 0 in this case, the criteria trivially holds:
d dt g(η, ς) = g(ς, ς) − R(v, η, v, η) ≥ g(ς, ς) + α 2 g(η, η) > 0. for any (η, ς) ∈ C + (x, v), (x, v) ∈ SM.
Locally symmetric manifolds
In this section we look at the case of (M, g) compact locally symmetric manifold of noncompact type. In a previous work we had shown that if rank is one then the geodesic flow is partially hyperbolic, if rank is at least two, then it is not.
Definition 4.1. A simply connected Riemannian manifold is called symmetric if for every x ∈ M there is an isometry σ x : M → M such that
σ x (x) = x, dσ x (x) = −id TxM .
The property of being symmetric is equivalent to:
• ∇R ≡ 0,
• if X(t), Y (t) and Z(t) are parallel vector fields along γ(t), then R(X(t), Y (t))Z(t) is also a parallel vector field along γ(t).
Each locally symmetric space N is the quotient of a simply connected symmetric space M and a group Γ acting on M discretly, without fixed points, and isometrically, such that N = M/Γ.
Locally symmetric manifolds of noncompact type and of rank one
Locally symmetric spaces with non constant negative curvature have the following parallel subspaces of (Rv) ⊥ :
A(x, v) := {w ∈ T x M : K(v, w) = −4a 2 }, (1) B(x, v) := {w ∈ T x M : K(v, w) = −a 2 },(2)
where a ∈ R. The curvature tensor for locally symmetric manifolds of noncompact type and rank one is
R(v, η)v = −4a 2 η A − a 2 η B ,
where v ∈ SM. Partial hyperbolicity follows from: , 2a), for if e ∈ (a, 2a) then e + a 2 e < 4a. For these subspaces of g, k ⊕ p = g and k ∩ p = {0}, and T p M identifies with p.
d dt (g(η A , ς A ) − e 2 g(η B , η B ) − g(ς B , ς B )) = g(ς A , ς A ) − g(R(v, η)v, η A ) −2e 2 g(η B , ς B ) + 2g(R(v, η)v, ς B ) = 4a 2 g(η A , η A ) + g(ς A , ς A ) −2e 2 g(η B , ς B ) − 2a 2 g(η B , ς B ) > 4a 2 g(η A , η A ) + g(ς A , ς A ) −(e + a 2 e )g(η A , ς A ) > 0 if e ∈ (a
Definition 4.3. Given p ∈ M, we define the involution φ p (g) :
G → G : g → σ p • g • σ p .
Then, we obtain θ p : dφ p : g → g. Since θ 2 p = id and θ p preserves the lie brackets, the properties of this subspaces of g are:
i. θ p|k = id, ii. θ p|p = −id, iii. [k, k] ⊂ k, [p, p] ⊂ k, [k, p] ⊂ p,
Fix a maximal Abelian subspace a ⊂ p. Let Λ denote the set of roots determined by a, and g = g 0 + α∈Λ g α . g α = {w ∈ g : (adX)w = α(X)w}, α : a → R is a one-form. Define a corresponding decomposition for each α ∈ Λ, k α = (id + θ)g α and p α = (id − θ)g α . Then:
i. id + θ : g α → k α and id − θ : g α → p α are isomorphisms, ii. p α = p −α , k α = k −α , and p α ⊕ k α = g α ⊕ g −α ,
iii. p = a + α∈Λ p α , k = k 0 + α∈Λ k α , where k 0 = g 0 ∩ k.
For X ∈ a we have that, along the geodesic γ in M with initial conditions γ(0) = p, γ ′ (0) = X, the Jacobi fields are linear combinations of the following Jacobi fields: cosh(|α(X)|t)v j (t) and sinh(|α(X)|t)v j (t).
Proposition 4.4. If (M, g) is a locally symmetric manifold of noncompact type and rank bigger than one, then there is no continuous function
A : SM → Gr(r, T M) : v → A(v) ⊂ T p(v) M
satisfying the hypothesis of the theorem 3.1.
So, in the case of rank bigger than one, fix r < dimM, pick v ∈ T x M such that
A(v) = ⊕ r i=1 p α i , i = 1, . . . , r, |α 1 | > |α 2 | > . . . > |α r |, such that if β = α i , ∀i = 1, . . . , r, then β(v) < α i (v), ∀i = 1, . . . , r. Now we pick (x, v ′ ) such that α 1 (v ′ ) = 0. Then A(v ′ ) = ⊕ r i=1 p β i , for some β j ∈ Λ, j = 1, . . . , r, |β 1 | > |β 2 | > . . . > |β r |. Notice that α 1 (v ′ ) = 0 implies β j = α 1 , ∀j = 1, . . . , r.
There is no way to go from one decomposition to the other continuously, so there is no way to define a continuous A as in the statement of the theorem. Remark 4.5. In the case of locally symmetric manifolds of rank bigger than one, all the three hypothesis stated prior to theorem 3.1 are not satisfied. It would be interesting to look for examples which do not satisfy only one of these hypothesis.
Non Anosov example
Let (M, g) be a Riemannian manifold, ∇ its Levi-Civita connection, R its curvature tensor. Let (M, g 1 = e α g) be Riemannian manifold with a metric in the conformal class of g, ∇ 1 its Levi-Civita connection, R 1 its curvature tensor. Then
∇ 1 X Y = ∇ X Y + 1 2 g(∇α, X)Y + 1 2 g(∇α, Y )X − 1 2 g(X, Y )∇α,
and if α is C 2 -close to zero, then R 1 (X, Z, X, W ) ≈ R(X, Z, X, W ) − 1 2 g(X, X)g(∇ Z ∇α, W ) − 1 2 g(Z, W )g(∇ X ∇α, X).
If (M, g) is the locally symmetric space with curvature in [−4a 2 , −a 2 ], the idea is to pick a closed geodesic γ without self-intersections, take a tubular neighborhood aroud γ. Define an orthogonal x 0 , x 1 , . . . , x n−1 coordinate system in the tubular neighborhood such that along γ, γ ′ = ∂ x 0 , K(γ ′ , ∂ xi ) = −4a 2 for i = 1, . . . , r and K(γ ′ , ∂ x i ) = −a 2 for i = r + 1, . . . , n − 1. Then we are able to define an α : SM → R such that for g 1 = e α g, K(γ ′ , ∂ xi ) = −4a 2 for i = 1, . . . , r and K(γ ′ , ∂ x i ) = 0 for i = r + 1, . . . , n − 1. Define A as in subsection 4.2. Then, for the same quadractic form of the theorem 3.1, the criteria holds at a set PH ⊂ SM. Let T := SM − PH. Any orbit which crosses T stays there as little time as we want -time depends on the size of the tubular neighborhood. So, with a bit more work, we can show that its geodesic flow is partially hyperbolic (see details in [CP]).
symmetric manifolds of noncompact type and of rank at least two Definition 4.2. Let g be the algebra of Killing fields on the symmetric space M, p ∈ M. Define k := {X ∈ g : X(p) = 0}, p := {X ∈ g : ∇X(p) = 0}.
Werner Ballmann, Lectures on spaces of nonpositive curvature. BostonBirkhauser25Werner Ballmann, Lectures on spaces of nonpositive curvature, DMV Seminar, vol. 25, Birkhauser, Boston, 1995.
Persistence of transitive diffeomorphisms. C Bonatti, L J Diaz, Annals of Math. 143C. Bonatti, L. J. Diaz, Persistence of transitive diffeomorphisms, Annals of Math 143 (1995), 367-396.
Flows of frames on manifolds of negative curvature. (Russian) Uspehi Mat. M I Brin, Ja B Pesin, Nauk. 284M. I. Brin, Ja. B. Pesin; Flows of frames on manifolds of negative curvature. (Russian) Uspehi Mat. Nauk 28 (1973), no. 4(172), 209-210.
SRB measures for partially hyperbolic systems whose central direction is mostly contracting. C Bonatti, M Viana, Israel J. Math. 115C. Bonatti, M. Viana, SRB measures for partially hyperbolic systems whose cen- tral direction is mostly contracting. Israel J. Math. 115 (2000), 157-193.
Partially hyperbolic geodesic flows. Fernando Carneiro, Enrique Pujals, to appearFernando Carneiro and Enrique Pujals, Partially hyperbolic geodesic flows, to appear.
Partially Hyperbolic Dynamical Systems, Handbook of Dynamical Systems. Boris Hasselblatt, Yakov Pesin, vo. 1BElsevierNorth-HollandBoris Hasselblatt, Yakov Pesin, Partially Hyperbolic Dynamical Systems, Hand- book of Dynamical Systems, vo. 1B, Elsevier, North-Holland (2006).
Lyapunov functions and stability of geodesic flows. J Lewowicz, Lect. Notes. Math. 1007J. Lewowicz, Lyapunov functions and stability of geodesic flows, Lect. Notes. Math. 1007 (1981), 463-480.
Contributions to the stability conjecture. Ricardo Mañé, Topology. 174Ricardo Mañé, Contributions to the stability conjecture, Topology 17 (1978), no. 4, 383-396.
Roberto Markarian, Non-uniformly hyperbolic billiards, Annales de la Faculté des Sciences de Toulouse. 3Roberto Markarian, Non-uniformly hyperbolic billiards, Annales de la Faculté des Sciences de Toulouse, 3: 223-257 (1994).
Pinball billiards with dominated splitting. Roberto Markarian, Enrique Pujals, Martin Sambarino, PreMat 2008/110 y Preprint IMPA A614. Roberto Markarian, Enrique Pujals, Martin Sambarino, Pinball billiards with dominated splitting, PreMat 2008/110 y Preprint IMPA A614.
Geodesic flows Progress in mathematics. Gabriel Paternain, BirkhauserBostonGabriel Paternain, Geodesic flows Progress in mathematics, Birkhauser, Boston, 1999.
Topics on homoclinic bifurcation, dominated splitting, robust transitivity and related results. E R Pujals, M Sambarino, Handbook of dynamical systems. 1ElsevierE. R. Pujals, M. Sambarino, Topics on homoclinic bifurcation, dominated split- ting, robust transitivity and related results, Handbook of dynamical systems vol 1B, Elsevier (2005) 327-378.
Persistently expansive geodesic flows. Rafael Ruggiero, Comm. Math. Phys. 1401Rafael Ruggiero, Persistently expansive geodesic flows, Comm. Math. Phys. 140 (1991), no. 1, 203-215.
On the creation of conjugate points. Rafael Ruggiero, Mathematische Zeitschrift. 208Springer-VerlagRafael Ruggiero, On the creation of conjugate points, Mathematische Zeitschrift, 208, 41-55, Springer-Verlag (1991).
M Shub, Topologically transitive diffeomorphism of T 4 , in Symposium on Differential Equations and Dynamical Systems. Berlin-NewYorkSpringer-Verlag206University of WarwickM. Shub, Topologically transitive diffeomorphism of T 4 , in Symposium on Differ- ential Equations and Dynamical Systems (University of Warwick, 1968/69), pp. 39-40. Lecture Notes in Math.. 206. Springer-Verlag, Berlin-NewYork, 1971.
Maciej Wojtjowski, Magnetic flows and Gaussian thermostats on manifolds of negative curvature. 163Maciej Wojtjowski, Magnetic flows and Gaussian thermostats on manifolds of negative curvature, Fundamenta Mathematicae 163 (2000), no. 2, 177-191.
Smooth Ergodic Theory and Its Applications. Maciej Wojtjowski, J-Algebra Monotonicity, Lyapunov Of Potapov, Exponents, Proc. Sympos.Pure Math. AMSMaciej Wojtjowski, Monotonicity, J-algebra of Potapov and Lyapunov exponents, Smooth Ergodic Theory and Its Applications, Proc. Sympos.Pure Math. (AMS) 69 (2001) 499-521.
| We give examples of direct products of three hyperbolic groups in which there cannot exist an algorithm to decide which finitely presented subgroups are isomorphic. | We classify the finite semigroups S, for which all the Z-orders O of the rational Q-algebra QS, is such that the unit group U(O) is hyperbolic. We also classify the RA-loops L, for which the unit loop U(ZL) does not contain any free abelian subgroup of rank two. | Using a probabilistic argument we show that the second bounded cohomology of an acylindrically hyperbolic group $G$ (e.g., a non-elementary hyperbolic or relatively hyperbolic group, non-exceptional mapping class group, ${\rm Out}(F_n)$, \dots) embeds via the natural restriction maps into the inverse limit of the second bounded cohomologies of its virtually free subgroups, and in fact even into the inverse limit of the second bounded cohomologies of its hyperbolically embedded virtually free subgroups. This result is new and non-trivial even in the case where $G$ is a (non-free) hyperbolic group. The corresponding statement fails in general for the third bounded cohomology, even for surface groups. | Solvability of the conjugacy problem for relatively hyperbolic groups was announced by Gromov (18). Using the definition of Farb of a relatively hyperbolic group in the strong sense (14), we prove this assertion. We conclude that the conjugacy problem is solvable for fundamental groups of complete, finite-volume, negatively curved manifolds, and for finitely generated fully residually free groups. AMS Classification 20F67; 20F10 | We show that in general for a given group the structure of a maximal hyperbolic tower over a free group is not canonical: We construct examples of groups having hyperbolic tower structures over free subgroups which have arbitrarily large ratios between their ranks. These groups have the same first order theory as non-abelian free groups and we use them to study the weight of types in this theory. | 1,999,831 | On cubulated relatively hyperbolic groups | Maximal hyperbolic towers and weight in the theory of free groups | Bounded cohomology and virtually free hyperbolically embedded subgroups | In this expository note, we illustrate phenomena and conjectures about boundaries of hyperbolic groups by considering the special cases of certain amalgams of hyperbolic groups. While doing so, we describe fundamental results on hyperbolic groups and their boundaries by Bowditch and Haissinsky, along with special treatments for the boundaries of free groups by Otal and Cashen. | Let P be the right-angled hyperbolic dodecahedron or 120-cell, and let W be the group generated by reflections across codimension-one faces of P . We prove that if Γ ⊂ W is a torsion free subgroup of minimal index, then the corresponding hyperbolic manifold H n /Γ is determined up to homeomorphism by Γ modulo the symmetry group of P . | Characterization of Gromov hyperbolic short graphs | The conjugacy problem for relatively hyperbolic groups | Recognition of subgroups of direct products of hyperbolic groups | ATLAS of Finite Groups |
1,999,832 | Khanat söker Khan: Uzbeks Vikarie | The Çamlık Railway Museum, a.k.a. Çamlık Steam Locomotive Museum, ( or Çamlık Buharlı Lokomotif Müzesi) is an outdoor railway museum at Çamlık village of Selçuk district in Izmir Province, Turkey. It is the largest railway museum in Turkey and contains one of the largest steam locomotive collections in Europe.
History
The museum is located on a former part of the ORC mainline, the oldest line in Turkey, near the village Çamlık, very close to the historical site at Ephesus. When the tracks on the Izmir-to-Aydın main line were realigned, a small portion of the line, as well as the original Çamlık railway station, were abandoned. The museum was started in 1991, and completed in 1997. It uses the original tracks built in 1866.
While the land, the buildings and the collection are all the property of the Turkish State Railways (TCDD), the museum is run by Atilla Mısırlıoğlu on a 99-year lease. He is the son of the first signalman serving at the Çamlık railway station.
Museum
In the museum, there are 33 steam locomotives displayed outside, half of them arrayed around an 18-road turntable. The manufacturing years of the locomotives range from 1891 to 1951. The oldest one is built by British Stephenson. The steam engines on display were made by: Henschel (8), Maffei (2), Borsig (1), BMAG (2), MBA (1), Krupp (3), Humboldt (1) from Germany; NOHAB (2) from Sweden; ČKD (1) from Czechoslovakia; Stephenson (2), North British (1), Beyer Peacock (1) from the UK; Lima Locomotive Works (1), ALCO (1), Vulcan Iron Works (1) from the USA; and Creusot (1), Batignolles (1), Corpet-Louvet (2) from France. Visitors may climb up into the engines. The locomotives are provided with plaques giving information about technical details.
The steam locomotive number 45501, which was involved in the Yarımburgaz train disaster as part of the Simplon-Orient_Express, is exhibited in the museum. The head-on collision in 1957, with its death toll of 95, is the deadliest train accident in Turkey as of 2010.
The museum offers nine passenger cars including two wooden cars. The salon car used by Mustafa Kemal Atatürk (1881-1938) can be visited inside. There are also seven freight cars on display. In addition to various rolling stock,there are many railway and rail station utilities at the facility such as a water tower, road turntable, hand lorry and crane.
See also
History of rail transport in Turkey
TCDD Open Air Steam Locomotive Museum in Ankara
Istanbul Railway Museum
Atatürk's Residence and Railway Museum in Ankara
References
External links
Image gallery of the museum items at Trains of Turkey website
Image gallery of the museum items at International Steam website
Railway museums in Turkey
Museums in İzmir Province
Museums established in 1997
1997 establishments in Turkey
Selçuk District
Open-air museums in Turkey | Khan Noonien Singh five-part series of comic books telling the story of the "Into Darkness" incarnation of Khan. The first issue in the series acknowledges the discrepancy of Khan's physical appearance compared to that of the previous incarnation. In keeping with the prime timeline's backstory, Khan's beginnings, rise to power, and involvement in the Eugenics War are depicted. It is also revealed his birth name was Noonien Singh and that he adopted the title "Khan" out of admiration for Genghis Khan. The series goes on to mention that Khan's anatomy and memories were altered per Marcus's orders, so that Khan would initially believe | 18 What can be said to have been the positive aspects of the Mongol conquests? | Dinçkök (Kurmanji: Gede) is a Yazidi village located in the Viranşehir district of the Şanlıurfa Province in southeastern Turkey. The village is located ca. east of Viranşehir in southeastern Anatolia.
References
Villages in Şanlıurfa Province
Yazidi villages in Turkey | france teriminin Türkçe sözlük anlamı, france nedir, france Türkçesi ve diğer anlamları
france Türkçe | Ali Khan Bayat was the fourth khan of the Maku Khanate from 1822 to 1866.
References
People from Maku, Iran
Maku Khanate
19th-century monarchs of Persia
Year of birth unknown
Year of death unknown | Khandi Alexander ( born 4 September 1957 ) is an American dancer , choreographer , and movie and television actress . | Türkiye'ye gelince, insanların çoğunluğunun Erdoğan'dan nefret ettiklerini fark ettim. Neden? | 1,999,832 | Jag kan inte närvara nu på söndag, så en vikarie för Uzbek eftersöks.
Kvalifikationer som krävs: tycker om hästar och mamluker.
Heter Ponzai på steam. | Jag försvarar omskärelse - Fråga vad du vill i P3 | Vet någon vart jag kan hitta en Labbrock av Howie typ i Sverige? | Kunde ni vara snälla och lyssna på mitt svenskt uttal? | Jag jagar sponsring av LAN för en grundskola. Är folk intresserade av att veta statistik gällande vilka företag som ställer upp? | När förskola och skola styrs av valfrihet och vinstintresse, hur ska jag som "konsument" bete mig? Vad händer om jag inte kan/vill bete mig så? | V, MP, S och C kan tillsammans styra migrationspolitiken. M, SD, KD och L är nära en liknande situation. Tankar? | Hej /r/sweden! Min kollega och jag skriver en uppsats om nikotinpåsar. Nu behöver vi deltagare till vår enkät! | [Seriöst] folk rastar sina hundar och tar en paus på mina föräldrars tomt. Vad kan vi göra? |
1,999,833 | what is the occupation of john ross in ronald james marsh | Reginald Marsh (actor) "The Plane Makers" (1963–64). He also appeared in "The Stone Tape" (1972), "Emmerdale Farm" (1973), "Crown Court" (1973–74), "QB VII" (1974), "Bless This House" (1974), "The Sweeney" (1975) and "The Duchess of Duke Street" (1976). In 1975, Marsh played Andrew, Jerry's boss and Managing Director of JJM, in three episodes of the first series of "The Good Life". He would later feature in one episode in the second series and the final episodes of the fourth series in 1977. Marsh played a similar role in "George and Mildred" from 1976 to 1979, as Humphrey Pumphrey, Mildred's brother-in-law. From 1979 to | Jimmie Walker James Carter Walker Jr. (born June 25, 1947) is an American actor and comedian. Walker is best known for portraying James Evans Jr. ("J.J."), the oldest son of Florida and James Evans Sr. on the CBS television series "Good Times", which ran from 1974 to 1979. Walker was nominated for Golden Globe awards "Best Supporting Actor In A Television Series" in 1975 and 1976 for his role. While on the show, Walker's character was known for the catchphrase ""Dy-no-mite!"" which he also used in his mid–1970s TV commercial for a Panasonic line of cassette and 8-track tape players. | J. W. McLeod was born in Dumbarton on 2 January 1887. His father, John, an architect, belonged to a family whose occupations ranged through law, medicine, the civil service, industry and commerce, conducted mainly in the south of Scotland. John McLeod had built up a successful practice, and at the time of his marriage in 1884 had just completed the new Glasgow synagogue— a surprising commission for a Presbyterian. He was then aged forty-five and his bride, Lilias Symington McClymont, who was twenty-one years his junior, was the daughter of what was then described as a gentleman farmer in Borgue, Kirkcudbrightshire. Less than four years later John died of diabetes, leaving his widow with two sons, Norman and James. Norman was to work for many years on irrigation schemes in India, and later to become a technical adviser to the World Bank. Four months after her husband’s death, Mrs McLeod bore a third son who was named John, after his father. He was to train as a lawyer and to make his career in banking. | Elizabeth Bowen and Henry James | John Wesley Brandes (born April 2, 1964 in Fort Riley, Kansas) is a former American football tight end and long snapper in the National Football League for the Indianapolis Colts, Washington Redskins, New York Giants, and the San Francisco 49ers. He played college football at Cameron University.
1964 births
Living people
American football tight ends
Indianapolis Colts players
Washington Redskins players
New York Giants players
San Francisco 49ers players
Cameron Aggies football players
People from Fort Riley, Kansas
National Football League replacement players | John Marsh (composer) music making in the towns and cities where he worked, especially in Chichester, where he led the subscription concerts for some 35 years. Marsh was perhaps the most prolific English composer of his time. His own catalog of compositions records over 350 works, of which he lists 39 symphonies. Of these, only the nine that Marsh had printed are extant, together with three one-movement finales. Marsh was a man of varied interests, and his 37 volumes of journals are among the most valuable sources of information on life and music in 18th-century England. They represent one of the most important | William L. Adams may refer to:
William L. Adams (pioneer) (1821–1906), American writer, newspaper editor, and doctor from Oregon
William L. Adams (businessman) (1914–2011), Baltimore businessman and venture capitalist | John Alexander was an Australian politician.
He was a merchant who ran a firm in partnership with John Gilchrist and later with John Watt. He served in the New South Wales Legislative Council from 1856 to 1861. By the time he left the Council he was a squatter and acquired extensive pastoral land.
References
Year of birth unknown
Year of death missing
Members of the New South Wales Legislative Council | 1,999,833 | Sinner" starring: Patricia Kirkwood - Irene James Jack Watling - John Ross Joy Shelton - Vera Lamb Sydney Tafler - Jimmy Smart Thora Hird - Mrs. James The story is that of John Ross, a bank clerk, who is in love with Irene James for whom he will do anything, including stooping to crime. Irene cannot give up her criminal former boyfriend, Jimmy Smart, while John realises, too late, that he should have remained with his former fiancée. The story ultimately ends in the tragedy so often associated with obsessive love. Ronald Marsh's other novels include: Ronald James Marsh Ronald | what disease does john hartigan have in sin city | who is the killer in the affairs of jimmy valentine | where do they go in the movie where sinners meet | who is judith's mother in temptation confessions of a marriage counselor | what is the name of the album born sinner | who dies in the movie temptation confessions of a marriage counselor | who dies in the garden of sinners movie | who played bass on jimmy page's scarlet |
1,999,834 | LibGuides. Copyright © UNBC. Fair Dealing. | A starting point for copyright information, this LibGuide provides links to copyright & fair use resources. | An introduction to copyright and fair use. How to find Creative Commons licensed content and other alternatives | Compiled by Beth Bloom. This guide covers aspects of Copyright law that pertain to the academic community. It is based on a guide developed by Ingrid Redman at NYU. | Selected Resources on Copyright Law | Des Moines University's copyright policy, procedures for documenting fair use, and other helpful resources | Des Moines University's copyright policy, procedures for documenting fair use, and other helpful resources | Des Moines University's copyright policy, procedures for documenting fair use, and other helpful resources | What are the four Fair Use factors of the copyright law? | 1,999,834 | Copyright information for faculty, staff and students of the University of Northern British Columbia | LibGuides. Copyright Guidelines for Faculty. Fair Use. | University Library: Copyright: Students - study and research: Infringement of copyright | DMU Library: Copyright at DMU: Copyright Friendly Resources | DMU Library: Copyright at DMU: Copyright Law | Abstract Although widely adopted at university and college libraries in the United States, Electronic Reserve services in Canada have developed at a much slower pace. Based on the results of an extended pilot project for Electronic Reserves at a medium-sized university library in Canada, the author concludes that the most significant barrier to this development is the restrictive nature of copyright law in Canada. Results of an informal survey of university libraries in Canada seem to confirm this assumption. A brief overview of copyright law in Canada as it pertains to Electronic Reserves is discussed, as is the process of copyright reform recently undertaken by the Canadian government. Finally, an argument in favor of a broadened interpretation of ‘fair dealing’ (the Canadian version of ‘fair use’) is made as it may pertain to the development of Electronic Reserves services in Canadian academic libraries. | DMU Library: Copyright at DMU: Helpful Resources | Accessibility of British Columbia’s Post Secondary Library Web Sites, Catalogues and Databases : A Preliminary Report | LibGuides. Copyright Information for ResU Personnel. Public Domain & Creative Commons. |
1,999,835 | Anyone else feeling alone in music? | I do like the music, but I find it much more immersive with the music turned off. Anyone else do this? | Right now, the weather here in Boston is cloudy and rainy, and I just feel like listening to sad love songs, because I'm also too deep into studying chemistry and calculus... and also remembering the emotional rollercoaster of last month. Have you ever felt the same? Have you ever linked certain songs to the weather or life situations?
Right now I'm listening to: MYRNE - Confessions
and Dreamcatcher - Fly High | As my anxiety got worse over the years, I found that my experiences with music have gotten stronger.
When I listen to slow/sad/depressing songs I tend to turn the volume all the way up and immerse myself in the music, blocking out the rest of the world. I have such strong emotions that I can feel them with every fiber of my body to the point I start breathing heavily and almost begin to cry. A few times I even did end up crying.
And I don't know why but when I listen to more upbeat music I find it to be very superficial and boring so I gravitate towards the emotional songs.
I had read a while back that people with anxiety tend to have that stronger connection to music so I was wondering if anyone else had similar experiences?
(sorry for the long post!) | Whenever it's cold, I can't stand listening to loud music. It's not because I feel colder, but I sense a "sharpness" in music that I can't stand. What other strange things do you feel? | This song transports me... it makes me feel like I'm alone, but not in the lonely sense, more in the surreal sense where I'm by myself, falling into a vortex, to contemplate my existence | For me, when I feel overwhelmed and need to calm down, I listen to heavy metal or metal rap such as Metallica, Nonstop, Scarlxrd and Denzel Curry. I think the loud drums and bass and loud screaming help to let out the frustration or anger I feel during that time | I'm just happy that music exists. My life would be nothing without it.
I'm going through a pretty rough time irl with some personal stuff but writing music has seriously helped me. | After watching Joel critique so many songs, anyone else listen to music now and go that's not mixed correctly, things sound off etc?
I find myself hearing music differently now #RoomieEffect. | 1,999,835 | Just wondering if anyone else feels alone in doing music. I’ve been working at it for months and for a long time now it’s all been off my own support and energy because no one else cares for what I enjoy doing. | Why do you think we enjoy music? | Why did you get into music? | What are your thoughts on playing music you love to friends and or family? | Why am I never satisfied with my music? | Just Curious Does anyone on this sub actually make a living off of music production ? | Does anyone else have experience with no motivation ?? | I struggle with songwriting solo | What's Your End Goal With Music Production? |
1,999,836 | The Best Writing Products are always Pilot Pencils & Pens!!! | Buy these if you want something clever to show off but not actually write with. The pens break easy and hardly write. | I'm ridiculously obsessive about what I write with. Not sure why. Just curious what pens, markers, and such that you all liked to use in the lab. I'm looking for something that I can use on everything: glass, plastic, paper (without bleed through). Found the Pilot Multiball which is supposed to write on all of the above plus more. Might give it a shot. | i like to note everything but don't like too write with every pen those are really soft and easy to write... | I have loved these pens since the first time I wrote with them. Every time some one uses my pen they have to check out what brand it is so they can buy one too! | I know this sounds silly, but I've never had very good handwriting, and at the moment my handwriting is the same as a 3rd grader, messy, sloppy, and uneven (I think I may have even had better handwriting as a third grader). I really want to have legible handwriting and I don't know any real effective ways to improve it. I've tried those writing sheets that you get in elementary, but that didn't work. Having beautiful handwriting that you see, in subs like oddly satisfying, is my goal.
Thanks all! | I wouldnt write a lot of words with these like I would a Sharpie Pen. But there's so many colors and the ink lasts a long time! Great for organizing notes and making flowcharts | I use these for writing, they are one of my favorite pencils. | Very inexpensive pens and they write nice and smooth. It seems as the more you use it the nicer it starts to write. | 1,999,836 | Pilot has always been my pen & pencil of 1st choice! From my University of Baltimore days as a young Accounting B.S. student to a retired Director of 3 Profitable Corporations. My beginning was when I could barely afford Bic Stics, I was in a wheelchair from childhood polio, from rushing to classes, my hands were sweaty with my hands shaky/sweaty/sore my grip would just slide straight down the pen. Fortunately, a sweet girl who's father was a banker gave me a pilot stick pen & pencil with the ribbed bottom on the hard plastic. AMAZING!!! It made my notes faster, more thorough, legible and easy to recall what the Professors were trying to get across to us rushing under a full 18 Credits + extra credit work. Also, that was when C.L.E.P.(Short for College Level Examination Program; it used to be featured with Abe Lincoln sitting for a job interview & in response to a question on College Degree Attained, he responds "Well, I've done a lot of reading, sort of 'on my own'!"), One 8 hour exam picking the "least stupid sounding selections bet. A,B,C & D" netted me 27College Credits, getting my B.S. in Acctg in 22mos. 126 Credits 3.97G.P.A..Be Smart Buy Pilot! | My favorite pen for a while now has been the Pilot ... | Great Penmanship Program | Pilot has amazing pens. Pilot Juice are not sold at Staples ... | College students/People who have to take lots of notes: I'm curious what your notes look like! | but overall a very nice pen. If you're familiar with the Pilot Metropolitan | Take my pen away before the class test? Yeah riiight.. | Pens last about 3 lectures for me, what's the deal? | Using one of those professional student lines of credit - to invest |
1,999,837 | Book four of a five book series | I did not know this was a series of 4. It was interesting enough that I read all four books. Having said that, it is really a YA book and I would recommend it for that group. My taste are more sophisticated however but the series was cute. | What is a four series in literature called? | An incredible series...I'm into Book #5 and cannot say enough good about the other 4!! Definitely one of the best "reads" of this summer... | What is the fourth book of the left behind series? | The 4th book in the series, can't wait till the 5th in October. I've very much enjoyed reading these books and this author' | I have rated all four books in this series with five stars. Terrific story, great characters, extremely well written, don't miss! | Having not read the previous four books in the series, I was a little lost during parts of the book and some things were not explained well BUT this was a great book. Even having not read the previous four in the series, I was able to enjoy the story line and feel like I knew each of the characters. The writing was great and the book held my attention from the very beginning. After finishing this book, I am now in the midst of reading the previous four, from the beginning. I will definitely need to read more from this author.
I received a free copy of this story in exchange for an honest review. | I loved this book I love the series I'm on book 4 now can't wait till book 5 comes out | 1,999,837 | Book four of a five book series. The fifth book is to be released in November 2014. Supposedly the serieswill sadly end at that point.
The invasion by the Saliks is not going very well and Ia is here to help! Or, make things worse depending on your point of view. | The end o a 5 book series. | When will book 4 come out of the series nightmare academy? | I love this series and cannot wait until the 5th book | I LOVE this series and couldn't wait for book four | Will Season 5 ever be released to DVD/Blu-Ray/Netflix? Will there be a remaster of the original four seasons? | Great series! Can't wait to read book 4 and ... | Will there be a 5 book in the gallagher girls series? | when does the next series of asgard books come out |
1,999,838 | Is there an Uppers translation? | **übergeordnet** translates to **superior**
––––––––––––
Join our new subreddit for language learners @ /r/LearnANewLanguage | Not a authorized translation, which is mentioned in the forward. I don't recall seeing this in the description when deciding to make my purchase. I will use this as a reference work but am a bit disappointed. | No single translation is perfect, but this is one of the essential translations. This makes the edition suitable for symbologists. | State-of-the-art approaches to multi-source translation involve a multimodal-like process which applies an individual translation system to each source language. Then, the translations of the individual systems are combined to obtain a consensus output. We propose to use the (generalised) median string as the consensus output of the individual translation systems. Different approximations to the median string are studied as well as different approaches to improve the median string performance when dealing with natural language strings. The proposed approaches were evaluated on the Europarl corpus, achieving significant improvements in translation quality. | original translation with wording sometimes hard to understand. | What is the Croatian translation of 'Hello'? | From which language does the word or the phrase Encore comes? | What is the Hebrew translation for the word health? | 1,999,838 | I just picked up a copy of Uppers at a con and going to play it later. I don't have any japanese knowledge but I figure it will be worth the cost if I can just try it for a bit. Does anyone have some translations for the menu, or can point me to a video with them? I can figure out the fighting controls through button mashing, but it would be a downer if I accidently kept deleting my save files. | Changing Japanese Wii Menu to English? | Some more translation peculiarities from the German version of Smash 4! | To those who have played the Japanese version: Post your tips here! | Kindly help translate a menu item? | UPDATE: I created a handy (free) menu bar translator widget for MacOS! | We (Crazy Moo) Need your help! We need our game translated into YOUR languge | HELP!!! to find ways to translate a japanese deck | Does anyone know where to find ultimate muscle (Kinnikuman Nisei) with English subs? |
1,999,839 | according to james george frazer, magic was initially separate from what | Aleister Crowley framework. Unlike Frazer, however, Crowley did not see magic as a survival from the past that required eradication, but rather he believed that magic had to be adapted to suit the new age of science. In Crowley's alternative schema, old systems of "magic" had to decline (per Frazer's framework) so that science and magic could synthesize into "magick", which would simultaneously accept the existence of the supernatural and an experimental method. Crowley deliberately adopted an exceptionally broad definition of magick that included almost all forms of technology as magick, adopting an instrumentalist interpretation of magic, science, and technology. Sexuality played | ...spill his blood to create magic in FoL?
My thinking on this (and I'm not sure whether this is confirmed or rejected in previous books (I'm on my first read) or whether it is dealt with in the second half of FoL) is that K'rul recognized that the inevitable destruction of civilization, and degradation of the environment, is precipitated by technology and innovation. It removes people further from small tribes, permits widespread expansion, and the use and abuse of natural resources.
Magic being introduced takes away that need. It is, after all, why so many fantasy worlds are kept in the Middle Ages. You don't need to develop industry when magic users can heal any wound or create/develop luxuries. If society is reorganized (for all races) in this way, it at least removes much of the impetus for growth and development that previously existed, and therefore slows civilization and its growth down.
Now this was fucked up in Lether. The magic was too blunt for the fine use managed in other parts of the world. And so while it still surely had some uses, it did not stop them from their capitalistic expansion and obsession over profit and development. Lether was the one part of the world that K'rul could not help. And, of course, Lether was where The Errant made his home.
Is this trivially true, trivially false, or instead a plausible interpretation of K'rul's motives? | Magic (illusion) cutting a head off, and then "restore" it, make something appear to move from one place to another, or they may escape from a restraining device. Other illusions include making something appear to defy gravity, making a solid object appear to pass through another object, or appearing to predict the choice of a spectator. Many magic routines use combinations of effects. One of the earliest books on the subject is Gantziony's work of 1489, "Natural and Unnatural Magic", which describes and explains old-time tricks. In 1584, Englishman Reginald Scot published "The Discoverie of Witchcraft", part of which was devoted to | So tell me about your magic system. Where does magic come from, how is it learned? Is it hereditary? What makes your system unique? | Scott Meyer (author) the website. "Magic 2.0" is a comic fantasy series of books written by Scott Meyer. The series so far consists of five novels, “Off to Be the Wizard”, “Spell or High Water”, “An Unwelcome Quest”, “Fight and Flight”, and “Out of Spite, Out of Mind” which were published by publisher 47North. The series follows Martin Banks, a programmer from 2012, who uses a computer file that allows him to alter reality to time travel to medieval England where he joins a community of other computer programmers posing as wizards. The first 4 books are also available as unabridged audiobooks on | I apologise if this is already common knowledge, but was thinking about how "lumos", bringing light to a wizard/witch's wand, derives from luminosity. Were spells like this, with obvious significance to the English language, created by the wizard img community? Or were the words magically 'coded' into certain words? | Witchfinder General (film) Brandeston, Suffolk, to visit his lover Sara (Hilary Dwyer). Sara is the niece of the village priest, John Lowes (Rupert Davies). Lowes gives his permission to Marshall to marry Sara, telling him there is trouble coming to the village and he wants Sara far away before it arrives. Marshall asks Sara why the old man is frightened. She tells him they have been threatened and become outcasts in their own village. Marshall vows to Sara, "rest easy and no-one shall harm you. I put my oath to that." At the end of his army leave, Marshall rides back to join | Who originally sang magic? | 1,999,839 | James George Frazer earlier anthropological descriptions of cultural evolution, including that of Auguste Comte, because he claimed magic was both initially separate from religion and invariably preceded religion. He also defined magic separately from belief in the supernatural and superstition, presenting an ultimately ambivalent view of its place in culture. Frazer believed that magic and science were similar because both shared an emphasis on experimentation and practicality; indeed, his emphasis on this relationship is so broad that almost any disproven scientific hypothesis technically constitutes magic under his system. In contrast to both magic and science, Frazer defined religion in terms of belief in | which austrian psychologist is associated with the emotionalist view of magic | what did freud believe led primitive men to create magic | What are the differences between religion and magic? | what did aleister crowley call science and magic | Recent discoveries indicate the existence of man, at least of some animal given to chipping stones, for hundreds of thousands of years upon this earth. This almost infinite extension of the course of human events into the so-called prehistoric ages makes the recorded past so insignificant a fraction of the whole, that it must not be wondered at if now and again a historian slips his leash and wanders out into the open fields of anthropological sociology, where time and space are at his free disposal, and all the phenomena of life from anthropoidal apes to the latest prodigy in one of our colleges find a den or a home. Such excursions are not without a certain danger for the mere student of history, but the spirit of adventure is not entirely dead, even among those whose lives are spent in the ascetic disciplines of that monkish subject.It is frankly in the spirit of adventure that I make bold tonight to take up before you what I suppose is the largest subject in human history-magic. It was the science and religion combined, much of the art, and most of the mode of thinking of our race for those vast stretches of centuries that we so lightly term the prehistoric. It is still the most important basis of actionl and of belief for millions of human beings, and has, as I hope to show, penetrated European history in such vital ways as to modify the structure of both church and state, dominate a large part of the philosophy, and affect the progress of science. Clothed in other forms it has enshrined itself in the most sacred association of many a person here present.It is incredible that so vital a subject should have so long escaped satisfactory treatment. But the incredible is true. For there is not an exhaustive description or analysis of magic-78I satisfactory synthesis which will explain the phenomena and the r6le of magic. Meanwhile, however, we are supplied with some provisional treatments, which we may regard as working hypotheses, and it is to these, not as final results, but as possible interpretations, that I wish to direct your attention tonight.Let us take first that great compilation from which most English readers derive their ideas of comparative religion, The Golden Bough by J. G. Frazer. According to Frazer,* magic is the opposite of religion. It is a rude and mistaken science, in which man began his struggle with the mysterious forces of the world. By spell and by charm he met those dangerous powers whose presence he saw revealed in the multifold crises of his life: in sickness and death, in the chances of the hunt or the perils of war, in birth, in sexual relations, in the terror of spilt blood, in the gloom of the night, in the march of the storm, in all the terrible and the wonderful in his miracle-wrought universe. Such as he was, Frazer thinks, this brute man of the eoliths, whether of the prehistoric past or of Australia today, turned his dawning consciousness upon the problem of a direct struggle with the elements. No god was invoked in that chatter- | Science substitute for magic | Magic Mystery And Science The Occult In Western Civilization | what is the name for a magical entity who is a force of nature |
1,999,840 | Do automatics need new brakes more often than standart transmission? | I read somewhere else that engine braking will unnecessarily wear the clutch. To what extent is that true? I think the quote was something like "new brake pads are a whole lot cheaper than a new clutch."
Say you're approaching a red light at 50mph in 4th gear. Do you downshift to 3rd and then 2nd riding out each gear before you come to a stop? Or do you hold the clutch and use your brakes the whole way while downshifting without engaging the gears on the way down?
I tend to engine brake to pretty much every stop, but since seeing the warning, I've cut back on it. What are your opinions on how often / when you should use engine braking?
Thanks. | How often should you change your brakes on a honda accord? | Brakes are requiring a long time to break in. Stock harley brakes are better. | What tools need for brakes? | So it seems that I see more and more single speed riders in my city who do not have any brakes. I wonder if any of you do this as well. If so, what is the advantage? I am frightened at the idea of having to brake "flintstones" style... | I'm trying to hook up the electrical wiring of a large linear actuator (only pushes horizontal loads), and the wiring diagram says there is an optional brake resistor that I can hook up for certain applications (though it doesn't say when). The example the manual gives is for a vertical load, but mine is a horizontal load. An excerpt of the manual on brake resistors is given here:
My question is when would a brake resistor be necessary, and in general, when would I not need it? I've used actuators that don't require a brake resistor but they're typically smaller so I'm not too familiar with this aspect. Hope you guys can help me out! | No, almost every vehicle model has a different shape of brake pad. The friction materials that are on the pad are different because almost every vehicle has different requirements and performance capabilities. | It probably sounds stupid but I bought a older road bike and the brakes suck. Instead of taking it to a mechanic I would prefer to learn it myself for future situations. So would changing my brakes be any different to bikes of today brake changes. I only ask that because I’ve been watching videos but all of bikes on those videos are new. Does that make any difference? | 1,999,840 | So I have never driven a torque converter automatic and only like twice a DSG transmission. I'm used to engine braking and have heard a few times already that true automatics need new brakes more frequently than manual transmissions since they don't use engine braking like manuals. So is it true or did I here wrong? | Is torque converter usually replaced with auto transmission? | Is automatic transmission really worth it? | what percentage of cars in western europe had automatic transmission | Is automatic or manual shifting faster? | Why the preference for automatic transmission cars in the USA existed for decades? | Car enthusiast, assuming you hit all perfect shifts (manual car), is it possible to beat the automatic version of your car? | Any way to check if an automatic transmission is good before install? | As the braking device of the aircraft electromechanical actuation system, the brake is a vital link in the aircraft attitude change or function adjustment. Among them, the permanent magnet brake has attracted extensive attention in the field of aerospace technology because of its advantages of low energy consumption and high reliability. At present, the domestic permanent magnet brake is heavy and the braking torque density is generally low, which limits its further development in the field of aerospace. In order to improve the braking torque density of permanent magnet brake, this paper proposes a research method of high torque density permanent magnet brake is proposed. By establishing the magnetic circuit structure of the permanent magnet brake, the relationship between the external characteristics of the permanent magnet brake and the design parameters is determined, and then the performance parameters of the permanent magnet brake are simulated and verified by using the finite element simulation software. Finally, through the physical test, the results show that this method can effectively improve the braking torque density. |
1,999,841 | How did the voyage of Columbus lead to global exchanges of goods and ideas? | What were the effects of columbus voyage? | Why did spain payed chrisopher columbus voyage to the new world? | What was christopher's columbus contributions? | When did Christopher Columbus go on this voyage? | When did Christopher Columbus come to new world? | How did the meeting of christopher columbus change the world? | Columbus took enough supplies on his first voyage to last approximately plus? | Why did Spain pay for Christopher Columbus' voyage to the new world? | 1,999,841 | How did voyages of columbus lead to global exchange of goods and ideas? | Why was columbus's exploration important? | Columbus's last voyage. | Why did columbus come the new world? | which continent did christopher columbus believe could be reached by sailing west across the | What did christopher columbus discovery benefit? | Malfeasance and the Foundations for Global Trade: The Structure of English Trade in the East Indies, 1601-1833 | Columbus took enough supplies on his first voyage to last apporximately? | Why did the transatlantic trade take place? |
1,999,842 | The Research on the Aerolion Dust Deposition Monitoring | Dust indicators based on light scattering photometers are widely used to measure aerosol concentrations in work environments. These concentrations at workplaces in Japan are measured by these dust indicators and calibrated by mass concentration in order to control workers' exposure to dust. The mass concentration in a specific point in a workplace is measured simultaneously with a dust indicator. The mass concentration of the respirable fraction of dust particles should be determined by the gravimetric method with low volume air samplers or other devices, but some dust indicators are not equipped with a size separator for respirable fraction, and we used to get unstable results at the calibration. In this study, we designed miniature cyclones for a dust indicator and evaluated their performances of respirable fraction and PM2.5 fraction. | Development of a Sampler for Total Aerosol Deposition in the Human Respiratory Tract | LIDAR OBSERVATION OF JET ENGINE EXHAUST FOR AIR QUALITY | Emission of industrial atmospheric particles containing heavy metals should be monitored continuously in order to reduce impact on the neighboring population. A laboratory prototype of the monitoring system based on advanced chemical sensors has been developed and is presented. | Comparative Analysis of Monitoring Devices for Particulate Content in Exhaust Gases |
Introduction
Dust storms are serious natural hazards that are driven by strong winds from the ground and reduce horizontal visibility to less than 1 km, which usually occur in arid and semi-arid areas. Intense dust storms, especially black storms, with strong winds and horizontal maximum visibility of less than 2 m, are extremely destructive environmental disasters. Due to their suddenness, short duration, and high intensity, dust storms often cause serious harm in a short time. They bring a colossal amount of dust aerosols to the atmosphere, which can significantly deteriorate air quality and photosynthetic activity (Korotaeva et al., 2018;Kaskaoutis et al., 2019) by increasing the particulate concentrations at levels that potentially increase atmospheric turbidity, causing the extinction of solar and atmospheric radiation via scattering and absorption (Kaskaoutis et al., 2006;Garcia-Pando et al., 2014;Maghrabi & Al-Dosari, 2016;Kaskaoutis et al., 2019). In addition, the wind erosion of dust storms aggravates desertification, seriously affecting the ecosystem and human health Li et al., 2020).
Dust aerosols, derived mainly from dust storms, are one of the important components of the atmospheric system. They can not only change cloud albedo or life cycle by acting as cloud condensation or ice nuclei Nguyen et al., 2019;Yan & Wang, 2020) but also disrupt radiation budget by directly scattering and absorbing solar radiation, reducing the amount of solar radiation gained by the ground and lower atmosphere, before modifying the near-surface temperature (Ge et al., 2010;Gao et al., 2015;Samset et al., 2018;Wang et al., 2018;2019;2020;Zhou et al., 2022a;2022b). In addition, dust aerosols can stimulate abnormal water cycle feedback and change precipitation distribution (Lau et al., 2017;Zhao et al., 2020). Dust also reduces visibility (Watson, 2002), exacerbates air quality (Salvador et al., 2019), and affects atmospheric circulation by changing atmospheric heating in the middle and upper troposphere (Alizadeh-Choobari et al., 2014). Overall, dust has adverse effects on human health and climate change at regional and even global scales (Huang et al., 2014;Zhao et al., 2018;Liu et al., 2021). Therefore, systematic studies on the characteristics and radiation effects of dust aerosols during intense dust storms are necessary to develop strategies for mitigating the impacts of dust storms on radiation balance, ecosystems, and human health (Middleton, 2017;Middleton & Kang, 2017).
For dust storms, numerous studies have focused on examining dust source regions, weather background, spatial-temporal distribution, and characteristics and irradiation effect of dust aerosols Ashpole and Washington, 2013;Qi et al., 2013;Saeed et al., 2014;Kedia et al., 2018;Filonchyk et al., 2019;Kaskaoutis et al., 2019;Nguyen et al., 2019;Gao et al., 2022;Qin et al., 2022;Zhang et al., 2022). Most of these studies have been performed based on ground observation and satellite remote sensing data (Gehlot et al., 2015;Maghrabi & Al-Dosari, 2016;Maghrabi, 2017;Tian et al., 2018;Bi et al., 2022). Nonetheless, the uneven distribution and the limited number of ground monitoring stations cannot obtain continuous spatial coverage information. Moreover, it is difficult to effectively reflect the spatial and temporal evolution characteristics of related factors (Kaufman et al., 1997;. Satellite remote-sensing observation covers a wide area, with the advantages of macroscopic, economic, and long-term dynamic monitoring, which can compensate for the limitations of ground monitoring stations in spatial distribution . However, satellite remote-sensing inversion remains a difficult problem for the Xinjiang region with its vast territory, complex underlying surface, multi-mountain snow, desert, and other bright background regions. For instance, a large area with missing data makes it difficult for satellite remote-sensing data to completely reflect the occurrence, development, transport characteristics, and climate effects of dust aerosols (Wang et al., 2010). Particularly, the absence of observation data limits the operation simulation of meteorological/environmental models, which ultimately leads to the rarely quantitative effect evaluation of dust storm transport on environmental factors such as temperature and humidity in the downstream area .
Numerical simulation technology considering dust processes is an important tool for studying dust emission, transport, deposition, and interactions with meteorological factors (Sugimoto et al., 2013;McClintock et al., 2019); however, not all numerical models meet our research needs. Mahowald et al. (2010) showed that the Community Climate System Model (CCSM) could not capture dust changes in five research regions (Australia, North Africa, North America, South America, and Middle East/Central Asia) in the 1920s. Because the dust size distribution was biased toward small particles in CMIP5 models, Evan et al. (2014) and Wu et al. (2018) found that the CMIP5 climate model could not reproduce the basic aspects of dust emission and transport over the second half of the 20th century over North Africa and the decrease of dust event occurrence over East Asia between 1961 and 2005. Moreover, the common dust prediction models, including Community Multi-scale Air Quality (CMAQ) and Weather Research and Forecasting-Dust (WRF-Dust), were used for unidirectional coupling sand; the lifting scheme with mesoscale weather model is unsuitable for simulating the long-distance transport process of dust and cannot analyze the feedback of the radiation effect of dust aerosol on the meteorological field and the effect of climate change (Su et al., 2022). In contrast, the regional climate models (RegCMs), developed by the National Center for Atmospheric Research (NCAR) since 1989 (Dickinson et al., 1989) and improved by the International Center for Theoretical Physics (ICTP, Trieste, Italy) (Giorgi & Mearns, 1999), have higher spatial resolution and provide additional details about regional physical processes. This consequently improves the capacity to simulate mesoscale events (Frei et al., 2003). They can not only present spatial and temporal distribution characteristics of dust aerosol, temperature, humidity, radiation, and other environmental meteorological elements but also be used to analyze the interaction and effect mechanism among various elements. The RegCMs have compensated for the shortcomings of existing research methods (Tummon et al., 2010;Yan et al., 2011;Nabat et al., 2012;Solmon et al., 2012) and have been widely used to study climate change and prediction, water cycle, and radiation budget (Pu et al., 2017;Xie et al., 2019).
In the spring of 2015, a black storm with extremely high-speed wind, high intensity of dust aerosols, and a large area of influence was observed in Xinjiang, China. The air quality index (AQI) in Urumqi, the capital city of Xinjiang, reached the "hazardous level" based on the U.S. EPA (2016) for several hours on April 27, and its air quality ranked last among 607 cities in China. It was not only the Frontiers in Environmental Science frontiersin.org first dusty weather since 2015 but also the first strong dust episode observed after more than 30 years in Xinjiang. Therefore, this study presents the pollution situation, weather background, and backward trajectory during the black storm process based on the regional climate model RegCM version 4.6 (RegCM 4.6) and the Hybrid Single-Particle Lagrangian Integrated Trajectory (HYSPLIT) model, combined with MODIS satellite retrieval, meteorological, and environmental observational data. We analyzed the temporal-spatial distribution of dust aerosols, radiation effect, and temperature response under this extreme weather condition. We aimed toward providing a scientific basis for further understanding of the occurrence and development mechanism of extra-strong sandstorms; quantitative assessment of the impact of dust aerosol on the meteorological and environmental elements in the involved areas; and improvement in pollution level with early warning, forecast, and prevention and control capabilities. This paper is structured as follows: the data, model, and methodology are introduced in Section 2. The results and discussion are presented in Section 3, followed by a conclusion in Section 4. 2 Data, model, and methodology
Data
The hourly AQI and particulate matter (PM 10 and PM 2.5 , which include particles less than 10 or 2.5 μm in diameter, respectively) concentrations in Urumqi ( Figure 1) were obtained from the Xinjiang Environmental Protection Department.
As for satellite data, the EOST/MODIS satellite data after projection for dust remote-sensing monitoring were processed by SMART software of China Satellite Meteorological Center. In addition, unlike the performance of MODIS AOD retrievals with the Dark Target (DT) algorithm, Tao et al. (2017) and found the Deep Blue (DB) AOD to be more suited for the arid and semi-arid areas with a bright background. Therefore, we extracted the Level 2 Collection 6 MODIS Aqua (MYD) and MODIS Terra (MOD) DB AOD product (550 nm) at 10-km spatial resolution with high quality (Quality Assurance = 2, 3) during April 25-29 in eastern Asia (18-54°N, 73-145°E). The daily average value of MOD and MYD AOD that averaged over the 50 × 50 km window size was used to analyze the transport path of the black storm and confirm the simulation results.
To further analyze the occurrence and development of this black storm, the circulation situation and influence system during the black storm were analyzed based on the synoptic principle and synoptic dynamics diagnosis and analysis method using the National Centers for Environmental Prediction (NCEP) 2.5°x 2.5°r eanalysis data every 6 h. Moreover, this study used the HYSPLIT model, combined with 1°x 1°meteorological field data from the NCEP Global Data Assimilation System (GDAS) to calculate the 48 h backward and forward transport trajectories of airflow over Urumqi at 19:00 on April 27. The track initiation point of the trajectory was Urumqi (43.46°N, 87.36°E), and the origin time was 19:00 on April 27 (Beijing time). The simulation was conducted for 48 h backward (20:00 on April 25 to 19:00 on April 27) and forward (19:00 on April 27 to 18:00 on April 29), with a time interval of 6 h. The height of the air mass trajectory was 100 m, 500 m, and 1,000 m, respectively.
Model
The RegCM 4.6 model description and evaluation
The simulation was conducted using the regional climate model RegCM 4.6, a sigma vertical coordinate model (18 layers), within the hydrostatic version of the 5th generation of the Mesoscale Model MM5 as the dynamical core, developed by the Abdus Salam International Centre for Theoretical Physics (ICTP). Unlike previous versions, RegCM 4.6 improved in describing physical processes, including new land schemes and additional Frontiers in Environmental Science frontiersin.org modifications of cumulus convection, radiative transfer, and planetary boundary layer schemes (Liu et al., 2021). In RegCM 4.6, the aerosol scheme included dust, sea salt, black/ anthropic carbon, and sulfate aerosols. It also included atmospheric wind advection, turbulent diffusion, vertical transport of deep convection, surface emission, dry and wet removal processes, and chemical conversion mechanism of gas and liquid phases Liu et al., 2021). The shortwave radiative transfer was calculated using the Community Climate Model (CCM3), which followed the δ-Eddington approximation stated by Kiehl et al. (1998). The dust shortwave radiative effect was calculated with extinction coefficient, asymmetry factor, and single-scattering albedo based on the Mie theory. Additional details about RegCM 4.6 have been described and documented by Giorgi (2011).
To evaluate the simulation results of RegCM 4.6, our research team conducted a validation study of RegCM 4.6 based on the surface observation data . In our previous validation study, the basic data used for validation were the daily averaged quality-assured (accuracy less than ±0.01) and cloudscreened Level 2 AOD data at the Dalanzadgad (43.58°N, 104.42°E) site (downloaded from the AErosol RObotic NETwork/ AERONET website: http://aeronet. gsfc.nasa.gov). Meanwhile, the fixed grid point from the RegCM simulation that was closest to Dalanzadgad was selected for validation. From the statistical information between the daily averaged model and AERONET AOD at Dalanzadgad station (as shown in Table 1), the linear correlation coefficient (R) was 0.23 and passed the 0.05 significance test. This indicates that the model AOD was significantly and linearly correlated with the observation. Data distribution was relatively concentrated with the root-mean-square error (RMSE) of 0.17. Generally, the model underestimated the AOD with the mean absolute error (MAE) of 0.11 and the relative mean bias (RMB) of 0.80 (Liu et al., 2021). Figure 2 shows the comparison of monthly mean AOD between AERONET observations (at 500 nm) and model simulation results at Dalanzadgad station. As shown, the average difference in monthly AOD between the two was −0.03. Although discrepancies can be found on individual times, the simulated AOD was in line with the observations. Specifically, the seasonal and interannual variations of AOD were well-captured at the site (Liu et al., 2021). According to the aforestated observations, the difference between the model and AERONET AOD may come from two aspects. One is that the AERONET AOD accounted for all types of aerosols; however, the model AOD only included dust aerosols. The other is that the AERONET AOD was obtained from sun/sky radiometers and only included daytime AOD. In addition, Su et al. (2022) showed that the RegCM 4 model simulated results of dust concentration and that dust optical depth was consistent with the observed distribution, which echoes our findings.
Model set up
The model domain in this study covered the whole eastern Asia region (−1°N~70°N, 5°E~175°E) with (40°N, 90°E) as the center ( Figure 3); the horizontal resolution was 50 km, and the top level was at 50 hPa. We adopted the National Center for Atmospheric Research (NCAR) Community Climate Model 3 (CCM3) (Kiehl et al., 1998) as the radiative transfer scheme; Emanuel (1991) was used as the cumulus convective scheme; Holtslag et al. (1990) was employed as the planetary boundary layer scheme. Relaxation, an exponential technique, was employed as the lateral boundary conditions scheme. The Zeng scheme was adopted as the ocean flux scheme; the Explicit moisture scheme was used for moisture; and the Use full fields scheme was used for pressure gradient acquisition. Moreover, the NOAA Optimum Interpolation Sea Surface Temperature (OISST) dataset and Global Multi-resolution Terrain Elevation Data (GMTED, Lambert projection) were used as sea surface temperature and terrain data, whereas the EIN15 dataset of the ECMWF (European Centre for Medium-Range Weather Forecasts) global reanalysis data was used to drive the initial field and side boundary field of RegCM 4.6.
The simulation ran between 1 March 2015 and 31 May 2015, where the first month was the initialization time, and the simulation results were the output every 3 h on average. We only analyzed the simulation results between April 25 and April 29 during the black storm. We designed two experimental schemes, of which the mode settings remain unchanged except for the aerosol module, i.e., 1) DUST scheme-open aerosol module based on the DUST04 scheme Note. The character "n" represents the number of samples, and the * indicates passing the 0.05 significance test.
FIGURE 2
Comparison of monthly mean AOD between AERONET observations (at 500 nm) and model simulation results at Dalanzadgad station (43.58°N, 104.42°E).
Frontiers in Environmental Science frontiersin.org and 2) NODUST scheme-closed aerosol module to simulate the situation without dust aerosols.
Methodology
The RegCM 4.6 simulated (RCM) AOD, net short-wave radiation at the top of the atmosphere (NSR TOA ), net short-wave radiation at the Earth's surface (NSR SUR ), net short-wave radiative forcing of dust aerosols at TOA and the Earth's surface (ADRF SUR , ADRF TOA ), and the TR SUR were selected as parameters for analysis. The calculation scheme of ADRF SUR , ADRF TOA , and TR SUR are as follows:
ADRF TOA NSR TOA Dust ( )− NSR TOA 0 ( ),(1)ADRF SUR NSR SUR Dust ( )− NSR SUR 0 ( ),(2)TR SUR T SUR Dust ( )− T SUR 0 ( ).( 3 )
NSR TOA (Dust), NSR SUR (Dust), and T SUR (Dust) represent the NSR TOA , NSR SUR , and temperature at 2 m near the ground when there are dust aerosols, respectively. NSR TOA (0), NSR SUR (0), and T SUR (0) represent the corresponding three parameters when there is no dust aerosol, respectively.
Results and discussion
Pollution status of this black storm episode
During April 26-29, 2015, a black storm with extremely highspeed wind, high intensity of dust aerosols, and a wide range of influence occurred in Xinjiang, China. In total, 57 of the 105 meteorological observation stations in Xinjiang had observed sand and dust weather of varying degrees; among them, sandstorms appeared in 16 stations. All the meteorological departments in Xinjiang had sounded 14 early warning signals. Specifically, the visibility of Moyu County and Yutian County in Hotan was zero. Figure 4 shows the temporal variation of the AQI and particulate mass concentrations in Urumqi during April 26-29, 2015. The period from 0:00 on April 26 to 06:00 on April 27 was slightly polluted, during which the AQI fluctuated slightly around 80-150, and the particulate mass concentrations showed a slow accumulation trend. At 07:00 on the 27th, with the emergence of the black storm, the AQI and particulate mass concentrations increased and reached their respective peaks at noon when the dust storm was the most serious, AQI = 500, PM 10 concentration = 1000 μg•m -3 , and PM 2.5 concentration = 628 μg•m -3 (upper limits of the instrument that detect AQI and PM 10 concentration are 500 and Simulation area and its terrain distribution (unit of altitude: m).
FIGURE 4
Temporal variation of the AQI and particulate mass concentrations in Urumqi during April 26-29, 2015. The black, red, and green lines represent the AQI, PM 10 concentration, and PM 2.5 concentration, respectively.
Frontiers in Environmental Science
frontiersin.org 1000 μg/m 3 respectively, and the corresponding value of the upper limit is displayed when the meter needle exceeds the upper limits). The air was still heavily polluted until 19:00 on the 27th, when all of the above indices were at high levels, with AQI >374, PM 10 concentration >478 μg•m -3 , and even gone off the charts for several hours. As shown in Figure 2, PM 2.5 concentration was also significantly higher than that without dust, but the increase was not as significant as that of PM 10 . After 20:00 on the 27th, as the dust weather weakened, the AQI and particulate mass concentrations decreased significantly, the air quality became good, and the pollution process appeared to end. In addition, the ratio of PM 2.5 to PM 10 had different performances at different stages. When there was no dust, the ratio of PM 2.5 to PM 10 in Urumqi was mostly concentrated at 0.25-0.40 (the average ratio in the 10 days before and after this dust storm was 0.34). However, when the black storm appeared, the ratio of PM 2.5 to PM 10 decreased to 0.11-0.15, with a large number of coarse dust particles in the atmosphere, making PM 10 the major pollutant. Figure 5 is the EOST/MODIS monitor of dust in the south region of Xinjiang at 13:13 on April 27(a) and 13:01 on April 29(b); the spatial resolution is 250 m. As shown, during the black storm process, a large area of dust appeared in the southern Xinjiang Basin, and the main dust body showed a transmission trend from east to west in southern Xinjiang from 27th to 29th.
Meanwhile, based on the meteorological observations, the dust first appeared in the western part of northern Xinjiang at 05:00 on April 27th. The extent of dust in northern Xinjiang expanded at 08: 00, with strong dust appearing along the Tianshan Mountains. At 17:00 on April 27th, a large range of strong dust appeared in the eastern part of the southern Xinjiang Basin, and at the same time, sandstorms or blowing sand were in eastern Xinjiang. In summary, the black storm started in the western part of northern Xinjiang; the dust moved eastward along the Tianshan Mountains and crossed into the eastern part of southern Xinjiang before moving east to eastern Xinjiang.
3.2 Weather background and airflow trajectory during this black storm episode Figure 6 shows the circulation situation of 500 hPa from April 26th to 29th, 2015. During the early stage of the process, the circulation situation of "two troughs and two ridges" was in Europe and Asia, upper westerly jet active ( Figure 6A). Western Siberia and Central Asia were active regions of the low-pressure trough, with dense contour lines and isotherms behind the trough and a large gradient. The temperature trough was behind the height trough, and the strong cold flat flow was transported to the trough after the low trough, with the low-pressure trough further developing. At this time, Xinjiang was controlled by the highpressure ridge. As the development of the upper European high ridge moved eastward, the eastward movement of the low trough intensified in Western Siberia and Central Asia. From 27th to 28th ( Figures 6B, C), the convergence of the low trough in the high and middle latitudes strengthened in the Balkhash Lake region, and the short wave at the bottom of the trough quickly moved into northern Xinjiang. The strong cold air moved eastward and southward, causing a wide range of wind and dust weather. At the same time, the Central Asia trough moved eastward into the Tarim Basin, and with the cold air moving westward, gale and dust weather appeared in the southern Xinjiang Basin. On the 29th (Figure 6D), the trough of low pressure moved eastward,
Frontiers in Environmental Science
frontiersin.org and the northwest wind gradually changed to the westerly wind, which was conducive to the transmission of dust to the downstream areas.
Combined with the sea-level pressure field view (Figure 7), the surface high pressure was located in the Caspian Sea and the Aral Sea on the 26th (Figure 7A), and the high pressure continued to increase Frontiers in Environmental Science frontiersin.org 07 to 1,027 hPa as it moved northeast on the 27th ( Figure 7B). The cold front entered Xinjiang, and the isobars behind the front were dense. A large pressure gradient was noted between the warm and cold air masses before and after the cold front, resulting in a surface wind. At the same time, under the effect of the low pressure of 1,005 hPa, a notable area of large value of pressure gradient was evident between high and low pressure, and the pressure gradient formed strong gradient wind, causing gale and dust weather in the northwest. As the upper-level system moved eastward, the cold front passed through on the 28th ( Figure 7C), and the dust arrived with the wind. During the development and movement of the high pressure to the northeast, the high-pressure center split into two centers, i.e., the north and south. The north high pressure quickly introduced cold air into the area, and the cold air accumulated along the Tianshan Mountains, causing gale and dust weather along the Tianshan Mountains. The cold air then crossed the Tianshan Mountains and entered the Tarim Basin. In addition, the cold air from the south moved westward, and the gale from the northwest caused sandstorm weather in the west and north of the basin. Additionally, during the northeast movement of the surface high pressure, the cold air entered from the east and caused the sandstorm weather in the east of the basin. The cold air invaded the basin from the east, the west, and the mountain, and the wind and dust scopes were further expanded, forming large-scale sandstorm weather. The high-altitude influence system gradually moved eastward on the 29th ( Figure 7D), and the strong front area moved eastward out of the northwest region.
In conclusion, this process was caused by the surface cold high pressure and frontal transit under the background of the upper-air circulation of "two troughs and two ridges." In addition, during spring in northwest China, the soil was dry and loose, with less vegetation cover (Chi, 2020); the dust was easily raised by the wind, creating optimum conditions for the occurrence of strong dust storms. As the cold front moved eastward, the dust carried by the wind was transported to the upper air along with the updraft. The prevailing westerly winds in the upper air constantly transmitted the dust aerosols to Inner Mongolia, North China, and other regions downstream, affecting a large region of East Asia.
The HYSPLIT backward ( Figure 8A) and forward ( Figure 8B) trajectories of Urumqi air at 19:00 on April 27th (48 h) were represented to further analyze the occurrence and transportation of this air pollution episode. The red, blue, and green lines represent the path of air masses at 1,000 m, 500 m, and 100 m, respectively. As shown in Figure 8A, the high-altitude air masses crossed Turkmenistan and Uzbekistan from the northwest of Turkmenistan to Kazakhstan at 20:00 on the 25th and entered Xinjiang at 08:00 on the 27th. The air masses at 500 m started from the Caspian Sea region, passed through the three Central Asian countries, and entered Xinjiang at 08:00 on the 27th. Meanwhile, the low-altitude air masses entered Kazakhstan from the northeastern end of Uzbekistan on the air stream and entered Xinjiang at 07:00 on the 27th. Subsequently, under the action of air currents, air masses at various heights passed through many cities in northern Xinjiang and reached Urumqi at 19:00 on the 27th. As illustrated, the three air masses at different heights had similar transport trajectories during this black storm process; all showing that exogenous pollutants primarily originated from the west of Xinjiang and entered the north of Xinjiang almost synchronously under the action of southwest airflow before reaching Urumqi along the north slope of Tianshan Mountains.
According to the Figure 8B, from 19:00 on the 27th to the early morning of the 29th, the air masses at different heights had similar transport trajectories, all piled up along the Tianshan Mountains before turning over the mountains into the southern Xinjiang Basin, which was consistent with the MODIS observation results. However, since the early morning of the 29th, the three air masses began to move in different directions, i.e., the high-altitude air masses moved west to the east end of Atushi before turning north; the air masses at 500 m followed the southern foot of the western Tianshan Mountains to Atushi and Kashi, the low-altitude air masses follows the southwest into the desert hinterland.
Frontiers in Environmental Science
frontiersin.org Frontiers in Environmental Science frontiersin.org
Temporal-spatial distributions of MODIS AOD and RCM AOD during this black storm episode
Figures 9A, C, E, G, I show the spatial distributions of MODIS AOD (the average value of the MOD AOD and the MYD AOD) during April 25-29 in eastern Asia. As shown, satellite remotesensing retrieving under bright background remains an extremely difficult problem, as described by and Tao et al. (2017). The northwest of China is a vast region dominated by arid and semi-arid landforms such as deserts, wastelands, and sparse vegetation-specifically Xinjiang, with unique topographical features and two of the largest basins in China, i.e., Tarim Basin and Junggar Basin (Figure 1). In addition, in the period of more clouds or when the satellite inversion grid is completely covered by clouds, there will be a large number of non-random missing cases in satellite remote sensing AOD, and even the corresponding aerosol inversion results cannot be obtained (Jia et al., 2021). The complex underlying surface and cloud coverage make the satellite retrieval missing area (the white areas in Figures 9A, C, E, G, I) large, which is difficult to completely present the aerosol spatial distribution and obtain the transport process of dust aerosols. However, it can be roughly seen that the sandstorm appeared in Xinjiang from April 27 to 29, 2015, and the dust aerosols showed a trend of movements from east to west in the Xinjiang region. From April 25 to 26, the AOD of Xinjiang was relatively small, around 0.1. Dust aerosols entered Xinjiang on April 27, with high AOD areas (AOD >1.3) appearing in the north of Tianshan Mountains. On April 28, a high-value zone of AOD (AOD = 1.9) appeared at the junction of the southern Tarim Basin and Altun Mountains, and the high-value area, with the AOD lower than that on the 28th (between 1.0-1.4), was transferred to the western region of Xinjiang on April 29.
The RegCM 4.6 simulated results (the mean value between 9: 00 a.m. and 3:00 p.m. local time), which could resolve the limitation of satellite retrieval under the complex underlying surface conditions, were used to present a wider range of AOD spatial distribution. From the spatial distributions of RCM AOD on April 25-29 ( Figures 9B, D, F, H, J), the spatial distribution of AOD was significantly affected by the underlying surface conditions; the highvalue areas were predominant mostly in desert regions and basins, whereas the low-value areas mainly were in mountainous areas with relatively high altitude. Tarim Basin and Junggar Basin are the key areas of wind-sand activities, and their unique topography endows them with more dust emission conditions; under the influence of atmospheric circulation and meteorological conditions during sandstorms, there would be secondary or multiple dust generations. In addition, the AOD in the whole Xinjiang region was lower on April 25 and increased during 26-29. On the 25th, there was a high AOD area (AOD reached 1.3) in the Sarayye Siktra Desert in Kazakhstan; however, the AOD in the entire Xinjiang region was less than 0.5. On the 26th, the AOD high-value area (0.9-1.2) appeared in the Taklimakan Desert and the Gurbantungut Desert in Xinjiang, whereas that of the Taklimakan Desert was above 1.0 on the 27th. On the 28th, the high AOD area moved eastward to the Gurbantungut Desert and southern Mongolia and the western Gobi Desert, and AOD was small across Xinjiang on the 29th. Although the characteristics of aerosol transport from east to west in the Xinjiang region were not prominent, the dust was evidently from Kazakhstan and entered Xinjiang along the Tianshan Mountains.
As evident, the AOD from the simulation was generally lower than that retrieved by MODIS, particularly in eastern China. The primary reason for the underestimation is that the MODIS detected all types of aerosols, including black carbon, sulfate, and anthropogenic organic carbon, which were excluded in the current simulation. Moreover, the simulated AOD was also smaller than MODIS retrievals over the main desert areas (Qaidam Basin, Gobi Desert, Taklimakan Desert, etc.), partly because the MODIS overestimates the AOD magnitude over the semi-arid area due to large uncertainty related to the assumed surface reflectance (Remer et al., 2005;Levy et al., 2013). Overall, the spatial pattern of AOD from RegCM 4.6 simulation was similar to that from MODIS over the dust source region; however, the AOD was generally smaller. The dust emission is activated in the grid cell when the friction velocity, resolved as a function of RegCM 4.6 simulated wind speed and surface roughness, is higher than the minimum friction velocity threshold calculated with surface roughness and soil moisture (Zakey et al., 2006). The overestimated areas were between the Tianshan and Altay mountains, while the underestimated area was distributed in the Taklimakan Desert. The bias should be caused by complex topography and atmospheric circulation in the region which the model cannot effectively deal with (Liu et al., 2021).
Temporal-spatial distribution of NSR during this black storm episode
From the spatial distributions of the NSR SUR during April 25-29 ( Figures 10A, C, E, G, I), the NSR SUR under the cloud-free condition was with a zonal distribution of "high in the south and low in the north." Solar radiation was weak in high latitudes but strong in low latitudes (Liu et al., 2006). Xinjiang, the Himalayas, and the Saryesik Atyrau Desert in Kazakhstan had lower radiant fluxes, and the strong scattering effect of dust aerosols on solar radiation caused a decrease in NSR SUR . On the 25th, there was an apparent low-value area of the NSR SUR , which was between 160-180 W•m -2 and simultaneously corresponded to the highvalue area of AOD in the Atyrau Desert of Sareyesik. On the 26th, the NSR SUR in the central Tarim Basin of Xinjiang and the northern Junggar Basin, with high AOD values, were both small (below 170 W•m -2 ). On the 27th, the low-value area of NSR SUR in Xinjiang and Kazakhstan was enlarged, NSR SUR in most areas of Xinjiang was between 170-180 W•m -2 , and there was a low value below 170 W·m -2 in the central part of the Tarim Basin. From 28-29th, the low-value area of NSR SUR moved eastward, and the range of the low-value area in western Inner Mongolia expanded on the 29th.
From the spatial distributions of NSR TOA under the cloud-free condition on April 25-29 ( Figures 10B, D, F, H, J), the NSR TOA was generally higher than the NSR SUR . The basin and the Himalayas were still the low-value areas, whereas the low-value areas in Kazakhstan were relatively inconspicuous. The NSR TOA of the Tarim Basin was low on April 25 (260-280 W•m -2 ), and the lowvalue area expanded during April 26-27, with the NSR TOA falling below 240 W•m -2 . Meanwhile, the radiation flux in the Saray Atyrau Frontiers in Environmental Science frontiersin.org Frontiers in Environmental Science frontiersin.org 11 Frontiers in Environmental Science frontiersin.org Desert in Kazakhstan decreased to approximately 290 W•m -2 . On April 28-29, the NSR TOA of Xinjiang was higher than that on April 27-28, and the low-value area over Kazakhstan disappeared.
Temporal-spatial distribution of ADRF during this black storm episode
According to the spatial distributions of ADRF SUR on April 25-29 ( Figures 11A, C, E, G, I), the dust aerosols had a significant cooling effect on the ground. All of the ADRF SUR corresponding to the highvalue areas of AOD was negative, whereas the ADRF SUR of the areas with fewer dust aerosols was close to 0. On April 25, the ADRF SUR in the Saryesik Atyrau Desert in Kazakhstan was the largest (up to −91 W•m -2 ). On April 26, the ADRF SUR was more significant in the Sareysike Atyrau Desert, the Gurbantungut Desert in the Junggar Basin, and the western part of the Taklimakan Desert, where the AOD was greater than 0.9, with ADRF SUR ranging between −65 and −78 W•m -2 . On April 27, the ADRF SUR was between −19 and −32 W•m -2 in some areas of Xinjiang, where the AOD was between 0.4 and 0.7. On April 28, a high-value area of ADRF SUR appeared in the Junggar Basin, up to −80 W•m -2 , and there was a palpable correspondence with the high-value area of AOD in spatial distribution. ADRF SUR was above −70 W•m -2 in areas where the AOD value was higher than 0.7. With regard to the spatial distributions of the ADRF TOA on April 25-29 ( Figures 11B, D, F, H, J), the maximum ADRF TOA was above −24 W•m -2 , which was approximately a quarter of ADRF SUR . On April 25-28, the Saryesik Atyrau Desert in Kazakhstan was an area with high ADRF TOA , particularly during April 25-27; the ADRF TOA in this area was higher than −24 W•m -2 . ADRF TOA in most parts of Xinjiang was approximately between 0 and −12 W•m -2 . On April 29, the western part of Inner Mongolia was the high-value area of ADRF TOA with a clear correspondence with the high-value area of AOD.
As for the dust-induced radiative forcing, Kaskaoutis et al. (2019) examined the multiple dust storms that hit the eastern Mediterranean and Greece during March 2018; consequently, the ADRF estimates revealed a significant impact of dust on the radiation budget, with large (~−40 to −50 W•m −2 ) decrease in SSR and an overall cooling effect at the TOA (~−5 to −30 W•m −2 ). Wang (2013) noted that along with a heavy dust storm in northwestern China during April 24-30, 2010, for the Minqin and Semi-Arid Climate and Environment Observatory of Lanzhou University (SACOL) sites, the net dust aerosols direct radiative forcing ranged between −6 and −31 W•m −2 at the surface and 6-36 W•m −2 at the TOA. Huang et al. (2009) found that the average daily mean ADRF during a dust storm over the Taklimakan desert was 44 and −42 W•m −2 at the TOA and surface, respectively. Comparatively speaking, the black storm in our study had a stronger effect on radiation, and the resulting dust aerosols caused a greater degree of the radiation attenuation with a more significant cooling effect at the TOA and surface.
The near-surface temperature response to dust aerosols
Under the influence of the cold air accompanying the dust weather, the near-surface temperature in most areas decreased significantly, with a descending range of about 3.69°C-11.09°C. The near-surface temperature in Urumqi decreased from 16.00°C on the 25th to about 5.00°C on the 28th to 29th.
To further analyze the effect of dust aerosols produced by the black storm on near-surface temperature, we conducted two simulations under the condition that mode settings except the aerosol module remained unchanged; consequently, the TR SUR of dust aerosols was obtained. From the spatial distributions of TR SUR in eastern Asia during April 25-29, 2015 (Figure 12), a cooling phenomenon was observed in Xinjiang and Kazakhstan, affected by dust aerosols from the black storm. On April 25, the temperature in Xinjiang when dust aerosol appeared was 0.40°C-1.10°C lower than when there was no dust. On April 27, the area with a significant temperature decrease wasTarim Basin, where the temperature decreased by 0.30°C-1.60°C, and its center temperature decreased by 1.60°C-2.90°C. The region with a significant temperature decrease corresponded to the high-value region of ADRF SUR because the sensible heat flux entering the atmosphere can balance the surface shortwave radiative forcing of sand and dust for the cooling effect to be more pronounced in the region with significant surface shortwave radiative forcing. On April 29, sand and dust particles moving to western Inner Mongolia cooled down the region between 0.60°C-1.10°C. This further shows that dust aerosols have a cooling effect near the ground and that cooling of more than 2.00°C could occur in areas with high dust content. Researchers have analyzed the effect of eastern Asia dust aerosols on temperature and found that the ADRF can influence the rate of local temperature change and relative humidity; in addition, dust aerosols decrease the surface temperature in entire eastern Asia by approximately 0.21°C (Su et al., 2016;.
Conclusion
Atmospheric dust aerosols from dust storms can strongly scatter and absorb solar radiation, influencing the amount of solar radiation at the TOA and surface, and consequently, the near-surface temperature. Based on RegCM 4.6 simulation, combined with MODIS satellite retrieval, meteorological, and environmental observational data, this study reported the pollution situation, weather background, and backward trajectory during the black storm in Xinjiang during April 26-29, 2015. We also analyzed the temporal-spatial distribution of AOD, the effects of dust aerosols on solar radiation, and the near-surface temperature under this extreme weather condition.
This black storm, with PM 10 as the major pollutant, was most severe on the 27th for the capital city of Xinjiang, Urumqi; the AQI, PM 10 , and PM 2.5 increased, reaching their respective peaks of 500, 1,000 μg•m -3 , and 628 μg•m -3 , respectively. In addition, during the black storm, a large area of dust appeared in the southern Xinjiang Basin, and the main dust body displayed movement from east to west in southern Xinjiang from 27th to 29th. From the weather background, we can deduce that this process was caused by the surface cold high pressure and frontal transit under the background of the upper-air circulation of "two troughs and two ridges." The climatic conditions in spring provided abundant sand sources for the occurrence of this black storm. The eastward movement of the cold front and the upper westerly winds continuously transmitted the dust aerosols carried by the dust to Inner Mongolia, North China, and other regions downstream, affecting a large range of East Asia. The backward trajectory showed that the air masses with the pollutants primarily originated from Xinjiang and Central Asia, entered Northern Xinjiang under the action of southwest airflow, and reached Urumqi along the north slope of Tianshan Mountain before pouring east into southern Xinjiang Basin.
Combined with the AOD from the satellite remote sensing and model simulation, we found that the dust of this black storm was from Kazakhstan, entered Xinjiang on April 27, and moved from the east to west in the Xinjiang region. Under the effect of geographical and climatic conditions, the areas with high AOD were mostly in desert regions and basins, including the Taklimakan Desert, whereas the low-value areas were primarily mountainous areas with relatively high altitudes. The AOD from RegCM 4.6 was generally lower than that of MODIS since the aerosol models of the MODIS and RegCM 4.6 are different and influenced differently by different underlying surfaces and climatic conditions. Moreover, the dust aerosols from this black storm caused a significant decrease in NSR both at the TOA and surface, which was more significant at the surface. The cooling effect was more prominent in the regions with high AOD. ADRF SUR was above −70 W•m −2 in areas where the AOD value was higher than 0.70. The cooling effect at the TOA was not as significant as that at the surface; the maximum ADRF TOA was above −24 W•m −2 , which was approximately a quarter of the surface. Moreover, the ADRF from dust aerosols decreased the near-surface temperature decrease, and the region with a significant temperature decrease corresponded to high-value areas of ADRF SUR /AOD. During this black storm, the near-surface temperature response to dust aerosols with high AOD was approximately 0.40°C-2.90°C; specifically, the TR SUR was above 2.00°C and the maximum reaching 2.90°C at the center of the black storm, with the near-surface temperature in most areas decreasing to approximately 3.69°C-11.09°C because of cold air.
Data availability statement
The raw data supporting the conclusion of this article will be made available by the authors, without undue reservation.
FIGURE 1
1Geographical location and terrain of Xinjiang region.
FIGURE 3
3FIGURE 3 Simulation area and its terrain distribution (unit of altitude: m).
FIGURE 5
5EOST/MODIS monitor of dust in the south region of Xinjiang at 13:13 on April 27 (A) and 13:01 on April 29 (B).
FIGURE 6
6500 hPa potential height field (black contour lines, unit: dagpm), temperature field (red dashed line, unit:°C), and wind field (blue vector, unit: m·s -1 ) during April 26-29, 2015 [(A) April 26th; (B) April 27th; (C) April 28th; and (D) April 29th].
FIGURE 7
7Sea-level pressure field (contour lines, unit: hPa) during April 26-29, 2015 [(A) April 26th; (B) April 27th; (C) April 28th; and (D) April 29th].
FIGURE 8
8HYSPLIT backward (A) and forward (B) trajectories of Urumqi air at 19:00 on April 27th (48 h).
FIGURE 9
9Spatial distributions of MODIS AOD (A, C, E, G, and I) and RCM AOD (B, D, F, H, and J) in eastern Asia during April 25-29, 2015.
FIGURE 10
10Spatial distributions of NSR SUR (A, C, E, G, and I) and NSR TOA (B, D, F, H, and J) under the cloudless condition in eastern Asia during April 25-29, 2015.
FIGURE 11
11Spatial distributions of ADRF SUR (A, C, E, G, and I) and ADRF TOA (B, D, F, H, and J) from dust aerosols in eastern Asia during April 25-29, 2015.
FIGURE 12
12Spatial distributions of TR SUR in eastern Asia during April 25-29, 2015 [(A) April 25th; (B) April 26th; (C) April 27th; (D) April 28th; and (E) April 29th].Frontiers in Environmental Science frontiersin.org
investigation, formal analysis, charting, and writing-original draft preparation. YZ: charting and analysis of weather background. ZG: model simulation and analysis. XL: model simulation and validation. YC: writing-reviewing and editing and funding acquisition. QL: supervision and funding acquisition. ZT: literature search and collection. PW: conceptualization and charting. QH: data curation and funding acquisition. JG: charting. YZ: charting and analysis of weather background. All authors have read and agreed to the published version of the manuscript.
Funding
This work was supported by the National Natural Science Foundation of China (Grant Nos 41905131, 41830968, 41675026, and 41375021), the Science and Technology Planning Program of Xinjiang, China (Grant No. 2022E01047), the Natural Science Basic Research Program of Shaanxi Province, China (Grant No. 2021JQ-768), grants from Sichuan University Humanities and Social Sciences Key Research Base, and Meteorological Disaster Prediction, Early Warning and Emergency Management Research Center (No. ZHYJ21-ZD04).
TABLE 1
1Statistics describing the relationship of daily averaged dust AOD between AERONET and simulation at Dalanzadgad (43.58°N, 104.42°E) station during spring from 2012 to 2014.n
R
MAE
RMSE
RMB
234
0.23*
0.11
0.17
0.80
AcknowledgmentsMODIS and AERONET data used in this paper were obtained from the NASA Langley Research Center Atmospheric Science Data Center, and the reanalysis data were obtained from the NCEP. The authors are grateful to Xinjiang Meteorological Observatory and Xinjiang Environmental Protection Department for providing relevant data. The authors would like to thank the Home for Researchers editorial team (www.home-for-researchers.com) for the language editing service and the editor and the three reviewers for their helpful comments and suggestions.Conflict of interestThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.Publisher's noteAll claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors, and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
A global satellite view of the seasonal distribution of mineral dust and its correlation with atmospheric circulation. O Alizadeh-Choobari, A Sturman, P Zawar-Reza, 10.1016/j.dynatmoce.2014.07.002Dyn. Atmos. Oceans. 68Alizadeh-Choobari, O., Sturman, A., and Zawar-Reza, P. (2014). A global satellite view of the seasonal distribution of mineral dust and its correlation with atmospheric circulation. Dyn. Atmos. Oceans. 68, 20-34. doi:10.1016/j.dynatmoce.2014.07.002
A new high-resolution central and Western Saharan summertime dust source map from automated satellite dust plume tracking. I Ashpole, Washington , R , Ashpole, I., and Washington, R. (2013). A new high-resolution central and Western Saharan summertime dust source map from automated satellite dust plume tracking.
. 10.1002/jgrd.50554J. Geophys. Res. Atmos. 118J. Geophys. Res. Atmos. 118, 6981-6995. doi:10.1002/jgrd.50554
Study on a dust pollution process in Taklamakan Desert based on vertical observation by UAV. D Bi, Q He, J Li, Z Lu, C Zhou, L Meng, 10.13671/j.hjkxxb.2022.0146Acta Sci. Circumstantiae. 42Bi, D., He, Q., Li, J., Lu, Z., Zhou, C., Meng, L., et al. (2022). Study on a dust pollution process in Taklamakan Desert based on vertical observation by UAV. Acta Sci. Circumstantiae 42, 1-13. doi:10.13671/j.hjkxxb.2022.0146
Remote sensing of land uses in dust source regions of East Asia. M X Chi, HohhotInner Mongolia Normal UniversityChi, M. X. (2020). Remote sensing of land uses in dust source regions of East Asia. Hohhot: Inner Mongolia Normal University.
