text
stringlengths 113
6.79k
| label
int64 0
8
|
|---|---|
the back plate specifically the support 107 is radially lengthened as with the back plate 61 of the conventional brush seal 51 the lengthened support 107 engages a substantial length of the bristles 117 to limit bristle blowover in the flow direction the support 107 could be lengthened by for example welding additional material thereto since the retainer 109 is removable the present invention can either can either radially lengthen the retainer 109 similar to the support 109 or the present invention can use a replacement retainer 109 that made to length as with the side plate 57 of the conventional brush seal the proximal i e radially outer end of the retainer 109 abuts the bristles 113 the distal i e radially inner end of the retainer is laterally spaced from the bristles 113 to act as the windage cover replacement of the brush seal 101 of the present invention should be less expensive than the replacement of the conventional brush seal 51 when replacing the conventional brush seal 51 the technician removes the rivets 69 to release the retainer 67 removes the brush seal 51 including the side plate back plate and bristle packs provides a replacement brush seal with side plate back plate and bristle packs and resecures the retainer 67 when replacing the brush seal 101 of the present invention the technician only needs to remove the rivets 111 to release the retainer 109 remove the bristle ring 113 replace the bristle ring 113 and reattach the retainer 109 in essence since the side plate and back plate are engine part not part of the. | 5 |
would cause such inconvenience if it is worn for a long time the belt 104 excepting for the mount portion 94 is generally formed of soft leather like material and includes a fastening belt portion 108 having attached thereto peelable adhesive textile 106 tradename velclo a metal ring 110 through which the belt portion 108 may be passed to fit around the wrist and a thumb holding portion 112 in which the wearer 39 s thumb may be inserted such belt 104 may be mounted on the wrist in the manner as shown in fig1 but unlike that shown in fig1 the belt 104 has such a wide area of contact with the wrist that will provide a highly stable fit and good retention characteristic and the thumb holding portion 112 contributes to further enhancement of said stability and retention characteristic thus such belt is meritorious in that it permits the wearer to wear the typewriter on his wrist for a long time without fatiguing the wearer in fig1 the typewriter body 2 is shown as being mounted on the left hand wrist as previously mentioned and features of the typewriter of the present embodiment will now be described with respect particularly to fig1 the operator usually wears the typewriter body 2 on his wrist in the manner as shown in fig1 and whenever a need for conversation arises he may suitably operate the keys 6 and space key 8 on the keyboard 7 to provide a desired message on the recording paper 12 and present to his partner the recording paper 12 as it is discharged through the port 16 whereby the message may be communicated the keys 6 on the keyboard 7 are suitably arranged so that. | 1 |
or other electrical components connected to the bus even if there should be a short circuit or other such fault in the bus when the power supply section 10 and the test system as a whole are shut down all of the switches 1 2 3 and 4 are in their open positions as shown in fig1 in accordance with this invention before the test system is powered up and more particularly before the main power supply 12 is turned on a self testing procedure is carried out by the power supply section 10 in accordance with the routine shown in fig2 this routine is initiated by closing switch 1 usually manually the closing of that switch supplies power to the central processor 16 voltmeter 18 and to the switch 3 in the test power supply 28 at this point switch 2 is in its open or cpu position so that the processor can operate its booting routine but is unable to control the overall test system if the boot procedure is not successful processor 16 logs a power up failure and may be arranged to shut down the system by opening switch 1 and or to signal the failure by activating an indicator 38 in any event the failure marks the completion of the. | 6 |
ballast lamp operations application_number US 64989803 A description with reference now to fig3 a self oscillating driver ic 10 drives half bridge power stages with transistors m 1 and m 2 generating an ac voltage across the input of a resonant load ic 10 has a built in oscillator that is or is similar to the u201c 555 u201d timer of the prior art oscillator frequency can be programmed with a timing circuit 12 coupled to pins rt ct and common u201c corn u201d the feedback circuit includes blocks 14 and 16 that couple inverter high voltage output lh to timing circuit 12 block 14 attenuates the output voltage signal and block 16 phase shifts the output voltage signal from 150 u00b0 to 200 u00b0 to compensate for the phase difference between the inverter output voltage and the external synchronization signal timing circuit 12 may include a timing capacitor ct and resistor rt see fig2 and switches when the timing capacitor is charged to u2154 vcc and discharged to u2153 vcc in a standard ic application the timing capacitor voltage waveform is an exponential ramp that is superposed on the dc voltage by mixing in a small phase shifted signal to the ramp the ic oscillator correlates its frequency preferably a source of this signal is coupled between ground and the timing capacitor in an embodiment of the device shown in fig4 which is particularly suited for high frequency application 200 270 khz attenuating block 14 fig3 includes a capacitive divider with capacitors c 4 and c 5 connected to inverter high voltage output lh phase shifting block 16 includes an active signal inverter that includes transistor m. | 8 |
of the middle layer consists of synthetic fibres and 90 of absorbent fibres the proportions between the synthetic fibres and the absorbent fibres such as cellulose fibres 7 8 this means that 47 of the top layer consists of synthetic fibres and 53 of absorbent fibres the process processes in a way that the first forming bead 41 will be supplied with the fibres for the bottom layer the other forming head 42 with the fibres for the middle layer and the third forming head 43 with the fibres for the top layer thus the three layers will be formed in each layer 39 s separate forming head 41 42 43 and successively will be laid on top of one another subsequently the process continues in the same way as described for the first construction form the in fig3 shown fourth construction form for a plant according to the invention separates itself from the above mentioned and in fig3 shown third construction form by now similar to the other construction form and as shown in fig2 a special continuous thermal bonding oven 36 is inserted between the conveyor and the hydro entangling section 3 similar parts are therefore also in this case indicated with the same reference numbers with this setting of the plant according to the fourth construction form the same advantages will be achieved. | 3 |
and time and effort as well as providing a less well refined overall fencing construction design an important rib set back configuration is also shown in fig3 here the rib set back 50 which is at least 0 010 inches and preferably is in the range of 0 010 to 0 050 inches further minimizes flashing exiting the mating area of the securement zone 22 and 34 during ultrasonic welding of the caps to the structural members preferably the set back distance is chosen to be greater than between 50 to 100 of the vertical height of the welding rib for polyvinyl chloride thermoplastic material this set back is usually 0 010 to 0 050 inches this is because the welding rib 40 is positioned immediately adjacent to the capping securement zone inner boundary line 38 while being positioned spatially distant from and set back from the capping securement zone outer boundary line 36 thus movement of the excess fluid thermoplastic material during ultrasonic welding toward the bore 14 will be enhanced this is also an important consideration in the overlapping or external cap side mounted configuration 58 shown in fig8 here again we see the rib set back space 50 between the welding rib 40 and the capping securement zone outer boundary line 36 on the other hand the welding rib 40 extends all the way to the capping securement inner boundary line 38 in this configuration since it is overlapping configuration the capping securement zone inner boundary line 38 is not immediately adjacent to the bore 14 of structural fence member 10 however the set back of the welding rib 40 and the angular relationship between the. | 1 |
