query_id
int64 0
355k
| query
stringlengths 2
25.6k
| neg_doc_0
stringlengths 13
360k
| neg_doc_1
stringlengths 9
301k
| neg_doc_2
stringlengths 9
364k
| neg_doc_3
stringlengths 13
347k
| neg_doc_4
stringlengths 14
562k
| neg_doc_5
stringlengths 13
589k
| neg_doc_6
stringlengths 14
293k
| neg_doc_7
stringlengths 11
403k
| doc_id
int64 0
355k
| positive
stringlengths 1
679k
| neg_query_0
stringlengths 3
23.4k
| neg_query_1
stringlengths 2
47.3k
| neg_query_2
stringlengths 3
47.3k
| neg_query_3
stringlengths 3
37.6k
| neg_query_4
stringlengths 2
64.1k
| neg_query_5
stringlengths 3
64.1k
| neg_query_6
stringlengths 2
21.3k
| neg_query_7
stringlengths 3
64.1k
|
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
0 | I like how there are so many flaps for good air ... | How are airbags good? | This improvement allowed the flaps to be used more during takeoffs and landing . | Very nice people to work with. Flap wouldn't stay shut and they were very quick to resolve my issue. | High-lift device In the split flap, the lower surface hinges downwards while the upper surface remains either fixed to the wing or moves independently. Travelling flaps also extend backwards, to increase the wing chord when deployed, increasing the wing area to help produce yet more lift. These began to appear just before World War II due to the efforts of many different individuals and organizations in the 1920s and 30s. Slotted flaps comprise several separate small airfoils which separate apart, hinge and even slide past each other when deployed. Such complex flap arrangements are found on many modern aircraft. Large modern airliners | The paper describes experimental results of controlling flow separation by periodic excitation on the flap of a generic high-lift configuration. The single slotted flap of the two-dimensional test model is equipped with a robust and reliable actuator system that fits inside the flap. The flow is excited using a pulsed wall jet that emanates from the upper surface near the flap's leading edge through a small spanwise-oriented slot By preventing the flow from separating or by reattaching the separated flow, lift and drag are substantially improved, resulting in a lift-to-drag ratio enhancement of 20-25 %. Because of the actuator assembly with spanwise individually addressable segments, the separated flow can be forced to attach only to certain parts of the flap. Local spanwise excitation is thus used to generate a rolling moment without the need to deflect an aileron. | This is the flap I needed, it is as sturdy as it can be for the job it does. | Not a very good product. After a day of use, the magnetic bars that are supposed to move up and down to capture the flaps are sticking, leaving the flaps at the mercy of the wind.
UPDATE: This continues to be a piece of crap. Sadly once you have an opening of a certain size, you find yourself stuck with a certain product.
Don't waste your money. | The concept seemed to be really neat, and it appear to be truly a better, design. However in 3-4 weeks of operation it has stuck open 3 times. Since we have holding tanks, and have to pay for a pump truck this turned out to be a big deal! I could have replaced my conventional flapper 20 times for what this has cost me. So I lived and learned! In the garbage with this one, and back to the old faithful flapper. And just in case you are wondering, YES, I did install it correctly, it is simply a piece of junk. | 0 | Fit perfectly. I like how there are so many flaps for good air circulation. | fits good. Only problem is the straps are glued on ... | Fits perfectly. This is really not hugely important but ... | This bag fits perfect. Some of the reviewers complained about it not ... | Fit OK but the leg holes at the bottom have ... | Fits wonderfully. I hve purchased several of them and will ... | The fit is great and I am very happy with the product overall | Fits perfect and I'm very pleased with it | fit very nice only problem was that the strap popped and i ... |
1 | how many pages is rosette wolczak's file | Investigator Sheets, subtitled "Diabolical Dossiers of Doom", is published by Chaosium in 1993 for the horror role-playing game Call of Cthulhu.
Contents
Chaosium first published the Lovecraftian horror role-playing game Call of Cthulhu in 1981, and subsequently produced a number of editions, including the 5th edition in 1992. The following year, Chaosium produced two supplemental products for use with the 5th edition under the subtitle "Diabolical Dossiers of Doom": a package of various blank certificates called Dire Documents; and Investigator Sheets, a set of character sheets for the three standard eras used in the game: the 1890s, 1920s, and 1990s.
Reception
In the October 1993 edition of Dragon (#198), Rick Swan questioned why any player with access to a photocopier would need these.
Other recognition
A copy of Investigator Sheets is held in the "Edwin and Terry Murray Collection of Role-Playing Games, 1972-2017" at Duke University.
References
Call of Cthulhu (role-playing game) supplements
Character sheets | So yea there is this one book which used 2015 digits to print it's page numbers. Also on the first page, it start's with site 5; so we assume there are no other pages before page number 5.
What number is on the last page?
I came up with 705 but my friend says "You gotta add up the 4 missing pages in the beginning"
Whyyyy I really don't understand?
Edit: Also how would I search for this in WolframAlpha? | How many pages does Hoot by Carl Hiaasen have? | This is a waste of paper.. and money, but mostly paper. Every page has 2 words, she doesnt. Do not buy this it shouldnt even be sold. | How many pages is the fire Eternal hardback? | Assimil has four CD's with a work book. The work book is very small. The type is difficult to read. I don't understand why they did not make the work book with a font of normal size. I stopped using it after a few hours. I may return to use it again but have been disappointed so I cannot recommend. | The first hundred or so pages are great. Probably the rest are too but after the first hundred you get the idea. | The format was terrible and the pages turned sideways were impossible to follow. I would like my money back on this book!
Jean Wojakowski | 1 | Rosette Wolczak the files of more than 20,000 persons arrested between 1942 and the end of the war by the police. Rosette's file number is "CH.AEG Justice et police. Ef/2-041-No4928" and contains 30 pages. In 2007, following an inventory work of Jewish children deported during World War II, a memorial was inaugurated in Rosette's school in Paris in the 3rd arrondissement. Michel Beretti received funds from the "Foundation for the memory of the Shoah victims" to adapt Rosette's story for the theater in 2012. His work is archived under the tag ""4928 project"", a reference to the number of Rosette's administrative file | where are rosettes issued to soldiers | what is the population of rose hulman institute of technology | Memorializing the White Rose Resistance Group in Post-War Germany | what is the name of audrey rose's daughter | how many people are on the committee that discussed the future of the rose art museum | [The preservability of rosette-forming blood cells in various culture media]. | who identified the rosette in the retina | Rose Center & Neighborhood Women, Inc. : Project in CED final report |
2 | DESIGN AND CONSTRUCTION OF THE LA MAURICIE NATIONAL PARK SCENIC ROAD | Faro del Comercio Faro del Comercio is a monument designed by the accomplished Mexican architect Luis Barragán and constructed in 1984 by architect Raúl Ferrera. It is a recognizable sight in Monterrey among many other modern manmade landmarks, such as Neptune's Fountain (Fuente de la Vida), the Monterrey City Hall, the Papal Bridge (El Puente del Papa), and the Bridge of Unity (Puente de la Unidad) in San Pedro, connecting that municipality to Monterrey. These sites are intended on one hand to complement the city's few remaining traditional landmarks, such as, the Bishopric Palace (Palacio del Obispado) and Museum, the | Arví Park (in Spanish known as "Ecotourism Park Arví") is both an ecological nature preserve and Pre-Hispanic archeological site on the eastern slopes of Aburrá Valley, in the northeast area of Medellín, Colombia. The park covers several other municipalities of Antioquia, including Envigado, Bello, and Copacabana. It covers 16,000 hectares, 1,760 of which are in the state of natural forests. And it is equipped with 54 miles of walkable trails. It is a major tourist attraction, known for its wildflowers, butterflies and trails. Activities include hiking, nature tours, cycling, and outdoor adventure sports. An outdoor food market is located next to the gondola station. The Piedras Blancas Ecological Hotel and its private reserve are adjacent to the park.
The park can be reached from downtown Medellín via the metro station. Line L on the Medellín Metro goes to Arví station, where there is a direct link to the metrocables that go to the park.
Development
The investment in this huge park, the largest of its kind in the country, is made entirely by regional state agencies, and it has achieved the feat of offering 12 square meters of parkland for each resident of Medellin, where before it was only 4 meters.
Thanks to the joint efforts of many companies Antioquia (EPM, the Metro de Medellín, Comfenalco, and several others) the park is now a reality.
Pre-Hispanic constructions
The park features sections of prehispanic construction, including antique buildings, water works, platforms, roads, gardens and ditches. It has trail called "Camino Cieza de León" or the "Prehispanic Trail", which can be more than 1,500 years old. It is very wide, built of stone, and is still well preserved some of the original parts.
Access via Metrocable
Among the most featured attractions of Arví Park is its access system, which is realized through a metrocable that is oriented towards ecological tourism.
Cable Arví, also called Metrocable Line L, is a section of the cable cars that connects Santo Domingo Savio station with Arví Ecotourism Park. It is the first tourist line of the Metro and the third by cable car System, and began commercial operation in February 2010.
References
External links
Parque Arví website
Nature reserves in Colombia
Geography of Medellín
Parks in Medellín
Tourist attractions in Medellín | book published in 1880, gave one of the first descriptions of the area and referred to the three towers as "Cleopatra's Needles". She and her party are sometimes credited as being the first "foreign tourists" to visit the area that is now called Torres del Paine National Park. Several European scientists and explorers visited the area in the following decades, including Otto Nordenskiöld, Carl Skottsberg, and Alberto María de Agostini. Gunther Plüschow was the first person to fly over the Paine massif. The park was established in 1959 as "Parque Nacional de Turismo Lago Grey" (Grey Lake National Tourism Park) | Park Güell Park Güell The Park Güell ( ; ) is a public park system composed of gardens and architectonic elements located on Carmel Hill, in Barcelona, Catalonia, Spain. Carmel Hill belongs to the mountain range of Collserola – the Parc del Carmel is located on the northern face. Park Güell is located in La Salut, a neighborhood in the Gràcia district of Barcelona. With urbanization in mind, Eusebi Güell assigned the design of the park to Antoni Gaudí, a renowned architect and the face of Catalan modernism. The park was built from 1900 to 1914 and was officially opened as a | Grutas de Cacahuamilpa National Park The Grutas de Cacahuamilpa National Park in Guerrero, Mexico, is best known for the Grutas de Cacahuamilpa Caverns, which are one of the largest cave systems in the world. It is also home to the Grutas of Carlos Pacheco, a smaller system, as well as two subterranean rivers which have carved out tunnels in the rock. The park has outdoor pursuit attractions such as rappelling, and rock climbing in Limontitla Canyon. as well as the two underground rivers to explore. It also has a small botanical garden, a pool and places to camp. The park | Makati Park and Garden Rehabilitation Commission. It is also a bird sanctuary and one of five plant nurseries in Makati. A prominent feature of the park is the monument to Andrés Bonifacio located on the western side near the parking area. The monument, designed by Filipino sculptor Juan Sajid Imao, son of National Artist Abdulmari Imao, was erected in 1997 to commemorate Bonifacio's death centennial. The park also features a small lake, fountains, a man-made waterfall, an aviary, amphiteater, pavilion, and gazebos, including a floating octagonal gazebo. The park's Artist Pavilion serves as a function hall and is a favorite venue for social activities | half of the 2000s, there were efforts to build a 19 lane ski resort on the north side of the volcano itself. However these efforts have been resisted by local residents concerned about losing access to their lands. Nevado de Toluca National Park The Nevado de Toluca National Park is located southwest of the city of Toluca, Mexico State. It was decreed a park in 1936, primarily to protect the Nevado de Toluca volcano, which forms nearly the park’s entire surface and is the fourth highest peak in Mexico. It is 45 km from Toluca and 135 from Mexico City. | Cerro Sechín slabs at Cerro Sechin may represent the central Andes' oldest known monumental sculpture. Cerro Sechín sits on a granitic hill, in the Casma Valley. It is located east of the Pan-American Highway, from the provincial capital of Casma and north of Lima. It is situated from the Pacific Ocean, near the confluence of the Sechin and Moxeke Rivers at an altitude of above sea level. The site contains walled enclosures around dwellings as well as temple platforms. Although the archaeological site occupies approximately , the monuments are grouped in a single hectare. The Sechin Complex is made up of several | 2 | The "La Mauricie" National Park's scenic road is the first of its kind in Canada. It was built into an underdeveloped territory, where no other transportation facility existed. The 14 million dollar road covers 62.5 kilometres; the design and construction started in 1971 and was completed by 1980. The scenic road links the developed sectors of the park. This paper is a summary of the different steps in the design and construction of the road. Because Parks Canada's main goal is the protection of surrounding territory, many design and location criteria were added to current standards. These preservation criteria bring additional constraints for the execution. The methods of construction and some elements of design were modified so that the project could be both economical and practical. (Author/TRRL) | The Function Development of National Scenic Sites and Their Protection and Utilization | how much does the national scenic road fund | SOME PROBLEMS ABOUT THE CONSTRUCTION OF NATIONAL GEOLOGICAL PARK OF CHINA | who remodeled holyrood park in the late 17th century | A national park in alberta canada? | On the Mountain Park Planning and Constructions——Landscape Planning and Design of the Maanshan Park,Huadu,Guangzhou | Ideas on Zhenghe Park Design: The Integration of History, Reality and Future | A Study on Scientific Status of Tourism Resources and Conservation Action Plan of the Five-finger Peaks Geo-park |
3 | Primary Investigation on Spider Community in Konglin of Qufu of Shandong | Abstract Survey was conducted to determine the composition of the spiders in a grape vineyard by using pitfall traps in Sunggeo-eup, Chunan in 1999. Total 17 genera and 19 species belonging to 10 families of spiders were identified. The dominant family was Linyphiidae. Overall, the seasonal fluctuation of the spider population showed two peaks a year. The results showed that the composition of species was very poor and occurrence density was very low in a grape vineyard in this study. | Diversity and abundance of spider fauna at different habitats of Jahangirnagar University Campus, Bangladesh | The spider species in different period in transitional zone between cotton field and its near desert in Xinjiang was analyzed using Berger-Parker dominance index(d).The result showed that the dominant species of spider communities in cotton field were Philodromus xinjiangensis,Xysticus and Pardosa falcate,and the dominant species of spider communities in transitional zone were Philodromus xinjiangensis,Xysticus and Oxyopes sushilae.And also the comparison of their dynamics between Aphis gossypii in cotton field was made. | Diversity and Distribution of Spiders in Southwestern Nigeria | A large and dense population of over 500 burrows of Atypoides riversi in a 2 .0 x 3.2 m are a was monitored for two years to indirectly determine demographics, growth rates, survivorship and longevity o f the spiders . Twelve size classes of spiders were designated by correlating spider size to burrow size . All siz e classes were present simultaneously throughout the year . Variable growth rates were recorded for spiders in each size class, and survivorship was lowest for spiders in the smallest size classes . It is estimated, based in large par t on growth rates, that A. riversi can live at least 16 years in the field . | Daviesa is a genus of Australian tangled nest spiders first described by A. Ö. Koçak & M. Kemal in 2008. it contains only two species.
References
External links
Amaurobiidae
Araneomorphae genera
Spiders of Australia | Where garden spiders' habitat? | What is the scientific name for the garden spider? | 3 | The spiders were sampled by net-covering and trapping methods,the spiders in Konglin of Qufu of Shandong Province were investigated.In result,there were 1 562 sample spiders were collected totally and they belong to 42 species,35 genera,15 families,2 suborder.Among them,there were 7 species of spiders newly recorded in Shandong Province. | A Catalogue of Insects Investigation from Zhongshan Wugui Mountain Nature Reserve in Guangdong (II) | Species composition and seasonal occurrence of spider mites (Acari: Tetranychidae) and their predators in Japanese pear orchards with different agrochemical spraying programs. | ON THE SPIDER DIVERSITY IN AND AROUND DEEG- TOWN, BHARATPUR (RAJASTHAN) | Inter- and intra-population variations in diapause attribute of the two-spotted spider mite,Tetranychus urticae Koch, in Japan | what type of spider has matriphagy in it | Two new species of the trapdoor spider genus Conothele Thorell, 1878 (Mygalomorphae: Halonoproctidae) from China. | Study on Dynamics of Dominant Spider Species and Aphis gossypii in Transitional Zone Between Cotton Field and Its Near Desert In Xinjiang | how many genera are there of anapidae spiders |
4 | SOS BY ETHERNET : DUBLIN IS IMPLEMENTING AN AUSTRALIAN HI-TECH MOTORWAY SOS PHONE SYSTEM | Does your telephone voice communication share the fiber-optic cabel whit Internet data? | S-band is used in North America for a successful and growing satellite radio one-way broadcast system. It is currently being expanded and improved to provide localization, personalized and on-demand services. Two way capability to accomplish this will initially be through the internet accessed by cellular telephones, iphones and smartphones. Future improvement for high volume requested returns to the mobile subscriber may use Wi-Fi access to the internet. | Hello,
I'm traveling around Europe for a couple of months, and currently in Amsterdam. I was contacted by Facebook a few weeks ago, and we've had difficulties scheduling an interview due to the time difference between Central Europe and California. I was supposed to have an interview on Friday morning while in Paris, but our Skype call dropped four times in 10 minutes, I believe part of the problem was the flaky internet connection I was using though the interviewer said the problem was on his side, so we rescheduled for today.
I don't trust the internet connection at my hostel, and I'm looking for a quiet place with a fast and reliable internet connection for my call today at 5pm. I've found a few internet cafes online, but I'm not sure they'd be a good environment for an important call.
TLDR: Need a quiet place with fast internet for a interview over Skype. | Device that connects a computer to a network via telephone line? | Bell Aliant High Speed Internet is the residential broadband Internet technology offered by Bell Aliant. It is available in Atlantic Canada.
Features
Bell Aliant High Speed Internet includes a wired modem, wireless internet, and Internet Security service options.
Bell Aliant has two stand-alone unlimited High Speed Internet options: High-Speed, which offers up to 1.5 Mbit/s download and up to 640 kbit/s upload and High-Speed Ultra, which offers up to 7 Mbit/s download and up to 640 kbit/s upload.
In a Bundle (with satellite or IPTV and home phone), Bell Aliant High Speed offers unlimited internet up to 7 Mbit/s download and up to 640 kbit/s upload.
References
Bell Aliant | AT&T Computer Systems the 3B5 and 3B15 computers for billing and telecom switching control applications. After divestiture, January 1, 1984, American Telephone & Telegraph was required to put its computer business into a fully separated subsidiary called AT&T Information Systems (ATTIS, without the ampersand or hyphen). Software was developed in New Jersey locations (Murray Hill, Summit, Holmdel, and Piscataway), and software, hardware, and system solutions were developed in Naperville and Lisle, Illinois. After a couple years of court hearings, AT&T was allowed to pull the business back into the mainstream corporate organization, and it was renamed AT&T Data Systems Group, consisting of 3 | In this paper, a third-generation universal mobile telecommunications system (UMTS) solution for the delivery of biomedical information from an ambulance to a hospital is presented. The joint transmission of voice, real-time video, electrocardiogram signals, and medical scans in a realistic cellular multiuser simulation environment is considered, taking into account the advantages and particularities of UMTS technology for such transmission. The accomplishment of quality of service constraints for different services is investigated and quantitative results are provided in order to demonstrate the feasibility of using UMTS technology for emergency care services on high-speed moving ambulance vehicles. | Like, could anyone just start up a phone company or dial-up ISP using the existing lines?
EDIT: In the USA | 4 | A new SOS phone system has been installed on the Southern Cross sector of the M50 ring road in Dublin, Ireland. The phone system was developed by Clearsonics, an Australian firm. It deploys innovative voice over Internet protocol (VoIP) call management technology activated from hands-free roadside phones | what type of switches were used to provide voice service in ireland | Challenges of 'VoiP' Communication Systems for Air Traffic Management | At the University of Applied Sciences, Bremen, we have developed a Crypto-Chip for real-time enciphering connections in any ISDN-net in close cooperation with an ISDN-component manufacturer. The chip is called "TELECRYPT", has less than 40 pads and is designed for the requirements of the telecommunication industry. Aside from the hardware implementation of the ciphering algorithm a new concept for the integration of a ciphering chip into telephones and telephone systems is proposed. The underlying technology can also be used for ciphering other serial datastreams. With the development of TELECRYPT it will be possible for the first time to set up telephones and telephone systems with minimum effort with one security module. | One of the several initiatives to bridge the digital divide in developing countries has been the deployment of information kiosks or knowledge centers in villages in rural parts of the country. These kiosks provide services ranging from email, chat and browsing to distance education programs, agricultural services and eGovernance services. A kiosk typically comprises of a computer with printer, web cam, multimedia system and Internet connectivity and is owned by a local entrepreneur. Moving away from the PC based kiosk model, we present an alternative platform to create and host such information kiosks in the telephony network. We call these as VoiKiosks and they are accessible through voice interaction over an ordinary phone call. | Design and Implementation of Telephone Integrated Information Management System | My company just put me in charge of converting our companies phone system to VoIP.. Can someone ELI5 what I need to know? | voicetree is a telephony provider based in which city | Cisco 8865 setup with voip.ms |
5 | Initial impression everything is laid out great. Cannot speak to durability new though | So far I have been extremely pleased with the product. It is easy to put on, fits perfectly and seems to be very durable. I have not had an occasion to verify the durability yet but I think it will be fine. | Oustanding quality. I used mine for two years and it still looks like new. | Nice product, I am not sure about durability because I just installed it but it has lifetime warranty so it does not really matter. So far so good | Very attractive out of the package. I do not know about durability yet. This is a gift and it has not been opened yet. | This is a Christmas present. It looks good but I really can't rate its durability. | UPDATE: I have been using this bench for two years now and it's still working as new. I was initially concerned with durability since the bench is somewhat wobbly, but it is really not an issue. I raised the rating to 5 stars from 4. Both myself and my wife really like it. It's a very good deal for the money.
This is good equipment for the money. It's not the same quality as what you see in a commercial gym, but it works well. | Have owned same before and my expectations of quality, durability, etc were met just as well as they were 30 years ago when I bought my first one as a gift for my father. | haven't had it long enough to comment on durability, ,but this is much thicker and sturdier than the tarp a recently bought from target which was just a few bucks less | 5 | Initial impression everything is laid out great. Cannot speak to durability new though. Price exceptional, $50 less than the local gun club. Looked at many before picking for husband as a gift (after he already said he would pick his own) and he is happy with it...which is a win here. Like that it has so many different compartments to separate gear rather than just junking it into a big pile in one slot. | and so far seems durable and is a great value. It met all my expectations | So far so good. Easy to clean & take apart/put together | So far it seems pretty durable & a great 1st backpack | ... I usually spend but the durability and flexibility is great. I do wish it had another internal and ... | Wow Great durable but the pistol is a little light but ... | To those who have had the Boosted Backpack for a while, how durable and well-made is it? | but for the price and portability it seems fine. Surprisingly durable too | It appears to be pretty durable and has more learning options than I expected |
6 | Is there a phobia for being scared of food with human faces on them. | Phobia for fear of being eaten alive? | What is the fear of touching your food with your hands? | I'm writing a short adventure where a wizard has hidden a key from a particular monster by hiding it in a place that the monster is afraid of. But I can only think of a few monsters with fears like this.
For example:
Vampires weakness to garlic
Cats afraid of dogs
It doesn't have to be something necessarily fantasy or magical, something that exists in the real world is fine too. | I thought it was a more common phobia, but i've never met anyone else with it and every time I explain it people look at me like I'm crazy.
Orangutans, chimpanzees, and gorillas specifically. I think it might have stemmed out of a nature documentary following chimpanzees when I was younger. | What the name for being scared? | Zoophobia Zoophobia or animal phobia is a class of specific phobias to particular animals, or an irrational fear or even simply dislike of any non-human animals. Examples of specific zoophobias would be entomophobias, such as that of bees (apiphobia). Fears of spiders (arachnophobia), birds (ornithophobia) and snakes (ophidiophobia) are also common. See the article at -phobia for the list of various phobias. Sigmund Freud mentioned that an animal phobia is one of the most frequent psychoneurotic diseases among children. Zoophobia is not the sensible fear of dangerous or threatening animals, such as wild dogs (example: wolves, dingoes, and coyotes), big | What phobia is the fear of speaking in front crowds? | Entomophobia Entomophobia (also known as insectophobia) is a specific phobia characterized by an excessive or unrealistic fear of one or more classes of insect, and classified as a phobia by the DSM-5. More specific cases included apiphobia (fear of bees), myrmecophobia (fear of ants), and lepidopterophobia (fear of moths and butterflies). One book claims 6% of all US inhabitants have this phobia. Lepidopterophobia can be developed in some ways. One of them by having a scary experience or if the person believes that the insect is dangerous. For example, if the person thinks a butterfly is poisonous, he/she will do | 6 | I remember my mom shown me this video for a birthday my cousin had and it was about these eggs with human faces screaming because they realised they were going to be used to make a cake.
I couldn't eat properly for two years straight because of that.
Anywho does a phobia like that exist? If not it should. | What is the phobia of cotton balls called? | What's the most strange or unusual phobia which you've actually seen affect someone in real life? | what is the more common name for the phobia of insects | The phobia of having a phobia? | Is anyone else terrified about Bumblebee? | what is the fear of children called in disney films | Phobias are too much for me, even in VR | Why are people scared of spiders but not octopi? |
7 | The Effects of Sarbanes‐Oxley on Auditing and Internal Control Strength | Information Security and Sarbanes-Oxley Compliance:An Exploratory Study | Section 404 of the Sarbanes-Oxley Act requires firms to assess the effectiveness of internal controls over financial reporting and auditors to express an opinion on the effectiveness of such internal controls. We examine whether the first-time inclusion of additional audited information in Section 404 company filings were associated with higher earnings response coefficients (ERC) for accelerated filers. We find that the ERCs of companies with clean internal control reports were greater in the SOX 404 year of adoption than in the previous year. However, there is no difference in the ERCs in the two years for companies with material weaknesses. We interpret these results as indicating that even clean Section 404 reports - which form a majority of all internal control reports - contribute positively to investor perceptions about the quality of financial reporting. | Sarbanes Oxley Section 404 Costs of Compliance: A Case Study | ABSTRACT: This study examines the association between internal control deficiencies (ICDs) reported under Section 404 of the Sarbanes‐Oxley Act (SOX, U.S. House of Representatives 2002) and the presence of former audit partners on the audit committee who are affiliated (AFAPs) and unaffiliated (UFAPs) with the firm's external auditor. We find a negative association between AFAPs and UFAPs on the audit committee and ICDs. We also find results that suggest the NYSE and NASDAQ three‐year “cooling‐off” rule applying to AFAPs may be unwarranted and deserves further empirical and regulatory attention. Further tests suggest AFAPs do not allow management to circumvent the disclosure of ICDs when conditions appear to suggest this may be so, and that AFAPs are negatively related to performance‐adjusted discretionary accruals. Collectively, we interpret these findings to suggest that AFAPs and UFAPs on the audit committee are associated with more effective monitoring of internal controls and financial reporting. |
received an "Ineffective" audit opinion and other firms that received clean audit opinion on the effectiveness of the internal control over financial reporting under Section 404 of SOX. Our analyses show the following. First, we find that auditors charge significantly higher audit fees for all firms in the post-SOX period than in the pre-SOX period. Second, we find that auditors' opinions on the weakness in internal control (WIC) are positively associated with audit fees, and that the positive association between the two is pronounced primarily in the post-SOX period, but not in the pre-SOX period. Third, we find that clients with WIC problems that are highly levered and/or report losses pay incrementally higher audit fees during the post-
INTRODUCTION
A series of corporate scandals that started with the Enron debacle and the subsequent collapse of Andersen LLP triggered the United States (U.S.) Congress to pass the Sarbanes-Oxley Act (SOX) of 2002 in an attempt to restore public confidence in the quality of audited financial statements. One of the most contentious measures mandated by SOX is related to the efficacy of a firm's internal controls over financial reporting (ICOFR). Section 404 of SOX mandates management to assess the effectiveness of a firm's ICOFR and to report its conclusion in the firm's annual reports for fiscal years ending after November 2004. Section 404 also requires the auditor to review management's assessment, and then, to report her own conclusion regarding the effectiveness of the ICOFR.
Corporate executives have increasingly voiced doubts about the net benefits of this controversial regulation, and have often claimed that the costs of Section 404 compliance are excessively high compared with the associated benefits alleged by regulators and lawmakers. For example, cross-listed foreign Securities and Exchange Commission (SEC) registrants often express that they are considering withdrawing their American Depository Receipts (ADR) listings from the US exchanges due to the high compliance cost. 1) Given that a non-trivial component of the Section 404 compliance cost is an in-1) See two recent speeches by SEC Commissioners (SEC 2005a(SEC , 2005b. crease in audit fees and that data on auditors' assessment of clients' internal controls have now become publicly available, it is interesting and timely to examine whether and how the auditor incorporates her own assessment of the strength or weakness of a client's internal control system into audit pricing.
In this paper, we first investigate whether the enactment of SOX lead to an increase in the level of audit fees for all firms, regardless of the effectiveness of their ICOFRs. As further explained in the next section, SOX caused not only an increase in audit work but also an increase in auditors' legal liabilities. We therefore predict that auditors charge higher audit fees for all firms in the post-SOX period than in the pre-SOX period to compensate for the additional audit effort to comply with the SOX requirements and to compensate for the expected increases in legal liability costs.
Second, we examine whether and how auditors' assessments of material weaknesses in internal controls (hereafter WIC) of their client firms are priced in the audit fee-setting process. In doing so, we analyze auditors' opinions on the effectiveness of the ICOFR that are reported in recently filed 10-K reports, and identify client firms that received an "Ineffective" opinion on the ICOFR from their auditors. We label these ' WIC clients.' 2) We predict that auditors charge higher audit fees for WIC clients than for non-WIC clients because clients with WIC problems are more likely to have accounting errors or irregularities and to engage in opportunistic earnings management, compared with clients without WIC problems (Ashbaugh-Skaife et al. 2007). Auditors must therefore exert more engagement efforts to audit WIC clients than to audit non-WIC clients. In addition, auditors are likely to be exposed to a higher litigation risk, other things being equal, when auditing WIC clients than non-WIC clients. As a result, auditors are likely to charge higher audit fees for WIC clients than for non-WIC clients -to compensate for the higher effort and/ or the increased litigation risk associated with the audits of WIC clients.
Third, we test whether the positive relation, if any, between WIC and audit fees emerged only after the passage of SOX. Thus, we pre-2) In fact, Section 404 of SOX does not require firms to improve the efficacy of their internal controls, but it does require management to assess it and disclose their assessment in the company's annual report. It further mandates auditors to report their opinions on management's assessment in their audit reports. In this sense, Section 404 can be viewed as a pure disclosure regulation.
dict that the effect of WIC on fees will be stronger in the post-SOX period than in the pre-SOX period. This test allows us to make inference on how the effect of auditors' WIC assessment on the audit fees interacts with a shift in the auditors' legal liability caused by the enactment of SOX. In addition to testing the above three predictions, we further examine whether SOX affected the audit fee structure. Specifically, we study the impact on audit fees of client-specific risk and auditor quality. Client-specific risk factors (e.g., leverage and loss) and auditor quality (Big 4 vs. non-Big 4 auditors) are likely to interact with WIC, and lead to high-risk clients with WIC problems and Big 4 auditors being even more exposed to potential legal liabilities subsequent to the enactment of SOX. We therefore examine whether and how the fee-increasing effect of client-specific risk and auditor quality differs systematically between the pre-and post-SOX periods, and this difference, if any, is greater for WIC clients than for non-WIC clients.
We test our hypotheses using audit fee data for the five-year period from 2000 to 2004 and data on auditors' opinions on WIC under Section 404 of the SOX that are recorded in recent 10K reports filed from February 2005 to May 2005. The results of our various tests reveal the following. First, we find that audit fees are, on average, significantly higher for all firms in the post-SOX period than in the pre-SOX period after controlling for all other factors that are deemed to affect audit fees, suggesting that SOX lead to increases in audit effort and/or auditors' legal liabilities. Second, we find that firms that received an "Ineffective" opinion on the ICOFR from their auditors in response to Section 404 of SOX (i.e., firms with WIC problems) pay higher audit fees, and that this positive association between audit fees and the weakness in internal control is pronounced primarily in the post-SOX period (2003~2004), but not in the pre-SOX period (2000~2002). This suggests that the effect of WIC on fees was driven by the upward shift in legal liability which resulted from the enactment of SOX. We also find that highly levered clients and/ or clients reporting losses with WIC pay higher audit fees, compared with i) not-highly-levered and/or profit-reporting clients with WIC and ii) clients without WIC during the post-SOX period. However, we find that Big 4 audit fee premium increased for all clients during the post-SOX period, irrespective of whether the clients had WIC problems.
Our study contributes to the existing literature in the following ways. Several studies have examined the issue of WIC in various contexts such as the relation with accrual quality or earnings management (Ashbaugh-Skaife et al. 2007;Hogan and Wilkins 2008), cross-sectional determinants of WIC (Doyle et al. 2007;Ge and McVay 2005), and stock market reactions to WIC disclosure (Beneish et al. 2008;DeFranco et al. 2005;Hammersley et al. 2008). Specifically, previous research of Hogan and Wilkins (2008) and Hoitash et al. (2008) examines the relation between WIC and audit pricing. Our study provides further evidence how WICs interacts with other client-specific risks and auditor quality. Simunic and Stein (1996) argue that audit fees reflect client-specific litigation risk. More recently, Choi, Kim, Liu, and Simunic (2008: hereafter CKLS) provide a theory and, using country-level litigation risk measures, suggest international evidence showing that audit fees reflect expected legal liability costs. However, prior research has paid little attention to the issue of how WIC influence an auditor's assessment of client-specific litigation risk because data on auditors' assessment of WIC for public companies became publicly available only after Section 404 were implemented. In short, our results provide useful insights into how the auditors, in terms of client risk assessment and pricing mechanism, respond to a shift in the legal liability regime associated with the enactment of SOX. The higher level of auditors' attention to the risky clients, as reflected in higher audit fees in the post-SOX period, could imply more audit effort, assignment of more experienced or expert auditors, and/or the increased fee per hour for the clients. To the extent that these changes lead to the higher audit quality, evidence provided in this study supports the view that the SOX enactment accomplished its regulatory objectives at least partially.
The remainder of the paper is structured as follows. In section 2, we briefly discuss the new requirements for WIC disclosures and attestation under Sections 302 and 404 of SOX, and offer a review of prior studies related to WIC issues. Section 3 develops hypotheses while section 4 describes the sample, data sources and empirical procedures. Section 5 presents the results of our hypothesis testing. In section 6, we perform further analyses on the effect of the SOX and various sensitivity checks. The final section concludes the paper.
THEORY DEVELOPMENT Background
The summary of the major SOX provisions that are important to accounting and auditing areas are reported in Appendix. Among them, Sections 302 and 404 of SOX are concerned with the internal controls over financial reporting (ICOFR). In particular, Section 302, which became effective for quarterly and annual reports covering periods ending after August 29, 2002, requires that chief executive officers (CEO) and chief financial officers (CFO) evaluate the design and effectiveness of internal controls and disclose any known material weakness, fraud, or changes in controls that are likely to have a material effect on financial statements. Compared with the Section 404 requirements, however, Section 302 requires relatively less extensive investigations and assessments by management, and does not specify specific procedures that management and the auditor must follow.
Section 404, which became effective for fiscal years ending after November 15, 2004 for accelerated filers, 3) has two main parts. Section 404(a) describes management's responsibility for maintaining an adequate internal control structure and procedures for financial reporting as well as responsibility for assessing the effectiveness of ICOFR. Section 404(b) mainly describes auditors' responsibility for attesting to management's report on the WIC assessment and their own assessment on the effectiveness of ICOFR.
Along with Section 404, the Public Company Accounting Oversight Board (2004) has adopted Auditing Standard No. 2, An Audit of Internal Control over Financial Reporting Performed in Conjunction with an Audit of Financial Statements. The Standard requires an integrat-3) A non-accelerated filer (a U.S. company with market capitalization less than $75 million that has filed at least one annual report with the SEC) must first comply with the SOX 404 requirements for its first fiscal year ending on or after July 15, 2007. The extension does not apply to a foreign private issuer that is an accelerated filer and that files annual reports on Form 20-F or Form 40-F; such an issuer must begin to comply with the internal control over financial reporting and related requirements in the annual report for its first fiscal year ending on or after July 15, 2006. We exclude non-accelerated filers and foreign firms from our sample.
ed audit of both financial statements and ICOFR, and requires auditors to express two separate opinions on: (1) whether the financial statements are fairly stated; and (2) whether the ICOFR is effective. The auditor is not permitted to conclude that the company's ICOFR are effective if there are one or more material weaknesses in the registrant's internal controls. In the event of a material weakness, the auditor could express an unqualified opinion (i.e., "fairly stated") on management's assessment so long as management properly identifies the material weakness, and conclude in their assessment that the internal controls are ineffective. If the auditors conclude that a material weakness exists but management does not and therefore concludes in their assessment that internal control is effective, the auditors should render an adverse opinion on management's assessment. 4)
Literature Review
Since the passage of SOX in 2002, several studies have investigated various issues related to internal controls using the WIC data disclosed under Section 302. For example, Ge and McVay (2005) find that WIC are positively associated with business complexity but negatively associated with firm size and profitability. Doyle et al. (2007) report a similar set of WIC determinants. In addition, they find that WIC clients have lower earnings quality measured by the extent to which accruals map into cash flows. Ashbaugh-Skaife et al. (2007) document that clients with more complex operations, recent changes in organization structure, more accounting risk exposure and less investment in internal control systems are more likely to disclose WIC. They also find that clients with WIC tend to have greater abnormal accruals and more frequent restatements of financial statements relative to their industry peers, consistent with the notion that WIC contribute to lower quality accounting information. Using the data for the period prior to the enforcement of Section 302 of SOX, Krishnan (2005) finds that firms with an indepen-4) Among our 252 sample firms that received an "Ineffective" opinion on the ICOFR from their auditors, only two firms received "not fairly stated" opinion on management assessment of the effectiveness of ICOFR and all the others received an unqualified opinion. This suggests that prior to the issuance of the opinion, the auditor and management have agreed on significant deficiency or material weakness in ICOFR in most cases since Section 404 was enacted. dent audit committee with financial expertise are less likely to have WIC. 5) On the other hand, Beneish et al. (2008), DeFranco et al. (2005), and Hammersley et al. (2008 examine stock market reactions to management's disclosure of WIC under Section 302. Overall, these studies find that the market reacts negatively to WIC disclosures. 6) These findings support the view that information about WIC is value-relevant.
A few studies examine the effect of the WIC disclosure under Section 302 and/or Section 404 on audit pricing. Hogan and Wilkins (2008) examine the effect of WIC disclosure under Section 302 on audit pricing. They find that audit fees of clients that disclosed WIC under Section 302 are higher than those of other clients. Under Section 404, Raghunandan and Rama (2006) and Hoitash et al. (2008) similarly find that audit fees for fiscal year 2004 are higher for clients with WIC compared to clients without such a weakness. Hoitash et al. (2008) also report that the severity of the WIC influences the audit fees.
Our study also investigates the effect of WIC on audit pricing but differs significantly from prior studies in the following ways. First, while they investigate the relation between WIC disclosed under Section 302 or 404 and the audit fees in the fiscal year that WIC were disclosed, we use a longer period of audit fee data covering the year 2004 (when auditors were required to express their opinions on ICOFR for the first time) and previous four years. The use of a longer time-series of audit fee data allows us to investigate whether there are changes in the audit fee-WIC association from the pre-SOX to the post-SOX period. We also address the issues of the interactions between WIC and other client characteristics, and changes in Big 4 audit fee premiums for the comprehensive analyses of audit pricing mechanism changes caused by the enactment of SOX. 5) Before the enactment of the SOX, firms were required to publicly disclose information on the internal control weakness (if any) pointed out by the predecessor auditor when they file 8-K to the SEC, only if there was a change in auditor (SEC 1988
Hypotheses Development
The enactment of SOX in 2002 caused a substantial change in the duties and responsibilities of external auditors of public companies. Specifically, Section 404 requires auditors to conduct an integrated audit of the financial statements and the internal control systems. Anecdotal evidence to date indicates that the audit fees paid by SEC registrants increased substantially subsequent to the enactment of SOX. 7)
The audit fee literature dates back to Simunic (1980). In his model, audit fees (or total audit costs) are a function of the expected costs of conducting the audit including a normal profit margin plus the expected costs of audit risk or the expected legal liability losses associated with an audit failure. Formally, his model can be expressed as:
E(tc) = cq + E(d)* E(r)(1)
where E(tc) is the expected total cost to the auditor; c is per unit cost of resources; q is quantity of resources used by the auditor in performing the audit; E(d) is the expected present value of possible future losses due to undetected material misstatements in this period; E(r) is the likelihood that the auditor will be liable from future litigation associated with undetected material misstatements in this period. Previous audit fee research has relied on the above model when examining whether auditors price the expected litigation costs as well as their effort or resource costs when setting audit fees, and found a positive relation between audit fees and various proxies for litigation risk. 8) Recently, CKLS extend the Simunic model by developing a formal model in which the strength (or strictness) of legal regime plays a crucial role in determining auditor effort and thus 7) For example, Financial Executives International indicated, in its January 2004 survey, an increase in audit fees of $591,000 due to Section 404 compliance. This is equivalent to an increase of 38 percent over pre-Section 404 fee levels. In its July 2004 survey, FEI updated this figure to $823,200, or an increase of 92.5 percent over pre-Section 404 levels. 8) For more details, see Pratt and Stice (1994), Simunic and Stein (1996), Seetharaman et al. (2002), and Lyon and Maher (2005). audit fees. 9) The CKLS model predicts that audit fees increase monotonically with the strictness of legal regime, because as the legal regime becomes stronger, the auditor is more likely to suffer from legal liabilities in case of an audit failure, and thus charges a higher audit fee to compensate for the increased legal liability costs. The enactment of SOX and the implementation of other accompanying accounting and auditing regulations lead to not only an increase in audit effort to comply with the SOX and other related requirements but also a significant upward shift in what CKLS call "the strength of a legal regime" during the post-SOX period. 10) In a similar vein, Ijiri (2005) predicts that the civil or criminal litigation risk will increase significantly even for honest firms, and further argues that the SOX is likely to reduce investors' beta risk (the risk of a dishonest report being judged to be honest) at the expense of increasing firms' alpha risk (the risk of honest report being judged to be dishonest). We therefore predict that the enactment of SOX causes auditors to charge higher audit fees during the post-SOX period to compensate for the increases in their legal liabilities as well as audit efforts than during the pre-SOX period. To test this prediction, we hypothesize in an alternative form:
H1: Other things being equal, audit fees are higher in the post-SOX period than in the pre-SOX period.
To prevent or detect material misstatements, the auditor typically performs various internal control tests to assess whether the internal control system of the client firm is properly designed. If the auditor concludes that the internal control system is not appropriate, auditing standards require her to perform additional substantive 9) Using data from United Kingdom (UK), Seetharaman et al. (2002) also show that auditors of UK firms charge higher fees for their services when their clients are cross-listed on the U.S. market, suggesting that audit fees reflect country-level litigation risk. 10) If we name a few examples, by Title VIII, "Corporate and Criminal Fraud Accountability Act of 2002," auditors are required to maintain all audit or review work papers for five years. Title IX, "White Collar Crime Penalty Enhancements" increased the maximum criminal penalty for mail and wire fraud from 5 to 10 years. For the comprehensive summary of the SOX provisions and legal requirement changes that are important to auditor/auditing, please refer to the Appendix. For the review of the legislation process of the SOX and the environmental changes in the US accounting, please refer to Ijiri (2005).
tests, and such additional tests may increase her effort or resource costs (the first component in Eq.
(1) or cq). Moreover, the auditor may use an engagement team with more industry-specific expertise if any WIC in complex situations requires a high level of industryspecific knowledge in detecting material misstatements (Johnstone and Bedard 2003). Such an audit team may charge a higher billing rate to the client, which leads to an increase in the first component in Eq.
(1) or cq. Alternatively, the greater risk related to an ineffective internal control system may cause auditors to charge an insurance premium to cover possible future losses associated with undetected misstatements (Bell, Landsman, and Shackelford 2001). 11) Previous research on audit fees finds that audit fees are sensitive to conditions that increase the overall audit risk. 12) To the extent that auditors' effort costs and/or expected litigation costs are greater for clients with WIC than for clients with no WIC, auditors are likely to charge a higher fee for clients with WIC than for clients with no WIC. We therefore hypothesize in alternative form:
H2: Other things being equal, audit fees are positively associated with material weaknesses in internal controls (WIC).
This hypothesis H2 is equivalent to those in the prior studies of Hogan and Wilkins (2008) and Raghunandan and Rama (2006). Using H2, we would like to show that the characteristics of our sample are not different from those used in prior studies.
In the context of the Simunic's model in Eq. (1), the enactment of SOX caused an upward shift in an auditor's assessment of E(d) and E(r), and thus lead the auditor to charge even higher audit fees for clients with WIC in the post-SOX period than in the pre-SOX period. 13) We therefore predict that the fee-increasing effect of WIC is more pronounced in the post-SOX period than in the pre-SOX period. To provide evidence on the above prediction, we test the follow-11) Charging an insurance premium may also be combined with additional substantive tests. 12) Experimental work by Houston et al. (1999) find that the presence of accounting choices reflecting higher risks of accounting irregularities leads to higher litigation risk assessments and fee premiums. 13) In addition, additional audit effort required to attest to the effectiveness of the client's internal control system will be another possible reason for the audit fee increase.
ing hypothesis in an alternative form:
H3: Other things being equal, the positive association, if any, between audit fees and WIC is more pronounced in the post-SOX period than in the pre-SOX period.
TEST PROCEDURES Empirical Model
Building upon previous research on audit fee determinants (Chaney et al. 2004;CKLS;Craswell et al. 1995;DeFond et al. 2002;Francis and Stokes 1986;Frankel et al. 2002;Sankaraguruswamy and Whisenant 2003;Simunic 1980;Simunic and Stein 1996), we posit the following audit fee model to test our hypotheses H1, H2 and H3: In the above, all the independent variables are measured as of the end of fiscal year unless otherwise noted. The variables, LNTA and EMPLOY, are used as proxies for client size, while the variable, NBS, NGS, INVREC, FOREIGN, EXORD, and RNDTA as proxies for the scope and complexity of the client's business. The demand for audit services is likely to increase with firm size (LNTA and EM-PLOY) and the extent of business diversification (NBS and NGS). We expect audit fees to be positively associated with these variables. Furthermore, audit fees are likely to be higher for clients with more complex business operations, so we expect the variables representing client complexity (i.e., INVREC, FOREIGN, EXORD, and RNDTA) to be positively associated with audit fees. In short, all coefficients on the aforementioned variables are expected to be positive.
AFEE = α 0 + α 1 YR0304 + α 2 WIC + α 3 (YR0304*WIC) + β 1 LEVE + β 2 LOSS + β 3 BIG4 + γ 1 LNTA + γ 2 NBS + γ 3 NGS + γ 4 EMPLOY + γ 5 INVREC + γ 6 ISSUE + γ 7 BTM (2) + γ 8 FOREIGN + γ 9 EXORD + γ 10 AUDCHG + γ 11 LAMDA + industry dummies +
We also include AUDCHG to control for possible low balling by new auditors (Sankaraguruswamy and Whisenant 2003). A negative sign on AUDCHG is consistent with the low balling hypothesis. We include ISSUE and BTM to capture the effect of the client's growth potential on audit fees. Growing firms are more often involved in external financing activities such as equity and bond offerings, and the demand for both audit and non-audit services is greater for high-growth firms than for low-growth firms. In addition, firms with equity and debt offerings in the recent past are in a need of more extensive audit services (Reynolds et al. 2004). We therefore expect a positive (negative) coefficient on ISSUE (BTM). In Eq.
(2), we also include LOSS and LEVE, to proxy for a client's risk characteristics. Since auditors charge higher fees for risky clients (Simunic and Stein 1996), we predict the coefficients on LOSS and LEVE to be positive. We include BIG4 to capture the effect of audit quality differentiation on audit fees. A positive coefficient on BIG4 suggests the existence of a Big 4 fee premium.
Our variables of interest are YR0304, WIC, and the interaction between YR0304 and WIC (i.e., YR0304*WIC). We measure WIC in three different ways. The first measure (WIC_D) is a dummy variable that equals 1 if a client receives a weakness-in-internal control opinion (hereafter WICO) on the effectiveness of ICOFR from the auditor in fiscal year 2004, and 0 otherwise. The second measure (WIC_C) is a continuous variable, measured by the natural log of one plus the number of categories of WIC cited in the auditor's report in the same year. The third measure (WIC_P) is the predicted value of WIC_C. We include the predicted value to control for the possible self-selection problem by using an instrumental variable approach. 14) It is possible that firms may have had greater internal control problems in the pre-SOX period than in the post-SOX period because WIC did not receive serious attention in the pre-SOX period. The use of WIC_P at least partially solves this problem by using year-by-year data to independently predict the value of WIC_C or WIC_D for each year.
If auditors charge higher audit fees in the post-SOX period than in the pre-SOX period as predicted in H1, the coefficient on YR0304 should be positive (i.e., α 1 > 0). 15) Similarly, if firms that receive WICO 14) WIC_D and WIC_C assume that a firm receiving a WICO in 2004 has the same problem from 2000 to 2004 inclusive. This is a strong assumption and is a limitation of our work, necessitated because of data availability.
15)
We choose year 2003 as the cut-off year to make the dummy variable YR0304. Even though the SOX was enforced from November 2002, the year-by-year analy-pay higher audit fees as predicted in H2, the coefficient on WIC should be positive (i.e., α 2 > 0). In addition, if the fee-increasing effect of WIC is more pronounced during the post-SOX period as predicted in H3, the coefficient on YR0304*WIC, should be positive (α 3 > 0). Hoitash et al. (2008) report that audit fee structure with respect SOX changed from year 2003 even though auditors are required to follow section 404 from year 2004. Thus, we choose year 2003 as a cut-off year. As explained later in Table 4, our empirical analyses also support this prediction.
In our regression specification in Eq.
(2), audit fees are linked to WIC and many other control variables. Previous research suggests that clients who receive WICO may be inherently different from those who do not (Ashbaugh-Skaife et al. 2007;Doyle et al. 2007). Suppose that clients who have the ability to pay high audit fees tend to keep weak or strong internal control systems. In such a case, the error term in Eq. (2) is likely to be correlated with the WIC variable and coefficient estimate is likely to be biased. To address this potential self-selection bias, we estimate the two-stage treatment effect model (Greene 2000). In the first stage, we estimate the probit WICO model with WIC_D as the dependent variable and obtain the inverse Mills ratio. 16) We then include the inverse Mills ratio, denoted 2007) and Doyle et al. (2007), we run the following probit model. WIC_D = a + β 1 LNTA + β 2 GROWTH + β 3 INVTA + β 4 LOSS + β 5 ROA + β 6 NBS + β 7 NGS + β 8 FOREIGN + β 9 MA + β 10 RESTRUCT + β 11 BIG4 + β 12 AUDCHG + β 13 OWNERSHIP + β 14 LITIG_IND + error terms where, GROWTH is the assets growth from year t -1 to year t scaled by the assets of year t -1; INVTA is inventory divided by total assets, MA is merger and acquisition dummy that has a value of 1 if the firm has any merger and acquisition activity in the year, and 0 otherwise; RESTRUCT is dummy variable if the firm's restructuring cost is higher than 1 percent of the sales; OWNERSHIP is a measure of ownership concentration (1 -[1,000 * (# of shareholders / # of outstanding shares)]); LITIG_IND is the litigious industry dummy variable. The definitions of other variables are the same as before. We also repeat the tests (i) after removing insignificant independent variables, and (ii) after removing the variables that are already included in Eq. (2), but the results are always similar. We also perform the OLS regression for the same equation as in the above with WIC_C as the dependent variable instead of WIC_D and with the same set of independent vari-by LAMDA, in Eq. (1) when we use WIC_D as a variable of interest in our analyses. Instead, when we use WIC_C, we repeat the test using WIC_P, which is the predicted value of WIC_C using an instrumental variable approach.
Sample and Data Sources
We obtain audit fee data from the 2005 Audit Analytics database. We retrieve all other financial data from the 2005 Compustat Industrial annual file. Our sample period is restricted to the five-year period from 2000 to 2004 because Audit Analytics includes audit fee data starting in 2000,17) and the current version of the database includes the data only up to fiscal year 2004. We exclude the data in the financial service industry because the audit fee determinants of firms in this industry may differ from those in other industries.
We hand-collected the data on WICO from recently filed 10-K reports. Because Section 404 of SOX applies to annual reports for fiscal year ending November 2004, we search the EDGAR database for all firms in our sample with fiscal years ending between November 2004 and February 2005 (inclusive) that filed their 10K reports from February 2005 to May 2005. To supplement our initial EDGARbased sample, we also refer to the PricewaterhouseCoopers (PwC) database that collected and compiled auditors' internal control reports from all SEC filings in 2005, and then classified each WIC cited in auditors' reports into 1 of 26 categories, based on the nature of the WIC.
In Panel A of Table 1, Section A reports the number of firms in our sample that received WICO from their auditors, while Section B reports the number of firm-year observations with WICO. As mentioned earlier, we hand-collected information on WICO for firms with fiscal years ending between November 2004 and February 2005. Assuming that WIC were constant for each sample firm over the fiveyear sample period, 2000-2004, we construct a sample of firm-year observations with WICO by including the same firms with WICO ables. Using the OLS estimates of regression parameters, we obtain the predicted value of WIC_C, namely WIC_P.
17) The SEC's Final Rule S7-13-00 (Revision of the Commission's Auditor Independence Requirements) requires registrants to disclose information about fees paid to the auditor in proxy statements filed on and after February 5, 2001. Table 1 reports the number of firm-year observations by each category of WIC. We collect a total of 26 different categories of WIC mentioned in the audit report. Among them, the most frequently mentioned WIC is related to the 'application of GAAP and accounting policies' which comprises 32.61 percent of all WIC. 19) The next most frequently mentioned WIC is related to 'review of transactions' which comprises 32.42 percent of all WIC. Because some categories of WIC are rarely mentioned, we group WIC into 15 different categories as reported in Panel B, and combine all other 11 categories to the 'Others' category. This final category comprises 31.47 percent of all WIC. One may argue that auditors charge higher audit fees for clients that receive multiple categories of WICO. As mentioned earlier, we therefore measure WIC by using the continuous variable (i.e., WIC_C) which is defined as natural log of one plus the number of WIC categories, in addition to the dummy variable (i.e., WIC_D).
18) Implicit here is the assumption that clients that receive WICO in 2004 have a similar level of WIC problems in 2000-2003 as well. This is a reasonable assumption in that, as pointed out in footnote 2, Section 404 of SOX does not require management to improve the effectiveness of ICOFR, though it requires management to disclose its assessment on the effectiveness of ICOFR. The findings of Ghosh and Rubberink (2006) also support this assumption. They report that companies with WIC have lower earnings response coefficient and less favorable common stock rating and debt ratings even before the firms disclose the WIC problems. However, as an alternative way to analyze the data without the assumption, we use the predicted value of the WIC (WIC_P) for our variable of interest in the analyses. 19) The sum of the percentage (%) in Panel B of Table 1 is greater than 100 percent because many client firms receive WICO with multiple categories of internal control weakness as reported in Panel A of Table 1.
MAIN RESULTS
Descriptive statistics
Table 2 presents descriptive statistics for the variables used in this study. With respect to the results in Table 2, the following are noteworthy: First, the mean AFEE, measured by natural log of audit fees in thousand dollars, over the five-year sample period is 6.0235 which translates into $ 413,022. The median AFEE is 5.9319 with a standard deviation of 1.2757, suggesting that AFEE is reasonably distributed. Second, the mean WIC_D of 0.1167 indicates that 11.67 percent of our sample clients received a WICO from their auditors in fiscal year 2004. The mean WIC_C is 0.1635 with a relatively large standard deviation of 0.4731, suggesting that the WIC_C distribution is skewed. Finally, the distributional properties of all other variables (that are used as control variables in our regressions) are, overall, comparable with those reported in previous research on audit fee determinants (e.g., CKLS; Frankel et al. 2002;Ashbaugh-Skaife et al. 2007). Note that LEVE is windsorized at 5 (approximately one percent of observations were extremely large) in order to alleviate the influence of a few extreme outliers on our results. Similarly, the BTM is winsorized at 0 and 4. Table 3 presents the correlation matrix for the variables included in Eq. (2). As shown in Table 3, WIC_D and WIC_C are highly correlated (ρ = 0.948), suggesting that both capture the same underlying construct (i.e., WIC). Consistent with H2, both measures are significantly and positively correlated with audit fees (AFEE). With respect to the correlation among our explanatory variables, the following are apparent: First, our two proxies for client-specific litigation risk (i.e., LEVE and LOSS) are significantly and positively correlated with each other (ρ = 0.106). Second, firm size (LNTA) is significantly and negatively correlated with the two proxies. Third, none of the control variables are highly correlated with two measures of WIC (i.e., WIC_D and WIC_C). Fourth, the inverse Mills ratio (LAMDA) is highly correlated with several other control variables. Thus, we perform analyses with and without the LAMDA variable. Finally, except for the correlation between LNTA and EMPLOY (ρ = 0.687), the magnitude of pairwise correlations among other explanatory variables (except for the correlation with LAMDA) does not exceed 0.5, suggesting that our multivariate regressions are unlikely to suffer from multi-collinearity problems. 20)
Pairwise Correlation among Research Variables
Univariate Analyses on Audit Fee Changes around the SOX Enactment
Panel A of Table 4 reports average audit fees by each year for the total sample, for the sample of firms that receive WICO (WIC_D = 1), and for the sample firms that do not receive WICO (WIC_D = 0). As shown in the table, audit fees for all three samples increase monotonically over the sample period, 2000-2004. Consistent with hypothesis H2, audit fees are greater for the WIC sample than for the non-WIC sample in all years.
To assess the effect of SOX on audit fees, we further examine changes in audit fees from the pre-SOX period to the post-SOX period. In Panel B of Table 4, we present the change in AFEE from 2002 (the year in which SOX was enacted) to 2003 for the WIC sample and for the non-WIC sample, and test for differences in means and medians between the two samples. In doing so, we include only those firms that are included in our dataset for both 2002 and 2003 in our WIC and non-WIC samples.
As shown in Panel B, the mean and median changes in AFEE changes from 2002 to 2003 are 0.3335 (a 7.76% percent increase) and 0.2571 (a 4.34 percent increase), respectively, for the WIC sample, and 0.2468 (a 5.63 perecent increase) and 0.1942 (a 3.15 percent increase), respectively, for the non-WIC sample. 21) Both the mean and median differences are significant, as reported in the bottom two rows of Panel B. These results suggest that SOX caused 20) In performing regression analyses, we also measure the VIF values to test for potential multi-collineraity problems. But none of the VIF values are high enough to cause the problem. Thus, we do not separately report the values in the paper.
As a robustness test, we also drop all the control variables or one of the control variables that are highly correlated with other control variable (one by one) and perform regression analyses with variables of interest. The results are qualitatively similar. 21) In dollar values, the median audit fee changes from $399,076 to $557,721 (a 40 percent increase) during the period for the clients with WIC, and $334,932 to $422,581 (a 26 percent increase) for the clients without WIC. The amount of change represents the change of the log value of audit fees (in thousand of dollars) and the percentage change represents the change in the log value of audit fees scaled by the log value of the audit fees at the start of the period. *, **, and *** denote p-value < 10%, p-value < 5%, and p-value < 1%, respectively with one-tailed tests. audit fees to increase more for firms that received WICO than for firms that did not, consistent with hypotheses, H1 and H3.
In Panel C of Table 4, we present the amount by which AFEE changes from the two-year pre-SOX period (i.e., 2001 and 2002) to the two-year post-SOX period (i.e., 2003 and 2004) for the WIC sample and for the non-WIC sample, along with the results of tests for the mean and median differences between the two samples. Here, the WIC and non-WIC samples consider only those firms included in our dataset for both two-year periods.
As shown in Panel C, the mean and median changes in AFEE are 0.9408 (a 17.70 percent increase) and 0.9571 (a 16.76 percent increase), respectively, for the WIC sample, and 0.6988 (a 12.49 percent increase) and 0.6943 (a 12.02 percent increase), respectively, for the non-WIC sample. Both the mean and median differences are highly significant, as reported in the bottom two rows of Panel C. Similar to the results reported in Panel B, these results reconfirm that SOX caused audit fees to increase more for firms which received WICO than for firms that did not.
Results of Multivariate Tests for H1, H2, and H3
To examine the effect of auditors' opinions on internal control weakness (WICO) on audit fees, we estimate various regressions for Eq. (2). Table 5 report the regression results. In Table 5, reported t-values are on an adjusted basis using White's (1980) heteroskedasticity-consistent covariance matrix. 22) To verify whether our dataset produces the coefficient estimates that are comparable to those reported in previous research in terms of their signs, significance, and magnitude, we first estimate model 1 which excludes our test variables, namely WIC, YR0304, and YR0304*WIC from Eq. (2). In models 2 (3), we include only one test variable, YR0304 (WIC). In models 4 and 5, we include both YR0304 and WIC. We also estimate models 6 to 9 with all three test variables, YR0304, WIC, and YR0304*WIC, included for our hypotheses, H1, H2, and H3, respectively. In models 3 to 7, the WIC variable is measured us-22) We repeat all the regression tests performed in this study by adjusting standard errors with a clustering procedure that accounts for serial dependence across years of a given firm. Because most of the results are qualitatively identical, we do not report them separately, except an exceptional case when the result is different. All t-statistics in parentheses are calculated using White's (1980) consistent standard error estimates to correct for heteroskedasticity. *, **, and *** denotes p-value < 10%, p-value < 5%, and p-value < 1%, respectively with two-tailed tests. WIC_D: Table 1 for the definitions of other variables.
ing the dummy variable, WIC_D, while in model 8, it is measured by the continuous variable, WIC_C, which is natural log of one plus the number of WIC categories. In model 9, the WIC variable is measured by WIC_P, which is the predicted value of WIC_C. Finally, models 5 and 7 include LAMDA (inverse Mills ratio), while all other models do not.
The results for models 1, 2 and 3 show that all explanatory variables except ISSUE and AUDCHG are highly significant with expected signs for all specifications, and the explanatory power of all three models is very high as reflected in the adjusted R 2 of about 71 to 78 percent. This suggests that a set of audit fee determinants included in Eq. (2) as our control variables explain a large portion of crosssectional variations in audit fees.
As shown in Table 5, the coefficient on YR0304 is highly significant across all specifications, which strongly supports H1. The result indicates that auditors charge higher audit fees in the post-SOX period than in the pre-SOX period, which is consistent with the CKLS prediction and anecdotal evidence 23) as well as the findings in Table 4. In model 3 to 5 where the interaction term YR0304*WIC is omitted, the coefficient on WIC is significantly positive, which is consistent with H2. This suggests that clients with WIC problems pay higher audit fees than do clients without WIC problems. However, when we estimate regressions with the interaction term YR0304*WIC included, as in models 6 to 9, the WIC-coefficient becomes insignificant, but the coefficient on the interaction term, i.e., YR0304*WIC, becomes significantly positive in all cases. This indicates that firms with WIC problems in fiscal year 2004 began to pay higher audit fees only in the post-SOX period (but not in the pre-SOX period). The results are robust to whether we use WIC_D, WIC_ C, or WIC_P. 24) Thus, it seems that the differences in the audit fees between WIC clients and non-WIC clients, as reported in Table 4, during the pre-SOX period simply reflect the different firm-specific characteristics of the clients rather than the audit fee effect of WIC.
To examine the economic significance of the results, we set all variables except WIC to their sample medians and calculate average 23) See footnote 7 for anecdotal evidence.
24) When we perform analyses with individual categories of WIC mentioned in
Panel B of Table 1, we find that segregation of duties and property/equipment/ lease are not significantly related to audit fees, while all the other categories are significantly associated with audit fees with positive signs. audit fees. Using the estimated coefficients from model 4, this procedure yields average audit fees of $548,986 for non-WIC firms during the post-SOX period. This indicates that WIC firms pay higher audit fees than do non-WIC firms by $58,952 (or 10.74 percent of audit fees). This suggests that the increase in audit fees for WIC firms is economically significant as well.
FURTHER ANALYSES The Effect of the Enactment of SOX on the Audit Fee Structure
The regression results in Table 5, overall, reveal that auditors charge higher audit fees for WIC clients than for non-WIC clients during the post-SOX period but not during the pre-SOX period. In this section, we further investigate whether and how the legal regime shift caused by SOX affects the structure of audit fees, in particular, the audit fee effects of client-specific risk and auditor quality.
To do so, we first examine whether the incremental fees that auditors charge for clients with WIC to compensate for the increased legal liability associated with SOX varies systematically across clients, depending on client-specific risk characteristics proxied by LEVE and LOSS. Auditors' assessment of the legal liability is likely to be greater when clients are exposed to a higher level of litigation risk. Auditors are likely to be exposed to a higher litigation risk during the post-SOX period, in particular, for the audits of WIC clients. We therefore predict that the fee-increasing effect of clientspecific risk (i.e., LEVE and LOSS) is pronounced during the post-SOX period, and the effect is even more pronounced for clients with WIC problems than those with no WIC.
Previous research shows that the potential legal liability cost is greater for Big 4 auditors than for non-Big 4 auditors, because Big 4 auditors have greater reputation losses at stake (DeAngelo 1981) as well as "deeper pockets," and thus they have more to lose in case of an audit failure (Dye 1993;Khurana and Raman 2004;Kim et al. 2003). To minimize this legal liability cost, Big 4 auditors have a greater incentive to increase audit effort, for example, by conducting more substantive tests than non-Big 4 auditors, which in turn leads to Big 4 auditors charging higher audit fees than non-Big 4 auditors (CKLS; Craswell et al. 1995;DeFond et al. 2000). This leads us to predict that the differences in audit fees charged by Big 4 auditors vis-à-vis non-Big 4 auditor (i.e., Big 4 fee premiums) are greater in the post-SOX period than in the pre-SOX period.
To test the above two predictions, we posit the following regression model which is an augmented version of Eq. (2): AFEE = α 0 + α 1 YR0304 + α 2 WIC + α 3 (YR0304*WIC) + β 1 LEVE + β 2 (LEVE*YR0304) +β 3 (LEVE*YR0304*WIC) + β 4 LOSS + β 5 (LOSS*YR0304) + β 6 (LOSS*YR0304*WIC) + β 7 BIG4 + β 8 (BIG4*YR0304) + β 9 (BIG4*YR0304*WIC) (3) + γ 1 LNTA + γ 2 NBS + γ 3 NGS + γ 4 EMPLOY + γ 5 INVREC + γ 6 ISSUE + γ 7 BTM + γ 8 FOREIGN + γ 9 EXORD + γ 10 AUDCHG + γ 11 LAMDA + industry dummies + error term where all variables are as defined earlier. Compared with Eq.
(2), we add the interaction terms between YR0304 and two firm-specific risk variables (i.e., LEVE and LOSS) as well as the BIG4 dummy variable.
In addition, we also add the variables representing the three-way interactions among the three variables representing client-specific risk and auditor quality (LEVE, LOSS, and BIG4), the dummy variable representing the post-SOX period (YR0304) and the weakness in internal control variable (WIC). The positive coefficients on LEVE*YR0304 and LOSS*YR0304 in Eq. (3) (i.e., β 2 , β 5 > 0) are consistent with the fee-increasing effect of client-specific risk (i.e., LEVE and LOSS) being greater in the post-SOX period than in the pre-SOX period. Moreover, the positive coefficients on the three-way interaction terms, LEVE*YR0304*WIC and LOSS*YR0304*WIC (i.e., β 3 , β 6 > 0), support the view that the incremental fee-increasing effect of client-specific risk (i.e., LEVE and LOSS) arising from SOX is greater for clients with WIC than for those with no WIC. In a similar vein, the positive coefficients on BIG4*YR0304 and BIG4*YR0304*WIC (i.e., β 8 , β 9 > 0) are consistent with the view that Big 4 auditors charge higher audit fees during the post-SOX period and, in particular, for the audits of clients with WIC, compared with non-Big 4 auditors. Table 6 presents the results of various regressions for Eq. (3). In Table 6, we report the results using WIC_D only, for brevity, because the results using WIC_C or WIC_P are qualitatively identical with those using WIC_D. With respect to the effect of LEVE on audit fees, the coefficient on LEVE is significantly positive in all cases, while the coefficient on the two-way interaction term, i.e., LEVE*YR0304, is insignificant in all cases. In addition, the three-way interaction term, i.e., LEVE*YR0304*WIC, is significant with a positive sign (as in models 2, 5, and 7). The above results, taken as a whole, suggest that highly levered firms pay higher audit fees in general, and the highly levered firms with WIC problems paid additionally higher fees during the post-SOX period, while the firms without WIC problems did not pay such incremental fees during the post-SOX period after an overall shift in audit fees in the post-SOX period is controlled for by YR0304.
With respect to the effect of LOSS on audit fees, the coefficient on LOSS itself is significantly positive at the 1% level, while the coefficient on LOSS*YR0304 is insignificant across all cases. The coefficient on LOSS*YR0304*WIC is significantly positive. These results, taken as a whole, suggest that firms that report losses generally paid higher audit fees. In addition, the loss firms with WIC began to pay even higher fees in the post-SOX period, while the loss firms without WIC problems paid no marginally higher fees in the post-SOX period.
With respect to the effect of BIG4 on audit fees, we find that the coefficient on BIG4 itself is significantly positive across all cases, suggesting the existence of a Big 4 audit fee premium. Furthermore, the coefficient on BIG4*YR0304 is also significant with a positive sign in all cases, suggesting that Big 4 audit fee premium increased significantly for both clients with and without WIC during the post-SOX period. However, the coefficients on the three-way interaction term, i.e., BIG4*YR0304*WIC, are insignificant across all cases, suggesting that Big 4 audit fee premium increased by the similar magnitude for both clients, or equivalently WIC clients pay a similar level of the Big 4 premium as do non-WIC clients.
Finally, as shown in Table 6, the coefficients on the WIC variable (i.e., α 2 ) are significant in models 1 and 6. When we add the interaction term, YR0304*WIC, as in models 2 to 7, however, the coefficient on WIC becomes insignificant and only the coefficient on the interaction term (i.e., α 3 ) is significantly positive. These results are consistent with those in Table 5 that clients with WIC began to pay higher fees from year 2003. 25) Also similar to the results reported in 25) When we estimate clustered standard error by each firm, the weakly significant results in models 5 and 7 for the coefficients on YR0304*WIC becomes marginally insignificant. All t-statistics in parentheses are calculated using White's (1980) consistent standard error estimates to correct for heteroskedasticity. *, **, and *** denotes p-value < 10%, p-value < 5%, and p-value < 1%, respectively with two-tailed tests. Table 1 for the definitions of other variables. Table 5, the coefficients on all the control variables except BTM are highly significant with expected signs. One may argue that the significant correlations among three variables of interest (LEVE, LOSS, and BIG4) as reported in Table 3 and the correlations among the associated interaction terms lead to some of their coefficients being insignificant as reported in Table 6. To examine this possibility, we estimate Eq. (3) after including only one variable of interest and its interaction terms. For example, we examine the audit fee effect of BIG4 using the following specification which excludes all the variables that contain LEVE and LOSS. AFEE = α 0 + α 1 YR0304 + α 2 WIC + α 3 (YR0304*WIC) + β 1 BIG4 + β 2 (BIG4 * YR0304) + β 3 (BIG4 * YR0304 * WIC) + γ 1 LNTA + γ 2 NBS + γ 3 NGS + γ 4 EMPLOY + γ 5 INVREC + γ 6 ISSUE + γ 7 BTM + γ 8 FOREIGN + γ 9 EXORD (4) + γ 10 AUDCHG + γ 11 LAMDA + industry and year dummies + error term
Table 6. OLS Regression analyses on interactions with firm-specific risks and internal control weakness
AFEE = α 0 + α 1 YR0304 + α 2 WIC + α 3 (YR0304*WIC) + β 1 LEVE + β 2 (LEVE*
The regression results for Eq. (4) reveal that the coefficient on BIG4*YR0304*WIC is not significantly different from zero, while the coefficient on BIG4*YR0304 is significant at 1 percent level. For example, we find that β 2 is 0.3044 with t = 6.81 and β 3 is -0.0812 with t = -0.73. Overall, the regression results for Eq. (4) are consistent with those presented in Table 6.
Similarly, to examine the LEVE (LOSS) effect, we estimate Eq. (4) after replacing BIG4 with LEVE (LOSS). Because the results are not qualitatively different from those reported Table 6, we do not separately report them for brevity. 26) In short, the above results indicate that our results reported in Table 6 are robust with respect potential problems of multi-collinearity among the three variables of interest, namely, LEVE, LOSS, and BIG4 and the interaction terms associated therewith.
Sensitivity Checks
We perform a variety of sensitivity analyses to check the 26) For example, if we replace BIG4 in Eq. (4) for LEVE (LOSS), the value of β 3 is 0.2528 (0.1412) with t = 3.30 (2.37). These results are qualitatively similar to those in Table 6.
robustness of our findings. First, given that the SOX was enacted in 2002, it is unclear whether or not the SOX influenced an auditor's pricing behavior in 2002. As a sensitivity check, we repeat our regression analyses after excluding the 2002 data. We find that the exclusion of the 2002 data does not alter our statistical inferences on the variables of interest. Second, the SOX specifically states that companies that are not required to file annual and quarterly reports on an accelerated basis (i.e., U.S. companies with market capitalization below $75 million) must comply with the Section 404 requirements starting the fiscal year ending on or after July 15, 2007. As explained before, our sample therefore does not include any firms that belong to this category because auditors are not required to report any WICO on these firms in 2004. We notice, however, that for some of such firms that belong to this category, auditors voluntarily report their opinions on WIC. As a sensitivity check, we expand our sample by including all firms regardless of their size. Using this expanded sample of 12,403 firm-year observations, we repeat our regression analyses. Though not reported, overall, the results using this expanded sample are qualitatively similar to those reported in the paper.
Third, we construct a balanced-panel sample by including the same set of sample firms throughout the five-year sample period, 2000 to 2004. Though not reported, the results using the balanced panel data are qualitatively identical to those reported in the paper.
Fourth, we perform tests using the following regression specification (with YR0304 excluded) after restricting the data period to the post-SOX period (year 2003 and 2004). AFEE = α 0 + α 1 WIC + β 1 LEVE + β 2 (LEVE*WIC) + β 3 LOSS + β 4 (LOSS*WIC) + β 5 BIG4 + β 6 (BIG4*WIC) + γ 1 LNTA + γ 2 NBS + γ 3 NGS + γ 4 EMPLOY + γ 5 INVREC (6) + γ 6 ISSUE + γ 7 BTM + γ 8 FOREIGN + γ 9 EXORD + γ 10 AUDCHG + γ 11 LAMDA + industry dummies + error term Consistent with the results reported in Table 6, we find that the coefficient on WIC is not significant, while the coefficients, β 1 to β 6 are all significant with positive sign except the insignificant coefficients of β 6 . This indicates that all the major inferences we made in Table 6 remain unaltered.
Finally, in an attempt to check whether our sample is comparable with the samples used in previous research, we replicate Hogan and Wilkins (2008). Consistent with their findings, we find that performance-matched discretionary accruals (Kasznik 1999or Kothari et al. 2005 are not significantly related to WIC. When our sample firms with WIC are matched to non-WIC firms in the same industry (2-digit SIC code) and the same year which have the closest return on assets, there is no significant difference in terms of the level of absolute discretionary accruals in both univairate and multivariate tests. The above results suggest that the characteristics of our dataset are not different from those used in previous related research.
CONCLUSION
The SOX requires the implementation of many new rules and procedures. In particular, Section 404 of SOX mandates management to assess the effectiveness of a firm's internal control in financial reporting (ICOFR) and to report its conclusion in the firm's annual reports for fiscal years ending after November 2004. Section 404 also mandates the auditor to review management's assessment, and then, to report her own conclusion regarding the effectiveness of the ICOFR.
Using a sample of 252 firms that received an "Ineffective" audit opinion on the effectiveness of the ICOFR under Section 404 of SOX, this study investigates the effect of the enactment of SOX in year 2002 on audit pricing. The results of various tests reveal the following. First, we find that audit fees were, on average, significantly higher in the post-SOX period than in the pre-SOX period after controlling for all other factors that are deemed to affect audit fees. This suggests that SOX lead to an upward shift in the strength of the US legal environment, which in turn increased an auditor's legal liability. This increased legal liability caused the auditor to charge higher audit fees and/or work harder. Second, we find that firms that received an "Ineffective" opinion on the ICOFR from their auditors in response to Section 404 of SOX paid higher audit fees for their financial statement audits. In other words, auditors' opinions on WIC are positively associated with audit fees. We also find that this positive association between audit fees and WIC is pronounced primarily in the post-SOX period (years 2003 and 2004), but not in the pre-SOX period (years 2000 to 2002). The above results, taken as a whole, suggest that auditors either worked more or charged higher risk premiums to compensate for the increased legal liability cost associated with the audits of clients with WIC during the post-SOX period.
Further analyses reveal that clients with WIC that are highly levered and/or report losses paid higher audit fees during the post-SOX period, compared with not-highly-levered and/or profitreporting clients with WIC and clients without WIC. However, we find that Big 4 audit fee premium increased for both clients with and without WIC during the post-SOX period, whether or not the clients had WIC.
Overall, our results suggest that the SOX is successful in changing auditors' behavior by motivating them to focus more on the WIC. To the extent that this change results in the higher audit quality, evidence provided in this study supports the view that the enactment of SOX accomplished its regulatory objectives at least partially. In conclusion, given the scarcity of empirical evidence on the issue, our results provide useful insights into how the auditors, in terms of client risk assessment and pricing mechanism, respond to the legal regime shift caused by the enactment of SOX.
This study has some limitation. First, the higher audit fee does not necessarily imply the higher audit quality, although the fee is frequently used as a proxy for the quality. Second, Ge and McVay (2005) and Doyle et al. (2007) classify the WIC to different types. Due to time limitation, we do not follow the classifications. Future studies should investigate this issue.
Section/Title number Key provisions
Section 206: Conflicts of Interest.
The CEO, Controller, CFO, Chief Accounting Officer or person in an equivalent position cannot have been employed by the company's audit firm during the 1-year period preceding the audit.
Section 301: Public Company Audit Committees.
Each member of the audit committee shall be a member of the board of directors of the issuer, and shall otherwise be independent. The audit committee of an issuer shall be directly responsible for the appointment, compensation, and oversight of the work of any registered public accounting firm employed by that issuer.
Section 302: Corporate Responsibility For Financial Reports
The CEO and CFO of each issuer shall prepare a statement to accompany the audit report to certify the "appropriateness of the financial statements and disclosures contained in the periodic report, and that those financial statements and disclosures fairly present, in all material respects, the operations and financial condition of the issuer."
Section 304: Forfeiture of Certain Bonuses and Profits
If an issuer is required to prepare a restatement due to "material noncompliance" with financial reporting requirements, the chief executive officer and the chief financial officer shall "reimburse the issuer for any bonus or other incentive-based or equity-based compensation received" during the twelve months following the issuance or filing of the non-compliant document and "any profits realized from the sale of securities of the issuer" during that period.
Section 402: Enhanced Conflict of Interest Provisions.
Generally, it will be unlawful for an issuer to extend credit to any director or executive officer.
Section 404: Management Assessment Of Internal Controls
Requires each annual report of an issuer to contain an "internal control report", which shall: (1) state the responsibility of management for establishing and maintaining an adequate internal control structure and procedures for financial reporting; and
(2) contain an assessment, as of the end of the issuer's fiscal year, of the effectiveness of the internal control structure and procedures of the issuer for financial reporting. Each issuer's auditor shall attest to, and report on, the assessment made by the management of the issuer. An attestation made under this section shall be in accordance with standards for attestation engagements issued or adopted by the Board.
Section/Title number Key provisions
Section 407: Disclosure of Audit Committee Financial Expert.
The SEC shall issue rules to require issuers to disclose whether at least 1 member of its audit committee is a "financial expert."
Title VIII: Corporate and Criminal Fraud Accountability
It is a felony to "knowingly" destroy or create documents to "impede, obstruct or influence" any existing or contemplated federal investigation. Auditors are required to maintain "all audit or review work papers" for five years. The statute of limitations on securities fraud claims is extended to the earlier of five years from the fraud, or two years after the fraud was discovered, from three years and one year, respectively. Employees of issuers and accounting firms are extended "whistleblower protection" that would prohibit the employer from taking certain actions against employees who lawfully disclose private employer information to, among others, parties in a judicial proceeding involving a fraud claim. Whistle blowers are also granted a remedy of special damages and attorney's fees. A new crime for securities fraud that has penalties of fines and up to 10 years imprisonment.
Title IX: White Collar Crime Penalty Enhancements.
Maximum penalty for mail and wire fraud increased from 5 to 10 years. SEC is given authority to seek court freeze of extraordinary payments to directors, offices, partners, controlling persons, agents of employees. SEC may prohibit anyone convicted of securities fraud from being an officer or director of any publicly traded company. Financial statements filed with the SEC must be certified by the CEO and CFO. The certification must state that the financial statements and disclosures fully comply with provisions of the Securities Exchange Act and that they fairly present, in all material respects, the operations and financial condition of the issuer. Maximum penalties for willful and knowing violations of this section are a fine of not more than $500,000 and/or imprisonment of up to 5 years.
Reference: the American Institute of Certified Public Accountants, Summary of the Provisions of the Sarbanes-Oxley Act of 2002 (http://www.aicpa.org)
error term where, for each firm and in each year: AFEE = natural log of fees paid to auditors for their financial statement audits (i.e., audit fees) in thousand dollars; YR0304 = 1 if the fiscal year is 2003 or 2004 and 0 otherwise; WIC = A weakness of a client's internal control variable measured by either WIC_D, WIC_C, or WIC_P where WIC_D equals 1 if a client receives an internal control weakness opinion from its auditor and 0 otherwise; WIC_C equals natural log of one plus the number of categories of internal control weakness cited in the auditor's report; WIC_P is the predicted value of WIC_C. The WIC_ D and WIC_C are measured in 2004 and assumed to remain the same during the five-year sample period, 2000-2004, while WIC_P is measured for each firm-year observations.
LEVE
= leverage measured by total liabilities divided by total assets; windsorized at 5; LOSS = 1 if the firm reports net loss and 0 otherwise; BIG4 = 1 if the auditor is one of Big 4 and 0 otherwise; LNTA = natural log of total assets in thousand dollars; NBS = natural log of one plus number of business segments; NGS = natural log of one plus number of geographic segments; EMPLOY = square root of the number of employees; INVREC = inventory plus receivables, divided by total assets; ISSUE = 1 if the sum of debt or equity issued during the past 3 years are more than 5 percent of the total assets and 0 otherwise; BTM = book-to-market ratio, windsorized at 0 and 4; FOREIGN = 1 if the firm pays any foreign income tax and 0 otherwise; EXORD = 1 if the firm reports any extraordinary gains or losses and 0 otherwise; RNDTA = research and development expenditure (Compustat data item number 46) divided by total assets; AUDCHG = 1 if the incumbent auditor is different from the last year's auditor and 0 otherwise; LAMDA = inverse Mills ratio.
ses reveal that there exist clear coefficients differences between the period until 2002 and the period after year 2002. The results for year 2002 are more similar to those of year 2000 or 2001 in the year-by-year analyses than those of year 2003 or 2004. Thus, we select year 2003 as the cut-off year. This result suggests that it took about 1 year for the SOX to change the pricing mechanism of the auditors. 16) Following Ashbaugh-Skaife et al. (
identified in our 2004 sample into the 2000-2003 sample as long as the data requirements for estimating our regression models are satisfied. 18) As shown in Panel A ofTable 1, our final sample consists of 2,437 client firms or 9,067 firm-year observations. As shown in Section A, 252 of the 2,437 clients (or 10.27 percent of the sample) received WICO from their auditors in 2004. Similarly, 88.33 percent of the observations have WIC_D that equals 0 and the remaining 11.67 percent of our sample have WIC_D that equals 1. Panel A also reports the number of the categories of WIC cited on the auditor's report. Twenty-eight firms (121 observations) receiving WICOs from their auditors have only one category of WIC, whereas 6 firms (25 observations) have 10 different categories of WIC.Panel B of
Definitions of Variables AFEE = natural log of audit fees in thousand dollars; WIC_D = 1 if the auditor of the client firm receives internal control weakness opinion in fiscal year 2004, 0 otherwise; WIC_C = natural log of one plus the number categories of internal control weakness cited in the auditor's report for fiscal year 2004; LEVE = leverage (total liabilities divided by total assets); LOSS = 1 if the firm reports a loss during the year, 0 otherwise; BIG4 = 1 if the auditor is a Big 4 or predecessor auditor, 0 otherwise; LNTA = natural log of total assets in thousand dollars; NBS = natural log of one plus number of business segments; NGS = natural log of one plus number of geographic segments; EMPLOY = square root of the number of employees; INVREC = inventory and receivables divided by total assets; ISSUE = 1 if the sum of debt or equity issued during the past 3 years are more than 5% of the total assets, 0 otherwise; BTM = book-to-market ratio, windsorized at 0 and 4; FOREIGN = 1 if the firm pays any foreign income tax, 0 otherwise; EXORD = 1 if the firm reports any extraordinary gains or losses, 0 otherwise; RNDTA = research and development expenditure divided by total assets; AUDCHG = 1 if auditor is in the first year of audit engagement, 0 otherwise; LAMDA = inverse Mills ratio for the receipt of endogenous weak internal control opinion.
receives internal control weakness opinion in fiscal year 2004 and 0 otherwise. WIC_C: natural log of one plus the number categories of internal control weakness cited in the auditor's report of fiscal year 2004. WIC_P: predicted number of internal control weakness categories. YR0304: 1 if the fiscal year is 2003 or 2004 and 0 otherwise. See
WIC = WIC_ D. WIC_D: 1 if the company receives internal control weakness opinion in fiscal year 2004 and 0 otherwise. YR0304: 1 if the fiscal year is 2003 or 2004 and 0 otherwise. See
Table 1 .
1Statistics on weakness in internal control Panel A: Number of internal control weakness opinions Panel B: Categorization of the weakness in internal controlNumber of
weakness in
internal control
Section A
No. of Firms
Section B
No. of firm-year observations
Number
%
Number
%
0
1
2
3
4
5
6
7
8
9
10
2,185
28
73
48
43
20
17
9
3
5
6
89.73
1.14
2.97
1.96
1.75
0.82
0.69
0.37
0.12
0.20
0.24
8,009
121
311
209
178
76
65
41
11
21
25
88.33
1.33
3.43
2.31
1.96
0.84
0.72
0.45
0.12
0.23
0.28
Total
2,437
100.00
9,067
100.00
Category
Number of
observations
%
Application of GAAP/accounting policies
Review of transactions
Tax-related issues
Staffing issues (levels, training, or expertise)
Property, equipment, lease
Policies/documentation issues
Financial statement closing process/controls
Control environments
International operations/subsidiaries
IT & applications
Merger/acquisition-related issues
Inventory management
Revenue/billing
Segregation of duties
Employee benefit/pension
Others
345
343
319
293
277
241
233
198
172
138
136
113
101
93
74
333
32.61
32.42
30.15
27.69
26.18
22.78
22.02
18.71
16.26
13.04
12.85
10.68
9.55
8.79
6.99
31.47
Table 2 .
2Distributions of variablesVariable
Mean
Std. Dev.
1%
50%
99%
AFEE
WIC_D
WIC_C
LEVE
LOSS
BIG4
LNTA
NBS
NGS
EMPLOY
INVREC
ISSUE
BTM
FOREIGN
EXORD
RNDTA
AUDCHG
LAMDA
6.0235
0.1167
0.1635
0.5293
0.4028
0.8894
12.7669
1.0029
0.9833
64.5678
0.2393
0.4872
0.5686
0.4773
0.2296
0.0679
0.0867
1.7863
1.2757
0.3211
0.4731
0.4776
0.4905
0.3137
2.0210
0.4830
0.6315
76.5885
0.1818
0.4999
0.6146
0.4995
0.4206
0.1417
0.2814
0.2378
3.2048
0
0
0.0451
0
0
7.3265
0
0
2.2360
0
0
0
0
0
0
0
1.3580
5.9319
0
0
0.4791
0
1
12.7305
0.6931
1.0986
38.9101
0.2114
0
0.4078
0
0
0.0039
0
1.7588
9.2003
1
2.0794
2.1748
1
1
17.2799
2.0794
2.3026
370.1351
0.7613
1
3.5834
1
1
0.7812
1
2.6232
Table 3 .
3Pearson correlations among variablesVariable AFEE
WIC_D WIC_C
LEVE
LOSS
BIG4
LNTA
NBS
NGS
EMP-
LOY
INV-
REC
ISSUE
BTM
FOR-
EIGN
EXORD RNDTA
AUD-
CHG
WIC_D
0.057
(<0.001)
WIC_C
0.061
(<0.001)
0.948
(<0.001)
LEVE
0.027
(0.011)
-0.018
(0.092)
-0.017
(0.092)
LOSS
-0.230
(<0.001)
0.036
(0.001)
0.048
(<0.001)
0.106
(<0.001)
BIG4
0.359
(<0.001)
0.037
(<0.001)
0.031
(0.003)
-0.157
(<0.001)
-0.126
(<0.001)
LNTA
0.800
(<0.001)
0.027
(0.009)
0.022
(0.040)
-0.041
(<0.001)
-0.334
(<0.001)
0.441
(<0.001)
NBS
0.227
(<0.001)
0.028
(0.007)
0.029
(0.005)
0.039
(<0.001)
-0.096
(<0.001)
0.056
(<0.001)
0.216
(<0.001)
NGS
0.407
(<0.001)
0.060
(<0.001)
0.075
(<0.001)
-0.034
(0.001)
-0.140
(<0.001)
0.157
(<0.001)
0.335
(<0.001)
0.119
(<0.001)
EMP-
LOY
0.594
(<0.001)
-0.008
(0.433)
-0.019
(0.074)
0.083
(<0.001)
-0.258
(<0.001)
0.197
(<0.001)
0.687
(<0.001)
0.140
(<0.001)
0.187
(<0.001)
INVREC
0.031
(0.003)
0.003
(0.812)
-0.003
(0.798)
0.078
(<0.001)
-0.231
(<0.001)
-0.071
(<0.001)
-0.040
(<0.001)
0.074
(<0.001)
0.148
(<0.001)
0.083
(<0.001)
ISSUE
-0.043
(<0.001)
-0.012
(0.255)
-0.014
(0.182)
0.123
(<0.001)
0.125
(<0.001)
-0.046
(<0.001)
-0.052
(<0.001)
-0.032
(0.002)
-0.111
(<0.001)
-0.068
(<0.001)
-0.111
(<0.001)
BTM
-0.067
(<0.001)
0.019
(0.070)
0.021
(0.049)
-0.117
(<0.001)
0.061
(<0.001)
0.015
(0.142)
0.020
(0.052)
0.068
(<0.001)
0.004
(0.735)
-0.014
(0.181)
0.126
(<0.001)
-0.111
(<0.001)
FOR-
EIGN
0.482
(<0.001)
0.054
(<0.001)
0.065
(<0.001)
-0.021
(0.043)
-0.208
(<0.001)
0.179
(<0.001)
0.406
(<0.001)
0.137
(<0.001)
0.594
(<0.001)
0.268
(<0.001)
0.157
(<0.001)
-0.118
(<0.001)
-0.024
(0.021)
EXORD
0.225
(<0.001)
0.024
(<0.024)
0.028
(0.008)
0.122
(<0.001)
0.035
(<0.001)
0.054
(<0.001)
0.221
(<0.001)
0.136
(<0.001)
0.074
(<0.001)
0.172
(<0.001)
-0.026
(0.015)
0.018
(0.083)
0.073
(<0.001)
0.082
(<0.001)
RNDTA
-0.253
(<0.001)
-0.039
(<0.001)
-0.024
(0.022)
0.046
(<0.001)
0.366
(<0.001)
-0.074
(<0.001)
-0.392
(<0.001)
-0.168
(<0.001)
-0.167
(<0.001)
-0.251
(<0.001)
-0.219
(<0.001)
0.116
(<0.001)
-0.180
(<0.001)
-0.164
(<0.001)
-0.122
(<0.001)
AUD-
CHG
-0.104
(<0.001)
0.021
(0.045)
0.020
(0.054)
0.045
(<0.001)
0.048
(<0.001)
-0.155
(<0.001)
-0.090
(<0.001)
-0.012
(0.263)
-0.019
(0.077)
-0.065
(<0.001)
0.006
(0.599)
-0.013
(0.235)
0.040
(<0.001)
-0.045
(<0.001)
0.018
(0.083)
0.008
(0.441)
LAMDA
-0.598
(<0.001)
-0.092
(<0.001)
-0.092
(<0.001)
0.330
(<0.001)
0.013
(0.235)
-0.639
(<0.001)
-0.711
(<0.001)
-0.216
(<0.001)
-0.469
(<0.001)
-0.383
(<0.001)
-0.019
(0.067)
0.055
(<0.001)
-0.080
(<0.001)
-0.516
(<0.001)
-0.133
(<0.001)
0.241
(<0.001)
-0.023
(0.029)
Table 4 .
4Audit fee difference between the pre-SOX and post-SOX periodsPanel A: Mean audit fees by year for the total sample, the WIC sample,
and the non-WIC sample
Year
N
Total sample
WIC sample
(WIC_D = 1)
Non-WIC sample
(WIC_D = 0)
2000
2001
2002
2003
2004
1,626
1,740
1,868
1,941
1,892
5.5856
5.6589
5.8200
6.0791
6.8787
5.5984
5.7522
6.0080
6.3239
7.2209
5.5840
5.6483
5.7956
6.0464
6.8304
Panel B: Average audit fee changes from 2002 to 2003 for the WIC and
non-WIC samples
N
Amount of
change
Percentage change
(%)
WIC sample
(WIC_D = 1)
228
Mean
Median
0.3335
0.2571
7.76
4.34
Non-WIC sample
(WIC_D = 0)
1,689
Mean
Median
0.2468
0.1942
5.63
3.15
Test for mean differences
Test for median differences
t value
z value
2.38***
2.61***
1.56*
3.05***
Panel C: Average audit fee changes from years 2001 and 2002 to years
2003 and 2004 for the WIC and non-WIC samples
N
Amount of
change
Percentage change
(%)
WIC sample
(WIC_D = 1)
215
Mean
Median
0.9408
0.9571
17.70
16.76
Non-WIC sample
(WIC_D = 0)
1,378
Mean
Median
0.6988
0.6943
12.49
12.02
Test for mean difference
Test for median differences
T value
z value
7.47***
4.59***
7.35***
6.47***
Table 5 .
5OLS Regression analyses on determinants of audit feesAFEE
= α
0 + α
1 YR0304+
α
2 WIC
+ α
3 (YR0304*WIC) + β
1 LEVE
+ β
2 LOSS
+ β
3 BIG4
+ γ
1 LNTA
+ γ
2 NBS
+ γ
3 NGS
+ γ
4 EMPLOY
+ γ
5 INVREC
+ γ
6 ISSUE
+ γ
7 BTM
+ γ
8 FOREIGN
+ γ
9 EXORD
+ γ
10 AUDCHG
+ γ
11 LAMDA
+ industry dummies
+ error term
Variables
Predicted
sign
Model 1
Model 2
Model 3
Model 4
Model 5
Model 6
Model 7
Model 8
Model 9
With both WIC
and YR0304
excluded
With WIC
excluded
WIC = WIC_D
With YR0304
excluded
WIC = WIC_D
With Lamda
excluded
WIC = WIC_D
With Lamda
included
WIC = WIC_D
With Lamda
excluded
WIC = WIC_D
With Lamda
included
WIC = WIC_C
With Lamda
excluded
WIC = WIC_P
With Lamda
excluded
Table 5 . (Continued)
5Variable
Pred.
sign
Model 1
Model 2
Model 3
Model 4
Model 5
Model 6
Model 7
Model 8
Model 9
ISSUE
+
0.0097
(0.65)
0.0176
(1.34)
0.0096
(0.64)
0.0175
(1.35)
0.0356
(2.70***)
0.0176
(1.35)
0.0356
(2.70***)
0.0174
(1.33)
0.0177
(1.35)
AppendixSummary of the major SOX provisions that are important to Auditor/ AuditingSection/Title number Key provisionsSection 101: establishment; Administrative Provisions.The Public Company Accounting Oversight Board (The Board) is established as an independent non-profit corporation which shall oversee the audit of public companies that are subject to the securities laws and related matters.Section 103: Auditing, Quality Control, And Independence Standards And Rules.The Board must require registered public accounting firms to "prepare, and maintain for a period of not less than 7 years, audit work papers, and other information related to any audit report, in sufficient detail to support the conclusions reached in such report."The Board must require a 2nd partner review (concurring review) and approval of audit reports registered accounting firms must adopt quality control standards.Section 104: Inspections of Registered Public Accounting Firms.Annual quality reviews (inspections) must be conducted for firms that audit more than 100 issues, all others must be conducted every 3 years. The SEC and/or the Board may order a special inspection of any firm at any time.Section 201: Services Outside The Scope Of Practice Of Auditors.It shall be "unlawful" for a registered public accounting firm to provide any non-audit service to an issuer contemporaneously with the audit, including: (1) bookkeeping or other services related to the accounting records or financial statements of the audit client; (2) financial information systems design and implementation; (3) appraisal or valuation services, fairness opinions, or contribution-in-kind reports; (4) actuarial services; (5) internal audit outsourcing services; (6) management functions or human resources; (7) broker or dealer, investment adviser, or investment banking services; (8) legal services and expert services unrelated to the audit; (9) any other service that the Board determines, by regulation, is impermissible.Section 203: Audit Partner RotationThe lead audit or coordinating partner and the reviewing partner must rotate off of the audit every 5 years.
The Discovery and Consequences of Internal Control Deficiencies prior to SOX-mandated Audits. H Ashbaugh-Skaife, D Collins, W Kinney, Journal of Accounting and Economics. 44Ashbaugh-Skaife, H., D. Collins, and W. Kinney (2007), "The Discovery and Consequences of Internal Control Deficiencies prior to SOX-mandated Audits," Journal of Accounting and Economics, 44, 166-192.
Auditors' Perceived Business Risk and Audit Fees: Analysis and Evidence. T B Bell, W R Landsman, D A Shackelford, Journal of Accounting Research. 391Bell, T. B., W. R. Landsman, and D. A. Shackelford (2001), "Auditors' Perceived Business Risk and Audit Fees: Analysis and Evidence," Jour- nal of Accounting Research, 39(1), 35-43.
Internal Control Weaknesses and Information Uncertainty. M D Beneish, M Billings, L Hodder, The Accounting Review. 833Beneish, M.D., M. Billings, and L. Hodder (2008), "Internal Control Weaknesses and Information Uncertainty," The Accounting Review, 83(3), 665-703.
Self-selection of Auditors and Audit Pricing in Private Firms. P Chaney, D C Jeter, L Shivakumar, The Accounting Review. 791Chaney, P., D. C. Jeter, and L. Shivakumar (2004), "Self-selection of Auditors and Audit Pricing in Private Firms," The Accounting Review, 79(1), 51-72.
Audit Pricing, Legal Liability Regimes, and Big 4 Premiums: Theory and Crosscountry Evidence. J. -H Choi, J. -B Kim, X Liu, D A Simunic, Contemporary Accounting Research. 251Choi, J. -H., J. -B. Kim, X. Liu, and D. A. Simunic (2008), "Audit Pricing, Legal Liability Regimes, and Big 4 Premiums: Theory and Cross- country Evidence," Contemporary Accounting Research, 25(1), 55-99.
Auditor Brand Name Reputations and Industry Specialization. A Craswell, J R Francis, S Taylor, Journal of Accounting and Economics. 203Craswell, A., J.R. Francis, and S. Taylor (1995), "Auditor Brand Name Reputations and Industry Specialization," Journal of Accounting and Economics, 20(3), 297-322.
Auditor Size and Audit Quality. L E Deangelo, Journal of Accounting and Economics. 32DeAngelo, L. E. (1981), "Auditor Size and Audit Quality," Journal of Account- ing and Economics, 3(2), 183-199.
Auditor Industry Specialization and Market Segmentation: Evidence from Hong Kong. M L Defond, F R Francis, T J Wong, Auditing: A Journal of Practice and Theory. 191DeFond, M.L., F.R. Francis, and T.J. Wong (2000), "Auditor Industry Specialization and Market Segmentation: Evidence from Hong Kong," Auditing: A Journal of Practice and Theory, 19(1), 49-66.
Do Nonaudit Services Fees Impair Auditor Independence? Evidence from Going Concern Audit Opinions. M Defond, K Raghunandan, K Subramanyam, Journal of Accounting Research. 404DeFond, M., K. Raghunandan, and K. Subramanyam (2002), "Do Non- audit Services Fees Impair Auditor Independence? Evidence from Going Concern Audit Opinions," Journal of Accounting Research, 40(4), 1247- 1274.
The Wealth Change and Redistribution Effects of Sarbanes-Oxley Internal Control Disclosures. G Defranco, Y Guan, H Lu, University of TorontoWorking PaperDeFranco, G., Y. Guan, and H. Lu (2005), "The Wealth Change and Redistribution Effects of Sarbanes-Oxley Internal Control Disclosures," Working Paper, University of Toronto.
Determinants of Internal Control over Financial Reporting. J Doyle, W Ge, S Mcvay, Journal of Accounting and Economics. 44Doyle, J., W. Ge, and S. McVay (2007), "Determinants of Internal Control over Financial Reporting," Journal of Accounting and Economics, 44, 193-223.
Auditing Standards, Legal Liabilities and Auditor Wealth. R A Dye, Journal of Political Economy. 101Dye, R. A. (1993), "Auditing Standards, Legal Liabilities and Auditor Wealth," Journal of Political Economy, 101, 877-914.
Audit Prices, Product Differentiation, and Scale Economies: Further Evidence from the Australian Market. J Francis, D J Stokes, Journal of Accounting Research. 242Francis, J., and D. J. Stokes (1986), "Audit Prices, Product Differentiation, and Scale Economies: Further Evidence from the Australian Market," Journal of Accounting Research, 24(2), 383-393.
The Relation between Auditors' Fees for Non-audit Services and Earnings Quality. R Frankel, M Johnson, K Nelson, The Accounting Review. 77SupplementFrankel, R., M. Johnson, and K. Nelson (2002), "The Relation between Auditors' Fees for Non-audit Services and Earnings Quality," The Ac- counting Review, 77 (Supplement), 71-105.
The Disclosure of Material Weaknesses in Internal Control after the Sarbanes-Oxley Act. W Ge, S Mcvay, Accounting Horizons. 193Ge, W., and S. McVay (2005), "The Disclosure of Material Weaknesses in Internal Control after the Sarbanes-Oxley Act," Accounting Horizons, 19(3), 137-158.
Mandated Disclosures under Section 404: Too Little and Too Late?. A Ghosh, M Lubberink, City University of New YorkWorking PaperGhosh, A., and M. Lubberink (2006), "Mandated Disclosures under Section 404: Too Little and Too Late?," Working Paper, City University of New York.
Market Reactions to the Disclosure of Internal Control Weaknesses and to the Characteristics of Those Weaknesses under Section 302 of the Sarbanes Oxley Act of. W Greene, N J Prentice Hall, L J S Hammersley, C Meyers, Shakespeare, Econometric Analysis. 13Greene, W. (2000), Econometric Analysis, Prentice Hall, NJ. Hammersley. J. S., L. Meyers, and C. Shakespeare (2008), "Market Reactions to the Disclosure of Internal Control Weaknesses and to the Characteristics of Those Weaknesses under Section 302 of the Sar- banes Oxley Act of 2002," Review of Accounting Studies, 13(1), 141-165.
The Impact of SOX on Auditor Resignations and Dismissals. K Hertz, University of WashingtonWorking PaperHertz, K. (2005), "The Impact of SOX on Auditor Resignations and Dismissals," Working Paper. University of Washington.
Evidence on the Audit Risk Model: Do Auditors Increase Audit Effort in the Presence of Internal Control Weakness?. M C E S Hogan, Wilkins, Contemporary Accounting Research. 251Hogan. C. E., and M. S. Wilkins (2008), "Evidence on the Audit Risk Model: Do Auditors Increase Audit Effort in the Presence of Internal Control Weakness?," Contemporary Accounting Research, 25(1), 219-242.
Internal Control Quality and Audit Pricing under the Sarbanes-Oxley Act. R Hoitash, U Hoitash, J C Bedard, Auditing: A Journal of Practice & Theory. 271Hoitash, R., U. Hoitash, and J. C. Bedard (2008), "Internal Control Quality and Audit Pricing under the Sarbanes-Oxley Act," Auditing: A Journal of Practice & Theory, 27(1), 105-126.
The Audit Risk Model, Business Risk, and Audit-planning Decisions. M R W F Houston, H Pratt, Jamie, The Accounting Review. 743Houston. R. W., M. F. Pratt, and H. Jamie (1999), "The Audit Risk Model, Business Risk, and Audit-planning Decisions," The Accounting Review, 74(3), 281-298.
US Accounting Standards and Their Environment: A Dualistic Study of Their 75-years of Transition. Y Ijiri, Journal of Accounting and Public Policy. 24Ijiri, Y. (2005), "US Accounting Standards and Their Environment: A Dualistic Study of Their 75-years of Transition," Journal of Accounting and Public Policy, (24), 255-279.
Risk Management in Client Acceptance Decisions. K M Johnston, J C Bedard, The Accounting Review. 784Johnston, K. M. and J. C. Bedard (2003), "Risk Management in Client Acceptance Decisions," The Accounting Review, 78(4), 1003-1025.
On the Association between Voluntary Disclosure and Earnings Management. R Kasznik, Journal of Accounting Research. 371Kasznik, R. (1999), "On the Association between Voluntary Disclosure and Earnings Management," Journal of Accounting Research, 37(1), 57-81.
Auditor Conservatism, Asymmetric Monitoring and Earnings Management. J.-B Kim, R Chung, M Firth, Contemporary Accounting Research. 20Kim, J.-B., R. Chung, and M. Firth (2003), "Auditor Conservatism, Asymmetric Monitoring and Earnings Management," Contemporary Ac- counting Research, 20, 323-359.
Performance Matched Discretionary Accrual Measures. S P Kothari, A J Leone, C E Wasley, Journal of Accounting and Economics. 391Kothari, S. P., A. J. Leone, and C. E. Wasley (2005), "Performance Matched Discretionary Accrual Measures," Journal of Accounting and Economics, 39(1), 163-197.
Litigation Risk and the Financial Reporting Credibility of Big 4 vs. Non-Big 4 Audits: Evidence from Anglo-American Countries. I K Khurana, K K Raman, The Accounting Review. 792Khurana, I. K., and K. K. Raman (2004), "Litigation Risk and the Financial Reporting Credibility of Big 4 vs. Non-Big 4 Audits: Evidence from An- glo-American Countries," The Accounting Review, 79(2), 473-495.
Audit Committee Quality and Internal Control: An Empirical Analysis. J Krishnan, The Accounting Review. 802Krishnan, J. (2005), "Audit Committee Quality and Internal Control: An Empirical Analysis," The Accounting Review, 80(2), 649-675.
The Importance of Business Risk in Setting Audit Fees: Evidence form Cases of Client Misconduct. J D Lyon, M W Maher, Journal of Accounting Research. 431Lyon, J. D., and M. W. Maher (2005), "The Importance of Business Risk in Setting Audit Fees: Evidence form Cases of Client Misconduct," Journal of Accounting Research, 43(1), 133-151.
Error Cost and Auditors' Termination Decisions. K Menon, D D Williams, Journal of Accounting, Auditing & Finance. 142Menon, K. and D. D. Williams (2001), "Error Cost and Auditors' Termination Decisions," Journal of Accounting, Auditing & Finance, 14(2), 95-123.
Section 404 Reporting on Internal Control: Our Early Experience. Moody's Investor Service. Special CommentMoody's Investor Service (2005), "Section 404 Reporting on Internal Control: Our Early Experience," Special Comment (April).
Who Got Sued?. Z Palmrose, Journal of Accountancy. 1833Palmrose, Z. (1997), "Who Got Sued?," Journal of Accountancy, 183(3), 67- 69.
The Effects of Client Characteristics on Auditor Litigation Risk Judgments, Required Audit Evidence, and Recommended Audit Fees. J Pratt, J D Stice, The Accounting Review. 694Pratt, J., and J. D. Stice (1994), "The Effects of Client Characteristics on Auditor Litigation Risk Judgments, Required Audit Evidence, and Recommended Audit Fees," The Accounting Review, 69(4), 639-656.
An Audit of Internal Control over Financial Reporting Performed in Conjunction with an Audit of Financial Statements. K Pcaob Raghunandan, D V Rama, SOX Section 404 Material Weakness Disclosures and Audit Fees. Washington, D.C25Auditing StandardsPublic Company Accounting Oversight Board (PCAOB) (2004), "An Audit of Internal Control over Financial Reporting Performed in Conjunction with an Audit of Financial Statements," Auditing Standards No. 2. Washington, D.C.: PCAOB Raghunandan, K., and D. V. Rama (2006), "SOX Section 404 Material Weakness Disclosures and Audit Fees," Auditing: A Journal of Practice and Theory, 25(1), 99-114.
. J L Reynolds, D Deis, J R Francis, Professional Service Fees and Auditor Objectivity. 231Auditing: A Journal of Practice and TheoryReynolds, J.L., D. Deis, and J.R. Francis (2004), "Professional Service Fees and Auditor Objectivity," Auditing: A Journal of Practice and Theory, 23(1), 29-52.
Pricing Initial Audit Engagements: Empirical Evidence Following Public Disclosure of Audit Fees. S Sankaraguruswamy, S Whisenant, Working paper, University of HoustonSankaraguruswamy, S., and S. Whisenant (2003), "Pricing Initial Audit Engagements: Empirical Evidence Following Public Disclosure of Audit Fees," Working paper, University of Houston.
Available at www.sec.gov/news/speech/sp-ch021605psa.htm. Securities and Exchange Commission (SEC) (2005b), "Remarks Before the European Corporate Governance Summit: An SEC Commissioner's View: The Post-Sarbanes-Oxley Environment for Foreign Issuer. Speech by SEC Commissioner. Washington, D. C., SEC; Memphis, Tennessee; London, England31Securities and Exchange Commission (SECSpeech by SEC CommissionerSecurities and Exchange Commission (SEC) (1988) "Disclosure Amendments to Regulation S-K, Form 8-K and Schedule 14A Regarding Changes in Accountants and Potential Opinion Shopping Situations," Financial Reporting Release No. 31 (April), SEC Docket 1140-1147, Washington, D. C., SEC. Securities and Exchange Commission (SEC) (2005a), "Remarks Before the Economic Hub of Memphis," Speech by SEC Commissioner (February 16), Memphis, Tennessee, Available at www.sec.gov/news/speech/sp- ch021605psa.htm. Securities and Exchange Commission (SEC) (2005b), "Remarks Before the European Corporate Governance Summit: An SEC Commissioner's View: The Post-Sarbanes-Oxley Environment for Foreign Issuer," Speech by SEC Commissioner (March 2), London, England. Available at www.sec.gov/news/speech/spch030205cag.htm.
Litigation Risk and Audit Fees: Evidence from U.K. Firms Cross-listed on U.S. Markets. A Seetharaman, F A Gul, S G Lynn, Journal of Accounting and Economics. 331Seetharaman, A., F. A. Gul, and S. G. Lynn (2002), "Litigation Risk and Audit Fees: Evidence from U.K. Firms Cross-listed on U.S. Markets," Journal of Accounting and Economics, 33(1), 91-115.
The Effects of Auditor Change on Audit Fees: Tests of Price Cutting and Price Recovery. D Simon, J Francis, The Accounting Review. 63Simon, D. and J. Francis (1988), "The Effects of Auditor Change on Audit Fees: Tests of Price Cutting and Price Recovery," The Accounting Re- view, 63(2), 255-269.
| Factors influencing the effectiveness of internal audit on organizational performance | Institute of Internal Auditors owes much to Sawyer's vision. With the implementation in the United States of the Sarbanes-Oxley Act of 2002, the profession's exposure and value was enhanced, as many internal auditors possessed the skills required to help companies meet the requirements of the law. However, the focus by internal audit departments of publicly traded companies on SOX related financial policy and procedures derailed progress made by the profession in the late 20th century toward Larry Sawyer's vision for internal audit. Beginning in about 2010, the IIA once again began advocating for the broader role internal auditing should play | This paper examines the responses of the government, the AICPA, and the FASB after the Enron and WorldCom accounting scandals. The major failures of these companies center on their creative accounting and bad corporate governance. The Congress responded to these issues with the Sarbanes-Oxley Act of 2002. The SEC responded with a variety of measures to restore confidence in the accounting profession; expand the role of management; improve disclosures and financial reporting; improve the performance of audit committees; and enhance enforcement tools. The Auditing Standards Board of the AICPA responded by issuing SAS No. 99, which provides auditors with additional guidance for detecting material fraud. The FASB has been slower to respond due to its lengthier due process rules. The paper discusses whether those responses would have been enough to prevent the Enron and WorldCom financial disasters, and whether they are ample now to prevent corporate failures in the future. | 7 | We provide a theoretical investigation of the effects of the Sarbanes‐Oxley Act of 2002 on auditing intensity and internal control strength. We propose a model of strategic auditing in which the auditor can use resources for both internal control tests and substantive tests, while the manager can choose the strength of internal controls and the amount of fraud. We find that control tests are a valuable tool for the auditor when control strength is informative about the likelihood of fraud. We find that Sarbanes‐Oxley has the desired effect of inducing stronger internal control systems and less fraud, but does not necessarily induce higher levels of control testing. Our model suggests that audit risk increases as a result of the Sarbanes‐Oxley Act. | Internal Control and Audit Program Effectiveness: Empirical Evidence from Jordan | Auditability in public procurement: an analysis of internal controls and fraud vulnerability | Strengthening of the Internal Control and Risk Management Audit in Universities | The effect of management change, audit opinion, and financial distress on auditor switching | The recent revelation of the misleading audited accounts of several big companies in the US has heightened public concern about the integrity of a firm’s financial reporting processes. The management of the accounts is commonly known as accrual management as it is effectively accomplished through manipulation of discretionary accruals. A firm’s internal corporate governance systems should be able to constrain the extent of earnings being managed. To this end, this paper investigates one important aspect of the internal corporate governance, namely the independence of the board of directors and the audit committee. It is argued that the extent to which the board and the audit committee are independent of management determines their ability to constrain the management of discretionary accruals. Using data from the Kuala Lumpur Stock Exchange (KLSE) non-financial Main Board listed companies in 1998 evidence showed that neither board independence nor the audit committee independence effectively constrained the accrual management level. The interactive effects of board independence and audit committee independence were also found to be insignificant. Evidence in this paper, therefore, casts doubt that the independence of boards and the audit committee can lead to high quality accounting information, which is thereby useful to users. JEL classification: G34, M41 Key words: Accrual management, Audit committee independence, Discretionary accruals | The aim of this paper is to investigate the effects of management entrenchment on research and development business decisions in the French listed companies and to detect these effects when we test simultaneously the impact of the board of directors' characteristics and the external audit quality. Using data from the French listed companies on the SBF 120 index during the period 2003-2011, this paper statistically tests the hypotheses on the relationship between corporate R&D intensity and managers' entrenchment indicators associated with two types of corporate governance mechanisms: the board of directors' characteristics and the external audit quality. Our results show that R&D intensity is affected by most of management entrenchment indicators (the age, the career, the stock ownership, the education and the firm's past performance), the external audit quality and some control variables (the size and the industry). | Locus Of Control And Dysfunctional Audit Behavior | The Empirical Research on the Relationship Between the Effectiveness of Internal Control and Financial Fraud ——Based on the Data of Chinese Listed Companies |
8 | When did it cease being important that a woman should be a virgin untill marriage? | the young couple were expected to marry. Marriage and birth records from the late 1700s reveal that between 30 and 40 percent of New England brides were pregnant before marriage. The growing popularity of the automobile, and corresponding changes in dating practices, caused premarital sex to become more prevalent. Alfred Kinsey found that American women who became sexually mature during the 1920s were much less likely to be virgins at marriage than those who became mature before World War I. A majority of women during the 1920s under the age of 30 were nonetheless virgins at marriage, however, and half | It is necessary to a nun to be a virgin? | What percentage of men are virgins on the day they got married? | ordered for women who go against traditional societal notions of "public morality and rules of modesty", though in 1999 the Turkish penal code was altered to require a woman's consent prior to performing such an examination. Notes Further reading Virginity Virginity is the state of a person who has never engaged in sexual intercourse. There are cultural and religious traditions that place special value and significance on this state, predominantly towards unmarried females, associated with notions of personal purity, honor and worth. Like chastity, the concept of virginity has traditionally involved sexual abstinence. The concept of virginity usually involves moral | I'm sure there's a more formal term to the era I'm referring to but I'm no expert. I'm thinking of a time period such as the 1200-1500's of Europe, a time where a show like Game of Thrones would apply. In entertainment today they make it seem like sex was as promiscuous as it is today, but that era's law was also very ecclesiastical so pre-marital sex seems as though it wouldn't have as much of a presence as it's being portrayed. Was everyone just swiping right back then? | I'm wondering if marriage would be trickier if one spouse was a virgin while the other wasn't prior to the marriage. Any church teachings on this? | Are you still considered a virgin if you were raped? | Fornication indictable offence at common law. Prior to the passing of the Marriage Act 1753, laws against bastard children became more strict during the 1730s and 1740s. In the Victorian era, however, the English working class continued to have a different set of sexual mores from the upper-middle and upper classes. Premarital intercourse was considered acceptable for the working class but only after an extended period of courtship and occurred infrequently even then. The couple were expected to marry, though. Disgrace only arose if the female became pregnant and the couple did not marry. Ethical issues arising from sexual relations between | 8 | Throughout history we've seen how important it was for a woman to be *unspoiled* untill she married and found a husband. At what point in history did it stop being important that the woman should be a virgin? | who was the founder of the rule for virgins | who would have a kept woman as a mistress | The Importance of Marrying a Virgin Woman | Is there a religion that conclusively established women's rights long before the modern world did? | Saving virginity until marriage | the unibrow is associated with virginity in which country | Cheating - Society made women permanent victims | what has virginity traditionally involved |
9 | On general periodic time-varying bilinear processes | The paper gives sufficient conditions for the absolute regularity of bilinear models. Our approach is based on their Markovian representation. The above property is a direct consequence of the geometric ergodicity of the Markovian process in this representation. The latter process belongs to what we call the generalised random coefficients autoregressive models. Conditions for the geometric ergodicity and also for the existence of moments for this model are given. Our results generalise that of Feigin and Tweedie. | On The Response of Linear Time-Periodic Systems Subjected to Deterministic and Stochastic Excitations | A weighted occupation time is defined for measure-valued processes and a representation for it is obtained for a class of measure-valued branching random motions on Rd. Considered as a process in its own right, the first and second order asymptotics are found as time t→∞. Specifically the finiteness of the total weighted occupation time is determined as a function of the dimension d, and when infinite, a central limit type renormalization is considered, yielding Gaussian or asymmetric stable generalized random fields in the limit. In one Gaussian case the results are contrasted in high versus low dimensions. | We consider the invariant measure of a homogeneous continuous- time Markov process in the quarter-plane. The basic solutions of the global balance equation are the geometric distributions. We first show that the invariant measure can not be a finite linear combination of basic geometric distributions, unless it consists of a single basic geo- metric distribution. Second, we show that a countable linear combina- tion of geometric terms can be an invariant measure only if it consists of pairwise-coupled terms. As a consequence, we obtain a complete characterization of all countable linear combinations of geometric dis- tributions that may yield an invariant measure for a homogeneous continuous-time Markov process in the quarter-plane. | Temporal aggregation in a periodically integrated autoregressive process | Continuous-time linear stochastic processes A(t)= -f'f(tu)dX(u) where X( ) is a homogeneous additive process, are examined. The result of Westcott (1970) that A( ) and f determine X( ) uniquely is generalised slightly. It is shown that if essentially distinct pairs fi, X1( ) and f2, X2(. ) give rise to the same linear process A, then X( -) and X2( ) are Gaussian, and that if a process A is time-reversible then X( ) is Gaussian. These results are continuous-time analogues of Rao (1966) and of Weiss (1975) respectively. | We consider the concepts of continuous Bernoulli systems and non-commutative white noises. We address the question of isomorphism of continuous Bernoulli systems and show that for large classes of quantum L{\'e}vy processes one can make quite precise statements about the time behaviour of their moments. | In this paper, general periodic ecosystems are discussed. Through studying of the fixed point behaviours to the mixed monotone operator, we obtain some results about the existence and uniqueness, and attraction of the positive periodic solution for general periodic ecosystems. Our results unify and improve some known results. | 9 | We study in this note the class of bilinear processes with periodic time-varying coefficients. We give necessary and sufficient conditions ensuring the existence of strict and second order stationary solutions (in periodic sense) and for the existence of higher order moments. The given conditions can be applied to periodic ARMA or periodic GARCH models. The central limit theorem and the law of iterated logarithm (LIL) for higher order sample moments are showed. | A characterization of vector autoregressive processes with common cyclical features | Almost Periodic Solutions for Limit Periodic Systems | Abstract In this paper we prove the existence and uniqueness of C ( n ) -almost periodic solutions to the ordinary differential equation x ′ ( t ) = A ( t ) x ( t ) + f ( t ) , t ∈ R , where the matrix A ( t ) : R → M k ( C ) is τ -periodic and f : R → C k is C ( n ) -almost periodic. We also prove the existence and uniqueness of an ultra-weak C ( n ) -almost periodic solution in the case when A ( t ) = A is independent of t . Finally we prove also the existence and uniqueness of a mild C ( n ) -almost periodic solution of the semilinear hyperbolic equation x ′ ( t ) = A x ( t ) + f ( t , x ) considered in a Banach space, assuming f ( t , x ) is C ( n ) -almost periodic in t for each x ∈ X , satisfies a global Lipschitz condition and takes values in an extrapolation space F A − 1 associated to A . | Evidence of quasi-biennial oscillations in a general circulation model | In this note the almost sure convergence of stationary, ϕ-mixing sequences of random variables with values in real, separable Banach spaces according to summability methods is linked to the fulfillment of a certain integrability condition generalizing and extending the results for i.i.d. sequences. Furthermore we give via Baum-Katz type results an estimate for the rate of convergence in these laws. | Second-order properties of multivariate stationary time series | The Stepanov almost periodic solution of a certain second-order differential equation in a reflexive Banach space is shown to be almost periodic. | Existence and Stability Properties of Almost Periodic Solutions in Discrete Almost Periodic Systems |
10 | We report on the generation of mid- and far-infrared radiation using periodically poled materials. In particular, cw mode-locked fs optical parametric oscillators based on (PPLN) periodically poled LiNbO/sub 3/:MgO with strongly reduced photorefractivity and optical rectification in PPLN for the generation of tunable narrowband THz radiation will be discussed. | We report on all periodically-poled crystals based singly-resonant optical parametric oscillator (SRO) generating continuous-wave, single-frequency, tunable UV radiation with maximum output power of 336mW in 18.5 MHz line-width at 399.2nm. It has tunability of 18nm. | Temperature-tunable nanosecond optical parametric oscillator based on periodically poled MgO:LiNbO3 | Single-cycle THz radiation was generated by optical rectification of Yb-fiber laser pulses with 250 fs duration and 10 muJ energy. We obtained an average power of 0.5 mW at 1 MHz repetition rate. | By using a short-pulse field, periodically poled grating (A = 29 μm) was successfully fabricated in a 1.0 mm-thick MgO:LiNbO3 (mole fraction of doped MgO is 5%). A high-repetition-rate optical parametric generation (OPG) based on periodically poled MgO:LiNbO3 (PPMgLN) was pumped by a 1.064 μm acousto-optically Q-switched Nd:YVO4 laser. With 3 W of input pump power, 44 mW of output signal power was obtained at a conversion efficiency of 1.5%. Tunable infrared (IR) output from 1.4538–1.4750 μm was also obtained by tuning the temperature of PPMgLN, which is 45°C–160°C. | The operating principles and a practical demonstration of surface-emitted THz waves via difference frequency mixing are discussed. We developed periodically poled lithium niobate (PPLN) THz-wave generators and an optical source based on 1.5-/spl mu/m diode lasers. | We present a continuous-wave dual-crystal optical parametric oscillator that generates signal waves of about 1.4??m wavelength with a tunable difference frequency ?? between 0.64 and 5.3?THz. A model of the parametric gain in such a system indicates that the lowest reachable value for ?? depends on the refractive index dispersion of the nonlinear material used. As a proof of principle, we demonstrate the generation of terahertz radiation by photomixing the signal waves. Frequencies between 0.64 and 0.85?THz are created and detected coherently with ion-irradiated InGaAs interdigitated photomixers. | We demonstrate a compact and cost-effective setup to generate broadband THz radiation. As pump source we use a diode-pumped solid-state femtosecond oscillator or a femtosecond fiber laser system, partially in combination with an optical parametric oscillator. For the THz generation we utilize optical rectification in gallium phosphide (GaP) and gallium arsenide (GaAs). The THz power is on the order of 1 μW and we demonstrate imaging and spectral measurements with this setup. | The authors analyse harmonic mode-locking at (sub)terahertz frequencies in linear Fabry-Perot compound-cavity laser diodes (theoretically), and in ring structures (experimentally and theoretically) and compare these lasers with other constructions used for harmonic mode-locking. | 10 | We demonstrate a promising technique for generating narrow-band terahertz electromagnetic radiation. Femtosecond optical pulses are propagated through a periodically poled lithium-niobate crystal, where the domain length is matched to the walk-off length between the optical and THz pulses. The bandwidth of the THz wave forms is 0.11 at 1.7 THz. Optical rectification gives rise to a THz wave form which corresponds to the domain structure of the periodically poled lithium niobate. | Power-scalable narrowband terahertz pulses generated by periodically-poled LiTaO3 based on backward rectification | Characterization of High-power Narrow-band Terahertz Radiation Generation Using Large-aperture Photoconductive Antennas | Generation of tunable continuous-wave terahertz radiation by photomixing the signal waves of a dual-crystal optical parametric oscillator | Terahertz Photonics: Optoelectronic Techniques for Generation and Detection of Terahertz Waves | Generation of continuous-wave terahertz radiation using a two-mode titanium sapphire laser containing an intracavity Fabry–Perot etalon | Optical rectification for terahertz generation | The magnetic field dependence of terahertz radiation from InAs excited by femtosecond laser pulses has been measured with the time-domain spectroscopy up to 10 T. The magnetic field dependence of n-InAs shows a radiation power minimum around 5 T whereas p-InAs does not show such a minimum. Additionally, it is found that the polarity of the amplitude of terahertz radiation is reversed at 5 T for n-InAs. This polarity reversal is attributed to a crossover of the radiation mechanism from the photo-Dember effect to magnetoplasma oscillations with increasing magnetic field. | Generation of terahertz pulses by photoionization of electrically biased air |
11 | when was the clavius crater on the moon created | Clavius Base Clavius Base is a fictional lunar settlement in the "Space Odyssey" literary universe created by Arthur C. Clarke. The base, located at Clavius crater, is featured in both the novel and film versions of "". According to the novel, the base was finished in 1994 by United States Astronautical Engineering Corps. If necessary, the base can be self-sustaining. As depicted on screen, Clavius Base features some surface features (a landing pad and control tower, together with other ancillary support structures), but the vast majority of the base is located beneath the Lunar surface to protect it from micro-meteoroid | one of the few craters on the Moon that was not created as a result of an impact, and is instead believed to be volcanic in origin. It lacks the raised outer rim that is typical with impact craters. Hyginus was also considered a possible landing site during the Apollo Program, because it was thought to possibly be a site of active volcanism. By convention these features are identified on lunar maps by placing the letter on the side of the crater midpoint that is closest to Hyginus. Hyginus (crater) Hyginus is a small lunar caldera located at the east | Flag (crater) Flag crater is a small crater in the Descartes Highlands of the moon visited by the astronauts of Apollo 16. The name of the crater was formally adopted by the IAU in 1973. Geology Station 1 is adjacent to Flag, at the much smaller Plum crater. On April 21, 1972, the Apollo 16 lunar module (LM) "Orion" landed about 1.5 km east of Flag, which is between the prominent North Ray and South Ray craters. The astronauts John Young and Charles Duke explored the area over the course of three EVAs using a Lunar Roving Vehicle, or rover. | Why have observers on earth never seen the craters on the back side of moon? | Impact event Moon were ascribed to volcanism. It was not until 1903–1905 that the Barringer Crater was correctly identified as an impact crater, and it was not until as recently as 1963 that research by Eugene Merle Shoemaker conclusively proved this hypothesis. The findings of late 20th-century space exploration and the work of scientists such as Shoemaker demonstrated that impact cratering was by far the most widespread geological process at work on the Solar System's solid bodies. Every surveyed solid body in the Solar System was found to be cratered, and there was no reason to believe that the Earth had somehow | crater midpoint that is closest to Cleomedes. Cleomedes (crater) Cleomedes is a prominent lunar impact crater located in the northeast part of the visible Moon, to the north of Mare Crisium. At this location, on Earth, the crater appears oval due to foreshortening, but the crater is nearly circular. It is surrounded by rough ground with multiple crater impacts. The irregular crater Tralles intrudes into the northwest rim. To the east is Delmotte. North of Cleomedes is a triple-crater formation with Burckhardt occupying the center. The outer wall of Cleomedes is heavily worn and eroded, especially along the southern part | Why might more craters be present on the far side of the moon than on the side of the moon facing earth? | What was the first foot neil armstrong put on the moon? | 11 | Clavius (crater) as a prominent notch in the terminator about 1–2 days after the Moon reaches first quarter. The crater is one of the older formations on the lunar surface and was likely formed during the Nectarian period about 4 billion years ago. Despite its age, however, the crater is relatively well-preserved. It has a relatively low outer wall in comparison to its size, and it is heavily worn and pock-marked by craterlets. The rim does not significantly overlook the surrounding terrain, making this a "walled depression". The inner surface of the rim is hilly, notched, and varies in width, with the | how long was clavius base on the moon | what shape is cleomedes crater on the moon | Stress systems in the vicinity of lunar craters | Small lunar craters at the Apollo 16 and 17 landing sites - morphology and degradation | A global inventory of lunar craters: identification, classification, and distribution | why do crater rims on the moon have greater height | why has clavibacter michiganensis been classified into other genera | LUNAR FLOOR-FRACTURED CRATERS: INTRUSION EMPLACEMENT AND ASSOCIATED GRAVITY ANOMALIES |
12 | Cirroc Lofton and Aron Eisenberg (Jake and Nog) have a podcast where they talk about DS9? | I know the "what podcasts does everyone recommend" topics come up often, so I'll apologize upfront for yet another podcast recs post. However, with a bunch of my DS9-specific podcast subscriptions coming to an end this past year (Upper Pylon 2, Reopening the Wormhole), nearing the ends of their DS9-specific run (The Pensky File), or essentially abandoned (The Orb has been a no show for pretty much the entire 25th Anniversary year, the documentary, and the passing of Aron Eisenberg), I'm looking to add in some fresh DS9-specific chat into the rotation - ideally ones that have started up recently. Any suggestions are welcome.
&#x200B;
And yes, I already have Mission Log in the rotation, although - as someone who has been listening to and enjoying Ken and John's Trek talk since it was still on Nerdist - I haven't liked their DS9 run so far so, while it'll be weird with Ken leaving, I'm looking forward to seeing how the vibe changes with the new co-host hopefully. But, as a Niner, I also don't want the lone DS9 podcast in my rotation to be one I'm just not that into. | The cold open for the DS9 episode where Jake and nog try to get Benjamin the baseball card, it’s Ben having the ops crew over for dinner and trying to talk about anything BUT the impending war, and they can’t cause nothing else is happening. It really hit me hard today, because same.
Edit : The episode title is In The Cards, I should’ve put that in the title. | I just got into this podcast, it's been both very good background noise and a very informative look into the minds of half the american voting population. But right now I'm on episode 9, the one talking about Alex's first JRE appearance, and Dan mentioned that Jones' crunken ramble about interdimensional energy vampires was lifted from an anonymous internet post, and I'm curious if anyone has tracked it down. I know I'm way late to the party here, but I like knowing where some of these crazy ideas first show up, and what they were before being filtered through the mind of Jones. | Are the commentators of Jomez Productions, specifically the guys in this ( video Chuck Bryant and Josh Clark from the Stuff You Should Know Podcast (
If not, they sure do share a lot of the same podcast personality traits. | So I figured I would watch some DS9 and then I thought...."Why not just stream it?" So I am starting with season 1 episode 5 (random I know). Come watch, I should be around for a few hours.
| Hey guys, here's an interview with Ross Atkins from TSN 1050 from yesterday, he talks about Vlad Jr, JD and Tulo. Thought I would share it with all since these are some hot topics at the moment.
I believe the Interview starts at 22:15:
| I'm trying to compile a the best 10 episodes of both for a few friends to watch, but I am unable to choose only ten especially from DS9.
Any help is greatly appreciated!! | 1999 was the last year of the 1990s as well as the penultimate year of the 20th century and the 2nd millennium.
1999 may also refer to:
NGC 1999, a dust filled bright nebula
Film, TV and entertainment
1999 (film), a 2009 Canadian crime drama film
Space: 1999, a 1975–1977 British television series
1999: Hore, Mita koto ka! Seikimatsu, a Famicom game released only in Japan
In 1999, a 1912 vaudeville sketch
Archer: 1999, the tenth season of the animated television series, Archer
Music
Albums
1999 (Prince album), 1982
1999 (Cassius album), 1999
1999 (Joey Badass album), 2012
Ratt (album), album by Ratt often referred to as "1999"
Songs
"1999" (Prince song), 1982
1999: The New Master, a 1999 EP containing remixes of the above song
"1999" (Charli XCX and Troye Sivan song), 2018
"1998" (instrumental), a track by Binary Finary also known by its remix/reissue name "1999" | 12 | It's called The 7th rule and it's fairly interesting. I've only listened to the first few, but they talk about DS9 and discovery with some guests like jg hertzler and Armin shimerman. the episodes aren't all on YouTube, so you'll have to find them on iTunes or iHeartRadio, but they provide some good banter about DS9 and disco. Might be worth a listen if you like some behind the scenes talk. | I watched the first 10 episodes of DS9 and don't know if I want to keep watching | Must see episodes of DS9 season 2. | What are the best Episode guides for TNG and DS9? | DS9 - Never Liked it? Want to Try it? Here's a minimalist ESSENTIAL episode list! | [CHAIN] TS9 into Fulltone OCD, or OCD into TS9? Seeking a John Mayer tone | when did the show the nine come back | DS9 has become my new favorite series. | Best episodes to listen to while camping in the woods? |
13 | I'm new to sashiko. When you guys are doing single rows, do you prefer to knot off each row, or do multiple rows at a time with the same thread? | If you were to do miter squares in stockinette rather than garter, would you be doing the pattern on both rows? i.e. k2tog, ssk for knit rows and p2tog, ssp for purl rows
Thanks! :] | Anglo concertina of each row are on each side. The two rows are musically a fifth apart. For example, if the row closest to the player's wrist is in the key of G, the next outer row is in the key of C below. An advantage of the Richter tuning is that pressing three adjacent notes in one row produces a major triad. Also, because the travel direction inverts as you progress up the scale, at the point where the scale crosses from one side of the concertina to the other octaves can be played in the home keys. A third row | This is so handy. I've never used one and was always ha long to go back and count my rows. This is very helpful. | I'm knitting the Jay sweater pattern.
I'm having trouble with the increase rows in the yoke, the whole row is either too tight or too loose. I really need to frog it but I was wondering if there were any tips for the increase rows? Or just for color work in a top down in general? | I just got into cross stitching a couple of weeks ago, and after doing a few tiny warm-up projects, I'm tackling this one.
The thing I've had the hardest time with is always what path to follow when stitching - where to start, which way to go, all of that (this is hard to describe!). The hardest part on this one is the half stitches.
With a full stitch, I can do a row in half stitch and cross back to the beginning, making doing rows pretty simple. But this pattern has lots of rows of half stitches, and I don't know how to handle that. Should I restart the thread with each row? Work in different directions? Hiding the thread underneath is also a big concern, as there's a lot of the aida exposed in the finished design.
Any advice would be gratefully soaked up. | Is the boarding group (6, 7, 8, etc) tied to the row #?
If you sit more in front, will you be in an earlier group? | Does anybody know how to unravel a row of double stockinette. I’ve accidentally picked up a stitch and so now my rows are out of line. Having trouble unravelling the normal way as double stockinette is almost two sheets of knitting back to back. Fairly new to knitting so need help! | I have a table that is 12 rows and 4 columns; however, I would like to add a row that is only one column (but spans the width of the table). I know it's possible but I can't seem to figure out how to do it. | 13 | Just trying to figure out the most practical way to go about this in my endeavor to learn sashiko.
Also do your approach/preferences change when it comes to cross stitches? | Question regarding Asian Stitches | Help with an Asian/Mooshu stitch | Advice on single stitches? | Shish Kabob on Stitches counteracts his entire being and turns Stitches into a detriment for his team. It is a dead talent and I think you can do something better Blizzard! (Statistics and Suggestions Included!). | Another piece of information I found out in making beautiful stitches is if you unwind the tension knob to ... | Motifs for cross stitch | Embroiderer's Handbook : The Essential Step-by-step Guide to Creative Stitches and Versatile Techniques | What knitting stitches would you recommend a beginner learns? |
14 | The region of russia known as Russia's freezer and sleeping land is? | What is the region of russia? | What country is russia was found? | What is the name of th esea that separates Russia and Japan? | What country is bigger russia or china in terms of land? | What is the name of the mountain range that seperates the european part of russia from theasian part of russia? | What are the 3 major geographic regions of siberia? | Which continent does Russia belong to? Russia is part of both Europe and Asia. | Which island is located in the arctic region but belongs to a country located outside the arctic region? | 14 | What region is known as russia's freezer? | What region is it in and what conns it to that region in russia? | Border between europe and siberia? | On Thin Ice? (Mis)Interpreting Russian Policy in the High North | How did the country Russia get its name? | What conintent is russia found? | mainly covers 'European' Russia | What is the name of the mountain range that sepsrates European part of Russia and the Asian part of Russia? | Is russia have states in it? |
15 | Horribly written and deleted it from my library post haste | The wrong folder opened when I was uploading my answers. Great way to assert dominance. Not sure how my prof's gonna like it though. | I typed a whole essay last night and saved it on onedrive. When I went back to print it today it opened the first paragraph (my first save) and said failure to upload or something. Being confused I went to the online version of the software and checked to see if all my work from last night was there. It was (*few*) so I decided to open it in word and it prompted me to update the upload. I thought "yes perfect upload and save my work, which I thought was your job to automatically do." Then like a rusted knife into my back word uploaded the first paragraph over the finished copy of the document. I was so angry I debated committing suicide and/or finding a random microsoft employee and murdering them.
Moral: OneDrive, no matter how convenient it is is still a microsoft product and will fuck up your good day any chance it gets.
This was just a rant, don't do what I said if you don't want.
Oh and it is not in the Onedrive recycling bin. I checked | I'm trying to improve my English by posting what I wrote and getting feedback from others. Could someone please proofread what I wrote?
This is a Reddit post sharing my thoughts. Nothing serious.
To make it easy to edit, I post what I wrote as a first comment. In this way, it is easy to copy and edit it. | I just started reading the physical copy of Watts's *Freeze Frame Revolution* and noticed that there's occasionally letters printed in red instead of black. Looking at the first few, it seems like they're spelling something. So, questions to anyone who's taken the time to figure out the message:
Is it something that should be done before, while or after reading the story?
Does it spoil anything?
Does jotting-it-down-as-you-read add anything to the reading experience?
Am I going to miss anything if I ignore it for now and just go back and figure it out later?
I'm NOT asking anyone to reply with the message. If you feel compelled to do so, please wrap it with a spoiler tag. | This is the third copy for my library. I keep lending this out and it never comes back. I highly recommend this along with The Unthinkable by Amanda Ripley. | HELP I [REDACTED] [REDACTED] [REDACTED] [REDACTED] poop [REDACTED] [REDACTED] [REDACTED]
I [REDACTED] have much more time | Written weird. Had to look up every other word, which is ok, but sure slowed the reading process. Still never really understood a single word it said. | Too many miscellaneous small errors. Just too many. The contents are great. | 15 | Must have been written by an 9-year old. Horribly written and deleted it from my library post haste. (No offense to 9-year olds) | a 9 year old made me read it! | We started trying to read this with my 9yr old ... | My 9 year old son begged me to read a ... | I gave this book as a gift to a 9 ... | An 8 year old's Minecraft Q&A blog - please help encourage my boy to write <3 | The quality of the writing made it sound like a 10 year old had written it | My 8 year old son read this in a day ... | Well written and Fun to read - even my 9 year old with ... |
16 | Metamaterials: A Leading Edge of Science and Technology | In this paper, we outline the background, mission, and activities of the Virtual Institute for Artificial Electromagnetic Materials and Metamaterials (METAMORPHOSE VI). This international association, founded in the framework of the FP-6 Network of Excellence METAMORPHOSE, aims at promoting and developing research, training, and dissemination activities in the emerging and highly dynamic field of advanced electromagnetic materials and metamaterials at both European and International levels. More than 300 researchers are currently associated with the METAMORPHOSE VI which networks them together in a learnt society. After a brief description of the association and its mission, we present an overview of the activities developed by the METAMORPHOSE VI, with a particular emphasis on the coordination of the European Doctoral Program on Metamaterials (EUPROMETA) and the organization of the International Congress on Advanced Electromagnetic Materials in Microwaves and Optics – metamaterials congress. | Metamaterials are artificial composite structures that lead to many exciting applications beyond nature such as imaging objects below the diffraction limit, optical clocking, sensing and communications. Traditional metamaterials are considered as “hard” materials that structural units cannot be tailored after their formation which limits their material responses and applications. It remains a critical and unsolved problem to design “soft metamaterials” that can spontaneously self-adapt to changes in the source wavelength or the environment. | Metamaterials are designed to achieve unprecedented light-matter interactions. Here we demonstrate a novel viable and scalable assembly route to optical metamaterials with structures dictated by their own light-matter interactions. |
Introduction
Metamaterials consist of artificially engineered subwavelength structures that exhibit novel properties [1][2][3][4][5][6]. Structures such as split ring resonators (SRRs) [7,8], subwavelength wires [9][10][11], and fishnets [12,13] can manipulate electromagnetic waves at optical frequencies. These artificial structures can induce electric or magnetic coupling, leading to exotic properties such as negative refractive index [4,5,7,14], perfect absorption [15][16][17][18], and hyperbolic dispersion [19,20]. Over the last two decades, optical metamaterials have enabled possibilities of invisibility cloaking [21,22], super-resolution imaging [23][24][25], and efficient energy harvesting [17,26,27]. However, the applications of conventional metamaterials are often limited due to their rigid constituent materials, which usually lack flexibility and tuning capability. Besides, they are generally not compatible with biological environments, hindering their potential applications. These issues can be addressed by the incorporation of soft materials, or the sophisticated design of metamaterials that are globally deformable.
It is well accepted that soft materials possess two significant features of complexity and flexibility [28]. The complexity arises from the complex physics behind them, while the flexibility indicates that a mild change in a soft material can lead to a dramatic response [29]. Traditional soft materials include polymers, colloidal dispersions, fluids, and liquid crystals, which are specifically suitable for flexible optoelectronics, biophotonics, and applications in aqueous and biological environments. Moreover, soft materials have several advantages: (i) Properties of soft materials can be easily tuned by external stimuli; (ii) Soft materials are usually low-cost in terms of both raw materials and processing techniques; (iii) Processing of soft materials (e.g. making a metafluid) is often simpler than fabricating a complex rigid metamaterial structure, which typically involve top-down, or high-temperature fabrication techniques. Soft materials offer great opportunities to construct optical metamaterials due to their unique light-matter interaction phenomena [30,31].
The concept of soft materials can be extended to optical metamaterials [32]. By integrating soft matters within metamaterials or designing globally deformable metamaterials, the flexibility of optical metamaterials are significantly improved. Analogous to soft materials, the properties of soft optical metamaterials are usually adaptive to the environment, and can be easily reconfigured via optical, electrical, thermal or mechanical stimuli. Processing methods of many soft optical metamaterials are simple, low-cost and scalable. Soft optical metamaterials offer cost-effective and versatile opportunities in sensing and dynamic control of optical properties. Soft matters have also been applied in other frequency range, such as infrared [33,34], acoustic [35,36], ultrasonic [37,38], microwave [39][40][41][42], and THz frequencies [43][44][45][46]. In addition, many soft mechanical metamaterials [47][48][49][50] have also been demonstrated. Their exotic mechanical properties were also attained either by integrating soft matters with metamaterial elements or the metamaterials were designed to deform with external stimuli.
Here, we review the properties, fabrication methods, and potential applications of different types of soft metamaterials in the optical frequency regime. Section 2 categorizes optical metamaterials based on their soft material constituents, including liquid crystals, fluids, polymers, and biomaterials. Section 3 discusses the use of electrical, optical, thermal and mechanical stimuli to reconfigure the optical properties of soft optical metamaterials. Finally, Sect. 4 describes common fabrication methods for soft optical metamaterials.
Soft materials in metamaterials
Most optical metamaterials consist of metallic nanostructure arrays sitting on rigid substrates. The lack of flexibility and shape constraint thus limit metamaterials' potential applications. One solution is to incorporate soft materials, such as liquid crystals, fluids, biomaterials, and polymers in metamaterials. These soft materialsbased metamaterials contain metallic nanostructures to achieve desired plasmonic responses, while soft materials contribute to deformability and tunability. Soft materialbased metamaterials offer versatile, tunable, easy processing, and adaptive characteristics for various applications.
Liquid crystals
Liquid crystals (LCs) are one of the more common soft materials applied in metamaterials. Metallic nanostructures that possess strong optical response are combined with LCs with changeable crystalline orders. In ordered LCs, the long axes of LC molecules are aligned in the same direction, and this direction vector is called a director (see vector n in Fig. 1a). By applying an external electric field, the director orientation can be changed, which modifies its refractive index (RI). The electro-optical response of LC-incorporated metamaterials enables a wide range of RI tuning from negative to zero to positive values. Two device configurations integrating LCs and metamaterial structures were proposed in early years. The first structure consisted of negative-index metamaterial (NIM) unit cells where an anisotropic LC layer was sandwiched between two silver (Ag) stripes [51]. By applying an external electric field, the RI can be reconfigured from − 1.8 to 0 in the near-infrared wavelengths. The second structure used LC cladding layers to cover an Ag NIM [52]. By electrically altering the LC's permeability from 2 to 6, the RI of this LC-cladded NIM can be tuned from − 1 to + 1.8, as shown in Fig. 1b. Such a large range of RI tuning can hardly be achieved with conventional metamaterials whose properties are fixed upon fabrication.
LC-incorporated metamaterials often utilize LCs in the nematic phase, where the LC molecules are arranged with their long axis parallel to each other without a specific positional order (see the alignment of LC molecules in Fig. 1a). LCs were later incorporated in the fishnet metamaterial structures [53]. Experiments showed that by infiltrating nematic liquid crystals (NLCs) into the air region of fishnet metamaterials, the RI of the combined metamaterial can be tuned from − 2 to + 2 due to the reorientation of LC directors. Besides, NLC-infiltrated fishnet metamaterials can also show a nonlinear optical response, where the nonlinear transmission can be altered with different biased voltages [54].
An alternative way to realize LC-based optical metamaterials is by dispersing metallic nanostructures within the LC. For instance, a nematic LC with dispersed coreshell metallic nanoparticles (NPs) is shown to achieve a tunable RI from − 1 to 1 [55]. A smectic LC-gold nanospheres composite metamaterial is also feasible for tuning optical properties under external voltages [56]. In the smectic phase, LC molecules not only point to the same direction, but they also align with each other to form 'layers' . Thus, the stability of NP dispersions in smectic LC can be enhanced, and the aggregations of the metallic NPs around the molecules are precluded, rendering it more useful for practical applications [57]. While LCintegrated metamaterials enable exotic optical properties and tuning capability, the interaction between LC molecules and plasmonic nanostructures should be carefully considered in design [58]. Their interaction can diminish the birefringence of LCs and lower the tuning range, a problem that needs to be addressed for practical use of LC-incorporated metamaterials.
Metafluid
Analogous to the terms "metamaterial" and "metasurface", metafluid is a fluidic solution containing subwavelength nanostructures to attain unconventional bulk optical properties. The term 'metafluid' was first introduced by Urzhumov et al. [59]. In this theoretical work, they proposed to disperse tetrahedrally arranged clusters of gold artificial plasmonic molecules, named tetramer, in a colloidal solution. They showed that the colloidal solution could possess very large, small, or even negative permittivity values. Since then, many efforts have been taken to introduce different nanostructures in colloidal solutions, including gold (Au) and silver nanospheres arranging in tetrahedral, octahedral, icosahedral, and raspberry configurations [60][61][62][63]. Kubo et al. developed an n-dodecane solution with dispersed alkanethiolcapped gold NPs [64]. The solution demonstrated a tunable RI in visible and near-infrared wavelengths by controlling the volume fraction of the gold NPs. Such fluidic metamaterials have the advantage of being lowcost and scalable, since solution-based processing is usually easier and cheaper to fabricate than rigid solid-state metamaterials.
In recent years, more studies have been focused on investigating different constituent of metafluids to extend their applications. For example, silver nanoparticles (AgNP) that are packed around polystyrene cores in a fluid solution (as illustrated in Fig. 1c) can exhibit a strong magnetic response [65]. The magnetic dipole scattering from this metafluid is 12% of the strength of electric dipole scattering, and more than one order of magnitude higher than a control sample based on unpacked AgNPs. Negative permeability from − 1 to 0 in the visible region can also be achieved by adjusting the packing ratio. Yang et al. developed a metafluid that has a tunable narrow (~ 100 nm) transparency window within a broadband absorption spanning 200-3300 nm wavelength range, as shown in Fig. 1d [66]. This was made possible by integrating both excitonic (boron-doped silicon nanocrystals, SiNC) and plasmonic materials (gold nanorods, AuNRs) in a colloidal solution. Five types of AuNRs with different geometries combine to produce the narrow transparency window, while the boron-doped SiNC functions as an optical absorber in the ultraviolet and blue-green ranges, and water absorbs in the near-infrared regime. Kim et al. studied the effective refractive index of AuNP metafluids [67]. By considering close-packed and high-volume-factor metamolecules, they discovered that AuNP metafluids could achieve near-zero refractive index and ultrahigh refractive index up to n eff = 10 in the visible wavelengths. A colloidal Au nanocube assembly has also shown a high RI of ~ 6.4 at NIR region [68]. In a separate work, Cho et al. developed an all-dielectric optical metafluid using selenium (Se) colloids, where an efficient coupling between its electric and magnetic resonances led to a Kerker-type directional light scattering [69]. The Se colloid metafluid could be used as a generic magnetodielectric building block for fluidic low-loss optical antennas. The same group later synthesized gram-scale and highly-uniform Se metafluids and colloids, which exhibited directional scattering, magnetic resonance, and magnetodielectric bandgaps [70]. Remarkably, colloidal Se metamolecules achieved magnetic resonances with highly uniform nano-sized gaps. In essence, metafluids allow the use of different constituent plasmonic materials to engineer a wide range of optical properties. Such solution-based soft metafluids also break the conventional space and shape constraints, enabling versatile metamaterials with many interesting applications such as adjustable optical filters, optical microfluidic cells, and working fluids in solar-thermal systems.
Biomaterials
Biomaterials are natural or engineered materials that are compatible with bio-environments. Natural biomaterials from biological tissues and biomacromolecules, such as protein and DNA, are usually soft in texture, transparent, low-cost, and interactive with biological systems. In addition, biomaterials contain sophisticated structures with excellent responsivity, making them useful for biomedical device applications, such as bio-sensing and telemedicine. Recently, biomaterials have also been integrated with optical metamaterials, offering the advantages in terms of cost, tunability, and biocompatibility.
Silk protein is one notable biomaterial with large mechanical tunability and elastomeric properties [71]. Silk protein has been used to create a biocompatible sensing metamaterial, as illustrated in Fig. 1e [72]. The silk plasmonic absorber sensor (SPAS) utilized the local field enhancement (from localized surface plasmon resonance, LSPR) of the metal-silk protein insulator-metal layer, which is analogous to the conventional metalinsulator-metal (MIM) structure. Since silk protein has hydrophilic properties, it exhibits a controllable swelling when immersed in water-alcohol mixtures. The swelling of silk protein leads to resonance shift in the reflection spectrum of the SPAS metamaterial, as shown in Fig. 1f. The amount of resonance shift also depends strongly on the RI of the environment, making SPAS a good RI sensor with a high sensing figure of merit (FOM) up to 1200 nm/RIU (refractive index units).
A hybrid structure consisted of silk protein and AuNPembedded zinc oxide nanorod arrays also demonstrates superior mechanical flexibility [73]. Remarkably, its optoelectronic properties remain unchanged when it undergoes bending or stretching, making it a robust biocompatible photodetector. A silk protein MIM structure can also be used as a chemically-tunable optical resonator for pH value sensing [74]. Its resonance is red shifted when swelling, and the swelling can be controlled by environmental stimuli such as the pH value and alcohol concentration.
As biomaterials are active in nature and can facilitate self-assembly of complex structures, biomaterials are also used as building blocks of chiral metamaterials. A DNA-based self-assembly of Au nanoparticles has been demonstrated [75]. The Au nanoparticles were arranged in helices around a DNA origami to form a chiral metamaterial with high precision. The soft assembly enabled chiral responses that were tunable in handedness, color and intensity. Chiral metamaterials composed of DNA origamis attached with arranged plasmonic nanoparticles has been fabricated [76]. By adding or removing phosphate-buffered saline buffers to the environment of the chiral metamaterials, the alignment and orientation of the DNA plasmonic metamolecules could be changed. The changes of DNA alignment and orientation in turn switched the chiral responses of the metamaterial. DNAs also enabled reconfigurable three-dimensional (3D) chiral metamaterials [77]. Here, DNA functioned both as the guide for the self-assembly of the 3D metamaterial, and the building block that enabled the reconfigurability. By adding or removing a strand of DNA, the handedness of the chiral metamaterial could be switched. Amino acid and peptide have also been used to direct the synthesis of chiral AuNPs to fabricate highly twisted nanoparticles [78]. These biomolecule-directed helical nanoparticles display a strong chiral optical activity with a dissymmetry factor of 0.2. A silk fibroin thin film is also employed as a spacer layer to enable tunable circular dichroism (CD) signals in an active plasmonic chiral metamaterial [79]. Bioinspired and biomimetic intramolecular synthesis has been widely employed to fabricate chiral metamaterials [80]. Biomaterial based metamaterials thus provide the opportunities to produce cost-effective, bio-compatible, and mechanically flexible devices such as bio-sensors, soft photodetectors, and chiral molecules.
Polymers
Flexible optical metamaterials are often realized through the use of deformable substrates that are mainly composed of polymers. Polymer-based metamaterials are versatile and low-cost, as they can be easily processed via spin-coating, thermal curing, and well-established microfabrication techniques. Among them, poly-dimethyl-siloxane (PDMS) is a popular choice. As a soft polymer, PDMS can be easily integrated with nonplanar structures and enables direct pattern transfer, benefiting from its low surface energy. The elastic nature of PDMS and its transparency make it a good candidate to realize a deformable metamaterial over a broad optical bandwidth. Chanda et al. fabricated a large-area (8.7 cm × 8.7 cm) bendable NIM on a PDMS polymer substrate, as shown in Fig. 2a [81]. The metamaterial displays negative refractive indices in the NIR wavelength range, as shown in Fig. 2b. Similarly, a nanoimprinted large-area NIM on a PDMS substrate can be engineered to show negative RI in visible wavelength regime [82]. A mechanically tunable titanium dioxide (TiO 2 ) dielectric resonator metasurface on a PDMS substrate has also demonstrated straindependent transmission spectra [83]. Other PDMS-based optical metamaterials include highly compliant metamaterials with large frequency tunability (~ 400 nm) at NIR range [85], and high-performance surface enhanced Raman scattering (SERS) devices [86].
Polyimide is also widely used as the substrate for metamaterials. Choi et al. demonstrated a flexible metamaterial supported with polyimide layers instead of the more rigid oxide layers [87]. The soft polyimide layers make the fabrication of NIM metamaterial easier, without complicated backside etching. SU-8 is another candidate for the substrate of flexible metamaterials. Falco et al. fabricated nano-antennas and fishnet metamaterials on SU-8 layers, as shown in Fig. 2c [88]. The same group then studied the influence of mechanical deformation on the optical behavior of metamaterials [89,90]. While some might think that the deformation will always change the properties of metamaterials, they found that the resonant effect is invariant to bending but dependent on the stretching of the flexible metamaterial, as shown in Fig. 2d. Poly(ethylene naphthalate) (PEN) has also been employed as a soft substrate. Xu et al. fabricated a PENbased Au SRR metamaterial (Fig. 2e) operating at visible and NIR wavelength ranges [91]. Its electrical and magnetic responses are highly sensitive to out-of-plane bending strain, as shown in Fig. 2f. Other than the aforementioned materials, flexible metamaterials have also been fabricated on a polystyrene substrate [92].