A regional climate model for the Western United-States. R E Dickinson, R M Errico, F Giorgi, G T Bates, 10.1007/bf00240465Clim. Chang. 15Dickinson, R. E., Errico, R. M., Giorgi, F., and Bates, G. T. (1989). A regional climate model for the Western United-States. Clim. Chang. 15, 383-422. doi:10.1007/bf00240465
A scheme for representing cumulus convection in large-scale models. K A Emanuel, 10.1175/1520-0469(1991)048<2313:ASFRCC>2.0.CO;2J. Atmos. Sci. 48Emanuel, K. A. (1991). A scheme for representing cumulus convection in large-scale models. J. Atmos. Sci. 48, 2313-2329. doi:10.1175/1520-0469(1991)048<2313:
An analysis of aeolian dust in climate models. A T Evan, C Flamant, S Fiedler, O Doherty, 10.1002/2014GL060545Geophys. Res. Lett. 41Evan, A. T., Flamant, C., Fiedler, S., and Doherty, O. (2014). An analysis of aeolian dust in climate models. Geophys. Res. Lett. 41, 5996-6001. doi:10.1002/2014GL060545
Aerosol contamination survey during dust storm process in Northwestern China using ground, satellite observations and atmospheric modeling data. M Filonchyk, H Yan, T M E Shareef, Yang , S , 10.1007/s00704-017-2362-8Theor. Appl. Climatol. 135Filonchyk, M., Yan, H., Shareef, T. M. E., and Yang, S. (2019). Aerosol contamination survey during dust storm process in Northwestern China using ground, satellite observations and atmospheric modeling data. Theor. Appl. Climatol. 135, 119-133. doi:10.1007/s00704-017-2362-8
. C Frei, J H Christensen, M Deque, D Jacob, R G Jones, P L Vidale, Frei, C., Christensen, J. H., Deque, M., Jacob, D., Jones, R. G., and Vidale, P. L. (2003).
Daily precipitation statistics in regional climate models: Evaluation and intercomparison for the European alps. 10.1029/2002JD002287doi:10. 1029/2002JD002287J. Geophys. Res. Atmos. 1084124Daily precipitation statistics in regional climate models: Evaluation and intercomparison for the European alps. J. Geophys. Res. Atmos. 108, 4124. doi:10. 1029/2002JD002287
Modeling the feedback between aerosol and meteorological variables in the atmospheric boundary layer during a severe fog-haze event over the North China Plain. Y Gao, M Zhang, Z Liu, L Wang, P Wang, X Xia, 10.5194/acp-15-4279-2015Atmos. Chem. Phys. 158Gao, Y., Zhang, M., Liu, Z., Wang, L., Wang, P., Xia, X., et al. (2015). Modeling the feedback between aerosol and meteorological variables in the atmospheric boundary layer during a severe fog-haze event over the North China Plain. Atmos. Chem. Phys. 15 (8), 4279-4295. doi:10.5194/acp-15-4279-2015
Characteristic analysis of three sanddust storm process in 2021 based on FY-4A satellite remote sensing data. Z Gao, X Hu, X Zhang, Wang , Y , Meteorological Sci. Technol. 50Gao, Z., Hu, X., Zhang, X., and Wang, Y. (2022). Characteristic analysis of three sand- dust storm process in 2021 based on FY-4A satellite remote sensing data. Meteorological Sci. Technol. 50, 536-544.
Soil dust aerosols and wind as predictors of seasonal meningitis incidence in Niger. C P Garcia-Pando, M C Stanton, P J Diggle, S Trzaska, R L Miller, J P Perlwitz, 10.1289/ehp.1306640Environ. Health Persp. 122Garcia-Pando, C. P., Stanton, M. C., Diggle, P. J., Trzaska, S., Miller, R. L., Perlwitz, J. P., et al. (2014). Soil dust aerosols and wind as predictors of seasonal meningitis incidence in Niger. Environ. Health Persp. 122, 679-686. doi:10.1289/ehp.1306640
Dust aerosol optical properties retrieval and radiative forcing over northwestern China during the 2008 China-U.S. joint field experiment. J M Ge, J Su, T P Ackerman, Q Fu, J P Huang, J S Shi, 10.1029/2009JD013263doi:10.1029/ 2009JD013263J. Geophys. Res. 115Ge, J. M., Su, J., Ackerman, T. P., Fu, Q., Huang, J. P., and Shi, J. S. (2010). Dust aerosol optical properties retrieval and radiative forcing over northwestern China during the 2008 China-U.S. joint field experiment. J. Geophys. Res. 115, D00K12. doi:10.1029/ 2009JD013263
Impact of Sahara dust on solar radiation at Cape Verde Islands derived from MODIS and surface measurements. S Gehlot, P J Minnett, D Stammer, 10.1016/j.rse.2015.05.026Remote Sens. Environ. 166Gehlot, S., Minnett, P. J., and Stammer, D. (2015). Impact of Sahara dust on solar radiation at Cape Verde Islands derived from MODIS and surface measurements. Remote Sens. Environ. 166, 154-162. doi:10.1016/j.rse.2015.05.026
RegCM 4: Model description and preliminary tests over multiple CORDEX domains. F Giorgi, E Coppola, F Solmon, L Mariotti, M Sylla, X Bi, 10.3354/cr01018Clim. Res. 521Giorgi, F., Coppola, E., Solmon, F., Mariotti, L., Sylla, M., Bi, X., et al. (2011). RegCM 4: Model description and preliminary tests over multiple CORDEX domains. Clim. Res. 52 (1), 7-29. doi:10.3354/cr01018
Introduction to special section: Regional climate modeling revisited. F Giorgi, L O Mearns, 10.1029/98JD02072J. Geophys. Res. Atmos. 104Giorgi, F., and Mearns, L. O. (1999). Introduction to special section: Regional climate modeling revisited. J. Geophys. Res. Atmos. 104, 6335-6352. doi:10.1029/98JD02072
A high-resolution air-mass transformation model for short-range weather forecasting. A A M Holtslag, E I F Debruijn, H L Pan, 10.1175/1520-0493(1990)118<1561:ahramt>2.0.co;2Mon. Weather Rev. 118Holtslag, A. A. M., Debruijn, E. I. F., and Pan, H. L. (1990). A high-resolution air-mass transformation model for short-range weather forecasting. Mon. Weather Rev. 118, 1561-1575. doi:10.1175/1520-0493(1990)118<1561:ahramt>2.0.co;2
Validation and accuracy analysis of the collection 6.1 MODIS aerosol optical depth over the westernmost city in China based on the sun-sky radiometer observations from SONET. G Huang, Y Chen, Z Li, Q Liu, Y Wang, Q He, 10.1029/2019EA001041Earth Space Sci. 7Huang, G., Chen, Y., Li, Z., Liu, Q., Wang, Y., He, Q., et al. (2020). Validation and accuracy analysis of the collection 6.1 MODIS aerosol optical depth over the westernmost city in China based on the sun-sky radiometer observations from SONET. Earth Space Sci. 7, e2019EA001041. doi:10.1029/2019EA001041
The accuracy improvement of clear-sky surface shortwave radiation derived from CERES SSF dataset with a simulation analysis. G Huang, Q Liu, Y Wang, Q He, Y Chen, L Jin, 10.1016/j.scitotenv.2020.141671Sci. Total Environ. 749141671Huang, G., Liu, Q., Wang, Y., He, Q., Chen, Y., Jin, L., et al. (2020). The accuracy improvement of clear-sky surface shortwave radiation derived from CERES SSF dataset with a simulation analysis. Sci. Total Environ. 749, 141671. doi:10.1016/j.scitotenv.2020. 141671
Estimation of net surface shortwave radiation from MODIS data. G Huang, S Liu, S Liang, 10.1080/01431161.2011.577834Int. J. Remote Sens. 33Huang, G., Liu, S., and Liang, S. (2012). Estimation of net surface shortwave radiation from MODIS data. Int. J. Remote Sens. 33, 804-825. doi:10.1080/01431161.2011.577834
Taklimakan dust aerosol radiative heating derived from CALIPSO observations using the Fu-Liou radiation model with CERES constraints. J Huang, Q Fu, J Su, Q Tang, P Minnis, Y Hu, 10.5194/acp-9-4011-2009doi:10. 5194/acp-9-4011-2009Atmos. Chem. Phys. 9Huang, J., Fu, Q., Su, J., Tang, Q., Minnis, P., Hu, Y., et al. (2009). Taklimakan dust aerosol radiative heating derived from CALIPSO observations using the Fu-Liou radiation model with CERES constraints. Atmos. Chem. Phys. 9, 4011-4021. doi:10. 5194/acp-9-4011-2009
Long-range transport and vertical structure of Asian dust from CALIPSO and surface measurements during PACDEX. J Huang, P Minnis, B Chen, Z Huang, Z Liu, Q Zhao, 10.1029/2008JD010620D23212. doi:10.1029/ 2008JD010620J. Geophys. Res. Atmos. 113Huang, J., Minnis, P., Chen, B., Huang, Z., Liu, Z., Zhao, Q., et al. (2008). Long-range transport and vertical structure of Asian dust from CALIPSO and surface measurements during PACDEX. J. Geophys. Res. Atmos. 113, D23212. doi:10.1029/ 2008JD010620
Climate effects of dust aerosols over East Asian arid and semiarid regions. J Huang, T Wang, W Wang, Z Li, Yan , H , 10.1002/2014JD021796J. Geophys. Res. Atmos. 119Huang, J., Wang, T., Wang, W., Li, Z., and Yan, H. (2014). Climate effects of dust aerosols over East Asian arid and semiarid regions. J. Geophys. Res. Atmos. 119, 11398-11416. doi:10.1002/2014JD021796
Significant underestimation of radiative forcing by aerosol-cloud interactions derived from satellite-based methods. H Jia, X Ma, F Yu, J Quaas, 10.1038/s41467-021-23888-1Nat. Commun. 123649Jia, H., Ma, X., Yu, F., and Quaas, J. (2021). Significant underestimation of radiative forcing by aerosol-cloud interactions derived from satellite-based methods. Nat. Commun. 12, 3649. doi:10.1038/s41467-021-23888-1
The spatial and temporal distributions of absorbing aerosols over. L Kang, S Chen, J Huang, S Zhao, X Ma, T Yuan, 10.3390/rs9101050East Asia. Remote Sens. 9101050Kang, L., Chen, S., Huang, J., Zhao, S., Ma, X., Yuan, T., et al. (2017). The spatial and temporal distributions of absorbing aerosols over East Asia. Remote Sens. 9 (10), 1050. doi:10.3390/rs9101050
Analysis of intense dust storms over the eastern Mediterranean in March 2018: Impact on radiative forcing and Athens air quality. D G Kaskaoutis, U C Dumka, A Rashki, B E Psiloglou, A Gavriil, A Mofidi, 10.1016/j.atmosenv.2019.04.025Atmos. Environ. 209Kaskaoutis, D. G., Dumka, U. C., Rashki, A., Psiloglou, B. E., Gavriil, A., Mofidi, A., et al. (2019). Analysis of intense dust storms over the eastern Mediterranean in March 2018: Impact on radiative forcing and Athens air quality. Atmos. Environ. 209, 23-39. doi:10.1016/j.atmosenv.2019.04.025
. D G Kaskaoutis, H D Kambezidis, C P Jacovides, M D Steven, Kaskaoutis, D. G., Kambezidis, H. D., Jacovides, C. P., and Steven, M. D. (2006).
Modification of solar radiation components under different atmospheric conditions in the Greater Athens area. 10.1016/j.jastp.2005.05.002doi:10.1016/ j.jastp.2005.05.002Greece. J. Atmos. Solar-Terr. Phys. 68Modification of solar radiation components under different atmospheric conditions in the Greater Athens area, Greece. J. Atmos. Solar-Terr. Phys. 68, 1043-1052. doi:10.1016/ j.jastp.2005.05.002
. Y J Kaufman, D Tanre, H R Gordon, T Nakajima, J Lenoble, R Frouin, Kaufman, Y. J., Tanre, D., Gordon, H. R., Nakajima, T., Lenoble, J., Frouin, R., et al.
Passive remote sensing of tropospheric aerosol and atmospheric correction for the aerosol effect. 10.1029/97JD01496J. Geophys. Res. Atmos. 102Passive remote sensing of tropospheric aerosol and atmospheric correction for the aerosol effect. J. Geophys. Res. Atmos. 102, 16815-16830. doi:10.1029/97JD01496
Radiative impact of a heavy dust storm over India and surrounding oceanic regions. S Kedia, R Kumar, S Islam, Y Sathe, A Kaginalkar, 10.1016/j.atmosenv.2018.05.005Atmos. Env. 185Kedia, S., Kumar, R., Islam, S., Sathe, Y., and Kaginalkar, A. (2018). Radiative impact of a heavy dust storm over India and surrounding oceanic regions. Atmos. Env. 185, 109-120. doi:10.1016/j.atmosenv.2018.05.005
The national center for atmospheric research community climate model: CCM3. J T Kiehl, J J Hack, G B Bonan, B A Boville, D L Williamson, P J Rasch, 10.1175/1520-0442(1998)011<1131:TNCFAR>2.0.CO;2J. Clim. 11Kiehl, J. T., Hack, J. J., Bonan, G. B., Boville, B. A., Williamson, D. L., and Rasch, P. J. (1998). The national center for atmospheric research community climate model: CCM3. J. Clim. 11, 1131-1149. doi:10.1175/1520-0442(1998)011<1131:
The impact of the environmental factors on the photosynthetic activity of common pine (Pinus sylvestris) in spring and in autumn in the region of Eastern Siberia. N E Korotaeva, M V Ivanova, G G Suvorova, G B Borovskii, 10.1007/s11676-017-0582-5J. For. Res. 29Korotaeva, N. E., Ivanova, M. V., Suvorova, G. G., and Borovskii, G. B. (2018). The impact of the environmental factors on the photosynthetic activity of common pine (Pinus sylvestris) in spring and in autumn in the region of Eastern Siberia. J. For. Res. 29, 1465-1473. doi:10.1007/s11676-017-0582-5
Impacts of aerosol monsoon interaction on rainfall and circulation over Northern India and the Himalaya Foothills. W K M Lau, K M Kim, J J Shi, T Matsui, M Chin, Q Tan, 10.5194/amt-6-2989-2013doi:10.5194/amt-6-2989-2013Atmos. Meas. Techn. 49Clim. Dyn.Lau, W. K. M., Kim, K. M., Shi, J. J., Matsui, T., Chin, M., Tan, Q., et al. (2017). Impacts of aerosol monsoon interaction on rainfall and circulation over Northern India and the Himalaya Foothills. Clim. Dyn. 49, 1945-1960. doi:10.1007/s00382- 016-3430-y Levy, R. C., Mattoo, S., Munchak, L. A., Remer, L. A., Sayer, A. M., Patadia, F., et al. (2013). The Collection 6 MODIS aerosol products over land and ocean. Atmos. Meas. Techn. 6, 2989-3034. doi:10.5194/amt-6-2989-2013
Future precipitation changes over China under 1.5°C and 2.0°C global warming targets by using CORDEX regional climate models. H Li, H Chen, H Wang, Yu , E , 10.1016/j.scitotenv.2018.05.324Sci. Total Environ. 640Li, H., Chen, H., Wang, H., and Yu, E. (2018). Future precipitation changes over China under 1.5°C and 2.0°C global warming targets by using CORDEX regional climate models. Sci. Total Environ. 640, 543-554. doi:10.1016/j.scitotenv.2018.05.324
Long-term variation of cloud droplet number concentrations from space-based Lidar. J Li, B Jian, J Huang, Y Hu, C Zhao, K Kawamoto, 10.1016/j.rse.2018.05.011Remote Sens. Environ. 213Li, J., Jian, B., Huang, J., Hu, Y., Zhao, C., Kawamoto, K., et al. (2018). Long-term variation of cloud droplet number concentrations from space-based Lidar. Remote Sens. Environ. 213, 144-161. doi:10.1016/j.rse.2018.05.011
Research progress of respiratory system injury caused by dust weather and its mechanism. Y Li, Y Hou, Y Sang, W Luo, X Xiao, F Lei, Chin. J. New Clin. Med. 1310Li, Y., Hou, Y., Sang, Y., Luo, W., Xiao, X., and Lei, F. (2020). Research progress of respiratory system injury caused by dust weather and its mechanism. Chin. J. New Clin. Med. 13 (10), 1056-1061.
Recent advances in regional climate modeling and applications. H Liu, D Zhang, Wang , B , Clim. Environ. Res. 11in ChineseLiu, H., Zhang, D., and Wang, B. (2006). Recent advances in regional climate modeling and applications. Clim. Environ. Res. 11, 649-668. (in Chinese).
The influence of dusts on radiation and temperature over the eastern Asia with a regional climate model. X Liu, S Chen, Z Guo, H Zhou, Y Chen, Y Kang, 10.1016/j.scitotenv.2021.148351Sci. Total Environ. 792148351Liu, X., Chen, S., Guo, Z., Zhou, H., Chen, Y., Kang, Y., et al. (2021). The influence of dusts on radiation and temperature over the eastern Asia with a regional climate model. Sci. Total Environ. 792, 148351. doi:10.1016/j.scitotenv. 2021.148351
Evaluation of net shortwave radiation over China with a regional climate model. X Liu, Y Kang, Q Liu, Z Guo, Y Chen, D Huang, 10.3354/cr01598Clim. Res. 80Liu, X., Kang, Y., Liu, Q., Guo, Z., Chen, Y., Huang, D., et al. (2020). Evaluation of net shortwave radiation over China with a regional climate model. Clim. Res. 80, 147-163. doi:10.3354/cr01598
Effects on surface meteorological parameters and radiation levels of a heavy dust storm occurred in Central Arabian Peninsula. A H Maghrabi, Al-Dosari , A F , 10.1016/j.atmosres.2016.07.024Atmos. Res. 182Maghrabi, A. H., and Al-Dosari, A. F. (2016). Effects on surface meteorological parameters and radiation levels of a heavy dust storm occurred in Central Arabian Peninsula. Atmos. Res. 182, 30-35. doi:10.1016/j.atmosres.2016.07.024
The influence of dust storms on solar radiation data, aerosol properties and meteorological variables in Central Arabian Peninsula. A Maghrabi, 10.1007/s13762-017-1279-1Int. J. Environ. Sci. Te. 14Maghrabi, A. (2017). The influence of dust storms on solar radiation data, aerosol properties and meteorological variables in Central Arabian Peninsula. Int. J. Environ. Sci. Te. 14, 1643-1650. doi:10.1007/s13762-017-1279-1
. N M Mahowald, S Kloster, S Engelstaedter, J K Moore, S Mukhopadhyay, Mahowald, N. M., Kloster, S., Engelstaedter, S., Moore, J. K., Mukhopadhyay, S.,
Observed 20th century desert dust variability: Impact on climate and biogeochemistry. J R Mcconnell, 10.5194/acp-10-10875-2010Atmos. Chem. Phys. 10McConnell, J. R., et al. (2010). Observed 20th century desert dust variability: Impact on climate and biogeochemistry. Atmos. Chem. Phys. 10, 10875-10893. doi:10.5194/acp- 10-10875-2010
African dust deposition in Puerto Rico: Analysis of a 20-year rainfall chemistry record and comparison with models. M A Mcclintock, W H Mcdowell, G González, M Schulz, J C Pett-Ridge, 10.1016/j.atmosenv.2019.116907doi:10.1016/j. atmosenv.2019.116907Atmos. Environ. 216116907McClintock, M. A., McDowell, W. H., González, G., Schulz, M., and Pett-Ridge, J. C. (2019). African dust deposition in Puerto Rico: Analysis of a 20-year rainfall chemistry record and comparison with models. Atmos. Environ. 216, 116907. doi:10.1016/j. atmosenv.2019.116907
Desert dust hazards: A global review. N Middleton, 10.1016/j.aeolia.2016.12.001Aeolian Res. 24Middleton, N. (2017). Desert dust hazards: A global review. Aeolian Res. 24, 53-63. doi:10.1016/j.aeolia.2016.12.001
Sand and dust storms: Impact mitigation. N Middleton, U Kang, 10.3390/su906105391053Middleton, N., and Kang, U. (2017). Sand and dust storms: Impact mitigation. Sustainability 9, 1053. doi:10.3390/su9061053
Dust emission size distribution impact on aerosol budget and radiative forcing over the mediterranean region: A regional climate model approach. P Nabat, F Solmon, M Mallet, J F Kok, S Somot, 10.5194/acp-12-10545-2012Atmos. Chem. Phys. 12Nabat, P., Solmon, F., Mallet, M., Kok, J. F., and Somot, S. (2012). Dust emission size distribution impact on aerosol budget and radiative forcing over the mediterranean region: A regional climate model approach. Atmos. Chem. Phys. 12, 10545-10567. doi:10.5194/acp-12-10545-2012
Dust storm event of February 2019 in central and East Coast of Australia and evidence of long-range transport to New Zealand and Antarctica. H D Nguyen, M Riley, J Leys, D Salter, 10.3390/atmos10110653doi:10.3390/ atmos10110653Atmosphere. 10653Nguyen, H. D., Riley, M., Leys, J., and Salter, D. (2019). Dust storm event of February 2019 in central and East Coast of Australia and evidence of long-range transport to New Zealand and Antarctica. Atmosphere 10, 653. doi:10.3390/ atmos10110653
. X Pu, T Wang, X Huang, D Melas, P Zanis, D K Papanastasiou, Pu, X., Wang, T., Huang, X., Melas, D., Zanis, P., Papanastasiou, D. K., et al. (2017).
Enhanced surface ozone during the heat wave of 2013 in Yangtze River Delta region. 10.1016/j.scitotenv.2017.03.056China. Sci. Total Environ. 603Enhanced surface ozone during the heat wave of 2013 in Yangtze River Delta region, China. Sci. Total Environ. 603, 807-816. doi:10.1016/j.scitotenv.2017.03.056
Spatial and temporal distribution of MODIS and MISR aerosol optical depth over northern China and comparison with AERONET. Y Qi, J Ge, J Huang, 10.1007/s11434-013-5678-5Atmos. Sci. 58Qi, Y., Ge, J., and Huang, J. (2013). Spatial and temporal distribution of MODIS and MISR aerosol optical depth over northern China and comparison with AERONET. Atmos. Sci. 58, 2497-2506. doi:10.1007/s11434-013-5678-5
Characteristics and causes of regional sandstorms in Northwest of China from 2000 to 2020. H Qin, X Yang, L Ma, Y Wang, C Fu, J Zhang, J. Desert Res. 42in ChineseQin, H., Yang, X., Ma, L., Wang, Y., Fu, C., Zhang, J., et al. (2022). Characteristics and causes of regional sandstorms in Northwest of China from 2000 to 2020. J. Desert Res. 42, 53-64. (in Chinese).
The MODIS aerosol algorithm, products, and validation. L A Remer, Y J Kaufman, D Tanre, S Mattoo, D A Chu, J V Martins, 10.1175/JAS3385.1J. Atmos. Sci. 62Remer, L. A., Kaufman, Y. J., Tanre, D., Mattoo, S., Chu, D. A., Martins, J. V., et al. (2005). The MODIS aerosol algorithm, products, and validation. J. Atmos. Sci. 62, 947-973. doi:10.1175/JAS3385.1
Aerosol's optical and physical characteristics and direct radiative forcing during a shamal dust storm, a case study. T M Saeed, H Al-Dashti, C Spyrou, 10.5194/acp-14-3751-2014Atmos. Chem. Phys. 14Saeed, T. M., Al-Dashti, H., and Spyrou, C. (2014). Aerosol's optical and physical characteristics and direct radiative forcing during a shamal dust storm, a case study. Atmos. Chem. Phys. 14, 3751-3769. doi:10.5194/acp-14-3751-2014
. P Salvador, F Molero, A J Fernandez, A Tobías, M Pandolfi, F Gómez-Moreno, Salvador, P., Molero, F., Fernandez, A. J., Tobías, A., Pandolfi, M., Gómez-Moreno, F.
Synergistic effect of the occurrence of African dust outbreaks on atmospheric pollutant levels in the Madrid metropolitan area. J , 10.1016/j.atmosres.2019.04.025Atmos. Res. 226J., et al. (2019). Synergistic effect of the occurrence of African dust outbreaks on atmospheric pollutant levels in the Madrid metropolitan area. Atmos. Res. 226, 208-218. doi:10.1016/j.atmosres.2019.04.025
. B H Samset, M Sand, C J Smith, S E Bauer, P M Forster, J S Fuglestvedt, Samset, B. H., Sand, M., Smith, C. J., Bauer, S. E., Forster, P. M., Fuglestvedt, J. S., et al.
Climate impacts from a removal of anthropogenic aerosol emissions. 10.1002/2017GL076079Geophys. Res. Lett. 45Climate impacts from a removal of anthropogenic aerosol emissions. Geophys. Res. Lett. 45, 1020-1029. doi:10.1002/2017GL076079
Radiative and climatic effects of dust over West Africa, as simulated by a regional climate model. F Solmon, N Elguindi, M Mallet, 10.3354/cr01039Clim. Res. 52Solmon, F., Elguindi, N., and Mallet, M. (2012). Radiative and climatic effects of dust over West Africa, as simulated by a regional climate model. Clim. Res. 52, 97-113. doi:10.3354/cr01039
Aerosol modelling for regional climate studies: Application to anthropogenic particles and evaluation over a European/african domain. F Solmon, F Giorgi, C Liousse, 10.1111/j.1600-0889.2005.00155.xTellus Ser. B Chem. Phys. Meteorol. 58Solmon, F., Giorgi, F., and Liousse, C. (2006). Aerosol modelling for regional climate studies: Application to anthropogenic particles and evaluation over a European/african domain. Tellus Ser. B Chem. Phys. Meteorol. 58, 51-72. doi:10.1111/j.1600-0889.2005.
The optical properties of East Asian dust aerosol and its impact on radiative forcing and temperature. X Su, K Li, Q Wer, Wen , W , 10.7522/j.issn.1000-694X.2015.00154J. Desert Res. 36in ChineseSu, X., Li, K., Wer, Q., and Wen, W. (2016). The optical properties of East Asian dust aerosol and its impact on radiative forcing and temperature. J. Desert Res. 36, 1381-1390. (in Chinese). doi:10.7522/j.issn.1000-694X.2015.00154
Validation of RegCM-Dust model for simulating a sand-dust storm in East Asia. X Su, H Sun, S Bian, 10.12013/qxyjzyj20222-021Meteorology Disaster Reduct. Res. 45in ChineseSu, X., Sun, H., and Bian, S. (2022). Validation of RegCM-Dust model for simulating a sand-dust storm in East Asia. Meteorology Disaster Reduct. Res. 45, 145-150. (in Chinese). doi:10.12013/qxyjzyj20222-021
Prediction on dust in spring during 2015-2100 over East Asia under A1B scenario. X Su, Z Zhang, L Ou, 10.7522/j.issn.1000-694X.2015.00226doi:10. 7522/j.issn.1000-694X.2015.00226J. Desert Res. 37in ChineseSu, X., Zhang, Z., and Ou, L. (2017). Prediction on dust in spring during 2015- 2100 over East Asia under A1B scenario. J. Desert Res. 37, 315-320. (in Chinese). doi:10. 7522/j.issn.1000-694X.2015.00226
Analysis of dust events in 2008 and 2009 using the lidar network, surface observations and the CFORS model. N Sugimoto, Y Hara, A Shimizu, T Nishizawa, I Matsui, M Nishikawa, 10.1007/s13143-013-0004-3doi:10.1007/ s13143-013-0004-3Asia-Pac. J. Atmos. Sci. 49Sugimoto, N., Hara, Y., Shimizu, A., Nishizawa, T., Matsui, I., and Nishikawa, M. (2013). Analysis of dust events in 2008 and 2009 using the lidar network, surface observations and the CFORS model. Asia-Pac. J. Atmos. Sci. 49, 27-39. doi:10.1007/ s13143-013-0004-3
Evaluation of MODIS Deep Blue aerosol algorithm in desert region of East Asia: Ground validation and intercomparison. M Tao, L Chen, Z Wang, J Wang, H Che, X Xu, 10.1002/2017jd026976doi:10.1002J. Geophys. Res. Atmos. 122Tao, M., Chen, L., Wang, Z., Wang, J., Che, H., Xu, X., et al. (2017). Evaluation of MODIS Deep Blue aerosol algorithm in desert region of East Asia: Ground validation and intercomparison. J. Geophys. Res. Atmos. 122, 10357-10368. doi:10.1002/ 2017jd026976
Influence of spring dust aerosol on radiation over the arid area in Hexi Corridor. L Tian, W Zhang, Z Chang, J Mu, N Cao, S Ma, 10.12118/j.issn.1000-6060.2018.05.03Arid. Land Geogr. 41in ChineseTian, L., Zhang, W., Chang, Z., Mu, J., Cao, N., and Ma, S. (2018). Influence of spring dust aerosol on radiation over the arid area in Hexi Corridor. Arid. Land Geogr. 41, 923-929. (in Chinese). doi:10.12118/j.issn.1000-6060.2018.05.03
Simulation of the direct and semidirect aerosol effects on the southern Africa regional climate during the biomass burning season. F Tummon, F Solmon, C Liousse, M Tadross, 10.1029/2009JD013738doi:10.1029/ 2009JD013738J. Geophys. Res. Atmos. 11519206Tummon, F., Solmon, F., Liousse, C., and Tadross, M. (2010). Simulation of the direct and semidirect aerosol effects on the southern Africa regional climate during the biomass burning season. J. Geophys. Res. Atmos. 115, D19206. doi:10.1029/ 2009JD013738
Parameterization of the singlescattering properties of dust aerosols in radiative flux calculations. M Wang, J Su, X Li, C Wang, J Ge, 10.3390/atmos10120728Atmosphere. 10728Wang, M., Su, J., Li, X., Wang, C., and Ge, J. (2019). Parameterization of the single- scattering properties of dust aerosols in radiative flux calculations. Atmosphere 10, 728. doi:10.3390/atmos10120728
Climatology of dust-forced radiative heating over the Tibetan Plateau and its surroundings. T Wang, Y Han, J Huang, M Sun, B Jian, Z Huang, 10.1029/2020JD032942J. Geophys. Res. Atmos. 125Wang, T., Han, Y., Huang, J., Sun, M., Jian, B., Huang, Z., et al. (2020). Climatology of dust-forced radiative heating over the Tibetan Plateau and its surroundings. J. Geophys. Res. Atmos. 125, e2020JD032942. doi:10.1029/2020JD032942
Observation study of dust aerosols' transport and climate effect. W C Wang, LanzhouLanzhou UniversityWang, W. C. (2013). Observation study of dust aerosols' transport and climate effect. Lanzhou: Lanzhou University.
Estimation of radiative effect of a heavy dust storm over northwest China using Fu-Liou model and ground measurements. W Wang, J Huang, T Zhou, J Bi, L Lin, Y Chen, 10.1016/j.jqsrt.2012.10.018J. Quant. Spectrosc. Ra. 122Wang, W., Huang, J., Zhou, T., Bi, J., Lin, L., Chen, Y., et al. (2013). Estimation of radiative effect of a heavy dust storm over northwest China using Fu-Liou model and ground measurements. J. Quant. Spectrosc. Ra. 122, 114-126. doi:10.1016/j.jqsrt.2012. 10.018
Surface measurements of aerosol properties over northwest China during ARM China. X Wang, J Huang, R Zhang, B Chen, J Bi, deploymentWang, X., Huang, J., Zhang, R., Chen, B., and Bi, J. (2010). Surface measurements of aerosol properties over northwest China during ARM China 2008 deployment.
. 10.1029/2009JD013467J. Geophys. Res. Atmos. 115J. Geophys. Res. Atmos. 115, D00K27. doi:10.1029/2009JD013467
Spatial and temporal evolution of natural and anthropogenic dust events over northern China. X Wang, J Liu, H Che, F Ji, J Liu, 10.1038/s41598-018-20382-5doi:10. 1038/s41598-018-20382-5Sci. Rep. 82141Wang, X., Liu, J., Che, H., Ji, F., and Liu, J. (2018). Spatial and temporal evolution of natural and anthropogenic dust events over northern China. Sci. Rep. 8, 2141. doi:10. 1038/s41598-018-20382-5
. Frontiers in Environmental Science frontiersin.org. Frontiers in Environmental Science frontiersin.org
Visibility: Science and regulation. J G Watson, J D Bachmann, S S Wierman, C Mathai, W C Malm, W H White, 10.1080/10473289.2002.10470844J. Air Waste Manage. Assoc. 52Watson, J. G., Bachmann, J. D., Wierman, S. S., Mathai, C., Malm, W. C., White, W. H., et al. (2002). Visibility: Science and regulation. J. Air Waste Manage. Assoc. 52, 973-999. doi:10.1080/10473289.2002.10470844
Can climate models reproduce the decadal change of dust aerosol in East Asia?. C Wu, Z Lin, X Liu, Y Li, Z Lu, M Wu, 10.1029/2018GL079376Geophys. Res. Lett. 45Wu, C., Lin, Z., Liu, X., Li, Y., Lu, Z., and Wu, M. (2018). Can climate models reproduce the decadal change of dust aerosol in East Asia? Geophys. Res. Lett. 45, 9953-9962. doi:10.1029/2018GL079376
Numerical modeling of ozone damage to plants and its effects on atmospheric CO 2 in China. X Xie, T Wang, X Yue, S Li, B Zhuang, M Wang, Xie, X., Wang, T., Yue, X., Li, S., Zhuang, B., Wang, M., et al. (2019). Numerical modeling of ozone damage to plants and its effects on atmospheric CO 2 in China.
. 10.1016/j.atmosenv.2019.116970Atmos. Environ. 217116970Atmos. Environ. 217, 116970. doi:10.1016/j.atmosenv.2019.116970
Ten years of aerosol effects on single-layer overcast clouds over the US Southern Great Plains and the China Loess Plateau. H Yan, Wang , T , 10.1155/2020/6719160Adv. Meteorol. 6719160Yan, H., and Wang, T. (2020). Ten years of aerosol effects on single-layer overcast clouds over the US Southern Great Plains and the China Loess Plateau. Adv. Meteorol. 6719160, 1-15. doi:10.1155/2020/6719160
Study of the impact of summer monsoon circulation on spatial distribution of aerosols in East Asia based on numerical simulations. L Yan, X Liu, P Yang, Z Yin, G North, 10.1175/2011JAMC-D-11-06.1J. Appl. Meteorol. Climatol. 50Yan, L., Liu, X., Yang, P., Yin, Z., and North, G. (2011). Study of the impact of summer monsoon circulation on spatial distribution of aerosols in East Asia based on numerical simulations. J. Appl. Meteorol. Climatol. 50, 2270-2282. doi:10.1175/2011JAMC-D-11- 06.1
Implementation and testing of a desert dust module in a regional climate model. A S Zakey, F Solmon, Giorgi , F , 10.5194/acp-6-4687-2006doi:10. 5194/acp-6-4687-2006Atmos. Chem. Phys. 6Zakey, A. S., Solmon, F., and Giorgi, F. (2006). Implementation and testing of a desert dust module in a regional climate model. Atmos. Chem. Phys. 6, 4687-4704. doi:10. 5194/acp-6-4687-2006
Projected climate change in Guizhou during 2018-2050. J Zhang, Y Li, Z Wu, Z Chen, Yang , Y , Meteorological Sci. Technol. 46in ChineseZhang, J., Li, Y., Wu, Z., Chen, Z., and Yang, Y. (2018). Projected climate change in Guizhou during 2018-2050. Meteorological Sci. Technol. 46, 1165-1171. (in Chinese).
Diagnosis of sandstorm weather process and analysis of sand pollution transportation in northern China from 14th to 16 th. L Zhang, G Song, F Fan, H Wu, Y Zou, Z Zhou, 10.13671/j.hjkxxb.2021.0452doi:10. 13671/j.hjkxxb.2021.0452Acta Sci. Circumstantiae. 42Zhang, L., Song, G., Fan, F., Wu, H., Zou, Y., Zhou, Z., et al. (2022). Diagnosis of sandstorm weather process and analysis of sand pollution transportation in northern China from 14th to 16 th , March 2021. Acta Sci. Circumstantiae 42, 351-363. doi:10. 13671/j.hjkxxb.2021.0452
Growth rates of fine aerosol particles at a site near Beijing in. C Zhao, Y Li, F Zhang, Y Sun, Wang , P , 10.1007/s00376-017-7069-3doi:10.1007/ s00376-017-7069-3Adv. Atmos. Sci. 35Zhao, C., Li, Y., Zhang, F., Sun, Y., and Wang, P. (2018). Growth rates of fine aerosol particles at a site near Beijing in June 2013. Adv. Atmos. Sci. 35, 209-217. doi:10.1007/ s00376-017-7069-3
Dust emission and transport in northwest China: WRF-chem simulation and comparisons with multi-sensor observations. J Zhao, X Ma, S Wu, Sha , T , 10.1016/j.atmosres.2020.104978Atmos. Res. Zhao, J., Ma, X., Wu, S., and Sha, T. (2020). Dust emission and transport in northwest China: WRF-chem simulation and comparisons with multi-sensor observations. Atmos. Res. 241, 104978. doi:10.1016/j.atmosres.2020.104978
Dust characteristics observed by unmanned aerial vehicle over the Taklimakan Desert. C Zhou, Y Liu, Q He, X Zhong, Q Zhu, F Yang, 10.3390/rs14040990Remote Sens. 144990Zhou, C., Liu, Y., He, Q., Zhong, X., Zhu, Q., Yang, F., et al. (2022a). Dust characteristics observed by unmanned aerial vehicle over the Taklimakan Desert. Remote Sens. 14 (4), 990. doi:10.3390/rs14040990
In situ observation of warm atmospheric layer and the heat contribution of suspended dust over the Tarim Basin. C Zhou, Y Liu, Q Zhu, Q He, T Zhao, F Yang, 10.5194/acp-22-5195-2022Atmos. Chem. Phys. 22Zhou, C., Liu, Y., Zhu, Q., He, Q., Zhao, T., Yang, F., et al. (2022b). In situ observation of warm atmospheric layer and the heat contribution of suspended dust over the Tarim Basin. Atmos. Chem. Phys. 22, 5195-5207. doi:10.5194/acp-22-5195-2022
. Frontiers in Environmental Science frontiersin.org. Frontiers in Environmental Science frontiersin.org
| The Progress in Electron Microscopy Studies of Particulate Matters to Be Used as a Standard Monitoring Method for Air Dust Pollution | Abstract This paper reviews the rationale of the methods that are currently used to determine the performance of aerosol samplers. Emphasis is placed on the performance indices that are required and those methods that are the most suitable to provide a valid determination of those indices. The specific example of health-related sampling (for which there is considerable interest and activity) is used to focus the discussion. | 1,999,842 | Aeolian dust deposition is one of the main processes for the exchange between atmosphere and earth-surface, which indicates important environmental information. But now the monitoring of Aeolian dust deposition is insufficient for relating research. Based on current monitoring procedure, the methods to measure dust deposition could be classified into tow: dry and wet way, according to different sampling medium. Compared on the monitor results carried on the flat roof of Yifu2# building in Peking university, sampling amount by dry way is 76% of the wet way. Any way by vessel, no matter dry or wet, could not simulate natural dust deposit completely. Therefore the data should be rectified grounding on the regional geography. Establishing the monitoring network for Aeolian dust deposition is discussed at the end of this paper. | Direct measurement of atmospheric dry deposition to natural surfaces in a semiarid region of north central India | Determination of Al, Ca, V and Mn by INAA: Application to the Reference Material IAEA-395 “Urban Dust” | Applications of PVDF dust sensor systems in space | Abstract We made carbon and oxygen isotope analyses on the carbonates in atmospheric dust samples (hereafter, atmospheric dust carbonates) over the saline land of Songnen Plain (SSL) and at Changchun, 50 km eastward from the east margin of SSL, as well as in the surface soil samples in SSL. The atmospheric dust carbonates from SSL and Changchun had similar carbon isotopic composition as the soil carbonates from SSL, while showing a distinct difference with the atmospheric dust carbonates in the northwestern Chinese deserts. The atmospheric dust carbonates for two of the three heavy dust storms at Changchun had a similar carbon isotopic composition as those in SSL. The dust emission from SSL makes a significant contribution to the dust storms in the downwind area. Carbon isotopic composition of the atmospheric dust carbonates should be a useful indicator for inferring the dust source. We have also noted a depleting trend of 13C of atmospheric dust carbonates from west to east over northern China. The incorporating process of dust generated in areas under the pathway of the Asian dust transport might be investigated from the carbon isotopic composition in atmospheric dust carbonates. | Rock Varnish: A Passive Forensic Tool for Monitoring Recent Air Pollution and Source Identification | Understanding new particle formation and their subsequent growth in the troposphere has a critical impact on our ability to predict atmospheric composition and global climate change. High pre-existing particle loadings have been thought to suppress the formation of new atmospheric aerosol particles due to high condensation and coagulation sinks. Here, based on field measurements at a mountain site in South China, we report, for the first time, in situ observational evidence on new particle formation and growth in remote ambient atmosphere during heavy dust episodes mixed with anthropogenic pollution. Both the formation and growth rates of particles in the diameter range 15-50 nm were enhanced during the dust episodes, indicating the influence of photo-induced, dust surface-mediated reactions and resulting condensable vapor production. This study provides unique in situ observations of heterogeneous photochemical processes inducing new particle formation and growth in the real atmosphere, and suggests an unexpected impact of mineral dust on climate and atmospheric chemistry. | A general relationship between roadway tunnel air quality and vehicle emissions has been derived. The model includes the effect of pollutant deposition on the tunnel surfaces and dilution from ventilation. The model is applied to air quality measurements of SO2 and particulates obtained at the Tuscarora Mountain Tunnel. It is found that, if deposition is neglected, SO2 and sulfate emission factors for both gasoline and Diesel vehicles may be underestimated by ~ 10%. The derived deposition velocities are 0.07cms−1 for SO2, 0.03cms−1 for sulfate, and ~ 0.001 cms−1 for total suspended particulates and paniculate components (except sulfate). The last value is lower than smooth-surface values quoted for aerosol deposition, and the difference between the last two values presumably reflects the approximations in the model and/or the uncertainty in its input data. | Study on Improving the Atmosphere Environmental Quality of Tianjin -Anatomy of Nankai District |
1,999,843 | Strength of Ta-Si interfaces by molecular dynamics | ABSTRACT The measurement results about trapping energy level of the mobile ions in SiO2 at both interfaces for poly Si-SiO2-Si system are reported with TSIC method. A new approximation method to calculate the initial energies distributions of ions among the interface trapping states is presented. It is intuitively simplier and clearer than one's suggested by Boudry and Stagg. We have pointed out that is unfeasible to calculate trapping energy levels with the relation between 1n σ and 1/T presented by Kuhn and Silversmith in 1971. | Abstract We examine the cyclotron resonance of Si(100) surface electrons at interfaces with deliberate and controlled Na + concentrations. At densities below 10 11 Na + cm -2 an unexpectedly strong damping and subsequent recovery of the resonance is found. For high Na + concentrations we confirm the scattering rate found from mobility studies, but disagree considerably with the SdH results. | Tight-binding molecular dynamics (TBMD) simulations are performed (i) to evaluate the formation and binding energies of point defects and defect clusters, (ii) to compute the diffusivity of self-interstitial and vacancy in crystalline silicon, and (iii) to characterize the diffusion path and mechanism at the atomistic level. In addition, the interaction between individual defects and their clustering is investigated. | We simulate the liquid silicon surface with first-principles molecular dynamics in a slab geometry. We find that the atom-density profile presents a pronounced layering, similar to those observed in low-temperature liquid metals like Ga and Hg. The depth-dependent pair correlation function shows that the effect originates from directional bonding of Si atoms at the surface, and propagates into the bulk. The layering has no major effects in the electronic and dynamical properties of the system, that are very similar to those of bulk liquid Si. To our knowledge, this is the first study of a liquid surface by first-principles molecular dynamics. | Abstract The experimental ability to reach rapidly, under UHV and on the same substrate holder, the high temperatures (1100 K) required for silicon surface reconstructions and the low temperatures (80 K) needed to condense ammonia molecularly or to adsorb this gas dissociatively on specific silicon surface states, allowed us to elaborate thin multilayers made up of various combinations of the nitrogen chemical environments involved in the Si/NH 3 system. Included in a surface laye ( 3 ), amide (NH 2 ) and imide (NH) fragments and nitrides (Si 3 N) by simultaneously and easily comparable N 1s core level recordings. The results confirm that beside the T s dependence of the degree of dissociation of NH 3 , the silicon surface state configuration (Si(100)-2 × 1. Si(111)-7 × 7 a-Si) is another important parameter explaining the presence of differently adsorbed N, NH or NH 2 groups. | Time Evolution of a Cl-Terminated Si Surface at Ambient Conditions | We have investigated the integration of Hf-based material as Inter Poly Dielectric in flash memories devices. Electrical measurements showed the good properties of SiO 2 /HfO 2 /SiO 2 stacks. We then interested to the impact of the thermal budget on this specific stack which induces changes in the electrical properties. XPS measurements suggests those changes are due to the presence of an Hf-silicate layer at the SiO 2 /HfO 2 interface. | Molecular Dynamics Simulation of the Crystal Orientation and Temperature Influences in the Hardness on Monocrystalline Silicon | 1,999,843 | Abstract Miniaturization of electronic devices leads to nanoscale structures in the near future. In these length scales the technological choice for metalization and interconnect material seems to be copper mainly because of its low electrical resistance and resistivity against electromigration. In copper metalization a barrier layer between copper and silicon is needed to prevent diffusion. Tantalum seems to be the most common barrier metal. We use a modified embedded atom potential and molecular dynamics to study the energy, structure, and strength of Ta–Si interfaces. The interfacial energy has a negative correlation between the strength of the interface. We propose that mixing on the interface has an important role in interface strength. | Characterization of “Ultrathin-Cu”/Ru(Ta)/TaN Liner Stack for Copper Interconnects | Electronic Properties of Semiconductor Interfaces | Effects of Ion Bombardment on Metal-Silicon Interface | INTERFACE ELECTRONIC STRUCTURE OF TA2O5-AL2O3 ALLOYS FOR SI-FIELD-EFFECT TRANSISTOR GATE DIELECTRIC APPLICATIONS | Band gap engineering of (N, Si)-codoped TiO2 from hybrid density functional theory calculations | Strain effect and intermixing at the Si surface: A hybrid quantum and molecular mechanics study | Tuning thermal conductance across sintered silicon interface by local nanostructures | Copper Direct-Bonding Characterization and Its Interests for 3D Integration |
1,999,844 | low stress part-time jobs for students? | If you are between the ages of 18 and 35 you may be eligible to participate in a paid research study examining different strategies for responding to stress. This study includes one 3.5 hour lab visit with:
\-psychological questionnaires
\-three 5-minute bouts of aerobic exercise at varying intensities
\-a recorded speech task -measurements of height, wight and resting heart rate 0 -2 saliva samples
\-Compensation for your participation is $35
Complete this short survey to see if you are eligible to participate:
For more information, please visit | I've planned to go into Epi for a few years. But now I'm at a place in my life where I want to like.. relax. Not have extra stress. I have a lot of life goals I want to accomplish outside of work while still wanting to do something in public health.
I have a job now at a hospital as a nutrition tech and I like this level of stress (but don't want to talk to so many people lol). I go there and work hardcore, but then I have NOTHING to do or stress out at home. Very set hours, rarely work more than 15 minutes later.
Are there particular jobs in Epi that are more or less stressful? Or anything closely related that's more what I like? | Where you can find a part time job? | The 5 minute Stress Solutions contains some great advice on handling stress with small segments of time, it offers great ideas one of which is my favortie for dealing with stress... Eat Some Chocolate... but not too much, evidently dark chocolate actually helps you reduce stress :). | How do stress management programs treat stress? | Examines the issues of work‐related stress in the health‐care professions, focusing on junior medical and dental staff. Identifies the stressors, and reports on an interview survey conducted as part of a larger study funded by the NHS Management Executive to identify the levels of stress. Concludes that outsourcing to an independent counselling service could prove to be an effective stress management strategy. | How do you handle work stress in general? | For anyone who is or has worked full-time or part time (like a little more than 15 hours a week at least) while being a full time student, how did you juggle both? I currently work, but only part time and only on weekends. However, I anticipate getting a job that may be requiring me to work at least 20 hours during this coming fall term. This is more than I currently work which is about 14 hours a week. I am just curious how you balance your time. If you have any useful tips that have helped you while doing both, please feel free to share. I am open to hearing anyone’s experience, but preferably someone in STEM since that is what I am doing. Thanks in advance! | 1,999,844 | Hello everyone,
Starting RT school in less than two months and just wondering what kind of jobs you have worked during your studies? What was your schedule like? Low stress jobs? I have always worked full-time my whole career so stepping down into a part-time scares me, mostly because I have to handle my bills on my own (just basic things like credit cards, car payment, phone, gym, etc.). I'm fortunate enough that I do not have to worry about rent because my fiance is taking care of that.
Your feedback is appreciated :) | Should I switch from full-time to part-time to focus on my study? | Attending college soon, looking for part time work. Need resume advice. | Full time to part time student | Working Full-time and studying | College kids, what are you currently stressing about? | Are there any possible unemployment benefits for full-time students? | Studying part-time as a 'mature student' is NOT a waste of time... | Can part-time jobs give you credit if you work 15 hrs a week per semester |
1,999,845 | What is a rap song thats nothing but bass? | What are some really gangster rap songs? | I'm not big into rap, but sometimes I enjoy it, so I wanted to see if there were any songs that featured some kind of rap in them or maybe some kind of "Punk Goes Crunk" or something. | Hey y’all, I don’t make money on my songs and they’re just for fun. So if you wanna rap on a weird but okay rap beat, hit me up!
(My SoundCloud is failed2abort) | What is the differece between hip hop and rap? | Freestyle rap lyrics? | How many songs have N-Dubz make? | Things that rhyme with rapping? | I'm looking for songs that have a long intro with no bass (to build tension), and then kick hard. I want these for when I show off my subs at shows and to friends. I prefer rap or edm songs but anything would be appreciated! | 1,999,845 | What song has a lot of bass? | What song best illustrates the importance of the bass in music? | good songs with really good bass? | Less known songs with awesome bass lines | Best songs with heavy bass drops? | Anybody know any indie songs with good basslines? | Bass solos in popular songs | Why do you suppose bass is always buried in the mix? | What kinda bass guitar is this? |
1,999,846 | when did area 51 come out in arcades | video game review aggregator Metacritic. In 2004, ahead of the game's release, Paramount Pictures announced that they had reached an agreement concerning the film rights for the game. In March 2007, comic book author Grant Morrison was hired to adapt the game as a screenplay. This project is unrelated to the movie "Area 51" by Oren Peli. Area 51 (2005 video game) Area 51 is a science fiction first-person shooter video game that was released in 2005. It was developed by Midway Studios Austin and published by Midway for the PlayStation 2, Xbox, and Microsoft Windows. It is a loose | Area 51 (2005 video game) uses a teleporter to escape into the Nevada desert. He lands by the "White Mailbox" area and watches Area 51 being destroyed by the exploding ship in a tornado like explosion. Cole watches as a truck drives past, with a green, alien-like container on board with unknown contents inside and walks away from the site. He reflects upon his original purpose at Area 51 and recognizes that while he and Hazmat Team Bravo had failed, their sacrifices may have saved mankind. The PlayStation 2 version received "generally favorable reviews", while the PC and Xbox versions received "average reviews", according to | the fact they were not able to test the game properly. He lost his job at Midway soon after making this comment. BlackSite: Area 51 BlackSite: Area 51 (released in Europe and Australia as BlackSite) is a first-person shooter video game, released for Xbox 360 and Microsoft Windows on November 12, 2007 in North America, and PlayStation 3 on December 10, 2007. The game is mostly unrelated to the 2005 multi-platform game "Area 51". The game was developed by Midway Austin and published by Midway Games. "BlackSite: Area 51" features standard first-person shooter gameplay. It uses a regenerating health system; | BlackSite: Area 51 BlackSite: Area 51 (released in Europe and Australia as BlackSite) is a first-person shooter video game, released for Xbox 360 and Microsoft Windows on November 12, 2007 in North America, and PlayStation 3 on December 10, 2007. The game is mostly unrelated to the 2005 multi-platform game "Area 51". The game was developed by Midway Austin and published by Midway Games. "BlackSite: Area 51" features standard first-person shooter gameplay. It uses a regenerating health system; additionally the player's character can absorb relatively large amounts of gunfire before dying. The game features six different weapons, though only two | Underground comix "", co-edited by Spiegelman and Bill Griffith. With the underground movement encountering a slowdown, Spiegelman and Griffith conceived of "Arcade" as a "safe berth," featuring contributions from such major underground figures as Robert Armstrong, Robert Crumb, Justin Green, Aline Kominsky, Jay Lynch, Spain Rodriguez, Gilbert Shelton, and S. Clay Wilson (as well as Griffith and Spiegelman). "Arcade" stood out from similar publications by having an editorial plan, in which Spiegelman and Griffith attempted to show how comics connected to the broader realms of artistic and literary culture. "Arcade" lasted seven issues, from 1975 to 1976. Autobiographical comics began to come | Arcade (TV series) upgraded control rooms and cameras and, of course, the construction of the massive "Arcade" set itself. Not long before the show was axed, there was talk the series might be moved to a later timeslot allowing it to become a bit "raunchier" (similar to the hit series Number 96) and a large new set had been built featuring a "western-style" saloon bar, so that more of the action could take place in a venue that supplied alcohol. There were also moves (before the show was axed) to have some of the regular characters "perform" in the bar/nightclub setting, as many | Hey everyone!
Here is a video showcasing almost all of the exploits in the Halo 5 Arena maps. The exploits I excluded include the Coliseum under blue cave, on top of Fathom, and a few others.
I hope this can be used to help people know where people may hide, or just for fun.
Thank you!
*SEE COMMENTS FOR LINK* | of someone's urban nightmare." "Detroit Free Press" gave the PS2 version one star out of four and stated that it "lacks everything that would make it new, innovative or just plain fun. The graphics are really muddy and sub-par. The controls seem to be a bit confusing." 25 to Life 25 to Life is a third-person shooter video game for Microsoft Windows, PlayStation 2, Xbox and released in 2006. The game was developed by Avalanche Software and published by Eidos Interactive. Set in a modern environment, the game allows the player to play as both a cop and a gangster, | 1,999,846 | Area 51 (series) released into arcades in 1995, and ported in 1996 to the PlayStation, Sega Saturn and PC. A sequel, "" was released by Atari in 1998. Unlike the original, it was not ported to any home consoles. Like all of Atari Games' products, it was absorbed into Midway Games' portfolio after Midway's shutdown of Atari Games in 2003. Midway subsequently rebooted the franchise as a first-person shooter. In 2005, "Area 51" was released by Midway for the PlayStation 2, Xbox and Microsoft Windows platforms. A sequel, "" was released in 2007 for the PlayStation 3, Xbox 360 and Windows. On August | when did area 51 come out for ps3 | who made the video game area 51 | Pete Hines Says Bethesda Never Planned to Give Up on Fallout 76 | How do I properly use the P-51 in arcade? | what console did sega discontinue in march of 2001 | when did area 51 receive the fsd prototype | when did they stop using engine 51 | when did interplay's rights to fallout 2 expire |
1,999,847 | What did Mother Teresa do for a living? | What did mother teresa go through to help the poor? | Was mother teresa a st? | Why did Mother Teresa became a nun? | Where did mother teresa learn to become a nun? | How tall was Mother Teresa? | What has mother teresa worked for? | How did mother teresa make an impact on others' lifes? | What did mother teresa do with hr money? | 1,999,847 | What did mother teresa do fo a living? | Mother teresa real name? | How did the mother teresa's mother die? | What lanugage did mother teresa speak? | Why did mother teresa work? | How old would mother teresa be right now in her coffin? | What was mother teresa's goal and dreams? | What did mother teresa train to become? | Is mother teresa a st? |
1,999,848 | Not a bad product for those with a weak neck | The good thing is you can pull it over your mouth if you need to. The bad thing is that it can be too lose around your neck. Sometimes it's better to have a thicker material hugging your neck outside. This is good if you already have a thin turtleneck on. | I chose this product because of the high neck. However, the neck is somewhat flimsy and fits too loosely around my neck. | My husband LOVES this!1 He says it makes the job so much easier. Saves your neck and arms too! Wish we knew about this sooner!! Get it, you'll be happy you did!! | Works. Need to be a little longer if u plan on wearing around your neck. | It's too big for me and does not fit snuggly around my neck. Unfortunately I am disappointed, I won't be able to use this product and it was pretty pricey. | After using it for a month,
I'm very satisfied with how precisely and easily it can be adjusted.
My neck pain from head bending has gone.
This product is very good. | Had to buy a second for my husband because he kept stealing it! We both love it. I have extensive neck issues, and this truly helps. Worth every penny. | Looks great, helps with the neck, BUT I fear the mesh will wear out and gets lose .... I only have it for a week and I feel the mesh is already stretching to much, so my head is on the floor already | 1,999,848 | I only use 25 pounds and the harness is tattered/ripping. Not a bad product for those with a weak neck, but those with a strong nape should look elsewhere. | Head and neck wear, what do you use? | Neckline is a bit sloppy/too big but the rest of ... | but it feels like the backpack wants to ride more on my neck ... | I have a Boxer and this is very nice. She does not have to strain her neck ... | [help] need recommendations for head collar / harness | No neck support, would not recommend | What a truly fantastic product for real neck support for a degeneration condition | Neck area bigger than most harnesses |
1,999,849 | What do you call Gara using an Archwing gun? | What are gatling guns used for? | I know a regular minigun this combo is one of the most glitched, but is it for gauss as well? | As the title says, boltguns, bolt pistols or something else? | What darts dose the nerf vulcan use? | What darts can a nerf firefly shoot? | Who used axe weapons in lord of the rings? | Was killing scorched with the Gatling Gun and the achievement popped "Kill Scorched with a Pistol (76)". So for all you that were wondering.. it's a pistol. | im 2 days away from it. with the ability to rename melee weapons at hoks anvil i'm thinking of renaming it. are there any weapons that are like the zenistar? from like myths or legends or something? or other videogames? | 1,999,849 | A glass cannon
PS. DE can we please have a line of Archwing weapon matching the themes for some of the recent Warframes? :) | [Suggestion] Obsidian Hand Cannon | Need help locating a Thalmor Themed Glass Weapon retexture. | forsaken exotic hand cannon? | PVE Anaconda Weapons Layout Tips? | Can we choose what our weapons will look like? | Weekday Weapon Discussion for 9/27: The Back Scatter | what year is the artifact in camouflage set | Hand Cannons similar to Ikelos_HC? |
1,999,850 | Essential for students! | A superb resource of practical information. As far as I am concerned this stuff is essential reading, and essential practice. | The Essential Features of Undergraduate Research | Information on good student? | What are the most important factors in student performance? | Worked perfect in my. Classroom. Exactly as described | Able to comply w/ school requirements for daughter's college courses. Will be planning to purchase additional books in the future | High school teachers are like: Don't worry, you'll learn this in university.
Uni profs are like: You should already know this material from high school.
Me:
Professor Parkinson | Most college courses can be self-taught and don't require college/university.
Sometimes you'll hear a person say they can't wait to take a class and learn such-and-such, but what surprises me is how often these classes have all the resources to "learn" them readily available. Textbooks, videos, and syllabi are out there for much of what's taught in classrooms.
I recognize that instructors are useful for their ability to answer questions and to elaborate on difficult topics. But "useful" isn't nearly the same as "necessary", or even as "very important". I also recognize that some classes make use of labs or "clinicals" and these can't be substituted for by oneself. But for so many classes that work out of books, this isn't applicable.
I'm not someone that thinks college is some unnecessary expense either. I recognize it has value and that it's necessary as a certifying body.
I just think that with all the resources available, so much of what's done in the classroom is redundant, unnecessary, and wholly available for many students to do on their own - and that last point is something that seems to escape most students. | 1,999,850 | The best notebook around! These have fabric over the spiral, so no snags. They also have heavy duty plastic front and back so no mushing pages and bends! These are essential for any student. They are cheaper here than anywhere, and believe me, I've priced them all over the place! | Great notebook. The pages are nice and thick so ... | High quality hardcover notebooks | Beautiful notebook for a journal or work notes | Make a book for replaceable notebooks | good notebook, crummy binding | Beware - very soft, flimsy cover - large book holder with spine support required | Good notebooks for grad school? (Philosophy) | Notebook pages: Fear of Efficiency |
1,999,851 | What human activities increase co2? | What are the main human activities which induce Carbon dioxide? | What human activities may increase the level of greenhouse in the atmosphere? | How does carbon dioxide damage the earth? | If you increase the amount of CO2, the other necessary essentials for plants to grow will become limiting factors, meaning they’re halting the speed of growth. So more CO2 may help plants to grow faster, but for the plants to continue growing faster, they’d also need the other essentials to remain at high amounts high or increase such as light, water, etc. | Cutting down the trees will produce more carbon dioxide? | How does increased carbon dioxide in the atmosphere would benefit plants? | What human activities form parts of the carbon cycle? | Below is a small article I put together explaining why the CO2 increase could be natural. It's only an armchair skeptic's view of the situation and I am sure I have left out important points.
| 1,999,851 | What human activities might tend to increases the greenhouse effect? | What human activities can help increase the greenhouse effect? | How could humans effect the greenhouse effect? | What are 3 human actions that lead to the greenhouse effect? | How can people reduce greenhouse effect? | What is the enhanced greenhouse effect? | The increased greenhouse effect-A general review | What is meant by the enhanced greenhouse effect? | The Greenhouse effect is necessary for life on Earth because? |
1,999,852 | Operation Buffalo (1967) | the movie villian, monster, whatever replaced the paint bullets with real bullets in a military camp training exercise, I think it was one of the Chucky movies | Operation Buffalo (1967) while the Marines suffered 2 dead and 29 wounded. In the afternoon Company G engaged another PAVN force and the PAVN lost 118 killed while the Marines suffered 14 dead and 43 wounded. For the remainder of the operation there were no further ground contacts and the Marines only encountered mines and harassing artillery fire. The operation ended on 14 July with total Marine casualties for the operation amounting to 159 killed, 845 wounded and 1 missing. U.S. forces claimed that the PAVN suffered 1,290 killed and a further 513 probably killed. 164 bunkers and 15 artillery and rocket positions | The 612th Tank Destroyer Battalion was a unit of the United States Army during World War II. It played an instrumental role in defending Hofen during the Battle of the Bulge. The specialized tank destroyer unit was attached to various organizations during the war. In December, 1944, the twelve 3-inch guns of Company A were integrated into the defensive positions of the 395th Infantry Regiment and were key to keeping the attacking Sixth Panzer Army from gaining essential objectives in the first days of the offensive.
Organization and training
The 612th Tank Destroyer Battalion was activated as a light battalion at Camp Swift, Texas, on 25 June 1942, under the command of Lt. Col. W. A. Hedden. The cadre of two officers and seventy-three enlisted men were from the 631st Tank Destroyer Battalion. All of the tank destroyer battalions used the same logo, that of a panther eating a caterpillar tread. The logo was widely used at Camp Hood where tank destroyer forces were trained, on uniforms, equipment, and official U.S. Army publications.
The Battalion received its men and moved to Camp Bowie, Texas, on 4 December 1942, where they received basic training. Major Joseph M. Deeley assumed command of the battalion on 27 February 1943.
For advanced training as a self-propelled unit, the battalion first moved to Camp Hood, Texas, on 3 March 1943. The battalion moved back to Camp Swift on 14 June 1943 and participated in the Third Army Maneuvers in Louisiana from September to November 1943, then returned to Camp Swift. On 20 December 1943, the battalion was reorganized as a towed battalion utilizing 3-inch guns and on 26 March 1944 traveled to Camp Kilmer, New Jersey, arriving on 29 March 1944. The battalion embarked on the Ile de France, on 5 April 1944, at the New York Port of Embarkation, and sailed on 7 April 1944.
Arrival on continent
After arriving in England, two platoons of Company B were the first elements to sail from England aboard a LST on 12 June, arriving in France on 14 June. They immediately moved into positions on the line in the 2nd Infantry Division sector, with the mission to provide anti-mechanized protection for the Division. The remainder of Headquarters Company, Company A, elements of Company B and Company C arrived on 16 June.
From 20 June to 10 July, the battalion protected the division from anti-mechanized attack, with elements harassing the enemy with high velocity interdiction fire. All during this time the enemy was looking down on the U.S. positions from Hill 192, and kept the U.S. units covered with continual harassing mortar, artillery, and long range machine gun fire.
On 25 June the rear echelon arrived from England, which completed the battalion's presence in Normandy. On 3 July the battalion lost its first member in a combat death.
Siege of Brest
During August 1944, the battalion participated in the siege of Brest helping to breach the old city walls. The unit was credited with destroying multiple pill boxes, dugouts, machine gun emplacements, an ammunition dump, anti-aircraft guns, large caliber artillery pieces, houses and a large hotel. In destroying these enemy installations and material, the company inflicted more than four hundred casualties upon the enemy.
The battalion then participated in the attack on St. Marc, and although subjected to exceptionally heavy 88mm fire, found it necessary to move to positions fully visible to the Germans so they could place direct fire on German installations. Two platoons entered the city of Brest on 11 September, following closely on the heels of advancing infantry. During the engagement, they received intense sniper fire. Gun crews knocked out a pill box and several enemy observation posts during the day.
Despite heavy counterbattery and sniper fire on all gun positions during the final five days of the siege, the second platoon of Company B fired approximately 200 rounds per day and eliminated a number of pill boxes and other reinforced positions, enabling units of the 29th Infantry Division to steadily move forward. To be effective, tank destroyer guns operated within the front line rifle platoons.
Defense in Battle of the Bulge
On the morning of 27 September, the battalion began a motor march across France and Belgium to Germany. On 13 December 1944, Company A was attached to the 9th Infantry Regimental Combat Team (RCT) and moved to Höfen, Germany to support the planned attack of the 9th RCT with direct fire on Rohren, Germany.
On 15 December the battalion observation post was moved to Wirtzfeld, Belgium to prepare for the attack on the Rohr River Dams.
At 5:30 am on 16 December, after a 30-minute cannon and rocket barrage, the 3rd platoon of Company A was attacked by a strong German force which had penetrated the infantry lines. This became one of the decisive actions of the Battle of the Bulge. The battalion's actions during this action resulted in it being recognized with a Presidential Unit Citation. The enemy was driven off by vigorous counterattacks by Company A, fighting as infantry, and the U.S. lines were restored. Many enemy dead were piled up in front of the lines and 21 POWs were taken.
On 17 December, Company B with the 1st Reconnaissance platoon attached, was detached from the 23rd Infantry Regiment, 2nd Infantry Division, and attached to the 99th Infantry Division. It was moved to the vicinity of Honsfeld, Belgium. The Germans attacked from the southwest with tanks and armored infantry and the platoons were surrounded. Three officers and 110 men being reported as missing in action, along with one officer and 18 men of 1st Reconnaissance platoon.
The morning of 17 December, Company C was attached to the 99th Infantry Division, but on the same day at 2:00 pm was reassigned to the 26th Infantry Regiment of the 1st Infantry Division, and took up defensive positions at Butgenbach, Belgium. Later this day the remnants of Company B were relieved from attachment to the 99th Infantry Division and placed in direct support of the 23rd Infantry Regiment.
Company A was again attacked at Höfen by an enemy force estimated to be about one regiment in size, but they were successfully beaten back. Company C was relieved from attachment to the 26th Infantry Regiment and placed in support of the 38th Infantry Regiment of the 2nd Infantry Division, and took up defensive positions east of Wirtzfeld on 19 December. In Höfen, Company A was attacked by strong enemy forces, and again they repulsed the attack. Eleven men were reported missing in action.
The battalion forward moved to Elsenborn Ridge to the 99th Division Advance Command Post, where Lt. Col. Deeley took command of anti-tank defenses of the 99th Infantry Division on 20 December. On 21 December, Company A had engaged German paratroopers, part of a failed German reinforcement plan. At the end of the year Company A and Company B were relieved from their positions and were converted to self-propelled M-18 tank destroyers in the vicinity of Verviers, Belgium. Company C continued to maintaining its position east of Berg.
Central Europe campaign
On 6 March, the battalion jumped-off on the drive for the Rhine. Traveling from the Roer River dams they encountered little resistance, most in the form of road blocks and scattered mines. There were isolated instances of stubbornly defended towns where machine guns, Panzerfaust teams, and Hitler Youth, along with some Volkssturm, slowed down the drive until the infantry dismounted and cleared the towns while the tanks and destroyers covered them with fire.
Continuing the pursuit along the Roer River valley to the Rhine, the companies targeted retreating columns of Germans, often overrun by speeding U.S. troops. On 11 March the battalion reached the Rhine in the vicinity of Sinzig. The companies deployed to protect the famed Remagen Bridge from enemy attack from the water, firing at boats and floating debris suspected of containing demolitions, and boat loads of enemy escaping across the river. Guns were sited to engage enemy targets across the Rhine. Company C was with the 38th Infantry protecting the south flank of the First Army against an enemy thrust at the bridge from the south.
Company A, Company C and Headquarters crossed the Rhine on 21 March, and the battalion command post was established at Honningen. Company C further attached to Combat Command A of the 9th Armored Division drove along with the combat command up the Rhine and then eastwards through Langscheid, Rechtenbach, Bernfeld, and Homberg. The U.S. 2nd Reconnaissance platoon acted as advance point for the spearhead on the drive to Paderborn, closing in the Ruhr Pocket.
However, on 2 May the battalion began a march into Czechoslovakia, where they relieved elements of the extended Third United States Army in the vicinity of Waldmünchen, Germany. The entire distance was covered in one day through a May snow storm, traveling on the Autobahn to Bayreuth, and east toward the Czechoslovakian border.
Post-war occupation duty
The war ended for the battalion after 10 months and 23 days of fighting across Europe – from Normandy to Plzeň, Czechoslovakia. They had expended 40,149 rounds of 3-inch ammunition, traveled , taking 742 enemy prisoners and killing 1145. They were credited with knocking out 57 machine gun nests, 65 vehicles of all types, 11 tanks and 27 guns from anti aircraft to 6 inch Naval guns. U.S. units held like a stone wall at Höfen, assisting in stopping the German breakthrough in the Ardennes, and fought across Germany on the spearhead.
Commendations and recognition
The unit was awarded the following decorations:
Belgian Fouragere 1940, for the period 20 Dec 44 – 26 Jan 45
Cited in the Order of the Day of the Belgian Army for action in the Ardennes (Company A cited for period 20 Dec 1944–26 Jan 1945
Cited in the Order of the Day of the Belgian Army for action at Elsenborn Crest (612th TD Bn cited for period 13–19 Dec 1944
Cited in the Order of the Day of the Belgian Army for action in the Ardennes (612th TD Bn cited for period 19–20 Dec 1944
Different sources give conflicting information about whether the 612th was awarded a Presidential Unit Citation for their stand at Höfen, Belgium in the battle of the Ardennes. The 612th Tank Destroyer Battalion Association quotes the text of a possible commendation, but no official government record has been found. Lt. Col. McClernand Butler, commanding officer of the 3rd Battalion, 395th Infantry Regiment, wrote a summary of the unit's action and recommended them for a commendation, which was endorsed and forwarded by Lt. Col Joseph M Deeley. Butler's recommendation included the text of the citation quoted by the unit's association web site.
Butler's recommendation for a unit commendation was forwarded up the chain of command to Col. George W. Smythe, commanding officer of the 47th Infantry Division, to which Company A of the 612th had been attached. On 6 March 1945, Smythe wrote that singling out a single unit for meritorious conduct during the battle would be "unfair to the other units participating in the defense" and, "in view of its [Company A's] small losses," he disapproved the award. His decision was supported by 2nd Infantry Division Headquarters and commanding general of V Corps. On 5 April 1945, Col. S. E. Senior of V Corps HQ, writing for commander of the First Army, Major General Courtney Hodges, responded that the actions of the unit, "while meritorious, is not sufficient to justify the award of the unit citation."
Campaign participation
The 612th was authorized to wear five Bronze Stars on its European Theater of Operations Service Ribbon, signifying its participation in the five major campaigns on the European Theater of Operations:
Normandy
Northern France
Rhineland
Ardennes-Alsace
Central Europe
References
Further reading
612th Tank Destroyer Battalion
Tank destroyer battalions of the United States Army | Purchased from Mr Tague personally prior to his passing. Great book although self published but to my knowledge he was one of the first to place the blame on Lyndon Baines Johnson and identify Mack Wallace as a 6th floor TSBD shooter. | The Dirty Dozen: The Deadly Mission The Dirty Dozen: The Deadly Mission is a 1987 made-for-TV film and is the second sequel to the original "The Dirty Dozen". It features an all-new 'dirty dozen,' this time under the leadership of Major Wright (Telly Savalas), playing a different role than in the 1967 film. Learning of a Nazi plot to attack Washington, D.C. with a deadly nerve gas, Major Wright leads twelve convicts on a suicide mission deep into occupied France to destroy the secret factory where the poison is made. The film opens with Major Wright fighting alongside Italian partisans | I was at best buy the other day looking at 4K OLED TV's watching a scene from a movie I have no clue how to find. I tried calling and the workers couldn't help me with the movie title. The scene I saw was American troops inside a bomber getting ready to drop their payload on Japanese forces when Japanese fighters come flying in to intercept.
Edit: Based off the feel of the scene the main character was one of the members in the bomber. The camera work was all done from inside the plane. A couple times the camera switched to the crosshairs of the lens used by the crew to decide when the bombs were dropped. | Operation Crossbow (film) work well, and that they should use English with a heavy German accent. Director Michael Anderson insisted on staying with the idea. However, it did not come across well, apparently leading to many of Henreid's scenes being cut. Some scenes of the bombing of the factory, at the end of the film, were later used in Battlestar Galactica to show the inside of the spacecraft burning. The Scenes are obvious because a railway oil tank wagon is clearly visible. Some real people were portrayed quite accurately in the film: "Operation Crossbow" opened in the US on April 1, 1965. The | Johnny Micheal Spann Johnny Micheal "Mike" Spann (March 1, 1969 – November 25, 2001) was a paramilitary operations officer in the Central Intelligence Agency's Special Activities Division (renamed Special Activities Center in 2016). Spann was the first American killed in combat during the U.S. invasion of Afghanistan in 2001. He died at the Qala-i-Jangi fortress in a Taliban prisoner uprising. Johnny Micheal Spann was from the small town of Winfield, Alabama, the son of a real estate agent and his wife. Spann graduated in 1987 from Winfield City High School, where he played football. At 17, he earned his private | 1,999,852 | Operation Buffalo (2–14 July 1967) was an operation of the Vietnam War that took place in the southern half of the Demilitarized Zone, around Con Thien.
Operation
2 July
On the morning of 2 July, Alpha and Bravo Companies, 1st Battalion, 9th Marines made their way up north on Highway 561 and secured a crossroad as their first objective. As they went further north between Gia Binh and An Kha, near a place called "The Market Place" (), they made contact with the elements of the People's Army of Vietnam (PAVN) 90th Regiment when sniper fire began to break out, enemy fire intensified as efforts were made by the 3rd Platoon to suppress it. Tri-directional ambushes had virtually decimated company B. Alpha Company, sent to rescue Company B was ambushed. During the battle the PAVN used flamethrowers in combat for the first time setting fire to hedgerows along Highway 561 forcing the Marines out into the open, exposing them to artillery, mortar and small arms fire, causing heavy casualties on A and B Companies and prevented them from linking up. B Company Headquarters was wiped out when a single PAVN artillery round exploded within the command group. The company commander, Capt. Sterling K. Coates, two platoon leaders, the radio operator, forward observer and several others were killed.
Airstrikes disrupted PAVN attempts to "hug" the 1st Platoon, eventually allowing the 1st Platoon and the battered 2nd Platoon to link up. 1/9's commander, LtCol Richard Schening, sent out a small rescue force involving C and D Companies supported by four tanks. Using helicopter and tank fire to disperse enemy troops, D Company was able to secure a helicopter landing zone for the evacuation of casualties. C Company then continued to move north under heavy fire to rescue what was left of the two Companies.
Out of nearly 400 Marines, the two Companies suffered 84 killed, 190 wounded and 9 missing making this the worst one-day loss for the Marines in Vietnam. Only 27 Marines from B/1/9 and about 90 from A/1/9 were fit for duty after the first day. U.S. forces reported that the PAVN suffered 55 killed with another 88 believed to have been killed, but unaccounted for.
3–5 July
On 3 July a USAF observer spotted more than 100 PAVN soldiers moving south from positions north of Con Thien, Battery E, 3/12 Marines fired on them killing 75 men.
On the morning of 4 July, following 12 hours of preparatory airstrikes, 3/9 Marines supported by Battalion Landing Team (BLT) 1/3 Marines attacked towards the Marketplace ambush site to recover the bodies of those killed on 2 July. 3/9 Marines met heavy resistance from the PAVN southwest of the Marketplace and by the end of the day had suffered 15 dead and 33 wounded, while BLT 1/3 suffered 11 wounded.
On 5 July the Marines operating north of Con Thien came under artillery and mortar fire, but there was little ground contact and the Marines were able to collect the dead from the 2 July fighting. It was reported that some of the Marines were shot at point-blank range by the PAVN, some of the bodies had been booby-trapped while others had been mutilated by the PAVN. In the afternoon PAVN soldiers were seen 3 km northeast of Con Thien and artillery and tactical air strikes were called in resulting in US claims of an estimated 200 PAVN killed.
6–7 July
On the morning of 6 July BLT 2/3 ran into a PAVN force north of Con Thien and killed 35 PAVN for the loss of 5 killed and 25 wounded. Company A, 9th Marines reinforced by the survivors of Company C and a detachment of the 3rd Reconnaissance Battalion moved northeast of Con Thien and established a forward fighting position. By the afternoon 1/3 and 2/3 Marines were stopped by PAVN artillery fire and an aerial observer reported that 400 PAVN soldiers had crossed the Ben Hai River and were heading towards the two Battalions. The PAVN force was unaware of the presence of Company A 9th Marines who were able to ambush the PAVN force, the PAVN quickly reorganized and attacked Company A, but were unable to penetrate their lines and Marine artillery fire effectively boxed in the defending Marines. The following morning Company A counted 154 PAVN dead, while suffering only 12 wounded. While the PAVN force attacked Company A, the remainder of the PAVN 90th Regiment attacked 1/3 and 2/3 Marines achieving negligible results before breaking contact at 21:30.
Also on 6 July the PAVN fired eight SAM-2s from positions north of the DMZ hitting an A-4E #151032 of VMA-311 as it conducted close air support in front of 1/3's lines. The pilot Maj. Ralph Brubaker ejected successfully and was rescued the following day.
On the morning of 7 July Company A was withdrawn into the Battalion perimeter just before a heavy PAVN artillery bombardment hit their ambush positions of the previous day. 7 July saw minimal ground contact and the Marines spent most of the day trying to achieve an accurate PAVN body count, but this proved difficult due to the carnage caused by the artillery and air strikes.
8 July
On the morning of 8 July BLT 2/3 moved southwest towards the Cam Lo River when they discovered a PAVN bunker complex. Air and artillery strikes were called in and then Company G attacked the bunkers, the PAVN lost 39 killed while the Marines suffered 2 dead and 29 wounded. In the afternoon Company G engaged another PAVN force and the PAVN lost 118 killed while the Marines suffered 14 dead and 43 wounded.
9–14 July
For the remainder of the operation there were no further ground contacts and the Marines only encountered mines and harassing artillery fire.
Aftermath
The operation ended on 14 July with total Marine casualties for the operation amounting to 159 killed, 845 wounded and 1 missing. U.S. forces claimed that the PAVN suffered 1,290 killed and a further 513 probably killed. 164 bunkers and 15 artillery and rocket positions were destroyed. Around 100 PAVN weapons were recovered or captured.
One marine who fought in the operation recounted 40 years later that he and other Marines were cynical of claimed PAVN casualty figures in the fighting along the DMZ, stating that "If we sent in a body count of fifteen to the headquarters for the Marines Corps in Vietnam, it would turn into twenty or thirty and by the time it got to MACV in Saigon it would turn into fifty or sixty".
1st Lt Gatlin J. Howell and SSgt Leon R. Burns were both awarded the Navy Cross for their actions during this battle.
The Marines launched Operation Hickory II and Operation Kingfisher in the same general area within days of the conclusion of Operation Buffalo.
References
Further reading
External links
1st Battalion 9th Marines "Walking Dead"
1st Amphibian Tractor Battalion Operation Buffalo – Between the Hickories, July 1–14, 1967
Buffalo
United States Marine Corps in the Vietnam War
Battles and operations of the Vietnam War in 1967
History of Quảng Trị Province | how many soldiers died in operation robin | why did the b-29s jettison their bombs in operation matterhorn | who killed 3 marines at forward operating base delhi | how many missions did the 456th bombardment group have against romanian | where did the 51st expeditionary signal battalion go | how many rounds of operation displace were there | how many troops defected during operation cedar falls | They failed and were forced to withdraw , and a number were captured , including battalion commander Maj. Hal McCown . |
1,999,853 | This paper presents a model to describe contractual dispute resolution by mediation in situations where a defaulting supplier is nearinsolvent. While each party has internal constraints, and if alternate performances are available, such as more costly alternative goods, the proposed approach allows the mediator to find an optimal solution. The notion of optimality is presented as adherence to the initial contract, therefore optimising a value function for the nondefaulting party. The proposed model includes describing the evolution over time of each party's perceived constraints using a phasorlike approach with a modulation to the core constraints phasing out of the real part and phasing in the imaginary part of complex numbers. The offers related to alternative performances by the defaulting party are modelled by a Gompertz function, being an exponential learning curve of the supplier in regards to the reaction to its offers, limited by another exponential function when approaching its internal constraints. Furthermore, the model takes into account the discount associated to the delay in the delivery time of the alternative performances. | Supplier selection is one of the most critical decisions in a supply chain. While good suppliers can contribute to the supply chain's overall performance, incorrect selection can drive the whole supply chain into disarray. In this paper, we focus on the problem of supplier selection in a manufacturing firm. We allow each supplier to compete with each other to be selected by the buyer for procurement. The competition is modeled in an auction framework as a bidding process where a supplier cannot observe immediate actions of other suppliers but has complete knowledge of their previous actions. We allow a supplier to use this knowledge in guessing other suppliers future actions and bid accordingly. Our model enables repeated games, which can be assumed to be more flexible compared to most game theory applications in the supplier selection literature. Reinforcement learning and fictitious play are used in the auction framework to implement repeated games. | In the process of collaborative procurement, buyers and suppliers are prone to conflict in cooperation due to differences in needs and preferences. Negotiation is a crucial way to resolve the conflict. Aimed at ameliorating the situations of underdeveloped self-adaptive learning effect of current collaborative procurement negotiation, this paper constructs a negotiation model based on multi-agent system and proposes a negotiation optimization strategy combined with machine learning. It provides a novel perspective for the analysis of intelligent SCM. The experimental results suggest that the proposed strategy improves the success rate of self-adaptive learning and joint utility of agents compared with the strategy of single learning machine, and it achieves win-win cooperation between purchasing enterprise and supplier. | This article shows how the principles of modern bargaining theory can help develop a better understanding of contractual terms such as royalties between copyright holders and users such as between an artist and a recording company (or between an author and a publisher). We develop the main principles in a non-technical and illustrative manner. | This paper examines the strategic rivalry in a duopoly where firms must correctly time the construction of the first plant in a growing market. We explicitly model rivalry for market share. Firms recognize the effect of the rival's actions on their profits; they behave noncooperatively to maximize discounted profits over the infinite horizon. For the timing problem we develop an appropriate solution concept. It is a Nash equilibrium in the space of sequential decision rules which specify each firm's correct action as a function of the state of the world. We then show how the equilibrium can be computed by backward induction dynamic programming. Numerical examples illustrate the sequential Nash solution and characterize the rivalry to be the first to build. Parametric analysis of the example enables us to explore the competitive dynamics of capacity choice in new markets. | This paper illustrates how a supplier profit may be affected by the market pricing mechanism under imperfect competition. A parameterized Supply Function Equilibrium (SFE) model involving manipulation of the sole intercept is used to represent the strategic behavior of each supplier. Through utilizing a bilevel optimization technique and a Mathematical Program with Equilibrium Constraints (MPECs) approach, market equilibria are calculated and compared under pay-as-bid pricing (PABP) and marginal pricing (MP) mechanisms. For an unconstrained case, analytically it is demonstrated that the optimal bidding strategy and the maximum profit of each supplier, as well as the market clearing price are the same under PABP and MP. The effects of the transmission limits and the supplier capacity constraints are discussed through numerical results. | This paper takes domestic lithium grease industry as the background, citing industry competition game theory and reasonable inference, using inverse analysis resource supplier and downstream leading enterprises marketing strategy. The analysis points out, resource providers because of the special market structure and resources inherence attribute on the downstream impact, downstream industry leaders in lower concentration have a strike first to gain the initiative expansion and intrinsic motivation. In the special market structure, especially the resource supplier can maintain the stability of supply chain with the customer through a modest higher price. In the mastery of downstream market strategy under the premise, developing resource supplier market strategy has its rationality and leading role, the analysis is similar to draw some useful conclusions from the supply chain. | Alternative Dispute resolution is the primary method after dispute because of characteristics of rural society.So,it is very important.It demonstrates the basis principles of ADR,including the concept and type of ADR,the main reason of client's choose advantages and defect of ADR.Finally,it discusses the necessary to the elevation of ADR for solution of dispute. | Channel coordination parameters: prices for the different contracts, salvage value, shortage penalty, lead-time, etc. Most of the one-period models apply the newsvendor model. On two-period horizon, this is extended with the possibility of two production modes. On a multiple period horizon the base-stock, or in case of deterministic demand the EOQ models are the most widespread. In such cases the optimal solution can be determined with simple algebraic operations. These simple models usually completely disregard technological constraints; however, in real industrial cases resource capacity, inventory or budget constraints may be relevant. This necessitates more complex models, such as LP, MIP, stochastic program, | 1,999,853 |
INTRODUCTION
Contractual dispute resolution is often required when a party is in default to its contract or when there is a disagreement on the execution of the obligations of each parties. Parisi et al. (2011) have demonstrated, for bilateral contracts, that it is possible to correct imperfections in contract enforcement, such as imperfect compensation due to parties' insolvency. While recourse to courts or arbitration is common in such cases, the parties may be willing to try to resolve the dispute by mediation to settle the issue quickly and avoid legal expenses. Mediation to resolve contractual disputes is a form of negotiation, and therefore a noncooperative game. Wilson (2007), showed that, with a mediator making sequential random proposals, the subgame perfect payoff converges to an asymmetric Nash solution with weights influenced by the relative discount rates of the players. Others have suggested adding noise to the information gathered by the mediator (Goltsman et al. 2009). However, reallife mediators usually have a strategy and the proposals are not random. Ross and Chen (2007) have studied experimentally the effect of online mediator strategy, but their results show no effect of the mediator strategy over the concessions the parties offer. In their case however, the parties had preprogrammed to make moderately competitive proposals. On the other hand, Ethano et al. (2001) have proposed a stepbystep method to reach a Paretoefficient agreement. Their approach does not require the parties to reveal their utility functions (constraints). In their approach, the mediator helps the parties find favourable directions to the negotiation. Zeleznikow and Bellucci (2006) have made proposals for a negotiation decision support system to support mediators to dynamically modify initial preferences throughout the negotiation process. However, in commercial contractual dispute resolution, it might not be the preferences that shift during the mediation process, but rather the perception of their own constraints by each party. The mediator's role includes acting as an "agent of reality" and to "increases the parties' perceptions of their cases" (AAA, 2013). Each party may reassess its constraints during the mediation process, a form of introspection, leading usually to more reconcilable positions for each party over time.
Therefore, it is important to propose an approach allowing the mediator to identify an optimal solution which takes into account the constraints of the parties, the evolution of the perception by each party of their constraints, and an approach allowing a mediator to guide the parties to a settlement which is as close as possible to an optimal solution. Also, it is needed to have a model taking into account the evolution of the offers that will be made by the defaulting supplier during the mediation process. In a defaulting supplier mediation, the parties are however limited by their internal constraints, and the relation is therefore not simply exponential nor linear. Offers of the defaulting party should tend asymptotically to a maximum situation that would affect its economic viability. Montrol (1978) has suggested that almost all social phenomena can be approximated by such a sigmoid function, except for unusual intermittent events. Foster and Wild (1999) have demonstrated the use of logistic functions for econometric modelling, and Li et al. (2006) have suggested it as a model for static concessions in automated ebusiness negotiations. A sigmoid function may be inadequate to describe Boulwarism, whereas a party will make a "takeit or leaveit" offer, which is out of the scope of this paper. Among the sigmoid functions, the logistic functions represent a broad family of functions. SánchezChóliz and Jarne (2015) have studied the limitations of the logistic and Gompertz functions, which both have functional weaknesses, noting however, their operational advantages. The present paper proposes using the Gompertz function to describe the evolution of the offers in a mediation. This paper also describes a method whereas an optimisation technique may be used by a mediator to determine an optimal outcome, and also provide a model to describe a typical mediation process. In order to provide such description, we must consider the evolution of each party's perception of their own constraints, as well as the discount rate associated with delays in delivery.