shown then passes under particulate material depositor 75 which deposits the particulate material onto the first layer of aerated confectionery mass the mold not shown then passes under manifold 52 with deposition fingers 45 where the second layer of aerated confectionery mass is deposited thereon although not shown there may be additional aerated confectionery mass manifolds 44 and 52 included if additional layers of aerated confectionery mass are to be deposited as well as additional particulate material depositor 45 if additional layers of particulate materials either different or the same particulate materials are desired moreover as one skilled in the art would understand if desired the same or different aerated confectionary masses could be deposited by manifolds 44 and 52 by making the appropriate process design changes as not the entire confectionery mass is deposited through the second manifold 52 a return line 54 is provided which serves to return a confectionery mass through a further pressure valve 56 comprising a pressure sensor 58 and various static mixers 60 for decrystalling and de aerating to the storage tank 10 in order to conduct tests and experiments in connection with the method described herein three different recipes of known milk chocolate masses of the applicant were prepared the masses were aerated and deposited into molds related to known products of the applicant through depositors having discharge outlets with a width of about 2 mm as described above as described herein depositing was carried out in a layered. | 0 |
water displacement produced at the same location considering that wells pressure may be decreased to one atmosphere and then increasing with this productive life of this type of well the process starts with the transportation of the oil gas mixture of the well 100 towards the separating skid 103 by means of production pipes 101 which are a part of the inventive process already inside the separating skid 103 the gaseous and liquid separation of the phases are performed oil and water transferring the liquids to the closest processing center the gas is passed by means of pipes 104 to the rectifying stage inside the separating skid during the rectifying step the gas is cleaned from liquid particles suspended therein after rectification the gas is driven to the compression skid 110 to the suction inputs of the compressor through a piping that is characterized for starting in first diameter on the rectifier output and then changes to a second diameter that is bigger than the first diameter and finalizing in the compressor input with a third diameter that is equal or smaller to the first diameter the gas oil exhaust bypass valve 102 is generally kept closed during the passing of the oil and gas to the separator 117 it is only opened when there is maintenance service in the well to send. | 4 |
nitrogen atmosphere at room temperature the admixture was stirred at 45 u00b0 c for 2 hours the procedure for the preparation of catalyst component a 39 was followed except that silica alumina surface area 300 m 2 g pore volume 0 7 cc g had average particle size 50 u03bcm was used in place of silica a 300 cc three necked flask was charged with 150 ml refined toluene 15 4 g alet 2 cl 4 2 g zr opr 4 and 3 4 g cyclopentadiene in nitrogen atmosphere at room temperature the admixture was stirred at 45 u00b0 c for 2 hours a 300 cc three necked flask was charged with 50 ml refined toluene 5 84 g triethylaluminum 4 85 g biscyclopentadienyldimethylsilane and 3 5 g zr oet 4 in nitrogen atmosphere at room temperature the admixture was stirred at 45 u00b0 c for 2 hours a 300 cc three necked flask was charged with 150 ml refined toluene 5 84 g triethylaluminum 3 7 g biscyclopentadienylmethane and 4 2 g zr opr 4 in nitrogen atmosphere at room temperature the admixture was stirred at 45 u00b0 c for 2 hours the procedure for catalyst component a 39 was followed except that 15 ml toluene solution of trimethylaluminum concentration 1 mmol ml was used in place of methylalmoxane a 300 cc three necked flask was charged with 150 ml refined toluene 11 7 g triethylaluminum 13 4 g bisindenylethane and 3 9 g zr opr 4 cl in nitrogen atmosphere at room temperature the admixture was stirred at 45 u00b0 c for hours 3 g zirconium. | 8 |
light limiter 31 the experiments were carried out to confirm the operation and effects for the light limiter 31 21 of these embodiments by use this experimental system in this experiment it is confirmed that the optical spectral band width is increased by the parametric amplification in the dispersion shifted optical fiber 32 by exchanging the optical surge peak power the inhibiting effect for the optical surge peak was examined by varying the fiber length of dispersion shifted optical fiber 32 and then the most suitable length thereof was examined in addition in order to quantitatively confirm the inhibiting effect the efficiency of the light limiter 31 21 of these embodiments was examined by measuring the attenuation characteristics and input output characteristics of the optical surge peak power these experimental results are shown in fig4 to 14 fig4 to 8 show that the optical spectral band width is increased by the parametric amplification in addition fig4 shows that the optical waveform output from the optical amplifier 44 before transmission in a dispersion shifted optical fiber 32 the light having a peak wavelength at 1556 nm is the amplified signal light and the optical spectra having a wide band excepting the peak wavelength of 1556 nm are the ase light fig5 to 7 show the optical spectrum after a transmission of 16 km. | 6 |
might be used as an add on component to a standard intravenous administration set fig6 shows the ivfbv manufactured as an integral part of an intravenous administration set with a syringe 17 attached to the stopcock 6 fig7 depicts a bypass valve in which the one way pressure operated valve 30 is separate from the twr 4 the pressure operated valve is attached to proximal tubing 31 which is connected to one branch of proximal y split 32 the stem of the proximal y split is inserted in an iv fluid bag the pressure operated value is also attached to distal tubing 33 which is connected to distal connector 34 shown as a stopcock a traditional n set extends from the other branch of the proximal y split to the distal connector fig8 demonstrates an alternative embodiment with annular pvc rings and the spring in a position similar to that described above the plunger handle 18 faces downwards within the spring the plunger head 19 sits on top of the spring and in the neutral position seals against the underside of the proximal annulus fig9 demonstrates the ivfbv with a clip 20 applied that distorts the shape of the proximal annular pvc ring fig1 shows a top view of the proximal annular ring which is in the shape of a doughnut 14 and the ball bearing underneath the ring 15 shown here in a dotted line the housing 12. | 0 |
be added without sequential staging as present construction practices require further all components of the terraced structured land joint and assembly can be built in factories easily transported to the job site and assembled without training or extensive knowledge of construction trades construction time is greatly reduced weather or seasonal considerations would not dictate construction scheduling with reference to drawing fig1 13b a terraced structured land joint and assembly for structured land is presented an embodiment of he land joint and assembly includes a plurality of ball joints 20 a having outer surfaces each ball joint having a plurality of monolithic mortises 74 of even diameter disposed on the ball joint outer surface 26 at predetermined locations and angles each such monolithic mortise having a monolithic tension member 70 of predetermined diameter centered in each mortise 74 and extending orthogonally therefrom for a predetermined length along a longitudinal axis and having a swelled end portion 72 fig6 9 and 9 a a second embodiment of the land joint and assembly further includes a plurality of ball joints 20 b having outer surfaces each ball joint having a plurality of monolithic tenons 24 disposed on the ball joint outer surface 26 at predetermined locations and angles each such monolithic node having a monolithic tension member 70 of predetermined diameter centered on the tenon 24 and extending orthogonally therefrom for a predetermined length along a longitudinal axis and having a swelled end portion 72 fig7 8 9 and 9 a an embodiment of the land joint and assembly further includes a a plurality of compression members 40 of predetermined length defining a uniform compression member cross sectional area and uniform compression member interior volume 44 for receiving and housing at least one tension member 50 and having two compression ends sized. | 4 |