Comparing with rigid optical metamaterials, flexible optical metamaterials benefit from their deformability and elasticity, and consequently broaden its functionality in sensing, energy harvesting, large-area cloaking, and beamed light control. For instance, one can tune the resonance frequencies of a PDMS-based SRR metamaterial by varying the stretching force on the metamaterial [85]. Fano resonance frequencies can also be tuned by stretching a metamaterial consisted of Au heptamers on top of a PDMS substrate [93]. Aksu et al. showed that by attaching a layer of highly stretchable low density polyethylene (LDPE) under the PDMS and Au nanorod layers, there could be a resonance peak shift up to 160 nm [94]. Soft polymers enable flexible optical metamaterials with new capabilities, such as negative refractive index [82,87,95], nonplanar SERS detectors [86,92] and molecular sensing [91,92,96].
Reconfigurable soft optical metamaterials
To attain dynamic control and a larger tuning range of the soft metamaterials' exotic optical properties, soft and active materials are often used. Optical, electrical, thermal and mechanical stimuli are commonly applied on these materials to fully tune their properties, which constitutes a new family of soft metamaterials that is reconfigurable. This provides new degrees of freedom to achieve desired control capabilities such as dynamic tuning, optical switching, and ultrafast electro-optical modulation for optical computing and communication.
Optically reconfigurable soft metamaterials
Optically reconfigurable soft metamaterials are typically enabled by active constituents, such as polymers that are highly sensitive to optical excitation. For instance, certain soft polymers undergo a photoisomerization state transition (where the isomers experience structural changes) upon optical illumination. The resulting RI or molecular polarizability changes motivate the use of such polymers as the active layer around the metamaterial structures. Ren et al. reported a reconfigurable metasurface that enabled polarization tuning at optical frequencies by incorporating a photoisomerizable ethyl red layer, as shown in Fig. 3a [97]. The polarization tuning was achieved via optical excitation to switch the coupling condition between the plasmonic modes and the binary isomeric states of the ethyl red layer. The azimuthal angle of the elliptical polarization formed by the metasurface shifted 20° under a moderate switching light power of 4 mW, as shown in Fig. 3b. Azobenzene, a photo-responsive aryl azo compound, has also shown polarization switching capability [98]. Upon irradiation by a linearly polarized light, the isomers would vertically orient with the electric field direction after a series of trans-cis-trans state transitions. When an azobenzene layer was spin-coated on an Au nanohole metamaterial, cross polarization conversion effect is observed. An Au nanocluster metafluid in azobenzene cationic surfactants has demonstrated optically tunable plasmonic responses [99]. By illuminating with ultraviolet light, azobenzene undergoes trans-cis state transitions. The absorption peak of the AuNP metafluid thus red-shifted by 200 nm with a noticeable metafluid color change. Soft polymer constituents integrated with metamaterial structures enable intense tuning of optical properties under a moderate optical input and facilitate highly compact optical modulating devices as compared to regular tunable metamaterials.
Light can also induce global shape or geometry changes that modify the optical properties of a metamaterial. A good example is the realization of a plasmonic nanomechanical metamaterial consisting of gold stripes and silicon nitride (Si 3 N 4 ) layers [100]. Due to the difference in coefficient of thermal expansion (CTE) between the Au and Si 3 N 4 layers, incident light causes a bimorph deformation that changes the plasmonic resonance, enabling reversible modulation of the metamaterial's transmissivity. The induced electromagnetic forces between the plasmonic nanostructures also give rise to giant optical nonlinearity. The combined tuning speed and optical nonlinearity compare favorably with other nonlinear optical materials. Without the subwavelength nanostructures and the designed soft system, the nonlinear response would have been moderate and lacks reconfigurability.
Electrically reconfigurable soft metamaterials
Electrical control of optical properties in metamaterials relies on the voltage-induced changes in their molecular alignment and mechanical structure. Electrically reconfiguring with LCs are based on the realignment of LC molecules under an applied voltage. Early studies showed that by embedding gold nanoparticles [101] or nanorods [102] in LCs or simply placing a LC layer on top of a gold nanorods array [103], the peak of plasmon resonance can be shifted with an external bias, which changes the absorption and transmission spectra. Plasmonic metasurfaces incorporating LCs are also shown to achieve tunable color generation and filters in the visible wavelengths [104]. Electrically-induced reorientation of LC molecules can alter the effective RI of a LC-metasurface, and in turn changes the surface plasmon resonance peak and results in a distinct color tuning. Similarly, LCs are also employed to reconfigure the optical properties of a Mie-resonant all-dielectric metasurface consisted of silicon nanodisks [105]. Recently, an electrically switchable metamaterial color tag based on LCs has shown the capability to continuously control the color (wavelength) of transmitted light under a low applied voltage. 100 nm of wavelength change has been achieved with 0-5 V applied voltage [106]. External voltage can also control the beam bending direction of dielectric metasurfaces when the metasurfaces are incorporated in LCs [107]. An active metasurface spatial light modulator (SLM) with high resolution and efficiency has been achieved. Inclusions of LCs have also enabled electrically tunable color filtering of plasmonic nanohole arrays [108] and visible light modulation of TiO 2 metasurfaces [109]. These works demonstrate LC-metamaterials' potentials for high-resolution color printing, holograms, and dynamic displays.
Apart from LCs, several electrochromic soft polymers, whose optical properties can be changed when applying external voltage, have also been used as active media in electrically reconfigurable soft metamaterials. Peng et al. coated a thin layer of electrochromic polyaniline (PANI) on the AuNPs to realize a nanoparticle-on-mirror (NPoM) metamaterial, as shown in Fig. 3c [110]. An external voltage can change PANI's RI up to Δn = 0.6 due to the oxidization of PANI to PANI 2+ . The scalable soft NPoM metamaterial, demonstrates a continuous color switching of Δλ = 79 nm when the voltage is applied from − 0.3 to 0.8 V, as shown in Fig. 3d. Polystyrene (PS) has also been used as an electrochromic polymer in an Ag MIM nanohole metamaterial [111]. Here, a layer of PS is coated on an Ag-SiO2-Ag nanohole array to function as the active medium for electrical tuning due to the redox process of PS. A surface plasmon resonance (SPR) shift of 72 nm in NIR region has been achieved with applied voltages from 0 to 0.8 V. Electrochromic polymers serving as the active media enable high-sensitivity, large-range reconfiguration of scalable soft optical metamaterials.
Electrically reconfiguring of optical properties can be achieved using the electromechanical effects in a soft metamaterial system, for instance via electrostatic force actuation. Ou et al. showed an electromechanically reconfigurable metamaterial that is made of alternating meander-wire structures on flexible dielectric strings [112]. When a voltage is applied, the meanders and wires will move closer to each other, dramatically changing the transmission and reflection spectrum. This soft metamaterial offers a gigantic electro-optic response (10 −5 -10 −6 mV −1 ), allowing fast and reversible tuning of optical properties and low-energy, high-contrast non-volatile switching. Another electrically reconfigurable chevron nanowire array metamaterial on an elastic nanomembrane has also been demonstrated [113]. The metamaterial can be reconfigured by the Lorentz force generated from external electric and magnetic fields. The optical property changes as a result of Joule heating and the magneto-electro-optical effect. Reversible transmission tuning has been achieved in this metamaterial, which is promising for nano-tesla level field sensing and magneto-electro-optical modulation. Au meander-wire metamaterials on a flexible PDMS substrate can also be reconfigured by electro-thermo-mechanical effects [114]. By electron injection into the PDMS substrate, the induced heating effect results in the deformation of the PDMS substrate that changes the separation between the meander and the wire. A blue shift of the plasmon resonance frequency is observed at the NIR region. Piezoelectric effects of polymers have also been employed to electrically tune metamaterials. By depositing Ag on a patterned piezoelectric polymer polyvinylidene fluoride (PVDF), the Ag cluster metamaterial would change its shape due to the stretching of the PVDF substrate under external voltage [115]. The Ag cluster soft metamaterial demonstrated an LSPR shift of 100 nm under a moderate electric field intensity of 0.6 V μm −1 for 30 s. Arbabi et al. demonstrated a MEMS-tunable silicon metalens with a fast scanning frequency reaching up to kHz range [116]. This tunable metalens has potential in constructing a high field of view with a fast axial scanning capability. Electrical tuning combined with mechanical, thermal and magnetic effects enables fast, reversible and non-volatile reconfiguration of soft optical metamaterials.
Thermally reconfigurable soft metamaterials
Optical metamaterials have also been reconfigured by thermal stimuli. Thermally reconfigurable metamaterials typically rely on two mechanisms. First, the difference in CTE between two attached constituents in a metamaterial allows the use of temperature to cause deformation, which leads to a change in optical properties. Second, certain materials have temperature-dependent molecules or phases, such as LCs, and shape memory alloys (SMAs). Thermally reconfigurable metamaterials can be achieved by integrating these soft and thermally responsive materials with plasmonic nanostructures. Taking advantage of the materials' CTE difference, Ou et al. patterned Au slit SRRs on silicon nitride (Si 3 N 4 ) to form bilayer membranes that can bend by either heating or cooling [117]. The bending deformation will change the coupling between neighboring plasmonic structures and enable reversible and large-range tuning of the metamaterial's transmission up to 50%.
LCs can change from an ordered phase to an isotropic phase when the ambient temperature reaches a critical value. This characteristic has been employed to thermally reconfigure metamaterials, as LCs exhibit different optical properties for different phases. Xiao et al. demonstrated a thermally tunable negative permeability optical metamaterial [118]. By covering coupled plasmonic nanostrips with a NLC layer, a magnetic resonance shift from 650 to 632 nm is achieved with the ambient temperature rising from 20 to 50 °C. Similarly, a Mie-resonant dielectric metasurface has been tuned using thermal stimuli, as shown in Fig. 3e [119]. The dielectric metasurface is embedded in an LC cell on a fluorescent glass substrate. By heating up the structure (comprised of a Si nanodisk metasurface and NLCs) over a critical temperature T c = 58 °C, the spectral response of the metasurface is shifted, and in turn changes the spontaneous emission of the fluorescent substrate, as shown in Fig. 3f. Active thermal tuning and switching of all-dielectric metasurfaces has also been achieved with the use of NLCs [120,121]. Efficient dynamic switching of laser beam angle from 0° to 12° is achieved when the LC-incorporated metamaterial is heated up to 60 °C [120]. Lewandowski et al. demonstrated a self-assembled AgNP-LC hybrid metamaterial [122]. The AgNP-LC hybrid is aligned in a lamellar pattern at a low temperature (< 70 °C), but upon heating at 95 °C the hybrid becomes isotropically distributed. The metamaterial shows different refractive indices in lamellar and isotropic phases, which enables direct tuning of optical properties such as extinction and transmission.
SMA is a phase change material that can be thermally activated. Having SMAs integrated with metamaterials would facilitate rewritable function, i.e. the ability to configure the metamaterial at its initial state, even after rounds of reconfiguring. Tsuruta et al. presented the first SMA optical metamaterial, whose structure consists of Au etched-in nanostructures sitting on a CuAlNi SMA layer, with a suspended membrane beneath it [123]. When temperature changes, the phase transition of the SMA as well as the CTE difference between the different layers drive the metamaterial to deform. Remarkably, the optical properties of this deformable metamaterial depend not only on the current temperature, but also the temperature history. In [123], the metamaterial is found to be 14% more transparent after cooling to 150 °C, than having been heated to 150 °C. More recently, Nagasaki et al. reported a plasmonic metamaterial based on a goldcoated array of NiTi shape memory nanowires [124]. The hysteretic phase transition (between martensite and austenite states) results in a hysteresis reflection spectrum with 12% difference in reflectivity at the same temperature, depending on whether it has been cooled or heated. Such unique properties cannot be easily attained in conventional metamaterials, rendering SMA-based metamaterials useful for non-volatile switching. The next challenge is to demonstrate even more dramatic shape-changing effect and integration of the SMA with spatially-varying nanostructures to realize functional metasurface optical devices.
Mechanically reconfigurable soft metamaterials
Mechanical stress and strain can serve as the stimuli to reconfigure the optical properties of metamaterials, especially with the use of soft elastomeric substrates. Huang et al. demonstrated an actively tunable Au dimer plasmonic structure on a elastomeric acrylic substrate [125]. When the metamaterial is being stretched, the surface plasmon response changes accordingly. PDMS is another common soft substrate owing to its elastomeric behavior, low-cost, easy fabrication, and favorable optical properties (such as transparency). Liu et al. fabricated a twolayered Au nanoribbon array on a PDMS substrate and stretched it to tune the surface plasmon resonance [126]. Similarly, an Au heptamers array fabricated on PDMS can have its Fano resonance mechanically tuned [93]. This is attributed to the stress-induced optical modes interaction when the distance between adjacent heptamers (and neighboring structures) are varied. A mechanically reconfigurable all-dielectric metamaterial based on TiO 2 nanodisk has also been realized on a PDMS substrate [83]. An Au nanorod array embedded in PDMS has also shown reversibly tunable reflection by stretching [127]. Remarkably, the reflection resonance showed ultrasensitive tunability, achieving 48 nm resonance wavelength shift per 1% external strain. Recently, a gold Fano-enhanced metamaterial embedded in PDMS shows reversible CD signals when pressing and releasing the metamaterial with a fiber tip [128].
More recently, researchers explore the use of mechanical stimuli on soft metasurfaces to achieve novel optical functionalities. Tseng et al. developed a new fabrication recipe to pattern and transfer fine aluminum nanostructures on a PDMS substrate and demonstrated a stretchable color display [129]. Remarkably, the displayed color can be tuned to span the entire visible spectrum and produce more vivid colors than the standard red-greenblue (sRGB) color gamut. By introducing spatially-varying Au nanorods (with different orientation to control the phase distribution) on a PDMS substrate, a metasurface lens with a mechanically tunable focal length is demonstrated, as shown in Fig. 3g [130]. The focal length of the metalens can be continuously tuned from 150 µm to 250 µm at 632.8 nm wavelength when the stretching ratio increases from 0 to 30%, as shown in Fig. 3h. Later a dielectric metalens consisted of silicon nanoposts encapsulated in a PDMS layer is also realized, showing an even larger focal length tuning range from 600 µm to 1400 µm at 915 nm wavelength [131]. Malek et al. carefully engineered the position-dependent orientation angle of the AuNRs on a PDMS to build a metasurface hologram that is fully reconfigurable [132]. Three distinctly different holographic images can be switched upon stretching the device. These mechanically reconfigurable metamaterials pave the way for next-generation flexible photonic displays and reconfigurable optical communication devices.
Fabrication of soft metamaterials
The fast development of soft metamaterials greatly benefits from recent advances in micro/nanofabrication technologies. This is especially so for optical metamaterials, because their component feature size is considerably smaller than microwave and terahertz metamaterials that operate at longer wavelength ranges. The fabrication techniques for soft metamaterials include standard topdown and bottom-up approaches, and non-conventional nanolithography techniques. Herein, we aim to highlight some of representative fabrication processes to realize soft optical metamaterials.
Conventional top-down approaches
Top-down nanofabrication techniques, such as physical vapor deposition (PVD), chemical vapor deposition (CVD), reactive ion etching (RIE), electron beam lithography (EBL), focused ion beam (FIB) lithography are widely used to fabricate optical metamaterials. Most of the work covered in this review article (from soft material based metamaterials to reconfigurable metamaterials) are realized using these top-down techniques.
Unlike conventional materials, soft materials or systems are usually deformable, non-conductive, and sensitive to environments (such as high temperature, chemical attack, and mechanical stress), which poses certain challenges to top-down fabrication processes. For example, in EBL, during the release of the soft membrane from the host substrate, lift-off processes suffer from the collapsed and bended membrane. The region of the soft membrane that has already been lifted off will deform and become in contact with the substrate again, blocking more solution from infiltrating for further releasing. To solve the 'bending membrane' problem, a sacrificial layer method is a good alternative for releasing the soft metamaterial. Di Falco et al. fabricated a flexible Au metamaterial on a soft SU-8 substrate using EBL, with the assist of a releasing sacrificial layer (XP-SU8), as shown in Fig. 4a [89]. They firstly spun the sacrificial layer onto the host substrate before spinning the soft SU-8 membrane. After the EBL patterning processes, SU-8 based metamaterial is released from the host substrate by immersing in N-methylpirrolydone (NMP). Besides, some soft substrates, such as PDMS, suffer from low stability under electron beam, which impedes the direct patterning of nanostructures using EBL. A simple alternative approach is to employ a sacrificial layer-assisted transfer method. Wen et al. firstly spun-coated a Ni sacrificial layer on a stiff SiO 2 substrate [86]. Standard EBL is then preformed to fabricate Au SRRs on the Ni-coated SiO 2 substrate. Then, the nanostructure is coated with a soft PDMS layer. With the presence of water, Ni layer can be readily separated from SiO2, only leaving Au SRRs embedded in PDMS. A similar approach was carried out by Kamali et al. for a PDMS-based a-Si flexible metasurface [133]. A germanium sacrificial layer was employed between the PDMS membrane and Si host substrate. After patterning, the soft metasurface is released by immersion in a diluted ammonia solution to dissolve the germanium layer. This simple transfer method involving a sacrificial layer can be effectively applied in the fabrication of soft metamaterials.
On non-conductive substrates, EBL processes suffer from poor structure quality due to the charging effect in the substrates. This problem is detrimental to several polymers based soft metamaterial structures fabricated from EBL. To address the problem, a conducting layer, such as indium tin oxide (ITO) or thin metal, can be deposited underneath the e-beam resist before standard (See figure on next page.) Fig. 4 Fabrication methods of soft optical metamaterials. a An illustration of the direct top-down patterning of an SU-8 based metamaterial with a sacrificial layer. After the patterning, SU-8-based Au soft metamaterial can be realized by releasing the sacrificial layer. b A PDMS-based flexible metamaterial fabricated by stencil lithography. First, a stencil is made and placed above the PDMS substrate with a precise control of the gap distance. Then, gold is deposited through the stencil onto the substrate, forming bowtie nanostructures. c Nanoimprint lithography for fabricating a large-area PDMS-based flexible metamaterial. First, a stamp consists of silicon wafers is 'inked' . Then, the stamp is contacted against a target PDMS substrate. Finally, residual material on the stamp is removed to prepare for re-usage. d A protein-assisted self-assembly process to fabricate an AgNP-polystyrene metafluid. AgNPs are first functionalized with biotin terminated ligands (i), and then mixed with a high ionic solution of streptavidin-coated polystyrene NPs (ii) to form a metafluid consisting AgNP-polystyrene metamolecules (iii). Here, the highly specific chemical recognition between protein streptavidin and biotin ligands ensures the AgNPs to be closed packed around the polystyrene NPs. e Schematic illustration of DNA-programmable nanoparticle crystallization where the length of the linker strands can be tuned by increasing the value of n. DSP refers to the cyclic dithiol. a Reprinted with permission from [89], Copyright (2011) AIP Publishing LLC. b Reprinted with permission from [94], Copyright (2011) Wiley-VCH. c Reprinted with permission from [81], Copyright (2011) Nature Publishing Group. d Reprinted with permission from [65], Copyright (2013) ACS Publications. e Reprinted with permission from [143], Copyright (2013) Wiley-VCH EBL processes. Xu et al. fabricated an Au SRR flexible metamaterial on a non-conductive PEN substrate [91]. Before spin-coating a PMMA e-beam resist on the substrate, they first sputtered an ITO layer to decrease the charging effect. Standard EBL is then conducted to fabricate the flexible metamaterial. In addition, conventional top-down approaches have difficulties in integrating SMAs. Therefore, the fabrication of SMA-based reconfigurable metamaterials usually involves delicate co-sputtering technique and fine tuning of process parameters to achieve the correct composition. Nagasaki et al. carefully fabricated a NiTi SMA nanowire metamaterial [124]. The NiTi layer was deposited by co-sputtering with NiTi and Ni targets. Parameters such as base and working pressures, argon gas flow rate, target-substrate distance, deposition rate were optimized to get the SMA film of the desired thickness and composition.
Stencil lithography and nanoimprint lithography
Stencil lithography (SL, also known as shadow mask lithography) is another technique commonly employed in the fabrication of soft metamaterials. In SL, a stencil mask is first prepared with etch-through patterns. Then, the stencil mask is used in conjunction with deposition so that only a desired pattern of evaporated material is formed on the substrate. Since there is no direct EBL, exposure on the soft material is eliminated, and charging effects and high energy electron beam-resulted damage can be avoided. Aksu et al. demonstrated a high resolution fabrication method based on SL to create nanopatterns onto flexible substrates, as shown in Fig. 4b [94]. They minimized the stencil-substrate distance and thus minimized diffusion and shadowing problems arising from the gap. The resolution of SL could be as small as 10 nm. Vazquez-Mena et al. successfully fabricated Au and Al nanodots of 20 nm in size by SL on different polymers, including polyimide, SU-8, PDMS and parylene substrates [134]. There are several advantages of using SL for the fabrication of soft metamaterials. First, in SL, thin films can be deposited through the stencil on any planar and nonplanar surfaces. Since soft metamaterials are often employed on nonplanar devices, SL is very suitable for soft metamaterials. Second, the stencil is not in contact with the substrate in SL. Therefore, the lift-off process, which might be problematic for soft substrates, is no longer needed in SL. Besides, since SL is a one-step deposition method, no e-beam resist is needed on the soft substrate, thus avoiding possible material diffusion and contamination issues. However, it is difficult to employ SL for fabricating multi-layer 3D metamaterials, as it requires precise position control of each mask membrane, so that layers can align well with each other. Besides, if the stencil mask is re-used, the hole size will deteriorate, because the deposition of the material can close in at around the edge of the stencil membrane.
Nanoimprinting lithography (NIL) is a replication process using a mold or a stamp to create nanostructures. NIL has the advantages of being low-cost, simple and yet producing high resolution structures [135]. NIL enables high-speed patterning, thus allowing scale up of large-area soft optical metamaterials. Similar to SL, NIL can also be performed on unconventional, non-rigid substrates, which makes NIL particularly suitable for soft metamaterials. Chanda et al. successfully realized a flexible large-area optical NIM using the nanoimprinting method [81]. This nanoimprinting method mainly consists of four steps, as shown in Fig. 4c: (1) Pattern a silicon stamp using soft imprint lithography combined with RIE; (2) 'inking' the silicon stamp by electron beam deposition; (3) contacting the stamp against a PDMS substrate to pattern a layer of the desired structure by transferring the deposited material on the elevated regions of the stamp; (4) removing the residual of the deposited materials on the stamp and preparing the stamp for re-usage. In their work, they fabricated 11 layers (one Ag layer on top of five repeats of MgF 2 /Ag layers) on a flexible PDMS substrate. They created many stamps using a single mold, and each stamp was re-used for multiple times. Each unit cell could be printed in a short time of ~ 2.5 s (~ 10 8 times faster than FIB), making time-efficient manufacturing of large-area flexible metamaterials possible.
Soft lithography is similar to the conventional NIL, but instead of using rigid stamps, it utilizes a soft material, usually PDMS, as the printing stamp. The primary advantage of utilizing soft lithography is that the soft stamp allows an initial contact between the stamp surface and substrate even when the substrate surface is non-planar. This feature provides more flexibility to NIL and the fabrication of soft metamaterials. PDMS is usually chosen as the stamp material, because it is elastomeric, easy to contact and peel off, resistant to many acids, and optically transparent down to wavelength of 300 nm (thus can be used for UV-curing imprint). PDMS soft lithography has been employed to fabricate Ag anode-coated polymer metamaterial solar cells [84]. A PDMS mold, which was previously prepared by a Si master, inscribed desired patterns of recessed areas on the active layer of the solar cell via contact pressing. After removing the PDMS mold, MoO 3 and Au layers were thermally deposited to the patterns to form a metamaterial solar cell. Large-area 3D soft multilayer NIMs have also been achieved using PDMS soft lithography in conjunction with a subtractive lift-off process [82]. First, a liquid prepolymer was dropcast on the substrate. The inversed pattern of the NIM is then formed by pressing a prepared PDMS mold against the prepolymer and the subsequent curing to form a solid scaffold. After lifting off the PDMS mold, alternating layers of Ag and MgF 2 were deposited, forming an NIM on the prepolymer scaffold. The PDMS mold is then removed by a subtractive lift-off process. The NIM metamaterial is then formed after removing the scaffold.
Bottom-up approaches and solution processing
Soft optical metamaterials significantly benefit from the advancement in solution-based processing and bottomup self-assembly methods. Self-assembly is not restrained by the limitation of tools and patterning techniques. Instead, self-assembly takes place at the molecular level, enabling the creation of structures at least an order of magnitude smaller than the feature size attainable with top-down methods. Besides, solution or colloid based self-assembly is usually much cheaper and scalable to macroscopic volumes. Furthermore, solution and colloidbased processing is naturally beneficial for integrating multiple constituents to create soft optical metamaterials. Typically, self-assembly processes have to be guided by templates, which can be nanostructures or molecular structures such as liquid crystal, DNA, and protein. The feasibility of realizing isotropic magnetic-based plasmonic effects [136] and plasmonic nanoparticle superlattices as magnetic metamaterials [137] by self-assembly has been studied. Recently, self-assembly is designed to enable colloidal plasmonic superlattices for unnaturally high RI [138], AuNP monolayer as magnetic mirrors for graphene optoelectronics [139], and AuNP dispersion for increasing perovskite solar cell efficiencies [140].
LCs are great candidates as the guide for self-assembly of reconfigurable optical metamaterials because LC molecules can mediate the alignment and aggregation of NPs due to the anisotropy of mesogenic ligands. Gardner et al. showed that by controlling the orientation of the LC molecules, they attained different NPs arrangement and reconfigure the optical properties of the metamaterials formed [141]. On the other hand, a metafluid exhibiting strong optical magnetism was realized by protein-assisted self-assembly colloidal synthesis [65], as shown in Fig. 4d. AgNPs are first functionalized with biotin terminated ligands, and then mixed with a high ionic solution of streptavidin-coated polystyrene NPs to form a metafluid consisting of AgNP-polystyrene metamolecules. Here, the highly specific chemical recognition between protein streptavidin and biotin ligands ensures the AgNPs to be closely packed around the polystyrene NPs. Similarly, a LC-coated AgNP hybrid metamaterial has been fabricated by the ligand exchange reaction [122]. Poly(ethyleneglycol) polymer has been employed as the media to facilitate the self-assembly of silica-core gold-shell metamaterials [142]. Scalable manufacturing of metamaterials can be enabled by self-assembly. A centimeter-scale electrically reconfigurable soft NPoM metamaterial has been fabricated by meniscus-guided nanoparticle assembly [110].
DNA-directed assembly provides a programmable and high-resolution approach for the bottom-up fabrication of metamaterials. DNA-mediated self-assembly is used to synthesize both silver and binary silver-gold nanoparticle superlattices, where they showed epsilonnear-zero (ENZ) responses [143]. Here, DNA is used as a programmable linker to assemble spherical silver NPs into 3D assemblies, as shown in Fig. 4e. Similarly, chiral metamaterials have been fabricated by self-assembly of plasmonic nanoparticles using DNA origami [75]. Remarkably, the plasmonic nanoparticles are arranged in helices with an accuracy smaller than 2 nm. Tailored optical properties can be achieved by adjusting design protocols such as DNA sequences for achieving different arrangement of nanoparticles. Moreover, complex architectures of AuNP clusters have been developed by DNA origami-directed self-assembly [144]. The AuNP clusters network demonstrates strong artificial magnetism such as anti-ferromagnetism, magnetic surface plasmon polaritons, and purely magnetic-based Fano resonance at visible frequencies. 3D DNA origami has been employed to assemble 60-100 nm AuNP metamolecules with high roundness [145]. Programmable DNA origami-directed assembly is used to fabricate micrometer-scale honeycomb 2D lattices as platforms for plasmonic metamaterials [146]. DNA-directed assembly facilitates scalable, programmable, high-resolution, and molecular-level fabrication of plasmonic nanoparticle metamaterials with high roundness and consistency.
Arrays of AuNPs demonstrating broadband high refractive index of 4.2 at visible range have been selfassembled [147]. In this method, hydrophobic AuNPs are first dispersed in a mixture of toluene and hexane. After spreading the mixture on deionized water, the organic solvents are then evaporated in a controllable manner. Due to the differences in evaporation rates of the two organic solvents, AuNP monolayers are formed on the DI water. Remarkably, the assembled arrays of AuNPs can be subsequently transferred to any substrate by hydrographic printing, facilitating the fabrication of non-planar, flexible and tunable metamaterials. Bottom-up self-assembly has also been used to form AuNP clusters with high accuracy, smoothness and roundness with the direction of atomic force microscopy [148,149], AuNPs embedded in or placed on polymer substrates [150], and a tunable AuNP array with highly precise period and symmetry control [151]. Despite all these works, the understanding of the self-assembly process, especially at the molecular level, is still primitive and warrants further investigation. Another promising method could be the combination of top-down and bottom-up approaches. By fabricating the assembling guides using top-down methods, self-assembly can be achieved at a more controllable level for improving the performance of reconfigurable metamaterials or metafluids. With the development of integrated topdown and bottom-up methods, large-area and scalable production of soft and reconfigurable metamaterials can be envisioned.
Conclusion and outlook
Over the last two decades, the field of optical metamaterials have witnessed tremendous development in academic research. We believe that the metamaterial community is at a transition point, where more efforts are directed to overcome the challenges to apply metamaterials for practical usage. With the use of external stimuli and soft material constituents, optical metamaterials offer versatile, flexible, and on-demand applications in optoelectronics, imaging, communication, sensing and biophotonics. We believe there is much room for developing new soft optical metamaterials and improving their performances. On the materials side, researchers can identify new soft materials, such as organic fluids, aerogels, and biocompatible materials to integrate with metamaterials. While metasurfaces with spatially-varying phase elements have led to many flat optical devices, their combination with soft materials are still lacking. We thus expect to see continuous development to extend the performance, functionality and reconfigurability of these soft metasurfaces. Besides, the fabrication process can be improved towards cost-effective, reproducible, and scalable production of soft optical metamaterials. Nanofluidics can bring in new opportunities in the synthesis and controlled response of metafluids. Furthermore, programmable or computer-controlled soft metamaterials can be developed to fabricate multifunctional metamaterials with several constituents in a time-efficient manner. It is equally exciting to explore the design of exotic soft metamaterials based on topology, nonlinearity, and hyperbolic dispersion. We foresee that soft optical metamaterials will play an increasingly important role in the fundamental science and technological perspectives.
Fig. 2
2Polymer-based optical metamaterials. a A large-area (8.7 cm × 8.7 cm) flexible PDMS based Ag negative index metamaterial (NIM) that shows negative index of refraction at optical frequencies. PDMS has the advantage of enabling direct pattern transfer, benefiting from PDMS's low surface energy. b The transmission (T) and reflection (R) spectra of the large-area PDMS-based Ag NIM metamaterial. The metamaterial shows negative RI at a wavelength range of 1.7 µm to 2.4 µm. c An illustration of a flexible metamaterial consists of Au nanodisk array on top of an SU-8 substrate. SU-8 has high chemical and thermal resistance and good mechanical properties, rendering it useful as a flexible metamaterial substrate. d The reflection and transmission spectra of a flat (left) and a bent (right) SU-8-based flexible gold nanodisk metamaterial. The reflection is dependent on bending, but transmission of this flexible metamaterial is invariant of bending. e A scanning electron microscopy (SEM) image of a PEN-based Au split ring resonator (SRR) metamaterial. PEN has a high glass transition temperature and is transparent in visible and near-infrared (NIR) wavelength ranges. f The transmission spectra across visible and NIR wavelength ranges of a PEN-based Au SRR metamaterial with and without an applied out-of-plane strain. Given a strain of 1232 Pa, the electric peak shifts from 894 to 973 nm, showing a sensitivity of 0.06 nm/Pa. a, b Reprinted with permission from [81], Copyright (2011) Nature Publishing Group. c, d Reprinted with permission from [89], Copyright (2011) AIP Publishing LLC. e, f Reprinted with permission from [91], Copyright (2011) ACS Publications
Fig. 3
3Reconfigurable optical metamaterials triggered by different stimuli. a Illustration of an ethyl red based optically reconfigured metamaterial. Upon green laser excitation (control beam), the isomeric state of the ethyl red layer is changed, which results in a refractive index (RI) change and thus switching the optical properties of the soft metamaterial. b (Upper panel) Under a 4 mW green light excitation, both polarization azimuth angle φ and ellipticity angle χ witness blue shifts. (Lower panel) By increasing the control beam intensity, the transmitted ellipticity angle increases at a peak wavelength range of 760-820 nm. c Schematic of an electrically reconfigurable polyaniline (PANI) nanoparticle-on-mirror (NPoM) soft metamaterial unit cell. When voltage is applied, the thin PANI layer surrounding the AuNP will undergo a redox process where electrons transfer from PANI to the Au mirror underneath. This leads to a change in RI and the associated optical characteristics. d Measured scattering spectra of the scalable PANI NPoM metamaterial. By increasing the voltage from -0.3 V to 0.8 V, the resonance wavelength blue-shifted 79 nm (Δλ = c 0 − c 2+ ) due to the oxidization of PANI coating to PANI 2 . e LC-incorporated dielectric metamaterial for thermally tunable spontaneous emission. The device consists of silicon nanodisks embedded in LCs on a fluorescent glass substrate. Below a critical temperature of 58 °C, the LC remains in a nematic phase (left). Upon heating over the critical temperature, the LC changes to an isotropic phase (right) and the RI of LCs varies, enabling thermally tunable spontaneous emission. f Spontaneous emission spectra of the metamaterial in (e) at different temperatures. Heating above the critical temperature (T > T c ) of 58 °C leads to a pronounced red shift of the emission peak. g A mechanically reconfigurable metasurface consists of AuNRs on a PDMS substrate with a tunable focal length. h Measured longitudinal beam profiles of the AuNR/PDMS metasurface with different stretch ratios. The focal length can be continuously tuned by stretching. a, b Reprinted with permission from[97], Copyright (2017) Nature Publishing Group. c, d Reprinted with permission from[110], Copyright (2019) American Association for the Advancement of Science. e, f Reprinted with permission from[119], Copyright (2018) ACS Publications. g, h Reprinted with permission from[130], Copyright (2016) ACS Publications (See figure on next page.)
Abbreviations SRR: Split ring resonator; LC: Liquid crystal; RI: Refractive index; NIM: Negativeindex metamaterial; NLC: Nematic liquid crystal; NIR: Near-infrared; NP: Nanoparticle; AgNP: Silver nanoparticle; SiNC: Boron-doped silicon nanocrystal; AuNR: Gold nanorod; SPAS: Silk plasmonic absorber sensor; LSPR: Localized surface plasmon resonance; MIM: Metal-insulator-metal; FOM: Figure of merit; CD: Circular dichroism; PDMS: Poly-dimethyl-siloxane; SERS: Surface enhanced Raman scattering; PS: Polystyrene; PEN: Poly(ethylene naphthalate); LDPE: Low density polyethylene; ITO: Indium tin oxide; PANI: Polyaniline; NPoM: Nanoparticle-on-mirror; SPR: Surface plasmon resonance; PVDF: Polyvinylidene fluoride; CTE: Coefficient of thermal expansion; SLM: Spatial light modulator; ENZ: Epsilon-near-zero; SMA: Shape memory alloy; sRGB: Standard red-green-blue; NMP: N-Methylpirrolydone; PVD: Physical vapor deposition; CVD: Chemical vapor deposition; RIE: Reactive ion etching; EBL: Electron beam lithography; FIB: Focused ion beam; SL: Stencil lithography; NIL: Nanoimprinting lithography.
AcknowledgementsNot applicable.Authors' contributions YC wrote the manuscript. All authors contributed to discussions and editing of the manuscript. All authors read and approved the final manuscript.Funding Y.C., B.A. and Z.J.W. acknowledge the support from the President's Excellence Fund (T3).Availability of data and materialsData sharing is not applicable to this article as no datasets were generated or analyzed during the current study.Competing interestsThe authors declare that they have no competing interests.Received: 5 March 2020 Accepted: 28 April 2020
. E Shamonina, L Solymar, Metamaterials. 112E. Shamonina, L. Solymar, Metamaterials 1, 12 (2007)
W Cai, V Shalaev, Optical metamaterials: fundamentals and applications. BerlinSpringerW. Cai, V. Shalaev, Optical metamaterials: fundamentals and applications (Springer, Berlin, 2009)
. C M Soukoulis, M Wegener, Nat. Photonics. 5523C.M. Soukoulis, M. Wegener, Nat. Photonics 5, 523 (2011)
. V M Shalaev, Nat. Photonics. 141V.M. Shalaev, Nat. Photonics 1, 41 (2007)
. J Valentine, S Zhang, T Zentgraf, E Ulin-Avila, D A Genov, G Bartal, X Zhang, Nature. 455376J. Valentine, S. Zhang, T. Zentgraf, E. Ulin-Avila, D.A. Genov, G. Bartal, X. Zhang, Nature 455, 376 (2008)
. J B Pendry, A J Holden, D J Robbins, W Stewart, IEEE Trans. Microw. Theory Tech. 472075J.B. Pendry, A.J. Holden, D.J. Robbins, W. Stewart, IEEE Trans. Microw. Theory Tech. 47, 2075 (1999)
. R A Shelby, D R Smith, S Schultz, Science. 29277R.A. Shelby, D.R. Smith, S. Schultz, Science 292, 77 (2001)
. C Enkrich, F Pérez-Willard, D Gerthsen, J F Zhou, T Koschny, C M Soukoulis, M Wegener, S Linden, Adv. Mater. 172547C. Enkrich, F. Pérez-Willard, D. Gerthsen, J.F. Zhou, T. Koschny, C.M. Souk- oulis, M. Wegener, S. Linden, Adv. Mater. 17, 2547 (2005)
. P Belov, R Marques, S Maslovski, I Nefedov, M Silveirinha, C Simovski, S Tretyakov, Phys. Rev. B. 67113103P. Belov, R. Marques, S. Maslovski, I. Nefedov, M. Silveirinha, C. Simovski, S. Tretyakov, Phys. Rev. B 67, 113103 (2003)
. X Guo, Y Ying, L Tong, Acc. Chem. Res. 47656X. Guo, Y. Ying, L. Tong, Acc. Chem. Res. 47, 656 (2013)
. J Yao, Z Liu, Y Liu, Y Wang, C Sun, G Bartal, A M Stacy, X Zhang, Science. 321930J. Yao, Z. Liu, Y. Liu, Y. Wang, C. Sun, G. Bartal, A.M. Stacy, X. Zhang, Sci- ence 321, 930 (2008)
. M Kafesaki, I Tsiapa, N Katsarakis, T Koschny, C Soukoulis, E Economou, Phys. Rev. B. 75235114M. Kafesaki, I. Tsiapa, N. Katsarakis, T. Koschny, C. Soukoulis, E. Econo- mou, Phys. Rev. B 75, 235114 (2007)
. A Mary, S G Rodrigo, F Garcia-Vidal, L Martin-Moreno, Phys. Rev. Lett. 101103902A. Mary, S.G. Rodrigo, F. Garcia-Vidal, L. Martin-Moreno, Phys. Rev. Lett. 101, 103902 (2008)
. D R Smith, J B Pendry, M C Wiltshire, Science. 305788D.R. Smith, J.B. Pendry, M.C. Wiltshire, Science 305, 788 (2004)
. S Feng, K Halterman, Phys. Rev. B. 86165103S. Feng, K. Halterman, Phys. Rev. B 86, 165103 (2012)
. Y Cui, K H Fung, J Xu, H Ma, Y Jin, S He, N X Fang, Nano Lett. 121443Y. Cui, K.H. Fung, J. Xu, H. Ma, Y. Jin, S. He, N.X. Fang, Nano Lett. 12, 1443 (2012)
. O M Ramahi, T S Almoneef, M Alshareef, M S Boybay, Appl. Phys. Lett. 101173903O.M. Ramahi, T.S. Almoneef, M. AlShareef, M.S. Boybay, Appl. Phys. Lett. 101, 173903 (2012)
. N I Landy, S Sajuyigbe, J J Mock, D R Smith, W J Padilla, Phys. Rev. Lett. 100207402N.I. Landy, S. Sajuyigbe, J.J. Mock, D.R. Smith, W.J. Padilla, Phys. Rev. Lett. 100, 207402 (2008)
. S S Kruk, Z J Wong, E Pshenay-Severin, K O'brien, D N Neshev, Y S Kivshar, X Zhang, Nat. Commun. 711329S.S. Kruk, Z.J. Wong, E. Pshenay-Severin, K. O'Brien, D.N. Neshev, Y.S. Kivshar, X. Zhang, Nat. Commun. 7, 11329 (2016)
. A Poddubny, I Iorsh, P Belov, Y Kivshar, Nat. Photonics. 7948A. Poddubny, I. Iorsh, P. Belov, Y. Kivshar, Nat. Photonics 7, 948 (2013)
. X Ni, Z J Wong, M Mrejen, Y Wang, X Zhang, Science. 3491310X. Ni, Z.J. Wong, M. Mrejen, Y. Wang, X. Zhang, Science 349, 1310 (2015)
. T Ergin, N Stenger, P Brenner, J B Pendry, M Wegener, Science. 3285976T. Ergin, N. Stenger, P. Brenner, J.B. Pendry, M. Wegener, Science 328(5976), 337-339 (2010)
. X Zhang, Z Liu, Nat. Mater. 7435X. Zhang, Z. Liu, Nat. Mater. 7, 435 (2008)
. N Fang, H Lee, C Sun, X Zhang, Science. 308N. Fang, H. Lee, C. Sun, X. Zhang, Science 308, 534 (2005)
. Z Jacob, L V Alekseyev, E Narimanov, Opt. Express. 148247Z. Jacob, L.V. Alekseyev, E. Narimanov, Opt. Express 14, 8247 (2006)
. H Wang, V P Sivan, A Mitchell, G Rosengarten, P Phelan, L Wang, Sol. Energy Mater. Sol. Cells. 137235H. Wang, V.P. Sivan, A. Mitchell, G. Rosengarten, P. Phelan, L. Wang, Sol. Energy Mater. Sol. Cells 137, 235 (2015)
. Z Chen, B Guo, Y Yang, C Cheng, Physica B Condens. Matter. 4381Z. Chen, B. Guo, Y. Yang, C. Cheng, Physica B Condens. Matter 438, 1 (2014)
. P.-G. De Gennes, Rev. Mod. Phys. 64645P.-G. De Gennes, Rev. Mod. Phys. 64, 645 (1992)
A Fernandez-Nieves, A M Puertas, Fluids, colloids and soft materials: an introduction to soft matter physics. New YorkWiley7A. Fernandez-Nieves, A.M. Puertas, Fluids, colloids and soft materials: an introduction to soft matter physics, vol. 7 (Wiley, New York, 2016)
. K Kim, H Park, K J Park, S H Park, H H Kim, S Lee, Adv. Opt. Mater. 71900074K. Kim, H. Park, K.J. Park, S.H. Park, H.H. Kim, S. Lee, Adv. Opt. Mater. 7, 1900074 (2019)
. M Kolle, S Lee, Adv. Mater. 301702669M. Kolle, S. Lee, Adv. Mater. 30, 1702669 (2018)
In 2018 conference on lasers and electro-optics pacific rim (CLEO-PR). X Zhang, 1X. Zhang, In 2018 conference on lasers and electro-optics pacific rim (CLEO-PR), pp. 1 (2018)
. M J Rozin, D A Rosen, T J Dill, A R Tao, Nat. Commun. 67325M.J. Rozin, D.A. Rosen, T.J. Dill, A.R. Tao, Nat. Commun. 6, 7325 (2015)
. S J Palmer, X Xiao, N Pazos-Perez, L Guerrini, M A Correa-Duarte, S A Maier, R V Craster, R A Alvarez-Puebla, V Giannini, Nat. Commun. 102118S.J. Palmer, X. Xiao, N. Pazos-Perez, L. Guerrini, M.A. Correa-Duarte, S.A. Maier, R.V. Craster, R.A. Alvarez-Puebla, V. Giannini, Nat. Commun. 10, 2118 (2019)
. T Brunet, J Leng, O Mondain-Monval, Science. 342323T. Brunet, J. Leng, O. Mondain-Monval, Science 342, 323 (2013)
. F Ma, J H Wu, M Huang, W Zhang, S Zhang, J. Phys. D. 48175105F. Ma, J.H. Wu, M. Huang, W. Zhang, S. Zhang, J. Phys. D 48, 175105 (2015)
Aristegui, O. Mondain-Monval. T Brunet, A Merlin, B Mascaro, K Zimny, J Leng, O Poncelet, C , Nat. Mater. 14384T. Brunet, A. Merlin, B. Mascaro, K. Zimny, J. Leng, O. Poncelet, C. Aris- tegui, O. Mondain-Monval, Nat. Mater. 14, 384 (2015)
. F Xin, T Lu, Sci. Rep. 627432F. Xin, T. Lu, Sci. Rep. 6, 27432 (2016)
. A Andryieuski, S M Kuznetsova, S V Zhukovsky, Y S Kivshar, A.V. Lavrinenko, Sci. Rep. 513535A. Andryieuski, S.M. Kuznetsova, S.V. Zhukovsky, Y.S. Kivshar, A.V. Lavrinenko, Sci. Rep. 5, 13535 (2015)
. F Zhang, L Kang, Q Zhao, J Zhou, X Zhao, D Lippens, Opt. Express. 174360F. Zhang, L. Kang, Q. Zhao, J. Zhou, X. Zhao, D. Lippens, Opt. Express 17, 4360 (2009)
. Z Wang, L Jing, K Yao, Y Yang, B Zheng, C M Soukoulis, H Chen, Y Liu, Adv. Mater. 291700412Z. Wang, L. Jing, K. Yao, Y. Yang, B. Zheng, C.M. Soukoulis, H. Chen, Y. Liu, Adv. Mater. 29, 1700412 (2017)
. F Zhang, S Feng, K Qiu, Z Liu, Y Fan, W Zhang, Q Zhao, J Zhou, Appl. Phys. Lett. 10691907F. Zhang, S. Feng, K. Qiu, Z. Liu, Y. Fan, W. Zhang, Q. Zhao, J. Zhou, Appl. Phys. Lett. 106, 091907 (2015)
. S Lee, S Kim, T.-T Kim, Y Kim, M Choi, S H Lee, J.-Y Kim, B Min, Adv. Mater. 243491S. Lee, S. Kim, T.-T. Kim, Y. Kim, M. Choi, S.H. Lee, J.-Y. Kim, B. Min, Adv. Mater. 24, 3491 (2012)
. J Li, C M Shah, W Withayachumnankul, B S Y Ung, A Mitchell, S Sriram, M Bhaskaran, S Chang, D Abbott, Appl. Phys. Lett. 102121101J. Li, C.M. Shah, W. Withayachumnankul, B.S.Y. Ung, A. Mitchell, S. Sriram, M. Bhaskaran, S. Chang, D. Abbott, Appl. Phys. Lett. 102, 121101 (2013)
. R Yahiaoui, S Tan, L Cong, R Singh, F Yan, W Zhang, J. Appl. Phys. 11883103R. Yahiaoui, S. Tan, L. Cong, R. Singh, F. Yan, W. Zhang, J. Appl. Phys. 118, 083103 (2015)
. S Lee, B Kang, H Keum, N Ahmed, J A Rogers, P M Ferreira, S Kim, B Min, Sci. Rep. 627621S. Lee, B. Kang, H. Keum, N. Ahmed, J.A. Rogers, P.M. Ferreira, S. Kim, B. Min, Sci. Rep. 6, 27621 (2016)
. K Bertoldi, V Vitelli, J Christensen, M Van Hecke, Nat. Rev. Mater. 217066K. Bertoldi, V. Vitelli, J. Christensen, M. van Hecke, Nat. Rev. Mater. 2, 17066 (2017)
. J L Silverberg, A A Evans, L Mcleod, R C Hayward, T Hull, C D Santangelo, I Cohen, Science. 345647J.L. Silverberg, A.A. Evans, L. McLeod, R.C. Hayward, T. Hull, C.D. Santan- gelo, I. Cohen, Science 345, 647 (2014)
. Y Jiang, Q Wang, Sci. Rep. 634147Y. Jiang, Q. Wang, Sci. Rep. 6, 34147 (2016)
. H Zhang, X Guo, J Wu, D Fang, Y Zhang, Sci, Adv, 48535H. Zhang, X. Guo, J. Wu, D. Fang, Y. Zhang, Sci. Adv. 4, eaar8535 (2018)
. X Wang, D.-H Kwon, D H Werner, I.-C Khoo, A V Kildishev, V M Shalaev, Appl. Phys. Lett. 91143122X. Wang, D.-H. Kwon, D.H. Werner, I.-C. Khoo, A.V. Kildishev, V.M. Shalaev, Appl. Phys. Lett. 91, 143122 (2007)
. D H Werner, D.-H Kwon, I.-C Khoo, A V Kildishev, V M Shalaev, Opt. Express. 153342D.H. Werner, D.-H. Kwon, I.-C. Khoo, A.V. Kildishev, V.M. Shalaev, Opt. Express 15, 3342 (2007)
. A Minovich, D N Neshev, D A Powell, I V Shadrivov, Y S Kivshar, Appl. Phys. Lett. 96193103A. Minovich, D.N. Neshev, D.A. Powell, I.V. Shadrivov, Y.S. Kivshar, Appl. Phys. Lett. 96, 193103 (2010)
. A Minovich, Appl. Phys. Lett. 100121113A. Minovich et al., Appl. Phys. Lett. 100, 121113 (2012)
. I C Khoo, D H Werner, X Liang, A Diaz, B Weiner, Opt. Lett. 312592I.C. Khoo, D.H. Werner, X. Liang, A. Diaz, B. Weiner, Opt. Lett. 31, 2592 (2006)
. R Pratibha, K Park, I Smalyukh, W Park, Opt. Express. 1719459R. Pratibha, K. Park, I. Smalyukh, W. Park, Opt. Express 17, 19459 (2009)
. R Pratibha, W Park, I I Smalyukh, J. Appl. 10763511PhysicsR. Pratibha, W. Park, I.I. Smalyukh, J. Appl, Physics 107, 063511 (2010)
. J Ptasinski, S W Kim, L Pang, I.-C Khoo, Y Fainman, Opt. Lett. 382008J. Ptasinski, S.W. Kim, L. Pang, I.-C. Khoo, Y. Fainman, Opt. Lett. 38, 2008 (2013)
. Y A Urzhumov, G Shvets, J Fan, F Capasso, D Brandl, P Nordlander, Opt. Express. 1514129Y.A. Urzhumov, G. Shvets, J. Fan, F. Capasso, D. Brandl, P. Nordlander, Opt. Express 15, 14129 (2007)
. A Alù, N Engheta, Phys. Rev. B. 7885112A. Alù, N. Engheta, Phys. Rev. B 78, 085112 (2008)
. A Vallecchi, M Albani, F Capolino, Opt. Express. 192754A. Vallecchi, M. Albani, F. Capolino, Opt. Express 19, 2754 (2011)
R Merlin, Proc. Natl. Acad. Sci. Natl. Acad. Sci1061693R. Merlin, Proc. Natl. Acad. Sci. 106, 1693 (2009)
. C Simovski, S Tretyakov, Phys. Rev. B. 7945111C. Simovski, S. Tretyakov, Phys. Rev. B 79, 045111 (2009)
. S Kubo, A Diaz, Y Tang, T S Mayer, I C Khoo, T E Mallouk, Nano Lett. 73418S. Kubo, A. Diaz, Y. Tang, T.S. Mayer, I.C. Khoo, T.E. Mallouk, Nano Lett. 7, 3418 (2007)
. S N Sheikholeslami, H Alaeian, A L Koh, J A Dionne, Nano Lett. 134137S.N. Sheikholeslami, H. Alaeian, A.L. Koh, J.A. Dionne, Nano Lett. 13, 4137 (2013)
. J Yang, N J Kramer, K S Schramke, L M Wheeler, L V Besteiro, C J HoganJr, A O Govorov, U R Kortshagen, Nano Lett. 161472J. Yang, N.J. Kramer, K.S. Schramke, L.M. Wheeler, L.V. Besteiro, C.J. Hogan Jr., A.O. Govorov, U.R. Kortshagen, Nano Lett. 16, 1472 (2016)
. K Kim, S Yoo, J.-H Huh, Q H Park, S Lee, ACS Photonics. 42298K. Kim, S. Yoo, J.-H. Huh, Q.H. Park, S. Lee, ACS Photonics 4, 2298 (2017)
. J.-H Huh, J Lee, S Lee, 10.1021/acs.nanolett.0c00422Nano Lett. J.-H. Huh, J. Lee, S. Lee, Nano Lett. (2020). https ://doi.org/10.1021/acs. nanol ett.0c004 22
. Y Cho, J.-H Huh, K J Park, K Kim, J Lee, S Lee, Opt. Express. 2513822Y. Cho, J.-H. Huh, K.J. Park, K. Kim, J. Lee, S. Lee, Opt. Express 25, 13822 (2017)
. Y Cho, J.-H Huh, K Kim, S Lee, Adv. Opt. Mater. 71801167Y. Cho, J.-H. Huh, K. Kim, S. Lee, Adv. Opt. Mater. 7, 1801167 (2019)
. B P Partlow, Adv. Funct. Mater. 244615B.P. Partlow et al., Adv. Funct. Mater. 24, 4615 (2014)
. M Lee, H Jeon, S Kim, Nano Lett. 153358M. Lee, H. Jeon, S. Kim, Nano Lett. 15, 3358 (2015)
. N Gogurla, S C Kundu, S K Ray, Nanotechnology. 28145202N. Gogurla, S.C. Kundu, S.K. Ray, Nanotechnology 28, 145202 (2017)
. H Kwon, S Kim, ACS Photonics. 21675H. Kwon, S. Kim, ACS Photonics 2, 1675 (2015)
. A Kuzyk, R Schreiber, Z Fan, G Pardatscher, E.-M Roller, A Högele, F C Simmel, A O Govorov, T Liedl, Nature. 483311A. Kuzyk, R. Schreiber, Z. Fan, G. Pardatscher, E.-M. Roller, A. Högele, F.C. Simmel, A.O. Govorov, T. Liedl, Nature 483, 311 (2012)
. R Schreiber, Nat. Commun. 42948R. Schreiber et al., Nat. Commun. 4, 2948 (2013)
. A Kuzyk, R Schreiber, H Zhang, A O Govorov, T Liedl, N Liu, Nat. Mater. 13862A. Kuzyk, R. Schreiber, H. Zhang, A.O. Govorov, T. Liedl, N. Liu, Nat. Mater. 13, 862 (2014)
. H.-E Lee, Nature. 556360H.-E. Lee et al., Nature 556, 360 (2018)
. Z Wu, X Chen, M Wang, J Dong, Y Zheng, Acc. Chem. Res. 80. H.-Y. Ahn, S. Yoo, N.H. Cho, R.M. Kim, H. Kim, J.-H. Huh, S. Lee, K.T. Nam122768ACS NanoZ. Wu, X. Chen, M. Wang, J. Dong, Y. Zheng, ACS Nano 12, 5030 (2018) 80. H.-Y. Ahn, S. Yoo, N.H. Cho, R.M. Kim, H. Kim, J.-H. Huh, S. Lee, K.T. Nam, Acc. Chem. Res. 52, 2768 (2019)
. D Chanda, Nat. Nanotechnol. 6402D. Chanda et al., Nat. Nanotechnol. 6, 402 (2011)
. L Gao, K Shigeta, A Vazquez-Guardado, C J Progler, G R Bogart, J A Rogers, D Chanda, ACS Nano. 85535L. Gao, K. Shigeta, A. Vazquez-Guardado, C.J. Progler, G.R. Bogart, J.A. Rogers, D. Chanda, ACS Nano 8, 5535 (2014)
. P Gutruf, C Zou, W Withayachumnankul, M Bhaskaran, S Sriram, C Fumeaux, ACS Nano. 10133P. Gutruf, C. Zou, W. Withayachumnankul, M. Bhaskaran, S. Sriram, C. Fumeaux, ACS Nano 10, 133 (2016)
. X Li, W E Sha, W C Choy, D D Fung, F Xie, J. Phys. Chem. 1167200X. Li, W.E. Sha, W.C. Choy, D.D. Fung, F. Xie, J. Phys. Chem. 116, 7200 (2012)
. I M Pryce, K Aydin, Y A Kelaita, R M Briggs, H A Atwater, Nano Lett. 104222I.M. Pryce, K. Aydin, Y.A. Kelaita, R.M. Briggs, H.A. Atwater, Nano Lett. 10, 4222 (2010)
. X Wen, G Li, J Zhang, Q Zhang, B Peng, L M Wong, S Wang, Q Xiong, Nanoscale. 6132X. Wen, G. Li, J. Zhang, Q. Zhang, B. Peng, L.M. Wong, S. Wang, Q. Xiong, Nanoscale 6, 132 (2014)
. M Choi, J.-H Choe, B Kang, C.-G Choi, Curr. Appl. Phys. 131723M. Choi, J.-H. Choe, B. Kang, C.-G. Choi, Curr. Appl. Phys. 13, 1723 (2013)
. A Di Falco, M Ploschner, T F Krauss, New J. Phys. 12113006A. Di Falco, M. Ploschner, T.F. Krauss, New J. Phys. 12, 113006 (2010)
. A Di Falco, Y Zhao, A Alú, Appl. Phys. Lett. 99163110A. Di Falco, Y. Zhao, A. Alú, Appl. Phys. Lett. 99, 163110 (2011)
B Kirkpatrick, P Reader-Harris, Y Shen, J Wu, A Di Falco, Photonic and phononic properties of engineered nanostructures V (International society for optics and photonics. 93710B. Kirkpatrick, P. Reader-Harris, Y. Shen, J. Wu, and A. Di Falco, In Photonic and phononic properties of engineered nanostructures V (International society for optics and photonics, 2015), p. 93710Z
. X Xu, B Peng, D Li, J Zhang, L M Wong, Q Zhang, S Wang, Q Xiong, Nano Lett. 113232X. Xu, B. Peng, D. Li, J. Zhang, L.M. Wong, Q. Zhang, S. Wang, Q. Xiong, Nano Lett. 11, 3232 (2011)
. X Liu, J Wang, L Tang, L Xie, Y Ying, Adv. Funct. Mater. 265515X. Liu, J. Wang, L. Tang, L. Xie, Y. Ying, Adv. Funct. Mater. 26, 5515 (2016)
. Y Cui, J Zhou, V A Tamma, W Park, ACS Nano. 62385Y. Cui, J. Zhou, V.A. Tamma, W. Park, ACS Nano 6, 2385 (2012)
. S Aksu, M Huang, A Artar, A A Yanik, S Selvarasah, M R Dokmeci, H Altug, Adv. Mater. 234422S. Aksu, M. Huang, A. Artar, A.A. Yanik, S. Selvarasah, M.R. Dokmeci, H. Altug, Adv. Mater. 23, 4422 (2011)
. X Jia, Q Meng, C Yuan, Z Zhou, X Wang, Optik. 1275738X. Jia, Q. Meng, C. Yuan, Z. Zhou, X. Wang, Optik 127, 5738 (2016)
P Reader-Harris, B C Kirkpatrick, A Di Falco, Quantum sensing and nanophotonic devices XI (International Society for Optics and Photonics. 89930P. Reader-Harris, B. C. Kirkpatrick, and A. Di Falco, In Quantum sensing and nanophotonic devices XI (International Society for Optics and Pho- tonics, 2014), p. 89930P
. M.-X Ren, W Wu, W Cai, B Pi, X.-Z Zhang, J.-J Xu, Light Sci. Appl. 616254M.-X. Ren, W. Wu, W. Cai, B. Pi, X.-Z. Zhang, J.-J. Xu, Light Sci. Appl. 6, e16254 (2017)
. G Zhang, C Hsu, C Lan, R Gao, Y Wen, J Zhou, A C , S. Appl, Mater. Interfaces. 112254G. Zhang, C. Hsu, C. Lan, R. Gao, Y. Wen, J. Zhou, A.C.S. Appl, Mater. Interfaces 11, 2254 (2019)
. L Lysyakova, N Lomadze, D Neher, K Maximova, A V Kabashin, S Santer, J. Phys. Chem. 1193762L. Lysyakova, N. Lomadze, D. Neher, K. Maximova, A.V. Kabashin, S. Santer, J. Phys. Chem. 119, 3762 (2015)
. J Y Ou, E Plum, J Zhang, N I Zheludev, Adv. Mater. 28729J.Y. Ou, E. Plum, J. Zhang, N.I. Zheludev, Adv. Mater. 28, 729 (2016)
. J Müller, C Sönnichsen, H Von Poschinger, G Von Plessen, T Klar, J Feldmann, Appl. Phys. Lett. 81171J. Müller, C. Sönnichsen, H. Von Poschinger, G. Von Plessen, T. Klar, J. Feldmann, Appl. Phys. Lett. 81, 171 (2002)
. K C Chu, C Y Chao, Y F Chen, Y C Wu, C.-C Chen, Appl. Phys. Lett. 89103107K.C. Chu, C.Y. Chao, Y.F. Chen, Y.C. Wu, C.-C. Chen, Appl. Phys. Lett. 89, 103107 (2006)
. P Evans, G Wurtz, W Hendren, R Atkinson, W Dickson, A Zayats, R Pollard, Appl. Phys. Lett. 9143101P. Evans, G. Wurtz, W. Hendren, R. Atkinson, W. Dickson, A. Zayats, R. Pol- lard, Appl. Phys. Lett. 91, 043101 (2007)
. D Franklin, Y Chen, A Vazquez-Guardado, S Modak, J Boroumand, D Xu, S.-T Wu, D Chanda, Nat. Commun. 67337D. Franklin, Y. Chen, A. Vazquez-Guardado, S. Modak, J. Boroumand, D. Xu, S.-T. Wu, D. Chanda, Nat. Commun. 6, 7337 (2015)
. A Komar, Appl. Phys. Lett. 11071109A. Komar et al., Appl. Phys. Lett. 110, 071109 (2017)
. M Sharma, N Hendler, T J A O M Ellenbogen, Adv. Optical Mater. 81901182M. Sharma, N. Hendler, T.J.A.O.M. Ellenbogen, Adv. Optical Mater. 8, 1901182 (2020)
. S Q Li, X Xu, R Veetil, V Valuckas, R Paniagua-Domínguez, A I Kuznetsov, Science. 3641087S.Q. Li, X. Xu, R. Maruthiyodan Veetil, V. Valuckas, R. Paniagua- Domínguez, A.I. Kuznetsov, Science 364, 1087 (2019)
. Y Lee, ACS Photonics. 41954Y. Lee et al., ACS Photonics 4, 1954 (2017)
. M Sun, X Xu, X W Sun, X A Liang, V Valuckas, Y Zheng, R Paniagua-Domínguez, A.I. Kuznetsov, Sci. Rep. 98673M. Sun, X. Xu, X.W. Sun, X.A. Liang, V. Valuckas, Y. Zheng, R. Paniagua- Domínguez, A.I. Kuznetsov, Sci. Rep. 9, 8673 (2019)
. J Peng, H.-H Jeong, Q Lin, S Cormier, H.-L Liang, M F L De, S Volder, J J Vignolini, Baumberg, Sci. Adv. 52205J. Peng, H.-H. Jeong, Q. Lin, S. Cormier, H.-L. Liang, M.F.L. De Volder, S. Vignolini, J.J. Baumberg, Sci. Adv. 5, 2205 (2019)
. Z Zhou, ACS Appl. Mater. Interfaces. 935244Z. Zhou et al., ACS Appl. Mater. Interfaces. 9, 35244 (2017)
. J.-Y Ou, E Plum, J Zhang, N I Zheludev, Nat. Nanotechnol. 8252J.-Y. Ou, E. Plum, J. Zhang, N.I. Zheludev, Nat. Nanotechnol. 8, 252 (2013)
. J Valente, J.-Y Ou, E Plum, I J Youngs, N I Zheludev, Nat. Commun. 67021J. Valente, J.-Y. Ou, E. Plum, I.J. Youngs, N.I. Zheludev, Nat. Commun. 6, 7021 (2015)
. Q Zou, W Liu, Y Shen, C Jin, Nanoscale. 1111437Q. Zou, W. Liu, Y. Shen, C. Jin, Nanoscale 11, 11437 (2019)
. J Švanda, Y Kalachyova, P Slepička, V Švorčík, O Lyutakov, A , C.S. Appl, Mater. Interfaces. 8225J. Švanda, Y. Kalachyova, P. Slepička, V. Švorčík, O. Lyutakov, A.C.S. Appl, Mater. Interfaces 8, 225 (2016)
. E Arbabi, A Arbabi, S M Kamali, Y Horie, M Faraji-Dana, A Faraon, Nat. Commun. 9812E. Arbabi, A. Arbabi, S.M. Kamali, Y. Horie, M. Faraji-Dana, A. Faraon, Nat. Commun. 9, 812 (2018)
. J.-Y Ou, E Plum, L Jiang, N I Zheludev, Nano Lett. 112142J.-Y. Ou, E. Plum, L. Jiang, N.I. Zheludev, Nano Lett. 11, 2142 (2011)
. S Xiao, U K Chettiar, A V Kildishev, V Drachev, I Khoo, V M Shalaev, Appl. Phys. Lett. 9533115S. Xiao, U.K. Chettiar, A.V. Kildishev, V. Drachev, I. Khoo, V.M. Shalaev, Appl. Phys. Lett. 95, 033115 (2009)
. J Bohn, T Bucher, K E Chong, A Komar, D.-Y Choi, D N Neshev, Y S Kivshar, T Pertsch, I Staude, Nano Lett, 183461J. Bohn, T. Bucher, K.E. Chong, A. Komar, D.-Y. Choi, D.N. Neshev, Y.S. Kivshar, T. Pertsch, I. Staude, Nano Lett. 18, 3461 (2018)
. A Komar, R Paniagua-Domínguez, A Miroshnichenko, Y F Yu, Y S Kivshar, A I Kuznetsov, D Neshev, ACS Photonics. 51742A. Komar, R. Paniagua-Domínguez, A. Miroshnichenko, Y.F. Yu, Y.S. Kivs- har, A.I. Kuznetsov, D. Neshev, ACS Photonics 5, 1742 (2018)
. J Sautter, I Staude, M Decker, E Rusak, D N Neshev, I Brener, Y S Kivshar, ACS Nano. 94308J. Sautter, I. Staude, M. Decker, E. Rusak, D.N. Neshev, I. Brener, Y.S. Kivs- har, ACS Nano 9, 4308 (2015)
. W Lewandowski, M Fruhnert, J Mieczkowski, C Rockstuhl, E Górecka, Nat. Commun. 66590W. Lewandowski, M. Fruhnert, J. Mieczkowski, C. Rockstuhl, E. Górecka, Nat. Commun. 6, 6590 (2015)
M Tsuruta, CLEOJ Valente, CLEOB Gholipour, CLEOK Macdonald, CLEOE Plum, CLEON Zheludev, CLEOConference on lasers and electro-optics. M. Tsuruta, J. Valente, B. Gholipour, K. MacDonald, E. Plum, and N. Zhe- ludev, 2016 In Conference on lasers and electro-optics (CLEO) (2016)
. Y Nagasaki, B Gholipour, J.-Y Ou, M Tsuruta, E Plum, K F Macdonald, J Takahara, N I Zheludev, Appl. Phys. Lett. 11321105Y. Nagasaki, B. Gholipour, J.-Y. Ou, M. Tsuruta, E. Plum, K.F. MacDonald, J. Takahara, N.I. Zheludev, Appl. Phys. Lett. 113, 021105 (2018)
. F Huang, J J Baumberg, Nano Lett. 101787F. Huang, J.J. Baumberg, Nano Lett. 10, 1787 (2010)
. X Liu, Z Huang, C Zhu, L Wang, J Zang, Nano Lett, 181435X. Liu, Z. Huang, C. Zhu, L. Wang, J. Zang, Nano Lett. 18, 1435 (2018)
. W Chen, ACS Nano. 1210683W. Chen et al., ACS Nano 12, 10683 (2018)
. Z Liu, Y Xu, C.-Y Ji, S Chen, X Li, X Zhang, Y Yao, J Li, Adv. Mater. 321907077Z. Liu, Y. Xu, C.-Y. Ji, S. Chen, X. Li, X. Zhang, Y. Yao, J. Li, Adv. Mater. 32, 1907077 (2020)
. M L Tseng, J Yang, M Semmlinger, C Zhang, P Nordlander, N J Halas, Nano Lett. 176034M.L. Tseng, J. Yang, M. Semmlinger, C. Zhang, P. Nordlander, N.J. Halas, Nano Lett. 17, 6034 (2017)
. H.-S Ee, R Agarwal, Nano Lett, 162818H.-S. Ee, R. Agarwal, Nano Lett. 16, 2818 (2016)
. S M Kamali, E Arbabi, A Arbabi, Y Horie, A Faraon, Laser Photonics Rev. 101002S.M. Kamali, E. Arbabi, A. Arbabi, Y. Horie, A. Faraon, Laser Photonics Rev. 10, 1002 (2016)
. S C Malek, H.-S Ee, R Agarwal, Nano Lett. 173641S.C. Malek, H.-S. Ee, R. Agarwal, Nano Lett. 17, 3641 (2017)
. S M Kamali, A Arbabi, E Arbabi, Y Horie, A J N C Faraon, Nat. Commun. 711618S.M. Kamali, A. Arbabi, E. Arbabi, Y. Horie, A.J.N.C. Faraon, Nat. Commun. 7, 11618 (2016)
. O Vazquez-Mena, T Sannomiya, M Tosun, L G Villanueva, V Savu, J Voros, J Brugger, ACS Nano. 65474O. Vazquez-Mena, T. Sannomiya, M. Tosun, L.G. Villanueva, V. Savu, J. Voros, J. Brugger, ACS Nano 6, 5474 (2012)
Nanoimprint lithography for nanodevice fabrication. S Barcelo, Z Li, 10.1186/s40580-016-0081-yNano Convergence. A. Alù, N. Engheta35723Opt. ExpressS. Barcelo, Z. Li, Nanoimprint lithography for nanodevice fabrica- tion. Nano Convergence 3, 21 (2016). https ://doi.org/10.1186/s4058 0-016-0081-y 136. A. Alù, N. Engheta, Opt. Express 17, 5723 (2009)
. H Alaeian, J A Dionne, Opt. Express. 2015781H. Alaeian, J.A. Dionne, Opt. Express 20, 15781 (2012)
. S Lee, Opt. Express. 2328170S. Lee, Opt. Express 23, 28170 (2015)
. S Lee, J Kim, Opt. Express. 2321809S. Lee, J. Kim, Opt. Express 23, 21809 (2015)
. K Kim, S Lee, Opt. Express. 271241K. Kim, S. Lee, Opt. Express 27, A1241 (2019)
. D F Gardner, J S Evans, I I Smalyukh, Mol. Cryst. Liq. Cryst. 5451227D.F. Gardner, J.S. Evans, I.I. Smalyukh, Mol. Cryst. Liq. Cryst. 545, 1227 (2011)
. J A Fan, Science. 3281135J.A. Fan et al., Science 328, 1135 (2010)
. K L Young, Adv. Mater. 26653K.L. Young et al., Adv. Mater. 26, 653 (2014)
. P Wang, J.-H Huh, J Lee, K Kim, K J Park, S Lee, Y Ke, Adv. Mater. 311901364P. Wang, J.-H. Huh, J. Lee, K. Kim, K.J. Park, S. Lee, Y. Ke, Adv. Mater. 31, 1901364 (2019)
. J Lee, J.-H Huh, K Kim, S Lee, Adv. Funct. Mater. 281707309J. Lee, J.-H. Huh, K. Kim, S. Lee, Adv. Funct. Mater. 28, 1707309 (2018)
. P Wang, S Gaitanaros, S Lee, M Bathe, W M Shih, Y Ke, J. Am. Chem. Soc. 1387733P. Wang, S. Gaitanaros, S. Lee, M. Bathe, W.M. Shih, Y. Ke, J. Am. Chem. Soc. 138, 7733 (2016)
. R Kim, K Chung, J Y Kim, Y Nam, S.-H K Park, J Shin, ACS Photonics. 51188R. Kim, K. Chung, J.Y. Kim, Y. Nam, S.-H.K. Park, J. Shin, ACS Photonics 5, 1188 (2018)
. M Kim, S Lee, J Lee, D K Kim, Y J Hwang, G Lee, G.-R Yi, Y J Song, Opt. Express. 2312766M. Kim, S. Lee, J. Lee, D.K. Kim, Y.J. Hwang, G. Lee, G.-R. Yi, Y.J. Song, Opt. Express 23, 12766 (2015)
. K J Park, Sci. Rep. 76045K.J. Park et al., Sci. Rep. 7, 6045 (2017)
. M Kim, J. Phys. Chem. Lett. 83745M. Kim et al., J. Phys. Chem. Lett 8, 3745 (2017)
. J Y Kim, Nat. Commun. 712911J.Y. Kim et al., Nat. Commun. 7, 12911 (2016)
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Springer Nature remains neutral with regard to jurisdictional claims in pub- lished maps and institutional affiliations.
| Photonic metamaterial and eliminating all but the best. The process was repeated over multiple generations until the design became effective. The metamaterial is made of four layers on a silicon substrate. The first layer is palladium, covered by polyimide (plastic) and a palladium screen on top. The screen has sub-wavelength cutouts that block the various wavelengths. A polyimide layer caps the whole absorber. It can absorb 90 percent of infrared radiation at up to a 55 degree angle to the screen. The layers do not need accurate alignment. The polyimide cap protects the screen and helps reduce any impedance mismatch that might | In this paper, we give a review of the state of the art in the study of mechanical metamaterials. The very attractive property of having a microstructure capable of determining exotic and specifica... | In reviewing some recent work in metamaterials, we highlight two exciting new frontiers just emerging in this field — metamaterials made by new electronic materials (particularly graphene) and inhomogeneous metasurfaces to control light wave-fronts. | mechanics of wave propagation in a lattice structure. Also materials have mass, and instrinsic degrees of stiffness. Together these form a resonant system, and the mechanical (sonic) resonance may be excited by appropriate sonic frequencies (for example pulses at audio frequencies). Acoustic metamaterials have developed from the research and results behind metamaterials. The novel material was originally proposed by Victor Veselago in 1967, but not realized until some 33 years later. John Pendry produced the basic elements of metamaterials during the last part of the 1990s. His materials were combined and then negative index materials were realized first in the | 16 | This review paper is based on the brief history, classification and utilities of metamaterial in various fields. An introduction to metamaterials followed by a detailed elaboration on how to design unprecedented electromagnetic properties of metamaterials is presented. Further we discussed the different structure approaches of metamaterials and their advantages. Finally, we offer an outlook on future directions of metamaterials research. | Mechanical metamaterials: a state of the art | who developed the basic elements of metamaterials in the 1990s | Metamaterials: How the subject started | Metamaterials for Wireless Communications, Radiofrequency Identification, and Sensors | Group theoretical description of artificial electromagnetic metamaterials. | Novel architecture for waveguide based metamaterials | METAMORPHOSE VI – the Virtual Institute for artificial electromagnetic materials and metamaterials: origin, mission, and activities | Metamaterial-based electromagnetic wave shielding |
17 | A Cytological Investigation of the Different Species of Sansevieria with the AID of the Improved Technique | Seed structure and seedling anatomy ofCajanus cajan are investigated. Seeds are non-endospermic. Initially ovules are anatropous but later they become campylotropous. The epidermis and the hypodermis of the seed coat consist of macrosclereids and osteosclereids respectively. Macrosclereids have fluted wall thickenings. The “tracheid island” has cells with lignified reticulate wall thickenings. Vascular interrelationship between the radicle, epicotyl and first pair of leaves have been described. | for children's bedrooms. According to feng shui, because the leaves of "Sansevieria" grow upwards, the plants can be used for feng shui purposes. Some believe that having "Sansevieria" near children helps reduce coarseness, although care must be taken to ensure the child cannot reach the plant's poisonous leaves. Others recommend placing pots near the toilet tank to counter the drain-down vibrations. Such placement appears in the 1986 film "Blue Velvet". Sansevieria Sansevieria is a genus of about 70 species of flowering plants, native to Africa, Madagascar and southern Asia. Common names include mother-in-law's tongue, devil's tongue, jinn's tongue, bow string | Limonium ramosissimum Limonium ramosissimum, the Algerian sea lavender, is a species of sea lavender ("Limonium") native to the Mediterranean region. Its specific epithet means "many-branched" in Latin. As a halophyte, "Limonium ramosissimum" has the ability to tolerate a wide range of salt levels (salinity-tolerant) in the soil and also has the ability to actively lower the soil salinity by taking up and excreting salt through glands in the inflorescence, which are then free to break off and blow away. This could have the effect of changing the species composition of an area by reducing salinity in the soil. These plants | Chromosome numbers were determined and karyotypes were analyzed in 54 individuals from 9 populations representing 9 species of Campanula viz. C. alliariaefolia, C. carpatica, C. glomerata, C. lactiflora, C. raddeana, C. rigidipila, C. rotundifolia, C. siegizmundi and C. trachelium. The recorded diploid chromosome number in all the populations examined was 2n=2x=34, except in C. glomerata (2n=2x=30) and C. rotundifolia (2n=4x=68). Chromosome numbers in each of C. rigidipila and C. siegizmundi are scored for the first time, whereas those of the other species had confirmed previous reports. The karyotype parameters used were significantly differentiated in the species and the interspecific relationships were consistent with the current taxonomic delimitations. The evolutionary trends of the species based on their chromosomal data in relation to the morphological attributes and the geographical distribution were assessed. | Zieria montana is a plant in the citrus family Rutaceae and is endemic to a small area in south-east Queensland. It is a shrub with rough, ridged branches, leaves composed of three leaflets and groups of white, four-petalled flowers in spring and early summer.
Description
Zieria montana is an open, compact shrub which grows to a height of and has erect, wiry branches with conspicuous ridges. The leaves are composed of three elliptic to egg-shaped leaflets with the central one, long and wide, the leaves with a stalk long. The leaflets are glabrous except for a few scattered hairs on the lower side along the mid-vein.
The flowers are white, tinged with pink and are arranged in upper leaf axils in groups of 10 to 20. The groups are shorter than the leaves and each flower is on a stalk long. There are four egg-shaped sepal lobes about long and four petals about long. In common with other zierias, there are only four stamens. Flowering occurs from September to December.
Taxonomy and naming
Zieria montana was first formally described in 2002 by James Armstrong and the description was published in Australian Systematic Botany. The specific epithet (montana) is a Latin word meaning "of mountains".
Distribution and habitat
This zieria occurs in the Mount Barney National Park area, growing in heath near rocky outcrops.
Conservation
Zieria montana is listed as "Vulnerable" under the Queensland Nature Conservation Act 1992. The main threats to its survival are too-frequent fires and trampling by walkers.
References
montana
Sapindales of Australia
Flora of New South Wales
Plants described in 2002 | The essential oil of the Greek endemic species Marrubium thessalum Boiss. & Heldr. (Lamiaceae) was obtained by the hydrodistillation of its aerial parts during the flowering stage. The composition of the oil was analysed by GC and GC-MS. Thirty compounds were identified. The oil was devoid of monoterpenes, while sesquiterpenes constituted the major fraction. The main components of the oil were caryophyllene oxide (21.7%), β-caryophyllene (17.6%), germacrene D (15.3%), β-bisabolene (12.6%) and trans-β-farnesene (8.1%). | Abstract Of the 44 binomials recorded from the region (New Guinea, Solomon Islands, New Caledonia, Fiji, Samoa, Tahiti, and Vanuatu), only 20 are recognised, including 11 endemics. Thirteen new synonyms are proposed. Illustrations are provided for S. aequiloba, S. antara, S. fijiensis, S. brassii, S. caledonica, S. crinita, S. integerrima, S. lacerata, S. nadeaudiana, S. ramentacea, S. reinwardtii, and S. rubriseta. Photomicrographs of leaf cells are given for most of the species in this region. A key is provided for all species in Oceania and a list of recognised species of Schistochila in Asia and Oceania is also included. | Abstract This is the first behavioural study of Asemonea murphyi and Goleba puella from Kenya, Lysomanes patens and two unidentified species of Lyssomanes from Costa Rica: Onomastus nigricauda from Sri Lanka, and Onomastus holmi from Thailand. The manner in which these lyssomanine salticids catch prey and use silk is investigated and published information about other species is reviewed. All studied lyssomanines are similar to each other but differ significantly from typical salticids in some of their behaviours. Like typical salticids, lyssomanines spin nests which serve as sites for resting, moulting, and ovipositing. Unlike typical salticid nests, lyssomanine nests are large and sheet-like and assist during predation by temporarily detaining prey. During cursorial predation, lyssomanines often omit elements which are usually present in predatory sequences of typical salticids. Lyssomanines differ from typical salticids because they tend to ambush rather than stalk prey and to lunge at prey from close r... | 17 | The genus Sansevieria (family Dracaenaceae) in Zimbabwe. | Two new species of Asteraceae (tribe Anthemideae, subtribe Pentziinae) from the Cape Floristic Region of South Africa | Drimia exigua (Hyacinthaceae), a new species from Ethiopia | A revision of Pilea (Urticaceae) in Africa | Constituents of some West African members of the genus Terminalia | TAXONOMIC STUDY OF THE FAMILY MESOTAENIACEAE (DESMIDIOPHYCEAE SHAMEEL) IN CERTAIN NORTH- EASTERN AREAS OF PAKISTAN | Scorpiones, Solifugae and Araneae of the Matobo World Heritage Site, Zimbabwe | Taxonomic Notes on South American Miconia (Melastomataceae) | Une revision du genre Ehretia P. Browne sensu stricto pour Madagascar et les Comores est presentee. Ehretia cymosa Thonn. et E. obtusifolia A. DC. sont tous deux connus d'Afrique, tandis que les autres especes (E. australis J.S. Mill., E. decaryi J.S. Mill., E. meyersii J.S. Mill., E. phillipsonii J.S. Mill., et E. seyrigii J.S. Mill.) sont toutes endemiques, nouvelles et decrites ici. |
18 | who did peer de silva get permission to communicate with | Defense lawyers for Jose Padilla chipped away Monday at the credibility of the government's expert witness, who said he could not disclose details about some of his work because of secrecy agreements with unnamed foreign governments. | Francisco de Paula Vieira da Silva de Tovar, 1st Viscount of Molelos Francisco de Paula Vieira da Silva de Tovar e Nápoles, 11th Lord of the Honour of Molelos, 1st Baron and 1st Viscount of Molelos (1774–1852) was a Portuguese military officer and politician. He is best known for his role in the Portuguese invasion of the Banda Oriental, under the reign of king John VI, as well as for his active participation in Portugal's resistance against the invading troops of Napoleon (1807–1810) and, towards the end of his life, for his support for the Absolutist or Traditionalist faction during | Residents of this drab, industrial town where President Luiz Inacio Lula da Silva rose to prominence as a labor leader remain loyal to him despite the scandals that have rocked his presidency. | Joke Silva to support her, happy at the success she made of her career. During a slow period of her career, she returned to school, studying English at the University of Lagos. Silva has starred in numerous films and television series in both the English and Yoruba languages. One of her earliest roles was in the 1990 English film "Mind Bending". In 1993 she appeared in "Owulorojo", followed by "Violated" in 1995. In 1998 she starred opposite Colin Firth and Nia Long in the British-Canadian film "The Secret Laughter of Women", in which she portrayed Nene. Author Finola Kerrigan noted than Silva | The article starts from Paulo Freire literacy method and reflects particularly on the following issues: anthropological concept of culture; culture of silence; generative word. It reflects, therefore, on these elements of Paulo Freire's educational philosophy in connection with principles expressed by critical pedagogy. Starting from this reflection, we ask ourselves how to give life to a proposal of participatory didactics, generative of dialogue, critical conscience and social transformation. | Mankind is actively trying to communicate with extraterrestrial life. However, historically the discovery of new civilizations has led to war, subjugation, and even elimination. With that in mind, we believe that for any attempted contact with extraterrestrials our location must not be revealed. Therefore, we focus on the problem of location-private interstellar communication. We approach this as a security problem and propose to work towards solutions with tools from the domain of secure communications. As a first step, we give proposals for adversary models, security requirements, and security controls. | Covert communication can prevent the opponent from knowing that a wireless communication has occurred. If only the additive white Gaussian noise (AWGN) channels and ambient noise are taken into consideration, a square root law was obtained and the result shows that the privacy rate approaches zero asymptotically. In this paper, we consider the covert communication in large-scale wireless networks, where the transmitters form a stationary Poisson point process, and Alice wishes to communicate covertly to Bob without being detected by warden Dave. In this scenario, Bob and Dave not only experience the ambient noise, but also the aggregate interference simultaneously. Although the interference sources are not in collusion with Alice, and Bob's noise increases as well, our results show that, the measurement uncertainty of Dave will increase along with the increase of interference, and interference can indeed improve the performance of covert communication. | Ingo (novel) is prepared to defend what is held there. She also remembers that her father told her and Conor to never ever go near them and that it was dangerous. Sappy and Conor do their best to save Roger and his diving buddy Gray from the fierce seal guardians that protect that area. Conor is able to hear the seals song that they sing to the dying Mer, so he sings their song and makes them calm down. At first Faro and Elvira do not help, but then realize how brave Sapphire and Conor are so they help them. Sapphire and | 18 | Peer de Silva obtained permission from the embassy to communicate with Chang Myon, and they established rapport. In early 1960 an election was held, in which Chang most probably bested the corrupt Rhee regime, but for the "fraud and deceit" practices by his aides. Student protests were mounted. The police fired on a protesting crowd in Seoul killing over a hundred, wounding thousands. The populace erupted in anger. In the Blue House (Kyŏngmudae) the ruling party gathered; their police and army had abandoned the streets to protesting crowds. While the US ambassador waited for instructions from Washington, de Silva telephoned the Blue House | Why did the PRC's Tiananmen square massacre, which killed over 2,600 drew massive political/economic sanctions whereas the ROC's 228 Incident, which killed over 10,000 people, drew little or no attention at all? | who was the speaker of the house in south korea during the scandal | Chiang Kai-shek was leader of what party? | when did deng point out that the anti-corruption effort must be fought in an institutional | Analysis of Interpersonal Function in Political Oration——Taking Cameron's Oration in Beijing University for Example | who died in beijing in june 2007 | where did wangpha lowang first contest for election | what nerve agent killed north korean leader kim jong-un |
19 | what are the names of the characters in shantaram | the most prominent one being that Enki and Ninhursag with Fuxi and NuWa?
Both are snake bodies human faced gods, brother and sister, and what’s even more surprising is their names.
Ninhursag means female queen in Sumerian, while NuWa also means female queen in ancient Chinese. Also, NuWa, FuXi and PanGu in Chinese mythos have weird names as compared to their later counterparts, almost like they are named using a foreign language. | Shanakht ()(English Translation: Identity) is a Pakistani television social drama series that debuted on Hum TV on 5 August 2014. It is written and directed by Amna Nawaz Khan and is produced by Momina Duraid. It is a A N K Production project. The show stars Maya Ali, Fahad Mirza and Noor Hassan Rizvi in pivotal roles. The show aired Tuesdays at 8:00 pm.
The drama serial premiered on 5 August 2014 in Pakistan, with the prime slot of 8:00 pm every Friday on the channel Hum TV, the serial aired its final episode on 16 December 2014, and was extremely praised. The final episode of serial left an unforgettable effect on audience. Shanakht received widespread critical acclaim and is widely regarded to be one of the greatest television series of all time. Due to the Islamic serial trend and minimum cult philosophy cliche dialogues, the serial was a major hit and was praised heavily. It is also among the top series of Pakistan.
Plot
Shanakht mainly deals with the subject of social life in upper-class Pakistan. The story revolves around a young girl named Qurratulain (nicknamed Annie), a devout and practising Muslim. She is shown to often cover her head using a Hijaab as prescribed by her faith. She usually faces strong criticism and objections from her family members over her obsession about being a dutiful Muslim, especially from her liberal-thinking mother. As time progresses, Annie begins to develop feelings for her first cousin Hashim (Noor Hassan). Hashim, though fond of Annie, resents her for religious, and hence out-dated, outlook on life. In a twisted turn of events Hashim sends a wedding proposal for Kashaf, Annie's younger sister, rather than Annie who has always been deemed more compatible with him. Kahshaf outright rejects the proposal. With a broken heart Hashim leaves for England for higher studies where he befriends Rohaan (Fahad Mirza). Rohaan has a pleasant, fun loving personality, but despite this he also believes in adhering to religious teachings in life. Rohaan's friendship gradually changes Hashim, his attitude towards life and religion.
Cast
Maya Ali as Qurratulain (Annie)
Noor Hassan Rizvi as Hashim
Fahad Mirza as Rohaan
Muneeb Butt as Haris
Kanza Wayne as Faryal
Shamim Hilaly as Shareen
Azra Mohyeddin as Rohaan's mother
Shehryar Zaidi as Rohaan's father
Sabahat Ali Bukhari as Huma
Hina Javed As Kashaf
Faria Hassan As Ayesha
Mariam Ansari as Zubia
Bilal Awan
Summary
Episodes 1–6
Shanakht is a story of a girl Qurratulain or Annie (Maya Ali) who hails from a modern/liberal family. Things take a new turn, when Annie starts covering her head with head scarf commonly known as hijab. Annie faces opposition from her family over this decision, but she is firm on it. Like a typical young girl, Annie has feelings for her first cousin Hashim (Noor Hassan). Hashim (Noor Hassan) also likes her to be his life partner but is also allergic to new ideas and way of life of Ainne to an extent that he proposes Annie's sister Kashaf instead of Annie, but Kashaf rejects the proposal (as she is in love with her friend Haris). With a broken heart Hashim leaves for England for higher studies where he befriends Rohaan (Fahad Mirza). Rohaan has a pleasant, fun loving personality, but despite this he also believes in adhering to religious teachings in life. Rohaan's parents are friends with Hashim and Annie's parents, Hashim and Rohaan are unaware of this. Because of the marriage refuse there are also distances between Hashim and Kashaf's family, Annie breaks these distances and makes everyone live happily together. Rohaan's Family has fixed his marriage date with a girl named Esha but they are unaware of his new look, when Rohaan comes back to Pakistan everyone is shocked to see him.
Annie's mother is fed-up of her hijaab and wants her to get rid of it immediately, she is angry at Annie that no one is marrying Annie because of her new look and want her sister Kashaf for the marriage who is again refusing, it is shown that her mother blames her friend Ayesha(who is also Islamic) for her hijaab and forces her to stay away from Aysha, she is also forcing her to stop wearing hijaab which is also disturbing Annie. A new proposal comes and in order to appear in front of them Huma(Ainny's mother) tells her not to wear hijaab and also tells her that she can do what she wants after the marriage and now she has to listen to her, Annie does so and the proposal is accepted and marriage date is fixed leaving Annie sad and crying that she has disturbed her identity just for a proposal.
Episode 7-8(Climax)
Annie is disturbed with her fiancee's disturbing personality and she is disliking the fact that he wants her to go out on a date with him, Annie tells Kashaf about this and she tells her that she should be going out on a dinner with him because of which their understanding would grow, Annie agrees. The next day Annie goes to a restaurant with her fiancee on a dinner where he invites his friend, the episode focuses on the fact that he has a bad character, seeing this Ainne leaves to stop her he holds her hand and tells her that she has to stay and should listen to him, Ainne slaps him and shows him his limit after this she finishes her engagement. When she reaches home she tells everyone that she has done the right thing. After this she tells Huma that there is a charming man whom Ainne is waiting for and tells her that he would soon entire her life upon Allah's choice Huma smiles and agrees. The next morning Ainne asks her father Ajmat that she wants to join her office and through this she can prove that Hijaab is not a painful thing for women Ajmat smiles and agrees. Kashaf tells every one about Haris and gets engaged with him leaving Ajmat and Huma really happy for both their daughters
The next day in office Ainne is working and she meets Rohaan. Rohaan gets so impressed with her personality and asks her parents to take marriage proposal, her mother and sister are not happy with this decision. The other day Ainne and Rohaan's engagement takes place and it is decided that their marriage would take place in a mosque, this decision disturbs Huma, Kashaf and as well as Rohan's Mother and his sister Bina and Zubia.
The next episode starts with Rohan, his father and Amjat its is shown that they are making arrangements for the marriage, Rohan and Ainnie's Nikkah takes place and after the marriage everyone except of their fathers are shown angry with the marriage. After the marriage when Ainnie goes to her room, her Mother-in-law tells her that she always hated her and this marriage was only due to Rohaans decision and that now she has to live according to her decision this hurts Ainnie.
Next day she tells Ainnie to their take off her Hijaab in order to go to a dinner in which they were invited or their she should stay home for this Ainnie refuses to go. Haris is asking Kashaf for so many things which is disturbing Amjat.
Episode 9-13
Bina and Zubia (Rohaan's Sisters) are also the ones unhappy for the marriage, Zubia gets engaged with Hammad and it is shown that on a party she starts to dance and her video gets leaked on internet she gets very upset and scared, Annie Asks her to share her problem and while telling her Annie takes them both to her friend Ayesha's Home, Ayesha's brother helps them to pull off the video from internet and the video gets deleted. Zubia and Bina gets impressed with Annie's personality and starts to like her their mom however is accepting Annie. Kashaf and Haris are married and Annie and Rohaan invites them to a dinner in restaurant where Rohaan and Haris have little argument which further changes it into an emotional fight. Rohaan tells his parents that he has to attend a convention for his course and asks Annie to work for his office. Upon meeting Hashim he tells him that he is married. Because of Annie's Work every one in the office gets impressed including her father-in-law. Bina tries to wear Hijab but her mother yells at her and tells her to stop it, Rohaan and Hashim land to Pakistan together and Annie finds out that they both are friends and it is also revealed that Hashim has married a girl named Faryal, his mother is shocked to learn this but she accepts them home. Haris Asks for Kashaf to get him a Flat but she denies and he slaps her for this, she is kicked out and she leaves instantly, she later regrets that she would have done what Annie did, a marriage proposal comes for Zubia and she gets nervous, Annie handles her and calms her down she feels so relief and hugs her, Rohaan's Mother is watching this and she gets impressed with Annie, Shereen(Hashim's Mom) is not happy with Faryal's habits and asks Hashim that why he choose her upon Annie. Haris's dad tells him that his company has faced a loss because of him and only Rohaan can handle this, Haris talks to Rohaan and Rohaan Agrees to help Haris is now Shocked with his personality. Rohaan's mom finally accepts Annie as her daughter-in-law and now Zubia gets married.
Episode 14-16
Ainne is now living a very happy life as a wife, daughter-in-law, and as a worker due to her sweet nature she is loved by every one now. Hashim on other hand is tired of fighting between Faryal and his mother (Sheeren) he now is working with Rohaan and Ainne in their office. Haris now accepts his mistake and asks Kashaf to forgive him, Kashaf then asks Ainne and thanks her for being supportive.
These episode sequences sow that Hashim now is regretting about rejecting Ainne's proposal and wants Faryal to be a good daughter-in-law. He is feeling guilty for his bad deeds upon rejecting Ainne just because of her hijab.
Episode 17
Hashim and his Mom are telling Faryal to live according to live decently and stop her indecent acts but she tells them that she is what she always will be, further more distances have arise between Shereen and Faryal.
Next day Faryal goes to Rohaan's office in anger and tells Hashim to leave, Rohaan is not present there and Ainne tells Faryal to have coffee and tells her to wait. Faryal yells, and tells her to be quiet. Hashim gets angry at Faryal and tells her to shut up. Faryal then asks Hashim, why he rejected Ainne, if he likes Ainne more than her(Faryal). Ainne gets hurt and cries remembering her past. she takes leave from office and spends her time in depression where as Hashim tells Faryal to apologize to Ainne or else he would leave her. And Faryal also starts wearing the clothes that her mother-in-law selects for her.
Episode 18 (Last episode)
Episode starts with showing Ainne who is still depressed, it shows that Hashim and Faryal are now getting divorced when Ainne hears this news she tries her best to help them. Rohaan gets to know about Ainne and Hashim unstated relationship and tells her that he trusts her he tells her to stop them she next morning goes there and tells Hashim that she is the luckiest girl who didn't marry him and tells him that if he want Faryal to change he must change himself Faryal is shown listening to them silently and she gets to know the truth. The Last scene shown Faryal apologizing to Ainne. Every thing is settled Kashaf and Haris are also settled and the story ends happily showing Ainne Pregnant.
Reception
The Series started off with a good story and a catchy plot. In the start it received higher ratings compared to other shows. Within its first five episodes it scored higher Trps, when it reached episode 8 i.e. when the Protagonists got married the series scored a hit in trp and reached to more than 6.3Trps on average. Upon reaching more episodes the series eventually grew in Trp ratings and got highest achievement on Hum TV it has received a large number of viewers and is currently among top 10 series of Pakistan. In UK, Asia and Pakistan, according to the leading supplier of online BARB ratings reports, ‘Shanakht,’ broadcast at 20:00, garnered 116,800 viewers peaking at 172,200 viewers.
Inspiration
The drama is inspired by Haya from the most famous novel "Jannat Kay Pattay" written by Nemrah Ahmed.
Soundtrack
Shanakht'si title song is sung by Midhat, composed by Shani Haider the OST was released after the pilot episode and was appreciated.
Accolades
References
External links
Official Website
Hum TV's official Youtube
Hum TV's official Dailymotion
Hum TV's official Video channel
Hum TV original programming
Pakistani drama television series
Urdu-language television shows
2014 Pakistani television series debuts | Sadqay Tumhare her feelings often with her best friend, Humera (Sania Shamshad), while Khalil, who has been treated like the 'Prince of Punjab' his entire life and is rather arrogant, does not reciprocate the feelings that Shano feels for him. Shano is desperate to meet Khalil, as the two haven't met or seen each other for a long time. However Khalil, does not have any interest in meeting his fiancée. Shano felt this time again, she will return from her grandmother's house hopeless and disappointed. But that night Khalil has a dream, in which he saw Shano and that's when he decides | Thaandavam name is Shivakumar. He and Sharath (Jagapati Babu) complete various missions for the Indian government. Shiva and Sharath are very close friends. In the meantime, Shiva gets married to Meenakshi (Anushka Shetty), an eye doctor in Delhi. They both have the same views on marriage that one should first meet someone, become friends, fall in love, and then get married, but as their marriage happens in a hurry, they decide that they must first become friends. As time goes by, they become closer to each other and almost become the complete pair. Meenakshi decides to express her love to Shiva | but the script was altered to accommodate Baquero, who was 11 at the time. Afterward, she worked in various projects while still attending school. In 2009, she played the title role in John Connolly's horror film, "The New Daughter", with Kevin Costner, marking her first American role. In 2015, Baquero was cast in "The Shannara Chronicles", an MTV television adaptation of the Shannara novel series by Terry Brooks, in which she plays the role of Eretria; the show premiered in January 2016. Ivana Baquero Ivana Baquero Macías (born 11 June 1994) is a Spanish actress. At the age of 11, | To start, I’ll remind you of one of Tanya](’s many aliases. The researchers/journalists, led by [Andrew, that are sporadically featured in the novels that are searching for truths behind the war stumbled upon a redacted code that appears all over in military records and accounts of the war: xxxxxxxxxxx. This series of eleven redacted characters are featured prominently on accounts of drastic military victories for the Empire. Since this code almost universally occurs in places of victory for the Empire, this entity is referred to as “The Eleventh Goddess” by the journalists due to the savior-like nature of the entity.
Since the Empire](’s history that is featured in the story appears to be heavily influenced by Norse mythologies (much like the Germany in our world), I began searching through Norse Mythology and others from the area for any references to the Eleventh Goddess. In all literary accounts that I was able to find, the only Goddess (or God) to be referred to as the Eleventh Goddess in Gemanic, Slavic, or Norse mythologies is [Syn.
Syn, which means “refusal” in old norse, is a Goddess associated with defensive refusal and is listed among Frigg](’s Goddess handmaidens that reside in her Hall of [Fensalir]( In the Prose Edda book of [Gylfaginning, Syn is described as such:
“The eleventh is Syn: she keeps the door in the hall, and locks it before those who should not go in; she is also set at trials as a defense against such suits as she wishes to refute: thence is the expression, that *syn*\[1\] is set forward, when a man denies.”
Syn is also often attributed to the collective Disir. The Disir are considered to be quasi-deities that serve in similar poetic roles as the Valkyrie in the Norse Eddas. These deities can be either benevolent or malevolent unto mortals.
Tanya and the rest of her mages under her command are often referred to by their fellow soldiers and enemies as forces of nature, valkyries, or demons. I think that it wouldn’t be a stretch to compare the function of the 203 and Tanya’s role in *Youjo Senki* to the Disir and Syn’s role in the Poetic and Prose Eddas.
Syn’s role amongst the gods is to refuse entry into Frigg’s hall, which in the Norse mythos is often symbolic of home (fatherland) since it is the place where so many of the gods sprung forth. I believe that this draws a dramatic parallel with Tanya’s role in the story. They both act as a gatekeeper to their respective homes. Just as it is Syn’s role to turn away Frigg’s enemies, it is Tanya’s duty to refuse enemy’s entry to the Empire.
Carlo Zen has proven himself a history buff so it is conceivable that he went to Mythology for inspiration, but this is all just my own speculation on the matter.
So what do y'all think?
View Poll | Shanti Snyder Shanti Snyder (born 4 June 1981), better known as Shanti, is a Japanese lyricist, singer, songwriter, and music TV host of mixed descent, based in Japan and hailing from Kanagawa Prefecture. She performs with a few different formations at clubs in the Tokyo area and has also appeared with various other musical artists. Shanti's voice is well known through her collaborations with Yoko Kanno, notably in "Escaflowne the Movie", where she was the vocalist on the theme song "Sora". Shanti is a frequent lyricist and vocalist for commercials, working with many Tokyo based commercial song production companies and | Micah Solusod is an American voice actor at Funimation. His best-known role in anime has been the title character Soul Evans in Soul Eater, which was broadcast on Adult Swim's programming block Toonami. He debuted as Malek Yildrim Werner in Blassreiter, and later went on to play Toma Kamijo in A Certain Magical Index, Yuichiro Hyakuya in Seraph of the End, Yuno in Black Clover, and Yuri Plisetsky in Yuri on Ice.
Personal life
Outside of voice acting, Solusod is a freelance artist, where he posts on DeviantArt. He also works on original web comic series called Ties That Bind.
Solusod married voice actress Apphia Yu in 2016.
He is of Japanese and Filipino Descent.
Filmography
Anime
Animation
Films
Video games
References
External links
Micah Solusod convention appearances on AnimeCons.com
Living people
American male actors of Japanese descent
American male actors of Filipino descent
American male voice actors
American male video game actors
Male actors from Dallas
Male actors from Los Angeles
21st-century American male actors
American male television actors
American male film actors
Year of birth missing (living people) | 19 | Shantaram (novel) Prabhakar Kisan Khare was a real-life individual, as are the members of Khare family from the book (Kisan, Rukhma, Kishor and Parvati Khare) whose names appear on government issued identity cards. The family resides in the Navy Nagar slum where the lead character Shantaram also lived. The Khare family disputes many of Roberts' claims, although they acknowledge close association with Gregory Roberts in the 1980s. Prabhakar died in an accident in 1988 in circumstances matching the event in the book. In March 2006, the "Mumbai Mirror" reported they may have discovered the inspiration for the big smile of the character | where was the book krishna karnamrutam found | who narrates the story in kadhaprasangam | who played the role of sadhana in insaaf ki devi | which vedic literature is known for its kirtana | who does kashaf love in shanakht movie | how many daughters does parvati have in kahaani ghar ghar kii | who played the lead role in kadhalar dhinam movie | who dies in the end of the movie uthama puthiran |
20 | Uterine Leiomyosarcoma Metastasis to the Pancreas: Report of a Case and Review of the Literature | Primary leiomyosarcoma of the pancreas: report of a case treated by local excision and review of the literature | Abstract A case report of a woman with a history of breast carcinoma who presented with metastatic infiltration of uterine leiomyoma is described. The previously published literature on the subject is reviewed. | Leiomyosarcoma is an uncommon neoplasm. It occurs more frequently in the uterus, retroperitoneal space, stomach and large vessels. Metastatic leiomyosarcomas to the skin, in general, are extremely rare. Herein, we describe a patient with leiomyosarcomas of uterus who developed multiple cutaneous metastatic leiomyosarcomas on the scalp over the duration of one year. The diagnosis was confirmed by histopathological and immunohistochemical studies, which showed the tumor positively stained for desmin and smooth muscle actin, while negatively stained for cytokeratin, S-100 and CD117 (c-kit). Distant cutaneous metastases from sarcoma usually occur as a late event and carry a poor prognosis. The course in our patient is somewhat unusual, and she is still alive now, which is about 21 months after the occurrence of skin metastasis. | Hormonal manipulation of benign metastasizing leiomyomas: Report of two cases and review of the literature | Pancreatic metastasis is not common. The most usual primary malignancy of pancreatic metastasis is renal cell cancer, followed by colorectal cancer, melanoma and lung cancer. Sarcoma, especially resectable, as the primary malignancy of pancreatic metastasis is extremely unusual. In this article, we reported two pancreatic metastases cases, one is a 60-year-old woman with mammary gland stroma cell sarcoma, another is a 31-year-old man with mucous liposarcoma. Both of them have a history of the primary sarcoma. The imaging materials are in detail. The metastatic tumors are both resectable, and the final diagnoses of the pancreatic masses are proved through pathological section. | Intravenous Leiomyomatosis of the Uterus: A Clinicopathologic Study of 22 Cases | Leiomyosarcoma metastatic to the heart is rare and is usually fatal. The authors present the case of a 58-year-old woman who had a history of uterine leiomyosarcoma. Echocardiography and cardiac catheterization revealed a large right ventricular mass. Computed tomography confirmed the presence of the mass which extended into the pulmonary artery. The inferior vena cava was free of disease. At operation, a large tumour originating in the right ventricle and protruding through the pulmonary valve was found. Histologically, it was a leiomyosarcoma. Because there were numerous septal and intramural foci of tumour, complete resection was impossible, but palliative resection was performed successfully and the patient was alive and active 1 year after operation. | Primary leiomyosarcoma of the penis is very rare. Since 1930, only 53 cases have been re-ported in the international literature. We describe a case of primary leiomyosarcoma of the penis diagnosed in 2008 in a 63-year-oldman, presented to our department with a firm-fibrous mass involving the ventrolateral side of the shaft, treated with local excision and 3 times locally recurred. We also attempt a review of the literature regarding evolution, progression, differential diagnosis and possible treatment of this disease. | 20 | Introduction ::: Uterine leiomyosarcoma is an aggressive malignant tumor that often leads to metastatic dissemination, generally in the lungs, liver, brain, and bones. Despite the fact that pancreatic neoplasms spread easily, the pancreas is not a usual target organ from other neoplasms. | Uterine leiomyosarcoma with cardiac metastases. | Metastatic Primary Leiomyosarcoma of the Pancreas to the Liver: Report of a Surgically Treated Case | Abstract: We report a case of leiomyosarcoma of the prostate treated by radical cystectomy, radiation and chemotherapy. Microscopic examination revealed a mixture of incidental adenocarcinoma and leiomyosarcoma of the prostate. At 1-year followup the patient had no evidence of metastasis. | Peripheral artery leiomyosarcoma. | Abdominal aortic invasion by leiomyosarcoma | Prolonged Survival of a Young Female with High Grade Pleomorphic Leiomyosarcoma of Ovary Without Recurrence | Benign metastasizing leiomyoma: clinical, imaging, and pathologic correlation. | Benign metastasizing leiomyoma involving multiple sites: CT and MR findings |
21 | Cisco Spark Room - Peer Chat | Link to chat room found here.
Basically, it's a really insanely simple (hopefully) option for Bay Area Lyfters to coordinate their activities and give a centralized talking location for on-the-spot meetups for lunch or dinner breaks or what have you. It will also hopefully empower drivers by just having communication and being able to spread out.
The URL is easy to remember, lyftdriver.net, and you can access the chat by expanding the bottom right footer bar to open up the window. I have time stamps and smileys enabled but if the readout is wonky on a mobile device I can always change it.
Thanks! | How do you enable chat on aq worlds? | How do you able your chat on facebook? | Hey guys, I'm not sure if this has already been discussed or not. I have looked, but could not find anything. If it has, and I just missed it somewhere, please feel free to post me the link in a comment :)
**Now onto the point of the post:**
Will there be a Global Chat function? If so, will there be servers without this function? My worry is that if there is a Global chat, it will hurt more than it helps. My hope is that all forms of communication within a server will be limited to your immediate area. Sorry if it seems like a silly question, but it is something I have really strong feelings towards. :P | Create a group and you can have multi chats with the users in the group. | Sisters.
I have joined the discord, but am unable to chat. It says "You do not have permission to send messages in this channel" on all the chatrooms. Any help? If this is not a bug or problem and I simply do not yet have permission, tell me how to help get permissions, Thank you in advance sisters. | Haven't played since launch and was wondering if they implemented a global or server chat by now? If not, do they at least plan on implementing it in the future? | Hello Libp2p enthusiasts,
here is a comprehensive tutorial to build a group chat system using libp2p
OpenSource contributions are highly appreciated! | 21 | Any of you use Cisco Spark? I'm looking to create a group of people that can collaborate and bounce ideas off each other. I haven't contributed much to this Reddit but I'd find using a spark room would make it easier. I'm recruiting people that might want to build a relationship and chat around areas on improving their business, recruiting advice, growing teams, management, etc.
I'd love to connect with some like minded individuals running MSP groups of $1m+/MRR.
Let me know if anyone is interested. If you are PM me your email address to send the room link to. | Would anyone be interested in starting a discord group? | Is there a sub where people can request collaboration? | Is there a general discord? | Are any alliance leaders interested in seeing how I run my alliance's discord or need some tips? | Are there any online spirit companion groups? | Is there any good European option discord groups? | trader chatgroups/networking | Anyone know of any online live groups using skype or google hangouts? |
22 | what award did bryan cranston win for his role in cosby | Leonard Part 6 fraction of its $24 million budget. The movie won three Golden Raspberry Awards, for Worst Actor (Cosby), Worst Picture, and Worst Screenplay (Jonathan Reynolds and Cosby). It was nominated for two more Razzie Awards, for Worst Supporting Actress (Foster) and Worst Director (Weiland). A few weeks after the ceremony, Cosby accepted his three Razzies on Fox's "The Late Show." He demanded that the three Razzies he earned be specifically made out of 24 karat (99.99%) gold and Italian marble, which were later paid for by Fox. Cosby himself later brought the awards with him when he was a guest on | Chris Crocker that with Crocker's thousands of Facebook and Twitter followers, he is "one of those self-invented social media icons". Crocker was born in East Tennessee to a teenage couple and was raised by his grandparents. Crocker said he "raised eyebrows" by bringing Barbie dolls to kindergarten for show and tell rather than the toys or action figures more conventionally associated with boys. Crocker continued to live in Tennessee throughout his youth, and was homeschooled in response to constant "death threats, bullying and glares at his clothes and makeup" specifically after allegedly being "harassed by a homophobic high school gym coach". Crocker | American Video Awards naming the awardee have been found thus far. Casey Kasem along with Toni Scotti and Syd Vinnedge of Scotti Bros./Syd Vinnedge Productions, served as executive producers of the show, which was taped in advance and edited down to one hour for broadcast. Accordingly, only eight "artistic" award categories made it on the air, listed by Daniel Brogan of the "Chicago Tribune" as: "Best Pop Video, Best Urban Contemporary Video, Best Country Video, Best New Group, Best Male Performance, Best Female Performance, Best Duo or Group Performance and Best Home Video." Two videos by Bruce Springsteen won in three categories, but | by hot, humid summers and generally mild to cool winters. According to the Köppen Climate Classification system, Crockett has a humid subtropical climate, abbreviated "Cfa" on climate maps. Crockett, Texas Crockett is a city in Houston County, Texas, United States. As of the 2010 census, the city population was 6,950. It is the fifth oldest city and the county seat of Houston County, the oldest county in Texas. The town was named after David Crockett, who reportedly had camped nearby on his way to the Alamo; the site was very near the Old San Antonio Road. A family from Tennessee | the 4th Canadian Screen Awards in 2016, for Best Picture, Best Supporting Actor (Tony Nardi) and Best Costume Design (Judy Jonker), and 10 Jutra Award nominations at the 18th Jutra Awards. Corbo (film) Corbo is a Canadian drama film from Quebec, written and directed by Mathieu Denis. Based on a true story, the film stars Anthony Therrien as Giovanni (Jean) Corbo, the privileged but socially alienated son of wealthy Italian-Canadian businessman Nicola Corbo (Tony Nardi) and his wife Mignonne (Marie Brassard), who becomes radicalized after a chance meeting with two young activists (Karelle Tremblay and Antoine L'Écuyer) draws him into | also appeared on Broadway in "Passione". On October 26, 1992, Cronin died of cancer at the age of 53 at Northwestern Memorial Hospital. Laurel Cronin Laurel Cronin (October 10, 1939 – October 26, 1992) was an American actress, singer and dancer. Cronin was born on October 10, 1939, to Frank and Elizabeth Lewis. She had a son, Christopher, and a daughter, Jennifer. She maintained a residence in Oak Park, Illinois, for twenty years. Prior to her move to Los Angeles in 1990, Cronin worked thirty-five years of her career in theatre based in Chicago. In 1987, she won the Joseph | 1977 Australian Film Institute Awards Costume Design and Best Art Direction, and the award for Best Original Music Score was reinstated after it had not been given since 1973. The recipients of the peer voted feature-film awards included the film "Storm Boy", for Best Film; Bruce Beresford for Best Direction, for "Don's Party"; John Meillon for Best Actor, for "The Fourth Wish"; and Pat Bishop for Best Actress, for "Don's Party". Charles Chauvel received the Raymond Longford Award posthumously for his contribution to Australian screen culture and environment, and was presented to his wife Elsa Chauvel. "Storm Boy" was nominated for nine awards but only | Bill Cratty Bill Cratty (February 28, 1951 – September 9, 1998) was an American modern dancer and choreographer. Born William Anthony Cratty in Cleveland, Ohio, Bill Cratty began his dance training with tap and gymnastics lessons at the age of 5. He stopped his lessons (according to him, because too much practice was required; according to his mother, because Cratty's brothers teased him about dance) and didn’t resume dancing until high school, when he became involved in the school musical productions. Cratty went on to attend Ohio University where he received a BFA in dance in 1973. The six-foot one-inch | 22 | Bryan Cranston series was met with widespread critical acclaim, winning him the Primetime Emmy Award for Outstanding Lead Actor in a Drama Series in each of the show's first three seasons and being nominated in 2012 and 2013 for seasons four and five (winning again in 2014 for the second half of season 5). Cranston and Bill Cosby are the only actors to have won the award three consecutive times. Cranston was also a producer for the fourth and fifth seasons of the series, and directed three episodes of the show during its run. In 2011, Cranston had supporting roles in three | what is the name of the second drama series to win all acting awards in star awards | which us tv drama won two major awards at the 61st emmy ceremony | How many emmys has 60 minutes TV show won? | Which Trek actors have won Oscars (for any role at all, not necessarily Trek related)? | where is the 3rd international emmy awards held | The Full List Of Emmy Winners 2014 | List of television programs with the most Primetime Emmy Awards per ceremony | how many rounds are there at the international emmy awards |
23 | and especially like the USB input | Greatly improved convenience compared to hooking up to the computer USB port. | The only thing I don't like of it: USB ports are very small and you don't connect flash drives with ease | What are some examples of input devices on a personal computer? | Keyboard and mouse function effectively. Both have the superior grade feel. | The only good thing about this is the mouse pad, it stutters quite frequently, like its stuck, the home button never return you home and the esc button does not work, crap dnt waste your money, glad it only cost a few bucks. | Faulty USB port. It has failedd just like a phone would if your had damaged the port. I have only had it a couple of weeks and not happy with it at all. | Every now and then the receiver itself would freeze up and had to be turned off and turned back on, but that rarely happened when playing music from a USB drive. Besides that, for what it cost it was a great Radio/MP3 Player. | cant overite the usb. love it. can install home edition all day. | 23 | Compact, all necessary connections for me, and especially like the USB input. Plug in a bunch of mp3's with the USB and it's all good. Very high volume without distortion. I did have to return the first one, that transaction went well. Second unit is working great. | Very compact but has excellent sound quality | Very small and compact yet the clarity and bass will fill up a room easily! We love this speaker | Compact sound at a great price | Compact with quality sound | great mp3 player.very small n BIG sound. holds around 200 songs | Relatively compact system for the big sound you get | It is compact and easy to connect with my Iphone 5s | Amazing sound and compact |
24 | Adaptive mode tuning for vibrational gyroscopes | The problem of adaptive control of a single-axis vibratory gyroscope with drive motor is considered. Sliding mode with tuning surface control is designed. The design procedure, conditions of applicability, analysis of the stability of an adaptive control system and simulation results are presented. | This paper describes a low-cost silicon vibratory gyroscope that tolerates a relatively large mismatch between the driving-mode and sensing-mode frequencies. The gyroscope is based on beam-mass structure and realized by one silicon proof mass and two beams for the driving and sensing mode. Piezoelectric actuation is used to produce a large driving mode vibration displacement (about 100 mum) with about 32 Vpeak-to-peak. Two tiny sensing beams are separated from the vertical silicon beam to increase the sensitivity while keeping the sensing-mode resonant frequency high. Piezoresistive and piezoelectrical sensing mechanisms are applied to two different gyroscopes. The gyroscope operating at 1-4 kHz is capable of sub-degree-per-second angular rate sensitivity without any vacuum package. | Focusing on a typical tuning fork vibratory micromachined gyroscope,this paper introduces a sensitivity analysis method to the analysis and optimization of complicated multi-DOF model.It requires a dynamic sensitivity analysis to the 24 design parameters of the gyroscope by examining each parameter's influence on the natural frequencies of the driving mode and sensing mode.And then five influential parameters that are most influential on the output performance are determined as the design variables for the following structural optimization.An optimal structure of the gyroscope is obtained by an optimization procedure.The proposed method reduces much of the difficulties in the conventional design method,such as the amount of calculation and analysis period,and can be a reference for the structural design and optimization of MEMS. | Mode competition and control in higher-power gyrotron oscillators | We designed, fabricated, and experimentally demonstrated a dynamically balanced z-axis MEMS vibratory gyroscope utilizing the concentrated suspension architecture. This architecture allows for a high degree of structural symmetry (degeneracy of modes), potentially enabling high precision Rate Gyroscopes (RG) and Rate Integrating Gyroscopes (RIG). The full dynamic balance of the design is enabled by two concentric masses that oscillate in anti-phase as an unconstrained tuning fork, in any direction in-plane of the substrate. Experiments demonstrated a sub-Hz, as fabricated, frequency split (Δf) of 190mHz (0.19Hz) confirming the objective of the architecture. The high level of symmetry makes the gyro robust against temperature variations, demonstrating less than 50mHz variation of Δf in a broad range of temperatures, from −30°C to 100°C. | The invention discloses a dynamically tuned gyroscope servo control loop which is composed of a gyroscope gauge outfit, a torquer and a controller. The controller is composed of a second-order integration element, a differentiation element, a low-pass filter and the like. For the transfer function of the controller, two integration elements are used by the dynamically tuned gyroscope servo control loop for the first time so that a system becomes a II-type system. By means of the second-order integration element, errors relevant to constant disturbance torque can be eliminated, so that the stability precision of a servo loop system is improved. The differentiation element is used for increasing the gain and phase margin of a low-frequency stage, unconditionally stabilizing the system and improving the robust stability of parameters. The low-pass filter is used for eliminating high-frequency noise. | Acceleration-insensitive fully-decoupled tuning fork (FDTF) MEMS vibratory gyroscope with 1°/HR BIAS instability | This paper presents a new tuning fork gyroscope structure with a highly linear coupling mechanism that keeps the phases of the drive mode oscillating masses exactly opposite with the help of a symmetrically anchored ring-shaped spring. This structure eliminates the risk of drive mode instability due to any lower frequency structural modes and provides very linear drive mode oscillations together with very low g-sensitivity. The gyroscope is fabricated with the SOI-MUMPS process of MEMSCAP. The fabricated gyroscope has bias instability and angle random walk of 200 deg/hr and 5.47 deg/Vhr, respectively, according to Allan Variance curve. The g-sensitivy and scale factor are measured as 9.3 (deg/hr)/g and 12 mV/(deg/sec) with an R2 nonlinearity of 0.05%. | 24 | We present an adaptive controller for tuning the natural frequency of the drive axis of a vibrational gyroscope. This is an attractive alternative to a phase-locked loop, since it introduces feedback, which can reduce the effects of imprecise fabrication. We also operate the gyroscope at a fixed frequency, chosen by the designer, which can simplify signal processing. | Frequency Tracking and Locking Method Used in Resonator Micro-Optic Gyro | The Analysis of Motion Principle of Symmetric Gyroscope | The paper deals with the principles of single-axis vibratory gyroscope operation. A mathematical model for a single-mass vibratory gyroscope and some modes of its operations are considered and relations between measured values (angle of rotation or angular rate) and sensitive mass generalized coordinates are described. Some details for the forced oscillations mode used in measuring of the angular rate and for two modes of natural oscillations used in measuring of the rotational angle and angular rate are described. A new method for identification of anisoelasticity in a single-axis vibratory gyroscope is suggested. | Natural Frequencies of a Free Gyroscope Supported in Gimbals on an Elastic Shaft | Trident-type tuning fork silicon gyroscope by the phase difference detection | A scheme for improving the performance of a gyroscope-free inertial measurement unit | Stabilization of gyroscope with fiber amplifier/source configuration by tracking of optimum modulation condition | Time-Varying AngularRateSensing foraMEMS Z-Axis Gyroscopel |
25 | Applications of Self-assembly Technology in MEMS | Opto-electronic and MEMS/MOEMS packages require unique capabilities over and above traditional hermetic multichip modules. In addition to hermeticity or vacuum atmosphere, opto-electronic systems require direct input/output of optical, RF and other sensitive signals through the package using fiber-optic, coaxial and/or other interconnection approaches. Precise optical component alignment and accurate thermal management is critical to achieve component and system performance capabilities. Furthermore, to improve MEMS functionality, performance and service life, a suitable getter and/or dopant is required compatible with the hermetic/vacuum package atmosphere. The getter/dopant is usually activated after achieving hermetic or vacuum atmosphere. A comprehensive MEMS packaging approach is introduced based on thick film/LTCC and brazing technology, the new approach incorporates most reported MEMS packaging requirements for proven reliability, low cost and mass production capabilities. | For some MEMS based chemical sensors, it is desirable to incorporate 3D features such as enclosed reaction chambers and both chemical & electrical I/O. Like most other MEMS devices, it is preferential to create all of these features at the wafer level. Although wafer level integration has the potential to simplify back-end & packaging requirements, improve device performance, and reduce size & cost, developing reliable processes is a significant challenge. This paper reviews our process development efforts, including some practical tips and tricks for prototyping MEMS in an R&D environment. Test devices specifically designed to assess the key processes of low cost through wafer via creation and thermocompression wafer bonding were fabricated and characterized by simple electrical and mechanical testing. Process implications are offered for both the chemical sensors of interest as well as other MEMS devices. | MEMS chips that are to be implemented into higher-level functional modules are typically composed of exposed structures that may be vulnerable to conventional wafer and die handling. Thus, successful commercialization of such components requires special and low-cost approaches to separate individual die from wafers and to handle them. In this paper, a dedicated snapping process is described and used for MEMS wafer dicing as a replacement for standard sawing strategies, which are unsuitable for this category of non-encapsulated Optical MEMS devices. The developed process allows successful low-cost, high-yield singulation of on-wafer tested chips in a simple, harmless and clean manner with standard pick-and-place semiconductor equipment. | Micromachining of packaging materials for MEMS using lasers | A quasi-dry MEMS release process and release apparatus for research facilities and small volume fabrication companies is presented. The new apparatus is dedicated to the development of specialized MEMS devices that are not realizable by conventional processes. | Industrialization of MEMS devices such as silicon-based sensors and actuators requires specific tools to verify that their mechanical properties and/or motions obey the designer's's intent. Accordingly, this paper investigates new on-chip laboratories that will allow systematic mechanical analysis of MEMS-based structures and materials. | Developments in Microelectromechanical Systems (MEMS): A Manufacturing Perspective | MEMS devices must be packaged to be used. Unfortunately, MEMS packages are challenging to develop, and the packaging of MEMS devices often dominates the cost of the product. In recent years, our group has worked with a team from Bosch to develop and demonstrate a novel wafer-scale encapsulation approach for MEMS. This process uses MEMS fabrication steps to build the device and the package at the same time. The main advantage of this approach is that the wafers emerge from the fabrication facility with all the fragile MEMS structures completely buried within the wafer, allowing all existing standard handling and packaging approaches, such as wafer-dicing, pick/place, and injection mold packaging to be used. This encapsulation process enables CMOS integration, embedding, and extreme miniaturization of complete systems. In this paper, we describe some advantages for performance, size and cost that can come from this approach. | 25 | Self-assembly (SA) phenomenon was first observed in micro bio-chemical field where micro cells organize themselves in a specified form spontaneously. Since then it has been widely used in dif- ferent fields to generate new functional materials, devices and structures. As a "bottom-up" scheme, this approach can be potentially used to fabricate new devices and structures other than conventional tech- nologies in MEMS and NEMS area. This paper describes the technological evolution of SA technology and reviews typical SA methods by means of surface tension, capillary force, magnetic force, electro- static force and stress, etc. The promising application in MEMS in the future is also discussed. | Capillary Force Driven Self-Assembly of Anisotropic Hierarchical Structures Prepared by Femtosecond Laser 3D Printing and Their Applications in Crystallizing Microparticles | Construction of supramolecular self-assembled microfibers with fluorescent properties through a modified ionic self-assembly (ISA) strategy. | Nanotechnology demands the synthesis of highly precise, functional materials, tailored for specific applications. One such example is bit patterned media. These high-density magnetic data-storage materials require specific and uniform magnetic nanoparticles (MNPs) to be patterned over large areas (cm 2 range) in exact nanoscale arrays. However, the realisation of such materials for nanotechnology applications depends upon reproducible fabrication methods that are both precise and environmentallyfriendly, for cost-effective scale-up. A potentially ideal biological fabrication methodology is biomineralisation. This is the formation of inorganic minerals within organisms, and is known to be highly controlled down to the nanoscale whilst being carried out under ambient conditions. The magnetotactic bacterium Magnetospirillum magneticum AMB-1 uses a suite of dedicated biomineralisation proteins to control the formation of magnetite MNPs within their cell. One of these proteins, Mms6, has been shown to control formation of magnetite MNPs in vitro. We have previously used Mms6 on micro-contact printed (mCP) patterned self-assembled monolayer (SAM) surfaces to control the formation and location of MNPs in microscale arrays, offering a bioinspired and green-route to fabrication. However, mCP cannot produce patterns reliably with nanoscale dimensions, and most alternative nanofabrication techniques are slow and expensive. Interferometric lithography (IL) uses the interference of laser light to produce nanostructures over large areas via a simple process implemented under ambient conditions. Here we combine the bottom-up biomediated approach with a top down IL methodology to produce arrays of uniform magnetite MNPs (86 AE 21 nm) with a period of 357 nm. This shows a potentially revolutionary strategy for the production of magnetic arrays with nanoscale precision in a process with low environmental impact, which could be scaled readily to facilitate large-scale production of nanopatterned surface materials for technological applications. | Robotic Microassembly of 3D MEMS Structures | A floating self-assembly route to colloidal crystal templates for 3D cell scaffolds | One basic principle regulating self-assembly is associated with the asymmetry of constituent building blocks or packing models. Using asymmetry to manipulate molecular-level devices and hierarchical functional materials is a promising topic in materials sciences and supramolecular chemistry. Here, exemplified by recent major achievements in chiral hierarchical self-assembly, we show how chirality may be utilized in the design, construction and evolution of highly ordered and complex chiral nanostructures. We focus on how unique functions can be developed by the exploitation of chiral nanostructures instead of single basic units. Our perspective on the future prospects of chiral nanostructures via the hierarchical self-assembly strategy is also discussed. | Manufacturing cell formation using artificial immune system | Macro- and Microtribology of MEMS Materials |
26 | who did joey lawrence play on blossom | Joey Lawrence Joseph Lawrence Migogna Jr. (born April 20, 1976) is an American actor, musician, and game show host. He is known for his roles as Joey Donavan on "Gimme a Break", Joey Russo in "Blossom", Joe Roman in "Brotherly Love", and Joe Longo in "Melissa & Joey". Lawrence was born in Philadelphia, Pennsylvania, the son of Donna, a personnel manager and former elementary school teacher, and Joseph Lawrence Mignogna Sr., an insurance broker. He is of partial Italian descent. His family's surname was changed to "Lawrence" during his childhood. He has two younger brothers, Matt and Andy, who are | Joey Lawrence also actors. He graduated from Abington Friends School in Jenkintown, Pennsylvania, in 1994, and later attended the University of Southern California. Lawrence's first acting role was in a Cracker Jack commercial. At the age of five, he appeared on "The Tonight Show Starring Johnny Carson", where he performed the song "Give My Regards to Broadway". After appearing in guest spots on "Diff'rent Strokes" and "Silver Spoons", Lawrence won the role of Joey Donovan on the hit NBC sitcom "Gimme a Break!" in 1983. He continued in that role until the series ended in 1987. 1985 marked Lawrence's theatrical debut with | Joey (TV series) with All the Jealousy". Patrick Kerr, who played the producer of the Daytime Soap Awards, appeared in one episode of "Friends" as a restaurant manager who auditions Monica for a job as a chef. Brent Spiner, who played himself, appeared in one episode of "Friends" as James Campbell, who interviews Rachel for a job. Additionally, Robert Costanzo reprised his role as Joey's father, a character who originated in the first season of "Friends", in "Joey and the Dad". Costanzo was the only actor besides LeBlanc to play the same character in this series as in "Friends" (Gina appeared in a | and Andy called Still 3. They released their debut single "Lose Myself". Lawrence married Michelle Vella in 2002; the couple divorced in 2005. He met his second wife, Chandie Yawn-Nelson, earlier while on vacation in Disney World when the two were teenagers; they wed there in July 2005. The couple have two children. Reports surfaced in March 2018 that Lawrence and Yawn-Nelson had filed for bankruptcy in July 2017. On 6 April 2018 the Chapter 7 bankruptcy case was reportedly settled. Other non-charting singles Joey Lawrence Joseph Lawrence Migogna Jr. (born April 20, 1976) is an American actor, musician, and | Pal Joey (musical) socialite Vera Simpson arrives at the club and shows a definite interest in Joey. Joey plays hard-to-get and insults Vera, who walks out. Mike, the club owner, fires Joey, but Joey, believing Vera will be back, strikes a deal: if Vera doesn't come back within the next few days, Joey will leave without pay. The chorus girls continue with the show ("That Terrific Rainbow"); Linda, having witnessed Joey's caddish behavior, has left the club. Vera doesn't return, so Joey is fired. When Linda refuses to answer his calls, Joey calls Vera ("What is a Man"). After Joey's last night as | Joey Rainbow first. Casey catches Joey's eye but she rebuffs his advances and is only interested in Liam. The three of them begin hanging out together and find themselves in mortal danger one day when a shark attacks the boat they are in. Joey makes another friend in Stephanie when she joins their group. Stephanie later dies in a fall. Tiegan arrives in Summer Bay as Pippa Ross' (Debra Lawrence) newest foster child and Joey helps her with illiteracy; They grow closer but Tiegan is transferred to another family. Irene's surrogate baby son, Paul is kidnapped by Wendy Bachelor whose husband served | Pete and Gladys Pete and Gladys is an American sitcom television series starring Harry Morgan and Cara Williams that aired on CBS on Mondays at 8:00 p.m. Eastern and Pacific time for two seasons, beginning on September 19, 1960. The last episode was broadcast on September 10, 1962. One of CBS television's most popular and highly rated sitcoms of the 1950s, "December Bride", starred Spring Byington and Harry Morgan as next-door neighbor Pete Porter. Pete spent most of his time complaining about his scatterbrained wife Gladys, who was unseen to viewers. In this spin-off series, Gladys emerges as the redhaired | Pete and Gladys Pete and Gladys is an American sitcom television series starring Harry Morgan and Cara Williams that aired on CBS on Mondays at 8:00 p.m. Eastern and Pacific time for two seasons, beginning on September 19, 1960. The last episode was broadcast on September 10, 1962. One of CBS television's most popular and highly rated sitcoms of the 1950s, "December Bride", starred Spring Byington and Harry Morgan as next-door neighbor Pete Porter. Pete spent most of his time complaining about his scatterbrained wife Gladys, who was unseen to viewers. In this spin-off series, Gladys emerges as the redhaired | 26 | Joey Lawrence the release of "Summer Rental". Lawrence provided the voice of Oliver, the protagonist in the 1988 Disney film "Oliver & Company". From 1991-95, Lawrence co-starred in the hit TV series "Blossom", playing "Joey Russo". Lawrence has also starred in the series "Brotherly Love" (which featured his real life brothers, Matthew and Andrew Lawrence) and "Run of the House", and has guest starred on such programs as "American Dreams" and "". One of Lawrence's film credits is "" (2000). In 2006, Lawrence appeared on ABC's "Dancing with the Stars". Paired with professional dancer Edyta Śliwińska, he placed third in the competition. | steve lawrence sang the theme song to which tv series | what was the name of eddie lawrence’s last cartoon | how many nights did bob ralston play at the lawrence welk show | what instrument did vince lawrence play on the first house record | when did stephanie lawrence first appear in ballet | who did david lawrence play in the unit | in which disney cartoon did bill scott play the part of moosel | when did joey rainbow go from home and away |
27 | Some lifter told me "protein increases hydration," no idea what he meant. | Does protein help muscles? | Strength training not additionally increase fat-free mass or muscle size or strength. Protein that is neither needed for cell growth and repair nor consumed for energy is converted into urea mainly through the deamination process and is excreted by the kidneys. It was once thought that a high-protein diet entails risk of kidney damage, but studies have shown that kidney problems only occur in people with previous kidney disease. However failure to properly hydrate can put an increased strain on the kidney's ability to function. An adequate supply of carbohydrates (5–7 g per kg) is also needed as a source of energy | What happens if you injest too much protein? | Admittedly, tim ferris is someth8bg of a douche, but im wondering if his "have 30g of protein within 30mins if waking" has any science backing? Have googled and cant find anything conclusive. | Do protein shakes gain weight? | How much protein do you need for muscle growth? | What does it do to your body ?Why does your body need Protein ?Where do you get Protein from ? | What the consequences of protein intake? | 27 | He said the words "protein increases hydration." He was talking about how he would finish his protein drink after taking a shot of 151 because it will increase his hydration (met him at a party). I said "you mean, 'requires increased hydration?'" and he just said "no, increases hydration" back to me. He was either 100% wrong about protein metabolization or he was talking about something completely different. Either way I dropped it.
I was thinking about how your body requires more water to metabolize protein (vs fat/carbs). Otherwise, I have no idea what he was talking about.
Guy seemed pretty legit too, about 5'10", said he was 200-210 lbs, and claimed his powerlifting combined weight was 1300lbs. I'd believe it, he definitely looked like he was doing something right.
Anybody wanna tell me what he was talking about? | Is this guy's lecture on protein a bunch of shit or is he actually right about some things? | What are the 'real world' effects of removing water from (meat) protein? | Easier to gain muscle when lower BF%? How true is this? | What happens when someone has too much protein? | Protein absorption, why are people so counter-intuitive on this? | Expected water weight gain from Creatine. | what type of supplements did kerry kayes use to help him get his weight back | The Protein-Sparing Modified Fast for Adolescents With Severe Obesity: A Case Series |
28 | But if your just wearing it a few times it will be fine. | While I knew I was not getting a quality product I assumed it would last through one wearing, which it didn't. | [Light]
Sometimes even if I already wore the pants I want to the previous day. It just saves me a lot of time - I take forever to get ready.
Plus its winter, so I usually wear a sweater anyway. Nobody will see the wrinkles. Am I worried about my clothes being dirty in bed?
My bed isn't spanking clean right now, so it really doesn't matter if I sleep in dirty clothes. | I wear this whenever I am at the pool, which is almost every day. If I have a break in between students I wrap up and it dries quickly. I also use it after I shower to warm up and dry off. I folds nicely into my bag and I have had several comments about it. | Its okay for the short term. Wore out leather and clip wore thru but in all fairness this occurred after about 9 months | it broke in the first day I wore it. It was pretty though. | I purchased this about 6 months ago and I have worn it almost everyday! I spend most of the summer in the pool and it has been great. I shower and swim with it on a regular basis and have had no issues. I was concerned about the rubber on the band making my wrist sweaty but it hasn't been an issue. I would buy again in a heartbeat - it was a great decision. | Only issue. Somehow the dye has rubbed off on most of my underwear, bras and messed up a couple of my shirts. Thinking of letting it soak over night. | I wore it one time. Washed it and it doesn't fit anymore. Which is a shame I really liked it. | 28 | Started to rip at the seams after wearing after a few weeks. But if your just wearing it a few times it will be fine. | only had it a few months and under normal wear ... | ... already have torn seams before wearing even once are great. I had two pairs in this pack have ... | Seam separated on first wearing | I can still wear it but I'm worried it will break for good. | but I think it will be fine after wearing | It will probably last a long time because I don't like wearing it on other days due to the novelty ... | My only question is how will it hold up when it is worn but other than that it looks great! | Falls apart within 12 hours of wearing it. |
29 | Fun for even the pickiest kitty | Cats are not picky about their toys but my cat loves this. This gives her a place to both play and kneed. | This was a cool toy, my cat didn't play with it as much as I hoped even with the cat nip lol | Best cat toy I've bought yet. When you sprinkle cat nip in the middle, it drives the cats nuts! They love this toy and when they are inside during long cold winter days, this is the toy that brings them "back to life"! Well worth it! | Even my very shy and super cautious kitty likes this toy. It took her 5 hours to sneak up on it when I first got it (did I say she's very cautious?) but now she plays with it a lot.
P.S. Bought the "CatnipKiss" compressed catnip ball and it fits purrfectly in the outer track :) | My cats love it they keep playing it all night long lol won't stop they even fight over the mouse who gets to play next i have to buy more one for each kitty lol | Cats love this, they think its fun for one to sit at each end of the tell then the other darts out and scares each other its so cute! Its great how you can collapse it to put it away if company coming over and very durable considering kitties paws | my cats don't like the string treats. so i just fill up the container with catnip and they play with it to get the catnip out of the hole in the bottom of it. its great for that. but the strings...not so much. | My cats go crazy for this toy! It's well made and a great deal with the extra feathers. | 29 | This was bought as a gift and reported to be fun and very much appreciated by the picky cat that received it. | This was bought as a gift for a cat lover ... | so then ordered this one and its perfect. My cat loves it | It is a cute item and I can see how a kitten would like it. | Got it for my tabby cat, she loves it ... | love this so does my cat | My mom's cats loved this! It's a great gift | Gave this item as a Christmas gift to a pet ... | This is a great gift for cat enthusiasts |
30 | Simultaneous enhancement of B-mode axial and lateral resolution using axial deconvolution | Although significant progress has been achieved in microwave imaging, high/super-resolution imaging remains a long-sought-after goal. A subwavelength imaging based on temporal–spatial random illuminations is experimentally investigated. Experiments are conducted using a single-frequency array aperture with random phase modulation. The inversion is performed by two different algorithms based on the linear imaging model, and the results show that the location and profile of the object can be successfully reconstructed in a subwavelength scale. In contrast to the broadband meta-assisted imager, an imaging resolution of $0.6\lambda $ is achieved while the spectrum/energy efficiency are both guaranteed in the proposed imaging system. These imply the potential of the presented subwavelength imaging method for practical applications. | The presented work demonstrates that using a true logarithmic amplifier to precondition the frequency clock signal in swept source OCT can obtain optimal calibration hence improve the imaging performance such as axial resolution and SNR. | This paper considers techniques for creating enhanced resolution images from irregular samples, with specific application to imaging from scatterometers. Using previously established irregular sampling theory and developing the idea of sub-band limited Banach space, the authors show that frequency content in attenuated sidelobes can be recovered using resolution enhancement techniques, thus taking advantage of the high frequency content of measurements made with imperfect low pass aperture filters. They briefly compare and contrast the performance of additive ART, multiplicative ART and the Scatterometer Image Reconstruction (SIR) (a derivative of multiplicative ART) algorithms with and without noise. | We propose a new method which enables improved spatial resolution of a reconstructed image from a gamma camera emission CT(SPECT). SPECT images are blurred due to the effect of the collimator aperture. The blur effect changes with the geometrical structure of the collimator and with the distance between the rotational center of the gamma camera and the collimator surface. The acquired projection, affected by the collimator aperture, can be assumed to be the convolution of the ideal projection by the shift-variant blur functions. So the measured projection will be represented as a weighted summation of neighboring ideal projections of different angles and positions. From this standpoint, the blur function can be defined as a function of a common spatial frequency in the Fourier domain. Hence the deconvolution of the measured projection was circularly processed in the frequency domain. The effectiveness of the method was proven by simulations involving various aperture angles and the distances between the collimator surface and the rotational center. | The inhomogeneous imaging advantages offered by finite amplitude distortion appear to be obtainable in an indirect fashion. Instead of acquiring images based on the accretion of amplitude in a higher harmonic bandwidth, comparable images could be obtained using the corresponding depletion of amplitude from a lower harmonic bandwidth. Such an approach offers some advantages over traditional harmonic imaging, including reduced bandwidth demands, and more generally could be a useful complement to the traditional approach. | Optical resolution through atmospheric turbulence with finite outer scale | General and efficient super-resolution method for multi- slice MRI | Balanced reference-sample arm dispersion is critical in optical coherence tomography systems in order to attain images with the highest axial resolution. Here, an experimental method for the estimation and correction of dispersion in an optical coherence tomography system is presented. The system dispersion was computed from two optical coherence tomography images of the reference mirror that were symmetrically placed around the zero delay point. The method was tested using a broad bandwidth spectral domain optical coherence tomography system, compensating for the dispersion caused by a 3-mm-thick fused silica flat placed in the sample arm. Using our method, dispersion compensation was achieved and the axial resolution was improved from 10.6 µm to 1.9 µm in air. Results suggest that this technique can be a simple and effective technique for eliminating axial resolution degradation due to dispersion mismatch between the sample and reference arm in high-resolution optical coherence tomography systems. | 30 | Enhancement of image resolution in ultrasound images is key to help clinicians end early indicators of pathological lesions. Image resolution enhancement relies on deconvolving the point spread function (PSF) of the imaging system out of the raw ultrasound image prior to envelope detection and other postprocessing steps. Unfortunately, in most cases the PSF is spatially variant, complicating its estimation and subsequent use in deconvolution. The current work is driven by the realization that the PSF can be decomposed into spatially invariant and variant components, namely the electric and geometric responses of the transducer element(s). Since the electric response acts along the axial direction, depth-independent axial deconvolution can be performed along the entire image. Moreover, since axial deconvolution effectively shapes the frequency response of the transducer, lateral resolution can also be enhanced. Using simulated and experimental data from two single element transducers (of 20, 35 MHz nominal... | Ultrasound computed tomography techniques have the potential to provide clinicians with 3D, quantitative and high-resolution information of both soft and hard tissues such as the breast or the adult human brain. Their practical application requires accurate modelling of the acquisition setup: the spatial location, orientation, and impulse response of each ultrasound transducer. However, existing calibration methods fail to accurately characterise these transducers unless their size can be considered negligible when compared to the dominant wavelength, which reduces signal-to-noise ratios below usable levels in the presence of high-contrast tissues such as the skull. In this paper, we introduce a methodology that can simultaneously estimate the location, orientation, and impulse response of the ultrasound transducers in a single calibration. We do this by extending spatial response identification, an algorithm that we have recently proposed to estimate transducer impulse responses. Our proposed methodology replaces the transducers in the acquisition device with a surrogate model whose effective response matches the experimental data by fitting a numerical model of wave propagation. This results in a flexible and robust calibration procedure that can accurately predict the behaviour of the ultrasound acquisition device without ever having to know where the real transducers are or their individual impulse response. Experimental results using a ring acquisition system show that spatial response identification produces calibrations of significantly higher quality than standard methodologies across all transducers, both in transmission and in reception. Experimental fullwaveform inversion reconstructions of a tissue-mimicking phantom demonstrate that spatial response identification generates more accurate reconstructions than those produced with standard calibration techniques. | Robust minimun variance beamforming applied to ultrasound imaging in the presence of phase aberration | Constrained Least Squares Filtering Algorithm for Ultrasound Image Deconvolution | Biomedical Ultrasound Image Enhancement using SRAD | The speckle noise is one of the prominent features found in ultrasound images and it tends to degrade the quality of the image. There is a historic success in the works towards this approach particularly in the medical field related to image de-speckling. In this paper, a scale-space nonlinear anisotropic diffusion process and circular median filter is being combined with un-sharp masking to filter out the speckle noise from the ultrasound images. However, the performance evaluation and the comparison of both the filters are being done at each level of the process by comparing the various parameters of image quality measures. The nonlinear anisotropic diffusion filter has found to be performing better by two decimal point values in comparison to the circular median filter. | OBJECTIVE ::: This study presents an improved point-spread-function (PSF) mapping-based distortion correction method and accelerated PSF acquisition for distortion correction in EPI without loss of quality or reliability compared to full encoding. ::: ::: ::: MATERIALS AND METHODS ::: To correct geometric distortions accurately, the PSF in the EPI phase-encoding coordinates (EPI-PSF) was measured and used as a kernel for distortion correction. FOV reduction was applied in the PSF mapping dimension for highly accelerated PSF acquisition. A novel approach for fold-over artifact correction in this reduced dimension is introduced. Conventional gradient-echo EPI and corresponding full PSF reference data were acquired in phantoms and in human brain at 7 T. The distortion corrected EPI data with the proposed acceleration were compared to result with full encoding. Previously published interpolation methods based on shift maps, non-uniform Fourier transformation and a b-spline interpolation were compared with the proposed method. ::: ::: ::: RESULTS ::: The results demonstrate that the proposed method corrects geometric distortions in EPI with high accuracy and quality despite the high acceleration. In contrast to partial parallel imaging acceleration, no noise enhancement is introduced. ::: ::: ::: CONCLUSION ::: The proposed EPI-PSF-based distortion correction improves correction of EPI and accelerates PSF reference data acquisition and computation. | Phase Reversed Image Reconstruction Method of Industrial Ultrasonic CT | Background:Our purpose was to check the potential ability of oversampling as a method for computed tomography axial resolution improvement. The method of achieving isotropic and fine resolution, when the scanning system is characterized by anisotropic resolutions is proposed. In case of typical clinical system the axial resolution is much lower than the planar one. The idea relies on the scanning with a wide overlapping layers and subsequent resolution recovery on the level of scanning step.Material/Methods:Simulated three-dimensional images, as well as the real microtomographic images of rat femoral bone were used in proposed solution tests. Original high resolution images were virtually scanned with a wide beam and a small step in order to simulate the real measurements. The low resolution image series were subsequently processed in order to back to the original fine one. Original, virtually scanned and recovered images resolutions were compared with the use of modulation transfer function (MTF).Results/Conclusions:A good ability of oversampling as a method for the resolution recovery was showed. It was confirmed by comparing the resolving powers after and before resolution recovery. The MTF analysis showed resolution improvement. The resolution improvement was achieved but the image noise raised considerably, which is clearly visible on image histograms. Despite this disadvantage the proposed method can be successfully used in practice, especially in the trabecular bone studies because of high contrast between trabeculae and intertrabecular spaces. |
31 | Recommended for anyone who's ever wondered about the role of ... | I hope to see it expanded into a novel, or have the character appear in a supporting role in one. | Pretty typical roles in the book. However, for a strong female lead, scifi, with some good romance, I felt the book delivers. | One of the best books ever written about play directing by a master of the craft who directed more than 300 shows in his lifetime. This book is great for beginners, but also a gem for veterans who need a little reminder of why the process is so important to the final outcome... | Imaginative....purchased as a book club selection, and it generated some interesting discussion. | Primarily a psychological look at the how's and why's of joining a cult, rather than a focus on graphic violence. Interesting plot and characters. Enjoyable read. | Thoroughly engaging. The characters are vivid and believable and the pace is excellent. | a quick entertaining read ... great character dev of the main character ... | Sedaris has a rare skill turning The mundane and painful experiences of his life into humorous vignettes. Fun to read and a bit introspective. | 31 | This book is a thoughtful exploration of women in Orthodox Judaism. As someone from an egalitarian background, I appreciated the fresh look at traditional Jewish practices and learning more about their origins. Recommended for anyone who's ever wondered about the role of women in Orthodox Judaism and wants to go beyond their own assumptions. | New to Buddhism: what are good books to read about its teachings regarding women? | Ottoman Women: Myth and Reality | why were women expected to adapt to the traditional gender roles in palestine society | what were jewish men and women portrayed as in literature | The Fairy Tale and Women's Studies: An Annotated Bibliography | what type of lips did jewish rabbis consider ideal for women | Judith Hauptman's goal in her most recent book, Rereading the Rabbis: A Woman's Voice, is to describe rabbinic attitudes toward women as found in the legal portions of the rabbinic corpus in order to provide us with a history of Jewish law regarding women. In contrast to scholars like Tal Ban, who believe that historical information about women can be unearthed from rabbinic literature,1 Hauptman approaches rabbinic legal material armed with the assumption that legal sources are not historically descriptive.2 Based upon our readings of rabbinic law, we cannot conclude anything about the impact rabbinic legal decisions had upon the lives of women. We can only formulate a picture of how one group of Jewish men in antiquity viewed them and wished to see them conduct their lives. The parameters are clear; this is an analysis of rabbinic texts alone. Hauptman has chosen to read rabbinic halakhic sources written about women from within | Womens Leadership In Marginal Religions Explorations Outside The Mainstream |
32 | BAIRNSDALE - Place - Index to the AMA archive | Browse Places - P - Index to the AMA archive - NAME is a biographical, bibliographical and archival database of SUBJECT with links to related articles and images. ADD MORE DESCRIPTION AS REQUIRED | Wettenhall, Roland Ravenscroft - Biographical entry - Index to the AMA archive - NAME is a biographical, bibliographical and archival database of SUBJECT with links to related articles and images. ADD MORE DESCRIPTION AS REQUIRED | Browse Drawers - C - Index to the AMA archive - NAME is a biographical, bibliographical and archival database of SUBJECT with links to related articles and images. ADD MORE DESCRIPTION AS REQUIRED | File 00438 - Index to the AMA archive - NAME is a biographical, bibliographical and archival database of SUBJECT with links to related articles and images. ADD MORE DESCRIPTION AS REQUIRED | Allen, Edward - Biographical entry - Index to the AMA archive - NAME is a biographical, bibliographical and archival database of SUBJECT with links to related articles and images. ADD MORE DESCRIPTION AS REQUIRED | File 01451 - Index to the AMA archive - NAME is a biographical, bibliographical and archival database of SUBJECT with links to related articles and images. ADD MORE DESCRIPTION AS REQUIRED | File 01423 - Index to the AMA archive - NAME is a biographical, bibliographical and archival database of SUBJECT with links to related articles and images. ADD MORE DESCRIPTION AS REQUIRED | Browse Entries - U - Index to the AMA archive - NAME is a biographical, bibliographical and archival database of SUBJECT with links to related articles and images. ADD MORE DESCRIPTION AS REQUIRED | 32 | BAIRNSDALE - Place - Index to the AMA archive - NAME is a biographical, bibliographical and archival database of SUBJECT with links to related articles and images. ADD MORE DESCRIPTION AS REQUIRED | Aroney, Michael - Biographical entry - Index to the AMA archive | Hunt, Rolland Clifford - Biographical entry - Index to the AMA archive | Widolg, Goran Algot - Biographical entry - Index to the AMA archive | Frederick, WH - Biographical entry - Index to the AMA archive | Czulak, Nan - Biographical entry - Index to the AMA archive | Melville, Alexander Hugh - Biographical entry - Index to the AMA archive | Lewis, Aubrey - Biographical entry - Index to the AMA archive | Barr, John Stod - Biographical entry - Index to the AMA archive |
33 | What is the mineral gruop for antimony? | What is the latin name for the element antimony? | What charecteristics must a substance have to be considerd mineral? | What is rubidiums uses? | What symbol is the symbol for antimony? | What kind of minerals do you need? | What are nonsilicate minerals containg sulfer and oxygen? | What rock contains an iron compound? | group 15 of the periodic table, one of the elements called pnictogens, and has an electronegativity of 2.05. In accordance with periodic trends, it is more electronegative than tin or bismuth, and less electronegative than tellurium or arsenic. Antimony is stable in air at room temperature, but reacts with oxygen if heated to produce antimony trioxide, SbO. Antimony is a silvery, lustrous gray metalloid with a Mohs scale hardness of 3, which is too soft to make hard objects; coins of antimony were issued in China's Guizhou province in 1931 but the durability was poor and the minting was soon | 33 | What is the mineral group of antimony? | What is the latin name for element antimony? | Antimony | Antimony cycling in the western Mediterranean | Antimony tetroxide | what is the electronegativity of antimony | Nitrogen, phosphorus, arsenic, antimony, and bismuth | Compounds with gold-antimony bonds | Name three of vernmonts most important non-metallic minerals? |
34 | What is a bisons predator? | What eats a bison? | Where in the world can you find bison? | What is a mountain gorillas predator? | What is the hawk predator? | What are the advantages and disadvantages of the cowbird and bison? | What are camels predator? | Dose the bull shark have any predators? | Why are predators called predators? | 34 | What are bison's predators? | What do the bisons eat? | How do bison get their food? | Do bison live in the mountains? | What are predators of the bull shark? | Where can you find water bison? | What would be giraffes predators? | What are th raccoons predators? | are bears predators or prey? |
35 | Worked great for my peaches | Aside from eating them straight does anyone have some good recipes that involve peaches? | The spray worked really well for eliminating the peach leaf curl disease we had. No picking great peaches again! Thanks | I have a heavily gifted peaches. She is one of my favorite villagers. I love her SO much. Her catchphrase is N’ Cream. She has tons of clothes. All I want is for her to go to a good home, and not get voided. :) 💜 | Helps me grow an abundant amount of tree fruit. Last year had so many peaches.... the family could not keep up with the picking, canning and freezing. | I was given a bottle of Torani Peach Syrup. I drink a lot of coffee so I am well versed in other Torani products, but peach syrup in coffee does not sound good.
Any suggestions other than Iced Tea?