PRISONER'S DILEMMA AND OPTIMISATION
In a contract where a supplier fails to delivers the amount and/or type of goods expected by the buyer, and where the buyer retains payment of the sums agreed upon in retaliation for the undelivered goods, each party may make compromises in order to resolve the issuing dispute. The supplier may want to provide alternative performance in order to get paid. Conversely, the buyer may want to pay the amounts due in order for the deliveries to resume. Depending on the contract, the buyer may have other means of putting pressure on the defaulting supplier, such as threatening to exercise a penalty clause or preventing the other party from getting other contracts.
During conventional bipartite negotiation, none of the parties may be willing to make concession and take the first step towards resolution, for fear of obtaining nothing or little in exchange. Therefore, no party is willing to exchange their real position, leading to a standstill of the negotiation process, and possibly to a long and costly litigation process.
The utility of the negotiation process is therefore limited by the fact that each party ignores the other party's real position. It is therefore a prisoner's dilemma, since both party would be better of by divulging their real position to the other party, but is unwilling to make the first move toward a solution.
Furthermore, mediation usually occurs in situations whereas each party have constraints, but is not free to "shop around" to find a new partner. Alternative supplier may be considered, but may come at a cost due to delays, excess in prices, etc. Contrarily to a normal negotiation process, the mediation process is therefore bounded by constraints.
In modern mediation process, the mediator usually attempts to understand the real position of each party, conducting interviews with each of them individually. Such talks are usually confidential, and the mediator will only divulge to the other party what he is authorised to. However, getting both positions and both sides of the story, the mediator is able to find a solution whereas both parties make compromises (Klein et al. 2002).
The following table illustrates the various possible outcomes of the negotiation process described above as a prisoner's dilemma : Several jurisdiction around the world have adopted policies implementing alternative dispute resolution methods, including mediation. In commercial contracts between a buyer and supplier, mediation can be especially useful to resolve situations where the buyer needs to receive a certain amount of goods, but the supplier is unable to supply the full contracted amount of goods. However, contractual stability needs to be preserved as much as possible. Indeed, several legal systems around the world have rejected the "unforeseeability" theory. For example, the Code civil (France) provides that: "Contracts legally formed are the law of the parties that made it. They cannot be revoked unless from the mutual consent, or by causes authorised by law. They must be performed in good faith." The Civil Code of Quebec provides that: "A contract may not 1 be resolved, resiliated, modified or revoked except on grounds recognized by law or by agreement of the parties" . Common law jurisdiction have historically rejected unforeseen 2 changes as a justification of default, except in cases of frustrated contracts . In general, contracts 3 cannot be modified because of hardship of a single party, unless with the consent of the other parties.
On the other hand, the UNIDROIT principles include both an article on the binding character of the contract as a general rule , and provisions allowing the disadvantaged party to request 4 renegotiations in limited cases of hardship . Similar notions are integrated in the German civil 5 code ( Bürgerliches Gesetzbuch ), whereas a party may demand adaptation of the contract, or even revoke the contract if circumstances which became the basis of a contract have significantly changed . The purpose of such adaptation is to restore equilibrium between the parties. 6 Furthermore, the notion of "good faith" is used in several legal systems to entice a nondefaulting party to collaborate in finding solutions to the other party's unforeseen constraints, or at least not to exercise contractual rights abusively against such other party. For example, the Uniform Commercial Code, in force in almost every U.S. states, provides that: "Every contract or duty within the Uniform Commercial Code imposes an obligation of good faith in its performance and enforcement." 7
The parties to an agreement usually enter such agreement expecting the other parties and themselves to abide to the contract, this being an essential consideration to the contract itself. In a defaulting supplier situation, mediation may be used to counter the occurrence of unforeseen constraints. The goal of mediation should therefore be to reach not only an efficient solution, but also a solution which promotes contractual stability, therefore adherence to the contractual obligations of the parties. The mediator does not only need to find a mutually acceptable solution to both parties, but should also, whenever possible, favour solutions which have this added notion of "optimality" issuing from the compliance to the initial contract requirements.
In a broader perspective, free contracts could not exist if there was no contractual stability. The optimal solution has a social utility beyond resolving the dispute between two parties, which includes the social reliance on contractual systems and the avoidance of courts overcrowding to resolve disputes that can be solved otherwise.
The mediator should therefore be biased toward contractual stability, which can be assimilated to a bias toward the nondefaulting party. Ivanov (2009) has demonstrated that such bias in a strategic mediator provides the high payoff solution, as if the parties had communicated through an optimal nonstrategic mediator. In the proposed model, this bias toward contractual stability is introduced by linear optimisation of a function which is defined using contractual values to the nondefaulting party.
THE MODEL
Definitions and proposition
Let's consider a situation whereas the supplier is unable to fulfil its obligations towards a buyer regarding the delivery of a number of units.
Let's first define a value function of each type of alternative performance the defaulting supplier may provide to compensate for the obligation it is unable to fulfil. Under this function, there are p alternative performances types possible by the defaulting supplier. There are q possible moments delivery of said alternative performances (instalments):
F( z n,m ) = V n D( u m ) z n,m ∑ p n=1 ∑ q m=1
(1) whereas ∀ n ∃ C n 7 § 1304; see also § 2615, which provide excuse by failure of presupposed conditions in sales. V n being the contractual value of the performance for the buyer, and C n the corresponding cost for the defaulting supplier. For monetary performances, such as payment reductions or reimbursements, V n ∈ [0,1[ since there is an internal cost to find and alternate supplier and/or to manage the reimbursement. u m is the delay of delivery corresponding to a moment m. D( u m ) is the discount ratio function attributable to the delay of delivery (see section 3.2 below). We suggest using complex numbers for z n,m to take into account the evolution by each party of its perceived constraints (see section 3.3 below)
A set of constraints for each party shall be enunciated using these z n,m , V n and C n .
For nearinsolvent defaulting suppliers, a solution from linear optimisation of F( z n,m ) with this set of constraint will correspond to an outcome which is (i) acceptable to both parties, and (ii) promote contractual stability.
Indeed, if we define the nearinsolvent situation to be a situation where max F( z n,m ) < value of the obligations contracted by the supplier in the initial contract (i.e. that the supplier is not able to provide alternative performance having substantially the same value as the initial contract.) Element (i) of proposition 1 is inferred from being a solution within the range of the constraints for both parties. Element (ii) results from that the optimisation provides the highest F( z n,m ) value, therefore the closest total value of performances possible for the nondefaulting party.
Let's take the situation of a supplier having to deliver a certain amount of similar units (products such as computers, other devices or furniture). In cases where the supplier is unable to deliver the contracted number of units as prescribed by the initial contract, there is a number of information the mediator may gather by meeting the parties individually, under confidentiality:
From the supplier • cost of contractual units for the supplier (C init ); • cost of an alternative type of units the supplier could procure for each instalment (C alt, m ); • maximum number of units of alternative type available on the market, for each possible instalment (N max, m ); • maximum aggregate value of alternative units the supplier is able to buy due to its solvency limit during the performance of the contract (S); • maximum aggregate cost of alternate performance (including price reductions) the supplier is able to accept due to its solvency postperformance of the contract (R);
From the buyer
• number of undelivered units required by the buyer to operate (N min ); and • value of the various performances offered by the supplier (V n ).
Discount for delivery delays
The delivery delay for the alternative performance usually causes the buyer to discount them, and therefore it is necessary to determine a discount function for the various instalments. For the purpose of this model, as simple hyperbolic discount function is a good approximation of the perception of the buyer. A hyperbolic discount function has been described by others (Mazur 1987; Kirby 1997 as :
D( u m ) = 1 1 + ru m (2)
where r is the discount rate and u m is the delay for the delivery of the alternative performance by the defaulting supplier. The rate r expresses the confidence level of the buyer toward the supplier; if the buyer has a low level of confidence, the rate r will be high, and the value of delayed performances will be much lower than immediate performance. We can imagine cases whereas the rate r will be high enough that delayed performances will have little or no value to the buyer, and that optimisation will rely almost solely on immediate performance of the defaulting supplier. Mazur (1987) mentions an hyperbolic functions with exponents as sometimes more adequately describing of discount behaviour. While a simple hyperbolic function is used in the present model for simplicity, the model would also be compatible with a more complex functions.
Perceived constraints and time dependency
In postcontractual negotiations, parties may find themselves progressively renouncing to some of their contractual rights to focus on essential requirements. The constraints evolve over time. Newell et al. (2001) showed the use of complex numbers for time scale of changes in the case of motor learning, and Saaty (2007) for timedependant decision making.
Likewise, in this model, the perceived constraint is the real part of a complex function being a phasorlike modulation as a function of time, added to a fixed core value. Once the core value is reached, the constraint remains static (fully assessed). Under the proposed phasorlike method, the modulation will phaseout of the real part over time during the mediation process. Hereunder, core constraints values are marked "core" and modulation are marked "mod". N min ( t ) = N core +(N mod exp( ikt )) for 0 < kt ≤ π/2 and (3) N min ( t ) = N core + i N mod for kt > π/2 where typically N core + N mod ≅ initially contracted number of units; and where t is the elapsed mediation time, on a π/2 scale; and also R( t ) = R core +(R mod exp( iqt )) for 0 < qt ≤ π/2 and (4) R( t ) = R core + i R mod for qt > π/2 S( t ) = S core +(S mod exp( iqt )) for 0 < qt ≤ π/2 and (5) S( t ) = S core + i S mod for qt > π/2
This method could be generalised to describe more complex situations. For example, there could be situations where a party could be enticed to go beyond its core constraints, corresponding to variations for time values above π/2. This could give, between t =0 and t= π, a sigmoid shape to the position of the party, as often seen in social phenomenons. A party might also initially underestimate its core constraint, leading to a phase offset for the initial situation. There could also be, in different cases, a plus and minus uncertainty around the core value, for example if a party is unable to determine accurately its core constraints; kt and/or qt can be unbounded and the value Re{ z x } will oscillate around the core value. Such oscillation would lead to uncertainty in the resulting optimal settlement solution.
For the purpose of this paper, we shall only consider situations of fully assessable core constraints: the core constraints corresponds to the real minimal or maximal values associated to these constraints, and there will not be any negative Re{exp( it )} reversing the modulation of the constraints, as per the above set of constraints time dependency functions (3), (4) and (5).
It is to be noted that the modulation phaseout ratio k and q may be different for the buyer and the supplier, depending on the negotiating representatives personality and strategy.
Evolution of offers over time
In general, the defaulting supplier will likely enter the mediation process by expressing a position without concession on terms that are not foreseen of the initial contract (the "initial stage"). To avoid litigation, it will then make rapid concessions (the "intermediary stage"), and end with final stabilisation whereas it will be unable to concede beyond its internal constraints (the "final stage"). This progression can be approximated by a sigmoid shape, in Figure 1.
The alternative units and the reductions in payment are not terms of the initial contract. For such elements, there will be an initial stage whereas the defaulting party might not consider making offers of such alternative performance. The defaulting supplier is expected to present offers progressively in an intermediary stage, until being limited by internal constraints in the final stage. Sigmoid functions are known to describe learning by trials and errors (Leibowitz et al. 2010), and more specifically negotiation positions (Li et al. 2006; Gal & Pfeffer 2006).
In this model, offers can be modelled as an exponential learning curve limited by an embedded exponential corresponding to the constraints, hence a Gompertz function:
g n,m = Re { z n,m } exp(˗ a e ˗bt )(6)
Parameter a corresponds to the delay to start making concessions and parameter b, the rate of such concessions. Therefore, the value of the offers received, from the buyer standpoint, is :
G( g n,m ) = V n D( u m ) g n,m ∑ p n=1 ∑ q m=1
And therefore :
G( z n,m ) = Re{ V n D( u m ) z n,m } exp(˗ a e ˗bt ) ∑ p n=1 ∑ q m=1 (7)
where t is the elapsed mediation time This function G( z n,m ) can both serve the function of determining the value of the offered alternative performance with the initial contractual value. It can also be used to compare the offer of the defaulting supplier with alternate supplier, if they are available. This allows the buyer to determine if the value of the proposed outcome with the supplier makes this proposal acceptable in regards to alternative solutions, such as seeking alternate suppliers to provide the required goods or services.
For example, lets define an alternate supplier's offer, using the same notation, as the following function :
H( z l,k ) = V l D( u k ) z l,k ∑ p k=1 ∑ q l=1 (8)
The discount ratio r for the alternative supplier may be different than for the defaulting supplier. For example, if a long and usually good relationship exist between the buyer and the defaulting supplier, this ratio r may be lower for the defaulting supplier and the buyer will be willing to wait for delayed performance in order to keep its usual supplier. A low level of trust toward the alternate supplier would yield to the same result. At the other extreme, the ratio r may be higher for the defaulting supplier in cases where there is no relation of trust between the buyer and the defaulting supplier, or if the nature of the default is such that it has annihilated the confidence of the buyer in the defaulting supplier.
If there is such alternate supplier, the buyer should accept the settlement only if the following condition is met:
G( z n,m ) > v H( z n,m ) + w A D( u A ) B (9)
where A is the amount of the damages that the supplier is expecting to be awarded in the event a lawsuit is instituted by the buyer against the defaulting supplier (taking into account what the supplier believes to be solvency limits of the defaulting supplier), u A being the amount of time expected for the damages to be recuperated from the defaulting supplier, w a risk factor ∈ [0,1] corresponding to the risk of losing in court in the event of litigation with the defaulting supplier, v a risk factor ∈ [0,1] corresponding to the risk of the new supplier being also unable to fulfil the contractual requirements, and B is an anticipated cost of terminating the contract of with the defaulting supplier. The later is a compound of many factor, depending on the terms of the contract and other circumstances. It may include, for example, legal and management fees, contractual penalties to third parties and internal costs associated to doing business with a new supplier. A study of the evaluation of third party alternative could provide more details on these variables, but is outside of the scope of this paper.
Simple case
Let's take the case of alternative performances where the supplier is able to deliver a set of alternative units z 1,m and a reimbursement in a single instalment z 2,1 . Making the assumptions that :
• the value of the alternative units z 1,1 and z 1,2 is substantially the same value V 1 ; • these alternative units are replacement performances for units that had an initial value of V init ; • the value of reimbursement is depreciated, V 2 ∈ [0,1[ since there is an internal cost of managing the reimbursement and finding an alternate supplier; • there are two instalments of alternative units ( q =2); • the cost per alternative unit will remain constant throughout the duration of all the instalments, (C alt,1 = C alt,2 = C alt ) ; • there is a single instalment of the reimbursement ( m =1); and • there is a fixed maximum of units N max,1 for the first instalment.
Optimal solution may be found by the linear optimisation of :
F( z n,m ) = ( V 1 D( u m ) z 1,m ) + (V 2 D( u 1 ) z 2,1 ) ∑ 2 m=1(10)
considering:
Re{
z 1,m } ≥ Re{N( t )} ∑ 2 m=1 Re{ z 1,m } ≤ N max,m ∑ 2 m=1 Re{ (C alt ˗C init ) z 1,m )+ z 2,1 } ≤ Re{R( t )} ∑ 2 m=1 Re{ C alt z 1,m } ≤ Re{S( t )} ∑ 2 m=1
Re{ z n,m } ≥0 ∀ n , m
The above constraints above are inequalities on the real part of the functions, since only this part is relevant to the determination of the optimal solution at a given time.
Without a settlement through mediation, the supplier may go bankrupt, which would leave the buyer needs unsatisfied. The supplier may deliver a number of alternative performance to the contract. Typically, if there exist a less costly alternative (C alt < C init ), there will be no default, or at least no dispute since the supplier will not increase its solvency problem but rather decrease it by delivering alternative units. However, when, if the alternatives are more costly than the initial contracted units (C alt > C init ), the buyer may be reluctant to supply the required amount of units as he will lose money on each alternative unit delivered, at least compared to his contractual expectations.
The best possible outcome for the buyer is is to obtain as much undelivered units as possible z 1,m , as it would be more costly for the buyer to procure independently those units then the initial contractual value per unit, and to compensate undelivered units by reimbursements z 2,m .
For the purpose of this simple case, nearinsolvency situation could be defined as:
Re{S( t )} < Re{C init N 1 +C alt (N min ( t )˗N max,1 )}(11)
This corresponds to situations where N max,2 is limited by the solvency parameter S (t) of the supplier. Also, for the purpose of this simple case, lets define the following boundary, meaning that the discount due to the delay in the delivery of the second instalment of alternative units does not causes a decrease in its value to the buyer beyond the point where reimbursement is preferable:
> 1 + ru 2 V / V 1 init V 2 1 + ru 1(12)
The optimisation of F( z n,m ) gives the following result:
z 1,1 = N max,1(13)z 1,2 = (S( t ) ˗ C alt N max,1 )/ C alt z 2,1 = R( t )˗ [(C alt ˗C init ) × (N max,1 + (S( t ) ˗ C alt N max,1 )/C alt )]
During the mediation process, the evolution of the offers from supplier, in accordance to these optimal result, can be described by :
g 1,1 = N max,1 exp(˗ a e ˗bt )(14)
g 1,2 = Re{ (S( t ) ˗ C alt N max,1 )/ C alt } exp(˗ a e ˗bt ) g 2,1 = Re{ R( t )˗ [(C alt ˗C init ) × (N max,1 + (S( t ) ˗ C alt N max,1 ) /C alt )] } exp(˗ a e ˗bt )
And therefore, the value of the offers received for the buyer is :
G( g n,m ) = + + V g 1 1,1 1 + ru 1 V g 1 1,2 1 + ru 2 V g 2 2,1 1 + ru 1(15)
In the above example, the value of N min ( t ) is expected to decrease as a function of time, when the buyer's introspection leads to a reassessment of its requirements. We can expect a settlement to be reached when the supplier's offers meet the buyer's minimal requirements, therefore when ( g 1,1 +g 1,2 ) = N min ( t ).
In the case of the reverse condition :
< 1 + ru 2 V / V 1 init V 2 1 + ru 1(16)
Then optimisation of the G( z n,m ) function will instead favour the maximum reimbursement, as long as the minimum number of units N min is met. In this case, the results of linear optimisation would be:
g 1,1 = N max,1 exp(˗ a e ˗bt )(17)g 1,2 = Re{ N min ( t ) ˗ N max,1 } exp(˗ a e ˗bt ) g 2,1 = Re{ R( t )˗ [(C alt ˗C init ) × N min ( t ) ] } exp(˗ a e ˗bt )
Settlement is expected to occur for ( g 1,1 + g 1,2 )=N core . Optimisation should therefore only occur for g 2,1 ( t ). The optimal solution will be the maximum amount of g 2,1 ( t ) that can be reached after the N core is met by the offers of the supplier, which is expected to occur when the N mod will have completely phasedout at kt =π/2. The value of the offers received for the buyer G( g n,m ) can be calculated once again using the function G( g n,m ) in (15).
RESULTS
Using the same illustrative case as in section 3.5 above and where the (12) condition is fulfilled, the results of g 1,2 + g 1,2 and N min ( t ) can be represented over the mediation period by the following figures 2, 3, and 4. Figure 2 shows various examples with V 1 =V init =$1000, V 2 =0.8, C init =$700, C alt =$1100, N max,1 =100, N core =170, N mod =30, S core =$200,000, S mod =−$30,000, k =1.0. Since N max,1 <N core , the minimal requirement of the buyer cannot be met in a single instalment of units deliveries. Therefore, the offers of each parties will meet to when the Re{N min ( t )} line cross the ( g 1,1 + g 1,2 ) line, leading probably to a settlement corresponding to this value. It is to be noted that this occurs before t reaches complete phaseout of the modulation at π/2. For the red curve, q =1,5, a =2 and b =20, the parties positions meet at approximately t ≅ 1.16, for 182 units. This is also the optimal solution for core constraints without mediation timedependency (no Gompertz function applied to the offers of the supplier and considering only the core constraints of each party, but taking into consideration the discount D( u m ) for all alternative performances instalments). When a settlement is reached at t ≅ 1.16, the value of the reduction offered g 2,1 is $27,272, approximately the same result as without any mediation timedependency.
For all other parameters sets in figure 1, the number of units of the outcome is lower, therefore suboptimal compared to the solution without mediation timedependence. Early assessment of constraints and early concessions by the defaulting supplier yields the highest F( z i ). These conclusions were found to be applicable with different sets of parameters where the condition (12) is met, and also for situations whereas Re{S( t )}>Re{C init N 1 +C alt (N min ( t )˗N max,1 )} and where condition (16) is met. Figure 3 shows g 2,1 ( t ) using the same parameters as the best solution of figure 2 ( a =2, b =20, q =1.5), with R core =$100,000 and R mod =−$5,000. It shows the value of the reimbursement offered by the supplier to settle the situation. At t ≅ 0.30, the amount offered g 2,1 ( t ) peaks at $32,432. Even by applying a Gompertz function to offers, the supplier may want to rapidly offer a larger amount of money to settle the issue, as it is less costly for this supplier than buying more expensive alternative units which cost 10% more than the contractual value V of the units. However, when a settlement is reached for the number of units at t ≅ 1.16, the value of the reimbursement offered g 2,1 will have decreased to $27,272. Figure 4 represent the calculated value of the three terms of the G( g n,m ) in (15) as a function of the offers over the duration of the mediation process, for the set of parameters used in figure 2, and r =0.2, u 1 =1.1 and u 2 =1.5. The 1 st term is the buyer's perceived value of the offer for the first instalment of alternative units z 1,1 . At the moment of settlement t ≅ 1.16, this 1 st term is approximately $81,967, this is clearly the most valuable term. The 2 nd term represent the perceived value of the offers for the second term, corresponding to the second instalment of alternative units z 1,2 . At the moment of settlement, this 2 nd term is approximately $62,937. The third term is the value of the reimbursement z 2,1 . At the moment of settlement, this 3 rd term is approximately $17,884. The total max G( g n,m ) is therefore approximately $162,788. For comparison, the value V init ×N core = $170,000, and the value V init ×(N core +N mod ) = $200,000, both of which are higher than max G( g n,m ). This is the expected result, the proposed model aiming at solutions as close as possible, within the constraints, to the initial value of the contract V init ×(N core +N mod ).
In the above examples, the discount rate due to delay in delivery of the second instalment was set in accordance with condition (12) to favour the delivery of a maximum number of alternative units in the second instalment over a potential reimbursement. If, using the same set of parameters changing only u 2 =4, then it is condition (16) which is met. The optimal result would therefore be g 1,1 =100, g 1,2 =70, and g 2,1 =$32,000. This yields to max G( g n,m ) = $148,405. This lower value compared to the situation of figure 4 issues from the higher discount due to the long delivery delay u 2 . Figure 5 show the evolution of the g 2,1 during the mediation with u 2 =4. The curve shows an initial rapid increase, with a peak at t ≅ 0.30, then a progressive decrease a the offer of alternative units g 1,2 increases, decreasing the amount of money R( t ) available. Then, since the optimality favours reimbursement g 2,1 over alternative units g 1,2 , the former increases again as the defaulting supplier's R mod and S mod phaseout, and stabilises at $32,000 once qt ≥π/2. In order to achieve an optimal result, which corresponds to the complete phaseout of R mod and S mod , it is however necessary to have q >1 . Trivially, the inverse would lead to suboptimal g 2,1 results at the end of the mediation session t= π/2. Therefore, early assessment of its constraints by the defaulting supplier is again a requirement to achieve optimal results.
DISCUSSION
In this defaulting supplier problem, an optimal settlement requires an introspective analysis by each party of its own constraints (phaseout of the modulation to the core constraints). Without introspection and reassessment by each party, a suboptimal outcome, at best, may be achieved, which a party might disavow afterward despite entering into a settlement agreement. In some other cases, the partial presence of a modulation on top of the core constraint would even be sufficient to prevent any solution. The role of the mediator is therefore to facilitate this introspection by each party in order for the solution to correspond to a real optimal solution, not a hastily perceived solution.
However, as shown in the results above, the optimal settlement is achieved in situations where the defaulting supplier makes rapid concessions and assesses its own constraints earlier than the nondefaulting buyer.
In situations where the supplier is near insolvent, more specifically unable to perform its obligations to the buyer, and also unable to provide sufficient alternative performances sufficient to fulfil the contractual value of the initial contract, the function F( z n,m ) defined herein will be lower than this initial contractual value. Its maximisation will correspond to the highest value that the defaulting supplier is able to achieve. Also taking into account the negotiation process within mediation, we have defined a function G( z n,m ) which can be used to measure "optimality" of the offered solution and compare it to other possible outcomes. The offer which is closest to the initial contractual agreement will achieve highest G( z n,m ). This maximised G( z n,m ) will correspond to an acceptable solution for the buyer, and ideally, a settlement will issue with the corresponding g n,m values.
Where replacement suppliers are available, then the G( z n,m ) value could be used to take decisions using the comparative criteria of inequality (9). However, the buyer should not expect to be able to draw that comparison from the initial mediation position of the defaulting supplier, but should wait for the offers from the supplier to tend to their maxima after some time spent in mediation.
CONCLUSION
The approach presented herein may be used as a tool for mediators to analyse typical mediation for cases where a supplier is in default to limitation in its solvency.
The mediator may gather constraints on each side, then propose an optimal solution or guide the parties to it, which solution will achieve the highest possible adherence to the initial contractual value. This, in turn, promotes contractual stability, while allowing the survival of the defaulting supplier. For the buyer, this is typically the best possible outcome in situations where the supplier, even under forced execution by the courts, will not be able to provide the initial value to the contract. Seeking a solution which corresponds the maximum performance of the defaulting supplier allows the buyer to obtain instead the maximum value, while also meeting its minimal operational requirements (constraints).
The timedependant model presented herein shows that a mediator, in order to attain such optimal solution in a settlement agreement, should rapidly entice the defaulting party to seek alternatives to the contractual elements at issue and to reassess its internal constraints. This should be prioritised over the reassessment of the constraints of the nondefaulting party.
This approach could eventually be generalised to more complex contractual relationships. For example, a similar approach could be considered in situation whereas both parties are unable to fulfil their obligation under the contractual agreement.
(Please send comments to the author by email)
A Guide to Commercial Mediation and Arbitration for Business People. American Arbitration AssociationAmerican Arbitration Association. 2013. A Guide to Commercial Mediation and Arbitration for Business People. https://www.adr.org/aaa/ShowPDF?doc=ADRSTAGE2019455 (retreived December 22, 2015).
Searching for joint gains in multiparty negotiations. Harri Ehtamo, Eero Kettunen, Raimo P Hämäläinen, European Journal of Operational Research. 13015469Ehtamo, Harri, Eero Kettunen, and Raimo P. Hämäläinen. 2001. Searching for joint gains in multiparty negotiations. European Journal of Operational Research , 130 (1), pp.5469.
Time preference. Peter C Fishburn, Ariel Rubinstein, International Economic Review. 677694Fishburn, Peter C., and Ariel Rubinstein. 1982. Time preference. International Economic Review , pp.677694.
Predicting people's bidding behavior in negotiation. Ya Gal, Avi Pfeffer, Proceedings of the fifth international joint conference on Autonomous agents and multiagent systems. the fifth international joint conference on Autonomous agents and multiagent systemsACM370376Gal, Ya'akov, and Avi Pfeffer. 2006, May. Predicting people's bidding behavior in negotiation. In Proceedings of the fifth international joint conference on Autonomous agents and multiagent systems (pp. 370376). ACM.
Mediation, arbitration and negotiation. Maria Goltsman, Johannes Hörner, Gregory Pavlov, Francesco Squintani, Journal of Economic Theory. 144413971420Goltsman, Maria, Johannes Hörner, Gregory Pavlov, and Francesco Squintani. 2009. Mediation, arbitration and negotiation. Journal of Economic Theory , 144 (4), pp.13971420.
Communication via a strategic mediator. Maxim Ivanov, Journal of Economic Theory. 1452869884Ivanov, Maxim, 2010. Communication via a strategic mediator. Journal of Economic Theory , 145 (2), pp.869884.
Bidding on the future: evidence against normative discounting of delayed rewards. Kriss N Kirby, Journal of Experimental Psychology: General. 126154Kirby, Kriss N., 1997. Bidding on the future: evidence against normative discounting of delayed rewards. Journal of Experimental Psychology: General , 126 (1), p.54.
Using an annealing mediator to solve the prisoner's dilemma in the negotiation of complex contracts. Mark Klein, Peyman Faratin, Yaneer Baryam, AgentMediated Electronic Commerce IV. Designing Mechanisms and Systems. Berlin HeidelbergSpringer194202Klein, Mark, Peyman Faratin, and Yaneer BarYam. 2002. Using an annealing mediator to solve the prisoner's dilemma in the negotiation of complex contracts. In AgentMediated Electronic Commerce IV. Designing Mechanisms and Systems (pp. 194202). Springer Berlin Heidelberg.
The exponential learning equation as a function of successful trials results in sigmoid performance. Nathaniel Leibowitz, Barak Baum, Giora Enden, Amir Karniel, Journal of Mathematical Psychology. 543338340Leibowitz, Nathaniel, Barak Baum, Giora Enden, and Amir Karniel. 2010. The exponential learning equation as a function of successful trials results in sigmoid performance. Journal of Mathematical Psychology , 54 (3), pp.338340.
On automated e-business negotiations: Goal, policy, strategy, and plans of decision and action. Haifei Li, Y W Stanley, Herman Su, Lam, Journal of Organizational Computing and Electronic Commerce. 161129Li, Haifei, Stanley YW Su, and Herman Lam. 2006. On automated e-business negotiations: Goal, policy, strategy, and plans of decision and action. Journal of Organizational Computing and Electronic Commerce , 16 (1), pp.129.
An adjusting procedure for studying delayed reinforcement. James E Mazur, Commons, ML.; Mazur, JE.; Nevin, JA5573Mazur, James E., 1987. An adjusting procedure for studying delayed reinforcement. Commons, ML.; Mazur, JE.; Nevin, JA , pp.5573.
Time scales in motor learning and development. Karl M Newell, Yeouteh Liu, Gottfried Mayerkress, Psychological review. 108157Newell, Karl M., YeouTeh Liu, and Gottfried MayerKress. 2001. Time scales in motor learning and development. Psychological review , 108 (1), p.57.
Optimal Remedies for Bilateral Contracts. F Parisi, B Luppi, V Fon, Minnesota Legal Studies Research Paper. 0745Parisi, F., Luppi, B. and Fon, V. 2007. Optimal Remedies for Bilateral Contracts. Minnesota Legal Studies Research Paper , (0745).
The effects of online mediator's strategies under trust and distrust conditions. William H Ross, V Jengchung, Chen, International Journal of Management and Decision Making. 813051Ross, William H., and Jengchung V. Chen. 2007. The effects of online mediator's strategies under trust and distrust conditions. International Journal of Management and Decision Making , 8 (1), pp.3051.
Time dependent decisionmaking; dynamic priorities in the AHP/ANP: Generalizing from points to functions and from real to complex variables. Thomas L Saaty, Mathematical and Computer Modelling. 467860891Saaty, Thomas L. 2007. Time dependent decisionmaking; dynamic priorities in the AHP/ANP: Generalizing from points to functions and from real to complex variables. Mathematical and Computer Modelling , 46 (7), pp.860891.
Sigmoid Curves in Economics, Limits of Logistic and Gompertz Curves. Julio Sánchezchóliz, Gloria Jarne, retreived December 22SánchezChóliz, Julio, and, Jarne, Gloria 2015. Sigmoid Curves in Economics, Limits of Logistic and Gompertz Curves. http://www.researchgate.net/publication/238793433 (retreived December 22, 2015).
Mediation and the Nash bargaining solution. Charles A Wilson, Review of Economic Design. 634353370Wilson, Charles A. 2001. Mediation and the Nash bargaining solution. Review of Economic Design , 6 (34), pp.353370.
Family_MediatorAdding Notions of Fairness to Those of Interests. John Zelezni Kow, Emilia Bellucci, Frontiers in Artificial Intelligence and Applications. 152121Zelezni kow, John, and Bellucci, Emilia. 2006. Family_MediatorAdding Notions of Fairness to Those of Interests. Frontiers in Artificial Intelligence and Applications , 152, p.121.
| There is currently an intersection in the research of game theory and cryptography. Generally speaking, there are two aspects to this partnership. First there is the application of game theory to cryptography. Yet, the purpose of this paper is to focus on the second aspect, the converse of the first, the application of cryptography to game theory. Specifically, there exist a branch of non-cooperative games which have a correlated equilibrium as their solution. These equilibria tend to be superior to the more conventional Nash equilibria. The primary condition for a correlated equilibrium is the presence of a mediator within the game. This is simply a neutral and mutually trusted entity. It is the role of the mediator to make recommendations in terms of strategy profiles to all players, who then act (supposedly) on this advice. Each party privately provides the mediator with the necessary information, and the referee responds privately with their optimized strategy set. However, there seem to be a multitude of situations in which no mediator could exist. Thus, games modeling these sorts of cases could not use these entities as tools for analysis. Yet, if these equilibria are in the best interest of players, wouldn't it be rational to construct a machine, or protocol, to calculate them? Of course, this machine would need to satisfy some standard for secure transmission between a player and itself. The requirement that no third party (namely other players) could detect either the input or strategy profile would need to be satisfied by this scheme.Here is the synthesis of cryptography into game theory; analyzing the ability of the players to construct a protocol which can be used successfully in the place of a mediator. | Negotiation is a communication process in which different parties try to reach a common agreement. Due to high cost and time spent on traditional negotiation, in the last two decades automated negotiation has been considered. Similarly, in an automated negotiation, competing parties often do not reveal their complete or true preferences. Such setting is called an incomplete information environment. To overcome the complexity that it generates, agents can try to use online opponent modeling, learning the preferences of the opponent during the negotiation. This paper tries to find settings in which the opponent modeling helps agents to improve their performance in a bilateral negotiation. The results of the experiments show that the use of modeling by one or both of the agents will definitely improve social welfare. But when one agent uses opponent modeling, its utility is not necessarily increased. | Nash-in-Shapley: Bilateral Bargaining with Recursive Threat Points | Mechanism design theory strongly relies on the concept of Nash equilibrium. However, studies of experimental games show that Nash equilibria are rarely played and that subjects may be thinking only a finite number of iterations. We study one of the most influential benchmarks of mechanism design theory, the expected externality mechanism (D'Aspremont,Gerard-Varet, 1979) in a finite-depth environment described by the Lk model. While efficient implementation fails under certain conditions, our results provide a vindication of the mechanism in the convex quasi-linear environment with finitely-rational agents.1 challenge to efficient implementation is the fact that information about individual preferences is private. 1 In a setting with quasi-linear utilities, d'Aspremont and Gerard-Varet (AGV, 1979) construct an ingenious mechanism that aligns the agents' individual incentives with total welfare maximization. In a Bayes-Nash equilibrium, the agents' then reveal their types truthfully and efficiency is achieved. The AGV mechanism has become an essential building block for the mechanism design theory (Athey and Segal, 2013).Since the AGV mechanism is tailored to the concept of Bayes-Nash equilibrium, its success in inducing truth-telling and, therefore, efficiency in practice depends on (i) whether the participants' behavioral response to the mechanism coincides with the Bayes-Nash prediction and, if it does not, (ii) whether efficiency still obtains under the possible deviations. While the first question has not been addressed directly in the literature, the experimental results in (simpler) complete information games suggest that the answer is negative. As to the second question, little is known as to the loss of efficiency if the participants do not play equilibrium. 2 This paper tries to fill this gap by studying how the mechanism performs in a behavioral framework where, contrary to the requirement of Bayes-Nash equilibrium, the agents conduct only a limited number of iterations of reasoning.The choice of behavioral setting follows a large body of evidence from experimental games. Recent surveys by Crawford, Costa-Gomez, and Iriberri (2013) andCamerer and Ho (2015)show that non-equilibrium models with finite depth of reasoning, such as the Level-k model (Lk;Nagel 1995;Stahl and Wilson 1994;Costa-Gomes, Crawford, and Broseta 2001;Costa-Gomes and Crawford 2006)and the cognitive hierarchy model (CH; Camerer, Ho, and Chong 2004), systematically outperform equilibrium in predicting human behavior. Along with closely fitting the lab data, these models are able to predict some frequently observed field phenomena such as the winner's curse in common-value auctions: see Crawford and Iriberri, 2007. We choose the Lk model due to its tractability, but most of our results also hold in the CH model. 3 | Temporal Distance and Negotiation Issue Preference Ambiguity | Tactical Aspects of Bargaining and Mediation | who is the biggest buyer in asymmetric negotiations | Axiomatic Analysis of Negotiation Protocols |
1,999,854 | Why are exploits like the ones used in Helya slammed by the community, but addons that make fights easier not even thought about? | Hackers have always been an issue on Apoc, but they are few and far between for the most part. However, since late 2016 to 2017, hackers were a major issue. Every other server there was a child who was abused by his step father taking out his insecurities on Apoc. This was possible because all of the wannabe or be hackers were using Apoc to test their programming skills since it had, regarded by many to be the most effective anti cheat system. But by a combination of the appeal of hacking dying out to alot of long term hackers and more anti cheat efficient games taking the heat, Apoc 1 now only has the occasional "josephhernandez2006" spawning his friends guns. I frankly don't remember why I decided to play Apoc a few days ago, but I was pleasantly surprised to find everything fairly back to normal, you had your people who have no idea what they're doing, the regulars of Apoc, and the tryhards. My only instance of seeing an exploiter was a very naive individual who said "let me test out my hacks" and pushed a server announcement reading "its john cena". Not much later he left the game, my guess was that while testing out his new exploits, the anti cheat kicked in and he left.
Basically what I'm trying to say is that the trend of hacking Apoc has lost its traction and the only exploiters you're going to come across are the hardcore ones that have no idea what they're doing. Give it another go.
It's funny, I used to find myself hating all hackers. But I've come to realize that most of the people who get these exploits don't really understand how much of a taboo thing it is. I can't really hate them when I realize that they just want to have a bit of fun, which is understandable. In the average case the person who uses the exploit will quickly get bored of it, using hacks isn't very engaging past the initial feeling of control and power. | What is actually the mechanic at play here?
I have finally found a clan that raids regularly and I have twice in the last week! (Had only once prior and I've had the game since PC launch) So I want to be useful but also understand what's actually going on. I've learned the mechanics for a few others so I understand why we're taking the steps we are. I also just enjoy knowing that sort of thing because it can sometimes translate marginally well to the D&D games I run, but I'm also just weird.
But yeah! Why do we punch them? What is the point of only punching the one who's symbol doesn't show? What does this do?
Thanks! | I believe to prevent the random killing of hunters, miners, woodcutters, trading posts should be added into the frontier, in places throughout the frontier. This would improve the game by making it harder for toxic raiders to kill those attempting to farm resources, and would also add a place for those farmers to sell their loot without having to make the long trek back to St. Paul or James Bay. Lastly, this would also encourage people to explore, as they can go out farther to hunt, mine, explore, and cut wood without the same risk that would normally get them struck down by raiders attempting to find easy loot of the hard workers who have worked so hard for all that they have gained. | I don't know if this belongs here or to r/Minecraft, so please correct me if I'm posting in the wrong subreddit
But really, having combat based on timing and strategy is much better than just spam clicking. Most people say that shields made combat way too slow, but they simply forget that axes can disable shields and allow you to land some hits. They removed sword blocking-hitting, but to me it seemed more like a bug than a feature, having different items block and hit make combat much better.
English isn't my native language, so sorry if I made some mistakes | This especially goes to the types who are in the higher level rankings and trash others for how they play. (especially if they cheat their way through.)
&#x200B;
This is also coming from somebody who doesn't use addons unless they're specifically for interface or organisation, certainly not to show me how to progress, and does very well without all this other stuff.
&#x200B;
To start this off, I'm not saying nobody should use them, I really don't care whether people do or not, though I do have a severe issue with people forcing others to use them. My problem is specifically against those who are hateful toward others because they happened to progress more, but they don't think about the fact that they wouldn't even be as far as they do without.
&#x200B;
I'd be willing to bet they'd be nowhere near the top if they tried without, but that's neither here nor there. | Started a new playthrough for the sole reason of gay-romancing the bull with a dwarf(I find that sort of thing humorous) and decided to use the elite trial for some extra boost.
But the enemies power up in the worst of ways don't they?
Mages get an unending barrier that makes fights annoying, long and boring, same for elite shield guys.
How do you feel about this? | I have been playing around with call of the wild adding it and removing from my deck. Sometimes it is really strong but other times it just okay.
What is your experience with the new Call of the Wild and should i disenchant it for good? | Was curious if anybody had any stories of actually getting to use the big tough guys yet (vader, Luke, palpatine, bounty hunters) against their PC's and what were the results? | 1,999,854 | The main issue I see people having with these top guilds is how making the fight easier by exploiting is cheating. I agree, but how come addons are given a free pass even when they trivialise the fight.
Mythic archimonde without radar addons/ mark WA's. Iskar without iskar assist. Even the weak aura for ursoc taunting. Operator thogar had an addon to show where the trains were coming from. I know these arent as bad as essentially glitching a boss to outright not perform a part of the fight, but where is the line in peoples opinion | Odd experience with Ipsy regarding Add Ons. | What are some extra benefits or influences champs get by having certain passives/abilities? (Yuumi 6th slot because no boots, Kat R/ Samira R let you know of invisible enemies in your proximity, etc) [Discussion] | Looks like they are removing Guild leveling in WoD, how do you feel about that? | Apex Solos was a bust so they kept mechs in the game. | Can the Skyrim Thieve’s Guild be justified for a “good guy” play through? | So are y'all farming the best of the best passives on HE for ALL characters here just incase they get totally busted in the future? | Why Nu Wa's 2+3 combo is the best move(s) in the game. | WCL to ban guilds for continued uploading of exploited MOTHER logs |
1,999,855 | Rich Pastoral Advice on Friendship and Sexuality in Marriage | The emphasis on being friends with the other gender as opposed to my upbringing to completely avoid them lest there be fornication completely redefined my view on the topic and for that I am grateful. It would benefit church teen groups to read this and discuss often and I wish that I had this knowledge as a youth, instead of the sexual basis it was always turned into, but this is part of my story that I am thankful for as the husband God led me to and I are very happy in marriage. I greatly enjoyed the quotes from other favorite literary sources and the authors historical research. | The attitudes towards sexuality in Western society are undergoing dramatic change. One of the main problems sexual ethics has to deal with today is the question whether the church should acknowledge unmarried long-term relationships. The debate about the acknowledgement of homosexuality as a form of human sexuality equal to heterosexuality is aiming towards the acknowledgement of the equal status of homosexual partnerships and heterosexual marriages as a final consequence. In addition to these issues the article also discusses the issue of the blessing of unmarried or homosexual couples. In light of such public blessings and their liturgical form, the article aims to discuss the question about the promise such blessings holds according to Christian ethics. | I was talking to a good friend of mine earlier (she's a Buddhist) and she recommended to me that perhaps couples counseling would be helpful to me and my s/o. I explained that my s/o is an atheist (I guess I am agnostic), and that I also don't think it makes sense for people who are not certified/licensed to do therapy to be counseling couples for marriage. Her suggestion was still interesting to me simply because she has friends who are married who have all done year-long counseling before getting married and they have said that they think it made a huge difference in how successful their marriages are. I was just curious whether anyone has ever been given the suggestion before to do that kind of counseling, and what was your response? | Today I was watching the Sopranos and Father Phil's arc came to a conclusion when Carmella Soprano confronted him over his sexual teasing, and it made me wonder about Christian sexual conduct in today's hyper-sexualized world. Do you think it's best for Christians to get married sooner than later in order to stymie temptation and stifle sexual tension?
Edit: I don't know what the downvote was for, combating sexual immorality for me is a genuine concern and I'd hope it is for y'all too. | The debate within the Church over homosexuality and same-sex marriage continues to rage. Often without the love of Christ. I'm not a partisan--at least not in the sense of advocating for the A side (God blessed same-sex marriage.) or B side (Those with same-sex attractions must remain celebate.) So, it was refreshing to read something on the subject that makes a reasoned call for peace within the body of Christ. For charity and understanding.
I rather enjoyed Tim Otto's comments regarding the Church of the Sojourners. I, too, long for that intentional closeness. Emotional intimacy and vulnerability are sadly lacking in many churches. And, for me, the strongest part of this book is the author's plea for us as believers to set aside our division and simply love each other--and forgive each other--the way our Savior does us.
Definitely a recommended read if you're at all interested in the ongoing debate. And in bringing an end to the strife. | So I recently had a distant friend get back in contact with me because he had just been "saved" and was very keen on convincing me back into Christianity. I still hold some progressive Christian beliefs and i played them up in the convo. Well I kept emphasizing loving people as the primary goal of my life and of christianity and he spouted some bull shit about loving by telling harsh truths. He kept saying I was ignoring the bible (when all I was doing was properly translating and contextualizing it).
Well my thought was about the verse that says faith hope and love, but the greatest of these is love.
Would say that Christians today, by their actions and words, have proven that they truly believe that out of faith, hope, and love, they believe the greatest is faith. It is more important to them to have blind faith than it is to love people, like when it comes to homosexuality they believe its wrong based on their faith in the literalness of scripture. (they don't translate it or contextualize it properly but that's besides the point). They think it's more important to believe something that harms people than it is to love people.
I think calling them out on that would produce interesting results. Any thoughts? Is it a sound argument or would they say that I'm misusing the verse? Any ideas on where I could take it?
I have some Christian friends that I'm not looking to deconvert necessarily, but they will want to talk about this stuff when the pandemic is over and I'm looking for ways to engage that are healthy for the friendship but also challenging them to think for themselves (as cliché as that sounds) | Pastors, here is a resource for your use in pre-marriage counseling. It helps the process of your discussions, even of difficult topics or often forgotten ones, go smooth as possible. This is only a tool and is not to replace your Biblical counseling to couples seeking wedlock, but it is a great read for the perspective couple and helps them to bring things up in your sessions with them that may not have otherwise come up. A sturdy addition or viable alternative to other materials you may already be using. Give the help that is needed before the ceremony.
This is also a good review tool for the married, whether short or long time couples. -->Helps keep the knot tighter, or re-tighten the loosening knot. | Is it unrealistic to want straight couple ideals? Such as marriage, children and a stay at home spouse who cooks and cleans? Is no sex before marriage (even though not as commonly practiced anymore) realistic? | 1,999,855 | Based on two lectures given by Beeke at a conference in 2011, the book is rather short at 96 (small) pages. In concise, pointed language, Beeke makes the most of the short amount of space, providing a wealth of biblical counsel and wisdom on the matters of friendship and sexuality in marriage.
The first part (pp. 11-44) is on friendship and is divided into three chapters: on the biblical foundation for friendship in marriage (marriage as created and intended by God), on the cultivation of friendship in marriage (through sharing yourselves, your faith, your trust, and your joy), and on various temptations that marital friendships face. This first part is loaded with biblical wisdom as Beeke ably takes passages from the book Proverbs that speak of friendship and relationships in general and applies them directly to marriage.
He uses one section, for example, to expound upon Proverbs 27:5-6: "Better is open rebuke than hidden love. Faithful are the wounds of a friend; profuse are the kisses of an enemy." Beeke wisely sets this forth as a calling to learn how to give and receive criticism with charity and generosity, and to do so thoughfully as "disciplined thankfulness" (35).
The second part (pp. 45-88) is on sexuality in marriage, and is divided into 9 sections (briefer than ordinary chapters) that unfold the biblical picture of sex as a good gift of God within the context of marriage. Beeke uses a wise combination of pointed and respectful language - much of it taken from the puritans - providing a treasure trove of pastoral advice for couples in all stages of the marriage relationship. He exhorts husbands and wives to embrace the goodness of sexuality within the freeing boundaries of God's Word, showing how God's Word frees us from both the rejection of sex and the idolizing of sex, from both asceticism and the perversion of human sexuality. He makes foundational use of Paul's instructions in 1 Timothy:
"Now the Spirit expressly says that in later times some will depart from the faith by devoting themselves to deceitful spirits and teachings of demons, 2 through the insincerity of liars whose consciences are seared, 3 who forbid marriage and require abstinence from foods that God created to be received with thanksgiving by those who believe and know the truth. 4 For everything created by God is good, and nothing is to be rejected if it is received with thanksgiving, 5 for it is made holy by the word of God and prayer." (1Timothy 4:1-5)
The solution to materialism and slavery to sex, as Beeke notes on p. 46, is not asceticism, but "God, who richly provides us with everything to enjoy" (1Timothy 6:17). Beeke uses this insight, combined with the rich language of Proverbs and Song of Solomon (especially Proverbs 5), to set forth a positive vision for the goodness and beauty of sexuality in marriage.
The book concludes with a substantial list of thought-provoking discussion questions and a wealth of bibliographic guidance for further reading in the endnotes.
Joel Beeke's pastoral advice in this short book serves well to help husbands and wives confess of each other in Christ the words of Song of Solomon 5:16: "This is my beloved and this is my friend."
Highly recommended! | What does the bible say about sex and marriage | Love is classified in to 4 types in the Bible I think Can some one please tell me what all they? | A much needed Biblical book on sex in sexually confused culture | The Marriage Season - Bonding Of Love And Friendship | Where does it speak of marriage in the bible? | This book follows all of the traits of love found in 1 Corinthians 13 | What are the three types of love mentioned in the bible? | `Sweet Pea' and `Pussy Cat': An Examination of Idiom Use and Marital Satisfaction Over the Life Cycle: |
1,999,856 | Understanding prevention effectiveness in real-world settings: the National Cross-Site Evaluation of high risk youth programs. | We developed an interactive, customizable, Web-based program focused on the prevention of HIV, sexually transmitted infections, and hepatitis among youth. Results from a randomized, controlled trial with youth in treatment for substance use demonstrated that this Web-based tool, when provided as an adjunct to an educator-delivered prevention intervention, increased accurate prevention knowledge, increased intentions to carefully choose partners, and was perceived as significantly more useful relative to the educator-delivered intervention when provided alone. Results suggest this Web-based program may be effective and engaging and may increase the adoption of effective HIV and disease prevention science for youth. Limitations are discussed. | Teenagers face significant risks when using increasingly popular social network sites. Prevention and intervention efforts to raise awareness about these risks and to change risky behavior (so-called “e-safety” interventions) are essential for the wellbeing of these minors. However, several studies have revealed that while school interventions often affect awareness, they have only a limited impact on pupils’ unsafe behavior. Utilizing the Theory of Planned Behavior and theories about parental involvement, we hypothesized that involving parents in an e-safety intervention would positively influence pupils’ intentions and behavior. In a quasi-experimental study with pre- and post-test measures involving 207 pupils in secondary education, we compared the impact of an intervention without parental involvement with one that included active parental involvement by means of a homework task. We found that whereas parental involvement was not necessary to improve the intervention’s impact on risk awareness, it did change intentions to engage in certain unsafe behavior, such as posting personal and sexual information on the profile page of a social network site, and in reducing existing problematic behavior. This beneficial impact was particularly evident for boys. These findings suggest that developing prevention campaigns with active parental involvement is well worth the effort. Researchers and developers should therefore focus on other efficient strategies to involve parents. | In response to the commercial sexual exploitation of children (CSEC) within five U.S. cities, the CSEC Community Intervention Project (CCIP) was created to enhance collaboration among nongovernmental organization (NGO) representatives, law enforcement officials and prosecutors in Chicago, Atlantic City, Denver, Washington, D.C., and San Diego. A total of 211 participants were surveyed during a 3-day CCIP training institute held in each city. Evaluation data suggest that participants were positively influenced in their knowledge, skills, and attitudes regarding CSEC. Our findings inform NGO representatives, law enforcement officials, and prosecutors of the importance of professional training and the benefits of cross-disciplinary collaboration in addressing CSEC. | As the prevalence and severity of youth violence have risen, so have programs aimed at preventing such violence. We review 30 programs categorized as antiviolence, conflict-resolution, or peace programs, based on goals, target skills, and theoretical constructs. Through empirical evaluations, we designate programs as either promising or effective. After considering the unique aspects of each program, we outline five criteria to guide selection of the best violence-prevention programs for addressing theoretical foundations, comprehensive skills, diverse populations, teacher training, and children's self-worth. | Increased incidence of sexually transmitted diseases, especially HIV/AIDS, and unintended pregnancies among adolescents call for immediate measures that should educate adolescents and reduce risk from such outcomes. This article discusses school-based condom availability programs as one means to facilitate access to condoms and provide additional counseling for prevention of undesired consequences of adolescent sexual behaviors. | A computer-based intervention was designed to change perceived threat, perceived efficacy, attitudes, and knowledge regarding pregnancy, STD, and HIV prevention in rural adolescents. The intervention, which was guided largely by the extended parallel process model (Witte, 1992), was implemented and evaluated in nine rural high schools using an institutional cycle pretest–posttest control-group design (Campbell & Stanley, 1963; Cook & Campbell, 1979). Eight-hundred eighty-seven ninth-graders completed the survey at both points in time. Process evaluation results indicated that the intervention was implemented as intended, and that over 91% of students in the treatment group completed at least one of the six computer-based activities (M = 3.46, SD = 1.44 for those doing at least one activity). Two-way mixed-model repeated-measures analysis of variance revealed that students in the treatment group outperformed students in the control group on knowledge, condom self-efficacy, attitude toward waiting to have s... | The State of Rhode Island contracted with the authors to prepare a statewide, comprehensive substance abuse prevention plan. The literature review revealed a lack of research on statewide planning for prevention services. To obtain data for Rhode Island's plan, the authors conducted a family of studies including synthetic estimation, key informant interviews, a telephone survey of agency directors, program budget analysis, construction of a statistical index for estimating the optimal geographic allocation of prevention dollars, and a review of General Laws regarding tobacco, alcohol, and other drugs. Their recommendations include the increased funding and coordination of prevention services, allocating services according to need rather than popula tion size, greater use of social policy as a prevention tool, and a shift in primary prevention programming from senior high to lower grades and in program emphasis from information-education to psychosocial programs. | The aim of this present study was to evaluate the effectiveness of a child sexual abuse (CSA) prevention curriculum toward children and to compare the knowledge gains between children who were taught by teachers and their parents. Four hundred and eighty-four school-age children recruited from one primary school in Beijing, China, were randomly assigned to a CSA prevention program administered by teachers or their parents or to a wait-list control group. The findings reveal that children in the teacher education group demonstrated the highest level of CSA prevention knowledge and skills, followed by the parent education group, while children in the control group showed the least improvements. The knowledge and skills gains were retained at a 12-week follow-up. The present study shows that Chinese school-age children can benefit from CSA prevention program with increased knowledge and skills of personal safety. School-based CSA prevention education should be improved and implemented in other regions of China. | 1,999,856 | The National Cross-Site Evaluation is a large multisite evaluation (MSE) of 48 substance abuse prevention programs, 5,934 youth participating in programs, and 4,539 comparison youth programs. Data included a self-report questionnaire administered at 4 points in time, detailed dosage data on over 217,000 program contacts, and detailed site visit information. In a pooled analysis, the programs did not demonstrate significant positive effects on a composite outcome measure of tobacco, alcohol, and marijuana use in the previous 30 days. However, disaggregated analyses indicated that 1) sites in which comparison groups had strong opportunity to participate in prevention programs suppressed observed effects; 2) youth who had already started using before they entered programs reduced use significantly more than comparison youth who had started using; and 3) both males and females who participated in programs significantly reduced use relative to comparisons, but in very different patterns. Combining these patter... | Assessing Multisite Alcohol and Other Drug Dependency Treatment Programs | Background: Alcohol misuse ranks within the top ten health conditions with the highest global burden of disease. Lowintensity, Internet interventions for curbing adult alcohol misuse have been shown effective. Few meta-analyses have been carried out, however, and they have involved small numbers of studies, lacked indicators of drinking within low risk guidelines, and examined the effectiveness of unguided self-help only. We therefore conducted a more thorough metaanalysis that included both guided and unguided interventions.Methods: Systematic literature searches were performed up to September 2013. Primary outcome was the mean level of alcohol consumption and drinking within low risk guidelines for alcohol consumption at post-treatment.Findings: We selected 16 randomised controlled trials (with 23 comparisons and 5,612 participants) for inclusion. Results, showed a small but significant overall effect size in favour of Internet interventions (g = 0.20, 95% CI: 0.13-0.27, p,.001). Participants in Internet interventions drunk on average 22 grams of ethanol less than controls and were significantly more likely to be adhering to low-risk drinking guidelines at post-treatment (RD 0.13, 95% CI: 0.09-0.17, p,.001). Subgroup analyses revealed no significant differences in potential moderators for the outcome of alcohol consumption, although there was a near-significant difference between comparisons with waitlist control and those with assessment-only or alcohol information control conditions (p = .056).Conclusions: Internet interventions are effective in reducing adult alcohol consumption and inducing alcohol users to adhere to guidelines for low-risk drinking. This effect is small but from a public health point of view this may warrant large scale implementation at low cost of Internet interventions for adult alcohol misuse. Moderator analyses with sufficient power are, however, needed in order to assess the robustness of these overall results and to assess whether these interventions may impact on subgroups with different levels of success. | Abstract This paper describes both a pilot and a larger research effort to implement and evaluate a comprehensive community-based approach to drug abuse prevention. Since heart disease is a side effect of youth and adult chemical abusers, models for community-based prevention in the heart disease prevention area are discussed as well as issues that are specific to the area of drug abuse prevention. Criteria for successful community drug abuse prevention programs are outlined that include the necessity for employing a step-wise multi-component approach involving school, media, parent, and community organization programs. Implications of the initial results of the pilot for future community prevention programs are also described. Entry, community support, and long-term community ownership of prevention are emphasized. | Evaluation of Community-Level Effects of Communities That Care on Adolescent Drug Use and Delinquency Using a Repeated Cross-Sectional Design | Purpose: This study evaluates the effectiveness of an intervention targeting adolescent risk-taking associated with drug and alcohol use, driving, and celebrating. Methods: Pre- and post written surveys were administered in 21 intervention and 19 comparison schools in Northern New South Wales during March 2003 and 2004. The instrument covered knowledge and attitudes associated with self-reported potentially harmful and protective behaviors. Analysis was by multi-level regression. Results: There were 2705 baseline and 1996 follow-up respondents. Adolescents in the interven- tion area who attended the Reduce Risk Increase Student Knowledge (RRISK) seminar demon- strated some significant improvements in knowledge, attitudes and behavior compared with those who did not attend, and some significant improvements in knowledge compared with students in comparison schools. Conclusions: A well-designed one-day seminar that builds on existing curricula, can achieve some significant medium-term benefits in knowledge attitudes and behaviors. © 2006 Society for Ado- lescent Medicine. All rights reserved. | Using Value-Added Analysis to Examine Short-Term Effects of Early Intervention: | Group Session Rating Scale: Preliminary psychometrics in substance abuse group interventions | CATCH-IT Report: Evaluation of an Internet-Based Smoking Cessation Program: Lessons Learned From a Pilot Study |
1,999,857 | We herein report two cases of thymic cancer with Lynch syndrome showing a high frequency of microsatellite instability and loss of mismatch repair protein expression without MLH1 promoter hyper-methylation. In Case 1, a 71-year-old man had a pathogenic germline variant in MLH1 and underwent tumor resection. No relapse has been reported thus far. In Case 2, a 43-year-old man underwent genetic testing that also showed a pathogenic germline variant in MLH1. Since these two cases had MLH variants, we suspect a possible association between thymic cancer with Lynch syndrome and germline pathogenic variants in MLH1.A 71-year-old man was incidentally diagnosed with a mediastinal tumor by computed tomography (CT) during his regular checkup for LS and was referred to our department for a further examination.The patient had a medical history of metachronous gastric | e12524 Background: Tumours from patients with Lynch syndrome (LS) have characteristic features resulting from underlying defective mismatch repair (MMR), that results in microsatellite instability (MSI) and absence of MMR protein expression by immunohistochemistry (IHC). Most MSI is due to biallelic somatic hypermethylation of the MLH1 promoter in older patients with no family history of CRC. The presence of BRAF (V600E) mutation MLH1 makes a diagnosis of LS less likely. In addition, “germline epimutation” represents a novel mechanism for disease in which the affected allele of a gene is rendered silent in the germline by an epigenetic aberration. In this pilot study we describe the molecular workup to differentiate between sporadic colon tumours with MSI and LS. Methods: LS work-up in Ireland traditionally includes IHC, MSI, BRAF testing and genetic testing. CRC databases in two hospitals were reviewed and cross referenced with molecular data from the NCMG to identify individuals who additionally had MLH... | Abstract The pathogenic role for heritable mutations in the DNA sequence of tumor suppressor and DNA repair genes has been well established in familial cancer syndromes. These germ line mutations confer a high risk of developing particular types of cancer, according to the gene affected, at a young age of onset when compared to sporadically arising cancers of a similar type. The widespread role for epigenetic dysregulation in the development and progression of sporadic cancers is also well recognized. However, it has only become apparent in recent years that epigenetic aberrations can also occur constitutionally to confer a similar cancer phenotype as a genetic mutation within the same gene. These epigenetic errors are termed “constitutional epimutations” and are characterized by promoter methylation and transcriptional silencing of a single allele of the gene in normal somatic tissues in the absence of a sequence mutation within the affected locus. This is best exemplified in Lynch syndrome, which is an autosomal dominant cancer susceptibility syndrome characterized by the early development of colorectal, uterine, and additional cancers exhibiting microsatellite instability due to impaired mismatch repair. Lynch syndrome is usually caused by heterozygous loss-of-function germ line mutations of the mismatch repair genes, namely MLH1 , MSH2 , MSH6 , and PMS2 . Tumors develop following an acquired somatic loss of the remaining functional allele. However, a subset of Lynch syndrome cases without genetic mutations instead has a constitutional epimutation of MLH1 or MSH2 . These epimutations are associated with distinct patterns of inheritance depending on the nature of the mechanisms underlying them. | Loss of DNA Mismatch Repair Proteins in Skin Tumors From Patients With Muir–Torre Syndrome and MSH2 or MLH1 Germline Mutations: Establishment of Immunohistochemical Analysis as a Screening Test | 11523Background: Somatic mutations in mismatch repair (MMR) genes MLH1, MLH3, MSH2, MSH3, MSH6, and PMS2, and/or DNA polymerase POLE, are associated with a high mutation burden in cancer genomes. H... | Summary ::: ::: We report a 62-year-old man with rectal cancer, two keratoacanthomas and multiple sebaceous adenomas, epitheliomas and sebaceous hyperplasia. His brother and father died from colorectal cancer. A subgroup of patients with the Muir-Torre syndrome (MTS) is allelic to the cancer family syndrome. This genetic disorder is caused by an autosomal dominant inherited germline mutation in one of the DNA mismatch repair genes. It is thought that a somatic mutation of the other allele leads to a genomic instability responsible for tumorigenesis. In the patient presented here the instability was detected in two characteristic skin lesions; sebaceous adenoma and epithelioma. The search for a causal germline mutation revealed a frameshift mutation in the mismatch repair gene hMSH2 leading to a truncated protein. A presymptomatic molecular diagnosis can be offered to the children of the patient. | Hereditary Tyrosinemia Type 1 (HT1) is an autosomal recessive disorder resulting from a deficiency of fumarylacetoacetase caused by mutations in the fumarylacetoacetate hydrolase (FAH) gene. We detected 11 novel and 6 previously described pathogenic mutations in a cohort of 43 patients originating from the Middle East with the acute form HT1. All of the mutations were homozygous and we did not find the presence of a "founder mutation". | Hereditary nonpolyposis colorectal cancer (HNPCC), also termed Lynch syndrome, was originally called cancer family syndrome. Historically, in 1913 Aldred Warthin, a pathologist, published a family, now known as Family G, which had features of HNPCC. It was first delineated as a hereditary cancer syndrome in the mid-1960s by Lynch. There was an apparent autosomal dominant mode of inheritance of colorectal cancer and certain integral cancers, the most prominent of which was endometrial carcinoma. Prior to the discovery in 1993 and 1994 of genes (hMSH2, hMLH1, hPMS1, hPMS2) known as mismatch repair genes or mutator genes, the diagnosis of HNPCC rested exclusively upon evaluation of clinical findings in concert with a well-documented and extended pedigree. Thus, this disorder has evolved from a medical curiosity into a clinical syndrome wherein molecular biologists provided proof of its hereditary status. These discoveries should aid in elucidating its pathogenesis and carcinogenesis and in the next decade we likely will learn more about chemoprevention and surgical prophylaxis of HNPCC. | Review of the Lynch syndrome: history, molecular genetics, screening, differential diagnosis, and medicolegal ramifications. | 1,999,857 |
Introduction
Lynch syndrome (LS) is one of the most common genetic cancer syndromes, affecting one in every 250-1,000 people in the general population. This autosomal dominant disease is caused by a germline pathogenic variant in one of the four DNA mismatch repair (MMR) genes: MSH2, MLH1, MSH6 and PMS2 (1)(2)(3)(4).
The most common cancers associated with LS are colorectal cancer (CRC) and endometrial cancer. In addition, the carriers of pathogenic DNA variants in MMR genes are at high risk of developing other forms of cancers, such as gastric, ovarian, pancreatic, renal (pelvic/ureteral), and biliary tract cancer, as well as brain tumors, sebaceous tumors, keratoacanthomas, and small intestinal tumors (5). Other cancers reported to be potentially associated with LS include adrenocortical adenocarcinoma, thyroid carcinoma, peritoneal mesothelioma, malignant fibrohistiocytoma, rhabdomyosarcoma, dermatofibrosarcoma, leiomyosarcoma, liposarcoma, carcinoid tumor, non-Hodgkin's lymphoma, and malignant melanoma, along with pancreas, prostate, and breast cancer (6). However, very few studies have shown an association between thymic cancer and LS. Therefore, the correlation between thymic cancer and LS remains unclear (7,8).
In this case study, which was approved by the Institutional Review Board of Iwakuni Clinical Center (approval no. 0354), we describe two cases of thymic cancer in patients with LS. His family history met the revised Bethesda guidelines (5) but did not meet the modified Amsterdam criteria (9). Genetic testing of the patient's daughter and sibling showed pathogenic variants in MLH1 [NM_000249.4:c.381-431_ c.453+717del1221, (p.Ala128Trpfs * 8)], implying that the patient was an obligate carrier of MLH1.
CT detected an abnormal nodule in the anterior mediastinum, which was then suspected to be a thymoma, and it gradually grew in size. Video-assisted thoracoscopic thymomectomy was performed as the intraoperative pathological diagnosis was thymoma, and there were marked intrathoracic adhesions around the tumor. A final histological diagnosis was made, which revealed a poorly differentiated squamous cell carcinoma, Masaoka Stage II. Furthermore, the microsatellite instability (MSI) analysis of the tumor using the National Cancer Institute panel revealed a high frequency MSI (MSI-H) (5).
Immunohistochemistry (IHC) of the tumor was positive for MSH2 and MSH6 but negative for MLH1 and PMS2 ( Fig. 1), which was consistent with the germline variant of MLH1. A methylation analysis of the MLH1 promoter re-gion yielded negative results. These results suggested that thymic cancer developed as an LS-associated tumor.
Difficulty resecting the residual thymus led to additional radiotherapy being performed on the patient instead of thymectomy. A period of more than five years has passed, and no occurrences of a relapse or any other cancers have been reported in this patient.
Case 2
A 43-year-old man underwent surgery for cecum cancer at a local clinic. He was diagnosed with a high accumulation of fluorodeoxyglucose in the anterior mediastinum on positron emission tomography (PET). He was therefore referred to our hospital for a colon cancer recurrence checkup and further treatment, as this finding was suspected to be indicative of a malignant thymoma.
The patient had a medical history of sigmoid colon cancer (details unknown) at 17 years old and cecum cancer (T2N0 M0 Stage I: UICC TNM classification 8th edition) at 43 years old. His family history met the Amsterdam I criteria. Genetic testing showed a pathogenic variant of MLH1 [NM_ 000249.4:c.381-415_453+733del1221, (p.Ala128Trpfs * 8)]. A family history interview did not reveal any apparent consanguinity between Cases 1 and 2.
Extended thymectomy was performed. The histological diagnosis revealed a poorly differentiated squamous cell carcinoma that invaded the brachiocephalic vein and the left upper lobe of the lung (Masaoka Stage III). IHC revealed that the tumor was positive for MSH2 and MSH6 but negative for MLH1 and PMS2 (Fig. 2). The tumor exhibited MSI-H according to the MSI testing. A methylation analysis of the MLH1 promoter region yielded negative results. These results proved that the tumor was associated with LS.
Despite the fact that the surgical margin was negative, radiotherapy was administered to reduce the risk of local relapse. Unfortunately, multiple lung nodules were detected approximately one year after thymectomy had been performed. We performed wedge resection for one of the nodules and diagnosed him with metastases from previous colon cancer. Because he had received the folinic acid, fluorouracil and oxaliplatin (FOLFOX) regimen as adjuvant treatment after colectomy, we chose the folinic acid, fluorouracil and irinotecan (FOLFIRI) plus panitumumab (an epidermal growth factor receptor tyrosine kinase inhibitor) regimen for the recurrence. After disease progression, he received pembrolizumab (an immune checkpoint inhibitor) for approximately six months. Treatment was then discontinued due to interstitial pneumonia, and he died at 46 years old.
Discussion
The two cases of thymic cancer that occurred in patients with a pathogenic germline variant of MLH1 did not show methylation of the MLH1-promoter region in thymic cancer tissues. Therefore, these thymic cancers were presumed to have an association with LS. The role of DNA MMR genes is to maintain genome fidelity by repairing base mismatches and insertion-deletion mismatches during DNA replication. When the DNA MMR function is impaired, the sequence repeat number in simple repetitive sequences (microsatellites) is prone to change. An altered number of repetitive sequences in microsatellites is called MSI. Therefore, LSassociated tumors with variants in MMR genes commonly exhibit an MSI-H status. In addition, a majority of the DNA MMR function losses lead to the loss of the corresponding MMR protein products (5,6).
For CRC and endometrial cancer in patients with LS, MSI testing reportedly shows an MSI-H status in more than 90% of cases and is highly consistent with the loss of MMR protein expression in IHC (1, 3). Although MSI-H and loss of MMR protein expression in tumor tissues are characteristic features of LS, these phenomena frequently occur in sporadic CRC and endometrial cancer due to hypermethylation of the promoter region of MLH1.
Given the above, we conducted a methylation analysis to exclude epigenetic changes caused by hypermethylation of the promoter region of MLH1. Since both of our present cases showed an absence of methylation of MLH1, their thymic cancers were presumed to have developed as a result of LS. To our knowledge, only two cases of thymic cancer in LS have been reported previously.
Thymic cancer is rare and has high malignancy potential. In Japan, the incidence of thymic cancer is reported to be 0.29 cases per 100,000 person-years, and the number of surgically resected cases is approximately 300 per year. According to the World Health Organization's histological classification, thymic cancer is classified as type C thymoma. Although its symptoms include cough, chest pain, and dyspnea, it is generally detected incidentally by diagnostic imaging. This population is reportedly 66% men and 34% women, with a median age of 65.5 (range, 16-96) years old (10). The Masaoka classification system is the most widely used staging system for treatment (11). The frequency of MSI-H in thymic cancers was reported to be 0.67-0.81% (12,13). In sporadic thymic cancer, the frequency of MSI-H was low (<1%), whereas MSI-H was observed in both of the present cases of thymic cancer in patients with LS (Table) (7,8). These findings suggest that our cases of thymic cancer occurred as LS-associated tumors, so an MSI analysis for thymic cancer may be useful as an LS screening test. The incidence of LS-associated tumors reportedly varies, depending on MMR variants. For instance, biliary tract cancer is predominant in patients with MLH1 mutations, and renal, pelvic, and ureteral cancers are predominant in those with MSH2 variants (14). Although the number of reported cases of thymic cancer in LS is very limited, all four reported cases had MLH1 variants. Therefore, thymic cancer in LS may be predominant in patients with MLH1 variants.
Owing to the low incidence of thymic cancer, there are few optimal evidence-based therapies available for treatment. We performed surgical resection followed by radiation therapy in both of the cases presented here. There was no evidence of recurrence of thymic cancer. Effective chemotherapy and immunotherapy for advanced or metastatic thymic cancer are limited (15). However, in recent years, the efficacy of pembrolizumab, an immune checkpoint inhibitor (ICI) of anti-PD-1 antibody, against solid tumors with MMR deficiency characterized by MSI-H and/or MMR protein loss by IHC has been demonstrated (12,16,17). ICIs may thus be useful for treating thymic cancer with LS.
Figure 1 .
1A: Chest enhanced CT showed an anterior mediastinal tumor. B: A pathological analysis revealed thymic cancer (magnification ×100). C: Results of an immunohistochemical analysis. Loss of MLH1 and PMS2 and retention of MSH2 and MSH6 (magnification ×200). cancer at 54 (moderately differentiated adenocarcinoma, T2 N0M0 Stage I: Union for International Cancer Control (UICC) TNM classification 8th edition) and 62 years old (well-differentiated adenocarcinoma, T1bN0M0 Stage I: UICC TNM classification 8th edition). The patient had also had ascending colon cancer (TisN0M0 Stage 0: UICC TNM classification 8th edition) at 69 years old.
Figure 2 .
2A: Chest enhanced CT revealed an anterior mediastinal tumor that had invaded the brachiocephalic vein. B: A pathological analysis revealed thymic cancer (magnification ×100). C: Immunohistochemical analyses of the tumor were positive for MSH2 and MSH6, and negative for MLH1 and PMS2 (magnification ×200).
Table .
.Clinicopathological Characteristics of Reported Cases of Thymic Cancer in Patients with Lynch
Syndrome.
Reference
Age Sex
Microsatellite
status
Altered gene
Methylation
analysis
Pathogenic germline variant
(7)
45
F
Not reported †
MLH1
Not reported
Heterozygous mutation del exon 12
(8)
34
F
MSI-H
MLH1
Not reported
p.Gly351Aspfs*16
Our case
71
M
MSI-H
MLH1
Negative
p.Ala128Trpfs*8
Our case
43
M
MSI-H
MLH1
Negative
p.Ala128Trpfs*8
†
Genomic panel on the tumor revealed deficient MMR status with a two-copy deletion of MLH1 at 3p22.2 and c-Kit mutation.
ConclusionWe suspect an association existed between thymic cancer and LS in these two cases. Furthermore, based on the existing data and observations of the present families, the MLH1 variant may be predominant in thymic cancer patients with LC.Author's disclosure of potential Conflicts of Interest (COI). Kiwamu Akagi: Honoraria, MSD.
Lynch Syndrome. GeneReviews. W Kohlmann, S B Gruber, Internet. cited 2021 Jun 8Kohlmann W, Gruber SB. Lynch Syndrome. GeneReviews 2004 [Internet]. [cited 2021 Jun 8]. Available from: https://www.ncbi.nl m.nih.gov/books/NBK1211/
Heritable somatic methylation and inactivation of MSH2 in families with Lynch syndrome due to deletion of the 3' exons of TACSTD1. Mjl Ligtenberg, R P Kuiper, T L Chan, Nat Genet. 41Ligtenberg MJL, Kuiper RP, Chan TL, et al. Heritable somatic methylation and inactivation of MSH2 in families with Lynch syn- drome due to deletion of the 3' exons of TACSTD1. Nat Genet 41: 112-117, 2009.
Japanese Society for Cancer of the Colon and Rectum. Japanese Society for Cancer of the Colon and Rectum (JSCCR) Guidelines 2016 for the clinical practice of hereditary colorectal cancer (translated version). H Ishida, T Yamaguchi, K Tanakaya, J Anus Rectum Colon. 2Suppl IIshida H, Yamaguchi T, Tanakaya K, et al.; Japanese Society for Cancer of the Colon and Rectum. Japanese Society for Cancer of the Colon and Rectum (JSCCR) Guidelines 2016 for the clinical practice of hereditary colorectal cancer (translated version). J Anus Rectum Colon 2 (Suppl I): S1-S51, 2018.
Current clinical topics of Lynch syndrome. K Tanakaya, Int J Clin Oncol. 24Tanakaya K. Current clinical topics of Lynch syndrome. Int J Clin Oncol 24: 1013-1019, 2019.
Revised Bethesda Guidelines for hereditary nonpolyposis colorectal cancer (Lynch syndrome) and microsatellite instability. A Umar, C R Boland, J P Terdiman, J Natl Cancer Inst. 96Umar A, Boland CR, Terdiman JP, et al. Revised Bethesda Guide- lines for hereditary nonpolyposis colorectal cancer (Lynch syn- drome) and microsatellite instability. J Natl Cancer Inst 96: 261- 268, 2004.
Risk of breast cancer in Lynch syndrome: a systematic review. A K Win, N M Lindor, M A Jenkins, Breast Cancer Res. 1527Win AK, Lindor NM, Jenkins MA. Risk of breast cancer in Lynch syndrome: a systematic review. Breast Cancer Res 15: R27, 2013.
Thymic carcinoma with lynch syndrome: an unusual association. D Pandey, D Shepro, BMJ Case Rep. 13230241Pandey D, Shepro D. Thymic carcinoma with lynch syndrome: an unusual association. BMJ Case Rep 13: e230241, 2020.
Thymic carcinoma with Lynch syndrome or microsatellite instability, a rare entity responsive to immunotherapy. M Repetto, F Conforti, S Pirola, Eur J Cancer. 153Repetto M, Conforti F, Pirola S, et al. Thymic carcinoma with Lynch syndrome or microsatellite instability, a rare entity respon- sive to immunotherapy. Eur J Cancer 153: 162-167, 2021.
. Hfa Vassen, P Watson, J P Mecklin, H T Lynch, Vassen HFA, Watson P, Mecklin JP, Lynch HT;
New clinical criteria for hereditary nonpolyposis colorectal cancer (HNPCC, Lynch syndrome) proposed by the International Collaborative group on HNPCC. Icg-Hnpcc, Gastroenterology. 116ICG-HNPCC. New clinical criteria for hereditary nonpolyposis colorectal cancer (HNPCC, Lynch syndrome) proposed by the International Col- laborative group on HNPCC. Gastroenterology 116: 1453-1456, 1999.
National incidence and initial therapy for thymic carcinoma in Japan: based on analysis of hospital-based cancer registry data. T Koizumi, K Otsuki, Y Tanaka, Jap J Clin Oncol. 50Koizumi T, Otsuki K, Tanaka Y, et al. National incidence and in- itial therapy for thymic carcinoma in Japan: based on analysis of hospital-based cancer registry data, 2009-2015. Jap J Clin Oncol 50: 434-439, 2020.
Follow-up study of thymomas with special reference to their clinical stages. A Masaoka, Y Monden, K Nakahara, T Tanioka, Cancer. 48Masaoka A, Monden Y, Nakahara K, Tanioka T. Follow-up study of thymomas with special reference to their clinical stages. Cancer 48: 2485-2492, 1981.
Microsatellite instability status determined by next-generation sequencing and compared with PD-L1 and tumor mutational burden in 11,348 patients. A Vanderwalde, D Spetzler, N Xiao, Z Gatalica, J Marshall, Cancer Med. 7Vanderwalde A, Spetzler D, Xiao N, Gatalica Z, Marshall J. Mi- crosatellite instability status determined by next-generation se- quencing and compared with PD-L1 and tumor mutational burden in 11,348 patients. Cancer Med 7: 746-756, 2018.
Real-world data on microsatellite instability status in various unresectable or metastatic solid tumors. K Akagi, E Oki, H Taniguchi, Cancer Sci. 112Akagi K, Oki E, Taniguchi H, et al. Real-world data on microsat- ellite instability status in various unresectable or metastatic solid tumors. Cancer Sci 112: 1105-1113, 2021.
the Mallorca Group. Cancer risk and survival in path_MMR carriers by gene and gender up to 75 years of age: a report from the Prospective Lynch Syndrome Database. P Møller, T T Seppälä, I Bernstein, Gut. 67Møller P, Seppälä TT, Bernstein I, et al.; the Mallorca Group. Cancer risk and survival in path_MMR carriers by gene and gen- der up to 75 years of age: a report from the Prospective Lynch Syndrome Database. Gut 67: 1306-16, 2018.
Perspective of immune checkpoint inhibitors in thymic carcinoma. K Kaira, H Imai, H Kagamu, Cancers (Basel). 131065Kaira K, Imai H, Kagamu H. Perspective of immune checkpoint inhibitors in thymic carcinoma. Cancers (Basel) 13: 1065, 2021.
PD-1 blockade in tumors with mismatch-repair deficiency. D T Le, J N Uram, H Wang, N Engl Med. 372Le DT, Uram JN, Wang H, et al. PD-1 blockade in tumors with mismatch-repair deficiency. N Engl Med 372: 2509-2520, 2015.
Efficacy of pembrolizumab in patients with noncolorectal high microsatellite instability/ mismatch repair-deficient cancer: results from the phase II KEYNOTE-158 study. A Marabelle, D T Le, P A Ascierto, J Clin Oncol. 38Marabelle A, Le DT, Ascierto PA, et al. Efficacy of pembrolizu- mab in patients with noncolorectal high microsatellite instability/ mismatch repair-deficient cancer: results from the phase II KEYNOTE-158 study. J Clin Oncol 38: 1-10, 2020.
The Internal Medicine is an Open Access journal distributed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License. To view the details of this license. please visitThe Internal Medicine is an Open Access journal distributed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License. To view the details of this license, please visit (https://creativecommons.org/licenses/ by-nc-nd/4.0/).