a water jacket equipped with an immersion heater after 90 minutes mixing was stopped and the stirrer was rinsed to remove fibers the resultant slurry from rinsing the stirrer was collected and oven dried to a constant weight the difference in weight represents the depositable material which is then converted to grams of depositable material per ton of pulp the first experiment performed was to test a cationized talc i e talc treated with only a polydadmac against a control and a conventional talc an occ pulp from a mill was used in this study four samples of pulp were prepared one without talc control one with conventional talc and two with cationized talc at different dosages the results of the deposition testing described above are listed in table 2 the results show that the treated talc provides a reduction in stickies deposited on the stirrer the results also show that the percent reduction increases with an increase in the amount of treated talc added to the occ pulp thus it is clear that a polydadmac treated talc will significantly reduce stickies while it is possible to add a polydadmac treated talc to an occ pulp in the amounts shown above and such addition is specifically contemplated herein cost is a factor which in the practical world should be considered in addition to cost considerations it is noted that the addition of 40 pounds of talc per ton of occ pulp may affect other board properties such as strength stiffness or coefficient of friction thus while contemplated under the principles of the invention the addition of this much talc may have other impacts and therefore other chemistries were evaluated to determine whether other chemistries can provide the same benefits as the polydadmac treated talc the polymers. | 3 |
one would have the difference in the energy gap of these two processes comes from the isotope effect on the difference in the v 3 to v 2 energy spacing for both isotopic species the 3 u2192 2 de excitation process will be a few hundred cm u2212 1 out of resonance with the 0 u2192 1 excitation process because of the large anharmonicity of the c h stretch the small fractional difference in the energy deficit of the process between the 13 c and 12 c species is significantly less than the simple case of co 2 shown above it is difficult to imagine that such a small fractional difference in energy gap could lead to a substantial difference in vibrational energy transfer rates in cf 3 h the key to understanding the phenomenon of collisional enhanced isotope selectivity exploited in this invention is to realize that the initially prepared state of cf 3 h is not a pure v ch 3 stretch state vibrational state mixing in these molecules has been extensively studied and is well understood j segall et al j chem phys 86 634 1987 each overtone level with n ch stretch quanta is characterized by a polyad of n 1 strongly coupled states consisting of combinations of stretch and bend excitations thus for n 3 one has the group of coupled states designated v s v b gt for the number of stretch and bend quanta respectively 3 0 gt 2 2 gt 1 4 gt and 0 6. | 1 |
slot 42 in the grip 16 through which the locking screw 40 passes allows movement of the clicker block 36 and clicker spring 34 along the length of the handle 14 as shown in fig5 the clicker 34 will make a noise when the main spring deflects a distance x 1 which represents a force f 1 on the main spring 26 f 1 in fig5 is generally the maximum force possible with a given main spring in a given location thus when the clicker spring 34 is closest to the head the maximum force must be used the minimum force f 1 for a given position of main spring 24 is set on the torque wrench by moving the clicker spring to a position closest to the main spring 26 fig6 in this position a relatively small movement of the grip 16 causes a deflection x 2 to activate the clicker 34 this occurs simply because of the geometry of the grip being pivoted at 24 the closer the clicker spring 34 is to pivot 24 the more the main spring 26 has to be compressed and the greater the force f has to be before the click is heard the positions of the clicker spring 34 would normally be calibrated between those shown in fig5 and 6 it is also anticipated that a coil or loop spring could be placed at the pivot 24 and work in a similar manner one end. | 1 |
being cultured for seven days change the medium everyday then the clones were picked out 3 characterization of the embryonic stem cells knock in human ngf mature peptide mouse as shown in fig3 a the genomic dna of es cells and g418 fiau double resistant clone were extracted and digested with ecor i and then southern blotting was performed by using the probe a of 5 u2032 end targeting vector there was only one band about 10 kb in wild type cells compared with the recombinant es cells which show another band about 5 kb see fig3 b because of the ecor i site in human ngf mature peptide gene as shown in fig4 a primer 1 5 u2032 gctcatcctcccatcccatcttccaca 3 u2032 seq id no 13 locates at the 5 u2032 end of the mature peptide and primer 2 5 u2032 gaacgagatcagcagcctctgttc ca 3 u2032 seq id no 14 locates at neo gene when using primer 1 and primer 2 to amplify the genome there is not any band in wild type es cells but in recombinant es cells there is a band about 1200 bp amplified fig4 the pcr product was verified by ecor i digestion and dna sequencing and confirmed that the ngf mature peptide gene in mouse genome has already been replaced with that of human genome 1 the method to construct mutant ngf knock in mouse embryonic stem cells is the same as example 3 2 the characterization of mouse. | 2 |
wings are separated by the adjustment wing separator die cut 27 the left hand tire size macro adjustment wing die cut 23 accepts certain small size tire wheels however if adjustments need to be made to receive larger tires wheels the shield can be tailored to fit any size tire wheel by merely selecting the appropriate micro adjustment wing 24 position in other words the user separates wing 23 from the adjacent portion of wing 24 and folds wing 23 up out of the plane of the over spray areas 30 and the front apron 130 the user selects the location at which to fold wing 24 up out of the plane of the over spray areas 30 and the front apron 130 by selecting at which line 124 he she will fold wing 24 for a small tire footprint the user will not fold wing 24 up at all for a slightly larger footprint the user will fold wing 24 at the first line 124 to the right in fig2 of the separator die cut 27 or at the second or third line 124 to the right of the die cut 27 for a larger footprint etc for the largest footprint the user will fold wing 24 upwards at the farthest right line 124 in fig4 note that wing 23 preferably also has curved rounded front corners 129 at its front edge for forming curved opening corners 424 this way if the opening is formed from one flap. | 1 |
other elements of the weather roof support 20 also includes a collector 50 e g tray channel pan trough etc extending along the entire length of roof support 20 collector 50 projects laterally outward from a lower end of support web 22 and extends beneath a portion of each roof panel 14 slightly beyond the drip edges 16 collector 50 is configured to capture water that penetrates the joint created between the abutting roof panels 14 and support web 22 and divert the water to a drain not shown or away from the interior of the building referring to fig4 and 5 roof support 20 is shown according to a preferred embodiment roof support 20 is desirably formed using a thermoset pultrusion process where reinforcing filaments are passed from a fiber delivery system e g reels spindles etc and pulled through a resin impregnation bath the resin embedded fibers are then pulled through preform fixtures e g one or more dies which contour and align the fiber resin combination into the roof support shape that will be subsequently described the contoured fiber resin combination then passes through a heated fixture or die not shown to cure i e u201c cross link u201d the resin upon curing roof support 20 is extracted from the heated die and cut into the lengths that correspond to use in buildings 10 or. | 4 |
manager can view a profile for a subject such as a person in order to perform a risk assessment referring to fig1 the reviewer can begin the initial screening based on the name and date of birth of the subject a personal unique identification puid the number of instances of recorded data number of cases and number of credentials is displayed for a selected subject each instance of recorded data has a u201c citation u201d for purposes of data attribution such that every unique identity fact can be traced back to the raw risk information a unique identity and to any related cases decisions credentials that were based upon it as shown in fig1 u201c juan jacksons u201d may be selected as the subject by the case manager information about the subject is provided according to the format of the master identity hierarchy a number of tabs about the subject may be viewed by the reviewer including a risk management report identity vetting cases and credentials the reviewer can then select a sub category essentially drilling into the master identity hierarchy to view information such as overview biographic residence watchlist and criminality information in fig1 the reviewer can select the overview tab to identify the records available for the subject these include initial registration a personal record and criminal records rap sheets that are linked to the subject in fig1 the reviewer may select the biographic information tab for the subject in the example shown the subject has four 4 instances of biographic records with one of the records including a middle name carson data for the subject can be displayed to the case manager including gender date of birth place of birth social security number height weight hair color and eye color each identity. | 6 |