BTW I love baking so any baking recipes are welcome. | Peach (fruit) A peach is a soft, juicy and fleshy stone fruit produced by a peach tree. Peaches were cultivated in China as far back as 8,000 years ago, with domestication at least 4,000 years ago. The peach is deeply interwoven into Chinese traditions. Hundreds of peach and nectarine cultivars are known. These are classified into two categories — the freestones and the clingstones, depending on whether the flesh sticks to the stone or not. Freestones are those whose flesh separates readily from the pit. Clingstones are those whose flesh clings tightly to the pit. Some cultivars are partially freestone | Performance of Mechanical Thinners for Bloom or Green Fruit Thinning in Peaches | Early peach thinning during stage I was done at 0, 10, 20, 30, and 40 days after full bloom (DAFB). At each thinning time, trees were hand-thinned to achieve different crop loads by spacing flowers or fruits 10, 15, or 25 cm along the shoot on whole tree canopies. In 2001 and 2002, fruit weight decreased quadratically with increasing time to hand-thin and increased linearly with increasing spacing. In both years, fruit diameter decreased linearly with increasing time to thin and increased linearly with increased fruit spacing. In both years, number of fruits harvested and yield per tree decreased linearly with increased spacing. Hand-thinning at 0 or 10 DAFB resulted in fewer fruit and lower yield; therefore, thinning at 20 DAFB was better. The effect of time of thinning on soluble solids was not consistent. In both years spacing (i.e., crop load) did not affect soluble solids. | 35 | Okay, this thing is awkward to use, at first. As it is very long once put together. I used it for collecting peaches off my peach tree, and I found that my peaches did not bruise, and were caught in the basket. Occasionally I got a peach that got a scratch on it from the prongs, but that just meant I had to each that peach right away. Overall, I'm very happy with the products. | Easy to store & hold a lot of fruit | How do you maintain peach blossom? | Physical and Mechanical Properties of Peach | [Request] A peach hanging from a twig | What do I do with Peach Syrup? | Nars ‘Afterglow’ vs Too Faced ‘White Peach’ | study on design and construction of practical fresh-keeping storehouse of fruits | This is what Peach should be |
36 | This product exceeded my expectations. It was as advertised ... | This product is more than I expected. Great quality and truly above expectations. | PRoduct worked just as advertised, can't be more satisfied than that! | This is a well designed product and was just as advertised. | I was disappointed with this product. For the price I paid, I expected much more. For what I received, I could have gone to the dollar store for a fraction of the price. | Product was exactly as advertised, came on time, I would recommend this seller/vendor. | This product was exactly what I expected. The quality was great | Not impressed with the quality of the product. The application was difficult and produced a less than desirable results, I ended up throwing it away. | Wasn't what I expected, but I think that my expectations were too high for a product like this. | 36 | This product exceeded my expectations. It was as advertised, and then some. A lot of toy for the price. No complaints here. | This works as advertised and is great to that extent but to be a great toy ... | Fantastic toy, and even better customer service | This is a great toy! I purchased this for my daughter as ... | Nice toy but does not meet expectations as discribed by the seller | The toy was perfect and I have no complaints | Received this product in excellent condition, gave as a give to our grandson ... | The items purchase meet my expectations very good product can't complaint so far so good will recommend ... | This product is awesome. It is great quality and both my kids ... |
37 | Regulated Phosphorylation of the Gal4p Inhibitor Gal80p of Kluyveromyces lactis Revealed by Mutational Analysis | The galactofuranose moiety found in many surface constituents of microorganisms is derived from UDP-d-galactopyranose (UDP-Galp) via a unique ring contraction reaction catalyzed by UDP-Galp mutase. This enzyme, which has been isolated from several bacterial sources, is a flavoprotein. To study this catalysis, the cloned Escherichia coli mutase was purified and two fluorinated analogues, UDP-[2-F]Galf (9) and UDP-[3-F]Galf (10), were chemically synthesized. These two compounds were found to be substrates for the reduced UDP-Galp mutase with the Km values determined to be 65 and 861 μM for 9 and 10, respectively, and the corresponding kcat values estimated to be 0.033 and 5.7 s-1. Since the fluorine substituent is redox inert, a mechanism initiated by the oxidation of 2-OH or 3-OH on the galactose moiety can thus be firmly ruled out. Furthermore, both 9 and 10 are poorer substrates than UDP-Galf, and the rate reduction for 9 is especially significant. This finding may be ascribed to the inductive effect of ... | The flavoenzyme UDP-galactopyranose mutase (UGM) is a mediator of cell wall biosynthesis in many pathogenic microorganisms. UGM catalyzes a unique ring contraction reaction that results in the conversion of UDP-galactopyranose (UDP-Galp) to UDP-galactofuranose (UDP-Galf). UDP-Galf is an essential precursor to the galactofuranose residues found in many different cell wall glycoconjugates. Due to the important consequences of UGM catalysis, structural and biochemical studies are needed to elucidate the mechanism and identify the key residues involved. Here, we report the results of site-directed mutagenesis studies on the absolutely conserved residues in the putative active site cleft. By generating variants of the UGM from Klebsiella pneumoniae, we have identified two arginine residues that play critical catalytic roles (alanine substitution abolishes detectable activity). These residues also have a profound effect on the binding of a fluorescent UDP derivative that inhibits UGM, suggesting that the Arg va... | A Study on the Lactase Potential of Kluyveromyces lactis Grown in Whey | The KIPHOS gene encoding a repressible acid phosphatase in the yeast KIUyyveromyces Iactis : cloning , sequencing and transcriptional analysis of the gene , and purification and properties of the enzyme | We describe the molecular cloning of the gal operon of Salmonella typhimurium LT2 and the localization of the gal promoter and the genes galE, galT, and galK. The order of the genes and the direction of transcription was the same as in Escherichia coli K12. A restriction enzyme map of the operon was obtained, and the approximate termini of the gal genes were located by using transposon insertion mutagenesis and minicell analysis. We constructed a plasmid that contained a defined 0.4-kilobase deletion in the galE but still expressed galT and galK activities from the gal promoter. This galE deletion was recombined into the chromosomal gal operons of S. typhimurium and Salmonella typhi Ty2. The resulting strains were vigorous, nonreverting galE mutants that were sensitive to galactose-induced lysis at 0.2 mM galactose. The S. typhimurium galE derivatives were avirulent and protective in mice. | Protein phosphorylation way, the "E. coli" bacteria stores proteins and pyrophosphates in its periplasmic membrane until either are needed within the cell. Recent advancement in phosphoproteomic identification has resulted in the discoveries of countless phosphorylation sites in proteins. This required an integrative medium for accessible data in which known phosphorylation sites of proteins are organized. A curated database of dbPAF was created, containing known phosphorylation sites in "H. sapiens", "M. musculus", "R. norvegicus", "D. melanogaster", "C. elegans", "S. pombe" and "S. cerevisiae". The database currently holds 294,370 non-redundant phosphorylation sites of 40,432 proteins. Other tools of phosphorylation prediction in proteins include NetPhos | Branching enzyme from Escherichia coli is shown to be inhibited by the pseudooligosaccharide BAY e4609. The mechanism of binding is studied in detail by kinetics using reduced amylose as substrate. Lineweaver-Burk plots suggest the mechanism of a noncompetitive or slow-binding inhibitor. Further studies by progress curves and rate of loss of branching activity allows us to conclude BAY e4609 as being a slow-binding inhibitor of branching enzyme. We discuss how these results parallel the inhibition of alpha-amylase by acarbose and the significance of branching enzyme as belonging to the amylolytic family. | Effects of Growth Temperature on Cerebroside Content and Chemical Composition in Kluyveromyces lactis | 37 | GAL4 of Saccharomyces cerevisiae activates the lactose-galactose regulon of Kluyveromyces lactis and creates a new phenotype: glucose repression of the regulon. | Cloning and expression of Kluyveromyces fragilis LAC4 gene. | Lactose/whey utilization and ethanol production by transformed Saccharomyces cerevisiae cells | Generation of a stable non-reverting Leu− mutant of Kluyveromyces lactis by gene disruption | Lactotriaosylceramide beta-1,4-galactosyltransferase | Evidence for an inducible glucose transport system in Kluyveromyces lactis | Functions of lactose operon in controlling gene expression? | Structural basis for broad substrate specificity of UDP-glucose 4-epimerase in the human milk oligosaccharide catabolic pathway of Bifidobacterium longum | Transient responses of yeast continuous cultures to qualitative changes in the nutrient supply. Induction and repression of the galactose pathway enzymes |
38 | Has anyone heard anything new about the new EU servers? | As a player who plays Conan everyday I have noticed that most Official Servers have been dying, hardly peeking the 20 player mark. Does anyone believe that Official Servers will get some population in the future?
I am also aware that everyone is going to tell me to play on a private server and I know that, I have been considering it but most servers have boosted enhancements and I really do like the Vanilla 1x everything kind of play. | Wondering where to find out information for when a new server will be released? I'm on EU | Just curious if there has been any discussion on server stability on the full launch of the game tomorrow. Obviously, a lot more people around the globe will be playing/stressing the servers. Has Ubisoft mentioned anything about this? Anyone concerned? Worth mentioning that I don't know how Ubisoft has managed their game servers in the past ... I'm just going on other game launches that i have seen to be disastrous. | So no UK phone calling by the end of the year, no Google play movies integration, plus plenty of other IO announced features that have vanished it seems.
Have they announced anything about the delays? Or have the gone dark? :p | Be sure to discuss any problems or issues relating to the latest EU Update. | So i played this game when it released and a year or so after that. I feel a bit down because i can't find any interesting mmo to try and want to give this one a spin again.
So first of, are there still any EU servers? Second: What about expansions? Do you have to pay for those, and at fullprice still? | The end of their previous blogpost says:
>For now, we'll get back to working on the next major update to StaffPad, which is coming together well. We've still got a lot of work to do here, but I really can't wait to reveal what we've been up to later in the year.
That was quite a while ago (over nine months). I really enjoy the product, but there are still quite a few bugs and missing features. Have any of you heard anything? | As in title
What benefits will they have?
I don't understand why people rush to those new servers | 38 | I recall reading from somewhere, that today the new servers would be ready for the EU people of ArcheAge. Does anyone have any more info? | New player here, have they said anything about EU servers? | How are the EU Servers doing? Are there any? | Are there no EU servers for SM? | WTF is going on with EUW/EUNE servers today? | West EU Server in a nutshell | So until we get EU servers (Suggestion) | Good news! There are now xbox asia servers. | Let me once again ask some eu server questions; |
39 | This was a good story in which the sexual tension was drawn out ... | I love the story line but the sexual content deminished the actual story. This was nothing more than soft porn and not necessary for the story. I won't be watching. | This is a lovely story with hot hot sex and a lot of twists and turns. I couldn't put it down and was in tears at the end. | Exiting! Nail biting actions. It is too bad that too much explicit sex has been written in the stories. It is not a sex movie but a thriller! | I couldn't believe I was reading about "Love My Vagina Night"! The plot was really good, but some of the incidents were
too bizarre to be true (and I know they weren't). I had a good laugh, however! | The story line itself was good, but there are a few places that go into too much sexual detail for my taste. | This book had the potential to tell a impactful story, unfortunately the author felt the need to include an overabundance (and sometimes tasteless and obscene) use of sex scenes. The story line could have been much more poignant without all the sex scenes (they just didn't add anything good to the story)! | Light read but graphic sex depiction not adding to story so ended up skipping to the end of these passages, some which went on a bit. | What great story telling. It was hard to put down, even if it was getting too late in the evening! | 39 | This was a good story in which the sexual tension was drawn out nicely, with a bit of drama added in the conflicts between Vanessa and Mike, and Nathan and Jeremy. The only bone I have to pick is that the final sex scene is too short and could have been much raunchier; perhaps including an anal or a facial. | Help me find: Sex scene on the beach with David Perry? | Megan: ''I could never imagine being sexual with Alex'' | James is at it again and the story is so funny I almost fell down! | great story but the explicit sex was too much | I like that there were no major sexual scenes portrayed | The story line could have been much more poignant without all the sex scenes (they just didn't add anything good to the story) | The sex scene in Snow Crash | Enjoyed Zach and Emma's story |
40 | Onboard Vision System for Bus Lane Monitoring | Using vision systems to determine the vehicle position on the road | This paper presents two steering control algorithms for intelligent vehicles with a machine vision system to detect lane lines or a reference line along a path for lateral control. In one algorithm steering control is given as a weighted sum of deviations at multiple points along the path, the locations of which are defined based on a human driver behavior model. The other algorithm gives steering control by straightforward calculation based on the whole reference line captured in the field of view. Experiments with the vehicles are shown. | Today traffic telematics is gaining increasing importance contributing to the solution of road traffic problems. The employment of lane-related communication elements is a promising new development. The lane as an essential part of the visual driving area is of decisive importance to driving behavior as well as to traffic safety. This fact is the basis of a new development using lane-related communication elements to achieve a better and safe traffic control called insert lights. In road traffic insert lights can make a valuable contribution to improved (visual) movement control and, accordingly, to road safety. Areas of employment are specified as follows: Tunnel management, variable lane configuration, entry supporting facilities at flyover junction points, visual lane control, increase of attention in front of traffic signals and pedestrian crossings, and supplementation of dynamic block systems (e.g. disappearing bollard systems). (A*) For the covering abstract see ITRD E110327. | This paper contains a field report on using model-based design techniques for developing embedded vision applications. A lane border detection algorithm was chosen as target application for testing the design approach. The algorithm detects the lane borders, which marks the drivable area in front of a vehicle. It is an algorithm for an autonomous vehicle which participated in the Defense Advanced Research Projects Agency (DARPA) Grand Challenge 2005. The algorithm was processed on an embedded stereo vision system which was mounted on that vehicle. This paper describes the assembly of the vehicle, the principles of model-based design, the development of the lane border detection algorithm and its functional behavior. Furthermore, it presents evaluation results and our experiences with this design approach. | Sudden brake seems to be unavoidable in driving practice to prevent from accidence. The sudden brake may often cause falling risks to on-board passengers in public transport and even threaten the lives of the senior. Thus, this paper presents an omnidirectional vision system to assist bus drivers in ensuring the safety for passengers. To this end, we configure an auxiliary camera in the boarding gate to recognize the age of passengers and an omnidirectional camera on the ceiling of the bus to detect and track the passengers. Their trajectories and positions are mapped into a bus layout, together with their age information transferred from the auxiliary camera. This bus layout is shown on a small display in front of bus drivers. Instead of looking to the mirror to guess and gather information of passengers, the driver can collect such necessary information for safe driving. We set up experiments on a real bus and demonstrate the system by preliminary results. | Embedded Vehicle Counting System With ‘Silicon Retina’ Optical Sensor | The control system presented in this paper is part of the European Prometheus-ProLab 2 test vehicle which proposes several new significant aids to the driver for an enhanced traffic safety. The goal of this system is to detect and to provide a low-level interpretation of the movements of side-obstacles (vehicles) occurring at crossings. The system is composed of two video cameras and a real-time vision machine (Transvision) on which a specific software performing the obstacle detection and interpretation task has been implemented. The proposed system provides reliable and robust (real-time) control of standard intersections up to a distance of about 150 m. | This paper describes the lately completed hardware and software framework in the field of automotive intelligent lighting. Furthermore a brief overview of currently announced concepts within this focus as well as a deducted tendency will be given. As marking spot lights will draw the driver's attention to hazardous objects in the future, the “Automotive Spot Light” as a novel approach on this will be announced. The combination of visual as well as thermal imager both with their advantages will help to decrease fatal injury on the road plus enables new safety light applications. | 40 | Improving the mobility is one of the most important challenges the cities face. The coexistence of public and private vehicles sometimes force the city governments to designate reserved lanes for bus use only. However, not all the private drivers respect these reserved spaces and they use them. Therefore, it is necessary to provide a surveillance mechanism. This work presents a visual system devoted to perform automatic surveillance of a bus lane. This system proposal consists of a heuristic combination of filtered images of the road for the bus lane change detection. We show how to refine the strategy for reducing false positives as well as improving its computational performance. The resulting system is able to run in real time on an Intel Atom platform without the use of any programming optimization technique. | Toward Computationally Lightweight Stationary and Mobile Computer Vision-based Traffic Surveillance for Assistive Devices in Intelligent Transportation Systems | Highways tend to get congested because of the increase in the number of cars travelling on them. There are two solutions to this. The first one, which is also expensive, consists in building new highways to support the traffic. A much cheaper alternative consists in the introduction of advanced intelligent traffic control systems to manage traffic and increase the efficiency of the already existing highways. Intelligent lane reservation system for highways (ILRSH) is such a software control system. It is designed to assist and automate the use of a highway lane as a reserved lane. The idea is to allow and support drivers to travel at a speed higher, if in return they are willing to pay a small fee to reserve an empty virtual slot on the reserved lane. This slot is valid for a portion and of the highway and a time window, so each driver pays the fee depending thier its travelling needs. In return, drivers are guaranteed a congestion-free travel on that portion. In this paper, we present the proposed architecture of the ILRSH and its subsystems. The system is based on several proposed algorithms designed to assist the drivers, enter or exit the reserved lane, based on real-world driving observations. We present extensive simulation results showing the feasibility of the proposed approach, that can easily be implemented with little costs on already-existing highways, and the increase in traffic efficiency. | The smart card-based automated fare collection (AFC) system has become the main method for collecting urban bus and rail transit fares in many cities worldwide. Such smart card technologies provide new opportunities for transportation data collection since the transaction data obtained through AFC system contains a significant amount of archived information which can be gathered and leveraged to help estimate public transit origin-destination matrices. Boarding location detection is an important step particularly when there is no automatic vehicle location (AVL) system or GPS information in the database in some cases. With the analysis of raw data without AVL information in this paper, an algorithm for trip direction detection is built and the directions for any bus in operation can be confirmed. The transaction interval between each adjacent record will also be analyzed to detect the boarding clusters for all trips in sequence. Boarding stops will then be distributed with the help of route information and operation schedules. Finally, the feasibility and practicality of the methodology are tested using the bus transit smart card data collected in Guangzhou, China. | This paper introduces an HW implementation of real-time road and lane recognition in FPGA-based stereo camera. Information on the road, such as lanes, stop lines, crosswalks, and directional lines is the most basic and essential information for self-driving car. In order to accurately recognition this information, it is necessary to separate roads only from the actual urban road environment. We implemented road separation function in FPGA based stereo camera for real-time computation and shows good experimental results. | Road detection based on the color space and cluster connecting | Study of Precautionary Assistance System of Lane Keeping Based on Monocular Vision | Moving object detection using genetic algorithm for traffic surveillance | Visualization of Urban Traffic for the Management of Smart Cities |
41 | GOP Tax Bill and SALT (State and Local Taxes) | Salt Commission The Salt Industry Commission was an organization created in 758, during the decline of Tang dynasty China, used to raise tax revenue from the state monopoly of the salt trade, or salt gabelle. The Commission sold salt to private merchants at a price that included a low but cumulatively substantial tax, which was passed on by the merchants at the point of sale. This basic mechanism of an indirect tax collected by private merchants supervised by government officials endured to the mid-20th century. The salt tax enabled a weak government to sustain itself; the government need control only | Wa state excise tax for real estate- who pays? | Tax protester statutory arguments exclusivity. The "Montello Salt" case was not a Federal tax case, and no issues involving the meaning of the terms "state" or "includes" or "including" as used in the Internal Revenue Code were presented to or decided by the Court. The word "tax" is not found in the text of the "Montello Salt" decision. In a 1959 tax case, the United States Supreme Court indicated that the term "includes" in the Internal Revenue Code () is a term of expansion, not a term of exclusivity. Subsection (c) of section 7701 provides: Similarly, in the case of "United States v. Condo", | History of the British salt tax in India for this purpose. The recommendations of "Guanzi" became the official salt policy of early Chinese Emperors. At one point of time, salt taxes constituted over one half of China's revenues and contributed to the construction of the Great Wall of China. Salt was also important in the ancient Roman Empire. The first of the great Roman roads, the "Via Salaria", or Salt Road, was built for transporting salt. However, unlike the Chinese, Romans did not monopolize salt. In Britain, there are references to salt taxes in the Domesday Book but they had died out before patents were given in Tudor | Salt Draw Salt Draw is a river in Texas. On April 4, 2004 flash flooding of Salt Draw caused the failure of a protective levee around Toyah, Texas, extensive flooding of most homes and property in Toyah, and the destruction of the Interstate 20 bridge over Salt Draw between Toyah and Pecos, Texas in Reeves County. Indirectly, 5 lives were also lost in a weather related traffic accident on U.S. Route 285 south of Pecos, which was being used as a detour because of the bridge failure. Jeannette Walls' grandmother "Lily" lived from 1901 until 1911 in a dugout at | Great deal on some high quality salt. I purchased about 8 packs, to use in our large custom salt lamp and a few extra to use in sole mixes and to add to our magnesium salt baths. Very happy we made the purchase. | My roommates and I bought way too much salt. 5kg to be specific. We realize that we're never going to come anywhere close to using it, so we're looking for something to make with it all. | The Savior's Alliance for Lifting the Truth The Savior's Alliance for Lifting the Truth, commonly known as The SALT, is an evangelical Christian organization founded in 1996 by Christine O'Donnell, a Christian public relations and marketing consultant who ran for the United States Senate, hoping to represent the State of Delaware, in 2006, 2008, and 2010. O'Donnell served as president of The SALT from its founding and was still listed as its president as of July 2010. The organization sought to promote chastity in young people before marriage, preferring to avoid the use of the term sexual abstinence. The SALT | 41 | The SALT deduction has been around since the Federal income tax. There is no shortage of coverage of this issue from all angles:
Some say]( that SALT deduction gives States the benefit of the doubt that taxes levied on their citizens are justifiable; perhaps states like California have different tax/spending needs than states like Wyoming. [Others say the the SALT deduction is a subsidy for states who charge their citizens a high tax; perhaps it is not fair that the the government of Illinois can charge high taxes and Illinoisans can write this off of their federal income where the people of Texas, with low state taxes, can't.
Is there a unique angle on this that is not being covered in the Media? | SALT Tax Deduction Question | Has anyone heard about an increase in the Chicago bag tax? | WWCT: Rachel Maddow and Oklahoma's sun tax law | who owns the tv stations in salt lake city utah | Why does Congress allow municipal interest payments to be exempted from federal income taxes in the face of a very large chronic deficit in the federal budget, even though no constitutional provision requires that this tax policy continue? The rhetoric of tax exemption is philosophical, appealing to notions of appropriate intergovernmental relations and, in particular, to the doctrine of reciprocal immunity: no level of government should use its taxing authority to impose harm on another level. ; But the true force behind tax exemption is that it provides states and local governments with a valuable subsidy, which can be enjoyed at their discretion. This article identifies the problems posed by tax exemption, and assesses some alternatives. It asks whether the results of tax exemption represent an appropriate outcome, and questions whether tax exemption is really necessary to achieve the benefits stated in its favor. | Is There A Regional Bias in Federal Tax Subsidy Rates for Giving | what was the population of salton city california in 2010 | Can HELOC be tax deductible in this case? |
42 | Some thoughts after years of being a construction inspector | Why is the inspector important An Inspector Calls? | hold up construction work until inspection has been completed and approved. Some building inspection expertises like facade inspections are required by certain cities or counties and considered mandatory. These are to be done by engineers and not by contractors. An example of a city that adopted this law is Quebec followed by a fatal incident that occurred due to negligence of the state of a facade. These inspections are often included in a contracted building inspection but might not be carefully analyzed and diagnosed like an engineer would. The term building inspector is sometimes used for persons who inspect houses | hold up construction work until inspection has been completed and approved. Some building inspection expertises like facade inspections are required by certain cities or counties and considered mandatory. These are to be done by engineers and not by contractors. An example of a city that adopted this law is Quebec followed by a fatal incident that occurred due to negligence of the state of a facade. These inspections are often included in a contracted building inspection but might not be carefully analyzed and diagnosed like an engineer would. The term building inspector is sometimes used for persons who inspect houses | Sooo I do periodical vehicle inspections, I've had my inspector's license since February. Also a 3rd year BEng degree student (automotive&trasport engineering). And a car mechanic.
Also a cat person and been in a relationship for over 7 years.
AMA maybe? | The plural just sounds ridiculous. Inspectors General? Come on, General Inspectors sounds way better. | A safety inspector, sometimes called an occupational health and safety technician or specialist, examines and evaluates workplaces and practices to ensure compliance with state and federal regulations. | Chartered Quality Institute of Munitions, which placed inspectors in factories to ensure procedures were being followed correctly. In 1919, the institute was first known as the Technical Inspection Association when it attended a conference held by Woolwich Royal Arsenal's Inspection Department in London. The institute began with 500 members and was originally headquartered at its secretary's office at 44 Bedford Row, London WC1. On November 10, 1922 the TIA reformed as the Institution of Engineering Inspection,so that it could be open to industrial inspectors and inspectors employed by the UK government. In 1929, the institute's branch network was formed, with local groups meeting | United States Department of Housing and Urban Development appointed by the President and subject to Senate confirmation. The Inspector General is responsible for conducting and supervising audits, investigations, and inspections relating to the programs and operations of HUD. The OIG is to examine, evaluate and, where necessary, critique these operations and activities, recommending ways for the Department to carry out its responsibilities in the most effective, efficient, and economical manner possible. The mission of the Office of Inspector General (OIG) is to: The OIG accomplishes its mission by conducting investigations pertinent to its activities; by keeping Congress, the Secretary, and the public fully informed of its activities, and | 42 | 1) That old houses were built better than new ones is the biggest myth ever and I hate when I hear people saying this kind of thing. I've been in 100s of houses during remodeling(and 100s if not 1000s of new houses) and it's pretty crazy how much better houses are built today than 50-100 years ago. The biggest change is how much better structurally houses are today, with LVL headers, thicker foundation walls, larger floor joists, hold downs embedded into concrete, joist hangers, etc the houses are just better structurally in every way imaginable. And then there are the safety features from hard wired smoke detectors, Arc fault protected circuits, tempered glass locations, fireblocking in walls, stair steepness, etc that are just completely missing from old houses that make modern houses much safer. Then there is energy inefficiency...
2) I hear from outsiders that builders/contractors will be as cheap as possible, cut corners, can't be trusted, etc. I find this to be mostly untrue. Most builders want to have a quality reputation and want to build a quality product especially if they are a larger company that does a lot of business. There are still builders/subs out there that try to get away with things that aren't code compliant but that's what I'm there for, to keep them in check. I have a good relationship with most builders and many will even point out things their framer/electrician/etc did wrong before I find it during their inspection which makes the process better for everyone.
3) You wouldn't believe how many times I've heard "we've been doing it this way for 30 years". When I first started this job straight out of college it was intimidating to fight with a contractor who was twice my age and had decades in the industry telling me that I was wrong for failing his inspection and that I didn't know what I was talking about and to use common sense. Construction practices and codes are constantly changing and it takes time for the industry to catch up and there is usually a lot of resistance every time we adopt the new code edition.
4) tragedy stories make me realize how important my job is. I was inspecting one house being remodeled after a fire and the builder pointed out that the bedroom we were in was where 2 kids had died in the fire and that type of thing always effects me hard. Knowing that a child could die if I miss something makes me take pride in my work. I was shown the white snake concert fire footage at a code seminar at that also hit me very hard. | why do builders often renovate a home | There is too often a tendency to presume that particular environments can be created within historic house museums simply by "tightening up" the envelope and installing sophisticated mechanical equipment. This approach is unsustainable from many standpoints. Extensive mechanical systems can be intrusive or damaging to historic fabric, expensive to operate and maintain (to the point of overwhelming the financial capacity of institutions), and inadvertently hasten climate change. Careful consideration should be given to the basis for expected environments to be maintained with respect to both the actual needs of the collections and the capacity of the envelope to contain them. Only with a thorough understanding of both, gained through survey, testing, and monitoring, can mechanical systems be appropriately designed. In so doing, one must be willing to use to fullest advantage the structure's inherent historical methods of environmental modulation, and to creatively think "outside the box" when applying modern mechanical systems to fulfill the need.A CAUTIONARY TALEImagine this all-too-familiar scenario: a nationally significant historic house museum is due for a major mechanical system upgrade. Funds are raised, engineers are engaged, and the project team provides the following marching orders: "We need a system that will maintain optimal conditions for our valued collections."The house had originally been built with a gravity hot-air system, with its characteristic network of ducts emanating from a central coal-fired furnace like the tentacles of an octopus(Figure 1). Eventually the furnace was replaced with an oil-fired unit, and blowers were added to convert to forced air for improved distribution and control. Finally, the ducts in the cellar were reconfigured to create different heating zones.Having all happened decades prior to the house becoming a museum, this was perceived by the project team as terribly substandard. No doubt the house had never been conceived of as a museum, neither in its original design nor in its subsequent upgrades. As with all residential architecture, it was built and then altered in accordance with the standards of aesthetics, functionality, and comfort that were characteristic of its time.Since becoming a museum, however, windows were sealed shut to facilitate dust control and filtering of ultraviolet radiation and visible light. Heating was applied generously in the winter for the comfort of staff and visitors alike. Window air conditioners were installed because occupants could not abide the summertime heat buildup in a closed building. These measures notwithstanding, conditions seem less than optimal. The project team has noticed subtle damages to the collections, as veneers are detaching, cracks in various objects are opening, and metals are showing signs of corrosion. Moreover, the interior has begun to smell musty, and mold has been noticed on books on shelves and on surfaces behind furniture. | Let the critics critisize. It's the builders who count. | Just purchased a new home. Our final walkthrough will be in two months. What should I look for in regards to poor craftsmanship or issues that need to be addressed by the builder | What should be lifespan of new buildings? | High tech, energy efficient, durable prefab homes are a good idea? | Constructionactivitiesandthebuiltenvironmenthaveanenormouseffectontheenvironment,humanhealth,andtheoveralleconomy. Sustainable homebuilding in all three dimensions of economic, environmental, and social effects is attainable through practical innovations and technologies.However,thegreatestbarriertothewidespreadapplicationofsustainablehomebuildingisthehigherinitialcostslargelyattributable to the learning curve of workers building with these practical innovations and technologies, and the added cost resulting from ill-defined con- structionprocesses.Toaddressthesechallengesandreachtheidealofsustainableconstruction,thispaperproposestheuseofleanconstructionas a viable and effective strategy, in particular the lean tool kaizen. This paper uses several case studies to showcase the effect of lean on the triple bottomlineofsustainabilityinmodularhomebuilding.Eachcasestudyhighlightsonedimensionofsustainability.Leanconstructionresultedina significant environmental effect by reducing material waste by 64%, a significant social effect by reducing or eliminating key safety hazards of excessive force, poorposture, andstruck-by, and a significant economiceffect byreducing productionhours by31%.Findings from this research willcontributetoabetterunderstandingoftheeffectofleanonhomebuilding sustainabilityand willpromotelean and safebuilding techniquesin modular homebuilding. DOI: 10.1061/(ASCE)AE.1943-5568.0000054. © 2012 American Society of Civil Engineers. CE Database subject headings: Sustainable development; Construction industry; Residential buildings; Lean construction. Author keywords: Modular homebuilding; Sustainability; Offsite construction; Lean construction. | The causes of failure in building design are various—an inadequate brief, lack of data, poor communication, inadequate analysis or synthesis, quirks of human behaviour—all may contribute. Systematic appraisal of buildings in use may help us to understand why theory and practice do not always agree and also gives evidence for improved building economics. We have to involve users more in the design of buildings, and we need a much broader based education of building designers. |
43 | Alsophila javanica | I just wanted to let people know that they can check out a newer Rifujin na Magonote webnovel here | To improve Java programming educations, we have developed a Web-based Java Programming Learning System (JPLAS). To deal with students at different levels, JPLAS provides three levels of problems, namely, element fill-in-blank problems, statement fill-in-blank problems, and code writing problems. Unfortunately, since JPLAS has been implemented by various students who studied in our group at different years, the code has become complex and redundant, which makes further extensions of JPLAS extremely hard. In this paper, we propose the software architecture for JPLAS to avoid redundancy to the utmost at implementations of new functions that will be continued with this JPLAS project. Following the MVC model, our proposal basically uses Java for the model (M), JavaScript/CSS for the view (V), and JSP for the controller (C). For the evaluation, we implement JPLAS by this architecture and compare the number of code files with the previous implementation. | What websites are there for ameba pico? | Name the website from which you could download Prince of Persia full version? | Is there a site or download source? I can't afford manga and some scan translations are just to bad to read.
I have Android. | Why java is used in web application? | I was just wondering is there a list of groups, companies, game dev, etc that have acknowledged and "worked" with Etika or something?
From the top of my head I can think of:
* YouTube
* Nintendo
* Nintendo NY
* Fakku
* DramaAlert (?) | Tamarin (software) Tamarin is a free software virtual machine with just-in-time compilation (JIT) support intended to implement the 4th edition of the ECMAScript (ES4) language standard. Tamarin source code originates from ActionScript Virtual Machine 2 (AVM2) developed by Adobe Systems, as introduced within Adobe Flash Player 9, which implements ActionScript 3 scripting language. ActionScript Virtual Machine 2 was donated as open-source to Mozilla Foundation on November 7, 2006, to develop Tamarin as a high-performance virtual machine, with the support from broad Mozilla community, to be used by Mozilla and Adobe Systems in the next generation of their JavaScript and ActionScript | 43 | Alsophila javanica, synonym Cyathea javanica, is a species of tree fern native to western Java and Sumatra, in Indonesia. It grows in rain forest and on riverbanks at an altitude of 250–1500 m.
Description
The trunk of Alsophila javanica is erect and up to about 10 m tall. Fronds may be bi- or tripinnate and 2–3 m in length. The stipe is spiny and bears scattered scales throughout. These scales are dark and have fragile edges. A. javanica has round sori which are borne near the midvein of fertile pinnules. They are protected by firm, flat indusia that are saucer-like in appearance.
Taxonomy
Alsophila javanica appears to be most closely related to Alsophila doctersii. Large and Braggins (2004) note that A. doctersii may in fact be of hybrid origin between A. javanica and a member of the Alsophila latebrosa complex.
When Carl Blume described A. javanica (as Cyathea javanica), he also named one variety, rigida. Large and Braggins (2004) note that although variety rigida is apparently part of the A. javanica complex, the name has also occasionally been associated with Alsophila polycarpa.
References
javanica
Flora of Sumatra
Flora of Java
Ferns of Asia
Plants described in 1828 | It has been debated whether two Polygonum species, P. cyanandrum Diels and P. forrestii Diels, should be transferred to Koenigia. In the present paper, nucleotide variations of the chloroplast atpB-rbcL noncoding spacer were examined for these two species and related representatives from the Polygonaceae. The atpB-rbcL spacer region varies among sampled species with a range from 753 to 902 bp, and the great variation in this region provides enough information for evaluating the phylogenetic relationships of the two investigated species. In contrast to the view that these two species belong to Polygonum, our phylogenetic analyses based on these molecular data showed that P. cyanandrum and P. forrestii were nested within a well supported clade including Koenigia islandica; the other three Polygonum species grouped with species of different genera. These results suggest that the two species should be transferred to Koenigia from Polygonum, and that phylogenetic relationships among Polygonum and related genera need to be further investigated with increased taxon sampling and gene markers. The resulting phylogeny is consistent with the previous suggestions based on pollen and chromosome investigations. The generic circumscription between Koenigia and Polygonum is also discussed in light of these results in combination with gross morphology. | Are There Two Varieties in Hylomecon japonica (Papaveraceae)? Morphological and Molecular Evidence | Cladopus javanicus (Podostemaceae), a New Species from Java | The polypore genus Antrodia (Polyporales, Basidiomycota) in the strict sense consists of a small number of species grouped around the type species A. serpens in phylogenetic analyses. This distinct clade (Antrodia sensu stricto in our view) contains species of the Antrodia heteromorpha complex, A. macra coll. and Antrodia mappa (formerly Postia mappa). Nuclear rDNA ITS and tef1 data show that the Antrodia heteromorpha species complex includes four species: A. heteromorpha sensu stricto (mostly on gymnosperms, large pores and spores), A. serpens (on angiosperms in Europe, resupinate, smaller pores but large spores), A. favescens (smaller pores and spores, pileate species in North America, formerly known as Trametes sepium), and A. tanakai (a close kin of A. favescens in Eurasia). Antrodia albida is a synonym of A. heteromorpha sensu stricto. We combine A. mappa, A. favescens and A. tanakai in Antrodia and designate neotypes for A. albida and A. heteromorpha, and an epitype for A. serpens. We also compare the morphologically similar but distantly related A. albidoides and A. mellita, and conclude that A. macrospora and A. subalbidoides are synonyms of A. albidoides. | Citation: Ariyawansa HA, Phillips AJL, Chuang W-Y, Tsai I (2018) Tzeananiaceae, a new pleosporalean family associated with Ophiocordyceps macroacicularis fruiting bodies in Taiwan. MycoKeys 37: 1-17. https://doi.AbstractThe order Pleosporales comprises a miscellaneous group of fungi and is considered to be the largest order of the class Dothideomycetes. The circumscription of Pleosporales has undergone numerous changes in recent years due to the addition of large numbers of families reported from various habitats and with a large amount of morphological variation. Many asexual genera have been reported in Pleosporales and can be either hyphomycetes or coelomycetes. Phoma-like taxa are common and have been shown to be polyphyletic within the order and allied with several sexual genera. During the exploration of biodiversity of pleosporalean fungi in Taiwan, a fungal strain was isolated from mycelium growing on the fruiting body of an Ophiocordyceps species. Fruiting structures that developed on PDA were morphologically similar to Phoma and its relatives in having pycnidial conidiomata with hyaline conidia. The fungus is characterised by holoblastic, cylindrical, aseptate conidiogenous cells and cylindrical, hyaline, aseptate, guttulated, thinwalled conidia. Phylogenetic analysis based on six genes, ITS, LSU, rpb2, SSU, tef1 and tub2, produced a phylogenetic tree with the newly generated sequences grouping in a distinct clade separate from all of the known families. Therefore, a new pleosporalean family Tzeananiaceae is established to accommodate the monotypic genus Tzeanania and the species T. taiwanensis in Pleosporales, Dothideomycetes. The Ophiocordyceps species was identified as O. macroacicularis and this is a new record in Taiwan.A peer-reviewed open-access journalMycoKeysLaunched to accelerate biodiversity research RESEARCH ARTICLE Hiran A. Ariyawansa et al. / MycoKeys 37: 1-17 (2018) | TheAster leiophyllus complex is complicated taxonomically and includes many related taxa representing polyploid series. It has been reported that this group is diversified throughout the Kanto district, central Japan, and there are three taxa endemic to the Kanto district. However, as neither morphological variation range nor distribution pattern is sufficiently investigated, taxonomic confusion sometimes occurs. In this study, morphological variation was examined in relation to the ploidy level, and taxonomic consideration was given. As a result, four morphologically recognized taxa occur in the Kanto district;A. leiophyllus (2x, 6x),A. leiophyllus var.sawadanus (2x, 3x, 4x),A. semiamplexicaulis (2x), andA. sugimotoi (4x, 5x). The distribution ranges ofA. leiophyllus var.sawadanus, A. semiamplexicaulis andA. sugimotoi are small, whileA. leiophyllus is distributed over most of the Kanto district. Morphological and cytological observations indicate that one of the reasons of the taxonomic confusion is the presence of presumed hybridization betweenA. leiophyllus and other taxa. | Citation: de Castro Camelo M, Temponi LG, Mayo SJ, Coelho MAN, Baumgratz JFA (2021) Typifications of some species names in Anthurium section Pachyneurium (Araceae). PhytoKeys 178: 95-109. https://doi.AbstractDuring a taxonomic study of Anthurium sect. Pachyneurium, it was found that the names of four species required typification. Verification of the protologues and cited collections is discussed and typifications are proposed as follows: the illustration Schott Icones Aroideae No. 465 is designated as the neotype of A. affine Schott. A lectotype is designated for A. bonplandii G.S.Bunting since the holotype, cited in the protologue at MY, was not found there. An epitype is selected for A. solitarium Schott because the lectotype illustration of J.M.C. Vellozo (Flora Fluminensis t. 123) lacks sufficient detail to determine it unambiguously to species in A. sect. Pachyneurium. A lectotype is selected for A. glaziovii Hook.f., a synonym of A. solitarium. | Eight species of Ipomoea (Convolvulaceae) were morphometrically studied upon their leaf characters, with the help of taxonomical analysis to solve the relationship between these species. On the basis of taxonomical component analysis, among the studied species, it has been disclosed that the numerical characters such as leaf length, petiole length, leaf breadth and lamina length are positively correlated to resolved taxonomical relation of different species of the same genus. Contribute important role in bringing together the species within a genus using principal component analysis results of five quantitative characters based on similarity matrix reveals significantly the correlation between leaf length to leaf breadth, leaf base nerve number, and the ratio of leaf lamina length to petiole length significantly separates the species from each other. Morphometric characters provided justification for the existing classification of the Ipomoea genus. It also indicates the component matrix after extraction of the characters that contributed strongly in similarity between the selected Ipomoea species. Three characters which include Leaf length, leaf breadth, and the ratio of leaf length to leaf breadth contributed significantly to the delimitation of the species of Ipomoea studied. Morphometric analysis of eight species of Ipomoea quamoclit L.; Ipomoea batatas (L.) Lam.; Ipomoea cairica (L.) Sweet; Ipomoea hederacea Jacq.; Ipomoea obscura (L.) Ker Gawl.; Ipomoea cordatotriloba Dennst.; Ipomoea lacunosa L. and Ipomoea hederifolia L. Using five different quantitative characters provided justification for the existing classification of the Ipomoea Kale and Phadol; APRJ, 9(3): 25-31, 2022; Article no.APRJ.89105 26 genus. This characters which, contributed significantly to the delimitation of the species of Ipomoea studied. We recommend an application of this method in an elaborate taxonomic study of the genus Ipomoea in the future study.Original Research Article |
44 | What supports are you leaning towards in S4? | As my S7 Edge only supports up to QC 2.0, this was a great deal. Product arrived in perfect condition. I did away with the included stand and just mounted the USB hub flat on my nightstand with some double-sided Gorilla Tape. Makes for a nice, small USB charging station next to my bed, exactly as I had in mind. | Aight i need help to choose my s-support so i can S-support
Claude,
Raphael
Ignatz
Dorothea
Sylvain
Mercedes
Seteh
Rhea
Who would you choose and who do you think has the best S-Support | hey guys,
i have been playing s3 with 3 RL friends. we all come from the same city but now study all over the country and we used to play s3 to keep in touch and have fun on skype while playing. it was awesome and we played the go-to crusader, witchdoctor, dh, dh setup.
while not pushing for a high ladder spot or anything, we still want to maximize our efforts (we dont play that often so we want to make the "best" of it) and were wondering what the "best" 4 man setup would be in S4.
Since CC has been heavily nerfed, i am not sure which classes to choose.
do you guys know which classes and specs and builds we should play as? we are open to suggestions :) | Great support, feels sturdy, easy pairing. And folds down and looks classy and not tacky. Nothing but love and respect for every anker product I have. | Hey guys! I just had a few questions on the build options for Lapis. I know the best set up for her is despair revenge. But what stats do i go for? Currently I am building one with spd/cd/atk but was wondering if spd/atk/atk or even atk/cd/atk (with good speed) would be better. Please let me know and feel free to post your lapis runes as well so I may take a look at them and aim for something :)
Oh I also plan to use her for toa and rta id like her to hit hard but will listen to you guys :D | Everyone's always talking about the BEST stand/spec combo, but what's the worst? | I had the same clip for the S4 which worked great. This one had a "kickstand" that was really tough to deploy and put back. I had to work the hinge for awhile to loosen it up. Its still a bit tough to open and close, but otherwise I like it. | supports laptop well. is hard to get positions changed easily. maybe with some practice.. | 44 | I know relic shield is getting nerfed pretty hard today so that will likely change opinions a little. So far I'm liking: Leona, Taric, Thresh. AP casters seemed to spike on release day but then fall off (in high Silver - gold anyways). I've also seen Janna play pick way back up despite all the freaking out. Who do you like for S4 support? | What is your non-meta rta pick that you still use more often? | Best builds on Jinx, Tristana, and Ashe on new patch? | Ragnarok Static @A4S LF Healer OR DPS | Who is the best support player? | Best support caster build? | Old player returning to DS3. Any suggestions for viable pyro/melee or magic/melee hybrid builds for 2021? | Which casters are you playing and why? | What Champions do you feel have become ineffective as of Season 3. |
45 | Cleaning gear s3 under running water? | I trad-climbed a few days on some sea-cliffs recently, an am wondering if people clean their metalwear after just a short exposure like this?
I didn't get any water on it directly, but the crags and air felt/smelt a little salty...
If I was there regularly then sure, but as is my inclination is to not bother... but then I see articles like This]( and [This Thread... hmmm!
eg... "If you do climb by the sea wash your gear in clean, cool water and dry it naturally in a warm environment and lubricate it when dry."...
I've never done a thing to my gear, seems like a pain! And never really wanted to lubricate anything to avoid dirt-sticking...
Just wondering if people *actually* bother, and what they do if so! | How do you clean a Smith and Wesson SW40VE? | Dose clean water flow faster than dirty? | How do you clean lorcin 380? | What kind of rock can be used for cleaning? | Abstract This paper describes the unmanned underwater remotely operated vehicle (UROV) THETIS, an easy to operate vehicle suitable for exploiting water environments. The subsystems composing our system, as compared to conventional ROVs, are discussed and evaluated. The vehicle's primary use, at the present stage of development, is to perform underwater observations as well as temperature, pH/dissolved O 2 and suspended sediment measurements for underwater pollution studies. Using simple components, the ROV's high reliability and efficient performance offer a versatile and cost-effective work system. | Clean water fill does not stay clean because of the residue left from your brush. I thought you would be working with clean water each time. | My truck (98 k1500, 5.7l) was lagging in power lately, so I cleaned the throttle body and got it running quite a bit better. I'm not a mechanic by any means, so I'm curious if running the seafoam that you spray in as you run the engine would help clean everything out in the rest of the engine. Or if I should take the engine apart, and clean it all up myself. I've never done that before though, and would be working from YouTube videos and a Chilton book, so if the spray would work well, I'd rather go that route. Haha. Thanks for any advice! | 45 | Does anyone clean their s3 under running water? I have the frontier model, if that makes a difference. If so, does it cause any problems? If not, how do you clean your watch? | Cleaning model 3 in winter | [watch cleaning] what to use to clean off old watch? | How to clean GS63 CPU fan? | Surface cleaner not spinning | Dawnguard.esm has been cleaned twice but cannot manuel clean due to a Tes5edit 4.0 | Cleaning 2080ti before waterblock with arctic cleaner 1 and 2? | Should I take my Fitbit off while cleaning? | Samsung washing machine does not drain water. |
46 | Had to put zipties on both ends to hold the ... | They keep ripping on the side...not so happy about that | For some reason would open at all and had to cut it also right at the zip but my little dude loves them so I don't mind | Zipper falls off if try opening bag completely. Thought it was only one that was defective, but happened to all of them. They are fine for the price, just be very, very conscious when unzipping these to only go about 3in from the bottom, otherwise you'll unzip the zipper completely off the track. | I gave 4 stars just because zippers are too complicated.
I have found no explanation why would have they been places in such way (not in straight vertical line).
All the rest is perfect. | We've bought these a few times. They just don't hold up all that well and they are hugely frustrating to zip. We'll probably continue to use them because they are affordable but I imagine there are better quality products on the market! | At first, these wouldn't zip all the way up. Then I realized that I could loosen the strap around the back of the shaft. Once I loosened it, I could zip it up. Ok fit, color as described. Just a little blah. | Honestly just what I expected. However, the zippers cling together pretty loud with any movement. | I can not reccomend this. I ended up throwing it away. It has very little grab on the zip ties. You are better off just using a plier. | 46 | Had to put zipties on both ends to hold the sockets on the bar. It's delicate. Prolly won't last long in the diesel world. | I tried to put on three different 52" light bars ... | I used my bar for my curling irons: | Great tool. However I was expecting the bar to ... | it can gall together like it's welded | We installed the bars on the inside of the closet door and that was super easy. Then we put all his ties on ... | Using the closed end of the wrench it slips easily over the wires and makes the removal process a ... | Handlebar wraps come off pretty easily, already had to re-wrap mine | Easiest part to bolt on. |
47 | when was the capitulary of quierzy established | a significant decline. In recent years, Canada had made an effort to prevent overfishing in the region by use of provisions of the Coastal Fisheries Protection Act and the United Nations Fish Stocks Agreement. The origin of the Flemish Cap's name is unclear. It arguably refers to Flemish fishermen venturing out this far west in the nineteenth century. This area was also filmed by Wolfgang Petersen in his 2000 film "The Perfect Storm" as the final fishing grounds of "Andrea Gail", captained by Billy Tyne (George Clooney). Swordfish were their primary catch. Flemish Cap The Flemish Cap is an area | Capcir Capcir (; ) is a historical Catalan comarca of Northern Catalonia, now part of the French department of Pyrénées-Orientales. The capital of the comarca was Formiguera, and it borders the historical comarques of Conflent and Alta Cerdanya. Capcir is on a plateau, averaging 1500 metres above sea level, and allows passage between the high valleys of Aude and both the Spanish Cerdanya and French Cerdagne. It has traditionally been rural, but has developed considerably in last the forty years thanks to its tourist attractions. Capcir has two nicknames: little Siberia or little Canada. This gives an idea of the | this thing came without instructions , and no caps puller or anything .. the box was beat up to no end | Capiznon language Capiznon (Spanish: "capiceño") is an Austronesian regional language spoken in Western Visayas in the Philippines. Capiznon is concentrated in the province of Capiz in the northeast of Panay Island. It is a member of the Visayan language family and the people are part of the wider Visayan ethnolinguistic group, who constitute the largest Filipino ethnolinguistic group. The language is often confused with Hiligaynon due to dialectological comprehension similarities and as high as 91% mutual intelligibility, but it has its certain unique accent and vocabulary that integrates Aklanon and Waray lexicon. Despite its distinct corruption of Hiligaynon lateral approximants, | and Castle Löwenberg. The family spread over the world. So members of the family live in Germany, France, United States and Philippines. Capol Capol is an old Swiss noble family from the canton of Grisons. The family's origin is the Swiss village of Flims. Capol (or former named Capal) people of this family name have lived in this region since the 11th century. Variations of the family name include "Capoll", "Cappol", "Cappoll", "Cappal", "Kapol" and "Kapool". Johann Gaudenz von Capol (1641–1723), a member of the leading family of Flims, built the Schlössli (Little Castle), a manor house, in 1682. The | The Librarian: Quest for the Spear a golden capstoned pyramid at their hideout, augmented by a powerful electromagnetic field during a full moon. Coming to Nicole's aid, Flynn is forced to defend himself against the cult, then against Wilde inside the pyramid. Although Flynn is nearly killed by Wilde, the power of the repaired spear damages the pyramid support pillars causing the pyramid to crumble. The capstone then falls onto Wilde, killing him. Flynn reclaims the assembled spear in the name of the Library. Three months later, Flynn is at a café talking with his mother about his new job at the public library and his | Inspired by natural phenomena and mathematical theory this paper presents the development of a model, based on the dodecahedron, that visualizes the structural transition and expansion of a capsid (viral protein shell). | Your computer is typing in caps but its not in caps lock? | 47 | Capitulary of Quierzy The Capitulary of Quierzy (pronounced Kiersy), was a capitulary of the emperor Charles II, comprising a series of measures for safeguarding the administration of his realm during his second Italian expedition, as well as directions for his son Louis the Stammerer, who was entrusted with the government during his father's absence. It has traditionally been seen as the basis on which the major vassals of the kingdom of France such as the Counts of Flanders, were enabled to become more independent. It was promulgated on 14 June 877 at Quierzy-sur-Oise in France ("département" of Aisne), the site | Why did the French continue minting coins with Louis XVI's portrait even after he was forced to abdicate? | who was the first person to be granted parliamentarian immunity in france | who won the battle of cap français | who killed francois capois in 1806 | what was the capital of the french protectorate of tonkin | who was offered the french throne in the 1877 crisis | what was the capital of the atrebates in france | Napoleon and the Rules regarding the Devolution of the Crown |
48 | Thigh length shorts look really dumb. | These were significantly shorter than I expected. They look like 80's gym shorts on me. | My daughter does not like the way the shorts fit. | It's just the fashion trend right now and it will change. Men use to wear short shorts and before that women use to have to wear long 'skirts' to swim. It will change again. I also think it's hilarious that men wear the longest shorts and women wear the shortest shorts they can find. | They are longer than they appear on the model, I'm 6' 2" and have normal length legs for my height. The shorts end just below my knees if they sit directly on my waist. I really like them even though I was looking for something that fit as they appear on the model. | The BF's favorite pair of shorts. He's got short legs and these hit at just the right spot...right above the knees. | This is pretty typical with running shorts like this, the band is too tight , but the rest of the fit is good. Don't think I will buy again | The cut of the shorts are not like runner's shorts that essentially go straight down but rather, flair out. The XL waist is a tad smaller than what I am used to even with the elastic band. I was simply looking for a shorter short to work out in and these were okay for that. | I'm glad they make these shorts with the 15 inch leg length and roomy design. They are very comfortable. | 48 | On both men and women, I just think it looks horrible. It looks like you just forgot your pants at home and are just wearing underwear, and it's overall just too much bare leg for any public place except for the beach. I hate seeing entire bare legs barely being covered by anything.
&#x200B;
Now I don't mind knee length shorts, below the knee, or just slightly above the knee.
&#x200B;
But stuff like this]( [this]( or [this...they need to go away ASAP. Way too short. No one wants to see that much bare leg.
&#x200B;
It's overall more acceptable for women to wear shorts that length, but there are men who like to try to break the norm and go for those lengths as well...regardless, it looks terrible on everyone. | Women’s ‘biker shorts’ are hideous no matter how you style them. | The material is bad, the shorts run up your legs as you ... | I was glad I had read the reviews before purchasing these shorts ... | just got this and it is very pretty and will look great with shorts or leggings | People with shorter inseams that hemmed leggings/tights, how much did you take off? Were you happy with the result? (excluding pants to shorts) | love these shorts but the waist seems a bit tight | Is it socially acceptable to wear shorts and have tons of mosquito bite scabs on my legs? | Anyone on the fence about the New Way shorts? |
49 | who played nick swift in cloud 9 | Cloud 9 (2014 film) shredder in Summit Valley, competes in a snowboarding challenge and wins for the girls' division. With her Swift snowboarding teammate/boyfriend, Nick Swift (Mike Manning), who is also the son of team coach Sebastian Swift (Jeffrey Nordling), she trains as a part of the Swift Team to win the "Fire and Ice" snowboarding competition. A year ago, a viral video branding the famous, legendary snowboarder Will Cloud (Luke Benward) as an "epic failure" caused Will to end his snowboarding career. He wiped out attempting a move he created in Fire and Ice, called the Cloud 9, and almost died, allowing the | What does it mean when people say they're on cloud nine? | and the apples. While being reviewed on the Saturday morning show Live & Kicking on BBC 1, dance producer Norman Cook commented: "The most positive thing I can say about it, is that it's very white." UK CD1 UK CD2 European CD Cloud Number Nine "Cloud Number Nine" (sometimes spelled as "Cloud #9" or "Cloud Number 9") is a song by Canadian singer-songwriter Bryan Adams. It was released in April 1999 as the third single from his 1998 album "On a Day Like Today". Its single version is notable for being one of the few remixes Bryan Adams released with | Colonial Day ultimately not fully satisfied with his own writing in this regard because the assassination fizzles, but he thought director Jason Pate made the episode work nonetheless. Moore wanted to show life in the fleet away from "Galactica" but was opposed to a "planet of the week" format. "Cloud Nine" was created as a location within the fleet that could provide a visual environment replicating that of Caprica and the other Twelve Colonies. The exterior shots on "Cloud Nine" were filmed at the University of British Columbia, in the Rose Garden and in front of the Chan Centre for the Performing | is arguably his best known song because it is his only hit to have charted on both the Pop and Country charts. 9,999,999 Tears "9,999,999 Tears" is a single by American country music artist Dickey Lee. Released in November 1976, it was the third and final single from his album "Angels, Roses and Rain". The song peaked at number 3 on the U.S. "Billboard" Hot Country Singles and Canadian "RPM" Country Tracks charts. It also charted modestly on the pop charts of both nations. The song marked a return to the Pop charts for Lee following a 10-year hiatus. In | Cloud Number Nine "Cloud Number Nine" (sometimes spelled as "Cloud #9" or "Cloud Number 9") is a song by Canadian singer-songwriter Bryan Adams. It was released in April 1999 as the third single from his 1998 album "On a Day Like Today". Its single version is notable for being one of the few remixes Bryan Adams released with Chicane and the only one to gain notable chart success since his debut single. "Cloud Number Nine" would go on to reach number 6 in the UK Singles Chart in May 1999. The song was first released on Adams' 1998 album "On | Cloud Nine (The Temptations album) work, by the fall of 1968, Whitfield had the Temptations recording "Cloud Nine", which featured all five members (Otis Williams, the newly drafted Dennis Edwards, and founding members Eddie Kendricks, Paul Williams, and Melvin Franklin) trading lead vocals over a Family Stone-like instrumental track. Although Otis Williams denies the connection, "Cloud Nine's" lyrics have frequently been cited as empathizing with drug use. The song seems to suggest that the best way for someone to deal with the problems that come with being poor and black in America was to "ride high on 'cloud nine'". "Cloud Nine" was a number six | Cloud Nine (The Temptations song) as opposed to pianos and strings. The song also features the Cuban percussionist Mongo Santamaria on conga drums. Edwards, Eddie Kendricks and Paul Williams swap leads on the verses, bridges and choruses, such as this example from the first bridge: <poem>Paul Williams: "You can be what you wanna be..." Dennis Edwards: "You ain't got no responsibility..." Eddie Kendricks: "And every man, in his mind is free..." Dennis Edwards: "And you're a million miles from reality..."</poem> Otis Williams has some brief lead lines on the last half of the song (i.e.: he repeats "Reality…"), and Melvin Franklin also gets a line | 49 | Mike Manning (actor) Michael Christopher Manning (born April 12, 1987) is an American actor, producer, television personality and activist. Manning first gained fame as a cast member on the MTV series "" Since then he has starred in a number of films and television programs, such as the 2014 Disney Channel original movie "Cloud 9", in which he played Nick Swift, Hawaii Five-0 and Love Is All You Need? and produced the documentary "Kidnapped for Christ". Michael Christopher Manning is from Thornton, Colorado. His parents are Michael Sr. and Susan Manning. He is the oldest of three children; he has | who does mike brown play for in the six nations | who plays the dad in the thanksgiving promise | where was archie manning from in the tv series | when was the actor that played t5 joseph liebgott born | who wrote the song all for one for hawaii five-0 | when does season 5 of casey patterson come out | how many enslaved african american slaves did john manning own | who does michael play in michael every day |
50 | Milligrams to tables spoon? | How manyt ounces in a table spoon? | One fourth teaspoon equals how many milligrams? | How much is 3 milligrams? | How many millilitre in a tablespoon? | How many tea spoons equals a kilogram? | How many table spoons is 40 grams of butter? | How many milligrams of sodium are present in one ounce of table salt NaCl? | Do 2 teaspoons equal to 10ml? | 50 | How many milligrams in a table spoon? | How big is a tablespoon in millilitres? | How many ml are there in one teaspoon? | how many ml is a teaspoon of flour? | How many tables spoons of butter is 40 grams? | How many milligrams are in grain? | How many milligrams of sodium in one ounce of table salt? | how many tablespoons in one gram? | How many teaspoons are in 1 gram of salt? |
51 | Ubisoft made the bots too hard to kill | I have tried killing the enemy bots in IE and every time I try, they hit 1 health and just stay at one health while I am pounding them with my cooldowns, and instead of them dying, I die, because they are immortal and won't take that final damage for like 10-15 seconds
Is this intentional? Cause it's fucking annoying | In a game of hightower, there were a bunch of "Friendly Botkiller"s, and get this, they were friendly towards players, and killed bots. Not sure how, but they exsist now. | Bots are pretty brain dead. Even if you stand still they still can't hit you. Wish there was an option to make the bots harder. | Bots!! Bots!! is a massively multiplayer online game (MMO) created by Acclaim Games as the company's launch title and most popular game, with the theme of robots fighting against computer viruses. Players choose from one of three basic BOTS and level up their character through gameplay and buying items with virtual credits called gigas. Three game modes exist for the game: Sector Battle, Player versus Player, and Base Battle. A Korean version of the game, called BOUT!! (Bots Of Unlimited Transformation), also existed and was nearly identical, but received new updates earlier than the American version. BOUT!! was intended to | Although many people know about this, I'd like to spread awareness about the anti-hacker strategy, in case the bot doesn't crash the server. This is a Heavy with the Fists of Steel. If you can, recruit a Vaccinator Medic, if not, use the Dalokohs Bar to boost your health. Simply walk at the bot with your high bullet resistance, and it will be dead in two punches. This will allow people to play the game while it's dead while the enemy team hopefully kicks it. Thanks for reading, I hope to see more people using this. | First, see this to know what I'm talking about: #post37846452
So, I made this thread as to avoid people panicking and saying BattlEye is not working (already).
Before you go on rampage saying how the bots are still around, take note of this:
1. "[...] BattlEye is not yet actively shieding Tibia,[...]" so "[...]being able to bypass BattlEye is part of the initial phase and not considered as a bug. It is part of the information we are gathering. Rest assured, it won't go unnoticed."
2. Chances are, they WANT people to do this and try their bots on. On a personal side note: please, botters, do it! I beg you! Mwahaahahaha!
3. Let's not forget that BattlEye is a company that got *HIRED BY CIPSOFT TO DELIVER A SERVICE*. As with any other company in the world who sells services, the company's existence relies on the service being good and working as the costumer (CipSoft) expects it to work! This, above all, gives me faith in the relation Tibia-BattlEye.
That's it. Don't panic just yet. | Maybe the problem is worse since I've been playing at night, but in almost every game there are 2 bots on my team with names of the format "XX6x". All they do all game is walk down the lane killing a few minions before inting kills, completely refusing to even auto attack a 1% hp enemy. It's fucking disgusting and boring | they always make it seem like they care and hired people to ban bots etc. , yet i see permanent 30 bots in tria, and houses like this that stand for over week despite daily reports from at least 3 different people, why? EU server btw.
| 51 | I cannot kill them for the life of me. I got wrecked by an Aramusha bot today in brawls. I think the bots were just fine before this season. They are not meant to be tough to kill. They parry everything, they CGB everything, and they ruin this game for me.
I am not a good player. These bots may be good for pros like Spliced, Havok, Seraph of Hope, and Sypher PK, but not for casual players like me. | ARAM games just being bots? | Fatal Weapons - Every parry person should try them | Have bots gotten worse recently? | So I finished Akame ga Kill yesterday... | Fasnacht bots attacking lvl 1 settler passing by who can’t die | UVHM, why do people think that crystaliks are hard to kill? | Should I keep watching Akame ga Kill | Always get killed by nades! |
52 | what is the name of the manufacturer of basketball kits for the bbl | What shop can you buy jls jumpers? | Kel-Tec P-11 The Kel-Tec P-11 is a compact, semi-automatic, short-recoil operated pistol chambered in 9 mm Luger. It has been manufactured by Kel-Tec CNC Industries of Cocoa, FL since 1995. The P-11 was designed by Swedish-born George Kellgren, the designer of many earlier Husqvarna (Sweden), Intratec, and Grendel brand firearms. The P-11 uses an aluminum receiver inside a polymer grip housing held on with polymer pins. The slide, barrel, and magazine are steel. The standard magazine holds 10 rounds, or 12 rounds in states not limited to 10-round magazines. Both fit flush to the bottom of the pistol. At unloaded, | popularity during the 1980s and 1990s: Larry Bird, Earvin "Magic" Johnson, and Michael Jordan. In 2001, the NBA formed a developmental league, the National Basketball Development League (later known as the NBA D-League and then the NBA G League after a branding deal with Gatorade). As of the 2017–18 season, the G League has 26 teams. FIBA (International Basketball Federation) was formed in 1932 by eight founding nations: Argentina, Czechoslovakia, Greece, Italy, Latvia, Portugal, Romania and Switzerland. At this time, the organization only oversaw amateur players. Its acronym, derived from the French "Fédération Internationale de Basket-ball Amateur", was thus "FIBA". | Got it for my BIL as a gift and he loves it! Even better, Sportsmans Guide has great customer service and sent me a follow up email with contact information in case I ever have questions or problems. Fantastic! | by necking down the .25-20 Winchester cartridge to accept a .224 diameter bullet. Just as the .32-20 can be considered to be the parent cartridge of the .25-20, it can also be considered the parent cartridge to the .218 Bee. The cartridge was introduced as a commercial cartridge by Winchester in 1937 in their Model 65 lever action rifle, which was also chambered for the .25-20 and .32-20 Winchester cartridges. However, while the .25-20 and the .32-20 Model 65 rifles had 22 inch (560 mm) barrels, the rifles chambered for the Bee sported 24 inch (610 mm) barrels. While early | What is the value of a 1991 nba hoops michael jordan all-stars card 253? | Umarex Umarex Sportwaffen GmbH & Co. KG is a German manufacturer of air guns (including Umarex air pistols such as the Beretta Elite II), tear-gas and signal pistols, paintball markers under the RAM brand and airsoft guns, based in Arnsberg, North Rhine-Westphalia. The firm was founded in 1972. Its USA headquarters is located in Fort Smith, Arkansas. In 1993 the Carl Walther GmbH firm was acquired by Umarex, who continued to manufacture under the Walther name in Ulm and Arnsberg. In 2010, Röhm Gesellschaft, the firearms division of Röhm GmbH was also acquired. The United States subsidiary of Umarex is | Magpul Industries Magpul Industries Corporation is an American designer and manufacturer of high-tech polymer and composite firearms accessories. The corporate headquarters is in Austin, Texas in the United States. Magpul Industries takes its name from its first product, the MagPul (which stands for "magazine puller"), an accessory for the STANAG magazines used by US and NATO armed forces, which aided users in pulling the magazine out of its pouch. Originally based in Colorado, Magpul announced its intention to leave the state in 2013 when new gun control laws caused many of its products to become illegal in the state; it | 52 | won the 2014 BBL Playoffs. The Newcastle Eagles, London Lions, Glasgow Rocks , and Bristol Flyers have all signalled their intentions of playing at a European level in the near future. As of the 2016/17 BBL season Italian sportswear manufacturer Kappa was the kit supplier for all the 12 teams. During his time as BBL Chairman, Paul Blake outlined a goal for the League to expand to 16 teams with an overall vision to have between 15 and 18 teams playing out of venues with 2,000-plus spectator capacity by 2019. Primary venues used in the British Basketball League: Bold indicates | who won the bbl cup in 2014 | who is organising the 2015 premier league darts tournament | how many nba teams are in the ibl | how many teams in f1 2013 xbox 360 | how many teams will be in group b for euro 2020 | FIFA 19 FUT Pack Probability Announced | how many players are in the london sevens 2018 | how many teams in group b euro 2020 |
53 | Question about Neverwinter server and Latency issues | I am posting this because people still have latency problems but this isn't being said enough/at all.
It is proven from not only my experience, but also everyone in my outfit. If you have red latency, ping above 200 or so and huge packet loss, just restart the game. You will somehow connect differently and you can have hours of great gameplay.
This is of course not true if the servers start crumbling. But then it affects everyone and you know restart won't help. Mostly it's just you, though.
Also, go pay some money for the game so the CN doesn't close the game or introduce pay to win. Don't unsub now. | Hi, I'm playing on a modded server hosted by OVH and managed by a friend.
I had no problem, and since few weeks, I lag, and the datas I send to the server take more and more time to come, but I can see the others talking in chat instantly.
I tried pinging the IP address of the server, but my ping outside of minecraft is stable.
I was talking with him on teamspeak, whoch is also hosted on the same IP, and not a single problem.
The others have no problems when they play.
To give an example, when I connect I can act for a minute, and then everything starts delaying, opening chests take few seconds, when I break something it takes seconds to drop, and the delay just goes worse and worse without any reason.
I can still listen some youtube videos at the same time, and they don't experience lag.
I used my other computer, and I had no problem on that one, so I'm quite lost there.
I updated the computer, I have the last java update, my network adapter driver doesn't have more updates, and the parameters seem to be the same than my other computer.
I need help on that one, tried many googling, but couldn't find anything related to my problem... | Not sure if it has been asked before, but does anyone know how responsive/forgiving the game is for players with high (100-200ms+) latency?
Worst case I imagine that the telegraphs being quite troublesome if the time between the telegraph actually being sent to the game-client on your machine and the damage hitting your toon being so low / tightly-tuned that it is actually impossible to avoid being hit if you have over 100ms (which quite a few OCEANIC players will likely have)
Not sure if the NDA forbids this but if anyone is in the beta and in the OCEANIC region can you offer some comment (or perhaps a Carbine employee?)
I'm super keen on Wildstar and hopefully this has been addressed (go go local servers? haha) | Not to mention during the game i would spike up to 300 ping and my character would freeze (everyone else would run in one direction) then at the end game server kicks me; i log back in and i have a 120 minute deserter. | I have been thinking about getting back into vanilla WoW after nost died, but i'm unsure what servers someone from EU can play without lagging a lot.
:) | I have played since beta and I will tell you this, I have server disconnected countable on two hands. I don’t think I’m just “lucky” like everyone tries to tell me. I genuinely think people put to much blame on Bethesda’s servers when they are probably using a OG Xbox with the most basic internet connection. The latency you get from dogshit internet is certainly not helping your game play. So please before you bitch at Bethesda about server problems G check your internet provider. | My ping is generally < 50 and I have been experiencing a considerable amount of lag on almost all NWI servers for the last week or two. Any one else notice this?
steam name: bon zissou | I was just wondering because I remember it being difficult to host a server and play at the same time in the original KF. | 53 | Hey. So I've been playing this game for few days now. I have noticed that latency spikes occur very often and I find myself rubberbanding around from time to time. Is it only me or high ping/latency is an issue for you, guys, too? ALSO, I read somewhere that Arc and Steam Neverwinters are on two different servers/worlds? Is that true or bullshit? :D | Anyone else been having their latency randomly spike up to a few hundred or more? | Random disconnects and latency spikes. | The latency isn't consistent but that's just because I like to game sometimes | Anyone else experiencing lag spikes in the EU servers? | League of Legends ping spikes | Does anyone else have unplayable lag at low ping? | I didn't have a single game today without latency issues! | Why do I have bad ping in every game, everywhere? |
54 | Infrared spectra of soluble polytoluidines | The Fourier transform infrared spectra of agar, agarose, κ-, ι-, and λ-carrageenan, and ofChondrus canaliculatus, Iridaea ciliata, I. membranacea, I. laminarioides andGracilaria chilensis polysaccharides were recorded in the 4000–400 cm-1 region. The bands in the second derivative mode are sharper and more bands are resolved than in the normal spectra. | FT-IR spectra of solutions of carboxylic acids and of amines have been measured with the Circle (R) ATR method. The changes of the water spectrum under the influence of these solutes are discussed on the basis of `molar cross section spectra' for concentrations from 0.005 to 4 molar.© (1992) COPYRIGHT SPIE--The International Society for Optical Engineering. Downloading of the abstract is permitted for personal use only. | Infrared absorption and resonance Raman spectroscopy (RRS) are used to study poly(dG-dC)·poly(dG-dC) in two different forms: the right-handed B form at low ionic strength and the left-handed Z form at high ionic strength. The existence of a new electronic absorption band in the 290–300-nm region is evidenced by uv RRS studies of the Z form at different wavelengths of excitation. Infrared absorption spectra prove that this new electronic band is polarized perpendicularly to the cytosine plane. The possibility of a nπ* character of this transition moment is discussed. | Abstract The basic concepts relating to Fourier transform infrared spectroscopy (FTIR) have been set out to enable chromatographers to make use of gas chromatography (GC)—FTIR coupling. To describe the current position regarding applications, studies are briefly presented that are representative of the field of industrial products, natural vegetable extracts and pesticides. Biomedical applications are described in detail. The analyses of medicaments, metabolism studies and toxicological investigations are reviewed. Given the limited amount of published work in this field, it is possible to survey the limitations of GC—FTIR. The solutions provided by technological developments currently in progress are described. | Abstract Transmission infrared spectra of three fluorinated phosphonate monomers, perfluorovinylphosphonic acid, perfluoroallylphosphonic acid, and pentafluoroallyldiethylphosphonate, are presented and discussed. Characterization of such compounds by infrared spectroscopy is difficult, because considerable overlap occurs between absorptions arising from C-F stretching vibrations and absorptions arising from phosphonate moieties. Detailed band assignments were made on the basis of subtle similarities and differences in the structures of the compounds, such as degree of fluorination and intermolecular hydrogen bonding. The detailed identification of the absorption bands in the infrared spectra of PVPA, PAPA, and PADP provided by this report should be of assistance in subsequent infrared studies of similar compounds and polymers prepared from them. | The polarized infrared spectra of isotactic polybutene-1 in a hexagonal form will be measured in the region from 4000 to 700 cm−1. The normal vibrations of this polymer, which takes a three-fold helical conformation, will be calculated by the use of the GF-matrix method, with the modified Urey-Bradley force field. It will be found that the parallel and perpendicular bands correspond reasonably well to the calculated frequaencies of the A and E(2π/3) symmetry species respectively. In accordance with these correspondences, the assignments of these bands will be made and their vibrational modes discussed. | The low-energy throughput infrared spectra of some optically dense materials are obtained by using infrared spectral attenuation technique. The quality of these spectra is comparable with that obtained under normal state. | ABSTRACTCorrelation between theoretical and experimental (infrared and Raman spectroscopies) vibrational spectra of two compounds, both with a silyl group present in their main chain and with an optically active structure (L-valine) as side group, was performed. These compounds are based in a chiral dicarboxylic acid monomer and its respective polyamide-imide, oligomer that was previously synthesized by a direct polycondensation. Spectra were recorded in the region comprised between 500 and 4000 cm−1 for infrared and Raman analysis. The Raman spectra were obtained through a 1064 nm laser as excitation source.Theoretical models were carried out in order to find the optimal molecular geometry of the analyzed systems, with a complete assignment of their vibrational spectra. The Raman experimental data obtained with a Nd:YAG laser for this kind of silylated organic compounds, and the comparison between these results with the theoretical data is a useful advance in the polymer synthesis field, which can be use... | 54 | IR spectra of soluble poly-o-toluidine (POT) and poly-m-toluidine (PMT) have been studied. Preliminary assignment of their IR spectra is given by comparing their spectra in HCl and I2, doped states and in subsequently NH3 dedoped state with that in intrinsic state. | Infrared Spectra of High Polymers. VIII. Polyvinyl Nitrate | IR Spectroscopy for the Analysis of Scattering Polymeric Materials* | Study of IR Spectra of a Polymineral Natural Association of Phyllosilicate Minerals | Infrared Spectra of Perdeuterated Naphthalene, Phenanthrene, Chrysene, and Pyrene | IR spectroscopic study of conformational features of polyvinylacetate and polymethylmethacrylate synthesized on a silica surface | Thermal analytical and infrared spectroscopic investigations on polymorphic organic compounds?VIII | Infrared spectra of the M+HBr2− and the M+HClBr− ion pairs and their deuterium analogs isolated in argon matrices at 15 K | Origin of Near-Infrared Absorption for Azulene-Containing Conjugated Polymers upon Protonation or Oxidation. |
55 | Does anyone else feel like theres something seriously wrong with them. And they don't just get seizures, but its something else causing their epilepsy? | I'm 22 years old and have had epilepsy since I was about eight. People don't like to ask questions because they think it might be offensive but I would actually love to talk about it and answer questions :) I've hurt myself, had them in public places, in front of my friends.. AMA | Epilepsy syndromes (LGS) is a generalized epilepsy that consists of a triad of developmental delay or childhood dementia, mixed generalized seizures, and EEG demonstrating a pattern of approximately 2 Hz "slow" spike-waves. Onset occurs between two and 18 years. Epilepsy is consider a chronic (meaning it lasts for a long time) condition that is defined by seizures. Lennox-Gastaut syndrome (LGS) is a rare and severe form of epilepsy. As in West syndrome, LGS result from idiopathic, symptomatic, or cryptogenic causes, and many patients first have West syndrome. Authorities emphasize different seizure types as important in LGS, but most have astatic seizures (drop | A Proposed Etiology of Psychogenic Nonepileptic Seizures | Psychological Characteristics of the Epileptic | New‐onset epilepsy in the elderly | treatment. A number of children have underlying structural brain abnormalities. About 6% of those with epilepsy have seizures that are often triggered by specific events, known as reflex seizures. A number of epilepsy syndromes, known as reflex epilepsies, have seizures that are only triggered by specific stimuli. Common triggers include: flashing lights and sudden noises. Those with photosensitive epilepsy can have seizures triggered by flashing lights. Other precipitants can trigger an epileptic seizure in patients who otherwise would be susceptible to spontaneous seizures. For example, children with childhood absence epilepsy may be susceptible to hyperventilation. In fact, flashing lights and | Do strobe lights make you have seizures? | If no other cause can be found, the disease is called primary or idiopathic epilepsy. This problem is often an inherited condition, and German Shepherd Dogs are commonly afflicted. If your friend is prone to seizures, episodes will usually begin between six months and three years of age. | 55 | Please tell me that I'm not the only one who feels like this. All my doctors have told me I have epilepsy, but none have really seemed to care about where its coming from. I got diagnosed when I was 17. No one else in my family has had seizures. I have become obsessed with figuring out the actual cause of my seizures, if there is one. I have this internal feeling that theres some other medical condition thats causing my seizures. Kind of like my seizures are a symptom of another medical illness (i dont know if this is a good example or if it makes sense.. but like for example if your poop is a weird color it doesnt mean you have weirdcolorpoop disorder but its a sign that you have liver problems for example) thats how I feel about my seizures.. its coming from somewhere and doctors dont know so they name it epilepsy instead of finding the root of the problem. I know it's probably anxiety thats making me obsess, but I just can't seem to get rid of that internal feeling that its something more. Does anyone else feel like this? | Looking for some insight into why i'm having Seizures | Does anyone else have a soft spot for other epileptic people? | I think I have seizures. I don't know what to do. | Anyone else hyper aware of sensations in your body? I also have emetophobia and every little sensation I feel makes me so anxious. | I got diagnosed with epilepsy this morning, and I don’t know what to feel about this | Anyone with bpd suffer from intrusive/obsessive thoughts? | Focal seizures in the grocery store. | Anxiety, OCD? Seems to get worse. What should I do? |
56 | very nicely made pants | Well made but felt tricked. These are long Johns not pants. | Seems of good quality since Dickie's never seems to disappoint. However, the length for pants may be a little too big for some and may need to be hemmed. | Very cute pants, soft and comfy, but not the greatest quality. One of my legs is longer than the other and they are very thin. | The pants were "distressed" with frayed ends - not what I was expecting but not bad. Also a bit to large (okay, baggy) | A little baggier than I was expecting, but nice pants for the price. | Wears really well. Tough material, but look like regular slacks. | Rugged and stylish men's slacks. Well made with good detailing. | Great pants for your money.. Field tested and approved.. Good investment.. | 56 | very nicely made pants, I ordered short and got petite, the difference made the inseam a bit smaller but I can wear them. Nice looking. | The pants are good quality. However I ordered a short length | These pants are great because you can choose the size length you want | The pants are great fits well but a little be to short I'm ... | these pants are amazing, so comfortable and fit perfectly the length is ... | I bought these pants in tall size and I love them so much | The pants look fantastic. Be aware they will run small so buy ... | The pants are amazing. Fit great | The pants are nice, soft and cut to fit comfortably |
57 | The copper is easily dented, so it wasn't difficult to engrave | Copper
This was found in a field in far northern Illinois, not sure when, but it's been in our family for a while. I always thought it was awesome, but have no idea if it's a chunk of naturally occurring copper, or something man made. One side has a spot where someone tried drilling into it.
It weighs about 11 lbs, and I think it's cool either way, but I will be moving to Germany soon, and plan to bring it with me. My fiance pointed out that I *might* have issues importing it, and suggested it might be easier to get "papers" if it could be considered a collector piece and not just a chunk of raw material that I'm trying to bring over on a plane.
Any thoughts? | Arrived scratched revealing it is clearly not solid copper as stated. This would be a 1 star review save for the fact that it was a gift for my mother and she's delighted with it. | A good example of this is with the Statue of Liberty. Like obviously the statue is huge and was placed on a island, so it's safe to assume the statue was gonna be there for longer than the time it takes copper to oxidize (like 20 or so years.) So was that intentional, or did the designer just assume that the US would just upkeep it for the rest of it's existence. I also see it in architecture a lot. Theres an old firehouse turned condos in my town with the original roof that has copper accents. So do designer intent that oxidization or do they do it assume that their work won't outlive the copper oxidation. And obviously it may be a case by case situation, but just generally, is it intentional or not? | Very tasteful. I've gotten a lot of compliments. I work with my hands handling scrap metal, lumber, stone, etc. I needed something durable. So far not a single scratch. The tungsten is a very dense metal. It took me a while to get use to the weight of the ring. | Not copper, poorly plated fake copper. Looks good until they are used, then hand wash and watch the copper flake off.
Used twice, cannot use again!!!
****UPDATE****
Jacky sent me replacements for the original defective mugs. I have not used the new mugs yet, but I highly recommend Jacky as an honest seller.
I updated my review to a 4 star for great customer service. after using the mugs, I will hopefully give him 1 more star.
Thanks for the call and replacements Jacky, I will by from you again!!! | This did not arrive in time so I had to return it; copper is copper, although this was somewhat overpriced. | British embossed postage stamps of the stamp design cut away, (recessed), into the metal. The colourless detail as appears on the hair and diadem are achieved by variations in the depth of the engraving. The master die was engraved by William Wyon using as his basis the City medal of 1837 which he had also engraved. (This was the same model used for the head engraved on the Penny Black). The original master die did not show the pendant curl at the back of the hair and was not used in this form on the postage stamps, although it was used at the Royal | Works better than the copper chiller my buddy has and is a LOT tougher...don't have to worry about denting or bending. Only problem I've had is one of the collars used to hold the necks while it's expanded snapped. Went to Home Depot and got a replacement collar for 15 cents. Highly recommend. | 57 | Purchased these as a gift for a friend, then forgot to give it in the gift bag. Self gift! Installed them in my garden after handwriting (hand etching) the plant names on the copper plate. The copper is easily dented, so it wasn't difficult to engrave. I like the patina that the labels took on after being in the garden for a short time. Almost wish that I had purchased larger markers for my larger plants (trees, vines, etc), but the size is perfect for small plants or potted plants. Very nice product. | Plant ID labels - what do you use? I bought bit plastic ones and the sharpie-written names are quickly fading | Very nice pens. I bought them to make quilt labels | LOVE, LOVE, LOVE these plant markers!!! | these will come in handy for marking things in my ... | who was the engraver of the postal notes | Engraving is superficial and highly susceptible to scratches. Consequently ... | Engraved wording way to small. Can hardly be read ... | These are perfect for marking things I find worth remember |
58 | Anything better than the sennheisers momentum true wireless? | At the moment I'm using the Sennheiser Momentum In-Ear (using a phone so the audio don't have to be super good) And I need to get a new pair as my pair are "broken" so I need to get a new pair. Less then $100.
I want something good quality cause I use them daily to school!
Thanks in advance! | Loving these wireless blue tooth mics. Very lightweight and easy to use. | Just wanted to post an appreciation thread for Sennheiser. I did not expect to get a new pair of Momentum True Wireless 2 earbuds when I sent in my Momentum True Wireless earbuds. Not sure if it cost more to them to repair or send a refurbished pair of the original earbuds instead of just sending out the Momentum True Wireless 2 earbuds. Either way, it was a pleasant surprise, so I wanted to make a post to show appreciation. | Recently, I bought the Sennheiser Momentum in ear Wireless for $60 on Ebay. I wasn’t aware of there being fake Sennheisers on Ebay. So I recently got the in ears. The only thing I noticed that threw me off were the lack of QR scan on the right side of the box. And blurry text at the back.
Otherwise, everything else seems to be fine. They say “MOMENTUM M2 IEBT” on the bluetooth settings. They sound decent. All the voice assistance (power on, connected, etc.) sounds familiar. Even it’s vibration feature works.
I am not sure. Are these fake? | I returned this because the audio quality was too poor. Sounded distorted and terrible. However, I didn't see any wireless alternatives that were better... | I'm tired of snagging wires and shit when lifting, and I want some wireless headphones. Anyone have any recommendations? Price should be somewhere around $200 (the Beats I see everyone use sound like shit to me and are also $300...) | I was most interested in sennheiser headphones and was looking for something that was going to be very good for gaming (large sound stage for hearing footsteps and gunshots) I was wondering what the best "non gaming" pair would be within about $160 USD | Hi all
I’m looking for some on-ear headphones.
I’ve been eyeing the Sennheiser Momentum On-Ear in Ivory for a bit because I honestly love how they look & they’re within my price range.
My worry is that I’ve seen some reviews where they say the bass is loud & vocals sound “recessed” or something...? Anyone have experience with this? I’m worried they won’t sound good... but maybe I’m not experienced enough with “good headphones” to even notice this if I were to get them?
**What I currently use:** Mostly Apple earbuds but sometimes will use my brother’s gaming headset...Razer Kraken or something? (They don’t sound that great lol)
**Budget:** Something in the $100s/under $200. I would *potentially* go higher, but I would have to pretty much love everything about them... sound, look, feel, etc.
**What I listen on:** mostly IPhone. Also laptop & desktop, occasionally cassette player
**My music:** Eventually I cycle through & listen to a little bit of everything ... But recently it’s been The 1975, Tender, Glass Animals, The Beatles, The Stones, Max Richter.... and my playlists do tend to have a decent amount of bass in them... the majority contains vocals. So, make of this what you will
**Features I’m looking for:** On-ear headphones. They don’t need to be wireless or Bluetooth or be able to program my smart house. I want them for music listening (& to look nice lol). They *don’t* have to have fantastic noise cancellation. I will be honest and say I do go for things that have a certain look (hence the Momentum’s). Kinda like an older/retro vibe? I like metal &/or different textures. I find something that looks completely plastic to be unappealing (think Beats). One reason I like the Momentum’s is because of the tan suedey material & the metal. I don’t want something too chunky & heavy because I’ll wear them out. It’s a pointless purchase if I never end up wearing them :\
**Sonic features:** I know I don’t like that fuzzy & flat sound cheap headphones/earbuds tend to have (like the ones you find at a gas station or hanging up near the checkout of a store). Almost sounds like you’re congested. I also am not a fan of that scratchy metallic sound I’ve heard in some headphones... not really sure how to describe it. Any headphone I’ve liked (sorry, no particular brands I can remember) have sounded rich, resonant & bassy with clear vocals. There’s a sense of depth, perhaps? Overall I’d probably rather have too much bass than not enough
Keep in mind that I just want them to sound as-good-as or better than my Apple earbuds. I doubt I’m going to be taken to another planet with my budget restrictions & my pickiness on aesthetics
Any advice or recommendations for me? | 58 | They’re on sale for $205 figured ld get these. Had the mw07 master and dynamics but the volume sucked it was a big disappointment... are there any better earbuds for sound quality and a good amount of volume l can choose instead of the sennheisers momentum true wireless? Let me know!!
Thank you | Decent earbuds but no volume control | For purchase advice: Truly wirless earbuds | Excellent wireless earbuds | I need a pair of In-Ear, Wireless, Low Profile Buds with good, crystal clear sound quality for music listening that is under $200 | Best wireless earbuds I've had to date | I’m looking for some quality headphones for around $130 | ... there's an affordable set of truly wireless earbuds your better of with wired Bose earbuds | Decent Price for great earbuds |
59 | Starcraft Updater keep crashing. | Hi.
I updated my ETS2 game manually using the patch 1.35.1.31, please help.
game.log :
game.crash : | Everytime I find a game and enter the picking phase , the game will crash , and then when i relaunch the game , it forced me to update the game (nothing is actually updated, just 10-15 minutes of waiting). Only then can I play the game peacefully. I got 3 abandons and into LP for this. So everytime I want to play, I just practice with Bots to let the game crash and update. I try searching everywhere about this problem but I cant find any solution and I dont want to wait 10-15 minutes of useless update to play everytime. Any help will be much appreciated , Thanks in advance. | Hello,
So I randomly decided to start playing GW2 again after not playing it in probably 3 months. When I go to update, it will start to update, but like 2% in, it crashes and asks to send a report. It doesn't have an error or anything. I immediately decided to just reinstall the game, so I redid everything and still it crashes again in update. I found out how to do repair client and now the repair client is not responding on the screen where it says "Repairing Data Archive" and when it gets to an update screen, the same crash happens.
Any ideas??
Thanks!
Edit: The error is "A serious error has occurred that prevents the program from continuing to run..."
Edit: So far, a regular uninstall + reinstall does not fix the problem. Doing a Scandisk at the moment. | Hello all,
&#x200B;
As with the title, my game keeps crashing or gets an infinite blackscreen on startup after this update. I've tried doing EA's proposed solution for fixing this issue, I tried repairing the game on Origin, tried deleting the .exe files and then repairing on Origin, as well as restarting my PC. None of these solutions fixed my problem.
&#x200B;
I have no idea what the hell happened in a single patch but now I can't play the game whatsoever even though my PC could handle BF2 easily before this patch (60 fps high graphics no issue).
&#x200B;
Any and all help is appreciated, pretty peeved I can't play the new update right now. | Hey all,
So I finally figured out a good way to stream my PC to my Quest after hours of work because I'm not the best with comptuers lol. I'm using the AMD ReLive software and so far its doing alright.
I tried to launch Minecraft VR, and at first it said "Windows Update needs to be enabled"
After I fixed that, I launched it again, now it's saying "Checking for updates" then crashing!
Does anyone know what I need to do to fix this? Has anyone has this problem before? I tried looking on other reddit pages but all the fixes were for the Rift, and didn't really seem to apply.
Thanks a lot! | tl;dr: game crashes, wtf Anet, fix it
Since the new build I have had constant crashes pvp matches. I am getting very sick of this now. WHY is it not fixed, you have over a dozen crash reports from me.
I also found this thread. | The update before made my game crashing every now and then, and then I was good since 2 days ago, until now.
This update has made crashes more frequent, and I am suffering more frame drops and my FPS is generally lower now compared to before this update. Is this what 8 GB updates are supposed to do? By taking more space and making the game even more unplayable for me? cmon IW, what are these updates IW? PC is in a horrible state atm. | After updating the game last night, it completely broke the game. Stuck on DEV ERROR 5759 "DirectX has encountered and unrecoverable error" message
Methods tried:
1. Scan and repair
2. Update GPU Drivers
3. Roll back GPU Drivers
4. Battle.Net/Computer restarts
How can I fix this? | 59 | Hello, slight bit of technical problem here. I try to update my Starcraft, but the updater only goes a bit further in the update each time I open it, then it disappears and updates no further. Does anybody have an idea how I can fix this? | My Apex update wont go past 8.62 GB, anyone have any fixes? | April 2018 update stuck at 76% | Any way to disable updater? | Why does a 15Mb patch is taking me 1h to update? | Additional 16.7MB update just popped up for me | Stuck in checking for update loop? | How to get rid of update notification? | Install update stuck at 77% |
60 | Runs large for a mini | This item runs at least one size small. Not worth the price. | Runs small. Need to return it. Waste of time returning things. | Runs small needs to list the size I couldn't use it. But as far as looks this is what I wanted. | Runs sooooooooooo small. Quality is not that great. | Runs a little small, but quality seems very good. | We need to return it for a larger size before we can review it. It obviously runs on the small side. | Runs very small. I bought this in a medium for my sister and she could not even get it on. | It really runs small. But made really good. | 60 | Very cute! However, I ordered the medium mini size and it was huge on my larger minis. My 14hh paso fino is now using it. | Very cute and the size is perfect for carrying the bare minimal | Very cute but smaller than expected- wouldn't really call it ... | Cute! But, BE AWARE, little big for people on smaller sizes and NOT as long as it shows on picture. | Nice features, a little large for petite females | Beautiful but too large for my smaller dog | Super cute but runs somewhat large | Very cute but beware that it runs small | Cute but runs tiny in size |
61 | Modeling and verification of comprehensive errors of real-time wear-depth detecting for spherical plain bearing tester | A relatively recent development for the condition monitoring of oil-wetted machinery has been the in-line full-flow inductive wear debris sensor (hereafter referred to as inductive wear debris sensors). These sensors detect a disturbance to a magnetic field caused by metallic wear debris shed from deteriorating dynamic components that is entrained in the lubricant. Applications for these sensors currently include (but are not limited to) aviation machinery, wind-turbine generators, marine propulsion systems, and locomotives. Inductive wear debris sensors can distinguish between ferromagnetic and nonferromagnetic particles as well as providing size and other related information. One of the primary advantages of this sensor type is that the detectable size range is broad and may be used to track the progress of an incipient failure such as the rolling contact fatigue of a bearing or gear as it occurs. One aspect that has received little attention in the literature is the methodology for determining a suitab... | High-resolution position and velocity estimation algorithms based on binary Hall-effect sensors for low-cost vector control drives have been the subject of significant research in recent years. While different estimation algorithms have been proposed and analyzed, no contribution so far has dealt with Hall-effect sensor faults and their repercussion on the drive. This paper intends to fill this gap by analyzing single and multiple Hall-effect sensor faults and by proposing a method to detect, identify and mitigate such faults. The method is general, it ensures proper operation of the drive and is not dependent on the particular estimation algorithm that is used; by way of example, here it will be applied to a vector-tracking observer. Limitations on the performances of the faulty system are discussed and experimental results are reported to confirm the theoretical analysis. | A method for diagnosing multiple element defects in rolling bearings has been investigated. The method combines the time-synchronous averaging and envelope spectral analysis techniques to produce spectra of synchronously averaged envelope signals with a range of synchronous frequencies. The spectra are displayed in the synchronous period versus frequency domain, to result in the sync-period versus frequency distribution. The distribution separates the characteristic defect frequencies and their associated sidebands in the synchronous period axis. This analysis technique makes it possible to detect and diagnose multiple defects appearing in different elements of rolling bearings. Another main benefit of the method is the significant noise reduction by both the enveloping and the synchronous averaging processes. Results from both computer synthesised data and experimental simulated data are presented. | This article describes the design, analysis, and performance of a flatness inspection instrument to measure workpieces with up to 1mm departure from flatness. The instrument uses two air bearing spindles arranged with parallel axes to simultaneously rotate a workpiece and slowly pass a capacitance probe over the spinning surface. Capacitance probes offer user-selectable sensitivity to provide multiple combinations of measurement range and resolution. In tests with a high sensitivity probe, the instrument demonstrated measurement repeatability of 25nm on a ∅75mm workpiece. This article presents a complete homogeneous transformation matrix analysis of the propagation of errors into the measurement as well as sample measurements on diamond turned workpieces. |
Introduction
The monitoring of rotating systems through bearing sensoring is part of the implementation of predictive maintenance strategies. The deployment of such approaches is motivated by the resulting benefits for industrial rotors in terms of cost reduction and increased production [1]. A primary concern of predictive maintenance and condition monitoring is the fault diagnosis of bearings, this is for two main reasons. First, durability assessments of rolling bearings are affected by significant uncertainties [2], given the complex interaction between a variety of parts. Additionally, it is well established that bearings are key nodes for retrieving information on the whole mechanical system [3]. In this context, the analysis of vibration signals represents one of the most informative tools for the assessment of machine conditions [4].
The past thirty years have seen increasingly rapid advances in this field thanks to the development of numerous signal processing techniques for fault identification. For instance, the literature on envelope analysis has been considerably developed [2,[4][5][6][7][8][9][10][11], which has shown its effectiveness in benchmark cases [12] and it is being implemented in industry for condition monitoring purposes. The outcomes of this kind of signal processing tool have the benefit of being highly interpretable, since the models' assumptions are sharply identifiable. On the other hand, the outcomes may be user dependent. The extraction of diagnostic information from vibration signals is often affected by the assumptions of the identification models and by the user's experience. For instance, choosing an optimal demodulation band [13][14][15][16][17] naturally implies an inherent arbitrariness. This paper discusses the application of a transfer learning methodology to the test rig available at Politecnico di Torino [58], which was designed to accommodate medium-sized bearings of industrial interest. To the best of the author's knowledge, this is the first work including experiments conducted on medium-size industrial bearings with localized faults. Additionally, this paper aims to explore the fault diagnosis capabilities of CNNs pre-trained for audio classification. Namely, the VGGish convolutional network [37,59,60] is employed to perform bearing fault diagnosis. The VGGish network was originally trained for large-scale audio classification by using millions of audio samples extracted from YouTube®videos [37]. In this work, the pre-trained model is fine-tuned by a few thousands vibration records retrieved under different working conditions of the machine. Such a knowledge transfer is inspired by the idea that the search of fault distinctive features in vibration spectrograms is conceptually similar to the identification of sound spectrograms [56]. The results corroborate this hypothesis and show that the feature extraction capabilities of the pre-trained VGGish network can be effectively transferred to fault diagnosis scenarios. Thanks to the use of TL, a large-scale and high-potential classification model can be reused for the purpose of machine diagnosis by fine-tuning with a very small dataset. Furthermore, it is shown that the pre-trained VGGish model outperforms the VGGish framework trained from scratch in the presence of a thousandsample set. Additionally, it is found that, for the case under analysis, the VGGish performs better than models pre-trained for image recognition.
The overall structure of this paper takes the form of five sections. The introductory paragraph presents the topic of intelligent fault diagnosis of industrial bearings and provides the motivations which motivated the author to perform this investigation with respect to the existing literature. The second section gives an insight into the AI methodologies involved in this study, and CNNs, transfer learning and the VGGish model are presented. A description of the test rig for industrial bearings and the vibration dataset is provided in the third section, whereas the fourth section includes results, discussion and implications. Finally, the fifth section provides the concluding remarks.
Transfer Learning for Bearing Fault Diagnosis
This section provides a short summary of the main AI devices involved in this study. CNNs, transfer learning and the VGGish audio feature extractor are introduced.
Convolutional Neural Networks (CNNs)
The typical structure of a CNN ( Figure 1) includes a sequence of layers in which several algebraic operations take place. This claim is valid for the vast majority of deep learning approaches, but CNNs are differentiated by their ability to handle multidimensional data. That is one of the reasons why the introduction of CNNs [34,61] completely transformed image-based AI. A wide range of research areas thereafter took advantage of these structures. Indeed, as previously described, sound spectrograms were employed to train CNNs for audio classification [37]. The convolution operation mainly consists of applying filter kernels to the input data, whereas pooling layers carry out data downsampling. Finally, fully connected layers flatten multidimensional data [18,20,55,56] in one-dimensional vectors. For classification tasks, the last fully connected layer returns the output class. Convolutional and fully connected layers also implement nonlinear effects by means of activation functions. The Rectified Linear Unit (ReLU) is one of the possible activation functions for introducing nonlinearities in the output of convolutional layers [56].
The training process aims to optimize a specific loss function, which can be interpreted as a measure of the distance between the predictions of the model and the ground truth. For instance, the cross-entropy of Equation (1) is the typical loss function employed for classification tasks with mutually exclusive classes, • M is the number of observations; • N is the number of classes; •ŷ mn is the network output for the m-th observation and the n-th class; • y mn is the ground truth for the m-th observation and the n-th class. The training process aims to optimize a specific loss function, which can be interpreted as a measure of the distance between the predictions of the model and the ground truth. For instance, the cross-entropy of Equation (1) is the typical loss function employed for classification tasks with mutually exclusive classes,
Loss = − 1 M M ∑ m=1 N ∑ n=1 y mn lnŷ mn(1)− 1 ln (1)
where:
• is the number of observations; • is the number of classes; • is the network output for the -th observation and the -th class; • is the ground truth for the -th observation and the -th class. At the end of training stage, the weights of the network filters are optimized for the specific task and contain the knowledge related to the latter. In particular, the stacked convolutional layers learn hierarchical representations of the input data. Convolutional layers are mainly devoted to the feature extraction. For deep learning models, the extraction process is automated and does not require manual feature selection. Moreover, deeper layers correspond to more abstract features. In other words, the convolutional layers learn to extract discriminating features of the input data during training. The extracted feature maps are condensed in the fully connected layers which terminate in the network output for the classification.
Transfer Learning
Transfer learning covers a wide range of techniques aimed at reusing the knowledge already contained in AI models. A complete exploration of all the TL methodologies is beyond the scope of this study; a comprehensive insight is given by the works of Pan and Yang [42] and Lei et al. [20]. Parameter-based TL is considered for the purpose of this investigation. Namely, it is assumed that the knowledge transfer can be carried out by reusing the parameters of a pre-trained model. In the case of CNNs, the parameters are represented by the network weights, which enclose the knowledge. Thanks to the data from the source domain, the pre-trained network acquires the feature extraction capabilities for accomplishing the specific source task. The knowledge is thus transferred to the target domain of interest to fulfil a target task. Figure 1 shows a typical transfer learning framework for CNNs. Some or all of the At the end of training stage, the weights of the network filters are optimized for the specific task and contain the knowledge related to the latter. In particular, the stacked convolutional layers learn hierarchical representations of the input data. Convolutional layers are mainly devoted to the feature extraction. For deep learning models, the extraction process is automated and does not require manual feature selection. Moreover, deeper layers correspond to more abstract features. In other words, the convolutional layers learn to extract discriminating features of the input data during training. The extracted feature maps are condensed in the fully connected layers which terminate in the network output for the classification.
Transfer Learning
Transfer learning covers a wide range of techniques aimed at reusing the knowledge already contained in AI models. A complete exploration of all the TL methodologies is beyond the scope of this study; a comprehensive insight is given by the works of Pan and Yang [42] and Lei et al. [20]. Parameter-based TL is considered for the purpose of this investigation. Namely, it is assumed that the knowledge transfer can be carried out by reusing the parameters of a pre-trained model. In the case of CNNs, the parameters are represented by the network weights, which enclose the knowledge. Thanks to the data from the source domain, the pre-trained network acquires the feature extraction capabilities for accomplishing the specific source task. The knowledge is thus transferred to the target domain of interest to fulfil a target task. Figure 1 shows a typical transfer learning framework for CNNs. Some or all of the feature extraction layers are frozen, whereas the last layers are replaced with new ones. The weights of the latter are optimized by fine-tuning the model in the target domain. One of the most fascinating aspects of this technique is related to the amount of training data. Considering that the actual training involves few layers, the amount of training data is extremely low with respect to training from scratch. However, the potential of extracting complex features is preserved in the frozen layers.
This study investigates the case of knowledge transfer from an audio feature extractor to the assessment of bearing health state. The methodology is outlined in Figure 2. The model A is pre-trained for audio recognition. For instance, the label "Guitar" is assigned to guitar sounds. The ability of extracting spectrogram features is transferred to the domain of vibration signals by reusing part of the model A. Then, the model B is fine-tuned by employing a reduced amount of target data. As an example, the target task could be the assignment of the label "Bearing fault" to the vibration signal.
of the most fascinating aspects of this technique is related to the amount of training data. Considering that the actual training involves few layers, the amount of training data is extremely low with respect to training from scratch. However, the potential of extracting complex features is preserved in the frozen layers.
This study investigates the case of knowledge transfer from an audio feature extractor to the assessment of bearing health state. The methodology is outlined in Figure 2. The model A is pre-trained for audio recognition. For instance, the label "Guitar" is assigned to guitar sounds. The ability of extracting spectrogram features is transferred to the domain of vibration signals by reusing part of the model A. Then, the model B is fine-tuned by employing a reduced amount of target data. As an example, the target task could be the assignment of the label "Bearing fault" to the vibration signal.
VGGish Network for Bearing Health Monitoring
An audio feature extractor is a CNN designed to unpack the most distinctive features detectable in an audio spectrogram. These features are condensed in a low-dimensional space, where a classifier can operate more conveniently to discern classes. This process is also known as feature embedding. The classifier can also be constituted of a series of fully connected layers attached to the end of the feature extractor. The author chose to transfer knowledge from an audio CNN because those networks can already identify spectrogram features, wherever the signal originates. However, the literature shows examples of knowledge transfer from image classification networks [55] to benchmark vibration datasets.
The VGGish architecture [37] summarized in Table 1 contains 62 million weights. The model was originally trained by Hershey et al. [37] in 2017 by using 70 million YouTube clips, for a total amount of 5.24 million hours and 30,871 audio labels. The network input is constituted of a 96 × 64 mel spectrogram [62,63], which is a time-frequency transformation typically applied to audio signals. The pre-trained framework can be used in two ways. First, it can act as a feature extractor to embed audio in the 128 feature vector that feeds a classification model. Alternatively, the architecture can be part of a larger model that needs fine-tuning. Figure 3a and Figure 3b show examples of low-level and mediumlevel features, respectively, learned by the pre-trained VGGish. It is noted that more complex spectrogram features correspond to deeper layers.
VGGish Network for Bearing Health Monitoring
An audio feature extractor is a CNN designed to unpack the most distinctive features detectable in an audio spectrogram. These features are condensed in a low-dimensional space, where a classifier can operate more conveniently to discern classes. This process is also known as feature embedding. The classifier can also be constituted of a series of fully connected layers attached to the end of the feature extractor. The author chose to transfer knowledge from an audio CNN because those networks can already identify spectrogram features, wherever the signal originates. However, the literature shows examples of knowledge transfer from image classification networks [55] to benchmark vibration datasets.
The VGGish architecture [37] summarized in Table 1 contains 62 million weights. The model was originally trained by Hershey et al. [37] in 2017 by using 70 million YouTube®clips, for a total amount of 5.24 million hours and 30,871 audio labels. The network input is constituted of a 96 × 64 mel spectrogram [62,63], which is a time-frequency transformation typically applied to audio signals. The pre-trained framework can be used in two ways. First, it can act as a feature extractor to embed audio in the 128 feature vector that feeds a classification model. Alternatively, the architecture can be part of a larger model that needs fine-tuning. Figures 3a and 3b [62,63] is quite common in audio processing. Indeed, the mel scale is perceptually relevant for human hearing, which is more sensitive at lower frequencies. In this study, the same preprocessing steps are applied to vibration signals in order to enhance the similarities between the source and the The preprocessing steps result in a 96 × 64 patch, in accordance with the input of the network. The use of the mel spectrogram [62,63] is quite common in audio processing. Indeed, the mel scale is perceptually relevant for human hearing, which is more sensitive at lower frequencies. In this study, the same preprocessing steps are applied to vibration signals in order to enhance the similarities between the source and the target domain. According to the author of this work, it is reasonable to assume that this circumstance fosters knowledge transferability. TL was applied for identifying bearing health conditions. For this purpose, the last layer of the VGGish was replaced with a new one. Namely, the regression layer was replaced with a fully connected layer with three neurons for classifying three bearing health states. Next, a classification layer was added. Since the feature extraction layers remained unchanged, it can be stated that the original VGGish feature embedding fed the classification layer. Moreover, a dropout layer was added before the last fully connected layer. Dropout layers set weights to zero with a given probability in order to reduce the number of trainable parameters and avoid overfitting. In this case, the dropout probability was set to 50%. When the training was run, only the weights related to new layers were updated. The replacement of the only last layer and the implementation of dropout strategies showed to be the most effective approach for the analyzed case. Table 2 reports the set of hyperparameters adopted in this work.
× 64 × 1 1 − Conv 1 Convolution 3 × 3 × 1 64 ReLU Pool 1 Max Pooling 2 × 2 − − Conv 2 Convolution 3 × 3 × 64 128 ReLU Pool 2 Max Pooling 2 × 2 − − Conv 3_1 Convolution 3 × 3 × 128 256 ReLU Conv 3_2 Convolution 3 × 3 × 256 256 ReLU Pool 3 Max Pooling 2 × 2 − − Conv 4_1 Convolution 3 × 3 × 256 512 ReLU Conv 4_2 Convolution 3 × 3 × 512 512 ReLU Pool 4 Max Pooling 2 × 2 − − Fc 1_1 Fully Connected 4096 − ReLU Fc 1_2 Fully Connected 4096 − ReLU Fc 2 Fully Connected 128 − ReLU Output Regression Output − − −
Vibration Dataset for Industrial Bearings
The TL methodology was applied to the dataset generated by a test rig for industrial bearings available at Politecnico di Torino [58]. To the best of the author's knowledge, the existing literature provides scant evidence of deep learning strategies applied to datasets covering medium-size bearings (360 mm outer diameter). Three health states were analyzed: normal condition, inner race damage and outer race damage. This section provides a description of the test rig, of the experimental activity and of the dataset construction.
Description of the Test Rig
The test rig presented in reference [58] (Figure 4) can house up to four bearings with outer diameters ranging from 280 mm to 420 mm. A full description of the test rig goes beyond the scope of this work, since a comprehensive outline of the design activity and equipment is already provided in [58]. A 30 kW three-phase induction motor is controlled by an inverter. The motor is connected to the shaft by means of a rubber joint. The shaft rotation is sustained by the two main bearings. The so-called "self-contained box" houses the test bearings, which can be loaded with up to 200 kN thanks to oil actuators. The two air-oil pumps control the radial and the axial actuators, respectively, by converting pneumatic pressure into oil pressure (up to 500 bar). Then, the radial and the axial loads are applied independently. The lubrication system consists of an external control unit that monitors the oil jet system. The ISO VG 150 oil is injected with a flow rate of 2.5 L/min and a pressure of 6 bar. Four SKF CMS 2200T sensors are fitted to the four adapters in order to measure acceleration and temperature. The main features of the vibration sensors are reported in Table 3. The condition monitoring framework includes a LMS Scadas III data acquisition system. The latter is interfaced with a laptop for signal acquisition and post-processing. The layout of the self-contained box ( Figure 5) provides an advantage of balancing the loads of the actuators through the elastic deformation of the box. Thus, the test loads are internally accommodated and the load circuit is "self-contained". Consequently, the main Four SKF CMS 2200T sensors are fitted to the four adapters in order to measure acceleration and temperature. The main features of the vibration sensors are reported in Table 3. The condition monitoring framework includes a LMS Scadas III data acquisition system. The latter is interfaced with a laptop for signal acquisition and post-processing.
Experimental Activity and Dataset Construction
This study takes into account three health states for the spherical roller bearing SKF 22,240 CCK/W33 (Figure 6a). The bearings have an inner diameter of 200 mm with a 1:12 tapered bore and an outer diameter of 360 mm. In addition to the normal state, inner race (IR) damage ( Figure 6b) and outer race (OR) damage (Figure 6c) are considered. The faults have a diameter of 2 mm and a depth of 0.5 mm. The damages were mechanically machined on the race that is most loaded in the case of application of an axial load. In order to apply the damages, bearings were dismounted. Then, the faults were drilled on the race of interest by employing a solid carbide drill with a diameter of 2 mm. Although the produced faults are representative of localized defects in rolling bearings, the vibration data extracted cannot obviously represent the complete scenario of defects detectable in rolling bearings.
The experiment involved the analysis of four load cases at 10 different shaft speeds as reported in Table 4. Then, 40 signals were extracted for each health state totaling 120 signals. The vibration signals were acquired by means of the data acquisition system and sampled at 20,480 Hz. Each of the acquisitions lasted 30 s. Therefore, 1 hour of signal acquisition was taken into account. The experiment involved the analysis of four load cases at 10 different shaft speeds as reported in Table 4. Then, 40 signals were extracted for each health state totaling 120 signals. The vibration signals were acquired by means of the data acquisition system and sampled at 20,480 Hz. Each of the acquisitions lasted 30 s. Therefore, 1 hour of signal acquisition was taken into account. The dataset was constructed by extracting non-overlapping chunks from the vibration signals ( Table 5). The duration of the chunks was of 1.6 s. Therefore, 18 chunks were extracted for each signal. The resulting dataset consisted of 2160 samples equally balanced in the three classes: Normal, IR and OR. The data labelling for the supervised learning scheme was achieved as a natural consequence of the experiment. The amount of data are remarkably low for the use of large deep learning architectures. However, fault diagnosis can be performed thanks to TL. The dataset was constructed by extracting non-overlapping chunks from the vibration signals (Table 5). The duration of the chunks was of 1.6 s. Therefore, 18 chunks were extracted for each signal. The resulting dataset consisted of 2160 samples equally balanced in the three classes: Normal, IR and OR. The data labelling for the supervised learning scheme was achieved as a natural consequence of the experiment. The amount of data are remarkably low for the use of large deep learning architectures. However, fault diagnosis can be performed thanks to TL. The dataset was randomly split in order to test the applicability of the proposed method. Table 6 reports the information regarding the data split. A typical deep learning splitting strategy was applied: 80% of the data were used for fine-tuning the VGGish model, 10% of the data constituted the validation set, whereas the remaining 10% were used to test the method with new data.
Results and Discussion
This paper investigates the capabilities of CNNs pre-trained for audio classification to perform bearing fault diagnosis. It is argued that these networks are endowed with highly specific knowledge for extracting spectrogram features. For this purpose, the vibration dataset including damaged industrial medium-sized bearings was produced by means of proper experimental activity conducted on a specifically conceived test rig. A detailed description of the hardware is provided in reference [58]. As anticipated in Section 2.3, the VGGish convolutional architecture can act as a spectrogram feature extractor, as long as a proper preprocessing is carried out. Figures 7a, 7b and 7c show examples of normalized vibration signals for the normal state, IR and OR damages, respectively. Figure 8a-c shows the corresponding mel spectrograms obtained through the preprocessing. Finally, Figure 9a-c shows the corresponding 128-dimensional feature embedding output from the pre-trained VGGish feature extractor. Essentially, the information dissolved in the multifaceted mel spectrograms is translated and synthetized in a low-dimensional feature space via feature embedding. The classifier can discern classes by learning the differences that establish between feature embeddings. In this particular case, the feature embedding corresponds to a vector containing 128 elements.
Classes
Label Training Samples (80%)
Results and Discussion
This paper investigates the capabilities of CNNs pre-trained for audio classification to perform bearing fault diagnosis. It is argued that these networks are endowed with highly specific knowledge for extracting spectrogram features. For this purpose, the vibration dataset including damaged industrial medium-sized bearings was produced by means of proper experimental activity conducted on a specifically conceived test rig. A detailed description of the hardware is provided in reference [58]. As anticipated in Section 2.3, the VGGish convolutional architecture can act as a spectrogram feature extractor, as long as a proper preprocessing is carried out. Figure 7a, Figure 7b and Figure 7c show examples of normalized vibration signals for the normal state, IR and OR damages, respectively. Figure 8a-c shows the corresponding mel spectrograms obtained through the preprocessing. Finally, Figure 9a-c shows the corresponding 128-dimensional feature embedding output from the pre-trained VGGish feature extractor. Essentially, the information dissolved in the multifaceted mel spectrograms is translated and synthetized in a low-dimensional feature space via feature embedding. The classifier can discern classes by learning the differences that establish between feature embeddings. In this particular case, the feature embedding corresponds to a vector containing 128 elements. The model was fine-tuned using the hyperparameters reported in Table 2. The training time was 936 s on a standard laptop without GPU acceleration (Intel ® Core i7−10510U CPU @ 1.80 GHz). The model was implemented in the Matlab ® environment by means of machine learning, deep learning and audio toolbox libraries. It is worth noting that the original VGGish structure was trained on multiple GPUs for 184 hours [37]. Figure 10 shows the behavior of the loss functions during the training conducted according to the parameters in Table 2. In particular, the validation set served to monitor potential overfitting by analyzing the trend in the validation loss. The number of maximum epochs was set to four (216 iterations), since it was observed that the training process stabilized at this point and overfitting did not occur, though it was detectable during the first two epochs. The accuracies reported in Table 7 reveal the applicability of the diagnosis model to new test data. The complete confusion matrix resulting from the test data is shown in Figure 11. A single normal sample is predicted as OR damaged and a single OR sample is predicted as normal. Therefore, the classifier showed high precision and recall as reported in Table 8. The model was fine-tuned using the hyperparameters reported in Table 2. The training time was 936 s on a standard laptop without GPU acceleration (Intel ® Core i7−10510U CPU @ 1.80 GHz). The model was implemented in the Matlab ® environment by means of machine learning, deep learning and audio toolbox libraries. It is worth noting that the original VGGish structure was trained on multiple GPUs for 184 hours [37]. Figure 10 shows the behavior of the loss functions during the training conducted according to the parameters in Table 2. In particular, the validation set served to monitor potential overfitting by analyzing the trend in the validation loss. The number of maximum epochs was set to four (216 iterations), since it was observed that the training process stabilized at this point and overfitting did not occur, though it was detectable during the first two epochs. The accuracies reported in Table 7 reveal the applicability of the diagnosis model to new test data. The complete confusion matrix resulting from the test data is shown in Figure 11. A single normal sample is predicted as OR damaged and a single OR sample is predicted as normal. Therefore, the classifier showed high precision and recall as reported in Table 8.
Furthermore, the proposed model was compared with the VGGish model trained from scratch, the YAMNet model [56] and the VGG16 model pre-trained on ImageNet [34,35] proposed by Shao et al. [55]. Table 7 shows the accuracies obtained for the different models, whereas Table 8 reports the precision and the recall for the different classes. The VGGish trained from scratch reaches poor diagnosis accuracies and consistent overfitting phenomena occur. This is due to the fact that the original VGGish architecture was trained on millions of samples. Therefore, the structure is inherently unsuitable for correctly learning hierarchical features over a few thousands of training samples. Given the availability of a limited amount of training data, network weights of millions are extremely prone to overfit the training set. For this reason, TL is the most effective strategy. The YAMNet model [56] showed promising accuracies and reduced training times, but some overfitting was detectable. Finally, the VGG16 model [55] was trained by employing wavelet time-frequency images. The training of the model under the conditions reported in [55] required GPUs and was computationally expensive. The resulting metrics show that the VGG16 framework pre-trained on ImageNet is not suitable for the analyzed case.
According to the author of this work, this is due to the fact that several convolutional layers should be retrained in the model [55]. Consequently, more training data are required. On the other hand, few layers of the pre-trained VGGish and YAMNet need finetuning, since audio classification models are already capable of extracting distinctive spectrogram features. On the contrary, the knowledge contained in networks pre-trained on the ImageNet dataset cannot be considered highly specific for spectrogram recognition. tuning, since audio classification models are already capable of extracting distinctive spectrogram features. On the contrary, the knowledge contained in networks pre-trained on the ImageNet dataset cannot be considered highly specific for spectrogram recognition. Furthermore, the proposed model was compared with the VGGish model trained from scratch, the YAMNet model [56] and the VGG16 model pre-trained on ImageNet [34,35] proposed by Shao et al. [55]. Table 7 shows the accuracies obtained for the different models, whereas Table 8 reports the precision and the recall for the different classes. The VGGish trained from scratch reaches poor diagnosis accuracies and consistent overfitting phenomena occur. This is due to the fact that the original VGGish architecture was trained on millions of samples. Therefore, the structure is inherently unsuitable for correctly learning hierarchical features over a few thousands of training samples. Given the availability of a limited amount of training data, network weights of millions are extremely prone to overfit the training set. For this reason, TL is the most effective strategy. The YAMNet model [56] showed promising accuracies and reduced training times, but some overfitting was detectable. Finally, the VGG16 model [55] was trained by employing wavelet timefrequency images. The training of the model under the conditions reported in [55] required GPUs and was computationally expensive. The resulting metrics show that the VGG16 framework pre-trained on ImageNet is not suitable for the analyzed case. According to the author of this work, this is due to the fact that several convolutional layers should be retrained in the model [55]. Consequently, more training data are required. On the other hand, few layers of the pre-trained VGGish and YAMNet need fine-tuning, since audio classification models are already capable of extracting distinctive spectrogram features. On the contrary, the knowledge contained in networks pre-trained on the ImageNet dataset cannot be considered highly specific for spectrogram recognition.
The encouraging results indicate that the TL methodology is a valuable approach for the fault diagnosis of bearings. Remarkably, the knowledge contained in a network pre-trained for sound recognition can be reused for condition monitoring tasks. Moreover, the amount of training data is considerably low with respect to the network trained from scratch. The original VGGish network was trained by using 70 million audio samples, whereas less than 2000 samples were needed for performing fault diagnosis. Therefore, deep learning frameworks endowed with high knowledge content could be exploited without the need for millions of data samples. This remarkable implication is determined by the fact that the features extracted from the pre-trained VGGish network are already capable of identifying typical spectrogram features. Then, only slight adjustments are needed to adapt the model to the classification of vibration spectrograms. The feature embedding in which the sound spectrograms are translated is therefore convenient for vibration spectrograms as well.
However, this occurrence poses an issue in the interpretation of the diagnosis outcomes. Indeed, the 128 features which flow through the classifier have no clear physical interpretation. In this case, acoustically relevant features were able to classify vibrations. In contrast to traditional signal processing tools, where some parameters (e.g., kurtosis, crest factor and ball passing frequencies) have a physical meaning, the user does not know what the features actually represent for data-driven fault diagnosis, although they may perfectly work. Therefore, it is quite challenging to estimate the features variability with respect to the changes in the input signals. Additionally, the development of proper interpretability tools is of paramount importance for the correct visualization of domains alignment in transfer learning.
Conclusions
This work proposes a transfer learning methodology for fault diagnosis of industrial bearings. The VGGish architecture, originally pre-trained for sound classification on 70 million audio samples, is fine-tuned by using less than 2000 vibration samples. The experimental data related to the test set-up at the Politecnico di Torino and designed for the monitoring of industrial bearings are hereby presented. The experiment involved three health states ranging over ten speeds and four load cases for medium-size bearings. Vibration data were classified with 99.07% accuracy. The training time was 936 s. It is concluded that:
•
Deep learning CNNs are promising approaches for industrial condition monitoring; •
The existing potentials included in large deep learning architectures can be exploited for bearing fault diagnosis using of small datasets, as long as transfer learning is applied; • Transfer learning drastically reduces the computational demand by applying deep learning in fault diagnosis tasks; •
The acoustical features extracted from the VGGish network are also relevant for classifying bearing vibrations; • CNNs pre-trained for sound classification are more efficient and accurate than models pre-trained for image recognition.
The main limitations include the challenge of interpreting the extracted features. Although this study exhibits promising results, further investigations are also needed to apply this concept in industry, where fault data are scarcely available and balanced classes are not applicable. The knowledge transfer to unseen working conditions or different machines should be investigated as well.
Figure 1 .
1Typical transfer learning framework in CNNs.
Figure 1 .
1Typical transfer learning framework in CNNs.
Figure 2 .
2Knowledge transfer from an audio feature extractor to bearing health monitoring.
Figure 2 .
2Knowledge transfer from an audio feature extractor to bearing health monitoring.
Figure 3 .
3VGGish layers: (a) example of features learned in the layer Conv 2; (b) example of features learned in the layer Conv 3_1. Some preprocessing is needed to feed the VGGish architecture: • Signals are resampled at 16 kHz and normalized in the range [−1, 1]; • Each frame is converted in a log-mel spectrogram [62,63] of 64 frequency bins covering the range 125-7500 Hz by applying 25 ms windows every 10 ms; • Mel spectrograms are framed into samples of 0.96 s, which correspond to 96 frames of 10 ms.
Figure 3 .
3VGGish layers: (a) example of features learned in the layer Conv 2; (b) example of features learned in the layer Conv 3_1.
Sensors 2023 ,
202323, x FOR PEER REVIEW 8 of 16
Figure 4 .
4Test rig for industrial bearings[58].
Figure 4 .
4Test rig for industrial bearings[58].
not have to fulfil stringent requirements in terms of strength and minimum size. The test bearings can be replaced by resorting to proper adapters. The purpose of the adapters is to comply with the size of the box regardless of the outer diameter of the bearings.
Figure 4 .
4Test rig for industrial bearings[58].
Figure 5 .
5Scheme of the self-contained box[58].
Figure 5 .
5Scheme of the self-contained box[58].
Figure 6 .
6SKF 22,240 CCK/W33: (a) normal state bearing during dismounting; (b) inner race damage with 2 mm diameter and 0.5 mm depth; (c) outer race damage with 2 mm diameter and 0.5 mm depth.
Figure 6 .
6SKF 22,240 CCK/W33: (a) normal state bearing during dismounting; (b) inner race damage with 2 mm diameter and 0.5 mm depth; (c) outer race damage with 2 mm diameter and 0.5 mm depth.
Figure 7 .
7Vibration signal at 997 rpm and 124.8 kN radial load: (a) normal health state; (b) IR damage; (c) OR damage.
Figure 7 .Figure 8 .Figure 9 .
789Vibration signal at 997 rpm and 124.8 kN radial load: (a) normal health state; (b) IR damage; (c) OR damage. Sensors 2023, 23, Mel spectrogram at 997 rpm and 124.8 kN radial load: (a) normal health state; (b) IR damage; (c) OR damage. VGGish feature embedding at 997 rpm and 124.8 kN radial load: (a) normal health state;
Figure 8 .
8Mel spectrogram at 997 rpm and 124.8 kN radial load: (a) normal health state; (b) IR damage; (c) OR damage.
Figure 8 .Figure 9 .
89Mel spectrogram at 997 rpm and 124.8 kN radial load: (a) normal health state; (b) IR damage; (c) OR damage. VGGish feature embedding at 997 rpm and 124.8 kN radial load: (a) normal health state; (b) IR damage; (c) OR damage.
Figure 9 .
9VGGish feature embedding at 997 rpm and 124.8 kN radial load: (a) normal health state; (b) IR damage; (c) OR damage. Sensors 2023, 23, x FOR PEER REVIEW 12 of 16
Figure 10 .
10Loss functions.
Figure 11 .
11Test confusion matrix.
Figure 10 .
10Loss functions.
Figure 10 .
10Loss functions.
Figure 11 .
11Test confusion matrix.
show examples of low-level and medium-level features, respectively, learned by the pre-trained VGGish. It is noted that more complex spectrogram features correspond to deeper layers.Some preprocessing is needed to feed the VGGish architecture:• Signals are resampled at 16 kHz and normalized in the range [−1, 1]; • Each frame is converted in a log-mel spectrogram [62,63] of 64 frequency bins covering the range 125-7500 Hz by applying 25 ms windows every 10 ms; • Mel spectrograms are framed into samples of 0.96 s, which correspond to 96 frames of 10 ms. The preprocessing steps result in a 96 × 64 patch, in accordance with the input of the network. The use of the mel spectrogram
target domain. According to the author of this work, it is reasonable to assume that this circumstance fosters knowledge transferability.Table 1. VGGish layers.Sensors 2023, 23, 211
6 of 16
Layer
Type
Filter Size
Number of
Channels
Activation
Function
Input
Image Input
96
Table 1 .
1VGGish layers.Layer
Type
Filter Size
Number of
Channels
Activation
Function
Input
Image Input
96 × 64 × 1
1
−
Conv 1
Convolution
3 × 3 × 1
64
ReLU
Pool 1
Max Pooling
2 × 2
−
−
Conv 2
Convolution
3 × 3 × 64
128
ReLU
Pool 2
Max Pooling
2 × 2
−
−
Conv 3_1
Convolution
3 × 3 × 128
256
ReLU
Conv 3_2
Convolution
3 × 3 × 256
256
ReLU
Pool 3
Max Pooling
2 × 2
−
−
Conv 4_1
Convolution
3 × 3 × 256
512
ReLU
Conv 4_2
Convolution
3 × 3 × 512
512
ReLU
Pool 4
Max Pooling
2 × 2
−
−
Fc 1_1
Fully Connected
4096
−
ReLU
Fc 1_2
Fully Connected
4096
−
ReLU
Fc 2
Fully Connected
128
−
ReLU
Output
Regression Output
−
−
−
Table 2 .
2Hyperparameters for VGGish transfer learning.Hyperparameter
Value
Optimizer
Adam [64]
L2 regularization
1 × 10 −6
Mini batch size
32
Iterations per epoch
54
Initial learning rate
5 × 10 −4
Learning rate drop period
2
Learning rate drop factor
0.5
Max epochs
4
Table 3 .
3SKF CMS 2200T sensor specifications.Sensitivity
Table 3 .
3SKF CMS 2200T sensor specifications.Sensitivity
Table 4 .
4Test conditions.Load Case 1 Load Case 2
Load Case 3
Load Case 4
Radial load (kN)
0
64
124.8
124.8
Axial load (kN)
0
0
0
49
Nominal speeds (rpm)
127, 227, 353, 457, 523, 607, 727, 877, 937, 997
Table 4 .
4Test conditions.Load Case 1
Load Case 2
Load Case 3
Load Case 4
Radial load (kN)
0
64
124.8
124.8
Axial load (kN)
0
0
0
49
Nominal speeds (rpm)
127, 227, 353, 457, 523, 607, 727, 877, 937, 997
Table 5 .
5Signal extraction.Total acquisition duration (s)
30
Sampling frequency (Hz)
20,480
Chunk length (samples)
32,768
Chunk length (s)
1.6
Number of chunks per signal
18
Table 6 .
6Dataset split.Classes
Label
Training
Samples (80%)
Validation
Samples (10%)
Test
Samples (10%)
3
Normal
576
72
72
IR
576
72
72
OR
576
72
72
Total
1728
216
216
Table 7 .
7Diagnosis accuracies.Model
Training
Accuracy
Validation
Accuracy
Test
Accuracy
Hardware
Training
Time (s)
VGGish Transfer
Learning
100.00% 100.00%
99.07%
Intel ® Core i7−10510U
CPU @ 1.80 GHz
936
VGGish from
scratch
50.00%
33.33%
33.33%
Intel ® Core i7−10510U
CPU @ 1.80 GHz
1038
YAMNet [56]
100.00%
99.07%
91.20%
Intel ® Core i7−10510U
264
Table 7 .
7Diagnosis accuracies.Table 8. Precision and recall of the diagnosis models.Model
Training
Accuracy
Validation
Accuracy
Test
Accuracy
Hardware
Training
Time (s)
VGGish Transfer
Learning
100.00%
100.00%
99.07%
Intel®Core i7 − 10510U CPU @ 1.80 GHz
936
VGGish from scratch
50.00%
33.33%
33.33%
Intel 10510U CPU @ 1.80 GHz
1038
YAMNet [56]
100.00%
99.07%
91.20%
Intel 10510U CPU @ 1.80 GHz
264
VGG16 [55]
53.12%
66.20%
69.44%
GPU NVIDIA ® T4
693
Model
Label
Precision
Recall
Normal
98.61%
98.61%
VGGish Transfer Learning
IR
100.00%
100.00%
OR
98.61%
98.61%
Normal
33.33%
100.00%
VGGish from scratch
IR
0.00%
0.00%
OR
0.00%
0.00%
Table 8 .
8Cont.Model
Label
Precision
Recall
Normal
100.00%
73.60%
YAMNet [56]
IR
100.00%
100.00%
OR
79.10%
100.00%
Normal
67.90%
79.20%
VGG16 [55]
IR
69.40%
59.70%
OR
71.40%
69.40%
Table 7 .
7Diagnosis accuracies.Figure 11. Test confusion matrix.Model
Training
Accuracy
Validation
Accuracy
Test
Accuracy
Hardware
Training
Time (s)
VGGish Transfer
Learning
100.00% 100.00%
99.07%
Intel ® Core i7−10510U
CPU @ 1.80 GHz
936
VGGish from
scratch
50.00%
33.33%
33.33%
Intel ® Core i7−10510U
CPU @ 1.80 GHz
1038
YAMNet [56]
100.00%
99.07%
91.20%
Intel ® Core i7−10510U
CPU @ 1.80 GHz
264
VGG16 [55]
53.12%
66.20%
69.44%
GPU NVIDIA ® T4
693
Funding: This research received no external funding.Institutional Review Board Statement: Not applicable.Informed Consent Statement: Not applicable.Data Availability Statement:The data are not publicly available due to the policy of the department.Conflicts of Interest:The author declares no conflict of interest.
Machinery Condition Monitoring: Principles and Practices. A R Mohanty, CRC PressBoca Raton, FL, USAISBN 9781466593053Mohanty, A.R. Machinery Condition Monitoring: Principles and Practices; CRC Press: Boca Raton, FL, USA, 2014; ISBN 9781466593053.
Vibration-Based Condition Monitoring: Industrial, Aerospace and Automotive Applications. R B Randall, Randall, R.B. Vibration-Based Condition Monitoring: Industrial, Aerospace and Automotive Applications;
Design of a Kinematic Vibration Energy Harvester for a Smart Bearing with Piezoelectric/Magnetic Coupling. Mech. E Brusa, 10.1080/15376494.2018.1508795Adv. Mater. Struct. 27Brusa, E. Design of a Kinematic Vibration Energy Harvester for a Smart Bearing with Piezoelectric/Magnetic Coupling. Mech. Adv. Mater. Struct. 2020, 27, 1322-1330. [CrossRef]
Rolling Element Bearing Diagnostics-A Tutorial. R B Randall, J Antoni, 10.1016/j.ymssp.2010.07.017Mech. Syst. Signal Process. 25Randall, R.B.; Antoni, J. Rolling Element Bearing Diagnostics-A Tutorial. Mech. Syst. Signal Process. 2011, 25, 485-520. [CrossRef] Sensors 2023, 23, 211 14 of 16
Model for the Vibration Produced by a Single Point Defect in a Rolling Element Bearing. P D Mcfadden, J D Smith, 10.1016/0022-460X(84)90595-9J. Sound Vib. 96McFadden, P.D.; Smith, J.D. Model for the Vibration Produced by a Single Point Defect in a Rolling Element Bearing. J. Sound Vib. 1984, 96, 69-82. [CrossRef]
Envelope Analysis of Rotating Machine Vibrations in Variable Speed Conditions: A Comprehensive Treatment. D Abboud, J Antoni, S Sieg-Zieba, M Eltabach, 10.1016/j.ymssp.2016.06.033Mech. Syst. Signal Process. 84Abboud, D.; Antoni, J.; Sieg-Zieba, S.; Eltabach, M. Envelope Analysis of Rotating Machine Vibrations in Variable Speed Conditions: A Comprehensive Treatment. Mech. Syst. Signal Process. 2017, 84, 200-226. [CrossRef]
Health Indicators Construction for Damage Level Assessment in Bearing Diagnostics: A Proposal of an Energetic Approach Based on Envelope Analysis. E Brusa, F Bruzzone, C Delprete, L G Di Maggio, C Rosso, 10.3390/app10228131Appl. Sci. 2020Brusa, E.; Bruzzone, F.; Delprete, C.; Di Maggio, L.G.; Rosso, C. Health Indicators Construction for Damage Level Assessment in Bearing Diagnostics: A Proposal of an Energetic Approach Based on Envelope Analysis. Appl. Sci. 2020, 10, 8131. [CrossRef]
Envelope Analysis Applied to Non-Hertzian Contact Simulations in Damaged Roller Bearings. E Brusa, F Bruzzone, C Delprete, L Di Maggio, C Rosso, 10.1088/1757-899X/1038/1/012013IOP Conf. Ser. Mater. Sci. Eng. Brusa, E.; Bruzzone, F.; Delprete, C.; Di Maggio, L.; Rosso, C. Envelope Analysis Applied to Non-Hertzian Contact Simulations in Damaged Roller Bearings. IOP Conf. Ser. Mater. Sci. Eng. 2021, 1038, 012013. [CrossRef]
Rolling Bearings Monitoring and Damage Detection Methodology. C Delprete, M Milanesio, C Rosso, 10.4028/www.scientific.net/AMM.3-4.293Appl. Mech. Mater. 3Delprete, C.; Milanesio, M.; Rosso, C. Rolling Bearings Monitoring and Damage Detection Methodology. Appl. Mech. Mater. 2006, 3, 293-302. [CrossRef]
Application of Teager-Kaiser Energy Operator in the Early Fault Diagnosis of Rolling Bearings. X Shi, Z Zhang, Z Xia, B Li, X Gu, T Shi, 10.3390/s22176673Sensors. 2022Shi, X.; Zhang, Z.; Xia, Z.; Li, B.; Gu, X.; Shi, T. Application of Teager-Kaiser Energy Operator in the Early Fault Diagnosis of Rolling Bearings. Sensors 2022, 22, 6673. [CrossRef]
A Proposal of a Technique for Correlating Defect Dimensions to Vibration Amplitude in Bearing Monitoring. E Brusa, F Bruzzone, C Delprete, L G Di Maggio, C Rosso, Proceedings of the PHM Society European Conference. the PHM Society European ConferenceTurin, ItalyBrusa, E.; Bruzzone, F.; Delprete, C.; Di Maggio, L.G.; Rosso, C. A Proposal of a Technique for Correlating Defect Dimensions to Vibration Amplitude in Bearing Monitoring. In Proceedings of the PHM Society European Conference, Turin, Italy, 1-3 July 2020; pp. 1-14.
Rolling Element Bearing Diagnostics Using the Case Western Reserve University Data: A Benchmark Study. W A Smith, R B Randall, 10.1016/j.ymssp.2015.04.021Mech. Syst. Signal. Process. 64Smith, W.A.; Randall, R.B. Rolling Element Bearing Diagnostics Using the Case Western Reserve University Data: A Benchmark Study. Mech. Syst. Signal. Process. 2015, 64, 100-131. [CrossRef]
Entropic Evidence of the Signature of Repetitive Transients. J The Antoni, Infogram, 10.1016/j.ymssp.2015.04.034Mech. Syst. Signal. Process. 74Antoni, J. The Infogram: Entropic Evidence of the Signature of Repetitive Transients. Mech. Syst. Signal. Process. 2016, 74, 73-94. [CrossRef]
The Spectral Kurtosis: A Useful Tool for Characterising Non-Stationary Signals. J Antoni, 10.1016/j.ymssp.2004.09.001Mech. Syst. Signal. Process. 20Antoni, J. The Spectral Kurtosis: A Useful Tool for Characterising Non-Stationary Signals. Mech. Syst. Signal. Process. 2006, 20, 282-307. [CrossRef]
Optimal Demodulation-Band Selection for Envelope-Based Diagnostics: A Comparative Study of Traditional and Novel Tools. W A Smith, P Borghesani, Q Ni, K Wang, Z Peng, 10.1016/j.ymssp.2019.106303Mech. Syst. Signal. Process. 134Smith, W.A.; Borghesani, P.; Ni, Q.; Wang, K.; Peng, Z. Optimal Demodulation-Band Selection for Envelope-Based Diagnostics: A Comparative Study of Traditional and Novel Tools. Mech. Syst. Signal. Process. 2019, 134, 106303. [CrossRef]
The Autogram: An Effective Approach for Selecting the Optimal Demodulation Band in Rolling Element Bearings Diagnosis. A Moshrefzadeh, A Fasana, 10.1016/j.ymssp.2017.12.009Mech. Syst. Signal. Process. 105Moshrefzadeh, A.; Fasana, A. The Autogram: An Effective Approach for Selecting the Optimal Demodulation Band in Rolling Element Bearings Diagnosis. Mech. Syst. Signal. Process. 2018, 105, 294-318. [CrossRef]
A Novel Method for the Optimal Band Selection for Vibration Signal Demodulation and Comparison with the Kurtogram. T Barszcz, A Jabłoński, 10.1016/j.ymssp.2010.05.018Mech. Syst. Signal. Process. 25Barszcz, T.; Jabłoński, A. A Novel Method for the Optimal Band Selection for Vibration Signal Demodulation and Comparison with the Kurtogram. Mech. Syst. Signal. Process. 2011, 25, 431-451. [CrossRef]
Deep Learning and Its Applications to Machine Health Monitoring. R Zhao, R Yan, Z Chen, K Mao, P Wang, R X Gao, 10.1016/j.ymssp.2018.05.050Mech. Syst. Signal. Process. 115Zhao, R.; Yan, R.; Chen, Z.; Mao, K.; Wang, P.; Gao, R.X. Deep Learning and Its Applications to Machine Health Monitoring. Mech. Syst. Signal. Process. 2019, 115, 213-237. [CrossRef]
Support Vector Machine in Machine Condition Monitoring and Fault Diagnosis. A Widodo, B.-S Yang, 10.1016/j.ymssp.2006.12.007Mech. Syst. Signal. Process. 21Widodo, A.; Yang, B.-S. Support Vector Machine in Machine Condition Monitoring and Fault Diagnosis. Mech. Syst. Signal. Process. 2007, 21, 2560-2574. [CrossRef]
Applications of Machine Learning to Machine Fault Diagnosis: A Review and Roadmap. Y Lei, B Yang, X Jiang, F Jia, N Li, A K Nandi, 10.1016/j.ymssp.2019.106587Mech. Syst. Signal. Process. 138Lei, Y.; Yang, B.; Jiang, X.; Jia, F.; Li, N.; Nandi, A.K. Applications of Machine Learning to Machine Fault Diagnosis: A Review and Roadmap. Mech. Syst. Signal. Process. 2020, 138, 106587. [CrossRef]
Artificial Intelligence for Fault Diagnosis of Rotating Machinery: A Review. R Liu, B Yang, E Zio, X Chen, 10.1016/j.ymssp.2018.02.016Mech. Syst. Signal. Process. 108Liu, R.; Yang, B.; Zio, E.; Chen, X. Artificial Intelligence for Fault Diagnosis of Rotating Machinery: A Review. Mech. Syst. Signal. Process. 2018, 108, 33-47. [CrossRef]
An Explainable Artificial Intelligence Approach for Unsupervised Fault Detection and Diagnosis in Rotating Machinery. L C Brito, G A Susto, J N Brito, M A V Duarte, 10.1016/j.ymssp.2021.108105Mech. Syst. Signal. Process. 2022108105Brito, L.C.; Susto, G.A.; Brito, J.N.; Duarte, M.A.V. An Explainable Artificial Intelligence Approach for Unsupervised Fault Detection and Diagnosis in Rotating Machinery. Mech. Syst. Signal. Process. 2022, 163, 108105. [CrossRef]
Eigen-Spectrograms: An Interpretable Feature Space for Bearing Fault Diagnosis Based on Artificial Intelligence and Image Processing. E Brusa, C Delprete, L G Di Maggio, 10.1080/15376494.2022.2102274Mech. Adv. Mater. Struct. 2022Brusa, E.; Delprete, C.; Di Maggio, L.G. Eigen-Spectrograms: An Interpretable Feature Space for Bearing Fault Diagnosis Based on Artificial Intelligence and Image Processing. Mech. Adv. Mater. Struct. 2022, 1-13. [CrossRef]
Practical Industrial Application for Mechanical Faults Diagnostic. L M R Baccarini, V V Rocha E Silva, B R De Menezes, W M Caminhas, Svm, 10.1016/j.eswa.2010.12.017Expert Syst. Appl. 38Baccarini, L.M.R.; Rocha e Silva, V.V.; de Menezes, B.R.; Caminhas, W.M. SVM Practical Industrial Application for Mechanical Faults Diagnostic. Expert Syst. Appl. 2011, 38, 6980-6984. [CrossRef]
A Fault Diagnosis Approach for Roller Bearing Based on IMF Envelope Spectrum and SVM. Y Yang, D Yu, J Cheng, 10.1016/j.measurement.2006.10.010Measurement. 40Yang, Y.; Yu, D.; Cheng, J. A Fault Diagnosis Approach for Roller Bearing Based on IMF Envelope Spectrum and SVM. Measurement 2007, 40, 943-950. [CrossRef]
Application of Support Vector Machine Based on Pattern Spectrum Entropy in Fault Diagnostics of Rolling Element Bearings. R Hao, Z Peng, Z Feng, F Chu, 10.1088/0957-0233/22/4/045708Meas. Sci. Technol. Hao, R.; Peng, Z.; Feng, Z.; Chu, F. Application of Support Vector Machine Based on Pattern Spectrum Entropy in Fault Diagnostics of Rolling Element Bearings. Meas. Sci. Technol. 2011, 22, 045708. [CrossRef]
Fault Diagnosis of Ball Bearings Using Machine Learning Methods. P K Kankar, S C Sharma, S P Harsha, 10.1016/j.eswa.2010.07.119Expert Syst. Appl. 38Kankar, P.K.; Sharma, S.C.; Harsha, S.P. Fault Diagnosis of Ball Bearings Using Machine Learning Methods. Expert Syst. Appl. 2011, 38, 1876-1886. [CrossRef]
A Deep Learning Method for Bearing Fault Diagnosis through Stacked Residual Dilated Convolutions. Z Zhuang, H Lv, J Xu, Z Huang, W Qin, 10.3390/app9091823Appl. Sci. 9Zhuang, Z.; Lv, H.; Xu, J.; Huang, Z.; Qin, W. A Deep Learning Method for Bearing Fault Diagnosis through Stacked Residual Dilated Convolutions. Appl. Sci. 2019, 9, 1823. [CrossRef]
Fault Diagnosis for UAV Blades Using Artificial Neural Network. G Iannace, G Ciaburro, A Trematerra, 10.3390/robotics8030059Robotics. 859Iannace, G.; Ciaburro, G.; Trematerra, A. Fault Diagnosis for UAV Blades Using Artificial Neural Network. Robotics 2019, 8, 59. [CrossRef]
Fault Diagnosis Based on Deep Learning. F Lv, C Wen, Z Bao, M Liu, Proceedings of the 2016 American Control Conference (ACC). the 2016 American Control Conference (ACC)Boston, MA, USA, 6-8Lv, F.; Wen, C.; Bao, Z.; Liu, M. Fault Diagnosis Based on Deep Learning. In Proceedings of the 2016 American Control Conference (ACC), Boston, MA, USA, 6-8 July 2016; pp. 6851-6856.
A Novel Fault Diagnosis Method for Rotating Machinery Based on a. S Guo, T Yang, W Gao, C Zhang, 10.3390/s18051429Convolutional Neural Network. Sensors. 18Guo, S.; Yang, T.; Gao, W.; Zhang, C. A Novel Fault Diagnosis Method for Rotating Machinery Based on a Convolutional Neural Network. Sensors 2018, 18, 1429. [CrossRef]
A New Convolutional Neural Network-Based Data-Driven Fault Diagnosis Method. L Wen, X Li, L Gao, Y Zhang, 10.1109/TIE.2017.2774777IEEE Trans. Ind. Electron. 65Wen, L.; Li, X.; Gao, L.; Zhang, Y. A New Convolutional Neural Network-Based Data-Driven Fault Diagnosis Method. IEEE Trans. Ind. Electron. 2018, 65, 5990-5998. [CrossRef]
Automated Bearing Fault Diagnosis Scheme Using 2D Representation of Wavelet Packet Transform and Deep Convolutional Neural Network. M M M Islam, J M Kim, 10.1016/j.compind.2019.01.008Comput. Ind. 106Islam, M.M.M.; Kim, J.M. Automated Bearing Fault Diagnosis Scheme Using 2D Representation of Wavelet Packet Transform and Deep Convolutional Neural Network. Comput. Ind. 2019, 106, 142-153. [CrossRef]
Imagenet Classification with Deep Convolutional Neural Networks. A Krizhevsky, I Sutskever, G E Hinton, Advances in Neural Information Processing Systems. 25Krizhevsky, A.; Sutskever, I.; Hinton, G.E. Imagenet Classification with Deep Convolutional Neural Networks. In Advances in Neural Information Processing Systems 25 (NIPS 2012);
. Curran Associates, Red HookInc, Red Hook25NY, USACurran Associates, Inc.: Red Hook, NY, USA, 2012; Volume 25, pp. 1097-1105.
A Large-Scale Hierarchical Image Database. J Deng, W Dong, R Socher, L.-J Li, L Kai, Li Fei-Fei, Imagenet, 10.1109/cvpr.2009.5206848Proceedings of the 2009 IEEE Conference on Computer Vision and Pattern Recognition. the 2009 IEEE Conference on Computer Vision and Pattern RecognitionMiami, FL, USADeng, J.; Dong, W.; Socher, R.; Li, L.-J.; Kai, L. Li Fei-Fei ImageNet: A Large-Scale Hierarchical Image Database. In Proceedings of the 2009 IEEE Conference on Computer Vision and Pattern Recognition, Miami, FL, USA, 20-25 June 2009; pp. 248-255. [CrossRef]
Audio Set: An Ontology and Human-Labeled Dataset for Audio Events. J F Gemmeke, D P W Ellis, D Freedman, A Jansen, W Lawrence, R C Moore, M Plakal, M Ritter, 10.1109/ICASSP.2017.7952261Proceedings of the ICASSP, IEEE International Conference on Acoustics, Speech and Signal Processing. the ICASSP, IEEE International Conference on Acoustics, Speech and Signal ProcessingNew Orleans, LA, USAGemmeke, J.F.; Ellis, D.P.W.; Freedman, D.; Jansen, A.; Lawrence, W.; Moore, R.C.; Plakal, M.; Ritter, M. Audio Set: An Ontology and Human-Labeled Dataset for Audio Events. In Proceedings of the ICASSP, IEEE International Conference on Acoustics, Speech and Signal Processing, New Orleans, LA, USA, 5-9 March 2017; pp. 776-780. [CrossRef]
CNN Architectures for Large-Scale Audio Classification. S Hershey, S Chaudhuri, D P W Ellis, J F Gemmeke, A Jansen, R C Moore, M Plakal, D Platt, R A Saurous, B Seybold, 10.1109/ICASSP.2017.7952132Proceedings of the ICASSP, IEEE International Conference on Acoustics, Speech and Signal Processing. the ICASSP, IEEE International Conference on Acoustics, Speech and Signal ProcessingNew Orleans, LA, USAHershey, S.; Chaudhuri, S.; Ellis, D.P.W.; Gemmeke, J.F.; Jansen, A.; Moore, R.C.; Plakal, M.; Platt, D.; Saurous, R.A.; Seybold, B.; et al. CNN Architectures for Large-Scale Audio Classification. In Proceedings of the ICASSP, IEEE International Conference on Acoustics, Speech and Signal Processing, New Orleans, LA, USA, 5-9 March 2017; pp. 131-135. [CrossRef]
PRONOSTIA: An Experimental Platform for Bearings Accelerated Degradation Tests. P Nectoux, R Gouriveau, K Medjaher, E Ramasso, B Chebel-Morello, N Zerhouni, C Varnier, Proceedings of the IEEE International Conference on Prognostics and Health Management. the IEEE International Conference on Prognostics and Health ManagementDenver, CO, USANectoux, P.; Gouriveau, R.; Medjaher, K.; Ramasso, E.; Chebel-morello, B.; Zerhouni, N.; Varnier, C. PRONOSTIA: An Experimen- tal Platform for Bearings Accelerated Degradation Tests. In Proceedings of the IEEE International Conference on Prognostics and Health Management, Denver, CO, USA, 18-21 June 2012.
The Politecnico Di Torino Rolling Bearing Test Rig: Description and Analysis of Open Access Data. A P Daga, A Fasana, S Marchesiello, L Garibaldi, 10.1016/j.ymssp.2018.10.010Mech. Syst. Signal. Process. 120Daga, A.P.; Fasana, A.; Marchesiello, S.; Garibaldi, L. The Politecnico Di Torino Rolling Bearing Test Rig: Description and Analysis of Open Access Data. Mech. Syst. Signal. Process. 2019, 120, 252-273. [CrossRef]
Wavelet Filter-Based Weak Signature Detection Method and Its Application on Rolling Element Bearing Prognostics. H Qiu, J Lee, J Lin, G Yu, 10.1016/j.jsv.2005.03.007J. Sound Vib. 289Qiu, H.; Lee, J.; Lin, J.; Yu, G. Wavelet Filter-Based Weak Signature Detection Method and Its Application on Rolling Element Bearing Prognostics. J. Sound Vib. 2006, 289, 1066-1090. [CrossRef]
A Survey on Transfer Learning. S J Pan, Q Yang, 10.1109/TKDE.2009.191IEEE Trans. Knowl. Data Eng. 22Pan, S.J.; Yang, Q. A Survey on Transfer Learning. IEEE Trans. Knowl. Data Eng. 2010, 22, 1345-1359. [CrossRef]
A Systematic Review of Deep Transfer Learning for Machinery Fault Diagnosis. C Li, S Zhang, Y Qin, E Estupinan, 10.1016/j.neucom.2020.04.045Neurocomputing. 407Li, C.; Zhang, S.; Qin, Y.; Estupinan, E. A Systematic Review of Deep Transfer Learning for Machinery Fault Diagnosis. Neurocomputing 2020, 407, 121-135. [CrossRef]
Transfer Learning with Neural Networks for Bearing Fault Diagnosis in Changing Working Conditions. R Zhang, H Tao, L Wu, Y Guan, 10.1109/ACCESS.2017.2720965IEEE Access. 5Zhang, R.; Tao, H.; Wu, L.; Guan, Y. Transfer Learning with Neural Networks for Bearing Fault Diagnosis in Changing Working Conditions. IEEE Access 2017, 5, 14347-14357. [CrossRef]
Bearing State Recognition Method Based on Transfer Learning under Different Working Conditions. N Cao, Z Jiang, J Gao, B Cui, 10.3390/s20010234Sensors. 20Cao, N.; Jiang, Z.; Gao, J.; Cui, B. Bearing State Recognition Method Based on Transfer Learning under Different Working Conditions. Sensors 2020, 20, 234. [CrossRef]
A Multitask-Aided Transfer Learning-Based Diagnostic Framework for Bearings under Inconsistent Working Conditions. M J Hasan, M Sohaib, J M Kim, 10.3390/s20247205Sensors. 207205Hasan, M.J.; Sohaib, M.; Kim, J.M. A Multitask-Aided Transfer Learning-Based Diagnostic Framework for Bearings under Inconsistent Working Conditions. Sensors 2020, 20, 7205. [CrossRef]
Long Short-Term Memory Neural Network with Transfer Learning and Ensemble Learning for Remaining Useful Life Prediction. L Wang, H Liu, Z Pan, D Fan, C Zhou, Z Wang, 10.3390/s22155744Sensors. 2022Wang, L.; Liu, H.; Pan, Z.; Fan, D.; Zhou, C.; Wang, Z. Long Short-Term Memory Neural Network with Transfer Learning and Ensemble Learning for Remaining Useful Life Prediction. Sensors 2022, 22, 5744. [CrossRef]
Deep Convolutional Transfer Learning Network: A New Method for Intelligent Fault Diagnosis of Machines with Unlabeled Data. L Guo, Y Lei, S Xing, T Yan, N Li, 10.1109/TIE.2018.2877090IEEE Trans. Ind. Electron. 66Guo, L.; Lei, Y.; Xing, S.; Yan, T.; Li, N. Deep Convolutional Transfer Learning Network: A New Method for Intelligent Fault Diagnosis of Machines with Unlabeled Data. IEEE Trans. Ind. Electron. 2019, 66, 7316-7325. [CrossRef]
Online Domain Adaptation for Rolling Bearings Fault Diagnosis with Imbalanced Cross-Domain Data. K C Chao, C B Chou, C H Lee, 10.3390/s22124540Sensors. 20224540Chao, K.C.; Chou, C.B.; Lee, C.H. Online Domain Adaptation for Rolling Bearings Fault Diagnosis with Imbalanced Cross-Domain Data. Sensors 2022, 22, 4540. [CrossRef]
Rolling Bearing Incipient Fault Diagnosis Method Based on Improved Transfer Learning with Hybrid Feature Extraction. Z Yang, R Yang, M Huang, 10.3390/s21237894Sensors. 21Yang, Z.; Yang, R.; Huang, M. Rolling Bearing Incipient Fault Diagnosis Method Based on Improved Transfer Learning with Hybrid Feature Extraction. Sensors 2021, 21, 7894. [CrossRef]
Deep Transfer Network with Joint Distribution Adaptation: A New Intelligent Fault Diagnosis Framework for Industry Application. T Han, C Liu, W Yang, D Jiang, 10.1016/j.isatra.2019.08.012ISA Trans. 97PubMedHan, T.; Liu, C.; Yang, W.; Jiang, D. Deep Transfer Network with Joint Distribution Adaptation: A New Intelligent Fault Diagnosis Framework for Industry Application. ISA Trans. 2020, 97, 269-281. [CrossRef] [PubMed]
Cross-Domain Fault Diagnosis of Rolling Element Bearings Using Deep Generative Neural Networks. X Li, W Zhang, Q Ding, 10.1109/TIE.2018.2868023IEEE Trans. Ind. Electron. 66Li, X.; Zhang, W.; Ding, Q. Cross-Domain Fault Diagnosis of Rolling Element Bearings Using Deep Generative Neural Networks. IEEE Trans. Ind. Electron. 2019, 66, 5525-5534. [CrossRef]
Generative Adversarial Networks for Data Augmentation in Machine Fault Diagnosis. S Shao, P Wang, R Yan, 10.1016/j.compind.2019.01.001Comput. Ind. 106Shao, S.; Wang, P.; Yan, R. Generative Adversarial Networks for Data Augmentation in Machine Fault Diagnosis. Comput. Ind. 2019, 106, 85-93. [CrossRef]
An Intelligent Diagnosis Scheme Based on Generative Adversarial Learning Deep Neural Networks and Its Application to Planetary Gearbox Fault Pattern Recognition. Z Wang, J Wang, Y Wang, 10.1016/j.neucom.2018.05.024Neurocomputing. 310Wang, Z.; Wang, J.; Wang, Y. An Intelligent Diagnosis Scheme Based on Generative Adversarial Learning Deep Neural Networks and Its Application to Planetary Gearbox Fault Pattern Recognition. Neurocomputing 2018, 310, 213-222. [CrossRef]
Highly Accurate Machine Fault Diagnosis Using Deep Transfer Learning. S Shao, S Mcaleer, R Yan, P Baldi, 10.1109/TII.2018.2864759IEEE Trans. Industr. Inform. 15Shao, S.; McAleer, S.; Yan, R.; Baldi, P. Highly Accurate Machine Fault Diagnosis Using Deep Transfer Learning. IEEE Trans. Industr. Inform. 2019, 15, 2446-2455. [CrossRef]
Deep Transfer Learning for Machine Diagnosis: From Sound and Music Recognition to Bearing Fault Detection. E Brusa, C Delprete, L G Di Maggio, 10.3390/app112411663Appl. Sci. 2021Brusa, E.; Delprete, C.; Di Maggio, L.G. Deep Transfer Learning for Machine Diagnosis: From Sound and Music Recognition to Bearing Fault Detection. Appl. Sci. 2021, 11, 11663. [CrossRef]
Towards Better Benchmarking Using the CWRU Bearing Fault Dataset. J Hendriks, P Dumond, D A Knox, 10.1016/j.ymssp.2021.108732Mech. Syst. Signal. Process. 169108732Hendriks, J.; Dumond, P.; Knox, D.A. Towards Better Benchmarking Using the CWRU Bearing Fault Dataset. Mech. Syst. Signal. Process. 2022, 169, 108732. [CrossRef]
Design of an Innovative Test Rig for Industrial Bearing Monitoring with Self-Balancing Layout. E Brusa, C Delprete, L Giorio, L G Di Maggio, V Zanella, 10.3390/machines1001005410Brusa, E.; Delprete, C.; Giorio, L.; Di Maggio, L.G.; Zanella, V. Design of an Innovative Test Rig for Industrial Bearing Monitoring with Self-Balancing Layout. Machines 2022, 10, 54. [CrossRef]
. Matlab, Vggish, Matlab. VGGish. Available online: https://www.mathworks.com/help/audio/ref/vggish.html (accessed on 27 August 2022).
. Github, Vggish, GitHub. VGGish. Available online: https://github.com/tensorflow/models/tree/master/research/audioset/vggish (accessed on 27 August 2022).