. The Japanese Society of Internal Medicine Intern Med. 62The Japanese Society of Internal Medicine Intern Med 62: 649-653, 2023
| PURPOSE The current diagnostic testing algorithm for Lynch syndrome (LS) is complex and often involves multiple follow-up germline and somatic tests. We aimed to describe the results of paired tumor/germline testing performed on a large cohort of patients with colorectal cancer (CRC) and endometrial cancer (EC) to better determine the utility of this novel testing methodology.MATERIALS AND METHODSWe retrospectively reviewed a consecutive series of patients with CRC and EC undergoing paired tumor/germline analysis of the LS genes at a clinical diagnostic laboratory (N = 702). Microsatellite instability, MLH1 promoter hypermethylation, and germline testing of additional genes were performed if ordered. Patients were assigned to one of five groups on the basis of prior tumor screening and germline testing outcomes. Results for each group are described.RESULTSOverall results were informative regarding an LS diagnosis for 76.1% and 60.8% of patients with mismatch-repair-deficient (MMRd) CRC and EC without and with prior germline testing, respectively. LS germline mutations were identified in 24.8% of patients in the group without prior germline testing, and interestingly, in 9.5% of patients with previous germline testing; four of these were discordant with prior tumor screening. Upon excluding patients with MLH1 promoter hypermethylation and germline mutations, biallelic somatic inactivation was seen in approximately 50% of patients with MMRd tumors across groups.CONCLUSION Paired testing identified a cause for MMRd tumors in 76% and 61% of patients without and with prior LS germline testing, respectively. Findings support inclusion of tumor sequencing as well as comprehensive LS germline testing in the LS testing algorithm. Paired testing offers a complete, convenient evaluation for LS with high diagnostic resolution. | M uir-Torre syndrome (MTS; MIM 158320) is an autosomal dominant predisposition to skin tumours and various internal malignancies. Clinical criteria for a diagnosis of MTS are the synchronous or metachronous occurrence of at least one sebaceous gland neoplasia and at least one internal neoplasm in a patient (regardless of the family history). 1 2 The sebaceous gland neoplasias comprise adenomas, epitheliomas (sebaceomas), and carcinomas. In contrast, the frequent sebaceous gland hyperplasia is not indicative of MTS. 2 3 According to Schwartz and Torre, 2 the sebaceous neoplasias precede the internal neoplasias or are concurrent with them in 41% of MTS patients. As sebaceous gland neoplasias are rare, MTS should always be suspected when a sebaceous tumour has been diagnosed. Cystic sebaceous neoplasia is probably the most sensitive marker for this tumour predisposition syndrome. 2 4-6 Colorectal cancer is by far the most common internal malignancy in MTS patients.7The spectrum of internal malignancies in MTS is similar to the various tumour entities observed in hereditary non-polyposis colorectal cancer (HNPCC; MIM 114500). HNPCC is an autosomal dominant cancer predisposition syndrome characterised by early onset of colorectal cancer and other associated tumours. 8 9 Several genes underlying HNPCC which are involved in DNA mismatch repair (MMR) have been identified within the last decade.[10][11][12][13]Germline mutations in the DNA MMR genes were detected in a high proportion of MTS patients, demonstrating that MTS most often represents a phenotypic variant of HNPCC. 14 15 Due to the underlying genetic mechanisms of tumourigenesis, tumours of these MTS patients exhibit high microsatellite instability (MSI-H), the characteristic feature of HNPCC tumours.16Microsatellite analysis in tumour tissue of MTS patients therefore provides a useful tool to pre-select patients for mutation analysis in DNA MMR genes. 3 Immunohistochemical testing for expression of the MSH2 and MLH1 proteins in skin tumour tissue is an alternative reliable screening method with high predictive value for the diagnosis of DNA mismatch repair deficient MTS (HNPCC). 17 18 A diagnosis of HNPCC in an MTS patient is of major importance for both the patient and his/her close relatives, as all family members who inherited the DNA MMR defect have a substantially higher risk for HNPCC malignancies and should therefore undergo regular cancer surveillance examinations. Identification of the underlying DNA MMR germline mutation in the index patient enables predictive genetic testing of his/her family members at risk.To date, DNA MMR gene mutations in MTS patients have been reported in both the MSH2 and MLH1 genes. While the proportions of MLH1 and MSH2 mutations in HNPCC are almost equal (ICG-HNPCC mutation database, http:// www.nfdht.nl), in MTS the vast majority of mutations have been identified in MSH2. This suggests a genotype correlation for the Muir-Torre phenotype among HNPCC patients.15The aim of this study was to further support this genotypephenotype correlation in HNPCC. We determined the DNA MMR mutation spectrum in a large MTS patient sample after pre-selection by examination for MSI and immunostaining in tumour tissue. For this purpose we extended our previously reported sample of 15 MTS patients 4 15 19 20 to a total of 41 Abbreviations: DHPLC, denaturing high performance liquid chromatography; HNPCC, hereditary non-polyposis colorectal cancer; MLPA, multiplex ligation-dependent probe amplification; MMR, mismatch repair; MSI-H, high microsatellite instability; MTS, Muir-Torre syndrome; PTT, protein truncation test; SSCP, single strand conformation polymorphism Key points N Sebaceous gland neoplasms are the characteristic cutaneous manifestation of Muir-Torre syndrome (MTS), a phenotypic variant of hereditary non-polyposis colorectal cancer (HNPCC).N We performed mutation analysis in 41 unrelated index patients diagnosed with Muir-Torre syndrome or a sebaceous neoplasm. Thirty seven of these patients had been pre-selected for DNA mismatch repair deficiency in tumour tissue following proof of either high microsatellite instability or loss of MSH2/MLH1 protein expression, or both. In 27 of the 41 patients, we detected germline mutations in the DNA mismatch repair genes MSH2 and MLH1 (mutation detection rate of 66%); three mutations were large genomic deletions. N In contrast to HNPCC patients without the MTS phenotype, significantly more MSH2 mutations were detected among the MTS patients: 25 (93%) mutations were located in MSH2 compared to only two in MLH1. Our findings should have consequences for mutation detection protocols in MTS patients or HNPCC patients who have family members with MTS. | Carriers of any pathogenic variant in one of the MMR genes (path_MMR carriers) were traditionally thought to be at comparable risk of developing a range of different malignancies, foremost colorectal cancer (CRC) and endometrial cancer. However, it is now widely accepted that their cancer risk and cancer spectrum range notably depending on which MMR gene is affected. Moreover, there is increasing evidence that the MMR gene affected also influences the molecular pathogenesis of Lynch syndrome CRC. Although substantial progress has been made over the past decade in understanding these differences, many questions remain unanswered, especially pertaining to path_PMS2 carriers. Recent findings show that, while the cancer risk is relatively low, PMS2-deficient CRCs tend to show more aggressive behaviour and have a worse prognosis than other MMRdeficient CRCs. This, together with lower intratumoral immune infiltration, suggests that PMS2-deficient CRCs might have more in common biologically with sporadic MMR-proficient CRCs than with other MMR-deficient CRCs. These findings could have important consequences for surveillance, chemoprevention and therapeutic strategies (e.g. vaccines). In this review we discuss the current knowledge, current (clinical) challenges and knowledge gaps that should be targeted by future studies.KEYWORDSLynch syndrome (hereditary nonpolyposis colorectal cancer), mismatch repair (MMR), PMS2 gene, colorectal cancer, endometrial cancer, carcinonogenesis Frontiers in Oncology -ten Broeke SW (2023) PMS2associated Lynch syndrome: Past, present and future. | At least one-third of patients meeting clinical criteria for Lynch syndrome will have no germline mutation and constitutional epimutations leading to promoter methylation of MLH1 have been identified in a subset of these patients. We report the first case of constitutional MLH1 promoter methylation associated with a colonic polyposis syndrome in a 39 year-old man with a family history of colorectal cancer (CRC) and a personal history of 21 polyps identified over 8 years as well as the development of two synchronous CRCs over 16 months who was evaluated for a hereditary cancer syndrome. Immunohistochemistry (IHC) of multiple tumors showed absent MLH1 and PMS2 expression, though germline testing with Sanger sequencing and multiplex ligation-dependent probe amplification of these mismatch repair genes (MMR) genes was negative. A next generation sequencing panel of 29 genes also failed to identify a pathogenic mutation. Hypermethylation was identified in MLH1 intron 1 in tumor specimens along with buccal cells and peripheral white blood cells, confirming the diagnosis of constitutional MLH1 promoter methylation. This case highlights that constitutional MLH1 methylation should be considered in the differential diagnosis for a polyposis syndrome if IHC staining shows absent MMR gene expression. | Sebaceous neoplasms are cutaneous markers for the autosomal-dominant Muir-Torre syndrome (MTS). This phenotypic variant of Lynch syndrome (LS) is caused by germline mutations in DNA mismatch repair (MMR) genes. Microsatellite instability or loss of protein expression suggests a mutation or promoter hypermethylation in 1 of the MMR genes. BRAF gene sequencing may help to distinguish between patients with sporadic and LS-associated colorectal carcinomas with loss of MLH1 expression. LS-associated carcinomas are virtually negative for BRAF mutations, but a subset harbors KRAS mutations. The aim of our study was to test sebaceous neoplasms for V600E BRAF or KRAS mutations to determine if these mutations are associated with somatic or germline MMR defects, analogous to colorectal carcinomas. Over a 4-year period, 32 cases comprising 21 sebaceous adenomas, 3 sebaceomas, and 8 sebaceous carcinomas with sufficient material for testing were collected. MMR immunohistochemistry showed that 7 neoplasms had combined loss of MLH1-PMS2, 16 neoplasms had combined loss of MSH2-MSH6, 2 neoplasms had solitary loss of MSH6, and 7 sebaceous neoplasms had intact protein expression. BRAF/KRAS testing revealed all sebaceous neoplasms contained a wild-type BRAF gene. Two (15%) of 13 patients with MTS were found to harbor a KRAS mutation and loss of MLH1 expression. We conclude that a V600E BRAF mutation may not be helpful in distinguishing sporadic from MTS-associated sebaceous neoplasms. Further studies are needed to determine if KRAS mutations are restricted to patients with MTS or are also present in sporadic sebaceous neoplasms. | Multiple endocrine neoplasia (MEN) syndromes are infrequent inherited disorders in which more than one endocrine glands develop noncancerous (benign) or cancerous (malignant) tumors or grow excessively without forming tumors. There are 3 famous and wellknown forms of MEN syndromes (MEN 1, MEN 2A, and MEN 2B) and a newly documented one (MEN4). These syndromes are infrequent and occurred in all ages and both men and women. Usually, germ line mutations that can be resulted in neoplastic transformation of anterior pituitary, parathyroid glands, and pancreatic islets in addition to gastrointestinal tract can be an indicator for MEN1. The medullary thyroid cancer (MTC) in association with pheochromocytoma and/or multiple lesions of parathyroid glands with hyperparathyroidism can be pointer of MEN2 which can be subgrouped into the MEN 2A, MEN 2B, and familial MTC syndromes. There are no distinct biochemical markers that allow identification of familial versus nonfamilial forms of the tumors, but familial MTC usually happens at a younger age than sporadic MTC. The MEN1 gene (menin protein) is in charge of MEN 1 disease, CDNK1B for MEN 4, and RET proto-oncogene for MEN 2. The focus over the molecular targets can bring some hope for both diagnosis and management of MEN syndromes. In the current review, we look at this disease and responsible genes and their cell signaling pathway involved. | This is an open access article under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.AbstractBackground: LINC00941 has been proved to be related to various tumors, but its relationship with laryngocarcinoma remains vague.Methods: LINC00941 expression in laryngocarcinoma tumor and laryngocarcinoma cells was determined by real time-quantitative polymerase chain reaction (RT-qPCR). Besides, the five-year survival of laryngocarcinoma patients with different LINC00941 expression was analyzed with Kaplan-Meier survival analysis, and the clinical characteristics of laryngocarcinoma patients were also recorded. After transfection, cell viability, cell proliferation, apoptosis, cell cycle, migration, and invasion were detected by cell counting kit-8 (CCK-8), colony formation, flow cytometry, cell scratch, and Transwell assays, respectively. Glycolysis was assessed by the colorimetric method. Expressions of proliferation-associated proteins, migration-associated proteins, glycolysis-associated proteins, and phosphatidylinositol 3-kinase (PI3K)/ AKT/mammalian target of rapamycin (mTOR) signal pathway-associated proteins were detected by Western blot. Results: In laryngocarcinoma tumor tissues and cells, LINC00941 was highly expressed. High expression of LINC00941 decreased the 5-year survival of laryngocarcinoma patients, and it was positively related to lymph node metastasis and clinical stages. LINC00941 overexpression decreased apoptosis but promoted cell viability, proliferation, cell-cycle progression, migration, and invasion, and glucose consumption and lactate production in laryngocarcinoma cells. Moreover, LINC00941 overexpression elevated expressions of Ki-67, PCNA, MMP2, N-Cadherin, HK2, PFKFB4, and PKM, activated the PI3K/AKT/mTOR signal pathway but reduced E-Cadherin expression, while LINC00941 silencing had the opposite effects. PKM overexpression reversed the effects of LINC00941 silencing on cellular and glycolytic phenotypes. Conclusion: LINC00941 promoted in vitro progression and glycolysis of laryngocarcinoma cells by upregulating PKM via activating the PI3K/AKT/mTOR signaling pathway. | Background: SWI/SNF-related, matrix-associated, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member (SMARCA4)-de cient thoracic sarcoma (SMARCA4-DTS) is a rare disease that has recently been described as an entity. It is characterized by an aggressive clinical course and speci c genetic alterations. As an immunohistological feature, the tumors are de cient in SMARCA4 and SMARCA2 and express the sex-determining region Y-box 2 (SOX2). In contrast, Carney's triad is a syndrome that combines three rare soft tissue tumors: gastric leiomyosarcoma, pulmonary chondroma, and extra-adrenal paraganglioma, of which at least two are required for diagnosis. Both diseases are valuable case, and there have been no previous reports of their coexistence.Case presentation: A 43-year-old man visited our hospital because of respiratory distress. Computed tomography revealed a large mass measuring 55 mm in the upper lobe of his right lung and front mediastinum, with metastases in the surrounding lymph nodes. Needle biopsy was performed for diagnosis, and histological examination of the samples revealed monotonous epithelioid-like cells with loose binding and sheet-form proliferation. The tumor cells had distinct nuclei, with rhabdoid-kile cells in some locations. Immunohistochemical analysis revealed that the tumor cells were positive for SOX2, CD34, and p53 and negative for SMARCA4 and SMARCA2. The patient died 6 months after admission without any treatment. Autopsy revealed ganglioneuroma and enchondroma, suggesting an incomplete Carney complex.Conclusion: SMARCA4-DTS is a rare and recently established disease. While it is di cult to siagnose, it is necessary to distinguish undifferentiated carcinoma, large cell carcinoma, Ewing sarcoma, epithelioid sarcoma, etc. when diagnosing tumors involving the mediastinum, In addition, case with both an incomplete Carney complex and SMARCA4-DTS are very rare. We discuss and report about SMARCA4-DTS by examining the expression of AT-rich interactive domain-containing protein 1A and solute carrier family 7 member 11. SOX2: sex-determining region Y-box 2 Declarations Ethics approval and consent to participate: not applicable. |
1,999,858 | who sang the original twist and shout song | CD with many of the popular versions. The title of the song is referenced in Mary Chapin Carpenter's 1991 song "Down at the Twist and Shout". In 1974, artist George Rodrigue painted several iconic portraits of his vision of what Jolie Blonde would have looked like. His paintings can be found in "Jolie's Louisiana Bistro" in Lafayette, Louisiana. Rodrigue claims the origins of "Jolie Blonde" stem from a prisoner in Port Arthur, Texas, whose lover left him for someone else. Jole Blon Jole Blon or Jolie Blonde is a traditional Cajun waltz, often called "the Cajun national anthem" because of | "Got It Twisted" is the first single from Mobb Deep's 2004 album Amerikaz Nightmare. Produced by The Alchemist, the song samples the 1980s hit "She Blinded Me With Science" by Thomas Dolby. Big Noyd, Infamous Mobb, Jayo Felony, Kurupt, Illa Ghee, The Alchemist, DJ Felli Fel, and actor Danny Trejo are featured in the music video. There is also a remix which features Twista.
Track listing
Side A
"Got It Twisted" [Dirty Version]
"Got It Twisted" [Instrumental]
Side B
"Got It Twisted" [Clean Version]
"Got It Twisted" [Acappella]
Charts
References
2004 singles
Mobb Deep songs
Music videos directed by Benny Boom
Song recordings produced by the Alchemist (musician)
2004 songs
Jive Records singles
Songs written by Prodigy (rapper)
Songs written by Havoc (musician) | Who had the christmas number one song in 1984? | ballad where the female narrator expresses her fear of admitting her strong feelings to the object of her affection - a good friend, calling her feelings "complicated." The music video was directed by Lisa Mann and premiered in mid-2001. "Complicated" debuted at number 55 on the U.S. "Billboard" Hot Country Singles & Tracks for the week of April 21, 2001. Complicated (Carolyn Dawn Johnson song) "Complicated" is a song co-written and recorded by Canadian country music singer Carolyn Dawn Johnson. It was released in April 2001 the second single from her debut album "Room with a View". The song was |
My boyfriend has been singing this “sneaky theme song” as long as he can remember, but we can’t figure out what it is or where it’s from. He says it played in a cartoon when the villain character was being sneaky. He thinks the first part of the tune was something like an oboe and the last 2 notes were jazzy chords. Thanks for your help!! This one has been puzzling us for a while. | "". This version of the song was produced by Dave Stewart, Stevie Nicks, and Waddy Wachtel. Nicks said the following about the re-recording of the song: ""When songs go into movies you might as well dump them out the window as you're driving by because they never get heard"." On September 26, 2014, "Twisted" was released on SoundCloud by Warner Brothers Records. The song was removed two days later, but was reposted on October 7, 2014 (the day of the album's release). Twister Soundtrack version Enchanted version 24 Karat Gold: Songs from the Vault version Twisted (Stevie Nicks song) "Twisted'" | For the longest times, up until about 6 months ago, I could have sworn Time in a Bottle was sung by Gordon Lightfoot and not Jim Croce
Anybody else imagine this? | The Yelling (band) Many other sources have also stated that their music sounds much like that of the '70s, with one reviewer comparing their sound to "Led Zeppelin crash[ing] a Who recording session being produced by Iron Butterfly." They released a self-titled EP on October 7, 2008, which contained five songs. The last song on the EP, "Blood on the Steps", was featured on "Grand Theft Auto IV" soundtrack, and on a compilation album issued by Tankfarm Records entitled "Future Sounds 32", released a day after their eponymous EP. Billboard wrote that with regard to this song, its "...the thick, fuzzy chords; warbly | 1,999,858 | charts Twist and Shout "Twist and Shout" is a 1961 song written by Phil Medley and Bert Berns (later credited as "Bert Russell"). The song was originally recorded by the Top Notes. It first became a chart hit as a single by the Isley Brothers in 1962. The song has since been covered by several artists, including the Beatles on their first album "Please Please Me" (1963), as well as the Tremeloes in 1962 and the Who in 1970 and 1984. In 1961, one year after Phil Spector became a staff producer at Atlantic Records, he was asked to produce | how many times did the beatles record twist and shout | who sang down at the twist and shout first | who sang the beatles song ya ya twist | who wrote the song oliver twist for jackie coogan | what is the structure of shout choruses | who sang the song this charming man on top of the pops | when did stevie wonder sing sir duke | what beatles songs does smashmouth sing |
1,999,859 | Calculation of magnetic field and electromagnetic forces in MHD superconducting magnets | Based on the critical state model for the superconducting components, we develop a set of theoretical tools that allow extracting relevant engineering parameters of a superconducting levitation machine. We provide a number of analytical and numerical expressions for the evaluation of the electromagnetic quantities, energies, and forces in 2-D problems. This assumption includes the following: 1) rotational symmetric systems, as those in bearings and motors, and the case of 2) translational symmetry, as in long transportation lines. The theory, which trades off simplicity and predictive power, builds on the vector potential/current density formulation of the Maxwell equations (A, J) and is validated by comparison against experimental tension-compression data in our universal test machine. As shown, very simple computer coding is required to implement the method. | 3D analytical calculation of the forces exerted between two cuboidal magnets | We present in this paper an analytical model for the calculation of the electromagnetic field in a slotless surface mounted permanent magnet machines. This model takes into account the two essential directions of magnetization of the magnets, namely tangential magnetization and radial magnetization. It especially accounts for the parallel form of the magnetization direction. The model uses equivalent currents on the surfaces of the magnets, and in an original way, it uses currents in all volume of the magnet. The model is validated by numerical results obtained with a free software of calculation of the electromagnetic fields (FEMM: Finite Element Method Magnetics) which uses the finite elements method and by an existing experimental structure. The model is extended to the magnets segmented in bars and separated. It is then extended to the shape of magnets close to parallepiped forms which are really used in large machines. | Abstract A theory of hysteresis in superconductors based on an approximation to the fluxoid-fluxoid interaction is used to fit experimental data on highly hysteretic Nb wires. No adjustable parameters were used in the comparison, but only data pertaining to the shape of the magnetization curves. The qualitative agreement of the calculated and experimental curves is good, and quantitative agreement is reached on the curve of increasing field. | Magnetic Shielding Characteristics of Multiple Bulk Superconductors for Higher Field Applications | The Meissner effect doesn't have anything to do with any magnetic fields being generated in or by the superconductor. The Meissner effect is the active expulsion of a magnetic field as the superconductor reaches its critical temperature and is a result from the London equation and Maxwells equations. You might be mixing up the Meissner effect with superdiamagnetism, something that is quite common. Superconductors exhibits both of these phenomena. As a magnetic field flows around a superdiamagnet there will be currents induced in the surface and these currents in turn create their own magnetic fields which counteracts and cancels the external magnetic field. | Magnetic Field Measurement, Shimming and Processing for 230 MeV Superconducting Cyclotron Main Magnet | Superconducting magnet systems under construction and projected for the future contain magnets that are magnetically coupled and electrically connected with shared power supplies. A change in one power supply voltage affects all of the magnet currents. A current controller for these system must be designed as a multivariable system. The power describes a method, based on decoupling control, for the rational design of these systems. Dynamic decoupling is achieved by cross-feedback of the measured currents. A network of gains at the input decouples the system statically and eliminates the steady-state error. Errors are then due to component variations. The method has been applied to the magnet system of the MFTF-B, at the Lawrence Livermore National Laboratory. | 1,999,859 | A superconducting prototype magnet for MHD (magnetohydrodynamic) energy conversion is under development in Italy. The authors discuss analytical methods developed at the Department of Electrical Engineering of Padova University for calculating magnetic field and electromagnetic forces in MHD superconducting magnets and utilized in the preliminary design of the prototype. Due to the flexibility, speed, and ease of use of the corresponding computer programs, the described analytical methods for field computation proved to be useful in rapid parametric studies in the preliminary design of superconducting magnets with cylindrical or rectangular saddle coils. Some examples of application are presented concerning the choice of the number and shape of coils and the evaluation of the far field of the prototype magnet. > | Fabrication of a Lightweight Superconducting MHD Magnet. | Calculation of the Magnetic Field of an Electric Machine with Annular Superconducting Armature Winding and External Screen | Engineering aspects of magnetohydrodynamics | Design and analysis of magnetic coil for relativistic magnetron | In this paper, the computation of magnetization of a strand constituted of two superconducting square bars immersed in a uniform magnetic field is studied. The numerical results are obtained from the program developed with the FEM. Bean's critical state model is carried out to characterize the electrical behavior law of superconducting materials. The magnetization cycle, the magnetic field and the current density distributions are presented. The influence of strand length on the electromagnetic coupling phenomena in the superconducting square bars is also considered. The obtained results are in good agreement with the theoretical results. | Enhanced levitation force using YBa2Cu3Oy trapped field magnets | Electromagnetic Design of Superconducting Dipoles Based on Sector Coils | Calculation of magnetic field for 4 T fast cycling superconducting dipole magnet |
1,999,860 | It is very nicely made and very nice looking | Very well made,was very Happy with my purchase | Very well made and reasonably priced, works perfect for our needs | Very well made. Purchased as gift for my grandson. He really likes this. | Beautifully made, very fragile, I still quite haven't figured out how to use it. but it is very pretty. | Nice and very well made I thought it was expensive when I first saw it on line , but it is well worth it . | It's well made, fits almost like a glove and is a different and fun color. I love it! | I'm sure this is made well, but it is very, very small. A lot smaller than I expected and in my opinion, too small for the price. I sent it back. | Well made. Perfect design for my needs. Sturdy and comfortable! | 1,999,860 | Bought it for my husbands birthday. It is very nicely made and very nice looking. It keeps his drinks, lunch and ice packs cold all day. He loves it!
It did not however come with a longer strap which I was under the impression it did. But all in all a very nice gift. | Hubby liked it but didn't realize it had a strap for ... | ... items due to past reviews but this bag is awesome. There is plenty of room for my drink | Very long strap. I have an average arm and ... | This backpack was horribly built. The strap frayed within 2 days of ... | ... for a trip to a theme park - very happy that it has such a long strap | I like that it comes with straps to carry it | Pictured with ankle strap, did not come with strap. | Nice strap but too long for my 9 year old |
1,999,861 | Finally a narrow ankle | The shaft at ankle was wide, shaft at calf somewhat tight. My daughter bought a pair and just loves them. I had to return mine. | A little too narrow, but still a good shoe. | The ankle area was way too wide and didn't fit my ankle/leg at all - even pulled laces as tight as possible and no luck. Unrealistic width. Also the zipper was low quality and I could barely zip it up and down... I read the reviews alot and was confident in these but sadly they were a no go | The ankle of the boot was so narrow that it was impossible to get my foot inside! These were sent back immediately. | I was disappointed in the narrow toe. I expected the material to go higher on the bridge of the foot. | They were too big and it's too loose around his ankle it needs likrbsome sort of drawstring for ankle. | great shoe but the wide was nowhere near being wide. It wasn't a narrow size but no way was it a wide shoe.
Great props to Amazon for the easy return process! | This shoe has a narrow fit, but it is a good shoe. | 1,999,861 | Glad to have found boots that are not lose on my ankle. Wide footed gals beware-you might find this ankle boot too narrow! Comfortable to wear all day to work or play. Professional and feminine, comfortable while preserving a slender girly look, no drama, exactly what I needed. | They are wide enough that she can get wear her wool socks and not feel like the boots are too tight | I love these boots except that they are narrow in the ... | I have wide feet and these boots fit AMAZING!! | lace to toe boots are so good for people with wider feet at the toe area | Cute boots but not good for my narrow feet | I usually LOVE LifeStride wide calf boots because they're comfortable and usually ... | These boots are great, but they do run very narrow in the ... | The ankle of the boot was so narrow that it ... |
1,999,862 | where did werethekau come from in egypt | History of ancient Egypt Dynasty. The Thirteenth Dynasty proved unable to hold onto the long land of Egypt, and a provincial family of Levantine descent located in the marshes of the eastern Delta at Avaris broke away from the central authority to form the Fourteenth Dynasty. The splintering of the land most likely happened shortly after the reigns of the powerful Thirteenth Dynasty pharaohs Neferhotep I and Sobekhotep IV c. 1720 BC. While the Fourteenth Dynasty was Levantine, the Hyksos first appeared in Egypt c. 1650 BC when they took control of Avaris and rapidly moved south to Memphis, thereby ending the Thirteenth and | story is based directly on the "Story of Sinuhe", although adding details of a lovers' triangle romance involving Amenemhat I and Sinuhe that does not appear in the original. Mahfouz also includes the pharaoh in his account of Egypt's rulers "Facing the Throne". In this work, the Nobel laureate has the Ancient Egyptian gods judge the country's rulers from Pharaoh Mena to President Anwar Sadat. Amenemhat I Amenemhat I, also Amenemhet I and the hellenized form Ammenemes, was the first ruler of the Twelfth Dynasty, the dynasty considered to be the golden-age of the Middle Kingdom of Egypt. He ruled | Menkaure Menkaure (also Menkaura, Egyptian transliteration "mn-k3w-Rˁ"), was an ancient Egyptian king (pharaoh) of the 4th dynasty during the Old Kingdom, who is well known under his Hellenized names Mykerinos () (by Herodotus) and Menkheres (by Manetho). According to Manetho, he was the throne successor of king Bikheris, but according to archaeological evidences he rather was the successor of king Khafre. Menkaure became famous for his tomb, the Pyramid of Menkaure, at Giza and his beautiful statue triads, showing the king together with his wives Rekhetre and Khamerernebty. Menkaure was the son of Khafra and the grandson of Khufu. A | Normally Egyptian gods were shown in profile , but instead Bes appeared in portrait , ithyphallic , and sometimes in a soldier 's tunic , so as to appear ready to launch an attack on any approaching evil . | Younger Memnon him by his friend Johann Ludwig Burckhardt of digging the statue and bringing it to Britain, the British Consul General Henry Salt hired the adventurer Giovanni Belzoni in Cairo in 1815 for this purpose. Using his hydraulics and engineering skills, it was pulled on wooden rollers by ropes to the bank of the Nile opposite Luxor by hundreds of workmen. However, no boat was yet available to take it up to Alexandria and so Belzoni carried out an expedition to Nubia, returning by October. With French collectors also in the area possibly looking to acquire the statue, he then sent | Abstract In the beginning of the 20 th century thirteen Egyptians sculptures have been found In Diocletian's Palace (Split, Croatia) but none of them was intact. In the paper will be discussed the origin and the meaning of the Sphinx, their discovery during the conservation works in 1930-ties and 1960-ties. A special part is going to be given to the conservation work of the Sphinx at the peristyle in the last few years conducted by the Croatian Conservation Institute in Split (Croatia). | had translated books, many, including: Tharwat Okasha Tharwat Okasha (; born 1921) was an Egyptian writer, translator and Minister of Culture during the Nasserite era, Tharwat Okasha, who is referred to as the founder of Egypt’s cultural institutions, died on Monday 27 February 2012 in Cairo. He was 91 years old. Tharwat Okasha (1921–2012) was an army officer involved in the Free Officers Movement, along with former president Nasser and his comrades, which toppled King Farouk of Egypt from his crown in what is known as the 23 July Revolution of 1952. As a child of an aristocratic family, Okasha | Leontopolis (Heliopolis) Leontopolis (Egyptian: "Ney-ta-hut") is the Greek name for the modern area of Tell el Yehudiye or Tell el-Yahudiya (Egyptian Arabic: "Mound of the Jews"). It was an ancient city of Egypt in the 13th nome of Lower Egypt (the Heliopolite Nome), on the Pelusiac branch of the Nile. This site is known for its distinctive pottery known as Tell el-Yahudiyeh Ware. The site was identified in 1825 by Linant, and earlier was identified by Niebuhr in the late 18th century. The site includes some massive rectangular earthwork enclosures of the late Middle Kingdom or Second Intermediate Period. They | 1,999,862 | Werethekau Werethekau (Egyptian: "wrt-hk3w" "great one of magic, great enchantress"; alternately Urthekau, Weret Hekau) was an Ancient Egyptian deity. She served as the personification of supernatural powers. As a deity dedicated to protection, she often appeared on funerary objects, particularly weapons, to allow the deceased to protect him or herself against the dangers of the underworld. She also was placed on ivory knives as a charm to protect pregnant and nursing mothers. Her power was one of the inherent qualities of the Crowns of Egypt. As goddess of the crowns she was a snake or a lion-headed woman and dwelt | what is the power of a snake in egyptian mythology | in egyptian mythology, mehet-weret is the goddess of what | [GOD CONCEPT] Ixtab - Goddess of sacrifice | what is the name of the egyptian goddesses sculpted in human form | who was the father of the egyptian king menkaure | Why is Queen Nefertiti perceived as the most powerful female figure of Ancient Egypt? | in egyptian mythology, what is the name for an entity of immense destructive power | manasa is the mother goddess of which god |
1,999,863 | Dynamic Locomotion Through Online Nonlinear Motion Optimization for Quadrupedal Robots | We present a general motion planning scheme for a class of legged robots that walk in a quasi–static manner. The method does not depend upon the number of legs, nor is it based on foot placement concepts. Instead, our method is based on an extension of a nonlinear motion planning algorithm for smooth systems to the legged case, where the relevant dynamics are not smooth. The configuration space for the legged robot is comprised of different regimes, called strata, corresponding to when various combinations of feet are in contact with the ground. On each stratum, the equations of motion can be different. If vector fields satisfy a particular relationship, called strata decoupling, then it is possible to consider components of the equations of motion for the system on different strata as part of the equations of motion on one common stratum, which facilitates the application of the aformentioned nonlinear motion planning algorithm. The algorithm is illustrated with a simple example. | The structural framework of quadruped robot was built based on the bionics. Then, lead out the dynamic equa- tions of the simplified structure of the multiple rigid body system using Lagrange method considering the structural char- acteristic of quadruped robot. At the same time, the virtual prototype of quadruped robot was established and simulated using ADAMS with the planned gait. The simulation results verified the validity of mathematical modeling and the feasi- bility of the structure design, and it provided useful data information for the subsequent study to enhance the quality of control. | The authors have proposed a dynamic turning control system of a quadruped robot by using nonlinear oscillators. It is composed of a spontaneous locomotion controller and voluntary motion controller. In this article, capability of dynamic turning motion of the proposed control system is verified through numerical simulations and hardware experiments: Various turning speed and orientation make the motion of the robot asymmetry in terms of duty ratio, stride and center of pressure. The proposed controller actively and adaptively controls redundant DOF to cancel the dynamic asymmetry and established stable turning motion at various locomotion speed and turning orientation. | This paper introduces a new concept of multi-locomotion robot inspired by an animal. The robot, 'Gorilla Robot II', can select the appropriate locomotion from biped locomotion, quadruped locomotion and brachiation according to an environment or task. We consider 'brachiation' to be one of the most dynamic of animal motions. To develop a brachiation controller, architecture of the hierarchical behaviour-based controller, which consists of behaviour controllers and behaviour coordinators, was used. To achieve better brachiation, an enhanced learning method for motion control, adjusting the timing of the behaviour coordination, is proposed. Finally, it is shown that the developed robot successfully performs two types of brachiation and continuous locomotion. | The Acrobot, a two-link arm that is unactuated at the first joint, is challenging to control because it is an underactuated, nonlinear, continuous system. We describe a direct search algorithm for finding swingup trajectories for the Acrobot. The algorithm uses a lookahead search that maximizes the Acrobot's total energy in an N-step window. Because the controls are extremal and the number of switches in the window limited, the algorithm is fast. Nevertheless, the resulting trajectories are near optimal. | Multi-Robot Exploration in Unstructured and Dynamic Environments | Actuator Constrained Optimal Formation Keeping Near the Libration Points | OPTIMAL CONTROL THROUGH BIOLOGICALLY-INSPIRED PURSUIT | 1,999,863 | This letter presents a realtime motion planning and control method that enables a quadrupedal robot to execute dynamic gaits including trot, pace, and dynamic lateral walk, as well as gaits with full flight phases such as jumping, pronking, and running trot. The proposed method also enables smooth transitions between these gaits. Our approach relies on an online zero-moment point based motion planner which continuously updates the reference motion trajectory as a function of the contact schedule and the state of the robot. The reference footholds for each leg are obtained by solving a separate optimization problem. The resulting optimized motion plans are tracked by a hierarchical whole-body controller. Our framework has been tested in simulation and on ANYmal, a fully torque-controllable quadrupedal robot, both in simulation and on the actual robot. | We propose a method to generate actuation plans for a reduced order, dynamic model of bipedal running. This method explicitly enforces robustness to ground uncertainty. The plan generated is not a fixed body trajectory that is aggressively stabilized: instead, the plan interacts with the passive dynamics of the reduced order model to create emergent robustness. The goal is to create plans for legged robots that will be robust to imperfect perception of the environment, and to work with dynamics that are too complex to optimize in real-time. Working within this dynamic model of legged locomotion, we optimize a set of disturbance cases together with the nominal case, all with linked inputs. The input linking is nontrivial due to the hybrid dynamics of the running model but our solution is effective and has analytical gradients. The optimization procedure proposed is significantly slower than a standard trajectory optimization, but results in robust gaits that reject disturbances extremely effectively without any replanning required. | Reinforcement learning (RL) has become a promising approach to developing controllers for quadrupedal robots. Conventionally, an RL design for locomotion follows a position-based paradigm, wherein an RL policy outputs target joint positions at a low frequency that are then tracked by a high-frequency proportional-derivative (PD) controller to produce joint torques. In contrast, for the model-based control of quadrupedal locomotion, there has been a paradigm shift from position-based control to torque-based control. In light of the recent advances in model-based control, we explore an alternative to the position-based RL paradigm, by introducing a torque-based RL framework, where an RL policy directly predicts joint torques at a high frequency, thus circumventing the use of a PD controller. The proposed learning torque control framework is validated with extensive experiments, in which a quadruped is capable of traversing various terrain and resisting external disturbances while following user-specified commands. Furthermore, compared to learning position control, learning torque control demonstrates the potential to achieve a higher reward and is more robust to significant external disturbances. To our knowledge, this is the first sim-to-real attempt for endto-end learning torque control of quadrupedal locomotion. * These authors contributed equally to this work. | Translating the center of mass (CoM) while fixing the orientation of a rigid body supported by relatively massless, actuated limbs is a common problem setting in legged robotics. This paper proposes a hierarchical approach to such maneuvers that decouples CoM task planning from body orientation control in sagittal-plane models, thereby exposing a well-studied and computationally effective low dimensional dynamical system that can be used for CoM task planning. The resulting algorithms directly address the control authority (degree of underactuation) available at a given contact mode, enabling a-priori plans with these intuitive, robust pendular dynamics to be formally embedded at the (virtual) CoM of planar floatingtorso models, while focusing high gain posture stabilizing feedback upon the body orientation. A series of numerical and empirical examples address single-and multi-legged leaping -transitional maneuvers where only a single brief stance mode is available to load energy into the CoM and guide its direction. We compare our hierarchical method to a model-based model-predictive controller in one of the tasks, demonstrating similar performance with a significantly smaller computational footprint.INDEX TERMSLegged locomotion, template-based control. | Locomotion planning for quadruped robot over rough terrain | This paper presents a redundantly actuated and over-constrained 2RPU-2SPR parallel manipulator with two rotational and one translational coupling degrees of freedom. The kinematics analysis is firstly carried out and the mapping relationship of the velocity, acceleration and the independent parameters between the actuator joint and the moving platform are deduced by using the vector dot product and cross product operation. By employing d’Alembert’s principle and the principle of virtual work, the dynamics equilibrium equation is derived, and the simplified dynamics mathematical model of the parallel manipulator is further derived. Simultaneously, the generalized inertia matrix which can characterize the acceleration performance between joint space and operation space is further separated, and the performance indices including the dynamics dexterity, inertia coupling characteristics, energy transmission efficiency and driving force/torque balance are introduced. The analysis results show that the proposed redundantly actuated and over-constrained 2RPU-2SPR parallel manipulator in comparison with the existing non-redundant one has better dynamic comprehensive performance, which can be demonstrated practically by the successful application of the parallel kinematic machine head module of the hybrid machine tool. | The mechanics and control specifications of a hybrid quadruped robot currently being built at Harbin Institute of Technology, China is proposed. The robot, named HIT-HYBTOR, weights about 25 kilograms, has four legs and wheels on its feet so that it can walk and step over barriers on rough terrain or drive by wheels accessing more speed on even ground. To master the control task of HIT-HYBTOR, hierarchical hardware architecture was implemented with two levels: the microprocessor level and the PC level. The microprocessor level is responsible for the low-level control of the legs, the wheels and the body movement, of course, receive the sensor data too. The PC level controls the complete movement of the HIT-HYBTOR like trajectory planning and leg coordination. A behavior-based control system clasified into three kinds: step behaviors, posture behaviors and navigation behaviors for the quadruped walking robot is described. We investigate how the behavior-based approach can be used for control and gait generation of a quadruped walking in uneven terrain. Results from simulations and test of the robot are given. | In this paper, we investigated the locomotion of a quadruped robot, whose legs are controlled by an oscillator network system. In our previous work, simulation studies revealed that a quadruped robot produces walk and trot patterns through dynamic interactions among the robot's mechanical system, the oscillator network system, and the environment. These studies also showed that a walk-trot transition is induced by changing the walking speed. In addition, the gait-pattern transition exhibited a hysteresis similar to that observed in the locomotion of humans and animals. The aim of the present study is to verify such dynamic characteristics in the gait generation of quadrupedal locomotion in the real world by developing and evaluating a quadruped robot. | Four legged walking robot control using neural networks |
1,999,864 | Hólmfríður Karlsdóttir | Íslenzkt þjóðerni: Jón Jónsson Aðils’ Iceland and the road to the future | Old Norse—Icelandic Literature and German Culture | Проживание и рыбалка на севере Швеции. Услуги гида, бесплатные консультации.
Accommodation and fishing on the north of Sweden. Fishing guide and free consultations.
More information about us on our Facebook page]( or on our [website. | Darraðarljóð Witches in Shakespeare's "Macbeth". Darrað or Dorrud's vision is located in Caithness and the story is a "powerful mixture of Celtic and Old Norse imagery". Einar Selvik and Trevor Morris used stanzas from Darraðarljóð in the opening battle in season 2 of Vikings. Darraðarljóð Darraðarljóð is a skaldic poem in Old Norse found in chapter 157 of "Njáls saga". The song consists of 11 stanzas, and within it twelve :valkyries weave and choose who is to be slain at the Battle of Clontarf (fought outside Dublin in 1014 CE). Of the twelve valkyries weaving, six of their names are given: | The Tale of Thorstein Shiver The Tale of Thorstein Shiver ( Icelandic: þorsteins þáttur skelks) is an Icelandic þáttur (pl. þættir) about the conversion of the Nordic countries to Christianity. The þáttur tells the humorous tale of Thorstein Thorkelsson’s encounter with a demon and how he earns his nickname. The þáttur is contained in the Flateyjarbók. The story's status as a þáttur has been questioned. After refusing an order from King Olaf not to go to the bathroom at night alone, Thorstein finds a demon in the restroom. Thorstein engages it in conversation, asking the demon’s name. The demon claimed | Bjaðmunjo Mýrjartaksdóttir uncertainty concerning the political situation in the Isles in the last decade of the eleventh century. What is known for sure is that, before the end of the century, Magnús Óláfsson, King of Norway (died 1103) led a marauding fleet from Scandinavia into the Irish Sea region, where he held power until his death in 1103. The catalyst for this Norwegian intervention may have been the extension of Muirchertach's influence into the Irish Sea region following the death of Gofraid Crobán, King of the Isles (died 1095). The region itself appears to have degenerated into chaos following Gofraid's demise, and | Bárðar saga Snæfellsáss Sólrún, and Snati to Norway to the court of Olaf Tryggvason. The others convert to Christianity; Gestr resists but at the king's personal entreaty is primsigned. The following Christmas, the court is visited by the draugr of King Raknarr of Helluland, who challenges a hero to come and take his treasures. At the king's suggestion, Gestr accepts the challenge, going with a priest called Jósteinn, a male and a female seið-worker, 17 other men and various supplies from the king, including a magic candle, and his dog. After a long voyage which includes a visit from Odin, who preaches heathenry | Stórhöfði Stórhöfði Stórhöfði is a peninsula and the southernmost point of Heimaey, the largest island in the Vestmannaeyjar archipelago. It is claimed to be the windiest place in Europe, and holds the record for the lowest on land observation of air pressure in Europe. The name means "great cape" and was also the name of a street in Reykjavik's Höfði industrial area until 2015 when it was renamed Svarthöfði ("black cape"), which is the Icelandic term for Darth Vader. The street had formerly been named Bratthöfði, which translates as "steep cape". Stórhöfði is the location of one of the oldest lighthouses | 1,999,864 | Hólmfríður "Hófí" Karlsdóttir (born 3 June 1963) is an Icelandic former model and beauty queen who won the 1985 Miss World contest.
Miss World
Hólmfríður finished runner-up at the 1985 Miss Iceland contest behind Halla Jonsdóttir. Halla went to Miss Universe while Hólmfríður won the title of Miss World Iceland and represented Iceland at Miss World, where she was named Europe's Queen of Beauty and Miss World 1985, with Mandy Shires (UK) second and Brenda Denton (USA) third.
Life after Miss World
Hólmfríður is married to Elfar Rúnarsson and they have three children together, Anton Örn Elfarsson ('89), Rúnar Karl Elfarsson ('91) and Ásta Gígja Elfarsdóttir ('97). The family lives in Iceland, Garðabær, where Hófí works in a local kindergarten and Elfar works nearby as a lawyer.
References
Miss World winners
Miss World 1985 delegates
Living people
1963 births
Holmfridur Karlsdottir
Holmfridur Karlsdottir
Holmfridur Karlsdottir | how many times has scotland won the miss world | Miss World 1982 | how many contestants competed for miss world in 2015 | who came second in the 1970 miss world pageant | who was the winner of the 2006 miss earth pageant | who was the first afghan woman to compete in miss earth | how many australian women have won the miss world | Miss World 2019 |
1,999,865 | when was the last time daenerys targaryen won an oscar | and her retainers behind with awe, Daenerys rides the dragon for the first time and flees the city. "The Dance of Dragons" received a positive response from critics, who lauded its conclusion on Daznak's Pit but was polarized by the characterization of Stannis Baratheon. In the United States, it received a viewership of 7.14 million in its initial broadcast. It won two Primetime Creative Arts Emmy Awards for Outstanding Single-Camera Picture Editing for a Drama Series and Outstanding Special Visual Effects, and was submitted by actress Emilia Clarke (who portrayed Daenerys Targaryen) for her nomination for a Primetime Emmy Award | Drama Supporting Actress in 2013 and 2014, and the MTV Movie & TV Award for Best Actor In A Show in 2017. IGN also nominated Clarke for Best TV Actress in 2011. Daenerys Targaryen Daenerys Targaryen is a fictional character in George R. R. Martin's "A Song of Ice and Fire" series of novels, as well as the television adaptation, "Game of Thrones", where she is portrayed by English actress Emilia Clarke. In the novels, she is a prominent point of view character. She is one of the most popular characters in the series, and "The New York Times" cites | Daenerys Targaryen not face enough conflict, characterizing her conquering of cities as "cut and dry", stating that "She needs to be emancipated from her own easy, comfortable, mundane victory." From the beginning, Clarke's performance has been acclaimed by critics. She received an EWwy Award for Best Supporting Actress in a Drama in 2011, as well as a Scream Award for Breakout Performance by a Female. She also earned a Gracie Allen Award for Outstanding Female Rising Star in a Drama Series or Special in 2012, and a SFX Award for Best Actress in 2013. Clarke received Primetime Emmy Award nominations for Outstanding | Since Season 7 started late it couldn't make it into this year's Emmy nomination list. But for next year I'm more than confident that Emilia Clarke (Daenerys) and Lena Headey (Cersei) will receive a nomination in the actress category. Peter Dinklage (Tyrion) will be nominated in the actor category no question, but since he's already won two for the same role, Kit Harington (Jon) should win it instead if he's nominated as well.
Who do you think should win the award for Season 7 out of Lena and Emilia? | Which are the awards jk rowling has won? | in the Best Rock Performance category. According to the Recording Academy, "It was determined that metal has a very distinctive sound, and hard rock more closely aligns with rock and can exist comfortably as one end of the rock spectrum." Each year is linked to the article about the Grammy Awards held that year. Grammy Award for Best Hard Rock Performance The Grammy Award for Best Hard Rock Performance was an award presented to recording artists at the Grammy Awards until 2011. The Academy recognized hard rock music artists for the first time at the 31st Grammy Awards (1989). The | Game of Thrones in a Drama Series (Dinklage), Outstanding Supporting Actress in a Drama Series (Lena Headey), Outstanding Guest Actress in a Drama Series (Rigg), Outstanding Directing ("The Watchers on the Wall") and Outstanding Writing ("The Children"). The 2015 fifth season won the most Primetime Emmy Awards for a series in a year (12 awards from 24 nominations), including Outstanding Drama Series; other wins included Outstanding Supporting Actor in a Drama Series (Dinklage), Outstanding Directing ("Mother's Mercy") and Outstanding Writing ("Mother's Mercy"), and eight were Creative Arts Emmy Awards. In 2016, the sixth season received the most nominations for the 68th Primetime Emmy | 44th Academy Awards The 44th Academy Awards were presented April 10, 1972, at the Dorothy Chandler Pavilion in Los Angeles. The ceremonies were presided over by Helen Hayes, Alan King, Sammy Davis Jr., and Jack Lemmon. One of the highlights of the evening was the appearance of Betty Grable, battling cancer at the time, who made one of her last public appearances. She appeared along with one of her leading men from the 1940s, singer Dick Haymes, to present the musical scoring awards. Grable died the following year. This was the first time in the history of the Awards in | 1,999,865 | Daenerys Targaryen Supporting Actress in a Drama Series in 2013, 2015, and 2016. She was also nominated for a Critics' Choice Television Award for Best Supporting Actress in a Drama Series for the role in 2013 and 2016. Other nominations include the Golden Nymph Award for Outstanding Actress in a Drama Series in 2012, the Satellite Award for Best Supporting Actress in a Series, Miniseries or Television Film in 2013, the People's Choice Award for Favorite Sci-Fi/Fantasy TV Actress in 2014, 2016 and 2017, the Saturn Award for Best Supporting Actress on Television in 2015, the Gold Derby TV Award for Best | who played daenerys targaryen in game of thrones | Daenerys Targaryen #03 | Daenerys Targaryen Appreciation Thread | List of awards and nominations received by Jessica Mauboy | who awards the indian telly award for best actress in a negative role | how did the critics describe daenerys targaryen's rise to power | who won the 1996 empire award for best actress | who is hosting the international emmy awards 2017 |
1,999,866 | This paper presents a 32.8MHz low power, supply insensitive monolithic CMOS relaxation oscillator. Instead of using voltage-mode comparators for cycle-to-cycle capacitor voltage swing (CVS) threshold voltage comparison, the CVS is regulated by a low-power closed-loop control which consists of a current-controlled delay cell (CCDC), a Gm-C error integrator and a comparator-free switch logic block. The CCDC and switching logics are powered by a logic supply regulator for reducing switching-losses and line sensitivity. The oscillator consumes 16.6μW from a 1.5V supply voltage at room temperature, achieving a FOM of 0.51μW/MHz. The measured output frequency variation is <±0.13%/V @ 32.8MHz, for a supply range of 1.5V to 3.6V It occupies 0.013mm2 in a 0.18μm CMOS process. |
Introduction
With the rapid growth in the high-speed wireless communication system, the demand for integrating high-performance CMOS circuit's on-chip is raising [1,2]. Conventional CMOS circuit suffers from large power consumption at high speed due to dynamic power consumption directly related to the operation frequency. The different logic style has been proposed in the literature for low power consumption among them MOS current mode logic (MCML) is extensively used as an option to CMOS logic style for high-speed circuits. MCML dissipates less power at high frequency and provides high noise immunity [3][4][5]. Static power consumption due to the use of constant current sources is also a concern in MCML logic.
In comparison to the CMOS logic approach, MCML shows better power delay products at high frequency. In this paper, a power-efficient VCO is designed using the MCML technique for low-power applications. VCO circuits are designed by inductor-capacitor (LC) based or ringbased approach. A ring topology-based VCO is preferred over LC topology since its starting time is significantly less, and it avoids the use of passive inductors. Also, integration is straightforward and compatible with the digital CMOS fabrication process. Ring oscillator structures are usually constructed by several delay elements such as a logic gate and an operational amplifier. In the logic gate, the control current is modified to change the transition time of each delay stage. In the operation amplifier, the current is adjusted to vary the bias current so that the operation amplifier gains are modified to vary the oscillation frequency of VCO. Ring oscillators are widely used in applications like clock generators, frequency synthesizers, and analog to digital converters circuits [6,7]. Ring oscillator provides a wide tuning range, quadrature or multiphase output, small die area compared to LC oscillator [8].
Further, various design structures of VCOs can be grouped into two major design categories as VCOs with single-ended and differential-ended delay cells [9,10]. In a single-ended configuration, the maximum frequency is mainly depends on the delay time of delay cell. Various methods have been proposed to tune the ring oscillator frequency [11,12]. On the other hand, differential-ended topologies are more preferable for high-speed applications because they provide better common-mode and supply voltage rejection performance. Differential-ended delay cells have many advantages over the single-ended cell-like single-ended VCO. They can be designed only by the odd number of delay stages compared with differential ended delay cell, and it has no common-mode rejection of supply voltage and body noise [13]. Multiphase output can also be obtained in differential-ended VCO [14]. Each delay stage in single-ended VCO is designed by an inverter that consist an NMOS and PMOS transistor. Alternatively, a differential-ended delay cell is designed by a load element (active and passive) and a differential pair. In both types of configuration, frequency variation is achieved by varying the delay cell's delay time. In this paper, MOS based varactor is used to vary the delay time of the proposed delay stage. In comparison to reverse-biased diode varactor, MOS varactors are more preferably used in CMOS circuits. This kind of varactors shows large capacitance and easiness of implementation in CMOS technology. Different configurations of MOS transistors are reported to work as MOS varactors. Different VCO designs based on the MOS varactors have been reported in [15][16][17]. In conventional structure drain, source, and substrate of a MOS transistor are tied together to form one end of the varactor. Variable capacitance is obtained with a change in the voltage across the varactor. In this paper, the MOS varactor working in inversion mode is used to obtain frequency tuning. In inversion mode, the bulk of the NMOS/PMOS transistor is connected with the lowest/highest voltage in the circuit. MOS varactor is placed at the output of each stage as a variable load element. With the change in load element, a tunable range of frequency is obtained in the proposed VCO.
Further, the paper is organized as follows: Sect. 2 describes the architecture of the proposed VCO. Section 3 discusses the result and performance analysis of the proposed VCO. Finally, Sect. 4 provides the conclusion.
VCO architecture
The circuit diagram of the proposed delay stage, along with a four-stage ring VCO with I-MOS varactor, is shown in Fig. 1. Figure 1a shows a differential-ended delay stage designed with MCML logic. MCML based delay cell include a pull-down network (PDN), a constant current source, and a pull-up load circuit. Pull down the network is designed with two NMOS transistors (N1, N2) as an input that performs the logic function. Two PMOS transistors (P1, P2) are used as a load element responsible for the voltage swing, and transistors (N3) function as a constant current source. PMOS transistors (P3, P4) of the I-MOS varactor are included to change the oscillation frequency of the proposed VCO. The function of the MCML delay cell is based on the principle of current steering. As the input voltage across the input transistor is high (low), the source coupled NMOS transistor pair steers the bias current (I ref ) to drain of N1 and N2, thus generates a low (high) output voltage.
In the MCML delay cell, the PMOS transistor operates in the triode region, and the reference current generated by the transistor N3 is divided into two NMOS drain currents. The differential input voltage is applied at the input of NMOS transistors that is (V in+ ) -(V in− ), the reference current is flowing through the transistor N3. A tunable frequency range is obtained by changing the control voltage V tune and V b of the I-MOS varactor. Figure 1b shows the four-stage ring VCO designed using four identical differential stages connected in a closed-loop. By varying the control voltage, the equivalent capacitance at the delay stage's output terminal varies, and subsequently output frequency of VCO changes.
The delay stage's working can be explained by considering the half part of the differential pair circuit. Input voltage is applied at transistor (N1), and the output voltage is obtained at the drain terminal of the N1 transistor. where: C para. , C ox and C dep are the parasitic capacitance, oxide capacitance and depletion capacitance under the gate, per unit area, respectively. Depletion capacitance under the gate oxide is given by the Eq. (2).
(1) 2), Ɛ si and X d denotes the permittivity of silicon material and depletion width under the gate oxide. Variation in C equi depends on the applied voltage across I-MOS varactor. As the control voltage increases, depletion width (X d ) under the gate oxide increases that result to decrease in the equivalent capacitance.
C equi. = C para. + C ox × C dep. C ox + C dep.(a)V tune V b P4 P3 N3 N2 N1 P2 P1 V out + V out- V in+ V in- V ref. V dd
Results and discussions
The proposed VCO has been implemented in 0.25 μm CMOS technology. Frequency tuning range has been obtained with a change in control voltage i.e., V tune and V b of I-MOS varactor. Effect of change in supply voltage (V dd ) also has been observed. Output frequency tuning range of proposed VCO with V tune variation from 1.5 V to 2.5 V at V dd = 2.5 V and V b = 2.5 V has been shown in Figure 3 shows the effect of V tune on the output frequency. With rise in the tuning voltage, the equivalent capacitance at the output node of the delay stage increases, affecting the delay time of the delay stage. As a consequence, the output frequency of VCO decreases. Table 2 provides the output frequency variation with change in V dd at fixed V tune = 1.5 V, and V b = 2.5 V. VCO shows a tuning range from 0.710 GHz to 2.198 GHz with variation in V dd from 2 to 3 V with power dissipation variation from 1.744 mW to 3.127 mW. With the rise in the V dd , the current is flowing in the delay stage increases, increasing the output oscillation frequency. Further, power consumption directly related to the V dd also shows the rising trends, as shown in Table 2. Figure 4 illustrates the frequency variation with I-MOS varactor width (W). Table 3 shows the effect of variation in the V b of the I-MOS varactor. Output frequency Variation with V b is obtained at fixed V dd = 2.5 V and V tune = 1.5 V. From Table 3, it is evident that ring VCO oscillates in a range of 0.852 GHz to 2.014 GHz at a different value of MOS varactor widths (W). Figure 5 shows the trends for the frequency variation with V b . With the increase in the V b , equivalent capacitance across the gate and substrate terminal decreases, increasing the proposed VCO output frequency. Output waveforms for the VCO are shown in Fig. 6 with variation in V dd and MOS varactor width (W).
(2) C dep. = si X d
Frequency tuning characteristic of the proposed VCO for different temperatures is presented in Table 4 at V dd =1.8 V. Dual control voltages (V tune and V b ) are fixed at 1.5 V and 2.5 V, respectively. The output frequency of proposed VCO decreases as temperature rises. With the change of temperature, parasitic effects in the circuit vary along with the carriers' mobility effects. Overall current in the circuit is affected by these variations, and output frequency decreases. The temperature dependence of generated frequency is plotted, as shown in Fig. 7.
Performance characteristics of the proposed VCO at various V dd are presented in Table 5. At low V dd phase, noise and merit figures are improved due to the power consumption reduction. The circuit, however, shows a reasonably good phase noise performance over the wide range of supply voltage. Phase noise and jitter are continuous random variations in VCO. Phase noise is generally represented in the frequency domain, and jitter is usually characterized in the time domain. Figure 8 shows the phase noise waveform of the proposed VCO at 1 MHz offset. Table 6 shows the major performance parameters for the proposed VCO design and comparison with the previous reported work using the Figure of merit (FoM) is given by the Eq. (3). [17] Which evaluate three performance parameters of VCOs; phase noise, frequency and power consumption. where: f osc is the resonating frequency of proposed VCO, f off. is offset frequency, P diss represents the power consumption and PN define the phase noise in dBc/Hz of proposed VCO.
Conclusions
In Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http:// creat iveco mmons. org/ licen ses/ by/4. 0/.
For a fixed value of reference voltage (V ref. ), transistor N3 works as a constant current source I ref. MOS transistor (P1)is acting as a load element. A frequency variation in VCO is achieved by connecting an I-MOS varactor at the delay cell's output node. A dual control voltage is applied to the I-MOS varactor. Due to a change in the capacitance, a wide range of frequency is achieved. The I-MOS varactor's capacitance is estimated with the model as shown inFig. 2.Due to variation in load capacitance, frequency tuning is achieved in the proposed VCO while keeping power consumption remains constant. Equivalent capacitance of I-MOS varactor is given by the Eq. (1).
Fig. 1
1Proposed (a) MCML based delay stage (b) four stages ring VCO In Eq. (
Fig. 4
4Output frequency change with supply voltage variation (V dd ) at different value of MOS varactors width (W)
Fig. 6
6Output waveform at supply voltage V dd = 2 V with MOS varactors width W = 5 μm
Fig. 8
8Phase noise waveform at V dd = 2.6 V with (V tune = 1.5 V and V b = 2.5 V)
Table 1 .
1Proposed VCO achieved a variable frequency from
0.528 GHz to 1.472 GHz.
Table 2
2Frequency variation for different V ddSupply
voltage
(V dd )
Output frequency (GHz)
Power
dissipation
(mW)
W = 5 μm W = 10 μm W = 15 μm
2.0 V
1.428
0.940
0.710
1.744
2.1 V
1.573
1.042
0.770
1.923
2.2 V
1.686
1.127
0.839
2.080
2.3 V
1.808
1.199
0.900
2.223
2.4 V
1.913
1.272
0.954
2.359
2.5 V
1.992
1.332
1.000
2.490
2.6 V
2.055
1.378
1.032
2.618
2.7 V
2.119
1.415
1.060
2.746
2.8 V
2.152
1.443
1.085
2.873
2.9 V
2.196
1.461
1.095
3.000
3.0 V
2.198
1.477
1.115
3.127
Table 3
3Output frequency variation with V bBody bias voltage
(V b )
Output frequency (GHz)
W = 5 μm
W = 10 μm
W = 15 μm
1.0 V
1.790
1.099
0.852
1.2 V
1.822
1.176
0.876
1.4 V
1.862
1.213
0.904
1.6 V
1.904
1.256
0.935
1.8 V
1.934
1.282
0.958
2.0 V
1.956
1.301
0.973
2.2 V
1.973
1.316
0.986
2.4 V
1.987
1.327
0.996
2.6 V
1.997
1.337
1.004
2.8 V
2.006
1.345
1.011
3.0 V
2.014
1.352
1.017
Fig. 5 Output frequency variation with body bias voltage (V b ) at
different MOS varactor width (W)
Additional tuning techniques in addition to MOS varactors with improved delay cell can results in better VCO design.this work, a low-power MCML based ring-based VCO in
0.25 μm standard CMOS technology is presented. MOS var-
actor tuning technique is utilized to obtain a wide range
of frequencies. The proposed technique's results showed
that improvements in power consumption, tuning range,
and phase noise are obtained. The range of frequency
(3)
FoM(dBc/Hz) = 20log
f osc.
f off.
− 10log
P diss.
1mW
− PN
from 0.528 GHz to 2.014 GHz is achieved for the proposed
VCO by altering the I-MOS varactor's dual control volt-
age. Proposed VCO achieves -93.77 dBc/Hz phase noise at
an offset of 1 MHz from 1.272 GHz oscillation frequency.
Proposed VCO has a figure of merit (FoM) of 152.13 dBc/
Hz with a power dissipation of 2.359 mW. More design
improvements in the proposed delay cell can be explored
for nano scale VCO design with wider frequency range
and low power.
Table 4
4Parameters of proposed VCO for different temperaturesFig. 7 Temperature dependence of output frequency with different I-MOS varactors width (W)Temperature
(°C)
Output frequency (GHz)
W = 5 μm
W = 10 μm
W = 15 μm
10
1.277
0.832
0.617
20
1.230
0.800
0.593
30
1.185
0.769
0.572
40
1.141
0.741
0.551
50
1.100
0.715
0.531
60
1.060
0.689
0.512
70
1.021
0.665
0.494
80
0.986
0.642
0.477
Table 5
5Phase noise results at
different supply voltage (V dd )
Supply
voltage
(V)
Source/
drain volt-
age (V)
Body bias
voltage
(V)
Reference
voltage
(V)
Output
frequency
(GHz)
Power
dissipation
(mW)
Phase
noise
(dBc/Hz)
FoM (dBc/Hz)
2.0
1.5
2.5
1.5
0.940
1.744
-96.791
153.83
2.2
1.5
2.5
1.5
1.127
2.080
−94.948
152.80
2.4
1.5
2.5
1.5
1.272
2.359
−93.777
152.13
2.6
1.5
2.5
1.5
1.378
2.618
−93.230
151.83
2.8
1.5
2.5
1.5
1.443
2.873
−92.748
151.35
3.0
1.5
2.5
1.5
1.477
3.127
−92.333
150.56
Table 6 Proposed
6DeclarationConflict of interestOn behalf of all authors, the corresponding author states that there is no conflict of interest.VCO
comparison with earlier
presented work
References Frequency range (GHz) Technol-
ogy (µm)
Phase noise (dBc/Hz) Power
consumption
(mW)
FoM (dBc/Hz)
[8]
9.8-11.5
0.50
−98@2 MHz
75
153.1
[9]
4.2-5.9
0.18
−99.1@ 1 MHz
58
156.28
[10]
1.77-1.92
0.18
−102@ 1 MHz
13
156.3
[18]
0.8-2.1
0.25
−85.4@1 MHz
45
-
[19]
0.8-2.4
0.25
−98.5 400KHz
59
152.83
[20]
5.16-5.93
0.18
−99.2 @ 1 MHz
80
166
[21]
0.661-1.27
0.50
−106@1 MHz
15.4
153.2
[22]
1.82-10.18
0.13
−88.4@1 MHz
5
156.5
This Work
0.528-2.014
0.25
−93.77@1 MHz
2.35
152.13
A 8.7 mW 5-Gb/s clock and data recovery circuit with 0.18-µm CMOS. T J An, K S Son, Y J Kim, I S Kong, J K Kang, IEEE Int Symp Circuits Syst (ISCAS). 2014An TJ, Son KS, Kim YJ, Kong IS, Kang JK (2014) A 8.7 mW 5-Gb/s clock and data recovery circuit with 0.18-µm CMOS. IEEE Int Symp Circuits Syst (ISCAS) 2014:2329-2332
A power efficient delta-sigma ADC with series-bilinear switch capacitor voltage-controlled oscillator. D S Shylu, P S Paul, D J Moni, Monica Helan, J A , Telkomnika. 185Shylu DS, Paul PS, Moni DJ, Monica Helan JA (2020) A power efficient delta-sigma ADC with series-bilinear switch capacitor voltage-controlled oscillator. Telkomnika 18(5).
Design and development of high performance MOS current mode logic (MCML) processor for fast and power efficient computing. K S Pradeep, S S Kumar, 10.1007/s10586-018-1917-5Clust Comput. Pradeep KS, Kumar SS (2018) Design and development of high performance MOS current mode logic (MCML) processor for fast and power efficient computing. Clust Comput, 1-9. https:// doi. org/ 10. 1007/ s10586-018-1917-5
An MOS current mode logic (MCML) circuit for low-power sub-GHz processors. M Yamashina, H Yamashina, IEICE Trans. Electron. E75-C. 10Yamashina M, Yamashina H (1992) An MOS current mode logic (MCML) circuit for low-power sub-GHz processors. IEICE Trans. Electron. E75-C (10), pp 1181-1187.
Design of ultra-low power current mode logic gates using magnetic cells. V Jamshidi, M Fazeli, AEU-Int J Electr Commun. 83Jamshidi V, Fazeli M (2018) Design of ultra-low power current mode logic gates using magnetic cells. AEU-Int J Electr Com- mun 83:270-279
A low phase noise and low power 3-5 GHz frequency synthesizer in 0.18 µm CMOS technology. E Abiri, M R Salehi, S Salem, Microelectronics J. 456Abiri E, Salehi MR, Salem S (2014) A low phase noise and low power 3-5 GHz frequency synthesizer in 0.18 µm CMOS technol- ogy. Microelectronics J 45(6):740-750.
A digitally stabilized type-III PLL using ring VCO with 1.01 psrms integrated jitter in 65nm CMOS. A Sai, Y Kobayashi, S Saigusa, O Watanabe, T Itakura, IEEE International Solid-State Circuits Conference Digest of Technical Papers (ISSCC). Sai A, Kobayashi Y, Saigusa S, Watanabe O, Itakura T (2012) A digitally stabilized type-III PLL using ring VCO with 1.01 psrms integrated jitter in 65nm CMOS. In: IEEE International Solid- State Circuits Conference Digest of Technical Papers (ISSCC), pp 248-250.
A 9.8-11.5-GHz quadrature ring oscillator for optical receivers. J D Van Der Tang, D Kasperkovitz, A Van Roermund, IEEE J Solid-state Circuits. 373Van der Tang JD, Kasperkovitz D, Van Roermund A (2002) A 9.8- 11.5-GHz quadrature ring oscillator for optical receivers. IEEE J Solid-state Circuits 37(3):438-442.
A multiplepass ring oscillator based dual-loop phase-locked loop. C Danfeng, R Junyan, D Jingjing, L Wei, L Ning, J Semiconductors. 3010105014Danfeng C, Junyan R, Jingjing D, Wei L, Ning L (2009) A multiple- pass ring oscillator based dual-loop phase-locked loop. J Semi- conductors 30(10):105014
The design and analysis of dualdelay-path ring oscillators. Z Z Chen, T C Lee, IEEE Trans Circuits Syst I Regul Pap. 583Chen ZZ, Lee TC (2011) The design and analysis of dual- delay-path ring oscillators. IEEE Trans Circuits Syst I Regul Pap 58(3):470-478
New low power differential VCO circuit designs with active load and IMOS varactor. V Jangra, M Kumar, AEU-International Journal of Electronics and Communications. 153191Jangra V, Kumar M (2020) New low power differential VCO circuit designs with active load and IMOS varactor. AEU-International Journal of Electronics and Communications, 153191.
Design of Linear Low-Power Voltage-Controlled Oscillator with I-MOS Varactor and Back-Gate Tuning. M Kumar, 10.1007/s00034-018-0748-1Circuits, Systems, and Signal Processing. Kumar M (2018) Design of Linear Low-Power Voltage-Controlled Oscillator with I-MOS Varactor and Back-Gate Tuning. Circuits, Systems, and Signal Processing, pp 1-17. https:// doi. org/ 10. 1007/ s00034-018-0748-1
Oscillator phase noise: a tutorial. T H Lee, A Hajimiri, IEEE J Solid-State Circuits. 353Lee TH, Hajimiri A (2000) Oscillator phase noise: a tutorial. IEEE J Solid-State Circuits 35(3):326-336
Single-ended to differential converter for multiple-stage single-ended ring oscillators. Y Toh, J A Mcneill, IEEE J Solid-State Circuits. 381Toh Y, McNeill JA (2003) Single-ended to differential converter for multiple-stage single-ended ring oscillators. IEEE J Solid- State Circuits 38(1):141-145
A low power CMOS-based VCO design with I-MOS varactor tuning control. M Kumar, D Dwivedi, J Circuits Syst Comput. 27101850160Kumar M, Dwivedi D (2018) A low power CMOS-based VCO design with I-MOS varactor tuning control. J Circuits Syst Com- put 27(10):1850160
A new modified I-MOS varactor for linear range enhancement. A Karimi, E Ebrahimi, Microelectron J. 90Karimi A, Ebrahimi E (2019) A new modified I-MOS varactor for linear range enhancement. Microelectron J 90:181-186
A 2.4-GHz CMOS monolithic VCO with an MOS varactor. P Andreani, S Mattisson, Analog Integrated Circuits Signal Process. 221Andreani P, Mattisson S (2000). A 2.4-GHz CMOS monolithic VCO with an MOS varactor. Analog Integrated Circuits Signal Process 22(1):17-24.
A dual-path three-stage VCO with wide tuning range. W R Yang, W Y Jiang, 7th International Conference on ASIC. Yang WR, Jiang WY (2007) A dual-path three-stage VCO with wide tuning range. In: 2007 7th International Conference on ASIC, pp 542-544.
New wideband/dualband CMOS LC voltage-controlled oscillator. M A Do, R Y Zhao, K S Yeo, J G Ma, IEE Proc Circuits Devices Syst. 1505Do MA, Zhao RY, Yeo KS, Ma JG (2003) New wideband/dualband CMOS LC voltage-controlled oscillator. IEE Proc Circuits Devices Syst 150(5):453-459
A 5.9-GHz voltage-controlled ring oscillator in 0.18μm CMOS. Y A Eken, J P Uyemura, IEEE J Solid-State Circuits. 391Eken YA, Uyemura JP (2004) A 5.9-GHz voltage-controlled ring oscillator in 0.18μm CMOS. IEEE J Solid-State Circuits 39(1):230-233.
A 900-MHz CMOS low-phase-noise voltage-controlled ring scillator. Wst Yan, H C Luong, IEEE Trans Circuits Systems II Analog Digital Signal Process. 482Yan WST, Luong HC (2001) A 900-MHz CMOS low-phase-noise voltage-controlled ring scillator. IEEE Trans Circuits Systems II Analog Digital Signal Process 48(2):216-221
A two-stage ring oscillator in 0.13 μm CMOS for UWB impulse radio. B Fahs, W Y Ali-Ahmad, P Gamand, IEEE Trans Microw Theory Tech. 575Fahs B, Ali-Ahmad WY, Gamand P (2009) A two-stage ring oscil- lator in 0.13 μm CMOS for UWB impulse radio. IEEE Trans Microw Theory Tech 57(5):1074-1082.
| This paper investigates the effect of lowering the supply and threshold voltages on the energy efficiency of CMOS circuits. Using a first-order model of the energy and delay of a CMOS circuit, we show that lowering the supply and threshold voltage is generally advantageous, especially when the transistors are velocity saturated and the nodes have a high activity factor, In fact, for modern submicron technologies, this simple analysis suggests optimal energy efficiency at supply voltages under 0.5 V. Other process and circuit parameters have almost no effect on this optimal operating point. If there is some uncertainty in the value of the threshold or supply voltage, however, the power advantage of this very low voltage operation diminishes. Therefore, unless active feedback is used to control the uncertainty, in the future the supply and threshold voltage will not decrease drastically, but rather will continue to scale down to maintain constant electric fields. | A low-voltage, low-power CMOS delay element is proposed. With a unit CMOS inverter load, a delay from 2.6 ns to 76.3 ms is achieved in 0.8 /spl mu/m CMOS technology. Based on a CMOS thyristor concept, the delay value of the proposed element can be varied over a wide range by a control current. The inherent advantage of a CMOS thyristor in low voltage domains enables this delay element to work down to the supply voltage of 1 V while the threshold voltage of the nMOS and pMOS transistors are 840 mV and -770 mV, respectively. The designed delay value is less sensitive to supply voltage and temperature variation than RC-based or CMOS inverter-based delay elements. Temperature compensation and jitter performance in a noisy environment are also discussed. | A new high-speed and low-swing on-chip bus interface using Threshold Voltage swing (Vt) driver and Dual Sense Amplifier (DSA) receiver is proposed. The Vt-driver reduces the rising time in the bus to 30% of the full CMOS inverter and the DSA-receiver increases twice the throughput of the conventional reduced-swing buses using sense amplifiers. With Vt-driver and DSA-receiver combined, approximately 60% speed improvement and 75% power reduction are achieved in the proposed scheme compared to the conventional full CMOS inverter for the on-chip bus interface. | An accurate 1.08-GHz CMOS LC voltage-controlled oscillator is implemented in a 0.35/spl mu/m standard 2P4M CMOS process. In this paper we present a new convenient method of calculation of oscillating period. With this period calculation technique, the frequency tuning curves agree perfectly with the experiment. At a 3.3-V supply, the LC-VCO measures a phase noise of 82.2 dBc/Hz at a 10 kHz frequency offset while dissipating 3.1mA current. Chip size is 0.86mm /spl times/ 0.82mm. | In this paper, a 3V 8-bit 200MSPS CMOS folding / interpolation A/D Converter is proposed. It employs an efficient architecture whose FR(Folding Rate) is 8, NFB(Number of Folding Block) is 4, and IR (Interpolating Rate) is 8. For the purpose of improved SNDR by to be low input frequency, distributed track and hold circuits are included. In order to obtain a high speed and low power operation, further, a novel dynamic latch and digital encoder based on a novel delay error correction are proposed. The chip has been fabricated with a 0.35 2-poly 3-metal n-well CMOS technology. The effective chip area is 1070650 and it dissipates about 230mW at 3.3V power supply. The INL is within 1LSB and DNL is within 1LSB, respectively. The SNDR is about 43㏈, when the input frequency is 10MHz at 200MHz clock frequency. | High speed dynamic logic implementations have power consumption bottlenecks when driving large capacitive loads that occur in clock trees, memory bit/word lines and I/O pads. This severely limits their use in a System on Chip (SoC) at Gigabit rates. A novel dynamic logic gate that saves switching power by 50% with LC resonance is described. The stored energy on the load capacitance is transferred using an inductor during logic evaluation and recovered back for pre-charge, rather than being wasted. Implementation in a standard 90nm CMOS process illustrates feasibility with realistic on-chip inductors. Inductor values below 5nH are sufficient to operate at 1GHz speed driving 1pF of load while consuming less than 1.1mW of power from a 1.8V supply, thus breaking the f.CV2 barrier. The savings are realized over a wider range of frequency and less sensitive to LC variations than previously reported. | This brief presents a built-in self-calibration (BISC) circuit to correct nonmonotonic responses in a digitally controlled oscillator (DCO) with a cascading structure. Generally speaking, a cascading DCO structure has the advantages of low power consumption and a small chip area. Nevertheless, when a subfrequency band is changed, an overlap region between subfrequency bands causes a large phase error and cycle-to-cycle jitter in an output clock. The proposed BISC circuit can reduce this problem; thus, it is very suitable for a low-power all-digital phase-locked loop design in system-on-a-chip applications. The proposed DCO, implemented with a standard performance 65-nm complementary metal-oxide-semiconductor process, can output frequency ranges from 47.8 to 538.7 MHz. The total power consumption of the DCO with a calibration circuit is 0.142 mW at 58.7 MHz and 0.205 mW at 481.6 MHz. | 1,999,866 | An on-chip CMOS relaxation oscillator with voltage averaging feedback using a reference proportional to supply voltage is presented. A voltage-averaging feedback (VAF) concept is proposed to overcome conventional relaxation oscillator problems such as sensitivity to comparator delay, aging, and flicker noise of current sources. A test-chip with typical frequency of 14.0 MHz was fabricated in a 0.18 μm standard CMOS process and measured frequency variations of ±0.16 % for supply changes from 1.7 to 1.9 V and ±0.19% for temperature changes from -40 to 125°C. The prototype draws 25 μA from a 1.8 V supply, occupies 0.04 mm2, and achieves 7x reduction in accumulated jitter (at 1500th cycle) as compared to a oscillator without VAF. | Design of low-voltage high performance CMOS-Current feedback amplifier using indirect feedback compensated Op-Amp | Low-Voltage Low-Power CMOS Oscillator with Low Temperature and Process Sensitivity | This paper presents a low-area and low-power consumption CMOS differential current controlled oscillator (CCO) for neuromorphic applications. The oscillation frequency is improved over the conventional one by reducing the number of MOS transistors thus lowering the load capacitor in each stage. The analysis shows that for the same power consumption, the oscillation frequency can be increased about 11% compared with the conventional one without degrading the phase noise. Alternatively, the power consumption can be reduced 15% at the same frequency. The prototype structures are fabricated in a standard 65 nm CMOS technology and measurements demonstrate that the proposed CCO operates from 0.7 − 1.2 V supply with maximum frequencies of 80 MHz and energy/cycle ranging from 0.11 − 0.38 pJ over the tuning range. Further, system level simulations show that the nonlinearity in currentfrequency conversion by the CCO does not affect its use as a neuron in a Deep Neural Network if accounted for during training. | A modified current starved voltage controlled oscillator (VCO) is introduced that uses voltage to current convertor based biasing circuit. The voltage supply fluctuations are reduced at output of this VCO. The frequency range obtained at the output is varying with resistor value. The highest frequency is 4.9 GHz with resistance value of 60K.The output frequency is increasing with control voltage with less noise fluctuations and reduced power of 55uW at output. The phase noise of VCO obtained at output is -144.522dBc/Hz at 1MHz at resistance value of 60K. This VCO is useful in wireless communication such as phase locked loop, clock and data recovery circuits etc. It is designed using 180 nm CMOS technology of cadence virtuoso. | A low-phase-noise and low-power multiband CMOS voltage-controlled oscillator | A compact 2 V CMOS low-power direct-conversion quadrature modulator merged with quadrature voltage-controlled oscillator (VCO) and RF amplifier for 1.9 GHz RF transmitter applications is described. The circuit is implemented by using 0.35 /spl mu/m DPTM CMOS technology and dissipates only 19 mW under 2 V power supply voltage. The low power operation is enabled by the current reuse technique used among quadrature modulator, quadrature VCO, and RF amplifier. Due to small signal path mismatch, the unwanted lower sideband is below -50 dB when the 0 dB normalized desired upper sideband is set at 1.97 GHz. Moreover, the LO feedthrough, second-order intermodulation, and third-order intermodulation are less than -50 dB. The tuning range of the quadrature VCO is 270 MHz from 1.95 GHz to 2.22 GHz. | A differential complementary hartley CMOS voltage controlled oscillator | A Linear Current Starved Voltage Controlled Ring Oscillator With Wide Tuning Range Using 180nm CMOS Technology |
1,999,867 | A Study of the Diagnosis of Downtown Deterioration in Busan | Since the 1980's the school of Busan metropolitan city has been converted into the other land-use such as high-rise apartment houses, commercial and office buildings. School facilities are available to locate in green area due to not restricted by land use zone. And the location of school facilities were closely related with the school district, distribution of neighborhood unit, safety of students, and so on. The purpose of this study is to understand the location characteristic of school - moved sites in Busan metropolitan city. | The theme of this dissertation aims to reflect upon the comparison between the implementation, functioning and consequences in Prague of the latest means of transport and their addition to the existing system and structure. The thesis deals with each network, from the very beginning and through the various stages of their development. It also mentions the former types of transport their implementation, functioning and the causes of their disappearance. The evolution of transport in Prague is different from the other western metropolis because of the succession of political and economic systems the city has endured and whose signs are still visible today. Generally speaking, the present configuration seems to fairly accurately represent the irregular distribution of the population in the local community. This situation tends to increase the vulnerability of the remotest areas as well as those isolated as a result of the dense city centre means of transport. | How does busiess impact urbanization? | All the aspects of the redevelopment of central areas, in conjunction with the accumulated problems, are examined. Especially, the issues of war damages and the needed urban centres’ reconstruction in conjunction with the traffic problems, car parking and shopping needs are considered. Apart from the problem of war damage, redevelopment was necessary in most town centres also for a variety of other reasons since buildings had become outworn and outdated, the town centre had become unable to cope with modern traffic conditions, and it was necessary to provide a new environment for a changed way of living. To these three main reasons, two more were to be added, the movement of functions out of bombed city centres during the war, and the fact that the value of sites in central commercial areas had risen to a high level. | be built new and taller skyscrapers housing offices, hotels and even department stores, but it was still steadily losing ground as decentralization took its toll. Its daytime population was not keeping pace with the population growth of the city around it, and property values, while continuing to rise, were not rising as fast as those in the secondary business districts. Downtown was still the central business district, and was still the most important area for doing business and commerce, but it was no longer as dominant as it once was. The causes of decentralization, which decreased the importance of downtown | The combined effects of industrial decline and the development of a service economy currently bring about a change in urban economies. Accessibility, proximity and an attractive urban climate are considered important factors of urban competitiveness. These are all combined in railway station area, which is therefore considered a focus point of urban economic development. The paper investigates the role of station development projects in the perspective of these long-term social and institutional processes in contrast to the continuity found in a cityÂ’s estab-lished economic structure, prevailing policy arenas, objectives and cultures. It does so by means of an analysis of station development in Rotterdam, a manufacturing and seaport city now strug-gling to find ways to develop a competitive service economy. The paper draws a comparison with RotterdamÂ’s rival Amsterdam, showing that differences in present economic performance and urban development are partly rooted in different economic histories. The paper investigates to which extent these differences affect the role of major railway station redevelopment projects in both cities, and the way these projects are implemented. | The main purpose of this study is to investigate the continuity of the planning of shopping malls in downtown areas of Japan and to look into the tendencies of the current existing malls until today. This paper is a summary of a survey conducted on the actual conditions of current shopping malls and a questionnaire administered to local governments in the survey areas. The results of this study allow us to summarize the reasons for and changes caused by renewal efforts directed toward the streets, public spaces, and urban elements (pavement, bench, streetlight, arcade, sculpture, etc.) in shopping malls. Furthermore, these results also help us to understand the scale of the renewal efforts as well as their timing in relation to when the shopping mall was originally constructed. |
Introduction
According to (IDN Times, 2019) Damage highway in the district of Karawang based on data from the Department of Public Works and Spatial Planning (PUPR) Karawang, along the road status 1937.53 kilometers of district roads in poor condition.
Damage to roads in the Falkirk area often become the public spotlight, usually people often submit complaints road damage through the social media accounts of his, so that the Department PUPR Karawang more serious in addressing the problem because the construction of the road was immediately felt by the people and for the district government pay more attention to quality improvement roads are often damaged before the age of the specified path. (IDN Times, 2019).
Therefore it is very important to perform preventive maintenance and assuming the above background, so I took the title of this thesis with the title Analysis of the volume of traffic on the road destruction rigid in Badami karawang roads. VOLUME 2 │ NUMBER 2 │ MARCH 2020 Available online at http://proceedings.worldconference.id. ISSN: 2656ISSN: -1174 Source: radar karawang 2019 Figure 1. Damage to roads roads bedami karawang Highway Badami is a street located in the district Telukjambe West, the road is an alternative way to Bekasi and connecting roads Subdistrict Telukjambe West sub-district base, it causes high levels of mobilization on the road section, and make the construction of pavement rigid damaged before age plan determined by keluahuhan citizens and road users that often lead to accidents, especially for two-wheeler riders (radar karawang, 2019).
Damage in general is the increased volume of traffic load, poor drainage systems, poor material properties pavement construction, climate, soil conditions are unstable, the planning of pavement is very thin, a job that does not deserve a process to the specification, this has happened because of the number of passing vehicles exceeding road capacity. Results damage reduction factor in the quality and age.
This study aims to Know the kind of damage that existed at the surface layer rigid in the streets Badami, determine the effect of the volume of vehicles with the level of damage to roads, know the methods of repair and how much it costs is needed, increase knowledge about the causes of road damage rigid due to the number of vehicles increasing increased. As well as provide new reference materials for civil engineering students and researchers, in order to increase knowledge about the causes of road damage caused by the increasing number of vehicles and can be used as a medium of teaching.
Methodology
Metodologogi research Overall research activities can be described as follows.
Method of collecting data. 1. Secondary data among other data required length and width of the road, the number of segments, the median, the number of lanes of the road and completeness. 2. Primary data volume of data traffic, road damage data
The analytical method used among others 1. Methods of analysis the volume of vehicles and Methods Using the Damage value of Highways. 2. Regression analysis method to obtain vehicle volume relationship patterns with the level of damage to roads. 3. Road repair method using cement concrete road pavement planning in 2003 to calculate the cement concrete slab thickness. 4. The cost of repair method, technique Hint unit price cost analysis of district road of 1995 to determine the total cost of road handling. VOLUME 2 │ NUMBER 2 │ MARCH 2020 Available online at http://proceedings.worldconference.id.
ISSN: 2656-1174 (online)
Result
A. Traffic volume
To capture data in the field within a week at peak hours beginning at 6:00 to 09:00 pm and 16:00 to 19:00 pm, while the vehicle is observed light vehicle (LV), heavy vehicles (HV), Motorcycle (MC), vehicles are not motorized (UM).
B. Assess the damage
From the observation or field observations obtained some kind of damage can occur: longitudinal cracks, transverse cracks, corner cracks, slippery Aggregates, Hole Table 2. Sta 0 + 000-0 + 500 Directions West -East Table 3. Sta 0 + 000-0 + 500 Directions East -West Table 4. Sta 2 + 250-2 + 750 Directions West -East Table 5. Sta 2 + 250-2 + 750 Directions East -West C. Determine the correlation of the volume of vehicles on the road destruction Analyzes were performed using SPSS. Recapitulation X1, X2, X3, X4 and Y. kendaraa volume and road damage were analyzed with SPSS non-linear regression. Variables that are used can be seen from the table below. According to the table above shows that the coefficient of determination volume of vehicles on road damage 0.893 then this volume of vehicles has contributed damage 0.893 Street.
a) Counting LHR
In view of the value of the vehicle on a volume o b sta 0 + 000-0 + 500 is greater than the 2 + 250 -2 + 750 can be seen in the table above, the sta 0 + 000-0 + 500 to reference data to calculate how thick overlay (overlay) as a way of handling damage.
Light vehicle 2 ton = 4,372 veh / day / 2-way Bus 8 ton = 420 veh / day / 2-way Truck 2 as 13 tonne = 1,201 veh / day / 2-way Truck 3 as 20 ton = 1,020 veh / day / 2-way
b) Analysts vehicle axis
For step -step analysis of the number of axes calculation is as follows. Determine the configuration of the load, determine the number of vehicles, determine the number of axes per vehicle, specify the number of axis = number of vehicles X amount perkendaraan axis, determines the value of BS (axle) and JS (number of axes). VOLUME 2 │ NUMBER 2 │ MARCH 2020
Available online at http://proceedings.worldconference.id.
ISSN: 2656-1174 (online) c) Calculation repetition occurring axis So the total cost required to repair roads using additional layers of rigid pavement is Rp. 9,114,626.20 / segments
Conclussion
Table 1 .
1The volume of vehicle (veh / day)Source: Data Analyst
Table 6 .
6Summary of variables X and YSource: Data Analyst
Table 7 .
7Result of data processing SPSS 16 Obtained coefficient for each variable track Source: Data Analyst The effect can be concluded partial determination coefficient analysis of traffic volume mempegaruhi role in Karawang Badami road damage by light vehicles 33.8%, 47.7% Heavy Vehicles, Motorcycles 12.1%, 14.2% of non-motorized vehicles.
Table 8 .
8Results of Testing the overall path analysisSource: Data Analyst
Table 9 .
9Effect of Simultaneous Hypothesis Testing The volume of vehicles on the road destruction Source: Data Analyst According to the table above can be explained that the Sig. (0,000) <α (0.05) and f count (35.671)> F table (3.89) H0 is rejected. Thus dapatdisimpulkan that simultaneously affect traffic volume on road damage.D. Improved methods and costs1. Methods repair repair methods in use namely Structural Repair additional coating, the method of Highways ie additional coating rigid pavement with a design life of 10 years.To calculate how thick the need for an additional layer by calculating:
a. calculate LHR
b. Analysts vehicle axis
c. Calculation repetition occurring axis
d. Calculation of the concrete slab thickness
Table 10 .
10Calculation of Total Axis By Type and His burdenSource: Data Analyst
Table 11 .
11Repetition Axes Calculation Plan Relationship Graph graphic CBR CBR Effective Basic Land Basic Land Plan After determining the thickness of the estimates on can then continue with the Table Voltage Equivalent and Voltage Erosion and in Table thick sleb 250 and values .cbr effective 20 in view the value of STRT, Strg, STRdRG then the value is applied to the graph TE (Voltage Equivalent) and FE (Erosion factor) To determine the estimated thick concrete slab if it is safe or not.Source: Data Analyst
Table 12 .
12Fatigue Analysis and Erosion with estimates Thick Plates 25 cm used is 25 cm due to already meet the requirements of a strong and safe to use. Determining the required thick layer added to the equation: a. Determining thick layer immediately added: Thick layers of added directly required (Tr) Tr = 1.4 √ (T 1.4 -Cs.T0 1.4) With known: T = thick layers needed = 25 cm T0 = 30 cm Cs = 0.35 Then Tr = 1.4√ {(25) 1.4 -0.35 (30) 1.4} = 8.81 cm. b. Determining the layer thickness plus a separator: Tr = √ (T 2 -Cs.T0 2) With note: T0 = 30 cm Cs = 0.35 (fatherly broken pavement conditions strruktur) Then Tr = √ {(25) from 2 to 0.35 (30) 2} = 17.6cm Taken thick layer added Tr = 17.6 cm> Tr minimum = 8.81 cm Then take a thick layer added ≠ Tr = 17.6 cm 18 cm Source: Data Analyst 2. Repair Cost A. The volume of work B. Calculation of cost analysis of rigid pavement work C. Total cost of road repairs per segment The number of segments required = (road length / segment length) x 2 B. calculation of rigid pavement overlay HSP analysta. Wet = 10 year design life. b. HSP Wet Lean Concrete = Rp. 827,947.67 c. HSP casting plate = Rp. 2,443,085.01 d. Biaya Lean Concrete = volume x unit price = 1.75, x Rp. 827,947.67 = Rp. 1,448,908.42 e. Slab casting costs street = volume x unit price = 3.15 x Rp. 2,443,085.01 = Rp. 7.695.717.78 C. Total cost of road repairs per segment a. Cost Lean Wet Concrete = Rp. 1,448,908.42 b. Cost casting plate = Rp. 7,695,717.78 + amount = Rp. 9,114,626.20Source: Data Analyst
analysis and discussion. it can be concludedanalysis and discussion, it can be concluded:
000) <α (0.05) and f count (35.671)> F table (3.89) H0 is rejected. Based on the results of Simultaneous Effect Hypothesis that the Sig. (0. It can be concluded that the simultaneous effect of the Light Vehicle Damage to Roads of 33.8%, the simultaneous effect of the Heavy Vehicle Road Damage amounted to 47.7%, Motorcycles simultaneous effect against 12.1% Damage Roads and Motor Vehicles no simultaneous effect against Road damage by 14.2% .Based on the results of Simultaneous Effect Hypothesis that the Sig. (0,000) <α (0.05) and f count (35.671)> F table (3.89) H0 is rejected. It can be concluded that the simultaneous effect of the Light Vehicle Damage to Roads of 33.8%, the simultaneous effect of the Heavy Vehicle Road Damage amounted to 47.7%, Motorcycles simultaneous effect against 12.1% Damage Roads and Motor Vehicles no simultaneous effect against Road damage by 14.2% ..
Based on analysis of the design used road repair method with a design life of 10 years, namely: Rigid Pavement Overlay (Rigid Pavement) as thick as 18 cm. 2. Based on analysis of the design used road repair method with a design life of 10 years, namely: Rigid Pavement Overlay (Rigid Pavement) as thick as 18 cm.