pumping introducing argon heating to molten aluminum step b opening the reactor cover adding 240 g of potassium fluotitanate to the reactor leakage detecting after closing the reactor cover slowly raising the temperature to 150 u00b0 c vacuum pumping and then heating to 250 u00b0 c step c introducing argon into the reactor continuously raising the temperature to 750 u00b0 c stirring uniformly step d opening a valve to adjust the speed adding molten aluminum drops and controlling the reaction temperature to 750 u00b0 c to 850 u00b0 c step e opening the reactor cover removing the stirring device eliminating the upper layer of kalf 4 to obtain 48 29 g of sponge titanium in which the content of titanium is 98 6 and the reduction rate is 99 2 step b opening the reactor cover adding 240 g of potassium fluotitanate to the reactor leakage detecting after closing the reactor cover slowly raising the temperature to 150 u00b0 c vacuum pumping and then heating to 250 u00b0 c step c introducing argon into the reactor continuously raising the temperature to 750 u00b0 c step d opening a valve to adjust the speed adding molten aluminum drops and controlling the reaction temperature to 750 u00b0 c to 850 u00b0 c step e opening the reactor cover removing the stirring device eliminating the upper layers of kf and mgf 2 to obtain 47 56 g of sponge titanium in which the content of titanium is 99 2 and the reduction rate is 98 3 step b opening the reactor cover adding 240 g of potassium fluotitanate to the reactor leakage detecting after closing the reactor cover slowly raising the temperature to 150 u00b0 c vacuum pumping and then heating to 250 u00b0 c step c introducing argon. | 5 |
member 108 illustrated may be used to apply such a force to the cooling apparatus 112 in such embodiments in the illustrated embodiment there is a tab 114 connected to an axle 116 the tab 114 rotates about the axle 114 to force the loading member 108 down and cause the force 118 on the cooling apparatus 112 and integrated circuit package 106 the tab 114 also keeps the loading member 108 in place in other embodiments other structures may be used to cause the force 118 on the cooling apparatus 112 and integrated circuit package 106 fig1 b is atop view that further illustrates an embodiment of the device 100 described above with respect to fig1 a in the embodiment shown in fig1 b the loading member 108 is a piece of metal or other stiff material suitable to apply an appropriate force the loading member 108 includes an outer frame and a central opening obscured in fig1 b by the cooling apparatus 112 through which the cooling apparatus 112 may contact the integrated circuit package 106 so that heat may be conducted away from the integrated circuit package 106 in other embodiments the loading member 108 may have other. | 7 |
is described below the battery is now at least partly ejected by a spring element 5 fig8 shows a detailed view of the battery retainer 1 of fig7 being incorporated into an electric device d the latter only partially being shown the device d includes a housing h the battery retainer 1 includes a receiving chamber 3 which is directly incorporated into the housing h as a recess the receiving chamber 3 has a shape of a cylinder having a basically circular cross section and is delimited by a cylindrical outer wall 4 this shape corresponds to a coin battery 2 to be received in the receiving chamber 3 i e in the recess a spring element 5 is located at the bottom of the receiving chamber 3 for ejecting the battery 2 at least partly from the receiving chamber 3 when the pivotable retaining arm 5 is pivoted off for example as described above in fig9 when the retaining arm 5 is pivoted off by pressing the push part 10 a battery 2 received in the receiving chamber 3 is automatically ejected or is at its one end at least lifted to an extent that it can easily be removed e g by means of two fingers in detail the one end of the battery which end was previously underneath the retaining arm 5 is lifted and the other end partly remains underneath the static retaining element 16 and the battery. | 7 |
interchanged with one or more of other similar suitable components known in the art and changed in minor non functional respects these additional embodiments of the invention are also regarded as failing within the scope of the claims herein the examples detailed below are provided to better describe and more specifically set forth the elements and mechanics operation of the present invention with reference to the drawing but for obvious reasons cannot describe all of them it is to be recognized that the examples therefore are for illustrative purposes only however and should not be interpreted as limiting the spirit and scope of the invention as later recited by the claims that follow table 1 below shows results of drying experiments which are based on a conventional method for termination of drying the termination of drying was determined by the empirical formula drying time h load kg u00b7 0 7 the experiments were carried out using a centrifugal dryer unit tzt u2212 s from fima with the following equipment features sterile design fully automated cleaning in place cip sanitizing in place sip drying gas transported in open loop explosion protection by ensuring an inert atmosphere in the drying compartment maximum excess pressure during operation 3 bar before the final drying step in the fluidized bed drying the following process steps were carried out transfer of an insulin crystal suspension by means of excess nitrogen pressure from the crystallization container to the drum filter surface of the centrifugal dryer washing of the insulin filter cake passage of nitrogen through the insulin filter cake during fixed bed drying blowing off the insulin filter cake with the aid of a blow off nozzle beginning of the fluidized bed drying. | 5 |
in the following detailed description rather the embodiments are chosen and described so that others skilled in the art may appreciate and understand the principles and practices of the present invention with reference to fig2 of the present disclosure a work vehicle such as a front loader 200 is shown the vehicle 200 includes a front frame 202 and a rear frame assembly 204 that are pivotally joined together at an articulation pivot or joint not shown front ground engaging wheels 206 are coupled to the front frame 202 and rear ground engaging wheels 208 are coupled to the rear frame 204 for supporting and propelling the vehicle 200 although the present disclosure illustrates a front loader 200 it is not limited to such and may include other suitable work vehicles the front frame assembly 102 is provided with a work implement in the form of a loader bucket 214 that is controllably coupled to the front frame assembly 202 by a coupler or mechanical linkage 216 the bucket 214 can be actuated by a hydraulic cylinder 218 which is coupled to the coupler 216 in other embodiments the front frame assembly 102 can be coupled with a pair of forks a blade a rotary tiller a roller level a rotary cutter. | 1 |
to 4 is a quadruple nozzle weft insertion device having a weft guide 2a with a bullet like or conoid shape the weft guide 2 is a streamlined object that is an object whose curvature does not disrupt the smooth flow of fluid thereacross and causes a high velocity air stream to adhere thereto without causing turbulence the diameter of the guide 2 increases until a mid point of the streamlined portion and decreases thereafter until it terminates with a pointed end the weft guide 2a is mounted in the center between the four nozzles 1 1 39 1 34 and 1 39 34 and positioned in a coaxial relationship with the weft path line of sight 1 1 the guide 2a is positioned to contact the pressurized air discharged from the nozzles the high velocity air streaming from each nozzle carries a weft the air stream tends to adhere to the guide 2 in accordance with the coanda effect since the air stream is carrying the weft in the direction of the pointed end which is on the line of sight of the desired weft path as a result the wefts are directed toward the center of the reed channel by floating in the air stream redirected by the guide 2 a second embodiment of the present invention illustrated in fig5 to. | 3 |