Handwritten Digit Recognition with a Back-Propagation Network. Y Lecun, B E Boser, J S Denker, D Henderson, R E Howard, W E Hubbard, L D Jackel, Proceedings of the Advances in Neural Information Processing Systems 25 (NIPS 2012. the Advances in Neural Information Processing Systems 25 (NIPS 2012Denver, CO, USALeCun, Y.; Boser, B.E.; Denker, J.S.; Henderson, D.; Howard, R.E.; Hubbard, W.E.; Jackel, L.D. Handwritten Digit Recognition with a Back-Propagation Network. In Proceedings of the Advances in Neural Information Processing Systems 25 (NIPS 2012), Denver, CO, USA, 27-30 November 1989; pp. 396-404.
A Scale for the Measurement of the Psychological Magnitude Pitch. S S Stevens, J Volkmann, E B Newman, 10.1121/1.1915893J. Acoust. Soc. Am. 8Stevens, S.S.; Volkmann, J.; Newman, E.B. A Scale for the Measurement of the Psychological Magnitude Pitch. J. Acoust. Soc. Am. 1937, 8, 185-190. [CrossRef]
. L Rabiner, R Schafer, Theory and Applications of Digital Speech Processing. Rabiner, L.; Schafer, R. Theory and Applications of Digital Speech Processing;
A Method for Stochastic Optimization. D P Kingma, J L Ba, Adam, Proceedings of the 3rd International Conference on Learning Representations, ICLR 2015-Conference Track Proceedings. the 3rd International Conference on Learning Representations, ICLR 2015-Conference Track ProceedingsSan Diego, CA, USA, 7-9 MayKingma, D.P.; Ba, J.L. Adam: A Method for Stochastic Optimization. In Proceedings of the 3rd International Conference on Learning Representations, ICLR 2015-Conference Track Proceedings, San Diego, CA, USA, 7-9 May 2015; pp. 1-15.
The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods. Disclaimer/Publisher's Note, instructions or products referred to in the contentDisclaimer/Publisher's Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
|
Specifications
Table Subject
Mechanical Engineering Specific subject area Vibration-Based Condition Monitoring Type of data Datasets in ".mat" format Figures How the data were acquired A test setup based on FALEX multispecimen test bench and data acquisition system, comprising an accelerometer (model PCB 356A32), an axial loading mechanism (up to 8.8 kN) and a closed control for the bearing spindle. The data is based on a common aerospace bearing model FAG QJ212TVP. The bearing under test was fitted vertically in the test bench where a vertical axial load was applied to the inner race to match high loading at low speed actuation conditions in aerospace and energy systems. Data format Raw Description of data collection There are 28 datasets for ball bearings with different artificial fault sizes, sampling rate of 25.6 kHz and four operational factors: the rotational speed, the applied axial load, the fault size and the fault location. The key measurement criterion is to keep large number of data samples per fault size to study how the fault size and shape influence the instantaneous characteristics of vibration measurements. The fault type was a fatigue spall defect on the inner or outer race. The full 3D geometry of every fault is defined in the data description section.
Value of the Data
• These datasets are acquired under various bearing fault sizes at low rotational speeds and a high sampling rate. These conditions help understand how the fault geometry influences the instantaneous characteristics of vibration measurements. • These datasets can be used to study the time and frequency features of vibration measurements for healthy and spalled axial bearings. • These datasets are beneficial as a benchmark for developing fault size quantification and prognosis methods for various industrial and aerospace applications.
Objective
This data article is designed to support the fault size estimation research of ball bearings. The knowledge generated can be utilized for developing and validating efficient vibration-based predictive maintenance for energy and aerospace systems. The datasets are measured under various bearing fault sizes at low rotational speeds and a high sampling rate. These conditions aimed at guaranteed large number of data samples per fault-width (along the bearing's rotational speed) to study how the fault geometry (fault size and shape) influences the instantaneous characteristics of vibration measurements [1] . The gained knowledge was utilized to build a reliable vibration-based fault size estimation method without using machine learning [2] . It was observed that different fault sizes induce significant time transients that can be detected by the first time derivative of the vibration jerk better than the raw acceleration signal. This observation was used to extract the fault entry/exit instants (i.e. the fault width) from the vibrational jerk, which were numerically estimated from raw accelerometer data using Savitzky-Golay differentiators. Serviceable fault estimation for different operating speeds and load levels were successfully achieved for 91% of the datasets with a maximum estimation error of 20%.
Data Description
The datasets include 28 time series vibration measurements and they are available in [1] . They were used for vibration-based fault detection and quantification in previous research [ 2 , 3 ]. These datasets were collected under healthy and faulty conditions based on the common aerospace bearing model FAG QJ212TVP [4] . The fault type was a fatigue spall on the inner or outer race. These faults were created by spark-erosion machining. As shown in Figs. 1 and 2 , the geometry of a spall fault was identified by three parameters: width w, height h, and depth d. Each dataset was measured with a sampling frequency of 25.6 kHz. The datasets were stored in the standard MATLAB format, ".mat," in a single column without a time stamp, and they were collected at constant speeds for a fixed duration of 30 s.
The descriptions of the datasets according to the health and the operating conditions are provided as follows: 1. N5k_60_0.0.mat: a vibration dataset for a healthy bearing. The outer race is fixed and the inner race is connected to a spindle operating at 60 RPM and 5.0 kN axial load. 2. N8.8k_60_0.0.mat: a vibration dataset for a healthy bearing. The outer race is fixed and the inner race is connected to a spindle operating at 60 RPM and 8.8 kN axial load. 3. N5k_500_0.0.mat: a vibration dataset for a healthy bearing. The outer race is fixed and the inner race is connected to a spindle operating at 500 RPM and 5.0 kN axial load. 4. N8.8k_500_0.0.mat: a vibration dataset for a healthy bearing. The outer race is fixed and the inner race is connected to a spindle operating at 500 RPM and 8.8 kN axial load. The outer race is fixed and the inner race is connected to a spindle operating at 500 RPM and 8.8 kN axial load.
Experimental Design, Materials and Methods
The experimentation of the bearings was performed in FALEX multispecimen test bench [5] available in Tekniker lab [6] . While the bearing faults have been designed and manufactured at DLR lab. The FALEX test bench was modified by adding a complete monitoring infrastructure, including force, speed, temperature and vibration sensors and a data acquisition system. The bearing test rig ( Fig. 3 ) with three accelerometers, model PCB 356A32 [7] , was used to measure triaxial vibrations along the x-, y-, and z-axes at a sampling frequency of 25.6 kHz [8] . The shared datasets include only x-axis measurements. The bearing under test was fitted vertically in the test rig, and a vertical axial load was applied to the inner race to emulate loading and speed conditions for electromechanical aerospace systems. The datasets were collected and processed under four operating conditions: two speeds (60 RPM and 500 RPM) and two axial loads (5 kN and 8.8 kN). Table 1 lists the fault characteristic frequencies of the bearing for further signal processing for condition monitoring research.
Ethics Statements
This work does not involve human subjects, animal experiments, or any data collected from social media platforms,
CRediT
Declaration of Competing Interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Data availability
Vibration Data for Axial Ball Bearings and Spall Faults (Original data) (Mendeley Data).
Fig. 1 .
1Geometric profiles of outer and inner race spalls Fig. 2. Photographs of QJ212TVP bearing races and a seeded inner race spall Healthy bearings group:
Faulty bearings group: 1 .
1N5k_60_1.0_inner.mat: a vibration dataset for a faulty bearing on the inner race. The fault dimensions are: w = 1.0 mm, d = 0.05 mm, h = 2.6 mm as shown in Fig 1 . The outer race is fixed and the inner race is connected to a spindle operating at 60 RPM and 5.0 kN axial load. 2. N5k_60_2.1_inner.mat: a vibration dataset for a faulty bearing on the inner race. The fault dimensions are: w = 2.1 mm, d = 0.20 mm, h = 5.0 mm as shown in Fig 1 . The outer race is fixed and the inner race is connected to a spindle operating at 60 RPM and 5.0 kN axial load. 3. N5k_60_3.8_inner.mat: a vibration dataset for a faulty bearing on the inner race. The fault dimensions are: w = 3.8 mm, d = 0.40 mm, h = 6.8 mm as shown in Fig 1 . The outer race is fixed and the inner race is connected to a spindle operating at 60 RPM and 5.0 kN axial load. 4. N5k_500_1.0_inner.mat: a vibration dataset for a faulty bearing on the inner race. The fault dimensions are: w = 1.0 mm, d = 0.05 mm, h = 2.6 mm as shown in Fig 1 . The outer race is fixed and the inner race is connected to a spindle operating at 500 RPM and 5.0 kN axial load. 5. N5k_500_2.1_inner.mat: a vibration dataset for a faulty bearing on the inner race. The fault dimensions are: w = 2.1 mm, d = 0.20 mm, h = 5.0 mm as shown in Fig 1 . The outer race is fixed and the inner race is connected to a spindle operating at 500 RPM and 5.0 kN axial load. 6. N5k_500_3.8_inner.mat: a vibration dataset for a faulty bearing on the inner race. The fault dimensions are: w = 3.8 mm, d = 0.40 mm, h = 6.8 mm as shown in Fig 1 . The outer race is fixed and the inner race is connected to a spindle operating at 500 RPM and 5.0 kN axial load. 7. N8.8k_60_1.0_inner.mat: a vibration dataset for a faulty bearing on the inner race. The fault dimensions are: w = 1.0 mm, d = 0.05 mm, h = 2.6 mm as shown in Fig 1 . The outer race is fixed and the inner race is connected to a spindle operating at 60 RPM and 8.8 kN axial load. 8. N8.8k_60_2.1_inner.mat: a vibration dataset for a faulty bearing on the inner race. The fault dimensions are: w = 2.1 mm, d = 0.20 mm, h = 5.0 mm as shown in Fig 1 . The outer race is fixed and the inner race is connected to a spindle operating at 60 RPM and 8.8 kN axial load. 9. N8.8k_60_3.8_inner.mat: a vibration dataset for a faulty bearing on the inner race. The fault dimensions are: w = 3.8 mm, d = 0.40 mm, h = 6.8 mm as shown in Fig 1 . The outer race is fixed and the inner race is connected to a spindle operating at 60 RPM and 8.8 kN axial load. 10. N8.8k_500_1.0_inner.mat: a vibration dataset for a faulty bearing on the inner race. The fault dimensions are: w = 1.0 mm, d = 0.05 mm, h = 2.6 mm as shown in Fig 1 . The outer race is fixed and the inner race is connected to a spindle operating at 500 RPM and 8.8 kN axial load. 11. N8.8k_500_2.1_inner.mat: a vibration dataset for a faulty bearing on the inner race. The fault dimensions are: w = 2.1 mm, d = 0.20 mm, h = 5.0 mm as shown in Fig 1 . The outer race is fixed and the inner race is connected to a spindle operating at 500 RPM and 8.8 kN axial load. 12. N8.8k_500_3.8_inner.mat: a vibration dataset for a faulty bearing on the inner race. The fault dimensions are: w = 3.8 mm, d = 0.40 mm, h = 6.8 mm as shown in Fig 1 . The outer race is fixed and the inner race is connected to a spindle operating at 500 RPM and 8.8 kN axial load. 13. N5k_60_1.4_outer.mat: a vibration dataset for a faulty bearing on the outer race. The fault dimensions are: w = 1.4 mm, d = 0.05 mm, h = 2.6 mm as shown in Fig 1 . The outer race is fixed and the inner race is connected to a spindle operating at 60 RPM and 5.0 kN axial load. 14. N5k_60_2.4_outer.mat: a vibration dataset for a faulty bearing on the outer race. The fault dimensions are: w = 2.4 mm, d = 0.20 mm, h = 5.0 mm as shown in Fig 1 . The outer race is fixed and the inner race is connected to a spindle operating at 60 RPM and 5.0 kN axial load. 15. N5k_60_4.0_outer.mat: a vibration dataset for a faulty bearing on the outer race. The fault dimensions are: w = 4.0 mm, d = 0.40 mm, h = 6.8 mm as shown in Fig 1 . The outer race is fixed and the inner race is connected to a spindle operating at 60 RPM and 5.0 kN axial load. 16. N5k_500_1.4_outer.mat: a vibration dataset for a faulty bearing on the outer race. The fault dimensions are: w = 1.4 mm, d = 0.05 mm, h = 2.6 mm as shown in Fig 1 . The outer race is fixed and the inner race is connected to a spindle operating at 500 RPM and 5.0 kN axial load. 17. N5k_500_2.4_outer.mat: a vibration dataset for a faulty bearing on the outer race. The fault dimensions are: w = 2.4 mm, d = 0.20 mm, h = 5.0 mm as shown in Fig 1 . The outer race is fixed and the inner race is connected to a spindle operating at 500 RPM and 5.0 kN axial load. 18. N5k_500_4.0_outer.mat: a vibration dataset for a faulty bearing on the outer race. The fault dimensions are: w = 4.0 mm, d = 0.40 mm, h = 6.8 mm as shown in Fig 1 . The outer race is fixed and the inner race is connected to a spindle operating at 500 RPM and 5.0 kN axial load. 19. N8.8k_60_1.4_outer.mat: a vibration dataset for a faulty bearing on the outer race. The fault dimensions are: w = 1.4 mm, d = 0.05 mm, h = 2.6 mm as shown in Fig 1 . The outer race is fixed and the inner race is connected to a spindle operating at 60 RPM and 8.8 kN axial load. 20. N8.8k_60_2.4_outer.mat: a vibration dataset for a faulty bearing on the outer race. The fault dimensions are: w = 2.4 mm, d = 0.20 mm, h = 5.0 mm as shown in Fig 1 . The outer race is fixed and the inner race is connected to a spindle operating at 60 RPM and 8.8 kN axial load. 21. N8.8k_60_4.0_outer.mat: a vibration dataset for a faulty bearing on the outer race. The fault dimensions are: w = 4.0 mm, d = 0.40 mm, h = 6.8 mm as shown in Fig 1 . The outer race is fixed and the inner race is connected to a spindle operating at 60 RPM and 8.8 kN axial load. 22. N8.8k_500_1.4_outer.mat: a vibration dataset for a faulty bearing on the outer race. The fault dimensions are: w = 1.4 mm, d = 0.05 mm, h = 2.6 mm as shown in Fig 1 . The outer race is fixed and the inner race is connected to a spindle operating at 500 RPM and 8.8 kN axial load. 23. N8.8k_500_2.4_outer.mat: a vibration dataset for a faulty bearing on the outer race. The fault dimensions are: w = 2.4 mm, d = 0.20 mm, h = 5.0 mm as shown in Fig 1 . The outer race is fixed and the inner race is connected to a spindle operating at 500 RPM and 8.8 kN axial load. 24. N8.8k_500_4.0_outer.mat: a vibration dataset for a faulty bearing on the outer race. The fault dimensions are: w = 4.0 mm, d = 0.40 mm, h = 6.8 mm as shown in Fig 1 .
Fig. 3 .
3Schematic and photograph of a special bearing testing machine.
Author Statement Mohamed AA Ismail: Data curation, Writing -original draft preparation; Jens Windelberg: Reviewing & editing; Andreas Bierig: Reviewing & Supervision; Iñaki Bravo: Data generation, curation and Reviewing. Aitor Arnaiz : Reviewing and Supervision.
Direct URL to data: http://dx.doi.org/10.17632/chwhh9n3bf.2 Related research article M.A .A . Ismail, A. Bierig, N. Sawalhi, Automated vibration-based fault size estimation for ball bearings using Savitzky-Golay differentiators, J. Vib. Control.The faults were
seeded to the races by spark-erosion machining to physically emulate real spall
defects.
Data source location
DLR (German Aerospace Center)
Institute of Flight Systems
Condition Monitoring Research Group
Braunschweig, Germany
Data accessibility
Repository name: Vibration Data for Axial Ball Bearings and Spall Faults,
(Mendeley Data)
Data identification number (doi): 10.17632/chwhh9n3bf.2
24(18) (2018) 4297-4315. https://doi.org/10.1177/1077546317723227 .
Table 1
1Bearing size data and fault characteristic frequencies for bearing QJ212TVP. Ball pass frequency inner race * 8.6427 Hz Ball pass frequency outer race * 6.3573 Hz Bearing pitch diameter 85.15 mm * Estimated at a rotational speed of 1 Hz.Parameter
AcknowledgmentsWe would like to thank our former colleague Ms. Thu-Hien Pham for her collaboration in preparing the datasets. This research has been partially financed as a part of EU project ACTUA-TION 2015 (Ref. EU-284915).
Vibration data for axial ball bearings and spall faults V2.0, Mendeley Data. M A A Ismail, J Windelberg, B Andreas, B Iñaki, A Aitor, 10.17632/chwhh9n3bf.2M.A .A . Ismail, J. Windelberg, B. Andreas, B. Iñaki, A. Aitor, Vibration data for axial ball bearings and spall faults V2.0, Mendeley Data (2022), doi: 10.17632/chwhh9n3bf.2 .
Automated vibration-based fault size estimation for ball bearings using Savitzky-Golay differentiators. M A A Ismail, A Bierig, N Sawalhi, 10.1177/1077546317723227J. Vib. Control. 2418M.A .A . Ismail, A . Bierig, N. Sawalhi, Automated vibration-based fault size estimation for ball bearings using Savitzky- Golay differentiators, J. Vib. Control. 24 (18) (2018) 4297-4315, doi: 10.1177/1077546317723227 .
Vibration response characterization and fault-size estimation of spalled ball bearings. M A A Ismail, N Sawalhi, 10.1784/insi.2017.59.3.149Insight Non-Destr. Test. Cond. Monit. 593M.A .A . Ismail, N. Sawalhi, Vibration response characterization and fault-size estimation of spalled ball bearings, In- sight Non-Destr. Test. Cond. Monit. 59 (3) (2018) 149-154, doi: 10.1784/insi.2017.59.3.149 .
Bearing datasheet MODEL FAG QJ212TVP. 2022Bearing datasheet MODEL FAG QJ212TVP. https://www.fagbearing.cc/FAG-bearings/QJ212TVP _ FAG _ 50194.html , 2022 (accessed 10 October 2022).
. Falex multispecimen test bench. Falex Corporation USA. Falex multispecimen test bench. Falex Corporation USA. https://www.falex.com/ (accessed 21 October 2022).
Vibration sensor model. Pcb 356a32, Pcb, Usa, Vibration sensor model PCB 356A32. PCB PIEZOELECTRICS USA. https://www.synotech.de/produkte/datenblatt/ ?untergruppe=vib _ tri _ miniatur&h=PCB&m=356A32 _ NC . Accessed October 10, 2022.
A strategy on selection of condition monitoring methods and techniques. T Pham, J Windelberg, I Bravo-Imaz, S Ferreiro, First World CongT. Pham , J. Windelberg , I. Bravo-Imaz , S. Ferreiro , A strategy on selection of condition monitoring methods and tech- niques, First World Cong. on Cond. Monit, 2017 13.-16. June .
| This paper describes a general methodology for designing and testing a defect classification system for uniform web materials and a very difficult case study is used to illustrate the specific algorithms. We show that the proper selection of the sensing strategy can greatly simplify the inspection problem an increase the efficacy of the inspection system. This is shown by comparing performances of two configurations of the inspection system, one incorporating a smart sensor and the other a conventional sensor.© (1994) COPYRIGHT SPIE--The International Society for Optical Engineering. Downloading of the abstract is permitted for personal use only. | Current-based monitoring can offer significant economic savings and implementation advantages over traditional vibration monitoring for bearing fault detection. The key issue in current-based bearing fault detection is to extract bearing fault signatures from the motor stator current. Since the bearing fault signature in the stator current is typically very subtle, particularly when the fault is at an incipient stage, it is difficult to detect the fault signature directly. Therefore, in this paper, the bearing fault signature is detected alternatively by estimating and removing nonbearing fault components via a noise cancellation method. In this method, all the components of the stator current that are not related to bearing faults are regarded as noise and are estimated by a Wiener filter. Then, all these noise components are cancelled out by their estimates in a real-time fashion, and a fault indicator is established based on the remaining components which are mainly caused by bearing faults. Machine parameters, bearing dimensions, nameplate values, and the stator current spectrum distribution are not required in the method. The results of online experiments with a 20-hp induction motor under multiple load levels have confirmed the effectiveness of this method. | 61 | Thermal Error Compensation of the Wear-Depth Real-Time Detecting of Self-Lubricating Spherical Plain Bearings | Finite Element Analysis of Self-lubricating Joint Bearing Liner Wear | An experimental framework for determining wear in porous journal bearings operated in the mixed lubrication regime | Thick-Film Radial Position Sensor for High Temperature Active Magnetic Bearings | An experimental investigation into the friction and wear characteristics of unlubricated roller bearings | Analysis of Thermal Effect on Elastohydrodynamic Lubrication in Angular Contact Ball Bearing | Temperature Distributions and Heat Transfer in Journal Bearings | Variable-viscosity effects in externally pressurized spherical oil bearings | The thermal instability is one crucial factor leading to low bearing operation performance. This paper presents a novel experiment device for thermal performance investigation of an aircraft rolling bearings. A bidirectional fixing structure was designed to balance the spindle thermal deformation. The hydraulic loading was used and the oil injection manner was adopted in the new device. Experimental test was conducted using the new device and experimental results were compared with the calculation based on the temperature and thermal nodes theory. The comparison demonstrates that the temperature distribution trends between the theoretical and experimental results remained the same; specifically, the error between the theoretical and experimental results was 1.0 % under the condition of 200kg load and 2250 rpm driving speed. Consequently, the analysis result shows that the new device is feasible and reliable to provide precise thermal characteristics for the aircraft rolling bearings. |
62 | Do you need OneTouch Ultra test strips? I have hundreds and hundreds and am not using them right now. | These are poor quality and not very accurate. You can test 3 times and all the strips will give you different results. | You get to test plenty of stuff without spending a ton of money. Ive tried all of these in the sample pack and have purchased some of these items in the full sizes. You really do get a lot of stuff to try for very little money. Fully recommend this to anyone to doesnt want to spend loads of money without trying it out first. | Tried 3 other test kits/strips and this was the most consistent. Great price. Paid for next day shipping and it was there! | I have terrible hand writing, and iike using ultra fine markers when using the little dry erase boards, can I bring my own when I go take them exam?
Edit: thanks for all the answers! | Overpriced. Only the tips of these can be used for testing. The rest of the strip is plastic. Cut in half lengthwise to get four tests out of these. Testing for water content is another test that is probably necessary which these don't do. | What do you need to bring to your license test? | Hi fellow flexers,
So I did the equipment check and I read through the list of materials permitted at our desk on law hub. But I was wondering if there are any items we cannot have in our actual testing room? My room has a giant bookcase full of books and I want to know if it’s a good idea to try to remove all of them. What about mirrors, windows, or pictures hanging on the wall with words on them?
Thank you! Good luck this weekend! | I buy and use these testers on a regular basis. This one is my favorite for every day use. It's compact and the rubberized hourglass shape works well for me. | 62 | I'm in Brooklyn and can ship anywhere in the US. You can use these strips with a One Touch Ultra 2, a One Touch Ultra Smart, a One Touch Ping, a One Touch Ultra, a One Touch Ultra Link, or a One Touch Ultra Mini.
Merry Christmas, Chag Chanukah Sameach, Happy Kwanza, Happy New Years! | How to ship a large lithium ion battery/e-bike across the US? | Is it possible to have things shipped from Chelmico's Warner music Japan shop to the US? | SF Express over EMS to ship to the US (california)? | Can I ship face mask and related supplies domestically in US? | TIL Illamasqua is now shipping to the US | Razer International Shipping | I live off Campus but where ON Campus can I ship USPS/UPS packages? | If you're shipping across the Canada/US border... |
63 | Does NOT fit my Chevy | On line headline says that it fits 2006 -2013 Chevrolet vehicles but on the package when you get it says the only 2006 Chevrolet vehicle it fits is a Monte Carlo. I have a 2006 Chevy Silverado and it won't work. Very misleading! I even took it to a professional car stereo installation shop and they agreed. Good luck returning it after it's been opened and tried to install. Thank you Amazon for your incomplete information. | They fit my 97 chevy perfectly. Only issue was the packing tape was almost cut through completely down the length of the box. | Fit my 05 chevy cobalt well, the holder works nicely for my cell phone when streaming music from it while in the car. Screws were kind of useless but I just reused the old ones. | it said it would fit my 96 chevy blazor but when i received it,,,, it was to wide for my truck. why ask what kind of truck you have and you tell them and this is what you get | This item does not fit the vehicle it states its for. Also you can not return this item. | Nothing like the oem products for a Chevy truck .. work great ! | Worked on a 4.3l chevy with no problems. Easy as a matter of fact. | The Chevrolet Avalanche is a four-door, five or six passenger pickup truck sharing GM's long-wheelbase chassis used on the Chevrolet Suburban and Cadillac Escalade EXT. | 63 | I'm giving this one star based on the fact that the product does not fit the vehicle (Chevy) that it claims to fit. The adapter is not wide enough to accommodate the arm of the wiper on the car. A shame given that I ordered these in preparation of needing them, and the old pair lasted longer than expected so I can't return them. Very unhappy.
The wiper seems nice though. | Rear windshield wiper arm | Serial adapter with DTR/RTS? | Great product, no car adapter. | 2018 GLC300 Wiper Blade Replacement | Does not fit Anco Series 31 wiper blade frame. | Wiper Refill is great, Amazon fitment advice is incorrect for 2000 jetta | How do you remove wiper arms from a Chevy S-10? | Adaptiv |
64 | when was the catholic mission in mpala destroyed | Octavius Hadfield and Mātene Te Whiwhi for a missionary in their area, Hadfield travelled with Henry Williams to establish an Anglican mission on the Kapiti Coast in November 1839. In December 1843 Bishop Selwyn, the first Anglican Bishop of New Zealand, attended Otaki to confirm a young chief and 142 of his followers. Te Āti Awa built the first church within the "Waikanae pā" which inspired other churches, including Rangiātea, built by Ngati Raukawa in Otaki. Following the Wairau Affray in 1843, where a confrontation between Te Rauparaha and group of settlers left twenty-two Europeans dead, many settlers believed an attack on | Egyptian President Abdel Fattah al-Sisi greets Pope Francis upon his arrival to Cairo, Egypt April 28, 2017 in this handout picture courtesy of the Egyptian Presidency. The Egyptian Presidency/Handout via REUTERS
CAIRO Leaders of all faiths should unite in renouncing religious extremism and counter the "barbarity of those who foment hatred and violence," Pope Francis said on Friday at the start of a two-day visit to Cairo.
"Let us say once more a firm and clear 'No!' to every form of violence, vengeance and hatred carried out in the name of religion or in the name of God," the pope told a peace conference at Egypt's highest Islamic authority, Al-Azhar.
Francis's trip, aimed at improving ties between Muslims and Roman Catholics, comes three weeks after Islamic State suicide bombers killed at least 45 people in two Egyptian churches.
(Reporting by Crispian Balmer; Editing by Giles Elgood) | The books in this series make an argument that the Zonal Acharyas that Srila Prabhupada created before his death were authorized to accept disciples on Srila Prabhupada's behalf, not as their own disciples. This is an argument that I wish had been made at the time, when I was still involved in the movement. I find it convincing. | his church services are also "webcast" live on his website. His other ministries include the Full Gospel Bible Institute, Campaign India (an Evangelistic outreach program), and teaching seminars throughout South India. He is the Principal of 'The Full Gospel Bible College', which trains young men and women for ministry, using Chelladurai's church as a model. Sam Chelladurai taught on many different topics, including the following: Sam P. Chelladurai Sam P Chelladurai () is the Senior Pastor of the Apostolic Fellowship Tabernacle (more commonly known by its initials, AFT), a megachurch in purasawalkam Chennai, India. He is best known for his | Jacobite Syrian Christian Church (pro-autocephalous) faction and Jacobite (patriarchal) pro-autonomous faction. It was instituted to provide a regional head for Jacobite Syrian Church, the faction that remained closely aligned with the Patriarch of Antioch. The position had remained vacant between 1996 (date of death of Catholicos Baselios Paulose II) and 2002. The current Catholicos of India is Baselios Thomas I. He was enthroned as the Catholicos by Ignatius Zakka I Iwas, in a ceremony held in Damascus, Syria on 26 July 2002. He is the second Indian Maphrian and Catholicos of the Syriac Orthodox Church in India and Metropolitan Trustee of the Jacobite Syrian | Persecution of Christians military attaché, retired General Francois Buchwalter, reports that they were accidentally killed by the Algerian army in a rescue attempt, and claims have been made that the GIA itself was a cat's paw of Algeria's secret services (DRS). A Muslim gang allegedly looted and burned to the ground, a Pentecostal church in Tizi Ouzou on 9 January 2010. The pastor was quoted as saying that worshipers fled when local police supposedly left a group of local protestors unchecked. Many Bibles were burnt. On 3 June 2001 nine people were killed in an explosion at a Roman Catholic church in the | Lal Masjid, Islamabad reports swirled around the incident and it is difficult to determine the truth of these given the very sensitive political nature of the event; the actual number of casualties still cannot be verified independently. Many Believe The Causality Was Between 300 To 400 When Asked About The Alleged foreigners the government was unable to prove the presence of any foreigners in the mosque and Many Believe that some locals as Were Dubbed As Foreigners. Following the week-long siege, the country entered a three-day mourning period. The bodies of those killed were buried in temporary graves, awaiting collection from family members. | The Church of St. Giragos (St. Cyriacus) is an Armenian Apostolic church in Diyarbakır, Turkey, which was confiscated by the Turkish government in 2016. In the 2000s, it had been renovated in part as a sign of reconciliation with the Christian community. It was reopened on 23 October 2011 as "Turkey’s first church to be revived as a permanent place of worship". It was heavily damaged during armed clashes between the Kurdistan Workers' Party and the Turkish Armed Forces in February 2016, along with the rest of the historic district of Sur, Diyarbakır.
It was seen as one of the largest and most important Armenian churches in the Middle East, with seven altars. It was closed during the Armenian genocide in 1915–1916, and was returned to the local Armenian community in 1960, although due to emigration in the 1970s and 1980s the local Armenian community was much diminished. According to some art historians, the church is the largest in the Middle East. The complex sprawls over 3,200 square meters and includes priests' houses, chapels and a school. The church was seized by the Imperial German Army in 1913 and served as their local headquarters during World War I until 1918, when it was converted into a fabric warehouse.
Ayık also said St. Giragos had several unique architectural features. "Churches normally have one altar but St. Giragos has seven altars. Its original roof was covered with the earth from around the region. We will do it again. The earth has been stripped of seeds to prevent the growth of plants. It should also be vented regularly, every year. The chairman, whose family is originally from the southeastern province, said the church was handed over to the foundation by the General Directorate of Foundations in the 1950s and continued providing church services until the early 1990s." After the founding of the Turkish Republic in 1923, it was used as a state warehouse for canvas and fabrics, and then, despite sporadic efforts by the dwindling Armenian community in Diyarbakır, it had been left to deteriorate and decay until 2009, when a few Armenians born in Diyarbakır but living in Istanbul, formed a Foundation Board under the auspices of the Armenian Istanbul Patriarchate, with the goal of reconstructing the church, as well as to start a legal process to reclaim title to the significant land holdings originally belonging to the church.
The church attracts hundreds of people per day; according to Gafur Turkay of the Surp Giragos Foundation, "Many of them are Islamised Armenians like me."
On 26 March 2016 the Turkish government confiscated St. Giragos, under Article 27 of the Expropriation Law. Neighbouring Syriac, Chaldean and Protestant churches were also expropriated as part of the same decision, which comprised the expropriation of some 6,300 plots of land in Diyarbakir's Sur (walled town) district, about 80% of the property in that district. The Diyarbakir Bar Association released a statement saying "this decision violates the property right and is also against Turkish Constitutional Law, Expropriation Law, and European Convention on Human Rights".
Gallery
References
External links
Photo gallery of after and before restoration
Churches in Diyarbakır
Armenian Apostolic churches in Turkey
Armenian buildings in Turkey | 64 | designs promoted by the missionaries. Citations Sources Mpala Mpala is the location of an early Catholic mission in the Belgian Congo. A military station was established at Mpala on the shores of Lake Tanganyika in May 1883. It was transferred to the White Fathers missionaries in 1885. At one time it was hoped that it would form the nucleus of a Christian kingdom in the heart of Africa. However, after a military expedition had to be sent to protect the mission from destruction by local warlords in 1892, civil control returned to the Belgian colonial authorities. The first seminary in | when was the port of tubarao created | what is the name of the town on lake tanganyika | when was livingstonia mission established in malawi | where was the wakarusa war fought in 1855 | when did the ottomans build the railroad to beersheba | Vrana Lake in Dalmatia - Water, Surroundings and Protection | how many villages were involved in the wapi project | who supported the british in the battle for lake tanganyika |
65 | ... purchased this perch in the past and my cockatiel loved it. Unfortunately | This is a great perch. It's comfortable for the birds and stays secure. My TAG literally loves this to death. He chews them up rather quickly but he seems very happy so I wish it was available as a subscription item. I'll be buying this on a regular basis when I order his food. I suppose I should get a small one for my cockatiels. | Although it is a little larger than I expected and makes me spend more than one hour to fix all the things together, I still really appreciate this product's design and my cockatiels enjoy playing there.
The top perch seems a little bit big for their feet but it's acceptable. They have learnt to climb on the ladder very quickly with no problem.
Only two things I need to concern: they can hardly climb down to eat from the top perch, and can not climb up if they drop into the bottom. Maybe I need to buy a comfy perch and a ladder to make them some climbing tools.
After all, I'll recommend it to small to medium pet bird owner. | The item was broken when I received it, but the company was quick to replace it and the second one was intact. My cockatiels like sitting on it, but I have not seen them conditioning their beaks on it, though they may still be getting used to it. It is well-made, easy to clean and should last a long time. | Purchased for the 21 year old cockatiel for his new bigger cage. He still acts like he is 2 and enjoys the larger perches. These are best for conures, amazons, etc, but they work for the 'old man', too. | My (slightly chubby) chinchilla LOVES his new perch! Had all the necessary parts and was easy to screw onto the cage. | Great perch for African Grey sized bird, poop lands right in the lip part so a really tidy way to keep your bird by the bedside etc. | I'm rating this as a 5 stars with one caveat. Everything I read about transitioning a cockatiel to pellets warned that the birds would have a hard time with it. That was certainly the case with my cockatiel, she was not interested in this at all. I thought the problem was the usual birds preferring seeds over pellets issue. But I'm glad I kept looking. The same brand has the same version of this food but in smaller size, "for smaller birds". I got that and my cockatiel totally went for it. She is about 8 months old.
So, even thought there's a cockatiel on the package, you might want to give the smaller sized one a try for cockatiels instead of this one. But also keep in mind that a lot of people gave great reviews for this one so ymmv. | Worked great when I took my cockatiel to the vet. It is lightweight and has plenty of room. There are two different levels that you can install the perch that comes with it. I put some newspaper down on the floor to make cleaning unnecessary. My bird was perfectly happy and even was preening himself and looking out the window. | 65 | I purchased this perch in the past and my cockatiel loved it. Unfortunately, I misplaced the cord/adapter that connects it into the outlet and buying that one piece from the manufacturer cost almost the same as a whole new piece. I currently use this for my parakeet and cockatiel and both utilize it all winter- we do not have heat in my Arizona house and this does the trick. | My New Cockatiel Won’t Trust Me - Help! | My eclectus parrot uses this to get to and fro ... | best parrot food ever | If I have interacted with my new parrot for weeks in an aviary, how should my first day home with here go? | How are parrots adapted to their environment? | Party parrots are in need of homes! | Cockatiel can’t step down??? | Can I put a cockatiel in my parakeet cage? |
66 | INTERPRETING EXPERIENCE: History, Philosophy, and Science in the American Constitutional Debates | In American immigration cases, the courts have simultaneously imagined different kinds of situations in which immigrants are regulated: situations where the plenary power doctrine suspends the ordinary operation of the law and situations where everyday legal norms are operative. Focusing on the exclusionary era between 1882 and 1905, this article demonstrates how legal discourse imagines and describes the situations in which particular kinds of administrative action are to occur. These situations were fraught with an ambivalent tension between the extraordinary and the ordinary that corresponded to popular literary conventions in the late nineteenth century. Genres like naturalism and the western similarly demarcated ordinary and extraordinary situations, and the law’s composite sense of situation simultaneously drew upon and disseminated narrative conventions that existed in a wider cultural milieu. These correlations can inform our understanding of the connection between sovereignty and administrative d... | It is shown: (a) the core conservatives justices now on the Supreme Court (identified as White, Rehnquist, O'Connor, Scalia and Kennedy) are preoccupied with the problem of the fit between their rulings and the sources of law and with the ideal of predictability; (b) a new jurisprudential approach developed by Justice Scalia is gaining acceptance amongst them; (c) Scalia's reasons for rejecting the neo-conservative doctrine that the intentions of the Constitution's Framers should be the only legitimate point of reference in constitutional cases are sound; (d) his suggestions for an alternative theory offer a defensible way forward which has advantages over competing orientations. Copyright George Mason University 1992 | Contextualist interpretations of political thought need to be imaginatively constructed no less than the philosophically abstract readings they are often designed to supplant. Examples of recent scholarship on Hobbes, Locke and Rousseau, in particular, illustrate problems in establishing contextual meaning with precision. Manuscripts often embrace their authors' notions in an unrefined state, in their gestation and the immediacy of their first formulations. The study of manuscripts sometimes invites a free association of ideas across what, in a post-Enlightenment world, may be perceived as circumscribed disciplinary boundaries. |
eah . itman, elissa urray & atherine haw*
Abstract
In this short Essay, we discuss the lack of racial and gender diversity on and around the Supreme Court. As we note, the ranks of the Court's Justices and its clerks historically have been dominated by white men. But this homogeneity is not limited to the Court's members or its clerks. As we explain, much of the Court's broader ecosystem suffers from this same lack of diversity. The advocates who argue before the Court are primarily white men; the experts cited in the Court's opinions, as well as the experts on whom Court commentators rely in interpreting those opinions, are often white men; and the commentators who translate the Court's work for the public are also largely white men. We suggest this lack of diversity has consequences both for the Court's work and for the public's understanding of the Court. We also identify some of the factors that contribute to the lack of diversity in the Court's ecosystem, including unduly narrow conceptions of expertise and a rigid insistence on particular notions of neutrality. We also note and discuss our own modest efforts to disrupt these dynamics with Strict Scrutiny, our podcast about the Supreme Court and the legal culture that surrounds it. To be sure, a podcast, by itself, will not dismantle the institutional factors that we have identified in this Essay. Nevertheless, we maintain that our efforts to use the podcast as a platform for surfacing these institutional dynamics, while simultaneously cultivating a more diverse cadre of Supreme Court experts and commentators, is a step in the right direction.
Introduction
The February 2019 State of the Union featured an arresting visual of the changing face of representation in the federal government. On the heels of an historic midterm election that sent 102 women to the House of Representatives and twenty-five women to the Senate, 1 women from both sides of the aisle arrived at the Capitol outfitted in white, in honor of the suffrage movement that secured women's right to vote in 1920. In the sea of white clothing there were a number of faces of color, reflecting not just a shift in Congress's gender makeup, but in its racial and ethnic diversity as well.
But if the halls of Congress are becoming more diverse, the situation across the street from the Capitol is decidedly different. The Supreme Court has long been understood as a countermajoritarian institution, 3 with a degree of insulation from the political process. But its composition is also out of sync with the broader contours of the electorate. As currently constituted, the Court is overwhelmingly male, Catholic, and white. And if the Court is notably lacking in diversity, the ecosystem that surrounds it is even more so. Supreme Court clerks are 1. Deena Zaru, Why Republican Women Face a Bleaker Picture in the Battle for Representation in Congress, ABC NEWS (Oct. 14, 2020), https://abcnews.go.com/GMA/News /republican-women-face-bleaker-picture-battle-representation-congress /story?id=73560569 [https://perma.cc/9UMG-8CEV] The 116th Congress, which began in January 2019, represented "the most diverse group of lawmakers in U.S. history." Id. largely male and white, hailing from a handful of elite law schools. Those who practice before the Court are also a relatively homogenous group, as is the pundit class and commentariat that covers the Court and translates its doings for the general public. The homogeneity that surrounds the Court is not simply concerning. It has real costs both for how the Court does its work, and for how the general public understands that work.
This Essay proceeds in three parts. Part I elaborates on the homogeneity in the Court's ecosystem. Part II considers the implications of this homogeneity for the Court's jurisprudence and for discussions of the Court and its work. Part III then pivots to consider efforts to address these dynamics. We discuss our decision to launch a podcast that provides commentary on the Supreme Court and the legal culture that surrounds it, as well as some of the responses to our decision to do so.
I. Homogeneity and the Supreme Court, by the Numbers
In the history of the United States, 115 Justices have served on the Supreme Court. Of these 115 Justices, 108 (93.9%) have been white men. Indeed, there have been only five women Justices (4.3%) and three Justices of color (2.6%). 4 Of the three Justices of color, only one is a woman. 5 All seventeen of the Court's Chief Justices have been white men. 6 The ranks of those who work most closely with the Justices-the clerks-reflect a similar lack of diversity. When it comes to the Justices, the demographic data are largely unsurprising. After all, for much of the Court's-and the country'shistory, the legal profession was one in which white men predominated. With the rise of part-time law schools in the postbellum period, the profession underwent a kind of tentative democratization as part-time law schools often catered to the working class and immigrants.
10 But these fledgling outfits were hardly the proving ground for Supreme Court Justices, the ranks of whom were, then as now, more often composed of the products of elite networks and elite education. 11 If racial and gender diversity on the Court have increased in recent decades, diversity in educational background has actually decreased; even against an elite baseline in which many members of the The persistent homogeneity of the clerk pool is in some ways more surprising, particularly given the demographic changes that have occurred at law schools over the last twenty years. Today, most law schools boast diverse student bodies, with women comprising roughly half of law school graduates.
14 Yet the pool of Supreme Court clerks remains overwhelmingly white and male. 15 To be sure, some Justices have done a better job of diversifying their chambers. 16 As of 2017, 31% of Justice Sotomayor's clerks had been racial minorities-the highest percentage among the Justices. 17 And in October Term 2018, his first on the Court, Justice Kavanaugh boasted the first all-women complement of clerks. 18 Indeed, due in part to Justice Kavanaugh's clerk class, the 2018 Term was the first time that a majority of Supreme Court clerks were women-twenty-one of the forty-one clerks (51.2%). 19 The 2018 Term also saw the first Native American clerk, in Justice Gorsuch's chambers. 20 Despite these bright spots, however, racial and gender diversity among the clerks at the high Court remains elusive. Although Mauro reported modest improvement in clerkship diversity between 1998, when he first conducted the informal study, and 2005, he also noted that Justices Ginsburg and Alito had each only hired one Black clerk during the same time period. 22 And while the 2018 Term was a highwater mark for women's representation in the clerk ranks, in the 2019 Term the number of women clerks decreased to sixteen (41% of the total class) and remained at sixteen for the 2020 Term. 23 Part of the problem may be the small pool from which the Justices select their clerks. Although law clerk hiring is no longer completely outsourced to law professors or law school deans, as it once was, 24 such gatekeepers continue to play important roles in law clerk hiring decisions. 25 An equally important stepping stone is a clerkship with a "feeder" judge, a lower federal court judge (or occasionally a state supreme court justice) whom the Justices trust and respect. And the pool of socalled feeder judges also reflects a startling homogeneity. From 1970 to 2014, the top ten feeder judges were all men, and, with the exception of one, they were all white. 26 Over those forty-four years, this group of ten judges sent 392 clerks to the Supreme Court. 27 Although there were notable women judges who "fed" clerks to the Court, none did so with the kind of frequency of the all-men top ten. 28 the top ten women feeder judges sent only ninety-one clerks in total to the Court. 29 This disparity shows no signs of abating. In the past three Terms, men continued to dominate the ranks of feeder judges. Of the twentyfour judges who have "fed" at least two clerks to the Supreme Court in a single Term, only two of them, Judge Debra Livingston (Second Circuit) and Judge Dabney Friedrich (District Court for District of Columbia), are women (8.3%) and just three are racial minorities (12.5%). 30 No women judges of color sent multiple clerks to the Supreme Court in any of the last three Terms. 31 To the extent that the ranks of feeder judges are only as diverse as the judiciary itself, the recent wave of Trump appointees is unlikely to disrupt the homogeneity of the feeder judge pool. As of January 2021, only 24% of President Trump's judicial appointees were women, compared to 45% for President Obama by the end of his first term. 32 The racial demographics are even starker: A full 84% of President Trump's judicial nominees have been white, compared to 64% of President Obama's nominees during the first four years of his presidency. 33 This homogeneity is evident throughout the Court's ecosystem, not just in the ranks of the feeder judges and clerks. Those who argue before the Court, as well as those who comment on the Court and translate its doings for the larger world are also a relatively homogenous group. During the 2019 Term, there were 155 oral argument appear-29. Of this group of women feeder judges, then-Judge Ruth Bader Ginsburg "fed" seventeen clerks to the Court. Id. Her feeder status came to an abrupt conclusion in 1993 when she was appointed to the Court. ances made by 103 advocates. 34 Of those 155 appearances, only twenty (12.9%) were made by women, and twenty-seven (17.4%) were by advocates of color. 35 But even these numbers obscure the limited pool from which Supreme Court advocates are drawn. Three attorneys account for nine of the twenty appearances by women advocates: Lisa Blatt for private parties, and Erica Ross and Morgan Ratner for the Office of the Solicitor General. 36 Fourteen, or just more than half, of the appearances by advocates of color were made on behalf of the Office of the Solicitor General, including seven appearances by the Solicitor General, Noel J. Francisco. 37 In the entire 2019 Term, only one woman of color, Jessica E. Méndez-Colberg, made an appearance before the Court, arguing on behalf of Unión de Trabajadores de la Industria Eléctrica y Riego, Inc. in Financial Oversight and Management Board for Puerto Rico v. Aurelius Investment. 38 The Supreme Court bar is also narrow in terms of bar members' credentials. In the last five Terms, a small number of elite law schools have been responsible for a disproportionate number of Supreme Court advocates. 39 Specifically, over half of the Supreme Court appearances made in the past five terms were by advocates trained at just four law schools-Harvard, Yale, Chicago, and Stanford. 40 Indeed, Harvard graduates alone accounted for nearly one-quarter (23%) of the appearances made in the past five Terms. 41 This homogeneity-of both the Court and those who argue before it-is rarely remarked upon in media coverage. This may be because the lack of diversity in these spaces is expected 42 also be because those covering the Court look a lot like the Court itself. The Supreme Court beat is very specific, requiring journalists with particular expertise-ordinarily legal training or at least some familiarity with the federal courts. But that criterion need not cut against diversity, particularly at a time when there is greater diversity in law school matriculation and the legal profession more generally. 44 Still, despite these changes in the profession, the ranks of the Supreme Court beat remain stubbornly fixed. Of the top ten daily newspapers by circulation, 45 five have a journalist dedicated to covering the Supreme Court and its doings. All five of these journalists are white men: Adam Liptak (New York Times), Robert Barnes (Washington Post), Jess Bravin (Wall Street Journal), David Savage (Los Angeles Times), and Richard Wolf (USA Today). 46 To be sure, other prominent Court commentators are women-such as Linda Greenhouse (New York Times), Dahlia Lithwick (Slate), Joan Biskupic (CNN), and Nina Totenberg (National Public Radio). While Greenhouse was, from 1978 to 2008, the New York Times's principal journalist assigned to the Court, she has since retired from regular coverage and now writes a biweekly column staffers in TV newsrooms are people of color; in radio, it's 11.7 percent."); Elizabeth Grieco, Newsroom Employees Are Less Diverse than U.S. Workers Overall, PEW RSCH. CTR. (Nov. 2, 2018), https://www.pewresearch.org/fact-tank/2018/11/02/newsroomemployees-are-less-diverse-than-u-s-workers-overall/ [https://perma.cc/K6JV-7442] ("More than three-quarters (77%) of newsroom employees-those who work as reporters, editors, photographers and videographers in the newspaper, broadcasting and internet publishing industries-are non-Hispanic whites, according to the analysis of 2012-2016 American Community Survey data."). 43. There have been a number of recent high-profile efforts to disrupt the pervasive lack of diversity in journalism and media. 2020 saw the launch of The 19th, "a nonprofit, nonpartisan newsroom reporting on gender, politics, and policy," created in response to the lack of women and women's perspectives in journalism. on the Court. 47 And while Lithwick and Totenberg are well-known and deeply respected for their trenchant coverage of the Court, their outlets-Slate and National Public Radio-may reach smaller audiences than the top ten newspapers. When journalists seek commentary on the Court, the experts on whom they rely tend to be less diverse as well. The homogeneity of the Supreme Court clerks may exacerbate this problem, as journalists often solicit the input of those who have worked at the Court. But even where journalists turn to the legal academy for subject-matter expertise, they often call upon law professors who are white men.
Consider that New York Times reporter Adam Liptak cited individuals 119 times for their expertise or commentary about the Court between October 2019 and October 2020. 49 Only thirty-three of those times (just over 25%) were the individuals cited women. 50 who conducts empirical studies of the Court and its decisions. 51 One of the thirty-three citations was to an academic article written by Justice Kagan. 52 In this regard, the commentariat may take its cues for citing experts from the Court itself. Since the beginning of 2019, Justice Thomas has cited scholarly pieces that were authored by 128 individuals. 53 Of the 117 different named individuals he cited, eighty-eight were men-over 75%. 54 Justice Gorsuch cited pieces authored by 149 individuals, 121 of whom were men-over 80%. 55
II. The Consequences of Homogeneity at and Around the Court
As we explain below, the lack of diversity on the Supreme Court and in the ecosystem that surrounds it likely has substantive consequences for the Court's jurisprudence; it also impacts the ways in which the Court's work is translated and presented to the public.
A. Substantive Jurisprudence
Consider some of the Court's jurisprudence related to policing: It is a touchstone of Fourth Amendment doctrine that a stop by police has occurred only if a reasonable person would not feel free to leave an encounter. 56 Applying that standard in Florida v. Bostick, the Court concluded that a reasonable person would feel free to leave when police boarded a bus and asked a passenger for consent to search the passenger's luggage. 57 But even as a majority of the Court insisted on this vision of the Fourth Amendment, some members of the Court noted that it was wildly out of step with the experiences of racial minorities. In dis- sent, Justice Thurgood Marshall, the first Black Justice and, at the time, the only racial minority member of the Court, observed that for the respondent, a Black man, leaving the bus was hardly the most reasonable course of action. As Marshall explained, leaving "would have required respondent to squeeze past the gun-wielding [police] inquisitor who was blocking the aisle of the bus," which "hardly seems like a course that [the respondent] would have viewed as available to him." 58 Justice Marshall may have been drawing on his own experiences, 59 and recent evidence confirms how dangerous, and deadly, police encounters can be, particularly for Black men. 60 Still, these insights are wholly absent from the majority opinion and the resulting Fourth Amendment jurisprudence.
Utah v. Strieff similarly illustrates how considerations of race-and, specifically, the ability of seemingly neutral rules to selectively disadvantage racial minorities-are absent from the Court's criminal procedure jurisprudence. In that case, the Court held that evidence obtained during an unlawful stop could be admitted at trial so long as the person stopped had an outstanding arrest warrant. 61 Although the majority opinion scarcely acknowledged its likely impact on racial minorities, Justice Sotomayor, one of two racial minority members of the Court, did so in a vehement dissent. 62 As she explained, the ruling "risk[ed] treating members of our communities as second-class citizens," particularly given the prevalence of outstanding warrants in communities such as Ferguson, Missouri, the site of major Black Lives Matter protests. 63 [F]or generations, black and brown parents have given their children "the talk"-instructing them never to run down the street; always keep your hands where they can be seen; do not even think of talking back to a stranger-all out of fear of how an officer with a gun will react to them. 64 The consequences of the Court's lack of diversity are also evident in its reproductive rights and justice jurisprudence. In Little Sisters of the Poor Saints Peter & Paul Home v. Pennsylvania, 65 the Court held that the Trump administration had the statutory authority to exempt employers from having to notify the federal government of their objections to providing health insurance coverage for contraception. 66 (The relevant employers were not churches, who enjoyed a separate exemption.) While the majority opinion and Justice Kagan's concurrence focused on the vagaries of administrative law, 67 Justice Ginsburg, in her last dissent on the Court, emphasized the decision's likely impact on women throughout the country. As she explained, not only is contraception a critical aspect of women's health care that has been shown to improve health outcomes, it also "improves women's social and economic status." 68 The Court's decision, Ginsburg observed, would be devastating-likely resulting in "between 70,500 and 126,400 women . . . immediately los[ing] access to no-cost contraceptive services." 69 Even Justice Thomas, the Court's staunchest conservative and for nearly thirty years its only Black member, has felt obliged to surface issues of race and representation that have gone unnoticed or uncommented upon by his colleagues. In 2003, Thomas dissented in Virginia v. Black, a challenge to a Virginia statute that made it a felony "for any person . . . with the intent of intimidating any person or group . . . to burn . . . a cross on the property of another, a highway or other public place," and further specified that "[a]ny such burning . . . shall be prima facie evidence of an intent to intimidate a person or group." 70 A plurali-ty of the Court concluded that the statutory presumption that crossburning constituted "prima facie evidence" of intent to intimidate violated the First Amendment. 71 In dissent, Justice Thomas explained that the plurality overlooked "not only the words of the statute but also reality"-in particular, cross-burning's long-standing use by, and association with, the Ku Klux Klan, "the world's oldest, most persistent terrorist organization." 72 Taken together, these examples suggest that the Court's homogeneity is not simply a question of demographics. It has substantive implications for the Court's work. In areas of critical importance, the majority's decision-making is woefully inattentive to its impact on underrepresented groups. Where these perspectives have been surfaced, it has been in dissenting opinions written by the Court's few minority and women members.
But it is not just the limited diversity of the Court itself that impacts its jurisprudence. The Court's decisions and decision-making processes may also suffer when the advocates who appear before the Court reflect an exceedingly narrow range of backgrounds and experiences. 73 Former Fourth Circuit Judge J. Michael Luttig voiced this concern in a 2014 interview with Supreme Court reporter Joan Biskupic-one of the few prominent women on the Supreme Court beat. Luttig observed that the emergence of a "narrow group of elite justices and elite counsel talking to each other" could result in both a Court and a bar that are "detached and isolated from the real world, ultimately at the price of the healthy and proper development of the law." 74 In this regard, just as underrepresented voices on the Court can surface overlooked perspectives, cross-burning.html [https://perma.cc/6BVP-86Q7] (quoting Justice Thomas describing a burning cross as "unlike any symbol in our society," in that "[t]here's no other purpose to the cross, no communication, no particular message," but "to cause fear and to terrorize a population" as Justices Marshall, Thomas, and Sotomayor have done in their dissents, underrepresented voices before the Court can raise viewpoints that might otherwise go unstated in the rarefied air of One First Street.
B. Communicating Jurisprudence
Although the Court makes its decisions publicly available on its website and through other distribution channels, in truth, few Americans actually read the substance of Supreme Court opinions. Instead, many Americans rely on media outlets-like newspapers, television, and podcasts-to translate the Court's doings into lay terms. With this in mind, the lack of diversity in the ecosystem surrounding the Supreme Court bar, and particularly within the commentariat that translates the Court's work to the public, may have consequences for the ways in which the public receives and understands the Court's decisions. The largely homogeneous commentariat has adopted a very particular understanding of what constitutes expertise about the Supreme Courtnamely, an overly formal and rigid commitment to neutrality. This conception of expertise in many ways reproduces the Court's homogeneity in the commentariat: By insisting that one marker of Supreme Court expertise is that an individual avoid strong substantive positions and maintain a studious commitment to neutral, "both sides" commentary, the norm excludes many qualified people from being considered and credited as Supreme Court experts.
The homogeneity among Supreme Court "experts" is partially a product of the ways in which we credit-and discredit-expertise. For some, Supreme Court expertise means the ability to recall arcane historical facts or procedural complexities divorced from the substance of a particular case. Treating legal trivia as a proving ground for expertise risks dismissing-or worse, excluding-people who don't understand a reference, and it generates a contextless kind of expertise. Knowledge of procedural intricacies or legal arcana is certainly one kind of expertise, but it is not the only kind of expertise-or even the most important kind. Another, less valued kind of expertise is understanding the sociopolitical context of an issue or the potential consequences of decisionssuch as Strieff's consequences for heavily policed communities, or Little Sisters of the Poor's consequences for women with limited job mobility. Also less appreciated-though no less important-is awareness of the racial or gender dynamics underlying a particular area of law or particular Court decision. For example, it should be a serious mark in favor of someone's Supreme Court expertise if they are aware of maternal mor-tality rates for Black women and the history of "Mississippi appendectomies." 75 Yet this kind of knowledge can be devalued as a kind of specialized expertise-a "nice-to-have" rather than a necessary predicate for securing status as an informed Supreme Court commentator.
Equally concerning is what gets treated as evidence of a lack of expertise. Too often, when minorities and women advert to their own lived experiences in dissecting legal decisions, their commentary is viewed as relying unduly on anecdote and narrative, as opposed to real expertise. Similarly, holding strong views on an issue is treated as incompatible with genuine expertise. 76 Having substantive views and holding principles does not make someone less reasonable as a lawyer or less equipped to comment on the Supreme Court and its work. Yet the media often seek studiously neutral experts-and commentators cultivate such personas, dutifully reporting the merits of "both sides" of an argument. The interest in neutral, dispassionate commentators may have particularly negative consequences for women, particularly women of color, who are often viewed as being too emotional or personally invested in their opinions. 77 These norms about expertise can affect how the public understands the Court. In particular, they may fuel the perception that the Court is merely a forum for debating abstract ideas that have few consequences for real people's lives-a game between competitors with equal chances to prevail, based only on the logic of their arguments. In fact, the Court is a proving ground for some of the most consequential issues of the day; and given its current ideological composition, some issues may be more hospitably received than others.
Other features of Supreme Court commentary, including how commentators speak about the Court's work, may further reinforce the view of the Court as forum for disembodied debate. Supreme Court commentary sometimes has what might be called a "law bro" vibe, which manifests in different ways, but collectively codes in masculine terms. Sometimes this may be nothing more than an affect or style of conversation-a competitive exchange in which the goal is to one up the other speakers rather than engage in a collective effort of clarification or complication. It may also involve metaphors of sport or battle: Justices or advocates "score points," "clash," or "duel" while precedents "live to fight another day." 78 And explaining the Supreme Court through metaphors of competition is more in keeping with the adversarial style of communication that tends to be associated with men.
Some of these dynamics may not just reflect the homogeneity in the Supreme Court commentariat; they may also reproduce it. Consider the idea that, in the interest of neutrality, a good Supreme Court commentator and "true" expert will routinely find things to criticize about both ideological "sides" of the Court. This obligatory performance of even-handedness likely contributes to the homogeneity in the ranks of Supreme Court experts. As Justices Marshall and Sotomayor have acknowledged, the effects of the Court's decisions are likely to be experienced unevenly, with members of certain communities disproportionately bearing the impact. The assumption that those who are most affected by the Court's jurisprudence can view the different wings of the Court as equally reasonable ignores the very real impact of the Court's decisions on people's lives. As troublingly, this assumption may winnow out prospective members of the Supreme Court commentariat as people are dismissed-or, as likely, are never considered-because they are in- mi c hi g a n j o urn a l o f g e n de r & la w [Vol. 28:51 clined toward a particular position. 79 Put differently, it may be difficult for women and minorities to treat opinions that so acutely affect them and their lives as theoretical abstractions to be debated. Their inability to maintain a distant neutrality with regard to the Court's decisions makes them less likely to be viewed as credible experts capable of "good" Supreme Court commentary. 80 The norms that pepper the rarefied atmosphere of elite legal practice also reinforce the homogeneity of the group of people considered to be Supreme Court experts. Consider the norms of collegiality and loyalty that exist among elite lawyers. One of us has written about elite lawyers' unwillingness to hold their colleagues accountable for the positions they take, even when those positions threaten basic tenets of our constitutional democracy. 81 Time and again, despite having participated in actions that have been broadly condemned as deleterious to the rule of law, elite lawyers have been welcomed back into the fold with little more than a slap on the wrist for their earlier conduct. The norm of virtually unconditional collegiality and loyalty operates to shelter lawyers from censure and public accountability for some of their worst actions. That norm may be unpalatable to those who think the effects of a lawyer's positions are relevant to assessing her merits within the professional community. The norm may also be unsettling to those who must live with the real-world consequences of a lawyer's earlier actions.
Yet when push comes to shove, the norm of professional collegiality and loyalty operates to exclude-and disadvantage-those lawyers who work on behalf of the less powerful or who, because of their backgrounds and circumstances, are not fully entrenched within elite networks. Consider, for example, that both Caitlin Halligan and Goodwin Liu are undoubtedly "elite" lawyers by any metric-they graduated from top law schools, clerked for the Supreme Court, and had successful professional careers. Yet their elite credentials were insufficient to insulate them from the consequences of their decisions as advocates-79. In the case of women, especially women of color, it is more likely they will agree with the more liberal side of the Court. Halligan supported gun control measures, earning the ire of Second Amendment enthusiasts 82 who organized to oppose her nomination to the D.C. Circuit, while Liu breached the norm of elite loyalty by testifying against the confirmation of Justice Samuel Alito, 83 a fact that was emphasized repeatedly in Liu's failed nomination to the U.S. Court of Appeals for the Ninth Circuit. By contrast, Rod Rosenstein, who reportedly helped to orchestrate the Trump administration's family separation policy, 84 left the administration for a lucrative partnership with King & Spalding. Jay Bybee, who, as head of the Office of Legal Counsel for the second Bush administration, signed the infamous Torture Memos, was confirmed to a seat on the U.S. Court of Appeals for the Ninth Circuit. 85 While Rosenstein and Bybee, both white men, faced few consequences for their participation in two widely condemned government programs, both Halligan, a white woman, and Liu, an Asian American man, paid the price for their earlier decisions. In a profession that prides itself on collegiality and loyalty, few elite lawyers stepped up to expend social or professional capital to support Halligan and Liu. Their nominations to federal appeals courts foundered and were ultimately withdrawn. 86 In a similar vein, there are myriad examples of lawyers of color whose membership in elite networks was not enough to insulate them from criticism or questions about their intelligence and legal acumen. Throughout their careers on the Court, both Justice Thurgood Marshall and Justice Clarence Thomas, the only two Black jurists to serve on the mi c hi g a n j o urn a l o f g e n de r & la w [Vol. 28:51
Court, were routinely cast as intellectual lightweights under the sway of more intelligent colleagues. 87 Likewise, when Justice Sonia Sotomayor was nominated to the Supreme Court, numerous commentators publicly questioned her intellect 88 despite the fact that she was a summa cum laude graduate of Princeton, received her law degree from Yale, and practiced for years as a prosecutor under the tutelage of long-time Manhattan District Attorney Robert Morgenthau. 89 In some cases, advocating on behalf of underrepresented groups or unpopular causes can limit one's admission to the highest rungs of the legal profession. As a lawyer with the NAACP Legal Defense Fund, Debo Adegbile signed on to an appellate brief on behalf of Mumia Abu-Jamal, an internationally-known prisoner convicted of the murder of a Philadelphia police officer. Years later, when Adegbile was President Obama's nominee to serve as Assistant Attorney General for the Civil Rights Division, 90 bipartisan objections to this pro bono work scuttled his nomination. 91 Although President Obama defended his nominee's record, condemning the "wildly unfair character attacks against a good and qualified public servant," a majority of Senators were undeterred, raising the prospect of opposition from law enforcement as an impediment to Adegbile's ability to succeed in the position. 92 Adegbile's experience was hardly exceptional. Two decades earlier, Senate Republicans torpedoed Lani Guinier's nomination to the same position based on her "controversial writings" 93 about voting rights and the need to increase the political power of minorities. 94 Like Adegbile, Guinier was a product of elite legal institutions and possessed sterling credentials. 95 As a young lawyer, she had litigated civil rights cases with the NAACP Legal Defense Fund. 96 At the time of her nomination, she was a tenured professor at Harvard Law School-the first Black woman to achieve this distinction. 97 It did not matter. In the face of opposition, President Bill Clinton withdrew his support for Guinier, saying that, upon belatedly reviewing her writing, he concluded that her views were "inconsistent" with his own. 98 Dawn Johnsen, President Obama's first nominee to head the Office of Legal Counsel, suffered a similar fate. Despite her extensive experience as a top executive-branch lawyer (she had already served for a period as the acting OLC head during the Clinton administration) and a number of years as a distinguished law professor, her nomination was ultimately defeated based in part on Republican opposition to work she mi c hi g a n j o urn a l o f g e n de r & la w [Vol. 28:51 had done on behalf of abortion rights as a young lawyer with the ACLU and NARAL. 99 Taken together, these episodes gesture toward a number of insights. They make clear that membership in elite circles has its privileges, insulating those within the group from censure or criticism of their professional decisions and conduct. But membership within the elite can be selective. Despite the right credentials and experiences, not all lawyers who take on contested positions or controversial causes can be secure in their membership within the elite. Race, gender, and class-of the individual and those she may champion-may distance one from the security and protection that elite status may provide. In this way, the norms of collegiality and loyalty that mark the profession also serve as engines to preserve and perpetuate its homogeneity.
III. Disrupting Homogeneity, One Episode at a Time
Recognizing the homogeneity in all of these aspects of the Court's ecosystem, we wanted to do something to remedy these disparities-to highlight the voices of women and people of color, to celebrate the expertise and skill of lawyers who work on behalf of the less powerful, and to challenge prevailing views about what a Supreme Court expert looks and sounds like. Starting our podcast, Strict Scrutiny, was a small step in that direction. We are a podcast led by women and we wanted to create a space that was welcoming and inclusive to women, victims of genderbased violence, people of color, and victims of racial discrimination and violence. That is the audience to whom we speak. We are not shy about offering our opinions. We do not aim to spend equal amounts of time criticizing and praising both sides of the Court. Nor do we judge our success based on whether all ideological sides of the Supreme Court bar like what we have to say.
As importantly, we want to help democratize the Supreme Court and the discourse surrounding it. We want more lawyers to feel empowered to weigh in about the Supreme Court and to share their opinions. It is our hope that by sharing our views, others will feel comfortable doing the same. We also hope that by helping to keep the public up to date on the Court's work, we make it easier to stay abreast of an im-portant institution in our system of government-one whose output can often feel impenetrable and inaccessible.
On the whole, it has been an incredibly rewarding experience. We have delighted in each other's company and in the community that we have created with our listeners. It has been incredibly rewarding to hear from law students, particularly women law students, law students of color, and first generation law students, who tell us how much they enjoy the podcast and what it means to them to hear their perspectives surfaced in discussions of the Court and legal culture. And we have had more than a few laughs at ourselves, with each other, and (of course) at the Court, too.
And that's part of the point: We want to change the sound of Supreme Court expertise. Commentary and expertise can be fun and funny, rather that studiously abstract and stiflingly neutral. On the show, we talk about pop culture in addition to the Supreme Court and try to push back on some of the "male-ness" of Supreme Court commentary.
As with any endeavor, there have been challenges. One of us is untenured, prompting occasional questions about how she is spending her time. There are the occasional internet haters who explain-in detailall the things we have done wrong and could do better. It is never fun to be on the receiving end of missives questioning your competence to opine on matters of actual technical expertise or difficulty. Nor is it easy to read reviews about your "ranting" and "unreflective[] bias[]." There are also the expected comments about how our "voice and cadence are very difficult to listen to." Some people don't even like Leah's Voting Rights Act jokes. (Sorry; she's not sorry.)
But the challenges are clearly outweighed by the rewards. In just two years, we have been able to draw greater attention to issues that matter to us and to many of our listeners. We have celebrated stellar advocates while urging the Court to take greater steps to expand the ranks of its bar. We have highlighted cases-both those that garner outsized attention and those that pass with little fanfare-and dissected decisions. And in doing all of this, we have tried at every turn to underscore the many ways in which the Court's work impacts so much of our lives.
Conclusion
It is tempting to think that the diversity of the federal courts, the Supreme Court, the Supreme Court bar, and the Supreme Court commentariat will improve over time, as changing demographics at law schools result in a more diverse pool of attorneys. But it would be a mis-take to think that result is inevitable-that is, that diversity in the Supreme Court ecosystem will follow naturally from diversity in law schools. Law schools have been admitting and graduating women in equal numbers to men for decades, and they have been committed to admitting and graduating people of color. And yet that has failed to result in women and people of color breaking into the Supreme Court ecosystem in substantial numbers. Instead, what has happened is some small gains, followed by regression and stasis.
If we want a Supreme Court ecosystem that tracks the trajectory of the academy and the legal profession, we have to be open to rethinking the norms, rules, and cultural practices that together create and sustain that ecosystem.
2 .
2See id. (noting that of the 127 women in Congress in 2019, forty-seven were women of color, and that a record number of women of color won Congressional primaries in 2020). 3. See ALEXANDER M. BICKEL, THE LEAST DANGEROUS BRANCH: THE SUPREME COURT AT THE BAR OF POLITICS 16 (1962) (describing the "countermajoritarian difficulty").
48 While
48Greenhouse, Lithwick, and Totenberg's presence provides greater gender diversity in the Supreme Court beat, there is far less racial and ethnic diversity among the Court commentariat. While certainly not an exhaustive review, a search of Twitter profiles found several additional Supreme Court correspondents and commentators, including: Andrew Chung (Reuters), Ariane de Vogue (CNN), Garrett Epps (The Atlantic), Jessica Gresko (Associated Press), Jimmy Hoover (Law360), Lawrence Hurley (Reuters), John Kruzel (The Hill), Elie Mystal (The Nation), Kimberly Robinson (Bloomberg Law), Greg Stohr (Bloomberg News), and Jeffrey Toobin (CNN/formerly The New Yorker). Of these twelve journalists, six are white men (Epps, Hoover, Hurley, Kruzel, Stohr, and Toobin); three are, like Biskupic, Greenhouse, Lithwick, and Totenberg, white women (de Vogue, Gresko, and Robinson); one is an Asian man (Chung); and one is a Black man (Mystal).
75 .
75See Lisa Ko, Unwanted Sterilization and Eugenics Programs in the United States, PBS (Jan. 29, 2016), https://www.pbs.org/independentlens/blog/unwanted-sterilizationand-eugenics-programs-in-the-united-states/ [https://perma.cc/82F6-KKFT] ("'Mississippi appendectomies' was another name for unnecessary hysterectomies performed at teaching hospitals in the South on women of color as practice for medical students.") 76. See, e.g., Thomas B. Griffith, The Degradation of Civic Charity, 134 HARV. L. REV. F. 119, 120 (2020) ("[A]s I see it, the rot that infects our body politic comes less from the parade of Professor Klarman's horribles than from the contempt that has become the animating spirit of much of our public discourse. On that view of things, Professor Klarman's jeremiad is no cure for the infection that ails the heart of our democracy. Indeed, the tone and manner of his complaint compound the problem."). 77. Quentin Fottrell, 'Women Are Judged for Being Emotional' Yet It's More Acceptable for Men to Get Upset and Angry, Female Executives Say, MARKETWATCH (Nov. 29, 2019), https://www.marketwatch.com/story/serena-williams-got-angry-at-the-usopen-final-and-paid-a-heavy-priceworking-women-say-this-sounds-eerily-familiar-2018-09-10 [https://perma.cc/SH45-8TZ9]; Roxane Gay, Who Gets to Be Angry?, N.Y. TIMES (June 10, 2016), https://www.nytimes.com/2016/06/12/opinion/sunday /who-gets-to-be-angry.html [https://perma.cc/T9CK-MT9U].
In 2017, Supreme Court correspondent Tony Mauro conducted a survey of Supreme Court clerks, finding that between 2005 and 2017, 85% of the 487 clerks hired at the Supreme Court were white. Justice Sonia Sotomayor, the first Latina Justice, was appointed to the Court in 2009. See Campisi & Griggs, supra note 4. 7. Tony Mauro, Mostly White and Male: Diversity Still Lags Among SCOTUS Law7 During this period, only twenty of the
4. Jessica Campisi & Brandon Griggs, Of the 114 Supreme Court Justices in US History,
All But 6 Have Been White Men, CNN (Sept. 26, 2020), https://www.cnn.com/2020
/09/25/politics/supreme-court-justice-minorities-history-trnd/index.html
[https://perma.cc/59QW-RYAU].
5. Charlie Savage, Sotomayor Confirmed by Senate, 68-31, N.Y. TIMES (Aug. 6, 2009),
https://www.nytimes.com/2009/08/07/us/politics/07confirm.html [https://perma.cc
/ZU6W-Q6ZV].
6. Clerks, NAT'L L.J. (Dec. 11, 2017), https://www.law.com/nationallawjournal/sites
/nationallawjournal/2017/12/11/mostly-white-and-male-diversity-still-lags-among-
scotus-law-clerks/ [https://perma.cc/L929-EANW].
mi c hi g a n j o urn a l o f g e n de r & la w
[Vol. 28:51
clerks hired were Black (4.1%).
8 Roughly one-third of the clerks were
women.
9
Court have attended Ivy League institutions, as well as other well-regarded schools, 12 the current Court is notable in the near-ubiquity of elite credentials. Among the current members of the Court, all but two Justices completed their undergraduate education at Stanford or an Ivy League school (Justices Thomas and Barrett attended the College of the Holy Cross and Rhodes College, respectively), and all but one received a law degree from Yale Law School or Harvard Law School (Justice Barrett attended Notre Dame Law School). Id. The report does not indicate how many clerks were women of color. 10. Melissa Murray, Afterword to HERMA HILL KAY, PAVING THE WAY: THE FIRST AMERICAN WOMEN LAW PROFESSORS 295, 298 (2021). 11. Although "the first year when every Justice had four years of undergraduate work and three years of law school was 1986, when Justice Scalia replaced Chief Justice Burger," a number of Justices on earlier courts held degrees from elite institutions. Benjamin H. Barton, An Empirical Study of Supreme Court Justice Pre-Appointment Experience, 64 FLA. L. REV. 1137, 1168-69 (2012). For example, the Taney Court "featured Harvard alumnus Justice Joseph Story, Princeton (then called the College of New Jersey) alumni Justices Smith Thompson and James Wayne, and Yale alumnus Justice Henry Baldwin." Id. at 1170 n.100. 12. See Ilana Kowarski, Where Supreme Court Justices Earned Law Degrees, U.S. NEWS GZ9W] ("Among the 60 justices who were appointed in the 20th and 21st centuries, 38 received law degrees from law schools that are ranked among the top 25 in the 2021 Best Law Schools rankings."). 13. See id.; see also Valerie Strauss, The 'Cloistered' Harvard-Yale Monopoly on the Supreme13
8. Id.
9. (Nov. 5, 2020), https://www.usnews.com/education/best-graduate-schools/top-law-
schools/articles/where-supreme-court-justices-earned-law-degrees
[https://perma.cc
/8A68-Court, WASH. POST (July 10, 2018), https://www.washingtonpost.com/news/answer-
sheet/wp/2018/07/10/the-cloistered-harvard-yale-law-monopoly-on-the-supreme-
court/ [https://perma.cc/3XCX-ZG9U].
And many of the Justices have looked beyond the halls of traditionally elite law schools in their search for new clerks. 14. See Abigail Rowe, The Parity Paradox, BEST LAWYERS (June 25, 2018), https://www.bestlawyers.com/article/women-now-outnumber-men-in-lawschool/2029 [https://perma.cc/DCG5-85RW]. 15. See Mauro, supra note 7. 16. See Debra Cassens Weiss, Supreme Court Law Clerks Still Mostly White Men: Which Then-Judge Kavanaugh made much of this fact during his Supreme Court confirmation hearings: In the same speech in which he called Dr.21
Justices Had the Most Diverse Clerks?, A.B.A. J. (Dec. 12, 2017),
https://www.abajournal.com/news/article/supreme_court_law_clerks_are_still_mostly
_white_men_which_justices_had_the [https://perma.cc/3NQS-FZTN].
17. Mauro, supra note 7.
18. Christine Blasey Ford's sex-
ual assault allegations "a calculated and orchestrated political hit . . . on behalf of the
Clintons" and warned the Democratic members of the committee, "[y]ou sowed the
wind. For decades to come I fear the whole country will reap the whirlwind," he also
informed the Senate that "if confirmed, I'll be the first justice in the history of the
Supreme Court to have a group of all-women law clerks." Trish Turner & Meghan
Keneally, 'You'll Never Get Me to Quit': Read Brett Kavanaugh's Defiant Opening
Statement, ABC NEWS (Sept. 28, 2018), https://abcnews.go.com/Politics/read-
kavanaughs-opening-statement-effort-destroy-good-drive/story?id=58096427
[https://perma.cc/S4WQ-6ZTK].
19. Erin Coe & Jacqueline Bell, A High Court Milestone Stirs Hope of Gender Parity,
LAW360 (Oct. 17, 2018), https://www.law360.com/articles/1093264/a-high-court-
milestone-stirs-hope-of-gender-parity [https://perma.cc/C678-8335].
20. Tony Mauro, Gorsuch Hires Native American Law Clerk, Likely First in SCOTUS His-
tory, NAT'L L.J. (April 14, 2018), https://www.law.com/nationallawjournal/2018/04
/14/gorsuch-hires-native-american-law-clerk-likely-first-in-scotus-history/
[https://perma.cc/U9WD-WT6H].
21. For example, the first group of law clerks hired by the Court's newest member, Jus-
tice Amy Coney Barrett, includes graduates of the Northwestern University Pritzker
mi c hi g a n j o urn a l o f g e n de r & la w
[Vol. 28:51
See Leah M. Litman & Deeva Shah, On Sexual Harassment in the Judiciary, 115 NW. Alexandra G. Hess, The Collapse of the House That Ruth Built: The Impact of the Feed-Indeed, from 1970 to 2014,
School of Law, the University of Chicago Law School, and George Washington Law
School. See David Lat, Supreme Court Clerk Hiring Watch: Meet Justice Amy Coney
Barrett's Clerks (Nov. 3, 2020), https://abovethelaw.com/2020/11/supreme-court-
clerk-hiring-watch-meet-justice-amy-coney-barretts-clerks/ [https://perma.cc/N5D5-
QQ29].
22. Mauro, supra note 7.
23. Id.
24. As Judge Richard Posner described the selection process in the 1960s, when he was
chosen to serve as a law clerk, "There weren't many applications; there were no par-
ticular standards. Often the justice would delegate the selection of his law clerks to a
personal friend, a professional acquaintance, or a law professor he was friendly with,
without bothering to screen or interview applicants himself." Richard A. Posner, The
Supreme Court and Celebrity Culture, 88 CHI.-KENT L. REV. 299, 301 (2013).
25. U. L. REV. 599, 626-28 (2020).
26. er System on Female Judges and the Federal Judiciary, 1970-2014, 24 J. GENDER SOC.
POL'Y & L. 61, 80 (2015).
27. Id. at 81.
28. Id.
The runner up, Judge Patricia Wald, sent sixteen clerks to the Court between 1970 and 2014. Id. By contrast, during the same period, 1970 to 2014, the top male feeder judge, then-Judge Alex Kozinski, sent fifty-eight clerks to the Court, followed by Judge J. John Gramlich, How Trump Compares with Other Recent Presidents When Appointing Federal Judges, PEW RSCH. CTR. (July 15, 2020) [hereinafter Gramlich, 2020), http://web.archive.org/web/20210110233032/https://www.pewresearch.org /fact-tank/2020/07/15/how-trump-compares-with-other-recent-presidents-inappointing-federal-judges/. 33. Gramlich, 2021, supra note 32; Gramlich, 2020, supra note 32.Harvie Wilkinson, who sent fifty-
five clerks to the Court. Id. at 80.
30. Feeder Judges, SCOTUS Race & Gender Statistics (last updated November 2020)
(unpublished dataset) (on file with authors).
31. Id.
32. John Gramlich, How Trump Compares with Other Recent Presidents When Appointing
Federal Judges, PEW RSCH. CTR. (Jan. 13, 2021) [hereinafter Gramlich, 2021],
https://www.pewresearch.org/fact-tank/2021/01/13/how-trump-compares-with-
other-recent-presidents-in-appointing-federal-judges/
[https://perma.cc/2LZW-
E9Q6];
-even normalized. 43 It may 34. Supreme Court Bar, SCOTUS Race & Gender Statistics (last updated November 2020) (unpublished dataset) (on file with authors). 35. Id. 36. Id. 37. Id. 38. Id. 39. Id. 40. Id. 41. Id. 42. The lack of diversity in American newsrooms has been documented and critiqued. See, e.g., 17% of Newsroom Staff Is Not White, COLUM. JOURNALISM REV. (Nov. 5, 2018), https://www.cjr.org/special_report/race-ethnicity-newsrooms-data.php [https://perma.cc/6RXL-GFAP] ("Despite being in majority-minority cities, the newsrooms of The New York Times and The Wall Street Journal, for instance, are both 81 percent white. The Washington Post is 70 percent white. Minorities make up 72 percent of the population of Los Angeles, but only 33 percent of the Los Angeles Times. According to the Radio Television Digital News Association, the numbers in other media look slightly better, if still not impressive: in 2018, about a quarter of
See THE 19TH, https://19thnews.org/about/ [https://perma.cc/6HJX-Q5V9]. In response to journalists of color, who have spoken candidly about their own experiences in homogeneous newsrooms, several newspapers "have announced initiatives aimed at changing their culture and their coverage, creating new beats, promoting people of color within and examining their hiring practices." See Julie Drizin, Why Is Public Media So White?, CURRENT (June 24, 2020), https://current.org/2020/06/why-is-public-media-sowhite/ [https://perma.cc/EV5X-RT39]. 44. See Rowe, supra note 14 (discussing enrollment in law schools). 45. Top 10 U.S. Daily Newspapers, CISION MEDIA RSCH. (Jan. 4, 2019), https://www.cision.com/us/2019/01/top-ten-us-daily-newspapers/ [https://perma.cc /Q74W-3GF9]. 46. SCOTUS Journalists, SCOTUS Race & Gender Statistics (last updated November 2020) (unpublished data) (on file with authors). John Fritze, also a white man, replaced Richard Wolf at USA Today in early 2021. See John Fritze, USA TODAY, https://www.usatoday.com/staff/2647507001/john-fritze/ [https://perma.cc/QSL4-JMXZ].mi c hi g a n j o urn a l o f g e n de r & la w[Vol. 28:51
Seven of those thirty-three times were citations to Professor Lee Epstein, a professor of law and political science at Washington University in St. Louis, Compare, e.g., Audience & Traffic, WASH. POST PR BLOG, https://www.47. Linda Greenhouse, 2,691 Decisions, N.Y. TIMES (July 13, 2008),
https://www.nytimes.com/2008/07/13/weekinreview/13linda.html [https://perma.cc
/ZG3M-2AHT]; Linda Greenhouse, N.Y. TIMES, https://www.nytimes.com/column
/linda-greenhouse [https://perma.cc/R8LH-G6HH].
48. washington
post.com/public-relations/audience-traffic/ [https://perma.cc/R4ZJ-UQME] (esti-
mating more than 111 million people visited the Washington Post in January 2021),
with, Media Kit, SLATE, http://mediakit.slate.com/advertise/p/1 [https://perma.cc
/3AHU-Y9AM] (estimating twenty million people visit Slate per month).
49. Adam Liptak Article Scholar Citations, Oct. 2019-Oct. 2020 (last updated Novem-
ber 2020) (unpublished dataset) (on file with authors).
50. Id.
Bostick, 501 U.S. at 434.mi c hi g a n j o urn a l o f g e n de r & la w51. Id.
52. Id.
53. Thomas, Data Analysis: Thomas and Gorsuch Scholar Cites, 2018, 2019 Terms (last
updated November 2020) (unpublished dataset) (on file with authors).
54. Id.
55. Gorsuch, Data Analysis: Thomas and Gorsuch Scholar Cites, 2018, 2019 (last up-
dated November 2020) (unpublished dataset) (on file with authors).
56. Florida v. Bostick, 501 U.S. 429, 434 (1991) ("So long as a reasonable person would
feel free 'to disregard the police and go about his business,' California v. Hodari D.,
499 U.S. 621, 628 (1991), the encounter is consensual and no reasonable suspicion is
required.").
57. [Vol. 28:51
In a particularly memorable passage, Justice Sotomayor, citing W.E.B. Du Bois, James Baldwin, and Ta-Nehisi Coates, wrote: 58. Bostick, 501 U.S. at 448 (Marshall, J., dissenting). 59. As Justice Sandra Day O'Connor has noted, all Justices "come to the Court with [their] own personal histories and experiences." Sandra Day O'Connor, Thurgood Marshall: The Influence of a Raconteur, 44 STAN. L. REV. 1217, 1217 (1992). "At oral arguments and conference meetings, and in opinions and dissents" Justice Marshall, she observed, "imparted not only his legal acumen but also his life experiences, constantly pushing and prodding us to respond not only to the persuasiveness of legal argument but also to the power of moral truth." Id. 60. See, e.g., Jeffrey Fagan & Alexis D. Campbell, Race and Reasonableness in Police Killings, 100 B.U. L. REV. 951, 961 (2020) ("[A]cross several circumstances of police killings . . . Black suspects are more than twice as likely to be killed by police than are suspects from other racial or ethnic groups."). 61. Utah v. Strieff, 136 S. Ct. 2056, 2063 (2016). 62. Strieff, 136 S. Ct. at 2063. Justice Ginsburg joined other portions of Justice Sotomayor's dissent, but not this part. Justice Kagan wrote a separate dissent. 63. Strieff, 136 S. Ct. at 2059, 2069 (Sotomayor, J., dissenting); id. at 2068-69 (citing prevalence of outstanding warrants in New Orleans, Louisiana; Ferguson, Missouri; and Newark, New Jersey).
). For more on race and Justice Thomas's jurisprudence and worldview, see Melissa Murray, Race-ing Roe: Reproductive Justice, Racial Justice, and the Battle for Roe v. Wade, 134 HARV. L. REV. 2025, 2068-70 (2021). 71. Black, 538 U.S. at 367(2003). 72. Black, 538 U.S. at 388 (Thomas, J., dissenting). 73. See Katherine Shaw, Friends of the Court: Evaluating the Supreme Court's Amicus Invihttps://perma.cc/N6YC-5ZV2]; see also Richard J. Lazarus, Advocacy Matters Before and Within the Supreme Court: Transforming the Court by Transforming the Bar, 96 GEO. L.J. 1487, 1520-21 (2008).tations, 101 CORNELL L. REV. 1533, 1583 (2016) ("[A] more diverse pool of advo-
cates might bring to the Justices creative ways of approaching cases-ways they might
not otherwise encounter, and that might ultimately enrich and even improve our
body of law.").
74. See Joan Biskupic, Janet Roberts & John Shiffman, The Echo Chamber, REUTERS
(Dec.
8,
2014),
http://www.reuters.com/investigates/special-report/scotus/
[
mi c hi g a n j o urn a l o f g e n de r & la w [Vol. 28:51
. 136 S Strieff, Ct, at 2070 (Sotomayor, J., dissenting)Strieff, 136 S. Ct. at 2070 (Sotomayor, J., dissenting).
Little Sisters of the Poor Saints Peter & Paul Home v. Pennsylvania, 140 S. Ct. 2367Little Sisters of the Poor Saints Peter & Paul Home v. Pennsylvania, 140 S. Ct. 2367 (2020).
Little Sisters of the Poor, 140 S. Ct. 2373Little Sisters of the Poor, 140 S. Ct. at 2373.
Little Sisters of the Poor, 140 S. Ct. at 1378-82. id. at 2397 (Kagan, J., concurringLittle Sisters of the Poor, 140 S. Ct. at 1378-82; id. at 2397 (Kagan, J., concurring).
Little Sisters of the Poor, 140 S. Ct. at 2402 (Ginsburg, J., dissenting). Justice Sotomayor joined Justice Ginsburg's dissent. Little Sisters of the Poor, 140 S. Ct. at 2402 (Ginsburg, J., dissenting). Justice So- tomayor joined Justice Ginsburg's dissent.
Little Sisters of the Poor, 140 S. Ct. at 2401 (Ginsburg, J., dissenting). Little Sisters of the Poor, 140 S. Ct. at 2401 (Ginsburg, J., dissenting).
In addition to his dissent, Justice Thomas made a rare set of interventions at the oral argument. See Linda Greenhouse, An Intense Attack by Justice Thomas on Cross-Burning. N.Y. TIMES. Virginia v. Black, 538 U.S343348Virginia v. Black, 538 U.S. 343, 348 (2003). In addition to his dissent, Justice Thomas made a rare set of interventions at the oral argument. See Linda Greenhouse, An Intense Attack by Justice Thomas on Cross-Burning, N.Y. TIMES (Dec. 12, 2002), https://www.nytimes.com/2002/12/12/us/an-intense-attack-by-justice-thomas-on-
. Caitlin Halligan's Record Of Activism, Senate Rpc, Caitlin Halligan's Record of Activism, SENATE RPC (Mar. 4, 2013), https://www.rpc.senate.gov/policy-papers/caitlin-halligans-record-of-activism [https://perma.cc/MC9F-NJKD];
. Gary Marx, Halligan, The Second Amendment, Nat'l Rev, Gary Marx, Halligan and the Second Amendment, NAT'L REV. (Mar. 10, 2011), https://www.nationalreview.com/bench-memos /halligan-and-second-amendment-gary-marx/ [https://perma.cc/2EYC-7VSD].
A Liberal Nominee of Illiberal Temperament, REAL CLEAR POL. Wall Street Journal, Goodwin Liu, Wall Street Journal, Goodwin Liu: A Liberal Nominee of Illiberal Temperament, REAL CLEAR POL. (Apr. 17, 2010), https://www.realclearpolitics.com/2010/04/17/goodwin _liu_a_liberal_nominee_of_illiberal_temperament_232765.html [https://perma.cc /BHW2-6UQV].
We Need to Take Away Children. Michael D Shear, Katie Benner, & Michael, S Schmidt, Justice Dept. Officials Said, N.Y. TIMES. No Matter How YoungMichael D. Shear, Katie Benner & Michael S. Schmidt, 'We Need to Take Away Children,' No Matter How Young, Justice Dept. Officials Said, N.Y. TIMES (Oct. 6, 2020), https://www.nytimes.com/2020/10/06/us/politics/family-separation-border- immigration-jeff-sessions-rod-rosenstein.html [https://perma.cc/8AW4-47MS].
. Litman, 81Litman, supra note 81, at 309-10.
Abby Phillip, Goodwin Liu Withdraws Nomination. Abby Phillip, Goodwin Liu Withdraws Nomination, POLITICO (May 25, 2001), https://www.politico.com/story/2011/05/goodwin-liu-withdraws-nomination- 05572.4 [https://perma.cc/7727-TRC7];
See Ian Millhiser, Beware: Clarence Thomas Is One of America's Top Legal Minds, THINKPROGRESS. maintaining that Justice Thomas's silence on the bench "perpetuates a myth that Thomas is a lightweight, disengaged from his work and unequal to the task of jousting with his more intellectually gifted colleagues")See Ian Millhiser, Beware: Clarence Thomas Is One of America's Top Legal Minds, THINKPROGRESS (Feb. 24, 2014), https://archive.thinkprogress.org/beware-clarence- thomas-is-one-of-americas-top-legal-minds-718abf17a851/ [https://perma.cc/QG69- QD2D] (maintaining that Justice Thomas's silence on the bench "perpetuates a myth that Thomas is a lightweight, disengaged from his work and unequal to the task of jousting with his more intellectually gifted colleagues");
The Myth of Scalia's Puppet Is Quashed as Quickly as It's Created, HUFFPOST. Mike Sacks, Clarence Thomas' Questions, Part. 3https://perma.cc/S7SC-JE4X] (noting that "[t]he most persistent myth about Justice Thomas" is "that he is Justice Antonin Scalia's puppet")Mike Sacks, Clarence Thom- as' Questions, Part 3: The Myth of Scalia's Puppet Is Quashed as Quickly as It's Created, HUFFPOST (Nov. 21, 2011), https://www.huffpost.com/entry/clarence-thomas- antonin-scalia_n_1105776 [https://perma.cc/S7SC-JE4X] (noting that "[t]he most persistent myth about Justice Thomas" is "that he is Justice Antonin Scalia's pup- pet");
at C1 (noting that Bob Woodward and Carl Bernstein's The Brethren, a depiction of the Burger Court, portrayed Justice Thurgood Marshall "as a lazy man who spent much time watching TV and who left his court work to a series of firstrate law clerks. Juan Williams, Masks of Thurgood Marshall, WASH. POSTThe ManyJuan Williams, The Many Masks of Thurgood Marshall, WASH. POST (Jan. 31, 1993), at C1 (noting that Bob Woodward and Carl Bernstein's The Brethren, a de- piction of the Burger Court, portrayed Justice Thurgood Marshall "as a lazy man who spent much time watching TV and who left his court work to a series of first- rate law clerks").
The Case Against Sotomayor. Jeffrey Rosen, NEW REPUBLIC. Jeffrey Rosen, The Case Against Sotomayor, NEW REPUBLIC (May 3, 2009), https://newrepublic.com/article/60740/the-case-against-sotomayor [https://perma.cc /38R6-4GZ4];
s Leaked Memo: Sotomayor 'Not as Smart as She Seems to Think She Is. Debra Cassens Weiss, Laurence Tribe, A.B.A. J.Debra Cassens Weiss, Laurence Tribe's Leaked Memo: Sotomayor 'Not as Smart as She Seems to Think She Is,' A.B.A. J. (Oct. 29, 2010), https://www.abajournal.com/news/article/laurence_tribes_leaked_memo_sotomayor _not_as_smart_as_she_seems_to_think_sh [https://perma.cc/7DEA-7QYJ].
Sotomayor Pays Tribute at Robert Morgenthau's Funeral, AP NEWS. Verena Dobnik, Verena Dobnik, Sotomayor Pays Tribute at Robert Morgenthau's Funeral, AP NEWS (July 25, 2019), https://apnews.com/article/5c85aa57b09540cd95b14eee2d733cab [https://perma.cc/WDU2-PHPL].
whose-nomination-for-civil-rights-post-was-blocked-in-senate-joins-private-law-firm. Al Kamen, Debo Adegbile, WASH. POSTWhose Nomination for Civil Rights Post Was Blocked in SenateAl Kamen, Debo Adegbile, Whose Nomination for Civil Rights Post Was Blocked in Sen- ate, Joins Private Law Firm, WASH. POST (Sept. 15, 2014), https://www.washingtonpost.com/blogs/in-the-loop/wp/2014/09/15/debo-adegbile- whose-nomination-for-civil-rights-post-was-blocked-in-senate-joins-private-law-firm/ [https://perma.cc/G9BV-5H5R].
Adegbile's confirmation was shot down in March after senators objected to legal work he did with the NAACP's Legal Defense Fund. Meredith Clark, Obama Withdraws Nomination of Top DOJ Civil Rights Lawyer, MSNBC. Meredith Clark, Obama Withdraws Nomination of Top DOJ Civil Rights Lawyer, MSNBC (Sept. 15, 2014), https://www.msnbc.com/msnbc/obama-withdraws- nomination-debo-adegbile-doj-civil-rights-lawyer-msna412696 [https://perma.cc /ZHR2-38BU] ("Adegbile's confirmation was shot down in March after senators ob- jected to legal work he did with the NAACP's Legal Defense Fund.").
. Id, Id.
The President Says He Only Lately Read Her Legal Writings. He Decided She Stood for Principles He Could Not Support in a Divisive Confirmation Battle. David Lauter, Clinton Withdraws Guinier as Nominee for Civil Rights Job: Justice Dept. L.A. TIMESDavid Lauter, Clinton Withdraws Guinier as Nominee for Civil Rights Job: Justice Dept.: The President Says He Only Lately Read Her Legal Writings. He Decided She Stood for Principles He Could Not Support in a Divisive Confirmation Battle., L.A. TIMES (June 4, 1993), https://www.latimes.com/archives/la-xpm-1993-06-04-mn- 43290-story.html [https://perma.cc/NGF8-CB5T].
The Destruction of Lani Guinier, CHI. TRIBUNE. The Destruction of Lani Guinier, CHI. TRIBUNE (June 6, 1993), https://www.chicagotribune.com/news/ct-xpm-1993-06-06-9306060004-story.html [https://perma.cc/K2PU-V8J9].
. See Lani Guinier, ; L Harv, Sch, Bennet Boskey Professor of Law EmeritaSee Lani Guinier: Bennet Boskey Professor of Law Emerita, HARV. L. SCH., https://hls.harvard.edu/faculty/directory/10344/Guinier [https://perma.cc/SM76-
. Lauter, 93Lauter, supra note 93.
Obama Nominee to Legal Office Withdraws. Charlie Savage, N.Y. TIMES. Charlie Savage, Obama Nominee to Legal Office Withdraws, N.Y. TIMES (Apr. 9, 2010), https://www.nytimes.com/2010/04/10/us/politics/10johnsen.html [https://perma.cc/REV6-P7ZH];
I Have No Regrets. Carrie Johnson, Dawn Johnsen, NPRCarrie Johnson, Dawn Johnsen: 'I Have No Regrets,' NPR (June 25, 2020), https://www.npr.org/templates/story/story.php?storyId= 128099976 [https://perma.cc/HL4G-FK5Y].
| Introduction 1. The national-university vision and American constitutionalism 2. The national university and constitutional limits 3. The national university and state institutions 4. Constituting the university 5. Education, the national university, and constituting national identity 6. The civic dimensions of American constitutionalism Conclusion: the Constitution and the American mind. | Tom Woods' "33 Questions About American History You're Not Supposed to Ask" should be on every libertarian's book shelf (or as in my case, on their Kindle). Tom has a way of making history fun to read, interesting and very clear. It's not what they taught us in school, that's for sure. I learn something new every time I read one of his books. | This working paper is a review of P. Dobner & M. Loughlin The Twilight of Constitutionalism? (OUP 2010). | Historians and critics have long assessed the political import of Marbury v. Madison, an 1803 Supreme Court decision that declared part of a Congressional act unconstitutional. Critics explain the decision as part of an evolution in constitutional law and as a lively political drama. This essay identifies inferences by which the written opinion poses judgments about the function of law. The opinion delimits law to decisions about personal rights; it radicalizes its field of concern by reversing its argumentative momentum; it develops a progression of dichotomies that ask readers to stand in for the viability of a contractual political order. These ways of constructing the issue ask readers to affirm a formative myth of national identity. | 66 | Political scientists are predisposed to view the American constitution as the product of pragmatic politics. In part, this interpretation has been inspired by the founders themselves, who frequentl... | It is fitting that during the period of the bicentennial celebration of the U.S. Constitution public law scholars both reexamine constitutional history and engage in an introspective examination of the subfield within political science. There is dissatisfaction with the dominant approaches of political jurisprudence and judicial behavioralism (Stumpf 1983). Public choice theory, critical legal theory, and some normative models are vying for paradigmatic hegemony. Yet important figures of political jurisprudence and judicial behavioralism such as Pritchett, Murphy, Tanenhaus, Schubert, Schmidhauser, Nagel, Shapiro, and Ulmer, among others, have contributed greatly in explaining judicial decisionmaking in realistic political and human terms. It is a mistake to discard the advances of the last three or four decades in favor of approaches lacking explanatory power. Science, not rhetoric, must remain our epistemological foundation. | 1. "All governments rest on opinion" --James Madison (1) James Madison, a principle author of the U. S. Constitution and the Bill of Rights, was an accomplished student of political theory, both ancient and modern. The Federalist Papers were written as briefs for the ratification of the Constitution, but they were also reflections on government and human nature, making the Constitution itself a case study within a comprehensive theory of government. Madison states, "But what is government itself but the greatest of all reflections on human nature?" (2) Madison's statement in the epigraph above gains clarity as we fit it within his discussion of discourse. We can gain a better grasp of the American government--and of the people's role in it--through basing our own reflections on the intentions for the new government, voiced by Madison, and how they have played out over the past two centuries. (3) Taking Madison's thought as a starting point for clarifying what a democratic republic is, I will examine how citizens participate in the public discourse and decision-making of a democratic republic and where they place their trust when they do so. (4) Madison aims at a republic in contrast to a pure democracy in that he expects citizens to choose those who hold office but not handle the affairs of state themselves. (5) I will consider two later political thinkers, Walter Lippmann and John Dewey, who raise questions concerning possibility of republican government and of discourse in it. I will end with several observations on retaining or retrieving something akin to Madison's vision of a republic by making trust in civic discourse possible again. Although Madison's purpose in his Federalist Papers is to explicate the republican character of the proposed national government, in the epigraph Madison writes of "[a]ll governments," not of republics alone, that what they have in common is opinion. He does not give priority to the more typical concerns of modern political thought: the capacity for coercion and for security of subjects and their property, although he in no way dismisses the importance of these. All governments are basically alike in that they rest on opinion. What does this opinion concern? Whose opinion is it? People learn about their worldly condition so as to develop and follow strategies for successfully adapting and living with a certain style or spirit not least by means of institutions: settled forms of organized memory and conduct, such as those of law and government. Governments establish hierarchies; they encourage certain ambitions, characters, and skills necessary for serving the authorities and for taking up professions for the good of their fellows; they rely upon, generate, and are themselves expressions of knowledge and confidence that help rulers provide guidance that will enable (at least some) members of the regime to flourish. Madison's term 'opinion' refers to the kind of knowledge or belief that provides people the capacities to act with confidence in the surrounding world so as to have lives in which they flourish. 'Opinion' is a component of a practical understanding relative to the perspective of the knower, expressive of how the world appears to that person. Opinions are shared with one another and refined by the members of a group so that a common view, an enlarged opinion, emerges and binds members together for action within a common world. Throughout history, I propose, most people's opinions on their world have included their submission to a rule by others, whose views are not presented as some opinions among others, but as knowledge with a special importance commanding the attention of all. The opinions of the many necessarily included acquiescence in, and agreement with, the established order. In the extreme case of tyranny, the division of rulers and ruled reaches is widest and most destructive: all are ruled by one person or a small clique who must make fear pervasive in the populace. … | what did the founding fathers not intend american politics to be | Time Framing in the Rhetoric of Constitutional Preambles | American Intergovernmental Relations: A Fragmented Federal Polity | who is one of the proponents of declarationism | Wilson's program of political and social? | Question about founding the World Congress |
67 | What's with the 4 star reviews?! | I see everyone on here freaking out about getting a single 4 star review, but I’ve never let that stop me from purchasing from someone? Is it actually bad? | If I would have reviewed this a week ago probably would have gotten five stars but 4 is pretty good. The price isn't great but it's pretty good. My issue with it is that the more use it gets the more flimsy it can become. We'll see if that trend continues over the next few months. | Awful & Unprofessional !!! Forces you to rate, in order to leave a review. No Stars! | 3.5 stars is a more accurate review/rating. Enjoyable read. FYI, 4 stars is usually my highest. | Whenever I go on Amazon, I sort the reviews by one star, two star, and three star. And I don’t even bother reading the four and five star reviews. I enjoy the bad negative reviews because not only am I made aware of shipping issues, or products arriving broken, or possible dupes or counterfeit items, but the handful of “three stars - great product!” or “one star - haven’t read this yet” reviews are easy to eliminate and disregard. I’m always suuuuuper suspicious of perfect scores (especially with books), and a handful of negative reviews for completely random reasons reassures me that the seller/author didn’t spam their own product with employees/friends/family gushing over the latest and greatest craze for only $3.99 - or if they did, enough real, idiot people have bought it, tried it, and cared enough about it to leave a real, idiot review. | I had originally planned to purchase this game when it came out but stopped myself because of all the terrible reviews on reddit. Today i was scrolling through the store and noticed its extremely high rating of 4.3....which really confused me. Can anyone tell me why its so highly rated? Did they patch it or something since release? | I like it, see the star rating, but have no intention of reviewing it. I am posting this as a way to clear my review file, as there is minimum number of words required. | I'm giving this a 5-star review without even having purchased this, just because of the joy I'm getting from the reviews of angry people who didn't pay attention to what they were buying. Way to go, Blankeez! | 67 | So thankfully it doesn't happen very often, but I just don't get why someone would leave a 4 star review, with no reasoning? I've had a couple now where they say they love it, exactly as pictured, yet only 4 stars?
Would it be a bad move to reach out and ask what more could I have done to ensure a 5 star experience or is it just not worth it?
I feel like I couldn't do more, I triple quality check everything, they're exactly as pictured, I ship early, and it arrives gift wrapped both for protection (my products are delicate) and for that extra little something for the unboxing experience.
I guess you can't please everyone. | I would give this a zero star review if I ... | Gave a 4 star because the packaging was so bad and was concerned it might be damaged that was ... | ... probably would have gotten five stars but 4 is pretty good. The price isn't great but it's pretty ... | I gave it four stars because although it was not ... | The only reason i am giving it a 4 star ... | I posted a four-star review some weeks ago. The ... | I would give it a 4 star review, but ... | Good model. The only reason it's 4-star is because ... |
68 | Novel environment protection PVC cable sheath material | The use of polyethylene as a cable sheath is discussed in the light of difficulties encountered during actual field use. Protection against weathering is one problem; another is stress cracking when the polyethylene is subjected to certain environments such as soaps, alcohols, and wetting agents. | The present invention relates to a PVC wire coating friction material composition significantly reducing the friction between an outermost layer of a wire consisting of PVC and a surface contacted with the layer. The purpose of the present invention is achieved by having the friction material composition consisting of polyvinyl chloride (PVC) and a fatty acid amide. The friction material composition according to the present invention can obtain a faster effect, can obtain a better effect of reducing a friction, and has an excellent thermal stability. | Best exterior vinyl/plastic protectant I've used so far. Dries to a duller, less slippery coating, unlike the other 'auto-store' brands. | It reviewed the research situation and applications of nano-technologies on toughening and modifying PVC in recent years. | The invention relates to a cold-resistant polyvinyl chloride cable material and a preparation method thereof. The cold-resistant polyvinyl chloride cable material is prepared from raw materials in parts by weight as follows: 100 parts of polyvinyl chloride, 30-50 parts of DOP (dioctyl-phthalate), 40-60 parts of calcium carbonate, 9-15 parts of a toughening agent, 5-8 parts of barium stearate, 1-2 parts of polyethylene wax and 5-10 parts of epoxidized soybean oil. The toughening agent is matched with various preparations, accordingly, the cold resistance of polyvinyl chloride plastics can be effectively improved, sheaths of wire and cable products cannot crack in a cold state in a lower temperature range, and improvement of the production efficiency and reduction of the production cost are facilitated. | The invention discloses a photovoltaic wiring box body material. The photovoltaic wiring box body material consists of polybenzyl ether resin, graphene, polystyrene resin, an elastomer, a flame retardant and other auxiliaries. Through the addition of the graphene material into the traditional MPPO (Modified Polyphenylene Oxide), the heat radiatign performance of a wiring box body is improved, and the burnt rate of the wiring box due to poor heat radiation is greatly reduced. Meanwhile, the tenacity and the hardness of the material are improved, and the anti-impact performance of the wiring box is improved. | Abstract : A new protective sheath design for fiber optic cables has been developed. It features corrugated and longitudinally applied metal members with a plastic jacket in an adhesively bonded construction. The use of conventional corrugation tools and longitudinal application in a single pass results in low cost and high line speeds. Tests have shown this sheath to be rodent proof, to have exceptionally high ligthning-withstand capability, and in general, to be very rugged mechanically, without compromising cable handling qualities or optical performance. This design is used as a protective oversheath for stranded core cables. It is recommended for buried and aerial applications, particularly where rodent and lightning resistance is essential. It is also recommended as a general mechanical protection and in buried submarine application. (Author) | It's says leather in the title BUT "synthetic leather"... down in the description. I didn't know there was any such thing as "synthetic leather". Just thought there was either leather or plastic. | 68 | The invention relates to a novel environmental protection PVC cable sheathing material, and the main components are PVC resin powder, diisononyl phthalate, vegetable oil, light calcium carbonate superfine powder and appropriate amount of stabilizer, flame retardant, lubricant, coloring agent and the like. The cable sheathing material prepared by the invention does not contain toxic substances such as lead, cadmium, di-octyl phthalate (DOP) and the like, thereby being in line with the requirements of environmental protection; furthermore, the product has excellent heat resistance, aging resistance and volatility resistance, as well as great insulation, migration resistance and cold resistance. | Environment protection termiteproof cable sheath material made of middle high-density polyethylene and method for production thereof | Cold-resistant polyvinyl chloride cable material and preparation method thereof | Polymer insulated medium voltage cables have experienced premature failures in-service, due in large part to water treeing. Research has shown that the initiation sites of these water trees are often located where there are stress enhancements at the insulation/semiconducting shield interface and where water soluble contaminants permeate into the insulation. Material suppliers, cable manufacturers and users have introduced improved materials and cable designs as well as processing, manufacturing, transport, storage, and installation techniques that minimize contamination. Despite these advancements, gradual contamination can still occur due to the diffusion of ground water into the insulation. In fact, certain contaminants that are carried through the semiconductor/insulation shield interfaces tend to promote water tree growth. Manufacturers are now beginning to recognise this problem and have suggested the use of moisture resistant cables with jackets made of PVC, polyethylene or metal/polymer laminates along with underjacket water absorbing materials. This paper discusses the effectiveness of different jackets and materials and presents data on the effectiveness of water absorbing materials in delaying water permeation into the insulation. A simple and efficient cable-cell technique was developed which monitored the effectiveness of complete cable designs, by measuring the long-term water permeation resistance of short lengths of distribution class cables. | Exploring the extrusion process of flame retardant polyolefine cable insulation and sheath | Automatic temperature control cable material resin composition and preparation method thereof | Novel environmental protection insulation mortar and preparation method thereof | Materials and processes for environmental protection | what material was used to insulate submarine cables in the 1930's |
69 | how many agencies are involved in eif programme | International Decision Support Initiative Office of Health Economics, the University of Glasgow, and the University of Strathclyde. iDSI receives funding from the Bill & Melinda Gates Foundation, the UK Department for International Development, and the Rockefeller Foundation. In December 2015, iDSI received $12.8 million in funding from the Bill & Melinda Gates Foundation for phase 2 of its operations. iDSI has operated in China, India, Indonesia, Myanmar, the Philippines, South Africa, and Vietnam as "focus countries", but has also operated in additional countries. Most of iDSI's work has focused on noncommunicable diseases, maternal and child death, and more general priority-setting. As part of their | Affair," (episode 4 from season 1, from 1964) enforcement agent of U.N.C.L.E. Napoleon Solo reveals that U.N.C.L.E. is sponsored by the US, the Soviet Union, the United Kingdom, the Netherlands, Greece, Spain, Italy and Yugoslavia. Its primary opponent is the independent international criminal organization, . U.N.C.L.E. headquarters is in New York City near the lower East 40's United Nations. U.N.C.L.E. headquarters has four levels: one ground level; two higher levels (Waverly's office is on the top floor) and one sub-level. The roof has radar, a laser beam weapon, a helipad and communication antennas, disguised as billboards, that have a worldwide | The commercial segment constitutes roughly 60% of the industry. The defense segment caters to US government agencies, such as the Department of Defense (DOD) and the National Aerospace and Space Administration (NASA). AIA Chairman are selected from the leadership of member companies, as voted by the Board of Governors. Each Chairman serves a yearlong term, begin on the 1st of January and ending on the 31st of December. Aerospace Industries Association The Aerospace Industries Association (AIA) is an American trade association representing manufacturers and suppliers of civil, military, and business aircraft, helicopters, UAVs, space systems, aircraft engines, missiles, material, and | Employee Benefit Research Institute began in 1990, is the longest-running annual retirement survey of its kind in the nation. Its annual Health Confidence Survey asks similar questions on public attitudes on health issues. The EBRI Consumer Engagement in Health Care Survey provides national data on the growth of consumer-driven health plans and high-deductible health plans. Through its Education and Research Fund (ERF), EBRI operates the Choose to Save national public education and outreach campaign, and the American Savings Education Council, a national coalition of public- and private-sector organizations that promote saving. As part of Choose to Save, EBRI developed the Ballpark E$timate, a two-page | The Epidemic Intelligence Service (EIS) celebrated its 50th anniversary in April at an annual conference held in Atlanta, Georgia. The EIS was originally created to safeguard against biological warfare and man-made epidemics, but has more recently contributed to polio eradication in Africa and Asia, and investigated outbreaks of hantavirus and West Nile virus in the USA, and Ebola in Uganda and Zaire. The EIS also played an instrumental role in the global eradication of smallpox. The two year EIS program provides on-the-job training to various health specialists including physicians, nurses, dentists, epidemiologists and veterinarians. Currently, there are EIS field programs on every continent except Antarctica. AV (http://www.cdc.gov/eis) | E-Government in the United Arab Emirates that lays the foundation to achieve UAE Vision 2021. The UAE started some of its eServices such as eDirham in as early as the year 2001. The service initiated by the Ministry of Finance replaced the traditional way of paying and collecting fees for government services. The government gradually made more services available online. The official portal of the UAE Government is www.government.ae. It is part of the federal eGovernment programme and a major milestone in the process of eTransformation in the UAE. This portal brings all eServices provided by the UAE federal and local government bodies under one umbrella. | Bureau of International Information Programs The U.S. Department of State's Bureau of International Information Programs (IIP) supports the department's public diplomacy efforts by providing and supporting the places, content, and infrastructure needed for sustained conversations with foreign audiences. IIP is one of three bureaus that report to the Undersecretary for Public Diplomacy and Public Affairs. The Bureau of Educational and Cultural Affairs and the Bureau of Public Affairs are the sister bureaus. When the Foreign Affairs and Restructuring Act abolished the United States Information Agency (USIA) on October 1, 1999, USIA's broadcasting functions were moved to the newly created Broadcasting | E9 (countries) The E9 is a forum of nine countries, which was formed to achieve the goals of UNESCO's Education For All (EFA) initiative. The “E” stands for education and the “9” represents the following nine countries: Bangladesh, Brazil, China, Egypt, India, Indonesia, Mexico, Nigeria and Pakistan, representing over half of the world's population and 70% of the world's illiterate adults. E-9 Initiative was launched in 1993 at the EFA Summit in New Delhi, India. E-9 Initiative has become a forum for the countries to discuss their experiences related to education, exchange best practices, and monitor EFA-related progress. E-9 countries | 69 | Enhanced Integrated Framework as the broader Trade for Development and Aid for Trade spheres. Several bodies on the global and the national levels form the institutional framework of EIF program. The EIF Steering Committee is the highest level body of the EIF and responsible for setting the overall policy direction of the programme, reviewing its effectiveness and ensuring transparency. It is composed of representatives from each of the participating LDCs, the donor countries and agencies, the six core agencies, the EIF Executive Secretariat and the EIF Trust Fund Manager ex officio. The Steering Committee meets at least twice a year. The EIF Board | Questions regarding the Unifi control panel: | the multilateral investment guarantee agency is a member of | What is the responsibility of the EOC? | what is the name of the annual conference held by eccai | how many organizations are in the framework convention alliance | The Impact of the ECOWAS Protocol on Good Governance and Democracy | Are the EOC questions included in the Practice problems on the CFAI ecosystem? | Challenges for Multilevel Stakeholder Engagement in Public Trust Resource Governance |
70 | who does risque call to get help from x force | X-23 reunited with her friends from the "NYX" series. X-23 is shown to be part of Cyclops' "Alpha Roster" in the course of the "" story arc. Laura, along with the most of X-Force, accompany Cable and Cypher to the future in an attempt to shut down the Nimrod invasion. Following Cypher successfully over-riding the programming, Laura attempts to return through the temporal portal, only to sustain horrific injuries. The portal prevents any organic matter traveling through it. This leads Cable to sacrifice himself, allowing his techno-organic virus to overwhelm him, forcing the portal open and making it possible for | Professor X passes over, which are Kurt Wagner, Piotr Rasputin, Pietro and Wanda Maximoff, and Ororo Munroe. Xavier also trains Tessa in order to spy on Sebastian Shaw. Xavier founded Xavier's School for Gifted Youngsters, which provides a safe haven for mutants and teaches them to master their abilities. In addition, he seeks to foster mutant-human relations by providing his superhero team, the X-Men, as an example of mutants acting in good faith, as he told FBI agent Fred Duncan. With his inherited fortune, he uses his ancestral mansion at 1407 Graymalkin Lane in Salem Center, Westchester County, New York as a | Cable and X-Force interstellar genocidal murderer. Cable and Colossus are able to convince Abigail Brand that they freed Kliktok since in three days an alien armada was going to invade Earth in order to get revenge on Kliktok. Brand agrees to help free X-Force before the armada destroys their ship. Colossus is able to launch himself into the alien ship and free the team, but they them maroon Brand since they won't turn themselves in. Brand ask the Avengers to track Cable and Hope Summers. Havok, Captain America, and Rogue track Hope to a bus station. The noticed that she shook off their | Assault on Weapon Plus "Weapon I"). The story starts by catching up with Cyclops, who has recently left the X-Men after his psychic affair with Emma Frost was exposed. Wolverine finds him drinking at the Hellfire Club, contemplating quitting the X-Men. Incidentally, Sabretooth is also dining at the facility. Wolverine is aggressive toward Sabertooth, but is unable to escalate an argument into a conflict because it is against the rules of the Hellfire Club for patrons to fight within the building. Fantomex arrives and convinces both Cyclops and Wolverine to join him in breaking into the Weapon Plus installation floating in orbit around the | forcing jean (and kurt and kate, if not for the others intervening) off the council seemed like too transparent a move on shaw's part for xavier and magneto to go along with it so easily. did anyone else not think that? it makes sense that they would share the concern that shaw offered (the fate of the council if 1/4 of its members died in otherworld) but i still think xavier at least would have seen that shaw was acting in self-interest and pushed for a different solution. was this intentional - to suggest something about a shift in xavier's conduct - or do you think the narrative process was just simplified for space and convenience?
side note: it was interesting to see emma so inequivocally aligned with all the other x-men (bar xavier himself). what a relief after what was done to her between 2016 and 2019. | XCOM 2 that the forces of Earth retaliated aggressively and with prejudice. (This is presumed to have happened right after the player researches MECs, as stated by the autopsy of an ADVENT MEC.) The player again assumes the role of the Commander, who had up until recently been placed in alien stasis for them to make use of their strategic thinking via a brain implant. After the Commander is rescued by Central Officer Bradford, XCOM launches an attack on an alien convoy and steal an elerium core used to power the Avenger, an alien supply barge that has been converted into XCOM's | They intended to cause nuclear war between the US and the Soviet Union, which would wipe out the human race. The X-Men were able to escape the mountain base just before Mutant Master blew it up, and again thwarted their plans. Factor Three relocated to an alternate base, where Changeling, Mutant Master's second in command, discovered his plans to destroy mutantkind as well as humankind. Changeling freed Professor X and Banshee, who inadvertently destroyed the Mutant Master's cloaking device, revealing his alien appearance. The X-Men and the remainder of Factor Three joined forces in attacking Mutant Master, who committed suicide | They intended to cause nuclear war between the US and the Soviet Union, which would wipe out the human race. The X-Men were able to escape the mountain base just before Mutant Master blew it up, and again thwarted their plans. Factor Three relocated to an alternate base, where Changeling, Mutant Master's second in command, discovered his plans to destroy mutantkind as well as humankind. Changeling freed Professor X and Banshee, who inadvertently destroyed the Mutant Master's cloaking device, revealing his alien appearance. The X-Men and the remainder of Factor Three joined forces in attacking Mutant Master, who committed suicide | 70 | Risque (comics) heart. Seeing X-Force in her motel room, Risque flees to Wacky World itself. Once again underestimating the lengths X-Force would go for her capture, she is blindsided by the mutant Caliban. She escapes from Caliban on the monorail and hides with two willing young male collaborators, who enjoy the intrigue Risque brings. Caliban finally catches up with her in a maintenance tunnel but he collapses. This was due to numerous biological tampering done to him over the years. Risque initially desires to flee before calling for 9-1-1, but her conscience forces her to stay behind and tend to the injured | where did the woman go in rishtey | who does loa end up with in x force | who is the main character in putting on the ritz 1991 | rifaximin binds to the β subunit of | what kind of attack did xavier use to kill farouk | who did cable and x force free in the comics | How much Ritilan is too much | what was the x rating for in the movie scandal |
71 | Factors Affecting the Performance of Small and Medium Enterprises in the Jua Kali Sector In Nakuru Town, Kenya | Opportunities and challenges of the development of small and medium enterprises in the agricultural sector from the Republic of Moldova. |
Introduction
The main problem that prompted this study was the inadequacy and scarcity of empirical and up-to-date knowledge about the SME sector in Kosovo, which consequently made it difficult for entrepreneurs and researchers to implement and adapt practices and theories. This research addresses in particular the impact of internal factors in the SME sector. Considering that most of the studies by national and international actors did not include the micro-enterprise sector, which constitutes more than 93.1% of the SME sector, as a research subject we also included the micro-enterprise sector along with small and medium enterprises of Kosovo, which are vital to the country's economy, and the impact of factors such as managerial skills and competencies, access to finance and technological capabilities in the performance of their enterprises.
Small and medium enterprisesconcepts and relevance
The most common determination that distinguish large and small enterprises is the number of employees [1]. According to Bolton Report [2], describe two main approaches that summarize all definitions: quantitative and qualitative approach [3]. The majority of nations, policymakers, academics, statistical agencies, and international institutions mainly applying quantitative criteria in defining SMEs. In Kosovo the classification of SMEs is defined by law on foreign investment which entered into force in 2014. This law defines SMEs by the sole criterion of the size of the number of employees, which is in line with the definition of the EU. Source: [50] SMEs play a special role in the economy of Kosovo, accounting for 99.8% of all enterprises in 2016. They generate 81% (56.2% in EU) of the total value added and 76.2% (66.5%) of the total employment in the economy of Kosovo, making a significant deviation comparing to the EU average in the respective accounts (EC, 2019). In addition, the SME sector in Kosovo achieved strong growth rates in terms of value added with 88.5% (11.7% in EU) and employment 27% (6.6% in EU), substantially exceeding the average achievement by EU SMEs [4].
However, their contribution to export is only around 5-6% [4]. The largest value generated by Kosovo SMEs comes from medium-sized enterprises (47% of total value added) representing only 1% of the business population, which employs one-fifth of the total business sector employment, however the value added created by micro-enterprises (13.2% of total value added) remains very low compared to other economies in the region [5].
Services are largest and most important sector of Kosovo's economy contributing significantly to GDP (72.63% of the GDP) and job creation (85.3% of the employment in Kosovo), driven by construction, real estate, and retail [6]. Although the contribution of SMEs is undeniable for the economy of Kosovo, SME sector is characterized by traditional and noninnovative enterprises and often suffers from a lack of skills and training related to business activities; access to finance, poor competitiveness, technological capabilities, etc.
Literature
Review SME sector has always raised the interest of academics to adapt and create applied models and economic theories to achieve the best performance due to their socio-economic importance, specific business characteristics and behavior [7][8] [9].
Despite the large role for the economic and social development, growth of small and medium enterprises (SMEs) continues to be challenged by a various number of factors. Based on many empirical studies, it has been pointed out that most of the SMEs do not survive more than 5 years. Considering this conclusion, it is very important to increase attention to the factors that influence such results. The main characteristics of SMEs tend to derive from their limitation such as personalized management (owner/manager), constraints on resources (management/organization, human resources, finance) and technological capabilities, limited market impact, and greater flexibility to the external environment [7].
Although the authors have paid great attention to identifying the factors that affect the growth of SMEs, however, they have not yet been clearly defined. But, in an extensive study with 1386 fast-growing small businesses identified four groups of factors that affect the rapid growth of businesses such as entrepreneur's personality, business strategy, resources and capabilities of the business entity and the external environment [7]. Considering that most of the identified factors that affecting SME performance were internal, this study focused only on identifying and influencing internal environment in Kosovo SMEs.
According to [7], "managing the internal environment is usually connected to the degree of performance achievement of a business entity". Considering that studies examining only the impact of internal factors as a whole on the performance of businesses are rare, it increased the interest and attention to perform one.
Internal environmental factors are considered as factors within a business that affect the business and are more controllable by the business entity [10]. Internal factors can influence the performance of a business both positively and negatively. Main internal factors affecting performance can be grouped into three categories -human resources, finance and technology. However, we will focus on the internal factors that challenge SMEs. Therefore, in the literature review we have included factors such as managerial skills and competencies, access to finance, and technological capabilities.
Managerial competency and skills.
Managerial competencies which consist of a set of skills (human, financial and information), knowledge and attributes that enable an individual or small business owner to perform a specific task or activity within a function [11], are considered as crucial factors that contribute to survival and performance of SMEs. Recently, changes in the global market have increased attention to the impact of competencies and skills on the performance of SMEs. Many authors have found a positive relationship between managerial competencies and the performance of SMEs [12][13] [14]. However, a number of studies have examined the relationship between managerial competence and small business failure [15][16] [17], and identified that the lack of relevant skills or expertise (supervision of financial, marketing, HR) in basic business management are the major contribuors to small business performance and failure [18] [19]. In order to ensure a superior performance, a firm or owner must possess appropriate skills and abilities before running the businesses [20]. In Kosovo there is an insufficiency of studies in relation to factors such as managerial competencies and skills. Given the high importance we discussed of managerial competencies and skills in the performance of small and medium firms, it is of great importance to examine the impact of these factors on Kosovo SMEs.
Access to finance.
Access of SME to finance is considered as main barrier faced by SME in the region [21], impacting growth and development of business entities. Given the characteristics of the sector, the authors find that young firms of small size face greater obstacles when they seek to obtain financial resources [22]. However, it is noted that mostly of the SMEs rely on internal finance, such as existing cash, contribution from the owners, family and relatives, which is often insufficient for SMEs to survive and growth [23]. Kosovo as a developing economy with different market forces which are hindering the competitiveness of local businesses, the necessity of investment has been created in order to grow their businesses. As a result, the demand for external financing has been stimulated, especially for microenterprises. Credit is the main instrument of SMEs for funding. The most apparent private sector financing gaps in Kosovo include those for loans to micro-enterprises and for equity finance [24], which MFI struggle to meet the growing demand due to limited funding sources. However, as a result banking sector have decided to stop serving the microenterprise segment, which is hindering the growth and survival of 93,1% of SMEs. While small and medium loan finance availability is sufficient, high collateral requirements present a major barrier for access to finance by SMEs [24]. The lack of sophistication in areas such as business planning, financial record keeping, and growth management has created a barrier to responding low collateral and equity finance requirements, which have consequently limited credit.
Technological capabilities.
Technology has become a crucial and inseparable mechanism for all kinds of organizations. Through it, organizations improve the performance and overall effectiveness of products, services and systems by enabling businesses to expand quickly and efficiently. Technological advancement in the modern era presents a great challenge for the SME sector. The role of information technology for the SME sector is being considered critical in relation to performance enhancement, competitive advantage and firm survival [25] [26]. Given its importance, we conclude that technology is no longer something of a luxury, but a necessity for firms. However, the opportunity to adapt to technological developments is small, based on the fact that most of the SME sector in Kosovo consists of traditional and non-innovative enterprises. Despite the obstacles faced by these businesses, surprisingly, the technology sector is booming, contributing to economic growth in terms of employment of young men and women as well as increasing the level of exports. About 78% of firms in the technology sector export their services [27]. Based on these data, we notice that the domestic market has been left behind and overshadowed by the focus on exports, because they do not see it as a profitable market. This disconnect does not promote the local market and makes it impossible to capitalize on the benefits of technology. Consequently, skilled workforce, knowledge and financial means are main barriers for digital transformation of SME firms in Kosovo [28]. Also, in many literatures the positive relationship between IT capabilities and firm performance has been demonstrated [29]. IT capabilities are defined as the ability of the firm to use and mobilize IT resources along with other firm resources in order to improve the core performance mechanisms of the firm [30]. This section examined how IT capabilities affect the performance outcomes of SMEs in a dynamic environment.
Research methodology
This paper seeks to investigate the internal environment factors affecting performance of Small and Medium Enterprises in Kosovo. The purpose of this study is to examine the internal environment toward the performance of SMEs, considering the importance level of sector for the economy of Kosovo. Registered SMEs in Kosovo Business Registration Agency operating in three local governments, namely: Pristina, Ferizaj, Gjilan as shown on the Ministry of Trade and Industry, represents our target population. They are categorized in manufacturing, service and agricultural SMEs. To achieve objectives of the study, it is employed a cross-sectional study which the collected information are analyzed from each subject at a specific point in time. Based on general scientific guidelines for sample size developed by Krejcie & Morgan (1970) as cited in [31], the recommended sample size for this study was 379.
Questionnaire and data collected
In order to collect the data, it is developed a structured questionnaire mostly with yes/no and Likert Scale type of question. The questionnaire is composed in two sections. First section contains details of socio-demographic profile of the respondents. The second section of questionnaire contains the internal environment factors: managerial competencies and skills, access to finance and technological capabilities. Questionnaires were administered between 118 Technium Social Sciences Journal Vol. 11, 115-127, September 2020 ISSN: 2668-7798 www.techniumscience.com 10th January 2020 and 10th March 2020 on SMEs from selected local governments through online survey using emails. Random sampling technique employed to determine the eligible owners/managers to be questioned.
Reliability and validity
Reliability in quantitative research in the process of measuring a phenomenon concerns with repeatability, stability, and consistency of the results over the time. Based on a minimum internal consistency coefficient [32] [33], Cronbach Alpha Coefficient in the actual study is above .70 which shows that results are reliable. However, for a test to be reliable, it also needs to be valid [34]. Validity in quantitative research explains how well the collected data covers the actual area of investigation [35]. It is also meaning a "measure of what is intended to be measured" [36]. To improve our survey results, we used pre-testing method of Schindler & Cooper [37]. To validate the appropriateness of the questionnaire, pre-tests were performed with a group of relevant experts and as a result no major concerns were experienced or observed, thus paving the way for data to be collected as planned.
Data analysis
After taking the online results, data collected then imported to SPSS 25.0 version for analysis. The Demographic details are descriptive and are presented in tables and graphics. For continuous variables we used means (standard deviation), for categorical variables we used percentage. In order to find the significant factors relating the business performance its employed Chi-squared test of association. The majority of statistical tests were conducted A two-sided test its used employed at the significance level of 0.05 to conduct statistical tests. Considering that p-values in this study were reported to be less than 0.05, results are considered statistically significant.
Results and discussion
The presentation of results comprises in four parts. First, we summarize the socio-demographic profile of the respondents, showing the gender, job position and the level of education completed by owners/managers of relevant SMEs, and other company profile details. In the second part we present managerial competency and skills to further analyse the company practices in the context of operational activities. We also present results of challenges and impact in accessing finance in the context of business growth. The last part of results elaborates the impact of technological capabilities toward improving business performance of surveyed SMEs. Questionnaire was emailed to 379 SME owner/managers through online survey, resulting in 94 returns. The response rate was 24.8%. Majority of the participants (owners/managers) were males, which shows the dominance of SME ownership by males. According to Riinvest Institute [38] over 80 percent of women are inactive in the labour market, while only ten percent of the country's active businesses are owned by women. Our findings show an increase rate of women in business activities mostly oriented towards services and trade, particularly beauty and hairdressing. The average age of the participants was found to be 32 year, thus, reflecting the average working population of Kosovo according to 2011 census which is 30,2 years. A well-trained labour force could be a comparative advantage and a key resource for economic growth [39].
More than a half (50%) of participants had tertiary educational preparation, while the rest had vocational or secondary education. Many authors and scholars have found a positive impact between education of SME owners and performance of SMEs [40] [41][42] [43]. However, owner/managers need to seek knowledge in relate with their businesses, on the contrary education may not assist performance [44]. But still, higher education preparation of owner/managers is considered to provide a significant performance advantage for SMEs. All of the surveyed SMEs are registered business with a legal status. Given the fact that mostly of SME owners perform many roles our majority of the participants were both manager and owner. Regarding the legal status, recently in Kosovo it is seem more appropriate for SME owner/managers to choose the legal form of Limited Liability Company (56%), while the Individual Business form was option for about 1/3 of participants. However, Kosovo still continue to have large informal sector which is estimated at around 30% of GDP [45], and as a result creates unfair competition and weakens labor rights. Although, informal SMEs can be a significant source of job creation, it is considered that the formalization of SMEs is often associated with better performance [46] With a low level of industry as a developing country, Kosovo as the most important sector have services and industry, a fact that was emphasized in the survey results. The structural stretch of surveyed SMEs was mostly service-oriented (71%) and manufacturing oriented (25%), while agricultural stands at 3%. More than two-third of surveyed SMEs employ 1-10 people, which is in line with the Kosovo Government [47] definition criteria for MSMEs.
The majority of surveyed SMEs are in business for less than five years, indicating that Kosovo SMEs remain in the embryonic phase, which is 3-5 years since start-up, lacking growth. An empirical study conducted in 956 Croatian food industry businesses found a negative impact between firm age and business performance, stating that their accumulated knowledge in all crucial aspects of the business become overcome with their inertia, inflexibility and osseous by accumulated rules, routines and organizational structure [48]. Respondents were asked to indicate whether their SME performance is improved, worsened or unchanged in the past year in comparison to the previous year. As Table 2 summarize, 50% of participants indicated that their performance has improved, whilst more than 80% of them stated that running an SME was more difficult in the past year in comparison to the previous year.
Managerial competencies and skills
Regarding the experience of owner/managers in the relevant type of business, majority of them indicate that they have relevant experience (63%), while more than a half (30%) of them lack prior experience in managing SME. More than two-third of SME owner/managers are not engaged in formal training regarding business management activities and marketing, showing more difficultness level in running their businesses. The lack of training in business functions of SME owner/managers through empirical studies it's proved to have a negative impact in the business performance and growth [49]. In Kosovo, a majority of SME owners lack financial and planning skills which indicates directly on the performance indicators like effectiveness and goal achievement, firm growth, employment growth in long-term periods. As it stated above, most of the participants were found to have lack of skills in analyzing and preparing financial statements and cash flow forecasts. This situation is driven by the lack of training in relevant fields of SME owner/managers and low monthly fees of accountants' firms. Influenced by the current situation, more than 70% of surveyed SME owner/managers are forced to take services from external sources. The survey response reflects that majority (76%) of the SMEs outsource business functions, with accountancy and IT services being the most outsourced functions.
Access to finance
In Kosovo, access to SME finance remains a major obstacle to the survival and growth of this sector. This is confirmed by two-thirds (74%) of the surveyed owners / managers, emphasizing that access to finance is a great challenge to grow their business. With the increasing need for investment and development which was driven by the formalization of the micro-enterprise sector in particular which represents 97% of the entire private sector, created the continuing need for external financing (41%), mostly on loans, relatives and other sources of financing. Banks in Kosovo have restricted access to finance for the micro-enterprise sector through requirements for high collateral, business turnover and age, indicating difficulties (55%) in accessing external finance for surveyed businesses. The sector of new micro-enterprises has more difficulties in accessing finance, which as a result of lack of skills in the field of business planning, financial record keeping, growth management and low awareness have created a barrier to borrow with lower collateral requirements. This indicates a blockade of more than 93% of the total enterprises in private sector by banks in Kosovo, challenging the microfinance sector with limited funding sources to meet the growing demand of micro-enterprises.
Technological capabilities
The majority of respondent's state that they are interested and willing to invest in the technology of their firms. More than 90% of respondents point out that technology helps them improve performance. As awareness grows, they have realized that investments in technology contribute to increased performance and competition against other firms especially against the informal sector which has the main advantage of price. However, most respondents noted the difficulties they face during the digital transformation of their firms. The main barriers that challenged the surveyed businesses were more of a financial nature and lack of expertise and knowledge in the field of IT. Based on this approach, we note that the surveyed enterprises want to embrace the integration of technology but have not yet developed any concrete strategy or action plan on how to do it.
The contribution of this research can be seen in two contexts, practical and scientific, with a dynamic approach which covers only the impact of internal factors as a whole, and their impact on the performance of SMEs.
The impact of factors such as managerial skills and competencies requires a further and detailed study especially for the micro enterprise sector in the terms of growth and development, considering their significant impact on performance of the SMEs, which is found to be also related to other factors such as access to finance and technological skills. The factors examined in the study were grouped into three groups -managerial skills and competencies, access to finance and technological capabilities. This study confirms that all internal factors -managerial skills and competencies, access to finance and technological capabilities, depending on a period, have a significant impact on the performance of SMEs. Lack of training and experience in relevant important business activities was a negative indicator of business performance, making it difficult to run a business. Access to finance is considered a major challenge for businesses, especially for microenterprises which in the absence of skills in the field of business planning, financial record keeping, and growth management created barriers to respond to the requirements and procedures of financial institutions. Based on results, the majority of respondents considered technological capabilities as the main indicator for improving performance. Struggling to meet their costumer expectations, they see technology as their savior. However, the lack of IT skills and expertise, the lack of concrete action plan and strategy, and the associated costs limited the utilization of its technological capabilities.
The study has its own limitations. The first is poor response rate of the selected SME (24.8%), which could be due to time factor to complete the survey, and by the inadequacy of respondents to complete an online survey. The second limitation in this study was that the survey was conducted only in three regions of Kosovo and does not represent the sample of all Kosovo SMEs. Another limitation of this study is that performance appraisal is only analyzed within the framework of internal factors, excluding product innovation, organizational features of autonomy, market roles, and type/importance of goals. Examining the impact of these factors would strengthen the research results. However, performance measurement can be completed by adding the influence of external factors in Kosovo SME sector, a study which would be necessary in future academic research.
Table 1 .
1Definition of SMEs in Republic of KosovoEU definition
Kosovo
definition
Micro
< 10 employees,
turnover or balance
sheet total ≤ EUR 2 m
< 10
employees
Small
< 50 employees,
turnover or balance
sheet total ≤ EUR 10 m
< 50
employees
Medium
< 250 employees,
turnover or balance
sheet total ≤ EUR 43 m
< 250
employees
Table 2 .
2Socio-Demographic profile of the RespondentCategory
N Percentage
Gender
Male
71
75.53
Female
23
24.47
Job Position
Owner
58
61.70
Manager
21
22.34
Both
11
11.70
119
Table 3 .
3Background information of the participated SMEsCategory
N Percentage
Legal status of your business
Individual Business
31
32.97
General partnership
7
7.44
Limited liability company
53
56.38
Joint stock company
1
1.06
Foreign company
2
2.12
Sector of your business
Agriculture
3
3.1
Services
67
71.27
Manufacturing
24
25.5
How many people you employ?
Less than 10
79
85.1
11-49
11
11.7
50-249
2
2.12
Over 250
1
1.06
How long has your enterprise been in this
business?
Less than 3 years
32
34.04
3-5 years
40
42.55
5-10 years
7
7.44
120
Table 4 .
4Summary of accessing managerial skills of the participated SMEs121
Table 5 .
5Summary of accessing finance of the participated SMEs Category N Percentage Access to finance is a major challenge that affects the growth of my businessStrongly disagree
7
7.44
Disagree
16
17.02
Agree
26
27.65
Strongly agree
45
47.87
What financing methods you use to
finance your business?
Existing cash
56
59.57
Bank loans
21
22.34
Relatives
13
13.82
Other
4
4.25
Does your business experience
difficulties in accessing external
finance?
Yes
52
55.32
No
42
44.68
T S Hatten, Small Business Management: Entrepreneurship and Beyond (5 th ed.). Mason: South-Western Cengage Learning. T.S. HATTEN: Small Business Management: Entrepreneurship and Beyond (5 th ed.). Mason: South-Western Cengage Learning, (2011)
Report of the Committee of Enquiry on small firms. J E Bolton, Cmnd. 4811. London: HMSOBolton ReportJ.E. BOLTON: Report of the Committee of Enquiry on small firms. Bolton Report Cmnd. 4811. London: HMSO (1971).
S Carter, D Jones-Evans, Enterprise and Small Business: Principles, Practice and Policy. HarlowPrentice Hallnd ed.S. CARTER, D. JONES-EVANS: Enterprise and Small Business: Principles, Practice and Policy (2 nd ed.).Harlow: Prentice Hall. (2006)
. European Commission: Sba, Factsheet, EUROPEAN COMMISSION: SBA Factsheet: Kosovo. Accessed May 2020, https://ec.europa.eu/neighbourhood-enlargement/sites/near/files/sba-fs- 2019_kosovo.pdf
Oecd/Etf/Eu/Ebrd, 10.1787/g2g9fa9a-enSME Policy Index: Western Balkans and Turkey 2019: Assessing the Implementation of the Small Business Act for Europe, SME Policy Index. ParisOECD PublishingOECD/ETF/EU/EBRD (2019), SME Policy Index: Western Balkans and Turkey 2019: Assessing the Implementation of the Small Business Act for Europe, SME Policy Index, OECD Publishing, Paris. https://doi.org/10.1787/g2g9fa9a-en
. MINISTRY OF TRADE INDUSTRY: Brief on Trade in Services. MINISTRY OF TRADE INDUSTRY: Brief on Trade in Services 2018. Pristina (2019).
. Accessed, Accessed April 2020. https://mti.rks-gov.net/desk/inc/media/7593CC1B-475F- 4E0E-B130-B3A58AED5ECB.pdf
Impact of internal and external factors on the performance of fastgrowing small and medium businesses. D Dragnic, Management -Journal of Contemporary Management Issues. 191D. DRAGNIC: Impact of internal and external factors on the performance of fast- growing small and medium businesses. Management -Journal of Contemporary Management Issues, 19(1), pp. 119-159. (2019)
New Venture Creation: Entrepreneurship for the 21st Century. J A Timmons, McGraw-Hill EducationBostonJ.A. TIMMONS: New Venture Creation: Entrepreneurship for the 21st Century. Boston: McGraw-Hill Education. (2003)
A Gilmore, D Carson & K, Grant, SME marketing in practice. Marketing Intelligence & Planning. 19A. GILMORE, D. CARSON & K. GRANT: SME marketing in practice. Marketing Intelligence & Planning, 19 (1), 6-11. (2001)
GARWE: Obstacles to the growth of new SMEs in South Africa: a principal component analysis approach. O Fatoki, D , African Journal of Business Management. 45O. FATOKI, D. GARWE: Obstacles to the growth of new SMEs in South Africa: a principal component analysis approach, African Journal of Business Management, 4 (5), pp. 729-738. (2010)
Determinants of managerial competencies in the public health sector. C Nirachon, S Mohamad-Yzam, M S Faridahwati, Proceedings of the International Conference in Penang. the International Conference in PenangMalaysia; PenangAsian Academy of Management and School of Management, University Sains MalaysiaC. NIRACHON, S. MOHAMAD-YZAM, M.S. FARIDAHWATI: Determinants of managerial competencies in the public health sector. Proceedings of the International Conference in Penang, Malaysia, Asian Academy of Management and School of Management, University Sains Malaysia, Penang, 2007.
Entrepreneurial competencies: A literature review and development agenda. S Mitchelmore, J Rowley, International Journal of Entrepreneurial Behaviour and Research. 16S. MITCHELMORE, J. ROWLEY: Entrepreneurial competencies: A literature review and development agenda. International Journal of Entrepreneurial Behaviour and Research, 16, 92-111. (2010)
Literature Review on Small and Medium Enterprises' Access to Credit and Support in South Africa. National Credit Regulator (NCR), Underhill Corporate Solutions (UCS). E Mahembe, E. MAHEMBE: Literature Review on Small and Medium Enterprises' Access to Credit and Support in South Africa. National Credit Regulator (NCR), Underhill Corporate Solutions (UCS), December 2011.
The competitiveness of small and medium enterprises a conceptualization with focus on entrepreneurial competencies. W Y Man, L Thomas, K F Theresa, Chan, Journal of Business Venturing. 17MAN, W.Y. THOMAS, L. THERESA, K.F. CHAN: The competitiveness of small and medium enterprises a conceptualization with focus on entrepreneurial competencies. Journal of Business Venturing. 17, 123-142. (2002)
Defining business decline, failure and turnaround: a content analysis. M Pretorius, South African Journal Entrepreneurship and Small Business Management. 21M. PRETORIUS: Defining business decline, failure and turnaround: a content analysis. South African Journal Entrepreneurship and Small Business Management, 2(1): 1-16. (2009)
Differing perceptions of new venture failure: A matched exploratory study of venture capitalists and entrepreneurs. A L Zacharakis, G D Meyer, J De, Castro, Journal of Small Business Management. 373A.L. ZACHARAKIS, G.D. MEYER, J. DE CASTRO: Differing perceptions of new venture failure: A matched exploratory study of venture capitalists and entrepreneurs. Journal of Small Business Management, 37(3), 1-14. (1999)
The nature of entrepreneurial experience, business failure and comparative optimism. D Ucbasarab, P Westhead, M Wright, M Flores, Journal of Business Venturing. 25D. UCBASARAB, P. WESTHEAD, M. WRIGHT, M. FLORES: The nature of entrepreneurial experience, business failure and comparative optimism, Journal of Business Venturing, 25, 541-555. (2010)
HONING: The role of social and human capital among nascent entrepreneurs. P Davidsson, B , Journal of Business Venturing. 183P. DAVIDSSON, B. HONING: The role of social and human capital among nascent entrepreneurs. Journal of Business Venturing 18(3), 301-331. (2003)
Causes of small business failure in Uganda: A case study from Bushenyi and Mbarara towns. C Tushabonwe-Kazooba, African Studies Quarterly. 84C. TUSHABONWE-KAZOOBA: Causes of small business failure in Uganda: A case study from Bushenyi and Mbarara towns. African Studies Quarterly, 8(4), 27-35. (2006)
Determinants of small business growth constraints in a Sub-Saharan African economy. SAM Advanced Management Journal, 72. J O Okpara, P Wynn, J.O. OKPARA, P. WYNN: Determinants of small business growth constraints in a Sub-Saharan African economy. SAM Advanced Management Journal, 72.2007, 24-35. (2007)
Effects of global risk in transition countries. E Bajqinca, The Challenges of Financing Small and Medium Enterprises in Kosovo. 3University of Haxhi ZekaE. BAJQINCA: The Challenges of Financing Small and Medium Enterprises in Kosovo. Conference: `Effects of global risk in transition countries`, University of Haxhi Zeka, At Peja, 3(3). pp. 65-74. (2015)
MAKSIMOVIC: Bank competition and access to finance: international evidence. T Beck, A Demirguc-Kunt, V , J Money Credit Bank. 36T. BECK, A. DEMIRGUC-KUNT, V. MAKSIMOVIC: Bank competition and access to finance: international evidence. J Money Credit Bank, 36:627-648. (2004)
Business plan in bank-decision making when financing new ventures in South Africa. M Pretorius, G Shaw, South African Journal of Economics and Management Science. 72M. PRETORIUS, G. SHAW: Business plan in bank-decision making when financing new ventures in South Africa. South African Journal of Economics and Management Science, 7 (2), pp. 221-242. (2004)
Assessment of financing needs of SMEs in the Western Balkans countries. European, Bank, Kosovo. Zurich, SwitzerlandCountry ReportEUROPEAN INVESTMENT BANK: "Assessment of financing needs of SMEs in the Western Balkans countries". Country Report: Kosovo. Zurich, Switzerland. (2016)
On the contingent value of IT-based capabilities for the competitive advantage of SMEs: Mechanisms and empirical evidence. P Neirotti, E Raguseo, Information & Management. 542P. NEIROTTI, E. RAGUSEO: On the contingent value of IT-based capabilities for the competitive advantage of SMEs: Mechanisms and empirical evidence. Information & Management, 54(2), 139-153. (2017).
. Accessed, 10.1016/j.im.2016.05.004Accessed May 2020, https://doi.org/10.1016/j.im.2016.05.004
IT-enabled knowledge management for the competitive performance of manufacturing SMEs: An absorptive capacity-based view. Knowledge and Process Management. L Raymond, F Bergeron, A M Croteau, J St-Pierre, 10.1002/kpm.150323L. RAYMOND, F. BERGERON, A.M. CROTEAU, J. ST-PIERRE: IT-enabled knowledge management for the competitive performance of manufacturing SMEs: An absorptive capacity-based view. Knowledge and Process Management, 23(2), 110-123. (2016). Accessed May 2020, https://doi.org/10.1002/kpm.1503
ECIKS: Supporting Kosovo Growth: The role of the ICT sector. sectors%20for%20generatin g%20economic%20growth.&text=In%20fact%2C%20the%20ICT%20sector,existing %20companies%20export%20their%20servicesECIKS: Supporting Kosovo Growth: The role of the ICT sector, February 2020, accessed May 2020, https://eciks.com/supporting-kosovo-growth-the-role-of-the-ict- sector/#:~:text=The%20ICT%20sector%20in%20Kosovo,sectors%20for%20generatin g%20economic%20growth.&text=In%20fact%2C%20the%20ICT%20sector,existing %20companies%20export%20their%20services.
Digitalization of Business in Kosovo: -Status quo, challenges and opportunities. Kosovo Chamber Of, Commerce, PristinaKOSOVO CHAMBER OF COMMERCE: Digitalization of Business in Kosovo: - Status quo, challenges and opportunities. Pristina 2019. Accessed May 2020, https://www.oek- kcc.org/uploads/files/2020/June/30/Digitalization_of_Businesses_in_Kosovo1593526 670.pdf
Sustaining innovation performance in SMEs: Exploring the roles of strategic entrepreneurship and IT capabilities. M Lyver, T J Lu, Sustainability. 102442M. LYVER, T.J. LU: Sustaining innovation performance in SMEs: Exploring the roles of strategic entrepreneurship and IT capabilities. Sustainability, 10(2), 442. (2018).
. Accessed, 10.3390/su10020442Accessed May 2020, https://doi.org/10.3390/su10020442
A resource-based perspective on information technology capability and firm performance: An empirical investigation. A Bhardwaj, Management Information Systems Quarterly. 241A. BHARDWAJ: A resource-based perspective on information technology capability and firm performance: An empirical investigation. Management Information Systems Quarterly, 24(1), 169-196. (2000).
. Accessed, 10.2307/3250983Accessed May 2020 https://doi.org/10.2307/3250983
Research methods for business: A skill building approach. U Sekaran, R Bougie, John Wiley & Sons LtdUK5th ed. West SussexU. SEKARAN, R. BOUGIE: Research methods for business: A skill building approach. 5th ed. West Sussex, UK: John Wiley & Sons Ltd. (2010)
B E Whitley, Principals of Research and Behavioural Science. Boston, McGraw-HillB.E. WHITLEY: Principals of Research and Behavioural Science, Boston, McGraw- Hill. (2002)
J Robinson, Triandis theory of interpersonal behaviour in understanding software privace behaviour in the South African context. Masters degree. University of the Witwatersrand.J. ROBINSON: Triandis theory of interpersonal behaviour in understanding software privace behaviour in the South African context. Masters degree, University of the Witwatersrand. (2009)
Essentials of business research: a guide to doing your research project. J Wilson, SAGE PublicationJ. WILSON: Essentials of business research: a guide to doing your research project. SAGE Publication. (2010)
P Ghauri, K Gronhaug, Research Methods in Business Studies. Harlow, FT. Prentice HallP. GHAURI, K. GRONHAUG: Research Methods in Business Studies. Harlow, FT/Prentice Hall. (2005)
A P Field, Discovering Statistics Using SPSS. Sage Publications IncA.P. FIELD: Discovering Statistics Using SPSS. Sage Publications Inc. (2005)
. P S Schindler, R D Cooper, Business Research Methods. United States. McGraw-Hill IrwinP.S. SCHINDLER, R.D. COOPER: Business Research Methods. United States: McGraw-Hill Irwin. (2006)
Women's Entrepreneurship: An analysis in Doing Business in Kosovo. Riinvest Institute, RIINVEST INSTITUTE: Women's Entrepreneurship: An analysis in Doing Business in Kosovo. Pristina 2017. pp.7. Accessed April 2020.
. Technium Social Sciences Journal. 11https://www.riinvestinstitute.org/uploads/files/2017/November/10/Womens_Entrepren eurship1510307815.pdf Technium Social Sciences Journal Vol. 11, 115-127, September 2020 ISSN: 2668-7798
An overview of the World Bank's work in Kosovo. Country Snapshot. The, Bank In, Kosovo, THE WORLD BANK IN KOSOVO: An overview of the World Bank's work in Kosovo. Country Snapshot 2019. Accessed April 2020.
The role of education and self-employment success in Finland. A Kangasharju, S Pekkala, Growth and Change. 33A. KANGASHARJU, S. PEKKALA: The role of education and self-employment success in Finland. Growth and Change. 33:216-237. (2002)
Intellectual capital and business start-up success. I Pena, Journal of Intellectual Capital. 32I. PENA: Intellectual capital and business start-up success. Journal of Intellectual Capital. 3 (2):180-198. (2002)
Access to debt capital for women-and minority-owned small firms: Does educational attainment have an impact?. S Coleman, Journal of Developmental Entrepreneurship. 92S. COLEMAN: Access to debt capital for women-and minority-owned small firms: Does educational attainment have an impact? Journal of Developmental Entrepreneurship. 9 (2):127-143. (2004)
CHAMI: Growth determinants of micro-businesses in Canada: Canada's Business and Consumer Site. E Papadaki, B , E. PAPADAKI, B. CHAMI: Growth determinants of micro-businesses in Canada: Canada's Business and Consumer Site. (2002)
MOWL: Expatriate-owned small businesses: Measuring and accounting for success. T Blackwood, G , International Small Business Journal. 183T. BLACKWOOD, G. MOWL: Expatriate-owned small businesses: Measuring and accounting for success. International Small Business Journal 18 (3):60-73. (2002)
. European Commision, Report. P. 47EUROPEAN COMMISION: Kosovo 2019 Report. P.47. Accessed May 2020. https://ec.europa.eu/neighbourhood-enlargement/sites/near/files/20190529-kosovo- report.pdf
SHLEIFER: Informality and Development. R Porta, A , Journal of Economic Perspectives. 283109R. LA PORTA, A. SHLEIFER: Informality and Development. Journal of Economic Perspectives, 28(3), 109. (2014)
. Kosovo Government: Strategy, Development In Kosovo, 2020KOSOVO GOVERNMENT: Strategy for SME development in Kosovo: 2012-2016: vision 2020. (2011)
The Influence of Age on Firm Performance: Evidence from the Croatian Food Industry. M Pervan, I Pervan, M Ćurak, Research Article. IBIMA Publishing Journal of Eastern Europe Research in Business and Economics. 20171M. PERVAN, I. PERVAN, M. ĆURAK: The Influence of Age on Firm Performance: Evidence from the Croatian Food Industry. Research Article. IBIMA Publishing Journal of Eastern Europe Research in Business and Economics. Accessed May 2020. http://www.ibimapublishing.com/journals/JEERBE/jeerbe.html Vol. 2017, p.1
DEPARTMENT FOR BUSINESS INNOVATION AND SKILLS: Leadership and Management Skills in SMEs: Measuring Associations with Management Practices and Performance. BIS No. London1DEPARTMENT FOR BUSINESS INNOVATION AND SKILLS: Leadership and Management Skills in SMEs: Measuring Associations with Management Practices and Performance. BIS No.211 Vol. 1. London 2015. Accessed May 2020. https://assets.publishing.service.gov.uk/government/uploads/system/uploads/attachme nt_data/file/407624/BIS-15-95_Leadership_and_Management_Skills_in_SMEs.pdf
Official Gazette of the Republic of Kosova. Republic, Kosovo, Law No. 04/L-220 on Foreign Investment. REPUBLIC OF KOSOVO: Law No. 04/L-220 on Foreign Investment, Official Gazette of the Republic of Kosova 2014, https://mti.rks- gov.net/desk/inc/media/1916AE1F-48E8-451D-A328-CA350EC4D7D2.pdf.
| Business Strategy and Performance of Small and Medium Manufacturing Firms: Evidence from Saudi Arabia |
Introduction
Small and Medium Enterprises (SMEs) are a market share that is one of the economic drivers in Indonesia. SMEs have an essential role and are a driver of economic growth in some countries (Huang, Lai, Lin, and Chen, 2013) and (Hsu, Chang, and Luo, 2017). The existence of small and medium enterprises is a spirit of entrepreneurial spirit that is large in most people and can support the economy of a country. Small and Medium Enterprises (SMEs) are defined by Law Number 20 of 2008 concerning Micro Enterprises as a standalone productive economic business operated by people or business entities that are not subsidiaries or branches of companies that are owned, controlled, or become either directly or indirectly a part of large businesses. Small and Medium Enterprises (SMEs) were initiated and started from the lower level. They turned out to play a significant role in efforts to develop and improve the economy in Indonesia.
For SMEs to continue to be able to contribute to the economy in Indonesia, SMEs need to grow. Business growth includes an increase in the number of turnover and an increase in the number of employees, which means that if a business grows, its sales also increase, resulting in the company needing more employees. Attempt to make a SMEs can grow, so the competitiveness of SMEs needs to be developed. Several factors can affect the growth of SMEs to increase this competitiveness, so SMEs are required to innovate their business models to still compete with competitors out there. The company's ability to innovate a business classified as a creative industry can positively influence the success of a product made or sold by SMEs. SMEs that have learned to improve their innovation capabilities can increase growth in their business. To remain competitive, SMEs must innovate their business models continuously (Achtenhagen, Melin, and Naldi, 2013). Because the needs of consumers are increasingly diverse, businesses must also offer quality services so that consumers can feel comfortable. In addition to BMI, customer trust and commitment are essential factors in determining the business's success. By increasing trust and commitment to customers, the company can achieve customer commitment and achieve customer commitment so that word-of-mouth communication can be created. The purpose of the company producing goods or services is to increase trust in customers, achieve customer commitment and establish long-term relationships between the company and customers.