Based on analysis of the cost calculation of the fees obtained by the third method of repair is equal to: the cost of Rigid Pavement Overlay (Rigid Pavement) Rp. 9,114,626.20 / segments. VOLUME 2 │ NUMBER 2 │ MARCH. onlineBased on analysis of the cost calculation of the fees obtained by the third method of repair is equal to: the cost of Rigid Pavement Overlay (Rigid Pavement) Rp. 9,114,626.20 / segments. VOLUME 2 │ NUMBER 2 │ MARCH 2020 Available online at http://proceedings.worldconference.id. ISSN: 2656-1174 (online)
Rigid Pavement Maintenance Procedures (Concrete Road Works Planning 2003). pd T-14-2003. In planning the concrete road pavement Ministry of Resettlement and Prasaranawilayah. Radar Karawang, . ; Idn Times, K , Cement Concrete Pavement Planning, Ministry of Settlement and Prasaranawilayah Rigid Pavement Maintenance Procedures. Rigid Pavement. Direktorat General of HighwaysRadar Karawang. (2019, February). Damage Road Badami -Loji Increasingly Severe. IDN Times, K. (2019). 1937.53 Kilometers along the highway in Karawang Damaged Directorate General of Highways. (1991). Rigid Pavement Maintenance Procedures (Concrete Road Works Planning 2003). pd T-14-2003. In planning the concrete road pavement Ministry of Resettlement and Prasaranawilayah. (2003). Cement Concrete Pavement Planning, Ministry of Settlement and Prasaranawilayah Rigid Pavement Maintenance Procedures (Rigid Pavement) No. 10 / T / BNKT / (1991) .Direktorat General of Highways.
| 1,999,867 | City center Regeneration in Busan Metropolitan Using GIS | The Research and Design of GIS Based Urban Commercial Resources Management System | Analysis on the Application of GIS in Urban Housing Choice | This paper evaluates the fi rst local government-led neighborhood regeneration project in central Istanbul with reference to its neighborhood impact and its wider implications for the future of regeneration in the city. From a perspective rooted in historical and international comparative planning studies, the research methodology is elaborated through an analysis of the evolution of a generic model of contemporary sustainable urban regeneration that provides the analytical framework for the evaluation. A review of the emergence of regeneration in Istanbul since the early 2000s establishes the context and rationale for the Sulukule case study. The paper then presents an analysis of events which led to the total demolition of the historic Sulukule neighborhood and the destruction of its Roma community. These events fl owed from the authoritarian implementation of the Sulukule Renewal Area Plan, despite the efforts of civil society organizations to secure the development and implementation of a community-based alternative plan. The neighborhood level evaluation explains why the redevelopment of Sulukule should be understood as planned gentrifi cation. Evaluation on a wider front is necessary because Sulukule has become the cause celebre in a vigorous debate about the purpose, scope, and outcomes of regeneration, which centers on the question ‘whose Historic Peninsula?’. Many argue that regeneration should be stopped, as it inevitably means planned gentrifi cation. But others, including the authors, draw on international experience to argue for the development of an Istanbul/Turkish version of sustainable, conservation-led, and community-based neighborhood regeneration. More widely still, the Sulukule experience has fuelled growing opposition to regeneration per se, epitomized in the slogan ‘no Sulukule here’. Thus the paper concludes by outlining the action needed to move toward sustainable regeneration, not only for the city’s central historic neighborhoods, but also for the far more numerous poor and deteriorating 20 th century neighborhoods where the threat is not from gentrifi cation, but | Analysis of the Spatial-temporal Change of the Urban Development Suitability Based on GIS—A Case Study of Wuhan,Hubei | Conception of a GIS-Platform to simulate urban densification based on the analysis of topographic data | URBAN REDEVELOPMENT MODE THAT MAKES THE PAST SERVE THE PRESENT AND BRINGS FORTH THE NEW FROM THE OLD:A CASE STUDY ON RENOVATION PLANNING OF LITCHI BAY CULTURAL AND RECREATIONAL AREA OF GUANGZHOU | This paper analyzes the factors which impact the orientation of urban such as geographical location, natural resources, international political situation, and identify the status of the city in the national strategic pattern. Finally, manage and analyze these factors on GIS platform, present a rise dynamic orientation mode of Altay city. | Corporation-led urban development |
1,999,868 | Some points brought up by Prior in his court filing for upcoming hearing 1/6/21 for change of venue | Natural justice of prior notice serves three important purposes: The British courts have held it is not enough for an affected person to merely be informed of a hearing. He or she must also be told what is at stake; in other words, the gist of the case. Every person has the right to have a hearing and be allowed to present his or her own case. Should a person not attend the hearing, even with adequate notice given, the adjudicator has the discretion to decide if the hearing should proceed. In "Ridge v Baldwin", a chief constable succeeded in having his | Landmark Communications, Inc. v. Virginia his public duties." In his memoir "Speaking Freely", Abrams stated that it was the first case he argued by himself before the Supreme Court. He continued that he devoted most of their preparation for the case with three overlapping issues, "ones that have consumed my attention in every later Supreme Court argument as well." The first was jurisprudential: what rule of law would they urge the Court to adopt? What would be its effect as "stare decisis" and its impact on the First Amendment. The second was tactical. Justices are known for taking up the 30 minutes of allotted argument | Demos (U.S. think tank) that ensures Missourians have access to voter registration and that their registration records are accurately updated. In 2016, more than 750,000 people moved within Missouri—245,000 to another county. Every time one of these individuals reported a change of address with the state motor vehicle agency, their voter registration information should have been updated to reflect their new address unless they requested otherwise. • Demos’ case Husted v. A. Philip Randolph Institute went to the Supreme Court, and it was one of the more consequential decisions of the term. Ruling 5-4 against Demos, the high court found that the process by | Which amendment applies to this scenario the accused has the right to have the help of legal counsel an attorney at very step of legal process? | This article examines the Court of Appeal decision in Pitt v Holt, and its implications for the rule in Re Hastings-Bass. The article argues that there are some inconsistencies between the post-Pitt position and other rules relating to the control of trustee discretion, particularly fraud on a power and the standing of trustees to sue in respect of their own breaches of trust. It also considers what is meant by saying a power is 'fiduciary', and argues that it is wrong to categorise the duty created by Pitt as fiduciary, as the Court of Appeal appears to do. Finally, it considers the reasons why settlors may wish to restore the pre-Pitt position by careful drafting, and presents a possible strategy by which they might do so. Read more | FILE - In this Jan. 29, 2018, file photo, Missouri Gov. Eric Greitens speaks in Palmyra, Mo. Greitens is expected to ask a judge to move up his criminal trial to April 3, more than a month earlier than scheduled. Attorneys for the Republican governor at a hearing Monday, March, 19, 2018 also asked for a bench trial. The circuit attorney's office opposes both notions. Jeff Roberson, File AP Photo | If a defendant is not allowed to hear charges against him or her which amendment has been violated? | So, if a defendant does not raise certain defenses in his answer, i.e. lack of personal jurisdiction, he is deemed to have waived the defense. Imagine the defendant serves his answer without raising the defense of lack of PJ. What if he, within 21 days of serving the answer, amends the answer to include a defense of lack of PJ. Through the relation back doctrine, is the defendant deemed to have timely raised the defense? I couldn't find a clear answer in my bar prep materials, which mostly talk about relation back with regard to plaintiffs and statutes of limitations. | 1,999,868 | These are just a few things, not the whole 6 page document he filed\~
“At the direction of the stake president in Henry’s Fork, Mr. Daybell’s sister sent a mass email to all the ladies within the Henry’s Fork stake only causing greater concern that any potential jury pool would be tainted…Rather it has been suggested to defense counsel through investigation that she is related through marriage to law enforcement who may be and may have investigated this case. That causes defense counsel great concern as it would seem on the face of her assertions in her email to all the ladies of the Henry’s Fork stake that she has personal knowledge of the facts”
“East Idaho News who has a dominant and expansive readership within all of the Seventh Judicial District has on almost a daily basis reported on information regarding this case. It has published interviews with material witnesses to the case, published numerous pictures pf the location of where the bodies of the children were discovered. Photos of courthouses laced with ribbons and pictures. I have also submitted numerous photos of businesses and places within the Seventh Judicial District community expressing opinion on this case.”
“..majority of people interviewed stated that they have already made up their mind regarding the guilt of the Defendants.”
He then cites East Idaho News interviews with a material witness, the defense mentions Boise as an area far more likely to impanel an impartial jury “than the small number of eastern Idaho rural communities whose local media agency has an incredible following.”
Dec 3 2020
Signed
John Prior
***I think legally he has a good chance of getting the change of venue because Daybells sister in law (who is also related to LE through the marriage of one of her children, I believe) having been told to write the email by her church is pretty damning as far as jury tainting. Its also madding to see Prior file because Mark Means has done as much if not more jury tainting, but they are saying they arent working together so as far as the courts go i guess thats a different issue. Argh.***
Here are a few things Justin Lum from Fox10 pointed out about the recent (Dec 3,4) filings by *Prior and Means that I thought were interesting too:*
Prior also accused Special Prosecutor Rob Wood of not releasing Tammy Daybell’s autopsy results. She died on 10/19/19 and her body was exhumed 12/11/19 to be investigated.
Chad Daybell’s attorney John Prior files memorandum to support change of venue. Prior says fair & impartial trial can’t be had in Fremont, Madison or Bonneville Counties in Idaho. His argument mentions recording of Lori Vallow justifying right to harm her 3rd husband Joseph Ryan.
(Continued) - Daybell requests all articles and media coverage submitted to court ahead of this memorandum be admitted in its entirety to support motion to change venue. Hearing is on 1/6/21.
u/jlumfox10
Lori Vallow will also have a hearing on 1/6/21 for a motion to dismiss and motion for transfer of trial.
&#x200B;
***really short document filed by Means:***
“PLEASE TAKE NOTICE that Defendant Lori Norene Vallow (Daybell) will call for hearing her Motion for Transfer of Trial and Motion to Dismiss before this Honorable Court located at 151W.1“N., St.Anthony, ID 83445 on or about January 6, 2021 at 9:00am. DATED this 4 day of December 2020.
Signed
Mark L. Means
Link: | what was emma cunningham accused of in the oj simpson trial | Excellent Judge Dee mystery | proving Ronnies innocence and clearing her name for good. When bail is announced | when was the death of mitrice richardson ruled innocent | Determining the veracity of the news regarding SHC Judges' remarks on the Huma Younis case | THE DIGITAL AGE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 491 R III. JUDGES BEHAVING BADLY ON SOCIAL MEDIA . . . . . . . . . . . . . . . . . . . . . . . . . . . . 497 R A. Angela Dempsey . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 497 R B. Doe v. Sex Offender Registry Board . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 498 R C. Eugenio Mathis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 498 R D. Lee Johnson . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 499 R E. Ernest “Bucky” Woods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 499 R F. Shirley Strickland Saffold . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 500 R G. William Adams . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 501 R H. James Oppliger . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 502 R I. B. Carlton Terry, Jr. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 502 R IV. OTHER USES FOR SOCIAL MEDIA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 503 R V. ATTENUATED TIES AS A CHALLENGE TO JUDICIAL IMPARTIALITY . . . . . . . . . . . . . 507 R VI. JUDGED BY THE COMPANY YOU KEEP: A LOOK AT EACH JURISDICTION’S TREATMENT OF JUDGES AND SOCIAL MEDIA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 510 R A. ABA Formal Opinion 462 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 510 R B. New York . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 513 R C. Kentucky . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 514 R D. South Carolina . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 515 R E. Maryland . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 515 R F. Massachusetts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 516 R G. Tennessee . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 517 R H. Oklahoma . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 517 R I. Ohio . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 518 R J. California . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 519 R K. Florida . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 521 R L. Other States . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 526 R VII. CASES CONSTRUING JUDGES’ ACTIVITIES ON SOCIAL MEDIA . . . . . . . . . . . . . . . . 527 R A. Domville v. State . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 528 R B. Youkers v. State . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 530 R VIII. CONCLUSION . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 532 R | Defendant in Nia Wilson murder case gives bizarre testimony claiming sisters were 'aliens' | Wrongful conviction case headed to southeast Missouri judge - KMOV.com |
1,999,869 | i was wondering since i'm getting married, will my loans affect my husband in any way. i got student loans and haven't payed for them. i have a deferment right now. i was still going to school, after getting my first degree, but dropped it to look for a job. i know i will start paying my loans soon. but if i happen to miss some payments or if something happens will he have to pay them or will that ruin his credit. i heard from some people that the lenders will go after the spouse. is this true?? | We both have six-figure federal loans. I’m on the income based repayment plan (IBR). My husband used to be on IBR, but he has defaulted on his loans, so he is no longer eligible until his loans are rehabilitated.
We are not in a community property state and we both took out our loans before we were married.
In the past, we’ve filed our taxes as married filing separately, but for 2017, it makes more sense for us to file jointly. I’m not entirely sure how liability for student loans works when you are on IBR and file taxes jointly. I know the joint AGI is used to determine our monthly payment, but does each spouse become liable for that entire monthly payment or just their respective portion? Also, could my husbands defaulted loans affect my eligibility for IBR?
I’m probably worrying over nothing, but I just want to make sure I’m not taking on an unexpected liability just so we can get a bigger tax refund. I asked this previously in the student loan sub, but it was suggested to me that I see if anyone in this sub would be willing to weigh in on this. Thank you in advance for any guidance you can provide! | Hello! I am about to finish graduate school, and my student loans are coming out of deferment but I haven't been able to find a job yet. I was looking into income based repayment, but they ask about how you typically file taxes and then about spouse's income. I'm getting married in the fall, so this is the first year we will be filing taxes as a couple. What is my best bet here? If I don't have to, I don't want to tell them about my fiance's income and commit to that going to my loans before we are married and combine finances. Am I okay to tell the loan companies I'm single until September when I actually get married? | My wife has student loans that we need to pay off. I make considerably more income than she does though. We don't know if we will be filing jointly or not at the end of the year (this is out first married year). Is there a benefit to me sending her the money and her paying it from her account vs mine? If I send it to her, does she have to pay taxes on top of it as added income?
Thank you! | So I just inherited a large amount of student loans when I got married. My wife has an undergrad and Master's degree both of which required loans. Her parents did all the paperwork and everything on all the loans but promised to pay for all undergrad loans. The problem is that everything is in my wife's name on GreatLakes (at least that I know about) so she has already been paying interest on the full amount for a year and we are continuing to do that now. Even though only about a third of the debt is supposed to be "hers". If her parents are co-signers, is it possible to transfer some of the liability to them with their consent? | Me and my husband attended our first year of college in 2018-2019 and took out loans our first semester that don't need to be paid off until after college is over. I'm filing our taxes, do I need to list these loans? | Hi all,
My wife has about ~100k of students loans of which ~80k are at 11% interest and the rest at 7%. She is currently in a paid PhD program with a 30k a year stipend and should graduate in 2-3 years with a starting salary of about 100k. I work full time and make ~70k plus bonuses.
For the last few years while we were engaged we have been putting her full stipend into her loans (original balance was 150k) but it feels like 2 steps forwards one step back with this crazy interest.
Last year we tried to refinance her loans with a few providers (sofi and discover) before we were married with me as a co-signer and where rejected because she was in grad school.
will the fact that we are now married make any difference if we try again or are we stuck with this interest rate until she graduates? Our credit scores are both in the 780s and we have no other debt. | I just married my wife in august. I make about 50k more than her putting us in a questionable position position with her college loans which she has on income based repayment (IBR). Is it best for use to file separately which may put me in a higher tax bracket or is there actually a benefit to filing jointly that wont completely destroy her this tax season. | My aunt and uncle live in California US.
Before they got married, they both had student debt.
My aunt has debt of about 50k, and my uncle had around 70k.
My uncle recently died and now my aunt’s worried that she’ll have to take on his student debt on top of what she already has to pay.
My aunt says, though, they both didn’t have co-signers on the loans so she’s wondering if because he’s gone now, if she would still have to pay the debt since they were married? | 1,999,869 | No, they will not affect him. However if you and your husband consolidate your loans together ( they take all the loans the two of you have, and create one loan) then they will be. Once you consolidate them together, you can't separate them again. | Your husband and you are separated you are splitting the credit card debt He is the primary card holder on both cards you want your name off the card he is paying will the credit company do this? | Can I be liable for my spouse’s student loans if we file our taxes jointly? | Will filing for bankruptcy affecting asset under my spouse? | what happens to a joint mortgage when you divorce? | Sallie Mae is destroying my husbands credit, for a loan he never took out | FHA loan in only 1 persons name vs joint? | Buying out (ex)spouse of home during divorce | FHA or USDA loan using only one spouse in a community state? |
1,999,870 | Conditional solubility versus pO2− of cerium(III) oxide in molten equimolar NaCl+KCl at 727°C⋆ | Abstract Specific heat measurements on non-stoichiometric cerium oxide, CeO y , were carried out in the temperature range 320 ⩽ T ⩽ 1200 K for the composition range 1.700 ⩽ y ⩽ 2.000. The main results and their analysis is presented. | Abstract Measurements of the lattice constant and the magnetic susceptibility on (Ce 1− x La x )Ni 2 show that the electron state of Ce atoms having small atomic radii in CeNi 2 recovers the normal Ce 3+ state with the increase of La concentration. The Kondo effect was observed for the resistivity of samples having a wide range of Ce concentration. | Electrochemical behavior of TmCl3 solutions in a NaCl-2CsCl eutectic melt at temperatures of 823–973 K on an inert Mo electrode was studied by cyclic and square-wave voltammetry and the method of electromotive forces. The mechanism of the cathodic process was determined, kinetic parameters of the Tm(III) + e ⇆ Tm(II) reaction were found, and the temperature dependence of the diffusion coefficients of Tm(III) ions was calculated. The conditional standard redox potential for the Tm(III)/Tm(II) pair was measured in the temperature range under study. The basic thermodynamic characteristics of the Tm(III) + e ⇆ Tm(II) redox reaction in a molten NaCl-2CsCl eutectic mixture were determined. | Cerium(IV) sulfate Cerium(IV) sulfate, also called ceric sulfate, is an inorganic compound. It exists as the anhydrous salt Ce(SO) as well as a few hydrated forms: Ce(SO)(HO), with x equal to 4, 8, or 12. These salts are yellow to yellow/orange solids that are moderately soluble in water and dilute acids. Its neutral solutions slowly decompose, depositing the light yellow oxide CeO. Solutions of ceric sulfate have a strong yellow color. The tetrahydrate loses water when heated to 180-200 °C. It is insoluble in glacial acetic acid and pure (96%) ethanol. It was historically produced by direct reaction of fine, | The solubility of NiO in molten Li/sub 2/CO/sub 3/, Na/sub 2/CO/sub 3/, K/sub 2/CO/sub 3/, and Rb/sub 2/CO/sub 3/ was measured at 910C as a function of the basicity or -log ed (O/sup 2-/) of the salt. The basicity was controlled by varying the rhoCO/sub 2/ in the gas phase above the melt. Acidic and basic dissolution were observed in all salts except Li/sub 2/CO/sub 3/, which underwent only basic dissolution. The slopes of the solubility lines in both acid and basic regime were related to the dissolution products where possible. The dependence of NiO solubility on the activity of O/sub 2/ in the system was determined for both regimes of all the melts. | Abstract In the present work temperature dependencies of neodymium solubility in Ba-Cu-O fluxes of different compositions were investigated under the ambient air condition. Small amounts of samples were taken from thermally equilibrated melts in MgO crucibles at 1000–1065°C and the compositions were analyzed by the inductively coupled plasma spectroscopy (ICP) technique. The obtained data were compatible with DTA measurements and results of quenching experiments. The maximum solubility of neodymium in the liquid of about 7 at% achieves in the ‘Nd 2 CuO 4 -L’ field at the highest investigated temperature (1065°C) and for the copper-richest fluxes (Cu:Ba = 6:1). The dissolution enthalpy of the Nd 2 CuO 4 phase in this flux was estimated experimentally to be 115 kJ/mol. Based on the experimental solubility data, single crystals of the Nd 1 + x Ba 2 − x Cu 3 O z solid solution (x = 0.43 − 0.85) with non-metallic resistivity behaviour after oxygen annealing were grown by the TSSG method. | Thermodynamic Assessment of the Na-Cu and Na-K Binary Systems | A pressure-volume isotherm in cerium metal at 1100 K was measured in a large volume press of the Paris-Edinburgh type up to 6 GPa. The volume was determined by imaging a rectangular shape of the sample via white X-ray radiography. Energy dispersive x-ray diffraction spectra were recorded to ensure that the highly reactive cerium in the cell assembly remained pure at this temperature. Even at 1100 K the p-V equation of state of liquid cerium shows a pronounced decrease of the bulk modulus above the y-phase region similar to the 775 K isotherm in the solid that also shows an inflection point between y- and a-type cerium. The inflection point in the 1100 K isotherm indicating the minimum in the bulk modulus separating the γ- from the α-type liquid is located at approximately 3.5 GPa. | 1,999,870 | Reactions between cerium trichloride and oxide ions were studied in NaCl+KCl (1/1) at 1000°K, by potentiometry with a calcia-stabilized zirconia membrane electrode. Titration curves clearly demonstrated the existence of soluble cerium oxychloride (CeO+) and precipitated cerium oxide (Ce2O3), with respective dissociation constants 10−11 and 10−30 (molality scale). The corresponding conditional solubility diagram {log S (CeIII)=f(pO2−)} is presented and discussed. | This work presented the electrochemical study of cerium(III) on the insert electrode (Mo) in NaCl–KCl molten salt in the temperature range 954–1,007 K. The electrochemical methods such as cyclic voltammetry and square wave voltammetry were used for investigating the reduction of Ce(III). The results obtained showed that CeCl3 could be reduced into cerium metal in a quasi-reversible one-step process exchanging three electrons (Ce(III)+3e → Ce(0)) at the operating temperatures on a molybdenum cathode. The diffusion coefficients of Ce(III) ions at different temperatures were determined by cyclic voltammetry. The validity of the Arrhenius law was also verified and the activation energy for diffusion was found to be 46.0 kJ mol−1. The apparent standard potentials of the redox couple (Ce(III)/Ce(0)) at several temperatures was calculated. The thermodynamic properties of cerium trichloride have also been investigated. | Oxidation of cerium(III) to cerium(IV) using a mixture of hot concentrated perchloric and sulfuric acids | Here we report radiation-induced formation of Ce(III) nanostructures in an in situ liquid cell for the transmission electron microscope (TEM). Small (<5 nm) irregular Ce(OH) 3 nanoparticles were identified as the final products from cerium(III) nitrate solutions of initial pH 5.2. Pourbaix diagrams show that solid Ce(OH) 3 can only exist above pH 10.4, whereas at lower pH values, Ce(III) should remain soluble as aqueous Ce 3+ . Reduction of Ce 3+ to zerovalent Ce by aqueous electrons followed by hydrolysis is a plausible catalytic mechanism for generating hydroxide. Numerical simulations support that radiolysis of cerium nitrate solutions may lead to pH increases, in contrast to well-known acidification of pure water. Compared to previous radiolytic synthesis routes in aqueous solution for other metal or metal oxide nanoparticles, based on metal ion reduction, for example, the chemical pathways leading to these Ce(III) nanostructures require an increase in the local pH to alkaline conditions where Ce(OH) 3 can exist.These results extend the range of chemical conditions that can be induced by radiolysis to form oxidized nanostructures from solution. † Electronic supplementary information (ESI) available: Experimental methods, EELS scans used for estimating the thickness of liquid during experiments, the structural characterization of the oxide nanostructures by HRSTEM and HRTEM, calculation of the solubility of oxygen in water, equilibrium constants and thermodynamic calculations for constructing the Pourbaix diagram matching our experimental conditions, rate constants and results of modelling of the radiation-induced changes in solution chemistry including pH evolution in pure DI water and for an aqueous solution containing Ce-species, other chemical pathways involving the possible effect of nitrate ions, ESI Movies S1 and S2. See | Synergistic Effect of Triethyl Phosphate and Cerium( IV) Ion on Corrosion Inhibition for copper in Hydrochloric Acid Solution | Investigation of peroxyhydrates and hydrates of rubidium and cesium carbonates: Communication 3. Physicochemical study of the ternary system Cs2CO3-H2O2-H2O | Synthesis of Ultra Fine CeO_2 by Calcining Hydrated Cerium Carbonate with NH4Cl as Additive | how many sodium ions are in sodium oxide | Calcium carbonate (CaCO3) was crystallized in xanthan (XC) aqueous solutions. The CaCO3 particles were characterized by scanning electron microscopy (SEM), powder X-ray diffraction (XRD), Fourier transform infrared (FTIR) spectroscopy and thermogravimetry analysis (TGA) methods. The concentrations of XC, Ca2+ and CO32− ions and the ratios [Ca2+]/[CO32−] and [Mg2+]/[Ca2+] show evident influence on the aggregation and growth of CaCO3 particles. The presence of Mg2+ ions influences not only the morphology, but also the polymorph of CaCO3. |
1,999,871 | Is Dirt Rally compatible with a cheap headset ? | I have tritton kamas and I'm thinking about buying a Scuf sand was wondering if the headset adapter that comes with it would work with the Scuf.
Edit:Spelling | Didn't work with my headset. I think in addition to the physical size of the connectors, you need to pay attention to the number of conductors | I bought this item for the 3.5mm jack due to the computer not able to run sound thru usb and 3.5mm at the same time. Im running a buttkicker that uses 3.5mm and my old headset uses usb. Item works and sounds good. Cant beat the price. | Hi, Is the Kraken 2019 headset the same of the Kraken tournament edition? If no, which one of the 2 is the best one to pick? | Works like a charm with my Cisco IP Phone 7962. I use old Apple headphones but my assumption is any pair would work. | Does not feel like a cheap product at all. Works great with my single jack Skullcandy Hesh 2 headphones. Now I can use the Mic and speaker for Discord and Skype when I game. | Does anyone know if I can get beats studios wireless headphones at a sprint store as an accessory? | This is a pretty good noise reducing headset for the money. I imagine you can do better for a few hundred dollars, but it does what I want -- reduces jet engine noise enough so I can listen to my detective stories. | 1,999,871 | Hiya fellas, i'm hesitating to buy a low-cost vr headset (around 50 bucks) and I'm wondering : is Dirt Rally on PC only compatible with the oculus rift / HTC vive, or will any cheap headgear do the trick ?
Thanks a lot ! :) | DiRT Rally (Steam) and Oculus Rift CV1 | VR Possible on Dirt Rally 2 (windows) gamepass version? | What VR Headset (With Headtracking) can I use until the Oculus Rift is eventually released? | Dirty Rally VR help please | VR PC for sim racing and gaming | Is Valve developing the next Generation VR headset with help of eMagin and AMD ? | is there any way I could play beatsaber without a vr headset? | Steam VR Where are the other vendors creating Vr headsets (why is it still just HTC vive only) |
1,999,872 | Google home not detecting my vizio TV | I can't seem to get my YouTube tv to play via Google home. I can stream to YouTube and once YouTube tv is playing I can control the tv with Google home, but every time I try and say ok Google watch ESPN on YouTube tv she says I looked for change on YouTube tv but it either isn't available or can't be played right now. Has anyone else ever had this issue? I can't seem to find anything about it on Google | I just bought a google home mini with the hopes of being able to use it to operate my tv to start before I delve into more home automation. But I cant seem to get it to work despite that they were connected. I have Sony Bravia from 2015 and I downloaded Chromecast from the Google Play App Store on there but my home mini still wont control it. Any help? Suggestions? Anything would be much appreciated | I love my Google home setup! I am a die-hard Google fan with all different Google Homes throughout my house, an Ultra Chromecast for the TV, Google WiFi mesh routers throughout the house, both my wife and I have Google Pixel 2 XL for phones and are through Google Fi (but were there for Project Fi). All that being said I have noticed my Google Homes not following through on commands lately. They worked perfectly for the longest time but just recently (last few months) they've been buggy. I'll ask it to play a playlist and Google responds with the right command but then doesn't play anything... Or Google will not show all my homes when I want to cast something.
What's going on? I thought maybe it was a small glitch and it would be fixed with a small update but it seems to be happening more and more frequently. Like I said, I love my Google setup but I've been coming across more and more bugs lately. Anyone else? | We have Google Home set up using my Google account and would like to access YouTube TV to it, but YouTube TV is set up using my wife's Google account. Is there a workaround for this? | As of two weeks, my usual GA command for my Sonos One to play music on my Google Home does not work anymore. Setup: Sonos One in bathroom, Google Home Mini in living room.
When I say to Sonos One: 'Okay Google, play \[radio station\] on Google Home', GA responds with that it is not possible to play this on a device without display. When I state the same instruction to my Google Home directly, it works as expected.
Others experiencing the same type of problem? Know any resolutions? | My TV is fairly new and has Google tv built in.
Having Google home turn it off has always worked fine until recently.
Now, when telling it to turn off my tv, it says "I couldn’t turn off your tv. Please consult with your tv manual or manufacturer on whether this is supported.”
If i tell it to do it again, it normally does it.
It's annoying to have to tell it once, wait for it to complain, and then tell it again. How can I fix it? | Hi, so I've recently bought myself Xiaomi Bedside Lamp 2 and can't connect it to the Google Home. Yesterday I finally managed to do it via Xiaomi Home (not the Yeelight though as this one was not working at all in my case). Today, the lamp disconnected and i got the error that this lamp is not available right now. So I disconnected the app from Google Home and well now I cannot even find it on the list of the services like ther would not be an app like Mi Home. What can i do to make it work? | Long story short I have a good deal of Google Homes around the house and two TVs. As of a few days ago both TVs were controlled by Chromecasts and I had no issue with the Google Homes controlling those TVs and understanding the "default TV" option.
Yesterday I replaced my main TV with a Hisense H8F which runs Android TV. I have Casting turned on but now all my Google Homes no matter which default TV i have set in the settings will always try and do said action to the Android TV.
Example: Bedroom Google Home default TV is set to Bedroom TV. If I ask " turn on the TV" it responses with "turning on Living Room TV" which is the Hisense H8F. It doesn't matter which Google Home i'm using, they all do it. For good measure I did reset one of the Google Homes and the Chromecast.
Any ideas or has anyone else see this?
EDIT: I found a few small posts on the Google forums with users with the same issue. It started back in April. I created mine own hopefully to pull together all the info and get more visibility. Please upvote it here | 1,999,872 | I have my phone, GH, and vizio TV all on the same wifi. When I try and add my TV to go my google home, it keeps searching, but nothing comes up on the list.
TV is Vizio® M60-C3 60-in. Smart 4K Ultra HD LED TV
Tried my wifi on 2.4 and 5ghz, nothing seems to get it to detect the TV. Any ideas? | how to wirelessly connect iphone to lg smart tv? | Just bought a shield tv. Need help with initial set up on hotel WiFi. | Google launches TV search service | Setting up Google Wifi with Google Fiber | Google Home not obeying default TV with Android TV present | what kind of connectivity does google wifi have | Need local tv and Google play store.. only option is android tv? | how to connect my roku tv to wifi? |
1,999,873 | The Bulk-Synchronous Parallel Model |
Introduction
Parallel computing is simultaneous use of multiple computing resources to solve a computing problem in a reduced computation time. Such parallel computing is the best way to increase the computation speed and reduce run time of a program. Its application is rapidly increasing in the field of scientific and engineering computations (Chan et al. 2005;Polychronopoulos 1988;Wilkinson, Allen 2005). The approach surprisingly makes the calculations and simulations time efficient based on multi-core processors in addition to clusters. All major applications in different fields of science and technology are employing parallel computing for high speed computations and getting results in lesser time. Most desktop and laptop systems now ship with dual-core microprocessors or quad-core processors, which are best suited for parallel computing. Parallel programming is different from sequential computing, in which a problem/program is divided into a number of small instructions or tasks called threads, which are executed in the processor one by one.
To make many processors simultaneously work on a single program, the program must be divided into smaller independent chunks so that each processor can work on separate chunks of the problem (Wilkinson, Allen 2005). Distributed Memory Processors (DMP) is the computer hardware architecture, which is used in the research. DSM systems require a communication network to connect interprocessor memory (ordinary computers). To parallelize programs on DMP, the Message Passing Interface (MPI) compilers directives have to be used. In this case first find or create concurrency in the program and then by using MPI commands send concurrent parts of the program from the master computer to different computers; different computers perform operations on it and send back the results to the master computer, which is arranged and written by master computer (Polychronopoulos 1988).
The specialty of this research is that the master computer acts as a worker during the computation time and then it also collects the results from the worker, arranges the data and at the end displays the results. Parallel computing techniques (Fig. 1) have been implemented to parallelize a program for the response of the single degree of freedom structure against typical earthquake force. The program aimed at finding a response of the SDOF structures is created concurrently in the program by dividing the program into two parts, finding forced response and free response of the first half and the other part. Each part is executed on a different computer; and as SDOF Structure is linear and homogeneous, results can be added. In this way, the program for finding a response of the SDOF structure is parallelized. Time reduction in parallel programs can be seen over sequential programs in the presented results. Using multiple computing devices successfully created the concurrency, found the response of structure against earthquake force in lesser time than that of in case of sequential programs.
Parallel computing in earthquake engineering
Starting in the late 80's, clusters came to compete and eventually displace the concept of supercomputers for many applications. A cluster is a type of parallel computer built from large numbers of off-the-shelf computers connected by an off-the-shelf network. Today, clusters are the workhorse of scientific computing and are the dominant architecture in the data centres that power the modern information age (MPICH2 2006). Parallel and distributed computations can be efficaciously implemented in structural mechanics (Bittnar et al. 2001).
Frequent earthquakes that occur all over the world cause gigantic threat on structures Jameel et al. 2012a). Structural responses substantially vary with the occurrence of ground excitation induced from severe earthquake Jameel et al. 2012b). Therefore, the computation of seismic responses of structures is of utmost important (Islam et al. 2013;Lin et al. 2011). Ólafsson, Sigbjörnsson (2011) presented digital filters for simulation of seismic ground motion and structural response. Uma et al. (2010) developed probabilistic framework for performance-based seismic assessment of structures considering residual deformations. The equivalent force control method for real-time testing of nonlinear structures has been proposed by Wu et al. (2011) and Stochastic Modeling by Yazdani, Abdi (2011). Goda et al. (2009) studied probabilistic characteristics of seismic ductility demand of SDOF systems with Bouc-Wen hysteretic behaviour. Grand challenges are the computational problems, which can't run on one computer because of memory restraint or problems that take too much time to execute on a single computer, such as applied fluid dynamics, macro-scale environmental modelling, ecosystem simulations, weather forecast, biomedical imaging and biomechanics, earth quake & plate tectonics, molecular design and process optimization, nuclear power and weapons simulations, and strong artificial intelligence (Janies, Wheeler 2001;Čiegis et al. 2006). For such computations, parallel computing is readily used by, for example, the Earth Simulator Center (Bruck et al. 1997).
Parallel computing is used in the field of earthquake engineering as well (Zhong et al. 2003). It is worth mentioning that the computer aided analysis of complex structural model poses economic solution in time cost in advanced structural mechanics (Jameel et al. 2012c, d;Šliseris, Rocēns 2010;Vaidogas, Šakėnaitė 2011). Stability and ductility of structures are vital issues to be analysed in an accurate fashion with the rapid solution approach (Kvedaras 2010;Rasiulis, Gurkšnys 2010). Parallel computing is a competent tool used in optimization of earthquake response, selection of equivalent earthquake wave and optimization of damaged response index. This solution technique is used in getting the response of structure, which is rather difficult and is still in under progress (Gropp et al. 2007).
In the present study, parallel computing has been used to get the response of the simplest structure, i.e. the single degree of freedom structure against earthquake force. For the program of finding response of the SDOF structures concurrency in the program is created by dividing the program into two parts finding the forced response and the free response of the first half and the other part. Each part is executed on a different computer. As the SDOF Structure is linear and homogeneous, results can be added. In this approach, the program used for obtaining the responses of the SDOF structure is parallelized.
Parallel computing provides an effective utilization of multi-core processors as well as old computers, so its usage is becoming a more popular computational technique at present (Hossain et al. 2002). Chip manufacturers have begun to increase overall processing performance by adding additional CPU cores. The reason is that increasing performance through parallel processing can be far more energy-efficient than increasing microprocessor clock frequencies. In the world, which is increasingly more mobile and energy conscious, this has become essential (Quinn 2004).
Fig. 2. Schematic representation of Distributed Memory Computers
Technique of parallel computing
To execute programs in parallel, there are certain requirements, such as parallel computers/processors, an operating system (Linux preferred), a high level programming language, such as C or Fortran, the parallel application programming interface (MPI), and above all -a parallel algorithm. The author had used two computers connected by a high speed network, i.e. ether net, with LINUX 9 on each computer, programming language used was Fortran 77 with the latest MPICH version, in which one computer acted like the Master computer and the other one was a worker. It is to mention here that the Master computer also worked as a worker after distribution of the tasks to workers and then it also got the results from the Worker and displayed them after organization (Strout et al. 2006;MPI 1997).
MPI is parallel application programming interface (API), it is the sets of routines, data structures, object classes and/or protocols provided by libraries in order to support building of a parallel application. To make many processors simultaneously work on a single program, the program was divided into smaller independent chunks so that each processor could work on separate chunks of the problem. This is the foremost theme of parallel programming (MPI 1997). This way decomposed program is a parallel program and then it can be run on parallel architecture computers.
Parallel computing techniques depend on the computer hardware architecture, nature of the program and the number of available computers/processors (Kurc, Ozmen 2008). In this research, the main emphasis of parallel computing techniques is the distributed memory architecture (Fig. 2). There are several ways to develop such architectures like making clusters, or by installing different programs on multiple computers, which supports parallel programming. It is also within the scope of the study to create a parallel computing system from old ordinary computer with the help of the Local Area Network (LAN). A computer cluster is a group of linked computers, working together closely, so that in many respects they form a single computer. The components of a cluster are commonly, but not always, connected to each other through fast local area networks. These are usually used for a computational purpose.
Another very important trait of such computers is that these computers sustain their Identities. So, those computers are ordinary computers most of the time and when anyone wants to run any parallel application, those computers act as a single computer at that time. The idea of parallelization using the MPI is that we divide the problem into independent parts and data, which is required to operate that part independently, then it is shared and communicated with the help of MPI subroutines to different computers. So, the computers operate on different parts of a program independently and send back the results to the master computer, which assembles and displays the results (Pacheco 1998).
The main part of parallel computing is to exploit or to create the concurrency in the program, share it to the other computers/processors using the parallel application programming interface (API), such as the MPI, so that other computers can act upon the data (Peterson, Arbenz 2004). Some programs have inherent concurrency, which is easy to parallelize like some loops having different variables to operate upon; while, in some programs we can create concurrency, such as matrix operations; but some programs cannot be parallelized, such as the program to find Fibonacci series (Wittwer 2006 In this code, MPI subroutines will initiate the parallel environment, get the size (Numbers) of parallel computers, assign the numbers to parallel computers starting from 0 for masters and size -1 to workers and then terminates the parallel environment respectively. The Master computer then displays the print statement, which is in case of two computers in a parallel cluster (Kurc, Will 2006):
Hello world from process 0 of 2 Hello world from process 1 of 2 Following next are important points, which have been followed to develop the parallel algorithm for parallel programming:
1) Design, implementation, and tuning of the parallel algorithm should be such that it takes full advantage of parallel computing systems; 2) Partitioning the overall problem into separate tasks and allocating tasks to processors should uphold all computers busy equally; 3) The parallel algorithm can apply to the problems that are inherently parallelizable, mostly without data dependence; 4) Communication time should be as small as possible; 5) Communication always implies overhead, so try to reduce the communication by creating course granular partition of data; 6) All tasks should be kept busy, data should be evenly distributed; 7) Primary inhibitors to parallelism are loops, which usually the most common target of parallelization effort, so the first loop dependency should be analysed and then tried to parallelize that, if possible; 8) If work involves much I/O it is not suitable for parallelizing because I/O operations take nearly 10X more time than any operation; 9) Input and output should be displays only on master computer, i.e. computer, which has ID 0.
Parallelization of the SDOF program
The program has successfully been parallelized for response of the SDOF structure against earthquake. The numerical method, which the author used to calculate response of the SDOF structure is the Runge-Kutta Method. The Runge-Kutta Method is the initial value problem and it doesn't have any inherent parallelism. But due to the linear property of the SDOF structure, we can induce parallelism in the program. The main idea to parallelize such program is that we can find the free response as well as the forced response of the SDOF structure separately and then according to the principle of the super position we can add them up.
To make this parallel computing technique more general, effective and applicable to most programs, the author tried to parallelize the program using subroutines. As mostly programming for structural analysis and responses developed using different subroutines. We use several subroutines in a complicated problem and in the main program we just call these subroutines. The author found the technique to effectively call the same subroutine in the parallel program from different computers. We can apply the same method to parallelize a similar program.
These are the steps, which should be followed in making a parallel program for the response of the SDOF structure:
1) Split the input ground acceleration history into two equal parts as the author wanted to run that parallel program on two computers; 2) Input data is divided in such a way that we have some free response of the first part exactly after half of the computations, which can be added to forced response of the second computer to get the exact result. Normally, this extra computation for the free response in the first half is kept at 200 units; 3) Separate the computations from the subroutines, which required executing only once; 4) Send the subroutine parameters from computer 1 to computers 2; 5) Call the subroutine in the main program simultaneously from both computers; 6) Watch the processor history so that we can observe that both computers are busy in computations; 7) Format the calculations in such a way that we have acceleration, velocity and displacement responses easily in the form of graphs; 8) Compare results with that of the single computer calculations.
Framework for the parallel program
The author successfully ran the parallel program for the structure having typical values of damping, natural circular frequency, and input of the sine wave. The calculations from Computer 1 and Computer 2 from the same parallel program is obtained and shown in Figures 3 and 4, respectively. Then these results added to get the complete response of the SDOF structure, which is also shown in Figure 5. The response, which is received by parallel computing is then compared with the results from the equivalent sequential program, which is shown in Figure 6, and the difference between the results from the parallel program and the equivalent sequential program is shown in Figure 7. The difference between the results from the parallel program and the equivalent sequential program is negligible, which can be observed easily. The schematic representation of the parallel program for the response of the SDOF has been displayed in Figure 8.
This was one way to parallelize the program for the response of the SDOF structure by dividing all the computations into half, which is executed of different computer and later joined the results. There is another method of parallel programming, in which we divide the calculations. For example, a loop first calculates the sum of both variables in it and then calculates the square of resultants. Suppose we are able to calculate the sum on one computer and then square it on the other computer. This is another way to parallelize the problem but it is very difficult. First of all, such computations are highly dependent, which is very difficult to parallelize; secondly in such parallelization, one computer may have little computational effort compared to the other, so effective parallelism can be very difficult to achieve.
Results and discussions
The program for the response of the SDOF structure ran on two computers in parallel and reduced the run time of the program. Another important point in this research is that the Master computer also worked as a worker. Actually, in most of the parallel programs, the main computer acts as the Master computer and only distributes the data to be parallelized and then waits for the results, but in this research, the main computer distributes the data and then works on its part of data, then receives results and displays them. So, if we have small number of computers in the parallel computer cluster then the Master computer can also work as worker.
Moreover, the parallel computing technique used in this research was also very convenient and workable. In the program of finding response of the SDOF structures, concurrency in the program has been created by dividing the program into two parts finding the forced response and the free response of the first half and the other part. Schematic representation of the parallel computing technique is shown in Figures 3 and 4. Each part is executed on a different computer and as the SDOF structure is linear and homogeneous, the results can be added. In this way, the program for finding the response of the SDOF structure is parallelized. Time reduction in parallel programs is observed over sequential programs in the obtained results.
The use of processors of both computers has been checked during the runtime and processors use of both computers showed 100% use of processors by the program. The runtime is compared for the parallel program with similar sequential programs for the response of the SDOF structure. And the runtime of the parallel program reduced to nearly 2/3 of that of the sequential program. The reasons for this reduction of the runtime instead of making it half then that of the sequential program are: the coarseness or finesse of the parallel data, communication time between the parallel computers and computational efforts. There can be little drawbacks of the parallel computing like; latency in the network communications, steep learning curve, some programs have no concurrency like Fibonacci series, fineness in concurrent data. It is mostly useless to parallelize the program with high fineness.
The courser the data will be, the more reduces the runtime of the program will be. And if the data division is fine then the runtime of the program will be less reduced. Course data means that a large amount of data can send in single communication; and fine data means a small amount of parallel data send to other parallel computer. The 2 nd factor, which affects the results, is the communication time between the parallel computers. Data communicates between the computers via the Local Area Networks (LAN). The maximum communication speed is determined by the Switch we are using in the parallel computing. So we can have a 100 MB or 1 GB switch but even those have very small speed as compared to processor speed available nowadays. Generally, the data communication takes nearly 10 times more delay than that of processing. If data is needed to be sent to different computers in the cluster many times, then the runtime will also be affected. So, if we have to send small amounts of data many times in a parallel program, then such parallel program can take more time to show the results compared to sequential programming.
Computational effort is also made nearly equal in this research. So, the efforts have made course data parallel program, minimum communication between the data (only for distribution of the data and receiving the results) and nearly equal computational efforts. For comparison of a parallel and a sequential program, the computations should be reasonable, because for small computational efforts programs, the run time of parallel as well as sequential programs are nearly equal even in some cases the runtime of a parallel program can be more than that of a sequential program because of data communication between computers.
The study uses a reasonable amount of earthquake input data so that they can easily compare the results from the sequential as well as the parallel program. So, to make appropriate computational efforts, the author enlarged the data to be processed by the processors. The author introduced large computations of about 200,000 iterations of the loop. This then ran on parallel computers as well as equivalent sequential program, which also ran on a single computer.
The results from Computer 1 and Computer 2 were presented in Figures 5 and 6, respectively; and the sum of these two results is presented in Figure 7. Then, it is compared with the results from the sequential program shown in Figure 8. Those results are compared. The difference of calculations between the parallel as well as the sequential programming is very small and can be easily neglect as it is in the range of exponent -6 to exponent -9, as shown in Figure 9. Runtime comparison is shown in Figure 10. Time reduction in parallel programs can be seen over sequential programs in the presented results.
Conclusion
Parallel computing is the technology of the future; we can convert our computations from sequential computing to parallel computing for time efficiency of the program. As modern computing systems are multi-core computer systems, to fully utilize all the processors of modern computers we will have to use parallel programming and parallel computing. Moreover, parallel computing requires using multiple ordinary computers as a super computer.
Runtime of these parallel programs has been compared with equivalent sequential programs. But one important thing is that reduction of time by parallel computing is dominant in case of large computational efforts. For example, the run time for the parallel program for response of the SDOF structure is equal to equivalent sequential program, which is negligible in both cases. But when a large data is to be processed by the same parallel program and equivalent sequential program, then runtime for the parallel program is nearly 2/3 than that of the sequential program.
The cheapest way of parallel computing is by using Distributed Memory Processors like a multiple computer as in my case where a parallel computer and then using the MPI libraries on Linux OS. Because it consists of cheap computers connected together and all software is available either absolutely free or at a low cost. It is fruitful to parallelize those programs having large computational efforts. As you can see, for ordinary programs or programs with little computational efforts, it takes equal time in sequential as well as in parallel programs. To make a program parallel, problem should have inherent concurrency. Some problems, which do not have concurrency cannot be parallelized like the program used to calculate Fibonacci series.
Fig. 1 .
1Schematic representation of Parallel Computing
Fig. 3 .
3Parallel framework for response of SDOF structure Fig. 4. Schematic representation of Parallel Program for response of SDOF structure
Fig. 5 .Fig. 6 .Fig. 7 .
567Response of SDOF Structure from Computer 1 Response of SDOF Structure from Computer 2 Response of SDOF Structure from Parallel Program Fig. 8. Response of SDOF Structure from Sequential Program
Fig. 9 .
9Difference of results from Parallel Program & Sequential Program Fig. 10. Runtime comparison of sequential and parallel program
Parallel and distributed computations for structural mechanics: a review. Z Bittnar, J Kruis, J Němeček, B Patzák, D Rypl, 10.4203/csets.5.9Topping, B. H. V.Saxe-Coburg PublicationsStirlingshire, UK, ChapterCivil and Structural Engineering ComputingBittnar, Z.; Kruis, J.; Němeček, J.; Patzák, B.; Rypl, D. 2001. Parallel and distributed computations for structural me- chanics: a review, in Topping, B. H. V. (Ed.). Civil and Structural Engineering Computing: 2001. Saxe-Coburg Publications, Stirlingshire, UK, Chapter 9, 211-233. http://dx.doi.org/10.4203/csets.5.9
Efficient Message Passing Interface (MPI) for parallel computing on clusters of workstations. J Bruck, D Dolev, C.-T Ho, M.-C Roşu, R Strong, 10.1006/jpdc.1996.1267Journal of Parallel and Distributed Computing. 401Bruck, J.; Dolev, D.; Ho, C.-T.; Roşu, M.-C.; Strong, R. 1997. Efficient Message Passing Interface (MPI) for parallel computing on clusters of workstations, Journal of Parallel and Distributed Computing 40(1): 19-34. http://dx.doi.org/10.1006/jpdc.1996.1267
User's Guide for MPI Programs. A Chan, W Gropp, E Lusk, 34University of Chicago, Illinois: Aragon national laboratoryChan, A.; Gropp, W.; Lusk, E. 2005. User's Guide for MPI Programs. University of Chicago, Illinois: Aragon nation- al laboratory. 34 p.
Parallel global optimization of foundation schemes in civil engineering. R Čiegis, M Baravykaitė, R Belevičius, 10.1007/11558958_36Applied Parallel Computing. State of the Art in Scientific Computing. 3732Čiegis, R.; Baravykaitė, M.; Belevičius, R. 2006. Parallel global optimization of foundation schemes in civil engineering, Applied Parallel Computing. State of the Art in Scientific Computing 3732: 305-312. http://dx.doi.org/10.1007/11558958_36
Probabilistic characteristics of seismic ductility demand of SDOF systems with Bouc-Wen hysteretic behavior. K Goda, H P Hong, C S Lee, 10.1080/13632460802645098Journal of Earthquake Engineering. 135Goda, K.; Hong, H. P.; Lee, C. S. 2009. Probabilistic characte- ristics of seismic ductility demand of SDOF systems with Bouc-Wen hysteretic behavior, Journal of Earthquake Engineering 13(5): 600-622. http://dx.doi.org/10.1080/13632460802645098
. W Gropp, E Lusk, D Ashton, D Buntinas, R Butler, A Chan, R Ross, R Thakur, B Toonen, Gropp, W.; Lusk, E.; Ashton, D.; Buntinas, D.; Butler, R.; Chan, A.; Ross, R.; Thakur, R.; Toonen, B. 2007.
User's Guide Manual. Mpich2, 44University of Chicago, Illinois: Aragon national laboratoryMPICH2. User's Guide Manual. University of Chicago, Illinois: Aragon national laboratory. 44 p.
Impact of data dependencies in real-time high performance computing. M A Hossain, U Kabir, M O Tokhi, 10.1016/S0141-9331(02Microprocessors and Microsystems. 266Hossain, M. A.; Kabir, U.; Tokhi, M. O. 2002. Impact of data dependencies in real-time high performance computing, Microprocessors and Microsystems 26(6): 253-261. http://dx.doi.org/10.1016/S0141-9331(02)00027-3
Nonlinear dynamically automated excursions for rubber-steel bearing isolation in multi-storey construction, Automation in Construction. A B M S Islam, R R Hussain, M Z Jumaat, M A Rahman, 10.1016/j.autcon.2012.11.01030Islam, A. B. M. S.; Hussain, R. R.; Jumaat, M. Z.; Rahman, M. A. 2013. Nonlinear dynamically automated excursions for rubber-steel bearing isolation in multi-storey construction, Automation in Construction 30: 265-275. http://dx.doi.org/10.1016/j.autcon.2012.11.010
Incorporation of rubber-steel bearing isolation in multi-storey building. A B M S Islam, M Z Jumaat, R R Hussain, M A Alam, 10.3846/13923730.2013.801904Journal of Civil Engineering and Management. 19Supplement 1Islam, A. B. M. S.; Jumaat, M. Z.; Hussain, R. R.; Alam, M. A. 2012a. Incorporation of rubber-steel bearing isolation in multi-storey building, Journal of Civil Engineering and Management 19(Supplement 1): S33-S49. http://dx.doi.org/10.3846/13923730.2013.801904
Non-linear time domain analysis of base isolated multi-storey building under site specific bi-directional seismic loading. A B M S Islam, R R Hussain, M Jameel, M Z Jumaat, 10.1016/j.autcon.2011.11.017Automation in Construction. 22Islam, A. B. M. S.; Hussain, R. R.; Jameel, M.; Jumaat, M. Z. 2012b. Non-linear time domain analysis of base isolated multi-storey building under site specific bi-directional seismic loading, Automation in Construction 22: 554-566. http://dx.doi.org/10.1016/j.autcon.2011.11.017
Efficient design in building construction with rubber bearing in medium risk seismicity: case study & assessment. A B M S Islam, S I Ahmad, M Z Jumaat, R R Hussain, Journal of Civil Engineering and Management. in PressIslam, A. B. M. S.; Ahmad, S. I.; Jumaat, M. Z.; Hussain, R. R. 2012c. Efficient design in building construction with rubber bearing in medium risk seismicity: case study & assessment, Journal of Civil Engineering and Manage- ment (in Press).
. 10.3846/13923730.2013.801910http://dx.doi.org/10.3846/13923730.2013.801910
Efficient three dimensional modeling of high-rise building structures. M Jameel, A B M S Islam, M Khaleel, A Amirahmad, 10.3846/13923730.2013.799096Journal of Civil Engineering and Management. 196Jameel, M.; Islam, A. B. M. S.; Khaleel, M.; Amirahmad, A. 2012a. Efficient three dimensional modeling of high-rise building structures, Journal of Civil Engineering and Ma- nagement 19(6): 811-822. http://dx.doi.org/10.3846/13923730.2013.799096
Optimum structural modelling for tall buildings. M Jameel, A B M S Islam, R R Hussain, M Khaleel, M M Zaheer, 10.1002/tal.1004The Structural Design of Tall and Special Buildings. 2215Jameel, M.; Islam, A. B. M. S.; Hussain, R. R.; Khaleel, M.; Zaheer, M. M. 2012b. Optimum structural modelling for tall buildings, The Structural Design of Tall and Special Buildings 22(15): 1173-1185. http://dx.doi.org/10.1002/tal.1004
Nonlinear finite element analysis of spar platform. M Jameel, A B M S Islam, M Khaleel, M Z Jumaat, 10.1166/asl.2012.3851Advanced Science Letters. 13Jameel, M.; Islam, A. B. M. S.; Khaleel, M.; Jumaat, M. Z. 2012c. Nonlinear finite element analysis of spar platform, Advanced Science Letters 13: 723-726. http://dx.doi.org/10.1166/asl.2012.3851
Nonlinear dynamic analysis of coupled spar platform. M Jameel, S Ahmad, A B M S Islam, M Z Jumaat, 10.3846/13923730.2013.768546Journal of Civil Engineering and Management. 194Jameel, M.; Ahmad, S.; Islam, A. B. M. S.; Jumaat, M. Z. 2012d. Nonlinear dynamic analysis of coupled spar plat- form, Journal of Civil Engineering and Management 19(4): 476-491. http://dx.doi.org/10.3846/13923730.2013.768546
Efficiency of parallel direct optimization. D A Janies, W C Wheeler, 10.1111/j.1096-0031.2001.tb00106.xCladistics. 171Janies, D. A.; Wheeler, W. C. 2001. Efficiency of parallel direct optimization, Cladistics 17(1): S71-S82. http://dx.doi.org/10.1111/j.1096-0031.2001.tb00106.x
An efficient parallel solution framework for the linear analysis of large structures on PC Clusters. O Kurc, S Ozmen, Tsinghua Science and Technology. 13SIKurc, O.; Ozmen, S. 2008. An efficient parallel solution framework for the linear analysis of large structures on PC Clusters, Tsinghua Science and Technology 13(SI): 65-70.
Stability and ductility of structures: editorial. A K Kvedaras, 10.3846/jcem.2010.15Journal of Civil Engineering and Management. 162Kvedaras, A. K. 2010. Stability and ductility of structures: editorial, Journal of Civil Engineering and Management 16(2): 155-158. http://dx.doi.org/10.3846/jcem.2010.15
Structure development and performance evaluation of construction knowledge management system. L Lin, C Chang, Y Lin, 10.3846/13923730.2011.576833MPIJournal of Civil Engineering and Management. 172University of Tennessee, KnoxvilleA message passing interface standard from message passing interface forumLin, L.-k.; Chang, C.-c.; Lin, Y.-c. 2011. Structure development and performance evaluation of construction knowledge management system, Journal of Civil Engineering and Management 17(2): 184-196. http://dx.doi.org/10.3846/13923730.2011.576833 MPI 1997. A message passing interface standard from message passing interface forum. University of Tennessee, Knox- ville, Tennessee. 245 p.
MPICH2 Installation and Configuration Guide. MPICH2 Installation and Configuration Guide 2006.
Digital filters for simulation of seismic ground motion and structural response. S Ólafsson, R Sigbjörnsson, 10.1080/13632469.2011.565862Journal of Earthquake Engineering. 158Ólafsson, S.; Sigbjörnsson, R. 2011. Digital filters for simula- tion of seismic ground motion and structural response, Journal of Earthquake Engineering 15(8): 1212-1237. http://dx.doi.org/10.1080/13632469.2011.565862
A user's guide to MPI. P S Pacheco, 51San FranciscoPacheco, P. S. 1998. A user's guide to MPI. San Francisco. 51 p.
Introduction to parallel computing -a practical guide with examples in C. W P Peterson, P Arbenz, Oxford University Press288New YorkPeterson, W. P.; Arbenz, P. 2004. Introduction to parallel com- puting -a practical guide with examples in C. New York: Oxford University Press. 288 p.
Advanced loop optimizations for parallel computers, supercomputing. Lecture Notes in Computer Science. C Polychronopoulos, SpringerBerlin/HeidelbergPolychronopoulos, C. 1988. Advanced loop optimizations for parallel computers, supercomputing. Lecture Notes in Computer Science. Springer Berlin/Heidelberg, 255-277.
Parallel programming in C with MPI and OpenMP. M J Quinn, McGraw Hill516New YorkQuinn, M. J. 2004. Parallel programming in C with MPI and OpenMP. New York: McGraw Hill. 516 p.
Analyses of the stress intensity of the cylindrical tank wall at the place of the geometrical defect. K Rasiulis, K Gurkšnys, 10.3846/jcem.2010.23Journal of Civil Engineering and Management. 162Rasiulis, K.; Gurkšnys, K. 2010. Analyses of the stress intensity of the cylindrical tank wall at the place of the geometrical defect, Journal of Civil Engineering and Management 16(2): 209-215. http://dx.doi.org/10.3846/jcem.2010.23
Curvature analysis for composite with orthogonal, asymmetrical multi-layer structure. J Šliseris, K Rocēns, 10.3846/jcem.2010.28Journal of Civil Engineering and Management. 162Šliseris, J.; Rocēns, K. 2010. Curvature analysis for composite with orthogonal, asymmetrical multi-layer structure, Journal of Civil Engineering and Management 16(2): 242-248. http://dx.doi.org/10.3846/jcem.2010.28
Data-flow analysis for MPI programs. M M Strout, B Kreaseck, P D Hovland, 10.1109/ICPP.2006.32International Conference on Parallel Processing. Columbus, OhioStrout, M. M.; Kreaseck, B.; Hovland, P. D. 2006. Data-flow analysis for MPI programs, in International Conference on Parallel Processing (ICPP 2006), 14-18 August, 2006, Columbus, Ohio, 175-184. http://dx.doi.org/10.1109/ICPP.2006.32
Development of probabilistic framework for performance-based seismic assessment of structures considering residual deformations. S R Uma, S Pampanin, C Christopoulos, 10.1080/13632460903556509Journal of Earthquake Engineering. 147Uma, S. R.; Pampanin, S.; Christopoulos, C. 2010. Develop- ment of probabilistic framework for performance-based seismic assessment of structures considering residual de- formations, Journal of Earthquake Engineering 14(7): 1092-1111. http://dx.doi.org/10.1080/13632460903556509
A brief look at data on the reliability of sprinklers used in conventional buildings. E R Vaidogas, J Šakėnaitė, 10.3846/13923730.2011.559908Journal of Civil Engineering and Management. 171Vaidogas, E. R.; Šakėnaitė, J. 2011. A brief look at data on the reliability of sprinklers used in conventional buildings, Journal of Civil Engineering and Management 17(1): 115-125. http://dx.doi.org/10.3846/13923730.2011.559908
Parallel programming techniques and applications using networked workstations and parallel computers. B Wilkinson, M Allen, Pearson Prentice Hall496New YorkWilkinson, B.; Allen, M. 2005. Parallel programming techniques and applications using networked workstations and parallel computers. New York: Pearson Prentice Hall. 496 p.
An introduction to parallel programming. The Netherlands: VSSD Delft. T Wittwer, 63Wittwer, T. 2006. An introduction to parallel programming. The Netherlands: VSSD Delft. 63 p.
Equivalent force control method for real-time testing of nonlinear structures. B Wu, G Xu, P B Shing, 10.1080/13632461003681171Journal of Earthquake Engineering. 151Wu, B.; Xu, G.; Shing, P. B. 2011. Equivalent force control method for real-time testing of nonlinear structures, Jour- nal of Earthquake Engineering 15(1): 143-164. http://dx.doi.org/10.1080/13632461003681171
Stochastic modeling of earthquake scenarios in Greater Tehran. A Yazdani, M S Abdi, 10.1080/13632469.2010.498906Journal of Earthquake Engineering. 152Yazdani, A.; Abdi, M. S. 2011. Stochastic modeling of earthquake scenarios in Greater Tehran, Journal of Earthquake Engineering 15(2): 321-337. http://dx.doi.org/10.1080/13632469.2010.498906
Application of parallel computing to seismic damage process simulation of an arch dam. H Zhong, G Lin, J Li, 10.1088/1757-899X/10/1/012003IOP Conference Series: Materials Science and Engineering. 10Zhong, H.; Lin, G.; Li, J. 2003. Application of parallel compu- ting to seismic damage process simulation of an arch dam, in IOP Conference Series: Materials Science and Engineering 10(1): 1-9. http://dx.doi.org/10.1088/1757-899X/10/1/012003
He served as a Research Assistant at CoE-CRT. Sarfraz MUNIR is a PhD Student. Hong Kong Polytechnic University Hong Kong. He obtained Master's degree in Engineering from Saitama University, Japan. He has a BSc in Civil Engineering from University of Engineering & Technology Lahore, Pakistan ; KSU, KSA, Assistant Professor at University of Lahore, Lahore, Pakistan, and as a Lecturer at University of Engineering & Technology Lahore, PakistanSarfraz MUNIR is a PhD Student, in The Hong Kong Polytechnic University Hong Kong. He obtained Master's degree in Engineering from Saitama University, Japan. He has a BSc in Civil Engineering from University of Engineering & Technology Lahore, Pakistan. He served as a Research Assistant at CoE-CRT, KSU, KSA, Assistant Professor at Univer- sity of Lahore, Lahore, Pakistan, and as a Lecturer at University of Engineering & Technology Lahore, Pakistan.
He received his PhD and MSc in Civil Engineering from the University of Tokyo, Japan for which he was ranked outstanding and was awarded best research thesis award from the University of Tokyo. He received his PhD in record short period of just two years. He has authored more than 75 publications in less than 5 years of his post PhD tenure and has received several awards. Riyadh, Saudi ArabiaRaja Rizwan HUSSAIN is an Associate Professor in CoE-CRT, Department of Civil Engineering, College of Engineering, King Saud Universityprizes and distinctions throughout his research and academic careerRaja Rizwan HUSSAIN is an Associate Professor in CoE-CRT, Department of Civil Engineering, College of Engineer- ing, King Saud University, Riyadh, Saudi Arabia. He received his PhD and MSc in Civil Engineering from the University of Tokyo, Japan for which he was ranked outstanding and was awarded best research thesis award from the University of Tokyo. He received his PhD in record short period of just two years. He has authored more than 75 publications in less than 5 years of his post PhD tenure and has received several awards, prizes and distinctions throughout his research and academic career.
His research interests include offshore structures, nonlinear dynamics, finite element modelling, seismic protection, base isolation. A B M , ASCEBangladeshUniversity of Malaya, Malaysia. He completed his BSc in Civil Engineering and MSc in Structural Engineering from Bangladesh University of Engineering and Technology (BUET)Saiful ISLAM is a Research Fellow after receiving his PhD at the Department of Civil Engineering. pounding and special tall buildingsA. B. M. Saiful ISLAM is a Research Fellow after receiving his PhD at the Department of Civil Engineering, University of Malaya, Malaysia. He completed his BSc in Civil Engineering and MSc in Structural Engineering from Bangladesh University of Engineering and Technology (BUET), Bangladesh. He is a member of Institution of Engineers, Bangladesh and American Society of Civil Engineers (ASCE). His research interests include offshore structures, nonlinear dynamics, finite element modelling, seismic protection, base isolation, pounding and special tall buildings.
| for which the thesis does not hold. However, the model allows formula_5 parallel threads of computation after formula_6 steps. (See Big O notation.) Parberry (1986) suggested a more "reasonable" bound would be formula_7 or formula_8, in defense of the thesis. Goldschlager (1982) proposed a model which is sufficiently universal to emulate all "reasonable" parallel models, which adheres to the thesis. Chandra and Stockmeyer originally formalized and proved results related to the thesis for deterministic and alternating Turing machines, which is where the thesis originated. Parallel computation thesis In computational complexity theory, the parallel computation thesis is a hypothesis which states | A limit study of JavaScript parallelism | structures whose speedup grows with P are called scalable. The extent to which one can scale the performance of a concurrent data structure is captured by a formula known as Amdahl's law and more refined versions of it such as Gustafson's law. A key issue with the performance of concurrent data structures is the level of memory contention: the overhead in traffic to and from memory as a result of multiple threads concurrently attempting to access the same locations in memory. This issue is most acute with blocking implementations in which locks control access to memory. In order to acquire | Testing high-performance computing applications High performance computing applications run on massively parallel supercomputers consist of concurrent programs designed using multi-threaded, multi-process models. The applications may consist of various constructs (threads, local processes, distributed processes, etc.) with varying degree of parallelism. Although high performance concurrent programs use similar design patterns, models and principles as that of sequential programs, unlike sequential programs, they typically demonstrate non-deterministic behavior. The probability of bugs increases with the number of interactions between the various parallel constructs. Race conditions, data races, deadlocks, missed signals and live lock are common error types. Parallel programs can be divided into | Synchronization operation of generators is very essential in operation of power system.On precondition of operating correctly and paralleling in rapidly,it demands higher reliability and stability to ensure its security.This paper presents an automation synchronizer with double microprocessor——one working and the other in stand-by heat.The hardware redundancy in the device can guarantee high reliability.This device also forecasts the difference of angle by adopting a linear interpolation method to grasp synchronization opportunity rapidly and reliably.The testing indicates that this device can realize synchronization operation with high-accuracy,rapidness,reliability and stability.The device will be usually applied to the situation demanding high reliability and fast synchronization operation.There is a nice application foreground in the field of the synchronization operation of heavy-duty generators. | This paper presents two queueing network models which correspond to different implementations of the lock management algorithm for concurrent transaction processing in a database system. These models are developed to investigate the effects of varying the granularity of locks and the degree of multiprogramming on the performance of a database system. A numerical example is presented for a set of apparently realistic parameters and its results are discussed. In addition to other conclusions, these results also confirm the result of Ries and Stonebraker, using a simulation model [9], that a relatively coarse granularity is sufficient to allow enough parallelism for efficient resource utilization. In contrast with simulation models, the queueing network models presented in this paper allow us to examine more closely the cause-effect relationships of concurrent transaction processing in a database system at less cost. | Parallel Virtual File System and all servers managing a given file system use the same configuration file. The server receives requests over the network, carries out the request which may involve disk I/O and responds back to the original requester. Requests normally come from client nodes running application tasks but can come from other servers. The server is composed of the request processor, the job layer, Trove, BMI, and flow layers. The request processor consists of the server process' main loop and a number of state machines. State machines are based on a simple language developed for PVFS that manage concurrency within the server | 1,999,873 | The bulk-synchronous parallel (BSP) model of computation was introduced by Valiant [1] in the early 1990s, and further developed over the ensuing years [34, 35,41, 48–50]. Its primary purpose is to act as a “bridging model” [1] mitigating the discrepancies between parallel architectures and the software executed on them. In other words, BSP is intended to be a universal model of parallel computing, capable of providing a reliable underlying framework for the design of both scalable parallel architectures and portable parallel applications [34]. | Parallel Biological Sequence Comparison on Heterogeneous High Performance Computing Platforms with BSP++ | Bulk-Synchronous Parallel ML (BSML) is a functional dataparallel language for the implementation of Bulk-Synchronous Parallel (BSP) algorithms. It makes an estimation of the execution time (cost) possible. This paper presents some general examples of BSML programs and a comparison of their predicted costs with the measured execution time on a parallel machine. | The skeletal approach to the development of parallel applications has been revealed to be one of the most successful and has been widely explored in the recent years. The goal of this approach is to develop a methodology of parallel programming based on a restricted set of parallel constructs. This paper presents llc, a parallel skeletal language, the theoretical model that gives support to the language and a prototype implementation for its compiler. The language is based on directives, uses a C-like syntax and gives support to the most widely used skeletal constructs. llCoMP is a source to source compiler for the language built on top of MPI. We evaluate the performance of our prototype compiler using four different parallel architectures and three algorithms. We present the results obtained in both shared and distributed memory architectures. Our model guarantees the portability of the language to any platform and its simplicity greatly eases its implementation. | This paper presents strategies to parallelize a previously implemented kinetic Monte Carlo (kMC) algorithm. The process under simulation is the precipitation in an aluminum scandium alloy. The selected parallel algorithm is called synchronous parallel kinetic Monte Carlo (spkMC). spkMC was implemented with a distributed memory architecture and using the Message Passing Interface (MPI) communication protocol. In spkMC the different processes synchronize at regular points, called end of sprint. During a sprint there is no interaction among processes. A checker board scheme was adopted to avoid possible conflicts among processes during each sprint. To optimize performance different implementations were explored, each one with a different computation vs. communication strategy. The obtained results prove that a rigorous distributed and parallel implementation reproduces accurately the statistical behavior observed with the sequential kMC. Results also prove that simulation time can be reduced with a distributed parallelization but, due to the non-deterministic nature of kMC, significant and scalable gains in parallelization oblige to introduce some simplifications and approximations. | Enhancing internal parallelism of solid-state drives while balancing write loads across dies | A widespread method in parallel scientific computing is SPH, a grid-free method for particle simulations. Lots of libraries implementing this method evolved in the past. Since most of them are written in FORTRAN or C, there is a lack of integration of object-oriented concepts for scientific applications. These libraries are therefore hard to maintain and to extend. In this paper, we describe the design and implementation of sph2000, a parallel object-oriented framework for particle simulations written in C++. Its key features are easy configurability and good extensibility for the users to support their ongoing development of the SPH method. The use of design patterns lead to an efficient and clear design and the implementation of parallel I/O improved the performance significantly. A sample application was implemented to test the framework. | Applications of parallel processing to astrodynamics | Satisfying the I/O requirements of massively parallel supercomputers |
1,999,874 | November Discussion Thread #2: FTL: Faster Than Light [PC] | Slower Than Light's ( Kickstarter just launched at I know a lot of people who read this board are interested in seeing 4X games that are breaking out of the rut the new generation seems to have been in for the last few years. I hope this project does exactly that. Take a look; there will be a lot more information appearing over the course of the campaign. | Okay, this one bothers me pretty frequently, but it isn't terribly complex. Faster Than Eyesight means so many different things in different contexts, and is only rivaled by the 'buster' system in terms of vagueness. It is unique in that sense, because Faster Than Sound and Faster Than Light are both pretty easy measurements. But what exactly is Faster than Eyesight?
I've heard it argued that moving FTE is 'at least faster than sound', and while this seems like it would be easy to work with it really isn't. Moving faster than eyesight is a difficult thing to calc because of how many variables it involves that authors do or do not pay attention to.
For instance-Batman has moved 'faster than eyesight' many times, by relying on a darkened environment and dark outfits, along with countless other tricks. (I know Batgod can go FTE legitimately too, whatever that means.) Is he FTE based on that? Does that mean that someone capable of evading detection in broad daylight is faster? There are a plethora of problems with measuring speed by observation from other, in universe characters. Especially goons, which is another problem with Faster Than Eyesight.
The major problem with Faster Than Eyesight is, depending on your calc, it goes from either 'incredible tricks of the mind' to 'superluminal Wolverine'. It's like if we called city-busting attacks Bigger Than Nuke attacks, and attacks bigger than BTN attacks Majorly Bigger Than Nuke attacks. It's vague, totally worthless except for making speed feats when there aren't any, and is in almost no way a viable measurement of a character's ability.
also there's some shit about neutral universes and how one author's paying attention to how eyes work can dramatically weaken the series' power level, but we've had enough neutral universe bullshit. | Faster-than-light of reference get closer together is called the mutual or closing speed. This may approach twice the speed of light, as in the case of two particles travelling at close to the speed of light in opposite directions with respect to the reference frame. Imagine two fast-moving particles approaching each other from opposite sides of a particle accelerator of the collider type. The closing speed would be the rate at which the distance between the two particles is decreasing. From the point of view of an observer standing at rest relative to the accelerator, this rate will be slightly less | What is the fastest speed of a computer compatible with PowerPC? | A Slower Speed of Light A Slower Speed of Light is a freeware video game developed by MIT Game Lab that demonstrates the effects of special relativity by gradually slowing down the speed of light to a walking pace. The game runs on the Unity engine using the own open source OpenRelativity toolkit. In "A Slower Speed of Light", the player controls the ghost of a young child who was killed in an unspecified accident. The child wants to "become one with light", but the speed of light is too fast for the child. This is solved through the use | Are parallel functional languages feasible? The large majority of the current projects ::: investigating this question are based on MIMD machines and the current set of implementation methods for functional languages which is graph rewriting and combinators. We regret that we have ::: to come to a negative conclusion: it is highly unlikely that these projects will turn parallel processing ::: by means of functional languages into an attractive alternative to sequential processing, not even for ::: special purposes. ::: Although we express a clear conclusion, we have included some responses from the projects mentioned in this paper to allow the reader to make up his own opinion. | Whenever Goku is brought up in "who would win" arguments, I always see someone claim that Goku is faster than light. While I questioned the validity of such statements, I never thought about figuring it out, until I saw the subject surface today on our own subreddit.
Let me preface this by saying that physics does not always apply to anime. Nothing with mass can travel at or beyond the speed of light. So trying to explain that someone is moving FTL using physics is just paradoxical. We can however, measure a character's speed using quantitative feats.
So we know that the speed of light is roughly 300,000 km **per second**. With a circumfrence of 40,000km, Light can travel around the earth 7.5 times per second. Being able to hit this kind of speed on a whim would make all forms of in-atmosphere travel unnecessary, as one could be anywhere on earth whenever they wanted to be. Goku uses the flying nimbus up until the beginning of Z, so the idea of him being FTL in Dragonball is out the window. At FTL speeds, Goku could have collected all the dragonballs in a second, literally!
So how about we move on down the line? After Goku's training during the Saiyan Saga, King Kai estimated it would take Goku 2 days to travel snake-way. Snake-way is said to be 1,000,000 km long, so 1,000,000km in 2 days is equal to 20,830 km/h, or 5.8 km/s. However, on his return journey, Goku flew over snake-way, rather than running along its curved path. This would have cut the length of his journey in half or less, so we can conclude that Goku's speed at this time is less than or equal to 2.9 km/s. Were still pretty far off from lightspeed.
During his fight with Nappa, Goku's power-level was stated to be 8,000. Goku's highest officially stated power-level is 150,000,000, when he went super-saiyan on Namek (this is not stated in the show, but is listed in the Daizenshuu, an official DBZ encyclopedia written by Toriyama and his assistants). At this point, Goku is 18,750 times stronger than during his fight with Nappa, so we can plug in his earlier speed to get his current speed (18,750 x 2.9km/s): 54,375 km/s. Still not FTL, but now were getting somewhere. To get to lightspeed from here, we need to increase our power by 5.5 times, or reach a power-level of roughly 827,500,000, a power level which Goku would have achieved during the Android or Cell Sagas.
So finally, we can conclude that Goku is indeed capable of fighting at FTL speeds, but he is able to do so no earlier than the Android or Cell sagas.
Edit: Obviously I'm not including Instant Transmission. I'm talking about his physical movement, such as running, punching, flying, etc. But if thats a problem for you, then you can replace Goku with Vegeta and the above conclusion still applies, despite Vegeta never learning Instant Transmission. | Flash can think as fast as he moves. Which is sometimes the speed of light. Iron man once was able to accelerate his thoughts and process information at the speed of light. I have seen several other make this claim. But what does it really mean? How fast is the the thought of an irl human? How many times faster does the Flash think compared to the human thought speed? | 1,999,874 | **SUMMARY**
> FTL: Faster Than Light is available on PC.
**NOTES**
> Please mark spoilers as follows: \X kills Y!\
> Can't get enough? Visit /r/FTLGame for more news and discussion. | what is the software used to run a slower speed of light | SIB FTL: faster than light or shovel knight | Doubts Arise about RTX 2070 Super FPS Averages from Official Game Utilities! | who dies in the x files movie soft light | Pulling my hair out! FCP not using optimised media in timeline. | About DTL Speedrunning. . . | The current state of FPS Multiplayer scene on PC... | Dramatically reducing cycle times through flash development |
1,999,875 | Measurement by laser-Doppler flowmetry of microcirculation in lower leg muscle at different blood fluxes in relation to electromyographically determined contraction and accumulated fatigue | Non-contact assessment of muscle contraction: Laser Doppler Myography | Laser-Doppler flowmetry (LDF) and electromyography (EMG) were used simultaneously for measuring skeletal muscle blood perfusion in relation to static load and fatigue. Percutaneous single-fibre LDF and bipolar surface EMG of the trapezius muscle were performed continuously during a 10-min series of alternating periods of static contractions and rest, each of 1-min duration. The muscle was exposed to static load expressed as shoulder torque, by keeping the arms straight and elevated at 30, 60, 90 and 135°. On-line computer processing of the LDF and EMG signals made possible the interpretation of the relationship between the perfusion and the activity of the muscle. The LDF and root mean square (rms)-EMG were normalized by using the average value of the serial examinations of each individual as a reference value. Spectrum analyses of EMG showed the lowest variability for median frequency (MDF) in the frequency range 10–1000 Hz and mean power frequency (MPF) at 2–1000 Hz. The LDF power spectrum density during low (muscle rest) and high (high-force muscle contraction) perfusion indicated that disturbances were small when measurements were performed during sustained static contraction with as little movement as possible. Vasomotion, i.e. rhythmic variations in the blood flow, were present and showed a frequency of 5–6 cycles · min−1. Application of a tourniquet to the upper arm caused an arrest of the microcirculation in the distally situated brachioradial muscle which was followed by a postischaemic hyperaemia upon removal of the torniquet. In ten healthy men, regression analyses showed positive correlation between rms-EMG and shoulder torque (r=0.77), negative correlation between MPF and arm elevation angle (r= −0.89) indicating accumulated fatigue, and almost positive correlations between LDF and rms-EMG (r=0.65), and between LDF and shoulder angle (r=0.67) when the right trapezius muscle was examined. | Simultaneous Measurements of Pial Arteriolar Diameter and Laser-Doppler Flow during Somatosensory Stimulation |
Introduction
Muscle behavior in vivo is an essential problem to be resolved. Commonly used techniques for measuring muscle activities from different aspects include electromyography (EMG) [1], dynamometers, and ultrasonography [2]. Surface EMG is the most widely used tool for indirect assessment of mechanical activity of muscle, but it fails to disclose muscle's morphological changes. Dynamometers are devices for quantitative measurement of muscle, such as torque and power, but they cannot provide muscle's morphological information yet. Due to the quality of real-time imaging, widespread availability, and low cost, ultrasonography has been increasingly employed as a clinical and research tool to study the in vivo behavior of the quadriceps muscle from the morphological point of view, such as architectural changes of thickness [3][4][5][6], fascicle length [2,[6][7][8][9][10], pennation angle [2,7,8,[10][11][12], and cross-sectional area [2,13,14]. Dick and Wakeling recorded medial gastrocnemius tendon length, fascicle length, pennation angle, and thickness using ultrasonography and muscle activation using surface EMG during cycling [15]. They identified muscle force, and not velocity, as the mechanistic driving factor to allow muscle gearing to vary depending on the contractile conditions. All these works show the potential of using data and quantitative approaches to help understand the nature and functional implications of in vivo dynamic body movement. Quadriceps is always a focus as it is crucial in walking, running, jumping, and squatting. Wei et al. reported an image-based method to find the contour of the center tendon of rectus femoris quantitatively [16]. However, the knowledge about relative movement between quadriceps and femur during dynamic contraction remains unclear. The aim of this study is to quantify this movement for further understanding of muscle contraction mechanism.
As a matter of fact, in the data from a previous study [16], a phenomenon like shifting gear of a car was observed visually from time to time. Simply speaking, when the torque increases linearly, femur is frequently noticed to move around several relatively fixed positions. To verify this assumption, we repeated the experiment and recorded both the torque signal and the movement of femur under ultrasonography. Then, some established image processing techniques were used to disclose the gear shifting phenomenon.
Materials and Methods
Subjects and Experiment
Protocol. Eight healthy male subjects (mean ± SD, age = 28.5±0.6 years; body weight 67.3± 1.7 kg; height = 171.8 ± 0.6 cm) volunteered to participate in this study. No participants had a history of neuromuscular disorders, and all were aware of experimental purposes and procedures. The human subject ethical approval was obtained from the relevant committee in the authors' institution, and informed consent was obtained from subjects prior to the experiment.
The testing position of the subject was in accordance with the User's Guide of a Norm dynamometer (Humac/ Norm Testing and Rehabilitation System, Computer Sports Medicine, Inc., Massachusetts, USA). Each subject was required to put forth his maximal effort of isometric plantar flexion for a period of 3 seconds with verbal encouragement provided. The maximal voluntary contraction (MVC) was defined as the highest value of torque recorded during the entire isometric contraction. The MVC torque was then calculated by averaging the two recorded highest torque values from the two tests. The subject was instructed to generate a torque waveform up to 90% of his MVC, using ankle plantar flexion movements in prone position. The torque was measured by the aforementioned dynamometer and the reason for choosing 90% MVC as the highest value was to avoid muscle fatigue.
Data Acquisition and Data Processing.
A real-time Bmode ultrasonic scanner (EUB-8500, Hitachi Medical Corporation, Tokyo, Japan) with a 10 MHz electronic linear array probe (L53L, Hitachi Medical Corporation, Tokyo, Japan) was used to obtain ultrasound images of muscles. The long axis of the ultrasound probe (EUB-8500) was arranged perpendicularly to the long axis of the thigh on its superior aspect, 40% distally from the knee. As the position of probequadriceps is fixed, the movement of femur reflects the contraction of quadriceps. The ultrasound probe was fixed by a custom-designed foam container with fixing straps, and a very generous amount of ultrasound gel was applied to secure acoustic coupling between the probe and skin during muscle contractions, as shown in Figure 1. The probe was adjusted to optimize the contrast of muscle fascicles in ultrasound images. Then the B-mode ultrasound images were digitized by a video card (NI PCI-1411, National Instruments, Austin, USA) at a rate of 25 frame/s for later analysis.
Ultrasound probe Humac/Norm system Eight sequences of musculoskeletal ultrasound images were acquired and the number of frames per sequence was 240 images. All images were cropped to remove equipment tags in the images and keep the image content only using a home-made software. All data were processed offline using programs written in Matlab R2010b (Math Works, Natick, MA, USA) on a Windows-based computer with a P4 (3 GHz) processor and 2 GB memory.
Image Filtering and Femur Segmentation.
In this study, the shapes of femur are extracted automatically by two steps. The ultrasound images are first denoised using guided filter. Then, the femur in a sequence is segmented by using an active contour model, named implicit active contours driven by local binary fitting energy (LBF) [17]. To reduce the computation time and improve the accuracy of femur extraction, we located the region of interest (ROI) as a rectangle which could enclose the femur of the whole image sequence, and the subsequent operations are applied on this region rather than the whole image. The rectangle is expected to be small but able to contain the femur of the sequence.
Ultrasound images are usually affected by speckle noise [18], and the edges of femur are not clear in most images, which make it hard for the segmentation algorithm to recognize the accurate boundaries of femur. To handle this problem, we use a filtering algorithm, named guided filtering, for image smoothing and noise reduction before the segmentation step. This filter has edge-preserving smoothing property like bilateral filter but does not suffer from the gradient reversal artifacts. The derivation and details of the guided filtering algorithm can be found in Appendix A.
Although images are smoothed after guided filtering, intensity inhomogeneity still exists in ultrasound frames. Hence, we adopted implicit active contours driven by local binary fitting energy (LBF), to extract boundaries of femur from ultrasound images. In this model, a kernel function is introduced into a data fitting energy, so that intensity information in local regions is extracted to guide the motion of the contour, which thereby enables the model to cope with intensity inhomogeneity. The details and implementation of the LBF model are introduced in Appendix A. In this study, level set of each frame is initialized as two rectangles enclosing the femur. Then contours of femur will be extracted by evolving the level set iteratively using LBF model.
Analysis of Femur Motion.
To study the motion of femur, we use the contours in the previous step to generate corresponding segmentation images for the femur. Figure 5 is an overlapped plot of segmentation results in a knee extension process. In this figure, different color represents the duration time of the femur staying at this location and one may easily observe that the femur mainly stays at several positions. Figure 6 is a schematic drawing of a cross-sectional view of the quadriceps in which A, B, and C are different stages of femur motion. To see the motion in detail, we draw the overlapped plot of femur movement in both muscle contraction and relaxation stages in Figure 8(a) and plot an example of torque signal and related coordinates in Figures 8(b) and 8(c). In order to further study the process, we used optimal detection of change-points (ODC) algorithm [19] to cut the process into different clusters. The reason of using ODC is that the motion is a temporal continuous process and ODC algorithm can cover this continuity by design. The results and discussion of clustering can be found in the next section.
The flowchart of the proposed strategy mentioned above is illustrated in Figure 2.
Results and Discussion
Image Filtering and Femur Segmentation.
After acquisition of ultrasound frames, images were focused on the ROI, and then guided filter and LBF model were applied to smooth the image and extract the femur, respectively. In our numerical experiments, window radius and regularization parameter for guided filter are selected as 8 and 0.4 2 , respectively. And for femur segmentation using LBF model we empirically adopted parameters as follows: 1 = 1, 2 = 2, ] = 0.001 × 255 × 225, = 1, = 10, and time step Δ = 0.1. All parameters are empirical values and applied to frames of all subjects. The explanation and usage for mentioned parameters can be found in the Appendices.
A representative example of selected ROI, filtered image, and segmented femur are shown in Figure 3. And a representative example of femur segmentation process using LBF evolution model is shown in Figure 4.
Discussion.
After segmentation of femur, an interesting phenomenon could be found where (shown in Figure 5), corresponding to one ramp increasing and decreasing of quadriceps, femur relative to the ultrasound sensor in a sequence mainly concentrated at several positions which are shown as * A, * B, and * C. To further investigate the detailed motion and its relationship to torque changing, in Figure 8 change-points (ODC) method [19] to cut whole process into different stages using torque signal and coordinates. We can see the motion of femur and the torque changing have very different behaviors. The torque signal, which is shown in Figure 8(b), can be mainly divided into three stages which are corresponding to muscle contraction, relaxation, and resting, respectively, and, in each stage, the torque changes almost linearly, while, in Figures 8(c) and 8(d), the plotted and coordinates of femur centroid movement can be viewed as more stages than torque changing. When the torque signal changes into another stage, the motion of femur also changes to another stage which makes sense. Interestingly, we can observe that when the torque linearly increases or decreases in a stage, the trend of femur movement is not fixed and can be further divided into several stages. This stage changing reminds us of gear shifting in a car where there might also be a gear shifting of femur in the extension process. Therefore, to further investigate this phenomenon quantitatively, we use cluster analysis methods to study the behavior of femur movement. We first cut the process using torque signal into three stages, that is, contraction, relaxation, and resting. (The contraction stage and relaxation stage are separated by peak torque while the relaxation stage changes to resting stage when the torque signal reduced to less than 0.05.)
As we are studying the extension process, we only focus on contraction and relaxation stages. Both contraction and relaxation stages are clustered into three phases by ODC. Clustering results are displayed in Figure 7 and the six clusters are represented by #A, #B, #C, #C , #B , and #A , in which #A, #B, and #C correspond to beginning, middle, and ending of contraction stage and #A , #B , and #C correspond to beginning, middle, and ending of relaxing stage. In Table 1 first summarized the variances of each cluster in all subjects. In this table, we also included their rankings. Interestingly, in the relaxation phase, we find that #B has the largest variances for 7/8 subjects, #C has the median variances for 6/8 subjects, and #A has the smallest variances for 7/8 subjects. The variance of a group represents the moving speed of the femur in this cluster and we may conclude that the moving speed of femur changes in a fixed pattern in relaxation phase. In the contraction phase, the property is not very clear, but we can still notice that the femur generally moves faster in #A than in #B and #C. At all events, from the clustering results, we can find that the clusters in the same contraction or relaxation phase have different properties whereas the torque signal keeps linear changing. #A and #A , #B and #B , and #C and #C are considered as pairs as they have similar torque signal and, therefore, in Table 2, we also summarized the distances among them. Another interesting phenomenon can be seen from Table 2 that distances between clusters #A and #A are much larger than distances of other pairs. This can support the early suggestion that complete relaxation of muscle takes time. In many cases, muscle morphology has not returned to the initial condition although torque has done.
To sum up the points which we have just indicated, the main finding of this study could conclude that quadriceps movement is nonlinear and the relative position between the quadriceps and femur is piecewise with the change of torque during one contraction-relaxation. In other words, the contraction of quadriceps may have gear shifting mechanism during isometric knee extension.
Conclusion
In this paper, we observed a gear shifting pattern of quadriceps. To validate our observation, we proposed a systematic strategy to analyze the isometric knee extension process via ultrasonography, video processing, and related signal processing techniques. Analysis results provide preliminary support for the phenomenon. To our knowledge, the present study is the first report to describe the gear shifting motion pattern during quadriceps contractions in human skeletal muscles. However, there are still several limitations of this study. The number of participants is small. In future work, larger dataset would allow making further validation.