explained in more detail below the magnetic field is generated by a current flowing in a conductor such as wire 26 whose axis runs into and out of the plane of the figure the magnetic field generated by such a conductor decreases linearly with the distance from the conductor hence basic storage cell 23 will be subjected to a smaller field than basic storage cell 21 if the current is set such that the magnetic field at basic storage cell 21 is just below the field that would switch the hard layer of cell 21 then the largest possible number of cells is that for which the magnetic field at cell 23 is just large enough to write the soft layer of that cell to implement a memory based on an array of storage cells a scheme for addressing precisely one of a group of storage cells for writing is needed the present invention utilizes one address scheme for writing a storage cell and a different address scheme for reading the storage cell as noted above data is written into a storage cell by exposing the storage cell to a magnetic field of sufficient strength to align the soft layers in a direction specified by. | 6 |
element 11 against the butt 6 not being sufficient to cause the subsequent interception of the incline 55a against the lower part of the butt 8 thanks to the particular conformation of the cam 12 the said butt is not subjected to breakage the front surface of the butt 8 is in fact intercepted in the situation to which reference has just been made position k1 in fig7 by the sloping section 57 and this results in a consequent gradual elastic flexure of the tailpiece 35 the said deflection being made possible by the suddenly reduced area 35a because the butt is intercepted by the track c1 of the block 56 position k2 in fig7 the deflection continues the curved section of the part 53a of the successive cam 12 then has the task of re aligning the blade element 5 in the neutral position r when use made of the blade element 5 depicted in fig1 a instead of undergoing flexure the tailpiece 35 oscillates with respect to the axis thereof in contrast with the corresponding spring 60 the cams 12 13 14 and 15 the selector elements 11 are symmetrical with respect to corresponding vertical planes and thus the same considerations as above apply also to the movement in the direction t2 of the carriage to conclude the particular conformation of the blade element 5 and of the cam 12 depicted in fig6 and 7 enables the under mentioned advantages to be obtained the blade element 5 is not subjected to any stress in the event of the non selection thereof the blade element 5 is not subjected to any stress when selected correctly in fact the cam 12 attends to raising the element. | 3 |
the protective housing interposes between the imaging device and the region to be imaged thus protecting the imaging device from oil spillage knocks and other hazards preferably the protective housing comprises a transparent region located between the imaging device and the region to be imaged in an embodiment the transparent region comprises laminated glass and in a prototype triplex laminated glass of 22 mm thickness was used preferably the mounting is a floor mounting for mounting the imaging device at floor level in a particularly preferred embodiment the mounting is a flush floor mounting for insertion into a floor cavity reference is now made to fig4 which is a simplified flow chart showing operation of a preferred embodiment of the present invention in fig4 a vehicle is driven onto a rail carrying an imaging device the invention is not however restricted to u201c drive on u201d inspection of vehicles and thus as an alternative it is possible to insert a rail carrying an imaging assembly into any kind of space that it is difficult to access and then to operative the assembly to scan the space in either case the imaging device then scans the space either under control of a program or according to instructions from an operator the output is viewed and the operator decides whether any kind of action is necessary the output may additionally be recorded if desired reference is now made to fig5 which is a flow chart showing operation according to an alternative embodiment of the present invention stages that are identical to those of fig4 are not described again. | 6 |
source 20 structure according to the invention including an optical temperature sensor and associated electronics in source 20 optical light pipe 21 is disposed through hermetically sealed passthrough 22 in flange 23 with the light collecting end 21a disposed near or in contact with the bottom of crucible 24 the external end 21b of light pipe 21 is optically connected through fiber optic connector 25 or other suitable optical means to optical detector and associated measurement and data display instrumentation 26 light pipe 21 must be constructed of material having suitable high temperature low vapor pressure inertness and non contaminating characteristics needed for use within an mbe chamber suitable materials for light pipe 21 may therefore include sapphire quartz various optical glasses or other material as would occur to the skilled artisan guided by these teachings in a system built in demonstration of the invention sapphire was used as light pipe 21 light pipe 21 may be hermetically sealed in passthrough 22 by brazing or other suitable vacuum sealing means placement of detector 26 remote of heater coil 27 and the mbe chamber 12 39 containing source 20 renders source 20 substantially immune to electrical noise associated with the mbe process in an alternative configuration passthrough 22 may be configured to accommodate thermocouple 28 passthroughs 29a 29b provide for connecting heater coil 27 to external power source 30 detector 26 may be a photoconductive or photovoltaic detector thermopile or other optical detector as would occur to the skilled artisan practicing the invention a. | 2 |
carbon atoms with one or more polycarboxylic acids having from 2 to 14 carbon atoms examples of suitable polyhydric alcohols include ethylene glycol propylene glycol such as 1 2 propylene glycol and 1 3 propylene glycol glycerol pentaerythritol trimethylolpropane 1 4 6 octanetriol butanediol pentanediol hexanediol dodecanediol octanediol chloropentanediol glycerol monallyl ether glycerol monoethyl ether diethylene glycol 2 ethylhexanediol 1 4 cyclohexanediol 1 4 1 2 6 hexanetriol 1 3 5 hexanetriol 1 3 bis 2 hydroxyethoxy propane and the like examples of polycarboxylic acids include phthalic acid isophthalic acid terephthalic acid tetrachlorophthalic acid maleic acid dodecylmaleic acid octadecenylmaleic acid fumaric acid aconitic acid trimellitic acid tricarballylic acid 3 3 u2032 thiodipropionic acid succinic acid adipic acid malonic acid glutaric acid pimelic acid sebacic acid cyclohexane 1 2 dicarboxylic acid 1 4 cyclohexadiene 1 2 dicarboxylic acid 3 methyl 3 5 cyclohexadiene 1 2 dicarboxylic acid and the corresponding acid anhydrides acid chlorides and acid esters such as phthalic anhydride phthaloyl chloride and the dimethyl ester of phthalic acid preferred polycarboxylic acids are the aliphatic and cycloaliphatic dicarboxylic acids containing no more than 14 carbon atoms and the aromatic dicarboxylic acids containing no more than 14 atoms commercially available polyols which may be used in the practice of the invention include polyethers such as arcol ppg 2025 bayer polyg 20 56 arch and pluracol p 2010 basf polyesters such as dynacoll 7360 creanova fomrez 66 32 crompton and rucoflex s 105 30 bayer and polybutadiene such as poly bd r 45htlo elf atochem a most preferred polyol is polyoxypropylene polyoxyethylene non. | 2 |
the drains through a main regulating valve sr 13 in the case of an incident a safety regulating valve v 13 enables these condensates to be sent directly to the condenser the reservoir drt also receives the condensates of a drier se not shown through a main regulating valve sr 15 a safety regulating valve v 15 controlled in the same way as the valve sr 15 as a function of the level in the drier enables these condensates to be sent directly to the condenser if necessary the reservoir drt receives the condensates of the heater r 14 a safety regulating valve v 14 controlled by the level regulator r 14 is provided for sending the condensates to the condenser if necessary the contents of the reservoir drt are re injected by way of a condensate withdrawing valve pr in the main circuit cp between the feed pump pa and the heater r 14 through a main regulating valve sr 16 which is controlled by a level regulator rn 13 associated with the reservoir drt this regulator rn 13 also controls a safety regulating valve v 17 whereby the condensates of the reservoir drt may be sent to the condenser the condensates of the heater r 13 are sent either to a phase separator sp 13 through a main regulating valve sr 17 or to the condenser through a safety regulating valve v 17 as a function of the control of the level regulator rn 15 of the heater r 13 the condensates of the heater r 12 are sent either directly to the subheater sor and from there to the condenser through a main regulation valve sr 18 or. | 5 |