The practice of continuously changing a business model as it is being developed or modified is known as "business model innovation.". This update to business model innovation focuses on optimizing and reengineering complex resources. The company uses business model innovations to generate more profits. One of the factors that set business model innovation apart from business model is the efficacy of this business model innovation as evidenced from the output. According to (Björkdahl and Holmén, 2013), Planning and implementing a business model by coming up with a novel configuration involves business model innovation. The organization's job in business model innovation is to modify the business model to gain competitive advantages, such as by raising the standard of customer service or competing on alternative terms (Boons and Lüdeke-Freund, 2013). The notion of business model innovation offers clients goods or services that weren't previously possible under the company model. The concept of "business model innovation" modifies one or more aspects of the business model, resulting in a new arrangement of the developed and executed pieces.
Business model innovation is different from product innovation or teece process innovation which involves changes to the activity system or the company's operations. Meanwhile, business model innovation is the process of designing something new or modifying the plan of activities that still exist in the company (Amit and Zott, 2010). However, business model innovation can represent an opportunity to innovate products (Kastalli and Van Looy, 2013) because business model innovation and product innovation are a process to create and provide value that companies follow to compete for the success of new products (Evanschitzky, Eisend, Calantone, & Jiang, 2012). Because when business model innovation becomes innovative, it will benefit customers, such as new solutions that can show the advantages of their products in customers' eyes (Velu, 2015).
According to (Durmaz & İlhan, 2015) business growth is essential for every business or company to survive and develop. So that the business or company must innovate on the product and innovate the process to keep pace with other businesses or companies, growth can be seen through the quantitative and qualitative sides. Quantitative growth is an increase in the amount of output in the form of sales revenue, sales amount, type of product, and human resources (capital and employees). Meanwhile, qualitative growth is the development of the quality of business elements such as marketing planning, production planning, financial planning, and HR planning.
Therefore, it is possible in this study that business model innovation affects SMEs' development. Because it enables SMEs to promote their goods and resources in a distinctive way, these unique ways can be done by SMEs with innovative business models, so they can The Effect of Business Model Innovation, Customer Trust and Commitment on SME Business Growth work better than SMEs that do not have innovative business models. Companies that innovate will be able to respond to the wishes of potential customers quickly (Rangus & Slavec, 2017).
Based on the description above, the first hypothesis in this study is H1 = Business model innovation positively and significantly impacts SME's business growth.
Customer trust is a crucial route through which the development of new business models helps the organization flourish. Business model innovation can create value for customers by increasing trust in customers and potential customers. Customer trust is earned through business model innovations that drive the growth of SMEs. As long as transaction costs are kept to a minimum and transaction value is maximized, customer trust can enable the exchange of resources. (Rangus & Slavec, 2017). (Eggers et al., 2013) say that SMEs will be trusted if they get customers' trust with higher growth. Companies must have the ability to build trust in their customers.
Based on the description above, the second hypothesis in this study is H2 = Business model innovation has a positive and significant effect on SME's business growth through customer trust as a mediating variable.
Customer commitment is a means by which business model innovation affects the expansion of SMEs. By encouraging links between supplier chains, SMEs, and customers, business model innovation can raise customer loyalty. Innovation in company models will spur customer loyalty, which will help SMEs expand. depending on their willingness to share their expertise in order to combine their knowledge. SMEs can set a strategy for the growth of customer demand so that it can affect the development of SMEs.
Based on the description above, the third hypothesis in this study is H3 = Business model innovation has a positive and significant effect on SME's business growth through customer commitment as a mediating variable.
Picture 1. Frame of Mind
Innovation in Business Models (X) When creating or changing business models, the process known as "business model innovation" takes place continuously. This update to business model innovation focuses on optimizing and reengineering complex resources. The company uses business model innovations to generate more profits. The effectiveness of this business model innovation is seen from the output as one of the distinguishing characteristics between business model innovation and business model. According to (Björkdahl & Holmén, 2013) business model innovation requires planning and implementing a business model by creating a new configuration. The organization's job in business model innovation is to modify the business model to gain competitive advantages, such as by raising the standard of customer service or competing on alternative terms (Boons & Lüdeke-Freund, 2013). Customers may now choose from a variety of goods and services that weren't previously offered by the business model thanks to the business model innovation idea. The concept of business model innovation modifies one or more aspects of the business model, resulting in a new arrangement of the developed and executed pieces.
Previous research by (Chen, Liu, and Wang, 2020) with the title Social exchange perspective on business model innovation and growth of manufacturing SMEs. According to the study's findings, SMEs in the manufacturing sector are growing faster as a result of business model innovation. Additionally, the indirect impact of innovative business models on consumer loyalty and trust also contributes to development.
The difference between this study and the previous research is that the population and sample used in the research conducted by (Chen, Liu, and Wang, 2020) While in this study the population and sample used were UKM Center for Crafts in Bantul using 100 samples. The distinction also resides in the fact that business model innovation fosters SMEs' expansion in the manufacturing sector. Growth is furthermore accomplished through the indirect impact of company model innovation on client loyalty and trust. Although the findings of this study indicated that business model innovation had a favorable and significant impact on the growth of SMEs in the Bantul handicraft center. The results obtained from indirect growth through customer trust state that business model innovation through customer trust has a positive and insignificant effect on SME business growth. This means that the customer trust variable does not mediate the business model innovation variable on the SME business growth variable. This is because the data that has been collected has not succeeded in proving the relationship between the customer trust variable and the business model innovation variable and SME business growth. However, it does not mean that the customer trust variable does not affect the business model innovation variable and SME business growth, it's just that the sample data does not prove the relationship. The results obtained from indirect growth through customer commitment indicate that business model innovation through customer commitment has a positive and significant impact on SME business growth.
Seeing that SME handicrafts in Bantul have high potential in increasing sales to the international market, this research was made with the aim to explain the relationship between variables in the model. This research explains the innovation of business models, customer trust, and commitment to the growth of SMEs. (2) This research aims to develop previous research by (Vogels et al., 2021).
Research Method
The Bantul Handicraft Center's small and medium businesses (SMEs) were the subject of this study. The SME of the Bantul handcraft facility serves as the study's sample. This study uses non-probability sampling as its sampling technique. that is, a sampling technique that does not offer equal possibilities or opportunities for population members to be chosen to be sampled based on certain concerns. In contrast, this study's sample method employs the Purposive Sampling Technique, a technique with specific drawbacks (Sugiyono, 2016).
In this study, sampling was based on the minimum calculation result formula according to (Hair Jr, Black, Babin, Anderson, and Tatham, 2010), namely (Number of latent Variables + Number of indicators) x (Estimated parameters). This study's minimum number of samples was (4+15)x5 = 95 respondents. TheminimumThe minimum sample count in this study was 95 respondents. And to avoid questionnaires that do not return, the researcher will take a sample of 100 respondents.
The data analysis technique used in this study was using the Partial Least Square (PLS) Technique using SmartPLS 3.0 software. PLS-SEM analysis exists from two submodels, namely the measurement model or often referred to as the outer model, and the structural model or often referred to as, often referred as the external model, and the structural model or the inner model. Outer models or measurement models show how to manifest variables or observed variables present variables that are not visible but have the potential to appear or be measured. Meanwhile, the capital structure shows the strength of estimation between variables that are not visible but have the potential to emerge. There are two reasons why this study used PLS-SEM.
Results and Discussion
There are six questions related to the characteristics of respondents, namely gender, age, last education, length of service, length of time SMEs were established, and positions in SMEs. Based on the table above, it can be seen that the 100 respondents used in this study comprised 64% of male practice respondents and 36% of female respondents. The age of the 100 respondents used in this study comprised% of respondents aged < 30 years, 24% of respondents aged 30-40 years, 35% of respondents aged 41-50 years, and 29% of respondents aged > 50 years of n. The last education of the 100 respondents used in this study consisted of 10% of respondents who were least educated at the elementary level, 33% of respondents who were educated before the junior high school level, 46% of respondents who were least educated at the high school level, 7% of respondents who were educated last at the diploma level, and four respondents who were educated at the undergraduate level. The working period of the 100 respondents used in this study consisted of 16% of respondents who had worked < 5 years, 29% of respondents who had worked for 6-10 years, 25% of respondents who had worked for 11-15 years, 30% of respondents who had worked < for 15 years. The length of the SME was established; it is known that the 100 respondents used in this study consisted of 4% of respondents who worked in SMEs aged < 5 years, 22% of respondents who worked in SMEs old 5-9 years, 27% of respondents who worked in SMEs aged 10-15 years, 29% of respondents who worked in SMEs aged 16-20 years, and 18% of respondents working in SMEs who are > 20 years old. The positions of the 100 respondents in this study comprised 36% of respondents as owners and 64% as employees.
The description of the variables in this study uses the indicated mean to analyze the results of the respondents' answers to describe the respondents' perception of each variable consisting of business model innovation, customer trust, customer commitment, and SME business growth variables. SmartPLS analyzes the relationship between variables and indicators. (Ghozali and Latan, 2014) PLS-SEM analysis exists from two sub-models, namely the measurement model (measurement model) or often referred to as the outer model, and the structural model (structural model) or often referred to as the inner model. Outer models or measurement models show how to manifest variables or observed variables present variables that are not visible but have the potential to appear or be measured. Meanwhile, the Inner model or capital structure shows the strength of estimation between variables that are not visible but can occur.
Picture 1. Outer Model
Convergent validity is assessed by looking at the outer loading value of each indicator in each variable used in this study. The criteria used for convergent validity is outer loading > 0.7. We have seen this in Figure 2. All the indicators in this study above 0.7 are considered sufficient to qualify for the convergent validity test, so it can be concluded that every indicator used in this study is feasible or valid. Discriminant Validity is judged by looking at the value of the cross-loading factor indicator against the variable that has the most significant value compared to the value of the cross-loading factor indicator against other variables. Another method used to conduct validity tests in this study was to look at the average variance extracted (AVE) value. The AVE value for each variable must be > 0.5 to be declared valid. Table 3. It can be seen that the most significant cross-loading factor value is found in the construct formed. So it can be concluded that this study's indicators meet the discriminant validity requirements. Table 4. It can be seen that the AVE value on each variable is > 0.5, which means that every variable used in the study is valid. In addition to validity tests, PLS also conducts reliability tests to measure the internal consistency of measuring instruments. Reliability testing on PLS using composite reliability and Cronbach Alpha to strengthen reliability test results with composite reliability. Based on Table 5, it can be seen that the composite reliability value of all variables has a value of > 0.7 so that all constructs are declared reliable. Strengthen the reliability test results with composite reliability; it can be done by testing reliability by looking at the value of Cronbach's alpha. In Table 6, it can be seen that the Cronbach alpha value in all variables has a value of > 0.7, which means that all variables in this study can be declared reliable. The next stage is the analysis of the structure or inner model. Assessment based on R-Square is used to determine how much a dependent variable is affected by other variables. The higher the R-Square value, the better the prediction model in this research model will be. Based on the calculation results R 2 in Table 6, it is known that the business model innovation variable influences the customer trust variable by 65.1%, and the remaining 34.9% is influenced by variables not included in the research model. The effect of business model innovation on customer confidence of 0.651 falls into the moderate category. Furthermore, the customer commitment variable is influenced by the business model innovation variable of 72.9%, and the remaining 27.1% is controlled by variables that are not included in the research model. The effect of business model innovation on customer commitment of 0.729 is included in the strong category. Furthermore, the business growth variable is influenced by business model innovation variables, customer trust, and customer commitment of 64.5%. The remaining 44.5% is controlled by variables not included in the research model. The influence of business model innovation, customer trust, and customer commitment of 0.65.5 fall into the moderate category.
Hypothesis testing is carried out by looking at the value of probability and t-statistics of the relationship between variables. Significant value is obtained through the bootstrapping procedure. This test was carried out using smart PLS software. The probability value can be seen through the P-Value value with an alpha of 5%. The t-count value used was 1.66088. Based on the results of hypothesis testing in Table 4.7, it can be concluded that each relationship between the variables is as follows. H1: Business model innovation positively and significantly affects SME business growth. Based on Table 4. The 7 t-statistics values for the business model innovation variables against SME business growth were 2,343 > 1.66088 (t-table) and p-values of 0.000 < 0.05. The original value of the sample was positive at 0.278, which indicates that each direction of the relationship of the business model innovation variable to the growth of the SME business is positive. Thus, H1 in this study was accepted. This shows that business model innovation has a positive and significant effect on the growth of SME businesses. This means that the more effective the innovation of business models in SMEs, the higher the level of business growth in SMEs. This means that business model innovations in SMEs have functioned effectively in improving service quality and developing products with innovative ideas. H2: Business model innovation positively and significantly affects SME business growth through customer trust as a mediating variable. Based on Table 4. 7, the statistical tvalue for business model innovation variables to SME business growth through customer trust is 0.154 < 1.66088 (t-table) and p-value 0.439 > 0.05. The original value of the sample was positive at 0.015, which shows that each direction of the relationship of the business model innovation variable to the growth of the SME business through customer trust is positive. Thus, H2 in this study was rejected. This shows that business model innovation through customer trust has a positive and insignificant effect on the growth of SME businesses. This means that the customer trust variable does not mediate the business model innovation variable against the SME business growth variable. Because the data that has been collected has not succeeded in proving the relationship between customer trust variables and business model innovation variables, and SME business growth, however, this does not mean that the customer trust variable does not affect the variables of business model innovation and SME business growth, it's just that the sample data did not succeed in proving this relationship. H3: Business model innovation positively and significantly affects SME business growth through customer commitment as a mediating variable. According to Table 4. 7, the tstatistical value for the business model innovation variable to SME business growth through customer commitment is 1.858 > 1.66088 (t-table) and p-value 0.032 > 0.05. The original value of the sample was positive at 0.263, which shows that every direction of the relationship of business model innovation to the growth of the SME business through customer commitment is positive. Thus, H3 in this study was accepted. This shows that business model innovation through customer commitment has a positive and significant influence on the growth of the SME business. This means that the higher the commitment in the relationship between buyers and sellers, it can help easily find out the specific needs of potential customers and reduce all kinds of risks that aim to harm one of the parties.
Conclusion
Based on the research, it can be concluded that the SME batik center in Bantul is experiencing business growth because it has innovated business models through customer trust and commitment as a mediating variable. This statement is proven through the results of hypothesis testing, which shows that business model innovation is a variable affecting SME businesses' growth through customer trust and commitment as mediation variables. This study used Partial Least Square (PLS) to analyze the influence of the variables studied. Based on the results of testing and data analysis, as well as the discussion that has been described, it can be concluded as follows the results of the first hypothesis test show that business model innovation has a positive and significant effect on the growth of SME businesses. The results of the second hypothesis test show that business model innovation has a positive and insignificant effect on SME business growth through customer trust as a mediating variable. The results of the third hypothesis test show that business model innovation has a positive and significant effect on SME business growth through customer commitment as a mediating variable.
Table 1 .
1Characteristics of Respondent
Classification
Information
Sum
Percentage
Gender
Man
64
64%
Female
36
36%
Age
< 30 Year
12
12%
30-40 Year
24
24%
41-50 Year
35
35%
> 50 Year
29
29%
Recent Education
Elementary School
10
10%
Junior High School
33
33%
Senior High School
46
46%
Diploma (D1,D2,D3)
7
7%
Bachelor (S1,S2,S3)
4
4%
Service Life
< 5 Year
16
16%
6-10 Year
29
29%
11-15 Year
25
25%
< 15 Year
30
30%
Service Life
< 5 Year
4
4%
5-9 Year
22
22%
10-15 Year
27
27%
16-20 Year
29
29%
> 20 Year
18
18%
Service Life
Owner
36
36%
Employess
64
64%
Table 2 .
2Mean Variable
Variable
Mean
Category
Business Model innovation
4.057
High
Customer trust
4.465
Very High
Customer Commitment
4.326
Very High
Business Growth
3.90
High
Table 3 .
3Tcross-Loading Factor Indicator ItemConstruct
Business Model
Innovation
Customer
Trust
Customer
Commitment
Business
Growth
IMB 1
0.752
0.625
0.660
0.579
IMB 2
0.733
0.614
0.616
0.541
IMB 3
0.715
0.465
0.586
0.583
IMB 4
0.708
0.658
0.660
0.547
IMB 5
0.735
0.520
0.565
0.567
IMB 6
0.712
0.649
0.661
0.512
IMB 7
0.716
0.558
0.630
0.617
IMB 8
0.704
0.531
0,545
0.684
IMB 9
0.716
0.560
0.602
0.492
IMB 10
0.716
0.586
0.616
0.540
KCP 1
0.705
0.885
0.687
0.608
KCP 2
0.712
0.921
0.750
0.575
KCP 3
0.679
0.834
0.765
0.625
KCP 4
0.732
0.866
0.776
0.610
Table 4 .
4Average Variance Extracted (AVE)
Variable
AVE Criterion Description
Business Model innovation
0.520
> 0.5
Valid
Customer trust
0.769
> 0.5
Valid
Customer Commitment
0.612
> 0.5
Valid
Business Growth
0.627
> 0.5
Valid
Whereas in
Table 5 .
5Composite Reliability
Variable
Composite Reliability
Kriteria
Description
Business Model innovation
0.915
> 0.7
Valid
Customer trust
0.930
> 0.7
Valid
Customer Commitment
0.926
> 0.7
Valid
Business Growth
0.893
> 0.7
Valid
Table 6 .
6R-Square
Variable
R-Square R-Square Adjusted
Customer trust
0.651
0.648
Customer Commitment
0.729
0.726
Business Growth
0.645
0.634
Table 7 .
7Bootstrapping Calculation Result
Original
Sampel
(O)
Sample
Mean
(M)
Standard
Deviation
(STDEV)
T
Statistic
(| /
|
P-
Value
Decision
BMI→Business Growth
0.278
0.278
0.121
2.295
0.000 Accepted
BMI→Customer trust→
Business Growth
0.015
0.009
0.095
0.154
0.439 Rejected
BMI→Customer
Commitment→
Business Growth
0.263
0.272
0.142
1.858
0.032 Accepted
Shafira Firgynia Maharani, Zulian Yamit
The Effect of Business Model Innovation, Customer Trust and Commitment on SME Business Growth
Dynamics of Business Models -Strategizing, Critical Capabilities and Activities for Sustained Value Creation Paper forthcoming in: Long Range Planning. Leona Achtenhagen, Leif Melin, Lucia Naldi, 10.1016/j.lrp.2013.04.002Long Range Planning. 466Achtenhagen, Leona, Melin, Leif, & Naldi, Lucia. (2013). Dynamics of Business Models - Strategizing, Critical Capabilities and Activities for Sustained Value Creation Paper forthcoming in: Long Range Planning (2013). Long Range Planning, 46(6), 427-442. https://doi.org/10.1016/j.lrp.2013.04.002
Business model innovation: Creating value in times of change. Raphael Amit, Christoph Zott, 10.2139/ssrn.1701660Amit, Raphael, & Zott, Christoph. (2010). Business model innovation: Creating value in times of change. https://doi.org/10.2139/ssrn.1701660
Business model innovation-the challenges ahead. Joakim Björkdahl, Magnus Holmén, International Journal of Product Development. 183/4Björkdahl, Joakim, & Holmén, Magnus. (2013). Business model innovation-the challenges ahead. International Journal of Product Development, 18(3/4), 213-225.
Business models for sustainable innovation: state-of-the-art and steps towards a research agenda. Frank Boons, Florian Lüdeke-Freund, 10.1016/j.jclepro.2012.07.007Journal of Cleaner Production. 45Boons, Frank, & Lüdeke-Freund, Florian. (2013). Business models for sustainable innovation: state-of-the-art and steps towards a research agenda. Journal of Cleaner Production, 45, 9-19. https://doi.org/10.1016/j.jclepro.2012.07.007
Business model innovation and growth of manufacturing SMEs: a social exchange perspective. Jiawen Chen, Liu, Linlin, Yong Wang, 10.1108/JMTM-03-2020-0089Journal of Manufacturing Technology Management. Chen, Jiawen, Liu, Linlin, & Wang, Yong. (2020). Business model innovation and growth of manufacturing SMEs: a social exchange perspective. Journal of Manufacturing Technology Management. https://doi.org/10.1108/JMTM-03-2020-0089
Growth strategies in busynesses and a theoretical approach. Yakup Durmaz, Ahmet İlhan, 10.5539/ijbm.v10n4p210International Journal of Business and Management. 104Durmaz, Yakup, & İlhan, Ahmet. (2015). Growth strategies in busynesses and a theoretical approach. International Journal of Business and Management, 10(4), 210. https://doi.org/10.5539/ijbm.v10n4p210
The impact of brand authenticity on brand trust and SME growth: A CEO perspective. F Eggers, M O'dwyer, S Kraus, C Vallaster, S Güldenberg, 10.1016/j.jwb.2012.07.018Journal of World Business. 483Eggers, F., O'Dwyer, M., Kraus, S., Vallaster, C., & Güldenberg, S. (2013). The impact of brand authenticity on brand trust and SME growth: A CEO perspective. Journal of World Business, 48(3), 340-348. https://doi.org/10.1016/j.jwb.2012.07.018
Success factors of product innovation: An updated meta-analysis. Evanschitzky, Heiner, Eisend, Martin, Roger J Calantone, Yuanyuan Jiang, 10.1111/j.1540-5885.2012.00964.xJournal of Product Innovation Management. 29Evanschitzky, Heiner, Eisend, Martin, Calantone, Roger J., & Jiang, Yuanyuan. (2012). Success factors of product innovation: An updated meta-analysis. Journal of Product Innovation Management, 29, 21-37. https://doi.org/10.1111/j.1540-
Partial Least Squares konsep, metode dan Aplikasi menggunakan program WarpPLS 4.0. Semarang: Badan Penerbit Universitas Diponegoro. Imam Ghozali, Latan, Hengky, Ghozali, Imam, & Latan, Hengky. (2014). Partial Least Squares konsep, metode dan Aplikasi menggunakan program WarpPLS 4.0. Semarang: Badan Penerbit Universitas Diponegoro.
SEM: An introduction. Multivariate data analysis: A global perspective. Multivariate Data Analysis: A Global Perspective. Joseph F HairJr, Black, C William, Barry J Babin, Rolph E Anderson, R L Tatham, Hair Jr, Joseph F., Black, William C., Babin, Barry J., Anderson, Rolph E., & Tatham, R. L. (2010). SEM: An introduction. Multivariate data analysis: A global perspective. Multivariate Data Analysis: A Global Perspective, 629-686.
Identifying key performance factors for sustainability development of SMEs -integrating QFD and fuzzy MADM methods. Chih Hsu, Hung, An Chang, Yuan, Wei Luo, Journal of Cleaner Production. 161Hsu, Chih Hung, Chang, An Yuan, & Luo, Wei. (2017). Identifying key performance factors for sustainability development of SMEs -integrating QFD and fuzzy MADM methods. Journal of Cleaner Production, 161, 629-645.
. 10.1016/j.jclepro.2017.05.063https://doi.org/10.1016/j.jclepro.2017.05.063
Overcoming organizational inertia to strengthen business model innovation: An open innovation perspective. Hao Huang, Chen, Mei Lai, Chi, Lee Lin, Hsuan, Chien Chen, Tsai, Journal of Organizational Change Management. 266Huang, Hao Chen, Lai, Mei Chi, Lin, Lee Hsuan, & Chen, Chien Tsai. (2013). Overcoming organizational inertia to strengthen business model innovation: An open innovation perspective. Journal of Organizational Change Management, 26(6), 977-1002.
10.1108/JOCM-04-2012-0047The Effect of Business Model Innovation. The Effect of Business Model Innovation, Customer Trust and Commitment on SME Business Growth https://doi.org/10.1108/JOCM-04-2012-0047
Servitization: Disentangling the impact of service business model innovation on manufacturing firm performance. Ivanka Kastalli, Visnjic, Bart Van Looy, 10.1016/j.jom.2013.02.001Journal of Operations Management. 314Kastalli, Ivanka Visnjic, & Van Looy, Bart. (2013). Servitization: Disentangling the impact of service business model innovation on manufacturing firm performance. Journal of Operations Management, 31(4), 169-180. https://doi.org/10.1016/j.jom.2013.02.001
The interplay of decentralization, employee involvement and absorptive capacity on firms' innovation and business performance. Kaja Rangus, Alenka Slavec, Technological Forecasting and Social Change. 120Rangus, Kaja, & Slavec, Alenka. (2017). The interplay of decentralization, employee involvement and absorptive capacity on firms' innovation and business performance. Technological Forecasting and Social Change, 120, 195-203.
. 10.1016/j.techfore.2016.12.017https://doi.org/10.1016/j.techfore.2016.12.017
Metode kualitatif dan kuantitatif Cetakan ke-23. H Sugiyono, Alf. BandungSugiyono, H. (2016). Metode kualitatif dan kuantitatif Cetakan ke-23. Alf. Bandung.
Business model innovation and third-party alliance on the survival of new firms. Chander Velu, 35TechnovationVelu, Chander. (2015). Business model innovation and third-party alliance on the survival of new firms. Technovation, 35, 1-11.
. 10.1016/j.technovation.2014.09.007https://doi.org/10.1016/j.technovation.2014.09.007
SalivaDirect: A simplified and flexible platform to enhance SARS-CoV-2 testing capacity. Chantal B F Vogels, Anne E Watkins, Christina A Harden, Doug E Brackney, Jared Shafer, Wang, Jianhui, Caraballo, César, Kalinich, C Chaney, Isabel M Ott, Joseph R Fauver, 2Vogels, Chantal B. F., Watkins, Anne E., Harden, Christina A., Brackney, Doug E., Shafer, Jared, Wang, Jianhui, Caraballo, César, Kalinich, Chaney C., Ott, Isabel M., & Fauver, Joseph R. (2021). SalivaDirect: A simplified and flexible platform to enhance SARS-CoV-2 testing capacity. Med, 2(3), 263-280.
. 10.1016/j.medj.2020.12.010https://doi.org/10.1016/j.medj.2020.12.010
| This paper briefly introduces the connotations,features and external expressions of the core competitive power of the small and medium-sized enterprises,and starting from the analysis on the symptoms of the small and medium-sized enterprise,probes into the paths for building the core competitive power of he small and medium-sized enterprise from the strategic management,people-based concept,innovative ability,informatization,and corporate culture,etc. | A Thesis submitted in Partial fulfillment of the requirements for the Degree of Masters of Science in Agribusiness Management and Trade in the School of Agriculture of Kenyatta University. June 2016 |
Introduction
Entrepreneur is a risk taker that pursues a career in business. Entrepreneurs not only creates a career for him/herself, but also creates jobs for others. Successful entrepreneurs are able to increase per capita income of the local community and increase national income. Therefore, entrepreneurs are individuals who gather resources and create something new and different and add value through constructive ideas with the aim of increasing the wealth of individuals and develop them for the prosperity of society. Some scholars in entrepreneurship also provide their definition of a similar perspective. For example, Greene (2000), defines entrepreneurs as people who run their own businesses while Nor Aini Idris (2003) and Wim Naude (2010) consider the entrepreneurs as a group of businessmen and traders who are willing to take risks, always striving for innovation. They are smart and creative in getting how to increase wealth, power and social status. In Malaysia, Small and Medium Enterprises (SMEs) is among the most important sectors that contribute greatly to the economic growth of the country. The sector makes a big contribution to the national income. Therefore, the government should focus on attracting the indigenous communities to participate in SME sector. There are several agencies that assist Bumiputera entrepreneurs to come into business and become entrepreneurs in Malaysia. These include Majlis Amanah Rakyat (MARA), SME Bank, Perbadanan Nasional Berhad (PNS), Tabung Ekonomi Usaha Niaga (TEKUN), Bank Rakyat, Bank Pembangunan and UDA Holdings Bhd.
Viewed from the perspective of the problems, according to a study by Khairunnisa Mardzuki, Zaimah Darawi, Mohd Radzuan Rahid (2012), the indigenous rural community is often considered marginalized and lags behind in all aspects compared to the other groups. Hence, the Malaysians should take the initiative to make changes and drastic transformation of all aspects, especially, in terms of thinking and mentality to become entrepreneurs to enhance the strength and stability of the economy for a healthy competition with other nations and not to be left behind in the country's journey towards being high income country by 2020.
Che Mohd Zulkifli Che Omar, Nurdiana Mohd Nor Azmi
Factors Affecting the Success of Bumiputera Entrepreneurs in Small and Medium Enterprises (SMEs)
New SME Definition
There is a new definition to SMEs in Malaysia now. According to the official website of SME Corporation of Malaysia from January 1, 2014, more firms can be titled as SMEs when the new SME definition is effective. SME definition has been simplified as follows:
1. Manufacturing: Firms whose sales turnover doesn't exceed RM50 million or full-time employees 200 workers; 2. Services and other sectors: Firms whose sales turnover doesn't exceed RM20 million or full-time employees 75 workers. A business will be deemed as an SME if it meets either one of the two specified criteria. Details of the new definition are as follows:
• Microenterprises across all sectors: Sales turnover of less than RM 300, 000 or less than 5 full-time employees;
The table below shows the definition of small and medium categories based on the respective sectors.
Manufacturing
Sales turnover from RM300, 000 to less than RM15 million or full-time employees from 5 to less than 75.
Sales turnover from RM15 million to not exceeding RM50 million or full-time employees from 75 to not exceeding 200.
Services and other sectors
Sales turnover from RM300, 000 to less than RM3 million or fulltime employees from 5 to less than 30.
Sales turnover from RM3 million to not exceeding RM20 million or full-time employees from 30 to not exceeding 75.
Source: Official website of SME Corp 2015
Literature Review
According to a study by Suraiya Ishak et.al, (2012), successful entrepreneurs are those who are able to pass the most difficult situations in their business life cycle. These entrepreneurs find a transition point (turning point), which is the beginning of a success phase in their business. Model of Suraiya Isyak et.al, (2012), is a sub-model described by Grenier (1972) which operates in all growth phases. It refers to any phase in which Grenier stated. At the end of each level, there is a growth crisis the firm faces and requires completion before moving to the next phase of growth. The ability to solve problems in each stage enables businesses to reach turning point that leads to the survival and the ability to step into the next phase of growth. The ability to solve problems in each stage enables businesses to reach turning point that leads to the survival and the ability to step into the next phase of growth. Reviews Suraiya Ishak et.al, (2012), concluded that the pursuit of the turning point is a challenging phase because at this point there is a range of problems (challenges) that must be dealt with efficiently and effectively and these all take some time. The study of the growth of small firms by Gill et al. (2010) has shown the importance of the ability of the owners (entrepreneurs) in driving the growth of small firms. Their study found that the lack of skills and skills in managing conflict in family-business as factors that hinder the growth of small firms in Canada. There are many factors that can affect the success of Bumiputera entrepreneurs in SME sector in Malaysia. According to Ibrahim Mamat (2009), the goal is a major determinant of the birth of the positive attitude of successful entrepreneurs. Norashidah Hashim et.al, (2009) also have expressed that many entrepreneurs have family backgrounds who are involved in the same business. Moreover, all successful entrepreneurs have the skills and knowledge of the business, acquired either formally or through work experience before becoming an entrepreneur. Therefore, the knowledge acquired through family inheritance allows each entrepreneur to have an attitude study hard in promoting themselves with the knowledge and skills needed in business. Moreover, findings by the Buerah Tunggak et.al, (2011) illustrate that knowledge and entrepreneurial management skills are major weaknesses of Bumiputera SME entrepreneurs. Poor financial management is performed. Bumiputera entrepreneurs are split between private ownership of business entities that are willing to spend and entities using cash and merchandise for personal and family purpose without keeping accounting records. Sazelin Arif (2009) also found that one of the weaknesses among small business marketing of halal food in the center of Malacca is the lack of guidance and sharing of ideas because of a lack of cooperation networks among entrepreneurs. A study by Mohd Nor Hidayad Hambali (2011) asserts that all the government aid such as finance and credit, training and development, advisory and consultancy services, marketing and business opportunities as well as support infrastructure are there provided to help improve the success of Bumiputera entrepreneurs. The findings by Siti Nor Wardatulaina Mohd Yusof (2011) showed that support for entrepreneurship and government policies relating to the "angel investors" and the availability of risk capital, financial resources, government support for entrepreneurship all are correlated with entrepreneurial success in Malaysia.
Factors that influence the success of Bumiputera entrepreneurs in SMEs -Weaknesses in management
Most of Bumiputera entrepreneurs failed in doing business due to the weakness in management. With poor management, they are not able to survive and cannot afford to be greater even though they have been long in the business. The main cause of business failure is also due to a less effective performance management functions, particularly with regard to decision-making. Management is a science to be learned over time. However, there are some ethnic Malays who feel that if they had been trained to make something in a sense that people who are able to produce goods can take care of the business. It can work in certain areas, those areas which don't require knowledge to manage the business.
Failed in marketing
Weakness in marketing has also become a major factor Bumiputera entrepreneurs failure in business. They do not know to distinguish a real target market; they treat everyone as the target customer. In addition, they are also not able to meet the requirements of customers, causing customers to shift direction toward other traders. Most businesses do not perform activities of planning and market research. Decisions to meet the needs of customers are usually made by Bumiputera entrepreneurs themselves without getting return information from the market.
Financial problems
Bumiputera entrepreneurs often face problems related to finance and accounting. They are weak in dealing with stock control; control and financial records are incomplete. Some of them also do not have the financial records. This causes an organization to go bankrupt. In addition to the issue, Bumiputera also fail to provide funds to entrepreneurs. This led to businesses facing a serious financial crisis. Actually, commercial banks do not trust to lend money to them. In addition, SMEs often face a lack of liquid capital in cash to pay salaries, rent, water and electricity, suppliers or creditors, and other daily business expenses. Inability to cover everyday business expenses and creditors worsen the image of SMEs and complicate business operations.
Difficulties in financial assistance
Bumiputera entrepreneurs encounter difficulties to get financial support from the institutions or financial agencies. Financial agencies do not provide assistance to small entrepreneurs because they assume that parties cannot afford to expand the business. If aid is given, the agency believes that Malay SME entrepreneurs cannot repay the loan. Financial assistance is not given to them to cause because of the problems they face like low labor quality, non-appealing size and position of a firm, machinery and raw materials of poor quality as well as low production quality.
Limited participation of Bumiputera SME entrepreneurs in international markets
Market aspects of small and medium enterprises at the international level have to be challenged for the advancement of the industry. Space or scope of the market is limited due to the products features, particularly in perishable food
Che Mohd Zulkifli Che Omar, Nurdiana Mohd Nor Azmi
Factors Affecting the Success of Bumiputera Entrepreneurs in Small and Medium Enterprises (SMEs) industry. This problem is also due to the raw materials that cannot be saved because of their short life. The industrial market is being localized and it is hard to penetrate globalized market because of the lack of advertising and promotion. Unlike large companies, SMEs cannot afford to cover the costs of marketing at the international level. Most large companies are able to provide a high budget for advertising. Environmental problems are affecting the international companies to choose their suppliers. According to Fierro at el, (2009), SMEs must take into account the dynamic global market as a significant business opportunity rather than a threat. Thus, local Bumiputera entrepreneurs should ensure that products being marketed are environmentally friendly and are produced based on green technology in order to compete well.
Lack of skilled workers
One of the challenges faced by the SME sector is also lack of skilled labor. Normally, SMEs are handled by workers with inferior educated. Most SMEs are facing recruitment problems because they are not able to offer salaries and conditions of service, unable to provide a complete employee training schemes. At this point, large firms offer better employment conditions, thus, leaving SMEs workers who are less educated and low-skilled to handle business operations. Lack of knowledge, skills, training and employee commitment directly affects SME sector.
Problems to market the product
Bumiputera entrepreneurs are also experiencing challenges to market products in local supermarkets. Production of similar products complicated listing the products by the supermarkets because of the limited display space. Therefore, Bumiputera entrepreneurs should not focus on the range of products for the future, but, get specialized in producing one specific product with high quality in order to be the best in the market and beat the competition. There are also moments when some products cannot be sold within a period of time in the supermarkets. In addition, the entrepreneur fails to deliver products that meet the total orders and time set by the supermarkets.
Shortage of raw materials
Small and medium enterprises mostly rely on imported raw materials as a source of production. However, raw material resources are prone to decrease in the future and this may lead Bumiputera SMEs to fail to expand their businesses. In fact, the increase in raw material prices will also bring the same complexities. Increased prices of raw materials make SMEs increase the price of their marketed products which eventually cause a lack of demand in the market. For example, the batik industry affected when the world market price of white cloth soared.
Discussion and recommendations
Increase knowledge and skills in business
If Bumiputera SME entrepreneurs in Malaysia want to succeed in business, they need to develop an encouraging attitude of studying business. Bumiputera entrepreneurs have to prepare themselves with knowledge highly relevant to the economics and finance as well as management in order to compete well in the market. According Suhaila Nadzri et.al, (2014), they also need to enrich their relevant marketing knowledge by attending seminars and programs being organized by accountable government agencies. By attending the seminars, Malay traders can get information about the business opportunities around them.
Increase the types of help and support from government
Help and support that is already available through the relevant agencies should be continued and improvements should be made in line with the government's aim to develop the economy of Malay SMEs. Majlis Amanah Rakyat (MARA) is proposed to increase Entrepreneurship Training Programs, Market Development Program and others. Policies and procedures to obtain a loan must also be simplified in order to attract more Bumiputera entrepreneurs in the field of small and medium-sized industrial companies. This can prevent Bumiputera entrepreneurs borrowing from unlicensed parties.
Che Mohd Zulkifli Che Omar, Nurdiana Mohd Nor Azmi
Factors Affecting the Success of Bumiputera Entrepreneurs in Small and Medium Enterprises (SMEs)
The issue of skilled workers
Malay SME traders in the business who face problems should consult and discuss the problems with parties who are skilled as TEKUN and MARA. Talking to a person who specializes in business can help Bumiputera entrepreneurs to solve their problems and indirectly reduces future risks to be faced. Advice and counseling from the skilled personnel also enables entrepreneurs to create a basic business in the future. Advice and proper guidance make Bumiputera entrepreneurs improve knowledge and skills, thus, make them more competitive in a challenging business environment.
Conclusion
In conclusion, all parties must work together to assist Bumiputera entrepreneurs in addressing their problems in the field of small and medium enterprises (SMEs) in order for their businesses to compete in the market. Critical success factors Bumiputera entrepreneurs of SMEs should be identified. Based on the recommendations made, the financial problems faced by them can be overcome. In addition, the government and the private sector should provide training opportunities and skills to improve Bumiputera entrepreneurs' knowledge and skills. Eentrepreneurs should intensify efforts to develop the business, be more creative and gain a lot of confidence. They also need to get rid of shyness to ask the people who are skilled so that the Malays grow in business and develop with the help of, particularly, small and medium enterprises.
in Malaysia 41 ISSN 1849-5664 (online) http://researchleap.com/category/international-journal-of-management-science-and-business-administration ISSN 1849-5419 (print) International Journal of Management Science And Business Administration Vol. 1, No. 9, August 2015, pp. 40-45
Table 1 :
1SME classification in MalaysiaCategory
Small
Medium
Che Mohd Zulkifli Che Omar, Nurdiana Mohd Nor AzmiFactors Affecting the Success of Bumiputera Entrepreneurs inSmall and Medium Enterprises (SMEs) in Malaysia 42 ISSN 1849-5664 (online) http://researchleap.com/category/international-journal-of-management-science-and-business-administration ISSN 1849-5419 (print) International Journal of Management Science And Business Administration Vol. 1, No. 9, August 2015, pp. 40-45
in Malaysia 43 ISSN 1849-5664 (online) http://researchleap.com/category/international-journal-of-management-science-and-business-administration ISSN 1849-5419 (print) International Journal of Management Science And Business Administration Vol. 1, No. 9, August 2015, pp. 40-45
in Malaysia 44 ISSN 1849-5664 (online) http://researchleap.com/category/international-journal-of-management-science-and-business-administration ISSN 1849-5419 (print) International Journal of Management Science And Business Administration Vol. 1, No. 9, August 2015, pp. 40-45
Critical success factors of entrepreneurs. Abdul • Azmi, Nik Manaf, & Hairi Omar, Kuan Lee, Yee, • Azmi Abdul Manaf, Nik Hairi Omar & Lee, Kuan Yee (2012). Critical success factors of entrepreneurs Retrieved from http://journalarticle.ukm.my/5020/1/azmi012.pdf. At 2.5.2015
Training and long life learning for Islamic entrepreneur Jurnal Teknologi. Tunggak Buerah, Hussin Salamon & Baharin Abu. 55Sains Sosial• Buerah Tunggak, Hussin Salamon & Baharin Abu (2011). Training and long life learning for Islamic entrepreneur Jurnal Teknologi, 55 (Sains Sosial). Halaman 121-144
The challenges of internationalising national culture-based hand-crafted products. J C Fierro, R V Carrasco, E Centeno, Marketing Intelligence & Planning. 277• Fierro, J.C., Carrasco, R.V., & Centeno, E. (2009). The challenges of internationalising national culture-based hand-crafted products. Marketing Intelligence & Planning, Vol. 27 No. 7, pp. 900-908
The Power of Entrepreneurial Vision Vocational Education. • Greene, Educational Journal. 648• Greene (2000). The Power of Entrepreneurial Vision Vocational Education, Educational Journal. 64 (8), 28- 29.
Entrepreneur and malay competitive in industry in service sector Kuala Lumpur. Ali • Hasnah, Case Study: Factors influencing entrepreneurs success. Dewan Bahasa Dan Pustaka • Ishak Yussof, Khairunnisa Mardzuki, Zaimah Darawi & Mohd Shukri HajinoorEntrepreneurs success factors• Hasnah Ali, Norhafizah & Sanep Ahmad (2010). Case Study: Factors influencing entrepreneurs success Retrieved from http://www.ukm.my/fep/perkem/pdf/perkemV/PERKEM2010-2-15.pdf. At 2.5.2015 • http://www.kpdnkk.gov.my/kpdnkkv3/index.php?option=com_content&view=article&id=216&Itemid=303&l ang=my • http://www.smecorp.gov.my/vn2/?language=ms • Ibrahim Mamat (2009). Entrepreneur and malay competitive in industry in service sector Kuala Lumpur: Dewan Bahasa Dan Pustaka • Ishak Yussof, Khairunnisa Mardzuki, Zaimah Darawi & Mohd Shukri Hajinoor (2011). Entrepreneurs success factors Retrieved from http://www.ukm.my/fep/perkem/pdf/perkemVI/PERKEM2011-2-4D1.pdf. At 1.5.2015
Government aid for Malaysia SMEs Undergraduate thesis Malaysia technology University • Norashidah Hashim. • Mohd Nor Hidayat Hambali, Norasmah Othman, Noraishah Buang. 341Jurnal Pendidikan Malaysia• Mohd Nor Hidayat Hambali (2011). Government aid for Malaysia SMEs Undergraduate thesis Malaysia technology University • Norashidah Hashim, Norasmah Othman, Noraishah Buang (2009). Case Study: Entrepreneurial awarenesss in Malaysia. Jurnal Pendidikan Malaysia, 34(1), 187-203.
Aini • Nor, Idris, Women entrepreneur competitiveness globally Proceeding Persidangan Kebangsaan. • Nor Aini Idris (2003). Women entrepreneur competitiveness globally Proceeding Persidangan Kebangsaan, 7- 22
Marketing strategy for Halal food. MALIM Bil. Arif • Sazelin, 10• Sazelin Arif (2009). Marketing strategy for Halal food. MALIM Bil.10.
Success factors in Enterpreneurship: The Case Study of Malaysia, Pilot Research Work. Factors influencing success dan faili for Malaysia SMEs. Department D'Economia De L'Empresa, Universitat Autonoma de Barcelona • Suhaila Nadzri, Suhaily Md Shamsudin & Muhammad Firdaus Muhammad SabriPhd Thesis• Siti Nor Wardatulaina Mohd Yusof (2011). Success factors in Enterpreneurship: The Case Study of Malaysia, Pilot Research Work .Phd Thesis, Department D'Economia De L'Empresa, Universitat Autonoma de Barcelona • Suhaila Nadzri, Suhaily Md Shamsudin & Muhammad Firdaus Muhammad Sabri (2014). Factors influencing success dan faili for Malaysia SMEs Retrieved from http://www.kuis.edu.my/comm2014/eproceedings/C021%20FAKTOR%20FAKTOR%20PENYUMBANG%2
Che Mohd Zulkifli Che Omar, 1849-5419Nurdiana Mohd Nor Azmi Factors Affecting the Success of Bumiputera Entrepreneurs in Small and Medium Enterprises (SMEs) in Malaysia. 45printChe Mohd Zulkifli Che Omar, Nurdiana Mohd Nor Azmi Factors Affecting the Success of Bumiputera Entrepreneurs in Small and Medium Enterprises (SMEs) in Malaysia 45 ISSN 1849-5664 (online) http://researchleap.com/category/international-journal-of-management-science-and-business-administration ISSN 1849-5419 (print) International Journal of Management Science And Business Administration Vol. 1, No. 9, August 2015, pp. 40-45 0KEPADA%20KEJAYAAN%20DAN%20KEGAGALAN%20PERUSAHAAN%20KECIL%20DAN%20SE
. DERHANA%20BUMIPUTERA%20MALAYSIA.pdf. At. 1DERHANA%20BUMIPUTERA%20MALAYSIA.pdf. At 1.5.2015
CaseStudy::Businessstrategy. • Suraiya Ishak, Abdullah Sanusi Othman, Amal Hayati Ishak & Mohd Fauzi Mohd Jani• Suraiya Ishak, Abdullah Sanusi Othman, Amal Hayati Ishak & Mohd Fauzi Mohd Jani (2012).CaseStudy::Businessstrategy.Retrievedfromhttp://www.ukm.my/fep/perkem/pdf/perkemVII/PKEM201
At 2.5. 2_3b3, Pdf, 2_3B3.pdf. At 2.5.2015.
Economic development. • Suraiya Ishak, Journal Pengurusan Jawhar. Ahmad Raflis Che Omar & Amal Hayati Ishak32• Suraiya Ishak, Ahmad Raflis Che Omar & Amal Hayati Ishak (2009). Economic development Journal Pengurusan Jawhar. Vol. 3(2): 165-183.
Tales of the survivors: the Bumiputera entrepreneur's' experience. • Suraiya Ishak, Asian Social Science. Ahmad Raflis Che Omar & Azhar Ahmad83• Suraiya Ishak, Ahmad Raflis Che Omar & Azhar Ahmad (2012). Tales of the survivors: the Bumiputera entrepreneur's' experience. Asian Social Science. Vol. 8(3); 25-33.
Promoting entrepreneurship in developing countries: policy challenges. • Wim Naude, 4World Institute for Development Economics Research of the United Nations University (UNU-WIDER) Policy Brief• Wim Naude (2010). Promoting entrepreneurship in developing countries: policy challenges. World Institute for Development Economics Research of the United Nations University (UNU-WIDER) Policy Brief, 4, 1-8.
| After the economic crises hit Indonesia in 1997 and 2008 and contributed to downfall of a large number of big businesses in various industries. However, the small and medium enterprises (SMEs) sector has managed to survive from the crisis by showing a significant growth and rising contribution to the economy of Indonesia. Yogyakarta which is known as a city of student has acknowledged the important role of SMEs sector to improve the economic activity of the region and push the income of the people. Rising paradigm at universities and colleges in Yogyakarta about creating entrepreneurship from their graduates has contributed to the rise of graduates’ business in this place. The aim of the paper is to take a fresh look into graduate’ entrepreneurship on SMEs’ scale and competences in Yogyakarta. This paper focuses on a detailed study into the entrepreneurial activities of graduates in Yogyakarta and principally examines issues affecting their business development. Seven main issues were investigated: business establishment; location; premises (size, cost, tenure); concerns; advice utilization; education and training; and support requirements. The sample of the study was assembled from the ministry of department industry and KADIN Yogyakarta branch as formal sources. Other sample sources considered are entrepreneurship associations such as Konsultan Pengembangan Ide dan Usaha ARN of Yogyakarta. Data collecting methods used in this paper are in depth interviews and structured and semi structured questionnaires. Research method will relied mostly on ethnographic techniques. | 71 | Factors Affecting the Performance of Small and Micro Enterprises in Limuru Town Market of Kiambu County, Kenya | Development trends of small and medium size companies in Timisoara and Timis County: Romania | On Financial Control over Small-medium Size Enterprises | The impact on the small business in the agricultural sector in order to enhance competitiveness | Business strategy and performance of small and medium manufacturing firms in Malaysia | The present study aimed to investigate the Problems, Prospects and the role of Micro and Small Enterprises in economy the case of Western Hararghe. The greatest challenges of micro enterprises, opportunities of micro enterprises, the roles of micro enterprises in employment generation, the roles of micro enterprises in entrepreneurial development had been identified. The sample of the study consists of all the micro and small enterprises and micro enterprise offices in Western Hararghe. Stratified random sampling was used to get information from different sizes of the SMEs.The data were collected from 197 micro and small enterprises and micro enterprise offices in Western Hararghe . The data were gathered using questionnaire and interview. The data obtained were analysed using both quantitative and qualitative techniques. Quantitative data obtained were analysed using descriptive statistics and independent sample t-test. The qualitative data were analysed using narration. Comparison of the Fairness of tax based on establishment time using t-test show that that there was no significant difference between MSEs based on establishment time and result of comparison of MSEs on Profitability in relation to establishment time show there was no significant difference among MSEs regarding profitability. | The impact of government policies on the development of small- and medium-sized enterprises: the case of Vietnam | Innovation and success of small and medium enterprises (SMES) in Kano state Nigeria | Small business promotion projects in Africa's Sahel countries |
72 | How did Eamon de Valera become leader of the Irish Free State despite having led the Anti-Treaty faction in the Irish Civil War? | Anglo-Irish Treaty he came out against the treaty as signed. The cabinet decided by four votes to three to recommend the treaty to the Dáil on 14 December. The contents of the treaty divided the Irish Republic's leadership, with the President of the Republic, Éamon de Valera, leading the anti-treaty minority. The Treaty Debates were difficult but also comprised a wider and robust stock-taking of the position by the contending parties. Their differing views of the past and their hopes for the future were made public. The focus had to be on the constitutional options, but little mention was made of the | Ireland–New Zealand relations however, their numbers were never great which may have been attributed to the fact that most of those with Irish origins in the country were already second generation New Zealanders with loose connections with Ireland. By 1947, New Zealand essentially became an independent nation after accepting the Statute of Westminster Adopting Act. In April 1948, former Irish Taoiseach Éamon de Valera traveled to New Zealand seeking support for a united Ireland. However, de Valera was not successful due to the fact that Ireland remained neutral during World War II whereas New Zealand fought under the Commonwealth in the war. Although | Leader of Sinn Féin joined opposing sides with De Valera leading the Anti-Treaty faction, while Griffith joined the Pro-Treaty faction, which later became Cumann na nGaedheal. De Valera’ successor John J. O'Kelly was one of four leaders who served for brief periods of time as Sinn Féin’s party membership declined in favour of Fianna Fáil and Fine Gael. In 1937, Margaret Buckley became the first female President of Sinn Féin. During her thirteen years as leader, she vastly improved the relations between the IRA and the party. She was succeeded by Paddy McLogan and Tomás Ó Dubhghaill who both helped rebuild party support in | Irish neutrality during World War II The policy of Irish neutrality during World War II was adopted by the Oireachtas at the instigation of the Taoiseach Éamon de Valera upon the outbreak of World War II in Europe. It was maintained throughout the conflict, in spite of several German air raids by aircraft that missed their intended British targets and attacks on Ireland's shipping fleet by Allies and Axis alike. De Valera refrained from joining either the Allies or Axis powers. While the possibilities of not only a German but also a British invasion were discussed in the Dáil, and | Since the Civil War during 1922 and 1923, the Irish Republic has been an important symbol for radical republicans, amongst others. The Civil War began in June 1922 when both Sinn Féin and the IRA split between those pragmatists, who supported the Treaty, and those hardline republicans who opposed the compromises it contained. In particular the anti-Treaty faction objected to the continued role in the Irish constitution that would be granted to the British monarch under the Irish Free State. When the Dáil ratified the Treaty its opponents of the agreement walked out, arguing that the Dáil was attempting to | Ireland–Spain relations and all relations between Ireland and Spain were henceforth carried out through London. In December 1922, most of Ireland gained a form of independence within the British Empire as the Irish Free State and, in 1924, diplomatic relations were officially established between the new Irish Free State and the Kingdom of Spain. That same year, Spain opened its first consulate in Dublin. In 1935, the first Irish Minister was appointed to Spain with residence in Madrid. In 1936, Spain was engulfed in a Civil War between the Republican faction led by President Manuel Azaña; and the Nationalist faction led by | Confederate Ireland Ireland was arguably the only sustained attempt at Catholic Irish self-government between 1558 and the foundation of Irish Free State in 1922. Its style of parliament was similar to the landed oligarchy Parliament of Ireland established by the Normans in 1297, but it was not based on a democratic vote. Given their large notional power base, the Confederates ultimately failed to manage and reorganise Ireland so as to defend the interests of Irish Catholics. The Irish Confederate Wars and the ensuing Cromwellian conquest of Ireland (1649–53) caused massive loss of life and ended with the confiscation of almost all Irish | Moss (Maurice) Twomey Quirke. Twomey opposed the Anglo-Irish Treaty of December 1921, although he was critical of the tactics adopted by the anti-Treaty forces headquartered in the Four Courts - he was influenced by Oscar Traynor's opinion that garrison would destroy the Republic Éireann - Dublin during June 1922. Liam Lynch was a figure from the old IRA, dedicated to the cause, but also determined to fight. Four Courts showed the leadership that they were out of touch with the reality of the awesome power of artillery. Although reunited in adversity, the factional splits had not masked the changing nature political changes. Twomey | 72 | Irish history has always fascinated me and I have studied it up to degree level however of all the various episodes in modern Irish history I always find the Irish Civil war, its causes and aftermath, the most perplexing.
Most perplexing of all I find Eamon de Valera's leadership of the Irish Free State in the aftermath of the war. How is it that the leader of the loosing faction in the civil war could have attained the leadership of a state which he had been completely opposed to the existence of?
How did he maintain any political and moral credibility after having personally contributed, in no small way, to the outbreak of the civil war, how was it that senior members of the Pro-Treaty faction failed to sideline him, and how did he personally justify his change of stance towards the Free State and the partition of Ireland?
Any insight regarding this topic or any recommendations for reading on this question would be most appreciated. | Can someone explain to me all the Union politics in 'The Irishman'? | what was the basis for peace in ireland | who was the irish minister of defence at the time of the civil war | who was the commander-in-chief of the irish army during the civil war | who controlled most of ireland during the confederate war | in what year did the irish civil war begin | When did southern ireland became independant? | who was the leader of the irish nationalist party in 1882 |
73 | The Supreme court will uphold a law concerning a given group as long as the law is reasonably related to a legitimate government interest what is the name of this standard? | The Supreme Court will uphold a law concerning a given group as long as the law is reasonably related to a legitimate government interest What is the name for this standard? | The supreme court reviewing and ruling on act of other brances of the government is called? | For nearly five decades, scholars have explored interest group involve ment in courts, with their insights providing substantive and, eventually, theoretical breakthroughs. While the early pluralists noted instances of groups litigation in both federal and state courts, virtually all modern-day scholars have focused their attention on federal arenas. This emphasis is hardly surprising: we do not know whether or not interest groups participate in state court litigation in numbers sufficient to warrant investigation. In an effort to fill this gap, I address two interrelated questions about litigation in state courts: has interest group use of state judicial systems increased over the past four decades and has the scope of litigation activity expanded to incorporate a wider range of interests? An examination of litigation activity in sixteen state supreme courts generally answers these questions affirmatively. It indicates a heightened presence of organized interests; it also shows that a wider range of grou... | What term is defined as the right og the supreme court to examine the laws to see if they agree with the sonstitution? | What is called when the supreme coust reviews and rules on acts of thje other branches? | What branch of government decides cases about the constitution or the country's laws? | What court has the rule on the constitutionality of a federal law? | What type of cases does the supreme court have final authority on? | 73 | What US Supreme Court standard requires a law to be related to a legitimate government interest? | are supreme court decisions law? | Do cases in the Supreme Court have to be based on the Constitution or acts of Congress? | Duty to laws for supreme court? | When the supreme court rules on acts of other brances it is called? | Which term is defined as the right of the supreme court to examine laws? | The Impact of the Supreme Court on Trends in Economic Policy Making in the United States Courts of Appeals | The United states supreme court jurisdiction includes? | What is the supreme court reviewing and ruling an acts called? |
74 | Would rather a hat that had pins, very uncomfortable ... | so, I was just wondering if the pins can be used on hats and stuff like that because I haven't seen someone with pins on their hat. (idk, maybe I'm just that stupid and I just haven't seen anyone with a pin on a hat) Just asking this because I haven't had any Hazbin Hotel or Helluva Boss pins before and I just wanted to know if you can physically wear them. I kinda feel like an idiot for writing this whole thing but yk, I gotta know if I should buy them since I plan on putting them on hats and shit. hope you understand where I'm coming from. | didn't realize it would be so stiff and hard, I think I would have preferred a felt hat for my grandson | 1. I need some of the button connectors for the inside of my hat that the needle of the pin goes in. Can I get link of some of those you'd recommend? Preferably ones that don't poke at my head.
2. I tend to go to harder shows where I'll be headbanging and just all around be dancing really hard. Usually I take my hat off at the drop so I don't lose it but how common is it for pins to just fly off?
3. How the heck do some of you afford so many? At every festival I've been to they go for $15+
Thanks in advance! | These hats are things I personally would never wear, but this dies not say NO. I wear hats all the time and they are absolutely the best in hats and cost a lot of money. | Hello Gentlemen!
What do you wear on your head to keep you warm? I wear business casual clothes, so im not really into wear ball caps anymore. I just want something to put on my head to keep me warm and stylish.
Show me your hats! | So lightweight that I forget that I am wearing a hat. It doesn't put pressure on my head at all. | Would recommend wearing it with a hat as it tends to pull the hair when taking it off, though besides that works as intended | I don't like hats. I generally wear a visor rather than a hat, but I needed something with more sun protection. This one worked well. It has a mesh strip, but I wish it had a lot more ventilation. | 74 | Would rather a hat that had pins, very uncomfortable and weird looking when strapping it under your chin. Also, elastic piece broke half-way through the night, wouldn't recommend | Great fitting hat (seems to be well shaped/designed for a ... | The hat is pretty bi and the elastic does not fit my head ... | A good hat for casual use | the hat itself is fine the chin strap is horrible I discarded it and ... | Very comfortable hat. The Velcro on the front is a ... | ... have an unusually large head because this hat is pretty tight. There is a magical way to wear ... | Any Ideas on "Intractable" hat? | Types of winter hats for guys with curly hair |
75 | Intruder detectors: myths of our time | PROJECT PROPOSAL FOR INTRUDER DETECTION SYSTEM | Currently watching a show called Detectorists and I was curious to see where it might be like to have a go at it.
With a tiny bit of research I have found out there are laws regulations in place that prohibits you from detecting in a lot of places including parks and public beaches.
I find it all stupid, I can only assume it’s for archeological reasons but my opinion, if something historic were to be discovered it shouldn’t matter if the person who found it was an amateur. | How thorough is security at the main entrance for people entering the festival that are not camping? I'm assuming a simple pat down but are there worst case scenario any type of metal detectors? I arrived late last year for camping and my car was VERY intensely searched, so I could see it going in any direction. Thanks for any insight | The Myth of the Computer Hacker | using improved record keeping and employment of global positioning system, GIS, logbooks, photo scales and online databases may aid professionals in evaluating possible sites. When searching for a site, hobbyists can aid with electronic scanning, reducing the need for test holes. Some land managers, such as the Tennessee Valley Authority have cited a role for amateur archaeologists in protecting sensitive sites from illegal looting and metal detector hobbyists have aided in the location and preservation of many sites. A series of aircraft hijackings led the United States in 1972 to adopt metal detector technology to screen airline passengers, initially using | Windows Security Log the Security Log works can be enough to take precautions against detection. For instance, a user wanting to log into a fellow employee's account on a corporate network might wait until after hours to gain unobserved physical access to the computer in their cubicle; surreptitiously use a hardware keylogger to obtain their password; and later log into that user's account through Terminal Services from a Wi-Fi hotspot whose IP address cannot be traced back to the intruder. After the log is cleared through Event Viewer, one log entry is immediately created in the freshly cleared log noting the time it | those who were in the building at that time. Surveillance cameras might also be used to deter or detect unauthorized access Physical access Physical access is a term in computer security that refers to the ability of people to physically gain access to a computer system. According to Gregory White, "Given physical access to an office, the knowledgeable attacker will quickly be able to find the information needed to gain access to the organization's computer systems and network." Physical access opens up a variety of avenues for hacking. Michael Meyers notes that "the best network software security measures can be | those who were in the building at that time. Surveillance cameras might also be used to deter or detect unauthorized access Physical access Physical access is a term in computer security that refers to the ability of people to physically gain access to a computer system. According to Gregory White, "Given physical access to an office, the knowledgeable attacker will quickly be able to find the information needed to gain access to the organization's computer systems and network." Physical access opens up a variety of avenues for hacking. Michael Meyers notes that "the best network software security measures can be | 75 | This article looks at the popular myths surrounding intruder detectors and false alarms. What the user should be looking for in a detector to reduce the number of false alarms and what points should be taken into consideration when choosing an alarm. | Scared all the time - ideas for an alarm to warn off intruders? | Evaluating alternative responses to safeguards alarms | Too much false alarms | real time alerts with the ability to check the sound recording of an alarm that makes this product a must have! | (Suggestion) In-game alarms | False Alarm on False Alarm? | Great Detection - Too Many False Alerts | it would be good if First Alert made the same detector with a ... |
76 | Vote for objective start is a problem. Here's why. | For anyone voting for the first time:
If time is running short, and for whatever reason you have been unable to sufficiently educate yourself about every single item on the ballot, you are still doing your country a great service by voting for your representative, senator, and governor.
When I first started voting, I had a lot going on, and I was under the misconception that I HAD to submit a vote for each issue, one way or the other, and I ran out of time and was unable to get my ballot in.
Obviously it’s better to vote on all issues, but if that is not happening, fuck it – you still have a great power to #MAGA just by voting for your representative, senator, and/or governor.
I probably should’ve known that, but am mentioning it for any ‘pedes that may be procrastinating or overthinking this thing. | Getting as many people as possible to vote isn’t an objective good. If someone wouldn’t vote without significant prompting, they shouldn’t get as much of a say as someone who does take the time to vote of their own accord. | Sorry, but if a question is already up for voting, you cannot choose a best answer anymore. It will be decided by the voters. To choose a best answer, you have to do so in the first seven days before the question is automatically put to a vote. | People choosing not to vote is perfectly okay. We have a right to vote but it doesn't mean we have to exercise it.
If an election doesn't have a candidate you like or an issue you care about, not voting is a perfectly good option.
I also want to add that if you find yourself very uninformed or lacking information about an election or candidate than not voting is probably a good idea. There is no shame in saying I didn't feel properly informed enough to make a decision. | Pretty much everytime I get my 3 missions, I have to cancel the objective mission.
Why you ask? It's simple. I can't play objective since CMM doesn't put me in any games. I can't stand a que timer that's longer than 30 seconds, let alone 5 mintues (that's the longest I let it run).
If I could just get other missions instead, that'd be great. | In America, our state and federal elections only allow one day for people to cast ballots. Why can't we have polls open for two days? Or three? Or a week? A lot of people can't find time to take off work to go vote. Or if they do, they end up waiting around for hours. What if you get in a car accident on the way to vote and you end up in the hospital?
It doesn't make sense to me that we can't just wait a week so people will be able to find time to vote. This makes more sense to me than the more popular solution of making election day a national holiday. A lot of people still work on holidays.
Has this even been proposed seriously anywhere in America? | So the LD topic is officially compulsory voting and I think aff is gonna run that voters can vote for nobody (the no-name vote). If they run this and it is aff ground, would this be clash on the definition of voting or extra t since this leaves neg with little ground? | Wouldn't it be more logical to have people vote for which policies they want implemented instead of voting for a figure that may or may not implement policies that vaguely line up with their views? | 76 | Deliver the Bomb:
\- you have to vote for bomb delivery, but not for the launcher defense. It's not smart by its own, don't see reasons to explain
Repair the Shelter:
\- vote for a process of collecting modules which are locating at discovered area or nearby (recent subreddit topics proved this statement); if people will slack with vote or won't do it at start - as a result they will start to explore, openining bigger and bigger map area, making search more difficult, more time consuming and less fun if we could say that.
&#x200B;
All above and in general:
\- I bet whole vote system was designed to avoid trolls. For hundreds of hours I suffered from smth like this couple times but pls keep reading. It was always 4m missions with 1-2 players being afk or farming while objective defense was initiated. Recently we lost at Deliver the Bomb, 'cause 2 guys were afk and the remaining player thought we will carry this and started objective. Couldn't place traps in time or even upgrade walls. Maybe he forgot it's 4m; idk.
&#x200B;
This "feature", nobody asked for, is a problem, because very very very often I'm doing all on myself, i.e. building defenses, gathering bluglo and even then people don't vote. They don't vote one time, on 2-nd I asked "please vote" (in my last game) and two guys didn't vote although they weren't afk. I destroyed everything I've built and left. I keep playing Public games 'cause my friends aren't interested in StW and I hope to have some funny conversations and positive experience in general. But we have what we have.
If you're lazy af - not a problem I can carry you. But if you wasting my time and refuse to simply vote after 2 times, I'm sorry but for whatever reasons - you're an asshole. | Please add some more reward for playing the objective... | Hey DE, while you keep messing with raiders and pissing off the speed runner community. Why don't you actually fix the things that make your raids boring and undesirable to play | Reworking voting system to encourage objective based gameplay in competitive | Why do a lot of players not know how to hold objectives? | This game needs to be more punishing to afk or players that do nothing in a battle | My friend's campaign game is way easier than mine and I have no clue why | People, convince me to main your mains! | Making chaos ME campaign more fun? |
77 | Kikkerland sparklz wind up | Kilen is a village in Kristiansand municipality in Agder county, Norway. The village is located in the Finsland area in the northern part of the municipality on the east coast of the lake Livatnet. The village of Finsland lies about to the northwest and the municipal centre of Nodeland lies about to the southeast.
References
Villages in Agder
Geography of Kristiansand | Runemagick "k" to the name (see also magick). A rehearsal demo with Nicklas on drums was recorded and sent to Century Media Records, which got them a record deal for three albums. After many line-up changes, in 2000, the band parted with Century Media and eventually landed on the Norwegian label Aftermath Music. After the album "Dawn of the End" 2007 the band fell into a long sleep but resumed in 2017. In 2018 the band recorded and released a new album "Evoked From Abysmal Sleep" released by Aftermath Music, Parasitic Records and Flowing Downwards. The band also played live first | Enköping Municipality (Enköpings kommun) is a municipality in Uppsala County in east central Sweden. Its seat is located in the city of Enköping.
The present municipality consists of nearly forty original local government units. They were grouped into greater municipalities in 1952 and Enköping Municipality was created in 1971 when the City of Enköping was amalgamated with five surrounding units.
Localities
Enköping (seat)
Örsundsbro
Fjärdhundra
Grillby
Hjälstaby
Hummelsta
Lillkyrka
Bredsand
Sister cities
Kaarina, Finland
Ølstykke, Denmark (about to change due to the upcoming major municipality changes in Denmark)
Nedre Eiker, Norway
Jõgeva, Estonia
Santa Rosa, Philippines
(Source:)
Sports
The most successful sports team of the city has for several years been the football team Enköpings SK, with one peak season in the Swedish Premier Division (Allsvenskan) in 2003. Unfortunately, the team has now faced the harsh reality of sports and economics and will be playing in Division 2 in 2008. Their home arena is called Enavallen and is situated in downtown Enköping.
References
External links
Enköping Municipality - Official site
Enköpings SK - Official site
Municipalities of Uppsala County | Jönköpings IK is a floorball club in Jönköping, Sweden, established on 9 March 1985 following a merger of the SMU Immanuel Church and the Munksjö School teams. The men's team has played several seasons in the Swedish top division and lost the Swedish national finals in 1986, 1988, and 1990 while earning the national championship bronze medals in 1987, 1989, and 1991.
Roster
As of August 27, 2020
References
External links
Official website
1985 establishments in Sweden
Sport in Jönköping
Swedish floorball teams
Sports clubs established in 1985 | Kropotkinfjellet is a mountain in Sabine Land at Spitsbergen, Svalbard. It has an extension of about seven kilometers, with two glaciated peaks, and is located between the glaciers of Sveigbreen and Skruisbreen. The mountain is named after Russian prince and scientist Peter Kropotkin.
References
Mountains of Spitsbergen | Game of Thrones were filmed in November 2011 in Iceland: on the Vatnajökull glacier near Smyrlabjörg, the Svínafellsjökull glacier near Skaftafell and the Mýrdalsjökull glacier near Vik on Höfðabrekkuheiði. Third-season production returned to Dubrovnik, with the Walls of Dubrovnik, Fort Lovrijenac and nearby locations again used for scenes in King's Landing and the Red Keep. Trsteno Arboretum, a new location, is the garden of the Tyrells in King's Landing. The third season also returned to Morocco (including the city of Essaouira) to film Daenerys' scenes in Essos. Dimmuborgir and the Grjótagjá cave in Iceland were used as well. One scene, with a live | Group upon full recognition. As of Jan 1, 2018, the Nederlnadse Kooikerhondje has been fully recognized by the American Kennel Club and is now competing in the Sporting Group. In the United States, both the UKC and ARBA recognize the breed. In the UK, the breed has been removed from the import list and is now eligible to enter Crufts for the Best in Show award, despite there being only 76 of the breed in the UK. In January 2013, the Kennel Club announced it was re-classifying the Kooikerhondje from the gundog group to the utility group effective from January | longest fjord is Wijdefjorden (), followed by Isfjorden (), Van Mijenfjorden (), Woodfjorden () and Wahlenbergfjorden (). Svalbard is part of the High Arctic Large Igneous Province, and experienced Norway's strongest earthquake on 6 March 2009, which hit a magnitude of 6.5. Association football is the most popular sport in Svalbard. There are three football pitches, but no stadiums because of the low population. Norsemen possibly discovered Svalbard as early as the 12th century. There are traditional Norse accounts of a land known as Svalbarð—literally "cold shores"—although this might have referred to Jan Mayen, or a part of eastern Greenland. | 77 | Sparklz is the least exciting of the Kikkerland lineup. After six uses, his sparks grew less and less. I anticipate the friction and flint will soon wear out and we will be left with a toy that wobbles and nothing else. I own two other Kikkerland windups and they are far superior. i would not buy Sparklz again. | how many albums does k sparks have in the us | What to craft with 4k sparks? | Sparks still great after all these years | I really enjoy this I would prefer this over spark or any ... | Got my 50k. Should I get Nader, or Sparks? | It's sparkly, but that's the only thing going for ... | SPARKS IS KILLING ME!! | what did ruhmorff use to make sparks last longer |
78 | How to make My Harbinger not ugly | Harbinger Down Bowman encourages Sadie to investigate the moon lander before Stephen can find a way to claim it for himself. Bowman recruits Big G to distract Stephen while Sadie sneaks off. Sadie discovers that the Soviet cosmonaut died of an unknown infection and takes a skin sample to analyze. Stephen becomes further frustrated when he learns she has examined the spacecraft before him. He threatens to destroy her career unless she signs over the discovery to him. Graff threatens to take the issue to the courts but Sadie gives in. Meanwhile, Sadie learns that the moon lander was carrying tardigrades, a | Harbinger (film) Fischer and Austin. The prime shooting location was Rancho Mirando, a wedding venue in Fischer. "Harbinger" is the debut feature from writer/director Cody Duckworth, who grew up around San Antonio ranches. Film production spanned over seven years from inception to distribution. The original script was written as a horror film while the director was still in college. After producer Jonathan de la Luz came on board the project, the script was rewritten, embracing the eco-thriller genre with fracking as the primary threat in the film. Harbinger premiered at the Cine Las Americas International Film Festival in Austin, Texas on May | Just picked up Madelyn and am about to paint her up and I'm thinking about squeezing her into my Harbinger list. I was just wondering if anyone else use the two together and how useful the +1 command on Harby plays out? | I'm not entirely sure what I'm looking for. A friend of mine tried to describe it and I was hoping Reddit might be able to recall how to find it.
I wasn't told much about the story: the protagonist (a young girl?) sees a distant house that, in the sunlight, appears to glow or sparkle. She proceeds to make her way to said house. By the time she gets there, though, she looks back and sees that - because of a different time of day - it is now her own house that glows / sparkles.
Sorry it's so vague a description. Any ideas? Thanks. | I often find makeup that looks great on, doesn't always photograph well. In particular when it's heavy.
I have my end of uni ball coming up, and I want to look great both on the night and in photos. Do you have any tips? Should I be avoiding shimmery makeup, matte makeup etc? | Haazinu would incense them with a no-folk and vex them with a nation of fools. A fire flared in God's wrath and burned down to the base of the hills. God would sweep misfortunes on them, use God's arrows on them — famine, plague, pestilence, and fanged beasts — and with the sword would deal death and terror to young and old alike. God might have reduced them to nothing, made their memory cease among men, except for fear of the taunts of their enemies, who might misjudge and conclude that their own hand had prevailed and not God's. For Israel's | a journey into the 20th century, Magnus, Robot Fighter would be the one to convince Zephyr to found the resistance in the first place, stating that it was her destiny to do so.. Harbinger Resistance The Harbinger Resistance is a fictional organization appearing in the Valiant Comics universe. The Harbinger Resistance was started by the renegade Harbinger Faith Herbert, alias Zephyr, to combat the world dominating aspirations of Harbinger Foundation founder, Toyo Harada. Later on (according to Rai #0) this same resistance would be led by renegade Omega-class Harbinger Pete Stanchek, also called "Sting", a friend of Zephyr, who would | Besides a nose contour, what are some makeup tips that could balance out my face better? I have an oval face, dark brows, and a slightly big nose. I also have brown eyes and slightly hooded lids. Not sure if I should try false lashes bc I’m paranoid of drawing attention to my flaws. Any advice? | 78 | Hey guys, so I checked this video out by Rocket Science Hitbox visualizations and any other Ocatne hitbox car. So, I'm trying to make Harbinger my new main, but I physically can't if it's so ugly. How do I make it look cool? | How can I make this render look more realistic? | Anyone wanna make my comedy flyer not look so basic? [Request] | [Question] Any Tutorials on how to make good-looking Effects? | Super cool and realistic looking flicker | How would create this effect? Developers.Shopify Star Field Banner | How do you make your visuals? | This Makes My Car Look So Cool! | There really isn't any way to make it look very nice like the picture |
79 | who is making dreamfall chapters book 1 | Dreamfall Chapters RTG revealed a new level from the alpha version, showing Zoë Castillo in Storytime at the very start of the game. Work on the beta version began in May 2014, and the first "book" (prologue, two chapters, and an interlude) was feature complete by mid-June. After returning to an episodic video game format in June 2014, Red Thread Games released Book One, "Reborn", as the first episode of "Chapters" on 21 October 2014. On 26 August 2014, RTG announced a musical competition among Kickstarter backers and other fans, who were asked to submit soundtrack pieces to be included in the | Dreamfall Chapters Three was announced on 22 May 2015, and its release date, one month later. Book Four's subtitle was announced via Twitter and Facebook in late September, and its release date, on 30 November 2015. The subtitle and the release date of the fifth and final Book was announced via Kickstarter on 6 April and 9 June 2016, respectively. Originally, the episodes were distributed digitally on platforms such as Steam, where the game was cleared on the Greenlight process on 17 April 2013. Individual episodes have never been sold separately, but only as part of a complete season pass. Munich-based EuroVideo | This is a reprint of the Dreamwave version that was released in 2004. It does offer a wonderfully detailed listing of each Generation 1 bot, as well as gestalts, micromasters, targetmasters, headmasters and pretenders. Each listing covers Personality/Bio, Weapons and Abilities, Weaknesses as well as pictures of robotic and alternate mode/modes.
However:
When compared to my original Dreamwave copy, many of the pages in this one are not very clear or bright. It's almost as if the original artwork was not available for some of the pages and they used a photocopy for the page in this book, thus making the color less vibrant, less clear, quite dark in fact and the text part on these pages is effected as well. On other pages the color is just dull. The effected pages are all scattered sporadically throughout the book. Still this is perfectly usable for reference as well as to save your original copy (if you have one) wear and tear.
Nitpicking:
While this does have a one page character index in the back for all characters included in this volume, it is lacking the two page -covers both volumes- index that is in the back of the Dreamwave version. The lack of the two page index is disappointing as it is an extremely nice feature that covers both volume 1 and volume 2, so no matter which volume you pick up, you have the complete index for every character detailed in the books and don't have to switch books when trying to remember if a certain bot really exhists or not.
Ultimately:
Especially for the price being in the mid-teens, it's worth the money, especially if you don't have the original release. And recently the original Dreamwave release is selling for 30, 40, 50 or more dollars, thus making this version an even more reasonable bargain. | So I'm listening to the audiobooks this time around, and I just got TGS the other day. Two things got me thinking. The first was Brandon Sanderson's foreword where he says
>You may think of *The Gathering Storm* and its two followers as the three volumes of *A Memory of Light* or as the final three books of The Wheel of Time. Both are correct.
Then there's a scene where Rand has a vision of Perrin and Galad, which doesn't happen until ToM. Also, I just remembered the two books each have a scene at Natrin's Barrow. And so I wonder, has anyone made a chronological listing of the three books' chapters? I'd be interested in editing my audiobooks into one giant AMOL volume that goes in timeline order, instead of being split so each book flows properly. | Don't care for fantasy books. Disappointed that Patterson would lend his name to this book. Couldn't make it past Chapter 4. Wish I could get my money back. | Dreamfall Chapters Dreamachine to recover the rest, her secondary body disappears from Stark and appears in Arcadia. There, she reunites with her talking bird sidekick Crow and embarks on a journey to find the dreaming Lux. After merging with and gaining Lux's powers, Zoë's real body wakes up in Mumbai, where she reunites with her biological parents. However, Chang manages to sedate her, still intending to exploit her abilities. At the same time in Arcadia, one of the Azadi empresses arrives to Marcuria with General Hami and Mother Utana, Kian's mentor and stepmother, respectively. Afraid of Kian's confessions, the Prophet's accomplices attempt | The Glitch in Sleep as a hardcover on September 18, 2007. About two months later the audiobook version was released on November 1, 2007. The paperback was released along with a new cover on August 19, 2008. On July 7, 2008 a new cover was again released as a paperback. The main theme running throughout the story as review from VOYA noted is "suffering and its purpose in the world." The review notes how although many of the older kids will not buy the Bed Bugs, they serve a meaningful purpose. The Bed Bugs can show how suffering is still necessary just like how | I heard that it was by the same guy behind Fuuka so I wanted to give it a shot but at least on my end Crunchyroll is missing the first half. Is there a place to read those chapters before moving back to Crunchyroll? | 79 | Dreamfall Chapters RTG revealed a new level from the alpha version, showing Zoë Castillo in Storytime at the very start of the game. Work on the beta version began in May 2014, and the first "book" (prologue, two chapters, and an interlude) was feature complete by mid-June. After returning to an episodic video game format in June 2014, Red Thread Games released Book One, "Reborn", as the first episode of "Chapters" on 21 October 2014. On 26 August 2014, RTG announced a musical competition among Kickstarter backers and other fans, who were asked to submit soundtrack pieces to be included in the | when did they start working on dreamfall chapters beta | 07-12-2020 Update Chapter 16 of Book 1 - Launching shortly! | These are nice chapters but is a shame they never released a ... | Can I play through an entire campaign by 'loading a chapter'? | Anybody else irked the Lost Children Arc won’t be consolidated to a single deluxe release? | iRacing Buyers Guide has been updated for 2021 Season 1 | TIL the dates shown in the Part 2 trailer aren't the years each chapter takes place in | Re-launching an old book with updates |
80 | Got this for my wife and she loves it, ... | Got this for my Wife... she really enjoyed it.. | Ordered this for my wife. She likes it so I'm happy. | I bought it for my wife and, fortunately, she loves it. I do too. | Got it for my wife, she's fairly happy with it. | I bought it to my wife as a gift. She love it very much. | Bought it for the wife, and she is happy with it. | Purchased it for my wife. So far she seems to like it. | My wife loves it. I was surprised that so many of our friends never heard of it and now they all want one. | 80 | Got this for my wife and she loves it, only complaint is now she wants the figure with the hammer! | I love the figure and I'm hoping my friend loves it ... | love it! I put the perfect arch grooming tool ... | This was gift for my daughter who absolutely loved it. She is very tickled with the overall ... | Great model! Definitely buy a head magnifier to assist. | I love this thing and it is so heavy duty | Bought this for my girlfriend and she love it! She loves the style | I gave this as a gift and my friend loved it. It is a beautiful piece | She really enjoys making different fashions and I love that it takes no scissors and she can re-make ... |
81 | BACKGROUND: Cytlogical examinations of serous effusions have been well accepted and a positive diagnosis often considered as definitive diagnosis. It helps for staging and prognosis of the patients for malignancy. Diagnostic problem arise to differentiate between reactive cells and malignant cells by conventional smear (CS) method. Cell block (CB) method provides better architecture, morphological features between reactive mesothelial cells and malignant cells and thereby increases the efficacy of cytodiagnosis. AIMS AND OBJECTIVES: To perform exfoliative cytology of ascitic fluid along with CB preparation and compare the diagnostic efficacy of CS methods verses CB method. MATERIALS AND METHODS: Total 48 samples were subjected to routine smear examination and cell block preparation. These samples are obtained from patients attending N.R.S. Medical College with clinical suspicion of malignancy. RESULTS AND CONCLUSION: Using a combination of the cell block and smear techniques yielded 24% more malignant cases in ascitic fluid. By cell block technique morphological and architectural pattern were better appreciated and increased sensitivity of cytodiagnosis. |
Introduction
The appearance of malignant cells in an effusion is a common complication of malignancy in the pleural, pericardial, or peritoneal space. The detection of malignant cells in the serous effusion indicates a more advanced stage of cancer. The most common causes of pleural effusions are lung cancer, followed by breast cancer. Ovarian cancer is the most common cause of peritoneal effusion, which is detected at diagnosis in two-thirds of cases. By contrast, cancer indicated by pericardial effusion is less common and is detected in only about 2-30% of cancer patients at the time of autopsy (Naylor, 2008). The cytological diagnosis of serous effusion is an important method for the diagnosis of benign and malignant cells, especially when other tests are not available. The accuracy of a cytological diagnosis is thus critical to determining the prognosis and treatment of the patient (Kim et al., 2010). The cytological diagnosis for pleural, pericardial, and peritoneal effusion is an effective method, which not only gives a correct result but is suggestive of the primary origin of cancer. A sensitivity of 52-84% and a specificity of 89-92% of cytomorphological diagnosis has been reported (Motherby et al., 1999;Sen et al., 2015).
The cytological methods of both the direct smear method and the liquid-based cytological method can be used for effusion cytological diagnosis. The direct smear method and liquid-based cytological method are widely used for the preparation of gynecological and nongynecological cytology samples (Sharma et al., 2016). Other researchers have reported that despite the greater cost, the liquid-based cytological preparation resulted in (a) a cleaner background smear, (b) good cell distribution, (c) well-preserved cytomorphology, (d) reduced screening time, (e) well-preserved cells in solution for longer storage time, and (f) decreased air-dry artifacts better than direct smear preparation (Veneti et al., 2003;Gabriel et al., 2004;Nandini et al., 2012;Sigurdsson, 2013 of alcohol, 0.2% formalin, and non-toxic demulcents. The buffer is able to lyse red blood cells, to solubilize many proteins, and to fix cells and small tissue fragments. CRR yields a clean background smear, which preserves both diagnostic cells and cellular immunocytochemistry (Weidmann et al., 1999;Davis-Devine et al., 2003). The current study aimed to develop a modified liquid-based cytology technique for effusion cytology. The diagnostic results were based on cytomorphology and the quality of the background smear, and provided a comparison between the CRR solution and a modified-LBC preparation.
Materials and Methods
The study protocol was reviewed and approved by the Ethics Committee of Khon Kaen University, Thailand. The serous effusions of 110 cases for cytological examination were collected (between August, 2014 andMarch, 2016) from patients at Srinagarind Hospital. The serous effusions were received from 50 cases negative for, and 60 cases positive for, malignant effusions. All fresh serous effusions were processed using both the CRR solution and the modified-LBC preparation.
Processing of CytoRich Red solution
Ten milliliters of effusion sample was centrifuged at 1,600 rpm for 10 min. The supernatant was discarded and re-suspended with 6-10 ml of CRR solution and incubated for 15 min at room temperature. The sample was mixed with a pasteur pipette then 1 ml of sample/slide transferred to a cytofunnel disposable sample chamber, centrifuged at 1,250 rpm for 10 min by Cytospin, then the slide was dipped into 95% ethanol for at least 15 min. The sample was prepared on 2 positive charge slides and using Papanicolaou staining. The method of preparation of the slides was masked but observed by 2 cytotechnologists using a light microscope.
Processing of modified-LBC
Ten milliliters of effusion sample was centrifuged at 1,600 rpm for 10 min. The supernatant was discarded and the remaining protein pellet washed with 0.9% normal saline solution. The solution was centrifuged at 1,600 rpm for 5 min, then 50% ethanol added to the pellet; a ratio 1:1 before incubating for 15 min at room temperature to allow for blood hemolysis. The specimen was then centrifuged at 1,600 rpm for 5 min and re-suspended with 70% ethanol for fixation. The supernatant was mixed with a pasteur pipette, and 1 ml of sample/slide transferred to a cytofunnel disposable sample chamber. Cytospin smears stained with Papanicolaou were prepared on 2 positive charge slides, then observed by 2 cytotechnologists.
Interpretation and statistical analysis
All 110 serous effusion samples were prepared with CRR and modified-LBC then Papanicolaou staining. The respective diagnosis of the 60 malignancy and 50 benign cases were compared using light microscope by 2 independent cytotechnologists. The diagnoses were classified as either negative or positive for malignancy. The quality of the respective background smear studies was classified into the 3 categories: clean, moderate, and poor. The chi-square test was used to analyze the correlation between diagnosis and the quality of the background smear when using modified-LBC vs. CRR. A p-value < 0.05 was considered significant. All statistical tests were performed using STATA version 10.
Results
A total of 110 serous effusions were prepared by modified-LBC and CRR, including 54 (49.1%) pleural effusions, 50 (45.5%) peritoneal effusions, and 6 (5.4%) pericardial effusions. The effusions came from 57 (51.8%) men and 53 (48.2%) women between 27 and 89 years of age (mean 55.9).
Primary diseases in effusions from clinical diagnosis
Fifty benign effusion samples included 15 pleural effusions cases (30.0%), 29 peritoneal effusions cases (58.0%), and 6 pericardial effusions cases (12.0%). The most common primary disease in benign peritoneal effusions was cirrhosis (50%), in pleural effusions tuberculosis (26.7%), and in pericardial effusions chronic pericarditis and congestive heart failure (Table 1). Sixty malignant effusion samples included 39 pleural effusions cases (65.0%) and 21 peritoneal effusions cases (35.0%). The most common primary disease in malignant pleural effusions in males was lung cancer (15 cases; 38.5%) while it was breast cancer in females (13 cases; 33.3%). The most common primary disease in malignant peritoneal effusions in males was cholangiocarcinoma (4 cases; 19.0%) while it Table 2).
Comparison between CRR and modified-LBC preparations
All 110 serous effusion samples were prepared with CRR and modified-LBC and stained with Papanicolaou. The diagnostic results of the respective 60 and 50 malignant and benign serous effusion cases were compared by light microscope by 2 independent cytotechnologists. The results of the diagnoses were classified as either negative or positive for malignancy. All cases, whether malignant or benign, had the same diagnostic results; so there was no statistically significant difference in diagnosis (p>0.999) between the two methods of preparation (Table 3). Figure 1 illustrates how clusters of malignant cells prepared by either CRR or modified-LBC, retained well-preserved morphological features. Metastatic adenocarcinoma of the lung in pleural effusion showed clusters of well-preserved malignant cells with eccentric nuclei, hyperchomatic nuclei, somewhat irregular nuclear membranes, and secretory vacuoles in the cytoplasms.
The quality of the background was classified as: clean, moderate, or poor. In the CRR preparation, the background was clean in 54% (59/110), moderate in 42% (46/110) and poor in 4% (5/110). By comparison, in modified-LBC, the background was clean in 46% (51/110), moderate in 47% (52/110), and poor in 7% (7/110). The p value was 0.527, indicating there were no significant difference between the CRR and modified-LBC preparation (Table 3). Figure 2 shows a comparison of background smears for bloody effusion prepared by CRR and modified-LBC; morphological features are well-preserved and the background is clean by both methods.
Discussion
Serous effusion is a liquid originating from body cavities. We studied the cytopathology of cellular components from various such effusions in patients with a history of a clinical diagnosis (Table 1). Usually, the cytopathologic diagnosis for serous effusion is the gold standard for diagnosis whether or not there is a cancer metastasis at the body cavity (Fashoyin-Aje et al., 2014). Nance et al., (1991) reported that surgical biopsy is less sensitive than effusion cytology for detecting serosal malignancy: that is 45 vs. 71 for detecting biopsy vs. effusion cytology, respectively. Biopsy of focal lesions on the serous surface may be missed, leading to false negatives. Malignant cells, however, exfoliate and accumulate in effusion from all surfaces of the serous cavity and sometimes effusions represent the entire serous cavity.
We compared the quality of a background smear. All effusions were prepared by fixative CRR solution and modified-LBC. We found that the respective CRR preparation resulted in a clean, moderate, and poor background in 54% (59/110), 42% (46/110) and 4% (5/110) of the time. By comparison, the respective modified-LBC preparation resulted in a clean, moderate, and poor background in 46% (51/110), 47% (52/110), and 7% (7/110) of the time. The p value was 0.527 which indicates a non-statistically significant difference between the CRR and modified-LBC preparations; however, the modified-LBC solution was much less expensive than CRR. Our aim was to develop a method(s) for reducing the costs of specimen preparation without compromising quality as compared to using CRR solution. As such, we determined that by this method we can reduce the cost of specimen preparation 75 times. A previous study resulted in 92% clean backgrounds for effusion sample slides using automation CytoRich Red solution system (Dadhich et al., 2016). The clean background in the current study was 54%, which might be due to a difference in the preparation system. If proteinaceous material and/or red blood cells are found on the background of the slide, the malignant cell is obscured and it is difficult to identify abnormal cells. A poor smear background was found in 7% of the preparations, which was likely the effect of alcohol precipitating proteins from the effusion samples.
In conclusion, the preparation method for modified-LBC solution was less expensive than CRR: Modified-LBC solution was 75 times less expensive than the CRR solution: cell preservation and smear background results were as good as CRR. The modified-LBC preparation could be an alternative laboratory method when commercial preparations are unaffordable.
Funding Statement
Research funding included grants from the Faculty of Medicine, and the Graduate School, Khon Kaen University, Thailand.
Figure 1 .
1Metastatic Adenocarcinoma of Lung in Pleural Effusion, A. CRR preparation. B. Modified-LBC. Both A and B showed clusters of well-preserved malignant cells with eccentric nuclei, hyperchomatic nuclei, somewhat irregular nuclear membranes and secretory vacuoles in the cytoplasms (Pap staining x400). Comparative of Modified Liquid-Based Cytology and CytoRich Red Preparation in Serous Effusion was ovarian cancer in females (8 cases; 38.1%) (
Figure 2 .
2Comparison of Background Smear in Bloody Effusion, A: CRR preparation, B: Modified-LBC. Both A and B showed well-preserved morphological features with a clean background by both methods (Pap staining x100).
). Several commercial fixative solutions have become popular choices for liquid-based fixation, including: CytoRich Red (CRR), CytoRich Blue (BD Diagnostics), ThinPrep, and CellPrepPlus. CytoRich Red preservative solution (BD Diagnostics) is the most commonly used around the world, including Thailand. CRR is composed Department of Pathology, Faculty of Medicine, Khon Kaen University, Thailand. *For Correspondence: [email protected] Process: Submission:11/02/2017 Acceptance:05/19/2018
Table 1 .
1Primary Diseases and Types of Benign Effusions Included in StudyFinal diagnosis
with pap stain
Primary disease
Pleural effusions Peritoneal effusions Pericardial effusions
Total
Positive for
malignancy
Lung cancer, AC
24 (61.5%)
3 (14.3%)
0
27 (45.0%)
Breast cancer, AC
13 (33.3%)
0 (0.0%)
0
13 (21.7%)
Ovarian cancer, AC
0 (0.0%)
8 (33.1%)
0
8 (13.3%)
Bile duct cancer, AC
0 (0.0%)
5 (23.8%)
0
5 (8.3%)
Endometrium cancer, AC
0 (0.0%)
1 (33.33%)
0
1 (1.6%)
Unknown
2 (5.1%)
4 (19.0%)
0
6 (10.0%)
Total
39
21
0
60
AC, adenocarcinoma)
Table 2 .
2Primary Diseases and Types of Malignant Effusions Included in Study
Table 3 .
3Comparison of Background Smear and Diagnostic between CytoRich Red and Modified-LBC Preparation † Chi-square test, p value < 0.05
This work is licensed under a Creative Commons Attribution-Non Commercial 4.0 International License.
AcknowledgementsThe authors thank (a) patients and their families for their participation; (b) staff in the cytology lab for their assistance; (c) the Faculty of Medicine and the Graduate School, Khon Kaen University for research grants; and, (d) Mr. Bryan Roderick Hamman for assistance with the English-language presentation of the manuscript under the aegis of the Publication Clinic, Research Affairs, Faculty of Medicine.
A Comparative analysis of conventional cytopreparatory and liquid-based cytological techniques (sure path) in evaluation of serous effusion fluids. H Dadhich, P C Toi, N Siddaraju, K Sevvanthi, Diagn Cytopathol. 44Dadhich H, Toi PC, Siddaraju N, Sevvanthi K (2016). A Comparative analysis of conventional cytopreparatory and liquid-based cytological techniques (sure path) in evaluation of serous effusion fluids. Diagn Cytopathol, 44, 874-9.
New red blood cell lysing fixative for use in fine needle aspiration and fluid cytology. S Davis-Devine, S J Day, G G Freund, Acta Cytol. 47Davis-Devine S, Day SJ, Freund GG (2003). New red blood cell lysing fixative for use in fine needle aspiration and fluid cytology. Acta Cytol, 47, 630-6.
Use of liquid-based cytology in serous fluids: a comparison with conventional cytopreparatory techniques. C Gabriel, R Achten, M Drijkoningen, Acta Cytol. 48Gabriel C, Achten R, Drijkoningen M (2004). Use of liquid-based cytology in serous fluids: a comparison with conventional cytopreparatory techniques. Acta Cytol, 48, 825-35.
Utility of promoter hypermethylation for differentiating malignant and benign effusions in liquid-based cytology specimens. G E Kim, J H Kim, Y H Kim, C Choi, J S Lee, Korean J Pathol. 44Kim GE, Kim JH, Kim YH, Choi C, Lee JS (2010). Utility of promoter hypermethylation for differentiating malignant and benign effusions in liquid-based cytology specimens. Korean J Pathol, 44, 315-21.
Abelloff's clinical oncology. L A Fashoyin-Aje, J R Brahmer, J E Nieder, J O Armitage, J H Doroshow, Malignant effusions. 5th ed. Philadelphia: SaundersFashoyin-Aje LA, Brahmer JR (2014). Malignant effusions. In: Nieder JE, Armitage JO, Doroshow JH, et al, editors. Abelloff's clinical oncology. 5th ed. Philadelphia: Saunders, pp 794-805.
Diagnostic accuracy of effusion cytology. H Motherby, B Nadjari, P Friegel, Diagn Cytopathol. 20Motherby H, Nadjari B, Friegel P, et al (1999). Diagnostic accuracy of effusion cytology. Diagn Cytopathol, 20, 350-7.
Diagnostic efficacy of pleural biopsy as compared with that of pleural fluid examination. K V Nance, R W Shermer, F B Askin, Mod Pathol. 4Nance KV, Shermer RW, Askin FB (1991). Diagnostic efficacy of pleural biopsy as compared with that of pleural fluid examination. Mod Pathol, 4, 320-4.
Manual liquid-based cytology in primary screening for cervical cancer-a cost effective preposition for scarce resource settings. N M Nandini, S M Nandish, P Pallavi, Asian Pac J Cancer Prev. 13Nandini NM, Nandish SM, Pallavi P, et al (2012). Manual liquid-based cytology in primary screening for cervical cancer-a cost effective preposition for scarce resource settings. Asian Pac J Cancer Prev, 13, 3645-51.
Pleural, peritoneal, and pericardial effusions. B Naylor, No Parameter Variables CytoRich-Red N= 110 (100%) Modified-LBCN= 110 (100%) Statistical analysis. Naylor B (2008). Pleural, peritoneal, and pericardial effusions. In: No Parameter Variables CytoRich-Red N= 110 (100%) Modified-LBCN= 110 (100%) Statistical analysis
M Bibbo, D Wilbur, Comprehensive cytopathology. 3rd ed. Edinburgh: SaundersBibbo M, Wilbur D, editors. Comprehensive cytopathology. 3rd ed. Edinburgh: Saunders, pp 515-77.
Morphometric analysis and immunocytochemical staining on cytospin preparation in effusion cytology: a study. R Sen, S Hasija, R Kalra, J Cytol Histol. 10Sen R, Hasija S, Kalra R, et al (2015). Morphometric analysis and immunocytochemical staining on cytospin preparation in effusion cytology: a study. J Cytol Histol, 10, 345-51.
A comparative analysis of conventional and SurePath liquid-based cervicovaginal cytology: A study of 140 cases. J Sharma, P C Toi, N Siddaraju, M Sundareshan, S Habeebullah, J Cytol. 33Sharma J, Toi PC, Siddaraju N, Sundareshan M, Habeebullah S (2016). A comparative analysis of conventional and SurePath liquid-based cervicovaginal cytology: A study of 140 cases. J Cytol, 33, 80-4.
Is a liquid-based cytology more sensitive than a conventional Pap smear. K Sigurdsson, Cytopathol. 24Sigurdsson K (2013). Is a liquid-based cytology more sensitive than a conventional Pap smear?. Cytopathol, 24, 254-63.
Liquid-based cytology in breast fine needle aspiration. Comparison with the conventional smear. S Veneti, D Daskalopoulou, S Zervoudis, E Papasotiriou, L Ioannidou-Mouzaka, Acta Cytol. 47Veneti S, Daskalopoulou D, Zervoudis S, Papasotiriou E, Ioannidou-Mouzaka L (2003). Liquid-based cytology in breast fine needle aspiration. Comparison with the conventional smear. Acta Cytol, 47, 188-92.
Modification of CytoRich Red fixative system for use on bloody Pap and fine-needle aspiration smears. J Weidmann, L C King, M Bibbo, Diagn Cytopathol. 20Weidmann J, King LC, Bibbo M (1999). Modification of CytoRich Red fixative system for use on bloody Pap and fine-needle aspiration smears. Diagn Cytopathol, 20, 95-8.
| Objective To explore the clinical value of cell block and immunochemistry on adenocarcinoma cell in serous cavity effusions.Methods Sixty cases of metastatic adenocarcinoma with serous cavity effusions were choosed and prepared routing cell smears and cell blocks for each case.Cell blocks sections would be applied to the detection of immunocytochemical staining for the cell block sections for CK7,CK18,CEA,TTF-1,Vimentin,Calretinin and MC.Results In 60 of serous cavity effusion samples,CK7,CK18,CEA sensitivity to metastatic adenocarcinoma were 100%(60/60),95%(57/60)and 75%(45/60).The specificity were 100%(60/60),87%(52/60)and 80%(48/60).Conclusion Compared with the conventional cytology smear in cavity effusion cytology,cell block technique and immunocytochemical detection could improve the sensitivity and accuracy of cytological diagnosis significantly and rises to immunological level.It is a approach that is worthy spreading. | INTRODUCTION ::: The diagnosis of malignant ascites is a challenging problem in clinical practice, non-invasive techniques should be developed to improve diagnostic accuracy. The diagnostic performances of tumor markers in malignant ascites remained unsettled. Our aim was to evaluate diagnostic performance of tumor markers in differential diagnosis of benign and malignant ascites. ::: ::: ::: MATERIAL AND METHODS ::: A total of 437 patients were enrolled, and the relevant parameters of the patients were analyzed for the differentiation of benign ascites from malignant ascites. ::: ::: ::: RESULTS ::: At the predetermined cutoff values of tumor makers, tumor markers in ascitic fluid showed better diagnostic performance than those in serum. Combined use of tumor markers and the cytology increased the diagnostic yield of the latter by 37%. In cytologically negative malignant ascites, tumor markers provided assistance in differentiating malignant ascites from benign ascites, and the combination of ascitic tumor markers yielded 86% sensitivity, 97% specificity. ::: ::: ::: CONCLUSION ::: Use of a panel of tumor markers exhibited excellent diagnostic performance in diagnosing malignant ascites, which indicated the detection of tumor markers may represent a beneficial adjunct to cytology, thus guiding the selection of patients who might benefit from further invasive procedures. | Distinguishing reactive mesothelial cells from adenocarcinoma cells in serous effusions on the basis of morphological criteria alone is often difficult. Interest has therefore been focused on identifying reliable methods to supplement the conventional cytological techniques. Plant lectins have been reported as diagnostic markers for malignant cells. We studied 51 aspirated samples of benign and malignant effusions using horseradish-peroxidase-conjugated jackfruit lectin. No significant difference was observed between the cells of pleural and peritoneal fluids. The reactively proliferated mesothelial cells of benign effusions showed a predominence of mild staining while moderate and intense staining was predominant in malignant effusions. Intense and irregular lectin binding was observed in macrophages irrespective of the cause of effusion. The lectin staining method therefore appears to have some clinical significance as an additional diagnostic aid for use in effusion cytology. | Cellient™ automated cell block versus traditional cell block preparation: A comparison of morphologic features and immunohistochemical staining | Studies have compared the role of bone marrow aspirate cytology and trephine biopsy for diagnosing various hematological disorders but fewer studies have compared the relative value of imprint cytology with aspirate and trephine biopsy. The present study was conducted to compare the role of bone marrow aspirate, touch imprint and trephine biopsy to formulate an effective and rapid method for diagnosing wide spectrum of hematological diseases. The study included total 565 cases of bone marrow examination from January 2006 till May 2010. All the smears and sections were reviewed for morphological details and findings on aspirate, imprint and biopsy were compared to each other. The diagnostic accuracy of bone marrow aspirate was 77.5%, imprint cytology 83.7% and that of biopsy was of 99.2%. The study showed 78% positive correlation between aspirate and biopsy and 84.3% between imprint and biopsy; 93.3% cases of metastatic solid tumors were correctly diagnosed on imprint while only 70% cases were diagnosed on aspirate cytology. The study concludes that all the three preparations of aspirate, imprint and biopsy complement each other. The assessment of iron status by Perl's stain is most suitable on aspirate smears but trephine biopsy remains the gold standard for diagnosing granulomatous inflammation and hypoplastic/ aplastic anemia. Meticulously prepared imprint smears not only provide cellular composition of marrow but may also be helpful in defining the architecture of marrow especially in cases of metastatic solid tumors. Imprint cytology smears should be standard practice for evaluating any marrow. | A total of 390 body cavity fluids were analyzed by both cytopathologic examination and flow cytometric DNA analysis. The two methods gave compatible results in analyses of 304 fluids (78%). In 24 patients, cytopathologic studies found the specimens to contain malignant cells, but the DNA content was diploid. This illustrates an area where flow cytometric studies do not extend tumor detection. In 56 fluids from 48 patients, cytologic methods revealed no malignant cells but flow cytometry distinguished aneuploid cell populations; additional clinical information allowed the identification of malignant tumors in 24 (50%) of these patients. Because flow cytometry was able to detect aneuploidy in cases where conventional cytologic examination could not detect malignant cells, the number of patients with tumors detected was increased by 39% beyond those detected by cytologic methods alone in this series. | Carcinoma-specific antibodies would be a useful tool in immunocytology of serous effusions. We tested the carcinoma-’specific’ monoclonal antibody KC4 with cells obtained from pleural effusions evalua | 81 |
INTRODUCTION:
Cytological examination of serous fluid is one of the commonly performed and well accepted examinations. A positive diagnosis is often considered as definitive diagnosis. The first line of investigation of a suspected neoplastic lesion is often the cytological examination of fluid tapped from pleural, peritoneal and pericardial cavity. It is important not only in diagnosis but also staging and prognosis of the patients for malignancy. 1 Accurately diagnosing cells as being either malignant or benign reactive mesothelial cells in serous effusions is a common diagnostic problem in conventional cytological smears (CS). The lower sensitivity of cytodiagnosis of effusions is mainly attributable to bland morphological details of cells, overcrowding or overlapping of cells, cell loss, and changes due to different laboratory processing methods. 2 Cell block (CB) method provides better architecture, morphological features between reactive mesothelial cells and malignant cells and thereby increases the efficacy of cytodiagnosis. 3 The present study was undertaken to assess the utility of cell-block preparation method in increasing the sensitivity towards cytodiagnosis of malignant effusions and compare the diagnostic efficacy of conventional cytological methods for effusion versus cell-block techniques.
MATERIALS AND METHODS:
From February 2012 to July 2013, a total of 48 peritoneal effusion fluids were collected with clinical suspicion of malignancy in the Department of Pathology, NRS Medical College and Hospital, Kolkata after taking proper informed consent from the patients. Ten milliliters of fresh ascetic fluid sample was received and divided into two equal parts. One part subjected to conventional smear and staining and the remaining fluid was subjected to cellblock technique.
Conventional Smear Technique:
For conventional smear 5 ml of fluid was centrifuged at 2500 rpm for 15 minutes and a minimum of two thin smears were prepared from the sediment. One smear was air dried and stained with Leishman-Giemsa stain and the other smear was immediately fixed in 95% alcohol and stained with Papanicolaou stain.
Cell Block Technique: Remaining 5ml of fluid was processed for cellblock method. The fluid was centrifuged at 3000rpm for 5 minutes. The supernatant was decanted and the excess fluid was removed by inverting on the filter paper. To this sediment 2-3drops of plasma and 2-3 drops of thrombin was added and mixed well. Then this mixture of fluid was allowed to clot for 30 seconds. After that the clot was dislodged from the test tube and fixed in 1:1 mixture of alcohol formalin for one hour. Further the clot was transferred with the help of a pointed spatula on the top of lens paper inside the tissue cassette and then processed for paraffin embedding. Paraffin embedded 4-6µ thick sections were routinely stained with Hematoxylin and Eosin stain. Special stain like Periodic Acid Schiff (PAS) was performed wherever necessary. After studying all the available clinical data and various investigation reports, based on morphology the smears were categorized as benign, suspicious for malignant and malignant lesions.
The following morphological criteria such as cellularity, arrangement of cells (Acini, papillae and cell balls), cytoplasmic and nuclear details were used for giving the cytological diagnosis. Comparative evaluation of conventional smear versus cellblock technique was done and tabulation of cytomorphological characters was studied to identify the malignancy and most probable primary site.
The cellular material in conventional smear is considered to be mild when there are 5-50 nucleated cells per high power field, moderate when there are 50-200 cells per high power field and marked when there are >200 cells per high power field. The cellular material in the cellblock is mild when there are 5-200 nucleated cells per high power field, moderate when 200-1000 cells per high power field and marked when there are >1000 cells per high power field.
RESULTS:
Comparative evaluation of conventional smear versus cellblock technique was done. The data was tabulated and statistical analysis performed to see sensitivity, specificity, positive predictive value and negative predictive value to asses our study. Out of 48 ascitic fluids a mild male preponderance with male to female ratio 1.5:1 was noted. The maximum number of samples was in the age group of 51-60 years (25%). In males the maximum number of samples was in the age group of 51-60 years. In female the maximum number of samples was in the age group of 41-50years and 51-60years. Least number of samples was in the age group of 11-20 years. (Table 1). In case of ascitic fluids, in cellblock method 68% cases show marked cellularity while in conventional smear only 36% cases show marked cellularity. Singly scattered cells are more common in conventional smears and cell clusters, papillae are more common in cellblock.
Out of the 48 ascitic fluid samples cytological diagnosis of benign effusions was rendered in (76%) cases and suspicious for malignancy in (16%) cases where as in cellblock malignant effusions were diagnosed in (32%) cases. There was no diagnosis of suspicious for malignancy in cellblock. (Table 1). In ascitic fluid, out of 48 cases difference in diagnosis were noted in 12 cases. Among them 4 cases were diagnosed as benign effusion on conventional smear. Other 8 cases were diagnosed as suspicious for malignancy. By cellblock method additional 12 malignant cases were diagnosed. There is 24% more diagnostic yield for malignancy. Total number of 17 ascitic fluid samples was diagnosed as malignant effusions by cell block method. Out of 17 cases of ascitic fluid primary was identified in 11 cases. The sensitivity and specificity of our study is 100% and 76% respectively. The positive predictive value is 41% and negative predictive value is 100%. Accuracy rate is 80%. Kappa value is 0.475 which indicates moderate agreement.
DISCUSSION:
Cytological examination of serous fluids has increasingly gained acceptance in clinical practice to such an extent that a positive diagnosis often is considered the definitive test and obviates exploratory surgery. 4 Reactive mesothelial cells, abundance of inflammatory cells and paucity of representative cells contribute to considerable difficulties in making conclusive diagnosis on conventional smears. 5 In this study an attempt was made to prepare and analyze both smears and cellblock from the same specimen. Due consideration was given to age, sex, site of effusion and clinical and radiological findings to arrive at final diagnosis and also to identify primary malignant lesion. In the present study we evaluated conventional smears and cellblocks preparation for cellularity, architectural pattern, predominant cells, volume of obscuring background and the preservation of morphology. Here mild cellularity was observed in 40% samples and 24% samples show marked cellularity with conventional smear preparation where as in cell block method marked cellularity was observed in 52% samples. Chi-Square test for linear trend revealed statistically significant value indicating that the cellular yield was more with the cellblock method as compared to conventional smear method ( Table 1).
The cellblock concentrated the cellular material into a small area which was useful in screening the material in lesser time. Similar findings were noted in studies by Thapar et al, 2 Dekker et al, 4 Krogerus et al, 6 Yang et al. 7 Samples also show architectural patterns such as sheets, glands, papillae etc. In conventional smear 60% cases show single scattered cells whereas only 27% cases show single scattered cells in cellblock method. Here also Chi-Square test for linear trend revealed statistically significant value. Pseudoacinar or acinar structures and nucleoli were better appreciated in our study when compared to conventional smears. The reactive or atypical mesothelial cell which stimulate malignancy in smears were identified as reactive or mesothelial cells by cellblock method. Similar findings were noticed in Dekker and Bupp study. 4 In a study by Dekker et al, 4 the rate of recovery of tumor cells by cellblock preparation was double that obtained by smear alone. By using cellblock method tumours were subsequently demonstrated in 38% of the patient who had negative or atypical cytological reports. Thaper et al, 2 showed a diagnostic yield of 20% by cellblock preparations. The present study yielded 24% more malignant cases in ascitic fluid. In a study done by Khan et al, 8 additional findings were diagnostic in 16% of malignant cases. Khan et al,8 in another study titled as '' Usefulness of cellblock verses smears in malignant effusion cases '' reported that the recovery rate for malignant lesions by cellblock preparation was 20% greater than that obtained for specimen examined in smear only.
In ascitic fluid, out of 48 cases difference in diagnosis was noted in 12 cases. Among them 4 cases were diagnosed as benign effusion on conventional smear. Other 8 cases were diagnosed as suspicious for malignancy. By cellblock method additional 12 malignant cases were diagnosed. There is 24% more diagnostic yield for malignancy. The degenerating mesothelial cells appear like signet ring cells, with large vacuoles replacing the nucleus to periphery and thus can be misleading. Similar findings were also observed in studies by Dekker et al. 4, Takayagi et al, 9 Chapman et al, 10 and Vellios et al. 11 When conventional smears were compared with cellblock preparation for morphological preservation, the cellblock sections showed clearly recognizable cells with minimal shrinkage and aberrations. The cytomorphologic features were well maintained with minimal shrinkage and aberration. The findings were similar to the findings in the studies by Thaper et al, 2 Dekker et al. 4 Nathan et al, 3 and Takagi et al. 9 Studies by Takagi et al, 9 Vellios et al 11 The Disadvantages of the Cellblock Preparation are: Delay in diagnosis when compared to conventional smears. Loss of cellular materials and cytological details during processing. The techniques received not much attention, probably due to lack of standardized cost effective methods that achieve better diagnostic results.
The Limitations of the Present Study are:
Inadequate sample in some cases resulting in inadequate cell block. Total no of cases are low, observation could have been more representative and more statistically significant if number of cases were more. Immunohistochemistry could not done, which could have been more informative.
CONCLUSION:
Cytological examination of serous fluid is one of the commonly performed examinations. It is important not only in diagnosis but also staging and prognosis. The diagnostic performance of cytological study of fluid may be attributable to the fact that cell population present in sediment is representative of larger surface area than that obtained by needle biopsy. Cell block technique is simple, inexpensive and does not require any special training or instrument. Morphological features were better identified by cell block method when compared to conventional smear method. Multiple sections can be obtained if required for special stain or IHC study. It bridges the gap between cytology and histology. Therefore, a combined approach of conventional smears and cell block technique helps to get an additional diagnostic yield for malignancy in suspected pleural effusion and ascetic fluid samples.
and Sears et al12 have suggested a clear preference for cellblock sections in cytological examination of effusions. Takagi et al9 concluded that the results of Papanicolaou method can be improved with increased volume of fluid to be centrifuged. Vellios et al 11 stated that Papanicolaou stain offers excellent nuclear and cytoplasmic details and errors may be avoided by proper attention to technical details. Out of 17 cases of ascitic fluid primary was identified in 11 cases which included 8 cases of ovarian tumor and 3 cases from carcinoma of GIT.The advantages of the Cellblock Preparation are: Recognition of histologic patterns of diseases that sometimes cannot be identified reliably in smears. Possible processing of the multiple sections of the same material for routine staining, special staining and immunologic procedure, Less cellular dispersion, which permits easier microscopic observation than do the conventional smears, Less difficulty in spite of background showing excess blood on microscopic observation, Lower cost than the biopsies. Possibilities of storing slides for retrospective studies. Storage of the conventional smear is a practical problem.
Fig. 1 :
1Photomicrograph showing clusters and papillae of malignant cells in conventional smear (Leishman stain, 40x). Fig. 2: Photomicrograph showing malignant cell clusters o in cellblock (H & E, 40x).
Cytopathlogic diagnosis of serous fluids. V B Shidham, B Atkinson, WB Saunders. ElsevierShidham V B, Atkinson B F. Cytopathlogic diagnosis of serous fluids. Elsevier, WB Saunders, 2006; 1-55.
Critical analysis of cellblock versus smear examination in effusions. M Thapar, R K Mishra, A Sharma, V Goyal, Journal of cytology. 262Thapar M, Mishra RK, Sharma A, Goyal V. Critical analysis of cellblock versus smear examination in effusions. Journal of cytology 2009; 26(2): 60-64.
Cellblock cytology-Improved preparation and its efficacy in diagnostic cytology. N A Nathan, E Narayan, M M Smith, M J Horn, Am J Clin Pathol. 114Nathan NA, Narayan E, Smith MM, Horn MJ. Cellblock cytology-Improved preparation and its efficacy in diagnostic cytology. Am J Clin Pathol 2000; 114: 599-606.
Cytology of serous effusions. An investigation into the usefulness of cellblocks versus smears. A Dekker, P A Bupp, Am J Clin Pathol. 706Dekker A, Bupp PA. Cytology of serous effusions. An investigation into the usefulness of cellblocks versus smears. Am J Clin Pathol 1978; 70(6):855-60.
comparison of smears and cellblocks in the fine needle aspiration diagnosis of recurrent gynecological malignancies. E M Wojcik, S M Selvagi, Acta Cytol. 356Wojcik EM, Selvagi SM, comparison of smears and cellblocks in the fine needle aspiration diagnosis of recurrent gynecological malignancies. Acta Cytol 1991; 35 (6):773-6.
A simple method for the preparation of paraffin embedded cellblocks from fine needle aspirates, effusions and brushings. L A Krogerus, L C Anderson, Acta Cytol. 324Krogerus L A, Anderson L C. A simple method for the preparation of paraffin embedded cellblocks from fine needle aspirates, effusions and brushings. Acta Cytol 1998; 32 (4): 585-7.
Compact cellblocks use for body fluid, fine needle aspirations and endometrial brush biopsies. G C Yang, L S Wan, J Papellas, J Waisman, Acta Cytol. 48Yang GC, Wan L S, Papellas J, Waisman J. Compact cellblocks use for body fluid, fine needle aspirations and endometrial brush biopsies. Acta Cytol 1998; 48: 703-6.
Usefulness of cellblocks versus smears in malignant effusion cases. N Khan, K R Sherwani, N Afroz, S Kapoor, Journal of cytology. 233Khan N, Sherwani KR, Afroz N, Kapoor S. Usefulness of cellblocks versus smears in malignant effusion cases. Journal of cytology 2006; 23(3): 129-132.
Studies on tumor cells in serous effusion. F Takagi, Am J Clin Pathol. 24Takagi F. Studies on tumor cells in serous effusion. Am J Clin Pathol 1954; 24: 663-75.
The examination of serous fluids by cellblock technique. Chapman Cb, E J Whalen, New Engl. J. Med. 2377CB and Chapman Whalen EJ. The examination of serous fluids by cellblock technique. New Engl. J. Med 1947; 237(7):215-20.
The examination of body fluids for tumor cells. F Velios, J Griffin, Am J Clin Pathol. 24Velios F, Griffin J. The examination of body fluids for tumor cells Am J Clin Pathol 1954; 24: 676- 681.
The cytological diagnosis of malignant neoplasms in pleural and pericardial effusions. D Sears, S I Hajdu, Acta Cytol. 312Sears D, Hajdu SI. The cytological diagnosis of malignant neoplasms in pleural and pericardial effusions. Acta Cytol 1987; 31(2):85-97.
| Objective:We aimed to compare the cytomorphological diagnosis in serous effusion and quality of background between modified liquid-based cytology (modified-LBC) and CytoRich Red (CRR) preservative. Methods: We used an experimental study design: 110 fresh serous effusions were received from 50 cases negative for malignant effusions and 60 cases positive for malignant effusions. All fresh serous effusions were processed using both the CRR solution and the modified-LBC preparation. Blind sample slides were interpreted for cytomorphological diagnosis and the quality of background by 2 cytotechnologists. Result: All cases had the same diagnosis irrespective of the method. There was no statistically significant difference in the cytological diagnosis between the CRR and modified-LBC preparations (p>0.999). The quality of the background smear for the CRR preparation was clean (54%), moderate in 42%, and poor in 4%. By comparison, the modified-LBC preparation was clean in 46%, moderate in 47%, and poor in 7%. The difference between the quality of background smears between the two methods was not statistically significant (p= 0.527). Conclusion: There was no statistically significant difference in the diagnosis or quality of background between CRR and modified-LBC preparations. The serous effusion specimen prepared by modified-LBC solution was less expensive than CRR. The modified-LBC could be an alternative preparation when commercial preparations are too expensive. | Background: Pleural fluid cytology for malignant cells is the easiest way to diagnose malignant pleural effusion with good sensitivity and specificity. With the introduction of medical thoracoscopy, the use of closed pleural biopsy for the diagnosis of cytology negative malignant pleural effusion is gradually decreasing. However use of thoracoscopy is limited due to its high cost and procedure related complications. Aims: The aim was to assess the usefulness of closed pleural biopsy in the diagnosis of malignant pleural effusion. Materials and Methods: Sixty-six patients of pleural effusion associated with malignancy were selected from the patients admitted in the chest ward of a tertiary care hospital over a period of 1 year. Pleural fluid aspiration for cytology and closed pleural biopsy were done in all the patients. Results: Out of 66 patients, 46 (69%) patients showed malignant cells in pleural fluid cytology examination. Cytology was positive in 35 (52%), 10 (15%), and 1 (1.5%) patients in the first, second, and third samples respectively. Closed pleural biopsy was positive in 32 (48%) patients. Among them, 22 also had positive cytology. Additional 10 cytology negative patients were diagnosed by pleural biopsy. Cytology-histology concordance was seen in 12 patients. Definite histological diagnosis could be achieved in five patients with indeterminate cytology. Pleural biopsy was not associated with any major postoperative complication. Conclusion: Closed pleural biopsy can improve the diagnostic ability in cytology negative malignant pleural effusion. Closed pleural biopsy has still a place in evaluation of malignant pleural effusion especially in a resource-limited country like India. | Objective To evaluate the combined diagnostic value of three tumor markers in elderly patients with pleural effusion.Methods Sixty-four serum and 64 pleural fluid samples were collected from 64 patients with pleural effusion.Among them,34 patients presented with malignant pleural effusion and 30 patients with benign pleural effusion.The concentration of CEA,CYFRA21-1 and NSE was determined by immunoradiometric assay.Results The levels of CEA,CYFRA21-1 and NSE in serum and pleural fluid taken from patients with malignant pleural effusion were significantly higher than those from patients with benign pleural effusion(P0.01).The diagnostic sensitivity and specificity of CEA,CYFRA21-1,NSE for malignant pleural effusion were as follows:79.4% and 86.7%,79.4% and 83.3%,70.6% and 73.3% in serum,and 82.4% and 83.3%,79.4% and 80.0%,64.7% and 70.0% in pleural fluid,respectively.The sensitivity and accuracy of CEA combined with CYFRA21-1 were increased to 97.1% and 92.2% in serum,97.1% and 90.6% in pleural fluid.The parallel combined testing of three tumor markers of serum and pleural fluid increased the sensitivity to 100%,and serial combined testing increased the diagnostic specificity to 100%.Conclusions Tumor markers of CEA,CYFRA21-1 and NSE have high clinical values in the differential diagnosis of pleural effusion in elderly patients.The combined assay of CEA and CYFRA21-1 is recommended. | During a period of two years (1977 to 1978), 5,185 cerebrospinal fluid (CSF) specimens were examined in the Cytology Laboratory of Memorial Sloan-Kettering Cancer Center. Malignant cells were identified in 853 specimens. Of the positive specimens, 524 were obtained from 118 patients with nonlymphoreticular metastatic neoplasms. The most common tumors were mammary carcinoma (37%), pulmonary carcinoma (27%) and malignant melanoma (18%). The majority of epithelial tumors (77%) were adenocarcinomas. The interval between the primary diagnosis of malignancy and the time of first positive cytology varied significantly according to the type of neoplasm. The interval was approximately five times longer in patients with breast carcinoma and malignant melanoma (52 months) than in cases of lung carcinoma and bladder carcinoma (11 and 9 months, respectively). The prognosis, however, was invariably grave. Seventy-five percent of patients with follow-up died within 100 days of the first positive CSF. The tumor cells were often relatively small, with slight anisocytosis and pleomorphism as compared to their counterparts in other cytologic material. Cytology of the various neoplasms is presented, with attention to the morphologic changes during the follow-up period. | Making a differential diagnosis between malignant and non-malignant ascites is an important clinical issue, but cytological examination has a relatively low diagnostic sensitivity. This study aimed to find a discriminative model that distinguished between malignancy-related and non-malignant ascites. The study included 107 patients: 50 with non-malignant and 57 with malignant ascites. Ascites was analysed using a range of tumour markers and standard cytology. Standardized canonical discriminant function coefficients were used to distinguish between ascites types. The combination of carbohydrate antigen (CA) 15-3, carcinoembryonic antigen (CEA) and cytokeratin 19 fragments (CYFRA-21.1) discriminated between malignancy-related ascites and non-malignant ascites with an accuracy of 98.8% compared with an accuracy of 77.8% for cytological examination. In conclusion, the use of a discriminant function constructed from a combination of CA15-3, CEA and CYFRA-21.1 could distinguish malignant from non-malignant asc... | Background: Due to the high false-positive rate of the high-fluorescence body fluid (HF-BF) cell parameter of the hematology analyzer in BF mode, a novel algorithm based on the Mindray BC-6800 Plus hematology analyzer (BC-6800Plus), with higher diagnostic accuracy compared to that of the traditional HF-BF algorithm, was used to screen for malignant tumor cells in clinical BF samples. In this study, the body fluid mode of BC-6800Plus was applied to investigate the ability of its available parameters and characteristic regional particles in tumor cells screening.Methods: A total of 220 BF samples (including pleural effusion and ascites) were randomly classified into a training cohort (154 samples) and a validation cohort (66 samples), and detected on the BC-6800Plus in BF mode. Based on the scatter plot analysis of the instrument, a novel gating algorithm, malignant cell algorithm-body fluid (MA-BF), was designed to detect the aggregated cells expressing highest fluorescence (FL) signals and side-scatter (SS) signals than other cells. BF collection and analyses were performed in compliance with the CLSI H56-A guideline. tumor cell-positive samples were defined as greater than or equal to confirIIIb (Papanicolaou class system) by the pathological examination. The diagnostic accuracy of HF-BF and MA-BF were determined by the receiver operating characteristic (ROC) curve analysis.Results: When the cutoff values of the absolute count (HF-BF#) and relative count (HF-BF%) were set as 0.022×10 9 /L and 3.0%, respectively, the area under curve (AUC), sensitivity, and specificity were 0.76, 0.85 and 0.55 for HF-BF#, and were 0.70, 0.85, and 0.49 for HF-BF%, respectively. The new parameters, the absolute tumor cell count (MA-BF#) and relative count (MA-BF%), were established in the training cohort using the novel algorithm. We confirmed the cutoff values of MA-HF# and MA-HF% in BF were set as 0.006×10 9 /L and 0.2% in the training cohort, respectively. In the validation cohort, the AUC, sensitivity, and specificity were 0.89, 0.93, and 0.78 for MA-BF#, and were 0.89, 0.87 and 0.75 for MA-BF%, respectively.Conclusions:The MA-BF parameters of the novel algorithm output had better diagnostic accuracy for BF tumor cells than the traditional HF-BF parameters. | PURPOSE:Mediastinal lymphadenopathy (ML) is a cause for concern, especially in patients with previous malignancy. We report our experience with the use of endoscopic ultrasound-guided fine needle aspiration (EUS-FNA) with immunocytochemical stains in patients being evaluated for ML.METHODS:Retrospective analysis of patients with ML of unknown origin who underwent EUS-FNA. On-site evaluation was performed by experienced cytologist, and special immunocytochemical stains were requested as indicated.RESULTS:A total of 116 patients were included, and a total of 136 mediastinal LN were sampled. Prior malignancy was present in 45%. The most common site of examined lymph node (LN) were subcarinal (76%, 103 LN). The median long and short axis diameters were 28 mm and 13 mm, respectively. FNA was read on-site as malignant, 21 (16%); benign, 100 (76.9%); suspicious, six (4%); atypical, 3 (2%); and inadequate sample, six (4%). Sixty-four LN were deferred for additional studies; 22 for immunocytochemical and 26 for Gimesa (GMS) stain and 21 for flow cytometry. Final FNA read was malignant in 28 (21%), benign in 103 (76%), suspicious in three (2%), and atypical in two (1%). Metastatic malignancies disclosed included Hodgkin's and Non-Hodgkin's lymphoma, melanoma, hepatoma, breast, lung, colon, renal, endometrial, Fallopian tube, and unknown carcinoma. The sensitivity, specificity, and accuracy of the final FNA read to predict malignancy were 100%.CONCLUSION: EUS-guided FNA with additional ancillary studies is useful in disclosing metastatic ML from a variety of neoplasms. Due to its safety and accuracy profile, it should be considered the test of choice in evaluating abnormal ML in appropriately selected patients. | BACKGROUND: New information is available on pleural diseases. The authors selected articles to make recommendations on diagnostic and treatment aspects of pleural diseases.MATERIALS AND METhODS:Eleven articles published in the English language between 2004 and 2007 were chosen. The basis of selection of the articles was the impact on daily practice, change in prior thinking of a disease process or specific treatment modality, as well as proper design and execution of the study. 5-amino-laevulinic acid with fluorescent light combined with white light may allow further diagnostic yield in undiagnosed pleural disease. FDG-PET may allow prognostication of patients with pleural tumors. Utilizing ultrasound by trained Emergency Department physicians is a rapid and effective technique to evaluate non-traumatic pleural effusions in symptomatic patients. Serum osteopontin levels may distinguish patients exposed to asbestos with benign disease from those with pleural mesothelioma. Administration of streptokinase in patients with empyema does not need for surgical drainage, length of hospital stay, or mortality as compared to conventional treatment with chest tube drainage and intravenous antibiotics. Silver nitrate may be an alternative agent to talc for producing pleurodesis. Routine use of graded talc (50% particles greater than 25 microns) is recommended to reduce the morbidity associated with talc pleurodesis. Study design does not permit us to conclude that aspiration of spontaneous pneumothorax is as effective as chest tube drainage. Pleural catheter may prove to be an important palliative modality in treating debilitated patients or patients with trapped lung who show symptomatic improvement with drainage; however, at the present time, these catheters cannot be considered a first line treatment option for patients with malignant pleural effusion. One of the studies reviewed showed no significant difference in tract metastasis in patients with malignant mesothelioma undergoing an invasive pleural procedure with or without irradiation to the procedure site. However, the design of the trial does not allow us to make this conclusion at the present time. |
82 | Any Scanners/Trackers Still Working? | We have had this for 2 years now and use it for scaning all bills, receipts, medical records and other documents to PDF.
We love the size and ease of use.
Rarely is there a tracking issue.
Quality of scan is very good. | Scanner was fine. I thought in reading the description it was an upgraded version. I already had one like the one I ordered. | This little scanner is really quite awesome. I use it all the time. | I have this unit also, this is by far best scanner for the money... | I have spent a lot of money on scanners in the past. I have to have a good one for my job. This one works just as well as the high dollar (yes this is still expensive but I have spent more) ones. Very fast and legible scans. Easy to use. | does not have USB PORT, Does not self load for scanning. scans crooked so far for everything I try.... very disappointed | This scanner works as well as described. (NOTE: I do not like replacing equipment because the computer manufactures keep changing USB interface software protocols, and while scanner manufactures try to keep up with software upgrades, they are not always successful. Or choose to not upgrade the software and force users to buy new hardware. In my graphics shop, I have bought over 15 scanners, all of which still work with the older computers/operating systems that they originally started out with. However, they do not work on computers running the latest version of operating systems. The good news is that the prices of scanners today allow them to be considered consumable, and replaceable.) | We have gotten this NEAT scanner, and it is a great help in our office and shoppe.
We had some minor issues,and when we called the support desk, Neaven,
their support representative, was extremely helpful, very nice, and resolved our issues quickly.
It was a very nice surprise to find so helpful a support desk.
We highly recommend Neat. | 82 | A group of friends and I are heading down to Coronado tonight and scanners/trackers would really help :) | This is a great project! | M28 - Sweden/Europe/Anywhere - Looking for someone who can brighten up my (work) day | I'm walking across the US and I'm in Lake Charles. Let's Hang out [xPosted across related reddits :] | [PSA] Universal Cartographics is now available at Jacques Station (full facilities are present) | What would a good scanner to use be for mid-day market? | 26/M/LA Ahoy! Looking for a pretty wench to set sail with tonight! | FT: Pliny ISO: westy 12... will be in belgium see post | Shining Splendor Inventory Tracker |
83 | What do I do with my mail when I'm switching apartments? | I bought this house almost four months ago and the last tenant that had lived here moved out two weeks before that (with others over a month before), but I still receive a sizable amount of their mail. I get everything form Shopko mailers for one person, personal letters (look like birthday cards/party invites), even vehicle/driver's license renewal notices. I toss the BB&B, Shopko, etc. mailers in recycling and write "No Longer At This Address" on everything else and chuck it back in the mail box. They clearly never even did the change of address form. What can or should I be doing?
Thank you for your time. | I am moving to a different apartment in the same building on August 24, 2019. Basically I am moving from XXXX Drive, Apt 3X1, City, State, ZIP to XXXX Drive, Apt 3X3, Same City, Same State, Same ZIP. I filed a request for Change of Address online on August 15, 2019 to be rendered effective on **August 24, 2019**. However, since filing that request I have stopped getting any mail addressed to me. I see it on informed delivery that I had mail for Monday, August 19 that should have been delivered to me but it isn't there.
I am confused why this is. Have they lost my mail or just stopped? I checked the new apartment's mailbox too and it doesn't have anything in it. I didn't think they would stop sending me mail before August 24, since technically I haven't moved yet.
I'm very worried because I have documents from Immigration services that were to be delivered today that haven't arrived and I CANNOT miss that letter. I have updated Immigration (USCIS) about my pending move, but they had mailed this letter before I registered my address change.
What do I do about this? | The first thing I'm going to do from now on when moving apartments, is get one of these and replace the bedside outlet. It's a simple change (if you haven't learned how to change an outlet, you should - turn off the breaker, unscrew the old cover and outlet, swap the 2 or 3 wires from the old unit to the new one, put back together, turn the breaker back on) that makes a huge difference. I went from having a power splitter with 2 wall warts (for my phone and tablet) plus lamp and clock, to having all 4 things plugged directly in. Much cleaner and simpler (and safer), and all my electronics are happy. Highly recommended. | I am moving to a new apartment today and I made a list of all the services where I have to update my address. I think it might be useful to anybody else who might be moving for next school year.
1. USPS
2. DMV
3. Bank accounts
4. Credit Cards
5. UIUC Self-Service
6. Any online shopping site that has your address saved
Feel free to add to the list if I have missed anything. | Hey LA, google didn't help much so I wanted to better understand the legality of all this. My partner and I moved into an apartment about a month ago and the lease specifies that we will get 2 house keys and 1 mailbox key. We didn't know until we moved in that the landlord kept the other mailbox key and frequently checks the mail. They get all of their mail here (from what I can tell), including bills, etc. They refused to do mail forwarding to their address because they said it has been unreliable recently which doesn't make sense because obviously we had to get our mail forwarded here when we moved. In the end we agreed that they would only come get the mail on Sundays. My partner and I are both in the medical field and sometimes get PHI sent in the mail, which we told the landlord, but they wouldn't budge. Is this legal? Thanks! | I get alot of mail shipped to my box that's addressed to my apartment number, but names someone else. That or its for someone else and is addressed wrong. What do I do with it? | I moved into an apartment almost 2 months ago now and I have been receiving the old tenant's mail. It's mostly insurance and retirement things so I'm guessing it's probably somewhat important. The entire time I've been scribbling out my address and writing "Return to Sender" on every envelope then mailing it out again from my box or from my office.
Well, today I got home to my mailbox being overstuffed. It was completely full of the letters I returned with "Return to Sender" scribbles out and my address and the old tenant's name hand written on every one.
I called the post office since I already asked them to stop delivering her mail to me and they just told me to put it back in the box again. Is there anything I can do that will actually stop this?
(It's the USPS, and speaking from previous experience with them I'm not expecting much) | There will not be a permanent resident for the foreseeable future, and I'd love to stop receiving mail for previous occupants as well as the mountains of junk mail that come through. Can I request it be labeled as vacant, or is that up to the USPS to decide to stop mail delivery?
&#x200B;
Thanks for any help :) | 83 | I have a 9 day gap between moving out of my current apartment and moving into my new one (thanks rental companies). I know I can set up mail forwarding from my old address, but what do I do with the 9 days where I don't have an address? | How can I take steps before a move to make sure my address is not easily accessible online? | How do I put my apartment address down so that it goes to my mailbox? | where does the mail go without a return address | Moving next week. What' the best way to contact them? | How to move my base to another place ? | when do you have to change your address | What to do about moving, new address and extended family when NC? Help please! | What do I do with incorrect mail in my apartment? |
84 | The philosophy of Jaakko Hintikka | Samkhyakarika perception as the immediate knowledge one gains by the interaction of sense organ with anything; inference, it defines as the knowledge one gains based on meditation on one's perception; and testimony as that knowledge one gains from the efforts of those one considers as a reliable source; it then succinctly asserts that there are three types of inferences for the epistemic quest of man, without explaining what these three types of inferences are. Verse 6 asserts that objects can be known either through sensory organs or through super-sense (inner derivation from observations). Verse 7 of the "Karika" states that perception | in every person and can be awakened through the Buddhist practice prescribed by Nichiren. Further, a person's social actions at every moment can lead to "soka", or the creation of value (the theory of the interdependence of life). Societal change is facilitated through "human revolution", a way of living in the world that creates value. The doctrine of the Soka Gakkai derives from Nichiren, who promulgated the Lotus Sutra as he perceived its application to the epoch in which he and people today live. Soka Gakkai gives significance to Nichiren's writings, as Gosho, and Soka Gakkai refers to the collection | as the doctrine of "many-sidedness", "non-onesidedness", or "many pointedness". The term "anekāntavāda" is not found in early texts considered canonical by Svetambara tradition of Jainism. However, traces of the doctrines are found in comments of Mahavira in these Svetambara texts, where he states that the finite and infinite depends on one's perspective. The word anekantavada was coined by Acharya Siddhasen Divakar to significant the teaching of Mahavira that truth can be expressed in infinite ways. The earliest comprehensive teachings of anekāntavāda doctrine is found in the "Tattvarthasutra" by Acharya Umaswami, and is considered to be authoritative by all Jain sects. | practiced. Charvaka Charvaka (IAST: Cārvāka), originally known as Lokāyata and Bṛhaspatya, is the ancient school of Indian materialism. Charvaka holds direct perception, empiricism, and conditional inference as proper sources of knowledge, embraces philosophical skepticism and rejects Vedas, Vedic ritualism, and supernaturalism. Ajita Kesakambali is credited as the forerunner of the Charvakas, while Brihaspati is usually referred to as the founder of Charvaka or Lokāyata philosophy. Much of the primary literature of Charvaka, the Barhaspatya sutras (ca. 600 BCE), are missing or lost. Its teachings have been compiled from historic secondary literature such as those found in the shastras, sutras, and | Master Polikarp's Dialog with Death speculate that Mikołaj Rej has re-written the original text for print. One of the unique features of the work is its use of humour. The dialog mocks monks and priests, inn-keepers, fat women, dishonest physicians and unjust judges. The original version of the dialogue has been lost; what remains is an incomplete copy from ca. 1463-1465, belonging to Mikołaj of Mirzyniec (Mikołaj z Mirzyńca). The ending of the work was known due to its 16th century Russian translation. It has 498 lines, and presents everyday life scenes of members of different social classes of 15th century Poland. An unknown printed | The paper examines the spiritual practice of Kiai Tawakkal in Gus Mus’ Gus Jakfar implementing Slavoj Žižek’s theory of subject. The articles which combine these two scientific dimensions needs to be done because there are no similar studies which have been previously conducted. In addition, by using Žižek’s theory, it is expected that readers will be able to understand Sufism from a "rational" perspective. The results of this study indicate that suluk carried out by Kiai Tawakkal explicitly breaks the symbolic boundaries adopted by Gus Jakfar and the surrounding community. This act becomes a means for Kiai Tawakkal to reach the Real, or the Haq. | The present paper explores the relation of the riddle hymn, Rgveda 1.164, with the Pravargya ritual, one of the few rituals that are explicitly referred to in the Rgveda, Starting from a few verses which have a well-established and generally acknowledged relation with specific episodes in the Pravargya ritual (about which we have detailed information only from later texts), this paper shows that several other enigmatic verses yield a convincing interpretation when placed in the context of the Pravargya. The ritual interpretations can, moreover, serve to clarify and harmonize some of the traditional, more philosophical interpretations of the verses. Thus, the findings have important implications for our understanding of the early development of Vedic ritual and also of Indian thought and philosophical speculation. | Sveiki,
Gal kažkam yra tekę naudotis siuntinių tarpininkų paslaugomis siunčiantis daiktus iš JAV?
Reikia vieno daikto, bet nesinori mokėti nelogiškai didelio mokesčio už siuntimą.
Esu girdėjęs, kad yra firmelių, kurios tuo užsiima. Randu nemažai tinklapių, netgi kažkokių neaiškių FB grupių, bet taip ir nežinau kuo galima pasitikėti. | 84 | One of the world's most influential logicians, Jaakko Hintikka is a leading figure on the international philosophical scene. Here, he responds to his critics. The 27 critical and descriptive essays in this book, written by important scholars from a variety of fields, challenge Hintikka's innovations in philosophy, logic, and linguistics. His replies, and the essays themselves, all previously unpublished, form a lively, provocative exchange of ideas. Also included is an intellectual autobiography and a complete bibliography of Hintikka's writings. | Looking for an essay on Nadeko Sengoku | The technical term “tarka” in the Nyāya tradition is the object of the present investigation. Diverse texts including Buddhist ones exhibit a negative estimation of activities using tarka. In contrast, more often than not, later treatises dealing with logico-epistemic problems, especially certain Naiyāyika works, identify the methodological peculiarity of Nyāya with tarka. Such an ambivalent attitude toward tarka can be understood in a coherent way if the essential features of tarka that gave rise to it can be grasped. Starting from the Nyāyasūtra 1.1.40 and the explanation given in the Nyāyabhāṣya on it, the present researcher sorted out three characteristic features of tarka in the early Nyāya tradition. These three features focus on the main feature of tarka: namely, reflective analysis without requiring further factual information on the object of investigation. Based on this, the present researcher critically reviewed what promoted an understanding of tarka as a reductio ad absurdum argument or an a priori reasoning. Furthermore, certain passages from the Nyāyamanjarī, Nyāyakalikā, and Tarkasaṅgraha were examined to demonstrate that the present researcher’s interpretative understanding of tarka was adequate for explaining the usage of this term in a broad sense, with positive connotations. | Tatyana Litovchenko | The Berlin Phil. isn't enough--where's the spirit of Prokofiev? | Nadeko Sengoku has been created | The aim of this paper is to recall the figure of a Warsaw-based scholar who engaged with ancient history in its many aspects, exploring the language and literature as well as history in the broad sense, approached in the light of the ancient military and Roman law; a teacher of classics and an active contributor to Polish social and political life.The now virtually forgotten Warsaw historian Zdzisław Zmigryder Konopka (1897-1939) dedicated his scholarly and teaching career to exploring antiquity in many of its facets. In his relatively brief research work -caused by his untimely passing -he focused on the history of Rome, though he did not confine himself to one particular period or topic, quite the contrary.The protagonist of this paper has received the most attention from his student, Professor Iza Bieżuńska-Małowist 1 . Remembering her master, she cited a number of facts from his life, and the language of her texts betrays a tremendous emotional component and great esteem for Konopka: as a scholar and teacher, a community activist, but perhaps as a person in general above all. | [Player Discussion] Ondrej Palat | SİZİ AMINA KODUMUN İSRAİL VE AMERİKA TOHUMLARI SİZ GİDİN ANCA KOKA KOLA İÇİN |
85 | Do zebras have short tails or long tails? | Why do lynxs have short tails? | What do beavers use there tails for? | What do zebra tailed lizzards eat? | Why does a zebra have striped fur? | Do lizards have tails? | What is the animal whith the longest tail? | Do primates have prehensile tails? | Which animal doesn't have a tail? | 85 | Why will a zebra have a tail? | Whate does a zebra look like? | The relationship between ostriches and zebras? | How did the grevy zebra get its name? | Why do people need mountain zebras? | Where did zebras get their names? | Are zebras counted as a horse? | What do zebras live and? | What is the purpose of an animals tail? |
86 | Supplemental http://genesdev.cshlp.org/content/suppl/2011/08/09/25.15.1583.DC1.html References http://genesdev.cshlp.org/content/25/15/1583.full.html#related-urls Article cited in: http://genesdev.cshlp.org/content/25/15/1583.full.html#ref-list-1Remote distal enhancers may be located tens or thousands of kilobases away from their promoters. How they control gene expression is still poorly understood. Here, we analyze the influence of a remote enhancer on the balance between repression (Polycomb-PcG) and activation (Trithorax-TrxG) of a developmentally regulated gene associated with a CpG island. We reveal its essential, nonredundant role in clearing the PcG complex and H3K27me3 from the CpG island. In the absence of the enhancer, the H3K27me3 demethylase (JMJD3) is not recruited to the CpG island. We propose a new role of long-range regulatory elements in removing repressive PcG complexes. |
CpG islands are DNA sequences that are on average 1 kb long and are found almost exclusively at the 5' end of genes (Bird 1986(Bird , 1987. In mouse and man these genes include all sequenced housekeeping genes and many genes that show a tissue-restricted pattern of expression (Antequera and Bird 1993). CpG islands are expected to be nonmethylated when passed through the germ line, as methylation would subsequently lead to deamination and loss of the island structure (Cooper et al. 1983;Tykocinski and Max 1984;Bird et al. 1985). In somatic cells CpG islands are normally found to be nonmethylated, even in tissues where the gene is not expressed, but there are a few exceptions, including island-containing genes of the inactive X chromosome (for review, see Riggs and Pfeifer 1992), the testis-specific H2B gene of rat (Choi and Chae 1991), and several "imprinted" genes such as H19 (Ferguson-Smith et al. 1993) and Igf2r (St6ger et al. 1993). In all these cases, however, the CpG islands appear to be nonmethylated in the germ line (Driscoll and Migeon 1990;Choi and Chae 1991;Brandeis et al. 1993).
The CpG dinucleotide is the target for the mammalian methyltransferase that methylates the cytosine residue at the carbon 5 position. As CpG islands are rich in these dinucleotides, how do they remain free of methylation? Several models can be proposed, the simplest of which is that CpG islands are a poor substrate for the methyltransferase. In support of this idea, it has been shown that CpG-rich sequences are methylated relatively inefficiently in vitro (Carotti et al. 1989), suggesting that the high density of CpG dinucleotides in islands or their G+C richness inhibits the methyltransferase. The weakness of this model is that it does not explain why CpG islands are methylated on the inactive X, at imprinted genes, and also at nonessential genes in cultured cell lines (Antequera et al. 1990;Jones et al. 1990). A second model proposes that CpG islands are subject to de novo methylation but that the modification is removed by an island-specific demethylating activity (Frank et al. 1991). The model is based on the finding that partially methylated CpG islands lose methylation when introduced into fertilized mouse eggs or embryonic cells (Szyf et al. 1990;Frank et al. 1991). Demethylation may only occur when relatively few CpG sites within the transgene island are methylated but not when all CpGs are methylated (Choi and Chae 1993).
A third model proposes that steric hindrance by protein factors is responsible for excluding the methyltransferase from CpG islands (Bird 1986). Because CpG islands colocalize with gene promoters, transcription factors may be required for island protection. Evidence in favor of this model has come from in vivo footprinting studies of protein-DNA interactions within the CpG islands of the human PGK-1 gene (Pfeifer et al. 1990;Pfeifer and Riggs 1991) and the HTF9 locus (Stapleton et al. 1993). Multiple factors are bound over both of these CpG islands. In contrast, the methylated PGK-1 island of the inactive X chromosome has nucleosome-like structures replacing transcription factors (Pfeifer and Riggs 1991). These results suggest that in these cases, protein factors are bound across the island and could, in theory, block the methyltransferase by steric hindrance. Indirect support for the steric hindrance model has also been inferred from transgenic experiments showing that the CpG islands of transgenes can become methylated at high copy number, suggesting that there is a limited supply of factors that are capable of protecting the island (Mehtali et al. 1990;Gundersen et al. 1991). A limitation of the model is that it does not simply explain how inactive genes can nevertheless retain CpG islands that are methylation flee. For example, the human c~-globin and retinol-binding protein genes are each expressed in only one tissue but have nonmethylated islands in all cell types that have been examined Antequera et al. 1990).
In this study we have investigated the basis of immunity to methylation in a specific CpG island. We chose the mouse aprt gene as a test system, as this housekeeping gene has been studied previously (Dush et al. 1985(Dush et al. , 1988, and its CpG island occupies a typical location, extending -600 bp from the promoter downstream into the transcribed region. The bidirectional HTF9 promoter and the PGK promoter are both atypical in this respect, as the promoter region is centrally located within the island in each case. We have carried out a detailed analysis of methylation at all CpGs across the island and have identified regions that are bound to proteins in vivo. To test the significance of bound factors we have deleted and mutated the binding sites. Both treatments abolish the protection of the CpG island region against DNA methylation. Thus, the binding sites are important, but their asymmetrical location within the island suggests that protection against the methyltransferase is not simply attributable to steric hindrance.
Results
DNA methylation analysis of the aprt CpG island
To accurately position the CpG island relative to the structure of the mouse aprt gene, the distribution of the CpG dinucleotides was plotted using the published DNA sequence ( Fig. 1A; Dush et al. 1985). The greatest concentration of CpGs extends from the promoter at the left edge over the first two exons into the second intron of the gene. To analyze the boundaries of the island with respect to methylation, the bisulfite-modification technique was used (Frommer et al. 1992). This procedure changes nonmethylated cytosines into uracils while leaving methylated cytosines unchanged. Subsequent PCR amplification and sequencing reveals the methylated bases. Unlike the genomic sequencing method, which examines the combined pattern of methylation of a large number of molecules simultaneously, this method allows the sequence of individual molecules to be resolved. A large region of the aprt gene (1936 bp), including the whole CpG island, was analyzed in this way using liver DNA as starting material. These results show the position of methylated CpG sites in four independent clones, each corresponding to the sequence of the gene within an individual liver cell (Fig. 1B). In each case it can be seen that the central region, which also shows the highest frequency of CpGs, is completely nonmethylated. The analysis also shows which sites in the flanking DNA are methylated and allows the boundaries of the CpG island to be determined in terms of both CpG frequency and methylation. The methylation-free region extends from position 610 to 1425, and this coincides with the region of elevated CpG. In the flanking region it is notable that individual sites are methylated in some molecules and nonmethylated in others. Thus, although the overall pattern of methylation is inherited (Holliday and Pugh 1975;Riggs 1975) methylation of individual sites is not clonally derived.
In vivo footprinting across the aprt CpG island
Having established the detailed methylation pattern, we next asked whether protein factors were bound within Cold Spring Harbor Laboratory Press on July 20, 2018 -Published by genesdev.cshlp.org Downloaded from the CpG island. To detect p r o t e i n -D N A interactions in vivo we used the ligation-mediated polymerase chain reaction (LMPCR) technique to study the aprt promoter in F9 embryonal carcinoma (EC) cells. We designed pairs of D N A primers for LMPCR that spanned the island sequence (see Fig. 2A). By comparing the aprt " G ladder" produced by dimethylsulfate (DMS) piperidine cleavage of naked D N A with that from DMStreated F9 cells, we could establish sites of protein-DNA interaction. Unlike DNase I footprinting in vitro, where protein binding is shown as large gaps in the DNase I ladder, footprints using DMS are more subtle and are identified by missing or hypersensitive guanosine bases in the D N A from DMS-treated cells. Three footprints were obtained (Fig. 2B), which coincided with the three GC boxes identified in the aprt promoter (Dush et al. 1985). The GC box is the consensus binding site for the ubiquitous transcription factor Spl (Kadonaga et al. 1986). In the mouse aprt gene these sites have been shown previously to bind purified Spl by DNase I footprinting in vitro and are sufficient for transcription of the gene (Dush et al. 1988). Aside from the Spl sites, no Footprints are detected at each of the three GC boxes, on both strands of the DNA, and were confirmed by repeating the reactions several times. (C) Results of footprinting reactions with two primer sets, 5 and 8. Lanes 1 and 4 are LMPCR amplifications of purified F9 DNA after DMS/ piperidine cleavage. LMPCR amplifications of DMS-treated F9 cells for 2 min {lanes 2,5) or 5 min (lanes 3,6). Although some variation in band intensity can be detected in these gels, it was not reproducible (repeated twice) and no footprints were identified using these primer sets.
other factor binding sites have been identified within the promoter (Dush et al. 1988) and there is no TATA box (Dush et al. 1985). In our analysis, no other footprints could be identified using the other primer sets (e.g., Fig. 2C). These results suggest that protein factors are not bound over the entire island but only within the promoter that is at its left-hand edge (see Fig. 2A).
Nucleosome-like structures are positioned over the CpG island
Transcription factors are not the only proteins expected to bind CpG island DNA, as nucleosomes are also likely to be present. To determine nucleosome position, F9 nuclei were incubated with micrococcal nuclease, which cleaves between nucleosomes. Sites cut by the enzyme in the aprt gene were detected by LMPCR using three primer sets spanning the CpG island region (primers 1, X1, and 7; Fig. 3B). Micrococcal nuclease cleavage sites were clustered in the region that includes the three occupied GC boxes and transcription start sites (Fig. 3A). The same region is also hypersensitive to cleavage by DNase I and endogenous nucleases (data not shown). In addition to these cleavage sites, micrococcal nuclease cuts at -200-bp intervals across the CpG island (primer 1, Fig. 3A). At the boundaries of the island, cleavage sites are weak and irregularly spaced (primers X1 and 7, Fig. 3A). The size of the regions that are protected from the nuclease implies that they correspond to nucleosomes that are uniquely positioned across the island (Fig. 3B). The absence of a regular pattern of protection outside the island suggests that nucleosomes in the flanks are positioned differently in different cells.
Deletion of the aprt promoter leads to methylation of the CpG island
The occupied GC boxes are at the left edge of the CpG island ( Fig. 2A). To determine whether Spl binding in this region alone could protect the whole island from methylation, we tested the consequences of deleting or mutating the promoter region. To assay methylation, transgenic mice were generated by the injection of DNA constructs into the male pronucleus of fertilized mouse eggs, which were then inserted into the uterus of pseudopregnant mice. The transgenic offspring were subsequently identified by analysis of tail DNA. The control construct for injection comprised a 3.4-kb BgllI-SphI fragment, pABS, containing the unaltered aprt island that had been subcloned from the genomic aprt clone pSAM 6.3 (Turker et al. 1991). A deletion (pAAB) was made by removing a 210-bp BsaBI-MaeII fragment that includes the transcriptional start sites and GC boxes from pABS (see Fig. 4). Each of the constructs was digested with EcoRI and SphI, which removed all prokaryotic DNA sequence, except for a short region of polylinker containing a KpnI site. These constructs were purified and used to produce transgenic mice. Analysis of tail DNA from founder animals was then carried out by Southern blotting to determine the methylation status of the transgenes. In each case, this was facilitated by the presence of the KpnI site within the polylinker at the 5' end of the transgene (see Fig. 5A). Transgenes could be distinguished from the endogenous gene, as they gave a 1.7-kb restriction fragment (pABS)and a 1.5-kb fragment (pAAB) compared with the 5-kb fragment derived from the endogenous gene in KpnI digests. Methylation was assayed at several sites within the island using the methylation-sensitive restriction enzymes SmaI and HpaII (see Fig. 2A). If the Sinai site was nonmethylated, a KpnI-SmaI double digest produced a transgene-specific 1.1-kb restriction fragment with pABS and pAAB. The 2.5-kb fragment produced from the endogenous gene served as an intemal control for complete digestion. In an analysis of 10 founder mice with the wild-type construct pABS, (Fig. 5B) all but one were free of methylation at the SmaI site, as the 1.7-kb KpnI restriction fragment was abolished completely by this enzyme. These transgenes were also nonmethylated at many, if not all, HpaII sites (Fig. 5B). Thus, the nonmethylated CpG island is recreated at the aprt transgene in nearly all of the founder animals. Eleven pAAB founder mice were also tested in the same manner (Fig. 5C). Unlike the controls, the Sinai site was heavily methylated in these transgenes, as the 1.5-kb restriction fragment is largely resistant to cleavage, and very little of the 1.1-kb transgene-specific fragment, which would be expected if this site were nonmethylated, is seen. The HpaII sites were also heavily methylated, as most of the transgene-specific 1.5-kb KpnI fragment is uncut by this enzyme. The Turker et al. 1989). The solid horizontal bar represents the position of the probe used to hybridize to the Southern blots. The CpG island is denoted by brackets. (B) A Southern blot obtained from tail DNA of wild-type ( + ) or pABS transgenic mice (T1-T4) hybridized to an aprt-specifir probe (see A}. DNA was restricted with KpnI Ilanes 1,4, 7,10,13), KpnI + Sinai (lanes 2,5,8,11,14), or KpnI+HpaII (lanes 3,6,9 12,15). (M) Radioactively labeled 1-kb marker (BRL); the sizes of some hybridizing restriction fragments are shown in the margin (in bp). The arrowed T shows the position of the transgene-specific restriction fragment in the KpnI digests.