Appendix
A. Details of Guided Filtering Algorithm
The key assumption of the guided filter is that the filter output is a linear transform of the guidance image in a window centered at the pixel :
= + , ∀ ∈ , (A.1)
where ( , ) are some linear coefficients assumed to be constant in a square window with a radius .
To determine the linear coefficients, the following cost function is minimized in the window:
( , ) = ∑ ∈ (( + − ) 2 + 2 ) . (A.2)
Here is a regularization parameter, and are identical and given as the input ultrasound image. The solution to (A.2) can be given by linear regression:
= (1/ | |) ∑ ∈ − 2 + = − . (A.3)
Here, and 2 are the mean and variance of in , | | is the number of pixels in , and = (1/| |) ∑ ∈ is the mean of in .
So after computing ( , ) for all patches in the image, we compute the filter output by The derivative of is the following smooth function:
( ) = ( ) = 1 2 + 2 . (B.5)
Figure 1 :
1Experimental setup including the torque and ultrasound image data collection modules.
Figure 2 :
2, we draw the overlapped plot of femur movement in both muscle contraction and relaxation stages in (a), plot the torque signal in (b), and plot the coordinates of the femur centroid movement in (c). Then we use optimal detection of Flowchart of the proposed strategy for processing an ultrasound image sequence.
Figure 3 :
3A representative result of ROI selection, guided filtering, and femur segmentation.
Figure 4 :Figure 5 :
45A representative set of results of LBF model for femur segmentation. (a) Original image with initial contour. (b) Curve evolution result after 2 iterations. (c) Final contour after evolving stopped. A representative statistical result of femur position in a sequence, where * A, * B, and * C are the positions the femur mainly stay at.
Figure 6 :
6Schematic drawing of a cross-sectional view of the quadriceps shows the femur movement during a contraction-relaxation process of quadriceps, where A, B, and C are the main stages of femur movement.
Figure 7 :
7Classification results of all subjects.
Figure 8 :
8(a) Overlapped plot of muscle contraction and relaxation stages, (b) torque signal, and (c) coordinates of femur centroids.
Details of Local Binary Fitting ModelConsider the input image : Ω → N 2 , where Ω is the image domain. Let be the level set of a Lipschitz function; the gradient decent flow equation of the LBF energy functional is defined as= − ( ) ( 1 1 − 2 2 ) + ] ( ) ⋅ div ( ∇ ∇ ) + (∇ 2 − div (
, weFemur
Rectus femoris
Vastus lateralis
Vastus medialis
Vastus intermedius
A
B
C
Table 1 :
1Variances of clusters.Subject
#A
#B
#C
#C
#B
#A
1
15.4
Medium
18.7
Large
3.9
Small
8.6
Medium
24.0
Large
5.5
Small
2
3.9
Small
26.8
Medium
76.5
Large
2.3
Small
18.8
Large
8.6
Medium
3
19.0
Large
4.3
Small
15.3
Medium
5.8
Small
36.0
Large
10.1
Medium
4
28.1
Medium
6.7
Small
55.6
Large
7.1
Small
10.3
Medium
11.0
Large
5
27.0
Large
5.0
Medium
3.1
Small
8.5
Small
19.0
Large
14.2
Medium
6
69.9
Large
14.1
Medium
1.3
Small
3.4
Small
41.9
Large
10.2
Medium
7
7.2
Small
17.9
Large
15.7
Medium
4.0
Small
24.3
Large
9.7
Medium
8
16.2
Large
7.3
Small
15.1
Medium
4.0
Medium
31.7
Large
4.0
Small
Table 2: Cluster distance between contraction group and relaxation group.
Subject
Euclidean distance (mm)
#A-#A
#B-#B
#C-#C
1
1 7 . 3
1 3 . 6
3 . 1
2
14.6
13.5
10.8
3
16.9
2.1
6.6
4
12.6
17.5
8.3
5
26.2
4.7
5.8
6
12.1
2.7
2.3
7
2.9
9.8
6.6
8
5.2
0.4
6.7
Mean
11.3
5.0
5.7
Peak torque
50
100
0
200
250
150
AcknowledgmentsThis study is supported partially by the Science and Technology Planning Project of Shenzhen City (JCYJ20150525092941053) and the Science and Technology Planning Project of Guangdong Province (no. 2015A020214022).Conflicts of InterestThe authors have no conflicts of interest.Authors' ContributionsShu Zhang and Weijian Huang contributed equally to the work.
. J Basmajian, C Deluca, Muscle Alives, Williams & Wilkins, Baltimore, Md, USAJ. Basmajian and C. Deluca, Muscle Alives, Williams & Wilkins, Baltimore, Md, USA, 1985.
In vivo human gastrocnemius architecture with changing joint angle at rest and during graded isometric contraction. M V Narici, T Binzoni, E Hiltbrand, J Fasel, F Terrier, P Cerretelli, The Journal of Physiology. 4961M. V. Narici, T. Binzoni, E. Hiltbrand, J. Fasel, F. Terrier, and P. Cerretelli, "In vivo human gastrocnemius architecture with changing joint angle at rest and during graded isometric contraction, " The Journal of Physiology, vol. 496, no. 1, pp. 287- 297, 1996.
Automatic thickness estimation for skeletal muscle in ultrasonography: Evaluation of two enhancement methods. P Han, Y Chen, L Ao, Biomedical Engineering Online. 121P. Han, Y. Chen, L. Ao et al., "Automatic thickness estimation for skeletal muscle in ultrasonography: Evaluation of two enhancement methods, " Biomedical Engineering Online, vol. 12, no. 1, article no. 6, 2013.
Measurement of muscle contraction with ultrasound imaging. P W Hodges, L H M Pengel, R D Herbert, S C Gandevia, Muscle & Nerve. 276P. W. Hodges, L. H. M. Pengel, R. D. Herbert, and S. C. Gan- devia, "Measurement of muscle contraction with ultrasound imaging, " Muscle & Nerve, vol. 27, no. 6, pp. 682-692, 2003.
Automatic tracking of aponeuroses and estimation of muscle thickness in ultrasonography: A feasibility study. S Ling, Y Zhou, Y Chen, Y.-Q Zhao, L Wang, Y.-P Zheng, IEEE Journal of Biomedical and Health Informatics. 176S. Ling, Y. Zhou, Y. Chen, Y.-Q. Zhao, L. Wang, and Y.-P. Zheng, "Automatic tracking of aponeuroses and estimation of muscle thickness in ultrasonography: A feasibility study, " IEEE Journal of Biomedical and Health Informatics, vol. 17, no. 6, pp. 1031-1038, 2013.
In vivo ultrasound assessment of respiratory function of abdominal muscles in normal subjects. G Misuri, S Colagrande, M Gorini, European Respiratory Journal. 1012G. Misuri, S. Colagrande, M. Gorini et al., "In vivo ultrasound assessment of respiratory function of abdominal muscles in normal subjects, " European Respiratory Journal, vol. 10, no. 12, pp. 2861-2867, 1997.
Determination of fascicle length and pennation in a contracting human muscle in vivo. T Fukunaga, Y Ichinose, M Ito, Y Kawakami, S Fukashiro, Journal of Applied Physiology. 821T. Fukunaga, Y. Ichinose, M. Ito, Y. Kawakami, and S. Fukashiro, "Determination of fascicle length and pennation in a contract- ing human muscle in vivo, " Journal of Applied Physiology, vol. 82, no. 1, pp. 354-358, 1997.
Nonisometric behavior of fascicles during isometric contractions of a human muscle. M Ito, Y Kawakami, Y Ichinose, S Fukashiro, T Fukunaga, Journal of Applied Physiology. 854M. Ito, Y. Kawakami, Y. Ichinose, S. Fukashiro, and T. Fukunaga, "Nonisometric behavior of fascicles during isometric contrac- tions of a human muscle, " Journal of Applied Physiology, vol. 85, no. 4, pp. 1230-1235, 1998.
Behaviour of the human gastrocnemius muscle architecture during submaximal isometric fatigue. L Mademli, A Arampatzis, European Journal of Applied Physiology. 945-6L. Mademli and A. Arampatzis, "Behaviour of the human gas- trocnemius muscle architecture during submaximal isometric fatigue, " European Journal of Applied Physiology, vol. 94, no. 5- 6, pp. 611-617, 2005.
Repeated contractions alter the geometry of human skeletal muscle. C N Maganaris, V Baltzopoulos, A J Sargeant, Journal of Applied Physiology. 936C. N. Maganaris, V. Baltzopoulos, and A. J. Sargeant, "Repeated contractions alter the geometry of human skeletal muscle, " Journal of Applied Physiology, vol. 93, no. 6, pp. 2089-2094, 2002.
Dynamic measurement of pennation angle of gastrocnemius muscles during contractions based on ultrasound imaging. Y Zhou, J.-Z Li, G Zhou, Y.-P Zheng, Biomedical Engineering Online. 1163Y. Zhou, J.-Z. Li, G. Zhou, and Y.-P. Zheng, "Dynamic measure- ment of pennation angle of gastrocnemius muscles during con- tractions based on ultrasound imaging, " Biomedical Engineering Online, vol. 11, article no. 63, 2012.
Estimation of muscle fiber orientation in ultrasound images using revoting Hough transform (RVHT). Y Zhou, Y.-P Zheng, Ultrasound in Medicine & Biology. 349Y. Zhou and Y.-P. Zheng, "Estimation of muscle fiber orien- tation in ultrasound images using revoting Hough transform (RVHT), " Ultrasound in Medicine & Biology, vol. 34, no. 9, pp. 1474-1481, 2008.
Human calf muscle responses during repeated isometric plantarflexions. C N Maganaris, V Baltzopoulos, A J Sargeant, Journal of Biomechanics. 397C. N. Maganaris, V. Baltzopoulos, and A. J. Sargeant, "Human calf muscle responses during repeated isometric plantarflex- ions, " Journal of Biomechanics, vol. 39, no. 7, pp. 1249-1255, 2006.
Ultrasonographic assessment of human skeletal muscle size. N D Reeves, C N Maganaris, M V Narici, European Journal of Applied Physiology. 911N. D. Reeves, C. N. Maganaris, and M. V. Narici, "Ultrasono- graphic assessment of human skeletal muscle size, " European Journal of Applied Physiology, vol. 91, no. 1, pp. 116-118, 2004.
Shifting gears: dynamic muscle shape changes and force-velocity behavior in the medial gastrocnemius. T J Dick, J M Wakeling, Journal of Applied Physiology. 1236T. J. Dick and J. M. Wakeling, "Shifting gears: dynamic muscle shape changes and force-velocity behavior in the medial gas- trocnemius, " Journal of Applied Physiology, vol. 123, no. 6, pp. 1433-1442, 2017.
Automatic Extraction of Central Tendon of Rectus Femoris (CT-RF) in Ultrasound Images Using a New Intensity-Compensated Free-Form Deformation-Based Tracking Algorithm with Local Shape Refinement. X Wei, J Zhang, S.-C Chan, H.-C Wu, Y Zhou, Y.-P Zheng, IEEE Journal of Biomedical and Health Informatics. 214X. Wei, J. Zhang, S.-C. Chan, H.-C. Wu, Y. Zhou, and Y.- P. Zheng, "Automatic Extraction of Central Tendon of Rectus Femoris (CT-RF) in Ultrasound Images Using a New Intensity- Compensated Free-Form Deformation-Based Tracking Algo- rithm with Local Shape Refinement, " IEEE Journal of Biomedical and Health Informatics, vol. 21, no. 4, pp. 1058-1068, 2017.
Implicit active contours driven by local binary fitting energy. C Li, C.-Y Kao, J C Gore, Z Ding, Proceedings of the IEEE Computer Society Conference on Computer Vision and Pattern Recognition (CVPR '07). the IEEE Computer Society Conference on Computer Vision and Pattern Recognition (CVPR '07)Minneapolis, Minn, USAC. Li, C.-Y. Kao, J. C. Gore, and Z. Ding, "Implicit active contours driven by local binary fitting energy, " in Proceedings of the IEEE Computer Society Conference on Computer Vision and Pattern Recognition (CVPR '07), Minneapolis, Minn, USA, June 2007.
Systematic evaluation on speckle suppression methods in examination of ultrasound breast images. X Feng, X Guo, Q Huang, Applied Sciences. 7137X. Feng, X. Guo, and Q. Huang, "Systematic evaluation on speckle suppression methods in examination of ultrasound breast images, " Applied Sciences, vol. 7, no. 1, p. 37, 2017.
Optimal detection of changepoints with a linear computational cost. R Killick, P Fearnhead, I A Eckley, Journal. R. Killick, P. Fearnhead, and I. A. Eckley, "Optimal detection of changepoints with a linear computational cost, " Journal of the
. American Statistical Association. 107500American Statistical Association, vol. 107, no. 500, pp. 1590-1598, 2012.
| In this study, the process of muscular fatigue was examined using surface electromyography (sEMG) and continuous-wave near-infrared spectroscopy (cw-NIRS) simultaneously during an isometric hand grip exercise at 50% and 75% of the maximal voluntary contraction (MVC), sustained until volitional fatigue. The mean frequency of the sEMG decreased during the whole exercise, whereas the root mean square had a tendency to increase. Oxy- hemoglobin/deoxy hemoglobin concentration changes computed with cw-NIRS were found to exhibit a fast linear de- crease/increase in therst 10{20 s of the exercise, the so-called fast phase, followed by a plateau-like slow phase. The change rates were higher at 75% MVC for both the sEMG and cw-NIRS parameters. Signicant correlations were found, especially at 50% MVC, between the sEMG parameters computed for the whole exercise and cw-NIRS parameters com- puted from the early region of the exercise, i.e. infection duration and amplitude changes to the inection point. The �ndings emphasize the potential of cw-NIRS for muscle studies. |
Introduction
Muscle contraction occurs as a result of electro-mechanical coupling that determines shortening of sarcomeres and in turn the whole muscle fibre. Simultaneous contraction of thousands of muscle fibres causes shortening of the long axis of a muscle [1]. It has been proposed, as early as the 17th century by Swammerdam [2], that the skeletal muscle operates as a near-constant volume system, therefore shortening of the long axis must be linked to an increased transverse diameter [3]. More recently, relationships between muscle motor output and its geometry changes have been measured by using a realtime, brightness mode ultrasonic apparatus to follow instantaneous changes in gastrocnemius muscle fascicle length [4]. Simultaneous recording of torque alongside geometry changes provides evidence that tension is generated synchronously with changes in fascicle length. It is also established that surface mechanomyography (MMG) can measure the expansion of muscle fibres during contraction [4]; a strict relationship exists between the MMG amplitude and the oscillations of the output torque and the fascicle length. At a macro level, there are overlapping dynamics between torque oscillations at tendon-and surface-detected MMG, during both stimulated and voluntary contractions [5,6]. This further supports the concept that the muscle can be regarded as a near-constant volume system, with muscle fibre shortening and thickening, as detected by muscle surface displacement and tension at the tendon level [3]. In conclusion, muscle surface displacement can be a useful tool to track muscle contractile features during contraction. This method may be useful to establish the status of the muscle for either sporting performance or rehabilitation.
Therefore, this review starts by providing an overview of how the radial displacement of the skeletal muscle is evoked and measured to assess its contractile properties. Mechanomyography is briefly introduced as the most established method to measure muscle radial displacement. Thereafter, a more recent method, tensiomyography (TMG), which measures radial displacement following electrical stimulation of the muscle, is the main focus of this review. Tensiomyography uses the same principle as MMG; however, it is designed to work only with stimulated muscle contraction and uses a unique mechanical sensor to detect muscle radial displacement. We discuss the validity, reliability and applications of TMG and examine the existing evidence surrounding TMG as a practical tool within the field of sports medicine, highlighting strengths and weaknesses. Finally, a case is made that TMG can be regarded as a special case of MMG.
Literature Search
We searched the scientific literature relevant to this review between January and July 2017, using the US National Library of Medicine (PubMed) and the Google Scholar database. The terms 'tensiomyography', 'TMG', 'radial displacement', 'maximal displacement amplitude', 'contraction time', 'delay time', 'sustain time' and 'half relaxation time' were used in different combinations to retrieve pertinent articles. We also sourced relevant literature from the reference list of articles obtained from the database searches. Most TMG applications were reviewed as detailed in Sect. 4. A few TMG articles dealt with clinical applications outside the sports and exercise medicine field and, in keeping with the scope of Sports Medicine, they were not included. A total number of 227 articles were retrieved and 55 TMG papers were included. Only full-text articles and books were used for this review; congress abstracts are not included.
Assessment of Muscle Contractile Properties
Evoked Muscular Contraction
Muscle contraction can be voluntary or stimulated. Whilst the MMG technique has been used with either type of contraction, TMG only operates with stimulated muscle contraction. Therefore, in this review we only refer to stimulated muscle contraction.
Single twitch can be defined as the contractile response to a single electrical impulse and is a specific type of evoked muscle activity used to characterise the mechanical properties of a muscle or a single motor unit. The electrical stimulus can be applied to the motor nerve [7] or to the motor point identified on the muscle surface [8]. Either way, the stimulation travels through the nerve fibre and eventually reaches the muscle fibre. A rectangular stimulus is the most used in practice; however, stimuli of different shapes can be delivered [9]. Additionally, stimuli should be bipolar, with a negative area trailing the positive one, to avoid the polarization at the electrode-skin interface. Polarization may result in a less efficient current injection through the nerve. The duration of the stimulus spans from 25 to 1000 ls in subjects without neuromuscular diseases.
In the last 30 years, a number of studies have recorded the MMG signal following single-twitch stimulation. Early work of Barry [10] and Frangioni et al. [11] described the mechanisms of MMG generation in isolated frog muscle. A more recent paper by Kaczmarek et al. [12] examined in more detail the outward and inward muscle surface displacement and has related this phenomenon to the orientation of the muscle fibres. The time-relationship between electrical activation of the muscle, muscle surface displacement and tension generation has been studied by means of MMG in several studies, revealing a shorter latency of the MMG signal compared to the electromyogram activity [e.g. [13][14][15].
Mechanomyography detected by piezoelectric [16] or electric condenser [17] microphones, during evoked 'single motor unit' activity, produces a signal amplitude presenting a linear relationship with the specific rate and amount of force. Results also are dependent on the fast or slow classification of the investigated unit. A similar conclusion has been reported when a ''whole muscle'' response is analysed in slow-and fast-twitch human muscles [18]. These early experiments could be considered as the underpinning evidence that muscle surface displacement is strictly linked to features of muscle mechanical output at the tendon; hence, they provide the rationale for the TMG technique application reviewed here.
Changes in muscle contractile properties associated with peripheral fatigue have been extensively studied in the time domain analysis of evoked single twitch. In this condition, the amplitude of recorded MMG parallels observed torque reduction [15,19,20]. However, when twitch amplitude increases because of post-activation potentiation, the recorded MMG [21] and TMG [22] amplitudes also increase, which may [23] or may not [24] be accompanied by increased twitch speed. Specific neuromuscular diseases show a lengthening of the electromechanical delay [25] or a depression of the postactivation potentiation, [26] and this has been reflected by a reduction in the MMG signal amplitude.
Evoked muscular contraction using single-twitch stimulation, with the TMG signal being recorded, has been explored in a number of studies and applications. This evidence is extensively covered from Sect. 3 onwards.
Measurement of Radial Displacement of the Skeletal Muscle Following a Stimulus
The usefulness of detecting a change in muscle thickness to characterise muscle contraction was first recognised almost 100 years ago. In a textbook of physiology from the early 20th century, it is advocated that ''… the analysis of the mechanical effects of muscle excitements would be incomplete if only changes in muscle length were examined disregarding changes in muscle thickness …'' [27]. About 50 years later, Margaria and De Caro [28] detailed a method to record the contraction wave from the changes in muscle thickness. A curarized muscle was directly electrically stimulated by two wires, and two levers transduced the surface displacement on a kymograph. In more recent years, the technology for detecting radial displacement of skeletal muscle has obviously improved thanks to the development of a variety of relatively lightweight and low-cost sensors. The sensitivity of the sensors has also improved, along with the ability to process and analyse the signal. This has made this type of measurement more common. The laser sensor can detect the distance between the laser-beam head and the surface of the muscle and therefore any change in the distance as a result of muscle contraction [29]. Very light accelerometers secured to the skin have also been used for this purpose, either a single piezoelectric accelerometer [e.g. 30] or an array of accelerometers to characterise the spatial activity distribution of the muscle [31]. Alternatively, an accelerometer mounted on a probe pressed against the muscle has been used [32]. Piezoelectric contact sensors and microphones have been mainly used during dynamic muscle contractions [33]. The contact sensors are mechanically coupled to the muscle surface (using elastic or adhesive bands or an external support), whereas the microphones are coupled to the muscle surface via air, ultrasound gel or surgical cement [29].
Laser sensors, accelerometers, contact sensors and microphones have been used in the past 30 years to assess muscle function using MMG. An alternative sensor to detect radial displacement of skeletal muscle was proposed for the first time in 1996 [34]. However, a comprehensive description of this sensor only appeared the following year-it consisted of a spring-loaded probe embedded in a displacement sensor and pressed against the muscle with a pressure of 0.2 N/cm 2 [35]. Interestingly, even though the latter is commonly regarded as the first study to have employed TMG, the term was not used. To the best of our knowledge, it was only in 2001 that a study was published using a very similar sensor (probe with a pressure of 0.015 N/mm 2 ) and the term TMG was adopted for the first time [36]. A recent study made the first direct comparison between a contact sensor (similar to that employed in TMG) and a laser sensor [37]. After five consecutive single-twitch maximal stimulations, either sensor measured muscle displacement of the same portion of the muscle belly. Both MMG sensors showed good to excellent test-retest reliability. However, when comparing them a systematic bias was observed, with the contact sensor recording greater values than the laser sensor. The authors attributed this difference to the nature of the sensor (the laser is not in direct contact with the skin, unlike the contact sensor). They also argued that the differences may be clinically irrelevant.
Ljubljana, Slovenia, [35,36,[38][39][40] TMG has been developed as an alternative method to measure radial deformation of muscle. A high-precision (4-lm) digital displacement sensor is applied to the muscle belly with a controlled pre-tension between the sensor tip and the muscle. It is this pre-tension from which the method has derived the name TMG [36], and by providing controlled pre-tension the muscle twitch response is augmented, enhancing the measurement of contraction dynamics [41].
Muscle twitch is induced through a single 1-ms-wide electrical stimulus. In the TMG literature, there is currently no consensus regarding the polar orientation of electrodes. Indeed, this information has often been absent; however, we recommend the cathode be placed proximal to the anode, in line with the details provided in Sect. 2.1. Stimulation amplitude is variable inter-individually, as the amplitude required to provide a maximal muscle response is not equal among all muscles or individuals. It would be inappropriate to apply a similar stimulation amplitude universally as multiple factors influence muscle response, including: motor unit recruitment threshold, skin conductivity, subcutaneous depth, water retention and temperature [41]. Typically, studies report peak responses occurring at stimulation amplitudes between 60 and 100 mA. To identify the maximal required stimulation amplitude, and thus peak muscle response, a progressive incremental approach is adopted [42]. Stimulation amplitudes of increasing intensity are delivered intermittently-a time interval of 10 s is allotted between consecutive measurements to restrict the impact of fatigue and potentiation on the muscle under investigation [41]. Peak muscle twitch is identified by a plateau in displacement curves that, despite an increased stimulation amplitude, does not result in greater muscle displacement (Fig. 1).
Care must be taken to ensure precise positioning of sensors and electrodes, to avoid the detection of co-activation of deeper or neighbouring muscles, which could be misconstrued as further increases in peak radial displacement (Dm). An initial amplitude of 20-30 mA, with 10-mA incremental increases (up to a maximum of 110 mA), has been most widely adopted. Increments of \ 10 mA may lead to an observed plateau, before supramaximal stimulation has been reached. A small number of peer-reviewed studies have adopted a different approach, using a single universal amplitude (typically 100 mA); whilst this may provide adequate results, the rigor of such an approach is less than that of the incremental protocol. The incremental approach allows the operator to visualise the development of the twitch curve, as it grows towards a plateau with increasing stimulation amplitude (Fig. 1); this is not possible with the single stimulation method. We therefore recommend following the incremental protocol, which has been most widely reported within published research to date.
A number of parameters are extracted from twitch displacement/time curves (Fig. 2). Peak radial displacement signifies the absolute spatial transverse deformation of the muscle; reduced Dm is interpreted as an increase in muscle stiffness, therefore larger Dm implies lower muscle stiffness [43]. Contraction time (Tc) is measured as the time taken on the ascending curve between 10 and 90% of Dm. Contraction time therefore reflects the speed of twitch force generation; longer Tc means a slower twitch force generation, which could be a reflection of muscle fibre type but it could also depend on decreased tendon stiffness [43]. Among children aged 9-14 years, regular participation in sport (at least 3 h/week in the previous 5 years) has been associated with shorter Tc of biceps femoris [44]. In a similar population, shorter Tc of biceps femoris has been associated with faster running speed [45]. Delay time (Td) represents the time between delivery of the electrical stimulus and 10% of Dm, providing a measure of muscle responsiveness [46]. Half-relaxation time is given as the time taken from 90 to 50% of Dm on the descending curve; the duration for which twitch is sustained (Ts) is measured as the time between 50% of Dm on each side of the twitch curve, with each of these latter two parameters providing a theoretical assessment of muscle fibre fatigue status [46,47].
Contraction time is partly dependent on Dm, i.e. the greater Dm is the longer the Tc will be, if muscle excitability is the same. Therefore, it is important to measure the actual velocity of the muscle contraction. Contraction velocity (Vc) can be calculated as the rate of DDm between 10 and 90% relative to Tc [48]. Whilst Tc provides a measure of the speed at which the muscle reaches maximal Dm, Vc describes the rate of muscle contraction, and is independent of Dm. Similarly, Valenčič and Knez, [35] Rodríguez-Ruiz et al. [49] and Rodríguez-Ruiz et al. [50] have all reported normalised response speed (Vrn), representing the relationship between DDm between 10 and 90% and DTc divided by absolute Dm. It is not uncommon for Tc and Dm to alter disproportionately to one another; however, in such instances, we propose that the change in Tc, independent from Dm, will be driven by an alteration in the rate of contraction, as measured by Vc or Vrn. The most appropriate method to define Vc has yet to be established, and a number of variations have been described. In addition to the approach presented above, Loturco et al. [51] calculated Vc by dividing Dm by the sum of Tc and Td. Others have calculated Vc from the time elapsed when Dm had reached a specific threshold: 2 mm, [52,53] or 10 and 90% of Dm [54]. We suggest that further study is required to establish the most appropriate standard for assessing twitch velocity in relation to objective functional markers of muscle speed.
Validity and Reliability of Tensiomyography
Given that TMG is intended to measure, in vivo, contractile and mechanical properties of the skeletal muscle, criterionreferenced validity is inherently difficult to quantify. The construct validity of the TMG technique has been determined in a number of papers by relating the Tc, or Vc, to the proportion of slow-twitch fibres of the muscle/s examined ( Table 1). The very first attempt was conducted 20 years ago [35]. The authors showed, in one single subject, that Vc was lower in muscles known for having a higher percentage of slow-twitch fibres and was higher in faster muscles. Similarly, Valenčič et al. [42] related Tc measures to the percentage of type I muscle fibres provided from mammalian reference material (reported by Ariano et al. [55]) and reported an R 2 = 0.81. A slightly stronger research design was used a few years later [36]; muscle biopsies were taken from a group of 15 cadavers of healthy individuals who died suddenly. The percentage of type I muscle fibres was found to be positively correlated with Tc (r = 0.93), as measured by TMG, in a group of 15 subjects, matched with the cadavers for age and physical characteristics.
In a follow-up study using the same two samples, [38] the muscle fibre type was identified for the superficial and deep portion of a number of muscles in the cadaver group. The 15 subjects were measured for TMG using low-and high-intensity electrical stimulation, with the intention of recruiting superficial and deep portions of the muscle, respectively. The authors found a positive correlation between Tc at low-intensity stimulation and the percentage of type I muscle fibres in the superficial portion of the muscle (r = 0.76); and a positive correlation between Tc at high-intensity stimulation and the percentage of type I muscle fibres in the deep portion of the muscle (r = 0.90). A recent study [56] adopted a more robust research design than any of the previous investigations. A larger sample size was used (n = 27) and from the same subjects, TMG measurements and muscle biopsies from the vastus lateralis were taken. The authors found a positive and significant correlation between the proportion of myosin heavy chain I and Tc (r = 0.88), Td (r = 0.61) and Tr (r = 0.67).
In an attempt to contribute to construct the validity of TMG using a different approach, Dahmane et al. [39] observed a difference in Tc of the biceps femoris between 15 healthy men (30.25 ± 3.5 ms) and 15 male sprinters Inter-rater reliability has also been examined, with specific focus on the importance of transducer and electrode positioning [47]. In a similar finding, ICC was greater than 0.86 for each parameter, and the coefficient of variation (CV) below 5%, with the exception of Tr. It was noted that deliberately altering the inter-electrode distance significantly impacted the measurement of Dm, likely owing to a change in the recruitment pattern. Muscle fibres do not shorten homogeneously, owing to non-uniform sarcomeres, myofibres or fascicle lengths [57]. Therefore, consideration is also necessary regarding sensor positioning as morphological changes may occur in a muscle when the sensor is repositioned [58].
Inter-day reliability has returned comparatively favourable results, [59] with Dm and Tc in particular displaying ICCs of no less than 0.98, and CVs below 5%, across three separate lower limb muscles. However, the practical applicability of these findings must be queried, as measurements were performed following 60 min of bed rest. As such, Ditroilo et al. [60] evaluated the reliability of TMG in different muscle conditions-rested, exercised and fatigued; additionally assessing long-term (4-week interval) stability of the contractile parameters. Although reliability was reported to suffer when measurements were carried out over longer intervals (ICC ranging from 0.86 to 0.95 and CV from 14.8 to 8.0% for Dm; ICC ranging from 0.62 to 0.92 and CV from 9.4 to 3.8% for Tc), it is interesting that the measurements displayed greater reliability in an exercised or fatigued state, compared with a rested state.
As a result of the reported findings of these four reliability studies, it has been recommended that assessment carried out through TMG should focus on the most stable parameters, namely Dm and Tc [61]. Half-relaxation time is consistently the least reliable parameter across studies; in intra-session reliability (ICC = 0.86 [41]); in inter-session reliability (CV ranging from 6.4 to 9.3%, ICC \ 0.90 [59]); in inter-rater reliability (CV = 14.2%, ICC = 0.77 [47]); and in long-term stability (CV ranging from 29.4 to 32.7%, ICC \ 0.82 [60]).
In accordance with recommendations derived from the above-mentioned reliability studies, [41,47,59,60] Dm and Tc have been the most thoroughly investigated parameters using TMG. The existing body of research suggests that TMG may provide a valid alternative to more invasive analyses of skeletal muscle properties [32]. Peak radial displacement is typically considered in association with muscle stiffness and tendon mechanical properties [56,[62][63][64]; although to date, no study has compared Dm with a direct assessment of muscle stiffness in vivo. It has also been shown that fluctuations in muscle size, such as following disuse atrophy, [43,65] are associated (r = -0.70) with changes in Dm; thus increased Dm accompanied a reduction in muscle thickness. This decreased thickness would have led to diminished muscle stiffness, [66] allowing greater Dm in response to electrical stimulation.
To apply TMG effectively, it is important to integrate TMG parameter measurements with physiologically functional variables. That said, the relationship between contractile parameters (Dm and Tc) and muscle function has yet to be fully elucidated. Comparisons between twitch torque/force and TMG-recorded parameters [67,68] have x not measured, TMG tensiomyography, ICC Intra-class correlation coefficient, CV coefficient of variation Dm displacement, ICC intra-class correlation coefficient, Tc contraction time, Td delay time, Ts sustain time, Tr half-relaxation time, Ts sustain time suggested different mechanisms affect longitudinal and transversal skeletal muscle deformations. Torque, exerted by a contracted muscle belly, and detected longitudinally, must transmit via connective tissue to be measured externally, with a degree of slack present in the musculotendinous unit, which must be taken up before the connective tissue exerts the torque that represents muscle belly twitch force. Additional damping occurs from passive surrounding tissue, further interfering with longitudinal twitch interpretation [67]. Measuring temporal features of muscle radial displacement may provide limited insight into contraction speed. Because Tc is extracted as the duration of twitch between 10 and 90% of peak Dm, Tc is highly dependent on the size of Dm. Therefore, Tc may not provide an objective assessment of Vc. As such, to date, Dm, potentially assessing excitability [54] and/or passive tension, [56,[62][63][64] would appear to be the most advantageous mechanical measurement using TMG. Relative assessments of the speed of Dm (Vc and Vrn) may prove to be insightful, [69]; however, further investigations under different physiological conditions are required.
Applications of Tensiomyography
Assessment of Sporting Populations
As highlighted in the previous section, the validity and reliability of TMG have not been well established among specialist populations, including elite athletes. That being said, the use of TMG within a sports setting has recently been discussed [70]. In particular, interest surrounds the intensive demands of training and competition. Where supercompensation [71] transitions towards functional overreaching, performance may be negatively affected [72]. Muscle mechanical adaptations have been measured through TMG with strength [52,54] and endurance training [46]. Additionally, differences in mechanical properties between endurance and strength/power athletes have been described [73]. Measurements of Dm were lower following high-load resistance exercise compared with workloadmatched high-volume training [52]; while Tc was longer, and Dm tended to be reduced, following 6 days of highintensity interval training [70]. Among the few sport-specific applications of TMG assessment published to date, soccer has received the greatest attention. Soccer studies focussing on injury have described how reconstructive surgery and subsequent rehabilitation, following anterior cruciate ligament injury, have resulted in modified contractile mechanics of muscles in lower extremities on the injured limb, compared with both the contralateral limb and to uninjured soccer players [74]. Furthermore, Alentorn-Geli et al. [75,76] have proposed TMG as an appropriate screening tool to investigate knee flexor muscle stiffness as a risk factor for anterior cruciate ligament injury, with injured individuals presenting greater Dm and longer Tc (in the uninjured limb) compared with injury-free individuals [75]. The authors suggested that these differences, between individuals who have experienced an anterior cruciate ligament injury and those with no history of an anterior cruciate ligament injury, could hint at elevated susceptibility to ligament injury. Balance between contractile mechanics of knee flexors and extensors may be linked to co-contraction and this was also suggested as an important predictor for injury risk [75].
Such studies have strengthened the case for inclusion of TMG muscle contractile assessment within training [77] and rehabilitation programmes [78]. We suggest that further integration of TMG with established physiological markers is required to validate the technique for use further within high-performance sport. Soccer has also been the basis for longitudinal research into contractile alterations across a 10-week training cycle [79]. Spatial and temporal parameters were influenced by the training period, with reported reductions in Dm and Tc of knee extensors; furthermore, lower Dm in knee extensors and flexors were observed among soccer players compared with a control group. Similarly, García-García et al. [63] presented data describing longer Tc in latissimus dorsi, and longer Tc and Td, as well as larger Dm, in the trapezius, among female kayakers compared with non-kayakers. These differences are attributed to kayak-specific training. Differences have also been described between Vrn of knee extensors and flexors among volleyball players of different positions [50].
Greater insight could be provided by incorporating more regular measurements, throughout training cycles, as well as overlapping mechanical assessments with functional performance measures [e.g. running speed, counter movement jump (CMJ)]. To this end, Gil et al. [80] examined the association between TMG parameters and performance indicators (tests of jumping and sprinting) in elite soccer players. A moderate association (r & 0.5; p \ 0.05) was only found between Dm and parameters linked to the stretch-shortening cycle performance. This further supports the idea of Dm being a reflection of muscle stiffness [43]. In a similar type of approach, using physiological performance indicators, García-García [81] related TMG parameters to maximal oxygen consumption and power at maximal oxygen consumption and found a significant correlation between Dm and these performance indicators (r [ 0.6; p \ 0.05) only for biarticular muscles such as the biceps and rectus femoris. However, the study does not seem to provide a convincing physiological explanation for the observed association.
While the studies discussed in this section provide a promising start, there is certainly a demand for further evidence to grow our understanding of the direct links between TMG-derived twitch parameters and muscle performance. It would be remiss not to question the external validity of the technique within sporting applications given the low level of muscle contraction elicited; adding context to the parameters is crucial, and incorporating well-understood physiological measures in parallel with TMG is undoubtedly the sensible approach. Moreover, intervention-based research will be invaluable as the use of TMG continues to expand into the domain of elite sport.
Muscle Fatigue and Exercise-Induced Muscle Damage
To date, ten papers have been published examining the use of TMG to monitor the effect of fatigue. However, because the types of fatigue that can be induced are quite different, we have divided the studies into general vs. local fatigue ( Table 3). General fatigue was induced using an ultra-endurance triathlon, [46] an uphill-marathon, [82] lower limb strength training, [54] a 6-day high-intensity interval training, [70] a 6-day strength training, [83] or a 6-day strength or endurance training micro-cycle [69]. Local fatigue was induced using two different protocols of arm curls, [52] 2 min of cycling at maximal aerobic capacity [84] or a 5-min electrical stimulation programme [48]. As expected, a decline in Dm was observed in the three studies that induced local fatigue [48,52,84]. This occurrence was likely owing to impaired propagation of the electrical stimulus along the sarcolemma, resulting in less muscle displacement. This impairment is likely to occur from a pH-driven alteration of the Na ? and K ? gradient [85] across the muscle membrane, resulting in reduced Ca 2? and subsequent excitation-contraction coupling, [48] or through accumulation of inorganic phosphate within muscle cells.
Interestingly, of the seven studies inducing general fatigue, four reported a decrease in Dm, [70,83] two showed an increase in Dm, [46,82] whilst the other showed no change [86]. It has to be noted though that Raeder et al. [83] Wiewelhove et al. [70] de Paula Simola et al. [54] and de Paula Simola et al. [69] all used variations of high-intensity resistance or endurance training, or interval training, over short periods of time. Conversely, two other studies established the effects of ultra-endurance on TMG, namely an Ironman Ò triathlon [46] and an uphillmarathon (43 km, 3063 m elevation gain; [82]). Wiewelhove et al. [86] also adopted a high-intensity interval protocol, but despite reporting a decline in CMJ, there were no alterations in Dm. It is worth noting that CMJ incorporates multiple muscle groups across multiple joints, as well as including a central component, [87] while TMG analyses individual muscles in isolation from the central nervous system; for this reason, careful contextual consideration is required before attempting to assess muscle fatigue through TMG alone. In the case of the reduced muscle stiffness observed following ultra-endurance running, [46] it may follow that elevated cytokine release stimulated altered peripheral feedback [88]. Furthermore, conflicting results were reported for Tc, which showed a post-fatigue increase [46,70] or decrease, [82] or no change [83].
As discussed in Sect. 3, changes in Tc should be treated with caution, as measurements are subject to biasing influences from changes in Dm. Vc and Vrn are relative measures of twitch contraction speed, and therefore remain Macgregor et al. [48] Local ;
x = García-Manso et al. [52] Local ;
x ;
Carrasco et al. [84] Local ;
x x
Hunter et al. [89] EIMD ; : x : increased; ; decreased; = unchanged, x not measured. TMG tensiomyography, EIMD exercise induced muscle damage, Dm displacement, EIMD exercise induced muscle damage, Tc contraction time, Vc contraction velocity independent from Dm; however, Macgregor et al. [48] and Wiewelhove et al. [86] both reported no change in Vc in fatigued muscle. Furthermore, de Paula Simola et al. [54] and de Paula Simola et al. [69] both demonstrated decreases in Vc; interestingly, impaired Vc was delayed until 72 h after completion of high-intensity endurance training, unlike high-intensity strength training, following which Vc was impaired immediately. One previous study [89] adopted TMG as an objective assessment of exercise-induced muscle damage. Peak radial displacement was reduced, while Tc was extended, following eccentric exercise. Changes in Dm followed the same profile as reductions in muscle force capacity [correlation coefficient ranged from r = 0.55 (± 0.2) to r = 0.67 (± 0.27)], with a strong relationship also between Dm and creatine kinase levels, and changes in limb circumference and muscle soreness. It seems that TMG Dm can provide useful insights when assessing fatigue or muscle damage, although temporal parameters should be treated with caution.
Recovery
It is important to incorporate routine assessment of fatigue and recovery into training programmes, to help inform optimisation of training prescription and ensure competition readiness. Practically however, individuals will respond variably to given training stimuli, hence inconsistencies in quantifiable fatigue or recovery markers are commonplace [70]. Exorbitant levels of intense training, particularly incorporating only brief recovery time, subject the musculoskeletal system to considerable physiological demands, impairing subsequent performance [90]. Two different modalities of recovery have been investigated. The first is active recovery, which features submaximal 'warm-down' exercises combined with stretching target muscles [91]; it is designed to promote greater peripheral blood flow, preventing venous pooling, and to attenuate symptoms of muscle soreness and reduce musculotendinous stiffness. Passive recovery involves no specialised activities, but instead relies on resting for a period of time to promote muscle restoration. Rey et al. [92] compared 12 min of low-intensity running and 8 min of lower limb static stretching, with 20 min of passive recovery, in professional soccer players; complete recovery of Td, Tc and Dm was observed in the biceps femoris and rectus femoris, following both interventions. Recovery using whole-body vibrations following high-intensity exercise did not cause a change in the TMG variables when compared to passive recovery [84]. Similarly, no effect of foam rolling, a sports recovery tool, was observed on the TMG variables [93]. Following passive recovery only, elevated muscle soreness was reported, but despite this, there was no difference in TMG parameters between active and passive recoveries.
Comparing passive recovery following high-load or high-volume resistance training, García-Manso et al. [52] observed a more rapid recovery of biceps brachii Dm following high-volume (i.e. lower load) training between 6 and 15 min following the completion of exercise. Halfrelaxation time differed between groups, with high-load training resulting in longer Tr than high-volume training between 6 and 10 min following exercise; Tr was similar between groups by 15 min post-exercise. Sustain time also was longer following high-load training, but only up to 6 min post-exercise.
In another study, García-Manso et al. [94] described reductions in Dm, as well as slower Vc, following exposure to cold water immersion, a common practice to help recovery after high-intensity sport activity. The authors attributed this alteration in muscle stiffness to reduced Ca2 ? transport and changes in viscoelastic properties of the muscle. Based on the existing evidence, TMG can provide a non-invasive assessment of exercise recovery and will not in itself impact the recovery process.
Muscle Fibre Type
Five studies have attempted to relate the parameters extracted from TMG to type I muscle fibres to explore whether TMG can be used as a non-invasive method to estimate muscle fibre-type composition. These studies also represent the foundation for determining the construct validity of the TMG technique and have been described in detail in Sect. 3.2. Table 1 summarises the main results.
Very recently, Zubac and Š imunič [95] applied a noninvasive estimation of type I muscle fibres to link measurements of Dm and Tc to a performance marker (CMJ), following 8 weeks of plyometric training. They demonstrated an inverse correlation (r = -0.67) between improved CMJ following training and a change in estimated myosin heavy chain I.
Muscle Stiffness
While TMG will detect alterations in rates of muscle contraction, it will also measure muscle passive tension attributed to connective tissue elements between muscle fibres along with sarcoplasm and sarcolemma [96]. However, there have been a limited number of TMG studies that have experimentally isolated muscle length changes to determine how effective TMG is for measuring muscle stiffness per se. Pišot et al. [43] measured TMG and muscle thickness loss following 35 days of bed rest whereupon they demonstrated increased Dm alongside reduced muscle thickness. This reduced muscle mass would have reduced muscle stiffness to allow for greater Dm in response to the stimulus [66]. This negative correlation between muscle thickness and Dm indicates a lower muscle resting tension, resulting from muscle atrophy. As such, TMG amplitude (Dm) reflects muscle belly stiffness in the same way that MMG amplitude has been suggested to do [97].
An alternative method for altering stiffness of a muscle is to change its length by flexing the joint it is attached to. Ditroilo et al. [98] did this by flexing the knee joint and measuring TMG of the biceps femoris at three different angles (0°, 45°and 90°); as expected Dm increased alongside joint angle. Nevertheless, when using TMG to detect muscle status it can be difficult to differentiate between excitation and contraction coupling and stiffness changes, as in most situations both parameters are affected. Koren et al. [68] provide evidence that temporal parameters extracted by TMG from the displacement curve are shorter compared with the same parameters extracted from the twitch torque curve, suggesting that they are related more to intrinsic muscle properties. As such, TMG provides a complementary measure of muscle contraction dynamics to typical measurements of force and torque responses.
Currently, there is a shortage of data investigating potential intervention-associated alterations in muscle stiffness, using TMG. One case study has been published [99] describing increased Dm associated with reduced muscle stiffness, as a result of a dry needling treatment in a stroke patient. We propose that the application of TMG as a measure of interventions designed to alter local muscular stiffness is an area that requires greater attention.
Symmetry
Bilateral muscular asymmetry has previously been investigated in association with injury prevalence [100] and more recently, athletic ability [101,102]. Indeed, bilateral strength asymmetry can predict injury [103] and sporting performance [104,105]. Monitoring of asymmetry has also been conducted to assess the effectiveness of rehabilitation programmes and to inform when an individual is able to return to their sport or activity [106]. Tensiomyography allows for assessment of asymmetry at the individual muscle level, allowing the specific muscle underlying any bilateral imbalance to be identified [74][75][76]. Asymmetric TMG responses have been reported in injured soccer players, prior to anterior cruciate ligament reconstruction, with greater symmetry restored following surgery [74].
However, in a different study, asymmetries have been reported to persist for more than 2 years following surgery [107]. Uninjured soccer players were assessed for symmetry, with no differences between limbs observed for biceps femoris or rectus femoris, in Dm or Tc [74,80].
Vastus lateralis and vastus medialis did, however, display asymmetry with regard to Tc [74]. A study with a similar population showed less than 10% bilateral asymmetry in vastus medialis and up to about 20% asymmetry in the vastus lateralis, rectus femoris and biceps femoris [108]. In another study, volleyball players have also shown high levels of displacement symmetry in lower limb muscles, regardless of sex, which is in contrast to the untrained general population [50]. Temporal assessment of muscle twitch, however, revealed asymmetric differences in contraction speed in the vastus lateralis in men, and in the vastus medialis, rectus femoris and biceps femoris in women. These observations are attributed to the specific series of skills that are trained in sports such as volleyball [50]. To reduce asymmetry-associated injury risk, TMG could provide a useful measure, by identifying specific muscles that are causing the asymmetry, which additionally is feasible during injury rehabilitation.
Perceived Strengths and Weaknesses of Tensiomyography
There is a general consensus among practitioners that the TMG device is relatively inexpensive compared with laboratory-based equipment, easy to carry and set up, with a quick data collection process. This makes TMG ideal to be used in a field setting, in particular for sports applications, such as monitoring training load and fatigue. Not only is the data collection quick and easy, the pre-tension sensor tip produces a favourable signal-to-noise ratio in muscle response, avoiding the need for special filtering or postprocessing. This makes the TMG technique attractive for sports medicine practitioners and conditioning coaches. Additionally, TMG isolates the muscle of interest, excluding confounding central variables that could bias measurement. Owing to methodological requirements discussed above, such as sensor and electrode positioning, it is suggested that appropriate training and expertise should be applied to capture high-quality data. One of the main limitations of TMG is that the device only allows the examination of electrically stimulated contractions. The level of contraction elicited appears to be fairly low. Valenčič et al. [42] concurrently measured Dm and torque of the tibialis anterior muscle in healthy young subjects and reported values of about 0.3-3.0 mm and 0.1-1.1 Nm, respectively. The same subjects recorded tibialis anterior isometric torque of above 15 Nm during a slow isometric contraction up to the maximum. Ditroilo et al. [98] reported that the level of knee flexor torque recorded following an electrically stimulated contraction using TMG was lower than 10% of maximal voluntary contraction, which has been confirmed by Maffiuletti as reported in Ditroilo et al. [98] and briefly mentioned by Š imunič et al. [56] Surprisingly, this issue has received very little attention in the literature; however, it questions the external validity of the technique, especially for applications to sports performance. Before a conclusion on external validity can be reached, ad-hoc studies examining the relationship between electrical stimulation and level of torque elicited should be conducted on different muscle groups. Interestingly, Pišot et al. [43] managed to isolate the digital displacement sensor of the TMG and apply a voluntary contraction. They found that the muscle displacement increases linearly with muscle torque up to 68% of maximal voluntary contraction and it levels off afterwards. The muscle examined is not known though, thus this again would need more investigation in an attempt to gain a better insight into the relationship between the stimulus and response provided by TMG. As such, there is still much investigation required to pinpoint direct links between TMG and muscle function.
Conclusions
Tensiomyography is an in vivo non-invasive method to examine mechanical and contractile properties of the skeletal muscle. In previous sections, similarities and differences between TMG and MMG have been highlighted; they both use an electrically stimulated contraction to record the radial displacement of the muscle. In TMG, this is done using a digital displacement sensor. Even though the TMG manufacturer and most of the authors of TMG studies regard this technique as novel and unique, with the evidence we have provided we advocate that TMG is a special case of MMG. This might imply a terminology change or clarification in future TMG publications, and a credible consensus statement would help this.
Our final comments for researchers and practitioners are:
Even though construct validity and reliability of TMG have been ascertained, the issue of the low level of muscle contraction elicited questions on the external validity of the technique, at least for some of the applications.
Tensiomyography has been used in a number of applications, most of which concern sports performance and muscle contraction properties.
Reliability and validity among specialist populations (elite athletes, clinical patients) have not been described; therefore, before progressing with the application of TMG in such specialist populations, further research should be carried out to establish its efficacy.
Traditionally, five parameters are extracted from the TMG curve. However, the two most used are Dm and Tc, which are also the parameters with the highest level of reliability; Dm is a valid measure of muscle stiffness, while Tc can predict muscle fibre-type composition. The use of Vc, which combines Dm and Tc, is increasing.
Compliance with Ethical Standards
Funding The preparation of this review was funded by the UK Sport and SportScotland Institute of Sport.
Conflict of interest
Fig. 1
1Typical incremental progression of displacement curves. The increase in curve magnitude is induced by an increase in stimulation amplitude (typically up to 60-100 mA). Peak displacement (Dm) is identified by a plateau in displacement curves, despite increased stimulation amplitude. Peak radial displacement signifies the absolute spatial transverse deformation of the muscle
Fig. 2
2Parameters extracted from a typical displacement curve; displacement (Dm), contraction time (Tc), delay time (Td), contraction velocity (Vc) [Vc = (90%Dm -10%Dm)/Tc], sustain time (Ts) and half-relaxation time (Tr)
Lewis J. Macgregor, Angus M. Hunter, Claudio Orizio, Malcolm M. Fairweather and Massimiliano Ditroilo have no conflicts of interest directly relevant to the content of this review. Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http:// creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.
Table 1
1Summary of the studies correlating contraction time (Tc), one of the tensiomyography parameters, with and slow-twitch muscle fibre typeTc contraction time, MHC myosin heavy chain Tensiomyography to Assess Muscle Contractile Properties 1611 (19.5 ± 2.5 ms) aged 17-40 years. An inverse and significant correlation between Tc and running speed in sprinters was also reported (r = -0.72, p \ 0.05). Reliability of TMG measurement parameters has previously been investigated across a variety of conditions, in a number of studies (Table 2). Krizaj et al. [41] analysed short-term repeatability of each parameter extracted from muscle twitch responses, by delivering 30 consecutive stimulations and capturing individual measurements from each twitch response. Intra-class correlation coefficient (ICC) of 0.86 or greater was recorded for all parameters.Study, year
Comparison
Table 2
2Tensiomyography (TMG) reliabilityStudy, year
Muscle
TMG parameters
Dm
Tc
Td
Ts
Tr
Krizaj et al. [41]
Biceps brachii
ICC
0.98
0.97
0.94
0.89
0.86
CV (%) x
x
x
x
x
Tous-Fajardo et al. [47] Vastus medialis
ICC
0.97
0.92
0.86
0.96
0.77
CV (%) 4.7
3.4
2.7
14.2
2.4
Š imunič [59]
Vastus lateralis
ICC
0.99
0.98
0.89
0.96
0.89
CV (%) 1.8
1.5
4.4
7.6
4.7
Ditroilo et al. [60]
Gastrocnemius
medialis
ICC
0.86 to -0.95 0.62 to -0.92 0.56 to -0.62 0.71 to -0.86 0.67 to -0.79
CV (%) 8.0 to -14.8 3.8 to -9.4
7.0 to -9.2
5.3 to -8.2
27.8 to -32.7
Table 3 Tensiomyography
3(TMG) response after fatigue
Study, year
Type of fatigue/EIMD
TMG parameters
Dm
Tc
Vc
Wiewelhove et al. [86]
General
=
=
=
Raeder et al. [83]
General
;
=
x
de Paula Simola et al. [69]
General
;
=
;
de Paula Simola et al. [54]
General
;
;
;
Wiewelhove et al. [70]
General
; (trend)
:
x
Giovanelli et al. [82]
General
:
;
x
García-Manso et al. [46]
General
:
:
x
Tensiomyography: A Special Case of Mechanomyography? 3.1 Tensiomyography: Overview of the Technique Over the last two decades, primarily through pioneering work at the Faculty of Electrical Engineering, University of Tensiomyography to Assess Muscle Contractile Properties 1609
Molecular mechanisms in muscular contraction. J M Squire, Trends Neurosci. 6Squire JM. Molecular mechanisms in muscular contraction. Trends Neurosci. 1983;6:409-13.
The influence of Swammerdam. T Kardel, Steno on muscles. Kardel TPhiladelphia (PAAmerican Philosophical SocietyKardel T. The influence of Swammerdam. In: Kardel T, editor. Steno on muscles. Philadelphia (PA): American Philosophical Society; 1994. p. 16-7.
Volume change and pressure development in muscle during contraction. R Baskin, P Paolini, Am J Physiol. 2134Baskin R, Paolini P. Volume change and pressure development in muscle during contraction. Am J Physiol. 1967;213(4):1025-30.
Surface mechanomyogram reflects length changes in fascicles of human skeletal muscles. Y Yoshitake, Y Kawakami, H Kanehisa, T Fukunaga, Int J Sport Health Sci. 3Yoshitake Y, Kawakami Y, Kanehisa H, Fukunaga T. Surface mechanomyogram reflects length changes in fascicles of human skeletal muscles. Int J Sport Health Sci. 2005;3(Special_Issue_2005):280-5.
Laser-detected lateral muscle displacement is correlated with force fluctuations during voluntary contractions in humans. Y Yoshitake, K Masani, M Shinohara, J Neurosci Methods. 1732Yoshitake Y, Masani K, Shinohara M. Laser-detected lateral muscle displacement is correlated with force fluctuations during voluntary contractions in humans. J Neurosci Methods. 2008;173(2):271-8.
Muscle fatigue monitored by the force, surface mechanomyogram and EMG. C Orizio, Biomechanics and biology of movement. Nigg BM, MacIntosh BR, Mester JChampaign, IllinoisOrizio C. Muscle fatigue monitored by the force, surface mechanomyogram and EMG. In: Nigg BM, MacIntosh BR, Mester J, editors. Biomechanics and biology of movement. Champaign, Illinois: Human Kinetics; 2000, p 409-33.
Twitch potentiation induced by two different modalities of neuromuscular electrical stimulation: implications for motor unit recruitment. Regina Dias Da Silva, S Neyroud, D Maffiuletti, N A Gondin, J Place, N , Muscle Nerve. 513Regina Dias Da Silva S, Neyroud D, Maffiuletti NA, Gondin J, Place N. Twitch potentiation induced by two different modali- ties of neuromuscular electrical stimulation: implications for motor unit recruitment. Muscle Nerve. 2015;51(3):412-8.
The age related slow and fast contributions to the overall changes in tibialis anterior contractile features disclosed by maximal single twitch scan. C Orizio, M Cogliati, L Bissolotti, B Diemont, M Gobbo, J Celichowski, Arch Gerontol Geriatr. 66Orizio C, Cogliati M, Bissolotti L, Diemont B, Gobbo M, Celichowski J. The age related slow and fast contributions to the overall changes in tibialis anterior contractile features disclosed by maximal single twitch scan. Arch Gerontol Geriatr. 2016;66:1-6.
Stimulation artifact in surface EMG signal: effect of the stimulation waveform, detection system, and current amplitude using hybrid stimulation technique. F Mandrile, D Farina, M Pozzo, R Merletti, IEEE Trans Neural Syst Rehabil Eng. 114Mandrile F, Farina D, Pozzo M, Merletti R. Stimulation artifact in surface EMG signal: effect of the stimulation waveform, detection system, and current amplitude using hybrid stimula- tion technique. IEEE Trans Neural Syst Rehabil Eng. 2003;11(4):407-15.
Acoustic signals from frog skeletal muscle. D Barry, Biophys J. 515Barry D. Acoustic signals from frog skeletal muscle. Biophys J. 1987;51(5):769-73.
The mechanism of low-frequency sound production in muscle. J V Frangioni, T S Kwan-Gett, L E Dobrunz, T A Mcmahon, Biophys J. 515Frangioni JV, Kwan-Gett TS, Dobrunz LE, McMahon TA. The mechanism of low-frequency sound production in muscle. Biophys J. 1987;51(5):775-83.
The image of motor units architecture in the mechanomyographic signal during the single motor unit contraction: in vivo and simulation study. P Kaczmarek, J Celichowski, H Drzymała-Celichowska, A Kasiński, J Electromyogr Kinesiol. 194Kaczmarek P, Celichowski J, Drzymała-Celichowska H, Kasiński A. The image of motor units architecture in the mechanomyographic signal during the single motor unit con- traction: in vivo and simulation study. J Electromyogr Kinesiol. 2009;19(4):553-63.
Recording sound from human skeletal muscle: technical and physiological aspects. C F Bolton, A Parkes, T R Thompson, M R Clark, C J Sterne, Muscle Nerve. 122Bolton CF, Parkes A, Thompson TR, Clark MR, Sterne CJ. Recording sound from human skeletal muscle: technical and physiological aspects. Muscle Nerve. 1989;12(2):126-34.
Vibrations and sounds from evoked muscle twitches. D Barry, Electromyogr Clin Neurophysiol. 321-2Barry D. Vibrations and sounds from evoked muscle twitches. Electromyogr Clin Neurophysiol. 1991;32(1-2):35-40.
Phonomyogram of the diaphragm during unilateral and bilateral phrenic nerve stimulation and changes with fatigue. M Petitjean, F Bellemare, Muscle Nerve. 1710Petitjean M, Bellemare F. Phonomyogram of the diaphragm during unilateral and bilateral phrenic nerve stimulation and changes with fatigue. Muscle Nerve. 1994;17(10):1201-9.
Mechanomyograms recorded during evoked contractions of single motor units in the rat medial gastrocnemius muscle. E Bichler, Eur J Appl Physiol. 834Bichler E. Mechanomyograms recorded during evoked con- tractions of single motor units in the rat medial gastrocnemius muscle. Eur J Appl Physiol. 2000;83(4):310-9.
Characteristics of surface mechanomyogram are dependent on development of fusion of motor units in humans. Y Yoshitake, M Shinohara, H Ue, T Moritani, J Appl Physiol. 935Yoshitake Y, Shinohara M, Ue H, Moritani T. Characteristics of surface mechanomyogram are dependent on development of fusion of motor units in humans. J Appl Physiol. 2002;93(5):1744-52.
Can evoked phonomyography be used to recognize fast and slow muscle in man?. M Marchetti, F Felici, M Bernardi, P Minasi, Di Filippo, L , Int J Sports Med. 131Marchetti M, Felici F, Bernardi M, Minasi P, Di Filippo L. Can evoked phonomyography be used to recognize fast and slow muscle in man? Int J Sports Med. 1992;13(1):65-8.
Muscle fatigue measured with evoked muscle vibrations. D T Barry, T Hill, D Im, Muscle Nerve. 153Barry DT, Hill T, Im D. Muscle fatigue measured with evoked muscle vibrations. Muscle Nerve. 1992;15(3):303-9.
Torque and surface mechanomyogram parallel reduction during fatiguing stimulation in human muscles. M Gobbo, E Ce, B Diemont, F Esposito, C Orizio, Eur J Appl Physiol. 971Gobbo M, Ce E, Diemont B, Esposito F, Orizio C. Torque and surface mechanomyogram parallel reduction during fatiguing stimulation in human muscles. Eur J Appl Physiol. 2006;97(1):9-15.
The effect of postactivation potentiation on the mechanomyogram. N Shima, C L Rice, Y Ota, K Yabe, Eur J Appl Physiol. 961Shima N, Rice CL, Ota Y, Yabe K. The effect of postactivation potentiation on the mechanomyogram. Eur J Appl Physiol. 2006;96(1):17-23.
Repeated stimulation, interstimulus interval and inter-electrode distance alters muscle contractile properties as measured by tensiomyography. H V Wilson, M I Johnson, P Francis, 10.1371/journal.pone.0191965PLoS One. 132191965Wilson HV, Johnson MI, Francis P. Repeated stimulation, inter- stimulus interval and inter-electrode distance alters muscle contractile properties as measured by tensiomyography. PLoS One. 2018;13(2):e0191965. https://doi.org/10.1371/journal. pone.0191965.
Postactivation potentiation, fiber type, and twitch contraction time in human knee extensor muscles. T Hamada, D G Sale, J D Macdougall, M A Tarnopolsky, J Appl Physiol. 886Hamada T, Sale DG, MacDougall JD, Tarnopolsky MA. Postactivation potentiation, fiber type, and twitch contraction time in human knee extensor muscles. J Appl Physiol (1985). 2000;88(6):2131-7.
. 10.1152/jappl.2000.88.6.2131https://doi.org/10.1152/jappl.2000.88.6. 2131.
Comparison of twitch potentiation in the gastrocnemius of young and elderly men. R J Petrella, D A Cunningham, A A Vandervoort, D H Paterson, Eur J Appl Physiol Occup Physiol. 584Petrella RJ, Cunningham DA, Vandervoort AA, Paterson DH. Comparison of twitch potentiation in the gastrocnemius of young and elderly men. Eur J Appl Physiol Occup Physiol. 1989;58(4):395-9.
Veicsteinas A. Electrically-elicited surface mechanomyogram in myotonic dystrophy. C Orizio, F Esposito, I Paganotti, L Marino, B Rossi, Ital J Neurol Sci. 184Orizio C, Esposito F, Paganotti I, Marino L, Rossi B, Veic- steinas A. Electrically-elicited surface mechanomyogram in myotonic dystrophy. Ital J Neurol Sci. 1997;18(4):185-90.
Mechanomyographic determination of post-activation potentiation in myopathies. A R Ng, K Arimura, K Akataki, K Mita, I Higuchi, M Osame, Clin Neurophysiol. 1171Ng AR, Arimura K, Akataki K, Mita K, Higuchi I, Osame M. Mechanomyographic determination of post-activation potentia- tion in myopathies. Clin Neurophysiol. 2006;117(1):232-9.
Fisiologia dell'uomo. VI ed. Milano: Società Editrice Libraria. L Luciani, Luciani L. Fisiologia dell'uomo. VI ed. Milano: Società Editrice Libraria; 1923.
IV ed. Milano: Casa Editrice Vallardi-Società Editrice Libraria. R Margaria, De Caro, L Fisiologia Umana, Margaria R, De Caro L. Fisiologia Umana. IV ed. Milano: Casa Editrice Vallardi-Società Editrice Libraria; 1977.
Surface mechanomyogram. C Orizio, Electromyography: physiology, engineering and noninvasive applications. Merletti R, Parker PHoboken, NJWileyOrizio C. Surface mechanomyogram. In: Merletti R, Parker P, editors. Electromyography: physiology, engineering and nonin- vasive applications. Hoboken, NJ: Wiley; 2004, p. 305-19.
Mechanomyography and electromyography force relationships during concentric, isometric and eccentric contractions. P Madeleine, P Bajaj, K Søgaard, L Arendt-Nielsen, J Electromyogr Kinesiol. 112Madeleine P, Bajaj P, Søgaard K, Arendt-Nielsen L. Mechanomyography and electromyography force relationships during concentric, isometric and eccentric contractions. J Elec- tromyogr Kinesiol. 2001;11(2):113-21.
Spatial and force dependency of mechanomyographic signal features. P Madeleine, C Cescon, D Farina, J Neurosci Methods. 1581Madeleine P, Cescon C, Farina D. Spatial and force dependency of mechanomyographic signal features. J Neurosci Methods. 2006;158(1):89-99.
Validation of an accelerometer for determination of muscle belly radial displacement. T Zagar, D Krizaj, Med Biol Eng Comput. 431Zagar T, Krizaj D. Validation of an accelerometer for determi- nation of muscle belly radial displacement. Med Biol Eng Comput. 2005;43(1):78-84.
Mechanomyography and muscle function assessment: a review of current state and prospects. M O Ibitoye, N A Hamzaid, J M Zuniga, Aka Wahab, Clin Biomech. 296Ibitoye MO, Hamzaid NA, Zuniga JM, Wahab AKA. Mechanomyography and muscle function assessment: a review of current state and prospects. Clin Biomech (Bristol, Avon). 2014;29(6):691-704.
Properties of musculus gluteus maximus in above-knee amputees. H Burger, V Valenčič, C Marincek, N Kogovsek, Clin Biomech. 111Burger H, Valenčič V, Marincek C, Kogovsek N. Properties of musculus gluteus maximus in above-knee amputees. Clin Bio- mech (Bristol, Avon). 1996;11(1):35-8.
Measuring of skeletal muscles' dynamic properties. V Valenčič, N Knez, Artif Organs. 213Valenčič V, Knez N. Measuring of skeletal muscles' dynamic properties. Artif Organs. 1997;21(3):240-2.
Evaluation of the ability to make non-invasive estimation of muscle contractile properties on the basis of the muscle belly response. R Dahmane, V Valenčič, N Knez, I Eržen, Med Biol Eng Comput. 391Dahmane R, Valenčič V, Knez N, Eržen I. Evaluation of the ability to make non-invasive estimation of muscle contractile properties on the basis of the muscle belly response. Med Biol Eng Comput. 2001;39(1):51-5.
Test-retest reliability and reproducibility of laser-vs contact-displacement sensors in mechanomyography: implications for musculoskeletal research. L Seidl, D Tosovic, J M Brown, J Appl Biomech. 332Seidl L, Tosovic D, Brown JM. Test-retest reliability and reproducibility of laser-vs contact-displacement sensors in mechanomyography: implications for musculoskeletal research. J Appl Biomech. 2016;33(2):130-6.
Spatial fiber type distribution in normal human muscle Histochemical and tensiomyographical evaluation. R Dahmane, S Djordjevic, B Valencic, V , J Biomech. 3812Dahmane R, Djordjevic S, Š imunič B, Valencic V. Spatial fiber type distribution in normal human muscle Histochemical and tensiomyographical evaluation. J Biomech. 2005;38(12):2451-9.
Adaptive potential of human biceps femoris muscle demonstrated by histochemical, immunohistochemical and mechanomyographical methods. R Dahmane, S Djordjevic, V Smerdu, Med Biol Eng Comput. 4411Dahmane R, Djordjevic S, Smerdu V. Adaptive potential of human biceps femoris muscle demonstrated by histochemical, immunohistochemical and mechanomyographical methods. Med Biol Eng Comput. 2006;44(11):999-1006.
The muscle adaptation process as a result of pathological changes or specific training procedures. K Kersevan, V Valenčič, S Djordjevic, Cell Mol Biol Lett. 72Kersevan K, Valenčič V, Djordjevic S, Š imunič B. The muscle adaptation process as a result of pathological changes or specific training procedures. Cell Mol Biol Lett. 2002;7(2):367-9.
Short-term repeatability of parameters extracted from radial displacement of muscle belly. D Krizaj, B Zagar, T , J Electromyogr Kinesiol. 184Krizaj D, Š imunič B, Zagar T. Short-term repeatability of parameters extracted from radial displacement of muscle belly. J Electromyogr Kinesiol. 2008;18(4):645-51.
Tensiomyography: detection of skeletal muscle response by means of radial muscle belly displacement. V Valenčič, N Knez, Š , B , Biomed Eng. 1Valenčič V, Knez N, Š imunič B. Tensiomyography: detection of skeletal muscle response by means of radial muscle belly dis- placement. Biomed Eng. 2001;1:1-10.
Whole muscle contractile parameters and thickness loss during 35-day bed rest. R Pišot, M V Narici, B , De Boer, M Seynnes, O Jurdana, M , Eur J Appl Physiol. 1042Pišot R, Narici MV, Š imunič B, De Boer M, Seynnes O, Jurdana M, et al. Whole muscle contractile parameters and thickness loss during 35-day bed rest. Eur J Appl Physiol. 2008;104(2):409-14.
Tensiomyographic assessment of muscle contractile properties in 9-to 14-year old children. B Š Imunič, H Degens, J Zavrsnik, K Koren, T Volmut, R Pišot, Int J Sports Med. 389Š imunič B, Degens H, Zavrsnik J, Koren K, Volmut T, Pišot R. Tensiomyographic assessment of muscle contractile properties in 9-to 14-year old children. Int J Sports Med. 2017;38(9):659-65.
Biomechanical characteristics of skeletal muscles and associations between running speed and contraction time in 8-to 13-year-old children. J Zavrsnik, R Pisot, B Kokol, P , Blazun Vosner, H , J Int Med Res. 451Zavrsnik J, Pisot R, Š imunič B, Kokol P, Blazun Vosner H. Biomechanical characteristics of skeletal muscles and associa- tions between running speed and contraction time in 8-to 13-year-old children. J Int Med Res. 2017;45(1):231-45.
Assessment of muscle fatigue after an ultra-endurance triathlon using tensiomyography (TMG). J M García-Manso, D Rodriguez-Ruiz, D Rodriguez-Matoso, Y De Saa, S Sarmiento, M Quiroga, J Sports Sci. 296García-Manso JM, Rodriguez-Ruiz D, Rodriguez-Matoso D, de Saa Y, Sarmiento S, Quiroga M. Assessment of muscle fatigue after an ultra-endurance triathlon using tensiomyography (TMG). J Sports Sci. 2011;29(6):619-25.
Inter-rater reliability of muscle contractile property measurements using non-invasive tensiomyography. J Tous-Fajardo, G Moras, S Rodriguez-Jimenez, R Usach, D M Doutres, N A Maffiuletti, J Electromyogr Kinesiol. 204Tous-Fajardo J, Moras G, Rodriguez-Jimenez S, Usach R, Doutres DM, Maffiuletti NA. Inter-rater reliability of muscle contractile property measurements using non-invasive ten- siomyography. J Electromyogr Kinesiol. 2010;20(4):761-6.
Reduced radial displacement of the gastrocnemius medialis muscle after electrically elicited fatigue. L J Macgregor, M Ditroilo, I J Smith, M M Fairweather, A M Hunter, J Sport Rehabil. 253Macgregor LJ, Ditroilo M, Smith IJ, Fairweather MM, Hunter AM. Reduced radial displacement of the gastrocnemius medialis muscle after electrically elicited fatigue. J Sport Rehabil. 2016;25(3):241-7.
Effects of age and physical activity on response speed in knee flexor and extensor muscles. D Rodríguez-Ruiz, J García-Manso, D Rodríguez-Matoso, S Sarmiento, M Da Silva-Grigoletto, R Pisot, Eur Rev Aging Phys Act. 102Rodríguez-Ruiz D, García-Manso J, Rodríguez-Matoso D, Sar- miento S, da Silva-Grigoletto M, Pisot R. Effects of age and physical activity on response speed in knee flexor and extensor muscles. Eur Rev Aging Phys Act. 2013;10(2):127-32.
Analysis of the response speed of musculature of the knee in professional male and female volleyball players. D Rodríguez-Ruiz, I Diez-Vega, D Rodriguez-Matoso, M Fernandez-Del-Valle, R Sagastume, J J Molina, Biomed Res Int. 239708Rodríguez-Ruiz D, Diez-Vega I, Rodriguez-Matoso D, Fernan- dez-del-Valle M, Sagastume R, Molina JJ. Analysis of the response speed of musculature of the knee in professional male and female volleyball players. Biomed Res Int. 2014;2014:239708.
Muscle contraction velocity: a suitable approach to analyze the functional adaptations in elite soccer players. I Loturco, L A Pereira, R Kobal, K Kitamura, R Ramírez-Campillo, V Zanetti, J Sports Sci Med. 153483Loturco I, Pereira LA, Kobal R, Kitamura K, Ramírez-Campillo R, Zanetti V, et al. Muscle contraction velocity: a suitable ap- proach to analyze the functional adaptations in elite soccer players. J Sports Sci Med. 2016;15(3):483.
Effect of high-load and high-volume resistance exercise on the tensiomyographic twitch response of biceps brachii. J M García-Manso, D Rodriguez-Matoso, S Sarmiento, Y De Saa, D Vaamonde, D Rodriguez-Ruiz, J Electromyogr Kinesiol. 224García-Manso JM, Rodriguez-Matoso D, Sarmiento S, de Saa Y, Vaamonde D, Rodriguez-Ruiz D, et al. Effect of high-load and high-volume resistance exercise on the tensiomyographic twitch response of biceps brachii. J Electromyogr Kinesiol. 2012;22(4):612-9.
Evaluacion de la respuesta muscular como herramienta de control en el campo de la actividad fisica, la salud y el deporte. D Rodríguez-Matoso, J Garcia-Manso, S Sarmiento, Y De Saa, D Vaamonde, D Rodriguez-Ruiz, Rev Andaluza Med Deporte. 51Rodríguez-Matoso D, Garcia-Manso J, Sarmiento S, de Saa Y, Vaamonde D, Rodriguez-Ruiz D, et al. Evaluacion de la respuesta muscular como herramienta de control en el campo de la actividad fisica, la salud y el deporte. Rev Andaluza Med Deporte. 2012;5(1):28-40.
Assessment of neuromuscular function after different strength training protocols using tensiomyography. R A De Paula Simola, N Harms, C Raeder, M Kellmann, T Meyer, M Pfeiffer, J Strength Cond Res. 295de Paula Simola RA, Harms N, Raeder C, Kellmann M, Meyer T, Pfeiffer M, et al. Assessment of neuromuscular function after different strength training protocols using tensiomyography. J Strength Cond Res. 2015;29(5):1339-48.
Hindlimb muscle fiber populations of five mammals. M Ariano, V Edgerton, R Armstrong, J Histochem Cytochem. 211Ariano M, Edgerton V, Armstrong R. Hindlimb muscle fiber populations of five mammals. J Histochem Cytochem. 1973;21(1):51-5.
Noninvasive estimation of myosin heavy chain composition in human skeletal muscle. B Š Imunič, H Degens, J Rittweger, M Narici, I B Mekjavic, R Pišot, Med Sci Sports Exerc. 439Š imunič B, Degens H, Rittweger J, Narici M, Mekjavic IB, Pišot R. Noninvasive estimation of myosin heavy chain composition in human skeletal muscle. Med Sci Sports Exerc. 2011;43(9):1619-25.
From sarcomeres to whole muscles. D Morgan, J Exp Biol. 1151Morgan D. From sarcomeres to whole muscles. J Exp Biol. 1985;115(1):69-78.
Reproducibility of muscle response measurements using tensiomyography in a range of positions. D Rodríguez-Matoso, D Rodríguez-Ruiz, S Sarmiento, D Vaamonde, Da Silva-Grigoletto, M García-Manso, J , Rev Andal Med Deporte. 33Rodríguez-Matoso D, Rodríguez-Ruiz D, Sarmiento S, Vaa- monde D, Da Silva-Grigoletto M, García-Manso J. Repro- ducibility of muscle response measurements using tensiomyography in a range of positions. Rev Andal Med Deporte. 2010;3(3):81-6.
Between-day reliability of a method for non-invasive estimation of muscle composition. B Š Imunič, J Electromyogr Kinesiol. 224Š imunič B. Between-day reliability of a method for non-inva- sive estimation of muscle composition. J Electromyogr Kinesiol. 2012;22(4):527-30.
Long-term stability of tensiomyography measured under different muscle conditions. M Ditroilo, I J Smith, M M Fairweather, A M Hunter, J Electromyogr Kinesiol. 233Ditroilo M, Smith IJ, Fairweather MM, Hunter AM. Long-term stability of tensiomyography measured under different muscle conditions. J Electromyogr Kinesiol. 2013;23(3):558-63.
Reliability of tensiomyography (TMG) as a muscle assessment tool. A Benítez Jiménez, K Fernández Roldán, Montero Doblas, J , Romacho Castro, J , Rev Int Med Cienc Act Fis Dep. 1352Benítez Jiménez A, Fernández Roldán K, Montero Doblas J, Romacho Castro J. Reliability of tensiomyography (TMG) as a muscle assessment tool. Rev Int Med Cienc Act Fis Dep. 2013;13(52):647-56.
Differences in the contractile properties of the knee extensor and flexor muscles in professional road cyclists during the season. O García-García, J M Cancela-Carral, R Martinez-Trigo, V Serrano-Gomez, J Strength Cond Res. 2710García-García O, Cancela-Carral JM, Martinez-Trigo R, Ser- rano-Gomez V. Differences in the contractile properties of the knee extensor and flexor muscles in professional road cyclists during the season. J Strength Cond Res. 2013;27(10):2760-7.
Neuromuscular profile of top-level women kayakers assessed through tensiomyography. O García-García, J M Cancela-Carral, F Huelin-Trillo, J Strength Cond Res. 293García-García O, Cancela-Carral JM, Huelin-Trillo F. Neuro- muscular profile of top-level women kayakers assessed through tensiomyography. J Strength Cond Res. 2015;29(3):844-53.
The tensiomyography used for evaluating high level beach volleyball players. D Rodríguez-Ruiz, Quiroga Escudero, M E , Rodríguez Matoso, D , Sarmiento Montesdeoca, S , Losa Reyna, J , Saá Guerra, Y D , Rev Bras Med Esporte. 182Rodríguez-Ruiz D, Quiroga Escudero ME, Rodríguez Matoso D, Sarmiento Montesdeoca S, Losa Reyna J, Saá Guerra YD, et al. The tensiomyography used for evaluating high level beach volleyball players. Rev Bras Med Esporte. 2012;18(2):95-9.
Physical inactivity effect on morphological and musculoskeletal changes. R Pišot, B Dolenc, P , Acta Salus Vitae. 41Pišot R, Š imunič B, Dolenc P. Physical inactivity effect on morphological and musculoskeletal changes. Acta Salus Vitae. 2016;4(1):34-49.
Influence of 90-day simulated microgravity on human tendon mechanical properties and the effect of resistive countermeasures. N D Reeves, C N Maganaris, G Ferretti, M V Narici, J Appl Physiol. 986Reeves ND, Maganaris CN, Ferretti G, Narici MV. Influence of 90-day simulated microgravity on human tendon mechanical properties and the effect of resistive countermeasures. J Appl Physiol. 2005;98(6):2278-86.
Twitch parameters in transversal and longitudinal biceps brachii response. B Š Imunič, D Krizaj, M Narici, R Pišot, Ann Kinesiol. 1Š imunič B, Krizaj D, Narici M, Pišot R. Twitch parameters in transversal and longitudinal biceps brachii response. Ann Kinesiol. 2010;1:61-80.
Differences between skeletal muscle contractile parameters estimated from transversal tensiomyographic and longitudinal torque twitch response. K Koren, B Rejc, E Lazzer, S Pišot, R , Kineziologija. 471Koren K, Š imunič B, Rejc E, Lazzer S, Pišot R. Differences between skeletal muscle contractile parameters estimated from transversal tensiomyographic and longitudinal torque twitch response. Kineziologija. 2015;47(1):19-26.
Muscle mechanical properties of strength and endurance athletes and changes after one week of intensive training. R Á De Paula Simola, C Raeder, T Wiewelhove, M Kellmann, T Meyer, M Pfeiffer, J Electromyogr Kinesiol. 30de Paula Simola RÁ , Raeder C, Wiewelhove T, Kellmann M, Meyer T, Pfeiffer M, et al. Muscle mechanical properties of strength and endurance athletes and changes after one week of intensive training. J Electromyogr Kinesiol. 2016;30:73-80.
Markers for routine assessment of fatigue and recovery in male and female team sport athletes during highintensity interval training. T Wiewelhove, C Raeder, T Meyer, M Kellmann, M Pfeiffer, A Ferrauti, PLoS One. 1010139801Wiewelhove T, Raeder C, Meyer T, Kellmann M, Pfeiffer M, Ferrauti A. Markers for routine assessment of fatigue and recovery in male and female team sport athletes during high- intensity interval training. PLoS One. 2015;10(10):e0139801.
The science of winning: planning, periodizing and optimizing swim training. Tienen: F&G Partners. J Olbrecht, Olbrecht J. The science of winning: planning, periodizing and optimizing swim training. Tienen: F&G Partners; 2015
Monitoring training load to understand fatigue in athletes. S L Halson, Sports Med. 442Halson SL. Monitoring training load to understand fatigue in athletes. Sports Med. 2014;44(2):139-47.
Differences in muscle mechanical properties between elite power and endurance athletes: a comparative study. I Loturco, S Gil, C F De Souza Laurino, H Roschel, R Kobal, Cal Abad, C C , J Strength Cond Res. 296Loturco I, Gil S, de Souza Laurino CF, Roschel H, Kobal R, Cal Abad CC, et al. Differences in muscle mechanical properties between elite power and endurance athletes: a comparative study. J Strength Cond Res. 2015;29(6):1723-8.
Effects of anterior cruciate ligament reconstruction on neuromuscular tensiomyographic characteristics of the lower extremity in competitive male soccer players. P Alvarez-Diaz, Alentorn-Geli , E , Ramon S Marin, M Steinbacher, G Rius, M , Knee Surg Sports Traumatol Arthrosc. 2311Alvarez-Diaz P, Alentorn-Geli E, Ramon S, Marin M, Stein- bacher G, Rius M, et al. Effects of anterior cruciate ligament reconstruction on neuromuscular tensiomyographic characteris- tics of the lower extremity in competitive male soccer players. Knee Surg Sports Traumatol Arthrosc. 2015;23(11):3407-13.
Assessment of neuromuscular risk factors for anterior cruciate ligament injury through tensiomyography in male soccer players. E Alentorn-Geli, P Alvarez-Diaz, Ramon S Marin, M Steinbacher, G Boffa, J J , Knee Surg Sports Traumatol Arthrosc. 239Alentorn-Geli E, Alvarez-Diaz P, Ramon S, Marin M, Stein- bacher G, Boffa JJ, et al. Assessment of neuromuscular risk factors for anterior cruciate ligament injury through ten- siomyography in male soccer players. Knee Surg Sports Trau- matol Arthrosc. 2015;23(9):2508-13.
Assessment of gastrocnemius tensiomyographic neuromuscular characteristics as risk factors for anterior cruciate ligament injury in male soccer players. E Alentorn-Geli, P Alvarez-Diaz, Ramon S Marin, M Steinbacher, G Rius, M , Knee Surg Sports Traumatol Arthrosc. 239Alentorn-Geli E, Alvarez-Diaz P, Ramon S, Marin M, Stein- bacher G, Rius M, et al. Assessment of gastrocnemius ten- siomyographic neuromuscular characteristics as risk factors for anterior cruciate ligament injury in male soccer players. Knee Surg Sports Traumatol Arthrosc. 2015;23(9):2502-7.
Tensiomyography method used for neuromuscular assessment of muscle training. L D Rusu, G G Cosma, S M Cernaianu, M N Marin, P F Rusu, D P Ciocanescu, J Neuroeng Rehabil. 1067Rusu LD, Cosma GG, Cernaianu SM, Marin MN, Rusu PF, Ciocanescu DP, et al. Tensiomyography method used for neu- romuscular assessment of muscle training. J Neuroeng Rehabil. 2013;10:67.
Tensiomyography in physical rehabilitation of high level athletes. P S Dias, J S Fort, D A Marinho, A Santos, M C Marques, Open Sports Sci J. 3Dias PS, Fort JS, Marinho DA, Santos A, Marques MC. Ten- siomyography in physical rehabilitation of high level athletes. Open Sports Sci J. 2010;3:47-8.
Assessment of the in-season changes in mechanical and neuromuscular characteristics in professional soccer players. O García-García, V Serrano-Gomez, A Hernandez-Mendo, A Tapia-Flores, J Sports Med Phys Fitness. 566García-García O, Serrano-Gomez V, Hernandez-Mendo A, Tapia-Flores A. Assessment of the in-season changes in mechanical and neuromuscular characteristics in professional soccer players. J Sports Med Phys Fitness. 2016;56(6):714-23.
Tensiomyography parameters and jumping and sprinting performance in Brazilian elite soccer players. S Gil, I Loturco, V Tricoli, C Ugrinowitsch, R Kobal, Cal Abad, C C , Sports Biomech. 143Gil S, Loturco I, Tricoli V, Ugrinowitsch C, Kobal R, Cal Abad CC, et al. Tensiomyography parameters and jumping and sprinting performance in Brazilian elite soccer players. Sports Biomech. 2015;14(3):340-50.
The relationship between parameters of tensiomyography and potential performance indicators in professional cyclists. O García-García, Rev Int Med Cienc Act Fís Deporte. 1352García-García O. The relationship between parameters of ten- siomyography and potential performance indicators in profes- sional cyclists. Rev Int Med Cienc Act Fís Deporte. 2013;13(52):771-81.
Effects of an uphill marathon on running mechanics and lower-limb muscle fatigue. N Giovanelli, P Taboga, E Rejc, B Antonutto, G Lazzer, S , Int J Sports Physiol Perform. 114Giovanelli N, Taboga P, Rejc E, Š imunič B, Antonutto G, Lazzer S. Effects of an uphill marathon on running mechanics and lower-limb muscle fatigue. Int J Sports Physiol Perform. 2016;11(4):522-9.
Assessment of fatigue and recovery in male and female athletes following six days of intensified strength training. C Raeder, T Wiewelhove, R A De Paula Simola, M Kellmann, T Meyer, M Pfeiffer, J Strength Cond Res. 3012Raeder C, Wiewelhove T, De Paula Simola RA, Kellmann M, Meyer T, Pfeiffer M, et al. Assessment of fatigue and recovery in male and female athletes following six days of intensified strength training. J Strength Cond Res. 2016;30(12):3412-27.
Effectiveness of low-frequency vibration recovery method on blood lactate removal, muscle contractile properties and on time to exhaustion during cycling at VO(2)max power output. L Carrasco, B Sanudo, M De Hoyo, F Pradas, Da Silva, M E , Eur J Appl Physiol. 1119Carrasco L, Sanudo B, de Hoyo M, Pradas F, Da Silva ME. Effectiveness of low-frequency vibration recovery method on blood lactate removal, muscle contractile properties and on time to exhaustion during cycling at VO(2)max power output. Eur J Appl Physiol. 2011;111(9):2271-9.
pH-induced effects on median frequency and conduction velocity of the myoelectric signal. L Brody, M T Pollock, S H Roy, De Luca, C Celli, B , J Appl Physiol. 715Brody L, Pollock MT, Roy SH, De Luca C, Celli B. pH-induced effects on median frequency and conduction velocity of the myoelectric signal. J Appl Physiol. 1991;71(5):1878-85.
Tensiomyographic markers are not sensitive for monitoring muscle fatigue in elite youth athletes: a pilot study. T Wiewelhove, C Raeder, Paula De, R A Simola, C Schneider, A Doweling, A Ferrauti, Front Physiol. 8406Wiewelhove T, Raeder C, de Paula Simola RA, Schneider C, Doweling A, Ferrauti A. Tensiomyographic markers are not sensitive for monitoring muscle fatigue in elite youth athletes: a pilot study. Front Physiol. 2017;8:406.
A biomechanical analysis of good and poor performers of the vertical jump. A Vanezis, A Lees, Ergonomics. 48Vanezis A, Lees A. A biomechanical analysis of good and poor performers of the vertical jump. Ergonomics. 2005;48(11-14):1594-603.
Changes in running mechanics and spring-mass behavior induced by a mountain ultra-marathon race. J Morin, K Tomazin, P Edouard, G Millet, J Biomech. 446Morin J, Tomazin K, Edouard P, Millet G. Changes in running mechanics and spring-mass behavior induced by a mountain ultra-marathon race. J Biomech. 2011;44(6):1104-7.
Assessment of eccentric exercise-induced muscle damage of the elbow flexors by tensiomyography. A M Hunter, S D Galloway, I J Smith, J Tallent, M Ditroilo, M M Fairweather, J Electromyogr Kinesiol. 223Hunter AM, Galloway SD, Smith IJ, Tallent J, Ditroilo M, Fairweather MM, et al. Assessment of eccentric exercise-in- duced muscle damage of the elbow flexors by tensiomyography. J Electromyogr Kinesiol. 2012;22(3):334-41.