are provided for each row of tubes 24a b c in an alternative clamping means the beams 32a b 34a b are biassed apart by compression springs and a pneumatic ram acts on beam 32a to overcome the spring force and clamp the beams together upon release of the pneumatic ram the springs urge the beams apart to a condition similar to that of fig2 thus the tubes 24a b c are mounted in cantilever with their axes substantially parallel to the axis a of the base 12 in this embodiment the tubes 24a b c are almost as long as the base so that only a small gap exists between the free ends 42 of the tubes and the carrying means 18 in its position of rest as shown in fig1 it will be understood that the machine base could be long enough to accommodate tubes of a length desired to be used e g 6 metres or more however it would alternatively be possible to support very long tubes at their mid point i e to fit a sleeve around the middle of the tube which sleeve could then be clamped as above and then successively fin the separate halves of the tubes from each respective end following the finning of such a tube. | 1 |
21 is first rotated back by means of the auxiliary drive motor means 2 in such a way that the auxiliary shaft 4 is brought to a position corresponding to the desired set value 14 supplied to the control unit 6 this is automatically determined by control unit 6 and by means of the detectors 7 and 8 the control unit 6 then causes the switching off of the auxiliary drive motor means 2 the switching on or locking of the coupling element 13 and finally the switching on of the main drive motor means 1 to resume weaving it is to be noted that the auxiliary drive motor means 2 comprises a drive means which is also designed to achieve slow running of the weaving loom it is switched on coupling 13 locked it is also clear that in the case of a pick finding device 5 as illustrated in fig2 the coupling element 13 rotates at a higher speed compared with the rotational speed of the main shaft 3 and the auxiliary shaft 4 this provides an advantage in that the main shaft 3 and the auxiliary shaft 4 can be coupled to each other at many possible relative angular positions which is particularly suitable for achieving an. | 3 |
a submerged portion of sls 3 in the landing state and a represents the area under installation of sls 1 sls 3 can be prevented from floating up to the surface on condition that the quotient thus obtained is positive irrespectively of a variation of the water level when the upper structure 2 is constructed on sls 1 to accomplish the construction of sls 3 in this case u03b3 w represents the unit weight of water and v represents the volume of the submerged portion of sls 3 as described above the contact pressure p is found according to the expression of w 1 w 2 w 3 u03b3 w u00b7 v a the ground can be prevented from settlement due to consolidation on condition that the sum of the increment u03b4 u03c3 of the subsurface stress caused by the contact pressure p and the own weight stress u03c3 0 of the subsurface part determined by the self weight of the soil is smaller than the consolidation yield stress u03c3 y i e u03c3 0 u03b4 u03c3 lt u03c3 y when v varies with the variation of the water level the ground can be prevented from settlement on condition that the sum of u03c3 0 and the increment u03b4 u03c3 max of the stress corresponding to the maximum value of the contact pressure p is smaller than the. | 4 |
of material originating from both the layer 13 and the layer 14 the diameter of the formed holes is 1 2 um the recorded information may be read either in reflection or transmission from the air or via the substrate plate 8 in the recording element shown in cross section in fig4 two parallel arranged glass plates 17 and 18 each have a thickness of 1 mm these glass substrate plates are connected together by a cylindrical central spacer 19 manufactured from metal as well as an annular metal second spacer 20 the spacers 19 and 20 adhere to plates 17 18 and seal the space between the plates in an airtight manner from the surroundings the opposing surfaces of plates 17 and 18 are provided between the spacers 19 and 20 with u v light cured acrylate lacquer layers 21 and 22 respectively optically readable servo tracks 23 and 24 respectively are provided in the surface of the lacquer layers 21 and 22 lacquer layers 21 and 22 have a thickness of roughly 1 um and are covered with dye containing recording layers 25 and 26 respectively as described in examples 1 3 upon recording information the servo track is read with weak laser light in reflection via the substrate plate and on the basis of the servo data holes 27 and 28 respectively are formed in the recording layer by means of pulsated laser light which is focused on the recording layers 25 and 26 respectively the laser has a power of 7 mw on the recorded layer and a pulse time of 5 10 7 sec the holes 27 and 28 corresponding to the information have. | 8 |
also fig3 and 8 in that region the internal diameter d 10 8 over the length l 10 8 of the cooling tube 10 is smaller than the internal diameter d 10 9 of the internal portion 10 9 of the cooling tube 10 facing backwards and the external diameter d 10 10 over the length l 10 10 of the cooling tube 10 is larger than the external diameter d 10 11 of the external portion 10 11 of the cooling tube 10 facing backwards this thus gives rise to a bead like thickening 10 18 of the wall 10 19 of the cooling tube facing inwards and outwards this ensures that the flow cross section available to the coolant is only constricted in the front internal portion 10 8 and front external portion 10 10 in which a high flow velocity of a coolant is required for good heat dispersal and the greatest possible flow cross section is available in the rear region in order to keep the pressure drops in the rear internal portion 10 9 and rear external portion 10 11 as tow as possible a coolant first flows in the flow path through wv 1 water supply line 1 into the interior of the cooling tube 10 and encounters the inwardly extending region 7 5 of the electrode 7 before flowing back via the flow path wr 1 water return line 1 in the space. | 7 |
or even for one of the inside seals 20 or 21 disposed within the hull however it should be understood that seals of essentially similar configurations can be disposed in the alternate locations mentioned above for purposes of illustration the seal arrangement of the present invention is described in greater detail below with reference to the inner shaft seal 6 as illustrated in the accompanying fig2 and 3 a shaft bushing 9 can preferably be disposed about the inner shaft 8 this shaft bushing 9 can then preferably be torsionally connected in a conventional manner to the inner shaft propeller 5 by means of a flange 9 1 as such the shaft bushing 9 essentially connects the propeller 5 to the inner shaft 8 for rotation therewith a typical seal arrangement for sealing about a propeller shaft can generally provide that the shaft bushing 9 be contacted by at least one sealing gasket as shown in fig2 and 3 three gaskets designed as lip seals 10 1 10 2 10 3 can be disposed to contact the shaft bushing in essence the number of seals required can vary depending on the pressures to which the seals will be subjected etc the three lip seals 10 1 10 2 and. | 1 |
monomers b 1 is an n valent organic linking group preferably comprising ethylenic unsaturation or b 1 is absent suitable single valent b 1 groups preferably have the formula u2014 cr 8 u2550 cr 9 z wherein r 8 and r 9 are independently selected from hydrogen alkyl groups of 1 to 6 most preferably 1 to 3 carbon atoms and aryl groups and z is selected from hydrogen alkyl groups of 1 to 6 carbon atoms aryl groups u2014 co 2 r 7 wherein r 7 is an alkyl group preferably up to 6 carbon atoms an aryl group an aralkyl group or an alkaryl group most preferably z is u2014 co 2 r 7 wherein r 7 is an alkyl group preferably up to 6 carbon atoms an aryl group an aralkyl group or an alkaryl group suitable divalent b 1 groups include u2014 cr 8 u2550 cr 9 o u2014 z u2032 o 1 wherein r 8 and r 9 are as defined previously o is 1 or 2 and z u2032 is an alkyl group of 1 to 6 carbon atoms an aromatic group or a siloxane group most preferably o is 2 and z u2032 is a siloxane group ar 1 is a polyvalent aromatic or heteroaromatic group and the carbon atoms of the cyclobutane ring are bonded to adjacent carbon atoms on the same aromatic ring of ar 1 preferably ar 1 is a single aromatic ring n is an integer of 1 or more preferably 2 4 more preferably 2 and r 1 is a monovalent group preferably hydrogen lower alkyl of up to 6 carbon atoms the synthesis and properties of these cyclobutarenes as well as terms used. | 2 |