(C) As above, but with four pAAB transgenic mice. DNA was restricted with KpnI (lanes 1,4,7,10), KpnI+ Sinai (lanes 2,5,8,111,or KpnI+HpaII (lanes 3,6,9,12). (D) As above, but with four pAZM2 transgenic mice. DNA was restricted with KpnI (lanes 1,4,7,i0), KpnI + Sinai (lanes 2,5,8,11 ), or KpnI + HpaII (lanes 3,6,9,12). degree of methylation varied between founder animals, but the transgenes were all shown to be highly methyl-ated except in 1 of 11 examples, where the level of methylation was low (Fig. 5C). Unbound probe accounts for the radioactive band at the bottom of the gel. A specific complex is only seen in lanes 2 and 4.
construct (see Fig. 4). To test whether mutagenesis of these sites occluded Spl binding, a 210-bp fragment containing the intact sites (pABS) or the mutated sites (pAZM2) was end-labeled and incubated with a crude protein extract from F9 cells. Protein-DNA interaction was shown by bandshift {Fig. 6). The pABS fragment formed a complex with the extract that was effectively competed out by a double-stranded oligomer containing a high affinity binding site for Spl (see Fig. 6B, lanes 2,3). This confirmed that Spl bound to this fragment. No other factors besides Spl interact with the probe to produce a complex. The pAZM2 fragment, in which the Spl-binding sites have been mutated (see Fig. 4A), does not form a complex (Fig. 6B, lane 5). In a reciprocal experiment ( Fig. 6C) a DNA duplex containing a high affinity binding site for Spl was used in competition with a double-stranded wild-type aprt oligomer (N1) or an oligomer carrying mutations in the GC boxes (M1) (see Fig. 6A). The results of the bandshifts clearly show that only the wild-type oligomer effectively competes with the high affinity site for Spl (Fig. 6C, lane 3). The mutant M1 oligonucleotide is unable to compete (Fig. 6C, lane 4).
The EcoRI-SphI fragment was purified from the pAZM2 clone and used to produce transgenic mice. The results of the methylation analysis on four of the founder animals is shown in Figure 5D. As with pAAB, the transgenes are highly methylated in four of five founder animals tested as the 1.7-kb KpnI fragment is largely resistant to digestion with Sinai and HpaII (Fig. 5D). The transgene was nonmethylated in the fifth animal. This analysis shows that Spl sites are required to ensure that the aprt gene remains methylation free.
Discussion
We have shown that Spl elements play an important part in the maintenance of the aprt CpG island. Transgene constructs in which the GC boxes in the aprt promoter have been deleted or mutated no longer bind Spl and no longer exclude methylation from the CpG island (Table 1). It has been suggested previously that factors may be required to protect CpG islands (Bird 1986) and also that Spl may be involved (H611er et al. 1988). Our data provide direct evidence for this view. Previous attempts to define the origin of methylation-free islands have not implicated factor binding, but with hindsight
Mutagenesis of the aprt Spl-binding sites results in methylation of the CpG island
The above result showed that the 210-bp fragment from the aprt promoter was required to prevent methylation of the CpG island. As this region contains the entire promoter, the transcription start sites, and also includes part of the CpG island (see Fig. 2A), we tested whether the Sp 1 sites themselves were important. Specific mutations were introduced simultaneously into the three GC boxes by in vitro mutagenesis to produce the pAZM2 The numbers refer to the number of founder animals tested. Parentheses indicate weakly methylated.
the results that were obtained are compatible with the conclusions drawn here. Szyf et al. (1990) identified a 214-bp fragment from the mouse Thy-1 gene promoter that contained a "portable signal," which protected the Thy-1 gene (and plasmid vector) from methylation after transfection into embryonic stem (ES) cells. It was shown later that this DNA fragment contains binding sites for transcription factors, including Spl (Spanopoulou et al. 1991). Mummaneni et al. (1993) proposed that the boundaries of CpG islands have sequences that block the spread of methylation from nearby methylation centers. The existence of methylation centers was inferred from the finding that a CpG island fragment from the aprt gene became methylated when placed upstream of its normal position following transfection into EC cells.
The interpretation was that the island was unable to resist the influence of a methylation center when placed close to it. We note, however, that the CpG island fragment that was translocated omits two of the three GC boxes. Based on the work presented here, it seems likely that the loss of these sites may have been sufficient to lead to de novo methylation of the island wherever it was placed. Thus, these results are consistent with the proposal that binding sites for a group of factors, which may or may not always include Spl, are required for protection of CpG islands from methylation. It has been noted previously that GC boxes are frequently found within CpG islands (Gardiner-Garden and Frommer 1987). It is surprising that occupied Spl sites at one edge of the aprt CpG island are capable of preventing methylation of CpG sites some distance downstream. That these are the only occupied sites for sequence-specific binding proteins in the island is suggested by the absense of additional footprints in vivo and the presence of typically spaced nucleosomes across the island. The DNase I/micrococcal nuclease hypersensitive site is also located at the island periphery, coincident with the Spl sites and the transcription start sites. In the great majority of cases, CpG islands extend downstream from the promoter of a gene into its transcription unit. Thus, it may be generally true that bound transcription factors mark the 5' boundary of an island, the methylation-free domain extending several hundred base pairs downstream from this point. How factor binding prevents methylation and why the nonmethylated domain is relatively constant in length are unanswered questions at present. Their asymmetrical location makes it unlikely that the Spl sites exclude methylation by sterically preventing access by the methyltransferase. If this were the case, the methylation-free region would be expected to straddle the bound factors symmetrically. As shown previously (Tazi and Bird 1990), CpG islands are generally highly accessible to proteins (nucleases} and have features of "open chromatin" such as hyperacetylated histones and depletion of histone HI. It is difficult to sustain the argument that such an open structure should be much less accessible to the methyltransferase than typical nucleosomal chromatin. It is more likely that the binding of factors to the island excludes DNA methylation by a mechanism other than steric hindrance.
It may be significant that the presence of Spl is also required to drive transcription of the aprt promoter (Dush et al. 1988). Thus, changes that abolish promoter activity also abolish the ability of the island to remain free of methylation. The relationship between transcription and lack of CpG island methylation, however, remains a puzzle. Many genes with CpG islands, such as the human ~-globin gene, are highly tissue specific in expression yet are nonmethylated in expressing and nonexpressing tissues alike . A possible explanation is that genes of this kind are poised for transcription but do not, for some reason, make stable RNA. We have investigated this possibility for the human c~-globin gene and the mouse myoD1 gene by assaying for run-on transcription in isolated nuclei of nonexpressing cells and have failed to detect any inappropriate transcription (F. Antequera and D. Macleod, unpubl.). The results confirm similar findings for the tissue-specific
Thy-1 gene, which also has a CpG island (Kolsto et al. 1986). In addition, the results agree with evidence that neither the rnyoD1 gene nor the ~-globin gene (Yagi and Groudine 1986) display open chromatin or DNase I hypersensitive sites in nonexpressing tissues. Thus, CpG islands can be maintained methylation free in the apparent absence of either transcription or an open chromatin configuration. An alternative possibility is that there is a stage in early embryos where all island-associated genes, including tissue-specific genes, are transcribed or transcriptionally competent. Lack of methylation could be established at this time and be replicated because of maintenance methylation in somatic cells, where transcription no longer occurs. Future experiments are designed to test this and other possibilities.
Materials and methods
Bisulfite modification and sequencing of genomic DNA
This procedure was essentially as described by Frommer et al. (1992). Mouse liver DNA (10 ~g) was first cleaved with EcoRI and then denatured in 0.2 M NaOH for 10 min at 27~ in a volume of 110 ~1. The reaction was neutralized with 44 ~zl of 5 M ammonium acetate and precipitated with 620 ~l of ethanol. The pellet was washed with 70% ethanol, air-dried, and resuspended in 100 ~1 of cold sterile distilled water on ice, and 1.04 ml of fresh 3.8 M sodium bisulfite and 60 }zl of 10 mM Quinol were added. This mixture was overlayed with 200 ~1 of mineral oil and incubated at 50~ in the dark for 16 hr. The DNA was desalted and concentrated using Geneclean (Biol01), ethanol precipitated, and resuspended in sterile water. Aliquots were stored at -20~ An aliquot of DNA was amplified using the modified primers CTGAATTCACCCTCTCCTTTAATAAAA-CAT and TAGAATTCAACCCAAATACTATACTAAA, which are derived from the aprt sequence at positions 70--91 and 2390-2414 (Dush et al. 1985) and then reamplified using the internal set, TTGAATTCTTTTGGGTGGTGTAAATTTGATTT and TTGAATTCTTGAGGGGTATGGGAATTTAGAGGTTAA at positions 191-210 and 2101-2128. PCR reactions were carried out in Thesit buffer (Ponce and Micol 1992). The resulting PCR fragments, containing EcoRI ends, were cloned into pBluescribe vector (Stratagene) and sequenced using Sequenase (U.S. Biochemical).
In vivo footprinting using DMS
DMS treatment of F9 DNA or whole cells and subsequent cleavage by piperidine, ligation of linkers, and LMPCR reactions were as described (Pfeifer et al. 1989) except for the following modifications. PCR reactions were in Thesit buffer (Ponce and Micol 1992; 30 mM tricine at pH 8.4, 2 mM MgC12, 50 mM [3-mercaptoethanol, 0.1% gelatin, 0.1% Thesit)with the addition of 10% DMSO. In some reactions, 1 g,g of single strandedbinding protein (Promega) was also included in the Sequenase extention step, which improved results from G + C-rich regions. The sequence of each internal primer, of each nested set, is as follows: (1)
In vivo footprinting using micrococcal nuclease
Nuclei were prepared from 80% confluent F9 cells using the method of Shimada et al. (1986). Cells were harvested and resuspended in R buffer (10 mM Tris at pH 7.5, 10 mM NaC1, 3 mM MgC12, 0.1 mM PMSF, and 0.25 M sucrose). Cells were lysed by the addition of NP-40 to a final concentration of 0.25% and gentle homogenization with a Dounce. Nuclei were pelleted through a sucrose cushion (1.1 M sucrose in buffer R) twice at 5000 rpm for 3 min and finally resuspended in 50 mM Tris, 5 mM MgC12, 0.1 mM EDTA. Glycerol was added to 40%, and the nuclei were frozen at -70~ in aliquots equivalent to 300-500 ~g DNA/ml. Nuclei (1 ml aliquot) were pelleted for 5 min at 5000 rpm in an Eppendorf centrifuge and resuspended in 600 ~1 of buffer M (Shimada et al. 1986; 50 mM Tris at pH 7.4, 60 mM KC1, 3 mM CaCI~, and 0.34 M sucrose), and 100qzl aliquots were digested with increasing amounts (0.08-2.0 units) of micrococcal nuclease (Worthington, resuspended at 17 units/~1 in 10 mM Tris at pH 7.5, 0.5 mM EDTA, 0.5 mM DTT, and 50% glycerol).
Reactions were incubated at 37~ for 4 min and terminated with an equal volume of stop mix (1% SDS, 0.6 M NaC1, 20 mM EDTA, and 20 mM Tris-HC1 at pH 7.5). Proteinase K was added to a final concentration of 100 ~g/ml, and tubes were incubated at 55~ for 1 hr before extracting the DNA using established procedures. Digestion parameters sufficient to produce a nucleosomal ladder were determined empirically. DNA (3 ~g) was subsequently used for LMPCR amplification (see above), and products were resolved on 2% agarose gels in TAE buffer (40 mM Tris-acetate, 1 mM EDTA at pH 8). DNA was blotted onto nylon membranes (Hybond N +, Amersham) and hybridized to labeled probe.
In vitro mutagenesis
An 84-bp DNA oligomer, M1 (Fig. 6A) was used to generate three base pair changes simultaneously in each of the three GC boxes using the method of Kunkel et al. (1987) using a mutagenesis kit (Muta-gene, Bio-Rad). Clones were selected that contained an introduced XhoI site and then sequenced using an automatic DNA sequencer (ABI) to check that all of the desired base changes had been made.
Analysis of protein-DNA interactions by agarose-gel bandshift
A crude protein (NUN) extract was prepared from F9 nuclei (see above) using the method of Lavery and Schibler (1993). Nuclei were pelleted, as described above, from frozen stocks, and nine volumes of NUN buffer (final concentration 0.3 M NaC1, 1 M Urea, 1% NP-40, 25 mM HEPES at pH 7.6, 1 mM DTT, and 0.1 mM PMSF) were added. The mixture was vortexed for 5 sec before placing on ice for 15 min. The chromatin precipitate was removed by centrifugation in a microcentrifuge for 10 min at 10,000 rpm at 4~ and glycerol was added to a final concentration of 10%. Aliquots were frozen at -70~ and protein concentration was determined using a Bio-Rad protein assay reagent. Binding reactions were carried out as described by Somma et al. (1991). In a 20 ~1 reaction mixture, 5 ~zg of F9 protein extract was preincubated on ice with 1 ~g of nonspecific poly[d(I-C)] competitor (in some reactions, 0.1 ~g of specific competitor was also added) in 25 mM HEPES, 60 mM KC1, 1 mM DTT, 0.5 mM EDTA, and 8.7% glycerol for 10 min. The radioactive probe was then added and incubation was continued for an additional 30 min on ice. Restriction fragments from cloned DNA or PCR products were end-labeled with Klenow and 32p_ labeled nucleotides. Generally, 20-50 pg of probe was used in the binding reaction. The reactions were electrophoresed in 1.5% agarose gels in 0.5 • TBE buffer, subsequently dried under vacuum onto DE 81 paper, and exposed to Kodak XAR5 autoradiographic film.
Production of transgenic mice
Transgenic mice were generated by microinjection of the respective transgene fragment, at a concentration of 1 ~g/ml in 10 mM Tris-HC1, 0.1 mM EDTA (pH 7.5), using standard procedures (Hogan et al. 1986). Transgenes were injected into single-cell embryos isolated from a cross between C57B1/6x CBA/Ca F 1 mice. Offspring were weaned at 3 weeks of age, and tail biopsies performed for preparation of DNA. This was carried out by incubating the tail tips in proteinase K buffer (50 mM Tris at pH 8, 100 mM NaC1, 100 mM EDTA, 1% SDS, and 60 ~g/ml of proteinase K) overnight at 55~ and then extraction of nucleic acids was performed with phenol.
Cold Spring Harbor Laboratory Press on July 20, 2018 -Published by genesdev.cshlp.org Downloaded from
Figure 1 .
1(A) A CpG plot of the mouse aprt gene. Each vertical line indicates the position of each CpG dinucleotide in the DNA sequence (Dush et al. 1985). The positions of exons are indicated by open rectangles and transcription start sites by open arrowheads (Dush et al. 1988). The scale {top) is in base pairs. (B) An enlarged plot of a section of the above CpG plot, showing the part of the APRT sequence used in the methylation analysis. The series of vertical lines indicates the position of each CpG dinucleotide, and underneath this, the open circles indicate whether the cytosine in the dinucleotide is nonmethylated (O) or methylated (O). Each horizontal line of circles represents the methylation analysis from one of four independent clones.
Figure 2 .
2In vivo footprinting of bound factors. (A) A schematic diagram showing regions that were analyzed by LMPCR. (Top) The position of the CpG dinucleotides as in Fig. 1. The position of overlapping primer pairs used for in vivo footprinting are indicated relative to the CpG plot above, by a dot and number at the end of the arrowed lines. The length of the arrowed line corresponds to the region analyzed with each primer set; arrows pointing to the left are primers complementary to the lower strand of the sequence, arrows to the right are primers complementary to the upper strand. The positions of the three GC boxes are indicated by three thick vertical lines under the CpG plot. The positions of methylation-sensitive restriction enzyme cleavage sites within the CpG island are indicated: (H) HpaII; (S) SmaI. The bracketed region under the CpG plot shows the position of the BsaBI-MaeII fragment (see text). The scale at the top is in base pairs. (B) Results of in vivo footprinting reactions obtained using primer sets 4 {lanes 1-3) and X1, {lanes 4-6). LMPCR reactions were run on standard sequencing gels, electroblotted, and hybridized to an aprt PCR probe {primers l-X1, see A). Each lane shows the G ladder obtained from DMS-treated purified F9 DNA (lanes 1,4) or from F9 cells treated with DMS for 2 min {lanes 2,5) or 5 rain {lanes 3,6). Brackets show the positions of GC boxes {I, II, and III) that correspond to the DNA sequences below. Small circles show the position of weak or absent G bands (C)) or hyper-reactive G bands (O). Arrows A and B show the position of transcription start sites relative to the GC boxes as mapped by Dush et al. {1988).
Figure 3 .
3In vivo footprinting of nucleosomes. (A) Results of in vivo footprinting of nucleosomes using LMPCR amplification of DNA obtained from F9 nuclei restricted with micrococcal nuclease. The products were electrophoresed on 2% agarose gels, blotted to nylon membranes, and hybridized to an aprt probe {for primer sets 1 and X1, a PCR probe corresponding to position 45-883 of the aprt sequence was used and for primer set 7, a PCR probe between 1265 and 1502 was usedl. Each pair of tracks shows LMPCR products from nuclei digested with 0.16 units of enzyme(lanes 1,3,5) or 0.32 units {lanes 2,4,6). The primer sets used are indicated underneath. The open vertical rectangles represent protected regions and their position, relative to the CpG plot, is shown in B. The ladder of horizontal bands alongside the autoradiographs shows the position of 123-bp marker bands (BRL). (HS) Nuclease hypersensitive region from our experiments. (B)The CpG plot of the aprt gene as described inFig. 2. As inFigure 2A, the positions of the primers used to amplify micrococcal nuclease-cleaved DNA are indicated by a dot on the numbered, arrowed line under the CpG plot. The length of the arrowed line corresponds to the region analyzed with each primer set; arrows pointing to the left are primers complementary to the lower strand of the sequence, arrows to the right are primers complementary to the upper strand. The sites cleaved by the enzyme relative to the CpG plot are indicated by vertical arrows below. The arrow size is an approximate indication of the strength of signal obtained by hybridization to the probe as determined from A. The numbered circles represent the protected regions {which we suggest are nucleosomes). (HS) T h e micrococcal nuclease/DNase I hypersensitive site.
Figure 4 .
4DNA sequence that was deleted (pAAB) or mutagenized (pAZM2) from the wild-type aprt clone (pABS). Part of the aprt sequence from the aprt promoter is shown(Dush et al. 19851. The arrows indicate the position of the transcription start sites. The positions of the BsaBI and MaeII sites are indicated.These enzymes were used to cut this fragment (210 bp) from the wild-type parent clone, pABS, to obtain pAAB. The deletion removes the three GC boxes and transcription start sites. The GC boxes are bracketed and labeled (I, II, and III). The base changes in each box (CGC --* TTT) to create clone pAZM2 from the parent clone pABS are shown underneath. A single T ~ A change, which creates an XhoI site, was used for screening purposes (see Materials and methods).ther sites were tested by KpnI-HpaII digestion, which provided additional information on the level of methylation at other sites within the CpG island (Figs. 2A and 5AI.
Figure 5 .
5Methylation analysis of transgenic founder mice using methylation-sensitive restriction enzymes. (A) Restriction enzyme map of the endogenous genomic aprt gene and transgenes. Each vertical line on the map shows the position of KpnI (K1, Sinai (S), BglII (B), SphI (P), and HpaII {H) sites. One of the HpaII sites (outside the CpG island), indicated by an asterisk (*), is partially methylated in the genome (see
Figure 5 .Figure 6 .
56(See facing page for legend.) Bandshift experiment showing interaction with aprt probes and F9 protein extract. (A) (i) The wild type (N 1) oligomer sequence of aprt gene contained in pABS. The brackets mark the position of the GC boxes. (ii) The mutated (M1) oligomer sequence showing bases that are changed (*) from the above. This sequence is contained in pAZM2. (iii) The sequence of the high affinity Spl consensus binding site, showing the position of the GC box. (B) Autoradiograph showing the bandshifts obtained using a 210-bp probe (the same fragment as shown in Fig. 4), which includes the three GC boxes. Bandshift reactions using the wild-type aprt sequence (from pABS) are shown in lanes 1-3. Lanes 4-6 show bandshift reactions using the same sized probe from the mutated clone, pAZM2. Reactions in lanes 1 and 4 contained no extract. Reactions in lanes 2, 3, 5, and 6 contained 5 I~g of F9 protein extract. Reactions in lanes 3 and 6 have been preincubated with 0.1 ~g of Spl double-stranded oligomer [sequence (iii) above]. Unbound probe accounts for the radioactivity at the bottom of the gel; a specific complex is only seen in lane 2. (C) Autoradiograph showing the bandshifts obtained using the Spl oligomer [sequence (iii) above[. (Lane 1 No extract; (lanes 2-5) 5 ~g of F9 protein extract. Reactions in lanes 3, 4, and 5 are competed with 0.1 p~g of N1 [sequence (i) above] M1 [sequence (ii) above], or Spl [sequence (iii) above], respectively.
Table 1 .
1Summaryof the methylation results from
transgenic mice generated with the three DNA constructs
pABS, pAAB, and pAZM2
Methylated
Nonmethylated
pABS
(1)
9
pAAB
10
1
pAZM2
4
1
Cold Spring Harbor Laboratory Press on July 20, 2018 -Published by genesdev.cshlp.org Downloaded from
GENES & DEVELOPMENT Cold Spring Harbor Laboratory Press on July 20, 2018 -Published by genesdev.cshlp.org Downloaded from
AcknowledgmentsWe thank Genevieve Stapleton for her advise on using the LM-PCR method, Gillian Brooker, Aileen Greig, and Joan Davidson for their technical support, and Frank Johnson and Graham Brown for their photographic skills. We also thank Sally Cross and Richard Meehan for their helpful comments on the manuscript. This work was supported by The Wellcome Trust, The Imperial Cancer Research Fund, and The Howard Hughes Medical Institute. J.M. was supported by an Agricultural and Food Research Council (AFRC) grant (A550/40).The publication costs of this article were defrayed in part by payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 USC section 1734 solely to indicate this fact.
F Antequera, A Bird, Number of CpG islands and genes in human and mouse 9 Proc. Natl. Acad. Sci. 90Antequera, F. and A. Bird 9 1993. Number of CpG islands and genes in human and mouse 9 Proc. Natl. Acad. Sci. 90: 11995-11999
High levels of de novo methylation and altered chromatin structure at. F Antequera, J Boyes, A Bird, CpG islands in cell lines 9 Cell. 62Antequera, F., J. Boyes, and A. Bird. 1990. High levels of de novo methylation and altered chromatin structure at CpG islands in cell lines 9 Cell 62: 503-514.
CpG islands as gene markers in the vertebrate nucleus. A P Bird, Trends Genet. 321NatureBird, A.P. 1986. CpG-rich islands and the function of DNA methylation. Nature 321: 209-213. 1987. CpG islands as gene markers in the vertebrate nucleus. Trends Genet. 3: 342-347 9
A fraction of the mouse genome that is derived from islands of non-methylated, CpG-rich DNA. A Bird, M Taggart, M Frommer, O J Miller, D Macleod, Cell. 40Bird, A., M. Taggart, M. Frommer, O.J. Miller, and D. Macleod. 1985. A fraction of the mouse genome that is derived from islands of non-methylated, CpG-rich DNA. Cell 40: 91-99.
Non-methylated CpG-rich islands at the human alphaglobin locus: Implications for evolution of the alpha-globin pseudogene 9. A P Bird, R D Taggart, D R Nicholls, Higgs, EMBO J. 6Bird, A.P., M 9 Taggart, R.D. Nicholls, and D.R. Higgs. 1987. Non-methylated CpG-rich islands at the human alpha- globin locus: Implications for evolution of the alpha-globin pseudogene 9 EMBO J. 6: 999-1004.
Cedar 9 1993. The ontogeny of allele-specific methylation associated with imprinted genes in the mouse. M Brandeis, T Kafri, M Ariel, J R Chaillet, J Mccarrey, A Razin, H , EMBO ]. 12Brandeis, M., T. Kafri, M. Ariel, J.R. Chaillet, J. McCarrey, A. Razin, and H. Cedar 9 1993. The ontogeny of allele-specific methylation associated with imprinted genes in the mouse. EMBO ]. 12: 3669-3677.
In vitro methylation of CpG-rich islands 9. D Carotti, F Palitti, P Lavia, R Strom, Nucleic Acids Res. 17Carotti, D., F. Palitti, P. Lavia, and R. Strom. 1989. In vitro methylation of CpG-rich islands 9 Nucleic Acids Res. 17: 9219-9229.
Demethylation of somatic and testis-specific histone H2A and H2B genes in F9 embryonal carcinoma cells. Y.-C Choi, C.-B Chae, Mol. Cell. Biol. 266J. Biol. Chem.Choi, Y.-C. and C.-B. Chae. 1991. DNA hypomethylation and germ cell-specific expression of testis-specific H2B histone gene. J. Biol. Chem. 266:20504-20511. 9 1993. Demethylation of somatic and testis-specific his- tone H2A and H2B genes in F9 embryonal carcinoma cells. Mol. Cell. Biol. 13: 5538-5548 9
Unmethylated domains in vertebrate DNA. D N Cooper, M H Taggart, A P Bird, Nucleic Acids Res. 11Cooper, D.N., M.H. Taggart, and A.P. Bird. 1983. Unmethylated domains in vertebrate DNA. Nucleic Acids Res. 11: 647- 658.
Sex difference in methylation of single-copy genes in human meiotic germ cells: Implications for X chromosome inactivation, parental imprinting, and origin of CpG mutations. D J Driscoll, B R Migeon, Somatic Cell Mol. Genet. 16Driscoll, D.J. and B.R. Migeon. 1990. Sex difference in methyl- ation of single-copy genes in human meiotic germ cells: Im- plications for X chromosome inactivation, parental imprint- ing, and origin of CpG mutations. Somatic Cell Mol. Genet. 16: 267-282 9
Nucleotide sequence and organization of the mouse adenine phosphoribosyltransferase gene: Presence of a coding region common to animal and bacterial phosphpribosyltransferases that has a variable intron/exon arrangement. M K Dush, J M Sikela, S A Khan, J A Tischfield, P J Stambrook, Proc. Natl. Acad. Sci. 82Dush, M.K., J.M. Sikela, S.A. Khan, J.A. Tischfield, and P.J. Stambrook. 1985. Nucleotide sequence and organization of the mouse adenine phosphoribosyltransferase gene: Pres- ence of a coding region common to animal and bacterial phosphpribosyltransferases that has a variable intron/exon arrangement. Proc. Natl. Acad. Sci. 82: 2731-2735.
Identification of DNA sequences required for mouse APRT gene expression 9. M K Dush, M R Briggs, M E Royce, D A Schaff, S A Khan, J A Tischfield, P J Stambrook, Nucleic Acids Res. 16Dush, M.K., M.R. Briggs, M.E. Royce, D.A. Schaff, S.A. Khan, J.A. Tischfield, and P.J. Stambrook. 1988. Identification of DNA sequences required for mouse APRT gene expression 9 Nucleic Acids Res. 16: 8509-8525.
Parental-origin-specific epigenetic modification of the mouse H19 gene. A C Ferguson-Smith, H Sasaki, B M Cattanach, M A Surani, Nature. 362Ferguson-Smith, A.C., H. Sasaki, B.M. Cattanach, and M.A. Su- rani. 1993. Parental-origin-specific epigenetic modification of the mouse H19 gene. Nature 362: 751-755.
Demethylation of CpG islands in embryonic cells. D Frank, I Keshet, M Shani, A Levine, A Razin, H Cedar, Nature. 351Frank, D., I. Keshet, M. Shani, A. Levine, A. Razin, and H. Cedar 9 1991. Demethylation of CpG islands in embryonic cells. Nature 351: 239-241.
A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands. M Frommer, L E Mcdonald, D S Millar, C M Collis, J Watt, G W Grigg, P L Molloy, C L Paul, Proc. Natl. Acad. Sci. Natl. Acad. Sci89Frommer, M., L.E. McDonald, D.S. Millar, C.M. Collis, J. Watt, G.W. Grigg, P.L. Molloy, and C.L. Paul. 1992. A genomic sequencing protocol that yields a positive display of 5-me- thylcytosine residues in individual DNA strands. Proc. Natl. Acad. Sci. 89: 1827-1831.
CpG islands in vertebrate genomes. M Gardiner-Garden, M Frommer, J. Mol. Biol. 196Gardiner-Garden, M. and M. Frommer. 1987. CpG islands in vertebrate genomes. J. Mol. Biol. 196: 261-282.
Differential methylation of a CpG-island concatemer in hemi-and homozygous transgenic mice. G Gunderson, A.-B Kolsto, H Prydz, FEBS Lett. 295Gunderson, G., A.-B. Kolsto, and H. Prydz. 1991. Differential methylation of a CpG-island concatemer in hemi-and ho- mozygous transgenic mice. FEBS Lett. 295: 214-218.
Manipulating the mouse embryo. B Hogan, F Constantini, E Lacy, Cold Spring Harbor, New YorkCold Spring Harbor LaboratoryHogan, B., F. Constantini, and E. Lacy. 1986. Manipulating the mouse embryo. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.
Spl transcription factor binds DNA and activates transcription even when the binding site is CpG methylated. M H611er, G Westin, J Jiricny, W Shaffner, Genes & Dev. 2H611er, M., G. Westin, J. Jiricny, and W. Shaffner. 1988. Spl transcription factor binds DNA and activates transcription even when the binding site is CpG methylated. Genes & Dev. 2:1127-1135.
DNA modification mechanisms and gene activity during development. R Holliday, J E Pugh, Science. 186Holliday, R. and J.E. Pugh. 1975. DNA modification mecha- nisms and gene activity during development. Science 186: 226-232.
De novo methylation of the MyoD1 CpG island during the establishment of immortal cell lines. P A Jones, M J Wolkowitz, W M I Rideout, F A Gonzales, C M Marziasz, G A Coetzee, S J Tapscott, Proc. Natl. AcacI. Sci. 87Jones, P.A., M.J. Wolkowitz, W.M.I. Rideout, F.A. Gonzales, C.M. Marziasz, G.A. Coetzee, and S.J. Tapscott. 1990. De novo methylation of the MyoD1 CpG island during the es- tablishment of immortal cell lines. Proc. Natl. AcacI. Sci. 87: 6117-6121.
Promoter-specific activation of RNA polymerase II transcription by Spl. J Kadonaga, K Jones, R Tjian, Trends Biochem. Sci. 11Kadonaga, J., K. Jones, and R. Tjian. 1986. Promoter-specific activation of RNA polymerase II transcription by Spl. Trends Biochem. Sci. 11: 20-23.
The maintenance of methylation-free islands in transgenic mice. A.-B Kolsto, G Kollias, V Giguere, K.-I Isobe, H Prydz, F Grosveld, Nucleic Acids Res. 14Kolsto, A.-B., G. Kollias, V. Giguere, K.-I. Isobe, H. Prydz, and F. Grosveld. 1986. The maintenance of methylation-free is- lands in transgenic mice. Nucleic Acids Res. 14: 9667-9678 9
Rapid and efficient site-specific mutagenesis without phenotypic selection. T A Kunkel, J D Roberts, R A Zakour, Methods Enzymol. 154Kunkel, T.A., J.D. Roberts, and R.A. Zakour. 1987. Rapid and efficient site-specific mutagenesis without phenotypic selec- tion. Methods Enzymol. 154: 367-382.
Circadian transcription of the cholesterol 7e~ hydroxylase gene may involve the liverenriched bZIP protein DBP. D J Lavery, U Schibler, Genes & Dev. 7Lavery, D.J. and U. Schibler. 1993. Circadian transcription of the cholesterol 7e~ hydroxylase gene may involve the liver- enriched bZIP protein DBP. Genes & Dev. 7: 1871-1884.
The methylationfree status of a housekeeping transgene is lost at high copy number 9. M Mehtali, M Lemeur, R Lathe, Gene. 91Mehtali, M., M. LeMeur, and R. Lathe. 1990. The methylation- free status of a housekeeping transgene is lost at high copy number 9 Gene 91: 179-184.
In vivo footprinting of a muscle specific enhancer by ligation mediated PCR. P J Mueller, B Wold, Science. 246Mueller, P.J. and B. Wold. 1989. In vivo footprinting of a muscle specific enhancer by ligation mediated PCR. Science 246: 780-786.
A cisacting element accounts for a conserved methylation pattern upstream of the mouse adenine phosphoribosyltransferase gene. P Mummaneni, P L Bishop, M S Turker, J. Biol. Chem. 268Mummaneni, P., P.L. Bishop, and M.S. Turker. 1993. A cis- acting element accounts for a conserved methylation pattern upstream of the mouse adenine phosphoribosyltransferase gene. J. Biol. Chem. 268: 552-558 9
Chromatin differences between active and inactive X chromosomes revealed by genomic footprinting of permeabilized cells using DNase I and ligation-mediated PCR. G P Pfeifer, A D Riggs, Genes & Dev. 5Pfeifer, G.P. and A.D. Riggs. 1991. Chromatin differences be- tween active and inactive X chromosomes revealed by geno- mic footprinting of permeabilized cells using DNase I and ligation-mediated PCR. Genes & Dev. 5:1102-1113.
Genomic sequencing and methylation analysis by ligation mediated PCR. G P Pfeifer, S D Steigerwald, P R Mueller, B Wold, A D Riggs, Science. 246Pfeifer, G.P., S.D. Steigerwald, P.R. Mueller, B. Wold, and A.D. Riggs. 1989. Genomic sequencing and methylation analysis by ligation mediated PCR. Science 246:81 0-813.
In vivo footprint and methylation analysis by PCRaided genomic sequencing: Comparison of active and inactive X chromosomal DNA at the CpG island and promoter of human Pgk-1. G P Pfeifer, R L Tanguay, S D Steigerwald, A D Riggs, Genes & Dev. 4Pfeifer, G.P., R.L. Tanguay, S.D. Steigerwald, and A.D. Riggs. 1990. In vivo footprint and methylation analysis by PCR- aided genomic sequencing: Comparison of active and inac- tive X chromosomal DNA at the CpG island and promoter of human Pgk-1. Genes & Dev. 4: 1277-1287.
PCR amplification of long DNA fragments. M R Ponce, J L Micol, Nucleic Acids Res. 20623Ponce, M.R. and J.L. Micol. 1992. PCR amplification of long DNA fragments. Nucleic Acids Res. 20: 623.
X-inactivation, differentiation and DNA methylation. A D Riggs, Cytogenet. Cell. Genet. 14Riggs, A.D. 1975. X-inactivation, differentiation and DNA methylation. Cytogenet. Cell. Genet. 14: 9-25.
X-chromosome inactivation and cell memory. A D Riggs, G P Pfeifer, Trends Genet. 8Riggs, A.D. and G.P. Pfeifer. 1992. X-chromosome inactivation and cell memory. Trends Genet. 8: 169-174.
Chromatin structure of the human dihydrofolate reductase gene promoter. I. T Shimada, K Inokuchi, A W Nienhuis, Biol. Chem. 261Shimada, T., K. Inokuchi, and A.W. Nienhuis. 1986. Chromatin structure of the human dihydrofolate reductase gene pro- moter. I. Biol. Chem. 261: 1445-1452.
Transcription factors binding to the mouse HTF9 housekeeping promoter differ between cell types 9. M P Somma, I Gambino, P Lavia, Nucleic Acids Res. 19Somma, M.P., I. Gambino, and P. Lavia. 1991. Transcription factors binding to the mouse HTF9 housekeeping promoter differ between cell types 9 Nucleic Acids Res. 19: 4451--4458.
The functional domains of the Thy-1 gene promoter. E Spanopoulou, V Giguere, F Grosveld, Mol. Cell. Biol. 11Spanopoulou, E., V. Giguere, and F. Grosveld. 1991. The func- tional domains of the Thy-1 gene promoter. Mol. Cell. Biol. 11: 2216--2228.
Cell type-specific interactions of transcription factors with a housekeeping promoter in vivo. G Stapleton, M P Somma, P Lavia, Nucleic Acids Res. 21Stapleton, G., M.P. Somma, and P. Lavia. 1993. Cell type-spe- cific interactions of transcription factors with a housekeep- ing promoter in vivo. Nucleic Acids Res. 21: 2465-2471.
Maternal specific methylation of the imprinted mouse Igf2r locus identifies the expressed locus as carrying the imprinting signal. R St6ger, P Kubicka, C.-G Liu, T Kafri, A Razin, H Cedar, D P Barlow, Cell. 73St6ger, R., P. Kubicka, C.-G. Liu, T. Kafri, A. Razin, H. Cedar, and D.P. Barlow. 1993. Maternal specific methylation of the imprinted mouse Igf2r locus identifies the expressed locus as carrying the imprinting signal. Cell 73: 61-71.
A DNA signal from the thy-1 gene defines de novo methylation pat ~ terns in embryonic stem cells. M Szyf, G Tanigawa, P L J Mccarthy, Mol. Cell. Biol. 10Szyf, M., G. Tanigawa, and P.L.J. McCarthy. 1990. A DNA sig- nal from the thy-1 gene defines de novo methylation pat ~ terns in embryonic stem cells. Mol. Cell. Biol. 10: 4396- 4400.
Alternative chromatin structure at CpG islands. J Tazi, A Bird, Cell. 60Tazi, J. and A. Bird. 1990. Alternative chromatin structure at CpG islands. 1990. Cell 60: 909-920.
CG clusters in MHC genes and 5' demethylated genes. M L Tykocinski, E G Max, Nucleic Acids Res. 12Tykocinski, M.L. and E.G. Max. 1984. CG clusters in MHC genes and 5' demethylated genes. Nucleic Acids Res. 12: 4385-4396.
A partial methylation profile for a CpG site is stably maintained in mammalian tissues and cultured cell lines. M S Turker, K Swisshelm, A C Smith, G M Martin, J. Biol. Chem. 264Turker, M.S., K. Swisshelm, A.C. Smith, and G.M. Martin. 1989. A partial methylation profile for a CpG site is stably maintained in mammalian tissues and cultured cell lines. J. Biol. Chem. 264: 11632-11636.
Regionand cell type-specific de novo DNA methylation in cultured mammalian cells. M S Turker, P Mummaneni, P L Bishop, Somatic Cell Mol. Genet. 17Turker, M.S., P. Mummaneni, and P.L. Bishop. 1991. Region- and cell type-specific de novo DNA methylation in cultured mammalian cells. Somatic Cell Mol. Genet. 17: 151-157.
Chromatin structure and developmental expression of the human alpha-globin cluster. M Yagi, M Groudine, Mol. Cell. Biol. 6Yagi, M. and M. Groudine. 1986. Chromatin structure and de- velopmental expression of the human alpha-globin cluster. Mol. Cell. Biol. 6: 1108-1116.
|
A n important question in current biology concerns the mechanisms by which genes are switched on and off during differentiation and development. Ultimately this is determined by interaction of the three fundamental regulatory elements of the genome: enhancers, promoters, and boundary elements. The activity of these elements is closely related to the three-dimensional structure of the genome. Mammalian genomes are organized in topologically associating domains (TADs), which are self-interacting regions of chromatin, usually between 100 kb and 1 Mb in size (reviewed in refs. 1,2 ). The boundaries of TADs are often delineated by binding motifs for insulator proteins including CCCTC-binding factor (CTCF) and the promoters of actively transcribed genes 3,4 . There is increasing evidence that TADs are formed by a process of active extrusion of chromatin loops which is limited by these boundary elements [5][6][7] .
Specific interactions between regulatory elements appear to occur most frequently within TADs. For example, enhancers preferentially interact with gene promoters in the same TAD 8 and disruption of TAD boundaries results in promiscuous enhancer-promoter interactions and disrupted gene activity [9][10][11][12][13] . However, it is not clear how specificity between multiple enhancer elements and promoters contained within a single TAD is regulated. Enhancers often exert different effects on what appear to be equally accessible genes within individual TADs. It has been proposed that enhancer-driven transcription from different promoters within a TAD is dependent on distance, orientation, or affinity of the enhancers with respect to the specific promoters 14,15 . Previous studies have suggested that enhancers may only interact with one accessible promoter at a time. This has led to a model in which the pattern of gene expression within a TAD containing multiple genes is determined by competition between promoters for limited access to shared enhancers. Based on this model, it has been proposed that coexpression of multiple genes regulated by shared enhancers in a single TAD results from rapidly alternating interactions of these genes with the enhancers in a flip-flop mechanism 16,17 .
However, it has also been proposed that transcription of multiple genes might be coordinated within transcription factories 18 . Moreover, recent evidence suggests that transcriptional activation takes place in nuclear condensates, which contain a high concentration of transcription factors, co-factors, and components of the basal transcription machinery recruited by enhancer elements [19][20][21][22][23] . Such condensates imply that multiple regulatory elements within a TAD interact and function together in hub-like complexes. This has been postulated previously in the active chromatin hub model 24 and corresponding structures have recently been identified at a chromatin level 25,26 . In the context of these recent findings, it is unclear if and how promoter competition occurs and what the underlying structural mechanism is.
We have recently developed Tri-C, a Chromosome Conformation Capture (3C)-based approach, which can analyze multi-way chromatin interactions at single alleles 26 . Tri-C allows us to investigate whether promoters interact with enhancers in a mutually exclusive, one-to-one manner, or whether multiple promoters interact simultaneously with a shared set of enhancers in a hub structure. We have addressed this question using the well-characterized mouse α-globin locus as a model. The α-globin genes and their five enhancer elements, which fulfill the criteria for a super-enhancer 27 , are located in a small TAD which is activated during erythroid differentiation 28 . We have previously shown that in vivo deletion of two CTCF-binding sites at the upstream domain boundary results in an extension of the TAD and the incorporation of three upstream genes, which become highly upregulated under the influence of the strong α-globin enhancers 13 . These mutant mice provide an excellent model to analyze the interactions between genes co-activated by a set of well-characterized enhancers in primary cells.
By performing Tri-C in erythroid cells in which the CTCF boundary is deleted, here we show that the upregulated gene promoters preferentially interact in hub-like complexes containing both the α-globin enhancers and the other active gene promoters in the domain. This shows that interactions between promoters and enhancers are not mutually exclusive and that there is no intrinsic structural competition between promoters for shared enhancers. These findings contribute to our understanding of the interplay between regulatory elements within and beyond TAD structures and the multiple layers of regulation that control gene expression.
Results
CTCF deletions create an extension of the α-globin domain. We have previously defined the regulatory elements in and around the mouse α-globin cluster 13,27,28 (Fig. 1). The duplicated α-globin genes and the five globin enhancers (R1-R4 and Rm) lie within a small~90 kb TAD. This TAD is flanked by predominantly convergent CTCF boundary elements. We have previously shown that deletion of the HS-38 and HS-39 CTCFbinding motifs causes strong upregulation of the upstream Mpg, Rhbdf1 and Snrnp25 genes in erythroid cells 13 . To investigate how this deletion influences chromatin interactions with the α-globin enhancers, we performed Capture-C from the viewpoint of the strongest enhancer element, R2, in primary erythroid cells derived from wild type (WT) mice and mice in which the CTCFbinding motifs were deleted (D3839). This shows an extension of the interaction domain in the D3839 mice, causing increased interactions between the α-globin enhancers and the Mpg, Rhbdf1, and Snrnp25 promoters (Fig. 1). The D3839 deletion thus creates an extended~120 kb TAD in which the α-globin enhancers upregulate multiple genes. This extended domain enables us to address the mechanism by which a so-called super-enhancer interacts with multiple accessible gene promoters in a single TAD.
The regulatory elements in the α-globin domain form a hub.
Although Capture-C produces high-resolution 3C profiles 29 , it predominantly generates pair-wise interaction data. It is therefore not possible to determine the higher-order structures in which the multiple promoters and enhancers in the extended α-globin domain interact. Based on multi-way chromatin contacts generated by Tri-C, we have previously shown that the active α-globin locus is organized in a hub structure, in which multiple enhancer elements interact simultaneously with the α-globin promoters in a regulatory complex 26 . To examine this structure in the context of the extended α-globin TAD containing multiple gene promoters, we performed a Tri-C experiment from the viewpoint of the R2 enhancer in primary erythroid cells derived from D3839 and WT mice ( Fig. 2 and Supplementary Fig. 1). Direct comparison of multi-way interactions between biological triplicates of D3839 and WT cells allows us to normalize and correct for 3C-related artefacts 30 and thus to robustly quantify relevant interactions. We display the multi-way interactions detected by Tri-C in contact matrices in which we exclude the viewpoint of interest and plot the frequencies with which two elements interact simultaneously with this viewpoint at a single allele. Preferential, simultaneous interactions are visible as enrichments at the intersections between these elements, whereas mutually exclusive contacts between elements appear as depletions in the matrix. Consistent with our previous findings, we observe strong, simultaneous R2 interactions with the α-globin promoter and enhancer elements in WT cells. These interactions are not decreased in the D3839 cells, as would be expected if there was competition between these elements. Rather, there is a trend towards increased interactions contributing to the α-globin hub in the D3839 cells, though this is not significant (Fig. 2b, c; green). In addition to the multi-way contacts between the α-globin enhancers and promoters, in D3839 we observe simultaneous interactions between the αglobin enhancer elements and the Mpg and Rhbdf1 promoters (Fig. 2b, c, purple). Interestingly, the R2 contact matrix also shows simultaneous contacts with both the α-globin promoters and the Mpg and Rhbdf1 promoters (Fig. 2b, gray). This indicates that all promoters in the extended D3839 TAD interact together in a single hub.
Multiple gene promoters interact in a single regulatory hub. To allow more extensive examination of the simultaneous interactions that occur when the upstream genes interact with the αglobin enhancers in D3839 cells, we next generated Tri-C data from the viewpoint of the Mpg promoter ( Fig. 3 and Supplementary Figs. 2, 3). Comparison of multi-way Mpg interactions in D3839 and WT cells reveals a strong increase in interactions downstream of Mpg after removal of the CTCF boundary. These interactions are strongest proximal to the Mpg promoter and reduce in strength beyond the R1 enhancer, which is located close to the HS-29 CTCF-binding site. We also observe a clear increase in more distal downstream multi-way interactions, predominantly with the regions containing the α-globin promoters and enhancers. In a dynamic flip-flop model, the Mpg promoter would structurally compete with the α-globin promoters for interactions with the α-globin enhancers. Such mutually exclusive interactions would be reflected by a depletion of the corresponding multi-way interactions in the Tri-C matrix. However, we find preferential interactions between these elements. For example, when Mpg interacts with R1, it preferentially interacts with the α-globin promoters (Fig. 3, green) and R4 enhancer ( Supplementary Fig. 3). Similarly, we find enrichment of multiway interactions between Mpg, R1, and the Rhbdf1 promoter ( Fig. 3, purple). This shows that Mpg preferentially interacts with the α-globin enhancers in a complex that contains multiple Fig. 1 Characterization of a CTCF boundary deletion upstream of the α-globin locus. Gene annotation is shown at the top, with the α-globin genes in bold and genes upregulated by the CTCF boundary deletion highlighted in green. Open chromatin (ATAC in WT erythroid cells) is shown below, with the αglobin enhancers highlighted. CTCF occupancy in WT (blue) and D3839 (red) erythroid cells is shown underneath, with the orientation of the CTCFbinding motifs indicated by arrowheads (forward orientation in red; reverse orientation in blue). CTCF-binding sites of interest are highlighted and the deleted CTCF-binding sites are indicated with a black cross. The profiles below show Capture-C interactions from the viewpoint of the R2 enhancer (indicated with a black arrow) in WT (blue) and D3839 (red) erythroid cells, with a differential profile at the bottom. Profiles represent the mean number of normalized unique interaction counts per restriction fragment in n = 3 biological replicates. Coordinates (mm9): chr11:32,070,000-32,250,000.
enhancer elements and promoters. We also find that multi-way interactions between the three promoters are enriched ( Fig. 3; orange), which further confirms that there is no structural competition between active promoters for contact with the enhancers within the extended TAD.
Discussion
To investigate how multiple regulatory elements and genes contained within a single TAD structurally interact, we analyzed multi-way chromatin interactions in an engineered extended TAD containing the five clustered α-globin enhancers and multiple gene promoters. We show that all gene promoters interact simultaneously with the enhancers in a common regulatory hub.
Within the context of this extended TAD structure, the upstream non-globin genes do not interact as strongly and/or as frequently with the α-globin enhancers compared to the α-globin promoters. However, we show that when these genes form interactions with the α-globin enhancers, they preferentially interact in a complex in which the α-globin promoters are also present (Fig. 3, Supplementary Fig. 3). By comparing the α-globin hub in WT and D3839 cells, we show that the inclusion of additional promoters to this complex does not weaken the interactions between the αglobin promoters and enhancers and might even have an overall stabilizing effect on the hub (Fig. 2). Our data thus show that multiple gene promoters can simultaneously interact with shared enhancers at a single allele. Our findings at the α-globin locus-a well-understood model of gene regulation-demonstrate that the previously reported flip-flop model of promoter competition, in which individual gene promoters interact with enhancers in a mutually exclusive manner, is not universally true, and that there is no intrinsic competition between gene promoters for physical access to shared enhancers within a single TAD (Fig. 4). Our model is supported by recent live-imaging experiments in Drosophila which showed coordinated bursting of two genes regulated by a single shared enhancer 31 .
Our findings clarify how the activity of strong enhancers is distributed between the multiple genes surrounding these elements. In agreement with previous findings 9-13 , enhancers and promoters do not interact beyond strong CTCF-binding sites at TAD boundaries, since removal of the HS-38/-39 boundary is required for the upstream genes to be activated by the α-globin enhancers.
By contrast, within a single TAD, all promoters interact with the enhancers in a common nuclear compartment. This is consistent with previous models of transcription factories, transcriptional hubs and the recent model of transcriptional activation in nuclear condensates. However, even in the context of these cooperative structures, the activity of enhancers may not always be distributed equally between all promoters in a TAD. This might partially be explained by the relative position of where an active promoter located between an enhancer and another, more distal promoter causes reduced activity of the distal promoter 16,17,32,33 . It is possible that the proximal highly transcribed gene forms a barrier to loop extrusion 34 , due to accumulation of large amounts of transcriptional machinery and regulatory factors. This could reduce interactions between the more distal promoter and the enhancers and hence decrease expression of the distal gene. However, the underlying mechanism is not mutual exclusivity of enhancer-promoter interactions, but a structural boundary which reduces access of the distal promoter to a cooperative hub. Interestingly, we have shown that inclusion of the upstream genes in the α-globin hub causes upregulation of their expression, but not to the exceptionally high levels of the downstream αglobin genes 13 . This could be explained by the lower frequency of interaction and inclusion of these genes within the chromatin hub, which may correspond to a nuclear condensate. However, it is also possible that epigenetic chromatin modifications and biochemical processes within such condensates play a role, which might form another layer of regulation and potential competitive effects. For example, it could be that the α-globin genes are more responsive to the transcription and co-factors recruited by the αglobin enhancers 35 .
We have previously shown that the formation of the TAD in which the α-globin enhancers and promoters interact in erythroid cells is not dependent on the presence of all individual enhancer elements 27 . It will be of interest to further examine whether deletions of enhancer elements cause more subtle chromatin changes that might compromise the formation of the chromatin hub in both the intact locus and upon boundary deletion.
Furthermore, it will be very important to further investigate the dynamic 3D structures associated with gene activation across other gene loci and using orthogonal approaches, such as superresolution microscopy and live-cell imaging. At the moment, imaging-based technologies are still limited in both resolution and throughput. However, with rapid technological advancements it should be possible to directly relate chromatin structures to levels of gene expression in single cells in the future. This will provide important insights into the mechanisms that control gene activity and how mutations that disrupt regulatory chromatin structures contribute to human disease.
Methods
Animals and cells. We previously generated the D3839 mouse model, using TALEN and CRISPR-Cas9 to create small 19 and 26 bp deletions in the core CTCF-binding motifs of HS-38 and HS-39, respectively 13 . We performed all described experiments in primary cells obtained from spleens of female D3839 or WT C57BL/6 mice treated with phenylhydrazine, and selected erythroid cells based on the erythroid marker Ter119 using magnetic-activated cell sorting 29 . Experimental procedures were in accordance with the European Union Directive 2010/ 63/EU and/or the UK Animals (Scientific Procedures) Act (1986) and protocols were approved through the Oxford University Local Ethical Review process. Model of the structural interplay between the regulatory elements in the α-globin locus upon removal of the upstream CTCF boundary. The CTCF boundary upstream of the α-globin enhancers (green) normally constrains their activity to the downstream α-globin genes (red). Removal of this boundary causes upregulation of the genes upstream of the α-globin enhancers (yellow). Our data show that upregulation of these genes is not caused by dynamically switching interactions between the α-globin enhancers and individual promoters (left), but by the formation of a regulatory hub in which all regulatory elements interact simultaneously (right).
Capture-C experimental procedure. We performed Capture-C experiments in three biological replicates of primary erythroid cells derived from WT and D3839 mice following the Next-Generation Capture-C protocol 29 . We prepared 3C libraries using the DpnII-restriction enzyme for digestion. We added Illumina TruSeq adapters using NEBNext reagents and performed capture enrichment using Nimblegen reagents. We designed the capture oligonucleotides targeting the DpnII fragments containing the R1 and R2 enhancers using CapSequm 36 . Figure 1 shows the interaction profiles from the viewpoint of the R2 enhancer. Data from the R1 viewpoint have been published previously (GEO accession code GSE97871) 13 . The Capture-C libraries were sequenced on the Illumina MiSeq platform (V2 chemistry; 150 bp paired-end reads).
Capture-C data analysis. We analyzed Capture-C data using scripts available at https://github.com/Hughes-Genome-Group/CCseqBasicS. Because PCR duplicates are removed during data analysis, Capture-C accurately quantifies chromatin interactions 37 . The Capture-C profiles in Fig. 1 represent the mean number of unique interactions per restriction fragment from three biological replicates, normalized for a total of 100,000 interactions on the chromosome analyzed, and scaled to 1000. The differential profile highlights the interactions in D3839 cells after subtracting the normalized number of unique interactions in WT cells from those in D3839 cells. Interactions within a proximity zone of 1 kb around the viewpoint and with restriction fragments that were targeted by other capture oligonucleotides in the multiplexed capture procedure were excluded from analysis to prevent artefacts.
Tri-C experimental procedure. We performed Tri-C experiments in three biological replicates of primary erythroid cells derived from WT and D3839 mice following the protocol available on Protocol Exchange 38 . We used the NlaIII restriction enzyme for digestion during 3C library preparation. We added Illumina TruSeq adaptors using NEBNext DNA Library Prep reagents and Ampure XP beads (Beckman Coulter: A63881). We prepared WT libraries using the NEBNext DNA Library Prep Master Mix Set for Illumina (New England Biolabs: E6040S/L) according to the manufacturer's protocol. For each biological replicate, we performed 2-3 parallel reactions using 6 μg 3C library for sonication and all recovered material (~4.5 μg) for the subsequent library preparation. We amplified each library preparation reaction with a different index, using two separate PCR reactions per reaction (a total of 4-6 PCR reactions per biological replicate) to maximize library complexity. This procedure resulted in a total of seven technical replicates with unique indices. We prepared D3839 libraries using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs: E7645S/L) according to the manufacturer's protocol. For each biological replicate, we sonicated 4 μg 3C library, after which we split all recovered material (~3 μg) over two parallel library preparation reactions. We amplified the two parallel reactions with the same index using two separate PCR reactions (a total of four PCR reactions per biological replicate) to maximize library complexity for each biological replicate. This resulted in a total of three replicates with unique indices. Because the Ultra II reagents are more efficient than the standard DNA Library Prep reagents, this resulted in comparable complexity for each biological replicate and similar data depth for both conditions (Supplementary Figs. 1 and 2). We pooled all libraries to enrich for viewpoints of interest in a multiplexed double capture procedure using Nimblegen reagents with custom-designed capture oligonucleotides (Supplementary Tables 1 and 2). The Tri-C libraries were sequenced on the Illumina NextSeq platform (V2 chemistry; 150 bp paired-end reads).
Tri-C data analysis. We analyzed Tri-C data using scripts available at https:// github.com/Hughes-Genome-Group/CCseqBasicS and https://github.com/ oudelaar/TriC. Briefly, we used the CCseqBasic pipeline (flags: --CCversion CS5 --nla --sonicationSize 700 --wobblyEndBinWidth 6) to perform the initial fastq processing and aligning of the data, filter out spurious ligation events and PCR duplicates, and exclude interactions with restriction fragments that were targeted by other capture oligonucleotides in the multiplexed capture procedure. We used a custom script to select reads with two or more reporters to calculate multi-way interaction counts between reporter fragments for each viewpoint. We visualized these interactions in contact matrices at 1 kb resolution, after normalizing for the total counts in each matrix and correcting for the number of restriction fragments present in each bin. We integrated this workflow in the CCseqBasic pipeline, which is available at https://github.com/Hughes-Genome-Group/CCseqBasicS. To allow for direct comparisons between WT and D3839 cells, we scaled all contact matrices to 100 normalized interactions per bin. We derived differential matrices to highlight the interactions specific for each condition after subtracting the normalized interactions in WT cells from those in D3839 cells or vice versa. We also generated regular pair-wise interaction profiles based on the total interaction counts. These Tri-Capture-C profiles were derived as described above (Capture-C-data analysis). To calculate the enrichment of multi-way interactions between regulatory elements of interest (highlighted in Figs. 2 and 3), we calculated the counts in the bins in a 2 kb radius surrounding the foci of interest in the matrix and expressed these counts as a percentage of the total number of counts in the matrix. To examine the correlation between individual replicates, we used HiCRep to calculate stratum-adjusted correlation coefficients 39 , using a smoothing parameter optimized to h = 10 and a maximum distance of 100,000 bp. To analyze the differences between the WT and D3839 replicates, we used unpaired, two-tailed t-tests.
Statistical analysis. Statistical analyses were performed with Student's two-tailed t-tests using GraphPad Prism software.
Reporting summary. Further information on research design is available in the Nature Research Reporting Summary linked to this article.
Data availability
All sequencing data have been submitted to the NCBI Gene Expression Omnibus under accession number GSE130308. All other relevant data supporting the key findings of this study are available within the article and its Supplementary Information files or from the corresponding author upon reasonable request. A reporting summary for this Article is available as a Supplementary Information file.
Fig. 2
2The formation of the enhancer-promoter hub at the α-globin locus is not dependent on the upstream CTCF boundary. a Tri-C contact matrices showing multi-way chromatin interactions with R2 in D3839 (top) and WT (bottom) erythroid cells. Matrices represent mean numbers of normalized, unique contact counts at 1 kb resolution in n = 3 biological replicates with proximity contacts around the R2 viewpoint excluded (gray diagonal). Gene annotation, open chromatin (ATAC) and CTCF occupancy in WT erythroid cells are shown in the middle. Coordinates (mm9): chr11:32,070,000-32,250,000. b Tri-C contact matrices showing differential multi-way chromatin interactions with R2 between D3839 and WT erythroid cells (top) and vice versa (bottom). Pair-wise interaction profiles derived from the Tri-C data from the R2 viewpoint (R2 Tri-Capture-C) are shown in the middle (D3839 in red, WT in blue), with a differential profile in the bottom panel. Coordinates (mm9): chr11:32,070,000-32,250,000. c Quantification of multi-way contacts between R2, R1, and the αglobin promoters (R2-R1-Hba1/2, green, P = 0.29) and R2, R1, and the Mpg and Rhbdf1 promoters (R2-R1-Mpg/Rhbdf1, purple, P = 0.0055). Quantified contacts are highlighted with corresponding colors in the matrices above. Numbers represent the proportion of these three-way contacts relative to the total in the matrix and are averages of n = 3 biological replicates, with individual data points overlaid as dot plots and the standard error of the mean denoted by the error bar. P-values were calculated by two-tailed t-tests.
Fig. 3
3Deletion of a CTCF boundary results in the formation of a regulatory hub in which multiple gene promoters are incorporated. a Tri-C contact matrices showing multi-way chromatin interactions with Mpg in D3839 (top) and WT (bottom) erythroid cells. Matrices represent mean numbers of normalized, unique contact counts at 1 kb resolution in n = 3 biological replicates with proximity contacts around the Mpg viewpoint excluded (gray diagonal). Gene annotation, open chromatin (ATAC), and CTCF occupancy in WT erythroid cells are shown in the middle. Coordinates (mm9): chr11:32,070,000-32,250,000. b Tri-C contact matrices showing differential multi-way chromatin interactions with Mpg between D3839 and WT erythroid cells (top) and vice versa (bottom). Pairwise interaction profiles derived from the Tri-C data from the Mpg viewpoint (Mpg Tri-Capture-C) are shown in the middle (D3839 in red, WT in blue), with a differential profile in the bottom panel. Coordinates (mm9): chr11:32,070,000-32,250,000. c Quantification of multi-way contacts between Mpg, R1 and the αglobin promoters (Mpg-R1-Hba1/2, green, P = 0.046); Mpg, R1 and the Rhbdf1 promoter (Mpg-R1-Rhbdf1, purple, P = 0.0064); and Mpg, the α-globin promoters and the Rhbdf1 promoter (Mpg-Hba1/2-Rhbdf1, orange, P = 0.040). Quantified contacts are highlighted with corresponding colors in the matrices above. Numbers represent the proportion of these three-way contacts relative to the total in the matrix and are averages of n = 3 biological replicates, with individual data points overlaid as dot plots and the standard error of the mean denoted by the error bar. P-values were calculated by two-tailed t-tests. | (2019) 10:5412 | https://doi.org/10.1038/s41467-019-13404-x | www.nature.com/naturecommunications promoters with respect to the enhancers. Reported examples of promoter competition have often described situations,
Fig. 4
4Fig. 4 Model of the structural interplay between the regulatory elements in the α-globin locus upon removal of the upstream CTCF boundary. The CTCF boundary upstream of the α-globin enhancers (green) normally constrains their activity to the downstream α-globin genes (red). Removal of this boundary causes upregulation of the genes upstream of the α-globin enhancers (yellow). Our data show that upregulation of these genes is not caused by dynamically switching interactions between the α-globin enhancers and individual promoters (left), but by the formation of a regulatory hub in which all regulatory elements interact simultaneously (right).
NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-13404-x
NATURE COMMUNICATIONS | (2019) 10:5412 | https://doi.org/10.1038/s41467-019-13404-x | www.nature.com/naturecommunications
© The Author(s) 2019
Code availabilityCustom scripts used for the analysis of Capture-C and Tri-C data are available at https:// github.com/Hughes-Genome-Group/CCseqBasicS and https://github.com/oudelaar/TriC/.Author contributionsCompeting interestsThe authors declare no competing interests.Additional informationSupplementary information is available for this paper at https://doi.org/10.1038/s41467-019-13404-x.Correspondence and requests for materials should be addressed to J.R.H.Peer review information Nature Communications thanks the anonymous reviewer(s) for their contribution to the peer review of this work. Peer reviewer reports are available.Reprints and permission information is available at http://www.nature.com/reprintsPublisher's note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/ licenses/by/4.0/.
Structural and functional diversity of topologically associating domains. J Dekker, E Heard, FEBS Lett. 589Dekker, J. & Heard, E. Structural and functional diversity of topologically associating domains. FEBS Lett. 589, 2877-2884 (2015).
Chromatin domains: the unit of chromosome organization. J R Dixon, D U Gorkin, B Ren, Mol. Cell. 62Dixon, J. R., Gorkin, D. U. & Ren, B. Chromatin domains: the unit of chromosome organization. Mol. Cell 62, 668-680 (2016).
A 3D map of the human genome at kilobase resolution reveals principles of chromatin looping. S S P Rao, Cell. 159Rao, S. S. P. et al. A 3D map of the human genome at kilobase resolution reveals principles of chromatin looping. Cell 159, 1665-1680 (2014).
The long-range interaction landscape of gene promoters. A Sanyal, B R Lajoie, G Jain, J Dekker, Nature. 489Sanyal, A., Lajoie, B. R., Jain, G. & Dekker, J. The long-range interaction landscape of gene promoters. Nature 489, 109-113 (2012).
Emerging evidence of chromosome folding by loop extrusion. Cold Spring Harbor Symp. G Fudenberg, N Abdennur, M Imakaev, A Goloborodko, L A Mirny, 10.1101/sqb.2017.82.034710Quant. Biol. 34710Fudenberg, G., Abdennur, N., Imakaev, M., Goloborodko, A. & Mirny, L. A. Emerging evidence of chromosome folding by loop extrusion. Cold Spring Harbor Symp. Quant. Biol. 034710 (2018). https://doi.org/10.1101/ sqb.2017.82.034710
Formation of chromosomal domains by loop extrusion. G Fudenberg, Cell Rep. 15Fudenberg, G. et al. Formation of chromosomal domains by loop extrusion. Cell Rep. 15, 2038-2049 (2016).
Chromatin extrusion explains key features of loop and domain formation in wild-type and engineered genomes. A L Sanborn, Proc. Natl Acad. Sci. USA. 112Sanborn, A. L. et al. Chromatin extrusion explains key features of loop and domain formation in wild-type and engineered genomes. Proc. Natl Acad. Sci. USA 112, E6456-E6465 (2015).
Functional and topological characteristics of mammalian regulatory domains. O Symmons, Genome Res. 24Symmons, O. et al. Functional and topological characteristics of mammalian regulatory domains. Genome Res. 24, 390-400 (2014).
Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions. D G Lupiáñez, Cell. 161Lupiáñez, D. G. et al. Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions. Cell 161, 1012-1025 (2015).
CTCF establishes discrete functional chromatin domains at the Hox clusters during differentiation. V Narendra, Science. 347Narendra, V. et al. CTCF establishes discrete functional chromatin domains at the Hox clusters during differentiation. Science 347, 1017-1021 (2015).
CRISPR inversion of CTCF sites alters genome topology and enhancer/promoter function. Y Guo, Cell. 162Guo, Y. et al. CRISPR inversion of CTCF sites alters genome topology and enhancer/promoter function. Cell 162, 900-910 (2015).
CTCF binding polarity determines chromatin looping. E De Wit, Mol. Cell. 60de Wit, E. et al. CTCF binding polarity determines chromatin looping. Mol. Cell 60, 676-684 (2015).
Tissue-specific CTCF-cohesin-mediated chromatin architecture delimits enhancer interactions and function in vivo. L L P Hanssen, Nat. Cell Biol. 19Hanssen, L. L. P. et al. Tissue-specific CTCF-cohesin-mediated chromatin architecture delimits enhancer interactions and function in vivo. Nat. Cell Biol. 19, 952-961 (2017).
Ever-changing landscapes: transcriptional enhancers in development and evolution. H K Long, S L Prescott, J Wysocka, Cell. 167Long, H. K., Prescott, S. L. & Wysocka, J. Ever-changing landscapes: transcriptional enhancers in development and evolution. Cell 167, 1170-1187 (2016).
Developmental enhancers and chromosome topology. E E M Furlong, M Levine, Science. 361Furlong, E. E. M. & Levine, M. Developmental enhancers and chromosome topology. Science 361, 1341-1345 (2018).
Transcription complex stability and chromatin dynamics in vivo. M Wijgerde, F Grosveld, P Fraser, Nature. 377Wijgerde, M., Grosveld, F. & Fraser, P. Transcription complex stability and chromatin dynamics in vivo. Nature 377, 209-213 (1995).
Enhancer regulation of transcriptional bursting parameters revealed by forced chromatin looping. C R Bartman, S C Hsu, C C S Hsiung, A Raj, G A Blobel, Mol. Cell. 62Bartman, C. R., Hsu, S. C., Hsiung, C. C. S., Raj, A. & Blobel, G. A. Enhancer regulation of transcriptional bursting parameters revealed by forced chromatin looping. Mol. Cell 62, 237-247 (2016).
Visualization of focal sites of transcription within human nuclei. D A Jackson, A B Hassan, R J Errington, P R Cook, EMBO J. 12Jackson, D. A., Hassan, A. B., Errington, R. J. & Cook, P. R. Visualization of focal sites of transcription within human nuclei. EMBO J. 12, 1059-1065 (1993).
Imaging dynamic and selective low-complexity domain interactions that control gene transcription. S Chong, Science. 3612555Chong, S. et al. Imaging dynamic and selective low-complexity domain interactions that control gene transcription. Science 361, eaar2555 (2018).
Mediator and RNA polymerase II clusters associate in transcription-dependent condensates. W.-K Cho, Science. 361Cho, W.-K. et al. Mediator and RNA polymerase II clusters associate in transcription-dependent condensates. Science 361, 412-415 (2018).
Coactivator condensation at super-enhancers links phase separation and gene control. B R Sabari, Science. 3613958Sabari, B. R. et al. Coactivator condensation at super-enhancers links phase separation and gene control. Science 361, eaar3958 (2018).
Transcription factors activate genes through the phaseseparation capacity of their activation domains. A Boija, Cell. 175Boija, A. et al. Transcription factors activate genes through the phase- separation capacity of their activation domains. Cell 175, 1842-1855.e16 (2018).
RNA polymerase II clustering through carboxy-terminal domain phase separation. M Boehning, Nat. Struct. Mol. Biol. 25Boehning, M. et al. RNA polymerase II clustering through carboxy-terminal domain phase separation. Nat. Struct. Mol. Biol. 25, 833-840 (2018).
Looping and interaction between hypersensitive sites in the active β-globin locus. B Tolhuis, R.-J Palstra, E Splinter, F Grosveld, W De Laat, Mol. Cell. 10Tolhuis, B., Palstra, R.-J., Splinter, E., Grosveld, F. & de Laat, W. Looping and interaction between hypersensitive sites in the active β-globin locus. Mol. Cell 10, 1453-1465 (2002).
Enhancer hubs and loop collisions identified from singleallele topologies. A Allahyar, Nat. Genet. 2951306Allahyar, A. et al. Enhancer hubs and loop collisions identified from single- allele topologies. Nat. Genet. 295, 1306 (2018).
Single-allele chromatin interactions identify regulatory hubs in dynamic compartmentalized domains. A M Oudelaar, Nat. Genet. 50Oudelaar, A. M. et al. Single-allele chromatin interactions identify regulatory hubs in dynamic compartmentalized domains. Nat. Genet. 50, 1744-1751 (2018).
Genetic dissection of the α-globin super-enhancer in vivo. D Hay, Nat. Genet. 48Hay, D. et al. Genetic dissection of the α-globin super-enhancer in vivo. Nat. Genet. 48, 895-903 (2016).
A tissue-specific self-interacting chromatin domain forms independently of enhancer-promoter interactions. J M Brown, Nat. Commun. 9376Brown, J. M. et al. A tissue-specific self-interacting chromatin domain forms independently of enhancer-promoter interactions. Nat. Commun. 9, 376 (2018).
Multiplexed analysis of chromosome conformation at vastly improved sensitivity. J O J Davies, Nat. Methods. 86Davies, J. O. J. et al. Multiplexed analysis of chromosome conformation at vastly improved sensitivity. Nat. Methods 86, 1202-1210 (2015).
Iterative correction of Hi-C data reveals hallmarks of chromosome organization. M Imakaev, Nat. Methods. 9Imakaev, M. et al. Iterative correction of Hi-C data reveals hallmarks of chromosome organization. Nat. Methods 9, 999-1003 (2012).
Enhancer control of transcriptional bursting. T Fukaya, B Lim, M Levine, Cell. 166Fukaya, T., Lim, B. & Levine, M. Enhancer control of transcriptional bursting. Cell 166, 358-368 (2016).
A regulatory SNP causes a human genetic disease by creating a new transcriptional promoter. M De Gobbi, Science. 312De Gobbi, M. et al. A regulatory SNP causes a human genetic disease by creating a new transcriptional promoter. Science 312, 1215-1217 (2006).
Promoter of lncRNA Gene PVT1 is a tumor-suppressor DNA boundary element. S W Cho, Cell. 173Cho, S. W. et al. Promoter of lncRNA Gene PVT1 is a tumor-suppressor DNA boundary element. Cell 173, 1398-1412.e22 (2018).
RNA polymerases as moving barriers to condensin loop extrusion. H B Brandão, Proc. Natl Acad. Sci. USA. Natl Acad. Sci. USA11620489Brandão, H. B. et al. RNA polymerases as moving barriers to condensin loop extrusion. Proc. Natl Acad. Sci. USA 116, 20489 (2019).
Transcriptional cofactors display specificity for distinct types of core promoters. V Haberle, Nature. 570Haberle, V. et al. Transcriptional cofactors display specificity for distinct types of core promoters. Nature 570, 122-126 (2019).
Analysis of hundreds of cis-regulatory landscapes at high resolution in a single, high-throughput experiment. J R Hughes, Nat. Genet. 46Hughes, J. R. et al. Analysis of hundreds of cis-regulatory landscapes at high resolution in a single, high-throughput experiment. Nat. Genet. 46, 205-212 (2014).
Robust detection of chromosomal interactions from small numbers of cells using low-input Capture-C. A M Oudelaar, J O J Davies, D J Downes, D R Higgs, J R Hughes, 10.1093/nar/gkx1194Nucleic Acids Res. Oudelaar, A. M., Davies, J. O. J., Downes, D. J., Higgs, D. R. & Hughes, J. R. Robust detection of chromosomal interactions from small numbers of cells using low-input Capture-C. Nucleic Acids Res. https://doi.org/10.1093/nar/ gkx1194 (2017).
. A M Oudelaar, D J Downes, J R Hughes, Tri-C. Protoc, Exch, 10.1038/protex.2018.113Oudelaar, A. M., Downes, D. J. & Hughes, J. R. Tri-C. Protoc. Exch. https://doi. org/10.1038/protex.2018.113 (2018).
HiCRep: assessing the reproducibility of Hi-C data using a stratum-adjusted correlation coefficient. T Yang, Genome Res. 27Yang, T. et al. HiCRep: assessing the reproducibility of Hi-C data using a stratum-adjusted correlation coefficient. Genome Res. 27, 1939-1949 (2017).
|
Introduction
DNA methylation is a frequent biochemical modification of eukaryotic DNA [1][2][3][4][5][6]. In humans, it affects the C5 position of cytosines that belong to CpG dinucleotides (i.e., a cytosine directly followed by a guanine).
CpG dinucleotides are distributed unevenly across the human genome. In non-coding DNA, CpG dinucleotides are 4-fold underrepresented compared to the frequency of the other dinucleotides [7,8], with the remarkable exception of so-called CpG islands. There, CpGs are approximately as frequent as one would expect from single base pair frequencies. For practical reasons, CpG islands are usually defined as sequence stretches that fulfill three conditions [9]: (i) GC content above 50%, (ii) ratio of observed versus expected number of CpG dinucleotides above 0.6, and (iii) more than n base pairs in length (we use n ¼ 400 in accordance with the source of our dataset [10]). CpG islands rarely exceed 5,000 base pairs and are often associated with functional elements. In particular, CpG islands overlap with the promoter regions of 50% to 60% of human genes, including most housekeeping genes [11,12].
As DNA methylation in the human genome is largely confined to CpG dinucleotides, it is not surprising that the distribution of DNA methylation along the genome is closely intertwined with CpG frequencies. The classical view is that almost all dispersed CpG dinucleotides in the human genome are methylated by default, whereas CpG dinucleotides inside CpG island promoters are typically unmethylated in normal (i.e., non-neoplasic, non-senescent) tissue [1]. However, exceptions have been known for a long time, such as de novo methylation during cell differentiation [13], imprinting [3], and X-chromosome inactivation [14]. Strong biallelic DNA methylation of CpG island promoters is associated with stable silencing of neighboring or associated genes and constitutes a frequent event in cancer progression [15].
Initial chromosome-wide and genome-wide studies of CpG island methylation indicate that a sizeable fraction of CpG islands is methylated in normal tissue [10,16]. However, little is known about the mechanisms that lead to methylation of certain CpG islands while leaving others unmethylated, and it is unclear whether these two groups can be identified by characteristic attributes. Inspired by recent exploratory results pointing towards a significant role of local DNA sequences in predetermining DNA methylation at the nucleotide level (i.e., CpG dinucleotides instead of CpG islands) [17,18], as well as for aberrant methylation [19], we performed a comprehensive analysis of the association of DNA-related features and normal CpG island methylation on human Chromosome 21. Our results show that DNA sequence patterns, repeat frequencies, and predicted DNA structure are highly correlated with CpG island methylation. We successfully used this association to predict the methylation status for new CpG islands.
Results
In this study, we explore the relationship between DNA methylation and various DNA-related features at the biologically functional CpG island level, using computational epigenetics methodology. Based on a dataset published by Yamada et al., comprising all CpG islands on the nonrepetitive parts of human Chromosome 21 [10] and a compiled list of 1,184 DNA-related attributes, we quantify the correlation between CpG island methylation and eight attribute classes: (1) DNA sequence properties and patterns, (2) repeat frequency and distribution, (3) CpG island frequency and distribution, (4) predicted DNA structure, (5) gene and exon distribution, (6) predicted transcription factor binding sites, (7) evolutionary conservation, and (8) single nucleotide polymorphisms (SNPs). We identify the attributes that are most predictive in distinguishing between methylated and unmethylated CpG islands and we show that it is possible to predict CpG island methylation from DNA-related features with high accuracy. Finally, we validate our results both experimentally on Chromosome 21 and bioinformatically on data from the Human Epigenome Project (HEP) [20].
Identification of DNA-Related Attributes That Distinguish Methylated CpG Islands from Their Unmethylated Counterparts
As a first step towards understanding the relationship between DNA-related attributes and CpG island methylation, we statistically compared the distributions between methylated and unmethylated CpG islands for all attributes in our list (see Dataset S1 for the full list of p-values and Materials and Methods for an overview of attribute definitions). Using a conservative significance threshold, 41 attributes showed significant differences (Table 1).
Of the significant attributes, the majority are frequencies of GC-rich and CpG-rich DNA sequence patterns, which are overrepresented in unmethylated CpG islands. Non-strand-specific patterns and patterns that are strand-specific relative to the chromosomal plus-strand occur with similar frequency and composition. Several attributes that refer to repetitive DNA are more frequent in methylated CpG islands (such as segmental duplications, self chain alignments, and tandem repeats).
Interestingly, two aspects of predicted DNA structure, most prominently the average rise of the DNA helix, also show different distributions for methylated and unmethylated CpG islands (see Olson et al. [21] for an overview of DNA structure nomenclature). The role of predicted DNA structure becomes even more pronounced when considering not only the CpG island itself, but also the À20-kilobase (kb) to þ20-kb sequence windows surrounding it. In that case, the predicted average rise and the predicted average twist are the second and third most significant among all attributes (Dataset S1, second worksheet). An inspection of the corresponding boxplots ( Figure 1) shows that the predicted DNA rise increases on average within CpG islands compared to the genomic neighborhood, whereas the twist decreases. However, this effect is much stronger for methylated than for unmethylated CpG islands. Hence, methylated CpG islands tend to co-locate with areas of unusual predicted DNA structure.
Furthermore, it is apparent from Table 1 that a single pattern is over-represented in methylated CpG islands, namely the non-strand-specific CACC/GGTG pattern. Because this pattern contains a TpG, in contrast to the CpG-rich patterns that are frequent in unmethylated CpG islands, it is tempting to argue that this pattern may be the result of sporadic deamination of original GG M CG patterns (such mutations are less likely to be repaired for methylated CpGs [6]). In order to test whether differential CpG ! TpG mutation rates may be a source of differential pattern frequencies between methylated and unmethylated CpG islands, we compared the palindromic pattern CGCG with the non-strand-specific pattern TGTG/CACA, which can evolve from the former pattern by two subsequent deamination mutations.
In agreement with our hypothesis, we find the CGCG pattern more frequently in unmethylated CpG islands (mean of 12.61 occurrences per kb) compared to methylated CpG islands (7.15 occurrences per kb) and the TGTG/CACA pattern more frequently in methylated CpG islands (10.92 occurrences per kb) compared to unmethylated CpG islands (2.93 occurrences per kb). In both cases, p-values were below 0.001 according to a Wilcoxon test. These results suggest that during evolution, higher rates of germline CpG ! TpG mutation occurred in those CpG islands that are methylated in human lymphocytes compared to those that are unmethylated.
Finally, we analyzed the dataset for evidence of experimental bias. Because restriction enzyme digestion was used to discriminate between methylated and unmethylated CpG islands [10], incomplete digestion is a potential error source. In this case, we would expect the HpaII recognition site
Synopsis
DNA methylation is the only epigenetic mechanism in eukaryotes that is known to directly modify the DNA. It plays an important role for gene control during development and cell differentiation, and it is a promising therapeutic target in cancer research. While a genome-wide picture of DNA methylation patterns is currently emerging, we have only fragmentary knowledge about the linkage between DNA methylation and other genomic attributes such as DNA sequence and structure, repetitive elements, or sequence conservation. The authors fill this gap by reporting on a comprehensive bioinformatical analysis of DNA methylation on human Chromosome 21-and in part, extending to other regions of the human genome. They report new associations that will help elucidate the functions of DNA methylation along the human genome. Furthermore, the authors show that their findings can be applied to predicting DNA methylation patterns from genome sequence. Such predictions have the potential of speeding up genome-wide epigenetic profiling: It may be possible to focus experimental resources on a few selected areas while bioinformatics procedures are applied to the bulk of the genome.
(CCGG) to behave significantly different from patterns that are never cut. However, we observe no indication of this in our attribute statistics (Dataset S1, first worksheet). Five out of ten GC-rich and CpG-containing sequence patterns have higher p-values than the CCGG pattern (CCGC, CGCC, GCCG, CCCG, and CGCG), while the same number of patterns has a lower p-value (GCGC, CGGC, GCGG, CGGG, and GGCG). We conclude that the experimental method that was applied by Yamada et al. is sufficiently unbiased for our analysis.
Quantification of the Association between DNA-Related Attributes and CpG Island Methylation
Strikingly, all attributes that were significantly different between methylated and unmethylated CpG islands (Table 1) fall into three (out of eight) attribute classes: (1) DNA sequence properties and patterns, (2) repeat frequency and distribution, and (4) predicted DNA structure. In order to investigate this observation more systematically, we calculated the group-wise correlation between CpG island methylation and each of the eight attribute classes.
In contrast to single-attribute correlation coefficients, group-wise correlations are able to capture combined effects of interacting attributes (e.g., when neither A nor B has any significant impact on methylation alone, but the combined presence of both is highly associated with a certain methylation status). Support vector machines (SVMs) have been successfully employed to detect such combined effects. Therefore, we trained a (linear) SVM to predict CpG island methylation and tested its performance on unseen data (10fold cross-validation). Then, we calculated the correlation coefficient between the SVM's predictions on unseen data and the correct values, averaging over 20 independent crossvalidation runs. This measure gives us a conservative estimate for the group-wise correlation between the attribute group and CpG island methylation-conservative because it may well be that the SVM does not capture all information on CpG island methylation that is present in the attribute group, while it is highly unlikely to predict methylation correctly over multiple runs if not enough information is contained in the attributes. Our results substantiate the observation that three classes of DNA-related attributes are distinctly associated with CpG island methylation status ( Table 2, experiments 1 to 8): (1) DNA sequence properties and patterns, as well as (2) repeat frequency and distribution are correlated with CpG island methylation at medium to high rates (correlation coefficient of 0.635 and 0.657, respectively); whereas (4) predicted DNA structure falls behind (0.486). Three of the remaining attribute classes exhibit weak correlation with CpG island methylation, namely (5) gene and exon distribution (0.300), (8) SNPs (0.286), and (3) CpG island frequency and distribution (0.045). (6) Predicted transcription factor binding sites and (7) evolutionary conservation are uncorrelated with CpG island methylation (À0.021 and 0.000, respectively). Furthermore, the combination of all eight attribute classes results in a higher correlation value than any single class (0.740), indicating that at least some attribute classes capture complementary information.
To quantify the degree of complementarity and to find out which attribute classes are positively correlated with DNA methylation only due to indirect or secondary effects, we applied the following strategy. Given two attribute classes, we calculate the correlation for both classes separately and for the combination of both. If the latter is higher than any of the former, we can conclude that the attributes complement each other. Comparing DNA sequence with all other attribute classes reveals that only (2) repeat frequency and distribution and (4) predicted DNA structure give rise to an increased correlation when combined with (1) DNA sequence properties and patterns, by 18.4% and 8.3%, respectively ( Table 2, experiments 10 to 16). However, among these three classes, all combinations significantly increase the correlation (Table 2, experiments 10, 12, and 17).
Therefore, we conclude that three attribute classes, namely (1) DNA sequence properties and patterns, (2) repeat frequency and distribution, and (4) predicted DNA structure are correlated with CpG island methylation on their own right (primary effect). The remaining attribute classes are either not correlated with CpG island methylation at all (class 7 evolutionary conservation and class 8 predicted transcription factor binding sites), or their correlations are secondary, explainable by their co-location with certain DNA sequence patterns alone (class 3 CpG island frequency and distribution, class 5 gene and exon distribution, and class 8 SNPs).
Prediction of CpG Island Methylation Status from DNA-Related Attributes
While the previous section was concerned with quantifying the relative contribution of different attribute classes to explaining CpG island methylation, the same methodology can be used to predict the methylation status of new CpG islands. Here we report the prediction performance of our method and we address potential limitations.
Without prior knowledge it is sensible to include all 918 non-zero attributes simultaneously in order to achieve best prediction results. In a 10-fold stratified cross-validation of a linear SVM, which we repeated 20 times with different random partitions, this setup resulted in an average The diagram on the left shows boxplots of the predicted DNA rise distribution over the CpG island and the ten sequence windows from À20 kb to 20 kb surrounding the CpG island (averaged over all 132 CpG islands in the Chromosome 21 dataset). Green bars (left) correspond to methylated CpG islands, red bars (right) to unmethylated CpG islands. The diagram on the right shows similar information for the predicted DNA twist. DOI: 10.1371/journal.pgen.0020026.g001 correlation of 0.74, a test set accuracy of 91.5%, a specificity of 98.4%, and a sensitivity of 67.1% (Table 2, experiment 9).
In order to test the appropriateness of the prediction method that we used (SVM with linear kernel), we performed several control experiments employing other state-of-the-art machine learning algorithms [22], namely SVM with radial basis function kernel, AdaBoost using tree stumps, C4.5 tree generator, and a second widely used implementation of a linear SVM. The results show that performances of all methods lie within the same range ( Table 2, experiments 18 to 21).
Next, we investigated how prediction accuracies vary between CpG islands that are located at different positions relative to their closest annotated gene. For this analysis, we regard a single CpG island as reliably predicted if its prediction is correct in at least 15 out of 20 randomized cross-validations, and we manually assigned each of the 132 CpG islands of the Chromosome 21 dataset to one of the following categories (Dataset S2):
Category 1: Promoter CpG islands, defined as overlapping with the transcription start site of an annotated gene: 80 cases fall into this category, of which 78 are unmethylated.
Category 2: Intragenic CpG islands, defined as overlapping introns and/or exons of an annotated gene, but not the transcription start site: 24 cases fall into this category, of which 12 are unmethylated.
Category 3: Gene-terminal CpG islands, defined as overlapping mainly the last exon and/or the 39 UTR of an annotated gene: six cases fall into this category, of which one is unmethylated.
Category 4: Intergenic CpG islands, defined as not showing any overlap with an annotated human gene: 22 cases fall into this category, of which 12 are unmethylated.
Our results show that prediction accuracy is highest for promoter CpG islands, where 77 unmethylated cases and one methylated case are predicted correctly in more than 15 out of 20 runs (98% accuracy); the second methylated case is predicted correctly in seven out of 20 runs (Ensembl gene ENSG00000197597) and the one remaining unmethylated case is correctly predicted in only three runs (Ensembl gene ENSG00000160207). In categories 2, 3, and 4, the number of methylated and unmethylated CpG islands is almost balanced, thus prediction is much more difficult. Nevertheless, prediction accuracies stay high: For intragenic CpG islands, 20 cases are predicted correctly in more than 15 runs (83% accuracy). Among the gene-terminal CpG islands, four cases are predicted correctly in more than 15 runs (67% accuracy), and of all intergenic CpG islands, 18 are correctly predicted in more than 15 runs (82% accuracy).
In conclusion, our method achieves high prediction accuracy for CpG islands from all four categories. Finally, we note that the method significantly outperforms a heuristic prediction which relies on transcriptional start site overlap alone ( Table 2, experiment 22), and that the very high specificity of the method (98.4%) facilitates chromosome- wide screening for methylated CpG islands, giving rise to a low number of false-positives.
Experimental Validation by Bisulphite Sequencing
In order to further substantiate the reliability of our method, we experimentally validated its predictions for 12 CpG islands. To that end, we first predicted the methylation state of all CpG islands from Chromosome 21 that were not part of the original dataset [10]; either because they did not match the strict CpG island criteria imposed by Yamada et al. or because they (marginally) overlap with repetitive DNA. Next, we selected eight CpG islands that were predicted as unmethylated and four CpG islands that were predicted as methylated, and we experimentally determined their methylation status in human peripheral blood by bisulphite sequencing.
Hence, while keeping species (human) and chromosome (21) identical, we varied experimental technique (bisulphite sequencing instead of restriction enzyme digestion), cell type (peripheral blood instead of lymphocytes), sample origin (healthy European female instead of healthy unspecified), and-of course-the CpG island. In the selection of validation CpG islands, we did not stratify for CpG island categories (see previous section) because we wanted to assess the method's overall performance across all categories of CpG islands.
The experimental results (Table 3) show that our prediction was correct in ten out of 11 cases (p-value below 0.01). The 12th case, predicted as methylated, showed an incomplete yet significant methylation of 54%. Hence, our method can predict CpG island methylation with high accuracy on a previously unknown test set.
Comparison with HEP Dataset
The DNA methylation data from the HEP pilot study [20] gives us the opportunity to assess the generality of our method and the transferability of the predictions that we obtain from the Chromosome 21 dataset. A priori, one would not expect a high degree of transferability because the HEP data vary from the Chromosome 21 data that were used to develop the method in several important aspects. First, almost 90% of amplicons for which DNA methylation profiles were established do not fulfill CpG island properties. Second, the HEP did not analyze lymphocytes but a variety of other tissues (adipose, brain, breast, liver, lung, muscle, and prostate). Third, all analyzed sequences belong to the relatively small and exceptional major histocompatibility complex on Chromosome 6.
In order to make the HEP dataset accessible to our method, which works on CpG islands (or DNA stretches of comparable length), we calculated the average CpG dinucleotide methylation for every HEP amplicon, and we defined a threshold to distinguish methylated from unmethylated amplicons (see Materials and Methods for details). Next, we trained our method on the Chromosome 21 dataset and predicted the methylation status of all HEP amplicons, in a similar way as was done for the experimental validation in the previous section. The results show a prediction accuracy that is low but still better than random (correlation ¼ 0.15, accuracy ¼ 74.7%, true-negatives ¼ 10, false-negatives ¼ 16, false-positives ¼ 37, true-positives ¼ 147). Hence, there seems to be a core association between DNA-related features and CpG island methylation that is similar or identical across tissues and genomic locations. This association can be specified further by a comparison of prediction error rates. First, we observe a remarkably low false-negative rate of 10%. In other words, the characteristics that were learned to predict CpG islands as methylated in lymphocytes are to some extent transferable across tissues and genomic locations, giving rise to a low falsenegative rate on the HEP dataset. Second, the false-positive rate was 8-fold higher than the corresponding false-negative rate (79%), indicating that it is difficult to transfer the DNArelated characteristics of unmethylated cases between the two datasets.
Next, we analyzed to what degree the prediction performance improves when the method is provided with a more adequate training dataset, i.e., when it is permitted to learn the characteristics that are unique to the HEP dataset. To that end, we trained and evaluated our prediction method in a cross-validation on the HEP dataset using all eight attribute These results indicate that our prediction method is also well-suited to predict the average methylation status for sequences that are not necessarily CpG islands, at least when a suitable training set is provided and CpG dinucleotide frequency is not too low.
Finally, because the HEP dataset contains methylation information for seven different tissues it should be possible, in principle, to detect evidence of tissue-specific methylation regulation, for example, binding site patterns of tissuespecific transcription factors. Therefore, one would expect that the prediction performance of our method was higher if trained on data from only one tissue, compared to the combination of all tissues, at least when focusing only on the most tissue-specific amplicons. However, we find no evidence for this in our dataset. Instead, prediction performances for individual tissues closely resemble the average case (unpublished data). There are several possible explanations for the method's failure to learn tissue-specific methylation information from the HEP dataset. On the one hand, tissue-specific methylation may be largely uncorrelated with the sequencerelated attributes that we analyzed. On the other hand, the dataset may simply be too small. In fact, only between five and 19 out of 210 amplicons per tissue deviate from the ''default'' state calculated as the consensus methylation over all tissues.
Discussion
We have shown that CpG island methylation can be predicted from DNA sequence and that we may be able to enhance our understanding of the biology that controls methylation in vivo by predictive bioinformatics analysis. First, we identified DNA-related attributes that discriminate strongly between methylated and unmethylated CpG islands in human lymphocytes. Second, we quantified the correlation of CpG island methylation with eight groups of DNA-related attributes and found DNA sequence patterns, repeat frequencies, and predicted DNA structure to be the key contributors. Third, we developed a machine-learning method that can predict the methylation status of unknown CpG islands and we validated the accuracy and reliability of this method both statistically and experimentally.
Our results raise a number of questions concerning our current view of CpG island methylation. While it is apparent from the attribute statistics ( Table 1) that CpG-rich patterns are over-represented in unmethylated CpG islands, we found no evidence of a simple yet accurate relationship between CpG island methylation on the one hand and CpG dinucleotide frequency, observed versus expected ratio, or the density of restriction sites such as CCGG (HpaII) and CGCG (HhaI), on the other hand. Instead, methylated and unmethylated CpG islands each seem to be characterized by a relatively complex combination of the presence or absence of certain sequence motifs and attributes of DNA structure. However, we did not find any evidence of a combinatorial ''DNA sequence code'' for methylation; hence, we suggest that the individual sequence and structure attributes contribute to the preferred methylation state of a CpG island independently and possibly in an additive way.
For repetitive DNA, the situation is more straightforward: CpG islands that significantly overlap with a tandem repeat or a segmental duplication are methylated in almost all cases, which is in line with the long-known fact that tandem repeats form heterochromatin [23]. Unfortunately, we could not address the influence of retrotransposons such as SINE and LINE elements on CpG island methylation since our dataset [10] only contains CpG islands that are not suppressed by RepeatMasker [24].
Based on these observations, we propose that each CpG island can be assigned a degree of methylation propensity that is encoded in its DNA. This default state is what our prediction method captures. For a relatively small number of CpG islands the default state is overruled by biological processes such as tissue differentiation, X-chromosome inactivation, or imprinting, which enforce a certain methylation state. In normal tissue and on the autosomes, these effects seem to affect only a minority of CpG islandsotherwise the high prediction accuracies that we observe could not be argued. This is consistent with the observation that only around 5% of CpG islands are differentially methylated in a tissue-specific fashion [25], and that the effect of imprinting is even more limited. However, since our prediction analysis was constrained to data from two chromosomes and few tissues, such a far-reaching interpretation of our results has to be taken with care. It will be interesting to see whether CpG islands that consistently deviate from their default methylation state due to monoallelic methylation (imprinting, X-chromosome inactivation) are characterized by a medium degree of methylation propensity or whether the underlying biological processes are so strong that basically every CpG island can become differentially methylated independently of its DNA sequence.
Besides these general observations, five more specific results are worth commenting on. First, in line with earlier observations we find almost all promoter CpG islands unmethylated, but also a significant number of intergenic CpG islands, which are often distant from any annotated gene. Little is known about the functional role of intergenic CpG islands. However, it has been observed that unmethylated CpG islands often co-localize with DNA replication origins [26], and we believe that it would be worthwhile to analyze the functional role of unmethylated intergenic CpG islands experimentally on a large sample. Methylation predictions may help to speed up and guide such an approach.
Second, we found evidence that the default methylation status of many CpG islands may be relatively stable during evolution. By comparing frequencies of the CGCG pattern to its (mutated) counterpart TGTG/CACA (the former is overrepresented in unmethylated CpG islands of our dataset whereas the latter is over-represented in methylated CpG islands), we concluded that higher CpG !TpG mutation rates have applied to the CpG islands that we find methylated in human lymphocytes, than to those that we find unmethylated. Given that methylated CpG dinucleotides are more prone to CpG ! TpG mutations [6], a straightforward explanation would be to postulate that the methylation status that we observe in our dataset (i) is similar to that found in the germline where mutations become fixed, and (ii) was stable over evolutionary time, so that the observed mutations could accumulate.
Third, our results show that certain aspects of DNA sequence and (predicted) DNA structure such as a high DNA rise and a low DNA twist seem to be associated with methylated CpG islands in vivo. It would be interesting to analyze how these sequence and structure attributes correlate with the in vitro recognition and methylation potential of CpG-rich sequences by mammalian DNA methyltransferases. Some reports suggest that unusual DNA structures (such as repeats and cruciform structures [27]) can lead to increased methylation activity by DNA methyltransferases. Moreover, local transitions between DNA in A-form, B-form, or Z-form may influence the methylation potential of the DNA, and it is tempting to speculate that some of our observed parameters may reflect such local differences in DNA structure formation.
Fourth, differences in error rates when training on the Chromosome 21 dataset and testing on the HEP dataset suggest that DNA-related characteristics identifying consistently methylated CpG islands are robust across tissues and genomic locations while those identifying unmethylated CpG islands are not-and have to be learned specifically for each tissue or genomic location. This interpretation is consistent with the hypothesis that most CpG islands in the human genome can become methylated, and do so if they are not preserved in the unmethylated state by specific (and tissuedependent) influences, for example, the binding of transcription factors.
Fifth, we believe that our methodology for chromosomewide correlation analysis and prediction is general enough to yield interesting results for other types of genomic and epigenomic data as well (such as histone modifications, replication origins, and many types of ChIP-on-Chip data). Therefore, we implemented our method as a web service which we will make accessible to interested researchers on a cooperation basis.
In conclusion, an understanding of the exact interplay between DNA-related features and CpG island methylation is likely to be of high practical and theoretical value. On the one hand, a reliable tool for predicting default CpG island methylation status from sequence would be of interest as a reference in cancer epigenetics and beyond. On the other hand, the fact that CpG island methylation is closely interwoven with certain features related to DNA sequence and structure-while minor changes such as SNPs seem to make little difference-may provide a key to uncovering the mechanisms that result in inter-individually similar and reproducible epigenetic reprogramming in the germline and the early embryo.
Materials and Methods
DNA methylation data. This analysis is based on the results of a comprehensive measurement of CpG island methylation on human Chromosome 21 [10]. Briefly, Yamada et al. repeat-masked the chromosome sequence and computationally identified all nonrepetitive CpG islands using standard tools and parameters (GC content above 50%, ratio of observed versus expected number of CpG dinucleotides above 0.6, more than 400 base pairs in length). Next, they designed primers for each identified CpG island and extracted corresponding DNA from samples of human peripheral blood lymphocytes. Finally, they determined the methylation status of each CpG island by methylation-specific restriction enzymes (via HpaII-McrBC-PCR). Yamada et al. validated their method by bisulphite sequencing of some CpG islands and concluded that it is highly reliable.
Their dataset comprises the methylation status of 149 CpG islands, each belonging to one of the following categories: fully methylated, unmethylated, incompletely methylated, or compositely/differentially methylated. Exploratory analysis using bisulphite sequencing indicated that the latter two classifications were not always unambiguous (unpublished data); therefore we focused on the two well-defined categories, fully methylated (31 cases) and unmethylated (103 cases). In order to minimize potential error sources, we re-mapped the boundaries of the CpGs islands that were originally used by Yamada et al. to the current human genome sequence (NCBI35) and we excluded two cases (both belonging to the fully methylated class) from the analysis because, in the light of this new mapping, the primers did not pick the intended CpG islands. Therefore, our dataset comprised 132 independent CpG islands, which are distributed relatively evenly across Chromosome 21 (see Dataset S2).
For validation, we also used data from the HEP pilot study [20]. In this study, Rakyan et al. determined the methylation status of 3,273 unique CpG dinucleotides (belonging to 253 amplicons) across seven tissues and one to eight samples per tissue by means of bisulphite direct sequencing. Out of these 253 amplicons, 210 could be mapped unambiguously to the NCBI35 genome version and had at least one measurement for each tissue. For these amplicons, we calculated average CpG dinucleotide methylation levels, both separately for individual tissue types and for all tissues combined. Those amplicons below a (arbitrarily chosen) threshold of 60% methylation were marked as unmethylated and those above this threshold were marked as methylated, resulting in a dataset of 163 ''methylated'' and 47 ''unmethylated'' amplicons.
DNA-related attributes. In order to identify DNA sequence-related attributes that are correlated with CpG island methylation, we compiled a comprehensive list of attributes that can be linked directly or indirectly to DNA sequence (the full list is given in Table S1). Most attributes take the form of frequencies or numerical scores, averaged over sequence windows and standardized to a default window size of one kb. They fall into eight biological classes, namely: (1) DNA sequence properties and patterns (428 attributes), (2) repeat frequency and distribution (494 attributes), (3) CpG island frequency and distribution (16 attributes), (4) predicted DNA structure (28 attributes), (5) gene and exon distribution (60 attributes), (6) predicted transcription factor binding sites (135 attributes), (7) evolutionary conservation (ten attributes), and (8) SNPs (13 attributes). The data for most of these attributes were collected from annotation tracks in the UCSC Genome Browser [28]. However, the attributes for class 1 were directly calculated from DNA sequence and the attributes for class 4 were calculated from DNA sequence by averaging over octamers [29] and trimers (J. Greenbaum, personal communication), respectively. We calculated these attributes for each CpG island in our dataset, both for the re-mapped CpG island itself and for 11 sequence windows around the CpG island: À20 kb to À10 kb, À10 kb to À5 kb, À5 kb to À2 kb, À2 kb to À1 kb, À1 kb to left boundary of CpG island, CpG island, right boundary of CpG island to þ1 kb, þ1 kb to þ2 kb, þ2 kb to þ5 kb, þ5 kb to þ10 kb, þ10 kb to þ20 kb. Next, we removed those attributes that were zero in all cases (e.g., binding sites of rare transcription factors), giving us a list of 918 prediction attributes. To simplify the statistical analysis, we also removed attributes that were zero in most, but not all cases. For the CpG island level statistics (see next section), only the 706 attributes with non-zero values in the CpG island window of at least five methylated and five unmethylated cases were retained. For the sequence neighborhood statistics, only the 833 attributes were retained that had non-zero values in at least five methylated and five unmethylated cases, for at least four out of the 11 sequence windows.
Statistics. We performed statistical tests in order to determine attributes that exhibit significantly different values for fully methylated CpG islands compared to unmethylated CpG islands, at two levels. First, we compared all attributes at the CpG island level using the nonparametric Wilcoxon ranksum test (Dataset S1, first worksheet). Second, we compared all attributes across the complete sequence neighborhood of À20 kb to þ20 kb around the CpG island (Dataset S1, second worksheet). To that end, quadratic regression functions were fitted over the attribute values in the 11 sequence windows around the CpG island (see previous section) and we used the ANOVA statistic to assess whether separate fitting for unmethylated versus methylated cases resulted in a significantly decreased error compared to combined fitting (quadratic regression functions were chosen to capture symmetry around the CpG island).
Significance thresholds were adjusted for multiple testing using the highly conservative Bonferroni method. Technically speaking, we controlled the family-wise error rate to be less than 1%.
Prediction. Machine learning methodology was used for two tasks: (i) to quantify the correlation between CpG island methylation and several classes of DNA-related attributes, and (ii) to predict CpG island methylation from the local genomic neighborhood.
The technical procedure is similar in both cases (cross-validation) and is discussed below. However, intention and interpretation differ for the two tasks. Task (ii) is the classical prediction scenario: given a dataset of limited size, we want to train a classifier for predicting CpG island methylation on unknown data and to quantify its expected prediction performance. Therefore, we train the classifier on the full set of 918 attributes, assuming that at least some of these attributes contain information that may be useful for the classifier.
In task (i), the goal is not so much to predict new data but to understand existing data. Here, we use a classifier as a tool to quantify the relationship between an attribute class (e.g., DNA sequence properties or repeats) and CpG island methylation. The rationale behind this is simple: If a classifier can successfully and reliably predict CpG island methylation using only information from one particular attribute class, then the attributes in this class are functionally associated with CpG island methylation and the prediction performance is a measure of the degree of functional association.
The prediction experiments follow essentially the same procedure. Given the list of CpG islands or amplicons and any selection of attributes from our list, a linear SVM is repeatedly trained to predict methylation status based on a 90% subset of cases, and its performance is evaluated on the remaining 10% of unseen cases. Technically speaking, we repeat 10-fold stratified cross-validation 20 times with different random partitions and sum the results on the test set (in terms of true-negatives, false-negatives, false-positives, and truepositives). The prediction performance is measured as the correlation coefficient between the predictions and the correct values on the test set. This criterion is commonly viewed as superior to comparing prediction accuracies because it is not as strongly affected by unbalanced class distributions [30].
For most prediction experiments (prediction setup A in Table 2), we used the linear SVM implementation provided by the WEKA package [31], which is based on the sequential minimal optimization method [32]. Additionally, several control experiments were performed that use different algorithms: an SVM with radial basis function kernel (from WEKA package, prediction setup B), AdaBoost M1 with decision tree stumps as the underlying classifier (from WEKA package, prediction setup C), the C4.5 tree generator (from WEKA package, prediction setup D), and a different implementation of a linear SVM (R implementation of LIBSVM [33], prediction setup E). All algorithms were applied with their suggested standard parameters.
Experimental verification. Predictions were performed using a linear SVM that was trained on the full Chromosome 21 dataset (132 cases) and all attribute classes. Subsequently, we determined the methylation status of 12 selected CpG islands by bisulphite sequencing as follows: initially, we applied direct sequencing of the PCR product to all 12 CpG islands (Table 3). In nine cases, this produced unambiguous results (i.e., very high conversion of CpGs ¼ unmethylated, or almost no conversion ¼ methylated). In the three remaining cases with mixed CG/TG sequencing profiles, PCR products were cloned and individual clones were sequenced in order to determine the methylation status. Average methylation was scored from single clone sequences using the BiQ Analyzer software [34]. Details of the experimental setting and the primers that we used are reported in Protocol S1. Human peripheral blood was obtained with the written consent of the donor.
Supporting Information
Dataset S1. Attribute Statistics This Excel
Accession Numbers
The Ensembl database (http://www.ensembl.org/Homo_sapiens/ index.html) accession numbers for the genes discussed in this paper are Ensembl gene (ENSG00000197597) and Ensembl gene (ENSG00000160207).
Figure 1 .
1Predicted DNA Structure Differs in the Neighborhood of Methylated CpG Islands Compared with Their Unmethylated Counterparts
summarizes the prediction experiments that were performed in order to analyze the association between DNA-related attributes and CpG island methylation (1 to 17), plus several control experiments (18 to 23). Each row corresponds to one prediction experiment. The column ''Attribute Set'' specifies the attributes that were used for prediction, ''Number of Attributes'' gives the size of the attribute set, and ''Prediction Method'' summarizes the algorithm used (see Materials and Methods for details). The columns ''TN,'' ''FN,'' ''FP,'' and ''TP'' give the test set results for true-negatives, false-negatives, false-positives, and true-positives over a 10-fold stratified cross-validation that was repeated 20 times. Correlation and accuracy (the remaining two columns) are calculated in the usual way[30] with the modification that, in the case of correlation, we add 0.0001 to TN, FN, FP, and TP in order to prevent the correlation from being undefined when an algorithm always predicts the same class. TSS, transcription start site; TFBS, transcription factor binding sites. DOI: 10.1371/journal.pgen.0020026.t002
Table 1 .
1DNA-Related Attributes Differ Significantly between Methylated and Unmethylated CpG IslandsThis table lists all attributes with significantly different distribution among methylated and unmethylated CpG islands, respectively, according to a Wilcoxon test with Bonferroni correction for multiple testing and an overall significance threshold of 1%. The rightmost column displays single-test p-values, the significance threshold after multiple testing correction is 0.01/706 ¼ 1.42 3 10 À5 . Attributes with significantly higher values in fully methylated CpG are in green. Attributes in red are significantly higher in unmethylated CpGs. Detailed information on attribute definitions is given inTable S1. DOI: 10.1371/journal.pgen.0020026.t001Rank Attribute
Name
Attribute Description
Attribute
Class
Higher Value for
Single Test
Significance
1
SAl_len
Total length of self-alignments (alignments of the human genome against itself)
(2)
Methylated CpG Islands
2.62 3 10 À11
2
SAl_no
Total number of self-alignments
(2)
Methylated CpG Islands
3.23 3 10 À10
3
Pat_CCGC
Chromosome plus-strand pattern frequency of CCGC
(1)
Unmethylated CpG Islands
5.18 3 10 À10
4
Pat_CCCC
Chromosome plus-strand pattern frequency of CCCC
(1)
Unmethylated CpG Islands
1.39 3 10 À9
5
SAl_std
Standard deviation of self-alignment lengths
(2)
Methylated CpG Islands
1.96 3 10 À9
6
Uni_AAAG
Non-strand-specific pattern frequency of AAAG/CTTT
(1)
Unmethylated CpG Islands
8.87 3 10 À9
7
fC_std
Standard deviation of C content distribution
(1)
Unmethylated CpG Islands
9.13 3 10 À9
8
Rise_avg
Average DNA structure rise (as predicted from sequence)
(4)
Methylated CpG Islands
3.82 3 10 À8
9
Pat_CGCC
Chromosome plus-strand pattern frequency of CGCC
(1)
Unmethylated CpG Islands
5.05 3 10 À8
10
Pat_AAAG
Chromosome plus-strand pattern frequency of AAAG
(1)
Unmethylated CpG Islands
7.72 3 10 À8
11
Roll_skew
Skewness of DNA structure roll distribution (as predicted from sequence)
(4)
Unmethylated CpG Islands
1.15 3 10 À7
12
Pat_CTCC
Chromosome plus-strand pattern frequency of CTCC
(1)
Unmethylated CpG Islands
1.46 3 10 À7
13
fCG_std
Standard deviation of CpG content distribution
(1)
Unmethylated CpG Islands
2.15 3 10 À7
14
Pat_TCCC
Chromosome plus-strand pattern frequency of TCCC
(1)
Unmethylated CpG Islands
2.57 3 10 À7
15
SDu_no
Total number of sequential duplications
(2)
Methylated CpG Islands
3.49 3 10 À7
16
SAl_sco
Average self-alignment score
(2)
Methylated CpG Islands
4.19 3 10 À7
17
Pat_CTTT
Chromosome plus-strand pattern frequency of CTTT
(1)
Unmethylated CpG Islands
4.23 3 10 À7
18
Uni_CGGA
Non-strand-specific pattern frequency of CGGA/TCCG
(1)
Unmethylated CpG Islands
5.15 3 10 À7
19
Uni_CCGC
Non-strand-specific pattern frequency of CCGC/GCGG
(1)
Unmethylated CpG Islands
9.08 3 10 À7
20
Pat_CGGA
Chromosome plus-strand pattern frequency of CGGA
(1)
Unmethylated CpG Islands
1.16 3 10 À6
21
Pat_GCCG
Chromosome plus-strand pattern frequency of GCCG
(1)
Unmethylated CpG Islands
1.46 3 10 À6
22
Uni_AAGG
Non-strand-specific pattern frequency of AAGG/CCTT
(1)
Unmethylated CpG Islands
1.58 3 10 À6
23
Pat_CCCG
Chromosome plus-strand pattern frequency of CCCG
(1)
Unmethylated CpG Islands
1.86 3 10 À6
24
SAl_avg
Average length of self-alignments
(2)
Methylated CpG Islands
1.91 3 10 À6
25
Pat_TCCG
Chromosome plus-strand pattern frequency of TCCG
(1)
Unmethylated CpG Islands
2.60 3 10 À6
26
Pat_CGCG
Chromosome plus-strand pattern frequency of CGCG
(1)
Unmethylated CpG Islands
2.65 3 10 À6
27
Uni_CGCG
Non-strand-specific pattern frequency of CGCG/CGCG
(1)
Unmethylated CpG Islands
2.65 3 10 À6
28
Pat_ACCC
Chromosome plus-strand pattern frequency of ACCC
(1)
Unmethylated CpG Islands
2.87 3 10 À6
29
Uni_CAAA
Non-strand-specific pattern frequency of CAAA/TTTG
(1)
Unmethylated CpG Islands
2.90 3 10 À6
30
Pat_CAAA
Chromosome plus-strand pattern frequency of CAAA
(1)
Unmethylated CpG Islands
3.01 3 10 À6
31
Uni_CGGC
Non-strand-specific pattern frequency of CGGC/GCCG
(1)
Unmethylated CpG Islands
3.46 3 10 À6
32
Pat_GCCC
Chromosome plus-strand pattern frequency of GCCC
(1)
Unmethylated CpG Islands
3.95 3 10 À6
33
Pat_GGAA
Chromosome plus-strand pattern frequency of GGAA
(1)
Unmethylated CpG Islands
5.93 3 10 À6
34
Pat_TATT
Chromosome plus-strand pattern frequency of TATT
(1)
Unmethylated CpG Islands
6.43 3 10 À6
35
Pat_CCGG
Chromosome plus-strand pattern frequency of CCGG
(1)
Unmethylated CpG Islands
7.21 3 10 À6
36
Uni_CCGG
Non-strand-specific pattern frequency of CCGG/CCGG
(1)
Unmethylated CpG Islands
7.21 3 10 À6
37
Tan_sco
Goodness of fit score of tandem repeats
(2)
Methylated CpG Islands
9.34 3 10 À6
38
Uni_CACC
Non-strand-specific pattern frequency of CACC/GGTG
(1)
Methylated CpG Islands
9.55 3 10 À6
39
Tan_avg
Average lengths of tandem repeats
(2)
Methylated CpG Islands
9.60 3 10 À6
40
RC1_Low_
Alignment score of low complexity class repeats
(2)
Unmethylated CpG Islands
1.37 3 10 À5
41
RF1_Low_
Alignment score of low complexity family repeats
(2)
Unmethylated CpG Islands
1.37 3 10 À5
Table 2 .
2The Predictive Power of Attribute Classes Differs Remarkably; Control Experiments Confirm the Appropriateness of the Prediction MethodID Attribute Set
Number of
Attributes
Prediction Method
Correlation Accuracy TN
FN FP TP
1 DNA sequence properties and patterns
426
A (linear SVM)
0.635
0.884
1,994 241
66 339
2 Repeat frequency and distribution
311
A (linear SVM)
0.657
0.890
1,995 225
65 355
3 CpG island frequency and distribution
13
A (linear SVM)
0.045
0.755
1,994 532 116
48
4 Predicted DNA structure
28
A (linear SVM)
0.486
0.844
2,053 406
7 174
5 Gene and exon distribution
52
A (linear SVM)
0.300
0.806
2,044 495
16
85
6 Predicted transcription factor binding sites
68
A (linear SVM)
À0.021
0.779
2,056 580
4
0
7 Evolutionary conservation
10
A (linear SVM)
0.000
0.780
2,060 580
0
0
8 Single nucleotide polymorphisms
10
A (linear SVM)
0.286
0.804
2,030 487
30
93
9 All attributes
918
A (linear SVM)
0.740
0.915
2,027 191
33 389
10 Class 1 (sequence) and class 2 (repeats)
737
A (linear SVM)
0.752
0.919
2,037 191
23 389
11 Class 1 and class 3 (CpG islands)
439
A (linear SVM)
0.626
0.880
1,977 233
83 347
12 Class 1 and class 4 (DNA structure)
454
A (linear SVM)
0.688
0.900
2,024 229
36 351
13 Class 1 and class 5 (genes)
478
A (linear SVM)
0.614
0.877
1,980 244
80 336
14 Class 1 and class 6 (TFBS)
494
A (linear SVM)
0.655
0.890
2,007 238
53 342
15 Class 1 and class 7 (conservation)
436
A (linear SVM)
0.626
0.881
1,989 243
71 337
16 Class 1 and class 8 (SNPs)
436
A (linear SVM)
0.618
0.879
1,988 248
72 332
17 Class 2 (repeats) and class 4 (DNA structure) 339
A (linear SVM)
0.713
0.907
2,020 205
40 375
18 DNA sequence properties and patterns
426
B (RBF-kernel SVM)
0.580
0.869
2,040 327
20 253
19 DNA sequence properties and patterns
426
C (AdaBoost)
0.664
0.892
2,009 233
51 347
20 DNA sequence properties and patterns
426
D (C4.5 trees)
0.566
0.852
1,869 200 191 380
21 DNA sequence properties and patterns
426
E (linear SVM using LIBSVM in R)
0.684
0.898
2,018 226
42 354
22 Transcription start site overlap
1
Heuristic (if TSS overlap: unmethylated,
otherwise: throw coin)
0.358
0.788
1,810 310 250 270
23 Empty set
0
Trivial (predict everything as unmethylated)
0.000
0.780
2,060 580
0
0
This
table
Table 3 .
3Twelve CpG Islands Were Analyzed Experimentally to Validate Our PredictionsThis table summarizes the results of bisulphite sequencing of 12 selected CpG islands together with our prediction that was based on all attribute sets. In nine cases, bisulphite direct sequencing produced unambiguous results. In the three remaining cases, PCR products were cloned and individual clones were sequenced in order to determine the methylation status.CpG Island Position
(NCBI35)
Closest Gene Method
Number
of CpGs
Number
of CpGs
Analyzed
Methylation Experimental
Result
Prediction
Chr 21, 13331442-13331790 C21orf 99
Direct sequencing
14
11
91%
Methylated
Methylated
Chr 21, 13904631-13904830 ANKRD21
Direct sequencing
11
6
100%
Methylated
Methylated
Chr 21, 14676951-14678040 STCH
Direct sequencing
21
15
0%
Unmethylated
Unmethylated
Chr 21, 18538786-18539754 CHODL
Cloning and sequencing (nine clones) 26
26
7%
Unmethylated
Unmethylated
Chr 21, 26866818-26867612 CYYR1
Direct sequencing
21
14
0%
Unmethylated
Unmethylated
Chr 21, 29318596-29319405 USP16
Direct sequencing
18
13
0%
Unmethylated
Unmethylated
Chr 21, 30892864-30893090 KRTAP6-2
Direct sequencing
10
8
100%
Methylated
Methylated
Chr 21, 33836092-33837874 GART
Direct sequencing
18
14
0%
Unmethylated
Unmethylated
Chr 21, 38209756-38211197 KCNJ6
Direct sequencing
25
12
0%
Unmethylated
Unmethylated
Chr 21, 43461259-43461636 CRYAA
Cloning and sequencing (nine clones) 15
15
54%
Incomplete
Methylated
Chr 21, 45117025-45119447 PTTG1IP
Cloning and sequencing (five clones)
19
19
2%
Unmethylated
Unmethylated
Chr 21, 45669125-45669487 C21orf 123
Direct sequencing
10
7
100%
Methylated
Unmethylated
DOI: 10.1371/journal.pgen.0020026.t003
table reports raw p-values and multiple-testing-adjusted significance thresholds for all attribute statistics. Found at DOI: 10.1371/journal.pgen.0020026.sd001 (388 KB XLS). Dataset S2. DNA Methylation Data This Excel table contains a re-mapped and quality-controlled version of DNA methylation data that was originally reported by Yamada et al. [10], as it is used in this study. Furthermore, prediction accuracy and genome browser location are reported for all CpG islands. Found at DOI: 10.1371/journal.pgen.0020026.sd002 (525 KB XLS). Protocol S1. Experimental Validation This PDF document gives details on the experimental protocol that was used to determine the methylation status of the validation CpG islands, including PCR primers. Found at DOI: 10.1371/journal.pgen.0020026.sd003 (26 KB DOC).
Table S1 .
S1Overview of Prediction Attributes This PDF document reports information on calculation, naming, and reference of all attributes that are used in this study. Found at DOI: 10.1371/journal.pgen.0020026.st001 (89 KB DOC)
Prediction of CpG Island Methylation
PLoS Genetics | www.plosgenetics.org March 2006 | Volume 2 | Issue 3 | e26
PLoS Genetics | www.plosgenetics.org
AcknowledgmentsWe would like to thank Jö rg Rahnenfü hrer for statistics consulting, Joachim Bü ch for technical support, Takeshi Ito, Yoichi Yamada, and Vardhman Rakyan for the provision of DNA methylation data, and Eleanor Gardiner as well as Jason Greenbaum for the provision of data on DNA structure properties. Furthermore, we acknowledge the sequencing team at the Max-Planck-Institut fü r Molekulare Genetik for carrying out bisulphite direct sequencing.Author contributions. CB conceptualized the study, performed data preparation and analysis, and wrote the manuscript. ST and TM performed and evaluated the bisulphite sequencing experiments. MP and JW contributed to the interpretation of the results, and TL supervised the work. All authors contributed to the writing of the manuscript and have read and approved the manuscript.Funding. This work was conducted within the context of the EU Network of Excellence ''Biosapiens'' (LSHG-CT-2003-503265), the EU Network of Excellence ''The Epigenome'' (LSHG-CT-2004-503433), and the BMBF program ''Methylome'' (01-GR-0496).Competing interests. The authors have declared that no competing interests exist.
DNA methylation patterns and epigenetic memory. A Bird, Genes Dev. 16Bird A (2002) DNA methylation patterns and epigenetic memory. Genes Dev 16: 6-21.
The DNA methylation paradox. P A Jones, Trends Genet. 15Jones PA (1999) The DNA methylation paradox. Trends Genet 15: 34-37.
Mammalian epigenomics: Reprogramming the genome for development and therapy. W Reik, F Santos, W Dean, Theriogenology. 59Reik W, Santos F, Dean W (2003) Mammalian epigenomics: Reprogram- ming the genome for development and therapy. Theriogenology 59: 21-32.
. M J Fazzari, J M Greally, Epigenomics: Beyond CpG islands. Nat Rev Genet. 5Fazzari MJ, Greally JM (2004) Epigenomics: Beyond CpG islands. Nat Rev Genet 5: 446-455.
Controlling DNA methylation: Many roads to one modification. M Freitag, E U Selker, Curr Opin Genet Dev. 15Freitag M, Selker EU (2005) Controlling DNA methylation: Many roads to one modification. Curr Opin Genet Dev 15: 191-199.
DNA methylation and chromatin structure: The puzzling CpG islands. P Caiafa, M Zampieri, J Cell Biochem. 94Caiafa P, Zampieri M (2005) DNA methylation and chromatin structure: The puzzling CpG islands. J Cell Biochem 94: 257-265.
Initial sequencing and analysis of the human genome. E S Lander, L M Linton, B Birren, C Nusbaum, M C Zody, Nature. 409Lander ES, Linton LM, Birren B, Nusbaum C, Zody MC, et al. (2001) Initial sequencing and analysis of the human genome. Nature 409: 860-921.
The sequence of the human genome. J C Venter, M D Adams, E W Myers, P W Li, R J Mural, Science. 291Venter JC, Adams MD, Myers EW, Li PW, Mural RJ, et al. (2001) The sequence of the human genome. Science 291: 1304-1351.
CpG islands in vertebrate genomes. M Gardiner-Garden, M Frommer, J Mol Biol. 196Gardiner-Garden M, Frommer M (1987) CpG islands in vertebrate genomes. J Mol Biol 196: 261-282.
A comprehensive analysis of allelic methylation status of CpG islands on human Chromosome 21q. Y Yamada, H Watanabe, F Miura, H Soejima, M Uchiyama, Genome Res. 14Yamada Y, Watanabe H, Miura F, Soejima H, Uchiyama M, et al. (2004) A comprehensive analysis of allelic methylation status of CpG islands on human Chromosome 21q. Genome Res 14: 247-266.
An evaluation of new criteria for CpG islands in the human genome as gene markers. Y Wang, F C Leung, Bioinformatics. 20Wang Y, Leung FC (2004) An evaluation of new criteria for CpG islands in the human genome as gene markers. Bioinformatics 20: 1170-1177.
CpG islands as gene markers in the human genome. F Larsen, G Gundersen, R Lopez, H Prydz, Genomics. 13Larsen F, Gundersen G, Lopez R, Prydz H (1992) CpG islands as gene markers in the human genome. Genomics 13: 1095-1107.
Epigenetic aspects of differentiation. K L Arney, A G Fisher, J Cell Sci. 117Arney KL, Fisher AG (2004) Epigenetic aspects of differentiation. J Cell Sci 117: 4355-4363.
Recent advances in X-chromosome inactivation. E Heard, Curr Opin Cell Biol. 16Heard E (2004) Recent advances in X-chromosome inactivation. Curr Opin Cell Biol 16: 247-255.
The history of cancer epigenetics. A P Feinberg, B Tycko, Nat Rev Cancer. 4Feinberg AP, Tycko B (2004) The history of cancer epigenetics. Nat Rev Cancer 4: 143-153.
Chromosome-wide and promoter-specific analyses identify sites of differential DNA methylation in normal and transformed human cells. M Weber, J J Davies, D Wittig, E J Oakeley, M Haase, Nat Genet. 37Weber M, Davies JJ, Wittig D, Oakeley EJ, Haase M, et al. (2005) Chromosome-wide and promoter-specific analyses identify sites of differ- ential DNA methylation in normal and transformed human cells. Nat Genet 37: 853-862.
Prediction of methylated CpGs in DNA sequences using a support vector machine. M Bhasin, H Zhang, E L Reinherz, P A Reche, FEBS Lett. 579Bhasin M, Zhang H, Reinherz EL, Reche PA (2005) Prediction of methylated CpGs in DNA sequences using a support vector machine. FEBS Lett 579: 4302-4308.
Profound flanking sequence preference of Dnmt3a and Dnmt3b mammalian DNA methyltransferases shape the human epigenome. V Handa, A Jeltsch, J Mol Biol. 348Handa V, Jeltsch A (2005) Profound flanking sequence preference of Dnmt3a and Dnmt3b mammalian DNA methyltransferases shape the human epigenome. J Mol Biol 348: 1103-1112.
Predicting aberrant CpG island methylation. F A Feltus, E K Lee, J F Costello, C Plass, P M Vertino, Proc Natl Acad Sci U S A. 100Feltus FA, Lee EK, Costello JF, Plass C, Vertino PM (2003) Predicting aberrant CpG island methylation. Proc Natl Acad Sci U S A 100: 12253- 12258.
DNA methylation profiling of the human major histocompatibility complex: A pilot study for the Human Epigenome Project. V K Rakyan, T Hildmann, K L Novik, J Lewin, J Tost, e405. DOI: 10. 1371/journal.pbio.0020405PLoS Biol. 2Rakyan VK, Hildmann T, Novik KL, Lewin J, Tost J, et al. (2004) DNA methylation profiling of the human major histocompatibility complex: A pilot study for the Human Epigenome Project. PLoS Biol 2: e405. DOI: 10. 1371/journal.pbio.0020405
A standard reference frame for the description of nucleic acid base-pair geometry. W K Olson, M Bansal, S K Burley, R E Dickerson, M Gerstein, J Mol Biol. 313Olson WK, Bansal M, Burley SK, Dickerson RE, Gerstein M, et al. (2001) A standard reference frame for the description of nucleic acid base-pair geometry. J Mol Biol 313: 229-237.
The elements of statistical learning: Data mining, inference, and prediction. T Hastie, R Tibshirani, J H Friedman, Springer533New YorkHastie T, Tibshirani R, Friedman JH (2001) The elements of statistical learning: Data mining, inference, and prediction. New York: Springer. 533 p.
Maintenance of heterochromatin by RNA interference of tandem repeats. R A Martienssen, Nat Genet. 35Martienssen RA (2003) Maintenance of heterochromatin by RNA interfer- ence of tandem repeats. Nat Genet 35: 213-214.
. Afa Smit, R Hubley, P Green, RepeatMasker Open-3.0Smit AFA, Hubley R, Green P (1996-2004) RepeatMasker Open-3.0. Available: http://www.repeatmasker.org. Accessed 1 February 2006.
Association of tissue-specific differentially methylated regions (TDMs) with differential gene expression. F Song, J F Smith, M T Kimura, A D Morrow, T Matsuyama, Proc Natl Acad Sci U S A. 102Song F, Smith JF, Kimura MT, Morrow AD, Matsuyama T, et al. (2005) Association of tissue-specific differentially methylated regions (TDMs) with differential gene expression. Proc Natl Acad Sci U S A 102: 3336-3341.
Structure, function and evolution of CpG island promoters. F Antequera, Cell Mol Life Sci. 60Antequera F (2003) Structure, function and evolution of CpG island promoters. Cell Mol Life Sci 60: 1647-1658.
Hairpin induced slippage and hyper-methylation of the fragile X DNA triplets. X Chen, S V Mariappan, R K Moyzis, E M Bradbury, G Gupta, J Biomol Struct Dyn. 15Chen X, Mariappan SV, Moyzis RK, Bradbury EM, Gupta G (1998) Hairpin induced slippage and hyper-methylation of the fragile X DNA triplets. J Biomol Struct Dyn 15: 745-756.
The UCSC Genome Browser Database. D Karolchik, R Baertsch, M Diekhans, T S Furey, A Hinrichs, Nucleic Acids Res. 31Karolchik D, Baertsch R, Diekhans M, Furey TS, Hinrichs A, et al. (2003) The UCSC Genome Browser Database. Nucleic Acids Res 31: 51-54.
Sequencedependent DNA structure: A database of octamer structural parameters. E J Gardiner, C A Hunter, M J Packer, D S Palmer, P Willett, J Mol Biol. 332Gardiner EJ, Hunter CA, Packer MJ, Palmer DS, Willett P (2003) Sequence- dependent DNA structure: A database of octamer structural parameters. J Mol Biol 332: 1025-1035.
Assessing the accuracy of prediction algorithms for classification: An overview. P Baldi, S Brunak, Y Chauvin, C A Andersen, H Nielsen, Bioinformatics. 16Baldi P, Brunak S, Chauvin Y, Andersen CA, Nielsen H (2000) Assessing the accuracy of prediction algorithms for classification: An overview. Bio- informatics 16: 412-424.
Data mining: Practical machine learning tools and techniques with Java implementations. I H Witten, E Frank, Morgan Kaufmann371San FranciscoWitten IH, Frank E (2000) Data mining: Practical machine learning tools and techniques with Java implementations. San Francisco: Morgan Kaufmann. 371 p.
Fast training of support vector machines using sequential minimal optimization. J Platt, Advances in kernel methods: Support vector learning. Schö lkopf B, Burges CJC, Smola AJCambridge (MassachusettsMIT PressPlatt J (1999) Fast training of support vector machines using sequential minimal optimization. In: Schö lkopf B, Burges CJC, Smola AJ, editors. Advances in kernel methods: Support vector learning. Cambridge (Massachusetts): MIT Press. pp. 185-208.
LIBSVM: A library for support vector machines. C C Chang, C J Lin, Chang CC, Lin CJ (2005) LIBSVM: A library for support vector machines. Available: http://www.csie.ntu.edu.tw/;cjlin/libsvm. Accessed 1 February 2006.
BiQ Analyzer: Visualization and quality control for DNA methylation data from bisulfite sequencing. C Bock, S Reither, T Mikeska, M Paulsen, J Walter, Bioinformatics. 21Bock C, Reither S, Mikeska T, Paulsen M, Walter J, et al. (2005) BiQ Analyzer: Visualization and quality control for DNA methylation data from bisulfite sequencing. Bioinformatics 21: 4067-4068.
|
DNA methylation changes stereotypically accompany carcinogenesis. Although global DNA methylation levels decrease in cancer, CpG island sequences tend to be targets for hypermethylation (1,2). Hypermethylation of CpG islands appears responsible for the transcriptional silencing of critical genes, including caretaker genes and tumor suppressor genes, that may be selected during the development of cancer and during cancer progression in a variety of human cancers (3). Normal CpG dinucleotide methylation patterns are thought to be established during embryonic development and maintained by DNMT1, a DNA methyltransferase targeted to DNA replication sites via interaction with PCNA 1 (4 -6). In hepatocellular carcinoma (HCC), a number of genes are known to accumulate aberrant CpG island hypermethylation changes, including GSTP1, p16, and E-cadherin (7)(8)(9)(10)(11)(12). The mechanism by which CpG island hypermethylation, amid global hypomethylation, appears in HCC or in other human cancers has not been established.
The mechanism by which hypermethylation at CpG islands acts to suppress the transcription of genes is an area of active research. Methyl-CpG binding domain (MBD) family proteins have been identified as candidate mediators of this process. All MBD proteins contain a conserved methyl-CpG binding domain, first identified in MeCP2 (13)(14)(15). MeCP2 is capable of binding DNA containing a single 5-m CpG. MeCP2 also contains a transcriptional repression domain that permits interaction with Sin3a and histone deacetylase (HDAC) to form one postulated 5-m CpG-dependent transcriptional repression complex (13,16,17). MBD2, which also binds DNA containing 5-m CpG, has been shown to be a part of another transcriptional repression complex, containing HDACs, MBD3, and Mi-2⅐NuRD proteins (18). The Mi-2⅐NuRD complex appears capable of disrupting histone-DNA interactions to promote chromatin remodeling (19). For cancer genes inactivated by somatic CpG island hypermethylation, the role of HDACs in transcriptional silencing is unclear. For some genes, treatment with trichostatin A, an HDAC inhibitor, is sufficient to reverse the repression associated with CpG island hypermethylation, whereas for other genes, TSA treatment alone is unable to restore gene expression (17,20,21). Treatment with a combination of TSA and a DNMT inhibitor has been reported to trigger the reactivation of some cancer genes carrying somatic CpG island hypermethylation (20). GSTP1, encoding the human -class glutathione S-transferase, has been reported to be targeted for somatic CpG island hypermethylation in 85% of HCCs as well as in 30% of breast cancers and in Ͼ90% of prostate cancers (7,(22)(23)(24). Hep3B cells, a human HCC line, have been shown to contain densely hypermethylated GSTP1 CpG island sequences and to be devoid of GSTP1 mRNA (7). We report here that in Hep3B HCC cells, repression of GSTP1 associated with CpG island hypermethylation was reversed by treatment with 5-azadeoxycytidine (5-aza-dC) but was unaffected by treatment with TSA. Furthermore, when Hep3B cells were treated with 5-az-dC for 72 h, subjected to limiting dilution cloning, and then assessed by quantitative RT-PCR for GSTP1 mRNA and by bisulfite genomic sequencing for GSTP1 CpG island methylation, Hep3B-5-aza-dC clones that express GSTP1 mRNA all contained at least one unmethylated GSTP1 CpG island allele. Hep3B-5-aza-dC clones that failed to reverse hypermethylation at the GSTP1 CpG island failed to express GSTP1 mRNA. Repression of transcription from hypermethylated GSTP1 CpG island alleles in Hep3B cells appeared to be mediated by MBD2. Chromatin immunoprecipitation analysis of nucleoprotein complexes in Hep3B cells revealed a preferential association of MBD2, but not MeCP2, with hypermethylated GSTP1 promoter sequences. Furthermore, when siRNAs targeting MBD2 and MeCP2 mRNAs were introduced by transfection into Hep3B cells, cells with reduced MBD2 levels, but not cells with reduced MeCP2 levels, were incapable of repressing transcription from SssI-methylated GSTP1 promoters. All of the data collected suggest that MBD2, perhaps via an HDACindependent pathway, acts to repress transcription from hypermethylated GSTP1 promoters in HCC cells.
EXPERIMENTAL PROCEDURES
Culture of Hep3B Cells and Treatment with 5-aza-dC and TSA-Human Hep3B cells were propagated in vitro in minimal Eagle's medium (Mediatech) supplemented with 1.0 mM sodium pyruvate and 10% fetal bovine serum (Invitrogen) (25). Treatment of Hep3B cells with 5-aza-dC (Sigma) and with TSA (Sigma) was accomplished by adding the drugs to complete growth medium at a concentration of 1 M for 5-aza-dC and 100 ng/ml for TSA. Stock solutions of 5-aza-dC, 1 mM in Me 2 SO, and TSA, 100 mg/ml in ethanol, were stored at -20°C. To isolate individual Hep3B clones with varying degrees of GSTP1 CpG island methylation, Hep3B cells were treated with 5-aza-dC for 72 h and then maintained in complete growth medium without drugs. The cells were then subjected to limiting dilution cloning in drug-free medium using 96-well culture plates. Eight Hep3B-5-aza-dC clones were isolated and maintained in complete growth medium without drugs for at least 3 months before assessment for GSTP1 expression and GSTP1 CpG island hypermethylation.
Detection of GSTP1 mRNA by Northern Blot Analysis and GSTP1 Polypeptides by Immunoblot-Total RNA was isolated from Hep3B cells and Hep3B-5-aza-dC clones using an RNeasy RNA isolation kit (Qiagen) and quantified using an orcinol assay (26). Purified RNAs (20 g) were electrophoresed on 1.5% agarose gels in the presence of 2.2 M formaldehyde, transferred to Zeta-Probe ® GT (Bio-Rad) filters, and then assessed for GSTP1 mRNA levels by hybridization with specific 32 P-labeled GSTP1 cDNA probes (ATCC) prepared using Rediprime II DNA labeling system (Amersham Biosciences). After hybridization at 50°C for 3 h in Quick-Hybe ® (Stratagene) hybridization solution containing heat-denatured salmon sperm DNA (Sigma) at 200 g/ml, blots were washed twice with 2ϫ SSC (1ϫ SSC is 150 mM NaCl, 15 mM sodium citrate, pH 7.0) and 0.1% SDS at room temperature and once with 0.1ϫ SSC and 0.1% SDS at 60°C. Blot were exposed to X-OMAT ™ film (Eastman Kodak Co.) at -70°C. Immunoblot analyses for GSTP1 polypeptides in total protein extracts from cultured HCC cells were accomplished as described previously (7,27).
Detection of GSTP1 mRNA Using Quantitative RT-PCR-Total RNA from each of the Hep3B-5-aza-dC was subjected to quantitative RT-PCR for GSTP1 mRNA using an iCycler iQ ™ multi-color real time PCR system (Bio-Rad) (28). Before PCR, cDNA was synthesized from 1 g of RNA using and Omniscript ® RT kit (Qiagen). PCR reactions included cDNA from 125 ng of RNA, sense (5Ј-GGGCAGTGCCTTCACATAGT-3Ј) and antisense (5Ј-ggagacctcaccctgtacca-3Ј) primers, and the Master Mix from a QuantiTect ™ SYBR Green ® PCR kit (Qiagen). PCR cycles were 94°C for 30 s, 60°C for 30 s, and 72°C for 30 s. Cloned GSTP1 cDNA was used as a standard for quantification. As an internal control, TBP mRNA, encoding the TATA-binding protein, was also detected by quantitative RT-PCR using specific sense (5Ј-cacgaaccacggcactgatt-3Ј) and antisense (5-ttttcttgctgccagtctggac-3Ј) primers. PCR cycles for TBP cDNA detection were 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s. Each of the PCR assays was run in triplicate, and the GSTP1 and TBP copy numbers were estimated from the threshold amplification cycle numbers using software supplied with the iCycler IQ ™ Thermal Cycler.
Bisulfite Genomic Sequencing for Mapping GSTP1 CpG Island DNA Methylation Patterns in Genomic DNA-Genomic DNA was isolated from Hep3B cells using the DNneasy ™ kit (Qiagen). To map 5-m CpG dinucleotides in the GSTP1 CpG island region, a bisulfite genomic sequencing approach was undertaken (24,29). Purified DNAs (500 g) were treated with EcoRI, admixed with salmon sperm DNA (2.5 g), and then treated with sodium bisulfite as previously described (27). The bisulfite-treated DNA was then subjected to two rounds of PCR to amplify GSTP1 CPG island alleles using primers that recognize the antisense strand of GSTP1 after bisulfite conversion. First-round PCR primers were 5Ј-AC(A/G)CAACCTATAATTCCACCTACTC-3Ј and 5Ј-GT(T/C)GGGAGTTGGGGTTTGATGTTG-3Ј; second round PCR primers were 5Ј-AACCTAAACCACAAC(A/G)TAAAACAT-3Ј and 5Ј-TTG-GTTTTATGTTGGGAGTTTTGA-3Ј. PCR reaction conditions have been described previously. To permit DNA sequencing of individual GSTP1 CpG island alleles, PCR products were purified by electrophoresis on 1% agarose gels using the Qiaquick ™ gel extraction kit (Qiagen), ligated into pCR2.1pTOPO ® cloning vectors (Invitrogen), and then introduced into TOP 10 ® One Shot competent bacteria (Invitrogen). Plasmid DNA, isolated using Qiaprep ® Spin Miniprep kit, was subjected to DNA sequence analysis using M13 sequencing primers.
Chromatin Immunoprecipitation-8 -10 ϫ 10 6 growing Hep3B cells or Hep3B-5-aza-dC clone 5 cells were fixed with 1% formaldehyde for 10 min at 37°C, washed twice in ice-cold PBS containing protease inhibitor mixture III (Calbiochem), and then recovered by scraping and centrifugation at 325 ϫ g for 5 min (30). Cell pellets were resuspended in 200 l of chromatin lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl, pH 8.1), incubated for 10 min at 4°C, and then sonicated for 40 s using a Versonic micropipette sonicator to reduce DNA fragment size to 400 -600 bp. The sonicated chromatin lysates were clarified by centrifugation at 14,000 ϫ g for 10 min at 4°C, and the supernatants were added to 10 ml of precipitation buffer (0.01% SDS, 1.1% Triton X-100, 167 mM NaCl, and 1.2 mM EDTA in 16.7 mM Tris-HCl, pH 8.1). After preclearing with 400 l of salmon sperm DNA/protein A-agarose (Upstate Biotech) by incubation at 4°C for 30 min with gentle agitation and then centrifugation at 325 ϫ g for 1 min, nucleoprotein complexes were separated into 1 ml aliquots for immunoprecipitation using specific antibodies to MBD2, MeCP2, Sp1, and acetylated histone H4 (all from Upstate Biotechnology). 5-10 g of antibody solution was added to 1 ml of nucleoprotein complexes. Antibody-nucleoprotein complex mixtures were incubated at 4°C overnight with gentle agitation. Immunocomplexes were collected by the addition of 60 l of salmon sperm DNA/protein A-agarose (Upstate Biotech), incubated for 1 h at 4°C with rotation, then centrifugation at 325 ϫ g for 1 min. Pelleted immunocomplexes were washed with low salt wash buffer (0.1% SDS, 0.1% Triton X-100, 150 mM NaCl, and 2 mM EDTA in 20 mM Tris-HCl, pH 8.1), high salt wash buffer (0.1% SDS, 0.1% Triton X-100, 500 mM NaCl, and 2 mM EDTA in 20 mM Tris-HCl, pH 8.1), LiCl/Nonidet P-40/deoxycholate buffer (0.25 M LiCl, 1% Nonidet P-40, 1% sodium deoxycholate, and 1 mM EDTA in 10 mM Tris-HCl, pH 8.1), and with TE buffer (1 mM EDTA in 10 mM Tris-HCl, pH 8.0). Nucleoprotein complexes were eluted from the final washed immunoprecipitates in 250 l of 1% SDS and 0.1 M NaHCO 3 by incubation at room temperature for 15 min. To reverse the cross-linking of protein to DNA, 20 l of 5 M NaCl was added to the eluted immunoprecipitates and incubated at 65°C overnight. Proteins were digested by adding 2 l of proteinase K (10 mg/ml), 10 l of 0.5 M EDTA, and 20 l of Tris-HCl, pH 6.5, and incubating the mixture for 1 h at 45°C. DNA was recovered by phenol/chloroform extraction and EtOH precipitation. To detect GSTP1 CpG island DNA, quantitative PCR was undertaken using the iCycler iQ ™ multi-color real time PCR system (Bio-Rad) and a Quantitect ™ SYBR ® Green Master Mix. The PCR cycles were 95°C for 15 min, then 40 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 45 s. The GSTP1 primers were sense (5Ј-GACCTGGGAAAGAGAGGGAAAG-3Ј) and antisense (5Ј-ACTCACTGGTGGCGAAGACT-3Ј). PCR assays were run in triplicate, and GSTP1 copy numbers were estimated from the threshold amplification cycle numbers using software supplied with the iCycler IQ ™ Thermal Cycler. The amount of GSTP1 DNA recovered by immunoprecipitation with specific antibodies was expressed as a percent of the total amount of GSTP1 DNA in nucleoprotein complexes before immunoprecipitation.
siRNA "Knock-down" Experiments-siRNA duplexes were designed targeting AA(N 19 )UU sequences in the open reading frames of mRNA encoding MBD2 and MeCP2; siRNA-targeting mRNA encoding lamin A was already available (Dharmacon) (31). Selected siRNA target sequences were also submitted to BLAST searches against other human genome sequences to ensure target specificity. 21-Nucleotide RNAs were chemically synthesized by Dharmacon and obtained in annealed form. The following target sequences were used: MBD2 mRNA (5Ј-AAGAGGAUGGAUUGCCCGGCC-3Ј), MeCP2 mRNA (target 5Ј-AAG-CAUGAGCCCGUGCAGCCA-3Ј), and lamin A mRNA (5Ј-AAGGAC-CUGGAGGCUCUGCUG-3Ј). siRNAs were transfected into Hep3B cells using Oligofectamine ™ (Invitrogen). An additional siRNA transfection was undertaken 48 h later to increase the efficiency of target protein knock-down. The effectiveness of the target protein reduction was monitored by immunoblot analysis. Total protein extracts, prepared by lysing cells in 2% SDS, were electrophoresed on 10% polyacrylamide gels (Novex) in MES running buffer (Novex), transferred to nitrocellulose membranes (Invitrogen), and then probed with antibodies to MBD, MeCP2, acetylated histone H4, and lamin A/C (Upstate Biotechnology, Calbiochem) using horseradish peroxidase-conjugated anti-IgG (Amersham Biosciences) as previously described.
Transient Transfection Analysis of the Effects of CpG Island Hypermethylation on GSTP1 Promoter Activity-GSTP1 promoter-luciferase reporter constructs (pGL3 vector, Promega) containing sequences from Ϫ408 5Ј of the GSTP1 transcription start site to ϩ36 were treated with SssI, a CpG methylase, or left untreated and then transfected into Hep3B cells using LipofectAMINE ™ (Invitrogen) (24). After 48 h, the transfected cells were lysed using passive lysis buffer (Promega). Luciferase reporter activity was assayed using a Dual-Luciferase ® reporter assay system (Promega) and a 1450 MicroBeta ® JET luminometer (Wallac). A cytomegalovirus promoter--galactosidase reporter construct was used to monitor transfection efficiency. yltransferase Inhibitor-Although -class glutathione S-transferases appear to be up-regulated in rat models of HCC, the human -class glutathione S-transferase is not expressed in human HCCs or by the human HCC cell line, Hep3B (5). In normal human liver tissue, the GSTP1 CpG island is unmethylated, even though GSTP1 is usually not expressed (7,32). However, in Hep3B HCC cells, the GSTP1 promoter has been previously shown to be heavily methylated (7). When we subjected Hep3B cells to treatment with 5-aza-dC, a DNMT inhibitor, or with TSA, an HDAC inhibitor, GSTP1 expression was evident only in cells treated with 5-aza-dC within 72 h (Fig. 1). To ascertain whether combinations of 5-aza-dC and TSA might be more effective at restoring GSTP1 expression than 5-aza-dC alone, Hep3B cells were treated sequentially for 48 h with 5-aza-dC and/or TSA to a total 96 h of drug treatment (Fig. 2). Prior exposure of Hep3B cells to TSA did not potentiate the effect of 5-aza-dC on increasing GSTP1 mRNA levels, nor did exposure to TSA after 5-aza-dC treatment have any synergistic effect on restoring GSTP1 expression. These findings are con-sistent with a role for GSTP1 CpG island hypermethylation in the silencing of GSTP1 transcriptional in Hep3B cells and further suggest that the mechanism of methylation-associated inhibition of GSTP1 transcription may not require HDACs.
RESULTS
Reactivation
Bisulfite Genomic Sequencing Analysis of Individual Hep3B Clones Isolated after 5-aza-dC Treatment-To better characterize the effect of CpG island hypermethylation on GSTP1 expression in Hep3B cells, we treated the cells for 72 h with 5-aza-dC and then isolated individual Hep3B-5-aza-dC subclones by limiting dilution cloning. Eight Hep3B-5-aza-dC clones were recovered, and three of the clones expressed significant levels of GSTP1 mRNA by Northern blot (Fig. 3) and quantitative RT-PCR analyses (Fig. 4). DNMT inhibitors have been reported to restore the expression of many genes repressed by CpG island hypermethylation in cancer cells; however, a reduction in gene expression and a remethylation of CpG island sequences after prolonged passage in cell culture have been described for some such genes (33). In T24 bladder cancer cells, restoration of p16 mRNA expression by treatment
FIG. 5. Bisulfite genomic sequencing for mapping of 5-m CpG in the GSTP1 CpG island in Hep3B cells and in Hep3B-5-aza-dC clones.
Genomic DNA was isolated from Hep3B cells and Hep3B-5-aza-dC subclones, bisulfite-treated, amplified by PCR targeting the GSTP1 CpG island, and then subjected to DNA sequence analysis as described under "Experimental Procedures." A minimum of 10 individual PCR product clones were sequenced for each cell type. PCR product clones with less than 85% conversion of non-CpG cytosines to thymines were not considered. Sequences sharing (ATAAA) n repeat lengths were collected as individual GSTP1 alleles; three alleles were present in Hep3B cells. For each GSTP1 (ATAAA) n repeat allele in each cell type, a 5-m CpG map with the percentage of clones containing 5-m CpG at specific sites is displayed. with 5-aza-dC was completely reversed after 21 population doublings in the absence of the inhibitor (33). Remarkably, in Hep3B-5-aza-dC clones 2, 5, and 7, GSTP1 mRNA expression remained stable for at least 8 months during continuous cell culture in the absence of 5-aza-dC (not shown). Whether the apparent differences in propensity for CpG island remethylation between p16 in T24 cells and GSTP1 in Hep3B cells can be attributed to differences in selection for loss of p16 versus GSTP1 expression or to some mechanism has not been established (24). When genomic DNA from each of the clones was subjected to bisulfite genomic sequencing, capable of mapping 5-m CpG dinucleotides at the GSTP1 transcriptional regulatory region, a reduction in GSTP1 CpG island hypermethylation was evident only in Hep3B-5-aza-dC clones that expressed GSTP1 mRNA (Fig. 5). Of interest, the PCR primers for bisulfite genomic sequence analysis flanked a polymorphic (ATA-AA) n repeat located Ϫ506 bp 5Ј of the GSTP1 transcription start site, permitting discrimination of CpG dinucleotide methylation patterns on individual GSTP1 alleles. Hep3B cells and four of the Hep3B-5-aza-dC clones were found to contain three different (ATAAA) n repeat lengths, consistent with an instability of this polymorphic repeat at some point during the development, isolation, and propagation of Hep3B HCC cell line. Four of the Hep3B-5-aza-dC clones appeared to have lost GSTP1 allele 3 after 5-aza-dC treatment and limiting dilution cloning. For the three Hep3B-5-aza-dC clones with a reduction in GSTP1 CpG island methylation, the reduction was restricted to one GSTP1 allele. Furthermore, each of the three Hep3B-5-aza-dC subclones displayed reversal of GSTP1 CpG island hypermethylation at different GSTP1 alleles, suggesting no bias of 5-aza-dC action toward any specific GSTP1 allele. Hep3B-5-aza-dC clones 2 and 5 appeared to have completely reversed GSTP1 hypermethylation at a GSTP1 allele; Hep3B-5-aza-dC clone 7 only partially reversed the GSTP1 CpG island hypermethylation. These experiments further support a direct correlation between GSTP1 CpG island hypermethylation GSTP1 repression.
Chromatin Immunoprecipitation Analyses of Active and Inactive GSTP1 Promoters-To ascertain whether MBD family proteins formed transcriptional repression complexes at hypermethylated GSTP1 CpG islands, we performed chromatin immunoprecipitation analyses of Hep3B cells, which contain only hypermethylated GSTP1 CpG islands and fail to express GSTP1 mRNA, and of Hep3B-5-aza-dC clone 5 cells, which contain one unmethylated GSTP1 CpG island allele and express high levels of GSTP1 mRNA (Fig. 6). Antibodies to Sp1 and acetylated histone H4 were used to detect active transcription complexes, whereas antibodies to MBD2 and MeCP2 were FIG. 6. Chromatin immunoprecipitation targeting the GSPT1 promoter in Hep3B and Hep3B-5-aza-dC clone 5 cells. Nucleoprotein complexes recovered from Hep3B and Hep3B-5-aza-dC clone 5 cells were subjected to immunoprecipitation with antibodies against Sp1, acetylated H4, MBD2, and MeCP2. The immunoprecipitates were then analyzed by quantitative PCR targeting the GSTP1 promoter; the amount of GSTP1 promoter DNA in the immunoprecipitates is shown as a percentage of a total GSTP1 promoter DNA. Levels of GSTP1, MeCP2, MBD2, and acetylated H4 in Hep3B and Hep3B-5-aza-dC clone 5 cells were monitored using immunoblot analysis. used to detect repressive transcription complexes. For Hep3B cells, MBD2 and perhaps a small amount of MeCP2, but not Sp1 nor acetylated H4, were detected at the GSTP1 promoter. In contrast, for Hep3B-5-aza-dC clone 5 cells, Sp1 and a small amount of acetylated histone H4 were detected at the GSTP1 promoter on at least some GSTP1 alleles, whereas reduced levels of MBD2 and MeCP2 were present. Differences in levels of GSTP1-MBD2 and GSTP1-MeCP2 nucleoprotein complexes in Hep3B cells versus Hep3B-5-aza-dC clone 5 cells were not attributable to differences in MBD2 or MeCP2 polypeptide levels, because both proteins were readily detected in protein extracts from both cell lines. Thus, the presence of at least one unmethylated GSTP1 promoter allele permitted the assembly of GSTP1-protein complexes containing the transcriptional trans-activator Sp1 and histone H4, whereas the exclusive presence of hypermethylated GSTP1 promoter alleles only allowed the assembly of GSTP1-protein complexes containing MBD family proteins.
SssI-catalyzed CpG Methylation of GSTP1 Promoter Sequences Reduces GSTP1 Promoter Activity in Both Hep3B Cells and Hep3B-5-aza-dC Clone 5 Cells-Although the stable high level GSTP1 expression induced by brief treatment of Hep3B-5-aza-dC clone 5 cells with 5-aza-dC was correlated with reversal of GSTP1 CpG island hypermethylation and with the assembly of an Sp1-containing complex at the GSTP1 promoter, in principle, DNA methylation-independent increases in transactivation activity might still contribute to the high level of GSTP1 expression in the Hep3B-5-aza-dC clone 5 cells. Also, nucleoside DNMT inhibitors have been reported to increase the expression of some genes in the absence of alterations in DNA methylation (34 -36). Nonetheless, when unmethylated GSTP1 promoter sequences were transfected into Hep3B and Hep3B-5-aza-dC clone 5 cells, similar luciferase reporter expression levels, normalized to cytomegalovirus promoter-driven -galactosidase reporter expression levels, were seen (Fig. 4). Furthermore, 5-aza-dC treatment did not appear to increase the activity of unmethylated GSTP1 promoters (Fig. 7). However, when GSTP1 promoter sequences were treated with the CpG methylase SssI before transfection, a marked reduction in luciferase reporter expression in both Hep3B and Hep3B-5-aza-dC clone 5 cells was observed (Fig. 4).
siRNA Knock-down of MBD2 and MeCP2 in Hep3B Cells Implicates MBD2 in Hypermethylation-dependent GSTP1 Repression-To test whether MBD2, MeCP2, or both MBD2 and MeCP2 were responsible for repression of transcription from hypermethylated GSTP1 promoter alleles, the levels of the MBD family proteins were reduced in Hep3B cells by treatment with specific siRNAs capable of degrading mRNA transcripts in a target specific manner (Fig. 8). The effectiveness of siRNA knock-down of MBD family proteins was monitored by immunoblot analysis. Remarkably, when an SssI-methylated GSTP1 promoter was transfected into Hep3B cells treated with siRNAtargeting MBD2 mRNA, the reduction in MBD2 protein levels appeared to render the Hep3B cells incapable of repressing GSTP1 transcription. Finally, a combined knock-down of MBD2 levels and MeCP2 levels in Hep3B cells was no better at reversing alleviating repression from hypermethylated GSTP1 promoters as a knock-down of MBD2 alone. Considered along with the finding that MBD2 is located at hypermethylated GSTP1 promoters in Hep3B cells, the lack of repression activity for hypermethylated GSTP1 promoters in Hep3B cells with reduced MBD2 levels strongly suggest that MBD2 likely medi- ates CpG island hypermethylation-dependent repression of GSTP1.
DISCUSSION
All of the data collected suggest that CpG island hypermethylation is responsible for transcriptional silencing GSTP1 in Hep3B cells. GSTP1 repression was reversed by treatment with 5-aza-dC treatment, a DNMT inhibitor, but not with TSA, an HDAC inhibitor. For certain genes silenced by CpG island hypermethylation, treatment with TSA can activate gene expression, indicating the participation of HDACs in transcriptional repression, whereas for other genes, TSA alone is incapable of restoring gene function (17,20,21). In our chromatin immunoprecipitation experiments, we detected more acetylated histones in association with active GSTP1 promoters (in Hep3B-5-aza-dC clone 5 cells) than in association with inactive GSTP1 promoters (in parent Hep3B cells), suggesting that histone acetylation likely accompanies GSTP1 transcription. However, the absence of TSA stimulation of GSTP1 expression from hypermethylated GSTP1 promoters in Hep3B cells suggests that HDACs do not play a critical role in CpG island hypermethylation-associated GSTP1 repression.