The use of recovery methods post-exercise. T Reilly, B Ekblom, J Sports Sci. 236Reilly T, Ekblom B. The use of recovery methods post-exercise. J Sports Sci. 2005;23(6):619-27.
A survey of flexibility training protocols and hamstring strains in professional football clubs in England. B Dadebo, J White, K P George, Br J Sports Med. 384Dadebo B, White J, George KP. A survey of flexibility training protocols and hamstring strains in professional football clubs in England. Br J Sports Med. 2004;38(4):388-94.
The effect of recovery strategies on contractile properties using tensiomyography and perceived muscle soreness in professional soccer players. E Rey, C Lago-Penas, J Lago-Ballesteros, L Casais, J Strength Cond Res. 2611Rey E, Lago-Penas C, Lago-Ballesteros J, Casais L. The effect of recovery strategies on contractile properties using ten- siomyography and perceived muscle soreness in professional soccer players. J Strength Cond Res. 2012;26(11):3081-8.
Sixty seconds of foam rolling does not affect functional flexibility or change muscle temperature in adolescent athletes. A M Murray, T W Jones, C Horobeanu, A P Turner, J Sproule, Int J Sports Phys Ther. 115Murray AM, Jones TW, Horobeanu C, Turner AP, Sproule J. Sixty seconds of foam rolling does not affect functional flexi- bility or change muscle temperature in adolescent athletes. Int J Sports Phys Ther. 2016;11(5):765-76.
Effect of cold-water immersion on skeletal muscle contractile properties in soccer players. J M García-Manso, D Rodriguez-Matoso, D Rodriguez-Ruiz, S Sarmiento, Y De Saa, J Calderon, Am J Phys Med Rehabil. 905García-Manso JM, Rodriguez-Matoso D, Rodriguez-Ruiz D, Sarmiento S, de Saa Y, Calderon J. Effect of cold-water immersion on skeletal muscle contractile properties in soccer players. Am J Phys Med Rehabil. 2011;90(5):356-63.
Skeletal muscle contraction time and tone decrease after 8 weeks of plyometric training. D Zubac, J Strength Cond Res. 316Zubac D, Š imunič B. Skeletal muscle contraction time and tone decrease after 8 weeks of plyometric training. J Strength Cond Res. 2017;31(6):1610-9.
Changes in passive tension of muscle in humans and animals after eccentric exercise. N P Whitehead, N Weerakkody, J Gregory, D Morgan, U Proske, J Physiol. 5332Whitehead NP, Weerakkody N, Gregory J, Morgan D, Proske U. Changes in passive tension of muscle in humans and animals after eccentric exercise. J Physiol. 2001;533(2):593-604.
Mechanomyographic responses to concentric isokinetic muscle contractions. T K Evetovich, T J Housh, J R Stout, G O Johnson, D B Smith, K T Ebersole, Eur J Appl Physiol Occup Physiol. 752Evetovich TK, Housh TJ, Stout JR, Johnson GO, Smith DB, Ebersole KT. Mechanomyographic responses to concentric isokinetic muscle contractions. Eur J Appl Physiol Occup Physiol. 1997;75(2):166-9.
The effectiveness of two novel techniques in establishing the mechanical and contractile responses of biceps femoris. M Ditroilo, A M Hunter, S Haslam, De Vito, G , Physiol Meas. 328Ditroilo M, Hunter AM, Haslam S, De Vito G. The effectiveness of two novel techniques in establishing the mechanical and contractile responses of biceps femoris. Physiol Meas. 2011;32(8):1315-26.
Effects of dry needling (DNHS technique) on the contractile properties of spastic muscles in a patient with stroke: a case report. S Calvo, I Quintero, P Herrero, Int J Rehabil Res. 394Calvo S, Quintero I, Herrero P. Effects of dry needling (DNHS technique) on the contractile properties of spastic muscles in a patient with stroke: a case report. Int J Rehabil Res. 2016;39(4):372-6.
Hamstring muscle strain recurrence and strength performance disorders. J-L Croisier, B Forthomme, M-H Namurois, M Vanderthommen, J-M Crielaard, Am J Sports Med. 302Croisier J-L, Forthomme B, Namurois M-H, Vanderthommen M, Crielaard J-M. Hamstring muscle strain recurrence and strength performance disorders. Am J Sports Med. 2002;30(2):199-203.
Isometric force production symmetry and jumping performance in collegiate athletes. C Bailey, K Sato, Alexander R Chiang, C-Y Stone, M H , J Trainol. 21Bailey C, Sato K, Alexander R, Chiang C-Y, Stone MH. Iso- metric force production symmetry and jumping performance in collegiate athletes. J Trainol. 2013;2(1):1-5.
Asymmetry between the dominant and non-dominant legs in the kinematics of the lower extremities during a running single leg jump in collegiate basketball players. T Sugiyama, M Kameda, M Kageyama, K Kiba, H Kanehisa, A Maeda, J Sports Sci Med. 134951Sugiyama T, Kameda M, Kageyama M, Kiba K, Kanehisa H, Maeda A. Asymmetry between the dominant and non-dominant legs in the kinematics of the lower extremities during a running single leg jump in collegiate basketball players. J Sports Sci Med. 2014;13(4):951.
Strength imbalances and prevention of hamstring injury in professional soccer players a prospective study. J-L Croisier, S Ganteaume, J Binet, M Genty, J-M Ferret, Am J Sports Med. 368Croisier J-L, Ganteaume S, Binet J, Genty M, Ferret J-M. Strength imbalances and prevention of hamstring injury in professional soccer players a prospective study. Am J Sports Med. 2008;36(8):1469-75.
Analysis of lower limb asymmetries by isokinetic and vertical jump tests in soccer players. H-J Menzel, M H Chagas, L A Szmuchrowski, S R Araujo, A G De Andrade, F R De Jesus-Moraleida, J Strength Cond Res. 275Menzel H-J, Chagas MH, Szmuchrowski LA, Araujo SR, de Andrade AG, de Jesus-Moraleida FR. Analysis of lower limb asymmetries by isokinetic and vertical jump tests in soccer players. J Strength Cond Res. 2013;27(5):1370-7.
Lower body symmetry and running performance in elite Jamaican track and field athletes. R Trivers, B Fink, M Russell, K Mccarty, B James, B G Palestis, PLoS One. 911113106Trivers R, Fink B, Russell M, McCarty K, James B, Palestis BG. Lower body symmetry and running performance in elite Jamaican track and field athletes. PLoS One. 2014;9(11):e113106.
Recent advances in the rehabilitation of isolated and combined anterior cruciate ligament injuries. K E Wilk, M M Reinold, T R Hooks, Orthop Clin North Am. 341Wilk KE, Reinold MM, Hooks TR. Recent advances in the rehabilitation of isolated and combined anterior cruciate liga- ment injuries. Orthop Clin North Am. 2003;34(1):107-37.
Symmetry tensiomyographic neuromuscular response after chronic anterior cruciate ligament (ACL) reconstruction. N Maeda, Y Urabe, S Tsutsumi, H Fujishita, S Numano, T Takeuchi, Knee Surg Sports Traumatol Arthrosc. 262Maeda N, Urabe Y, Tsutsumi S, Fujishita H, Numano S, Takeuchi T, et al. Symmetry tensiomyographic neuromuscular response after chronic anterior cruciate ligament (ACL) recon- struction. Knee Surg Sports Traumatol Arthrosc. 2017;26(2):411-7.
Baseline mechanical and neuromuscular profile of knee extensor and flexor muscles in professional soccer players at the start of the pre-season. O García-García, V Serrano-Gómez, A Hernández-Mendo, V Morales-Sánchez, J Hum Kinet. 581García-García O, Serrano-Gómez V, Hernández-Mendo A, Morales-Sánchez V. Baseline mechanical and neuromuscular profile of knee extensor and flexor muscles in professional soccer players at the start of the pre-season. J Hum Kinet. 2017;58(1):23-34.
| Laser Doppler Flowmetry allows the measurement of the blood flow rate of different types of tissue. Rib on a muscle pedicle was compared with rib on a vascular pedicle in an animal experiment. The morphological results were compared with the LDF-results. During eleven clinical transfers of iliac crest bone grafts and one osteocutaneous scapular flap the blood flow values were measured intraoperatively before and after the transplantation. Postoperative monitoring was possible for 48 hours with the endoscopic probe and a screw implant. The blood flow of vascularized bone transplants is excellent and even rises post-operatively in some cases. | The linear blood flow velocity and the diameter of main arteries of the lower extremities were measured before and after a 30-min bicycle ergometer exercise in 18- to 22-year-old healthy male volunteers not involved in professional sports (controls), as well as in highly qualified wrestlers and track-and-field athletes. In comparison to the control group, the track-and-field athletes have wider arteries, whereas the wrestlers have stronger muscles. The arteries become wider during the first minutes after the bicycle ergometer exercise, which is accompanied by a decrease in the linear velocity of the blood flow. The athletes, especially the track-and-field athletes, have a shorter transitional period. The arterial blood flow in an extremity shows a 20% increase in the first minutes after the test; the shortest recovery period for this parameter was found in the track-and-field athletes. | 1,999,875 | Continuous percutaneous measurement by laser-Doppler flowmetry of skeletal muscle microcirculation at varying levels of contraction force determined electromyographically | Electromechanical delay (EMD) was described as a time elapsed between first trigger and force output. Various results have been reported based on the measurement method with observed inconsistent results when the trigger is elicited by voluntary contraction. However, mechanomyographic (MMG) sensor placed far away on the skin from the contracting muscle was used to detect muscle fiber motion and excitation-contraction (EC) coupling which may give unreliable results. On this basis, the purpose of this study was to detect EMD during active muscle contraction whilst introducing an ultrafast ultrasound (US) method to detect muscle fiber motion from a certain depth of the muscle. Time delays between onsets of EMG-MMG, EMG-US, MMG-FORCE, US-FORCE, and EMG-FORCE were calculated as 20.5 ± 4.73, 28.63 ± 6.31, 19.21 ± 6.79, 30.52 ± 8.85, and 49.73 ± 6.99 ms, respectively. Intrarater correlation coefficient (ICC) was higher than MMG when ultrafast US was used for detecton of the t EMG-US and t US-FORCE, ICC values of 0.75 and 0.70, respectively. Synchronization of the ultrafast ultrasound with EMG and FORCE sensors can reveal reliable and clinically useful results related to the EMD and its components when muscle is voluntarily contracted. With ultrafast US, we detect onset from the certain depth of the muscle excluding the tissues above the muscle acting as a low-pass filter which can lead to inaccurate time detection about the onset of the contracting muscle fibers. With this non-invasive technique, understanding of the muscle dynamics can be facilitated. (2014) Detection of the electromechanical delay and its components during voluntary isometric contraction of the quadriceps femoris muscle. Front. Physiol. 5:494. | Microscopic Laser Doppler Velocimeter Measuring Blood Velocity in Single Microvessel. | Background:The devices used for in vivo examination of muscle contractions assess only pure force contractions and the so-called isokinetic contractions. In isokinetic experiments, the extremity and its muscle are artificially moved with constant velocity by the measuring device, while a tetanic contraction is induced in the muscle, either by electrical stimulation or by maximal voluntary activation. With these systems, experiments cannot be performed at pre-defined, constant muscle length, single contractions cannot be evaluated individually and the separate examination of the isometric and the isotonic components of single contractions is not possible.Methods:The myograph presented in our study has two newly developed technical units, i.e. a). a counterforce unit which can load the muscle with an adjustable, but constant force and b). a length-adjusting unit which allows for both the stretching and the contraction length to be infinitely adjustable independently of one another. The two units support the examination of complex types of contraction and store the counterforce and lengthadjusting settings, so that these conditions may be accurately reapplied in later sessions.Results:The measurement examples presented show that the muscle can be brought to every possible prestretching length and that single isotonic or complex isometric-isotonic contractions may be performed at every length. The applied forces act during different phases of contraction, resulting into different pre-and after-loads that can be kept constant -uninfluenced by the contraction. Maximal values for force, shortening, velocity and work may be obtained for individual muscles. This offers the possibility to obtain information on the muscle status and to monitor its changes under non-invasive measurement conditions.Conclusion:With the Complex Myograph, the whole spectrum of a muscle's mechanical characteristics may be assessed. | Assessment of human muscle blood perfusion with single-fiber laser Doppler flowmetry | The time constant of venous drainage (tau v) is an important determinant of the return of blood to the heart. The lower the tau v, the higher the flow for a given volume. To determine whether the tau v of muscle decreases during muscle contraction, we anesthetized dogs with pentobarbital sodium and mechanically ventilated them. We isolated the vasculature of the gastrocnemius muscle and attached the muscle to a force transducer. The muscle was pump perfused, and flows were measured with electromagnetic flow probes on the artery and vein. Pressure in the venous compliant region (Pel) was obtained by simultaneously occluding the artery and vein. Changes in volume (delta V) were produced by changing inflow and obtaining the integral of the difference between inflow and outflow. The tau v was obtained from delta V divided by change in flow. Compliance was calculated from delta V divided by change in Pel from before to after a change in flow. The venous resistance was calculated from tau v divided by venous compliance. The muscle was set at the optimal length, and contractions were produced by stimulating the nerve to the muscle with supramaximal voltage at either 1- or 5-Hz trains with stimulations at 20 Hz, 0.2-ms duration, and duty cycle of 0.25. The tau v at rest was 4.06 +/- 2.16 s and decreased to 2.44 +/- 1.07 s (P < 0.05) at 1 Hz and to 1.81 +/- 0.4 s at 5 Hz. There were no significant changes in venous compliance or venous resistance. In conclusion, muscle contractions can reduce the time constant of venous drainage of muscle and could thereby contribute to the increased venous return and cardiac output during exercise. | On the experimental results of a noninvasive estimation technique of muscle conduction velocity distribution | Citation: Fedorovich, A.A.; Loktionova, Y.I.; Zharkikh, E.V.; Mikhailova, M.A.; Popova, J.A.; Suvorov, A.V.; Zherebtsov, E.Abstract: In this study we demonstrate what kind of relative alterations can be expected in average perfusion and blood flow oscillations during postural changes being measured in the skin of limbs and on the brow of the forehead by wearable laser Doppler flowmetry (LDF) sensors. The aims of the study were to evaluate the dynamics of cutaneous blood perfusion and the regulatory mechanisms of blood microcirculation in the areas of interest, and evaluate the possible significance of those effects for the diagnostics based on blood perfusion monitoring. The study involved 10 conditionally healthy volunteers (44 ± 12 years). Wearable laser Doppler flowmetry monitors were fixed at six points on the body: two devices were fixed on the forehead, on the brow; two were on the distal thirds of the right and left forearms; and two were on the distal thirds of the right and left lower legs. The protocol was used to record three body positions on the tilt table for orthostatic test for each volunteer in the following sequence: (a) supine body position; (b) upright body position (+75°); (c) tilted with the feet elevated above the head and the inclination of body axis of 15°(−15°, Trendelenburg position). Skin blood perfusion was recorded for 10 min in each body position, followed by the amplitudefrequency analysis of the registered signals using wavelet decomposition. The measurements were supplemented with the blood pressure and heart rate for every body position analysed. The results identified a statistically significant transformation in microcirculation parameters of the average level of skin blood perfusion and oscillations of amplitudes of neurogenic, myogenic and cardiac sensors caused by the postural changes. In paper, we present the analysis of microcirculation in the skin of the forehead, which for the first time was carried out in various positions of the body. The area is supplied by the internal carotid artery system and can be of particular interest for evaluation of the sufficiency of blood supply for the brain.Keywords: wearable blood flow sensors; blood perfusion; laser Doppler flowmetry; ortostatic test; postural changes; body position; blood perfusion in forehead; blood perfusion in wrists; blood perfusion in shins; blood perfusion oscillations; vasomotions Diagnostics 2021, 11, 436. | Repetitive elastance measurement as a means of recording pharmocological responses in vascular smooth muscles |
1,999,876 | how many phases of oppositional defiant disorder training | Oppositional defiant disorder (ODD) is a behavioral disorder that affects approximately 3.3% of the population across cultures. In this article, the author discusses symptoms, methods of diagnosis, and treatments for the disorder. Although most empirically supported treatments of ODD are based on parent–child training and therapy, there are some principles and strategies that educators can adopt. The author focuses on the salient strategies from research-based programs treating ODD and suggestions for educators on how to incorporate them in the classroom. | Oppositional defiant disorder, one of the disruptive behavior disorders, has far-reaching consequences for the individual, family, school, community, and society. Early recognition allows interventions geared toward promotion of prosocial behaviors, possibly halting progression to the more deviant conduct disorder. Awareness of this disorder and associated comorbidities is the first step that enables the school nurse to use assessment techniques and to assist in planning of interventions for the child. Children at risk often show tendencies toward oppositional defiant disorder as early as preschool. Interventions should be in place by the elementary school years to interrupt the pathways that may be difficult or impossible to change once adolescence begins. The school nurse can be instrumental in educating staff about risk factors, early associated behaviors, and referrals. Implementation of an individualized healthcare plan targets specific behaviors and provides a means of observing and documenting a ch... | Opposition is a natural and beneficial process for children to shape their personality, it is a necessary step in their own and parents' life. It challenges the five rules governing children's life: parents' educational principles, school constraints, social rules, rules with "peers" and children's own rules. However, opposition can become pathological: symptoms of oppositional behaviors include defying requests, psychosomatic disorders in infants, offending behavior and oppositional defiant disorder. It is essential to identify them, encourage active family participation and look for a coexisting psychological condition. Oppositional disorders should be managed rapidly to prevent them from becoming chronic or evolving towards oppositional defiant or conduct disorders. | Altered brain morphology in boys with attention-deficit/hyperactivity disorder with and without comorbid conduct disorder/oppositional defiant disorder | Intermittent explosive disorder (IED) is characterized by a dysfunction in the greater limbic system leading an individual to experience sudden aggressive behavior with little or no environmental perturbation. This report describes a procedure for the treatment of IED in a 19-year-old woman with a history of IED, having had episodes of severe violent attacks against family, dating to early childhood. Due to the severity and intractability of the illness, deep brain stimulation was performed, targeting the orbitofrontal projections to the hypothalamus. The patient's history and the procedure, management, and rationale are described in detail. | Objective: The aim of this study was to compare the effect of methylphenidate (MPH) versus MPH + parent training in children with ADHD and oppositional defiant disorder/conduct disorder (ODD/CD) over a 12-month period. Method: After careful screening, 120 children diagnosed with ADHD + ODD/CD were included in the study. Treatment consisted of ongoing medication management for 12 months, with or without participation in a parent-training program beginning after the 1st month. Participants were not randomly assigned to treatment groups because of ethical, practical, and methodological reasons. Results: Data analyses revealed that mother–child relationship improvements and symptom severity did not benefit from parent training. Conclusion: The results of this study highlighted the positive role of MPH in ADHD. No significant effects were observed after the addition of parent training to MPH treatment. Clinicians should carefully follow patients’ improvements and titrate the MPH dosage during long-term treatment. | Abstract Relaxation training, cue conditioning, and cognitively oriented procedures were used to establish self-control of violent temper outbursts in a moderately retarded adult female. Additional components of treatment included time-out and positive reinforcement. The frequency of temper outbursts in a sheltered workshop setting decreased from three a week to less than one a month. When programming was applied to a residential living situation a similar decrease was noted. Follow-up at one year indicated maintenance of therapeutic gains. It is concluded that relaxation training, self-control, and cognitive procedures may be effectively employed with retarded clients. | Behaviour therapy therapy and applied behaviour analysis to be founded in behaviourism. While behaviour modification and applied behaviour analysis typically uses interventions based on the same behavioural principles, many behaviour modifiers who are not applied behaviour analysts tend to use packages of interventions and do not conduct functional assessments before intervening. Possibly the first occurrence of the term "behavior therapy" was in a 1953 research project by B.F. Skinner, Ogden Lindsley, Nathan H. Azrin and Harry C. Solomon. The paper talked about operant conditioning and how it could be used to help improve the functioning of people who were diagnosed with chronic | 1,999,876 | Oppositional defiant disorder of steps they may go through. Assertiveness training educates individuals in keeping balance between passivity and aggression. It is about creating a response that is controlled, and fair. Child- focused problem solving skills training program aims to teach the child new skills and cognitive processes that teach how deal with negative thoughts, feelings and actions. According to randomized trials evidence shows that parent management training is most effective. It has strong influences over a longer period of time and in various environments. Parent-child interaction training is intended to coach the parents while involving the child. This training has two phases. | Applications of behavior-shaping devices to training severely and profoundly mentally retarded children in an institutional setting. | Combining gesture with verbal instruction promotes problem-solving skills among young children attempting difficult tasks | Advantages of assertiveness training in team building | how are children helped in regards to discipline | Increasing the Skills of Children with Developmental Disabilities through Staff Training in Behavioral Teaching Techniques | Assertiveness training to prevent verbal abuse in the OR | a jhana teaching process child | Using Key Instructional Elements to Systematically Promote Social Skill Generalization for Students with Challenging Behavior. |
1,999,877 | Why don't doctors get sick more often? | The younger chronic sick: how many beds? | Why do you become immune to some illnesses after we have had them? | What is the differences between sickness and disease? | Loads of debt, so many years of schooling. Also, their hours are nuts. If you become a doctor expect to be working crazy amounts of hours a week. Who cares how much money your making, if you don’t have time to even enjoy it? It doesn’t matter how much money your making.
Most doctors I’ve met look miserable and depressed. Who tf wants that? So many of my college friends are pre med because they wanna make that money.
(Be a computer science major like me!) | Why you cannot get many diseases more than once? | Yes, but only after they return to work. Cannot use sickness as a reason, but can create a reason at a later date. Sad but true. | I usually work out 3 days a week and do full body workouts each day that are high volume and intensity with mostly compound heavy movements. I've been sick 2 times with bad colds since the end of January.
Does lifting heavy and with a lot of overall volume decrease your immune system? I have a very sensitive central nervous system so I think maybe all this physical stress on my body just kills my immune system. | What are natural cures for illnesses you take today? | 1,999,877 | Why don't doctors who work with contagious patients get sick more often? Are their immune systems superior or do they simply protect themselves to the utmost extreme? | Why do you not become immune to flu? | Who vaccinated animals agains contagious diseases? | Why Herd Immunity Is Unlikely | Has living in house strengthened your immune system? | Why are auto-immune diseases more prevalent in women? | are viral and bacterial infections contagious? | is q fever contagious person to person? | Immune Systems and Sickness Behavior |
1,999,878 | The Effects Of Monetary Policy Shocks On Flow Of Funds:The Italian Case | We obtain new evidence on the transmission of monetary policy to the economy by analyzing the effects of restrictive monetary policy shocks on Italian flows of funds over the period 1980-2002. Firms reduce their issuance of debt and their acquisitions of financial assets, so there is no evidence of strong financial frictions. Households increase short-term liabilities and diminish purchases of liquid assets and shares in the first quarter following a shock. The public sector increases net borrowing during the first two years. Financial corporations decrease their borrowing for three quarters, while the foreign sector increases borrowed funds. The results shed new light on the role played by the financial decisions of the various economic sectors in the transmission of monetary policy. | Given the current stagnant evolution of affairs in Eastern Europe, the Italian government no longer believes in the imminent beginning of hostilities and therefore has reduced the defense budget by $15 Billion. These funds will be effective immediately transferred to the Ministry of Economy and Finance and will be used in the "Funds to be Distributed". It shall remain there for the remaining of the year and be used if a war does break out, otherwise it will be used for debt servicing, which took the biggest hit in this year's budget.
The Italian Minister of Economy and Finances has already denied any issues with Italy's debt servicing and has said "Italy is fully commited to maintain its obligation with foreign and domestic investors, and this year was not an exception, with the debt ratio still declining and all interests paid in full. This new influx, if used, will only attenuate our debt ratio even further, and has nothing to do with funding issues by the government".
This year's procurement will not be affected. | This paper follows Lucas (2000), and Serletis and Yavari (2004) and estimates the welfare cost of inflation in Italy. It uses recent advances in the field of applied econometrics to estimate the interest elasticity of money demand in Italy and reports welfare cost estimates close to those reported by Serletis and Yavari for Canada and the USA, but an order of magnitude smaller than those reported by Bullard and Russell (2004) for the US economy. | In a model where all banks are initially solvent, an exogenous shock affects confidence, causing a flight from deposits into domestic and foreign currency. Real interest rates increase unexpectedly, affecting firms and raising the share of the banks` nonperforming assets. This increase causes genuine solvency problems and accelerates the bank run. Policy simulations show that compensatory monetary policy (increasing currency supply when deposits fall) mitigates the bank run but causes inflation and external imbalances. Combining compensatory monetary policy with tight fiscal policies also slows the bank run and mitigates insolvency, but at a lower macroeconomic cost. A devaluation is shown to have little positive impact. | The role of bank capital in the propagation of shocks |
Introduction
The cross-border effects of a shift in the monetary policy stance in the United States have always been a focus of policymakers and academics. An empirical literature is rapidly developing that aims to quantify these cross-border monetary spillovers, with the common finding that changes in the stance of U.S. policy have sizable effects on economic activity in emerging economies (EMEs). 1 One prominent theme within this literature is an emphasis on the financial channel of spillovers, whereby a rise in U.S. rates transmits to foreign economies via tighter credit market conditions abroad as well as via substantial deviations from uncovered interest parity (UIP) (see Giovanni, Kalemli-Ozcan, Ulu and Baskaya (2017) and Degasperi, Hong and Ricco (2020)).
Typically, such studies focus on the effects of "pure" monetary policy shocks (i.e., changes in the monetary policy stance that do not represent a direct response to changes in the U.S. macroeconomic environment). But another dimension that is gaining prominence in the literature is the extent to which the cross-border spillovers of a monetary tightening in the U.S. may differ depending on the context in which that tightening is taking place. Depending on the shocks prompting U.S. monetary policy changes, the channels through which they transmit to foreign economies may differ. For example, Hoek, Kamin and Yoldas (2020) argue that it matters greatly whether the news about U.S. monetary policy represents a "growth" shock or a "monetary" shock. 2 Our objective in this paper is to explore the interaction of sources of policy changes and country vulnerabilities in shaping how U.S. monetary policy shifts transmit to foreign economies in a New Keynesian DSGE model. Our model is calibrated to capture empirically relevant features of a wide range of EMEs. We show that higher U.S. interest rates arising from stronger U.S. demand generate modestly positive spillovers to output in economies with stronger fundamentals but can be detrimental for vulnerable EMEs due to tightening of their financial conditions. By contrast, U.S. monetary shocks driven by a more hawkish Fed policy stance cause a slowdown in all EMEs, with the adverse effects being much larger for those with relatively higher vulnerabilities.
While Hoek et al. (2020) use an event-based study to focus on spillovers to EME financial markets for different types of U.S. interest rate shocks, our DSGE model allows a quantification of the spillovers to real macroeconomic variables as well, which is ultimately what is of most interest. In addition, our model-based approach allows a structural modelling of the vulnerabilities in EMEs that matter most, and thus an assessment of the relative importance of the different underlying channels for non-vulnerable and vulnerable economies. Our model-based results are complementary to and consistent with the conclusions on financial spillovers obtained by Hoek et al. (2020). And, our findings related to the importance of vulnerabilities are also consistent with other evidence in the literature (see, for example, Ahmed et al. (2017), Hoek et al. (2020), and Iacoviello and Navarro (2018)). 3 But, in addition to being able to quantify the effects on real variables and the relative importance of different sources of vulnerabilities, our approach, as discussed below, also gives some additional understanding about the importance of policy credibility and central bank communications. With respect to modelling the sources of vulnerabilities, the effects of U.S. monetary policy shocks on EMEs may be enhanced by the presence of foreign currency-denominated debt in firms' balance sheets, which render the latter susceptible to domestic currency depreciation. 4 Under these conditions, many EME central banks face pressure to respond by tightening their own monetary policy, in an effort to mitigate capital outflows and currency depreciation. 5 By raising policy rates, however, EME central banks run the risk of contributing to the initial contractionary forces-via a reduction in domestic aggregate demand resulting from higher real rates-and thereby exacerbate the downturn.
The policy response by EME central banks just described stands at odds with prescriptions from standard open-economy New Keynesian (NK) models found in the literature. 6 These models recommend loosening domestic policy in response to a contractionary policy rate hike in foreign economies, and allowing the exchange rate to depreciate, in an effort to mitigate the drop in the domestic output gap. Akinci and Queralto (2019) show that this prescription continues to hold in an economy with imperfect financial intermediation and partly-dollarized balance sheets which features strong financial spillovers, despite the fact that these features might a priori seem to make exchange rate stability especially desirable. 7 3 Bowman et al. (2015) reach the same conclusion with respect to the importance of EME vulnerabilities in financial spillovers to emerging markets from unconventional U.S. monetary policy changes.
4 See Bruno and Shin (2015) for evidence that foreign currency liabilities, especially in the corporate sector, are still sizable in EMEs.
5 For example, Curcuru et al. (2018) find that government bond yields in Korea, Brazil, and Mexico are strongly correlated to US yields around FOMC announcements-consistent with markets' expectation that central banks in these countries tend to hike policy rates along with the Fed. 6 E.g. Gali and Monacelli (2005). 7 The reason is that in this economy, the premium on the domestic currency endogenously rises following However, the literature cited above typically assumes fully anchored inflation expectations, along with rational expectations on the part of all agents. This assumption is likely not realistic for many EMEs, especially those without a long experience with inflation targeting regimes and histories of very high inflation episodes. Accordingly, we extend the model in Akinci and Queralto (2019) to allow for a belief mechanism that is a hybrid of adaptive and rational expectations, along the lines of Gertler (2017). 8 This mechanism postulates that agents form expectations about macroeconomic aggregates in an adaptive fashion, consistent with survey evidence in Coibion and Gorodnichenko (2012). At the same time, individuals' expectations of policy are rational in that they understand the central bank's policy rule. In addition, and crucially, agents' beliefs about trend inflation (i.e. the central bank's inflation target) react to actual realized inflation, rather than simply accepting the central bank's announcement of its target. This assumption captures the idea that the public needs to be convinced (with "hard" evidence) that the central bank can indeed deliver on its communicated inflation target.
One general implication that emerges from our setting is that global monetary policy spillovers can create significant tradeoffs (understood as the output gap and inflation moving in opposite directions) for EME policymakers, especially in more vulnerable countries, consistent with the discussion above. More specifically, we show how the hybrid belief mechanism can potentially rationalize the response of EME central banks to an advanced-economy monetary tightening described earlier. The intuition is as follows: When (say) the Federal Reserve tightens policy, the dollar appreciates against the home (i.e. the EME) currency. This makes home's imports from the United States more expensive, and thereby leads to a short-lived rise in the overall CPI inflation rate. Under the standard NK model with rational expectations, the monetary authority optimally "looks through" the transient rise in inflation, and instead worries about the decline in the home output gap. Thus, optimal policy tends to call for a reduction in the policy rate.
Under hybrid expectations, the picture differs considerably. Now the short-lived rise in CPI inflation feeds into agents' beliefs about trend inflation, and can thereby induce a much more persistent rise in actual inflation. The central bank thus may face a persistently higher inflation rate-along with a persistently lower output gap-resulting from the imperfect a policy hike by the domestic central bank, which makes it more costly (in terms of lost output) to attempt to prevent depreciation of the domestic currency. 8 The mechanism is in the spirit of recent work on "behavioral" approaches to expectation formation-e.g. Gabaix (2020), García-Schmidt and Woodford (2019), Farhi and Werning (2017)-in part motivated by an attempt to resolve the "forward guidance puzzle" (Giannoni et al. (2015)). credibility of the central bank's inflation target. In this environment, EME policymakers that aims to stabilize inflation would be forced to raise the policy rate. In recent work, Degasperi et al. (2020) show empirically that fragile EMEs face lower real economic activity and higher CPI inflation in response to unexpected U.S. monetary policy tightening, consistent with our model's predictions. They also show these countries then respond to U.S. tightening by raising short term nominal interest rates, also consistent with the predictions of our model with the hybrid belief mechanism. 9 We also explore the role of central bank communication about its inflation target in alleviating the tradeoffs faced by EME policy makers in response to a U.S. monetary tightening. More specifically, we now reformulate agents' beliefs about trend inflation such that central bank guidance on inflation has a larger weight in expectation formation, due to, for example, better communication. As we show, more-credible EME central bank communication mitigates the adverse effects of U.S. monetary policy on EME output and improves the tradeoff faced by EME central banks. The reason is that agents now take the announced inflation target more seriously, which in turn limits the impact of a short-lived rise in CPI inflation on agents' beliefs about trend inflation. As a result, the central bank can afford to look through the transient rise in inflation and focus more on the output stabilization objective. The short-term rate then rises much less and output falls less compared to a case with less-credible central bank communication.
The remainder of the paper proceeds as follows: Section 2 lays out some key empirical features of EMEs that help motivate some of our modeling choices, and section 3 presents our model in detail. In section 4 we highlight the role of country vulnerabilities, while section 5 discusses the importance of the sources of U.S. monetary tightenings. After examining the role of central bank communications in section 6, we conclude in section 7.
Some Key Empirical Features of EMEs
In this section, we lay out some key empirical features of EMEs that will affect the size of spillovers and then discuss some evidence that justifies why inflation expectations may not be fully anchored in many EMEs.
An important channel for cross-border spillovers is fluctuations in the cost of foreign Foreign currency-denominated debt as a percentage of total debt, non-government sectors currency borrowing by EME firms; a stronger U.S. dollar increases debt servicing costs. Figure 1 shows the share of foreign currency-denominated debt in total debt in selected emerging economies. The figure also shows the average foreign debt levels across emerging economies in earlier periods when these economies experienced "currency" crises (such as the 1997 Asian crises, or the 2001 Turkish banking crisis). Two features stand out: First, the average foreign currency debt level in these economies is smaller than before (30 percent vs 20 percent), but it is still sizable. Second, our simple figure shows that there is a heterogeneity in terms of how indebted these economies are: the so-called more vulnerable economies like Turkey and Argentina have higher foreign debt levels than economies known to have stronger macroeconomic fundamentals such as Korea and Taiwan. Another commonly referred to macroeconomic vulnerability for emerging economies is that inflation expectations in these countries have not been as well-anchored as in small open advanced economies, which have had a longer history of explicit inflation targeting (IT) regimes (see, for example Levin et al. (2004)). Below we document some empirical evidence to argue that inflation expectations are not as well anchored in many EMEs, even those that have adopted IT regimes. We also compare these results on EMEs with that of a group of small open advanced economies to highlight the contrast. This analysis provides some justification for introducing adaptive inflation expectations when characterizing a vulnerable small open EME in our model economy. 10 Dependent variable is ∆Eπ i,6,t . Linear interpolation to quarterly freq. * p < 0.05, * * p < 0.01, * * * p < 0.001
Source: Consensus Economics, London
Our statistical analysis follows the work of Levin et al. (2004). Specifically, we regress the first difference of inflation expectations on the first difference of a 3-year moving average of realized CPI inflation:
∆E t π t+h,i = α i + β i ∆π t,i + t,i(1)
where E t π t+h,i is h-period-ahead survey inflation expectations at time t for country i andπ t,i is a three-year moving average of inflation in country i ending at time t. We use inflation expectations survey data collected by Consensus Economics, London. Originally twice a year and now quarterly, the survey asks market forecasters about their inflation expectations at horizons of 1 year to 10 years ahead. The dataset begins in 1989 or 1990 and becomes quarterly in 2014. The regression in equation (1) is run as a panel for advanced and emerging economies separately. Table 1 shows results for small open IT advanced economies (AEs), as well as a group of emerging market economies over the 1993:Q1-2019:Q4 period. 11 For the advanced economies, our evidence suggests that long-run inflation expectations become well anchored after the adoption of inflation targeting regime. For the emerging market economies, on the contrary, inflation expectations at all horizons exhibit highly significant correlation with a 3-year moving average of realized CPI inflation, suggesting expectations are not well anchored. We rerun the regressions for EMEs starting from the date these economies adopted IT regime Peru, Philippines, Poland, Thailand, Turkey; and other EMEs include Argentina, Indonesia, Malaysia, Romania, Singapore, Slovakia, Taiwan, Ukraine. 11 Our estimations start from 1993 when most of the countries in our sample adopted IT regimes Dependent variable is ∆Eπ i,6,t . Linear interpolation to quarterly freq. * p < 0.05, * * p < 0.01, * * * p < 0.001
Source: Consensus Economics, London
(for the IT EMEs), and the results remain the same. 12 Table 2 shows results for a panel of countries, as defined before, for the 2004-2019 period. While there is still a positive correlation between the inflation expectations and the actual inflation in the more recent period, the estimated coefficients are smaller and less significant than their full sample counterparts. This result suggests that EMEs have made some progress on achieving monetary policy credibility from their crisis-prone times in the past. In fact, in the case of some EMEs with strong fundamentals this progress may be sufficient to allow them to follow countercyclical monetary policies. That is part of our motivation for distinguishing between vulnerable and non-vulnerable EMEs later and for modeling the non-vulnerable ones as having anchored inflation expectations.
Model
Our analysis builds on the model presented in Akinci and Queralto (2019), augmented with adaptive expectations. The core framework is a two-country open-economy New Keynesian model (for example, Gali andMonacelli 2005 andErceg et al. 2007). The critical departure from this literature is that we allow for imperfect financial markets as in Akinci and Queralto (2019). More specifically, the model features financial intermediaries (banks, for short) that borrow from domestic households in their own currency and from foreigners in dollars to finance activities of domestic firms. While both types of borrowing are subject to frictions, the imperfections arising from the latter type of borrowing are more severe, which gives rise to endogenous fluctuations in the domestic borrowing spread and in the UIP deviation. We also include a standard set of nominal and real rigidities in the model: nominal price and wage stickiness, habit persistence in consumption, and adjustment costs in investment and in the import share. These features help the model generate empirically realistic effects of monetary policy shocks (as shown by Christiano et al. 2005, for example).
Households
Following Erceg, Henderson and Levin (2000), there is a continuum of households indexed by i ∈ [0, 1], each a monopolistic supplier of specialized labor L it . A large number of competitive "employment agencies" combine specialized labor into a homogeneous labor input L t (in turn supplied to retail firms), according to
L t = 1 0 L 1 1+θw it di 1+θw
. From employment agencies' cost minimization, demand for labor variety of i is
L it = W it W t − 1+θw θw L t ,(2)
where W it is the nominal wage received by supplier of labor of type i, and the wage paid by
goods producers is W t = 1 0 W − 1 θw it dj −θw .
Household i seeks to solve max {CDt+j,MCt+j,Ct+j,
D t+j ,W it+j ,L it+j } ∞ j=0 E t ∞ j=0 β j log(C t+j − hC t+j−1 ) − χ 0 1 + χ L 1+χ it+j(3)
subject to (2) and to a sequence of budget constraints
P t C t + P t D t + B t ≤ W it L it + P t R t D t−1 + R n t B t−1 + W it + Π t(4)
for all t, where C t and P t are given, respectively, by
C t = (1 − ω) ρ 1+ρ C 1 1+ρ Dt + ω ρ 1+ρ (ϕ Ct M Ct ) 1 1+ρ 1+ρ (5) P t = (1 − ω)P − 1 ρ Dt + ωP − 1 ρ M t −ρ .(6)
The variable C t denotes the domestic consumption basket, a CES aggregate of a domesticallyproduced composite good, C Dt , and an imported composite good, M Ct ; D t is deposits in domestic banks, which pay real (i.e. in terms of the domestic basket) gross interest rate R t ; B t is holdings of a nominal one-period riskless bond (offered in zero net supply), which pays interest R n t (set by the domestic monetary authority) between t − 1 and t; W it is the net cash flow from household i's portfolio of state-contingent securities (which ensure that all households consume the same amount C t , despite earning different wages); and Π t is bank and firm profits distributed to the household. The variable ϕ Ct in (5) is given by
ϕ Ct = 1 − ϕ M 2 M Ct /C Dt M Ct−1 /C Dt−1 − 1 2
, and captures costs of changing the ratio of imports to domestically-produced goods.
The variables P Dt and P M t denote, respectively, the price of the domestically-produced composite good and of the imported good, and P t denotes the price of the home consumption basket (i.e. the CPI). In our baseline case, we assume that exporters in each country practice producer currency pricing (PCP):
P M t = e −1 t P * Dt (7) P * M t = e t P Dt ,(8)
where e t is the nominal exchange rate (i.e. the price in dollars of a unit of the home currency), P * Dt is the price of the foreign composite good (in dollars), and P * M t is the price of the domestic composite good abroad (throughout, we use * to refer to the foreign economy). The real exchange rate is thus S t = e t P t /P * t . For the vulnerable EMs, we will consider the dominant currency paradigm (DCP), consistent with evidence presented in Gopinath et al. (2018). Under DCP, firms in both countries set export prices in U.S. dollars. Thus, U.S. exporters continue to practice PCP, but vulnerable EM producers set one price in domestic currency for goods sold in the domestic market, and another in dollars for goods sold in the United States. Home import prices continue to satisfy P M t = e −1 t P * Dt , but now each domestic firm j also sets a dollar export price P * M t (j) subject to the Calvo price-setting friction. If firm j is not able to reset its export price, it follows indexation rule P
* M t (j) = P * M t−1 (j)π * ιp M t−1 , where π * M t = P * M t /P * M t−1 is export price inflation.
Finally, the household's problem (3) is also subject to a constraint on wage adjustment (nominal wage rigidity), whereby the wage can only be set optimally with probability 1 − ξ w , and otherwise must follow the indexation rule W it = W it−1 π ιw wt−1 , where π wt = W t /W t−1 is the wage inflation rate.
As in the basic model, the problem facing U.S. households is analogous to (3), with the exception that they can also supply dollar funds D * t to EM bankers, at interest rateR * t . Other than the features discussed above and its inflation expectations being well-anchored, the U.S. economy mirrors the features of the home country.
Bankers
The representative household has two types of members: workers and bankers, with measures 1 − f and f respectively. There is random turnover between bankers and workers: bankers alive in period t survive into t + 1 with exogenous probability σ b > 0, and become workers with complementary probability. Workers become bankers with probability Banker i's balance sheet identity is
(1 − σ b ) f 1−f , so there is a measure (1 − σ b )f of newQ t A it = D it + S −1 t D * it + N it ,(9)
where A it is the banker's claims on domestic non-financial firms, which have price Q t , and N it is the banker's net worth. A continuing banker's budget constraint, expressed in (real) domestic currency, is
Q t A it + R t D it−1 + R * t S −1 t D * it−1 ≤ R Kt Q t−1 A it−1 + D it + S −1 t D * it .(10)
The left-hand side of (10) is banker i's uses of funds, consisting of loans to non-financial firms
(Q t A it ) plus deposit payments inclusive of interest (both domestic, R t D it−1 , and for- eign, R * t S −1 t D * it−1 ,
where R t and R * t denote the gross local-currency and dollar interest rate respectively). The right-hand side is the source of funds, including returns from past loans (the first term) plus deposits issued (to domestic residents and to foreign households: second and third term, respectively). Given frictionless contracting between banks and domestic non-financial firms, the gross return R Kt satisfies
R Kt = Z t + (1 − δ)Q t Q t−1 ,(11)
where Z t is the (real) capital rental rate and δ is capital's depreciation rate.
Combining (9) and (10) yields the evolution of banker i's net worth, conditional on his or her survival into t + 1:
N it+1 = (R Kt+1 − R t+1 )Q t A it + R t+1 − R * t+1 S t /S t+1 S −1 t D * it + R t+1 N it .(12)
Banker i's objective is
V it = max A it ,D * it (1 − σ b )E t (Λ t,t+1 N it+1 ) + σ b E t (Λ t,t+1 V it+1 )(13)
subject to (12) and
(1 − σ b )E t (Λ t,t+1 N it+1 ) + σ b E t (Λ t,t+1 V it+1 ) ≥ Θ(x it )Q t A it ,(14)
where
x it ≡ S −1 t D * it /Q t A it and Λ t,t+1
is the domestic household's real stochastic discount factor between t and t + 1. Equation (14) is the incentive constraint. We assume Θ(x t ) is quadratic: Θ(x t ) = θ 1 + γ 2 x 2 it . All bankers choose the same ratio of dollar debt to assets:
x it = x t ∀i. The associated first order condition is t = Θ(x t ) Θ (x t ) − x t −1 µ t ,(15)
where t and µ t are given by
t = E t Λ t,t+1 Ω t+1 R t+1 − R * t+1 S t /S t+1 (16) µ t = E t [Λ t,t+1 Ω t+1 (R Kt+1 − R t+1 )] ,(17)
with
Ω t = 1 − σ b + σ b [ν t + (µ t + µ * t x t ) φ t ] ,(18)ν t = E t (Λ t,t+1 Ω t+1 ) R t+1 .(19)
The leverage ratio φ it = Q t A it /N it is also common across bankers and satisfies
φ t = ν t Θ(x t ) − (µ t + µ * t x t ) .(20)
Note that bankers discount future returns using an "augmented" discount factor Λ t+1 Ω t+1 , which accounts for next period's marginal value of funds internal to the bank (given by the variable Ω t+1 ). From equation (20), the leverage ratio φ t is increasing in ν t , the saving to the bank in deposit costs from an extra unit of net worth, and in µ t + t x t , the discounted total excess return on the bank's assets; and decreasing in the fraction of funds banks are able to divert, Θ(x t ).
Given that banks' leverage ratio φ t and foreign funding ratio x t do not depend on bankspecific factors, aggregating across banks yields the following relationships between the EM's aggregate assets and foreign debt (
A t = f 0 A it di and D * t = f 0 D * it di respectively) and aggregate net worth N t = f 0 N it di: Q t A t = φ t N t ,(21)S −1 t D * t = x t φ t N t .(22)
If bank i is a new entrant, its net worth is given by
N it = ξ b f Q t−1 A t−1 .
Using this condition and (12), aggregating N it across all banks (continuing ones and new entrants) yields the evolution of aggregate net worth:
N t = σ b (R Kt − R t )Q t−1 A t−1 + (R t − R * t S t−1 /S t ) S −1 t−1 D * t−1 + R t N t−1 + (1 − σ b )ξ b Q t−1 A t−1 .(23)
Firms
There is a continuum of mass unity of retail firms that are subject to pricing frictions.
Final output Y t is a CES composite of retailers' output:
Y t = 1 0 Y 1 1+θp jt dj 1+θp
, where Y jt is output by retailer j ∈ [0, 1]. Let the price set by retailer j be P Djt . The price level of
domestic final output is P Dt = 1 0 P − 1 θp Djt dj −θp .
Cost minimization by users of final output yields the following demand function for firm j's output:
Y jt = P Djt P Dt − 1+θp θp Y t .
Retailer i uses capital K jt and labor L jt as inputs to produce output Y jt , by means of the production function
Y jt = K α jt L 1−α jt .(24)
The (real) labor and capital rental rates are W t /P t and Z t respectively. Firm j can reset its price with probability 1−ξ p , and otherwise must follow the indexation rule P Djt = P Djt−1 π ιp t−1 , where π t = P Dt /P Dt−1 is inflation of domestically-produced goods.
Capital Producers
The domestic representative capital good producer uses domestic output to produce capital goods, subject to costs of adjusting the level of investment I t given by φ It = ψ I 2 It I t−1 − 1 2 I t and expressed in units of the home good. The representative capital producer solves
max {I t+j } ∞ j=0 E t ∞ j=0 Λ t,t+j Q t+j I t+j − P Dt+j P t+j φ It+j(25)
where Q t denotes the real (i.e. in units of the home consumption basket) price of the capital good. Similar to consumption, investment goods are a composite of domestic (I Dt ) and imported (M It ) goods, also subject to costs of adjusting the imported-domestic good mix:
I t = (1 − ω) ρ 1+ρ I 1 1+ρ Dt + ω ρ 1+ρ (ϕ It M It ) 1 1+ρ 1+ρ ,(26)with ϕ It = 1 − ϕ M 2 M It /I Dt M It−1 /I Dt−1 − 1 2 .
Optimality with respect to the investment aggregate I t gives rise to an investment-Tobin's Q relation:
Q t = 1 + P Dt P t ψ I I t I t−1 − 1 I t I t−1 + ψ I 2 I t I t−1 − 1 2 − E t Λ t,t+1 P Dt+1 P t+1 ψ I I t+1 I t − 1 I t+1 I t 2(27)
Market Clearing, Balance of Payments, and Monetary Policy
The market clearing condition for the home good is as follows:
Y t = C Dt + I Dt + φ It + ξ * ξ M * Ct + M * It ,(28)
where ξ * and ξ, are, respectively, the population sizes of the foreign and home economies (note that all variables are expressed in per-capita terms). Home output is either used domestically (for consumption or investment) or exported. Capital and labor market clearing require K t = 1 0 K jt dj and L t = 1 0 L jt dj, respectively. The aggregate capital stock evolves according to K t+1 = (1 − δ)K t + I t . In turn, market clearing for claims on EM physical capital (held by EM banks) requires A t = (1 − δ)K t + I t .
The balance of payments, obtained by aggregating the budget constraints of agents in the home economy, is given by
D * t − R * t D * t−1 = S t P M t P t (M Ct + M It ) − P Dt P t ξ * ξ (M * Ct + M * It ) .(29)
Equation (29) states that the EME's net accumulation of foreign liabilities, expressed in (real) dollars, equals the negative of the value of net exports. We assume that monetary policy in the home country follows an inertial Taylor rule:
R n t+1 = R n t γr β −1 π γπ t x γx t 1−γr ε r t ,(30)
where the monetary policy rate reacts only to domestic inflation and output gap. The parameter ε r t is an exogenous shock, and x t refers to the output gap. 13
Unanchored Inflation Expectations
To better capture the policy tradeoffs faced by vulnerable EMEs, we modify the inflation expectation formation process in the model economy just described to incorporate the possibility of imperfectly anchored inflation expectations, along the lines of Arias et al. (2016) and Ajello et al. (2020). Specifically, we assume that inflation expectations are formed in an "adaptive" manner, and are thus affected to some extent by realized inflation. Note that we assume expectation formation for all the model variables but inflation to be fully rational. Therefore, only the equations that involve inflation expectations will be modified.
Our key motivation for modifying the inflation expectation process is that as shown in Section (2), longer-run inflation expectations, particularly in the EMEs, are influenced by a range of factors beyond the central bank's inflation target, including realized inflation. Accordingly, we consider the possibility that high realized "headline" inflation in vulnerable EMEs is the catalyst for a rise in longer-run inflation expectations. To implement this, we assume that agents form inflation expectations according to:
E t {π t+1 } = ι 1 k k−1 j=0π ct−j + (1 − ι)E t {π t+1 } ,(31)
where E denotes the "rational" (i.e. model-implied) expectations operator, andẼ is its "adaptive" counterpart. The variable π ct denotes "headline" inflation, given by π ct = πt p Dt /p Dt−1 . We set k = 8, implying that agents consider the average headline inflation realization over the past two years in forming their expectations. In the baseline model described above, one can write the equations for inflation determination under the Calvo pricing assumption as:
π − 1 θp t = (1 − ξ p )(π o t ) − 1 θp + ξ p π − ιp θp t−1 (32) π o t = (1 + θ p ) x 1t x 2t π t (33) x 1t = C −1 σ t mc t Y t + βξ p π −ιp (1+θp) θp t E t x 1t+1 π 1+θp θp t+1 (34) x 2t = C −1 σ t p Dt Y t + βξ p π ιp 1− 1+θp θp t E t x 2t+1 π 1+θp θp −1 t+1 (35)
where π t is the domestic price inflation (recall that the relative price of domestic goods is denoted by p Dt = P Dt /P t ), and mc t is marginal cost for domestic firms. All other variables and parameters are as defined in Section (3.3).
Equation (32) results from assuming that if firm i does not reset the price in period t, it automatically sets price p Dt (i) = π ιp t−1 π 1−ιp p D,t−1 (i); i.e., it automatically increases its price by indexing to a combination of previous-period inflation π t−1 and trend inflation (or the CB's inflation target) π, with ι p weight on previous-period inflation and 1 − ι p weight on trend inflation. Thus, one can motivate ι p = 1 as the central bank's inflation target not being very credible, in the sense that firms' indexation rule assigns it a zero weight (and puts all the weight instead on observed past inflation). For simplicity we set π to 1.
One can easily show that with fully rational expectations, the linearized New Keynesian Phillips Curve (NKPC) takes the following form:
π t = κ 1 + βι p (mc t −p dt ) + ι p 1 + βι pπ t−1 + β 1 + βι p E t {π t+1 }(36)
where κ ≡ (1−ξp)(1−βξp) ξp , and all variables are expressed as log deviations from their respective steady states (and denoted by hat). Under adaptive expectations, we consider two modifications to (36). First, we replace the rational expectation in (36) (the last term) with its adaptive counterpart in (31). Second, we assume that firms not resetting their price also index to headline inflation, rather than domestic inflation. Thus, the indexation term in Equation (36) is replaced byπ c−1 . We also set ι p = 1. The resulting NKPC takes the following form:
π t = κ 1 + β (mc t −p dt ) + 1 1 + βπ ct−1 + ι 1 k k−1 j=0π ct−j + β(1 − ι) 1 + β E t {π t+1 }(37)
Below, we will assume that inflation dynamics for vulnerable EMEs are characterized by the equation above. In contrast to standard versions of the NKPC, equation (37) features greater weight on backward-looking inflation terms, due to the nature of the adaptive expectations in (31). These backward-looking terms capture not only domestic-good inflation, but overall headline inflation (due to the assumed effect of the latter on expectations). In addition, the weight on the forward-looking inflation term in (37) is lower than in the standard NKPC. 14 Overall, the formulation is meant to capture the notion that in this economy inflation expectations are not well anchored, and therefore a bout of temporary inflation pressures can make agents doubt the degree of commitment to price stability of the CB-and therefore expect higher future domestic inflation as well. In this way temporary inflationary pressures (due to, for example, currency depreciation) can become "entrenched" and feed into actual inflation.
Parameter Values
We calibrate the foreign economy to the United States, and take the home economy to represent a bloc of emerging economies, such as the Asian or the Latin American EMEs. 15 The calibration is asymmetric: the U.S. is much larger in size, and EM households are assumed to be relatively impatient, which introduces a motive for the latter to borrow from U.S. households. The relative impatience feature can be seen as capturing more-structural differences between EMEs and advanced economies, such as faster prospective trend growth in EMEs. Table 3 reports parameter values, and Table 4 displays key long run variables from data that we target in the calibration. We consider two different calibrations of the EME bloc: a baseline case in which borrower balance sheets are strong (in the sense that they have very low levels of dollar-denominated debt) and another with fragile balance sheets, with considerable levels of dollar debt. We first describe the baseline case and then discuss the "fragile" calibration-the latter will be another important feature characterizing EME vulnerabilities. In our framework, underlying vulnerabilities cause amplification of the shocks in the vulnerable group of countries, causing a differential response of real and financial variables in that bloc compared with their non-vulnerable counterparts.
We calibrate the U.S. discount factor, β * , to 0.9950, implying a steady-state real interest rate of 2% per year. This choice follows several recent studies (e.g. Reifschneider 2016) and is motivated by estimates indicating a decline in the U.S. natural rate (see, for example, Holston, Laubach and Williams 2017). We calibrate home discount factor to get real interest rate of 2.3 % per year for home economy. This target rate is smaller than the estimates of Mexico's long-run natural rate of 3% per year. The size of the home economy relative to the United States is ξ/ξ * = 0.68.
The capital share (α) and capital depreciation rate (δ) are calibrated to the conventional values of 0.33 and 0.025, respectively. We calibrate the steady-state wage and price markups, θ p and θ w , to 20 percent in each case, a conventional value. For the remaining parameters governing household and firm behavior, we rely on estimates from Justiniano et al. (2010). These parameters include the degree of consumption habits (h), the inverse Frisch elasticity of labor supply (χ), the parameters governing price and wage rigidities (ξ p , ι p , ξ w , and ι w ), and the investment adjustment cost parameter (Ψ I ). These parameters are set symmetrically across the two economies, and their values are fairly conventional. They are listed in the top part of Table 3.
Turning to parameters governing international trade, we follow Erceg et al. (2007) (who rely on estimates by Hooper et al. 2000) and set the trade price elasticity (1 + ρ)/ρ to 2. We impose the restriction that ω * = ωξ/ξ * , as frequently done in the literature (e.g. Blanchard et al. 2016). We set ω = 0.14, implying that 14 percent of the home economy's output is exported in steady state, as shown in Table 4, consistent with evidence. This value is lower than the ratio of Mexico's exports to the United States as a fraction of GDP (which equaled 0.28 in 2017) but higher than in other EMEs (for example, aggregating across the major EMEs in Asia and Latin America leads to a ratio of around 0.10 for 2017). 16 The trade Erceg et al. (2005) and Erceg et al. (2006). This value implies a price elasticity of slightly below unity after four quarters, consistent with the evidence that the short-run elasticity is lower than the long-run one. The Taylor rule both at home and in the U.S. features inertia with a coefficient of 0.90 and 0.82, respectively, an estimate for the latter are taken from Justiniano et al. 2010. In our baseline experiments we set the home and U.S. Taylor rule coefficients, γ π and γ * π , to the standard value of 1.5, capturing a rule focused on stabilizing domestic inflation. We set the coefficients on output gap, γ *
x , to 0.25 for the U.S., a conventional value used in the Trade statistics. literature (e.g. Taylor 1993). The home country features a smaller weight on the output gap than in the U.S., consistent with estimates presented in Leibovici (Second Quarter 2019) who show that the Taylor rule coefficient on the output gap takes a wide range of values but, on average, is close to zero in a group of emerging countries.
Regarding the parameters governing financial market frictions, we calibrated U.S. and EME bloc separately to match their respective leverage ratios and credit spreads in the steady state. We set home bank survival rate σ b to 0.95, implying an expected horizon of 6 years. This value is around the mid-point of values found in related work using variants of this framework. The remaining three parameters are set to hit three steady-state targets: a credit spread of 200 basis points annually, a leverage ratio of around 5, and a ratio of foreign-currency debt to total debt (i.e., the non-core funding ratio (D * /(D * + SD)) of 6 percent. The target leverage ratio is a rough average of leverage across different sectors. Leverage ratios in the banking sector are typically greater than five, 17 but the corporate sector features a much lower ratio of assets to equity (between two and three in emerging markets). 18 Our target of five reflects a compromise between these two values. Finally, for non-vulnerable EMEs the ratio of foreign-currency deposits to total assets (i.e., the foreign funding ratio) is around 5 percent, consistent with evidence presented in Chui et al. (2016). These targets imply θ = 0.41, ξ b = 0.075, and γ = 2.58. Financial variables for the U.S. are calibrated similarly to match the corresponding targets depicted in Table 4.
The calibration for vulnerable EMEs is different from non-vulnerable EMEs on two grounds. First, we calibrate the home discount factor to get a real interest rate of 3.6 percent in vulnerable EMEs, slightly higher than neutral real rate estimate for Mexico discussed before. This parameter value, along with the financial sector parameters discussed before, implies a ratio of foreign-currency debt to total debt of 35 percent. Second, we calibrate ι in Equation (31) to 0.9, so that inflation expectations in the adaptive case are mostly backward-looking.
The Role of Country Vulnerabilities
We begin our analysis by presenting the effects of a 100 basis point unexpected and exogenous U.S. monetary tightening, and show how the shock interacts with the potential country vulnerabilities outlined before. In order to clarify the role of each vulnerability in our model economy, Figure 2 shows the effect of the shock when each of the underlying vulnerabilities is added one at a time. More specifically, we first show the effect of the U.S. monetary policy shock on an EME with strong private balance sheets (i.e., with very low levels of currency mismatch) and under the PCP assumption. Second, we discuss the role of fragile balance sheets in amplifying the impact of the shock. Third, we allow for the fact that many emerging economies invoice their exports in dollars, and show the implied dynamics in this case. Finally, we add the presence of imperfectly anchored inflation expectations.
The black solid lines in the first row of Figure 2 show the effects of the Fed funds rate hike on the U.S economy. Overall, the shock has empirically realistic effects on the United States, with U.S. GDP falling around 0.35 after a year-close to the structural vector autoregression (SVAR) estimate presented in Akinci and Queralto (2019), and broadly similar to those found by other authors, like Christiano et al. (2005). Financial conditions tighten in the United States (as seen in the third panel showing an increase in U.S. corporate credit spreads), consistent with the evidence in Rey (2015) and Gertler and Karadi (2015).
Moving to the cross-border spillover effects of the shock, a first key observation from the figure is that the effects of the U.S. tightening on activity in the EME with strong balance sheets are modest, with GDP falling by slighlty more than 0.05 percent (second row, first column). The reason is that the tightening of EME financial conditions is fairly limited in this case, as balance sheets are not very vulnerable to currency depreciation. In addition, the EME central banks can afford to cut rates somewhat, without fears of the adverse effects of exchange rate depreciation on their economies.
With fragile balance sheets (yellow dashed line), the U.S. monetary tightening triggers a noticeably larger increase in EME credit spreads and a larger depreciation of EME currencies, as well as a bigger hit to GDP. As in Akinci and Queralto (2019), a strong three-way interaction between balance sheets, financial conditions, and currency values, magnifies the effect of the shock. The resulting financial tightening lowers domestic absorption through a slowdown in investment spending, despite a much stronger offset from exports due to the sharper depreciation.
We next consider the role of dollar trade invoicing in shaping the effects of the shock.
Under fragile balance sheets and DCP, EME GDP drops by about 0.15 percent (dash-dotted orange line)-considerably more than under PCP. The reason for the larger hit to activity is that under DCP, the currency depreciation of the home currency fails to translate into lower prices of home goods abroad, and thus its benefits in terms of boosting exports are sharply diminished: observe that now EME exports decline sharply, in contrast to a slight increase in the PCP case. Put differently, under fragile balance sheets and DCP, the home economy's output suffers the costs of a depreciating currency (which work to depress domestic absorption via the financial feedback effects described earlier) without any of the potential benefits (arising due to a boost in exports). 19 Finally, in the presence of unanchored inflation expectations, the drop in EME GDP is larger still, about 0.25 percent-nearing the drop in U.S. GDP itself. The EME central bank faces a worsened tradeoff in this case, as the large exchange rate depreciation feeds into actual domestic producer inflation via an increase in inflation expectations. EME central banks are forced to tighten policy to fight inflationary pressures, causing output to be much harder hit in response to the U.S. tightening.
Sources of U.S. Monetary Tightening and Spillovers
The purpose of this section is to explore how spillovers from U.S. interest rate increases to EMEs depend on the shock driving the U.S. monetary action, and how that interacts with EMEs' own vulnerabilities. Thus, we consider the effects on what we call "non-vulnerable" EMEs, as well as on "vulnerable" ones. The first group is characterized by strong balance sheets, well-anchored inflation expectations, and domestic-currency export pricing (as in the thin blue line in Figure 2). The second group is characterized by fragile balance sheets with considerable levels of dollar-denominated debt, poorly anchored inflation expectations, and dollar export pricing (as in the thick red line in Figure 2).
We begin by exploring U.S. demand-driven monetary spillovers, as depicted in Figure 3. In this experiment, we assume that U.S. economy experiences a boost in domestic aggregate demand (driven by both higher consumption and investment) that increases U.S. GDP by EMEs. Starting with the non-vulnerable EMEs, this type of tightening is actually beneficial for these countries, as somewhat tighter financial conditions are more than offset by stronger exports. On the other hand, the shock leads to downward pressure on vulnerable EMEs' GDP, because the extent of financial tightening is much larger (due to the more-adverse financial accelerator) and because the monetary authority is forced to increase policy rates substantially to fight inflationary pressures despite falling domestic output. In this respect, the figure suggests also a much worse macroeconomic tradeoff for vulnerable EMEs: observe that GDP and inflation move in opposite directions for these countries, while they move in the same direction for non-vulnerable EMEs. As discussed before, unanchored inflation expectations contribute significantly to the emergence of this tradeoff, and cause the EME policy rate to react much more forcefully to the U.S. tightening. Figure 4 shows that matters are very different when the shock is driven by a pure "hawkish" shift in the Fed's reaction function. In this figure, we assume exactly the same path of the federal funds rate as in Figure 3, but this time driven by a sequence of exogenous shifts in the U.S. Taylor rule (i.e., by "pure" monetary shocks). The idea is that the Fed exogenously turns more hawkish, for example to stave off fears of undesirably high inflation. This type of tightening is much more adverse for the EMEs as a whole-it drives down GDP for both vulnerable and non-vulnerable EMEs. The magnitude of the hit is much more substantial for the latter, as are the extents of financial tightening and currency depreciation. As expected, poorly anchored inflation expectations contribute significantly to this outcome.
The Role of Central Bank Communication
In this section we consider the effects of U.S. monetary tightening on EME economic activity and inflation, when central bank inflation guidance has a larger weight in agents' expectations formation. More specifically, agents' perceived inflation target now not only reflects realized inflation, but may also react to central bank communications about its target. With this modification, we want to capture a situation in which central banks can increase their credibility through better communications. The important role played by the communication to manage economic agents' expectations has been emphasized in the earlier literature (see, for example, Blinder (1999)). Our objective in this section is then to show quantitatively how better communication may alleviate the tradeoffs faced by EME central bank in response to unexpected U.S. monetary policy tightening. To be sure, it may not be straightforward in practice for a central bank to convince the public to expect a given level of inflation. However, given the history of less-than-fully credible policy in many EMEs, the expectations formation mechanism likely changes only slowly over time in these countries. Improved communication, in turn, can help accelerate this process. Our results below are meant to illustrate the benefits of these improvements in the face of a U.S. tightening.
Under better central bank communication formulation, inflation expectations shown in (31) can be rewritten as the following:
E t {π t+1 } = ι(1 − ζ)π t + ιζπ CB t + (1 − ι)E t {π t+1 }(38)
where ζ is strictly positive, implying that price-setting agents now assign some weight to the announced inflation target by the central bank. Figure 5 shows the results with more-credible central bank communication. More specifically, the figure displays the effects of a one-time unexpected U.S. monetary tightening on EMEs when these countries face fragile balance sheets (i.e., partly-dollarized balance sheets), trade invoiced in dollars and unanchored inflation expectations, both without credible central bank communication (red line) and with credible central bank communication (blue line, ζ = 0.5). Note that impulse responses shown in red are reproduced from Figure 2, and plotted along with the impulse responses under the modified inflation expectation formulation in (38) (thus, they correspond to what we have labelled as "vulnerable" EMEs). As discussed before, in the presence of unanchored inflation expectations, the drop in EME GDP is quite large, nearing the drop in U.S. GDP itself. The EME central bank faces a tradeoff in this case, as the large exchange rate depreciation feeds into actual domestic producer inflation via an increase in inflation expectations. EME central banks are then forced to tighten policy to fight inflationary pressures. More-credible EME central bank communication mitigates the adverse effects of U.S. monetary policy on EME output and improves the tradeoff faced by EME central banks. This is because agents now take announced inflation target more seriously, which in turn limits the impact of short-lived rise in CPI inflation on agents' beliefs about trend inflation. As a result, EME central banks can afford to look through the transient rise in inflation to some extent and focus more on output stabilization objective.
This implies that short term rates rise less and EME output falls less compared to the case without credible central bank communication.
Conclusion
We have developed a medium-scale quantitative New Keynesian model representing the U.S. economy and an emerging market economy. The latter is subject to financial frictions constraining balance sheets and poorly anchored inflation expectations (due to a hybrid belief mechanism that combines rational expectations with adaptive expectations)-both widely seen as key vulnerabilities afflicting some EMEs. The latter feature of the model allows long-run inflation expectations to be a function of realized inflation, enabling a feedback loop between realized and expected inflation.
We have investigated the consequences of these features for spillovers from U.S. monetary policy tightenings, depending on whether these tightenings are driven by stronger U.S. demand or by a more-hawkish U.S. policy stance. We show that strong fundamentals (i.e., a combination of local-currency denominated debt and well anchored inflation expectations) prove to be the best form of insulation from foreign monetary policy shocks, especially if these shocks are driven by more-hawkish monetary policy stance. We also show that the possibility of deanchoring of inflation expectations creates a rationale for central banks in EMEs to respond to foreign monetary shocks by tightening the local policy stance. Lastly, we demonstrate that credible central bank communication regarding the inflation target could be a useful tool for EME central banks as a way to alleviate policy tradeoffs in the face of external monetary policy shocks.
Figure 1 .
1Foreign
bankers each period, exactly offsetting the number that exit. Entrant bankers receive a small endowment in the form of fraction ξ b f of the value of the capital stock.
Figure 2 Fragile
2Balance Sheets, DCP Fragile Balance Sheets, DCP, Unanchored Inflation Exp. Note: The black lines in the first row show the effects on the U.S. economy of a monetary shock that raises the federal funds rate by 100 basis points on the U.S. economy. The colored lines in the middle and bottom rows show the effects on EMEs under different assumptions on their vulnerabilities.
Figure 3
3The black lines in the first row show the effects of a demand shock that raises U.S. GDP by 1 percent after about a year on the U.S. economy. The dashed blue line shows the effects of the shock on non-vulnerable EMEs. The dashed dotted red line displays the effect on vulnerable EMEs. the last panel of the first row, U.S. corporate credit spreads decrease by 75 basis points on impact and remain low for an extended period. The second and the third panel rows of the figure show the cross-border effects of the shock on both non-vulnerable (dashed blue line) and vulnerable (red dashed-dotted lines)
Figure 4
4The black lines in the first row show the effects of "pure" U.S. monetary policy shock that replicates the path of FFR inFigure (3) on the U.S. economy. The dashed blue line shows the effects of the shock on non-vulnerable EMs. The dashed dotted red line displays the effects on vulnerable EMEs.
Figure 5 .Fragile
5Role Balance Sheets, DCP, Unanchored Inflation Exp. w/ Credible Central Bank Communication Note: The dashed blue lines show the effects of a monetary shock that raises the federal funds rate by 100 basis points on the EMEs with more credible EME central bank communication. The red line is reproduced from Figure 2 for comparison.
Table 1 .
16-to 10-year-ahead expectations (1993-2019)
(1)
(2)
(3)
Inflation-Targeting AEs Inflation-Targeting EMEs All EMEs
∆π it
0.0477
0.153 * *
0.187 * * *
(1.57)
(2.91)
(5.03)
Constant
-0.00571
-0.0430
-0.0309
(-1.48)
(-1.33)
(-1.16)
Observations
400
1010
1412
Table 2 .
26-to 10-year-ahead expectations (2004-2019)
(1)
(2)
(3)
Inflation-Targeting AEs Inflation-Targeting EMEs All EMEs
∆π it
0.0222
0.0857 *
0.0629 *
(0.67)
(2.28)
(2.22)
Constant
-0.000985
-0.00947
0.00260
(-0.26)
(-0.60)
(0.11)
Observations
312
798
1122
Table 3 .
3Model CalibrationParameter
Symbol Home U.S.
Conventional Parameters
Home discount factor
β
0.9943 0.9950
Habit parameter
h
0.85
-
Inv. Frisch elas. of labor supply
χ
3.79
-
Trade price elasticity
(1 + ρ)/ρ
2
-
Trade openness
ω
0.14
0.095
Relative home size
ξ/ξ *
0.68
Trade adjustment cost
ϕ M
10
-
Capital share
α
0.33
-
Capital depreciation
δ
0.025
-
Prob. of keeping price fixed
ξ p
0.87
-
Price indexation
ι p
0.50
-
Price markup
θ p
0.20
-
Prob. of keeping wage fixed
ξ w
0.70
-
Wage indexation
ι w
0.15
-
Wage markup
θ w
0.20
-
Investment adjustment cost
Ψ I
4
-
Taylor rule coefficients
γ r
0.90
0.82
γ π
1.50
1.50
γ x
0.025
0.25
Financial Sector Parameters
Bank survival rate
σ b
0.95
0.98
Bank fraction divertable
θ
0.41
0.40
Bank transfer rate
ξ b
0.075
0.10
Home bias in bank funding
γ
2.58
-
adjustment cost parameter ϕ M is set to 10, as in
Table 4 .
4Calibration TargetsVariables and Symbols
Home: Baseline Home: Vulnerable U.S.
Real interest rate, R, ann. %
2.275
3.6
2
Foreign funding ratio, x, %
5
28
−
Leverage (φ = QK/N )
5
5
4
Noncore funding ratio, %
6
35
−
Credit Spread, (ER K − R), ann. bpt
200
200
75
Exports/GDP, %
14
14
9
Examples includeRey (2015),Bruno and Shin (2015),Dedola et al. (2017),Iacoviello and Navarro (2018),Bräuning and Ivashina (2019), Miranda-Agrippino and Rey (2020).2 Following Jarociński and Karadi (2020) and Nakamura and Steinsson (2018),Hoek et al. (2020) differentiate between "monetary shocks" and "growth shocks" by analyzing the evolution of U.S. equity prices and yields around FOMC announcements and U.S. employment-report releases.
Note that, as will be clear in the model section, our paper focuses on positive cross-border implications of the U.S. policy tightening under a given policy rule in EMEs that reacts to deviations of the inflation rate from its target and to deviations of the output gap from zero.
We also run these regressions in levels, truncating the sample to avoid the initial strong disinflation periods in many EMEs in early 1990s. Our results, available upon request, robustly point out that inflation expectations are not well anchored in many EMEs when we use long sample period.
Compared to a Taylor rule specification that assigns some weight to exchange rate stabilization, this specification helps us better highlight the policy tradeoffs faced by EME central banks with deanchored inflation expectations in response to foreign monetary policy shocks. Any tradeoff in our model then arises endogenously due to the underlying vulnerabilities of EMEs, rather than due to an assumption that monetary policy responds to the exchange rate.
This feature of our model resembles Gabaix (2020)'s behavioral model "cognitive discounting" in expectations formation.15 The approach of grouping countries into blocs is often used in larger-scale models for policy analysis, e.g.Erceg et al. (2006).
These statistics refer only to merchandise trade, so do not include services. Source: IMF Direction of
For example, bank assets to capital averaged around 10 for Mexico in recent years. Source: IMF Global Financial Stability Report.18 See e.g. IMF Global Financial Stability Report October 2015, Chapter 3.
percent after a year. 20 As shown in the first row of panels, this implies that Fed tightens the monetary policy stance gradually by about 70 basis points after two years. As shown in 19 This finding is consistent with evidence inShousha (2019).20 We engineer this scenario by adding a positive shock to U.S. households' marginal utility of consumption, which boosts desired consumption demand, as well as a positive impulse to U.S. banks' equity values, leading to a rise in investment spending.
International financial spillovers to emerging market economies: How important are economic fundamentals?. Shaghil Ahmed, Brahima Coulibaly, Andrei Zlate, Journal of International Money and Finance. 761Ahmed, Shaghil, Brahima Coulibaly, and Andrei Zlate, "International financial spillovers to emerging market economies: How important are economic fundamentals?," Journal of International Money and Finance, 2017, 76, 133-152. 1
Monetary Policy Tradeoffs and the Federal Reserve's Dual Mandate. Andrea Ajello, Isabel Cairó, Vasco Cúrdia, Thomas Lubik, Albert Queralto, 2020. 3.6Ajello, Andrea, Isabel Cairó, Vasco Cúrdia, Thomas Lubik, and Albert Queralto, "Monetary Policy Tradeoffs and the Federal Reserve's Dual Mandate," 2020. 3.6
Balance Sheets, Exchange Rates, and International Monetary Spillovers. Ozge Akinci, Albert Queralto, Akinci, Ozge and Albert Queralto, "Balance Sheets, Exchange Rates, and International Monetary Spillovers," May 2019. 1, 3, 4
The macroeconomic risks of undesirably low inflation. Jonas E Arias, Christopher Erceg, Mathias Trabandt, European Economic Review. 88Arias, Jonas E., Christopher Erceg, and Mathias Trabandt, "The macroeconomic risks of undesirably low inflation," European Economic Review, 2016, (88), 88-107. 3.6
Jump-Starting the Euro Area Recovery: Would a Rise in Core Fiscal Spending Help the Periphery?. Olivier Blanchard, Christopher Erceg, Jesper Linde, National Bureau of Economic Research. 317IncNBER Macroeconomics AnnualBlanchard, Olivier, Christopher Erceg, and Jesper Linde, "Jump-Starting the Euro Area Recovery: Would a Rise in Core Fiscal Spending Help the Periphery?," in "NBER Macroeconomics Annual 2016, Volume 31," National Bureau of Economic Research, Inc, 2016, pp. 103-182. 3.7
Alan S Blinder, Central Banking in Theory and Practice. The MIT Press1Blinder, Alan S., Central Banking in Theory and Practice, Vol. 1 of MIT Press Books, The MIT Press, February 1999. 6
U.S. unconventional monetary policy and transmission to emerging market economies. David Bowman, Juan M Londono, Horacio Sapriza, Journal of International Money and Finance. 553Bowman, David, Juan M. Londono, and Horacio Sapriza, "U.S. unconventional mon- etary policy and transmission to emerging market economies," Journal of International Money and Finance, 2015, 55, 27-59. 3
US monetary policy and emerging market credit cycles. Falk Bräuning, Victoria Ivashina, Journal of Monetary Economics. 1Bräuning, Falk and Victoria Ivashina, "US monetary policy and emerging market credit cycles," Journal of Monetary Economics, 2019. 1
Capital flows and the risk-taking channel of monetary policy. Valentina Bruno, Hyun Song Shin, Journal of Monetary Economics. 71C4Bruno, Valentina and Hyun Song Shin, "Capital flows and the risk-taking channel of monetary policy," Journal of Monetary Economics, 2015, 71 (C), 119-132. 1, 4
Nominal Rigidities and the Dynamic Effects of a Shock to Monetary Policy. Lawrence J Christiano, Martin Eichenbaum, Charles L Evans, Journal of Political Economy. 11314Christiano, Lawrence J., Martin Eichenbaum, and Charles L. Evans, "Nominal Rigidities and the Dynamic Effects of a Shock to Monetary Policy," Journal of Political Economy, February 2005, 113 (1), 1-45. 3, 4
A new dimension to currency mismatches in the emerging markets -non-financial companies. Michael Chui, Emese Kuruc, Philip Turner, Bank for International Settlements. 550Chui, Michael, Emese Kuruc, and Philip Turner, "A new dimension to currency mismatches in the emerging markets -non-financial companies," BIS Working Papers 550, Bank for International Settlements March 2016. 3.7
What Can Survey Forecasts Tell Us about Information Rigidities?. Olivier Coibion, Yuriy Gorodnichenko, Journal of Political Economy. 1201Coibion, Olivier and Yuriy Gorodnichenko, "What Can Survey Forecasts Tell Us about Information Rigidities?," Journal of Political Economy, 2012, 120 (1), 116-159. 1
International Finance Discussion Papers 1234, Board of Governors of the Federal Reserve System. Stephanie E Curcuru, B Steven, Kamin, U.S.International Spillovers of Monetary Policy : Conventional Policy vs. Quantitative EasingCurcuru, Stephanie E., Steven B. Kamin, Canlin Li, and Marius del Giudice Ro- driguez, "International Spillovers of Monetary Policy : Conventional Policy vs. Quanti- tative Easing," International Finance Discussion Papers 1234, Board of Governors of the Federal Reserve System (U.S.) August 2018. 5
If the Fed sneezes, who catches a cold?. Luca Dedola, Giulia Rivolta, Livio Stracca, Journal of International Economics. 1081Dedola, Luca, Giulia Rivolta, and Livio Stracca, "If the Fed sneezes, who catches a cold?," Journal of International Economics, 2017, 108, S23-S41. 1
The Global Transmission of U.S. Monetary Policy. Riccardo Degasperi, Seokki Simon Hong, Giovanni Ricco, 2020. 1Technical ReportDegasperi, Riccardo, Seokki Simon Hong, and Giovanni Ricco, "The Global Trans- mission of U.S. Monetary Policy," Technical Report 2020. 1
International Spillovers and Local Credit Cycles. Di Giovanni, Sebnem Julian, Mehmet Kalemli-Ozcan, Yusuf Soner Fatih Ulu, Baskaya, National Bureau of Economic ResearchWorking Paper 23149di Giovanni, Julian, Sebnem Kalemli-Ozcan, Mehmet Fatih Ulu, and Yusuf Soner Baskaya, "International Spillovers and Local Credit Cycles," Working Paper 23149, Na- tional Bureau of Economic Research February 2017. 1
The Transmission of Domestic Shocks in Open Economies. Christopher Erceg, Christopher Gust, David Lopez-Salido, University of Chicago Press3Erceg, Christopher, Christopher Gust, and David Lopez-Salido, The Transmission of Domestic Shocks in Open Economies, University of Chicago Press, June 3, 3.7
Optimal monetary policy with staggered wage and price contracts. Christopher J Erceg, W Dale, Andrew T Henderson, Levin, Journal of Monetary Economics. 462Erceg, Christopher J., Dale W. Henderson, and Andrew T. Levin, "Optimal mon- etary policy with staggered wage and price contracts," Journal of Monetary Economics, 2000, 46 (2), 281-313. 3.1
Expansionary fiscal shocks and the US trade deficit. Christopher J Erceg, Luca Guerrieri, Christopher Gust, 363-397. 3.7International Journal of Central Banking. 83International FinanceErceg, Christopher J, Luca Guerrieri, and Christopher Gust, "Expansionary fiscal shocks and the US trade deficit," International Finance, 2005, 8 (3), 363-397. 3.7 , , and , "SIGMA: A New Open Economy Model for Policy Analysis," International Journal of Central Banking, 2006. 15, 3.7
Fiscal Unions. Emmanuel Farhi, Iván Werning, American Economic Review. 10712Farhi, Emmanuel and Iván Werning, "Fiscal Unions," American Economic Review, December 2017, 107 (12), 3788-3834. 8
A Behavioral New Keynesian Model. Xavier Gabaix, American Economic Review. 2020814Gabaix, Xavier, "A Behavioral New Keynesian Model," American Economic Review, 2020, 110 (8), 2271-2327. 8, 14
Monetary Policy and Exchange Rate Volatility in a Small Open Economy. Jordi Gali, Tommaso Monacelli, Review of Economic Studies. 7233Gali, Jordi and Tommaso Monacelli, "Monetary Policy and Exchange Rate Volatility in a Small Open Economy," Review of Economic Studies, 2005, 72 (3), 707-734. 6, 3
Are Low Interest Rates Deflationary? A Paradox of Perfect-Foresight Analysis. Mariana García-Schmidt, Michael Woodford, American Economic Review. 1091García-Schmidt, Mariana and Michael Woodford, "Are Low Interest Rates Defla- tionary? A Paradox of Perfect-Foresight Analysis," American Economic Review, January 2019, 109 (1), 86-120. 8
Rethinking the Power of Forward Guidance: Lessons from Japan. Mark Gertler, NBER Working Papers 23707. Gertler, Mark, "Rethinking the Power of Forward Guidance: Lessons from Japan," NBER Working Papers 23707, National Bureau of Economic Research, Inc August 2017. 1
Monetary policy surprises, credit costs, and economic activity. Peter Karadi, American Economic Journal: Macroeconomics. 71and Peter Karadi, "Monetary policy surprises, credit costs, and economic activity," American Economic Journal: Macroeconomics, 2015, 7 (1), 44-76. 4
The Forward Guidance Puzzle. Marc Giannoni, Christina Patterson, Marco Del Negro, 2015 Meeting Papers 1529, Society for Economic Dynamics. Giannoni, Marc, Christina Patterson, and Marco Del Negro, "The Forward Guid- ance Puzzle," 2015 Meeting Papers 1529, Society for Economic Dynamics 2015. 8
Dominant Currency Paradigm. Gita Gopinath, Emine Boz, Camila Casas, Federico Diez, Pierre-Olivier Gourinchas, Mikkel Plagborg-Møller, 3.1NBER Working Paper. Gopinath, Gita, Emine Boz, Camila Casas, Federico Diez, Pierre-Olivier Gourin- chas, and Mikkel Plagborg-Møller, "Dominant Currency Paradigm," NBER Working Paper, 2018, (22943). 3.1
When is bad news good news? US monetary policy, macroeconomic news, and financial conditions in emerging markets. Jasper Hoek, Emre Steven B Kamin, Yoldas, FRB International Finance Discussion Paper. 1US Monetary Policy, Macroeconomic News, and Financial Conditions in Emerging MarketsHoek, Jasper, Steven B Kamin, and Emre Yoldas, "When is bad news good news? US monetary policy, macroeconomic news, and financial conditions in emerging markets," US Monetary Policy, Macroeconomic News, and Financial Conditions in Emerging Markets (January, 2020). FRB International Finance Discussion Paper, 2020, (1269). 1, 2
Measuring the natural rate of interest: International trends and determinants. Kathryn Holston, Thomas Laubach, John C Williams, S59-S75. 3.7Journal of International Economics. 108Holston, Kathryn, Thomas Laubach, and John C Williams, "Measuring the nat- ural rate of interest: International trends and determinants," Journal of International Economics, 2017, 108, S59-S75. 3.7
Trade elasticities for the G-7 countries. Peter Hooper, Karen Johnson, Jaime R Marquez, 2000. 3.7Hooper, Peter, Karen Johnson, and Jaime R Marquez, "Trade elasticities for the G-7 countries," 2000. 3.7
Foreign effects of higher U.S. interest rates. Matteo Iacoviello, Gaston Navarro, Journal of International Money and Finance. 11Iacoviello, Matteo and Gaston Navarro, "Foreign effects of higher U.S. interest rates," Journal of International Money and Finance, 2018. 1, 1
Deconstructing monetary policy surprises-the role of information shocks. Marek Jarociński, Peter Karadi, American Economic Journal: Macroeconomics. 122Jarociński, Marek and Peter Karadi, "Deconstructing monetary policy surprises-the role of information shocks," American Economic Journal: Macroeconomics, 2020, 12 (2), 1-43. 2
Investment shocks and business cycles. Alejandro Justiniano, Giorgio E Primiceri, Andrea Tambalotti, 132-145. 3.7Journal of Monetary Economics. 572Justiniano, Alejandro, Giorgio E Primiceri, and Andrea Tambalotti, "Investment shocks and business cycles," Journal of Monetary Economics, 2010, 57 (2), 132-145. 3.7
International Trade Openness and Monetary Policy: Evidence from Cross-Country Data. Fernando Leibovici, 93-113. 3.7Federal Reserve Bank of St. Louis Review, Second Quarter. 1012Leibovici, Fernando, "International Trade Openness and Monetary Policy: Evidence from Cross-Country Data," Federal Reserve Bank of St. Louis Review, Second Quarter 2019, 101(2), 93-113. 3.7
The macroeconomic effects of inflation targeting. Andrew T Levin, Jeremy M Piger, Fabio M Natalucci, Review. 2Levin, Andrew T., Jeremy M. Piger, and Fabio M. Natalucci, "The macroeconomic effects of inflation targeting," Review, 2004, (jul), 51-80. 2
U.S. Monetary Policy and the Global Financial Cycle. Silvia Miranda-Agrippino, Hélene Rey, The Review of Economic Studies. 20201Miranda-Agrippino, Silvia and Hélene Rey, "U.S. Monetary Policy and the Global Financial Cycle," The Review of Economic Studies, 2020. 1
High-frequency identification of monetary nonneutrality: the information effect. Emi Nakamura, Jón Steinsson, 1283-1330. 2The Quarterly Journal of Economics. 1333Nakamura, Emi and Jón Steinsson, "High-frequency identification of monetary non- neutrality: the information effect," The Quarterly Journal of Economics, 2018, 133 (3), 1283-1330. 2
Gauging the Ability of the FOMC to Respond to Future Recessions. David Reifschneider, 2016. 3.7Reifschneider, David, "Gauging the Ability of the FOMC to Respond to Future Reces- sions," 2016. 3.7
Dilemma not Trilemma: The Global Financial Cycle and Monetary Policy Independence. Helene Rey, 14National Bureau of Economic ResearchWorking Paper 21162Rey, Helene, "Dilemma not Trilemma: The Global Financial Cycle and Monetary Policy Independence," Working Paper 21162, National Bureau of Economic Research May 2015. 1, 4
The Dollar and Emerging Market Economies: Financial Vulnerabilities Meet the International Trade System. Samer Shousha, 19International Finance Discussion Papers, Board of Governors of the Federal Reserve SystemShousha, Samer, "The Dollar and Emerging Market Economies: Financial Vulnerabilities Meet the International Trade System," International Finance Discussion Papers, Board of Governors of the Federal Reserve System, 2019, 1258. 19
Discretion versus policy rules in practice. John B Taylor, Carnegie-Rochester Conference Series on Public Policy. Elsevier39Taylor, John B., "Discretion versus policy rules in practice," in "Carnegie-Rochester Con- ference Series on Public Policy," Vol. 39 Elsevier 1993, pp. 195-214. 3.7
| The paper analyses the financial structure of the private sector in the Czech Republic, Hungary and Poland and assesses its implications for the monetary transmission mechanism. The financial accounts of these countries provide a picture of a private sector which is predictably financially less mature than the EU average: the corporate sector relies significantly on non-market financial liabilities (such as trade credits and non-traded shares) and bears a substantial exchange rate risk; the household sector is less sophisticated both in terms of financial assets, whose composition is tilted towards bank deposits, and liabilities, the volume of which is still negligible. VAR system estimates conducted separately on each acceding country suggest that, despite the inferior financial development of these countries, the co-movement of macroeconomic variables conditional on a monetary policy shock is similar across countries and not dissimilar to what is found in the more advanced economies. | Impact of Treasury Single Account on the Liquidity | 1,999,878 | We study in a VAR model the effects of monetary policy shocks with new Italian flow of funds data for 1980-2002. First, our results are consistent with the literature, without being affected by commonly found puzzles. Second, new features of the transmission of monetary policy shocks to the Italian economy are provided. We do not find evidence of financial frictions which prevent firms from reduction of nominal expenditures. Households quickly adjust portfolios leading to a careful evaluation of limited participation hypothesis. Finally, the public sector increases net borrowing after the shock, improving on puzzling opposite results in the literature. | Monetary policy effects: new evidence from the Italian flow-of-funds | Responses of Argentine Output to Shocks to Monetary Policy, Fiscal Policy and Exchange Rates: A VAR Model | Monetary policy and stock prices – Cross-country evidence from cointegrated VAR models | The paper studies the dynamic effects of fiscal policy shocks upon Argentine macroeconomic variables such as the gross domestic product, the inflation rate and the level of unemployment; a structural Vector Autoregression model is resorted to in order to estimate the impulse response functions; the econometric analysis is carried out for the period 1984-2005 (second quarter) and quarterly logarithmic real variables are used for the VAR´s specification. Point estimation of impulse response functions indicate both a relatively low statistical significance of fiscal shocks upon macroeconomic variables and a short-lived impact of innovations while at the same time cast doubts upon some traditionally accepted Keynesian macroeconomic policy prescriptions. | TRANSMISSION EFFECTS OF CENTRAL BANK BILL TRADING POLICY——Evidence from China with the Panel-VAR Model | Purpose: This paper examines the effect of U.S monetary policy spillovers on macroeconomic conditions in Nigeria by estimating a time-varying parameter-VAR (TVP-VAR).Design/methodology/approach: The model is applied mainly due to its ability to capture possible nonlinearities and stochastic volatility of real and financial variables used. The impulse response of Nigeria's GDP, CPI inflation, exchange rate and monetary policy to U.S monetary policy proxy by shadow policy rate reveals that the effect on GDP and CPI inflation in Nigeria vary across the three major phases of U.S monetary policies (conventional, unconventional, and normalization). Findings: While the effect appeared to be positive during conventional monetary policy phase, evidence of beggar-thy-neighbour was found during unconventional and monetary policy normalization phases. The negative effect appears to be more significant and last longer than the positive effect. We, therefore, conclude that U.S monetary policy substantially explains the cyclical fluctuations in the Nigeria economy. Practical implications: The results may be used by the macroeconomic policy-makers in their attempt to capture U.S. monetary policy spillovers on macroeconomic conditions in Nigeria. | Which Financial Shocks Drive the Business Cycle?∗ | Uncertainty shocks and financial crisis indicators |
1,999,879 | I typically wear a medium, but ordered an XL ... | I usually wear a XL, and I ordered XL and it was perfect fit. | I normally wear a XL, but this thing is a 2 or 3 X. Gigantic. I had to return. | I usually wear an xl. I ordered 3x and it is way too small. The material is very thin too. | I ordered an extra large, though I typically wear a medium to a large. The XL was way too small. | I normally wear a medium. I ordered a large and they were too small for me. I gave them to my daughter. She loves them! | I normally wear a medium-large, after reading the reviews I saw that everyone said to order a size up so I ordered an XL, it's still pretty tight(which is probably how it's supposed to be), but I almost wish I got the XXL. Other than that they are good quality shirts. | Ordered an XL. I wear L/XL. This fit like a super snug tshirt, not at all appropriate as a dress. I will still use as a shirt, maybe with leggings. | I wear a large so I ordered a XL and it fit perfectly. It was long and comfortable. | 1,999,879 | I typically wear a medium, but ordered an XL to make sure these tanks were long enough to cover my full rear should I wear leggings to work. Because of the material and the larger size, these tanks can go all the way to my knees.