thin barrier layer 10 which is of the first or second conductivity type and has lower doping than the transition layer 3 is first applied over the first highly doped denatured transition layer 3 this barrier layer 10 is formed for instance of n ingaalas the second highly doped denatured transition layer 2 for instance being formed of n ingaalas is applied over this lower doped barrier layer 10 and the second outer cover layer 1 for instance being formed of n ingaalas is applied over the second highly doped denatured transition layer 2 the material of the barrier layer 10 preferably has a greater band gap than the material of the spacer layer 4 in particular the barrier layer 10 forms a barrier for electrons that extend past the active zone and the spacer layer 4 the layer sequence that is formed of the spacer layer 4 the first highly doped denatured transition layer 3 the barrier layer 10 and the second highly doped denatured transition layer 2 acts as the second waveguide layer 14 in this case as in the case of the semiconductor body 13 of the exemplary embodiment of fig1 in this case again the semiconductor substrate 8 is provided with a first contact metallizing 11 and the second outer cover layer 1 is provided with a second contact metallizing 12 the exemplary embodiment of fig3 differs from the exemplary embodiment of fig1 in that an additional barrier layer 10 of the second conductivity type such. | 7 |
the chloroheterocycle of procedure ii was accomplished with n formylpiperazine n t butyloxycarbonylpiperazine piperazine 1 methylpiperazine or several other appropriate amines a solution 1 mmole 3 ml of chloroheterocycle from procedure ii in benzene was stirred while 4 equivalents of piperazine 1 carboxyaldehyde was added the mixture was stirred and heated under reflux for about six to eight hours after the mixture had cooled to room temperature it was filtered and the benzene phase was concentrated to dryness the residue was purified by chromatography on silica gel using 2 4 methanol in chloroform for elution concentration of product containing fractions to dryness under reduced pressure yields product that usually will crystallize on standing deformylation of the product is carried out according to procedure iv alternatively the displacement reaction was run in isoamyl alcohol at 100 u00b0 c for 12 18 hours when the reaction was complete the mixture was concentrated to dryness under reduced pressure and the residue was partitioned between the components of a chloroform water system at ph 10 11 the product was purified by chromatography on silica gel using 2 methanol in chloroform for elution a solution 1 mmole 4 ml of chloroheterocycle from procedure ii in isoamyl alcohol was added dropwise in the course of about one hour to a solution 1 mmole 4 ml of n t butyloxycarbonylpiperazine in isoamyl alcohol at 100 u00b0 120 u00b0 c the reaction mixture is monitored for disappearance of chloroheterocycle by thin layer chromatography. | 2 |
a second alternate embodiment 30b of the previously described elastomeric compressor mount 30 is cross sectionally illustrated in fig7 and 8 for ease in comparison features and components in the mount 30b similar to those in the mount 30 have been given identical reference numerals having the subscript 34 b 34 the mount 30b is of a two piece construction and has a cylindrical lower base portion 34b with an annular top end 36b an annular bottom end 38b and an annular vertical outer side 40b and a generally cylindrical head portion 64 with an annular top side 66 and an annular bottom side 68 projecting upwardly beyond the top side 36b of the base portion 34b is an annular central section 70 which is outwardly circumscribed by the annular groove 54b in the top end 36b of the base portion 34b a central circularly cross sectioned opening 72 axially extends between the bottom base portion end 38b and the upper end of the central section 70 an annular central section 74 of the head portion 64 projects downwardly beyond the bottom side 68 and is outwardly circumscribed by an annular groove 76 formed in the bottom side 68 of the head portion 64 a central circularly cross sectioned opening 78 axially extends between the top side 66 of the head portion 64 and the lower end of the central section 74 the central section. | 5 |
power of the fluorine atoms for the carbon skeleton protects the internal force fields and necessitates a much higher energy of activation to initiate reaction for the fluorocarbons than for hydrocarbons henry 39 s law constants are inversely proportional to solubility on a mol basis fluorocarbon liquid dielectrics have a greater solubility for air components with increasing fluorine saturation this is demonstrated by the following ______________________________________henry 39 s law constants atmospheric at 24 u00b0 csolvent nitrogen oxygen argon krypton xenon______________________________________ccl sub 2 f sub 2 420 400 410 230 76ccl sub 3 f 760 530 500 210 62c sub 2 clf sub 3 340 450 510 360 130c sub 2 cl sub 2 f 450 410 410 220 72c sub 2 cl sub 3 f sub 3 650 480 460 200 62chclf sub 2 500 410 400 200 65chcl sub 2 f 1100 690 640 230 65ccl sub 2 f sub 3 420 400 410 230 76c sub 2 cl sub 2 f sub 4 450 410 410 220 72c sub 3 cl sub 2 f sub 6 460 400 400 210 68c sub 4 f sub 10 260 230 230 140 51c c sub 4 f sub 8 300 250 240 140 47______________________________________ regular and related solutions hildebrand prausnitz and scott advise converted from grams per liter to pounds per 1000 pounds as follows 1 atmosphere ______________________________________ carbon dioxidesolvent pounds per 1000 pounds solvent nitrogen oxygen______________________________________ c sub 4 f sub 9. | 2 |
an electrically controlled speed governor motor referring to fig6 to fig8 the non step speed changer 4 of the present invention may be formed by connection of a planetary gear set or a differential gear set which will be illustrated as follows 1 planetary gear set the planetary gear non step speed changer may be classified into two categories the first one makes use of the output power of the power allotment unit 3 as its input the second one uses the power produced by forward and reverse rotation of the dynamo 1 motor generator as an input with this scheme the power output from the output shaft of the planetary gear set will be able to maintain the engine 2 working at the most preferable region at any different roadway condition and vehicle speed see fig5 c by connecting the input side to the sun gear the output side to the planet gear and the supporting bracket of the planetary gear set is connected to the motor 11 by connecting the input shaft the motor 11 and the output shaft in different positions according to the characteristic motion of the planetary gear set represented by the formula ns u03b1ns u2212 1 u03b1 nc 0 there may be six possible arrangements shown in fig6 a to fig6 f 2 differential gear set as shown in fig7 there are two kinds of input power the first one makes use of the output power of the power allotment unit 3 as its input the second one uses the power produced by forward and reverse rotation of the dynamo 1 motor generator to control the performance. | 1 |
anion reagent to form allylic carbinols the vinyl anion reagents useful in this step of the process are compounds having a vinyl anion and a metal cation one example of such vinyl anion reagents is vinyl magnesium bromide although other vinyl metallic halides would be useful as well and should be considered equivalent to vinyl magnesium bromide step c of the present process involves an oxy cope rearrangement to form compounds va and vb in general a strong base which will deprotonate in alcohol is employed in this step one example of which is the combination of 18 crown 6 and kh the enolization of compound vii in step f can be accomplished with a base strong enough to deprotonate a ketone preferably the base is a strong amide base such as lithium hexamethyldisilazide the sulfenylation in step f may be accomplished with trost 39 s sulfenylating agent i e benzenesulfonate s phenyl ester phsso 2 pph although other sulfenylating agents may be employed with substantially equivalent results oxidation of the product of step f may be accomplished by a strong oxidizing agent such as for example naio 4 with respect to the alpha and beta epoxides produced in step h it has been quite unexpectedly found that it is not necessary to separate the alpha and beta products even though the beta form is the desired product and the mixture contains about 20 alpha epoxide the alpha beta mixture can be employed as such in step i with the result being a good yield of the desired product xii without any apparent adverse effect from the presence of the alpha epoxide in the reaction mixture a 250 ml pyrex photochemical. | 2 |
4 there is attached a bracket 25 to the arms 26 of which are pivoted by pivot 27 of the upper ends of the handle link 5 the upper ends of the lower handle 6 are pivoted by pivot pins 28 to the bracket 25 below and in line with the upper handle 4 a latch 29 is pivoted to the pivot pins 28 and is adapted to engage the pin 30 to lock the upper handle 4 and the lower handle 6 and the handle link 5 together a locking mechanism 31 locks the wheels in the spread condition and comprises an over centre locking latch having a front locking link 32 pivoted to the link 20 and a rear locking link 33 pivoted to the rear wheel frame 23 the two links 32 and 33 being pivoted together the rear of the front link 32 is provided with a stop 34 so that the hinging is prevented just over centre a locking plate 35 is provided so that by foot pressure on the plate 35 the links 32 33 are moved to their locked over centre position the links 33 on each side of the stroller extend beyond the links 23 extending upwardly to a cross bar 36 in order to collapse. | 1 |