The mechanism by which aberrant methylation patterns develop in cancer cells has not been determined. Several cytosine methyltransferase genes have been identified and charac-terized. Dnmt1, Dnmt3a, and Dnmt3b are each essential for mouse development (37). DNMT1, thought to function as a maintenance methyltransferase in normal cells, is present at replication foci during the S phase of the cell cycle (6). Under certain circumstances, DNMT1 may also promote de novo CpG dinucleotide methylation (38,39). In cancer cells, DNMT3a and DNMT3b may contribute to both de novo and to maintenance DNA methylation in some way. HCT116 colorectal carcinoma cells carrying disrupted DNMT1 alleles display only a ϳ20% reduction in 5-m CpG (40). Furthermore, although DNMT3a and DNMT3b seem to be expressed at high levels during embryonic development and at low levels in normal adult tissues, increased expression of DNMT3a and DNMT3b mRNA has been reported in human cancers (41)(42)(43). Nonetheless, DNMT1 has been more prominently implicated in the earliest stages of cancer development than other DNMTs. Apc min/ϩ mice develop fewer intestinal polyps when crossed to a Dnmt1 Ϯ background (44). Dnmt1 also appears essential for fos transformation of rat fibroblasts in vitro, as forced Dnmt1 overexpression recapitulates the fos-transformed phenotype, and antisense Dnmt1 cDNA inhibits transformation by fos (38). Despite these observations, whether DNMT1 acts to facilitate cancer development through catalyzing de novo CpG island methylation has not been irrefutably established. DNMT1 has been reported to act as a transcriptional repressor, independent of DNA methyltransferase activity, by forming complexes with HDAC2 and DMAP1 (45).
The MBD proteins all contain sequences similar to a 60 -80amino acid motif shown in MeCP2 to be responsible for 5-m CpG binding. MeCP2, the first of these proteins to be identified, acts as a transcriptional repressor via interaction with Sin3A and HDACs. MECP2 mutations are responsible for Rett's syndrome, a neurodegenerative disorder in females, and for severe mental retardation and death in males. Targeted disruption of Mecp2 leads to a similar phenotype in mice (46). In our studies, although we found a small amount of MeCP2 in association with hypermethylated GSTP1 promoters in Hep3B cells by chromatin immunoprecipitation, we were unable to increase GSTP1 promoter activity by treatment with siRNA-targeting MECP2 mRNA in the setting of GSTP1 promoter hypermethylation. These data suggest that MeCP2 is not required for transcriptional repression from hypermethylated GSTP1 promoters in Hep3B cells. MeCP1, a multi-component transcriptional repression complex, contains MBD2, MBD3, and Mi-2⅐NuRD proteins (18). MBD2 most likely serves to recruit MeCP1 complex proteins to hypermethylated transcriptional promoters, because MBD3 does not bind 5-m CpG (15,47). Perhaps for this reason, cells from Mbd2 Ϫ/Ϫ mice are unable to prevent transcription from exogenous hypermethylated SV40 promoters, whereas Mbd3 Ϫ/Ϫ cells remain capable of promoter hypermethylation-associated repression (47). We detected MBD2 bound to hypermethylated GSTP1 promoters in Hep3B cells by chromatin immunoprecipitation, and we showed that a reduction in MBD2 levels prevented repression of GSTP1 associated with hypermethylation. Confirming these findings, preliminary data collected using MCF-7 breast cancer cells suggests that siRNA knock-down of MBD2 triggers induction of GSTP1 mRNA expression despite the presence of hypermethylated GSTP1 promoters. 2 The participation of MBD2 in the silencing of hypermethylated GSTP1 promoters in Hep3B cells may provide a partial explanation for the failure of TSA to reactivate GSTP1 expression. MeCP1 contains the SWI/SNF helicase Mi-2 as well as HDACs (18). Co-transfection of cDNA encoding a dominant-negative Mi-2 has been reported to alle-2 X. Lin and W. G. Nelson, manuscript in preparation. viate repression from a model hypermethylated transcriptional promoter (18). For GSTP1 in Hep3B cells, CpG island hypermethylation appears to cause transcriptional silencing by an MBD2-dependent but HDAC-independent mechanism. Perhaps Mi-2 or some other MBD2-associated protein may help MBD2 mediate repression from hypermethylated GSTP1 promoters. In all, our findings support a critical role for MBD2 in the silencing of genes targeted for somatic CpG island hypermethylation during cancer development.
FIG. 1 .
1Activation of GSTP1 expression in Hep3B cells by treatment with 5-aza-dC. Hep3B cells were treated with 5-aza-dC (1 M) or TSA (100 ng/ml) for 24, 48, and 72 h. Expression of GSTP1 mRNA was monitored by Northern blot analysis using GSTP1 cDNA as a probe (upper panel). Ethidium bromide staining of rRNA was used as a loading control (bottom panel).
GSTP1 Expression from Hep3B Cells Containing Hypermethylated GSTP1 CpG Islands Using a DNA Meth-FIG. 2. Treatment with 5-aza-dC, but not with TSA, restores GSTP1 expression in Hep3B cells. Hep3B cells were treated sequentially for two 48-h periods with 5-aza-dC (1 M), TSA (100 ng/ ml), or neither drug. GSTP1 expression was monitored by Northern blot analysis as described for Fig 1.
FIG. 3 .
3GSTP1 expression by Hep3B clones isolated after 72 h of-5-aza-dC exposure. Hep3B cells were treated with 5-aza-dC (1 M) for 72 h, then maintained in complete growth medium without drugs thereafter. The drug-treated cells were subjected to limiting dilution cloning, and eight individual clones were isolated. GSTP1 expression was monitored by Northern blot analysis as described forFig. 1. FIG. 4. Quantitative RT-PCR for GSTP1 mRNA in Hep3B-5aza-dC clones. Hep3B-5-aza-dC sublcones were assessed for GSTP1 mRNA levels using quantitative RT-PCR. Results are displayed in the ratio GSTP1 mRNA/TBP mRNA for each Hep-3B-5-aza-dC subclone.
FIG. 7 .
7Inhibition of GSTP1 promoter activity in Hep3B cells by SssI-catalyzed CpG methylation. Hep3B cells were transfected with unmethylated and methylated GSTP1-P1 (a full-length GSTP1 promoter-luciferase reporter construct) along with a cytomegalovirus promoter--galactosidase control. To determine whether 5-aza-dC triggered trans-activation of unmethylated GSTP1 promoters, GSTP-P1-transfected Hep3B cells were treated with 5-aza-dC (1 M). Luciferase activity, normalized to -galactosidase activity, assessed 48 h after transfection, is shown.
FIG. 8 .
8Alleviation of repression from hypermethylated GSTP1 promoters after targeted reduction of MBD2 using siRNA. Hep3B cells were repeatedly transfected with siRNA-targeting mRNA encoding lamin A, MBD2, and MeCP2. Reductions in the levels of targeted proteins were monitored by immunoblot analysis. After two siRNA treatments, SssI-methylated (meth) GSTP-P1 promoter activity was assessed via transient transfection as described forFig. 7.
by guest on July 18, 2018 http://www.jbc.org/ Downloaded from
. S B Baylin, J G Herman, J R Graff, P M Vertino, J P Issa, Adv. Cancer Res. 72Baylin, S. B., Herman, J. G., Graff, J. R., Vertino, P. M., and Issa, J. P. (1998) Adv. Cancer Res. 72, 141-196
. K D Robertson, P A Jones, Carcinogenesis. 21Robertson, K. D., and Jones, P. A. (2000) Carcinogenesis 21, 461-467
. M Esteller, P G Corn, S B Baylin, J G Herman, Cancer Res. 61Esteller, M., Corn, P. G., Baylin, S. B., and Herman, J. G. (2001) Cancer Res. 61, 3225-3229
. R W Yen, P M Vertino, B D Nelkin, J J Yu, W El-Deiry, A Cumaraswamy, G G Lennon, B J Trask, P Celano, S B Baylin, Nucleic Acids Res. 20Yen, R. W., Vertino, P. M., Nelkin, B. D., Yu, J. J., el-Deiry, W., Cumaraswamy, A., Lennon, G. G., Trask, B. J., Celano, P., and Baylin, S. B. (1992) Nucleic Acids Res. 20, 2287-2291
. L S Chuang, H I Ian, T W Koh, H H Ng, G Xu, B F Li, Science. 277Chuang, L. S., Ian, H. I., Koh, T. W., Ng, H. H., Xu, G., and Li, B. F. (1997) Science 277, 1996 -2000
. H Leonhardt, A W Page, H U Weier, T H Bestor, Cell. 71Leonhardt, H., Page, A. W., Weier, H. U., and Bestor, T. H. (1992) Cell 71, 865-873
. J C Tchou, X Lin, D Freije, W B Isaacs, J D Brooks, A Rashid, A M De Marzo, Y Kanai, S Hirohashi, W G Nelson, Int. J. Oncol. 16Tchou, J. C., Lin, X., Freije, D., Isaacs, W. B., Brooks, J. D., Rashid, A., De Marzo, A. M., Kanai, Y., Hirohashi, S., and Nelson, W. G. (2000) Int. J. Oncol. 16, 663-676
. I H Wong, Y M Lo, J Zhang, C T Liew, M H Ng, N Wong, P B Lai, W Y Lau, N M Hjelm, Johnson , P J , Cancer Res. 59Wong, I. H., Lo, Y. M., Zhang, J., Liew, C. T., Ng, M. H., Wong, N., Lai, P. B., Lau, W. Y., Hjelm, N. M., and Johnson, P. J. (1999) Cancer Res. 59, 71-73
. Y Kanai, S Ushijima, A M Hui, A Ochiai, H Tsuda, M Sakamoto, S Hirohashi, Int. J. Cancer. 71Kanai, Y., Ushijima, S., Hui, A. M., Ochiai, A., Tsuda, H., Sakamoto, M., and Hirohashi, S. (1997) Int. J. Cancer 71, 355-359
. Y Kondo, Y Kanai, M Sakamoto, M Mizokami, R Ueda, S Hirohashi, Hepatology. 32Kondo, Y., Kanai, Y., Sakamoto, M., Mizokami, M., Ueda, R., and Hirohashi, S. (2000) Hepatology 32, 970 -979
. Y Kanai, A M Hui, L Sun, S Ushijima, M Sakamoto, H Tsuda, S Hirohashi, Hepatology. 29Kanai, Y., Hui, A. M., Sun, L., Ushijima, S., Sakamoto, M., Tsuda, H., and Hirohashi, S. (1999) Hepatology 29, 703-709
. Y Kanai, S Ushijima, H Tsuda, M Sakamoto, T Sugimura, S Hirohashi, Jpn. J. Cancer Res. 87Kanai, Y., Ushijima, S., Tsuda, H., Sakamoto, M., Sugimura, T., and Hirohashi, S. (1996) Jpn. J. Cancer Res. 87, 1210 -1217
. R R Meehan, J D Lewis, A P Bird, Nucleic Acids Res. 20Meehan, R. R., Lewis, J. D., and Bird, A. P. (1992) Nucleic Acids Res. 20, 5085-5092
. X Nan, R R Meehan, A Bird, Nucleic Acids Res. 21Nan, X., Meehan, R. R., and Bird, A. (1993) Nucleic Acids Res. 21, 4886 -4892
. B Hendrich, A Bird, Mol. Cell. Biol. 18Hendrich, B., and Bird, A. (1998) Mol. Cell. Biol. 18, 6538 -6547
. X Nan, H H Ng, C A Johnson, C D Laherty, B M Turner, R N Eisenman, A Bird, Nature. 393Nan, X., Ng, H. H., Johnson, C. A., Laherty, C. D., Turner, B. M., Eisenman, R. N., and Bird, A. (1998) Nature 393, 386 -389
. P L Jones, G J Veenstra, P A Wade, D Vermaak, S U Kass, N Landsberger, J Strouboulis, A P Wolffe, Nat. Genet. 19Jones, P. L., Veenstra, G. J., Wade, P. A., Vermaak, D., Kass, S. U., Landsberger, N., Strouboulis, J., and Wolffe, A. P. (1998) Nat. Genet. 19, 187-191
. Q Feng, Y Zhang, Genes Dev. 15Feng, Q., and Zhang, Y. (2001) Genes Dev. 15, 827-832
. J K Tong, C A Hassig, G R Schnitzler, R E Kingston, S L Schreiber, Nature. 395Tong, J. K., Hassig, C. A., Schnitzler, G. R., Kingston, R. E., and Schreiber, S. L. (1998) Nature 395, 917-921
. E E Cameron, K E Bachman, S Myohanen, J G Herman, S B Baylin, Nat. Genet. 21Cameron, E. E., Bachman, K. E., Myohanen, S., Herman, J. G., and Baylin, S. B. (1999) Nat. Genet. 21, 103-107
. S U Kass, N Landsberger, A P Wolffe, Curr. Biol. 7Kass, S. U., Landsberger, N., and Wolffe, A. P. (1997) Curr. Biol. 7, 157-165
. M Esteller, P G Corn, J M Urena, E Gabrielson, S B Baylin, J G Herman, Cancer Res. 58Esteller, M., Corn, P. G., Urena, J. M., Gabrielson, E., Baylin, S. B., and Herman, J. G. (1998) Cancer Res. 58, 4515-4518
. W H Lee, W B Isaacs, G S Bova, W G Nelson, Cancer Epidemiol. Biomark. Prev. 6Lee, W. H., Isaacs, W. B., Bova, G. S., and Nelson, W. G. (1997) Cancer Epidemiol. Biomark. Prev. 6, 443-450
. X Lin, M Tascilar, W H Lee, W J Vles, B H Lee, R Veeraswamy, K Asgari, D Freije, B Van Rees, W R Gage, G S Bova, W B Isaacs, J D Brooks, T L Deweese, A M De Marzo, W G Nelson, Am. J. Pathol. 159Lin, X., Tascilar, M., Lee, W. H., Vles, W. J., Lee, B. H., Veeraswamy, R., Asgari, K., Freije, D., van Rees, B., Gage, W. R., Bova, G. S., Isaacs, W. B., Brooks, J. D., DeWeese, T. L., De Marzo, A. M., and Nelson, W. G. (2001) Am. J. Pathol. 159, 1815-1826
. D P Aden, A Fogel, S Plotkin, I Damjanov, B B Knowles, Nature. 282Aden, D. P., Fogel, A., Plotkin, S., Damjanov, I., and Knowles, B. B. (1979) Nature 282, 615-616
. R I Lin, O A Schjeide, Anal. Biochem. 27Lin, R. I., and Schjeide, O. A. (1969) Anal. Biochem. 27, 473-483
. W H Lee, R A Morton, J I Epstein, J D Brooks, P A Campbell, G S Bova, W S Hsieh, W B Isaacs, W G Nelson, Proc. Natl. Acad. Sci. U. S. A. 91Lee, W. H., Morton, R. A., Epstein, J. I., Brooks, J. D., Campbell, P. A., Bova, G. S., Hsieh, W. S., Isaacs, W. B., and Nelson, W. G. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 11733-11737
. X Lin, K Asgari, M J Putzi, W R Gage, X Yu, B S Cornblatt, A Kumar, S Piantadosi, T L Deweese, A M De Marzo, W G Nelson, Cancer Res. 61Lin, X., Asgari, K., Putzi, M. J., Gage, W. R., Yu, X., Cornblatt, B. S., Kumar, A., Piantadosi, S., DeWeese, T. L., De Marzo, A. M., and Nelson, W. G. (2001) Cancer Res. 61, 8611-8616
. S J Clark, J Harrison, C L Paul, M Frommer, Nucleic Acids Res. 22Clark, S. J., Harrison, J., Paul, C. L., and Frommer, M. (1994) Nucleic Acids Res. 22, 2990 -2997
. A P Gould, J J Brookman, D I Strutt, R A White, Nature. 348Gould, A. P., Brookman, J. J., Strutt, D. I., and White, R. A. (1990) Nature 348, 308 -312
. N J Caplen, S Parrish, F Imani, A Fire, R A Morgan, Proc. Natl. Acad. Sci. U. S. A. 98Caplen, N. J., Parrish, S., Imani, F., Fire, A., and Morgan, R. A. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 9742-9747
. D S Millar, C L Paul, P L Molloy, S J Clark, J. Biol. Chem. 275Millar, D. S., Paul, C. L., Molloy, P. L., and Clark, S. J. (2000) J. Biol. Chem. 275, 24893-24899
. C M Bender, M L Gonzalgo, F A Gonzales, C T Nguyen, K D Robertson, P A Jones, Mol. Cell. Biol. 19Bender, C. M., Gonzalgo, M. L., Gonzales, F. A., Nguyen, C. T., Robertson, K. D., and Jones, P. A. (1999) Mol. Cell. Biol. 19, 6690 -6698
. S Periyasamy, S Ammanamanchi, M P Tillekeratne, M G Brattain, Oncogene. 19Periyasamy, S., Ammanamanchi, S., Tillekeratne, M. P., and Brattain, M. G. (2000) Oncogene 19, 4660 -4667
. S Ammanamanchi, S J Kim, L Z Sun, M G Brattain, J. Biol. Chem. 273Ammanamanchi, S., Kim, S. J., Sun, L. Z., and Brattain, M. G. (1998) J. Biol. Chem. 273, 16527-16534
. S Ammanamanchi, M G Brattain, J. Biol. Chem. 276Ammanamanchi, S., and Brattain, M. G. (2001) J. Biol. Chem. 276, 32854 -32859
. E Li, T H Bestor, R Jaenisch, Cell. 69Li, E., Bestor, T. H., and Jaenisch, R. (1992) Cell 69, 915-926
. A V Bakin, T Curran, Science. 283Bakin, A. V., and Curran, T. (1999) Science 283, 387-390
. P M Vertino, R W Yen, J Gao, S B Baylin, Mol. Cell. Biol. 16Vertino, P. M., Yen, R. W., Gao, J., and Baylin, S. B. (1996) Mol. Cell. Biol. 16, 4555-4565
. I Rhee, K W Jair, R W Yen, C Lengauer, J G Herman, K W Kinzler, B Vogelstein, S B Baylin, K E Schuebel, Nature. 404Rhee, I., Jair, K. W., Yen, R. W., Lengauer, C., Herman, J. G., Kinzler, K. W., Vogelstein, B., Baylin, S. B., and Schuebel, K. E. (2000) Nature 404, 1003-1007
. M Okano, D W Bell, D A Haber, Li , E , Cell. 99Okano, M., Bell, D. W., Haber, D. A., and Li, E. (1999) Cell 99, 247-257
. K D Robertson, E Uzvolgyi, G Liang, C Talmadge, J Sumegi, F A Gonzales, P A Jones, Nucleic Acids Res. 27Robertson, K. D., Uzvolgyi, E., Liang, G., Talmadge, C., Sumegi, J., Gonzales, F. A., and Jones, P. A. (1999) Nucleic Acids Res. 27, 2291-2298
. Y Saito, Y Kanai, M Sakamoto, H Saito, H Ishii, S Hirohashi, Hepatology. 33Saito, Y., Kanai, Y., Sakamoto, M., Saito, H., Ishii, H., and Hirohashi, S. (2001) Hepatology 33, 561-568
. P W Laird, L Jackson-Grusby, A Fazeli, S L Dickinson, W E Jung, E Li, R A Weinberg, Jaenisch , R , Cell. 81Laird, P. W., Jackson-Grusby, L., Fazeli, A., Dickinson, S. L., Jung, W. E., Li, E., Weinberg, R. A., and Jaenisch, R. (1995) Cell 81, 197-205
. M R Rountree, K E Bachman, S B Baylin, Nat. Genet. 25Rountree, M. R., Bachman, K. E., and Baylin, S. B. (2000) Nat. Genet. 25, 269 -277
. J Guy, B Hendrich, M Holmes, J E Martin, A Bird, Nat. Genet. 27Guy, J., Hendrich, B., Holmes, M., Martin, J. E., and Bird, A. (2001) Nat. Genet. 27, 322-326
. B Hendrich, J Guy, B Ramsahoye, V A Wilson, A Bird, Genes Dev. 15Hendrich, B., Guy, J., Ramsahoye, B., Wilson, V. A., and Bird, A. (2001) Genes Dev. 15, 710 -723
|
Background
DNA methylation is an important mechanism for epigenetic regulation of genes in both mouse and human [1]. It occurs mainly at the CpG dinucleotide, and methylation at this symmetrical site is efficiently maintained during replication by the action of the DNA methyltransferase 1 (DNMT1) enzyme [2]. Methylation is known to play an important role in regulating imprinted loci [3], genes on the inactive X chromosome [4] and germline-specific genes [5] in mouse.
Where methylation occurs at the promoter of a gene, it is strongly associated with the silencing of transcription, particularly if there is a high density of CpGs, a so-called CpG island (CGI). However, studies have shown that most CGI are intrinsically protected from methylation [6,7] and only a small number shows dynamic changes during development, mostly in the three classes mentioned above [5,8], though there may be others which have not yet been clearly defined. As you move outward from an island, the shores and shelves show higher levels of methylation and greater dynamic response [9], though here the link to changes in gene activity is less clear [10]. Methylation is also associated with larger regions of inert chromatin, such as the inactive X, pericentromeric repeats and regions rich in transposable elements [1], generally consistent with a repressive role. Recent genome-wide surveys have also indicated that high levels of methylation are found in the bodies of active genes, where they may facilitate transcription [11,12]. In keeping with this, we and others recently showed that artificially decreasing intragenic methylation levels reduced steady-state transcript levels, consistent with a positive role for methylation in the gene body [11][12][13].
Another major system for epigenetic repression is via histone modification, particularly by the polycomb group of proteins, with EZH2 being one of the main enzymes involved [14]. A number of studies suggest an interplay between polycomb-and DNMT-mediated repression, with a generally negative correlation between DNA methylation and the H3K27me3 mark deposited by EZH2 [15,16]. Supporting this, a loss of DNA methylation caused a reshaping of the histone landscape and derepression of some polycomb targets in mouse ES cells [17], suggesting that DNA methylation helps to determine where polycomb marks are deposited.
While DNMT1 is the main maintenance methyltransferase, there also appears to be an important role for the de novo enzymes DNMT3A and DNMT3B in complementing that activity at some loci [18,19]. In order to clarify which genes are most sensitive to DNMT1 loss in human, a number of studies have been carried out using mutations within the gene to assess the effects of loss of methylation [19][20][21][22]. While this has been a fruitful approach in mouse embryonic stem (ES) cells, where null mutants are tolerated, differentiation of the mouse cells leads to cell death [20,22,23], whereas DNMT1 disruption in human ES cells is not tolerated even in undifferentiated cells [24]. Genetic ablation in adult differentiated cells also leads to cell death within a few cell cycles, before passive demethylation of the genome can occur [23,25]. One of the best-studied systems in humans consists of HCT116 colon cancer cells carrying a hypomorphic allele in the DNMT1 gene together with a DNMT3B knockout (HCT116 DKO cells) [26][27][28]. Blattler et al. [29] found that there was widespread and relatively uniform demethylation across the genome in the DKO cells, with small effects at CGI (most of which are normally unmethylated anyway) and relatively few genes showing derepression. There was no enrichment by gene ontology (GO) analysis, but some effect at enhancers: however, this is complicated by the presence of the DNMT3B knockout alleles. Acute depletion of DNMT1 using an siRNA-mediated approach in embryonal carcinoma cells also found regions of low CpG density (open sea, shelf ) to be the most affected by loss of methylation [70]. Among the small number of dysregulated genes, there was some enrichment for cell morphogenesis and phosphorylation pathways.
Neither of these cancer cell lines, however, are a good model for the normal differentiated cell as they are transformed, aneuploid, hypermethylated, and contain a number of different mutations in key regulatory genes. Additionally, acute depletion of DNMT1 results in cell cycle delay, triggering of the DNA damage response and increased rates of cell death [24,25,30], making it difficult to separate acute and chronic effects.
To circumvent some of the difficulties outlined above, we generated a series of isogenic human cell lines derived from the hTERT-immortalised normal fibroblast line hTERT1604 as previously described [30]. These are normosomic and non-transformed, and by using a stably incorporated plasmid with an shRNA targeting DNMT1 we were able to isolate a number of clonally derived lines to allow identification of any cell line-specific effects. While these showed initially the range of shared features indicative of a global response to the loss of this critical regulator, including cell cycle delay, demethylation of imprinted genes and others, they could be cultured for longer under selection [30], allowing identification of loci with particular sensitivity for decreased maintenance methyltransferase activity. Here we set out to completely characterise the methylation changes seen in the cell lines using the Illumina Infinium HumanMeth-ylation450 BeadChip (450k) array platform [31] and subsequent analysis using the RnBeads pipeline [32]. These approaches were chosen due to their high reproducibility and low inter-operator variability, ensuring the reliable and sensitive detection of alterations in methylation. A sample of the observations was then further verified using locus-specific assays. In addition and for the same reasons, we used the HT-12 Expression v4 BeadChip array, to assay changes in transcription in our cell lines.
Methods
Cell culture
The parental or wild-type (WT) adherent hTERT1604 lung fibroblast cell line [33] was cultured in 4.5 g/l glucose DMEM (Thermofisher, Loughborough, UK) supplemented with 10% FBS and 2× NEAA (Gibco/ Thermofisher). Generation of the hTERT1604 cell lines stably depleted of DNMT1 using a pSilencer construct (Thermofisher) has been previously described [30]. Knockdown (KD) cells were maintained as for WT, but medium was supplemented with 150 μg/ml hygromycin B (Invitrogen/Thermofisher, Paisley, UK), which was removed at least 48 h before any experimental procedure. Treatment of cells with siRNA for 24 h was as previously described [34]: for the pulse-chase experiment cells were afterwards allowed to recover in normal media and passaged as required for up to 36 days. The siRNA (Dharmacon ON-TARGETplus SMARTpool) for DNMT1 and DNMT3B, as well as scrambled control, was obtained from Invitrogen/Thermofisher. HCT116 and double knockout (DKO) cells [27] were cultured in 1 g/l glucose DMEM (Gibco) supplemented with 10% FBS and 1× NEAA (Gibco). DZNeP (Sigma-Aldrich, Dorset, UK) was used at a final concentration of 1 μM.
DNA extraction and bisulphite conversion
Genomic DNA was harvested from cells in log phase of growth. Samples were incubated overnight at 55 °C in lysis buffer [50 mM Tris pH 8, 0.1 M EDTA (both Sigma-Aldrich), 0.5% SDS, 0.2 mg/ml proteinase K (Roche, West Sussex, UK)], with rotation, and DNA was subsequently isolated using the standard phenol/chloroform/ isoamyl alcohol (25:24:1 pH8, Sigma-Aldrich) extraction method. DNA quality was verified using gel electrophoresis and UV absorbance measurements at 260/280 and 260/230 nm using a Nanodrop UV spectrophotometer (Labtech International, Ringmer, UK). Bisulphite conversion of 500 ng of DNA was carried out using the EpiTect bisulphite kit (Qiagen, Crawley, UK) according to the manufacturer's instructions.
Hybridisation to 450K array and bioinformatic analyses
Three samples from each cell line were used to prepare DNA, with at least one biological repeat in each set. DNA was assessed for purity and integrity as above prior to quantification using the Quant-iT PicoGreen dsDNA assay kit (Thermo Fisher Scientific) as per manufacturer's instructions. In total, 500 ng of high-quality bisulphite-converted (Zymo Research) DNA was checked for purity and fragmentation on a bioanalyser and then loaded on the Infinium HumanMethylation450 BeadChip [31] and imaged using an Illumina iScan (Cambridge Genomic Services). Output files in IDAT format were processed using the RnBeads [32] methylation analysis package (v1.0.0) which carries out all the analysis from import to differential methylation within the R platform (3.2.0). Briefly, quality control used the built-in probes on the array and included filtering out of probes containing SNPs, and checking for hybridisation performance. Normalisation was then carried out using the SWAN method in minfi [35] after background subtraction with methylumi.noob. The exploratory analysis module was used to generate probe density distributions and scatter graphs. The differential methylation analyses was based on a combined ranking score, which combined absolute effect size, relative effect sizes and p-values from statistical modelling into one score where rank is computed as the most conservative value among mean difference in means, mean in quotients and combined p value across sites in the region: the enrichment analysis used the combined rank among the 1000 best-ranking regions and a hypergeometric test to identify GO terms in the AmiGO 2 database [36]. Pairwise comparison of triplicate samples from each cell line against WT hTERT was also made to determine change in beta value and associated combined p-value, adjusted for multiple comparison using false discovery rate (FDR). Some tailored analyses were also carried out using custom scripts in R. Additional GO studies were performed using DAVID (v6.7) [37].
We used the GALAXY platform [38] to map sites showing highly reproducible changes (FDR < 0.05) against the locations of RefSeq genes or ChromHMM regions on the UCSC genome browser [39] for each cell line. GO category genes which showed changes in methylation at multiple sites in more than one KD cell line were scored as true hits (Yes in the FDR column), while GO categories with few or no sites reproducibly altered across replicates (FDR > 0.05) or where methylation changes were small (< 0.1 β), inconsistent in direction, or not found in more than one KD cell line, were scored as false positives. Absolute β levels were used to measure median methylation across genes of interest using custom workflows in GALAXY, with further statistical analyses in Statistical Package for the Social Sciences software (SPSS) version 22.0 (SPSS UK Ltd).
Locus-specific methylation analysis
Amplification was carried out using the PyroMark PCR kit (Qiagen) with 2 μl bisulphite-converted DNA, 12.5 μl MasterMix, 2.5 μl CoralLoad Concentrate, 1.25 μl each primer (10 μM) and 5.5 μl nuclease-free H 2 o using the following conditions: 15 min at 95 °C followed by 45 cycles of 94 °C for 30 s, 56 °C for 30 s, 72 °C for 30 s and a final elongation step of 72 °C for 10 min. Pyrosequencing was carried out on the PyroMark Q24 System, according to the manufacturer's instructions (Qiagen). Most assays were designed in-house using the PyroMark Assay Design software 2.0 (LEP, MAGEA12, OR10J5, OR51E2, OR2AG1, PCDHA2, PCDHC4, UGT1A1, UGT1A4) prior to synthesis (Metabion, Germany): see Additional file 1: Table S1 for details: DAZL, SYCP3, D4Z4 and NBL2 were as described [34,40]. In some cases, pre-designed pyrosequencing primers were obtained from Qiagen (GABRQ PM00133483, GHSR PM00014350, SNRPN PM00168252). Clonal analysis was carried out as previously described [30].
Hybridisation to HT-12 microarray and bioinformatic analyses
Total RNA was extracted using the RNeasy minikit (Qiagen) as per manufacturer's instructions, including a DNase step. RNA integrity was verified via gel electrophoresis, and quality and quantity were verified using a SpectroStar (BMG Labtech, Aylesbury, UK) and a bioanalyser (Agilent Technologies, Cheadle, UK). Two hundred nanograms of total RNA underwent linear amplification using the Illumina TotalPrep RNA Amplification Kit (Life Technologies/Thermofisher, Paisley, UK) following the manufacturer's instructions. Microarray experiments were performed at Cambridge Genomic Services, University of Cambridge, using the HumanHT-12 v4 Expression BeadChip (Illumina, Chesterford, UK). After scanning the data were loaded in GenomeStudio (Illumina) and then processed in R (version 3.2.2). The data were filtered to remove any non-expressed probes using the detection p-value from Illumina, transformed using the variance stabilization transformation (VST) from lumi and normalised using the quantile method. Comparisons were made using the limma package with results corrected for multiple testing using false discovery rate (FDR) testing.
RNA and protein analysis
Transcriptional assays at individual loci using RT-and RT-qPCR were carried out essentially as in [34]: primer sequences are listed in Additional file 1: Table S1. Protein was extracted from cells growing in log phase using protein extraction buffer (50 mM Tris-HCl, 150 mM NaCl, 1% Triton-X, 10% glycerol, 5 mM EDTA; all Sigma-Aldrich) and 0.5 µl protease inhibitor mix (Sigma-Aldrich). For Western blotting, 30 μg protein was denatured in the presence of 5 μl 4× LDS sample buffer (Invitrogen) and 2 μl 10× reducing agent (Invitrogen) in a total volume of 20 μl nuclease-free water (Qiagen) via incubation at 70 °C. Proteins were separated by SDS-PAGE and then electroblotted onto a nitrocellulose membrane (Invitrogen) and blocked in 5% non-fat milk for 1 h at room temperature (RT). Membranes were incubated with anti-DNMT1 (a kind gift from Guoliang Xu) and anti-β-actin (Abcam ab8226) overnight at 4 °C, followed by HRP-conjugated secondary antibody incubation at RT using ECL (Invitrogen).
Statistical analysis
Statistical analysis was performed by the RnBeads package, or separately in Excel (Microsoft Office Professional Plus 2013), Prism (Graphpad) or SPSS (v22.0). Experiments were carried out in triplicate and included at least one biological replicate. PCR results were analysed using Student's paired t-test. Pyrosequencing results were analysed by ANOVA within representative runs and using Student's t-test on the average of multiple runs. Error bars on all graphs show standard error of the mean (SEM) or in the case of HT12 array data, 95% confidence interval (CI), unless otherwise stated. Asterisks are used to represent probability scores as follows: *p < 0.05; **p < 0.01; ***p < 0.005 or n.s. not significant.
Results
Generation of isogenic hTERT1604 fibroblast cell lines
Isogenic lines carrying an shRNA construct targeting DNMT1 were generated by transfecting the hTERTimmortalised human lung fibroblast cell line hTERT-1604 with pSilencer plasmid containing an shRNA (Fig. 1a). The generation and initial characterisation of these isogenic cell lines have been previously described [30]. Here we took two sublines typical of the intermediate levels of knockdown (KD) seen (d8 and d10) as well as one line (d16) with relatively low levels of mRNA, with good agreement between reverse transcription quantitative PCR (qPCR) and array results ( Fig. 1b; all p < 0.05 except d8 array). We also confirmed knockdown at the protein level using Western blotting, with HCT116 cells mutated in DNMT1 and DNMT3B [27] as controls (Additional file 3: Fig. S2A).
(See figure on next page.) Fig. 1 Cell line generation and overall changes seen in methylation levels. a Experimental approach: WT hTERT1604 fibroblasts were transfected with shRNA-containing plasmid and grown in selective medium; colonies of resistant cells were expanded, and three (d8, d10, d16) showing reduced DNMT1 levels were then analysed using genome-wide methylation and transcription arrays on the Illumina platform. b Levels of DNMT1 mRNA in cell lines from array and qPCR: error bars represent 95% confidence intervals around median, and standard error of the mean (SEM), respectively. All three knockdown (KD) lines were significantly depleted at p < 0.05 for both assays (except d8 array). c Overall methylation levels in WT and KD cells as measured by 450K: a β value of 1 equates to 100% methylation. Median values are indicated by the line, and whiskers represent interquartile range. The positions of the medians are also indicated at right (arrowheads). d The difference in median β value between each KD cell line and WT is shown first for all sites assayed (see c above) and then for each type of genomic element. CGI, CpG island; shore, region adjacent to CGI; shelf, adjacent to shore; sea, all other. See also Additional file 3: Fig. S2B. e Probe density distributions; in KD there is a decrease in the number of fully methylated sites (β closer to 1) and an increase in the number of unmethylated sites (β closer to 0), as well as in probes showing intermediate levels of methylation (arrow). f Numbers of sites (×10 4 ) showing significant changes in methylation (FDR < 0.05) compared to WT: the set of common sites is largest in each case, with close to twice as many sites commonly losing methylation in comparison with those gaining
Characterisation of overall changes in absolute methylation levels in depleted lines
Using the 450K array [31] and processing in RnBeads [32] to assess methylation levels across the genome (Fig. 1c), there was still a wide range of methylation values (given for the array as a value β ranging from 0 to 1) in KD lines as compared to WT, but the median values were decreased as expected in all three with d8 being comparable to d10, while d16 was lower (arrowheads at right). Principle components analysis and examination of the sites showing greatest differences in methylation between the stable lines confirmed that d8 and d10 were most similar (Additional file 2: Fig. S1). Probes on the array were annotated by location relative to genomic features, and while all regions showed a decrease in methylation, the difference in median values was smallest for CGI, which were unmethylated anyway in parental cells (β < 0.1 in WT), while the separation in medians was greatest at shelves and shores, where methylation levels were higher (Additional file 3: Fig. S2B). This can most clearly be seen by plotting the difference in medians (Fig. 1d). Both WT and the KD cell lines showed the typical bimodal probe density distribution pattern reported in most cell types [31] (Fig. 1e). Overall, there was an increase in the numbers of less methylated probes (β < 0.25) in the KD cell lines and a decrease in the numbers of highly methylated probes (β > 0.65). For individual regions CGI again showed the smallest change, while gene bodies (genes) appeared most altered (Additional file 3: Fig. S2C).
To determine whether methylation was lost stochastically in each KD cell line given the variation seen (Additional file 2: Fig. S1), or was more targeted, we determined the degree to which affected sites were shared between the three cell lines (Fig. 1f ). The largest set of sites losing methylation (17.2 × 10 4 ) was that shared between all three KD lines, supporting a non-random loss. A spike in numbers of probes showing intermediate levels of methylation (β ~ 0.50) in KD cell lines in the density profile plot (Fig. 1e, arrow) had indicated that a possible gain in methylation might also be occurring at some sites. Analysis showed that a substantial number (9.1 × 10 4 ) of sites gaining methylation are shared between all three KD lines, indicating reproducible gains in methylation at particular CpGs.
Overall pattern of sites showing significant differential methylation on DNMT1 depletion
We compared WT cells to all three KD lines using the RnBeads package in R and combined rank scoring (see methods). This confirmed that d16 has the greatest number of demethylated sites using a false discovery rate (FDR) cut-off of p < 0.05, but at p < 0.001 all three lines have comparable numbers of hypo-and hypermethylated sites (Additional file 4: Fig. S3A), with more sites losing than gaining. An analysis of the 1000 best-ranking sites highlights sites common to all three KD lines (Additional file 4: Fig. S3B), confirming that there are large numbers of sites which respond in the same way in each KD, with an excess of probes showing loss over gain.
We then looked to see whether shared probes were enriched in any particular gene region. As we were interested in changes which might cause altered transcription, we focussed on CGI, promoters and gene bodies (hereafter genes) rather than shores, shelves or open sea, where correlations with transcriptional output are harder to assess. Using a hypergeometric test in RnBeads, both promoters and genes, but not CGI, showed significant enrichment in demethylated probes for particular gene ontology (GO) terms. Table 1 indicates the top 3 ontology classes under biological process (BP) and molecular function (MF). For loss of methylation, examining common genes and processes suggested that three classes of genes were common to the enriched GO terms, which we grouped as follows: (1) genes involved in neuroepithelial differentiation; (2) genes involved in fat homoeostasis/body mass (FBM); and (3) olfactory receptor genes (groups 1-3 in Table 1), all of which will be dealt with below. The only orphan GO term whose members had multiple high-confidence demethylated sites was GO:0007506 gonadal mesoderm formation, which largely consists of members of the TSPY gene family on the Y chromosome. For gain of methylation, the same was true in that a relatively small number of histone modifier genes (group 4), represented under several GO terms, were responsible for many of the hits. In addition, the GO terms for glucuronosyltransferase activity (GO:0015020) and for regulation of megakaryocyte differentiation were also represented ( Table 1). These were then curated by looking for sites showing reproducible changes (FDR < 0.05) in all KD lines (described more fully in "Methods" section), which indicated strong support [Yes (Y) in confirm column, Table 1] for all GO categories showing loss, but only in two showing gain (GO:0015020 and GO:0004984). We then set about verifying these targets.
Loss of methylation at the protocadherin gamma gene cluster particularly affects the A and B class variable genes
A main contributor to the enrichment of neuroepithelial genes are the protocadherin genes. Protocadherin α, β and γ (PCDHA, PCDHB and PCDHG) genes are located in three linked clusters on chromosome 5 and give rise to neural cell-cell adhesion proteins, with significant loss of methylation across the whole region in all three cell lines (Additional file 4: Fig. S3C). The α and γ proteins have a variable extra-cellular recognition domain, either A, B or C-type, attached to a constant transmembrane and intracellular domain. This is achieved at the gene level by alternative 5′ exons encoding the variable region being spliced to the constant region exons. Figure 2a shows the tracks containing sites with significant (FDR < 0.05) methylation differences between KD and WT cells for the PCDHG cluster. These reveal loss of methylation (in red in Fig. 2a) at most A and B class variable exons in all three KD cell lines, but not at the C class variable or the constant exons. Array probes were present in this region, and examination of the absolute rather than relative methylation (amber, top track in Fig. 2a) confirmed high levels of methylation in WT, where median β values were high for all variable exons (Fig. 2b). Methylation decreased in all three KD lines, with d10 showing the least effect ( Fig. 2b). Methylation was substantially altered at all A and B class variable exons, but not at the C class (Fig. 2c). We could experimentally verify the loss of methylation at A2 (Fig. 2d), and no change at C4 (Fig. 2e), using pyrosequencing assays (pyroassay). Some demethylation of other neuroepithelial genes in this GO category was also seen from the array, such as S100P, ROBO1 and PAX6, with significant (p < 0.05) demethylation of S100P in two-thirds of KD cell lines confirmed by pyrosequencing (not shown).
Loss of methylation at other targets including fat homoeostasis/body mass (FBM) genes
Another class of genes showing enrichment all appear to be involved in some aspect of triglyceride processing, (Fig. 3a).
Most individual genes also showed substantial loss, with the exception of the ANXA genes (Fig. 3b). Loss of methylation at the LEP and GHSR promoters was confirmed using pyroassay (Fig. 3c).
Olfactory receptor (OR) genes appeared in a number of GO categories as having lost methylation, though some gains in the gene body were also indicated ( Table 1). ORs encode G protein-coupled receptor proteins and are members of a large gene family, many of which are grouped into major clusters, particularly on chromosome 11 [41]. To buffer against stochastic effects due to the large gene family involved, we carried out a second analysis starting instead with sites in promoters showing reliable methylation loss compared to WT (FDR < 0.05) in the triplicates of each KD line and then overlapping these (Fig. 3d) to see which sites were common to all three KD cell lines (Additional file 5: Table S2). Ontology analysis of these common sites using DAVID independently highlighted signalling receptor genes and more particularly olfactory receptors (n = 21). This group of OR genes also showed significant demethylation compared to WT (Kruskal-Wallis, p < 0.05) across the genes when median methylation at all available probes was analysed (Additional file 4: Fig. S3D). We chose three of these genes-OR10J5, OR51E2 and OR2AG1-located on different chromosomes and could verify loss of methylation in all KD lines (Fig. 3e).
The final GO category of genes (GOFMID:0007506) showing loss of methylation ( Table 1) consists largely of the TSPY gene family (TSPY1-4, 8 and 10) located on the Y chromosome and thought to be implicated in both normal gonadal development and in gonadoblastoma [42]. These also showed clear evidence of demethylation (Fig. 3f ).
Gains in methylation affect the UGT1A locus
As indicated above, with respect to gains in methylation only two of the GO classes identified in the genome-wide screen (Table 1) contained multiple sites showing significant gains in methylation (FDR < 0.05, > 0.1 gain in β). One of these was the olfactory genes, discussed above: the other GO term GO:0015020 was largely comprised of members of the UGT1A family. This gene family has a similar structure to the PCDHG cluster, where unique alternate 5′ exons splice to common 3′ exons, but in this case codes for a series of nine UDP-glucuronosyltransferase enzymes (UGTs). Substantial gains in methylation can be seen at the upstream promoters controlling the 5′ exons (Fig. 4a), most of which lack CGI. Median methylation levels also showed clear increases overall in the KD lines (Fig. 4b), though these did not reach significance. Most individual exons also showed a sharp increase (Fig. 4c), with A1 being a clear exception in all lines. We confirmed a significant gain in methylation in each cell line at A4 (Fig. 4d) but no alteration at A1 (Fig. 4e). In contrast to the clear gains in Fig. 3 Loss of methylation at fat homoeostasis/body mass (FBM) genes, olfactory receptors and the TSPY genes. a Median β values for all FBM genes (following curation) in WT and KD cell lines; significant differences (Mann-Whitney U) are indicated. b Median methylation values at each FBM gene in WT and d16 cells. c Average methylation levels obtained from pyroassays at the Leptin (LEP) and Ghrelin/growth factor receptor secretagogue (GSHR) promoters. d CpG located in promoters which showed highly reproducible loss of methylation (FDR < 0.05) were identified. The set of sites common to all three KD cell lines (n = 1185) was found to be enriched for olfactory receptors (such as the three indicated) using the DAVID tool. e Pyroassays designed for the three olfactory receptor genes from (d) confirmed methylation was consistently reduced across all KD cell lines. f Browser view showing loss of methylation (red) at the CGI-containing promoters for members of the TSPY family on the Y chromosome all three lines for UGT1A, the histone modifier group also identified as gaining methylation (Table 1, group 4) contained few FDR-supported sites and these often did not overlap between cell lines, with median β levels also not differing significantly (Additional file 4: Fig. S3E).
A cluster of loci showing gain of methylation on the X chromosome
Given that there were considerable numbers of probes showing gain in methylation, but few of the GO classes from the RnBeads analysis contained testable targets by our criteria, we tried an alternative analysis as for the OR above. Sites associated with promoters and which showed reliable (FDR < 0.05) gains were identified in each KD line, and then the lists of cognate genes were compared to find those which were common to all three cell lines (Fig. 5a). Examination of the 201 promoters from this analysis (Additional file 5: Table S2) failed to show any significantly enriched terms in DAVID. However, several of the genes showing the greatest gain in methylation were located on the X chromosome, including GABRQ and members of the MAGE family of cancer/testis antigens such as MAGEA12. Mapping of FDR sites to the X chromosome showed that adjacent domains could vary in methylation level by more than 80% in either direction (Fig. 5b). Pyroassays for GABRQ and the neighbouring MAGEA12 gene confirmed significant gains in methylation at the GABRQ promoter and in the MAGEA12 gene body (Fig. 5c). Clonal analysis for GABRQ indicated a uniform increase in methylation (78 vs. 16%) across all adjacent CpG at this locus (Fig. 5d). Both direction and degree of change in methylation were highly correlated between pyrosequencing and the 450K array across all sites which were covered by both types of assay (r = 0.916 for loss of methylation r = 0.818 for gain in methylation).
Transcriptional changes are enriched at cancer/testis antigen genes on X and Y
To see whether methylation changes were accompanied by large-scale changes in transcription, we carried out a genome-wide screen using the HT12 array which assays most RefSeq genes. Figure 7a shows the distribution of changes comparing d8 and WT: genes which showed > 2 fold change (FC) and with scores of p < 0.05 are highlighted, with the greater spread to the right indicating a greater tendency to derepression. Relatively small numbers of genes were affected (Fig. 6b), particularly at higher stringency (FDR < 0.01), and d16 showed fewest dysregulated genes. To determine common targets, we looked for shared genes (Fig. 6c). DAVID analysis on the genes common to all three (n = 70; Additional file 6: Table S3) indicated significant enrichment for genes coding for MAGE domains (Fig. 6d). MAGE genes on the X chromosome were previously identified as showing large changes in methylation (Fig. 5): also appearing here was a TSPY family member (Table 1, Fig. 3f ). Upregulation of members of these gene classes could be verified by RT-PCR (Fig. 6e) and showed similar direction of change to the array, and greater magnitude, by RT-qPCR (Fig. 6f ). Consistent with the transcriptional upregulation, median methylation levels at the promoters of these genes were lower than WT (Fig. 6g). Interestingly, there was an overall increase in intragenic (as opposed to promoter) methylation in the larger group of transcriptionally dysregulated genes common to d8 and d10 (n = 764, see Fig. 6h and Additional file 6: Table S3), which may 6 Transcriptional dysregulation of genes on the X and Y chromosomes correlates with methylation changes. a Volcano plot showing log fold change (FC) in transcription as measured by HT12 array versus FDR-corrected significance values: genes with > 2FC and FDR < 0.05 are highlighted in red. b Numbers of dysregulated genes at different FDR thresholds for the different KD lines. c Genes common to more than one KD line at FDR < 0.05; total numbers in each cell line are indicated in brackets. d Ontology enrichment output from DAVID for the genes common to all KD lines. e RT-PCR analysis of the three MAGE genes on X and a member of the TSPY gene family on Y highlighted in DAVID analysis (C). ACTB is a loading control; −ve, negative control lacking cDNA. A 100-bp ladder is shown at left with the 200-bp band indicated by an arrowhead. f Transcription levels of indicated MAGE genes from the HT12 array or by qPCR. Error bars are 95% CI for the array, SEM for qPCR; fold change was significant (p < 0.05) in all cases. g Median β values on 450K array for probes at MAGE promoters were decreased, though failed to reach significance. h Gene body methylation was increased in transcriptionally upregulated genes reflect increasing gene body methylation accompanying transcription.
Regions hypomethylated in shRNA lines correlate with polycomb repression
To investigate why losses in methylation occurred at the same positions in all KD lines, we used ENCODE data to look at chromosomal distribution, replication timing and chromatin features which might be important, since the DNMTs have no DNA sequence specificity themselves. Of these, the chromatin marks were most informative, in particular the ChromHMM dataset on lung fibroblasts which partitioned the genome into different types of chromatin based on a set of distinguishing histone marks and other features [43]. This indicated that probes significantly losing methylation in our shRNA lines are most densely distributed across regions which are normally polycomb-repressed or are heterochromatic/lowsignal regions in lung fibroblasts (Fig. 7a). Specifically, many regions show a striking correlation between polycomb marking and methylation loss, such as the LEP and neighbouring PRRT4 genes (Fig. 7b): in contrast, the intervening MGC27345 and RBM28 genes at that locus, which are highly methylated in WT cells (top track), show little or no loss of methylation and have chromatin marks associated with transcription.
These data suggested that polycomb-repressed regions might be more susceptible to demethylation than others. To test whether these regions lost methylation more readily than others, we treated hTERT1604 with siRNA for 72 h, which led to acute depletion of the DNMT1 mRNA (Fig. 7c). We found, however, that there was little difference between polycomb-repressed and other regions in terms of demethylation in the siRNA-treated lines (Fig. 7d), in contrast to the shRNA lines where losses were concentrated at the former (Fig. 7d). This could also be seen at the LEP locus, where MGC27345 and RBM28 now showed loss of methylation following siRNA treatment (Fig. 7b, siRNA track). Also of note, almost no probes showed gains in methylation relative to WT in the siRNA cells (Fig. 7e), indicating that this effect is associated exclusively with chronic treatment. These results suggested that gains of methylation had occurred only in shRNA lines and had effectively restored methylation to near WT levels at most regions outside of those marked as polycomb-repressed.
Since transcriptional analysis did not highlight dysregulation of polycomb regions in shRNA cells (Fig. 6d), we tested to see whether polycomb-mediated repression was being maintained there in the absence of DNA methylation. To do this, we treated with DZNep, an inhibitor of EZH2, and confirmed the upregulation of a positive control gene SLCA4 (Fig. 7f ) as previously reported [44]. Likewise, HOXC13-a known polycomb target-showed derepression (Fig. 7f ). The FBM genes marked by polycomb including LEP showed reactivation to a comparable degree to SLCA4, whereas the MAGEA12 gene which is in a heterochromatic region not marked by polycomb showed little effect (Fig. 7f ).
To further investigate the difference between acute and chronic DNMT1 depletion in these cells, we first examined the effects of acute depletion by siRNA on the loci identified in the stable lines: this confirmed that loci such as the clustered protocadherins and the fat/body mass genes also lose methylation on short-term depletion by siRNA (Fig. 7g). Following treatment, cells were then allowed to recover in the absence of siRNA for an extended period (36 days). DNMT1 levels returned to normal rapidly (Fig. 7h). Examination of the methylation response at various gene classes was very instructive. Germline genes (SYCP3, DAZL), which are known to become de novo methylated to high levels during somatic differentiation [5,34], showed initial loss versus a scrambled control (Scr), followed by remethylation over time to near WT levels (Fig. 7i), confirming that the hTERT cells possess sufficient de novo activity to remethylate (See figure on previous page.) Fig. 7 Methylation loss is concentrated at regions normally repressed by polycomb. a Distribution of probes showing significant loss per chromatin state-numbers of probes are shown at left, chromatin states below: tcn, transcription; heterochrom/Lo, heterochromatin or low signal; repetitive, repeat DNA. b Region around the LEP gene: tracks as before, with the addition of data from cells treated with siRNA for 72 h (top). A track showing ChromHMM chromatin states from NHLF foetal lung fibroblasts is shown at bottom: grey, polycomb-repressed; green, transcriptionally active (full colour key at top right). c DNMT1 mRNA levels by qPCR following treatment with siRNA (+) for 72 h compared with scrambled control (Scr). ACTB is shown as a control; ladder as above. d Median β values for all regions (WT) compared to medians for polycomb-repressed regions (Polycomb), or all other regions (Other) in the cell lines indicated at top; remeth, remethylated. e Numbers of probes showing loss and gain in methylation in hTERT cells following treatment with siRNA for 72 h compared with the shRNA lines (averaged); #, number. f mRNA levels for the indicated genes in shRNA lines treated with the EzH2 inhibitor DZNeP; UNT, untreated; bars represent SEM, experiment carried out in duplicate. g Median β values for all variable exons at the PCDHG locus (left) and for fat/body mass genes (FBM, right): compare d16 shRNA lines with cells treated with siRNA. h DNMT1 mRNA levels in WT cells exposed to siRNA for 48 h, then allowed to recover in normal medium; comparisons were made to a scrambled siRNA negative control (Scr). i Methylation levels by pyroassay at the loci indicated during the transient KD and recovery shown in (h); timepoints are in days. All loci showed significant loss of methylation: LEP and SNRPN showed no significant gain versus lowest methylation level, while PCDHGA2 showed no significant gain between d22 and d36 the genome, as already suggested (Fig. 7b-e). Imprinted genes are normally unable to regain methylation somatically [45], and we could confirm that the SNRPN imprint control region failed to remethylate (Fig. 7i). The polycomb-marked genes LEP and PCDHGA2 were also refractory to de novo methylation, either showing no gain (LEP) or reaching a plateau at an intermediate level of recovery only (PCDHGA2) (Fig. 7i).
Gain in methylation is associated with poised promoters in shRNA lines
Having established that loss of methylation in shRNA lines is linked to polycomb repression, we wished to determine what features are associated with gains in methylation in these chronically depleted cell lines. As indicated, gains were not seen genome-wide following acute depletion using siRNA (Fig. 7e) and specific loci such as UGT1A showed instead loss of methylation on acute treatment (Fig. 8a, siRNA track), suggesting that hypermethylation is associated with longer-term culture of the shRNA-containing cell lines. To investigate what features might be associated with such loci, we looked to see which chromatin states in shRNA lines showed the highest median β for probes which gained methylation and the largest difference in methylation (Fig. 8b). This identified weak and poised promoter categories, and comparing shRNA lines to WT (Fig. 8c), the median values were more different for poised than for weak promoters (0.4 vs. 0.2, Cohen's D test). These results suggested that poised promoters attract de novo methylation particularly strongly. Consistent with this, hypermethylation in the shRNA lines is centred around the UGT1A promoters and not the common 3′ exons (Fig. 8a). A heterochromatic location may contribute to over-methylation, since genes in adjacent active chromatin show restoration of normal methylation (Fig. 8a, compare siRNA to d10, d16 for DGKD), but not hypermethylation. While UGT1A transcription levels were very low compared to expressing cells by RT-qPCR (not shown), available HT12 array data showed a consistent decrease in transcription in all three shRNA lines (Fig. 8d, left), correlated with gains in methylation at the cognate promoters (Fig. 8d, right).
Further analysis confirmed that while gains in methylation were seen across all the UGT1A exons in all shRNA lines (Fig. 8e), all of these exons showed a loss of methylation following acute depletion with siRNA. We took advantage of our transient depletion and recovery experiment (Fig. 7h, i) to examine levels of methylation at UGT1A4 using pyrosequencing: this showed that while the region indeed loses methylation on acute depletion, it undergoes steady de novo methylation following recovery and at day 36 was the only gene examined whose methylation exceeded that seen in the scrambled control (32.4 vs. 31.3%), suggesting that these genes are indeed susceptible to hypermethylation.
One possible reason for the gains in methylation seen in the shRNA lines could be over-expression of a de novo enzyme. Previous reports have indicated that between them, DNMT3B and DNMT1 account for the majority of methylation in cultured adult human cells and that there may be a role for DNMT3B in maintenance as well as de novo methylation [27]. We saw little change in DNMT3B levels in the DNMT1 KD lines from the HT12 transcriptional array (Additional file 7: Fig. S4A) or RT-PCR (not shown), indicating that gains in methylation are not due to DNMT3B over-expression. To investigate a possible role in maintenance methylation, we carried out a transient siRNA treatment and could achieve robust knockdown of DNMT3B in the cells (Additional file 7: Fig. S4B). While some germline genes showed little effect, loci previously shown to require DNMT3B including D4Z4 and NBL2 did show loss of methylation (Additional file 7: Fig. S4C), confirming that we had achieved a functional depletion. Examination of the loci identified in our DNMT1 shRNA clones showed that these loci also showed loss of methylation in DNMT3B KD cells (Additional file 7: Fig. S4C), suggesting that loci which remain hypomethylated in the shRNA clones also require input from DNMT3B to retain WT methylation levels.
Discussion
Summary and model
We and others have previously shown that acute depletion of DNMT1 using siRNA triggered the DNA damage response and cell cycle perturbations in human cell lines, making it difficult to identify genes which are directly controlled by methylation. Here we used isogenic shRNA-containing derivatives of a normosomic lung fibroblast cell line to look at the effects of chronic depletion of the protein. We characterised the alterations in methylation and transcription using microarrays in three different cell lines, processing them using a highly reproducible pipeline, and verified changes using locus-specific pyrosequencing or RT-qPCR assays. Additionally, we compared the effects on methylation of this chronic depletion to the effects of acute depletion using siRNA, as well as investigating possible contributions by DNMT3B. Finally, we investigated the correlations between chromatin state and DNA methylation and showed a role for polycomb-mediated repression at some of the loci.
Our results show that while both siRNA and shRNAtreated cells lose methylation overall as would be expected, only the latter show gains in methylation, most likely reflecting selection against the deleterious effects of hypomethylation during clonal expansion and culture. Figure 8e shows what we propose to have occurred: shRNA treatment gave initial widespread demethylation in all three clonal lines, since each line shows the presence of some highly demethylated sites distributed across the genome, but methylation seems to have recovered at most CpGs ( Fig. 8e red line). Comparison to normal chromatin patterns in human lung fibroblasts indicated that remaining hypomethylation in the expanded cells was concentrated at regions normally marked for repression by polycomb (Fig. 8e purple line), while the smaller number of regions becoming hypermethylated relative to the parental cell line are associated with poised promoters (green line). TET expression was not detected, and the cells had little or no 5-hydroxymethylation (5hmC; data not shown), in keeping with other reports [46], suggesting that the hypermethylation does not represent 5hmC. Likewise, no over-expression of DNMT3B was detected.
In terms of what type of gene was particularly affected by chronic DNMT1 KD, the enrichment analyses and laboratory verification consistently pointed at the same small group of gene categories, namely (1)neuroepithelial genes, and in particular the protocadherins; (2) fat homoeostasis/body mass genes; (3) olfactory receptors; (4) the cancer/testis antigens; and (5) the UGT1A complex.
Protocadherins are major targets of DNA methylation in human cells
Emerging evidence suggests that the clustered protocadherin genes may be central to specifying individual neural cell identity [47,48] and they have been shown to become heavily methylated during embryonic development in mouse [49], suggesting that stable repression of non-transcribing copies is a programmed event during development. Recent work has shown that DNMT3B is important for de novo methylation at these loci and suggested that dysregulated expression may contribute to the phenotype in immunodeficiency, chromosome abnormalities and facial anomalies (ICF) syndrome [50], where DNMT3B is frequently mutated [51], and we found that depletion of DNMT3B was accompanied by loss of methylation at PCDHGA2. The PCDHA and PCDHB loci are heterochromatic and show persistent loss of methylation, as does the 5′ end of the PCDHG locus which is polycomb-repressed, but not the 3′ end which shows little loss of methylation and has instead chromatin marks associated with weak transcription (Additional file 3: Fig. S2B). Meehan and co-workers recently showed that longterm loss of DNA methylation in mouse Dnmt1 −/− ES cells led to spreading of polycomb marks (in particular H3K27me3): their analyses singled out the Pcdh genes, which were heavily methylated in WT but not mutant ESC, as also shown by others [52]. Reddington et al. [17] also showed an increase in H3K27me3. A similar sequence of events in our human cells would cause an increase in H3K27me3 on PCDH genes and potentially help block remethylation. The sensitivity of the protocadherin cluster to methylation changes may explain why these genes are frequently identified in screens for differentially methylated loci in cancer [53]. The lack of derepression in our stable fibroblast cells is unsurprising here since expression of these genes is restricted to neurons [54]: they are also, with the exception of part of the PCDHG complex, heterochromatic rather than polycomb-repressed and may as such be harder to reactivate.
Fat/body mass genes can be repressed by DNA methylation and polycomb
Currently, there is much interest in the possibility that altered diet, folate status or exposure to environmental toxins may lead to stable changes in the human methylome which particularly affect metabolic processes, as this offers an attractive mechanism by which it may be possible to partly explain the foetal origins of adult disease [55,56]. Enrichment analysis in our cells identified the FBM genes involved in the common processes of lipid storage and body mass homoeostasis, including LEP, GHSR and the APOC cluster. These loci are readily demethylated on acute DNMT1 depletion and remain demethylated in chronically depleted cells where many other loci have (See figure on previous page.) Fig. 8 Methylation gain is concentrated at poised promoters. a UGT1A locus showing siRNA treatment data (top), shRNA lines (middle) and chromatin states (bottom); grey, heterochromatin/low signal; green, transcriptionally active (for full key see previous fig). b Median β levels for probes gaining and losing in shRNA lines (bottom) and median changes in methylation (∆β) versus WT for different chromatin states. c Boxplots of methylation values for probes falling within weak and poised promoter chromatin regions in WT or shRNA lines (averaged). d Transcription at the UGT1A3 and UGT1A6 genes decreases (relative to WT, set to 1) in all three shRNA lines as methylation (β value) increases, as indicated by HT12 and 450K arrays, respectively. e Median methylation (β) across all UGT1A exons decreases in siRNA-treated cells, but shows gains in all shRNA lines. f Methylation at UGT1A2 during the transient KD and recovery experiment shown in Fig. 7h, i; differences are significant between control (Scr) and d4, but not Scr versus d36. g Model for methylation changes which occurred over time following chronic (shRNA) depletion of DNMT1: while polycomb-marked regions (purple) resisted remethylation, most regions ("other", red) regained normal or near-normal levels, while poised promoters (green) tended to become hypermethylated recovered methylation. These loci are heavily marked by polycomb in normal fibroblasts, rather than being heterochromatic, which can potentially explain both their resistance to remethylation and their lack of transcriptional depression in the stable lines. In keeping with this, inhibition of the polycomb repressor EZH2 which generates H3K27me3 marks could reactivate these genes, as well as the canonical polycomb targets the HOX genes. These results suggest that in cells which have both DNA methylation and polycomb-mediated repression, both layers of repression must be removed to achieve gene activation. Interestingly a recent report by Hajkova and colleagues showed that reprogramming of germ cells in mouse also required both removal of DNA methylation and alteration of polycomb marks [57].
Olfactory genes are methylated and largely inert
Olfactory receptors are also involved in specification of neural cell identity, where individual receptors are expressed in only a small group of cells in the olfactory epithelium [58]. They are largely monoallelically expressed, and methylation has been implicated as playing a role in their control [59,60]. The OR gene family is the largest in the genome, with approx. 380 active members, many organised into "gene factories" where they are flanked by many more pseudogenes and repeats, such as the large cluster on chr11 [41]. These regions are often transcriptionally inert and heterochromatic, which together with the requirement for tissue-specific factors may explain their lack of derepression.
Cancer/testis antigen genes are particular targets for demethylation and activation
The TSPY and MAGE genes fall into a functionally defined group known as the cancer/testis antigen (CTA) genes ( [61,62]; http://www.cta.lncc.br/) which are expressed during testis development normally, but which are aberrantly expressed in some tumours, such as melanoma and gonadoblastoma (e.g. TSPY2). This latter property makes them of particular interest for cancer immunotherapy, and monoclonal antibodies against some CTA members have already gained clinical approval [63]. CTA genes have been shown previously to lose methylation and become derepressed in several cancer cell types after treatment with the methyltransferase inhibitor 5′aza-2-deoxycytidine (Aza) [64][65][66] and in the HCT116 DNMT1 mutant line [66,67] using locus-specific approaches. Our study (1) shows in an unbiased genomic screen that CTA genes are the genes most affected by loss of maintenance activity, (2) shows this for the first time in a normal, differentiated cell line and (3) highlights the subset of CTA genes which are particularly dependent on maintenance activity to keep them repressed. It is noteworthy that the majority of these genes are on the X chromosome, which shows major fluxes in methylation in our stable lines. The genes are largely associated with heterochromatin, rather than polycomb repression, and do not respond to EZH2 inhibition, but rather directly to loss of methylation, which may reflect some difference in heterochromatin marking on the X. Strategies to demethylate and turn on these genes in tumour cells (e.g. with Aza) to facilitate cancer vaccine development may be worthwhile to pursue, given that these genes are the most responsive to loss of methylation in our cell lines.
UGT1A genes and other poised promoters are susceptible to hypermethylation
From the enrichment analysis, the UGT1A gene cluster was highlighted in terms of genes gaining methylation. These genes are known to be highly expressed in skin fibroblasts postnatally, and to be repressed in nonexpressing tissues by methylation [68,69]. The WT cells already had substantial levels of methylation but the increased methylation in the stable cell lines led to small but consistent decreases in transcription on the HT12 array, though levels were so low these could not be confirmed by Taqman qPCR (data not shown). It may be that the particular marks associated with a recent inactivation of the UGT1A cluster in the fibroblasts during adaptation to cell culture led to an increased de novo activity here, and in our transient KD experiment we saw the greatest gains in methylation at UGT1A4. Consistent with this, hypermethylation relative to the WT cells was associated with weak and poised promoters genome-wide, and the latter showed the greatest tendency to gain methylation above normal WT levels in the shRNA-containing lines.
Lack of transcriptional changes in part due to polycomb
It is notable that while there was widespread changes in methylation in the KD cell lines, this was not accompanied by large-scale transcriptional derepression, with only a few hundred genes showing dysregulation, and the fold change in transcription being small. Of the four gene classes identified as most affected in terms of methylation, only one-that containing the TSPY and MAGE genes-showed robust transcriptional derepression. A lack of global changes in transcription, also reported by others [29,70], is likely due to in part to the absence of transcription factors in fibroblasts needed to transcribe neural or adipocyte genes at high levels. However, many of the regions showing most persistent hypomethylation are polycomb-marked and this is likely to be sufficient in itself, as it is for example in Drosophila, to maintain repression of these genes. However, we could show that in the presence of an EZH2 inhibitor, polycombmarked loci which lacked DNA methylation, such as those involved in fat homoeostasis/body mass regulation, became upregulated, along with canonical polycomb targets such as the HOX genes. Our results therefore indicate both that the polycomb system is sufficient in itself to repress and also that polycomb-repressed regions appear to be refractive to remethylation, which may be due to the action of FBXL10 [71]. It has previously been proposed that the two systems work in parallel, with their own sets of targets and a degree of mutual exclusivity [15][16][17]: our results would support such a conclusion.
Comparison to other recent work
Two recent studies have also examined the effects of DNMT1 mutation on DNA methylation and gene transcription in human, albeit in cancer cells [29,70]. Acute depletion of DNMT1 using an siRNA-mediated approach found, as we did, regions of low CpG density (open sea, etc.) to be most affected, but differed in finding more evidence for cell morphogenesis and phosphorylation pathways being affected [70]. This might reflect differences between acute and chronic depletion and the high levels of cell death during acute depletion. Blattler and colleagues [29] also found that relatively few genes were dysregulated in DNMT1/3B double KO HCT116 cells, but some cancer/testis genes (the related GAGE genes) were upregulated, along with Krüppel-associated box genes, while chaperonins figured prominently among down-regulated genes. The latter two gene classes may therefore be more dependent on DNMT3B, or the combination of DNMT1 and 3B, for their maintenance; alternatively the differences may be due to the experiment being carried out in colon cancer cells rather than, as here, in non-transformed fibroblasts.
Conclusions
In conclusion, our study sheds new light on the loci which are most sensitive to sustained loss of maintenance activity in humans and shows an interplay between polycomb and DNA methylation-mediated repression in these differentiated cells.
Fig. 2
2Loss of methylation at the protocadherin γ (PCDHG) cluster of neuroepithelial identity genes. a Structure of the PCDHG cluster showing the 5′ variable exons (A, B and C classes) which are spliced to the 3′ constant exons (right). The top track (amber) shows absolute β values in the WT fibroblast cells from the 450K array, which range from 1(fully methylated) to zero (unmethylated). Only the sites showing significant differences from WT (FDR < 0.05) in each cell line are shown in the three tracks below, with decreases in red representing loss of methylation, and gains in blue. The size of the bar is proportional to the magnitude of change: maxima and minima are indicated on the scales at left. The locations of CpG islands (CGI) are also shown. Pyroassay locations are boxed. b Median β values for all variable exons. Significant differences (Mann-Whitney U) are indicated: *p < 0.05; **p < 0.1; n.s., not significant. c Methylation at each exon in WT and d16 cells obtained by taking the median of the absolute β value for all probes at that exon. The variable class C exons are underlined. d Average methylation values in WT and KD cells obtained from a pyrosequencing assay (pyroassay) designed to cover CpGs in the A2 exon. Bars represent SEM; ***p < 0.001, t-test. e Methylation at the C4 variable exon by pyroassay, shown as a control
Fig. 4
4Gains in methylation at the clustered UGT1A locus. a Structure of the UGT1A cluster showing the 5′ variable exons (UGT1A1-UGT1A10) which are spliced to the 3′ exons (right). Key to tracks as before; pyroassay locations (UGT1A1 and UGT1A4) are boxed. b Median β values for all first exons: though medians are higher in KD lines these failed to reach statistical significance. c Median absolute β values at individual first exons in WT and d16 cells. d Average methylation values in WT and KD cells obtained from a pyrosequencing assay (pyroassay) designed to cover CpGs in the A4 exon. e Methylation by pyroassay at the A1 exon, shown as a control
Fig. 5
5Gains in methylation on the X chromosome. a Sites reliably showing gain in methylation and located in promoters were analysed to identify those common to all three KD lines (n = 201). Some of these sites showing the greatest change in methylation were located on the X chromosome including MAGEA12 and GABRQ. b Schematic showing the locations of the two genes adjacent to each other on X in a region showing gain in methylation. Tracks indicate the locations of all 450K probes and CGI; the positions of the pyroassays are also indicated; the scale bar pertains to the bottom part of the schematic; ∆β, change in beta value. c Methylation as determined by pyroassay at the two genes indicated in a, b. d Clonal analysis of GABRQ in WT and d8. Filled circles represent methylated sites, open circles unmethylated. The CpG which were also analysed by the pyroassay (pyro) and the 450K array (asterisk) are indicated
Fig.
Fig. 6 Transcriptional dysregulation of genes on the X and Y chromosomes correlates with methylation changes. a Volcano plot showing log fold change (FC) in transcription as measured by HT12 array versus FDR-corrected significance values: genes with > 2FC and FDR < 0.05 are highlighted in red. b Numbers of dysregulated genes at different FDR thresholds for the different KD lines. c Genes common to more than one KD line at FDR < 0.05; total numbers in each cell line are indicated in brackets. d Ontology enrichment output from DAVID for the genes common to all KD lines. e RT-PCR analysis of the three MAGE genes on X and a member of the TSPY gene family on Y highlighted in DAVID analysis (C). ACTB is a loading control; −ve, negative control lacking cDNA. A 100-bp ladder is shown at left with the 200-bp band indicated by an arrowhead. f Transcription levels of indicated MAGE genes from the HT12 array or by qPCR. Error bars are 95% CI for the array, SEM for qPCR; fold change was significant (p < 0.05) in all cases. g Median β values on 450K array for probes at MAGE promoters were decreased, though failed to reach significance. h Gene body methylation was increased in transcriptionally upregulated genes
Table 1
1Gene ontology analysis for differentially methylated sites BP biological process, MF molecular function, GO FID gene ontology family identification code, P probability value, OR odds ratio, Ex expected number of hits, Obs observed number, Total total number of genes in that family, Grp-see below; confirm Y/N, confirmation given by FDR tracks Yes/No Groups (Grp): 1 = neuroepithelium; 2 = Fat homoeostasis/body mass (FBM); 3 = olfactory receptor; 4 = histone modifierType
GO FID
P
OR
Ex
Obs Total GO Term
Grp confirm
Loss
Promoter
BP
0098609
0.0011
3.0454
4.2148 12
189
Cell-cell adhesion
1
Y
0007156
0.0011
3.4722
3.0998 10
139
Homophilic cell adhesion via plasma membrane
1
Y
0010982
0.0015
88.2036
0.0669
2
3
Regulation of high-density lipoprotein particle clearance
2
Y
MF
0004888
0.0001
1.9709 24.2681 44
1055
Transmembrane signalling receptor activity
3
Y
0005509
0.0001
2.2488 14.3768 30
625
Calcium ion binding
1
Y
0004871
0.0003
1.7441 33.6302 54
1462
Signal transducer activity
3
Y
Gene
BP
0007506
0
130.3775
0.1339
5
7
Gonadal mesoderm development
Y
0032375
0.0001
25.9783
0.2295
4
12
Negative regulation of cholesterol transport
2
Y
0045409
0.0001
77.705
0.0956
3
5
Negative regulation of interleukin-6 biosynthetic process 2
Y
MF
0008083
0.0009
3.5742
3.0015 10
158
Growth factor activity
3
Y
0004984
0.0014
2.5939
6.136
15
323
Olfactory receptor activity
3
Y
0038023
0.0014
1.7776 22.9102 38
1206
Signalling receptor activity
3
Y
Gain
Promoter
BP
0035574
0
443.1106
0.4729 14
15
Histone H4-K20 demethylation
4
N
0045653
0
147.6833
0.5359 14
17
Negative regulation of megakaryocyte differentiation
N
0016577
0
26.4022
1.0404 15
33
Histone demethylation
4
N
MF
0035575
0
452.3692
0.4637 14
15
Histone demethylase activity (H4-K20 specific)
4
N
0032451
0
21.0879
1.1747 15
38
Demethylase activity
4
N
0015020
0
10.1109
0.8965
7
29
Glucuronosyltransferase activity
Y
Gene
BP
0035574
0
280.0725
0.4039 14
16
Histone H4-K20 demethylation
4
N
0045653
0
140.0181
0.4544 14
18
Negative regulation of megakaryocyte differentiation
N
0006335
0
31.0869
0.8078 14
32
DNA replication-dependent nucleosome assembly
4
N
MF
0035575
0
287.2955
0.3942 14
16
Histone demethylase activity (H4-K20 specific)
4
N
0032451
0
24.654
0.9856 15
40
Demethylase activity
4
N
0004984
0
4.4768
7.9586 31
323
Olfactory receptor activity
3
Y
AcknowledgementsAuthors' contributionsKONand REI supervised and carried out the majority of wet laboratory work and assembled figures; SJM and SJT carried out the majority of the bioinformatics analyses; AT carried out the DNMT3B work; CB and LM contributed results on specific loci; JL carried out initial KD experiments; DGM supervised and carried out bioinformatics analyses; CPW designed the experiments, carried out bioinformatics analyses, interpreted results and wrote the MS. All authors read and approved the final manuscript.Additional filesAdditional file 1:Table S1. Details of the primers used in this study.Additional file 2:Figure S1. Variation between shRNA clonal lines. (A) Relative similarities between cell lines based on principal component analysis (PCA) of the 450K data; three independent cultures of each line were analysed. Note the clustering of lines d8R and d10R. The fraction of total variance explained by each component is indicated in brackets. (B) The 1000 sites most variably methylated between cell lines were used for hierarchical clustering. The location of sites with respect to CpG island is indicated at left. Beta values are depicted as shades from red (low) to blue (high).Table 1. No significant differences between WT and KD were found by MWU.Table S2. Details of the hypomethylated and hypermethylated genes from Figs. 3d and 5a, respectively.Additional file 5:Competing interestsThe authors declare that they have no competing interests.Availability of data and materialsPublisher's NoteSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Submit your next manuscript to BioMed Central and we will help you at every step:
DNA methylation: roles in mammalian development. Z D Smith, A Meissner, Nat Rev. 14Smith ZD, Meissner A. DNA methylation: roles in mammalian develop- ment. Nat Rev. 2013;14:204-20.
DNA methylation and DNA methyltransferases. J R Edwards, O Yarychkivska, M Boulard, T H Bestor, 10.1186/s13072-017-0130-8Epigenetics Chromatin. 1023Edwards JR, Yarychkivska O, Boulard M, Bestor TH. DNA methylation and DNA methyltransferases. Epigenetics Chromatin. 2017;10:23. https://doi. org/10.1186/s13072-017-0130-8
Role for DNA methylation in genomic imprinting. E Li, C Beard, R Jaenisch, Nature. 366Li E, Beard C, Jaenisch R. Role for DNA methylation in genomic imprint- ing. Nature. 1993;366:362-5.
Loss of methylation activates Xist in somatic but not in embryonic cells. C Beard, E Li, R Jaenisch, Genes Dev. 9Beard C, Li E, Jaenisch R. Loss of methylation activates Xist in somatic but not in embryonic cells. Genes Dev. 1995;9:2325-34.
Distribution, silencing potential and evolutionary impact of promoter DNA methylation in the human genome. M Weber, I Hellmann, M B Stadler, L Ramos, S Paabo, M Rebhan, Nat Genet. 39Weber M, Hellmann I, Stadler MB, Ramos L, Paabo S, Rebhan M, et al. Distribution, silencing potential and evolutionary impact of promoter DNA methylation in the human genome. Nat Genet. 2007;39:457-66.
High-throughput engineering of a mammalian genome reveals building principles of methylation states at CG rich regions. A R Krebs, S Dessus-Babus, L Burger, D Schübeler, Elife [Internet]. 34094Krebs AR, Dessus-Babus S, Burger L, Schübeler D. High-throughput engineering of a mammalian genome reveals building principles of methylation states at CG rich regions. Elife [Internet]. 2014;3:e04094.
Synthetic CpG islands reveal DNA sequence determinants of chromatin structure. E Wachter, T Quante, C Merusi, A Arczewska, F Stewart, S Webb, Elife [Internet]. 3Wachter E, Quante T, Merusi C, Arczewska A, Stewart F, Webb S, et al. Synthetic CpG islands reveal DNA sequence determinants of chromatin structure. Elife [Internet]. 2014;3:1-16.
Cytosine methylation and mammalian development. C P Walsh, T H Bestor, Genes Dev [Internet]. 13Walsh CP, Bestor TH. Cytosine methylation and mammalian development. Genes Dev [Internet]. 1999;13:26-34.
The human colon cancer methylome shows similar hypo-and hypermethylation at conserved tissue-specific CpG island shores. R A Irizarry, C Ladd-Acosta, B Wen, Z Wu, C Montano, P Onyango, Nat Genet. 41Irizarry RA, Ladd-Acosta C, Wen B, Wu Z, Montano C, Onyango P, et al. The human colon cancer methylome shows similar hypo-and hypermethylation at conserved tissue-specific CpG island shores. Nat Genet [Internet]. 2009;41:178-86.
Functions of DNA methylation: islands, start sites, gene bodies and beyond. P A Jones, Nat Rev Genet [Internet]. 13Jones PA. Functions of DNA methylation: islands, start sites, gene bodies and beyond. Nat Rev Genet [Internet]. 2012;13:484-92.
Dnmt3L antagonizes DNA methylation at bivalent promoters and favors DNA methylation at gene bodies in ESCs. F Neri, A Krepelova, D Incarnato, M Maldotti, C Parlato, F Galvagni, Cell. 155Neri F, Krepelova A, Incarnato D, Maldotti M, Parlato C, Galvagni F, et al. Dnmt3L antagonizes DNA methylation at bivalent promoters and favors DNA methylation at gene bodies in ESCs. Cell. 2013;155:121-34.
Dnmt3a-dependent nonpromoter DNA methylation facilitates transcription of neurogenic genes. H Wu, V Coskun, J Tao, W Xie, W Ge, K Yoshikawa, Science. 329Wu H, Coskun V, Tao J, Xie W, Ge W, Yoshikawa K, et al. Dnmt3a-depend- ent nonpromoter DNA methylation facilitates transcription of neurogenic genes. Science. 2010;329:444-8.
5-Hydroxymethylation marks a class of neuronal gene regulated by intragenic methylcytosine levels. R E Irwin, A Thakur, K M O' Neill, C P Walsh, Genomics [Internet]. 104Irwin RE, Thakur A, O' Neill KM, Walsh CP. 5-Hydroxymethylation marks a class of neuronal gene regulated by intragenic methylcytosine levels. Genomics [Internet]. 2014;104:383-92.
The Polycomb complex PRC2 and its mark in life. R Margueron, D Reinberg, Nature [Internet]. 469Margueron R, Reinberg D. The Polycomb complex PRC2 and its mark in life. Nature [Internet]. 2011;469:343-9.
An interspecies analysis reveals a key role for unmethylated CpG dinucleotides in vertebrate Polycomb complex recruitment. M D Lynch, Ajh Smith, De Gobbi, M Flenley, M Hughes, J R Vernimmen, D , EMBO J [Internet]. 31Lynch MD, Smith AJH, De Gobbi M, Flenley M, Hughes JR, Vernimmen D, et al. An interspecies analysis reveals a key role for unmethylated CpG dinucleotides in vertebrate Polycomb complex recruitment. EMBO J [Internet]. 2012;31:317-29.
H3K27me3 profiling of the endosperm implies exclusion of polycomb group protein targeting by DNA methylation. I Weinhofer, E Hehenberger, P Roszak, L Hennig, C Köhler, PLoS Genet. 6Weinhofer I, Hehenberger E, Roszak P, Hennig L, Köhler C. H3K27me3 profiling of the endosperm implies exclusion of polycomb group protein targeting by DNA methylation. PLoS Genet. 2010;6:1-14.
Redistribution of H3K27me3 upon DNA hypomethylation results in de-repression of Polycomb target genes. J P Reddington, S M Perricone, C E Nestor, J Reichmann, N A Youngson, M Suzuki, Genome Biol. 1425Reddington JP, Perricone SM, Nestor CE, Reichmann J, Youngson NA, Suzuki M, et al. Redistribution of H3K27me3 upon DNA hypomethyla- tion results in de-repression of Polycomb target genes. Genome Biol. 2013;14:R25.
Eukaryotic cytosine methyltransferases. M G Goll, T H Bestor, Annu Rev Biochem [Internet]. 74Goll MG, Bestor TH. Eukaryotic cytosine methyltransferases. Annu Rev Biochem [Internet]. 2005;74:481-514.
De novo DNA cytosine methyltransferase activities in mouse embryonic stem cells. H Lei, S P Oh, M Okano, R Juttermann, K A Goss, R Jaenisch, Development. 122Lei H, Oh SP, Okano M, Juttermann R, Goss KA, Jaenisch R, et al. De novo DNA cytosine methyltransferase activities in mouse embryonic stem cells. Development. 1996;122:3195-205.
Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. E Li, T H Bestor, R Jaenisch, Cell. 69Li E, Bestor TH, Jaenisch R. Targeted mutation of the DNA methyltrans- ferase gene results in embryonic lethality. Cell. 1992;69:915-26.
Cloning and characterization of a family of novel mammalian DNA (cytosine-5) methyltransferases. M Okano, S Xie, E Li, Nat Genet. 19Okano M, Xie S, Li E. Cloning and characterization of a family of novel mammalian DNA (cytosine-5) methyltransferases. Nat Genet. 1998;19:219-20.
DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. M Okano, D W Bell, D A Haber, E Li, Cell. 99Okano M, Bell DW, Haber DA, Li E. DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian develop- ment. Cell. 1999;99:247-57.
Loss of genomic methylation causes p53-dependent apoptosis and epigenetic deregulation. L Jackson-Grusby, C Beard, R Possemato, M Tudor, D Fambrough, G Csankovszki, Nat Genet. 27Jackson-Grusby L, Beard C, Possemato R, Tudor M, Fambrough D, Csankovszki G, et al. Loss of genomic methylation causes p53-dependent apoptosis and epigenetic deregulation. Nat Genet. 2001;27:31-9.
Targeted disruption of DNMT1, DNMT3A and DNMT3B in human embryonic stem cells. J Liao, R Karnik, H Gu, M J Ziller, K Clement, A M Tsankov, Nat Genet. 47Liao J, Karnik R, Gu H, Ziller MJ, Clement K, Tsankov AM, et al. Targeted disruption of DNMT1, DNMT3A and DNMT3B in human embryonic stem cells. Nat Genet. 2015;47:469-78.
Complete inactivation of DNMT1 leads to mitotic catastrophe in human cancer cells. T Chen, S Hevi, F Gay, N Tsujimoto, T He, B Zhang, Nat Genet. 39Chen T, Hevi S, Gay F, Tsujimoto N, He T, Zhang B, et al. Complete inactiva- tion of DNMT1 leads to mitotic catastrophe in human cancer cells. Nat Genet. 2007;39:391-6.
CpG methylation is maintained in human cancer cells lacking DNMT1. I Rhee, K W Jair, R W Yen, C Lengauer, J G Herman, K W Kinzler, Nature. 404Rhee I, Jair KW, Yen RW, Lengauer C, Herman JG, Kinzler KW, et al. CpG methylation is maintained in human cancer cells lacking DNMT1. Nature. 2000;404:1003-7.
DNMT1 and DNMT3b cooperate to silence genes in human cancer cells. I Rhee, K E Bachman, B H Park, K W Jair, R W Yen, K E Schuebel, Nature. 416Rhee I, Bachman KE, Park BH, Jair KW, Yen RW, Schuebel KE, et al. DNMT1 and DNMT3b cooperate to silence genes in human cancer cells. Nature. 2002;416:552-6.
Identification of DNMT1 (DNA methyltransferase 1) hypomorphs in somatic knockouts suggests an essential role for DNMT1 in cell survival. G Egger, S Jeong, S G Escobar, C C Cortez, T W Li, Y Saito, Proc Natl Acad Sci USA. 103Egger G, Jeong S, Escobar SG, Cortez CC, Li TW, Saito Y, et al. Identification of DNMT1 (DNA methyltransferase 1) hypomorphs in somatic knockouts suggests an essential role for DNMT1 in cell survival. Proc Natl Acad Sci USA. 2006;103:14080-5.
Global loss of DNA methylation uncovers intronic enhancers in genes showing expression changes. A Blattler, L Yao, H Witt, Y Guo, C M Nicolet, B P Berman, Genome Biol. 15469InternetBlattler A, Yao L, Witt H, Guo Y, Nicolet CM, Berman BP, et al. Global loss of DNA methylation uncovers intronic enhancers in genes showing expres- sion changes. Genome Biol [Internet]. 2014;15:469.
DNMT1 deficiency triggers mismatch repair defects in human cells through depletion of repair protein levels in a process involving the DNA damage response. J E Loughery, P D Dunne, K M O'neill, R R Meehan, J R Mcdaid, C P Walsh, Hum Mol Genet. 20Loughery JE, Dunne PD, O'Neill KM, Meehan RR, McDaid JR, Walsh CP. DNMT1 deficiency triggers mismatch repair defects in human cells through depletion of repair protein levels in a process involving the DNA damage response. Hum Mol Genet. 2011;20:3241-55.
High density DNA methylation array with single CpG site resolution. M Bibikova, B Barnes, C Tsan, V Ho, B Klotzle, J M Le, Genomics. 98Bibikova M, Barnes B, Tsan C, Ho V, Klotzle B, Le JM, et al. High density DNA methylation array with single CpG site resolution. Genomics. 2011;98:288-95.
Comprehensive analysis of DNA methylation data with RnBeads. Y Assenov, F Muller, P Lutsik, J Walter, T Lengauer, C Bock, Nat Methods. 11Assenov Y, Muller F, Lutsik P, Walter J, Lengauer T, Bock C. Comprehen- sive analysis of DNA methylation data with RnBeads. Nat Methods. 2014;11:1138-40.
The establishment of telomerase-immortalized cell lines representing human chromosome instability syndromes. M M Ouellette, L D Mcdaniel, W E Wright, J W Shay, R A Schultz, Hum Mol Genet. 9Ouellette MM, McDaniel LD, Wright WE, Shay JW, Schultz RA. The establishment of telomerase-immortalized cell lines representing human chromosome instability syndromes. Hum Mol Genet. 2000;9:403-11.
Ontogeny, conservation and functional significance of maternally inherited DNA methylation at two classes of non-imprinted genes. C E Rutledge, A Thakur, K M O'neill, R E Irwin, S Sato, K Hata, Development. 141Rutledge CE, Thakur A, O'Neill KM, Irwin RE, Sato S, Hata K, et al. Ontog- eny, conservation and functional significance of maternally inherited DNA methylation at two classes of non-imprinted genes. Development. 2014;141:1313-23.
Minfi: a flexible and comprehensive Bioconductor package for the analysis of Infinium DNA methylation microarrays. M J Aryee, A E Jaffe, H Corrada-Bravo, C Ladd-Acosta, A P Feinberg, K D Hansen, Bioinformatics. 30Aryee MJ, Jaffe AE, Corrada-Bravo H, Ladd-Acosta C, Feinberg AP, Hansen KD, et al. Minfi: a flexible and comprehensive Bioconductor package for the analysis of Infinium DNA methylation microarrays. Bioinformatics. 2014;30:1363-9.
AmiGO: online access to ontology and annotation data. S Carbon, A Ireland, C J Mungall, S Shu, B Marshall, S Lewis, Bioinformatics. 25Carbon S, Ireland A, Mungall CJ, Shu S, Marshall B, Lewis S, et al. AmiGO: online access to ontology and annotation data. Bioinformatics. 2009;25:288-9.
Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. D W Huang, B T Sherman, R A Lempicki, Nat Protocol. 4Huang DW, Sherman BT, Lempicki RA. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protocol. 2009;4:44-57.
Galaxy: a platform for interactive large-scale genome analysis. B Giardine, C Riemer, R C Hardison, R Burhans, L Elnitski, P Shah, Genome Res. 15Giardine B, Riemer C, Hardison RC, Burhans R, Elnitski L, Shah P, et al. Galaxy: a platform for interactive large-scale genome analysis. Genome Res. 2005;15:1451-5.
The UCSC genome browser database. D Karolchik, R Baertsch, M Diekhans, T S Furey, A Hinrichs, Y T Lu, Nucleic Acids Res. 31Karolchik D, Baertsch R, Diekhans M, Furey TS, Hinrichs A, Lu YT, et al. The UCSC genome browser database. Nucleic Acids Res. 2003;31:51-4.
Wholegenome methylation scan in ICF syndrome: hypomethylation of nonsatellite DNA repeats D4Z4 and NBL2. T Kondo, M P Bobek, R Kuick, B Lamb, X Zhu, A Narayan, Hum Mol Genet. 9Kondo T, Bobek MP, Kuick R, Lamb B, Zhu X, Narayan A, et al. Whole- genome methylation scan in ICF syndrome: hypomethylation of non- satellite DNA repeats D4Z4 and NBL2. Hum Mol Genet. 2000;9:597-604.
The complete human olfactory subgenome. G Glusman, I Yanai, I Rubin, D Lancet, Genome Res. 11Glusman G, Yanai I, Rubin I, Lancet D. The complete human olfactory subgenome. Genome Res. 2001;11:685-702.
Gonadoblastoma locus and the TSPY gene on the human y chromosome. Yfc Lau, Y Li, T Kido, Birth Defects Res Part C Embryo Today Rev. 87Lau YFC, Li Y, Kido T. Gonadoblastoma locus and the TSPY gene on the human y chromosome. Birth Defects Res Part C Embryo Today Rev. 2009;87:114-22.
Mapping and analysis of chromatin state dynamics in nine human cell types. J Ernst, P Kheradpour, T S Mikkelsen, N Shoresh, L D Ward, C B Epstein, Nature [Internet]. 473Ernst J, Kheradpour P, Mikkelsen TS, Shoresh N, Ward LD, Epstein CB, et al. Mapping and analysis of chromatin state dynamics in nine human cell types. Nature [Internet]. 2011;473:43-9.
3-Deazaneplanocin A (DZNep), an inhibitor of S-adenosylmethioninedependent methyltransferase, promotes erythroid differentiation. T Fujiwara, H Saitoh, A Inoue, M Kobayashi, Y Okitsu, Y Katsuoka, J Biol Chem. 289Fujiwara T, Saitoh H, Inoue A, Kobayashi M, Okitsu Y, Katsuoka Y, et al. 3-Deazaneplanocin A (DZNep), an inhibitor of S-adenosylmethionine- dependent methyltransferase, promotes erythroid differentiation. J Biol Chem. 2014;289:8121-34.
Germ-line passage is required for establishment of methylation and expression patterns of imprinted but not of nonimprinted genes. K L Tucker, C Beard, J Dausmann, L Jackson-Grusby, P W Laird, H Lei, Genes Dev. 10Tucker KL, Beard C, Dausmann J, Jackson-Grusby L, Laird PW, Lei H, et al. Germ-line passage is required for establishment of methylation and expression patterns of imprinted but not of nonimprinted genes. Genes Dev. 1996;10:1008-20.
Tissue type is a major modifier of the 5-hydroxymethylcytosine content of human genes. C E Nestor, R Ottaviano, J Reddington, D Sproul, D Reinhardt, D Dunican, Genome Res. 22Nestor CE, Ottaviano R, Reddington J, Sproul D, Reinhardt D, Dunican D, et al. Tissue type is a major modifier of the 5-hydroxymethylcytosine content of human genes. Genome Res. 2012;22:467-77.
Molecular codes for neuronal individuality and cell assembly in the brain. T Yagi, Front Mol Neurosci [Internet]. 545Yagi T. Molecular codes for neuronal individuality and cell assembly in the brain. Front Mol Neurosci [Internet]. 2012;5:45.
Molecular logic of neuronal self-recognition through protocadherin domain interactions. R Rubinstein, C A Thu, K M Goodman, H N Wolcott, F Bahna, S Mannepalli, Cell. 163Rubinstein R, Thu CA, Goodman KM, Wolcott HN, Bahna F, Mannepalli S, et al. Molecular logic of neuronal self-recognition through protocadherin domain interactions. Cell. 2015;163:629-42.
Targets and dynamics of promoter DNA methylation during early mouse development. J Borgel, S Guibert, Y Li, H Chiba, D Schübeler, H Sasaki, Nat Genet [Internet]. 42Borgel J, Guibert S, Li Y, Chiba H, Schübeler D, Sasaki H, et al. Targets and dynamics of promoter DNA methylation during early mouse develop- ment. Nat Genet [Internet]. 2010;42:1093-100.
Developmental epigenetic modification regulates stochastic expression of clustered Protocadherin genes, generating single neuron diversity. S Toyoda, M Kawaguchi, T Kobayashi, E Tarusawa, T Toyama, M Okano, Neuron. 82Toyoda S, Kawaguchi M, Kobayashi T, Tarusawa E, Toyama T, Okano M, et al. Developmental epigenetic modification regulates stochastic expression of clustered Protocadherin genes, generating single neuron diversity. Neuron. 2014;82:94-108.
Chromosome instability and immunodeficiency syndrome caused by mutations in a DNA methyltransferase gene. G L Xu, T H Bestor, D Bourc'his, C L Hsieh, N Tommerup, M Bugge, Nature. 402Xu GL, Bestor TH, Bourc'his D, Hsieh CL, Tommerup N, Bugge M, et al. Chromosome instability and immunodeficiency syndrome caused by mutations in a DNA methyltransferase gene. Nature. 1999;402:187-91.
Cell cycle-dependent turnover of 5-hydroxymethyl cytosine in mouse embryonic stem cells. J Otani, H Kimura, J Sharif, T A Endo, Y Mishima, T Kawakami, PLoS ONE. 882961Otani J, Kimura H, Sharif J, Endo TA, Mishima Y, Kawakami T, et al. Cell cycle-dependent turnover of 5-hydroxymethyl cytosine in mouse embry- onic stem cells. PLoS ONE. 2013;8:e82961.
Beyond E-cadherin: roles of other cadherin superfamily members in cancer. F Van Roy, Nat Rev Cancer [Internet]. 14van Roy F. Beyond E-cadherin: roles of other cadherin superfamily mem- bers in cancer. Nat Rev Cancer [Internet]. 2014;14:121-34.
Clustered protocadherins. W V Chen, T Maniatis, Development [Internet]. 140Chen WV, Maniatis T. Clustered protocadherins. Development [Internet]. 2013;140:3297-302.
The developmental origins of chronic adult disease. Djp Barker, Acta Paediatr Suppl. 93Barker DJP. The developmental origins of chronic adult disease. Acta Paediatr Suppl. 2004;93:26-33.
The interplay between DNA methylation, folate and neurocognitive development. R E Irwin, K Pentieva, T Cassidy, D J Lees-Murdock, M Mclaughlin, G Prasad, Epigenomics [Internet]. 8863Irwin RE, Pentieva K, Cassidy T, Lees-Murdock DJ, McLaughlin M, Prasad G, et al. The interplay between DNA methylation, folate and neurocognitive development. Epigenomics [Internet]. 2016;8:863.
Epigenetic reprogramming enables the transition from primordial germ cell to gonocyte. Pws Hill, H G Leitch, C E Requena, Z Sun, R Amouroux, M Roman-Trufero, Nature [Internet]. 555Hill PWS, Leitch HG, Requena CE, Sun Z, Amouroux R, Roman-Trufero M, et al. Epigenetic reprogramming enables the transition from primordial germ cell to gonocyte. Nature [Internet]. 2018;555:392-6.
Achieving singularity in mammalian odorant receptor gene choice. T S Mcclintock, Chem Senses. 35McClintock TS. Achieving singularity in mammalian odorant receptor gene choice. Chem Senses. 2010;35:447-57.
Stage-specific induction of DNA methyltransferases in olfactory receptor neuron development. J L Macdonald, Csy Gin, A J Roskams, Dev Biol. 288MacDonald JL, Gin CSY, Roskams AJ. Stage-specific induction of DNA methyltransferases in olfactory receptor neuron development. Dev Biol. 2005;288:461-73.
Dnmt3a regulates global gene expression in olfactory sensory neurons and enables odorant-induced transcription. B M Colquitt, E Markenscoff-Papadimitriou, Duffie R Lomvardas, S , Neuron. 83Colquitt BM, Markenscoff-Papadimitriou E, Duffie R, Lomvardas S. Dnmt3a regulates global gene expression in olfactory sensory neurons and enables odorant-induced transcription. Neuron. 2014;83:823-38.
Cancer/testis antigens, gametogenesis and cancer. Ajg Simpson, O L Caballero, A Jungbluth, Y-T Chen, L J Old, Nat Rev Cancer. 5Simpson AJG, Caballero OL, Jungbluth A, Chen Y-T, Old LJ. Cancer/testis antigens, gametogenesis and cancer. Nat Rev Cancer. 2005;5:615-25.
CTdatabase: a knowledge-base of high-throughput and curated data on cancer-testis antigens. L G Almeida, N J Sakabe, A R De Oliveira, Mcc Silva, A S Mundstein, T Cohen, Nucleic Acids Res. 37816Almeida LG, Sakabe NJ, de Oliveira AR, Silva MCC, Mundstein AS, Cohen T, et al. CTdatabase: a knowledge-base of high-throughput and curated data on cancer-testis antigens. Nucleic Acids Res. 2009;37:D816.
Oncogenic cancer/testis antigens: prime candidates for immunotherapy. M F Gjerstorff, M H Andersen, H J Ditzel, Oncotarget. 6Gjerstorff MF, Andersen MH, Ditzel HJ. Oncogenic cancer/testis antigens: prime candidates for immunotherapy. Oncotarget. 2015;6:15772-87.
Evaluation of a 7-day continuous intravenous infusion of decitabine: inhibition of promoter-specific and global genomic DNA methylation. W E Samlowski, S A Leachman, M Wade, P Cassidy, P Porter-Gill, L Busby, J Clin Oncol. 23Samlowski WE, Leachman SA, Wade M, Cassidy P, Porter-Gill P, Busby L, et al. Evaluation of a 7-day continuous intravenous infusion of decitabine: inhibition of promoter-specific and global genomic DNA methylation. J Clin Oncol. 2005;23:3897-905.
A potential role for epigenetic modulatory drugs in the enhancement of cancer/germ-line antigen vaccine efficacy. A R Karpf, Epigenetics. 1Karpf AR. A potential role for epigenetic modulatory drugs in the enhancement of cancer/germ-line antigen vaccine efficacy. Epigenetics. 2006;1:116-20.
Frequent nonrandom activation of germ-line genes in human cancer. M Koslowski, C Bell, G Seitz, H A Lehr, K Roemer, H Müntefering, Cancer Res. 64Koslowski M, Bell C, Seitz G, Lehr HA, Roemer K, Müntefering H, et al. Frequent nonrandom activation of germ-line genes in human cancer. Cancer Res. 2004;64:5988-93.
Epigenetic regulation of X-linked cancer/germline antigen genes by DNMT1 and DNMT3b. S R James, P A Link, A R Karpf, Oncogene. 25James SR, Link PA, Karpf AR. Epigenetic regulation of X-linked can- cer/germline antigen genes by DNMT1 and DNMT3b. Oncogene. 2006;25:6975-85.
Regulation of UGT1A1 and HNF1 transcription factor gene expression by DNA methylation in colon cancer cells. A S Belanger, J Tojcic, M Harvey, C Guillemette, BMC Mol Biol. 119Belanger AS, Tojcic J, Harvey M, Guillemette C. Regulation of UGT1A1 and HNF1 transcription factor gene expression by DNA methylation in colon cancer cells. BMC Mol Biol. 2010;11:9.
Importance of UDP-glucuronosyltransferase 1A1 expression in skin and its induction by UVB in neonatal hyperbilirubinemia. K Sumida, M Kawana, E Kouno, T Itoh, S Takano, T Narawa, Mol Pharmacol. 84Sumida K, Kawana M, Kouno E, Itoh T, Takano S, Narawa T, et al. Impor- tance of UDP-glucuronosyltransferase 1A1 expression in skin and its induction by UVB in neonatal hyperbilirubinemia. Mol Pharmacol. 2013;84:679-86.
Acute depletion redefines the division of labor among DNA methyltransferases in methylating the human genome. R L Tiedemann, E L Putiri, J-H Lee, R A Hlady, K Kashiwagi, T Ordog, Cell Rep [Internet]. 9Tiedemann RL, Putiri EL, Lee J-H, Hlady RA, Kashiwagi K, Ordog T, et al. Acute depletion redefines the division of labor among DNA methyl- transferases in methylating the human genome. Cell Rep [Internet]. 2014;9:1554-66.
FBXL10 protects polycombbound genes from hypermethylation. M Boulard, J R Edwards, T H Bestor, Nat Genet. 475Boulard M, Edwards JR, Bestor TH (2015) FBXL10 protects polycomb- bound genes from hypermethylation. Nat Genet 47(5):479-85.
| Asymmetric sequence determinants flanking gene transcription start sites are shown to control directionality of transcription elongation in mammalian cells by regulating promoter-proximal cleavage and polyadenylation. | Cellular development, morphology and function are governed by precise patterns of gene expression. These are established by the coordinated action of genomic regulatory elements known as enhancers or cis-regulatory modules. More than 30 years after the initial discovery of enhancers, many of their properties have been elucidated; however, despite major efforts, we only have an incomplete picture of enhancers in animal genomes. In this Review, we discuss how properties of enhancer sequences and chromatin are used to predict enhancers in genome-wide studies. We also cover recently developed high-throughput methods that allow the direct testing and identification of enhancers on the basis of their activity. Finally, we discuss recent technological advances and current challenges in the field of regulatory genomics. |
N ascent RNAs are immediately bound by protein complexes that control their fate as well as that of the transcribing RNA polymerase II (RNA Pol II). The recruitment of splicing factors to the nascent end of pre-messenger RNAs (pre-mRNA) is promoted by interactions of the cap-binding complex with virtually all components of the splicing machinery 1-3 , by exonic sequences (exonic splice enhancers (ESEs)) recognized by sequence-specific trans-acting factors such as the SR proteins 3 and finally by the splice site at the 3′ end of the first exon. Recruitment of the splicing machinery to the nascent RNA reinforces gene transcription by promoting RNA Pol II elongation [4][5][6] and pre-initiation complex formation 7,8 , as well as the recruitment of co-regulators and chromatin remodelers 9,10 .
The impact of the splicing machinery on transcriptional control also starts emerging at enhancers. While many thousands of putative enhancers can be identified in each cell type based on the histone mark H3K4me1 (ref. 11 ), only a subset of them are active, as indicated by high histone acetylation levels and by the synthesis of enhancer RNAs (eRNAs) [12][13][14] . The term eRNAs has commonly been linked to short, capped and non-polyadenylated transcripts that emanate bi-directionally from enhancer cores 13 . However, enhancers also commonly drive the production of long, spliced and polyadenylated transcripts (elncRNAs) 12,15,16 . An emerging concept is that the recruitment of the splicing machinery mediated by splice sites and ESEs in the exons of elncRNAs contributes to enhancer activity and strength. Indeed, deletion of the splice sites of long noncoding RNAs (lncRNAs) was shown to affect the expression of the adjacent gene in an lncRNA-independent manner, suggesting a cis-regulatory effect 17 . Moreover, genomic analyses indicate that conserved splice sites of lncRNAs increase enhancer activity 18 and that polymorphisms affecting lncRNA splice site integrity are associated with reduced transcription of neighboring genes 19 . Consistent with this conceptual framework, splice sites of lncRNAs represent the main target of purifying selection acting on lncRNAs in humans, suggesting a critical role 20,21 .
The effects generated by the recruitment of the splicing machinery to enhancers may occur at the level of both transcription initiation 7,8 and elongation [4][5][6] . However, in spite of the abundant loading of RNA Pol II at highly acetylated and active enhancers 12,13 , their transcriptional output is extremely limited, which points to the existence of active termination mechanisms. This possibility is also suggested by the observation that RNA Pol II associated with enhancers lacks modifications associated with active elongation, notably Ser2 phosphorylation of its carboxy-terminal repeat domain (CTD), and it is instead associated with Ser5 phosphorylation, which marks the initiating and early elongating RNA Pol II (ref. 22 ).
We previously reported that the adapter protein WDR82, which interacts with Ser5-phosphorylated RNA Pol II (ref. 23 ), suppresses extragenic transcription emanating from active enhancers and promoters 24 . In cells depleted of WDR82, increased extragenic transcription was associated with the appearance of Ser2-phosphorylated RNA Pol II and H3K36me3 (a histone mark associated with productive transcription elongation) over extended genomic regions, suggesting the release from an early termination mechanism or an elongation block 24 . WDR82 is part of both the SET1 (COMPASS) H3K4 methyltransferase 23,25 and the PNUTS complex 26 , in which the PP1 protein phosphatase is associated with the nuclear targeting subunit PNUTS. However, whereas the depletion of SET1 or PNUTS complex components also caused various termination defects, it did not recapitulate the phenotype of WDR82 depletion 24 .
Here we report that WDR82 forms an additional complex, conserved from flies to humans, with the RNA-binding zinc finger protein ZC3H4 (formerly known as C19ORF7). We show that this complex controls an early transcription termination checkpoint activated by the inefficiently spliced first exon of elncRNAs and pa-lncRNAs.
Results
WDR82 depletion induces specific extragenic transcription changes. The depletion of WDR82 strongly increases transcription over kilobase-long extragenic regions originating from highly active putative enhancers and upstream of gene promoters 24 . It also causes termination defects at the 3′ end of selected genes 24 . We used 4-thiouridine (4sU) labeling and sequencing (4sU-seq) of newly synthesized transcripts to test whether the depletion of factors involved in transcription termination and in processing or degradation of extragenic transcripts could recapitulate the effects of WDR82 depletion (Extended Data Fig. 1 and Supplementary Fig. 1). The factors analyzed included: (1) the INTS11 subunit of the Integrator complex, which cleaves short noncoding RNAs including small nuclear RNAs (snRNAs) 27 and eRNAs 28 ; (2) the EXOSC3 subunit of the nuclear exosome, which degrades unstable and short extragenic transcripts 29 ; (3) the ARS2 protein, which connects the 5′ cap-binding complex with the nuclear exosome machinery 30 ; (4) the CPSF5 (NUDT21) subunit of the cleavage factor (CF), which collaborates with the cleavage and polyadenylation specificity factor (CPSF) to control transcript cleavage and transcription termination at the polyadenylation sites of canonical genes; and (5) the XRN2 exonuclease, which promotes transcription termination at sites of nascent transcript cleavage. Experiments were carried out in mouse bone marrow-derived macrophages (BMDMs) infected with short hairpin RNA (shRNA)-expressing retroviruses and activated by lipopolysaccharide (LPS), with LPS expanding the repertoire of highly active enhancers in this system 24,31 . Data in unstimulated cells were qualitatively comparable (data not shown).
The depletion of WDR82 with two distinct shRNAs resulted in the upregulation of extragenic transcription at an overlapping, high-confidence set of 2,870 regions, including enhancers (n = 1,572), transcription start site (TSS)-proximal regions (n = 637) and regions downstream of transcription end sites (TESs; n = 661) (Extended Data Fig. 1 and Supplementary Table 1). The depletion of the other termination factors tested resulted in detectable increases in extragenic transcription, but the effects observed at WDR82-sensitive enhancers and TSSs were considerably smaller than those found in cells depleted of WDR82 (Extended Data Fig. 1), in spite of overall similar depletion efficiencies ( Supplementary Fig. 1). Among the factors tested, the depletion of INTS11 mildly increased the abundance of slightly longer enhancer-generated transcripts, which is in line with the proposed role in transcription termination at enhancers 28 , while it caused strong termination defects at snRNA genes, which were instead unaffected by WDR82 depletion (Extended Data Fig. 1).
Overall, from both a qualitative and a quantitative point of view, the transcriptional phenotypes caused by the depletion of WDR82 were not recapitulated by the depletion of other termination factors, hinting at distinct molecular mechanisms.
A conserved WDR82-ZC3H4 complex controls transcription termination. To determine the molecular basis of WDR82-dependent suppression of extragenic transcription, we sought to identify WDR82 interactors that may be responsible for this activity. In addition to SET1 and PNUTS-PP1 complex components 26,32 , previous analyses of WDR82 immunoprecipitates by mass spectrometry identified a large protein of unknown function, initially named C19ORF7 and currently annotated as ZC3H4 (ref. 26 ). ZC3H4 was not co-immunoprecipitated when PNUTS-PP1 or SET1 complex components were used as baits 32 .
To validate the existence of a WDR82-ZC3H4 complex, we carried out co-immunoprecipitation experiments either on extracts of HEK-293 cells transduced with a Flag-ZC3H4 expression vector or on extracts from untransfected Raw264.7 mouse macrophages (Extended Data Fig. 2). The anti-FLAG and anti-ZC3H4 immunoprecipitates were blotted with antibodies specific for WDR82, the SET1 complex component RBBP5 and PNUTS. ZC3H4 efficiently co-precipitated WDR82 but neither RBBP5 nor PNUTS, indicating that the WDR82-ZC3H4 complex is a distinct entity.
ZC3H4 is the ortholog of Drosophila Su(s) (Suppressor of sable), which was identified as a suppressor of transcription of a gene in which a 7.5-kilobase transposon was inserted at the 5′ end of the first exon 33,34 and was independently found to form a complex with the Drosophila ortholog of WDR82 (ref. 35 ). ZC3H4 is a 1,303-amino acid (aa) protein (Fig. 1a) found to bind RNA in multiple screens [36][37][38] and containing in the amino terminus several features characteristic of RNA-binding proteins, including three adjacent C3H1-type zinc fingers, which are present in approximately 60 human and mouse RNA-binding proteins 39 , and a region rich in both SR dipeptides and RG repeats, which commonly mediate protein-RNA interactions 40 . An internal proline-rich domain (aa 506-690) showed high homology to a proline-rich region of the SF3A2 splicing factor. ZC3H4 interacted with WDR82 via a carboxy-terminal region devoid of identifiable domains (Extended Data Fig. 2). Overexpression of this ZC3H4 carboxy-terminal fragment (aa 804-1303) abrogated the interaction of endogenous ZC3H4 with WDR82 (Extended Data Fig. 2).
We depleted ZC3H4 from mouse macrophages by retroviral shRNA delivery and analyzed 4sU-labeled nascent transcripts as above. The depletion of ZC3H4 unveiled an auto-regulatory loop whereby WDR82-ZC3H4 repressed ZC3H4 transcription ( Supplementary Fig. 2). ZC3H4 depletion caused the upregulation of the 4sU signal at 915 genomic regions that extensively overlapped with the WDR82-suppressed extragenic and TSS-proximal regions ( Fig. 1b and Supplementary Table 2). The magnitudes of the extragenic transcription changes observed upon ZC3H4 depletion were similar to those measured upon depletion of WDR82 (Fig. 1c). The visual inspection of the data on the genome browser confirmed that the depletion of ZC3H4 and of WDR82 caused similar effects (Fig. 1d). A clear divergence of effects was found only at TESs, where most of the read-through events determined by WDR82 depletion were not recapitulated in cells depleted of ZC3H4 (Supplementary Table 2). Selective control of read-through transcription at TESs by WDR82 may depend on its interaction with PNUTS-PP1, a component of the pre-mRNA 3′ processing complex 41 whose depletion causes termination defects at TESs 24,42 .
To determine whether the main findings obtained in mouse macrophages could be reproduced also in other cell types, we depleted WDR82 and ZC3H4 in HeLa cells by transfection of short interfering RNAs (siRNAs) (Supplementary Fig. 3) and we generated 4sU RNA-sequencing (RNA-seq) datasets (Supplementary Table 3). In total, 1,509 extragenic regions were upregulated upon WDR82 depletion and 1,494 upon ZC3H4 depletion (Fig. 1e) with a high overlap (53% of the WDR82-repressed regions overlapped those repressed also by ZC3H4 and 55% of those repressed by ZC3H4 overlapped the regions sensitive to WDR82). Co-depletion of WDR82 and ZC3H4 did not cause significant additive effects at the extragenic regions tested (Extended Data Fig. 3). Consistent with the preferential effects of WDR82-ZC3H4 on extragenic transcripts, when considering sense (coding)/antisense (noncoding) transcript pairs, we nearly invariably detected the strong upregulation of the promoter-antisense RNA in the absence of any detectable effect on the associated sense transcript (Fig. 1f).
We next used 4sU-seq to test the effects of the disruption of the WDR82-ZC3H4 complex. Overexpression of the ZC3H4 (804-1303) deletion mutant in HeLa cells caused the upregulation of a large set (n = 2,475) of extragenic transcripts that extensively overlapped (68.9%) those upregulated upon WDR82 or ZC3H4 depletion (Fig. 1g- sites bound by ZC3H4, distributed over genes and extragenic regulatory regions (Extended Data Fig. 4). The ZC3H4 peaks showed extensive overlap with WDR82 peaks (Fig. 2a and Supplementary Table 4). The overlap with WDR82 ( Fig. 2a) and the intensity of the WDR82 peaks (Fig. 2b) increased progressively with the increase in the ZC3H4 signal, as shown by dividing the ZC3H4 ChIP-seq peaks into quartiles of increasing signal intensity. In total, 84% of the ZC3H4 peaks overlapped with RNA Pol II (Fig. 2c). Both the overlap with and the intensity of the RNA Pol II ChIP-seq peaks increased from the first to the fourth quartile of ZC3H4 occupancy, indicating that ZC3H4 is recruited to sites of high RNA Pol II occupancy (Fig. 2c,d). The WDR82 and RNA Pol II signals at regions bound by ZC3H4 are shown in the heatmaps in Fig. 2e and representative snapshots are reported in Fig. 2f.
We next analyzed whether the genomic regions where transcription increased upon WDR82 or ZC3H4 depletion were bound by these two proteins. When considering the 2,870 regions upregulated by WDR82 depletion, 51% of them were bound by ZC3H4 and/or WDR82 (Fig. 2g). The presence of a fraction of genomic regions in which increased transcription was not associated with direct binding of WDR82 or ZC3H4 may depend on issues related to the distinct signal-to-noise ratios and analytical thresholds in 4sU-seq and ChIP-seq experiments, although other explanations cannot be excluded.
WDR82 and ZC3H4 suppress lncRNAs transcribed from enhancers and promoters.
Two main considerations prompted us to analyze the interplay between WDR82-ZC3H4 and lncRNAs generated by cis-regulatory elements such as enhancers and promoters. First, both at highly acetylated enhancers and upstream of active genes the depletion of WDR82 enabled long-range RNA Pol II elongation associated with the gain of Ser2 phosphorylation at the CTD 24 . Second, most lncRNAs are generated from putative enhancers 16 and as antisense transcripts from promoters 43 , namely from genomic regions where depletion of WDR82-ZC3H4 resulted in increased transcription. Since elncRNAs and pa-lncRNAs are expressed at very low levels 16 , we considered the possibility that they might be suppressed by WDR82-ZC3H4. We analyzed the overlap of TSS-proximal regions and enhancers subjected to WDR82-ZC3H4 transcriptional suppression with the extensive collection of lncRNAs annotated in the NONCODE v.5 database. Visual inspection of the data showed that at both enhancers and promoters, many regions suppressed by WDR82-ZC3H4 overlapped annotated lncRNAs ( Fig. 3a,b and Supplementary Table 5). The 2,870 regions whose transcription was upregulated upon WDR82 depletion overlapped NONCODE v.5 lncRNAs in 57% of cases, with a prevalence of eln-cRNAs and pa-lncRNAs (Fig. 3c). Therefore, lncRNAs generated both at enhancers and at promoters of protein-coding genes were targets for WDR82-ZC3H4-mediated suppression.
To determine if, and how, many extragenic regions upregulated in the 4sU-seq data generated spliced and polyadenylated transcripts, we produced strand-specific polyadenylated RNA sequencing (polyA-RNA-seq) datasets at high sequencing depth. In macrophages, 45% of the upregulated extragenic regions generated transcripts with at least one splice junction ( Fig. 3d and Supplementary Table 6). Presence of splice junctions correlated with significantly higher induction in WDR82-depleted macrophages (Fig. 3e). A representative snapshot is shown in Fig. 3f.
In HeLa cells 78% of the 4sU-labeled regions upregulated upon WDR82 depletion overlapped annotated lncRNAs ( Fig. 3g and Supplementary Table 7) and in polyA-RNA-seq data 56% of them contained transcripts with one or more splice junctions ( Fig. 3h and Supplementary Table 8). A representative snapshot is shown in Fig. 3i.
When considering spliced and unspliced transcripts separately, most of the spliced ones overlapped annotated multi-exonic lncRNAs (Extended Data Fig. 5). Instead, about half of the unspliced transcripts regulated by WDR82-ZC3H4 overlapped annotated lncRNAs and among these 50% were multi-exonic. Therefore, lack of detectable splicing in a fraction of WDR82-ZC3H4-suppressed lncRNAs may reflect sensitivity issues related to the combination of low splicing efficiency and low expression of these transcripts.
Overall, transcripts suppressed by WDR82-ZC3H4 were often long and spliced RNAs.
lncRNAs upregulated by WDR82 depletion contain inefficiently spliced exons. These data hint at a termination activity of WDR82-ZC3H4 on transcription triggered by cis-regulatory elements located in proximity to one or more noncoding exons. Moreover, the asymmetry of the effects of WDR82 depletion at bidirectional promoters directing transcription of a sense/antisense (coding/ noncoding) pair suggests that fundamental differences in transcriptional or co-transcriptional processes that occur inside versus outside genes may underlie sensitivity to WDR82-ZC3H4.
We noticed that polyadenylated transcripts upregulated upon WDR82 depletion presented a chaotic splicing pattern due to large variation in the usage of splice donor and acceptor sites. Chaotic splicing was associated with high abundance of intronic reads (Fig. 3f,i). These two features suggest inefficient splicing and are consistent with reports showing that exons of lncRNAs are characterized by a massive splicing diversity 44 and a lower splicing efficiency compared with the exons of protein-coding genes 45 .
We analyzed the splice junctions of WDR82-sensitive extragenic transcripts versus the splice junctions of mRNAs. Compared with protein-coding transcripts, the junctions of noncoding transcripts upregulated upon WDR82 depletion both in macrophages ( Fig. 4a,b) and in HeLa cells (Extended Data Fig. 6) revealed inefficient splicing, as indicated by the reads ratio in a 20-nucleotide (nt) window centered on the 5′ splice site junction. Low splicing efficiency was also evident when comparing WDR82-sensitive lncRNAs with mRNAs with similar expression levels (Extended Data Fig. 7), indicating that the distinctive splicing properties of elncRNAs and pa-lncRNAs were not determined by their low level showing the overlap of WDR82-suppressed transcription with annotated lncRNAs in macrophages. c, Overlap between WDR82-suppressed extragenic transcripts (n = 2,870) in mouse macrophages and lncRNAs in the NONCODE v.5 database. d, Transcripts upregulated upon WDR82 depletion in 4sU RNA-seq data in mouse macrophages (n = 2,870) were classified as spliced (n = 1,292) or unspliced (n = 1,578) based on polyA-RNA-seq data. e, Signal intensity of spliced and unspliced WDR82-suppressed transcripts detected in 4sU-seq data in mouse macrophages (n = 4 independent experiments). The median value for each fold change is shown with a horizontal black line. Boxes show values between the first and the third quartiles. The lower and upper whiskers show the smallest and the highest values, respectively. Outliers are not shown. The notches correspond to ~95% confidence interval for the median. Statistical significance was assessed using the two-tailed Wilcoxon rank-sum test (P = 2.1 × 10 −92 ). *P < 0.01. f, PolyA-RNA-seq snapshot from mouse macrophages showing splice junctions at a representative genomic region containing lncRNAs whose expression was increased upon WDR82 depletion. g, Overlap between transcripts upregulated in 4sU-seq datasets from HeLa cells depleted of WDR82 (n = 1,509) and lncRNAs annotated in NONCODE v.5. h, Transcripts identified as upregulated in 4sU RNA-seq data in HeLa cells depleted of WDR82 (n = 1,509) were classified as spliced (n = 850) or unspliced (n = 659) based on polyA-RNA-seq data. i, Representative genomic region showing a coding gene (RBM26) and the associated promoter-antisense transcription in HeLa cells depleted of WDR82 or ZC3H4. Strand-specific 4sU-seq and polyA-RNA-seq data are shown. of expression. The sequence motifs of the donor and acceptor splice sites in WDR82-ZC3H4-sensitive lncRNAs and in mRNAs were overall similar ( Fig. 4c and Extended Data Fig. 6). However, the strength of the splice signals as measured by maximum entropy modeling 46 Gm5086 extragenic transcripts as compared with mRNAs ( Fig. 4c and Extended Data Fig. 6). Conversely, the density of ESE motifs 47,48 associated with the exons of WDR82-sensitive lncRNAs and of mRNAs was identical (Extended Data Fig. 8). When considering a set of spliced extragenic transcripts that were insensitive to WDR82 depletion, both splicing efficiency and strength of the splice sites were greatly and significantly higher compared with WDR82-sensitive transcripts (Extended Data Fig. 9). Protein-coding genes were in general poorly sensitive to WDR82-ZC3H4-mediated repression 24 although upregulation upon WDR82 depletion was observed in some cases, as exemplified by the case of ZC3H4 ( Supplementary Fig. 2). However, by dividing them into deciles based on their sensitivity to WDR82-ZC3H4 depletion, we found that the most WDR82-repressed genes were characterized by low splicing efficiency in their first exon in both macrophages and HeLa cells ( Fig. 4d and Extended Data Fig. 6), thus strengthening the correlation between inefficient splicing and WDR82-ZC3H4-mediated suppression.
(0-40) (0-30) (0-280) (0-0.5) (0-0.5) (0-0.5) (0-0.5) (0-0.5) RefSeq ncRNA Map3k8 T031303.2 G019223.2 T102803.1 4833419F23Rik 10 kb (0-250) (0-45) (0-200) (0-1) (0-1) (0-1) (0-1) (0-1)
Transcription termination by WDR82-ZC3H4 requires the first exon of lncRNAs. Transcription termination by WDR82-ZC3H4 appears to be an early event during transcription elongation since the corresponding extragenic transcripts produced in cells expressing WDR82-ZC3H4 are short 24 . Therefore, the possibility exists that the signals determining sensitivity to WDR82-ZC3H4 are close to the 5′ end of the transcript, either residing in the antisense promoter or at the beginning of the nascent transcript.
To address this issue, we used CRISPR-Cas9 to generate HeLa cell clones bearing inversions of the promoters (including the TSSs) of a sense/antisense transcriptional unit so that the sense (coding) promoter was placed upstream of the noncoding unit and vice versa (Fig. 5a). In this manner, we determined if sensitivity to WDR82-ZC3H4 was encoded in the promoter of the antisense transcript. The MARCHF6 sense/antisense unit was selected because it contains an antisense noncoding transcript highly sensitive to WDR82-ZC3H4 depletion (Fig. 5b) and at a randomly selected set of mRNA junctions (n = 6,500) (bottom) in mouse macrophages. A window of ±10 nt centered on the 5′ splice sites was used to measure read counts in polyA-RNA-seq data. b, log 2 -transformed ratio of polyA-RNA-seq reads in a window of 20 nt centered on the 5′ splice sites of WDR82-suppressed lncRNAs (n = 6,280) and a randomly selected set of mRNAs (n = 6,500) with at least one splice junction. c, Analysis of 5′ (left) and 3′ (right) splice site strength at WDR82-suppressed lncRNAs (n = 6,280 junctions) and randomly selected mRNAs (n = 6,500 junctions). MaxEnt scores were measured as described 46 . Statistical significance was assessed using the two-tailed Wilcoxon rank-sum test for both the 5′ (P = 3.3 × 10 −34 ) and the 3′ (P = 1.3 × 10 −22 ) splice sites. Nucleotide frequencies at splice sites are shown as sequence logos. Donor and acceptor splice sites are indicated with a black triangle. ***P < 0.01. d, Effects of the depletion of WDR82-ZC3H4 on transcription of protein-coding genes in mouse macrophages. Expressed protein-coding genes (n = 9,466) were divided into deciles based on their sensitivity to the depletion of WDR82 in the 4sU-seq data, with the tenth decile including the most upregulated genes. The log 2 -transformed RNA fold changes (polyA-and 4sU RNA-seq data) and the log 2 -transformed reads ratio across the first exon-intron junction are shown for the genes (n = 946 in each group) in the tenth, fifth and first deciles. Statistical significance was assessed using the two-tailed Wilcoxon signed rank test (P = 4.5 × 10 −22 ). *P < 0.01. Data were from n = 3 independent experiments. For b, c and d, the median value for each fold change is shown with a horizontal black line. Boxes show values between the first and the third quartiles. The lower and upper whiskers show the smallest and the highest values, respectively. Outliers are not shown. The notches correspond to ~95% confidence interval for the median. ss, splice site. with high specificity. We engineered multiple (n = 8) clones containing one inverted allele and one wild-type allele ( Supplementary Fig. 4) and tested the effects of the overexpression of the ZC3H4 C-terminal fragment (aa 804-1303) on the sense and the antisense transcripts. After promoter inversion, the noncoding unit remained sensitive, and the coding unit resistant, to WDR82-ZC3H4 depletion, respectively (Fig. 5c), thus showing that susceptibility to WDR82-ZC3H4-mediated suppression was not determined by the pa-lncRNA promoter.
Having excluded a role for the promoter, we hypothesized that the cis-acting elements required to terminate transcription and generating sensitivity to WDR82-ZC3H4 depletion resided in the very 5′ end of the nascent RNAs. To challenge this model, we analyzed the effects of the deletion of the first exon of several pa-lncRNAs on transcription and sensitivity to WDR82-ZC 3 H 4 depletion in HeLa cells. Deletions were generated using Cas9 and sgRNAs designed to remove the first exon from approximately 30 nt after the TSS of the antisense transcript (based on CAP analysis of gene expression by sequencing, CAGE-seq, data) to intronic sequences just downstream of the 5′ splice site (Fig. 5d). After checking for deletion efficiency ( Supplementary Fig. 5), bulk populations of cells were transduced with WDR82 siRNAs, ZC3H4 siRNAs or scramble siRNAs and levels of the corresponding pa-lncRNAs were measured by reverse transcription-quantitative PCR (RT-qPCR). At the B4GALT1-AS1 and PGGHG-AS1 lncRNAs, deletion of the first exon strongly increased basal transcription (Fig. 5e), suggesting the relief from a termination checkpoint. A similar effect was detected upon deletion of inefficiently spliced sequences of an lncRNA extending antisense from the PDXK gene promoter (Fig. 5e). At the same time, sensitivity to the depletion of WDR82 or ZC3H4 was strongly attenuated in first-exon-deleted cells (Fig. 5e). Importantly, deletion of the efficiently spliced first exon of protein-coding genes caused the opposite effect, namely transcriptional attenuation, but it did not result in gain of sensitivity to WDR82 or ZC3H4 depletion (Extended Data Fig. 10), indicating that loss of strong splicing signals is not sufficient to render a transcriptional unit sensitive to WDR82-ZC3H4-dependent termination.
Overall, these results indicate that the first exon of inefficiently spliced lncRNAs generated by cis-regulatory elements is required to trigger the WDR82-ZC3H4-mediated transcription termination checkpoint.
Discussion
Our data show that the first exon of elncRNAs and pa-lncRNAs triggers a WDR82-ZC3H4-mediated termination checkpoint that restrains noncoding transcription in the genome. This checkpoint appears to have evolved from an ancestral mechanism present in flies, wherein WDR82 and its partner Su(s) (the ortholog of ZC3H4) suppress transcription from genes in which splice signals in the first exon of protein-coding genes have been disrupted by transposon insertions 33,34 .
Although most gene promoters appear to be bidirectional and also to generate a plethora of both short and long antisense RNAs 43,49,50 , they drive sense transcription much more efficiently than antisense transcription. An explanation for promoter directionality is the higher density of polyA signals (PASs) in the antisense relative to the sense transcript, combined with the suppression of PAS usage inside genes because of the presence of motifs recognized by the spliceosomal U1 small nuclear ribonucleoprotein (snRNP) [51][52][53] . A similar mechanism may underlie the inefficient transcription of elncRNAs. However, data shown in this study indicate that in the absence of WDR82-ZC3H4, PAS-mediated termination did not suffice to efficiently prevent extragenic RNA Pol II elongation and the generation of long promoter-antisense and enhancer-driven transcripts.
Indeed, our data point to the existence of an additional dominant mechanism possibly based on the direct sensing of inefficiently spliced first exons and the subsequent delivery of a termination signal to RNA Pol II. Based on our results, we propose the following working hypothesis. As shown by the extensive overlap with RNA Pol II ChIP-seq signals, the WDR82-ZC3H4 complex is systematically tethered to sites of transcription initiation, possibly via WDR82 binding to Ser5-P in the CTD of the initiating RNA Pol II. The N-terminal domains of ZC3H4, such as the C3H1 zinc fingers and the RS-and RG-rich domains, may then directly recognize specific cis-acting elements in the nascent RNAs, such as imperfect 5′ splice sites, as reported for Su(s) 54 . Crosstalk with the splicing machinery may be enabled by the interaction of Ser5-P RNA Pol II with spliceosomal components 55,56 as well as by direct interactions of ZC3H4 with exon-definition complexes (as suggested by datasets from ref. 57 ). The inefficient resolution of splicing, and thus the persistence of the splicing machinery onto the nascent RNA, may underlie the delivery of termination signals to the early elongating RNA Pol II. It would thus be tempting to describe this mechanism as a first exon 'quality' checkpoint, but the precise identity of the RNA sequence features underlying the relative inefficiency of splicing of extragenic exons has remained elusive thus far.
An important issue is the evolutionary origin of the exons of elncRNAs and pa-lncRNAs that are subjected to the WDR82-ZC3H4-mediated checkpoint. A possibility is that these exons were generated from transposable elements (TEs), such as nonfunctional relics of retrotransposons 58 . Cooption of TE-derived exons to cis-regulatory elements may have been positively selected to enable the positive feedback of the splicing machinery onto the transcriptional machinery. Indeed, differently from protein-coding genes, exons and splicing junctions of lncRNAs have a high content of sequences derived from TEs 59 . Moreover, lncRNAs devoid of TEs are expressed at higher levels than those containing these sequences 59 , possibly implying that TE-derived sequences may negatively control their transcription. The notion that the termination checkpoint controlled by WDR82-ZC3H4 mainly operates on TE-derived sequences is also consistent with the observation that in Drosophila the WDR82-Su(s) complex suppresses transcription from genes containing a transposon inserted at their very 5′ end 33,34 . Therefore, the WDR82-ZC3H4 suppressive pathway may have initially appeared in evolution to limit transcription of TEs in the relatively compact genomes of higher eukaryotes, with its function being subsequently coopted in large genomes for the negative control of pervasive transcription initiated by highly active cis-regulatory elements associated with lncRNA exons.
Finally, a central question is the biological relevance of the transcription termination mechanism described in this study: is the extensive prevention of extragenic RNA Pol II elongation by WDR82-ZC3H4 an essential homeostatic process in higher eukaryotes and specifically in mammals? In keeping with a critical biological role of the first exon termination checkpoint described here, heterozygous loss of function mutations of ZC3H4 are strongly counter-selected in the human population, as indicated by the analysis of thousands of whole-exome datasets 60 . The precise biological impact of this pathway, however, will require extensive ad hoc investigation in cells and animals.
online content
Any methods, additional references, Nature Research reporting summaries, source data, extended data, supplementary information, acknowledgements, peer review information; details of author contributions and competing interests; and statements of data and code availability are available at https://doi.org/10.1038/ s41594-021-00572-y.
Methods
Cells and culture. Bone marrow isolation from female mice (age 6-8 weeks, FVB/Hsd strain from Envigo) was performed in accordance with the Italian laws (D.L.vo 116/92 and following additions), which enforce the EU 86/609 Directive. All animal procedures were approved by the OPBA (Organismo per il Benessere e Protezione Animale) of the Cogentech animal facility at the Istituto Firc for Molecular Oncology-Istituto Europeo di Oncologia (IFOM-IEO) Campus, Milan. BMDM cultures were carried out as described 61 . LPS from Escherichia coli serotype 055:B5 (catalog no. L4524, Sigma) was used at 10 ng ml −1 .
HeLa and HEK-293 cells (both from ATCC) were cultured in DMEM with South American serum (10%), Pen/Strep (1%, catalog no. P4333, Sigma) and l-glutamax (1%, catalog no. 35050061, Gibco). RAW264.7 cells (from ATCC) were cultured in DMEM with North American serum (10%), Pen/Strep (1%) and l-glutamax (1%). Cell lines were authenticated by the Tissue Culture Facility of the European Institute of Oncology using the GenePrint10 System (Promega) and were routinely screened for Mycoplasma contamination.
Retroviral shRNA delivery in BMDMs.
Retroviral infections were carried out as described 62 using the MSCV (murine stem cell virus)-based pLMP vector with either a scrambled shRNA or an shRNA specific for the gene of interest. Sequences of all the shRNA oligos and expression primers used are provided in Supplementary Table 9. PolyA-RNA-seq and 4sU RNA-seq. For sequencing of polyadenylated RNA, total RNA was first isolated using the Quick-RNA MiniPrep kit from Zymo Research (R1054) with on-column DNAse I treatment. For isolation of the polyA-RNA fraction, reagents from the TruSeq RNA sample preparation kit were used (Illumina RS-122-2001). Sequencing libraries were prepared from the polyA-RNA fraction using the TruSeq Stranded Total RNA sample preparation kit (RS-122-9007). For preparation of 4sU RNA-seq libraries from BMDMs or HeLa cells, 4sU (sc-204628A, Santa Cruz Biotechnology) was added to the medium at a final concentration of 300 μM for 45 min before collection. The labeled RNA was isolated and processed as described 24 . The nascent 4sU-labeled RNA was extracted from 50 μg of total TRIZOL-isolated RNA. About 1-1.5% of the total RNA was retrieved in the 4sU fraction. We used 100-200 ng of the isolated nascent 4sU-labeled RNA for cDNA-library synthesis using the TruSeq Stranded Total RNA Sample Preparation kit (RS-122-9007) with no ribosomal depletion or polyA selection. ChIP-seq. For WDR82 and ZC3H4 chromatin immunoprecipitation (ChIP) we used a double-crosslinking procedure with disuccinimidyl glutarate (DSG; catalog no. A7822,0001, Applichem) followed by formaldehyde-mediated DNA-protein crosslinking. Briefly, 200 × 10 6 RAW264.7 cells (stimulated for 45 min with LPS at 10 ng ml −1 ) were collected and resuspended in 10 ml of PBS to which DSG (dissolved in DMSO) was added to a final concentration of 2 mM. The crosslinking was performed at room temperature on a rolling wheel for 45 min, followed by two washes in ice-cold PBS. Cells were then resuspended in 10 ml of PBS and formaldehyde was added to a final concentration of 1%. Formaldehyde crosslinking was allowed to proceed for 10 min at room temperature on a rolling wheel. Then, formaldehyde was quenched using 125 mM Tris pH 7.4 and cells were pelleted and frozen at −80 °C until further processing. Cells were lysed and sonicated for immunoprecipitation as previously described 61 . For 200 × 10 6 cells, a volume of 6 ml of lysis buffer was used for immunoprecipitation with 10 μg of antibody. The following antibodies were used: anti-WDR82 (catalog no. 99751, clone D2I3B, Cell Signaling Technologies) and anti-ZC3H4 (catalog no. HPA040934, Sigma). Library preparation for Illumina sequencing on the NextSeq was carried out using a described protocol 63 . The purified DNA libraries were quantified with the 2100 Bioanalyzer (Agilent Technologies) or Tapestation (Agilent Technologies) and with Qubit (LifeTechnologies) and diluted to a working concentration of 10 nM.
Co
Promoter inversion experiments.
Inversion of a bidirectional promoter was obtained using CRISPR-Cas9 with two sgRNAs targeting the sense and the antisense promoters 30-50 nt downstream of each TSS. This led in most cases to the deletion of the region in between the guides, but at some alleles the promoter was re-ligated in the inverted orientation. sgRNAs were designed using the Benchling software, and were ordered from Invitrogen (TrueGuide Synthetic guideRNA). The sgRNAs were first hybridized to tracrRNA (trans-activating CRISPR RNA), then loaded onto the Cas9 protein according to manufacturer's instructions (Invitrogen) and transfected into semi-confluent HeLa cells using Lipofectamine CRISPRMAX (Invitrogen). A few days after transfection, the targeted cells were plated at 0.5 cells per well in 96-well plates to obtain single-cell clones. Clones were screened by genomic PCR for inversion of the promoter, and clones with one inverted allele were used in the experiments. Clones were transfected with 2.5 μg of the pCDNA3.1-ZC3H4(804-1303) expression vector or with the empty vector using Lipofectamine 2000 (no. 11668-019, Thermo Fisher). Transfected cells were collected after 48 h and total RNA was extracted. Total RNA was treated with TURBO DNAse (no. AM2238, Invitrogen) and reverse-transcribed with ImProm-II Reverse Transcription System and random primers. Quantitative PCR reactions were assembled with Fast SYBR Green Master Mix using primers designed to specifically detect transcripts generated by the inverted or the wild-type alleles (Supplementary Table 9).
First exon deletion experiments. The first exons of various lncRNAs (B4GALT1-AS1, PGGHG1-AS and PDXK-AS) or coding genes (COG2, FAM174A and RRP15) were deleted using CRISPR-Cas9. Two sgRNAs were designed, one annealing approximately 30-50 base pairs (bp) downstream of the TSS, and the other 50-100 bp after the first exon 5′ splice site. The TSS was determined based on annotations in the reference human genome hg38 or by CAGE-seq data. sgRNAs were designed using the Benchling software.
sgRNAs were ordered as sense and antisense DNA oligos and cloned into the pX330-2 × 1_A or pX330_S plasmid by Golden Gate assembly 64 , with the two sgRNAs targeting the same locus cloned into the same plasmid. The pX330 plasmid containing the two sgRNAs for a specific region and the Cas9 coding sequence was transfected into semi-confluent HeLa cells. At 3-5 d after targeting, cells were split and treated with siRNAs for WDR82, ZC3H4 or control siRNA on 2 consecutive days, and collected the day after. Transcript levels were determined by RT-qPCR analysis.
Analysis of 4sU RNA-seq datasets. After quality filtering according to the Illumina pipeline, single-end reads (51 bp or 76 bp) were aligned to the mm10 or the hg38 reference genome (GENCODE, https://www.gencodegenes.org/mouse/ release_M24.html and https://www.gencodegenes.org/human/release_33.html) using TopHat v.2.1.1 (ref. 65 ), allowing up to two mismatches and using the option --b2-very-sensitive --library-type fr-firststrand. Only uniquely mapping reads were retained (-g 1). Indels due to sequencing errors were identified using Bowtie2 v.2.6 (ref. 66 ). Reads originating from the two strands were separated based on the XS:A:+/XS:A: flag provided by TopHat2 (ref. 65 ).
Identification of differentially expressed extragenic transcripts.
We excluded all mapped reads that overlapped by more than 10 nt with annotated protein-coding genes according to the GENCODE annotation. SICER v.2 (ref. 67 ) was used to detect the extragenic transcripts regulated in cells depleted of individual factors. The entire genome was partitioned into blocks of nonoverlapping 500-bp windows with a gap size < 1,000 nt. An effective genome fraction of 1, a fragment size of 0 and a false discovery rate (FDR) cutoff < 0.01 were used. In particular, the FDR was calculated using P value adjusted for multiple testing, following the approach developed by Benjamini and Hochberg. In the SICER analysis, only clustered transcripts with more than twofold enrichment with respect to the control and at least 50 reads were retained. For each experiment, only transcripts upregulated in at least two replicates (out of four in BMDMs and three in HeLa cells) were retained, with a minimum acceptable overlap of 50% between different replicates using the intersecBed function from the BEDTools v.2.29.2 suite: -sorted -e -f 0.5 -F 0.5 (ref. 68 ).
Finally, each transcript was assigned to the nearest annotated macrophage enhancer based on available datasets 31,69,70 (http://fantom.gsc.riken.jp/5/), or to the nearest TSS/TES proximal regions (https://www.gencodegenes.org/mouse/release_ M1.html) using the ClosestBed tool from the BEDTools suite with the parameter -t first 68 . We indicated as promoter-antisense transcripts all transcripts in reverse orientation relative to the gene TSS, including transcripts arising inside the gene body and transcripts arising from an upstream antisense promoter.
In mouse macrophages, to compare the effects of WDR82 depletion with those of the depletion of other factors, we collected all extragenic transcripts that were upregulated in shRNA-transduced macrophages (shWdr82 n = 2,870; shExosc3 n = 1,427; shArs2 n = 903; shInt11 n = 1,135; shCpsf5 n = 1,434; shXrn2 n = 63). Using as reference the 2,870 extragenic transcripts upregulated in WDR82-depleted cells, we calculated in those regions the log 2 -transformed fold change (sh versus scramble) for each depletion experiment.
Counts were collected using the featureCounts v.1.6.4 (ref. 71 ) function taking into account the strand specificity (-s 2) and normalizing according to the reads per kilobase million (RPKM). For each of the transcripts upregulated upon WDR82 depletion, we calculated the fold change relative to control measured upon depletion of the other transcription termination factors tested. We used the same strategy to detect all extragenic transcripts that were upregulated upon ZC3H4 depletion in macrophages (n = 915). Using as reference the 915 extragenic transcripts upregulated in ZC3H4-depleted cells, we calculated in those regions the log 2transformed fold change (sh versus scramble) for each depletion experiment and we represented the median of the fold changes in a boxplot. Statistical significance was assessed using the two-tailed Wilcoxon signed rank test; a P value ≤0.01 was considered significant. A similar strategy was also used for the analysis of datasets from HeLa cells. To determine the proximity of extragenic upregulated transcripts with lncRNAs, we used the intersectBed function from the BEDTools suite, considering strand specificity (parameters: -s -u). For noncoding RNA (ncRNA) annotations, we used NONCODE v.5.0 (http://www.noncode.org/download.php).
Expression of paired mRNAs/pa-lncRNAs in HeLa cells.
4sU-seq data were used for this analysis. We evaluated read counts in sense-coding genes with the featureCounts 71 function taking into account the strand specificity (-s 2) and using the GENCODE gene annotation file (https://www.gencodegenes.org/human/release_33. html). Counts were normalized according to the RPKM (RPKM + 1), and finally the fold change for the comparison sh versus scramble was calculated, log 2 -transformed and represented in a boxplot. Statistical significance was assessed using the two-tailed Wilcoxon signed rank test and a P value ≤0.01 was considered significant.
Analysis of the effects of ZC3H4(804-1303) overexpression in HeLa cells.
In total, 2,475 transcripts with more than twofold enrichment with respect to the control and an FDR < 0.01 were retained. FDR was calculated using P value adjusted for multiple testing, following the approach developed by Benjamini and Hochberg. For each experiment, only transcripts upregulated in at least two replicates were retained. Considering the 1,509 nascent transcripts upregulated upon WDR82 depletion, we evaluated the read counts in both conditions (transfection of empty vector and of ZC3H4(804-1303) expression vector). Read counts were obtained with the featureCounts 71 function taking into account the strand specificity (-s 2). Counts were normalized according to the fragments per kilobase million (FPKM + 1), log 2 -transformed, and represented in a dotplot and a boxplot. Statistical significance was assessed using the two-tailed Wilcoxon signed rank test and a P value ≤0.01 was considered significant.
Analysis of ChIP-seq datasets.
Single-end reads (76 bp) were trimmed and clipped for quality control with Trimmomatic v.0.27 (ref. 72 ). Read quality was then checked using FastQC v.0.11.8 (http://www.bioinformatics.babraham. ac.uk/projects/fastqc/). High-quality reads were mapped to the mm10 reference genome using Bowtie2 v.2.6 (ref. 66 ). We used default parameters with the options --very-sensitive, --no-unal and with the pre-built bowtie2 index. Only uniquely mapping reads were retained. Peak calling was performed using SICER v.2 (ref. 67 ). We identified significantly enriched clusters using a redundancy threshold of 1, a window size of 200 bp, a gap size of 600 bp and an FDR cutoff of <0.01. FDR was calculated using P value adjusted for multiple testing, following the approach developed by Benjamini and Hochberg. Fragment size was set to 150 nt and the effective genome fraction to 0.80. Each ChIP was compared with input DNA derived from RAW264.7 mouse macrophages. Regions that overlapped with the blacklists of the ENCODE and modENCODE consortia (https://github.com/ Boyle-Lab/Blacklist/blob/master/lists/mm10-blacklist.v2.bed.gz) 73 were filtered out. Tracks (*.bigWig files) were generated using bamCoverage from deepTools v.3.1.3 (ref. 74 ).
WDR82 and ZC3H4 genomic occupancy. We considered SICER-blocks with an FDR cutoff of <0.01 in both replicates, obtaining 13,065 WDR82 peaks and 6,903 ZC3H4 peaks. The overlap of the ZC3H4 peaks versus WDR82 peaks in relation to the nearest TSS, TES or enhancer is shown as a stacked bar chart.
WDR82 and RNA Pol II genomic occupancy at sites of ZC3H4 binding. We ordered ZC3H4 peaks according to their log 2 -transformed enrichment with respect to the input and we divided them into quartiles. We checked the occupancy of Pol II and WDR82 in correspondence of ZC3H4 peaks. The numbers of WDR82 and RNA Pol II peaks in each ZC3H4 quartile were represented as barplots. The total numbers of RNA Pol II and WDR82 peaks that bound in correspondence of ZC3H4 are represented as barplots. The enrichment of WDR82 and RNA Pol II signals with respect to the input was log 2 -transformed and represented in a boxplot. Read counts were evaluated using the coverage tool from the BEDTools suite and normalized according to the RPKM.
Heatmaps of ZC3H4, WDR82 and RNA Pol II ChIP-seq peaks. We used plotHeatmap tools from deepTools v.3.1.3 (ref. 74 ). ComputeMatrix was run in the reference-point mode using as inputs:
-the bed file with the ZC3H4 ChIP-seq peaks ±1 bp from the middle point of the peak (option -R) -the bigWig format files related to ZC3H4, WDR82 and Pol II ChIP-seq (option -S). Other options that were specified included: -referencePoint center -b 10000 -a 10000 -missingDataAsZero.
For each of the ZC3H4 ChIP-seq regions we calculated the middle point ±1 bp of the peak and generated a bed file. Using as reference this file, we ran the computeMatrix function versus the Pol II data. A matrix with all RNA Pol II scores associated with the ZC3H4 regions was generated and used as input for the plotHeatmap tool to generate the Pol II heatmap. Using the options --sortUsingSamples 1 and -outFileSortedRegions, we sorted the ZC3H4 regions according to the Pol II signal intensity and created an RNA Pol II-sorted reference file that was used as input for generating two matrixes for ZC3H4 and WDR82 with the computeMatrix function. In this way, all ZC3H4 and WDR82 coverage values followed the order of Pol II intensity of signal. Then the WDR82 and ZC3H4 heatmaps were plotted separately for each antibody with the plotHeatmap function (--sortRegions no).
ZC3H4, WDR82 and RNA Pol II occupancy at coding genes in macrophages.
We considered 10,917 coding genes annotated in GENCODE and with a log 2 -transformed enrichment for RNA Pol II of at least twofold with respect to the input. We ordered these genes according to the quartiles of the intensity of the occupancy of RNA Pol II and we selected those belonging to the quartile with the lowest RNA Pol II signals (first quartile: n = 2,730) and those to the quartile with the highest RNA Pol II (fourth quartile: n = 2,729). The occupancy of ZC3H4 and WDR82 was evaluated in correspondence of the genes belonging to these quartiles.
We used plotHeatmap tools from deepTools v.3.1.3 (ref. 74 ). ComputeMatrix was run in the scale-region mode using as inputs the bed file with the annotated genes (option -R) and the bigWig format files related to ZC3H4, WDR82 and Pol II ChIP-seq (option -S). Other options that were specified included: -b 10000 -a 10000 --regionBodyLength 20000 -missingDataAsZero --bs 100.
For each quartile of RNA Pol II occupancy, a matrix with all Pol II scores associated with each quartile was generated and used as input for the plotHeatmap tool to generate the Pol II heatmap. The RNA Pol II sorted reference file was used as input for generating two matrixes for ZC3H4 and WDR82 with the computeMatrix function. In this way, for each quartile, ZC3H4 and WDR82 coverage values followed the order of RNA Pol II signal intensity. Then the WDR82 and ZC3H4 heatmaps were plotted separately for each antibody with the plotHeatmap function (--sortRegions no).
Analysis of PolyA-RNA-seq datasets. Strand-specific paired-end reads (76 or 51 nt) were trimmed to remove the adapter sequences and low-quality bases were discarded using Trimmomatic v.0.27 with the PE option 72 . Read quality was then checked for each sample using FastQC v.0.11.8. (http://www.bioinformatics. babraham.ac.uk/projects/fastqc/). High-quality reads were aligned to the mm10 (https://www.gencodegenes.org/mouse/release_M24.html) or hg38 (https://www. gencodegenes.org/human/release_33.html) reference genome with TopHat v.2.1.1 (-very-sensitive --library-type fr-firststrand -r 200 --microexon-search --no-mixed --no-discordant -g 1 --coverage-search). Indels due to sequencing errors were identified using Bowtie2 v.2.6.
Analysis of splice junctions in PolyA-RNA-seq data. Starting from the junctions. bed file generated by TopHat v.2.1.1, we added the left maximal overhang to the left coordinates and we subtracted the right maximal overhang from the right coordinates. We identified 291,482 junctions using the mouse GENCODE annotations (https://www.gencodegenes.org/mouse/release_M24.html) and 304,486 using the human annotations (https://www.gencodegenes.org/human/ release_33.html). Junctions in correspondence of protein-coding genes were named coding junctions and those with an overlap of 100% with respect to the coding gene were retained. Junctions that did not overlap with any stretch of RNA containing a protein-coding gene were considered noncoding junctions. Only noncoding junctions that overlapped with nascent transcripts upregulated after WDR82 depletion were retained for the analysis. To measure the overlap between junctions and annotated protein-coding genes, we used the intersectBED function from the bedTool v.2.29.2 with parameters -u -s. For the overlap of junctions in correspondence of protein-coding genes we also used the -f 1 parameter.
We measured the splicing ratio in exons of lncRNAs and mRNAs by calculating the average of reads number by centering on the 5′ splice site and considering 10 bases in the exon and 10 bases in the intron.
We used the computeMatrix function (-a 10 -b 10 --missingDataAsZero -bs 1) from deepTools v.3.1.3 (ref. 74 ), using as input the ±10-nt extended 5′ splice site bed file. A matrix was created and used as input for the plotProfile function from deepTools v.3.1.3 (--averageType median).
The log 2 -transformed ratio between the reads inside the exon and inside the intron was also measured and represented as a boxplot. To evaluate statistical differences between the groups, the two-sided Wilcoxon rank-sum test was applied. A P value ≤0.01 was considered significant. The maximum entropy score in correspondence of the donor (3 bases in the exon, 6 bases in the intron) and the acceptor splice sites (20 bases in the intron and 3 bases in the exon) was generated using MaxEntScan (http://hollywood.mit.edu/burgelab/maxent/Xmaxentscan_ scoreseq.html) 46 . The sequence logos were generated using WebLogo v.2.8.2 (https://weblogo.berkeley.edu/logo.cgi). We used the twoBitToFa v.1 tool (https:// genome.ucsc.edu/goldenpath/help/twoBit.html) to extract the FASTA format of the primary sequence in correspondence of the splice sites. The sequence of junctions annotated on the negative strand was reversed and complemented using the function fastx_reverse_complement from the fastx-toolkit v.0.0.14 (http:// hannonlab.cshl.edu/fastx_toolkit/index.html). Statistical differences between the classes were evaluated using the two-sided Wilcoxon rank-sum test. A P value ≤0.01 was considered significant.
Overlap between extragenic transcripts upregulated upon WDR82 depletion in 4sU-seq datasets and splice junction in polyA-RNA-seq datasets. To detect splicing events within transcripts regulated by WDR82 in mouse macrophages, we overlapped the 2,870 transcripts with the list of noncoding junctions (n = 24,962). Extragenic transcripts with at least one junction were considered spliced (45%). We evaluated 4sU read counts in spliced and unspliced extragenic transcripts using the featureCounts 71 function taking into account the strand specificity (-s 2). Counts were normalized according to the RPKM and the fold change was log 2 -transformed and represented in a boxplot. Statistical differences between the groups were evaluated using the two-sided Wilcoxon rank-sum test. A P value ≤0.01 was considered significant.
Identification of ESEs.
Based on a published list of 29 SRSF motifs 75 , we obtained a total of 312 primary sequences. Starting from 5′ splice sites, we extended 70 nt inside the upstream exon. We used twoBitToFa tool (https://genome.ucsc. edu/goldenpath/help/twoBit.html) to extract the FASTA format of the primary sequence in correspondence of those 70 nt. The sequence of junctions annotated on the negative strand was reversed and complemented using the function fastx_reverse_complement from the fastx-toolkit (http://hannonlab.cshl.edu/fastx_ toolkit/index.html). Finally, we calculated the total number of ESEs with a perfect match in the region and their distance from the 5′ splice sites Effects of WDR82 depletion on splicing of pre-mRNAs in macrophages and HeLa cells. We selected 9,466 and 8,804 coding genes in BMDMs and HeLa cells, respectively, based on GENCODE annotations and the expression in the control condition (FPKM ≥ 0.2 in BMDMs and ≥ 0.5 in HeLa cells in all three replicates). We divided these genes into deciles based on their log 2 (fold change) after WDR82 depletion in 4sU-seq data. We considered genes belonging to the tenth, fifth and first deciles and on their first exon we measured:
-the reads ratio between fragments inside the intron (10 nt) and fragments inside the exon (10 nt) -the maximum entropy score of the splice donor site (including 3 nt in the exon and 6 in the intron) using MaxEntScan 46 (http://hollywood.mit.edu/ burgelab/maxent/Xmaxentscan_scoreseq.html).
Invariant transcripts not affected by WDR82 depletion.
A golden set of invariant nascent extragenic transcripts (n = 884) in HeLa cells was identified based on their expression after WDR82 depletion (log 2 (fold change) < +0.5 and >−0.5 in all replicates) and statistical significance (FDR = 1 in all replicates). In total, 31% of these transcripts were spliced (n = 274) and included 1,436 splice junctions. The log 2 -transformed ratio between the reads across splice sites (10 nt before the splice site/10 nt after the splice site) was also measured and represented as a boxplot. The maximum entropy score in correspondence of the splice donor was calculated using MaxEntScan and represented in a boxplot. The statistical significance was assessed using the two-tailed Wilcoxon rank-sum test and a P value ≤0.01 was considered significant.
Analysis of spliced and unspliced lncRNAs suppressed by WDR82.
Extragenic transcripts upregulated upon WDR82 depletion in mouse macrophages and in HeLa cells were first divided into spliced and unspliced RNA. Then, within each of these two groups they were further divided based on their overlap with lncRNAs in the NONCODE v.5 database of noncoding RNAs, classified into single exon and multi-exonic ncRNAs.