My eyesight shows the "heather grey" as more of a traditional grey. | XL is a very poor descriptor for these leggings | I have very narrow feet and calves so the fit ... | ORDER according to your hip size!!! Left my sizes for help... nice medium hold shape wear ! | I am always a small in under armour tanks, ... | I buy the XL because with her beard it is easy to grab as we play tug-a-war | I have a 24 inch waist and usually wear a ... | I normally buy XL and have found that other brands ... | I usually wear a medium in tights. These are ... |
1,999,880 | where were the virginia conventions held in the civil war | Virginia Secession Convention of 1861 The Virginia Secession Convention of 1861 was called in Richmond to determine secession from the United States, to govern the state during a state of emergency, and to write a new Constitution for Virginia, which was subsequently voted down in referendum under the Confederate regime. Following Abraham Lincoln's constitutional election reflecting the nation's sectional divide, and before his inauguration, the Deep South states that had cast Electoral College votes for John C. Breckinridge resolved to secede from the United States and form the Confederate States of America. The Virginia Assembly called a special convention for | Virginia Conventions the new year of 1776, George Washington, a delegate in the Virginia Convention and in the Continental Congress, had been appointed in Philadelphia from the First Continental Congress as commander of Continental troops surrounding Boston. Virginia patriots had defeated an advancing British expeditionary force at the Battle of Great Bridge southeast of Norfolk in December. The newly elected Fifth Convention met in Williamsburg from May 6 to July 5, 1776. It elected Edmund Pendleton its presiding officer after his return as president of the First Continental Congress in Philadelphia. There were three parties in the Fifth Convention. The first was | West Virginia 30 voted against (with 2 abstentions). Almost immediately after that vote, a mass meeting at Clarksburg recommended that each county in northwestern Virginia send delegates to a convention to meet in Wheeling on May 13, 1861. When this First Wheeling Convention met, 425 delegates from 25 counties were present, though more than one-third of the delegates were from the northern panhandle area, but soon there was a division of sentiment. Some delegates led by John S. Carlile favored the immediate formation of a new state, while others led by Waitman Willey argued that, as Virginia's secession had not yet been | Virginia Constitutional Convention of 1868 for the Constitutional Convention, Radical Republican superior organization gained a surprise triumph over both Moderates and Conservatives, resulting in a majority of Convention delegates. The statewide majority of white ex-Confederates immediately organized Virginia's Conservative Party by meeting and forming the Committee of Nine shortly after the convention began meeting in December 1867. They incorporated the moderate former Unionists to seek white-only control of the state. The Convention's 104 delegates included 68 Republicans, among whom were 24 African Americans, 21 Virginia-born whites and 23 whites from out of state. The remaining 36 Conservatives were mostly wealthy ex-Confederates. The Convention met from | Piedmont, Augusta County, Virginia Piedmont is an unincorporated community in Augusta County, Virginia, United States. Piedmont is located northeast of Staunton, Virginia and north-northwest of Waynesboro, Virginia. During the American Civil War, the Battle of Piedmont between Union forces under Maj. Gen. David Hunter and Confederate forces under William E. Jones was fought on June 5, 1864 just north of Piedmont. During the battle, Jones was killed and Hunter's forces captured nearly 1,000 Confederate prisoners. The Confederate defeat near Piedmont allowed Hunter to easily occupy Staunton the next day, and threatened the Confederacy's security in the Shenandoah Valley as well | Fourth Virginia Convention The Fourth Virginia Convention was a meeting of the Patriot legislature of Virginia held in Williamsburg in December 1775. This Convention followed the Third Virginia Convention, which recessed on August 26, 1775. Peyton Randolph, who presided over the first three Conventions, died on October 22. On November 14th, the governor John Murray, 4th Earl of Dunmore issued Dunmore's Proclamation. This declared that Virginia was in a state of rebellion and would be placed under martial law, and promised freedom to any slaves to join the British armed forces in suppressing the revolt. Edmund Pendleton was elected to | Thomas Bayne (Sam Nixon) of Ohio to begin impeachment investigations. Three months later, on April 17, 1867, Union Republicans met in Richmond and elected Bayne as their convention's vice president, as they planned for the upcoming Virginia Constitutional Convention, since Congress had conditioned readmission of Virginia and other Confederate states upon adopting new constitutions which did not permit slavery and which did permit African Americans to vote. On October 22, 1867, Norfolk voters elected Bayne and Unionist Democrat Henry M. Bowden (1819-1871) to represent their city in the upcoming state constitutional convention. The Virginia Constitutional Convention of 1868 first met on December 3, 1867 | Thomas Bayne (Sam Nixon) of Ohio to begin impeachment investigations. Three months later, on April 17, 1867, Union Republicans met in Richmond and elected Bayne as their convention's vice president, as they planned for the upcoming Virginia Constitutional Convention, since Congress had conditioned readmission of Virginia and other Confederate states upon adopting new constitutions which did not permit slavery and which did permit African Americans to vote. On October 22, 1867, Norfolk voters elected Bayne and Unionist Democrat Henry M. Bowden (1819-1871) to represent their city in the upcoming state constitutional convention. The Virginia Constitutional Convention of 1868 first met on December 3, 1867 | 1,999,880 | Virginia Conventions the Civil War in 1864, 1868, and finally in 1902. These early conventions without restrictions on their jurisdiction were primarily concerned with voting rights and representation in the General Assembly. The Conventions of 1861 on the eve of the American Civil War were called in Richmond for secession and in Wheeling for government loyal to the U.S. Constitution. In the 20th century, limited state Conventions were used in 1945 to expand suffrage to members of the armed forces in wartime, and in 1955 to implement "massive resistance" to Supreme Court attempts to desegregate public schools. Alternatives to the conventions used | where was the first virginia convention held 1774 | when did the convention army arrive in virginia | when did the virginia commission on constitutional government start | who did the second virginia convention authorize to minister to soldiers | when did the first african american delegate to the virginia constitutional convention | who organized the northern virginia cavalry in the civil war | where did the first meeting of the west virginia convention take place | who was the governor of virginia at the beginning of the wheeling convention |
1,999,881 | One Year of Monitoring of the 2006 Outburst in Optical and Low Radio Frequencies | Using the narrowband all-sky imager mode of the LWA1 we have now detected 30 transients at 25.6 MHz, 1 at 34 MHz, and 93 at 38.0 MHz. While we have only optically confirmed that 37 of these events are radio afterglows from meteors, evidence suggests that most, if not all, are. Using the beam-forming mode of the LWA1 we have also captured the broadband spectra between 22.0 and 55.0 MHz of four events. We compare the smooth, spectral components of these four events and fit the frequency dependent flux density to a power law, and find that the spectral index is time variable, with the spectrum steepening over time for each meteor afterglow. Using these spectral indices along with the narrow band flux density measurements of the 123 events at 25.6 and 38 MHz, we predict the expected flux densities and rates for meteor afterglows potentially observable by other low frequency radio telescopes. | telescopes. The Cherenkov light that is produced by cosmic rays in the upper atmosphere is very dim, so VERITAS can only observe under clear, dark skies. Observations are not possible under cloudy or rainy skies, or when the moon is bright. This shrinks the observation time to approximately 70–100 hours each month from September until June. The observatory does not collect data in July or August due to local monsoon conditions. The Very Energetic Radiation Imaging Telescope Array System was built as first next generation IACT in the western hemisphere. It was originally planned as an array of seven telescopes, | A new generation of spectrometers for radio astronomy: fast Fourier transform spectrometer | According to error of satellite signals traveling through the ionosphere, it can be impractical and receiver performance can be severely degraded. At times of high sunspot number, transequatorial propagation on ionospheric scintillations is most likely to occur during solar maximum, particularly affecting equatorial and auroral regions. Although isolated efforts have been reported, systematic analyses of the effects on positioning systems have not been performed. Auroral disturbances affecting north-south gradients can lead to effects at mid-latitudes. This paper presents initial monitoring results of a study on transequatorial radio propagation. A state-of-the-art SAO explorer, which extracts scintillation parameters from radio frequencies measurements, is being used | High time-resolution data observed in two periods, respectively, by three frequencies (1.42, 2.84, and 3.67 GHz) or four frequencies (1.42, 2.00, 2.84, and 4.00 GHz) of fast sampling radiotelescopes were processed. Obtained were some significant results showing that during the obviously rising or maximum phases of solar cycle 22, the occurrence frequency of millisecond radio spikes at three or four frequencies decreased with the frequency increase and the highest occurrence frequency was at 1.42 GHz. If we assume the secondx-mode is pre-dominant in the growth rate of ECM instability, we calculate the magnetic intensity of source regions with spike bursts at the four frequencies and interpret the occurrence frequency of millisecond radio spikes on long centimetre and short decimetre wavelengths. Finally, this paper suggests that, owing to the Razing effect, whenf≤126 MHz the occurrence frequency of millisecond radio spikes starts to decrease. | We present a measurement of the angular spectrum of the cosmic microwave background from l = 26 to 225 from the 30 and 40 GHz channels of the MAT/TOCO experiment based on two seasons of observations. At comparable frequencies, the data extend to a lower l than the recent Very Small Array and DASI results. After accounting for known foreground emission in a self-consistent analysis, a rise from the Sachs-Wolfe plateau to a peak of δTl ≈ 80 μK near l ≈ 200 is observed. | We present the successful radio frequency (30 - 80 MHz) self-triggered detection and identification of 10 high energy cosmic rays with Caltech's Owens Valley Radio Observatory Long Wavelength Array (OVRO-LWA). The core of the OVRO-LWA consists of 256 dual-polarization antennas that are approximately evenly spaced in a 200 m diameter disk with several outliers at longer distances. Based on this success we present future plans for an array covering a 2.5 km diameter area for measuring the flux and composition of cosmic rays in the $3\times10^{16}$ eV - $10^{18}$ eV energy band. | The ground based vertical radio wave propagation experiment was conducted at the frequency of 2.5 MHz to study variations in ionospheric radio wave absorption during partial solar eclipse that occurred on October 24, 1995 at Delhi (28.6°N, 77.2° E). It was observed that the minimum in absorption data was four minutes earlier than the ground level eclipse totality, and an anomaly was accompanied by an abnormal sharp rise (shock-like wave structure) in absorption data around 30 minutes after the eclipse totality. Absorption during post-eclipse control days was higher compared to those on pre-eclipse control days. | 1,999,881 | The evolution of the optical spectrum of RS Ophiuchi was monitored beginning 1 day since the 2006 outburst discovery to over a year after the outburst. The evolution of the spectrum is found to be similar to previous outbursts. The outburst was also monitored in the low radio frequency region, in the 0.610 GHz, 0.325 GHz and 0.240 GHz bands. The radio observations began ∼ 20 days after the discovery and continued until ∼ 400 days. The outburst was detected, for the first time at frequencies below 1 GHz. The low frequency radio emission is non-thermal and is well-explained by a synchrotron spectrum of index α ∼ −0.8 (S ∝ να) suffering foreground absorption due to the pre-existing, ionized, warm, clumpy red giant wind. | Polarization and Spectral Energy Distribution in OJ 287 during the 2016/17 Outbursts | how many times the luminosity of the sun is theta ophiuchi | We present high-resolution optical spectra of 15 objects near or below the sub-stellar limit in the Upper Scorpius and ρ Ophiuchus star-forming regions. These spectra, obtained with the HIRES instrument on the Keck I telescope, are used to investigate disk accretion, rotation and activity in young very low mass objects. We report the detection of a broad, asymmetric Hα emission line in the ρ Oph source GY 5 which is also known to harbor mid-infrared excess, consistent with the presence of an accreting disk. The Hα profiles of the Upper Sco objects suggest little or no on-going accretion. Our results imply that if most brown dwarfs are born with disks, their accretion rates decrease rapidly, at timescales comparable to or smaller than those for T Tauri disks. The Upper Sco brown dwarfs appear to be rotating faster than their somewhat younger counterparts in Taurus, consistent with spin-up due to contraction following disk unlocking. The Hα activity is comparable to saturated activity levels in field M dwarfs with similar spectral type and rotation rates. Comparison of our data with published (albeit lower-resolution) spectra of a few of the same objects from other epochs suggests possible variability in accretion/activity indicators. | Observations of Leonid Meteors Using a Mid-Wave Infrared Imaging Spectrograph | AO 0235+164 is a very compact, flat spectrum radio source identified as a BL Lac object at a redshift of z = 0.94. It is one of the most violently variable extragalactic objects at both optical and radio wavelengths. The radio structure of the source revealed by various ground-based VLBI observations is dominated by a nearly unresolved compact component at almost all available frequencies.Dual-frequency space VLBI observations of AO 0235+164 were made with the VSOP mission in January-February 1999. The array of the Japanese HALCA satellite and co-observing ground radio telescopes in Australia, Japan, China and South Africa allowed us to study AO 0235+164 with an unprecedented angular resolution at frequencies of 1.6 and 5 GHz. We report on the sub-milliarcsecond structural properties of the source. The 5-GHz observations led to an estimate of T B > 5.8 × 10 13 K for the rest-frame brightness temperature of the core, which is the highest value measured with VSOP to date. | Context. Blue-shifted Fe K absorption lines have been detected in recent years between 7 and 10 keV in the X-ray spectra of several radio-quiet AGNs. The derived blue-shifted velocities of the lines can often reach mildly relativistic values, up to 0.2-0.4c. These findings are important because they suggest the presence of a previously unknown massive and highly ionized absorbing material outflowing from their nuclei, possibly connected with accretion disk winds/outflows. Aims. The scope of the present work is to statistically quantify the parameters and incidence of the blue-shifted Fe K absorption lines through a uniform analysis on a large sample of radio-quiet AGNs. This allows us to assess their global detection significance and to overcome any possible publication bias. Methods. We performed a blind search for narrow absorption features at energies greater than 6.4 keV in a sample of 42 radio-quiet AGNs observed with XMM-Newton. A simple uniform model composed by an absorbed power-law plus Gaussian emission and absorption lines provided a good fit for all the data sets. We derived the absorption lines parameters and calculated their detailed detection significance making use of the classical F-test and extensive Monte Carlo simulations. Results. We detect 36 narrow absorption lines on a total of 101 XMM-Newton EPIC pn observations. The number of absorption lines at rest-frame energies higher than 7 keV is 22. Their global probability to be generated by random fluctuations is very low, less than 3 × 10 −8 , and their detection have been independently confirmed by a spectral analysis of the MOS data, with associated random probability < 10 −7 . We identify the lines as Fe XXV and Fe XXVI K-shell resonant absorption. They are systematically blue-shifted, with a velocity distribution ranging from zero up to ∼0.3c, with a peak and mean value at ∼0.1c. We detect variability of the lines on both EWs and blue-shifted velocities among different XMM-Newton observations even on time-scales as short as a few days, possibly suggesting somewhat compact absorbers. Moreover, we find no significant correlation between the cosmological red-shifts of the sources and the lines blue-shifted velocities, ruling out any systematic contamination by local absorption. If we define Ultra-fast Outflows (UFOs) those highly ionized absorbers with outflow velocities higher than 10 4 km/s, then the majority of the lines are consistent with being associated to UFOs and the fraction of objects with detected UFOs in the whole sample is at least ∼35%. This fraction is similar for Type 1 and Type 2 sources. The global covering fraction of the absorbers is consequently estimated to be in the range C∼0.4-0.6, thereby implying large opening angles. Conclusions. From our systematic X-ray spectral analysis on a large sample of radio-quiet AGNs we have been able to clearly assess the global veracity of the blue-shifted Fe K absorption lines at E>7 keV and to overcome their publication bias. These lines indicate that UFOs are a rather common phenomenon observable in the central regions of these sources and they are probably the direct signature of AGN accretion disk winds/ejecta. The detailed photo-ionization modeling of these absorbers is presented in a companion paper. | Initial Observations of Sunspot Oscillations Excited by Solar Flare | We introduce the GENJI program (Gamma-ray Emitting Notable AGN Monitoring by Japanese VLBI), which is a monitoring program of gamma-ray bright AGNs with the VERA array (VLBI Exploration of Radio Astrometry). The GENJI programme aims a dense monitoring at 22 GHz towards the $\gamma$-ray emitting active galactic nuclei (AGNs) to investigate the radio time variation of the core and possible ejection of new radio component, motion of jets, and their relation with the emission at other wavelengths especially in $\gamma$-rays. Currently we are monitoring 8 $\gamma$-ray-emitting notable AGNs (DA 55, 3C 84, M 87, PKS 1510-089, DA 406, NRAO 530, BL Lac, 3C 454.3) about once every two weeks. This programme is promising to trace the trend of radio time variation on shorter timescale than conventional VLBI monitoring programme and to provide complimentary data with them (e.g., MOJAVE, Boston University Blazar Project). In particular, we successfully coordinated quick follow-up observations after the GeV $\gamma$-ray flare in NRAO 530 and 3C 454.3 reported by the Fermi Gamma-ray Space Telescope. Here we present the initial results of morphology and light curves for the first 7-month operation. |
1,999,882 | How much does a swollen limb weigh? | What is the weight bearing bone in the body? | How much does organs weigh? | How much does the Large Hippo weigh? | Pounds of pressure to break a femur? | One of the few 1lb limit anologe scales. Good condition and exceeds what I'm asking from it. | What do there suits weigh? | How much does a barret 50 cal weight? | I have the effect for my combat armor left leg which without it weighs 3 pounds but with it, it weighs 3.15, the effect is supposed to make it 90 percent lighter | 1,999,882 | Last weekend, I got a new tattoo on my forearm (with colours and stuff, so they needed to do multiple passes to get good coverage), and now my arm is swollen. Not so worried about that, but in the same weekend I gained 3,5kg. Is there any way of figuring out what part of that increase is currently in my arm? | Need help extending my forearm tattoo | Muscle growth, tattoos and stretch marks | Healed tattoo ink raises up | Working Out With New Tattoo | Getting a thigh tattoo in a few days, but I am also training for a 10k race. | Forearm mineral content in normal men: relationship to weight, height and plasma testosterone concentrations. | Why do fully healed tattoos rise sometimes? | Getting tattooed after losing the weight? |
1,999,883 | who wrote the queen of japan song mother | To Mother (song) "To Mother" is the sixteenth single by Japanese pop singer-songwriter Yui. It was released on June 2, 2010 by Gr8! Records. The single debuted atop the Oricon Weekly Single Chart, becoming her seventh number-one single. It was the first song in which Yui replaced guitar for piano. Although it is Yui's first song in which she exchanges her guitar for a piano, it was first written using a guitar. When asked about the decision in writing the song, unsurprisingly, was in support of mothers of the world. She also added that although she frequently wrote upbeat songs | Linda Yamamoto of her career. The song was written by the accomplished writing team of Yū Aku and Shunichi Tokora, who also wrote hits for Pink Lady, The Finger Five, and Momoe Yamaguchi. They later wrote more songs for Yamamoto, including "Jin Jin Sasete", "Kuruwasetaino", and "Neraiuchi". Yamamoto also had a brief turn as a voice actress in 1974, providing the speaking and singing voice of Princess Margaret in Gisaburo Sugii's anime movie version of "Jack and the Beanstalk". She also played the character of Mari in the original "Kamen Rider" TV series starting in 1971. However good her songs and singing | highlife, with Congolese Soukous-style guitar finger-picking. "Sweet Mother" went on to become one of the most popular hits in Africa, selling over 13 million copies. Sometimes called "Africa's anthem", it was voted Africa's favourite song by BBC readers and listeners in 2004, coming before Brenda Fassie's "Vuli Ndlela", Fela Kuti's "Lady", Franco's "Mario" and Miriam Makeba's version of "Malaika". Sweet Mother "Sweet Mother" is a highlife song by the Nigerian and Cameroonian singer Prince Nico Mbarga and his band Rocafil Jazz. Released in 1976, it remains one of the most popular songs in Africa. The demo-tape of "Sweet Mother" was | Yoko Nagae Ceschina Countess (5 April 1932 – 10 January 2015) was a Japanese-born patron of the arts, long resident in Italy, and noted patroness of classical music. Born in Kumamoto Prefecture, Japan, to a businessman father and mother who played the piano domestically, Yoko Nagae was exposed to music at an early age. Her parents separated when she was 8, and her father discarded the piano from the family residence. To continue playing the piano, she searched out neighbours' residences which had pianos. Nagae later studied harp at the Tokyo National University of Fine Arts and Music. She was | Morning Musume , sometimes referred to as Momusu is a Japanese girl group , whose act generally revolves around singing and dancing to upbeat melodies . | Torakku Yarō Torakku Yarō The plot formula is similar to the "Otoko wa Tsurai yo" films. Each time Momojiro falls in love with a woman (the "Madonna") and then ends up having to help her romance with another man. The stories end with Momojiro having to race his truck to meet a deadline to rejoin the couple. Momojiro Hoshi, nicknamed "Ichibanboshi", played by Bunta Sugawara. Kinzo Matsushita, nicknamed "Yamome no Jonathan", played by Kinya Aikawa. Kimie Matsushita, the wife of Kinzo Matsushita, played by Masumi Harukawa All the films have the same theme song, "Ichibanboshi Blues" by Ryudo Uzaki and Yoko Aki | in the 2018 comedy film Tag (2018 film) Mother (Danzig song) "Mother" is a song by American heavy metal band Danzig. It was originally released in August 1988 as the lead single from their debut album, "Danzig". In 1993–1994, almost six years after its original release, a remixed version of the song titled "Mother '93" became a hit on radio and earned Buzz Bin rotation on MTV after a music video incorporating live footage was created to promote the band's new EP, "". During this time the single was reissued by American Recordings, with the remix title updated to "Mother | Twin Sisters of Kyoto The film was remade in 1980 under the same title, "Koto", directed by Kon Ichikawa and starring Momoe Yamaguchi and Tomokazu Miura. Set in Kyoto, 20-year-old Cheiko (Shima Iwashita) works in her parents' wholesale silk goods store. She was brought up to think her parents stole her as a baby in a fit of passionate desire and becomes profoundly disturbed to learn (after a chance encounter with a girl who turns out to be her sister) that her real parents had abandoned her. Her identity crisis is exacerbated by her need to choose between carrying on | 1,999,883 | featured on the award-winning short movie "Icicle melt" starring Greta Scacchi. Some of their cover songs, such as "Mother" (written and originally recorded by John Lennon) and "Wanted Man" (written by Bob Dylan for Johnny Cash) infuse an electronic sound into songs which previously had a different style. They have also covered songs by Soft Cell, The Who, Olivia Newton-John, Marvin Gaye, Duran Duran, Thin Lizzy, Klaus Nomi and Frank Zappa. Remixes of Queen of Japan's work have appeared on a CD by DJ Keoki. Their music has also been featured at Fashion Week and appears on two CDs of | who sings love child of the queen on spiders | who sang the song the queen is here | who sings the song freakum dress with the mamas | when did the band momposo come out | Tiny Lil Sale (Natasha Denona, Pat McGrath MOTHERSHIP, Melt, Hourglass, Chanel, Kosas) | who sings mother maria with slash | what was the name of jeanette mcgruder's singing group | Anouk Finally Strikes Gold with "Who's Your Momma" CD |
1,999,884 | ARY Qtv | TSXV: QYOU
OTCQB: QYOUF
QYOU Media Inc., has announced that *The Q India,* the company's Hindi language youth oriented channel available in over 100 million TV households and to over 612 million OTT and mobile users in India, has announced that five new exclusive comedy series featuring several of India's fastest growing YouTube stars will be launching in July and August 2021.
New series include the eponymous *Rochit Rojha*, a YouTube sensation who has accumulated over 8 million subscribers and nearly 2 billion views on YouTube and the popular young brother and sister duo, *Ridhu Pidhu*, featuring two of YouTube India's fastest growing young stars.
Curt Marvis, CEO and Co-Founder of QYOU Media commented "This is another huge content win for the channel as we continue to lock up top social stars with TV series exclusively available on *The Q*."
Find the full release here at:
&#x200B;
Stay safe, this is not financial advice!! | KWTV-DT "Drone 6" (it is unclear as to whether it is just a single quadcopter used by both stations). On July 14, 2016, KWTV announced the implementation of "StreetScope", an Augmented Reality System developed by Churchill Navigation that overlays street and building names over live footage from the station's helicopter camera during breaking news and severe weather events; it is the first television station in the United States to use this technology. KWTV places a significant emphasis on weather, and has long been considered to be a pioneer in severe weather coverage and television forecasting technology. Most of these advances were | KWTV-DT "Drone 6" (it is unclear as to whether it is just a single quadcopter used by both stations). On July 14, 2016, KWTV announced the implementation of "StreetScope", an Augmented Reality System developed by Churchill Navigation that overlays street and building names over live footage from the station's helicopter camera during breaking news and severe weather events; it is the first television station in the United States to use this technology. KWTV places a significant emphasis on weather, and has long been considered to be a pioneer in severe weather coverage and television forecasting technology. Most of these advances were | Is there a tv program beginning with the letter z? | Quest (U.S. TV network) Quest is an American digital multicast television network that is owned by Cooper Media. The network specializes in travel, historical, science, and adventure-focused documentary and reality series aimed at adults between the ages of 25 and 54. The network, which broadcasts in 480i standard definition, is available in several large and mid-sized markets via digital subchannel affiliations with broadcast television stations. Stations have the option of placing their Quest-affiliated subchannels on cable television providers serving their market (via existing carriage agreements for local broadcast stations) to provide additional local coverage. The formation of Quest was announced | Ireland HD was swapped with the SD channel on Sky's EPG for HD subscribers. The BBC One Northern Ireland branding is utilised from 6am until the handover to the BBC News Channel with live continuity handled by a team of regional announcers who double up as playout directors. The channel's main competitor is UTV while also competing with RTÉ One and TV3 from the Republic of Ireland. Although BBC One NI and UTV are competitors, on the final night of UK digital switchover, BBC One NI and UTV joined forces for a special simulcast, "The Magic Box", with Eamonn Holmes, | Release : Silicon.Valley.Season.03.S03.HDTV.1080p.10bit.5.1.x265.HEVC-Qman[UTR]
Link : #F!KVXXXwkjb4A
Key : !Lr3daFPuz2zzHXXXyhTv6ukmg
Delete the XXX from both the link and the key | Recently, Peer-to-Peer (P2P) IPTV applications represents a challenging trend of the Internet. IPTV refers to the delivery of live video streaming and Video on Demand (VoD). In this paper, the basic concepts and algorithms of some popular existing IPTV applications are presented based on the experience of a real system deployed by PPLive, CoolStreaming, Sopcast and UUSee. The performance and technological Challenges are proposed. Finally, the advantages and disadvantages of the different IPTV applications are conclusion. | 1,999,884 | ARY QTV, formerly known as Quran Television (QTV), is a Pakistani television channel with a Sunni Islam belief, that produces programs mainly having focus on the Ahlesunnat wal Jamaat. QTV is part of the ARY Digital Network of Pakistan.
The channel has shows featuring well-known scholars such as Pir Muhammad Alauddin Siddiqui, Saqib Iqbal Shami, Muhammad Raza Saqib Mustafai, Shaykh Hassan Haseeb Ur Rehman, Dr. Muhammad Tahir-ul-Qadri, Dr. Umar Al-Qadri, Mufti Abu Baqr, Mufti Muhammad Akmal, Mufti Shahid, Mufti Sohail Raza Amjadi, Mufti Muhammad Aamir, Muhammad Ajmal Raza Qadri. Other shows include Qur'an teachings, hadith, talk shows, question-and-answer shows, Qawwali music and Na`at poetry.
Further reading
Ary Qtv
See also
Madani Channel
Islam Channel
References
External links
Official site
Islamic television networks
Television channels and stations established in 2003
Television stations in Pakistan
Religious television stations in Pakistan
Television stations in Karachi | Muslim Television Ahmadiyya International | azerbaijan's national television channel aztv is a member of which organization | Last banned Pakistani TV network on air | channel of tv chhajje ka pyaar serial | which is the only universal broadcasting service of pakistan | List of Gujarati-language television channels | what channel is kazd channel 55 in dallas | who is the owner of geo tv in pakistan |
1,999,885 | What country is home to the worlds man-made lake? | The great lake located in the us? | Where s the location of Lake Malawi? | Wha tis the largest lake in Asia? | What is India's largest fresh water lake? | What is great britains largest lake? | Great lake that starts with an h? | What is the second largest great lake? | What is the 50 largest lakes in the world? | 1,999,885 | What is the name of the largest man made lake in the world? | What is the largestmanmade lake in the us? | World's 50 largest lakes? | what is the largest man-made lake by surface area in the us? | World 50 largest lakes? | What is the name of the great lake that starts with an h? | What is the name of the lake due north of Wisconsin thats is the second largest lake in the world? | Largest lake in West Virginia? | What is the name of a large lake in utah and what is its name? |
1,999,886 | [Healing of experimental wounds under the effect of x-ray irradiation at high altitude]. | Objective:To study the pathological changes after different regimens of radiotherapy on wound healing in rats.Methods:A rat model was made by surgery, and the rats were irradiated with electron accelerator to observe the pathological alteration by macroscopic,microscopic and immunohistochemical examinations.Results:It is found that the wound healing process was postponed, expression of the transforming growth factors-β 1 and collagen bundles in the irradiated rats were decreased obviously by radiotherapy.A dose of 300?cGy everyday and 5 times a week irradiation could inhibit development of hypertrophic scar.Conclusions:The efficacy of lower dosage of electron beam was better than higher one. | Objective: To study the regularities and mechanism of the effect of radiation on wound healing. Methods: The pathological changes in radiation combined wound healing in rats were observed by macroscopic, microscopic, electron microscopic examinations, and examination of collagen types Ⅰ and Ⅲ. Results and conclusion: It was found that wound healing process was impaired and delayed obviously in irradiated rats. Firstly, the inflammatory responses in early phase were inhibited seriously, particularly the numbers of infiltrating monocytes and neutrophils were decreased in irradiated wounds, blood vessels were injured and hemorrhage increased. Secondly, the formation and maturation of granulation tissue were slowed down, fibroblasts were damaged seriously, “radiation fibroblasts” appeared, and synthesis and secretion of type Ⅰ and type Ⅲ collagens were decreased. Lastly, reepithelialization process was delayed and healing time was prolonged. [ | Twenty-six rabbits of about the same weight and age were subjected to charring burns on their backs (9 cm/sup 2/) The necrotic scab was removed at regular time intervals and an auto- or homograft was immediately transplanted into the opened wound. Twenty rabbits were subjected to repeated x irradiation (2 x 600 r). Penetrating radiation affected the recipient of the homograft, which, when transplanted during the height of radiation sickness dissolved rapidly. The healing process of autografts was slower in the irradiated animals than in the controls. Homografts transplanted from irradiated animals, 7 days after irradiation with 600 r, to healthy animals, remained alive for a long time and the epithelization of the wound occurred after 4 to 5 weeks. (OTS) | Background. Fractionated radiation therapy (RT) with adjuvant hyperthermia (HT) is being used in the treatment of cancer with noted clinical success. However, little information regarding wound repair in tissues receiving this combination therapy is available for comparison of surgical risk. Consequently, this study was undertaken to assess the effects of this combined therapy on wound healing by quantitatively evaluating wound repair using tensile strength measurements. Methods. Four treatment cohorts were designated: sham control, RT alone (600 cGy/d for 4 days), HT alone (water bath at 41.8 o C, subcutaneous temperature of 41.0±0.5 o C for 60 minutes on days 1 and 4), and combined RT and HT | Radiation-induced skin injuries from fluoroscopy. | Surgical intervention was performed in 16 patients with advanced tumors of the accessory sinuses and nose receiving neutron teletherapy. The 1st group (10 persons) was treated by combined therapy including preoperative irradiation with fast neutrons: 2 fractions a week at a dose of 1.2-1.4 Gy, total focal dose of 10 Gy corresponding to an equivalent dose of 40 Gy. Surgical intervention was performed in 10-15 days. In the 1st group during the post-operative period there were no complications, the period of wound healing was not increased as compared to that in the use of routine methods of combined therapy of tumors of the above site. In the 2nd group (6 persons) surgical intervention was performed 2-3 mos. after a radical course of combined neutron-photon therapy. The frequency of postoperative complications was 67%. The period of post-operative wound healing considerably increased. | Objective To inverstigate effective therapy for burn wounds caused by radiation treatment. Method 13 cases of burn wounds caused by radiation treatment in differernt position, different type of tumor and depth were treated with Kangfuxin Liquid. Results Except for 1 case terminated, another one with small residual deep wound healed with skin grafting, rest others were all healed physiologically. Conculsion Kangfuxin Liquid has reamrkable efficacy in treating heard to heal burn wounds caused by radiation treatment. | Although electrical burns of the upper extremity comprise a small percentage of all thermal injuries, they present formidable clinical problems. The physician must not be lulled into a false sense of security because the visible cutaneous burn is not great. Sound surgical principles, such as the control of bacterial proliferation with topical chemotherapy, débridement of dead tissue, and timely wound closure, in conjunction with the expertise necessary in caring for thermally injured patients, are necessary for a maximally rehabilitated patient. | 1,999,886 | Experiments were conducted on 969 mature rabbits; combined radiation injury (in general irradiation with 500 r and even more so in local irradiation with 2000 r) inflicated during the first two adaptation phases (particularly the first one) to the high altitide (3379 and 3640 m above the sea level) led to more profound morphological changes in the tissues and to the greater delay in the healing of the penetrating wounds on the pinna than in the valley (820 m above the sea level). | Effect of rapid rewarming on tissue survival of frozen rabbits' feet. | Distraction Osteogenesis in Irradiated Rabbit Mandibles With Adjunctive Hyperbaric Oxygen Therapy | Early and late changes in the functional vascularity of the hamster cheek pouch after local x-irradiation. | Acute Lethal Responses of Goats and Sheep to Bilateral or Unilateral Whole-body Irradiation by Gamma-rays and Fission Neutrons | Changes in the vascular supply to rat growth cartilage during radiation injury and repair | Experimental studies on rabbit ears amputated by either a clean sharp division or severed by a crushing blow showed that twice as much blood remained in the crush group. Microthrombi and tissue thrombi were seen in this group only. A review of 142 digital replantations performed over a 10 year period showed 126 survivals. Ninety-three were complete amputations and 80 of these survived; 49 were incomplete amputations and 46 survived after revascularization attempts. Of 74 clear amputations, 68 survived; of 68 crush-type amputations, 58 survived. Circulatory disturbances occurred in 36 replanted digits; 16 could not be salvaged. The primary cause of complications was venous obstruction. In 80 digital replantations done from January, 1974, to December, 1975, success was obtained in 75 (93.75 percent). Irrigation of vessels of the severed part is done only in cases of double level amputation, severely crushed or those due to avulsion. Heparin, low molecular weight dextran, urokinase, and antibiotics are given for several days after operation. | Improvement of Rabbit Production | Fractures in the maxillofacial region are among the most frequent incidences in patients exposed to trauma. The aim of this study was to evaluate the effect of 2100 MHz electromagnetic radiation on the healing of mandibular fractures in rabbits. The study was carried out on 12 mature male New Zealand rabbits. After producing a left mandibular osteotomy, the fracture was repaired by using a plate screw. The rabbits were divided into two groups À control and experimental. The experimental group was exposed for 3 h daily to a 2100 MHz radiofrequency (RF) for 28 d. Biomechanical, histopathological and radiological tests were performed during the healing of the mandibular bone. According to the biomechanical tests, the energy absorption capacity, toughness and maximum strength of the mandibular bone were increased compared to the control group (6.84 vs. 2.57, 0.135 vs. 0.041 and 22.21 vs. 10.32, respectively). No significant differences between the two groups were found during the radiological assessment. However, the histopathological examination revealed that the fracture healing score was higher in the experimental group when compared to the control group (8.0 vs. 2.75, respectively). In conclusion, the results of this study showed that a 2100 MHz RF radiation positively affected fracture healing. |
1,999,887 | Desk itself is great, fairly straightforward to put together and not terribly ... | Decent desk for the price. Not the most sturdy I've seen, but pretty easy to put together (even with the directions not being included in my box) and works well. | Decent desk, solid construction but came missing two pre-drilled holes. Luckily I could attach in other places. The keyboard tray is also a bit finicky. | The desk is beautiful and a perfect size for our home office. The assembly was easy and took less than a 30 minutes by myself. | Easy assembly, doesn't take up much room on the desk, and shines very brightly. A really good product for a great price! | I love the desk which was easy to put together and worth the price especially for a college dorm. | This is a great desk. It is easy to lift and lower and very comparable to other brands for a better price. | I've been in need of a simple computer desk. Desk is a legit size and is decent. Drawer on the desk seems a little cheap, like I will have to "baby" it. I was able to put the desk together myself and didn't have any problems. Desk isn't to heavy but has enough weight that its sturdy and holds its place. | This is a beautiful desk with a TON of work space--great value for the price! It took me less than an hour to put together which is another plus. | 1,999,887 | Desk itself is great, fairly straightforward to put together and not terribly heavy. Only flaw was upon taking it out of the box, one of the drawers was jammed and required a LOT of patience to wiggle it out of its cubby without snapping any of the wood. I don't even know how that happened, but honestly it's probably unlikely to happen to most. | The desk itself is pretty decent, especially for the price and it shipped ... | Great sturdy desk that was fairly easy to assemble with ... | Assembly was fairly easy. I would recommend this desk to anyone | Desk is easier to assemble than reviews led me to ... | This desk is great. Very sturdy and it cant get any easier ... | This desk was so easy to put together for my daughter | So this desk looks nice but was a bit difficult to put together due ... | but the instructions were pretty clear. The desk itself is very sturdy |
1,999,888 | What questions would an Entrepreneur ask at an Job Interview? | I see a lot of posts about what questions should I ask when interviewing a candidate and such but I haven't really seen any discussion on what questions you ask a company you are applying for.
If you make the interview stage what kind of things do you want to know about the company and their IT before you are willing to make a decision on whether it is the right position for you? | What do you ask the interviewer? | What would an employer ask his boss? | Launching into a whole round of interviews tomorrow and looking for something out of the ordinary. What questions do you like to ask potential candidates? | I'm currently a designer trying my hand at strategy and just got an interview at an awesome agency. What questions should I be expecting?
I'd appreciate any and all advice! | I am taking my first business class in college and one of my assignment is to interview a small business owner. Unfortunately i don't know one and i do not have the time to go around town to look for one. I'd be very grateful if someone could answer just a couple of questions from me. The questions are pretty much a SWOT(strengths, weaknesses,opportunities, and threats) analysis of your business which i will then have to format into essay form. | I have an interview in a few day and I was wondering what kinds of questions I should be asking the broker or if there’s anything I should keep in mind during it? | I'm a fresh graduate of comp sci, going into J2EE webapp development. I've found a great startup in the city that want to hire me.
What questions should I ask them before signing a contract? | 1,999,888 | Today I'm interviewing for a special projects job I really want. What questions would you ask at a job interview?
I'm a multi-media producer in a 2500+ person corporation in a very risk-averse field. I was part of a team to setup a framework to develop a culture of innovation. Ultimately we felt there needed to be a full-time team to develop ideas around the company. Instead of a think-tank, the team would use an online portal to collect ideas from employees and then work with the highest ranked idea submitters to analyze and vet their ideas and help them pitch them to Senior Management. More facilitators than innovators. To avoid bias, we hired a local startup accelerator to interview and choose the team for the first year. We took the Gallup EP10 and I came out as a strong Relator. I've prepared normally, walking through my answers to "the normal questions" but I have a feeling the accelerator might have a different line of questioning. So what other lines of thinking should I be considering?
Prior to this job, I spent over 10yrs freelance in video production working as a producer from one-man-band to large film sets. I managed my LLCs finances as well as setup numerous collaborations between other production groups. I was originally trained to be an editor but often took over control of a production if it was going off tracks. Took this job once our first kid was on the way. My company seems to use me as a second opinion and idea generator on numerous working groups including this innovation initiative.
Thanks ahead of time. | Doing research for the company I'm interviewing with? | Interview for Solution Architect job. What should I expect? | Advice for a junior front end interview | Need Advice: Salesforce SE interview process/expectations | For one of my classes, I need to interview an entrepreneur in my field. Anyone who has created or helped create a tech startup mind being interviewed? | What are your guys thoughts about asking an interviewer this question? | I have an interview coming up for a DWE role I'm really not qualified for. Help? | Important Job Interview Coming Up |
1,999,889 | It's a great laptop for its price | Very good laptop. Very affordable for the sale price $355. Very fast with minimal bloatware. Has everything you'll need or want from a laptop. | Best laptop I have ever had, lots of storage, great price and nice quality and works for everything I need to do. Definitely recommend buying. | Bought this laptop for my father back in 2012. Good price at the time. Working well to this day it even dropped from his desk and still functions like new. | This laptop computer definitely worth its value. It has a super core i7 processor with 6 gigs (I myself am going to upgrade it to 8 gigs). The performance is just wonderful and vaio`s design and keyboard are exceptional.
I strongly recommend anyone to buy this laptop. It is just a dream. | I am enjoying this laptop. I hesitated because I think of Acer as a bargain brand but it is excellent so far. Light enough for travel and an HDMI output to connect to a hotel TV to watch movies. | This computer is without a doubt, one of the best laptops I've purchased. | very nice looking laptop, but costs less than one would expect. touch screen is very responsive, colors are good. | Very cheap...It works fine
But really really slow.. If I have $100 or $200 more budget, I would never buy this
When buying laptops..
my suggestion is
1.never choose AMD processor
2.at least 8GB RAM
3. Windows 7 | 1,999,889 | It's a great laptop for its price. You will really like the big screen. It's faster. I am happy I found an alternative. From now on, it's only Acer. I am tired of Dells and HPs and their poor service for expensive stuffs. Windows 7 is a huge advantage. The laptop is great and what a laptop should be. Of course, I am not trying to overwhelm it with gaming or other high speed programs. I have used it to build my website and trade on the stock exchange. I give 4 stars only because the mouse pad is a bit scratchy...sometimes the cursor runs away or maybe the pad is too sensitive - before I know it, it's zooming in and out of windows :) but that ain't no biggie. I got me a good mouse to work around this although I am still 90% relying on the mouse pad.
LAPTOP WORKS G R 8 T. | Overall - very good laptop. Latest hardware on the market - chewing ... | The laptop is great. Fully meets my expectations | This computer is great. It is reasonably fast and has the windows ... | SIMPLY THE BEST NOTEBOOK ON THE MARKET AND THAT I HAVE EVER USED!!! | Great big screen laptop | Good laptop, good average working time | This laptop worth it or can I get something better for the price? | This is the best value laptop I've ever owned |
1,999,890 | I read the reviews on how great these were | I was surprised at how well them were made considering what i paid for them. I got a lot of compliments on them. | Had not used them yet but they look much better than other ones purchased. The very reason I brought these! | We've had these since May and used them extensively. They are indeed as great as all the other reviews suggest. | I loved them, they were so pretty and I got them on time. The bad thing is as soon as I put them on my car and went for a drive down the street they fell off and broke. Great price but they do not stay on. | I loved them, they are very innovative and great quality. I gave them as a Christmas present and they were really happy with them. | They were absolutely amazing! They did an amazing job making sure I got this before the big holiday! I will buy from them again! I highly recommend them! | They have been great from the time I got them out of the box till now and I will purchase these again...Love them.. | Got these for a birthday present. I think my brother liked them just fine. | 1,999,890 | I read the reviews on how great these were, but the color selection is odd and they are not that great. Kind of streaky and tips are sharp. | They are so sharp and were the perfect color burgundy that I needed | Love the colors A lil softer tips than other brands | They are excellent for adult coloring and are so smooth | These are fantastic with Sharpies | they are great. They look almost very dark blue as opposed ... | They are scary sharp and so good! Buy them | These are great, I prefer the smaller tipped ones but that ... | The rubber bands were of great quality and a great while color |
1,999,891 | I wouldn't be so anti Islam if Muslims talk less and act more. I wouldn't hate Muslims if they would prove to me they are different from the radicals. | My father brought up what I think is a somewhat valid point, he basically is saying that if the extremist Muslims are really only that 10% why don't the 90% come out and protest against them and make the point that it is a religion of peace. Not in those countries that there is risk of those extremist groups killing you but in first world countries. Not saying I agree with this but I just want some proof of protest/disagreement. | A poll shows that the majority of Muslims are anti-gay.
Generally, they are anti-Jewish and also not for women's equality.
Would these views make a Muslim right wing, alt-right, or fascist? | I'm an Islamophobe, but not Muslimophobe.
Does this make any sense?
We need to make a word that distinguish hatred towards muslim people and Islam as an Idea. | Going to the comments section is always one person saying, "This isn't Islam, I don't know what you're talking about," only to get massively downvoted. Then someone else posts a response about a bunch of Quranic verses taken out of context and establishes a sort of guilty until proven innocent scenario.
I can understand how the anti-islam under tone probably developed, but it's a lot more prevalent than I expected. | Anti-Shi'ism Anti-Shi'ism is the prejudice, hatred of, discrimination or violence directed against Shia Muslims because of their religious beliefs, traditions and cultural heritage. The term was first defined by Shia Rights Watch in 2011, but has been used in informal research and scholarly articles for decades. The dispute over the right successor to Muhammad resulted in the formation of two main sects, the Sunni, and the Shia. The Sunni, or followers of the way, followed the caliphate and maintained the premise that any member of Quraysh could potentially become the successor to the Prophet if accepted by the majority. The | It seems that threads about the recent tragedy in Canada are being flooded with Islamophobic comments. While this is (sadly) expected, I have noticed a much stronger push against people who compare Islamic radicalism to other religious radicalism.
My hypothesis is that the hatred of Christianity by /r/atheism helped to balance out the hatred of Islam by reddit's younger demographics. Whole hatred is certainly a bad thing, being able to say "reddit hates all religion, it's not prejudiced" is better than "reddit hated Muslims"
What do you thing has caused the recent spike in Islamaophoboa. | I keep hearing a lot from moderate muslims that these extremists are just giving islam a bad name and islam is really a religion of peace. I have not read the entire qu'ran cover to cover, but I have seen many passages that seem quite obviously promoting the idea of defending islam and stopping evil by force, and I dont really see how an extremist can be considered to be twisting the interpretation for personal or political reasons. I just dont want to be biased so just wondering if there is any convincing books that would help me see things from the moderates view, because the moderate view seems to be more twisted.
edit: thanks for the responses. sorry I didnt respond straight away. I have been busy the last couple days. | We get it ffs everyone on here agrees that you should be able to criticise Islam, you’re just talking to yourself if you post it on here. | 1,999,891 | I get the same "you hate Muslims that's wrong!" "just hate the religion, do not hate the followers "
I wouldn't hate any Muslim if they were honest, I'm more worried about the "moderate" Muslims than I am with ISIS. one of them hides behind a white knight shield while throwing arrows at me and the other is attacking me on their own. I can't defend myself against those arrows but I can defend myself against the attacker.
Moderates and their ideologies are more dangerous to society than a radical. Because they are allowed to do as they please. We Arab atheists are not getting unjustly killed off by ISIS, we are getting brutally judged by moderate islamic 'justice'. To most Muslims, ISIS crimes are barbaric, Moderate Muslim crimes are righteous.
Edit : I also like to point out that moderates always use extremists as a scapegoats. They say they are different yet they follow the same beliefs. For the ordinary western person it doesn't matter, learning about the religion is too much work so they just accept it. Ex Muslims can easily see between the lines but to westerners we're just bigots because we insulted raju and Habib the "foreign taxi driver who puts loud weird Indian music " and the "Muzlim guy who fixes my macbook and talks weird " | Is ISIS just *too* easy to hate? | ALMOST all armed conflict today is rooted in Islamic religious demands. Ofcourse Muslims claim these demands are all justified, whether its the murdering that Islamists are doing in the Philipines or Kashmir or Chechnia..etc..they are ALLLLL JUSTIFIED. In any case, many people insist that Islamic violence has no relation to Islam despite all the violence and hate in the Quran. \n\nSOOO....\n\nsuppose ALLL....EVERY SINGLE CONFLICT EVERYWHERE IN THE WORLD was rooted in ISLAMIC RELIGIOUS DEMANDS...take the very few non-islamic wars or conflicts in the world...like the Colombian FARC...suppose that became and Islamic conflict as with the remaining few...\n\nWOULD THAT FINALLY PERSUADE YOU THAT ISLAMIC VIOLENCE AND HATE AND WAR AND INTOLERANCE IS RELATED TO ISLAM or will you continue with your PURELY INSANE belief that ALLL RELIGIONS ARE INHERITENTLY GOOD? | Why do muslims hate americans and christians so much? | Don't want to spread negative vibes but I'm struggling to control my anger towards this hate against Muslims (rant) | Why do some people insist on provoking Muslims? Is there a better way to achieve the desired results? | Moderate Muslims: Is there a convincing book that shows that islamic extremists are really just twisting the interpretation of the qu'ran? | Ex-Muslims who don't hate Islam? | I fucking hate Muslim people |
1,999,892 | how many pancake blocks does jd walton have at allen high school | Waldo J. Wood Memorial High School High School Athletic Association class A with around 400 students in grades 9–12. The school colors are green, white and gold and the mascots are the Trojans and Lady Trojans. Since 2002, the school has been a member of the Blue Chip Conference, and more recently, the Southwest Seven Football Conference, although previously it was a member of the Pocket Athletic Conference (Two of its predecessor schools, Oakland City High School and Francisco High School were early members of the conference) along with its county rival Gibson Southern (Two of GS's predecessors were also members). Sports offered at Wood Memorial | James Madison High School (Norcross, Georgia) after starting a program and the student is not eligible based on the overall GPA, then the student will be switched to the general program track. If a homeschooled student, a student from an environment other than a public/private school or from a non-accredited school is not able to provide ample information in their portfolio, they must take a 9th grade entrance exam. Each year, an average of 2,500 traditional-age students, adult learners, and homeschoolers graduate from JMHS. Since 2007, the school has held a student graduation ceremony in Atlanta, Georgia. In order to graduate, students must meet requirements including | Kent Benson Michael Kent Benson (born December 27, 1954) is a retired American collegiate and professional basketball player. Having had a prolific career during the 1970s and 1980s, he scored a career high of 38 points, playing college basketball and later spending 11 seasons in the NBA for four teams. Kent Benson attended New Castle Chrysler High School, located in New Castle, Indiana, home of the New Castle Trojans. He was named Indiana's "Mr. Basketball" in 1973. Kent attended Indiana University, located in Bloomington, Indiana, where he played college basketball for coach Bobby Knight. As a freshman, Benson averaged 9.3 | Harold L. Richards High School Harold L. Richards High School is a co-ed public high school located in Oak Lawn, Illinois, a suburb of Chicago, and is a member of Illinois school district 218. The current enrollment is over 1,876 students. The school mascot is the bulldog. The school colors are Gold, Black, and White. The yearbook is 'The Golden Year' and the school newspaper is the 'Richards Herald'. The demographic breakdown of the 1576 students enrolled for the 2012-2013 school year is as follows: Richards competes in the South Suburban Conference (SSC) and is a member of the Illinois | Harold L. Richards High School Harold L. Richards High School is a co-ed public high school located in Oak Lawn, Illinois, a suburb of Chicago, and is a member of Illinois school district 218. The current enrollment is over 1,876 students. The school mascot is the bulldog. The school colors are Gold, Black, and White. The yearbook is 'The Golden Year' and the school newspaper is the 'Richards Herald'. The demographic breakdown of the 1576 students enrolled for the 2012-2013 school year is as follows: Richards competes in the South Suburban Conference (SSC) and is a member of the Illinois | North Marion High School is a public high school in Aurora, Oregon, United States. The school is part of the North Marion School District with all four schools being located on the same campus. The school draws students from the cities of Aurora, Hubbard, and Donald as well as the communities of Broadacres and Butteville.
Academics
The school earned a 4 (out of 5) in its report card grading for the 2013-2014 school year, meaning more than 70 percent of students met or exceeded standards on the Oregon Assessment of Knowledge and Skills. North Marion High School's completion rate was 94.8 percent, and its four-year graduation rate was 78.6 percent.
OAKS testing scores
2013-2014 North Marion High School test scores:
Reading: 95.7% passed or exceeded State Average: 85.6%
Writing: 74.8% passed or exceeded State Average: 61.3%
Mathematics: 98.2% passed or exceeded State Average: 71.3%
Science: 86.4% passed or exceeded State Average: 61.3%
Athletics
The North Marion High School athletics teams compete in the OSAA 4A Tri-Valley Conference. The school's athletic director is Ron Holyoake and athletic secretary is Anita Whitehead.
State Championships
Bob Brack Stadium
Bob Brack Stadium is the varsity baseball field located on the campus of North Marion High School, in the school's athletic complex. In 2011, it was rated "best high school baseball facility on the West Coast" by the National High School Baseball Coaches Association.
Media coverage
In 2011, North Marion students Josh Hauser, Cole Costello, Wyatt Moore, and Logan Beiser founded North Marion Athletics, an organization which highlights scores, storylines, and successes in varsity sports at North Marion High School. Weekly update videos were produced and uploaded on YouTube, along with various interviews, promotional videos, and live broadcasts with commentary of key away games. NM Athletics remained operational until the graduation of the founders in June 2013.
The student-led production was highlighted in local newspapers such as the Woodburn Independent and a Portland Metropolitan Area News Station in Fox 12 KPTV.
Notable alumni
Pat Chaffey, 1986, NFL runningback
Kory Casto, 2000, MLB player
Steve Schrenk, 1987, MLB player
Tucker Knight, 2008, a professional wrestler for WWE
References
Aurora, Oregon
High schools in Marion County, Oregon
Public high schools in Oregon | Madison High School (Houston) James Madison High School is a public High School located at 13719 White Heather Drive in the Hiram Clarke area of Houston, Texas, United States. The school serves grades 9 through 12 and is part of the Houston Independent School District. The school is named after James Madison, a former President of the United States. Madison contains HISD's magnet program for Space and Meteorological Sciences; the program is known as the High School for Meteorology & Space Science. James Madison Junior-Senior High School was opened on September 8, 1965. In February 1968, Dick Dowling Junior High | James Lott Cedar Shoals High School in Athens, Georgia which lasted 25 years. Lott is still number 3 on the all-time list behind Edwards and the current record holder James White from Grandview High School in Grandview, MissouriLott won 3 NCAA High Jump Titles and 6 SWC Indoor and outdoor titles at The University of Texas. Lott also enjoyed an extensive Football career at The University of Texas. Lott started for the Longhorns in 1984 and 1985 at Cornerback. He was inducted into the Texas HS Football Hall of Fame in 1994, and is a Member of the SWC All Decade Team. | 1,999,892 | J. D. Walton Justin Daniel "J. D." Walton (born March 24, 1987) is an American football center who is a free agent. He was drafted by the Denver Broncos in the third round of the 2010 NFL Draft and has also played for the Washington Redskins, Miami Dolphins, and New York Giants. He played college football at Baylor. Walton attended Allen High School in Texas, where he was a first-team all-district and first-team all-county offensive lineman. He recorded 79 pancake blocks to lead District 9-5A as senior, as he helped Allen to win the bi-district championship. In his junior year, | who does mark walton play for in nfl | when did jimmy kleinsasser go to nfl | where did brandon ghee play high school football | who did travis walton used to play for | who did the 49ers trade for j d smith | when did derrick walton go undrafted in the nba | List of Northern Illinois Huskies in the NFL Draft | how many all american players did todd whitten coach at sam houston state |
1,999,893 | A tendency of a mineral to break along a flat surface where layers of atoms are attached weakly to each other? | What is the term describing a mineral resistances to being scratched? | What are to ways a mineral could break? | Compare cleavage and fractures in minerals? | Breaking down of materials on earths crust? | Mineral with crystals that break into thin sheets? | Which silicate minerals separate easily into sheet when they break? | What describes a mineral's response to mechanical impact or the way the mineral naturally breaks? | What its a called when a mineral has a nstural shape? | 1,999,893 | The tendency of a mineral to break along planes of weak bonding is? | What two ways does a mineral break? | What character acteristics must a substance have to be considered a mineral? | Why do ionic compound tend to be brittle? | What silicate minerals seperate easily when they break? | This property of a mineral being able to scratch another substance is known as? | The minerals that looklike plastic have a luster? | A substance made up of atoms of more than one kind of bonder together is a? | What is streak when it comes to talking about minerals? |
1,999,894 | Replacing my Dell Kubernetes cluster | You can deploy a Kubernetes cluster on a local machine, cloud, on-prem datacenter, or choose a managed Kubernetes cluster. You can also create custom solutions across a wide range of cloud providers, or bare metal environments. More simply, you can create a Kubernetes cluster in learning and production environments. | Interested in how people plan to deploy their Kubernetes clusters.
View Poll | I already deployed my Cloudkit+Core Data schema to production. However, I would now like to add an attribute to one of the entities in an update. The option to add a field isn't in the production schema in Cloudkit Dashboard, so can/should I simply deploy to production again? Will my users' existing data be safe? | Kubernetes-757
Kubernetes is a distributed computing platform that has transformed the cloud-native application landscape. This meetup will cover a wide breadth of topics that align with this eco-system | Here are new architecture for Kubernetes monitoring. We try to resolve some issue from Prometheus like Global view for multi cluster, multi tenancy, long term storage and others. Any comments and questionnaire are always welcome.
&#x200B;
| I'm pretty much brand new to Kubernetes, but I'm relatively experienced in Docker. My job's looking into the feasibility of Kubernetes, and I'm trying to set up a cluster. I'm working with multiple CentOS 7 servers on an internal network, and have been able to use kubeadm to set up a cluster. However, I'm looking to make the setup more resilient and add additional masters, as suggested in one of the tutorials.
I know that kubeadm doesn't support additional masters out of the box, but I was wondering if a kubeadm setup would be able to be modified to multi-master setup. I've looked multiple times through the multi-master guide and it seems like it might be possible, but I'm still a bit unclear.
* The guide mentions providing and populating /srv/kubernetes with certs. kubeadm populates /etc/kubernetes/pki with certs. Would these be the same certs that /src/kubernetes would want, and should I just copy them into /etc/kubernetes/pki on my new masters?
* Creating a load balancer doesn't have much information. Am I correct in assuming that I would require an external load balancer such as NGINX running on a separate host to route to my new masters, or is this something that I can rig with Kubernetes to provide (maybe an NGINX container?)?
* For my new workers, if I was to set them up with kubeadm, would the join token point to the load balancer? Or given that kubeadm isn't intended for a multi-master setup, would I need to do this the old way? | Hi all -- I'm a nix n00b (but I'm getting there), and I'm trying to switch to using the various parts of the ecosystem to manage a new Macbook. Right now, I've a fairly simple. I presume this is because home-manager services are for Linux.
I found the nix-darwin project, and I'm wondering how it fits into what I already have.
1. First, does anyone have experience with this? An example configuration to share? Is it wishful thinking to imagine completely erasing any use of Homebrew?
2. Suppose I could achieve this. There are then two files: home.nix for home-manager and darwin-configuration.nix for nix-darwin. Do I use both \`home-manager switch\` and \`darwin-rebuild switch\` depending on what's changed? Or do I somehow import home.nix into configuration.nix and only use the latter command to rebuild everything? | Kubernetes has been making waves! I suppose many are including it in their workflow. But is it a part of your development cycle? or is it only a deployment target ? | 1,999,894 | Hello /r/homelab,
Currently I'm running three Dell desktop PCs (2 optiplex, 1 inspiron) running my kubernetes(k3s . The Dells are a bit older, 2nd and 3 gen i3/i5 which I upgraded to 8gb ram each. Each server has a 120/240gb SSD.
They are mostly idle because I'm still rewriting the software that should run on the cluster. At the time being it is running Kibana and some static webservers. Even while idle I can hear the fans, removing the 80mm fans the CPU fan will ramp up because the BIOS detects that a fan is missing. I live in a small apartment so they are under a table next to my couch. Not a enjoyable experience as you can imagine.
So time for an upgrade, this is my current idea for three new servers:
PCPartPicker Part List
|Type|Item|Price|
|:-|:-|:-|
|**CPU**|AMD Ryzen 7 2700 3.2 GHz 8-Core Processor|$149.99 @ Newegg|
|**CPU Cooler**|CRYORIG C7 40.5 CFM CPU Cooler|$99.99 @ Amazon|
|**Motherboard**|ASRock Fatal1ty B450 Gaming-ITX/ac Mini ITX AM4 Motherboard|$119.99 @ Amazon|
|**Memory**|Kingston HyperX Predator 32 GB (2 x 16 GB) DDR4-3000 Memory|$169.00 @ Amazon|
|**Storage**|Samsung 970 Evo Plus 250 GB M.2-2280 NVME Solid State Drive|$69.98 @ Amazon|
|**Video Card**|MSI GeForce GT 710 1 GB Video Card|$36.99 @ Amazon|
|**Case**|Silverstone SG13 Mini ITX Tower Case|$57.99 @ B&H|
|**Power Supply (this is actually a 450 watt version)**|Corsair SF 600 W 80+ Platinum Certified Fully Modular SFX Power Supply|$139.00 @ Amazon|
|**Case Fan**|be quiet! SilentWings 3 pwm 59.5 CFM 140 mm Fan|$26.90 @ Amazon|
|*Prices include shipping, taxes, rebates, and discounts*|||
|**Total**|**$869.83**||
|Generated by PCPartPicker 2020-01-21 13:39 EST-0500|||
&#x200B;
I live in the Netherlands and for some reason this build is around 700 euros, which is odd because most of the time hardware is more little bit more expensive.
A huge upgrade of course, but I think cooling and in turn maybe the silent operation may be a problem. The workload will mostly be containers for development and web crawlers that I'm currently working on.
Maybe I do need a bigger case or downgrade the CPU, but I really want to fit those three machines under the table next to my couch. The dimensions of that the three cases should share:
52cm X 52cm X 40cm (Length X Width X Height)
20inches X 20inches X 15inches
I hope somebody here has experience with a AMD ryzen 8-core cpus and a Cryorig C7 in a small ITX case to confirm/deny my suspicion. Other tips/changes/gotchas are also welcome!
**TL;DR:** Want to replace 3 pcs, worried that the CPU will get too hot with new build. | Great MOBO for beginner, only one system fan | how many cpu clusters does the powerpc e6500 support | Gigabyte B75M-D3H feedback required... | Replacing my Roku 3, Should I get the i3 or i5 Broadwell NUC? | Upgrading my Core i3 - Core i5 6500 or i5 6600? | While waiting for new Threadrippers I was thinking that maybe Epyc is a better idea for my use case, but I don't know that much about server (SP3) motherboards | I might get a free i3 CPU What's the next step? | Cheap PC. Overclocking Linux -> Home Server (UK) <£100 |
1,999,895 | How do you know When your Sneakers are Worn Out? | I've heard and had the impression that alot of girls find shoes to be a very important part of how a guy looks. Their eyes just basically quickly shift downwards upon first sight to check his shoes. Is this true? If not, then what part of clothing/accessories (e.g. watches) do you find important and why?
Just really curious since I am really aware of what I wear every day. I probably spend more time choosing my clothes and check wether they match than an average guy and just want to look good. | When should running shoes be replaced? | at first the sneakers felt a little small and than after walking around a couple hours a day they felt better. | I have too many sneakers. My tastes have changed over the years, and I now have several pairs that have literally only been worn a few times. These include roshe 1, roshe 2, janoskis, air max, kostons, and some others I can't remember.
What do you guys do? I'm thinking about taking them down to my local consignment shop, but I know I'd take a bath on the value (not that they're worth much).
It's not killing me to keep them, but I'd like to free up some space, maybe I should just put the ones I don't wear away in the closet and forget about them? | Hello there,
I've bought two pairs of low top Converse imitation sneakers for 7 euro's per pair, just to experiment with my style.
I really like the look of the Converse sneakers, so I decided that I am going to buy a pair of authentic Converse sneakers.
Now my question is: How long can I expect Converse sneakers to last (not look ****ed up after a few months) if I keep them in a steady rotation of shoes and not wear them on consecutive days?
And also, does the black line on the side of the white sole fade quickly on real Converse sneakers? Because mine do, and I have been wearing them for 3 months or so.
Album:
I've been wearing the grey pair almost daily and the black pair mostly when I hang with my friends in the weekends.
Thanks! | I have been running in these for as long as they have been out and don't know what to do when they are gone. I put extra pairs on the shelf to prepare!!! | Title. I get out of the car after a long car ride and I noticed my shoes were united, just wondering | When the converse sneakers were made? | 1,999,895 | I'm not trying to wear my sneakers until they have holes or they tear up. But I assume at some point the shoes have broken down and not performing their best. Do I go by tread wear? It's often not easy to feel the difference when wearing the shoes. Any ideas? | How do you keep your shoes from wrecking really easily? | Will shoes fall apart from not wearing them? | I can tear up a pair of shoes pretty fast but these are ok | These shoes are super comfy. I didn't really have to break them ... | If you wear them everyday without rotating between shoes they will wear down pretty quickly. The shoelaces are cheap but easily | I'm on my second replacement pair after the tread cracked ... | fit question: how snug is too snug with new 100% leather shoes? Should I wait for them to break in, or return them? | I wear these shoes all the time. They last ... |
1,999,896 | Do you think there is any interest in bringing RoLo back? | This is not to bring up any discussion on the upsetting news re: Nectar, but rather to say that the only proper replacement, the only other bass artist who is that big, that incredible, with such a massive following, and who shockingly has not yet played Roo is Excision. It is time to get him there.
Plus, it would make up for what I’m sure was a nightmare for Excision when Roo was rescheduled for Lost Lands weekend.
So, please please Roo gods, bring us some X next year! | In an alternate.universe What if roxas won? Or any other candidate what do you think of the changes that could happen under their rule in the first 3 to 6 months.
Poe
Roxas
Binay
Miriam
Would there will still be butthurt emo sore losers because their candidate didn't won in reddit ph like we do now? | Not just for the non-shipped Roshan statues of 2017 and 2018. IMO i think it would be a great incentive to reach lvl 2000 again. Question's up for debate ! What you guys think? | With the news that Perrons time in Vegas coming to an end, do you think it would be good for the blues for him to come back or should we pass and look elsewhere? I think if he came back it would do great things for our power play and overall depth but he would have to be able to show up in the playoffs which he hasn't been able to do consistently. | Not involved like guilty, but affected. Louisville has been accused of steering young players towards certain agents and the sports apparel company, Adidas. Who is Rozier signed with? Adidas.
I know we're all excited about the start of the season but this seemed like something to share on the sub.
More here. | Is it worth downgrading Laca to Lukaku to fit SBC Luiz in my team? Not sure if Lukaku can carry my team up front the way Lacazette has but that Luiz is so tempting. | Is anyone else concerned of them trying to transfer with crean gone? I know we all think he should go but what if they liked him and don't want to play for a new guy. | Recently Roode himself has been popping up on NXT but my question is, is this just a tease and will he be picked up in the draft as the hottest free agent in wrestling? | 1,999,896 | I've seen a lot of people talk about how we need a legit big man who can defend down low and give good rim... protection. Which made me think about RoLo, I vaguely recall an article about how in 2014(?) he was second in the league as far as rim protection. He's 28 and right in his prime as far as big men goes. He was fun and fit in well, plus hasn't fully suited up for Chicago yet.
Any-who, it's off season, thought why not post some more hypothetical arm chair GM. Thoughts on bringing side show RoLo back to RipCity? | Wanna know your opinions on Rolo | who did michal rozsíval play for last year | 7 months removed from playoff hype,what is Terry roziers value in upcoming free agency? | What hurt more? Pavelski leaving or Marleau? | My brother tells me Joe Harris is better than Bojan Bogdanovic. Do you guys agree? | Alaba in Defensive Midfield? | when did michal rozsíval join the chicago blackhawks | Terry Rozier Ready To Get Back To Fiery Self In Game 5 |
1,999,897 | Computer Science with Zaamount | "Algorithms and Data Structures: The Science of Computing" is designed as a second course computer science textbook for colleges. At this level most computer sciences classes tend to focus on programming and programming theory. While it does have some programming examples (all in Java), this book takes a more overall view and deals with the basics of algorithms and data structures. Why is this an important difference? I have seen a lot of bloated code over the years where a programmer writes a hundred or more lines of code to do something that a couple of lines could do if they only had a better understanding of algorithms. This course gives you the conceptual knowledge you need to be able to adapt to other computer languages and coding techniques as they are developed.
The book does make some assumptions about the reader. First, it assumes the reader has had an introductory course in an object-oriented programming language. As indicated earlier, all examples are in Java, but you should be able to follow along if you have had a course in any object-oriented language. Second, the book also assumes a good (but not necessarily college level) background in mathematics.
This is a foundational course in the design of algorithms, and data structures and mathematical theory to predict and verify, as well as empirical analysis to test the results. "Algorithms and Data Structures: The Science of Computing" is a recommended book as a second course in a computer sciences degree as well as a foundational course for those who are trying to develop a broad basis of computer knowledge at home. | I know all the usual power players - MIT, Carnegie, Stanford, but what are some good ones that are a little more cost friendly and have a good reputation within the cs field?
EDIT: spelling
EDIT: I live in arizona so my choices are pretty limited with asu, u of a, and nau. None of which I don't think I've heard if having great reputations within the computer science field. I'm willing to pay reasonable out of state public I if it has a well known program. | Programming the Z80 Programming the Z80 is a seminal programming text, written by Rodnay Zaks and first published in 1979 by Sybex. It is designed as both an educational text to teach programming techniques of elementary to intermediate level using Assembly language, and as a self-contained reference book. Topics specific to the Zilog Z80 microprocessor, such as its internal hardware organisation and instruction set are described in detail. Additionally more general concepts, such as information representation and data structures are also covered. The book is considered an indispensable reference guide by many Z80 programmers. It was also published by Radio | Where math meets in computer technician? | There used to be this course called computer algebra, which is basically a theory course on symbolic computation. Does anyone know of a course along the same line? For reference, here is the old course that is no longer offered.
CSC478H1
Computer Algebra 26L, 13T
Algebraic theory that underlies symbolic and algebraic manipulation by computer. Chinese Remainder and interpolation theory, fast algorithms for computations with integers, polynomials and power series. Newton and Hensel iteration, polynomial and integer gcd algorithms, factorization of polynomials, the Fast Fourier transform, prime number tests, public-key cryptosystems. The Maple computer algebra system.
Thank you | The Department of Statistics at North Carolina State University (NCSU) established a Computational Science Training for Undergraduates in the Mathematical Sciences (CSUMS) program funded by the National Science Foundation (NSF) to provide a rich applied computational statistics research experience to a diverse population of undergraduate students that will encourage them to continue their academic programs to the graduate level and will help them in making more informed decisions about their academic or nonacademic careers. The CSUMS project, NCSU Computation for Undergraduates in Statistics Program (NCSU-CUSP) prepares students to engage in a significant research experience and to be fluent in the languages of computing, mathematics, and statistics. | Greetings all, I am looking for recommendations on the best resources I can use to guide my focus on ramping up my knowledge on CS Algorithms and Data Structures over the next week (short term).
*Background:* I have an interview in the coming weeks that will focus on the usual meat/breadbutter of algo/structs. I have a EE degree and did not take the opportunity to take a course on Algorithms when I was in school, but have started a few algo courses on Coursera to supplement.
What would you use in the same situation with the knowledge you have now? | I got a couple questions particularly about computational cognition any advice or help would be appreciated?
I am from UTM so will I be able to apply to cog science from here and can I take most of the courses at UTM?
what first year and second year courses must I take for computational cognition It was kind of unclear on the website?
Can I get CS pey with computational cognition with out a struggle?
how are job opertunities in software after I graduate?
i have seen quite a few loop hole post with computational cognition are the true and can I take 3 CS courses (FYI I love cs just post screwed me over and I don’t wanna leave lol). | 1,999,897 | Hello I’m a new student at the u of c and one of my classes has the prof Zaamount, as he doesn’t have a lot of info at the u of c and how he is in classes, I was wondering if anyone had him and if they did how was he as a prof for beginner computer sciences classes? | when does john zandig return to czw | how many professors did the zamojski academy have | when did zainab ahmed get her bsc in accounting | Question about Alvis and Zanza | what is rafael zamarripa's career | I'm in love with Zaureth! | who is known as the lucasian professor of mathematics | who performed the two-person mentalist ritual known as the zancig routine |
1,999,898 | I was found. They emailed me to ask me to plan an activity. When I asked how, they said through the "lds.org" database. I left so long ago I didn't know that was a thing. | Went to look up the details for the whole LDS HeartSell mind control deal to show my exmo girlfriend, but it seems all that's left is web archives and indirect articles about it. Just another bit of church history white-washing? | Look at the Church's web page...LDS.org...you should be able to find something. I know I've managed to find a ward or branch everywhere I've ever been in the world. Isn't it wonderful!!!\n\nI found an area there... | We, a small team of BYU heretics, have just finished coding a site which will include...
* the full LDS canon, complete with annotations on science, linguistics, parallels, ethics, and so on
* a database of fun quotes from LDS officials
* a lot of user-submitted analysis (you can annotate a chapter of the BoM, write an editorial, anything)
* and much more
It will be in the "beta" phase until we can get enough startup cash to open it to everyone. Post here or PM me for the temporary site address if you're interested in getting a sneak peak and lending feedback.
Thanks for reading. We're excited to release this to the public and we're confident that you'll appreciate it. | I grew up mormon and I have listened to The Last Podcast on the Left series. I am doing a presentation for my Zombies and Dystopia History class (IKR? it's pretty awesome) with my chosen topic being Ghostly spaces:communing with the dead through history and technology. I'm going to reference Spiritualism of the late 1800's, early 1900's. I know there are links to the early formation of the church and the Smith family's preoccupation with the occult and spiritualism myths dominant at the time. I figured that instead of scouring the internets for relevant articles someone here would have a handy reference or two. TIA! | Wanted to see what the Mormons teach about things, so I know how to better witness to Momons. | So I’m an ex Mormon and am on a spiritual journey to find a new religion and I’m interested in learning about this religion what should I do to see if this religion speaks out to me and is what I wanna join | MormonLeaks sexual orientation of Chelsea Manning. LDS Church spokesman Eric Hawkins provided an official response, which stated: "In these committee meetings, presentations are routinely received from various religious, political and subject matter experts on various topics. The purpose is to understand issues that may face the Church, and is in pursuit of the obligation Church leaders feel to be informed on and have open discussion about current issues. This is an informational forum, not a decision-making body." Hawkins pointed out the videos were from a timeframe of 2007 through 2012. In total the 15 videos were published to YouTube on the | THE CHURCH OF
JESUS CHRIST
OF LATTER-DAY SAINTS
March 27, 2015
ANNANDALE VIRGINIA STAKE
Dear Brothers and Sisters,
Through the miracle of technology our world is increasingly connected. Given the ease with which we can access a wide array of content, it is more important now than ever to ensure we are tuning in to voices that encourage us to make righteous choices.
The First Presidency recently sent an electronic newsletter to members with an LDS Account. Your LDS Account is used to access all resources on lds.org, familysearch.org, and other Church sites. If you do not have an account, we encourage you to create one and keep your profile information such as your e-mail updated. This will enable you to receive important information. We also encourage you to upload a photo of yourself as well.
Church leaders have asked members to utilize technology to be a positive light to the world. One area of emphasis is social media. For some using social media is a part of your daily life while others feel apprehensive or overwhelmed using it. No matter your familiarity with social media, we invite you to study Elder Bednar’s address given at Education Week. He provides some basic nuts and bolts to social media and ideas as to how we can use it to 'hasten the work'. Please prayerfully consider how you might act on this invitation:
"what has been accomplished thus far in this dispensation communicating gospel messages through social media channels is a good beginning—but only a small trickle. I now extend to you the invitation to help transform the trickle into a flood. . . .I exhort you to sweep the earth with messages filled with righteousness and truth—messages that are authentic, edifying, and praiseworthy—and literally to sweep the earth as with a flood." David A. Bednar, address given at BYU Education Week, August 19, 2014.
In accepting this invitation please do not project that your postings, blogs, pages, boards, websites etc. speak for or were created by the Church. People need to find the official sites of the Church such as lds.org and mormon.org easily. You should avoid using MORMON or LDS or Church logos in the name of your pages, blogs, boards, websites, and so forth.
Our stake has a Facebook page as well as a board on Pinterest. We encourage you to "like" and "follow" these pages as they will facilitate the sharing of positive content with those in your sphere of influence.
We also admonish you to unite as individuals with others of faith in standing for values such as religious freedom. Please consider visiting FaithCounts.com and following that service on the social media of your choice. In addition, contemplate what other actions you might take as an individual to develop positive relations with community and faith leaders in our area.
May the Lord bless and guide you as you consider how to use technology and other tools in accomplishing the mission of helping all come unto Christ.
Sincerely,
Text Box:
For the Annandale Stake Presidency | 1,999,898 | (This is my first time posting after much time lurking. Hello, you lovely people!)
I don't know how to get myself removed.
I bounced sometime around '08 and never looked back. The only real member in my life still is my mom, who thankfully has respected my wishes and not tried to include me in the church or anything related to it. She's run interference for me with her family members, who are all TBMs and the mean, angry, fearsome ones at that. She even went to bat to me against other members. We're really close.
Today I got emailed by some woman who's in my old hometown stake asking me and seven other women to help her plan a YSA activity (which lol I'm married but okay). It was lengthy and detailed and reading it, even if it was innocuous, made me sick.
I went through so much in the last few years I was semi-active and while I've dealt with a lot of it in therapy I still don't like thinking about it. Leadership convinced my friends to secretly spy on me and report back to the bishopric, my bishop sat me down in his office and asked me to describe my sex life in detail, I was publicly accused of prostituting myself (?!) with no evidence to the point that various members were calling my mom on vacation to figure out "what to do with me", they tried to destroy my relationship with my non-member father... on and on. I was only 17 and when I went to college I cut and run and my mom promised, even if she's still active in that same ward, to never update them about me.
Getting this email made it all come flooding back. I have no idea how they got it because my email isn't publicly listed anywhere and I created it when I was in college. When I asked the sender how she got my contact information, she said she did a search in the LDS.org]( ward directory for all women under a certain age who were unmarried in the stake and contacted them. Maybe I'm naive (and I knew they kept paper records) but I didn't realize there was a SEARCHABLE DATABASE with information. I searched to see how I could get it taken down since I don't want my contact information up for any reason (I also have a stalker, non-Mormon, so I tend to file information takedown requests whenever and wherever) but it all seems you have to do it from within an [LDS.org account which I obviously do NOT have.
I know it's been a decade and I know they can't hurt me but this put me in kind of an emotional tailspin. The woman was very polite when I told her I'm no longer active and haven't lived in the stake for a decade, but just knowing that anybody from my ward could somehow find my contact information really bothers me. I just want that part of my life over and I thought it was. I never formally resigned or got excommunicated (I'm not sure anybody cares enough to kick out even a pot smoking bisexual libertine like me, or they don't know) because I didn't want more scrutiny on my mom; she's been so respectful and accommodating to me that I have wanted to be the same way for her. But now I think maybe I want to. I have to deal with my mom's family repeatedly trying to get me back to church and sending me non-stop messages about how it's never too late, my soul can still be saved, I can forsake my sinful ways and Jesus will love me again but for some reason somebody calling me "Sister \_\_\_\_\_\_" again was kind of the final straw.
Thank you for reading. I just... had to rant about it to people who may understand. | My ex [40M] keeps contacting me [20F], even going as far as harassing my mom [46F] about it. | I (32 F) just found out my dad (78 M) molested my sister (41 F) | My ex girlfriend broke up with me over assumed religion-centric incompatibility | Spiritual sleep therapist harrassing 82 year old grandmother | A survivor myself, I victimized a younger friend as a child (unknowingly at the time). Considering contacting her 15 years later. Thoughts? Advice? | If she kicked me out then why does she keep calling me? Should I involve the elders? Please read. | I've been disowned, what's the next step? | My [27M] ex's [26F] mom reached out and I'm not sure if I should respond |
1,999,899 | Una nueva especie de Opistognathus (Pisces: Perciformes) para la Isla de Gorgona (Pacífico Colombiano) | A new species of Opuntia, O. preciadoae Scheinvar, Olalde, Gallegos & J.Morales is described. It is distributed in Coniferous and Quercus Forest of some northern states of Mexico where few opuntias live. | Hi, here's a 2 part travel doc about the 2019 Chile Eclipse:
Hola, aqui esta un documental de viaje en dos partes sobre el Eclipse de Chile 2019:
&#x200B;
Parte 1 / Part 1 (Elipse Hunting / Buscando El Eclipse)
Parte 2 / Part 2 (Elipse Day / Dia del Eclipse)
| from its strata, mainly near to the modern town of Villa de Leiva in Boyacá. Paja Formation The Paja Formation is a Mesozoic geologic formation from the Aptian epochs of the Early Cretaceous of central Colombia, extending on the Altiplano Cundiboyacense in the Eastern Ranges of the Colombian Andes in the departments of Cundinamarca, Santander and Boyacá. It mainly composed of mudrocks with nodules of sandstones and limestones, that are interpreted as part of a marginal marine deposit, with anoxic zones, in the warm and shallow sea that covered most of the Colombian territory during the Cretaceous. Plesiosaur, ichthyosaur, sea | from its strata, mainly near to the modern town of Villa de Leiva in Boyacá. Paja Formation The Paja Formation is a Mesozoic geologic formation from the Aptian epochs of the Early Cretaceous of central Colombia, extending on the Altiplano Cundiboyacense in the Eastern Ranges of the Colombian Andes in the departments of Cundinamarca, Santander and Boyacá. It mainly composed of mudrocks with nodules of sandstones and limestones, that are interpreted as part of a marginal marine deposit, with anoxic zones, in the warm and shallow sea that covered most of the Colombian territory during the Cretaceous. Plesiosaur, ichthyosaur, sea | seals, seagulls and cormorants, as well as the human-introduced deer and goats. The island is the location of one of the more southerly Atlantic breeding colonies of the Magellanic penguin. As early as the last part of the 18th century, Isla de los Estados was used as a seal harvesting location. Isla de los Estados Isla de los Estados (English: Staten Island, from the Dutch "Stateneiland") is an Argentine island that lies off the eastern extremity of the Argentine portion of Tierra del Fuego, from which it is separated by the Le Maire Strait. It was named after the Netherlands | Hiskatherium saintandrei, gen. et sp. nov.: An Unusual Sloth from the Santacrucian of Quebrada Honda (Bolivia) and an Overview of Middle Miocene, Small Megatherioids | Pyura chilensis clouds of sperm and eggs into the surrounding water. If it is alone, it will procreate by self-fertilization. Its blood is clear and can contain high concentrations of vanadium, which may be ten million times that found in surrounding seawater, although the source and function of this element's concentrations are unknown. The earliest mention of the "P. chilensis" was in 1782 by Juan Ignacio Molina in his book "Saggio Sulla Storia Naturale del Chili." Molina, a Chilean abbot who was shunned from Chile along with the rest of the Jesuit missionaries, wrote this book to describe the life lived by | This guide is a selection of resources available at Belk Library and Information Commons to assist with research on El Camino de Santiago de Compostela. | 1,999,899 | Four new species of eastern tropical Pacific jawfishes (Opistognathus: Opistognathidae). | The Chromodorididae (Opisthobranchia: Mollusca) of the Indo-West Pacific: a review of the genera | how many genera are there of ophiocordyceps sinensis | Three Species of Grandidierella (Crustacea: Amphipoda: Aoridae) from Coastal Areas of the Tohoku and Kanto-Tokai Districts, East Japan, with the Description of Two New Species | The genus Chelonuropoda is reviewed and a key to the known species is given. Three new species (Chelonuropoda banari sp. nov., Chelonuropoda canalitica sp. nov. and Chelonuropoda brasiliana sp. nov.) are described and illustrated. Three Oplitis species (Oplitis athiasae Hirschmann and Zirngiebl-Nicol, 1973; Oplitis similibispirata Hirschmann and Zirngiebl-Nicol, 1973 and Oplitis nicolae Hirschmann, 1991) are transferred to the genus Chelonuropoda as new combinations. | Three new species of freshwaterDiploneisfrom Japan | A new genus and new species of terrestrial potamid crab ( Carpomon pomulum) is described from the island of Palawan in the Philippines. This new genus can easily be distinguished from all other Philippine potamids in its smooth and inflated carapace, no trace of an epibranchial tooth, extremely low postorbital cristae, and stout and twisted male first gonopod. | A molecular phylogenetic approach to the New Zealand species of Enantiobuninae (Opiliones:Eupnoi:Neopilionidae) | Five aquatic Oligochaeta species new for the fauna of Montenegro |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.