Track generation and visualization. Tracks were generated using bamCoverage (-bs 1 --normalizeUsing RPKM --outFileFormat bigwig) from deepTools v.3.1.3 (ref. 74 ). To create strand-specific bigWig files the option --filterRNAstrand forward or --filterRNAstrand reverse was used. Tracks for the Integrative Genomics Viewer 76 were generated using the uniquely aligned reads.
Statistics and plots. R v.3.6.1 was used to compute statistics and generate plots (https://www.r-project.org/). Exact P values of statistical tests are reported in the legends of the figures. In the case of ties, an approximate P value is reported.
Reporting Summary. Further information on experimental design is available in the Nature Research Reporting Summary linked to this article.
Data availability
The complete list of datasets used in this study is reported in Supplementary . c, First exon deletion efficiency at the three genes tested was analyzed by genomic PCR. The quantification of the wild type allele gel band in wt cells and cells in which the first exon was deleted using sgRNAs+Cas9 is shown on the right. Uncropped images are available online as source data.
Fig. 3 |
3control of lncRNA production by WDR82-Zc3H4. a,b, A representative candidate enhancer (a) and promoter (b)
Fig. 4 |
4lncRNAs suppressed by WDR82-Zc3H4 contain inefficiently spliced exons. a, Splicing efficiency at junctions (n = 6,280) of WDR82-sensitive lncRNAs (top)
P = 0. 011 Fig. 5 |
0115A first exon transcription termination checkpoint. a, Schematic drawing showing promoter/TSS inversions at sense/antisense transcription units. b, Snapshot of the MARCHF6-MARCHF6-AS genomic locus. Plus strand (red) and minus strand (orange) polyA-RNA-seq data in control, WDR82-depleted and ZC3H4-depleted HeLa cells are shown. c, Effects of the overexpression of ZC3H4(804-1303) on the sense and antisense transcriptional units of the MARCHF6 locus at wild-type and promoter-inverted alleles. Data are shown as mean ± s.d. from n = 4 independent experiments. *P < 0.05, ** P < 0.01, by two-tailed t-test. d, Schematic drawing showing the deletion of the first exon of pa-lncRNAs generated using CRISPR-Cas9 in HeLa cells. e, Effects of first exon deletion on pa-lncRNA transcription. On the left, polyA-RNA-seq data in control, WDR82-depleted and ZC3H4-depleted HeLa cells are shown (plus strand RNA, red; minus strand RNA, orange). The genomic regions deleted by CRISPR-Cas9 are indicated by red horizontal square brackets. Effects of WDR82 or ZC3H4 depletion on the transcription of the wild-type (WT) or first-exon-deleted (Del.) pa-lncRNAs are shown on the right. The bar plots show the mean ± s.d. of RNA fold changes measured in n = 4 independent experiments. P values obtained by two-tailed t-test are shown for the indicated comparisons. All the data were normalized based on the housekeeping gene NRSN2 or CDC25B. Del., deleted; WT, wild type.
siRNA-mediated knockdown of target genes in HeLa cells.For siRNA-mediated knockdown of WDR82 and ZC3H4 in HeLa cells, siRNAs from Santa Cruz were used: siWdr82 catalog no. sc-78161, siZC3H4 catalog no. sc-97377, and control siRNA a or b (catalog no. sc-37007 or sc-44230). For transfection of the siRNAs, Lipofectamine RNAiMAX reagent (catalog no. 13778150, Thermo Fisher) was used according to the manufacturer's protocol.Antibodies for western blots. The following antibodies were used: anti-WDR82 (catalog no. 99751, clone D2I3B, Cell Signaling Technologies), anti-PNUTS (catalog no. A300-440A, Bethyl Laboratories), anti-ARS2 (catalog no. A304-550A, Bethyl Laboratories), anti EXOSC3 (catalog no. Ab156683, Abcam), anti-CFI25m/ Nudt21 (catalog no. sc-81109, Sant Cruz Biotechnology), anti-VINCULIN (catalog no. V9131, Sigma), anti-ZC3H4 (catalog no. HPA040934, Sigma) and anti-ACTIN (catalog no. A2547, Sigma). Images were acquired using Chemidoc (Bio-Rad). Expression vectors. Full-length human ZC3H4 was cloned into pcDNA3.1 + N-terminal FLAG (DYK) tag expression vector (Genscript). Vectors corresponding to the ZC3H4 C-terminal fragment (aa 804-1303), the ZC3H4 N-terminal fragment (aa 1-803) and to the two smaller fragments of the ZC3H4 C-terminal portion (aa 804-1057 and aa 1057-1303) were PCR amplified from the full-length complementary DNA, sequenced and cloned into pcDNA3.1 + N-terminal FLAG (DYK).
ZC3H4 C terminus overexpression. Hela cells were transfected with 2.5 μg of the pCDNA3.1-ZC3H4(804-1303) or with the empty vector using Lipofectamine 2000 (cat no. 11668-019 Thermo Fisher). At 48 h post transfection, 4sU (sc-204628A, Santa Cruz Biotechnology) was added to the medium of the cells at a final concentration of 300 μM for 45 min before collection.
-immunoprecipitations. Total cell lysates (lysis buffer: 250 mM NaCl, 50 mM Tris-HCl pH 8.0, 0.5 mM EDTA, 0.5 mM EGTA and 0.2% NP-40) were obtained from: (1) wild-type RAW264.7 cells; (2) RAW264.7 cells infected with lentiviruses generated with the pScalp-Puro FLAG-ZC3H4 expression vector; (3) 293T cells transfected with pScalp-Puro FLAG-ZC3H4 expression vector; (4) 293T cells transfected with pCDNA3.1-based vectors encoding FLAG-ZC3H4 or its deletion mutants; and (5) HeLa cells transfected with pCDNA3.1-Flag-ZC3H4(804-1303) or with empty vector. Between 4 and 10 μg of anti-ZC3H4 antibody (no. HPA040934, Sigma) or Rabbit IgG (no. 011-000-003, ChromPure) was pre-bound to 100 μl of G protein-coupled paramagnetic beads (Dynabeads) in PBS/BSA 0.5%. Beads were then added to the Raw264.7 cell lysate. Flag-ZC3H4 was immunoprecipitated overnight using 100 μl of anti-Flag agarose beads (no. A2220, Sigma). Immunoprecipitates were washed extensively, eluted in Laemmli buffer (Bio-Rad no. 1610747), resolved by SDS-PAGE and immunoblotted with anti-Flag (no. F1804, Sigma), anti-ZC3H4 (no. HPA040934, Sigma), anti-WDR82 (no. 99715, clone D2I3B, Cell Signaling Technologies), anti-PNUTS (no. A300-440A, Bethyl Laboratories) and anti-RBPP5 (no. A300-109A, Sigma) antibodies.
Extended Data Fig. 2 |
2Interaction of WDR82 with the zinc finger protein Zc3H4. a,b, Immunoprecipitations were carried out either with an anti-Flag antibody on extracts of HEK-293 cells transduced with a Flag-mouse ZC3H4 expression vector (A) or with an anti-ZC3H4 rabbit polyclonal antibody on extracts from Raw264.7 mouse macrophages (B). Different parts of the western blot membrane were hybridized with the indicated antibodies. Data are representative of n=4 independent experiments. The position of molecular weight markers (kDa) is shown on the right. Uncropped images are available online as Source Data. c, Upper panel: Schematic representation of (A) the full length human ZC3H4 protein and (B to E) its deletion mutants used in transfection and co-immunoprecipitation experiments. The ZC3H4 domains annotated in UniProt are shown. Bottom panel: lysates from HEK-293 cells, either untransfected (-) or transduced with the indicated Flag-ZC3H4 expression vectors (A-E) were used in co-immunoprecipitation experiments with an anti-Flag antibody. Inputs (left) and immunoprecipitates (right) were immunoblotted and probed with an anti-FLAG (top) or an anti-WDR82 (bottom) antibody as indicated. The position of molecular weight markers (kDa) is shown on the right. Uncropped images are available online as Source Data. d, The Flag-tagged ZC3H4 C-terminal fragment (804-1303) was expressed in HeLa cells. Lysates were immunoprecipitated with an anti-ZC3H4 antibody directed against aa. 677-765 and blotted with anti-Flag or anti-WDR82 antibody. Inputs are shown on the left and molecular weight markers (kDa) on the right. Uncropped images are available online as Source Data. Extended Data Fig. 5 | Analysis of spliced and unspliced lncRNAs suppressed by WDR82. Extragenic transcripts upregulated upon WDR82 depletion in mouse macrophages (n=2,870; top) or in HeLa cells (n=1,509; bottom) were first divided into spliced (left) and unspliced RNA species (right). Then within each of these two groups they were further divided based on their overlap with lncRNAs in the NONCODE v5 database of non-coding RNAs, classified into single exon and multi-exonic ncRNAs. Extended Data Fig. 7 | Relationship between gene transcript expression and splicing efficiency. a, Genes were ranked into deciles of decreasing expression based on 4sU-seq data in macrophages (left) and HeLa cells (right). In both panels, expression of the lncRNAs upregulated in WDR82-depleted cells is shown in the red boxes on the right. Data are from n=3 independent experiments. b, Splicing efficiency of the 1 st exon of the ranked genes was measured by dividing the sequencing reads in the 10nt upstream by those in the 10nt downstream of the 5′ splice junction in polyA RNA-seq data. Left: macrophages (n=6,280 junctions); right: HeLa (n=8,804 junctions). Data are from n=3 independent experiments. Boxes show values between the first and the third quartile. The lower and upper whisker show the smallest and the highest value, respectively. Outliers are not shown. The notches correspond to ~95% confidence interval for the median. Extended Data Fig. 9 | characterization of splicing efficiency and splice site quality of extragenic transcripts not affected by WDR82 depletion. a, log2-transformed ratio of polyA RNA-seq reads upstream and downstream of the 5′ splice sites of WDR82-suppressed and WDR82-insensitive lncRNAs in HeLa cells. Statistical significance was assessed using the two-tailed Wilcoxon rank sum test (p-value= 1.8e-175 for the controls and p-value=1.3e-199 in WDR82-depleted cells). ***p-value < 0.01. Data are from n=3 independent experiments. b, Analysis of 5′ (left) and 3′ (right) splice site strength at WDR82-suppressed and WDR82-insensitive lncRNAs in HeLa cells. MaxEnt scores for both donor and acceptor splice sites were measured. Statistical significance was assessed using the two-tailed Wilcoxon rank sum test in correspondence of both the 5′ (p-value= 1.3e-20) and the 3′ (p-value= 3e-04) splice sites. *** p-value < 0.01. Data are from n=3 independent experiments. Boxes show values between the first and the third quartile. The lower and upper whisker show the smallest and the highest value, respectively. Outliers are not shown. The notches correspond to ~95% confidence interval for the median. Extended Data Fig. 10 | First exon deletions in protein coding genes. a, Schematic representation of the deletion of the first exons of protein coding genes. sgRNAs were designed to remove a genomic sequence that included the first exon from 30-50 nt downstream of the TSS to the intronic sequences just downstream of the 5′ splice site. b, Expression of the indicated gene mRNAs was measured by qRT-PCR in bulk populations of wild type or first exon-deleted HeLa cells after transduction of the indicated siRNAs. Primers used were specific for spliced mRNAs and were designed on downstream exons (Methods). The plot shows the mean ± s.d. of n=3 independent experiments. * P < 0.05; **P < 0.01, by two tailed t-test. The data were normalized on the housekeeping gene NRSN2. P-values for COG2: WT vs. DEL siCtl = 1.75E-07; DEL siCtl vs. siWdr82 = 0.78 (n.s.); DEL siCtl vs. siWdr82 = 0.80 (n.s.). P-values for FAM174a: WT vs. DEL siCtl = 0.0005; DEL siCtl vs. siWdr82 = 0.85 (n.s.); DEL siCtl vs. siWdr82 = 0.15 (n.s.). P-values for RRP15: WT vs. DEL siCtl = 0.013; DEL siCtl vs. siWdr82 = 0.70 (n.s.); DEL siCtl vs. siWdr82 = 0.65 (n.s.)
i and Supplementary Table 3). A representative snapshot is shown inFig. 1j. Overall, these data indicate that the WDR82-ZC3H4 complex is a repressor of extragenic transcription.Recruitment of WDR82 and ZC3H4 at sites of high RNA Pol II occupancy. We next used ChIP-seq to determine the genomic distribution of WDR82 and ZC3H4 and their overlap. By intersecting two biological ChIP-seq replicates generated for each protein in mouse macrophage Raw264.7 cells, we obtained a high-confidence set of 13,065 genomic regions bound by WDR82 and a set of 6,903Fig. 1 | Effects of Zc3H4 depletion on extragenic transcription. a, Schematic representation of the ZC3H4 protein with annotated domains. P-rich, proline-rich region; CC, coiled-coil; RGG, arginine-glycine-rich domain; SR, arginine-serine dipeptide-rich motif; C3H1, CCCH-type Zn fingers.Enhancer
TSS
T ES
ZC3H4 only
ZC3H4 WDR82
28%
26%
46%
24%
9%
67%
86%
14%
ZC3H4(804-1303)
Vector
4sU normalized read count (log
2 )
0
1
2
3
0
1
2
3
Overlap
68.94%
No overlap
31.06%
sh versus scramble (log
2 fold change)
Control
H3K4me3
H3K4me1
H3K27Ac
Control
Pfpl
Mpeg1
Lgals3
10 kb
10 kb
Anti-
sense
Sense
0
1
2
3
4
0
0.5
1.0
1.5
siWDR82
siZC3H4
siCTRL
***
***
n = 1,509
4sU normalized read count (log
2 )
0
0.5
1.0
1.5
Vector
ZC3H4
(804-1303)
***
4sU normalized read count (log
2 )
a
b
c
e
f
g
h
i
j
MEF2D
WDR82
depletion
ZC3H4
depletion
Control
WDR82
depletion
ZC3H4
depletion
Empty
vector
ZC3H4
(804-1303)
chr1:156,432,000-156,488,000
chr19:12,425,500-12,466,500
chr14:47,332,000-47,388,000
siWDR82
siZC3H4
siCTRL
siWDR82
siZC3H4
siCTRL
1
1303
P-rich
3×
C3H1
P-rich
RGG
SR
CC
CC
800
d
***
***
-2
0
2
4
n = 915
ZC3H4
WDR82
Exosc3
Ars2
Ints11
CFIm25
Xrn2
b, Overlap between extragenic transcripts upregulated upon ZC3H4 depletion (n = 915) and those upregulated upon WDR82 depletion (n = 3) in mouse
macrophages. Genomic annotation of transcripts concordantly upregulated upon depletion of ZC3H4 and WDR82 or transcripts upregulated only
upon depletion of ZC3H4. Data from n = 3 independent experiments are shown. c, Effects of the depletion of ZC3H4 and other termination factors on
transcription of extragenic regions suppressed by WDR82 in mouse macrophages. Data from n = 3 independent experiments are shown. d, Representative
genomic regions showing the effects of WDR82 and ZC3H4 depletion on extragenic transcription in macrophages. Red and orange tracks correspond to
plus and minus strand RNAs, respectively. e, Upregulation of extragenic transcription in HeLa cells depleted of WDR82 or ZC3H4 by siRNA transfection.
Read counts at n = 1,513 extragenic regions upregulated in HeLa cells depleted of WDR82 are reported. Data from n = 3 independent experiments
are shown. Statistical significance was assessed using the two-tailed Wilcoxon signed rank test (P < 2.2 × 10 −16 in both comparisons). ***P < 0.01.
f, Promoter-antisense RNAs (n = 429) upregulated in 4sU-seq datasets upon WDR82 or ZC3H4 depletion in HeLa cells. Transcription of the paired
sense (coding) RNAs is shown. Data from n = 3 independent experiments are shown. Statistical significance was assessed using the two-tailed Wilcoxon
signed rank test for the comparison between siWDR82 versus siCTRL (P = 1.9 × 10 −210 ) and siZC3H4 versus siCTRL (P = 1.1 × 10 −203 ). ***P < 0.01. g, Effects
of ZC3H4(804-1303) overexpression on transcription of the n = 1,509 extragenic regions upregulated in WDR82-depleted HeLa cells. Data from n = 3
independent experiments are shown. Statistical significance was assessed using the two-tailed Wilcoxon signed rank test (P < 2.2 × 10 −16 ). h, The same
data as in g were represented as a scatter plot. i, Overlap of the transcripts upregulated upon overexpression of ZC3H4(804-1303) and the transcripts
upregulated in HeLa cells depleted of WDR82 or ZC3H4. j, A representative genomic region showing MEF2D sense and promoter-antisense transcription
in HeLa cells depleted of WDR82 or ZC3H4 or over-expressing ZC3H4(804-1303). For c, e and f, the median value for each fold change is shown with a
horizontal black line. Boxes show values between the first and the third quartiles. The lower and upper whiskers show the smallest and the highest values,
respectively. Outliers are not shown. The notches correspond to ~95% confidence interval for the median.
1 2 3 4
Quartiles
(ZC3H4 enrichment)
1 2 3 4
Overlap with
ZC3H4 peaks (%)
Quartiles
(ZC3H4 enrichment)
0
20
40
60
80
100
Quartiles
(ZC3H4 enrichment)
1 2 3 4
RNA Pol II enrichment (log
2 )
Quartiles
(ZC3H4 enrichment)
a
b
c
d
ZC3H4
WDR82
Coverage
-10
+10
kb from midpoint
e
g
999
1,307
1,510
1,612
1,180
1,454
1,568
1,597
f
Ltbp3
Scyl1
Malat1
N eat1
Frmd8
Lst1
Ltb Tnf
N fkbil
Ddx39b
(0-4)
(0-1.2)
(0-8)
(0-180)
(0-300)
(0-3)
(0-8)
(0-8)
(0-320)
(0-300)
WDR82
ZC3H4
RNA Pol II
H3K4me3
H3K27ac
WDR82
ZC3H4
RNA Pol II
H3K4me3
H3K27ac
chr19:5,740,000-5,880,000
chr17:35,180,300-35,258,000
RNA Pol II
-10
+10
-10
+10
kb from midpoint
kb from midpoint
was significantly, albeit only moderately, lower at both the 5′ and the 3′ splice sites of WDR82-ZC3H4-suppressedH3K4me3
H3K4me1
H3K27ac
Control
WDR82
depletion
T092081.1
T018787.2
T018786.2
T018770.2
G011683.3
50 kb
G011672.2
T018753.2 T092079.1
Lncenc1
as well as appropriately located DNA sequences amenable to targeting by single guide RNAs (sgRNAs)a
b
c
Read counts
(median)
-10 nt
5′ splice site
10 nt
mRNAs
Read counts
(median)
-10 nt
5′ splice site
10 nt
0
200
400
600
800
1,000
1,200
0
20
40
60
80
100
Scramble
WDR82 sh
Scramble
WDR82 sh
WDR82-suppressed lncRNAs
WDR82 sh
+
+
log
2 ratio
(-10 nt before 5′ ss/+10 nt after 5′ ss)
-
-
lncRNAs
mRNAs
-10
-5
0
5
10
15
20
25
mRNAs
5′ splice site
l n c R
N
A s
m
R
N
A s
5′ ss MaxEnt score
***
-3
+6
-3
+6
mRNAs
-20
+3
-20
+3
0
5
10
15
l n c R
N
A s
m
R
N
A s
3′ ss MaxEnt score
3′ splice site
Table 10 .
10Datasets generated in this study are available in the Gene Expression Omnibus (GEO) database under the accession number GSE133109. Source data are provided with this paper.Extended DataFig. 1| Extragenic transcription in cells depleted of WDR82 or other transcription terminators. a, The effects of the depletion of known termination factors on extragenic transcription was measured by 4sU labeling and sequencing in mouse bone marrow-derived macrophages. We considered the n=2,870 extragenic regions whose transcription was increased in macrophages depleted of WDR82 at 45′ after LPS stimulation and measured their 4sU labeling in macrophages depleted of the indicated proteins. Each transcript was assigned to the nearest annotated enhancer, Transcription Start Site (TSS) or Transcription End Site (TES). The log2-transformed fold change (sh vs. scramble) for each depletion experiment is shown. Statistical significance was assessed using the two-tailed Wilcoxon signed rank test and a p-value ≤ 0.01 was considered significant. p-values for transcripts assigned to Enhancers: Exosc3 p-value= 2.2e-208, Ars2 p-value= 2.9e-206, Ints11 p-value= 1.4e-217, CFIm25 p-value= 4.4e-189, Xrn2 p-value= 9.2e-239. p-values for transcripts assigned to TSS: Exosc3 p-value= 4.6e-69, Ars2 p-value= 3.7e-73, Ints11 p-value= 1.6e-72, CFIm25 p-value= 7.1e-72, Xrn2 p-value= 7.8e-101. p-values for transcripts assigned to TES: Exosc3 p-value= 1.5e-14, Ars2 p-value= 5.8e-10, Ints11 p-value= 6.7e-26, CFIm25 p-value= 0.149775, Xrn2 p-value= 1.0e-81. *** = p-value <0.01. ns: not statistically significant. Inside the boxplot, the median value for each fold change is shown with a horizontal black line. Boxes show values between the first and the third quartile. The lower and upper whisker show the smallest and the highest value, respectively. Outliers are not shown. The notches correspond to ~95% confidence interval for the median. b, Comparison of the effects of the depletion of WDR82 and INTS11 on transcription termination at snRNA genes. c, A representative genomic region on mouse chromosome 11 containing multiple snRNA genes. d, Snapshots of genomic regions showing the effects of the depletion of WDR82 and other termination factors on extragenic transcription.
NAtuRE StRuctuRAL & MoLEcuLAR BIoLoGy | VOL 28 | APRIL 2021 | 337-346 | www.nature.com/nsmb
© The Author(s), under exclusive licence to Springer Nature America, Inc. 2021 NAtuRE StRuctuRAL & MoLEcuLAR BIoLoGy | VOL 28 | APRIL 2021 | 337-346 | www.nature.com/nsmb
NAtuRE StRuctuRAL & MoLEcuLAR BIoLoGy | www.nature.com/nsmb
NAtuRE StRuCtuRAl & MolECulAR BIology Extended Data Fig. 3 | See next page for caption. NAtuRE StRuctuRAL & MoLEcuLAR BIoLoGy | www.nature.com/nsmb
AcknowledgementsWe thank B. Amati (IEO) and S. Monticelli (IRB, Bellinzona) for critical comments on the manuscript. This work was supported by the European Research Council (Advanced ERC grant no. 692789 to G.N).Author contributionsL.M.I.A., V.P., M.R. and G.N. conceptualized the study. L.M.I.A. and M.R. generated all data with contributions from E.P., D.P., S.G. and G.R.D. V.P. analyzed all data withcompeting interestsThe authors declare no competing interests.Additional informationExtended data is available for this paper at https://doi.org/10.1038/s41594-021-00572-y.Supplementary informationThe online version contains supplementary material available at https://doi.org/10.1038/s41594-021-00572-y.Correspondence and requests for materials should be addressed to L.M.I.A. or G.N.Peer review information Nature Structural & Molecular Biology thanks ChristopherGlass and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. Peer reviewer reports are available. Anke Sparmann was the primary editor on this article and managed its editorial process and peer review in collaboration with the rest of the editorial team.Reprints and permissions information is available at www.nature.com/reprints.
Recognition of cap structure in splicing in vitro of mRNA precursors. M M Konarska, R A Padgett, P A Sharp, Cell. 38Konarska, M. M., Padgett, R. A. & Sharp, P. A. Recognition of cap structure in splicing in vitro of mRNA precursors. Cell 38, 731-736 (1984).
A nuclear cap binding protein complex involved in pre-mRNA splicing. E Izaurralde, Cell. 78Izaurralde, E. et al. A nuclear cap binding protein complex involved in pre-mRNA splicing. Cell 78, 657-668 (1994).
Splicing and transcription touch base: co-transcriptional spliceosome assembly and function. L Herzel, D S M Ottoz, T Alpert, K M Neugebauer, Nat. Rev. Mol. Cell Biol. 18Herzel, L., Ottoz, D. S. M., Alpert, T. & Neugebauer, K. M. Splicing and transcription touch base: co-transcriptional spliceosome assembly and function. Nat. Rev. Mol. Cell Biol. 18, 637-650 (2017).
Stimulatory effect of splicing factors on transcriptional elongation. Y W Fong, Q Zhou, Nature. 414Fong, Y. W. & Zhou, Q. Stimulatory effect of splicing factors on transcriptional elongation. Nature 414, 929-933 (2001).
The splicing factor SC35 has an active role in transcriptional elongation. S Lin, G Coutinho-Mansfield, D Wang, S Pandit, X D Fu, Nat. Struct. Mol. Biol. 15Lin, S., Coutinho-Mansfield, G., Wang, D., Pandit, S. & Fu, X. D. The splicing factor SC35 has an active role in transcriptional elongation. Nat. Struct. Mol. Biol. 15, 819-826 (2008).
SR proteins collaborate with 7SK and promoter-associated nascent RNA to release paused polymerase. X Ji, Cell. 153Ji, X. et al. SR proteins collaborate with 7SK and promoter-associated nascent RNA to release paused polymerase. Cell 153, 855-868 (2013).
SR proteins function in coupling RNAP II transcription to pre-mRNA splicing. R Das, Mol. Cell. 26Das, R. et al. SR proteins function in coupling RNAP II transcription to pre-mRNA splicing. Mol. Cell 26, 867-881 (2007).
A 5′ splice site enhances the recruitment of basal transcription initiation factors in vivo. C K Damgaard, Mol. Cell. 29Damgaard, C. K. et al. A 5′ splice site enhances the recruitment of basal transcription initiation factors in vivo. Mol. Cell 29, 271-278 (2008).
Recognition of trimethylated histone H3 lysine 4 facilitates the recruitment of transcription postinitiation factors and pre-mRNA splicing. R J Sims, Iii, Mol. Cell. 28Sims, R. J. III. et al. Recognition of trimethylated histone H3 lysine 4 facilitates the recruitment of transcription postinitiation factors and pre-mRNA splicing. Mol. Cell 28, 665-676 (2007).
SWI/SNF associates with nascent pre-mRNPs and regulates alternative pre-mRNA processing. A Tyagi, J Ryme, D Brodin, A K Ostlund Farrants, N Visa, PLoS Genet. 51000470Tyagi, A., Ryme, J., Brodin, D., Ostlund Farrants, A. K. & Visa, N. SWI/SNF associates with nascent pre-mRNPs and regulates alternative pre-mRNA processing. PLoS Genet. 5, e1000470 (2009).
Distinct and predictive chromatin signatures of transcriptional promoters and enhancers in the human genome. N Heintzman, Nat. Genet. 39Heintzman, N. et al. Distinct and predictive chromatin signatures of transcriptional promoters and enhancers in the human genome. Nat. Genet. 39, 311-318 (2007).
A large fraction of extragenic RNA pol II transcription sites overlap enhancers. F De Santa, PLoS Biol. 81000384De Santa, F. et al. A large fraction of extragenic RNA pol II transcription sites overlap enhancers. PLoS Biol. 8, e1000384 (2010).
Widespread transcription at neuronal activity-regulated enhancers. T K Kim, Nature. 465Kim, T. K. et al. Widespread transcription at neuronal activity-regulated enhancers. Nature 465, 182-187 (2010).
Noncoding transcription at enhancers: general principles and functional models. G Natoli, J C Andrau, Annu. Rev. Genet. 46Natoli, G. & Andrau, J. C. Noncoding transcription at enhancers: general principles and functional models. Annu. Rev. Genet. 46, 1-19 (2012).
Chromatin signatures at transcriptional start sites separate two equally populated yet distinct classes of intergenic long noncoding RNAs. A C Marques, Genome Biol. 14131Marques, A. C. et al. Chromatin signatures at transcriptional start sites separate two equally populated yet distinct classes of intergenic long noncoding RNAs. Genome Biol. 14, R131 (2013).
An atlas of human long non-coding RNAs with accurate 5′ ends. C C Hon, Nature. 543Hon, C. C. et al. An atlas of human long non-coding RNAs with accurate 5′ ends. Nature 543, 199-204 (2017).
Local regulation of gene expression by lncRNA promoters, transcription and splicing. J M Engreitz, Nature. 539Engreitz, J. M. et al. Local regulation of gene expression by lncRNA promoters, transcription and splicing. Nature 539, 452-455 (2016).
Production of spliced long noncoding RNAs specifies regions with increased enhancer activity. N Gil, I Ulitsky, Cell Syst. 7Gil, N. & Ulitsky, I. Production of spliced long noncoding RNAs specifies regions with increased enhancer activity. Cell Syst. 7, 537-547.e3 (2018).
Splicing of enhancer-associated lincRNAs contributes to enhancer activity. J Y Tan, A Biasini, R S Young, A C Marques, Life Sci. Alliance. 3202000663Tan, J. Y., Biasini, A., Young, R. S. & Marques, A. C. Splicing of enhancer-associated lincRNAs contributes to enhancer activity. Life Sci. Alliance 3, e202000663 (2020).
Functionality or transcriptional noise? Evidence for selection within long noncoding RNAs. J Ponjavic, C P Ponting, G Lunter, Genome Res. 17Ponjavic, J., Ponting, C. P. & Lunter, G. Functionality or transcriptional noise? Evidence for selection within long noncoding RNAs. Genome Res. 17, 556-565 (2007).
Purifying selection on splice-related motifs, not expression level nor RNA folding, explains nearly all constraint on human lincRNAs. A Schuler, A T Ghanbarian, L D Hurst, Mol. Biol. Evol. 31Schuler, A., Ghanbarian, A. T. & Hurst, L. D. Purifying selection on splice-related motifs, not expression level nor RNA folding, explains nearly all constraint on human lincRNAs. Mol. Biol. Evol. 31, 3164-3183 (2014).
Transcription initiation platforms and GTF recruitment at tissue-specific enhancers and promoters. F Koch, Nat. Struct. Mol. Biol. 18Koch, F. et al. Transcription initiation platforms and GTF recruitment at tissue-specific enhancers and promoters. Nat. Struct. Mol. Biol. 18, 956-963 (2011).
Wdr82 is a C-terminal domain-binding protein that recruits the Setd1A histone H3-Lys4 methyltransferase complex to transcription start sites of transcribed human genes. J H Lee, D G Skalnik, Mol. Cell. Biol. 28Lee, J. H. & Skalnik, D. G. Wdr82 is a C-terminal domain-binding protein that recruits the Setd1A histone H3-Lys4 methyltransferase complex to transcription start sites of transcribed human genes. Mol. Cell. Biol. 28, 609-618 (2008).
Transcription of mammalian cis-regulatory elements is restrained by actively enforced early termination. L M Austenaa, Mol. Cell. 60Austenaa, L. M. et al. Transcription of mammalian cis-regulatory elements is restrained by actively enforced early termination. Mol. Cell 60, 460-474 (2015).
Molecular regulation of H3K4 trimethylation by Wdr82, a component of human Set1/COMPASS. M Wu, Mol. Cell. Biol. 28Wu, M. et al. Molecular regulation of H3K4 trimethylation by Wdr82, a component of human Set1/COMPASS. Mol. Cell. Biol. 28, 7337-7344 (2008).
Identification and characterization of a novel human PP1 phosphatase complex. J H Lee, J You, E Dobrota, D G Skalnik, J. Biol. Chem. 285Lee, J. H., You, J., Dobrota, E. & Skalnik, D. G. Identification and characterization of a novel human PP1 phosphatase complex. J. Biol. Chem. 285, 24466-24476 (2010).
Integrator, a multiprotein mediator of small nuclear RNA processing, associates with the C-terminal repeat of RNA polymerase II. D Baillat, Cell. 123Baillat, D. et al. Integrator, a multiprotein mediator of small nuclear RNA processing, associates with the C-terminal repeat of RNA polymerase II. Cell 123, 265-276 (2005).
Integrator mediates the biogenesis of enhancer RNAs. F Lai, A Gardini, A Zhang, R Shiekhattar, Nature. 525Lai, F., Gardini, A., Zhang, A. & Shiekhattar, R. Integrator mediates the biogenesis of enhancer RNAs. Nature 525, 399-403 (2015).
RNA exosome depletion reveals transcription upstream of active human promoters. P Preker, Science. 322Preker, P. et al. RNA exosome depletion reveals transcription upstream of active human promoters. Science 322, 1851-1854 (2008).
The human cap-binding complex is functionally connected to the nuclear RNA exosome. P R Andersen, Nat. Struct. Mol. Biol. 20Andersen, P. R. et al. The human cap-binding complex is functionally connected to the nuclear RNA exosome. Nat. Struct. Mol. Biol. 20, 1367-1376 (2013).
Latent enhancers activated by stimulation in differentiated cells. R Ostuni, Cell. 152Ostuni, R. et al. Latent enhancers activated by stimulation in differentiated cells. Cell 152, 157-171 (2013).
Quantitative dissection and stoichiometry determination of the human SET1/MLL histone methyltransferase complexes. R Van Nuland, Mol. Cell. Biol. 33van Nuland, R. et al. Quantitative dissection and stoichiometry determination of the human SET1/MLL histone methyltransferase complexes. Mol. Cell. Biol. 33, 2067-2077 (2013).
Structure and transcription of the Drosophila melanogaster vermilion gene and several mutant alleles. L L Searles, R S Ruth, A M Pret, R A Fridell, A J Ali, Mol. Cell. Biol. 10Searles, L. L., Ruth, R. S., Pret, A. M., Fridell, R. A. & Ali, A. J. Structure and transcription of the Drosophila melanogaster vermilion gene and several mutant alleles. Mol. Cell. Biol. 10, 1423-1431 (1990).
A retrotransposon 412 insertion within an exon of the Drosophila melanogaster vermilion gene is spliced from the precursor RNA. R A Fridell, A M Pret, L L Searles, Genes Dev. 4Fridell, R. A., Pret, A. M. & Searles, L. L. A retrotransposon 412 insertion within an exon of the Drosophila melanogaster vermilion gene is spliced from the precursor RNA. Genes Dev. 4, 559-566 (1990).
Suppressor of sable [Su(s)] and Wdr82 down-regulate RNA from heat-shock-inducible repetitive elements by a mechanism that involves transcription termination. P Brewer-Jensen, RNA. 22Brewer-Jensen, P. et al. Suppressor of sable [Su(s)] and Wdr82 down-regulate RNA from heat-shock-inducible repetitive elements by a mechanism that involves transcription termination. RNA 22, 139-154 (2016).
Insights into RNA biology from an atlas of mammalian mRNA-binding proteins. A Castello, Cell. 149Castello, A. et al. Insights into RNA biology from an atlas of mammalian mRNA-binding proteins. Cell 149, 1393-1406 (2012).
The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. A G Baltz, Mol. Cell. 46Baltz, A. G. et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Mol. Cell 46, 674-690 (2012).
The RNA-binding protein repertoire of embryonic stem cells. S C Kwon, Nat. Struct. Mol. Biol. 20Kwon, S. C. et al. The RNA-binding protein repertoire of embryonic stem cells. Nat. Struct. Mol. Biol. 20, 1122-1130 (2013).
RNA-binding proteins in immune regulation: a focus on CCCH zinc finger proteins. M Fu, P J Blackshear, Nat. Rev. Immunol. 17Fu, M. & Blackshear, P. J. RNA-binding proteins in immune regulation: a focus on CCCH zinc finger proteins. Nat. Rev. Immunol. 17, 130-143 (2017).
How arginine-rich domains coordinate mRNA maturation events. K S Godin, G Varani, RNA Biol. 4Godin, K. S. & Varani, G. How arginine-rich domains coordinate mRNA maturation events. RNA Biol. 4, 69-75 (2007).
Molecular architecture of the human pre-mRNA 3′ processing complex. Y Shi, Mol. Cell. 33Shi, Y. et al. Molecular architecture of the human pre-mRNA 3′ processing complex. Mol. Cell 33, 365-376 (2009).
Control of RNA Pol II Speed by PNUTS-PP1 and Spt5 Dephosphorylation Facilitates Termination by a "Sitting Duck Torpedo" Mechanism. M A Cortazar, Mol. Cell. 76Cortazar, M. A. et al. Control of RNA Pol II Speed by PNUTS-PP1 and Spt5 Dephosphorylation Facilitates Termination by a "Sitting Duck Torpedo" Mechanism. Mol. Cell 76, 896-908.e4 (2019).
Divergent transcription of long noncoding RNA/mRNA gene pairs in embryonic stem cells. A A Sigova, Proc. Natl Acad. Sci. USA. 110Sigova, A. A. et al. Divergent transcription of long noncoding RNA/mRNA gene pairs in embryonic stem cells. Proc. Natl Acad. Sci. USA 110, 2876-2881 (2013).
Universal alternative splicing of noncoding exons. I W Deveson, Cell Syst. 6Deveson, I. W. et al. Universal alternative splicing of noncoding exons. Cell Syst. 6, 245-255 (2018).
Chromatin environment, transcriptional regulation, and splicing distinguish lincRNAs and mRNAs. M Mele, Genome Res. 27Mele, M. et al. Chromatin environment, transcriptional regulation, and splicing distinguish lincRNAs and mRNAs. Genome Res. 27, 27-37 (2017).
Maximum entropy modeling of short sequence motifs with applications to RNA splicing signals. G Yeo, C B Burge, J. Comput. Biol. 11Yeo, G. & Burge, C. B. Maximum entropy modeling of short sequence motifs with applications to RNA splicing signals. J. Comput. Biol. 11, 377-394 (2004).
Predictive identification of exonic splicing enhancers in human genes. W G Fairbrother, R F Yeh, P A Sharp, C B Burge, Science. 297Fairbrother, W. G., Yeh, R. F., Sharp, P. A. & Burge, C. B. Predictive identification of exonic splicing enhancers in human genes. Science 297, 1007-1013 (2002).
The evolution, impact and properties of exonic splice enhancers. E F Caceres, L D Hurst, Genome Biol. 14143Caceres, E. F. & Hurst, L. D. The evolution, impact and properties of exonic splice enhancers. Genome Biol. 14, R143 (2013).
Human gene promoters are intrinsically bidirectional. R Andersson, Mol. Cell. 60Andersson, R. et al. Human gene promoters are intrinsically bidirectional. Mol. Cell 60, 346-347 (2015).
Divergent transcription from active promoters. A C Seila, Science. 322Seila, A. C. et al. Divergent transcription from active promoters. Science 322, 1849-1851 (2008).
U1 snRNP protects pre-mRNAs from premature cleavage and polyadenylation. D Kaida, Nature. 468Kaida, D. et al. U1 snRNP protects pre-mRNAs from premature cleavage and polyadenylation. Nature 468, 664-668 (2010).
Promoter directionality is controlled by U1 snRNP and polyadenylation signals. A E Almada, X Wu, A J Kriz, C B Burge, P A Sharp, Nature. 499Almada, A. E., Wu, X., Kriz, A. J., Burge, C. B. & Sharp, P. A. Promoter directionality is controlled by U1 snRNP and polyadenylation signals. Nature 499, 360-363 (2013).
Polyadenylation site-induced decay of upstream transcripts enforces promoter directionality. E Ntini, Nat. Struct. Mol. Biol. 20Ntini, E. et al. Polyadenylation site-induced decay of upstream transcripts enforces promoter directionality. Nat. Struct. Mol. Biol. 20, 923-928 (2013).
The Drosophila suppressor of sable protein binds to RNA and associates with a subset of polytene chromosome bands. M V Murray, M A Turnage, K J Williamson, W R Steinhauer, L L Searles, Mol. Cell. Biol. 17Murray, M. V., Turnage, M. A., Williamson, K. J., Steinhauer, W. R. & Searles, L. L. The Drosophila suppressor of sable protein binds to RNA and associates with a subset of polytene chromosome bands. Mol. Cell. Biol. 17, 2291-2300 (1997).
Mammalian NET-seq reveals genome-wide nascent transcription coupled to RNA processing. T Nojima, Cell. 161Nojima, T. et al. Mammalian NET-seq reveals genome-wide nascent transcription coupled to RNA processing. Cell 161, 526-540 (2015).
RNA polymerase II phosphorylated on CTD serine 5 interacts with the spliceosome during co-transcriptional splicing. T Nojima, Mol. Cell. 72Nojima, T. et al. RNA polymerase II phosphorylated on CTD serine 5 interacts with the spliceosome during co-transcriptional splicing. Mol. Cell 72, 369-379.e4 (2018).
Large-scale remodeling of a repressed exon ribonucleoprotein to an exon definition complex active for splicing. S P Wongpalee, 519743Wongpalee, S. P. et al. Large-scale remodeling of a repressed exon ribonucleoprotein to an exon definition complex active for splicing. Elife 5, e19743 (2016).
Genomic accumulation of retrotransposons was facilitated by repressive RNA-binding proteins: a hypothesis. J Attig, J Ule, Bioessays. 411800132Attig, J. & Ule, J. Genomic accumulation of retrotransposons was facilitated by repressive RNA-binding proteins: a hypothesis. Bioessays 41, e1800132 (2019).
Transposable elements reveal a stem cell-specific class of long noncoding RNAs. D Kelley, J Rinn, Genome Biol. 13107Kelley, D. & Rinn, J. Transposable elements reveal a stem cell-specific class of long noncoding RNAs. Genome Biol. 13, R107 (2012).
Estimating the selective effects of heterozygous protein-truncating variants from human exome data. C A Cassa, Nat. Genet. 49Cassa, C. A. et al. Estimating the selective effects of heterozygous protein-truncating variants from human exome data. Nat. Genet. 49, 806-810 (2017).
Publisher's note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Publisher's note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
The histone methyltransferase Wbp7 controls macrophage function through GPI glycolipid anchor synthesis. L Austenaa, Immunity. 36Austenaa, L. et al. The histone methyltransferase Wbp7 controls macrophage function through GPI glycolipid anchor synthesis. Immunity 36, 572-585 (2012).
The histone H3 lysine-27 demethylase Jmjd3 links inflammation to inhibition of Polycomb-mediated gene silencing. F De Santa, Cell. 130De Santa, F. et al. The histone H3 lysine-27 demethylase Jmjd3 links inflammation to inhibition of Polycomb-mediated gene silencing. Cell 130, 1083-1094 (2007).
Co-optation of tandem DNA repeats for the maintenance of mesenchymal identity. C Balestrieri, Cell. 173Balestrieri, C. et al. Co-optation of tandem DNA repeats for the maintenance of mesenchymal identity. Cell 173, 1150-1164.e14 (2018).
Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. T Sakuma, A Nishikawa, S Kume, K Chayama, T Yamamoto, Sci. Rep. 45400Sakuma, T., Nishikawa, A., Kume, S., Chayama, K. & Yamamoto, T. Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci. Rep. 4, 5400 (2014).
Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. C Trapnell, Nat. Protoc. 7Trapnell, C. et al. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat. Protoc. 7, 562-578 (2012).
Fast gapped-read alignment with Bowtie 2. B Langmead, S L Salzberg, Nat. Methods. 9Langmead, B. & Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 9, 357-359 (2012).
A clustering approach for identification of enriched domains from histone modification ChIP-seq data. C Zang, Bioinformatics. 25Zang, C. et al. A clustering approach for identification of enriched domains from histone modification ChIP-seq data. Bioinformatics 25, 1952-1958 (2009).
BEDTools: a flexible suite of utilities for comparing genomic features. A R Quinlan, I M Hall, Bioinformatics. 26Quinlan, A. R. & Hall, I. M. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841-842 (2010).
Transcribed enhancers lead waves of coordinated transcription in transitioning mammalian cells. E Arner, Science. 347Arner, E. et al. Transcribed enhancers lead waves of coordinated transcription in transitioning mammalian cells. Science 347, 1010-1014 (2015).
Super-enhancers in the control of cell identity and disease. D Hnisz, Cell. 155Hnisz, D. et al. Super-enhancers in the control of cell identity and disease. Cell 155, 934-947 (2013).
featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Y Liao, G K Smyth, W Shi, Bioinformatics. 30Liao, Y., Smyth, G. K. & Shi, W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923-930 (2014).
Trimmomatic: a flexible trimmer for Illumina sequence data. A M Bolger, M Lohse, B Usadel, Bioinformatics. 30Bolger, A. M., Lohse, M. & Usadel, B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114-2120 (2014).
The ENCODE blacklist: identification of problematic regions of the genome. H M Amemiya, A Kundaje, A P Boyle, Sci. Rep. 99354Amemiya, H. M., Kundaje, A. & Boyle, A. P. The ENCODE blacklist: identification of problematic regions of the genome. Sci. Rep. 9, 9354 (2019).
deepTools2: a next generation web server for deep-sequencing data analysis. F Ramirez, Nucleic Acids Res. 44Ramirez, F. et al. deepTools2: a next generation web server for deep-sequencing data analysis. Nucleic Acids Res. 44, W160-W165 (2016).
Splicing of long non-coding RNAs primarily depends on polypyrimidine tract and 5′ splice-site sequences due to weak interactions with SR proteins. Z Krchnakova, Nucleic Acids Res. 47Krchnakova, Z. et al. Splicing of long non-coding RNAs primarily depends on polypyrimidine tract and 5′ splice-site sequences due to weak interactions with SR proteins. Nucleic Acids Res. 47, 911-928 (2019).
Integrative genomics viewer. J T Robinson, Nat. Biotechnol. 29Robinson, J. T. et al. Integrative genomics viewer. Nat. Biotechnol. 29, 24-26 (2011).
generated and processed sequencing libraries. G.N. wrote the manuscript with contributions from all authors. G.N. supervised the study. G.N. was responsible for funding acquisition. I.B. S.P.contributions from I.B. S.P. generated and processed sequencing libraries. G.N. wrote the manuscript with contributions from all authors. G.N. supervised the study. G.N. was responsible for funding acquisition.
The effects of WDR82, ZC3H4 or their combined depletion by siRNA transfection were measured on selected extragenic transcripts, as indicated. In co-depletion experiments, a double amount of siRNA was used, as indicated. The bar plots show the mean ± SD of n=4 biological replicates. The data were normalized on the housekeeping gene CDC25b. Light grey columns: 30pmol siRNA, dark grey columns, 60pmol siRNA. b, Depletion efficiency of WDR82 (left) and ZC3H4 mRNA (right) in individual and combined depletions. Extended Data Fig. 3 | Effects of WDR82 and Zc3H4 co-depletion on extragenic transcription in HeLa cells. a. The bar plots show the mean ± SD of n=4 independent experimentsExtended Data Fig. 3 | Effects of WDR82 and Zc3H4 co-depletion on extragenic transcription in HeLa cells. a, The effects of WDR82, ZC3H4 or their combined depletion by siRNA transfection were measured on selected extragenic transcripts, as indicated. In co-depletion experiments, a double amount of siRNA was used, as indicated. The bar plots show the mean ± SD of n=4 biological replicates. The data were normalized on the housekeeping gene CDC25b. Light grey columns: 30pmol siRNA, dark grey columns, 60pmol siRNA. b, Depletion efficiency of WDR82 (left) and ZC3H4 mRNA (right) in individual and combined depletions. The bar plots show the mean ± SD of n=4 independent experiments.
Extended Data Fig. 4 | Distribution of WDR82, Zc3H4 and RNA Pol II chIP-seq peaks. a, Classification of WDR82 and ZC3H4 ChIP-seq peaks based on their genomic location. TSS: Transcription Start Site; TES: Transcription End Site. Data are from n=2 independent experiments. b, Transcribed protein-coding genes (n=10,917) were divided into quartiles of increasing RNA Pol II occupancy. The heatmaps show WDR82, ZC3H4 and RNA Pol II ChIP-seq signals at genes of the 1. st and 4 th quartilesExtended Data Fig. 4 | Distribution of WDR82, Zc3H4 and RNA Pol II chIP-seq peaks. a, Classification of WDR82 and ZC3H4 ChIP-seq peaks based on their genomic location. TSS: Transcription Start Site; TES: Transcription End Site. Data are from n=2 independent experiments. b, Transcribed protein-coding genes (n=10,917) were divided into quartiles of increasing RNA Pol II occupancy. The heatmaps show WDR82, ZC3H4 and RNA Pol II ChIP-seq signals at genes of the 1 st and 4 th quartiles.
A window of ±− 10 nucleotides centered on the 5′ splice sites was used to measure read counts in polyA RNA-seq data. b, log2-transformed ratio of polyA RNA-seq reads in a 20 nt window centered on the 5′ splice sites of WDR82-suppressed lncRNA or of randomly selected set of mRNAs with at least one splice junction. c, Analysis of 5′ (left) and 3′ (right) splice site strength (measured as MaxEnt scores) at WDR82-suppressed lncRNAs. Statistical significance was assessed using the two-tailed Wilcoxon rank sum test in correspondence of both the 5′ (p-value=1.2e-21) and the 3′ (p-value=2.6e-06) splice sites. ***=p-value <0.01. Nucleotide frequencies at splice sites are shown as sequence logos. Donor and acceptor splice sites are indicated as black triangles. d, Effects of the depletion of WDR82-ZC3H4 on transcription of protein coding genes in HeLa cells. Expressed protein-coding genes (n=8,804) were divided into deciles based on their sensitivity to the depletion of WDR82 in 4sU-seq data, with the 10 th decile including the most upregulated genes. Log2-transformed RNA fold changes (polyA and 4sU RNA-seq data) and log2-transformed reads ratio across the first exon-intron junction, as annotated in GENCODE, are shown for the 10 th , 5 th and 1 st deciles. Statistical significance was assessed using the two-tailed Wilcoxon rank sum test (pvalue = 2.0e-21). ***=p-value<0.01. Data were from n=3 independent experiments. Extended Data Fig. 6 | Analysis of splice efficiency and splice site sequences of lncRNAs suppressed by Zc3H4-WDR82 in HeLa cells. a, Splicing efficiency at WDR82-suppressed lncRNA junctions (n=3,717) (top panel) and at a randomly selected set of premRNA junctions (n=4,000) (bottom panel) in HeLa cells. In the boxplots in panels B, C, D the median value for each group is shown with a horizontal black line. Boxes show values between the first and the third quartile. The lower and upper whisker show the smallest and the highest value, respectively. Outliers are not shown. The notches correspond to ~95% confidence interval for the medianExtended Data Fig. 6 | Analysis of splice efficiency and splice site sequences of lncRNAs suppressed by Zc3H4-WDR82 in HeLa cells. a, Splicing efficiency at WDR82-suppressed lncRNA junctions (n=3,717) (top panel) and at a randomly selected set of premRNA junctions (n=4,000) (bottom panel) in HeLa cells. A window of ±− 10 nucleotides centered on the 5′ splice sites was used to measure read counts in polyA RNA-seq data. b, log2-transformed ratio of polyA RNA-seq reads in a 20 nt window centered on the 5′ splice sites of WDR82-suppressed lncRNA or of randomly selected set of mRNAs with at least one splice junction. c, Analysis of 5′ (left) and 3′ (right) splice site strength (measured as MaxEnt scores) at WDR82-suppressed lncRNAs. Statistical significance was assessed using the two-tailed Wilcoxon rank sum test in correspondence of both the 5′ (p-value=1.2e-21) and the 3′ (p-value=2.6e-06) splice sites. ***=p-value <0.01. Nucleotide frequencies at splice sites are shown as sequence logos. Donor and acceptor splice sites are indicated as black triangles. d, Effects of the depletion of WDR82-ZC3H4 on transcription of protein coding genes in HeLa cells. Expressed protein-coding genes (n=8,804) were divided into deciles based on their sensitivity to the depletion of WDR82 in 4sU-seq data, with the 10 th decile including the most upregulated genes. Log2-transformed RNA fold changes (polyA and 4sU RNA-seq data) and log2-transformed reads ratio across the first exon-intron junction, as annotated in GENCODE, are shown for the 10 th , 5 th and 1 st deciles. Statistical significance was assessed using the two-tailed Wilcoxon rank sum test (pvalue = 2.0e-21). ***=p-value<0.01. Data were from n=3 independent experiments. In the boxplots in panels B, C, D the median value for each group is shown with a horizontal black line. Boxes show values between the first and the third quartile. The lower and upper whisker show the smallest and the highest value, respectively. Outliers are not shown. The notches correspond to ~95% confidence interval for the median.
Extended Data Fig. 8 | Exonic splice enhancer (ESE) sequences in exons of WDR82-suppressed lncRNAs and in mRNAs. a, Number of ESE per exon in lncRNAs and in mRNAs suppressed by WDR82 in macrophages. Data are from n=3 independent experiments. b, Distance between ESEs and 5′ splice sites in lncRNAs and in mRNAs suppressed by WDR82. Data are from n=3 independent experiments. c, Number of ESEs per exon recognized by individual SRSF proteins in lncRNAs and in mRNAs suppressed by WDR82. Extended Data Fig. 8 | Exonic splice enhancer (ESE) sequences in exons of WDR82-suppressed lncRNAs and in mRNAs. a, Number of ESE per exon in lncRNAs and in mRNAs suppressed by WDR82 in macrophages. Data are from n=3 independent experiments. b, Distance between ESEs and 5′ splice sites in lncRNAs and in mRNAs suppressed by WDR82. Data are from n=3 independent experiments. c, Number of ESEs per exon recognized by individual SRSF proteins in lncRNAs and in mRNAs suppressed by WDR82.
| 86 |
It is still not fully understood how genes are switched on or off during differentiation and development. However, the role of remote regulatory elements in this process is thought to be critical (Bulger and Groudine 2011). One important epigenetic mechanism regulating many genes involves the opposing effects of the Polycomb (PcG, repressive) and Trithorax group (TrxG, activating) proteins, which play critical roles in stem cell biology, development, and cancer (Simon and Kingston 2009). The promoters of most PcG/TrxG target genes are associated with CpG islands that remain unmethylated in all cell types (Mendenhall et al. 2010; MD Lynch, AJ Smith, M De Gobbi, M Flenley, JR Hughes, D Vernimmen, H Ayyub, JA Sharpe, JA Sloane-Stanley, L Sutherland, et al., in prep.). During lineage commitment and differentiation, PcG complexes are cleared from silenced genes and replaced by TrxG complexes as these genes are switched on. Specific histone methyltransferases in these complexes create characteristic chromatin signatures when PcG (H3K27me3) or TrxG (H3K4me3) complexes are bound to chromatin. Bivalent chromatin patterns (H3K27me3 and H3K4me3) may be seen prior to commitment, and these two chromatin marks are then resolved during differentiation (Sawarkar and Paro 2010;Surface et al. 2010). Bivalent domains may also arise de novo during differentiation (Roh et al. 2006;Mohn et al. 2008). The recruitment and removal of PcG and TrxG complexes are a dynamic process. However, the potential of remote cis-acting elements to influence the balance between repression and activation throughout development and differentiation has not been explored. To address these issues, we characterized changes in the recruitment of transcription factors (TFs), cofactors, chromatin-associated proteins (including PcG and TrxG), and associated chromatin modifications to the human a-globin CpG island in the presence or absence of a distant enhancer.
A major problem in analyzing these aspects of gene regulation arises when perturbation of the gene in question (e.g., a key TF) leads to a perturbation of cell fate. In this case, the cellular phenotype alters as regulation of the gene under investigation is altered. To circumvent this, such experiments are often done in cell lines whose fate is fixed. To analyze human a-globin expression in primary cells, we developed an experimental model in which the human a-globin cluster (117 kb) replaces the mouse a-globin cluster (87 kb; humanized model) ( Fig. 1; Wallace et al. 2007). Since a-globin is an end product of a gene regulatory network, perturbing this gene has no effect on cell fate. Expression of the human a-globin genes is controlled by remote upstream regulatory elements (MCSR1-4), of which MCS-R2 (also known as HS-40) (Fig. 1), located 60 kb upstream of the a-globin promoters, is the major enhancer element (Higgs et al. 2008). In the humanized system in which MCS-R2 has been deleted by homologous recombination, the erythroid progenitors in adult mice differentiate normally, and thus, in terms of the trans-acting environment, the normal and mutant cells are directly comparable (Vernimmen et al. 2009). Any differences are solely due to the presence or absence of MCS-R2 in cis to the promoter.
Here we show that, in erythroid cells, the remote tissue-specific enhancer (MCS-R2) plays an essential, nonredundant role in clearing the PcG complex and its associated modification (H3K27me3) from the CpG island, when the a-globin genes become fully activated. Furthermore, in the absence of the enhancer, the CpG island does not recruit the H3K27 demethylase JMJD3. This demonstrates that in addition to the recruitment of TFs, cofactors, and the preinitiation complex (PIC) at the promoter, long-range regulatory elements also play a critical role in removing repressive PcG complexes.
Results and Discussion
Using the humanized mouse, we previously showed that the removal of MCS-R2 dramatically reduces the formation of chromosomal looping, which normally occurs between the upstream regulatory elements and the promoter in erythroid cells. In the absence of MCS-R2, the human a-globin genes are expressed at <2% of normal, in erythroid cells (Vernimmen et al. 2009). Here, we first determined the effect of MCS-R2 on recruitment of key, cell type-specific, and ubiquitously expressed TFs known to bind the a-globin promoter in Ter119 + mature erythroblasts (Vernimmen et al. 2007). In the absence of MCS-R2, TFs (e.g., Sp-XKLF and NFY) and cofactors, such as histone acetyl transferases (PCAF, GCN5, CBP, and p300), are not recruited efficiently (Supplemental Table 1). These findings are reflected by suboptimal histone acetylation (Supplemental Table 1). Of interest, there is a progressive decrease in TF occupancy at key cis elements (MCS-R1/HS-48, MCS-R3/HS-33, and MCS-R4/HS-10) along the chromosome, with the a-globin promoter being the most affected (Supplemental Fig. 1; Supplemental Table 1). Furthermore, in the absence of MCS-R2, ubiquitination of H2B (H2Bub, associated with activation) does not occur efficiently at the a-globin gene (Fig. 2, left panel). Ubiquitination of H2B is thought to be required for subsequent methylation of H3K79 by Dot1 (Shilatifard 2008), and without MCS-R2, H3K79 is not efficiently methylated ( Fig. 2; Supplemental Fig. 2). As previously described (Vernimmen et al. 2007), without MCS-R2, occupancies of the PIC components (TBP, TFIIE, and TFIIB) were all low with an even more dramatic effect on PolII ( Fig. 2; Supplemental Fig. 1) compared with the normal chromosome. These findings confirm that in the humanized mouse cells (as in primary human and mouse cells), a key role of the upstream element (MCS-R2) is to facilitate recruitment and/or stabilization of the PIC at the a-globin promoter, late during erythropoiesis.
We then evaluated the role of MCS-R2 on the deposition of methyl groups to the Lys 4 residue of histone H3. As in human primary erythroblasts ), the upstream elements are marked by mono-and dimethyl H3K4 in fully active humanized erythroid cells (Supplemental Fig. 3). In contrast, the chromatin associated with the a-globin promoter and the body of the gene is modified by H3K4me3 (Fig. 2, right panel; Supplemental Fig. 3). These findings are also consistent with the chromatin features of enhancers and promoters, as established in genome-wide analyses (Heintzman et al. 2007). In the absence of MCS-R2, the mono-and dimethylation of H3K4 seem to occur normally (Supplemental Fig. 3, left panel). Moreover and more unexpectedly, despite the absence of detectable H2Bub and H3K79me3 and the associated transcription (expression of only ;2% of normal), the overall level of H3K4me3 at the a-globin gene was ;50% of that seen in the fully active, highly transcribed gene (considering the amount of H3K4me3 detected on the endogenous control) ( Fig. 2; Supplemental Fig. 3). Note that, in the absence of MCS-R2, the distribution of mono-, di-, and trimethyl H3K4 becomes skewed more to the promoter than the body of the gene. This might be partially due to higher levels of H3 occupancy at the promoter in the DMCS-R2 compared with normal (Supplemental Fig. 4). Of interest, in the absence of the enhancer, H3K36me3 (a marker of transcriptional elongation) is also detectable (Supplemental Fig. 5).
The H3K4me3 modification is imposed by the human TrxG proteins, which include several complexes (hSet1 and MLL1-5) (Shilatifard 2008). It has recently been shown that H3K4 methylation at CpG islands may be mediated via the hSet1 complex, which contains a CpG island-binding protein (CGBP, or Cfp1). CGBP is thought to bind unmethylated CpG-rich sequences irrespective of transcription, thereby recruiting hSet1 (Thomson et al. 2010). This implies that chromatin at unmethylated CpG islands might be modified by H3K4me3 as a default state.
Here we found that in human nonerythroid cells, CGBP/ Cfp1 is not detectable at the associated CpG island (as judged by two different antibodies) (Supplemental Fig. 6). Similarly, when the a genes are severely down-regulated in the humanized mouse MCS-R2 mutant, CGBP/Cfp1 is present at very low levels ( Fig. 2; Supplemental Fig. 7). Thus, CGBP/Cfp1 is only readily detected in association with high levels of a-globin expression. Therefore, it seems unlikely that the relatively high levels of H3K4me3 seen in the DMCS-R2 mutant (when the a genes are expressed at relatively low levels) reflect a default state mediated by CGBP/Cfp1. In contrast, it suggests Figure 1. Generation of humanized mice as a model to study the human a-globin locus and organization of the human a-globin cluster. A region of conserved synteny in mouse chromosome 11 was replaced by the orthologous human region (Wallace et al. 2007). In this study, heterozygous mice were used to avoid lethality using the MCS-R2 deletion (DMCS-R2) but also to keep the other allele (mouse) as an endogenous positive control. The globin genes are shown as labeled red boxes. The positions of previously described, DNaseI-hypersensitive sites are shown as arrows. The widely expressed gene NPRL3 (also known as the À14 gene in human or the Prox gene in mouse) transcribed from the opposite strand to that of the a-globin is shown as an orange box. Short vertical lines (black) indicate amplicons used in ChIP experiments. Gray boxes refer to previously defined multispecies conserved elements (MCS) and light-green boxes indicate CpG islands.
that H3K4me3 might be a sensitive mark of basal transcription. Interestingly, it was previously suggested that CpG islands marked by H3K27me3 may exclude binding of CGBP (Thomson et al. 2010). We showed previously that a functionally repressive PcG complex is bound at the CpG islands associated with the human a-globin promoters in human nonerythroid cells, in which the a genes are transcriptionally silent (Garrick et al. 2008). Here, we show that CGBP is indeed excluded from CpG islands bound by PcG by comparing human nonexpressing (PcGbound) versus expressing (PcG-unbound) cells (Supplemental Fig. 6). We therefore next determined whether the lack of CGBP recruitment in the DMCS-R2 mutant is associated with persistent PcG binding.
PcG complex is normally bound to both the adult (a) and embryonic (z) globin CpG islands in human embryonic Figure 2. H3K4me3 is not associated with H2Bub, H3K79me3, Pol II, and CGBP. Real-time PCR analysis of immunoprecipitated chromatin using the antibodies indicated in ÀMCS-R2 (left) and +MCS-R2 (right) humanized erythroid cells (Ter119-positive cells purified by automagnetic-activated cell sorting). The Y-axis represents enrichment over the input DNA, normalized to a control sequence in the mouse GAPDH gene. The X-axis represents the positions of the TaqMan probes used. The coding sequence is represented by the three exons (Promoter/ Ex1, Ex2, Ex3) of the human a-globin genes as shown in Figure 1. (Mouse Ex1 and Mouse Ex2) Control sequences at the mouse a-globin gene; (CpG Act) additional control sequence at the CpG island of the mouse b-actin gene. The amplicons highlighted in red represent deleted regions in the humanized mice, for which no PCR signal is observed. Error bars correspond to 61 SD from at least two independent ChIPs. The CGBP antibody used here was purchased from Abcam.
Long-range control of epigenetic regulation stem cells and pluripotent progenitors, in which expression of the a genes is detectable at extremely low levels (De Gobbi et al. 2011). Polycomb remains bound to the silenced embryonic (z) gene in mature erythroid cells. In contrast, PcG is cleared from the adjacent a-globin CpG island as this gene becomes expressed at high levels in mature erythroid cells (Garrick et al. 2008;De Gobbi et al. 2011). This pattern is fully recapitulated in the humanized mouse system (Fig. 3, right panel; Supplemental Fig. 8). Moreover, we show here that as the PRC2-associated chromatin modification (H3K27me3) is erased, the histone H3K27 demethylase JMJD3 is recruited (Fig. 3, right panel; Supplemental Fig. 8). We next studied humanized mice in which MCS-R2 had been deleted to determine whether the upstream enhancer normally plays a role in clearing the PcG complex from the a-globin CpG island during erythropoiesis. As before, in the absence of MCS-R2, the silenced z gene remains bound by PcG throughout differentiation. However, in the absence of MCS-R2, PRC2 is no longer cleared from the a-globin CpG island, and JMJD3 is no longer recruited (Fig. 3, left panel; Supplemental Fig. 8). We showed previously that PcG repression of the a-globin gene may be mediated (at least in part) by HDAC1, which is normally cleared with PcG complex during erythropoiesis (Garrick et al. 2008). Here, in the absence of MCS-R2, HDAC1 remains bound to the a-globin genes (Fig. 3). These contrasting observations on two adjacent CpG islands show that MCS-R2 exerts a specific effect on PcG clearance from the a-globin (but not the z-globin) gene during adult erythropoiesis.
There is increasing evidence that CpG islands, such as those associated with the a-globin promoter, constitute at least one element that can mediate recruitment of PcG and TrxG complexes to mammalian promoters (Mendenhall et al. 2010 et al., in prep.). As previously noted, PcGbinding sites are dynamic, are nucleosomedepleted, and have a rapid histone turnover (the residency time of PcG is in the order of a few minutes) (Ficz et al. 2005). PcG binding is therefore thought to be dynamic and sensitive to the antagonistic action of TrxG proteins together with positive and negative input from other TFs and cofactors. However, it is not known whether the eviction of PcG silencing complex from its targets, seen during development and differentiation, depends on the presence of distal regulatory elements or only on (co)factors acting at proximal cis elements. In this study, we used a mouse experimental model to analyze the CpG island associated with the human a-globin promoter in two states: without and with its interacting distant enhancer, both in terminally differentiated erythroid cells. We also compared the recruitment of CGBP in nonexpressing versus expressing human cells. In nonerythroid cells, the unmethylated, nuclease-insensitive CpG island associated with the a-globin gene is bound by PcG and is transcriptionally silenced (referred to as the ''silent state'') ( Fig. 4A). In erythroid cells without MCS-R2 (referred to as ''basal state''), and in contrast to nonerythroid cells (Garrick et al. 2008), the promoter becomes accessible to some TFs and is associated with some active chromatin modifications (e.g., H3K4me3) with relatively low levels of transcription (;2% of normal) (Fig. 4B). Nevertheless, the PcG complex with its associated modification (H3K27me3) is still prominent at the a-globin CpG island. We also demonstrate here that PcG and CGBP binding are mutually exclusive (cf. Figs. 2 and 3). In erythroid cells with MCS-R2 (referred to as ''active state''), PcG complexes are completely removed from the CpG island (Fig. 4C). Furthermore, the histone H3K27 demethylase JMJD3, which may remove H3K27me3 and thereby facilitate transcription, is also recruited at high levels. Recruitment of the SAGA complex (e.g., PCAF and GCN5) becomes prominent and the downstream effects (e.g., deposition of H2Bub and H3K79 methylation) are established. At this stage, high levels of transcription are associated with binding of CGBP. We thus show that the recruitment of the demethylase JMJD3 and full clearance of the PcG-repressive complex (including PRC2 and HDAC1) at the a-globin CpG island depend on one or more activities mediated by the remote regulatory element and are associated In nonerythroid cells, the CpG island is entirely silenced by PcG and HDAC1, associated with the repressive histone mark H3K27me3. The promoter ''P'' is not sensitive to DNaseI, and transcription does not occur. (B) In erythroid cells lacking the enhancer, the gene remains repressed by PcG and marked by H3K27me3. At this basal level of expression, the promoter becomes accessible to some TFs and chromatin-modifying enzymes and is marked by moderate levels of H3K4me3, which reflect very low levels of transcription. (C) In the presence of the enhancer, PcG is evicted and the H3K27me3 histone mark is erased by recruitment of demethylase JMJD3. Acetylation (H3ac and H4ac), H3K79me3, and H2Bub increases with spreading of HAT and Bre (SAGA) along the coding sequence ''C.'' At this activated stage, the remaining TFs, including Pol II, are now fully recruited, and a high rate of transcription occurs. The CpG island at this stage is also bound by CGBP.
with the transition between basal and fully activated transcription.
These findings demonstrate for the first time that the pattern of PcG binding at a CpG island may be affected by cis-acting elements located far away from the associated promoter. In contrast, the chromatin modification associated with TrxG activity (H3K4me3) appears to be more dependent on local changes at the CpG island that occur in the context of basal transcription. Future studies will address how long-range enhancers exert these effects. It is possible that transcriptional activation per se competes with the competitive binding of PcG complexes and is responsible for the clearance of these complexes (MD Lynch, AJ Smith, M De Gobbi, M Flenley, JR Hughes, D Vernimmen, H Ayyub, JA Sharpe, JA Sloane-Stanley, L Sutherland, et al., in prep.). The second is that upstream elements also deliver new proteins (e.g., JMJD3) or modify proteins (e.g., histones) that facilitate the removal of PcG. In the past, detailed analysis of the globin genes has established many of the general principles underlying mammalian gene regulation, and it therefore seems probable that this new role of distal regulatory elements in removing PcG from their target promoters will be of considerable general importance.
Materials and methods
Primary cells
Ter119-positive mature primary mouse erythroid cells (humanized) were obtained by automagnetic-activated cell sorting, as previously described (Vernimmen et al. 2007(Vernimmen et al. , 2009Wallace et al. 2007). Primary human erythroblasts were obtained from peripheral blood mononuclear cells (PBMCs) collected from blood donors and expanded in a two-phase system as previously described ). Epstein-Barr virus (EBV)-transformed lymphoblastoid cell lines were derived from healthy subjects.
Chromatin immunoprecipitation assay (ChIP)
ChIP was performed as previously described (Vernimmen et al. 2007). For histone-modifying enzymes, chromatin was first cross-linked with EGS (Pearce, Thermo Scientific, product no. 21565) in PBS at a final concentration of 2 mM for 60 min at room temperature. Formaldehyde was then added at a final concentration of 1% for 15 min at room temperature, and samples were sonicated for 20 min at 4°C to fragment genomic DNA (Bioruptor; Diagenode). The antibodies used were Pol II (H-224), JMJD3 (N-24), GCN5 (H-75), PCAF (H-369), p300 (C-20), CBP (A-22) (purchased from Santa Cruz Biotechnology); H3K79me1 (ab2886), H3K79me2 (ab3594), H3K79me3 (ab2621), H3K27ac (ab4729), H3 (ab1791), CGBP (ab56035), H3K4me3 (ab8085), and Suz12 (ab12073) (purchased from abcam); DOT1L (A300-954A) (purchased from Bethyl Laboratory, Inc.); HDAC1 (06-720), H3ac (06-599), H4ac (06-866), H3K9ac (07-352), H3K14ac (07-353), H3K27me3 (07-449), H3K4me1 (07-436), H3K4me2 (07-030), H3K4me3 (05-745R), H4 (07-108), H2A (06-13923), H2B (06-1790), JMJD3 (07-1533), and JMJD3 (07-1534) (purchased from Millipore); H2Bub (MM-0029) (purchased from Medimabs); and Ezh2 (PAB0649) (purchased from Abnova). Real-time PCR using primers and probes (59FAM-39TAMRA) for murine and human a-globin locus were described previously (Anguita et al. 2004;De Gobbi et al. 2007).
Figure 3 .
3Removal of Polycomb repressor complexes is dependent on MCS-R2 and associated with recruitment of JMJD3. Graphs are displayed as in Figure 2. Additional amplicons flanking the embryonic z-globin gene (142, 147, and 149) have been used in these experiments to highlight the two independent PcG domains observed in the mutant human allele DMCS-R2 (shown in the left panel). The shaded area represents the adult a-globin CpG island, from which PcG is normally cleared in the Normal allele in erythroid cells (shown in the right panel). (Left) In the absence of MCS-R2, PcG is not cleared from the a-globin genes and thus remains present at both domains. M Gata6 represents a positive control for PcG binding. The JMJD3 antibody used recognizes the N-terminal region of the protein (Millipore).
; MD Lynch, AJ Smith, M De Gobbi, M Flenley, JR Hughes, D Vernimmen, H Ayyub, JA Sharpe, JA Sloane-Stanley, L Sutherland,
Figure 4 .
4Long-range control of epigenetic regulation. (A)
[ Keywords :
Keywordspolycomb; enhancer; chromatin; CpG islands] 3 Corresponding author. E-mail [email protected]. Article is online at http://www.genesdev.org/cgi/doi/10.1101/gad.16985411. Freely available online through the Genes & Development Open Access option.
GENES & DEVELOPMENT 25:1583-1588 Ó 2011 by Cold Spring Harbor Laboratory Press ISSN 0890-9369/11; www.genesdev.org
Cold Spring Harbor Laboratory Press on November 10, 2012 -Published by genesdev.cshlp.org Downloaded from
GENES & DEVELOPMENT Cold Spring Harbor Laboratory Press on November 10, 2012 -Published by genesdev.cshlp.org Downloaded from
AcknowledgmentsWe are very grateful to Dave Skalnik for CGBP antibody. Many thanks to Jane Mellor, Tom Milne, Nick Proudfoot, Roger Patient, Maggie Walmsley, and Richard Gibbons for critically reading the manuscript. Furthermore, we thank Sue Butler and Christina Rode for technical assistance. This work was funded by the Medical Research Council and the National Institute for Health Research (NIHR) Biomedical Research Centre Program.
Globin gene activation during haemopoiesis is driven by protein complexes nucleated by GATA-1 and GATA-2. E Anguita, J Hughes, C Heyworth, G A Blobel, W G Wood, D R Higgs, EMBO J. 23Anguita E, Hughes J, Heyworth C, Blobel GA, Wood WG, Higgs DR. 2004. Globin gene activation during haemopoiesis is driven by protein complexes nucleated by GATA-1 and GATA-2. EMBO J 23: 2841- 2852.
Functional and mechanistic diversity of distal transcription enhancers. M Bulger, M Groudine, Cell. 144Bulger M, Groudine M. 2011. Functional and mechanistic diversity of distal transcription enhancers. Cell 144: 327-339.
Tissuespecific histone modification and transcription factor binding in a globin gene expression. M De Gobbi, E Anguita, J Hughes, J A Sloane-Stanley, J A Sharpe, C M Koch, I Dunham, R J Gibbons, W G Wood, D R Higgs, Blood. 110De Gobbi M, Anguita E, Hughes J, Sloane-Stanley JA, Sharpe JA, Koch CM, Dunham I, Gibbons RJ, Wood WG, Higgs DR. 2007. Tissue- specific histone modification and transcription factor binding in a globin gene expression. Blood 110: 4503-4510.
Generation of bivalent chromatin domains during cell fate decisions. M De Gobbi, D Garrick, M Lynch, D Vernimmen, J R Hughes, N Goardon, L Sidinh, K M Lower, J A Sloane-Stanley, C Pina, 10.1186/1756-8935-4-9Epigenetics Chromatin. 49De Gobbi M, Garrick D, Lynch M, Vernimmen D, Hughes JR, Goardon N, Sidinh L, Lower KM, Sloane-Stanley JA, Pina C, et al. 2011. Gener- ation of bivalent chromatin domains during cell fate decisions. Epigenetics Chromatin 4: 9. doi: 10.1186/1756-8935-4-9.
Polycomb group protein complexes exchange rapidly in living Drosophila. G Ficz, R Heintzmann, D J Arndt-Jovin, Development. 132Ficz G, Heintzmann R, Arndt-Jovin DJ. 2005. Polycomb group protein complexes exchange rapidly in living Drosophila. Development 132: 3963-3976.
The role of the polycomb complex in silencing a-globin gene expression in nonerythroid cells. D Garrick, De Gobbi, M Samara, V Rugless, M Holland, M Ayyub, H Lower, K Sloane-Stanley, J Gray, N Koch, C , Blood. 112Garrick D, De Gobbi M, Samara V, Rugless M, Holland M, Ayyub H, Lower K, Sloane-Stanley J, Gray N, Koch C, et al. 2008. The role of the polycomb complex in silencing a-globin gene expression in nonerythroid cells. Blood 112: 3889-3899.
Distinct and predictive chromatin signatures of transcriptional promoters and enhancers in the human genome. N D Heintzman, R K Stuart, G Hon, Y Fu, C W Ching, R D Hawkins, L O Barrera, S Van Calcar, C Qu, K A Ching, Nat Genet. 39Heintzman ND, Stuart RK, Hon G, Fu Y, Ching CW, Hawkins RD, Barrera LO, Van Calcar S, Qu C, Ching KA, et al. 2007. Distinct and predictive chromatin signatures of transcriptional promoters and enhancers in the human genome. Nat Genet 39: 311-318.
Long-range regulation of a-globin gene expression. D R Higgs, D Vernimmen, B Wood, Adv Genet. 61Higgs DR, Vernimmen D, Wood B. 2008. Long-range regulation of a-globin gene expression. Adv Genet 61: 143-173.
GC-rich sequence elements recruit PRC2 in mammalian ES cells. E M Mendenhall, R P Koche, T Truong, V W Zhou, B Issac, A S Chi, M Ku, B E Bernstein, 10.1371/journal.pgen.1001244PLoS Genet. 61001244Mendenhall EM, Koche RP, Truong T, Zhou VW, Issac B, Chi AS, Ku M, Bernstein BE. 2010. GC-rich sequence elements recruit PRC2 in mammalian ES cells. PLoS Genet 6: e1001244. doi: 10.1371/journal. pgen.1001244.
Lineage-specific polycomb targets and de novo DNA methylation define restriction and potential of neuronal progenitors. F Mohn, M Weber, M Rebhan, T C Roloff, J Richter, M B Stadler, M Bibel, D Schubeler, Mol Cell. 30Mohn F, Weber M, Rebhan M, Roloff TC, Richter J, Stadler MB, Bibel M, Schubeler D. 2008. Lineage-specific polycomb targets and de novo DNA methylation define restriction and potential of neuronal pro- genitors. Mol Cell 30: 755-766.
The genomic landscape of histone modifications in human T cells. T Y Roh, S Cuddapah, K Cui, K Zhao, Proc Natl Acad Sci. 103Roh TY, Cuddapah S, Cui K, Zhao K. 2006. The genomic landscape of histone modifications in human T cells. Proc Natl Acad Sci 103: 15782-15787.
Interpretation of developmental signaling at chromatin: the Polycomb perspective. R Sawarkar, R Paro, Dev Cell. 19Sawarkar R, Paro R. 2010. Interpretation of developmental signaling at chromatin: the Polycomb perspective. Dev Cell 19: 651-661.
Molecular implementation and physiological roles for histone H3 lysine 4 (H3K4) methylation. A Shilatifard, Curr Opin Cell Biol. 20Shilatifard A. 2008. Molecular implementation and physiological roles for histone H3 lysine 4 (H3K4) methylation. Curr Opin Cell Biol 20: 341- 348.
Mechanisms of polycomb gene silencing: knowns and unknowns. J A Simon, R E Kingston, Nat Rev Mol Cell Biol. 10Simon JA, Kingston RE. 2009. Mechanisms of polycomb gene silencing: knowns and unknowns. Nat Rev Mol Cell Biol 10: 697-708.
Polycomb group proteins set the stage for early lineage commitment. L E Surface, S R Thornton, L A Boyer, Cell Stem Cell. 7Surface LE, Thornton SR, Boyer LA. 2010. Polycomb group proteins set the stage for early lineage commitment. Cell Stem Cell 7: 288-298.
CpG islands influence chromatin structure via the CpG-binding protein Cfp1. J P Thomson, P J Skene, J Selfridge, T Clouaire, J Guy, S Webb, A R Kerr, A Deaton, R Andrews, K D James, Nature. 464Thomson JP, Skene PJ, Selfridge J, Clouaire T, Guy J, Webb S, Kerr AR, Deaton A, Andrews R, James KD, et al. 2010. CpG islands influence chromatin structure via the CpG-binding protein Cfp1. Nature 464: 1082-1086.
Long-range chromosomal interactions regulate the timing of the transition between poised and active gene expression. D Vernimmen, De Gobbi, M Sloane-Stanley, J A Wood, W G Higgs, D R , EMBO J. 26Vernimmen D, De Gobbi M, Sloane-Stanley JA, Wood WG, Higgs DR. 2007. Long-range chromosomal interactions regulate the timing of the transition between poised and active gene expression. EMBO J 26: 2041-2051.
Chromosome looping at the human a-globin locus is mediated via the major upstream regulatory element (HS-40). D Vernimmen, F Marques-Kranc, J A Sharpe, J A Sloane-Stanley, W G Wood, H A Wallace, A J Smith, D R Higgs, Blood. 114Vernimmen D, Marques-Kranc F, Sharpe JA, Sloane-Stanley JA, Wood WG, Wallace HA, Smith AJ, Higgs DR. 2009. Chromosome looping at the human a-globin locus is mediated via the major upstream regulatory element (HS-40). Blood 114: 4253-4260.
Manipulating the mouse genome to engineer precise functional syntenic replacements with human sequence. H A Wallace, F Marques-Kranc, M Richardson, F Luna-Crespo, J A Sharpe, J Hughes, W G Wood, D R Higgs, A J Smith, Cell. 128Wallace HA, Marques-Kranc F, Richardson M, Luna-Crespo F, Sharpe JA, Hughes J, Wood WG, Higgs DR, Smith AJ. 2007. Manipulating the mouse genome to engineer precise functional syntenic replacements with human sequence. Cell 128: 197-209.
| Chromatin is spatially and temporally regulated through a series of orchestrated processes resulting in the formation of 3D chromatin structures such as topologically associating domains (TADs), loops and Polycomb Bodies. These structures are closely linked to transcriptional regulation, with loss of control of these processes a frequent feature of cancer and developmental syndromes. One such oncogenic disruption of the 3D genome is through recurrent dysregulation of Polycomb Group Complex (PcG) functions either through genetic mutations, amplification or deletion of genes that encode for PcG proteins. PcG complexes are evolutionarily conserved epigenetic complexes. They are key for early development and are essential transcriptional repressors. PcG complexes include PRC1, PRC2 and PR-DUB which are responsible for the control of the histone modifications H2AK119ub1 and H3K27me3. The spatial distribution of the complexes within the nuclear environment, and their associated modifications have profound effects on the regulation of gene transcription and the 3D genome. Nevertheless, how PcG complexes regulate 3D chromatin organization is still poorly understood. Here we glean insights into the role of PcG complexes in 3D genome regulation and compaction, how these processes go awry during tumorigenesis and the therapeutic implications that result from our insights into these mechanisms. | Trichloroethylene (TCE) is an industrial solvent and drinking water pollutant associated with CD4 + T cell-mediated autoimmunity. In our mouse model, discontinuation of TCE exposure during adulthood after developmental exposure did not prevent immunotoxicity. To determine whether persistent effects were linked to epigenetic changes we conducted whole genome reduced representation bisulfite sequencing (RRBS) to evaluate methylation of CpG sites in autosomal chromosomes in activated effector/memory CD4 + T cells. Female MRL+/+ mice were exposed to vehicle control or TCE in the drinking water from gestation until ∼37 weeks of age [postnatal day (PND) 259]. In a subset of mice, TCE exposure was discontinued at ∼22 weeks of age (PND 154). At PND 259, RRBS assessment revealed more global methylation changes in the continuous exposure group vs. the discontinuous exposure group. A majority of the differentially methylated CpG regions (DMRs) across promoters, islands, and regulatory elements were hypermethylated (∼90%). However, continuous developmental TCE exposure altered the methylation of 274 CpG sites in promoters and CpG islands. In contrast, only 4 CpG island regions were differentially methylated (hypermethylated) in the discontinuous group. Interestingly, 2 of these 4 sites were also hypermethylated in the continuous exposure group, and both of these island regions are associated with lysine 27 on histone H3 (H3K27) involved in polycomb complex-dependent transcriptional repression via H3K27 tri-methylation. CpG sites were overlapped with the Open Regulatory Annotation database. Unlike the discontinuous group, continuous TCE treatment resulted in 129 DMRs including 12 unique transcription factors and regulatory elements; 80% of which were enriched for one or more polycomb group (PcG) protein binding regions (i.e., SUZ12, EZH2, JARID2, and MTF2). Pathway analysis of the DMRs indicated that TCE primarily altered the methylation of genes associated with regulation Byrum et al.TCE Altered Polycomb Binding Sitesof cellular metabolism and cell signaling. The results demonstrated that continuous developmental exposure to TCE differentially methylated binding sites of PcG proteins in effector/memory CD4 + cells. There were minimal yet potentially biologically significant effects that occurred when exposure was discontinued. These results point toward a novel mechanism by which chronic developmental TCE exposure may alter terminally differentiated CD4 + T cell function in adulthood. | Mouse embryonic stem cells (mESCs) cycle in and out of a transient 2-cell (2C)-like totipotent state, driven by a complex genetic circuit involves both the coding and repetitive sections of the genome. While a vast array of regulators, including the multi-functional protein Rif1, has been reported to influence the switch of fate potential, how they act in concert to achieve this cellular plasticity remains elusive. Here, by modularizing the known totipotency regulatory factors, we identify an unprecedented functional connection between Rif1 and the non-canonical polycomb repressive complex PRC1.6. Downregulation of the expression of either Rif1 or PRC1.6 subunits imposes similar impacts on the transcriptome of mESCs. The LacO-LacI induced ectopic colocalization assay detects a specific interaction between Rif1 and Pcgf6, bolstering the intactness of the PRC1.6 complex. Chromatin immunoprecipitation followed by sequencing (ChIP-seq) analysis further reveals that Rif1 is required for the accurate targeting of Pcgf6 to a group of genomic loci encompassing many genes involved in the regulation of the 2C-like state. Depletion of Rif1 or Pcgf6 not only activates 2C genes such as Zscan4 and Zfp352, but also derepresses a group of the endogenous retroviral element MERVL, a key marker for totipotency. Collectively, our findings discover that Rif1 can serve as a novel auxiliary component in the PRC1.6 complex to restrain the genetic circuit underlying totipotent fate potential, shedding new mechanistic insights into its function in regulating the cellular plasticity of embryonic stem cells. | Polycomb group (PcG) proteins function as vital epigenetic regulators in various biological processes, including pluripotency, development, and carcinogenesis. PcG proteins form multicomponent complexes, and two major types of protein complexes have been identified in mammals to date, Polycomb Repressive Complexes 1 and 2 (PRC1 and PRC2). The PRC1 complexes are composed in a hierarchical manner in which the catalytic core, RING1A/B, exclusively interacts with one of six Polycomb group RING finger (PCGF) proteins. This association with specific PCGF proteins allows for PRC1 to be subdivided into six distinct groups, each with their own unique modes of action arising from the distinct set of associated proteins. Historically, PRC1 was considered to be a transcription repressor that deposited monoubiquitylation of histone H2A at lysine 119 (H2AK119ub1) and compacted local chromatin. More recently, there is increasing evidence that demonstrates the transcription activation role of PRC1. Moreover, studies on the higher-order chromatin structure have revealed a new function for PRC1 in mediating long-range interactions. This provides a different perspective regarding both the transcription activation and repression characteristics of PRC1. This review summarizes new advancements regarding the composition of mammalian PRC1 and accompanying explanations of how diverse PRC1-associated proteins participate in distinct transcription regulation mechanisms. | Background: Polycomb group (PcG) proteins are a set of chromatin-modifying proteins that play a key role in epigenetic gene regulation. The PcG proteins form large multiprotein complexes with different activities. The two best-characterized PcG complexes are the PcG repressive complex 1 (PRC1) and 2 (PRC2) that respectively possess histone 2A lysine 119 E3 ubiquitin ligase and histone 3 lysine 27 methyltransferase activities. While PRC2-like complexes are conserved throughout the eukaryotic kingdoms, PRC1-like complexes have only been described in Drosophila and vertebrates. Since both complexes are required for the gene silencing mechanism in Drosophila and vertebrates, how PRC1 function is realized in organisms that apparently lack PRC1 such as plants, is so far unknown. In vertebrates, PRC1 includes three proteins, Ring1B, Ring1A, and Bmi-1 that form an E3 ubiquitin ligase complex. These PRC1 proteins have an N-terminally located Ring finger domain associated to a poorly characterized conserved C-terminal region.Results:We obtained statistically significant evidences of sequence similarity between the Cterminal region of the PRC1 Ring finger proteins and the ubiquitin (Ubq)-like family proteins, thus defining a new Ubq-like domain, the RAWUL domain. In addition, our analysis revealed the existence of plant and worm proteins that display the conserved combination of a Ring finger domain at the N-terminus and a RAWUL domain at the C-terminus.Conclusion:Analysis of the conserved domain architecture among PRC1 Ring finger proteins revealed the existence of long sought PRC1 protein orthologs in these organisms, suggesting the functional conservation of PRC1 throughout higher eukaryotes. | Insulator proteins located at the boundaries of topological associated domains (TAD) are involved in regulating chromatin loops. Yet, how chromatin loops contribute to transcription regulation is still not clear. Here we show that Relative-of-WOC (ROW) is essential for the long-range transcription regulation mediated by the Boundary Element-Associated Factor of 32kD (BEAF-32). We found that ROW physically interacts with heterochromatin proteins (HP1b and HP1c) and the insulator protein BEAF-32.The co-localization happens at TAD boundaries where ROW, through its AT-hooks motifs, binds AT-rich sequences flanked by BEAF-32 binding sites and motifs.Knockdown of row resulted in downregulation of genes that are long-range targets of BEAF-32 and bound indirectly by ROW (without binding motif). Analysis of highthroughput chromosome conformation capture (Hi-C) data revealed long-range interactions between promoters of housekeeping genes bound directly by ROW and promoters of developmental genes bound indirectly by ROW. Thus, our results show cooperation between BEAF-32 and the ROW complex, which includes HP1 proteins, to regulate the transcription of developmental and inducible genes by chromatin loops. 4 immunoprecipitation in Drosophila S2 cells followed by high-throughput sequencing (ChIP-seq) of ROW, WOC, and HP1c revealed localization of the complex around the transcription start sites (TSSs) of actively transcribed genes (22). Finally, depletion of row in S2 cells leads to the downregulation of approximately 80% of the genes that are both differentially expressed and are targets of the complex (22). However, in vivo expression analysis with RNAi lines of row, woc, and HP1c (RNA from whole larvae) showed similar numbers of upregulated and downregulated genes (20). ROW is also an ortholog of POGZ -a human risk gene for neurodevelopmental disorders (26) that interacts with heterochromatin proteins (27). Although row is expressed throughout most Drosophila tissues and developmental stages, it displays the highest expression level in the larval central nervous system (26). Moreover, neuron-specific knockdown of row in adult flies affects non-associative learning (26). Thus, row is similar to POGZ as both interact with heterochromatin proteins and are involved in neurodevelopment and learning (28).Here, we comprehensively characterized row and its binding partners for the first time in-vivo in adult Drosophila. We found that knockdown of row using constitutive promoter results in reduced viability, fertility, and changes in the expression of metabolic-related genes. Interestingly, we found that in addition to WOC, HP1b, and HP1c, ROW binds to components of the insulator complex, BEAF-32, and Chromator. ChIP-seq experiments showed that ROW binds AT-rich sequences through three AT-hooks. The binding sites of ROW are located upstream to the transcription start sites of housekeeping genes and flanked by binding motifs of BEAF-32. Moreover, we found that the genome distribution of ROW was highly correlated with BEAF-32 and significantly enriched at TAD boundaries. Depleting row and BEAF-5 32 in S2 cells resulted in a correlated change in gene expression. The differential expressed genes were more likely to be downregulated, indirect targets of ROW and BEAF-32 (without binding sequences), and regulated through long-range contacts. The analysis of Hi-C data revealed enrichment of long-range interactions between promoters of housekeeping genes bound directly by ROW and promoters of developmental and inducible genes bound indirectly by ROW. Thus, our data show that ROW and BEAF-32 provide a general regulation mechanism depending on the contact between promoters of housekeeping and inducible genes.ResultsKnockdown of row causes a decrease in survival and fertilityTo determine the functions of row in vivo, we utilized two publicly available UASrow RNAi transgenic fly lines, hereby referred to as row RNAi-1 and row RNAi-2 . When combined with the ubiquitous actin5C-GAL4 driver, the progenies carrying the Gal4 driver and row RNAi construct show a significant decrease in ROW protein levels in fly heads, which was more substantial in row RNAi-1 relative to row RNAi-2 (94% and 87%, respectively; P <0.05;Fig. 1A).We examined the viability of row RNAi flies(Fig. 1B). Relative to the expected proportion of 50% (the Gal4 driver line is heterozygous for the insertion), there was a small but significant reduction in the progeny carrying both the Gal4 driver and expressing row RNAi-1 , (36.4%; P < 1.1 ×10 -4 ), but the reduction in viability was not significant for row RNAi-2 (46.2%; P =0.15;Fig. 1B). We observed that the lethality occurred at the pupal stage as row RNAi-1 pupal eclosion was significantly reduced (13% compared to 33% of row RNAi-1 control, P= 0.0058;Fig. 1C). In addition to development, | During the pathogenesis of human hepatocellular carcinoma (HCC), the CpG island encompassing the -class glutathione S-transferase gene (GSTP1) becomes hypermethylated. Repression of transcription accompanying CpG island hypermethylation has been proposed to be mediated by methyl-CpG binding domain (MBD) proteins. We report here that inhibition of transcription from hypermethylated GSTP1 promoters in Hep3B HCC cells, which fail to express GSTP1 mRNA or GSTP1 polypeptides, appears to be mediated by MBD2. Treatment of Hep3B cells with 5-azadeoxycytidine (5-aza-dC), a methyltransferase inhibitor, activated GSTP1 expression, whereas treatment with trichostatin A, a histone deacetylase inhibitor, had little effect. To more precisely assess the contribution of the pattern of GSTP1 CpG island methylation on GSTP1 mRNA expression, Hep3B cells were treated for 72 h with 5-aza-dC and then subjected to limiting dilution cloning. Bisulfite sequencing was used to map the methylation patterns of the GSTP1 promoter region in GSTP1-expressing and -non-expressing clones. In the clone that expressed GSTP1 mRNA determined by Northern blot analysis and quantitative reverse transcriptase (RT)-PCR, widespread demethylation of at least one GSTP1 allele was evident. Chromatin immunoprecipitation experiments revealed the presence of MBD2, but not Sp1, at the GSTP1 promoter in Hep3B cells. In contrast, Sp1 was detected at the GSTP1 promoter in a GSTP1-expressing Hep3B 5-aza-dC subclone. To test whether MBD2 might be responsible for the inhibition of GSTP1 transcription from hypermethylated GSTP1 promoters, siRNAs were used to reduce MBD2 polypeptide levels in Hep3B cells. SssI-catalyzed methylation of GSTP1 promoter sequences resulted in diminished luciferase reporter activity after transfection into Hep3B cells. However, when hypermethylated GSTP1 promoter sequences were transfected into Hep3B cells that had been treated with siRNA-targeting MBD2 mRNA, no repression of luciferase reporter expression was evident. These findings implicate MBD2 in the repression of GSTP1 expression associated with GSTP1 CpG island hypermethylation in HCC cells. | Genome-wide RNA expression data provide a detailed view of an organism's biological state; hence, a dataset measuring expression variation between genetically diverse individuals (eQTL data) may provide important insights into the genetics of complex traits. However, with data from a relatively small number of individuals, it is difficult to distinguish true causal polymorphisms from the large number of possibilities. The problem is particularly challenging in populations with significant linkage disequilibrium, where traits are often linked to large chromosomal regions containing many genes. Here, we present a novel method, Lirnet, that automatically learns a regulatory potential for each sequence polymorphism, estimating how likely it is to have a significant effect on gene expression. This regulatory potential is defined in terms of ''regulatory features''-including the function of the gene and the conservation, type, and position of genetic polymorphisms-that are available for any organism. The extent to which the different features influence the regulatory potential is learned automatically, making Lirnet readily applicable to different datasets, organisms, and feature sets. We apply Lirnet both to the human HapMap eQTL dataset and to a yeast eQTL dataset and provide statistical and biological results demonstrating that Lirnet produces significantly better regulatory programs than other recent approaches. We demonstrate in the yeast data that Lirnet can correctly suggest a specific causal sequence variation within a large, linked chromosomal region. In one example, Lirnet uncovered a novel, experimentally validated connection between Puf3-a sequence-specific RNA binding protein-and P-bodies-cytoplasmic structures that regulate translation and RNA stabilityas well as the particular causative polymorphism, a SNP in Mkt1, that induces the variation in the pathway. |
87 | Cultural Responses to a Late Holocene Climatic Oscillation in the Mariana Islands, Micronesia: Lessons from the Past | Freshwater influx into 700 and 2900 year-old islands of Holocene ooid sand in the Schooner Cays has produced significant amounts of aragonite dissolution and interparticle cementation by low-Mg calcite. The amount of diagenetic alteration, expressed as the diagenetic maturity of a rock, varies as a function of time and hydrologic regime. All other factors (i.e. climate, mineralogy, sediment type) are constant between the islands. | Coupled productivity and carbon isotope records in the southwest Pacific Ocean during the late Miocene-early Pliocene biogenic bloom | Pliocene climate probably underway before the end of the epoch. The global cooling that occurred during the Pliocene may have spurred on the disappearance of forests and the spread of grasslands and savannas. During the Pliocene the earth climate system response shifted from a period of high frequency-low amplitude oscillation dominated by the 41,000-year period of Earth's obliquity to one of low-frequency, high-amplitude oscillation dominated by the 100,000-year period of the orbital eccentricity characteristic of the Pleistocene glacial-interglacial cycles. The equatorial pacific ocean sea surface temperature gradient was considerably lower than it is today, mean sea surface temperature in the east were | Lake-level records from Latin America (including Mexico) indicate climatic change over a range of timescales, including El Nino-Southern Oscillation variability. In most tropical areas, the Last Glacial Maximum and Late Glacial were drier than present. The Bolivian Altiplano is a significant exception to this. Lake levels rose in response to insolation forcing (and changes in the location of the intertropical convergence zone) in the early Holocene in the Northern Hemisphere and after the mid-Holocene in the Southern Hemisphere. The late Holocene shows increasing climatic variability in all areas and severe drought episodes seem to have been associated with major cultural changes. | Millennial- to century-scale variability in Gulf of Mexico Holocene climate records | Reef development at high-latitudes during multiple interglacial cycles: New evidence from Lord Howe Island, southwestern Pacific | Sea surface temperature (SST), salinity, and flux of terrigenous material oscillated on millennial time scales in the Pleistocene North Atlantic, but there are few records of Holocene variability. Because of high rates of sediment accumulation, Holocene oscillations are well documented in the northern Sargasso Sea. Results from a radiocarbon-dated box core show that SST was approximately 1°C cooler than today approximately 400 years ago (the Little Ice Age) and 1700 years ago, and approximately 1°C warmer than today 1000 years ago (the Medieval Warm Period). Thus, at least some of the warming since the Little Ice Age appears to be part of a natural oscillation. | Strontium isotope dating of the New Zealand Oligocene | 87 | Archaeological data from south-central Guam are presented to show that technological and social adaptations enabled the ancestral Chamorros of the Mariana Islands, Micronesia, to remain mobile farmer-fishers despite a major climatic oscillation, from the Medieval Warm Period (MWP, c. 800-1350 C.E.) to the Little Ice Age (LIA, c. 1350-1900 C.E.). For several centuries people responded appropriately to increased aridity and harvest shortfalls during the LIA but tolerance limits for stresses to their cultural system were exceeded during violent clashes with Spanish colonizers in the late 17th century. | who introduced non-native plants into the chagos islands | Oral histories of early Filipino migrants to Hawaii: Casimera Tampan | The Pacific Age | AbstractTechnologically, the Initial Period in Peru began with the introduction of pottery and the change from twined to woven textile production. Within the Moche Valley, it was the time when a complex settlement first appeared in the valley interior — a relocation correlated with the beginnings of irrigation agriculture. This critical point in the process of adaptation to irrigation agriculture is explored through an examination of subsistence data from two sites: the Initial Period (1800-1400 B.C.) site of Gramalote on the coast and the Initial Period and Early Horizon (1400-400 B.C.) settlement of Caballo Muerto located well inland. Evidence from Caballo Muerto suggests that the shift from floodwater to irrigation agriculture was complete, yet the inland site still relied heavily on animal protein from Gramalote on the coast. Taken together, the two early ceramic sites form an economic unit which, when explored, reveals several important aspects of the transition from an exclusively coastal orientatio... | The Little Ice Age and Medieval Warm Period in the Sargasso Sea | The Arrival of Homo sapiens into the Southern Cone at 14,000 Years Ago | What was new caledonia used for? | This chapter discusses the Chagos islanders' first communal visit to the Chagos archipelago. From an anthropological perspective this journey provides an exceptional vantage point to explore important cultural dimensions of the Chagossian community and their political struggles for proper compensation and the right to repatriation. The chapter presents the central activities undertaken by the pilgrims in the course of the journey. Special attention will be paid to the considerable efforts Chagossians vested in cleaning and tending to abandoned cemeteries on the Chagos islands. The final section of this chapter shows that Chagossians hold quite specific cultural beliefs regarding their relationship to their homeland, although certain aspects have taken on new importance in the context of their contemporary social and political circumstances. Chagossians feel they have filial duties to assist the spirits of their forefathers, their expulsion from the place the ancestors were buried has resulted in a cultural dilemma. Keywords: Chagos archipelago; Chagossian; cultural dimensions; political circumstances |
88 | How do you unlock the door to the gym in sootopolis? | How can ibeat the gym leader of sootopolis? | How do you unlock the door to the gym in the Cinnabar city in leaf green pokemon? | How do you get the door open of the 8th gym in pokemon sapphire? | Where do you find the key to the cinnabar island gym in pokemon yellow? | Where are the switches for the gym in vermilion soulsilver? | How do you get through driftveil city gym? | What do you do after you beat the gym in canalave city? | How do you beat the snow point city gym leader? | 88 | How do you open the sootopolis gyms door? | What is the sootopolis gym leader? | Howdo you unlock the doors for the gym at cinnabar on leaf versio n? | Where is the 8th gym in pokemon diamond? | How do you get to the third gym in pokemon sapphire? | How do you open the blinds in wimpy wonderland? | How do you open up the wizard's door in kingdom hearts 1? | How do you enter the locked door in goldenrod city underground? | Pokemon silver where is the 8th gym? |
89 | Great quality shoe. Very well made. Will probably last for years and very comfortable on the foot. | Great quality shoe at a great deal. I have a similar pair that have lasted over a year and still look good and fit well. | Amazing looking. Best shoe I have ever worn. Will not go back to another brand. Complimented constantly. Hope it last as long as everyone says. | Great shoes. Impeccably made and stylish. Very comfortable. My old pair of Ferrangamos lasted 10 years, hope these are just as well made. | Great shoe. Excellent quality. Made in the USA. Love the rubber sole for wet weather. | Excellent shoes, buy them to give to my husband and I am delighted with the design and comfortable they were. Great shoes. | Nice shoe. Comfortable. Pretty. Well made. Runs large. I like how it has the straps and foot is more secure. | Great shoes. Very comfortable first time wearing it. Love the lightweight of the shoe and feels comfortable throughout the whole day. Best work shoes i owned so far! I hope these last long. This shoe is highly recommended! | Great shoe, I hope this style and in white leather stills get made for years to come. They are the only ones I like. Comfortable, high arch, clean up well, last forever! Almost... | 89 | Great quality shoe. Very well made. Will probably last for years and very comfortable on the foot. I've been wearing New Balance for years. | Bought this shoe in April 2014 and still in good shape. Excellent quality and very comfortable | good quality. I get compliments on these shoes everywhere ... | New Balance is my favorite brand. Their shoes are comfortable and strong and ... | This shoe is much better than the last one from New Balance that I ... | Very nice quality shoe especially for the price | Absolutely would NOT recommend these shoes if you are an experienced New Balance wearer! - Back to Amazon they go! | Great quality. Best money I've ever spent on shoes | Great shoes. Great fit and stability |
90 | Coverlet, not a quilt. | Good quilt for the price , very big and not bulky , good for cool spring and fall nights | As a long-arm quilter, I was hoping for more of the same as seen on the cover and as large as shown on the cover, so a little disappointed at first. But then I took a second look through and started coloring--it is so much fun. I draw zentangles for relaxation and improving my skills and this is just as much fun. Thank you. | How is a quilt used? | This quilt is beautiful. It's very feminine and lovely for a girl's room. This is a very lightweight quilt.
This is not exactly the quilt in the picture, the backing of the quilt that I received is purple and white, not blue and white. There also are not green squares. | autumn. Monument Quilt The Monument Quilt is an enormous quilt made as a memorial for survivors of rape. The quilt includes a collection of survivors' stories stitched, written, and painted onto red fabric. The quilt includes more than 1000 squares and over 700 stories by rape and abuse survivors. It has been publicly displayed in 22 cities in the United States and includes 1500 squares that spell out "Not Alone". The goal of the quilt project is to "create healing spaces by and for survivors." Visitors are invited to share their stories on designated blank squares when the quilt is | I love these quilts; however they have been published previously in books or magazines. It's very disappointing that the description didn't tell us that, so I could have saved my money. | History of quilting Quilting, the stitching together of layers of padding and fabric, may date back as far as ancient Egypt. In Europe quilting appears to have been introduced by Crusaders in the 12th century (Colby 1971), in particular in the form of the aketon or gambeson, a quilted garment worn under armour which later developed into the doublet. One of the earliest existing decorative works is the Tristan quilt, made around 1360. M Sicily, and as one of the earliest surviving quilts in the world, at least two sections survive at the V&A Museum (London) and in Bargello palace | I actually bout this for someone else and I did not use it but was told it was of good quality and worked for quilting. | 90 | This is a coverlet, not truly a quilt. I love the pattern, but, should only be used as decorative on top of an actual quilt. | more like a coverlet than a quilt | I like this quilt as a coverlet for a twin bed | Feminine, girly quilt-Not exactly like the picture | It really is just a quilted cover, and the ... | It is a beautiful quilt, as other reviews stated | i have looked all over for a quilt like this found some similiar but you cannot experience its ... | Looks great! Love the Levtex brand have other quilts in ... | I feel this quilt was misleading in it's description. ... |
91 | how much did the bengals give leon hall for 2011 | Cory Hall Cory Hall (born December 5, 1976) is an American football coach and former player. He was drafted by the Cincinnati Bengals in the third round of the 1999 NFL Draft. He played college football at Fresno State. Hall also played for the Atlanta Falcons. In 2017, Hall served as Oregon State's interim head football coach for six games after Gary Andersen abruptly resigned. Hall was the head coach at Clovis North High School for three seasons, from 2011 to 2013. While coaching at CNEC, he led the Broncos to a 32–8 record, a CIF Central Valley Championship in | Ken Zampese record, good for another division championship and playoff berth (24-14 loss to N.Y. Jets). Under Zampese's watch, Palmer set Bengals records in career passer rating (86.9) and completion percentage (62.9), as well as single-season marks for completions (373), passing yards (4131), TD passes (32) and passer rating (101.1). Andy Dalton Zampese fielded his next challenge in the spring of 2011, as a Palmer trade request created another search for a quarterback to lead the franchise. Zampese was again part of a scouting/evaluation effort that yielded another starting quarterback via the draft, as Andy Dalton of Texas Christian University was selected | 2012 Cincinnati Bengals season forced the Giants to re-attempt the play. On the ensuing punt, Bengals cornerback Adam “Pacman” Jones returned the ball sixty-eight yards to the Giants eleven yard line. The Bengals did not hesitate to take advantage of the large swing in field positioning, as second year quarterback Andy Dalton connected with receiver Andrew Hawkins for an eleven-yard touchdown strike on third-and-ten. The three play drive took only eighteen second off of the clock, and gave the Bengals a 14–0 advantage. The Giants would see a measure of momentum swing in their favor as following their ensuing possession, which resulted in a | Hello Colts fans,
I am a Steelers fan that is just looking around through free agent options to replace Heath Miller. I know some people may not, but I respect the hell out of your team. I know that Dwayne Allen is a free agent, and in a recent interview he said, "Miller is the reason I wear 83". I loved the quote because, obviously, of the respect for Heath.
But here is my question...what can any of you tell me about Dwayne Allen if he does choose to go to Pitt, and do you think he will go to another team or go back to Indy?
Regardless, would love to see a AFC Championship with Luck vs. Roethlisberger!
Good Luck in the draft and next year. | John Henry Johnson franchise all-time rushing yards list, behind Franco Harris, Jerome Bettis, and Willie Parker. In 1987, he was selected to the Pro Football Hall of Fame, and chose Steelers owner Art Rooney as his presenter. Many of his contemporaries felt his induction was belated; he had been eligible for induction for the past fifteen years. The 49ers' "Million Dollar Backfield" is currently the only full-house backfield to have all four of its members enshrined in the Hall of Fame. Johnson is a member of the Pittsburgh Steelers Legends team, which honors the franchise's best players pre-1970. He was a charter inductee | Brandon Underwood Brandon Dante Underwood (born June 24, 1986) is an American football safety who is currently a free agent. He was drafted by the Green Bay Packers in the sixth round of the 2009 NFL Draft and would later be a part of their Super Bowl XLV championship team over the Pittsburgh Steelers. He played college football at Cincinnati. After going to Hamilton High School, Underwood spent his first two years at Ohio State, where he was redshirted as a freshman in 2005. He played in the season opener against Miami, recording three tackles before suffering a season-ending shoulder | Bengals director of player personnel Duke Tobin said the team will be drafting a running back. SOURCE
Does this mean the team is giving up on Jeremy Hill? How does this impact his, and Giovanni Bernard's value going forward? | the 2018 NFL Draft. The Indianapolis Colts traded their third (67th overall) and sixth round (178th overall) picks to the Cleveland Browns and drafted Lewis with the third round pick they received in exchange. On May 11, 2018, the Indianapolis Colts signed Lewis to a four-year, $4.36 million contract that includes a signing bonus of $1.25 million. He was placed on injured reserve on September 3, 2018 with a toe injury. He was activated off injured reserve on November 9, 2018. Lewis has three younger brothers. Tyquan Lewis Tyquan Lewis (born January 30, 1995) is an American football defensive end | 91 | Leon Hall Bengals' 23–20 loss at the Cleveland Browns in Week 4. Hall completed the 2010 season with 44 combined tackles (33 solo), 11 assists, and four interceptions in 16 games and 16 starts. On September 2, 2011, the Cincinnati Bengals signed Hall to a four-year, $39 million contract extension with $14.10 guaranteed and a signing bonus of $9 million. Head coach Marvin Lewis chose Hall and Nate Clements to be the starting cornerbacks to begin the regular season after Johnathan Joseph departed for the Houston Texans during free agency. On November 13, 2011, Hall tore his left Achilles tendon in a | when did jeff hall come into the nfl | how many years did dana hall play for the 49ers | where did the bengals play linebacker in 2014 | who did trevor insley play for in the nfl | who was the texans leading receiver in 2010 season | who was the bengals quarterback when derek anderson started for them | who did bryan randall play for in the nfl | how much yards per kickoff return did ken hall average in his career |
92 | when did basutoland get the law of the cape colony | annexed by Britain, and then in 1873 by the Cape Colony. International confusion over the legality of the transfer required Prime Minister John Molteno of the Cape Colony to reaffirm the annexation later, with the "Ichaboe and Penguin Islands Act (1874)". The annexation was originally intended to form part of an overall absorption of South West Africa into the Cape Colony forming one locally governed British colony. This was to be instituted by the Palgrave Commission (1876). British interference and the resulting break-down in relations between the British Empire and the local Cape government obstructed the Commission's work long enough | History of the Cape Colony from 1806 to 1870 from the Dutch farmers towards the Cape government. Moreover, the inadequate compensation awarded to slave-owners, and the suspicions engendered by the method of payment, caused much resentment, and in 1835 the trend where farmers trekked into unknown country in order to escape from a disliked government recommenced. Emigration beyond the colonial border had in fact been continuous for 150 years, but it now took on larger proportions. On the eastern border, further trouble arose between the government and the Xhosa, towards whom the policy of the Cape government was marked by much vacillation. On 11 December 1834, a government commando | **South African History**
&#x200B;
in 1647 two employees of the Dutch East India company shipwrecked in South Africa and were able to survive thanks to the help of South African natives. When the sailors returned to Holland they brought stories of South Africa's fertile and beautiful landscape, and remarked that due to it's position on the southern most tip of Africa the country could serve as a "warehouse and garden" for traders looking to take respite on their way from Europe to Asia. The Dutch soon began colonize South Africa. Dutch semi nomadic settlers known as Boers (the dutch word for farmer) initially began colonizing South Africa, often fighting bloody conflicts with local Xhosa tribes.
&#x200B;
In 1806, after the Napoleonic wars, the British were ceded control of South Africa, and in 1820 British began heavily colonizing South Africa in numbers never before reached by the Dutch. Then in 1867 the British discovered diamonds in South Africa, and things got much worse. South African native Zulus made a push for freedom with the Anglo-Zulu war in 1879 but were defeated by the British. In 1913 the British passed the Natives' Land Act, which restricted land ownership by native South Africans.
&#x200B;
In 1948 the National Party of South Africa instituted Apartheid, which defined three distinct races, blacks, coloureds, and whites. Under Apartheid marriage was restricted across racial lines, the majority blacks were removed from their homes and forced to live in specially designated areas in which conditions were brutal. Employment and land ownership was restricted for majority blacks in South Africa. Whites in South Africa enjoyed the best living conditions in all of Africa and prospered immensely off of South Africa's rich lands and mineral deposits. Apartheid laws were not removed until the early 1990s.
&#x200B;
Today South Africa is home to some of the largest and poorest slums in the world. Informal segregation is still alive and well in South Africa's "townships" which are essentially enormous sprawling cities populated by South African blacks living in intense poverty with little to no fresh water or other basic amenities. These townships, which on some cases can be home to millions, are often positioned directly across from South African vineyards and farmland, which not only serve to make their white owners rich, but use a drastically disproportionate amount of water and resources.
&#x200B;
**My Philosophy in Context**
&#x200B;
It is clear upon examination of the history and current state of affairs in South Africa, that historically, black people have been systematically taken advantage of by white people. It also clear that currently, modern day white people are profiting off of this historical injustice and modern day black people are suffering for it.
&#x200B;
I also acknowledge that the white people profiting did not commit the injustices that allowed them to succeed. I acknowledge that it is wrong to make a person pay for crimes they did not commit.
&#x200B;
I acknowledge that a strong argument against land redistribution is that white farmers should not be penalized for the sins of their ancestors. However, there is a simple response to this argument. Just as white farmers should not be penalized for the sins of their forefathers, they should not be allowed to profit off them either.
&#x200B;
I acknowledge that I do not possess a strong enough understanding of the South Africa economy to provide a concrete plan with specifics on how exactly land should be redistributed, but I don't want these details to be the focus of this argument. I am arguing philosophically for the idea that it is unfair for South African white to continue to profit off the vestiges of Apartheid while the blacks suffer under it.
&#x200B;
In the case of South Africa, after decades of egregious mistreatment of Blacks, leading to intensely unequal conditions, I feel that redistribution of land is not over-correction, but retribution. | Customary law in South Africa that colonial law was not always appropriate or convenient for the colonised in dealing with instances of everyday life (such as family law). Accordingly, the colonial state began to define the parameters that marked the jurisdictions of legal systems within its control and, in so doing, divided colonial and customary law into "separate and [allegedly] autonomous spheres." In addition, there were many different types of customary law, each based on the indigenous group practicing the law. Mahmood Mamdani has emphasized the importance of Theophilus Shepstone's role in creating the system known today as indirect rule and, with it, official customary | Why did people move from europe to south carolina colony? | In addition, the monopolies were rescinded. This meant that the Dutch East India Company re-asserted the official Company policy with regards to prohibiting the involvement of Company officials in farming and trading activities and restricting them to their official administrative responsibilities. All political prisoners were released from the Castle and the Huguenots celebrated their victory. On 31 December 1708, Dirk Coetsee began his last term as Hoofdheemraad of Stellenbosch.()< In the Cape Colony, the Board of the Landdrost (Magistrate) and Heemraad (Council) governed the country districts and answered directly to the Governor. The Cape Colony was divided into four districts: | Cape Colony by the UK following the Battle of Blaauwberg in 1806, and British possession affirmed with the Anglo-Dutch Treaty of 1814. The Cape of Good Hope then remained in the British Empire, becoming self-governing in 1872, and uniting with three other colonies to form the Union of South Africa in 1910. It then was renamed the Province of the Cape of Good Hope. South Africa became a sovereign state in 1931 by the Statute of Westminster. In 1961 it became the Republic of South Africa and obtained its own monetary unit called the Rand. Following the 1994 creation of the present-day | History of the Cape Colony before 1806 Town. The supplying of these ships with fresh provisions, fruit, and wine provided a very large market for the surplus produce of the colony. The Cape colonists gradually acquired all of the land of the Khoikhoi to the north and east of their base at Cape Town. Besides those who died in warfare, whole tribes of Khoikhoi were severely disrupted by smallpox epidemics in 1713 and 1755. A few remaining tribes maintained their independence, but the majority of the Khoikhoi took jobs with the colonists as herdsmen. The Dutch East India Company government passed a law in 1787 subjecting the | 92 | Law of Namibia of colonisation. Basutoland (Lesotho) received the law of the Cape Colony in 1884, and Bechuanaland (Botswana) and Southern Rhodesia (Zimbabwe) received it in 1891. Swaziland received the law of the Transvaal Colony in 1904, and South-West Africa (Namibia) received the law of the Cape Province in 1920, after its conquest by South Africa. The Namibian court system is organised hierarchically, and consists of (from lowest to highest legal authority): Magistrates' Courts; High Courts; a Supreme Court of Appeal, the highest authority in non-Constitutional matters; and a Constitutional Court, which is the highest authority in constitutional matters. The Constitutional Court has | when did the apartheid laws begin in south africa | what does namibia's courts lack | how many tiers of courts are there in namibia | who is recognised as a person in south africa law | Government of Namibia | where is the country of namibia located on a map | when was the interim constitution of south africa enacted | what is the name of south africa's free state court |
93 | what word is on the cover of cleo magazine | In Li'l Abner's words, "Shmoos "hain't" make believe. The hull [whole] earth is one!!" The term "shmoo" has entered the English language, defining highly technical concepts in at least four separate fields of science: An unexpected—and virtually unprecedented—postwar merchandising phenomenon followed Capp's introduction of the Shmoo in "Li'l Abner". As in the strip, shmoos suddenly appeared to be everywhere in 1949 and 1950—including a "Time" cover story. They also garnered nearly a full page of coverage (under "Economics") in "Time's" International section. Major articles also ran in "Newsweek", "Life", "The New Republic" and countless other publications and newspapers. Virtually overnight, | issue was published in January, 2018. The circulation of "Tiempo" was 141,000 copies in 1994. Its circulation was 31,680 copies in 2009. In June 2011 the weekly had a circulation of 24,975 copies. For the first part of 2013 the circulation of the magazine rose to 29,229 copies. Official website Tiempo (magazine) Tiempo, also known as "El Tiempo" and "Tiempo de hoy", was a Spanish language weekly news magazine published in Spain from 1982 to 2018. "Tiempo" was first published on 17 May 1982. Its founder was Antonio Asensio Pizarro, who also established Grupo Zeta in 1976. Julián Lago was | What features are in a magazine? | Differetiate between a newspaper and magazine? | Smena () is a formerly Soviet, now Russian, illustrated magazine first published in January 1924 by Molodaya Gvardiya, the publisher of the Komsomol press, and subsequently by the publisher Pravda. It appeared twice monthly, including analytical and polemical journalism alongside fiction and poetry. Smena today continues to publish literary fiction and reporting. In its early years Smena was one of several magazines aimed explicitly at young people that was part of a rich early Soviet print culture designed both as propaganda, and to educate its readership and discuss their concerns.
It is impossible to directly translate the word смена from Russian, as it encapsulates several meanings relevant to the revolutionary project of which the magazine participated. With definitions including “shift,” and “replacement,” and suggestive of generational change, the title reflects the magazine’s intended purpose to shape Soviet youth and engage them in the revolutionary struggle.
History
Smena was founded in 1924 as an organ of the Central Committee of the Komsomol, intended to educate its young audience. It was part of a broader propaganda and literacy campaign. Its status as an illustrated magazine was essential, particularly since much of its intended audience was semi-literate. The inaugural issue laid out its program, of: Revolutionary romanticism, novels, tales, stories and verse.
Travelogues, geographical, ethnographic, geological sketches, articles on questions of nature, engineering, social hygiene, the scientific organization of labor and others.
A chronical of scientific discoveries and technical advancements.
Sketches on the history of the revolutionary movement in Russia and abroad, sketches on the history of the party and youth movement.
Popular articles on questions of social science.
The magazine devotes particular attention to coverage of the lives of working youth.
The magazine’s clear propagandistic function was accompanied by a need to appeal to readers to motivate them to engage with the magazine, so Smena and other such contemporary publications devoted a great deal of coverage to difficult social issues of the time. Contributors to the literary sections of the magazine in this period included Vladimir Mayakovsky, while the work of artists including Alexander Rodchenko also appeared in its pages. By the 1930s, the magazine was also a “litconsultancy” designed to publish and develop new Soviet writing following the model Maxim Gorky established at the magazine Literaturnaia ucheba.
The majority of Smena was devoted to coverage of Party activities and meetings, industry, agriculture, new technologies and products, and the everyday lives of workers (and to a lesser degree, peasants) and the organization of labor. Smena also covered various aspects of the Red Army to demonstrate technological advancements and the training and achievements of recruits. A focus on literacy and agitation, with reflections on what Smena meant to readers, was also a theme that recurs throughout the 1920s and 1930s. Discussions and depictions of Lenin, his life, and the lessons to be drawn from his work, plus readers’ personal reflections on his role and inspiration in their lives, demonstrate the construction of his cult of personality and his central role in Soviet propaganda under Stalin, whose youth, life, and qualities were also held up as an example during his rule. By the 1930s, the kinds of frank discussions of thorny social questions which had been printed during the period of the New Economic Policy was no longer possible, and Party policy was rarely, if ever, openly criticized. Other figures who appear in the magazine include senior party officials and writers, with articles about Mayakovsky and his relationship with readers appearing more frequently than of any other writer in Smena throughout the 1930s and ‘40s. Gorky is also a key figure.
The theme of fizkul’tura - the Soviet campaign for physical education which also promoted group activities - first appears in issues in the late 1920s and continued to be a major theme during the 1930s and beyond. The fiction published in Smena also reflected the growing dominance of literary socialist realism, and both Paustovsky and Kataev's work appeared in this period. By the 1940s, Smena’s content had become focussed on the Great Patriotic War, like many publications in the Soviet Union and beyond. In a shift also of the magazine’s aesthetic style, it adopted the moniker of “fortnightly journal of military-physical culture (voenno-fizkul’turnyi) of the Central Committee and MK VLKSM for Soviet youth." By August 1942 this has been shortened simply to “fortnightly military journal of the Central Committee and MK VLKSM” (voennyi zhurnal). In wartime, like many other publications, Smena published a great deal of coverage from the front and celebrated the bravery and heroism of young fighters, disseminated anti-Nazi propaganda, and galvanized their readership in the war effort, some articles specifically encouraging women to join up. Imagery of Stalin is less prominent in this period of the magazine, although unsurprisingly it remains unwavering in its support of his leadership. Towards the end of the war, the magazine alters its moniker again, to “literary-artistic and socio-political journal of the Central Committee of VLKSM”, and returns to printing a greater proportion of literary material and non-military coverage. The postwar period sees a more optimistic tone, alongside accounts of wartime heroism. There is a notable amount of sports coverage, and by the end of the 1940s, the sheet music and lyrics to songs celebrating different aspects of Soviet life become a fixture which persists throughout the 1950s.
Given the ubiquity of Stalin’s image in Smena during his life, it is extremely notable that it all but disappears after the issue devoted to the announcement of his death. (Lenin's image and articles on Lenin, in contrast, continues to appear in Smena and on its cover for many years after). Even on the issue published around the anniversary of his death, only a photograph of Stalin is printed, with no accompanying articles. [№643, март 1954]. There is no mention of the second anniversary of his death. Throughout the ‘50s and ‘60s, Smena continues to publish content on party activism, industry, agriculture, and the lives of Soviet citizens, as well as travelogues and coverage of other countries and articles devoted to the legacies of 19th century Russian writers like Tolstoy and Chekhov alongside its contemporary poetry and prose. By the 1960s, contemporary issues predominate in the magazine, and propaganda surrounding the space race begins to appear frequently. Throughout the subsequent decades, Smena reflects changing political currents, and during perestroika it began to discuss themes such as rock music which had previously been forbidden.
In January 1990, Smena was reduced to a monthly publication schedule due to shortages, but pledged all the same to continue the long traditions of the magazine, in “activating public consciousness and the moral potential of the younger generation.” It became a privately-owned publication in 1991.
In the twenty-first century, Smena has published the work of writers such as Svetlana Alexievich among many others.
Smena and debates on novyi byt
From its foundation in 1924 to the early 1930s, Smena engaged in a dialogue with its young readership, with editorials in the form of letters written by workers and students of the same age which invited responses, while depictions of exemplary Komsomol members and working youth served as models for life. In 1925, Nikolai Bukharin demanded a “cultural revolution” in the Komsomol press, which precipitated yet greater debate about the morality of Soviet youth. Much of the journalism and fiction in Smena addressed social problems affecting young people, including issues of novyi byt (the new form of everyday life), or questions of what it meant to be a good Soviet citizen under changing social norms and in the 1920s, many differing opinions were published in Smena on what novyi byt should look like, demonstrating the relative plurality of this controlled form of public debate during this period as norms in the new Soviet society were yet to be fully established.
The conditions of women's lives and their place in the Komsomol was a topic of frequent discussion in the magazine from 1924-7, as the mobilization of women in the workforce and attendant social changes had a profound impact on society in the early Soviet period. These discussions about women’s lives frequently hinge on the central problem that the promises of the revolution had yet to be realized either in more equal sexual relationships between men and women, or – relatedly – in women’s lack of access to childcare and the unequal division of domestic labor. The many opinions printed in Smena of how women should manage sexual relationships with men who had not embraced Soviet insistence on gender equality was the subject of a series of polemical articles which reveal the complex nature of the debate at the time. Abortion was legal in the Soviet Union until 1936, and in the early issues of Smena it was a theme of both fictional representations like Roza Melevich as well as other reporting. Readers’ responses to these articles reveal the wide range of views on this issue at the time.
References
External links
Smena online archive (ru)
Entry on Smena in the Great Russian Encyclopedia (ru)
1924 establishments in the Soviet Union
Magazines published in the Soviet Union
Russian-language magazines
Magazines published in Moscow | Brian Cleeve Mansions", which delves deeper into some of the subjects covered in its predecessor. The third book, "The Fourth Mary", was published in 1982 and is an account of a branch of the cult of Dionysus that flourished in first century Jerusalem. When the clamour caused by his spiritual books died down, Cleeve withdrew from the public gaze. He continued to write for a small audience of those who contacted him following publication of "The House on the Rock". In 2001, he published a collection of essays on the Internet summarising his spiritual beliefs. In these, he described the steps he | "Vanity Fair" and "Vogue". Cloutier (style agency) The Cloutier Agency is based in Santa Monica, California. It represents creative artists who provide hair, make-up, grooming and wardrobe styling for motion pictures, advertising, photographic layouts and more. The agency also sometimes provides photographers and art direction for photo shoots. The Cloutier Agency was founded in 1977 by Chantal Cloutier, a former fashion model. At the time, most California-based celebrities and Hollywood film studios used freelance make-up and hair artists for their photography shoots. Cloutier established an agency that chose many artists in photography, including (Matthew Rolston, Herb Ritts and Paul Jasmin), | Il Giorno dei Ragazzi Il Giorno dei Ragazzi was a weekly comic supplement magazine of the Italian newspaper "Il Giorno", published between 1957 and 1968. The comic magazine debuted on 28 March 1957. It was originally intended as the Italian version of the British children's periodical "Eagle", of which it published several series such as "Dan Dare, Pilot of the Future", "Storm Nelson" and ' "Riders of the Range". It also presented a significant Italian production, mainly of humorous genre, which included Benito Jacovitti's "Cocco Bill", "Gionni Galassia" and "Tom Ficcanaso", Bruno Bozzetto's comic versions of "West and Soda" and | 93 | Cleo (magazine) home with their parents reading a magazine which has the word 'orgasm' in bold print on the cover". In the pages of "Cleo", all the racy content of the earlier, more progressive era was replaced with celebrity news and fashion, beauty and fitness tips. Now sexy, according to December 2014 cover girl Taylor Swift is "knowing who you are and not needing to defend yourself." As seen through the pages of "Cleo", there was a shift away from sexual liberation to personal gratification and self- improvement, a maxim characteristic of Generation Y. In October 2012, multinational publisher Bauer Media purchased | What's this whole thing between Alpharad and Taylor Swift? | Miley Cyrus won't feature in Girl Talk magazine, after sexualised behaviour .
She was once a regular cover star of publication, which launched in 1995 .
Instead Jessica Ennis, Taylor Swift and presenter Helen Skelton favoured . | Taylor Swift actually had a lot to do with cleaning up Instagram | Branding and Bricolage Gender, consumption and transition | Future of Taylor Swift Productions | Impulsive and Self-Conscious: Adolescents' Vulnerability to Advertising and Promotion | which magazine is known for its topless cover | What is one of a Cover girl commercial script? |
94 | Speed-sensorless torque control of induction machine based on carrier signal injection and smooth-air-gap induction machine model | Various control algorithms have been proposed for the speed-sensorless control of an induction motor. These sensorless algorithms are mainly based on the speed feedback with the flux and speed estimations. This paper proposes a new scheme for the speed-sensorless control of an induction motor. The proposed scheme is based on the current estimation without the flux and speed estimations, in which the controlled stator voltage is applied to the induction motor so that the difference between stator currents of the mathematical model and motor may be forced to decay to zero. The performance of the proposed scheme is verified through simulation and experiment. | This paper presents a study of speed sensorless vector control of an induction machine (IM), fed by a pulse width inverter using observers. The control strategy used is an indirect control by rotor flux oriented with proportional-integral PI controllers. The parameters of these controllers are calculated directly from the machine settings using conventional analytical methods, which require careful calculation and good knowledge of all the machine parameters. The speed is estimated from the measured terminal voltages and currents. Full-order observers estimate all the state variables and are sensitive to any noise in the measurements of currents, voltages and speed. They require filters to remove the noise signals. The current paper presents the rotor flux vector control of an induction motor, using a reduced order Luenberger observer and a Kalman filter. | Modelling of Variable-Speed Induction Machines | The basic concept of direct torque control of induction machines is investigated in order to emphasize the effects produced by a given voltage vector on stator flux and torque variations. The low number of voltage vectors which can be applied to the machine using the basic DTC scheme may cause undesired torque and current ripple. An improvement of the drive performance can be obtained using a new DTC algorithm based on the application of the space vector modulation (SVM) for prefixed time intervals. In this way a sort of discrete space vector modulation (DSVM) is introduced. Numerical simulations and experimental tests have been carried out to validate the proposed method. | In this paper a method is depicted, that enables a highly precise speed control of an induction machine, designed as squirrel cage rotor, without use of a sensor. The speed of an induction machine depends on the rotary field assigned as well as on the load of the machine. In general, the load and with it the slip is unknown. So, the fundamental wave model does not reveal any information about the exact speed. It is impossible to find this information by observing the machine's ideal equivalent circuit. This leads to the fact that, as a rule, in an industrial environment sensorless controlled induction machines do not gain more than 0.5 % speed precision in relation to the rated operating point [1]. In case of need for more precise speed control, the use of a sensor has been essential up to now. As an alternative to the common sensor, this paper is showing a method by which the exact slip frequency and thus the exact speed of the induction machine can be detected by evaluation of anisotropies. This approach is making use of rotor anisotropies. Such anisotropies enable the measuring of the slip frequency, being the base of highly precise speed assessment. The slip frequency as well as update rate of the slip frequency measurement are low in the chosen analysis method. In order to prevent a reduction of the dynamics of the speed control by a low update rate of the slip frequency, the measured value of the rotor slip is not used directly in the evaluation of the rotation speed actual value. The measured value is used advantageously in adapting the model parameter rotor resistance to the reality. Based on this, a highly precise speed control can be ensured without any reductions in dynamics. | "Universal Sensorless Vector (USV) control" is a method to drive all ac motors (induction motors, surface and interior permanent magnet synchronous motors including both line-start and damper-less machines, and synchronous reluctance motors) by means of a unified position/speed sensorless vector control algorithm and a unified motor parameter tuning process. This paper discusses how to apply the USV control to closed-slot cage induction motors having non-linearity of leakage inductance. Experimental results on a 0.33kW closed-slot cage IM demonstrate that the proposed parameter tuning can reduce speed and torque errors in the proposed sensorless control. | To reduce the low speed torque ripple of induction motor based on direct torque control(DTC),a new control strategy-torque predict is proposed.The experiment shows that it can reduce the torque ripple,improve the waveform of stator flux and current. | This paper examines the speed control of an induction motor system which has a motor and a load connected via a flexible shaft. Such a system often generates shaft torsional vibrations. These vibrations makes it difficult to achieve a fast response to the speed command and may result in damage to the plant. In this paper, a speed control scheme based on two degree-of-freedom control is proposed. The feedback part is designed to suppress torsional vibrations and reject torque disturbances. The feedforward part is also designed to improve the speed response to commands. | 94 | A speed-estimation technique for induction machines, based on carrier signal injection and the standard two-axis smooth-air-gap induction machine model, is presented. The proposed speed-estimation technique can work over a wide range of operating points, including fundamental dc excitation. The stability of the algorithm is analyzed using a two-time-scale approach. Based on the estimated rotor speed, a torque controller is designed. Experimental results are presented confirming the validity of this approach. A method to reduce torque ripple generated by the injected carrier signals is also introduced | Induction motors are robust and inexpensive machines and are widely used for variable speed control because of recent development of electronic technique. In the case that loads of the motors are compressors, pumps, and so on, the constant V/F control of the induction motors is usually employed because it is difficult to install speed sensors and accurate speed control is not required. In such loads, the rotational speed of the motors is considerably fluctuated because the load torque is pulsated. When frequency of the torque pulsation is close to the resonant frequency of the mechanical system, large vibration and acoustic noise are produced especially in low frequency region.In this paper, authors propose a method to suppress the variation of the rotational speed of the V/F controlled induction motor with a fluctuated load by feedforward compensation using a timing sensor of 1 pulse/rev. considering that the load torque varies periodically. The feedforward data by a period for the compensation is obtained by the learning control based on the repetitive control in which the motor speed is controlled by periodically reflecting the past speed error on the present V/F input to the inverter. Effectiveness of the proposed method is confirmed by approximate analysis, simulations and experiments. | Nonlinear modeling and simulation of induction machine | Induction motor speed-torque-current curves | A differential-algebraic approach to speed estimation in an induction motor: open loop experimental results | A simplified model for speed control of AC voltage controller fed induction motor drives | Complete Parameter Identification of Large Induction Machines From No-Load Acceleration–Deceleration Tests | The Study of Harmonic Behavior Caused by Slotting for Speed Calculating Application in Induction Motors | Experimental investigation on detection of air gap eccentricity in induction motors by current and vibration signature analysis using non-invasive sensors |
95 | The Growth of GaN Films by Migration-Enhanced Epitaxy | High-quality GaN thin films are grown by rf-plasma assisted molecular beam epitaxy. The quality of the GaN epitaxial layer is significantly improved by using an intermediate-temperature GaN buffer layer (ITBL) in addition to a conventional 20-nm-thick low-temperature buffer layer. The GaN epitaxial layers demonstrate systematic improvements in the electron mobility increasing from 82 cm2 V-1 s-1, for films grown with just the low-temperature buffer layer, to about 380 cm2 V-1 s-1 for films grown with an ITBL of thickness 800 nm. The photoluminescence also indicates systematic improvements in the intensity and the full-width-half-maximum with the use of ITBL. Photoreflectance spectra are measured from the GaN films. Detailed analyses of the excitonic transition energy demonstrate that the residual strain relaxes rapidly with the use of ITBL, which is attributed to the observed improvements in the mobility and the PL spectra. | A comprehensive model for the electron mobility in AlGaN lattices-matched to GaN is developed. A large number of experimental and theoretical mobility data and the results of Monte Carlo transport simulations in previous literature have been evaluated and referred as the basis for the model development. The proposed model describes the variation of the field-dependent mobility with carrier concentration, temperature, Al composition, random alloy, etc., showing good agreements with previous results. More emphases have been put on the effects of the temperature and random alloy in this work. | Lateral, accumulation-mode gallium nitride (GaN) MOSFETs were fabricated on a silicon-doped GaN epilayer on a AlGaN isolation layer on a conducting 6H-SiC substrate. The polysilicon gate was formed over a 100 nm silicon dioxide gate dielectric deposited by low-pressure chemical vapor deposition at 900/spl deg/C. The accumulation-layer field-effect mobility is measured to be 110 cm/sup 2//V-s. GaN MOSFETS with a 9 /spl mu/m RESURF length were characterized with an on-resistance of 140 m/spl Omega/-cm/sup 2/ at V/sub GS/=15 Volts and breakdown voltage /spl les/180 Volts attributed to tunneling through the AlGaN isolation layer. | A comprehensive study on the growth and properties of GaN films is presented. The films were grown by the electron cyclotron resonance microwave plasma assisted MBE method. The heteroepitaxial growth was carried out on a variety of substrates in two temperature steps in order to separate the nucleation and growth phases. The transport, optical and photoluminescence properties of GaN are discussed. | Abstract With the recognition of the importance of the structural perfection of GaN films for highest performance devices, the growth of GaN bulk crystals or thick GaN layers to be used as substrates as well as high-quality epitaxial layers is considered with increased interest. The different approaches are discussed. GaN films were grown by liquid-phase epitaxy (LPE) on (0 0 0 1)sapphire, on (0 0 1)LiGaO 2 , on (1 0 0)LiAlO 2 , and on vapor-grown GaN seed films from Ga(l) at 900°C. | Abstract We investigated the optical transitions in cubic GaN films grown on GaAs(1 0 0) substrates by metalorganic vapor-phase epitaxy. The cubic GaN films show good optical quality. From temperature and excitation intensity dependence, the emission lines at 3.274 and 3.178 eV were assigned to the excitonic transition and the donor–acceptor pair transition, respectively. We also suggested an additional acceptor level ( E A′ ≈212 meV) to explain the origin of the emission lines at 3.088 and 3.056 eV, on the basis of the excitation intensity dependence. | Layer transfer via ion-cut has been developed for GaN to fabricate multiple templates from a high-quality GaN wafer without compromising the crystallinity. Here, we report on the successful fabrication of 4-in. layer-transferred GaN on sapphire. A high quality epitaxial layer is also successfully grown despite the structural degradation in the transferred layer by hydrogen implantation. Fully packaged vertical light-emitting diodes grown on the template exhibit the peak external quantum efficiency of 48.6% and optical output power of 1.8 W at 220 A/cm2, suggesting that the template could serve as a low-cost substrate for high-performance nitride devices. | In this article, we report the effects of indium doping on crystalline and optical properties of GaN grown by metalorganic chemical vapor deposition during initial growth stage. Atomic force microscopy observations revealed that the In doping enhanced the lateral growth while the c-face growth rate was reduced. X-ray diffraction (XRD) and micro-Raman scattering measurements showed that the epilayers during this growth stage are nearly strain free. From XRD measurements, we found that In doping has increased the full width at half maximum values in both (0002) and (2024) ω-scan. Room temperature photoluminescence measurements show that In doping has enhanced the band-edge related emission by an order of magnitude compared to that of undoped GaN. Raman spectra indicate that In doping suppressed the misorientation of crystallites. In addition, a Raman mode occurred near 710 cm−1 in the In-doped GaN and has been assigned as the Frohlich vibration. | 95 | Gallium Nitride epitaxial films were grown by migration enhanced epitaxy directly on sapphire (0001) without using any pre-growth substrate nitridation or low temperature buffer layers. In comparison with the material grown directly on sapphire by conventional molecular beam epitaxy, a significant improvement in the surface morphology and layer properties, measured by reflection high energy electron diffraction, X-ray diffraction, scanning electron microscopy, room temperature photoluminescence and the Hall effect, was observed for material grown by migration enhanced epitaxy. | High electron mobility AlGaN/GaN heterostructures grown on sapphire substrates by molecular-beam epitaxy | Molecular beam epitaxy of GaN(0001) utilizing NH3 and/or NH+x ions: Growth kinetics and defect structure | Precipitates in GaN epilayers grown on sapphire substrates | Substrate nitridation effect and low temperature growth of GaN on sapphire (0 0 0 1) by plasma-excited organometallic vapor-phase epitaxy | Growing GaN Film by Hydride Vapor Phase Epitaxy with Low Temperature AlN Interlayer | Temperature dependence of InN growth on (0001) sapphire substrates by atmospheric pressure hydride vapor phase epitaxy | Molecular beam epitaxial (MBE) growth of silicon on gallium‐activated Si(111) surface is investigated by microprobe reflection high‐energy electron diffraction. Improvement in crystallinity is observed for a film grown on Ga adsorbed surface compared with that grown on a clean Si surface. Substrate temperature dependence of denuded zone width of two‐dimensional (2D) nuclei is measured for various growth rates. The measurements give the activation energy of surface diffusion and the critical 2D nucleus size. Due to gallium adsorption on the surface, the activation energy becomes lower and the size becomes larger than those on the clean Si surface. This improves the crystallinity of the grown film. MBE growth of Si on partially activated surface is also reported. It is found that a film with good crystallinity grows selectively on Ga‐adsorbed area. | Epitaxial beta-gallium oxide (β-Ga2O3) has been deposited on c-plane sapphire by plasma-assisted molecular-beam epitaxy technique using two methods. One method relied on a compound Ga2O3 source with oxygen plasma while the second used elemental Ga source with oxygen plasma. A side-by-side comparison of the growth parameters between these two methods has been demonstrated. With various substrate temperatures, pure phase (2¯01) oriented β-Ga2O3 thin films were obtained using both sources. Reflection high energy electron diffraction patterns displayed a threefold reconstruction during the growth. X-ray photoelectron spectroscopy analysis showed a shift in the binding energy of the Ga 2p peaks consistent with a Ga being in a +3 oxidation state. For transparent oxide like β-Ga2O3, it is important to determine the index of refraction (n) and its functional dependence on the wavelength. The Cauchy dispersion relation was employed to evaluate the refractive index, film thickness, roughness values, and extinction ... |
96 | would have givin 5 stars for part but don't like allen screw at front | I would have givin four stars but when I talked to the guy when placing the order he said he would put the spllin spacer in the kit as I had lost it but he didn't do it I had to drive an hour to get a 1 dollar part to complete the job | I already have the Borg eng boff from the pre-order bonus and the Borg sci officer from the accolade. I know I can also get a romulan Borg boff from the lobi store.
My question is, can I get a fourth borg boff from somewhere to have a full Borg away team as Fed? | Is Vance McDonald a good handcuff for Vernon if he sits out this game? I play in a relatively deep league: 3wr, 2rb, 1te, and 3 flex, with 12 teams, so that waiver wire is slim pickings. The game against Indy should be a shoot out so if Davis sits out McDonald could be a good pickup. What do you guys think? | East to put together. Didn't give 5 stars because of the caps for the screw holes.. repeatedly fell out and got lost. Otherwise would have been 5 star. | H2H league: G, A, +/-, PIM, PPP, SOG
Positions don't necessarily matter as I have Ovy, Benn, and Hartnell for LW and MacKinnnon, H. Sedin, T. Seguin and Stephan lying in IR.
Keeper league, but it doesn't matter because it's only 2 keepers.
Ultimately, am I to believe Conacher in a line with Okoposo and Tavares is going to get the looks for G's A's and +/- or do I trust a somewhat tried and true Shaw on the 2nd line of the Blackhawks? | For starters, I'd like to say a bridge deal is probably not happening. He's only an RFA for 1 more year and even a 1 year bridge contract would make him a UFA in 2018. I'd say he's getting a 5 year, $4.3 million per year contract. Why? He's already making $3.5 million, in a place with higher taxes and Benning has a hard on for big, strong tough guys that are right handed. Since this only represents a $.8 million increase in salary, I'm probably underestimating.
Anything above what Gudbranson makes right now would be an overpayment, imo. | Light was great and comes with everything you need to mount to rifle. Only reason for 3 stars and not 5 is because something was wrong with the screw that allows you to tighten or loosen the mounting bracket. Maybe it was cross threaded from the factory, but it wouldn't allow me to back it out enough to clamp onto my picitanny rail. After using more force to back it out, It broke the small pin that keeps it from spinning the screw. For now it's ziptied until I buy a different scout mount. Also the knob is kinda big and was difficult mounting close to rail using an magpul offset rail section. Still a great light at this price. I would buy another. Hopefully my mount was just a rare incident. | Would rate 0 stars if possible. Screw and nut to hold stake together didn't have any threads!!! Had already thrown away box otherwise I'd return!! | 96 | broke back side ear off of gun trying to remove roll pin. would have givin 5 stars for part but don't like allen screw at front. wouldve liked if spring loaded like orig. but like how looks and feels | The rail looks and feels great but the screws were to big for the Mossberg ... | It came out perfect with these clock arms | Mag stuck in gun, will not remove. | Great for a long action/long barrel rifle | Permanently attached to barrel? | Need advice / parts for an antique Hopkins and Allen rifle | what kind of rifle is the pindad spring | Recoil Pad Suggestions for a Mossberg 500 |
97 | how much of the mutant population was affected by hub | Summary A recent paper in this journal by Deng, Li and Li has investigated methods to estimate rates and eects of polygenic mutations using data from mutation accumulation experiments. Here, I evaluate a number of critical points in this paper concerning a maximum likelihood (ML) procedure to analyse mutation accumulation data. I show that Deng, Li and Li’s criticisms are based on misunderstandings, or numerical problems they encountered that could have been readily overcome. In Monte Carlo simulations, I show that ML can give a considerable increase in precision over the method of moments that is traditionally used to analyse mutation accumulation data. Furthermore, ML allows the comparison of the fit of dierent models for the distribution of mutation eects. | USB hubs increase the number of USB devices that can connect to a computer without having to add additional hardware. ... The difference between powered and non-powered USB hubs is that the former draws its power from an electrical outlet while the latter draws its power from the computer connection. | Nearly neutral theory of molecular evolution increasing the mean fitness of the population. In response, the mutation rate of nearly neutral mutations is reduced because these mutations are restricted to the tail of the distribution of selection coefficients. The “fixed model” expands the nearly neutral theory. Tachida classified evolution under the “fixed model” based on the product of formula_5 and the variance in the distribution of formula_10: a large product corresponds to adaptive evolution, an intermediate product corresponds to nearly neutral evolution, and a small product corresponds to almost neutral evolution. According to this classification, slightly advantageous mutations can contribute to nearly neutral evolution. Michael Lynch | I had an issue with this hub. I tried using it with my Logitech keyboard/mouse combination with Logitech's Unifying Receiver. It worked fine at first, but then after some time, my mouse and/or keyboard would become intermittently unresponsive. I can't be sure, but I think it's because the Unifying Receiver gets too hot in this unit, and I believe the heat must be coming from the Ethernet port that's integrated into this hub. I don't have any problems with my Logitech Unifying Receiver when directly plugged into my pc, docking station or another USB hub that I use at my house.
Bottom line, it didn't work for me, so going to try another. | I mistakenly purchased this USB hub forgetting that while my devices are powered with their on individual supplies
the hub is what connects each of them to the computer. If you have a $400.00 audio interface, or $1,500.00 keyboards
with their own drivers, putting them through a $15.00 hub is not wise. It clicked and popped until I realized I had made
a mistake. For less expensive consumer-oriented products this may be fine. The shiny surface can't replace
quality electronic transmission, shielding, and such. I shouldn't have bought it. | Several authors predicted that microcomputers would have the type of impact during the 1980s that tractors had on farms during the 1940s. Many of these authors also made optimistic predictions that farmers would readily adopt microcomputers ( Beasley, 1983; Legacy, Stitt, & Reneau, 1984; Levins & Walden, 1984; Siitler, 1984; Sonka, 1983). A sparse research base, however, makes it difficult to judge the accuracy of these predictions. In this regard, Yarbrough and Scherer (1984) concluded, "...the innovation of on-farm computers is diffusing, although at a modest rate. The rate, however, is about what we should expect of a relatively complex technology” (p. 17). Yarbrough (1987) later concluded that more than half of farmers will never adopt computers. | generated as part of the International Knockout Mouse Consortium program — a high-throughput mutagenesis project to generate and distribute animal models of disease to interested scientists. Male and female animals underwent a standardized phenotypic screen to determine the effects of deletion. Twenty five tests were carried out on mutant mice and two significant abnormalities were observed. Homozygous mutant males were sub-fertile and both sexes had a decreased number of lumbar and sacral vertebrae. BET inhibitors such as JQ1 block the region of BRDT responsible for chromatin binding, and cause a reversible reduction of sperm production, sperm quality, and size of | I have had this hub for one year without any problems with it. I have two printers and two computers connected to it and it works like a charm. I'm amazed that it works so well and costs so little. | 97 | Hub (comics) the resulting electro-magnetic damage. Inside of the gang, she became close friends with Hack and the two of them began to doubt if Unus' exclusive, clique-like strategy was the best way. When a mentally ill Scarlet Witch removed the mutant gene from over 90% of the mutant population, Hub was one of the many who lost her powers. However, Quicksilver—as an act of penance for his part in the worldwide depowering—stole some Terrigen crystals from the Inhumans in an attempt to repower some mutants. He started his mass efforts in Genosha and effectively restored the abilities of many on the | who does hub end up with in the comics | who plays nefarious in ratchet and clank 2 | Quicksilver's death and Wanda's reaction resonated after my own twin died | [MCU] What if Pym Particles didn’t let things grow? | Why was Fatestealer removed? | Gyro is still broken on the Switch, and Epic has yet to acknowledge it | Quick little crisis I’m in with getting my friend into the MCU | (Ultron Spoiler) Quicksilver |
98 | My 9 month old granddaughter loved her Baby Stella | Baby lily loves her baby stella! Stella is soft and takes what a 1 1/2 year old can dish out,. Sweet doll for a sweet grand baby. | This was only one of the Babay Stella sets my mother gave my 21 month old daughter for Christmas. She loves the doll and is getting the hang of the feeding set, diaper bag and Corelle baby bed. I think this doll is adorable. It is so soft and cuddly, with a little tummy button, baby belly and bottom. My daughter loves it and this is the first doll she has taken to as before she would just throw them on the floor after looking at them. Baby Stella sleeps with her every night. I'm sure soon she will be changing the doll's diaper and feeding her at dinner time, but right now she mostly likes to cuddle her. | It's so cute! Still waiting for my little Chloe to get used to it though. | Baby LOVES the doll, she is 4 months old, holds it and "talks" to it, then hugs it!
It is so soft and cuddly, perfect size for little baby. | Hands up-I've got my darling eldest boy who is now 9 years old (he has Noonans and autism) who I had when I was 18! I've now got 13 month old twins and another little bundle on the way.
Who else was a teen mom/mum here too? | The truth of the matter is that my six month old Grandson loves, Loves, LOVES Mabel the Cow.. |
Me and my wife just welcomed our first baby to the family today. Gwendolynn . Celebrating a quick smoke tonight with a Romeo y Julieta coronitas en cedro. Herfing later with my bros later this week to truly celebrate.
Edit: This is her. Gwendolynn Pauline. 7lbs 11ozs. 20 in long | My niece is 5. She has so many questions about "the new baby" (my daughter - just about one month old). Here are the funniest exchanges so far:
---
Niece: Can we give the baby a bottle?
Me: She doesn't drink from a bottle.
Niece: What? What does she drink?
Me: (glance at my sister, who nods for me to go ahead) She drinks from my boobies.
Niece: ...Oh. WHAT?!
---
Niece to my sister (her mom): Did the doctor have to take the baby out of [toweryogi] with a knife?
My sister: No [toweryogi] pushed the baby out.
Niece: ...out of her mouth?
My sister: ...yes.
---
She keeps us laughing! | 98 | My 9 month old granddaughter loved her Baby Stella. She was pretty busy with all the Christmas, but when things calmed down, she hugged her babydoll and kept taking off the binkie and giving it back to her!! I feel I made a good choice. | My little Stella loves Baby Stella! | my granddaughter Loves Stella!, and she loves to ... | My grandaughter loved her boy baby | My granddaughter will be so happy when she opens her Mermaid Tail Blanket on Christmas ... | My daughter's favorite plush. It was lost and I've been so ... | My one year old daughter loves her baby. I ... | So cute my daughter will love. Cant wait for her to open on Christmas | My granddaughter loves her baby boy. She told me ... |
99 | Revisiting the JDL model for information exploitation | In order to standardize and describe vulnerability information in detail as far as possible and realize knowledge sharing, reuse and extension at the semantic level, a vulnerability ontology is constructed based on the information security public databases such as CVE, CWE and CAPEC and industry public standards like CVSS. By analyzing the relationship between vulnerability class and weakness class, inference rules are defined to realize knowledge inference from vulnerability instance to its consequence and from one vulnerability instance to another vulnerability instance. The experimental results show that this model can analyze the causal and congeneric relationships between vulnerability instances, which is helpful to repair vulnerabilities and predict attacks. | In this paper,we base our reseach on a human resourse management,and discuss the system modelization and the process of exploitation by utilizing UML. | Issue-based variability management | Modeling Static and Dynamic Aspects of Information Systems. | I can usually comprehend and apply new technologies very quickly. I read this book and JDO still has me baffled. In my 7 year, Java career, having worked with many large companies, I have been exposed to many homegrown persistence APIs. I though that through these experiences, learning JDO would be simple. I keep waiting for the author to apply parts of the JDO spec to concepts and challenges to which I have become familiar. The author lost me early. He failed to mention how JDO solved common problems developers face while persisting Java objects to XML or RDBMS. I still don't know how JDO handles composite primary keys, or many to many joins. This is one of those rare cases where the spec may be easier to understand that the explanation of the spec. | A Meta-Model for Textual Use Case Description | A bibliography of APL articles on modeling and KBES | The application of generalised constraints to object-oriented database models | 99 | The original Joint Directors of Laboratories (JDL) model was developed in the early 90's, with revisits in 1998, and 2004. Today, with new technologies of big data, cloud computing, and machine analytics, there is an ever increasing need for integration of people and machines. The original JDL model focused on the data fusion (correlation, filtering, and association) issues, while today there is an increasing emphasis on an integrated approach to information exploitation over sensors, users, and missions using enterprise architectures, interoperability standards, and intelligence to the edge. Given these recent changes to computation and distributed access, we examine ways for extending the JDL model from 1998 to support exploitation functions and information management for situation awareness, massive data analytics for contextual awareness, and domain-specific needs for mission awareness. | Talking about Laboratory Information Management | The Integration Domain and the Application Architecture: Report of Workgroup 2 of ICEIMT Workshop II | From Debris to Database: The Development of an Efficient Data Processing Chain for Space Situational Awareness Services | Large-scale instruments sharing platform has been completed based on using Java language to program, and using spring Boot framework technology for building the background project, and using MySQL database to store the data, and using Vue to design the front-page, which will been shared and used in District, University and Enterprise. The test system of eclipse is used for case test to realize the sharing function of large-scale instruments. Through this platform, the instruments' information and leasing of large-scale instruments can be understood in real time, and the status information, online use records, equipment using experience, and online booking, comments and customer service consultation can also be carried out on the platform, so as to make rational and efficient use of large-scale instruments, reduce the using waste of large-scale instruments, and be more conducive to the sustainable development of economy, science and technology and expand the scope of resource sharing. | LABGEN, expert system for knowledge-based modelling of analytical laboratories : Part 1. Laboratory Organization | User requirements on the future laboratory information systems | The importance of data is steadily increasing in the domain of business process management due to recent advances in data science, IoT, and Big Data. To reflect this paradigm shift towards data-awareness in service choreographies, we introduced the notion of data-aware choreographies based on concepts for Transparent Data Exchange (TraDE) in our previous works. The goal is to simplify the modeling of business-relevant data and its exchange in choreography models while increasing their run time flexibility. To further improve and simplify the modeling of data-related aspects in service choreographies, in this paper, we focus on the extension of our TraDE concepts to support the modeling of data transformations in service choreographies. Such data transformation capabilities are of dire need to mediate between different data formats, structures and representations of the collaborating participants within service choreographies. Therefore, the paper presents a modeling extension as means for specifying and executing heterogeneous data transformations in service choreographies based on our TraDE concepts. | This paper explores challenges facing information system professionals in the management of data and knowledge in the Department of Defense (DOD), particularly in the information systems utilized to support Command, Control, Communications, Computers, and Intelligence (C 4 I). These information systems include operational tactical systems, decision-support systems, modeling and simulation systems, and nontactical business systems, all of which affect the design, operation, interoperation, and application of C 4 I systems. Specific topics include issues in integration and interoperability, joint standards, data access, data aggregation, information system component reuse, and legacy systems. Broad technological trends, as well as the use of specific developing technologies are discussed in light of how they may enable the DOD to meet the present and future informationmanagement challenges.Index Terms-Command and control, data access, data aggregation, data and knowledge management, data mining, integration and interoperability, military information system, network-centric warfare, software reuse, standards. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.