the invention on the one hand and compositions containing the non micronized active ingredient combined with a surfactant micronized or otherwise on the other hand gave the following results ______________________________________ 20 min 30 min 90 min ______________________________________non micronized diacerhein 60 80 non micronized surfactantnon micronized diacerhein 60 80 micronized surfactantcomposition of the invention 95 100 100 ______________________________________ it can be seen that the speed of dissolution of the active ingredient is markedly improved in the composition in accordance with the invention bioequivalence studies in 10 healthy volunteers were carried out according to a double blind design with a randomization table between hard gelatin capsules containing 50 mg doses of diacerhein in a commercialized form and hard gelatin capsules containing 50 mg doses of diacerhein and 5 6 mg of sodium lauryl sulfate comicronized according to the invention the results obtained have made it possible to show that the improvement in absorption linked to the comicronization of diacerhein comicronized with the surfactant is of the order of 30 compared with the original product these results were confirmed by a second double blind bioequivalence study in 22 healthy volunteers for which the original formulation of 50 mg of diacerhein proved to be comparable to a formulation in accordance with the present invention containing 35 mg of diacerhein and 3 9 mg of sodium lauryl sulfate comicronized as regards the pharmacokinetic characteristics represented by the cmax plasma concentration tmax time necessary to reach cmax and the auc area under the curve values furthermore the tests carried out have shown that the. | 0 |
the ct values listed in the table are the average values from the two samples the viruses were concentrated as follows i transfer 1 8 ml of the virus containing cell culture sample into a 2 0 ml test tube add 25 u03bcl of an aqueous alginate solution 1 and 200 u03bcl 1 hydrochloric acid to the cell culture medium 2 ml vortex and incubate at rt for 10 minutes ii centrifuge at 14 000 rpm for 2 minutes remove supernatant completely iii resuspend the gel fragment with 500 u03bcl of a chaotropic salt solution 4 m guanidine isothiocyanate the viral nucleic acids were subsequently isolated on an automatic extraction system innupure u00ae c12 analytik jena ag for this purpose a commercial kit innuprep virus rna kit analytik jena ag was used using the commercial kit 200 u03bcl samples were also worked up directly on an automatic extraction system innupure u00ae c12 innuprep rna kit c12 analytik jena ag thereafter the isolated nucleic acid was used for detection of the virus by means of real time pcr results of the real time pcr u2014 comparison of the u201c standard method u201d with the inventive concentration method thus it is clear that a larger sample volume can be processed with the inventive concentration method this results in the advantage of higher sensitivity especially when the number of viruses to be detected is small in this way it is shown that the inventive method offers an option for processing larger sample volumes and therefore achieving higher detection sensitivity each document patent patent application or patent publication cited by or referred to in this disclosure is. | 2 |
a novel sample cup including an integral venting cap for use in xrf spectroscopy application_number US 201514871266 A description shown in fig1 is an outer member 1 with a top open end shown and a bottom open end not shown the outer member is dimensioned to frictionally fit circumferentially about inner member 2 shown in fig2 outer member is distinguished by a flanged upper rim 3 first projections 4 about the flanged upper rim a lower body and second projections 5 about said lower body shown in fig2 is inner member 2 with a top closed end not shown and bottom open end inner member 2 is shown with a hinged cap 6 in the closed position a center portion 9 is designed to be depressed to vent said inner top closed end shown in fig3 is the outer member 1 assembled in position over inner member 2 shown in fig4 is outer member 1 partially assembled on inner member 2 in practice a thin film would be placed between outer member 1 and inner member 2 the thin film dimensioned to cover the bottom open end of inner member 2 such that upon assembly a liquid sample would be retained for spectroscopic analysis the first projections 4 may be dimensioned such that when the sample cup is assembled on a hard surface such as a tabletop the first projections will contact the tabletop when outer member is fully assembled over inner member in at least one embodiment this may result in approximately 0 005 u2033 clearance between the thin film covering the. | 1 |
6 c carbides decreases average interdiffusion coefficient too much addition can result in the formation of undesirable brittle intermetallic phases and can reduce oxidation resistance manganese stabilizes the austenitic matrix phase provides solid solution strengthening and also helps in trapping sulfur carbon nitrogen required for the formation of carbide and carbo nitride phases that can act as grain boundary pinning agents to minimize grain growth and to provide resistance to grain boundary sliding fine precipitation of carbides and carbonitrides can increase high temperature strength and creep resistance tungsten provides solid solution strengthening and decreases average interdiffusion coefficient too much can result in the formation of brittle intermetallic phases typically ni based alloys are strengthened through a combination of solid solution strengthening and precipitation strengthening the primary advantage of solid solution strengthened alloys is microstructural stability since strengthening is primarily obtained through the presence of solute elements in solid solution that may be different in size and chemical composition from the solvent and not through the presence of precipitates microstructural changes such as coarsening of precipitates will not be relevant in determining the properties of these alloys furthermore fabrication such as forming and welding operations are simpler due to solid solution strengthening being the primary strengthening mechanism however solid solution strengthened alloys can be primarily used in applications that need relatively lower yield and tensile strengths and lower creep strength when compared to precipitation strengthened alloys but require consistent properties for. | 2 |
a constant of value 0 77 the power converter apparatus 40 shown in fig2 derives its power from a photovoltaic array 41 made up of photovoltaic cells 42 the positive terminal 43 and the negative terminal 44 of the photovoltaic array 41 are connected to the switching power converter 45 and the latter is in turn connected to a load 46 an oscillator 47 is connected to an inhibiting control function on the switching power converter 45 and inhibits the operation of the switching power converter 45 for fifty milliseconds every ten seconds a diode 51 has its anode connected to the positive terminal 43 of the photovoltaic array and its cathode connected to a capacitor 52 the other terminal of the capacitor 52 is connected to the negative terminal 44 of the photovoltaic array 41 an upper resistor 53 and a lower resistor 54 form a resistive divider across the capacitor 52 and the junction between the resistors 53 and 54 is connected to one input of a comparator 57 the other input to the comparator 57 is connected to the common connection point of a resistive divider comprising a positive rail resistor 55 and a negative rail resistor 56 the relative values of the resistors 53 and 54 and 55 and 56 are arranged such that the voltages. | 8 |
each other at a common place which is situated substantially midway between the inner and outer surfaces of the wall 1 as is apparent from fig3 where the tang 16 is shown in cross section within the hollow interior of the receptacle which is formed by the shells 2 and 11 it will be noted that along their surfaces which engage each other and which are situated in a notch of the bucket wall 1 the shells are provided with exterior bevelled surfaces 9 whicih define an elongated v groove for receiving welding material which serves to join the shells to each other to form a receptacle according to the invention before this receptacle is introduced into the notch which is formed in the wall 1 thus the wall 1 is formed with a notch extending therethrough and extending inwardly substantially perpendicularly from the substantially straight front cutting edge region of the wall 1 and it is this notch which receives the receptacle 2 11 the inner shell 2 has at its front end region a pair of lips 7 which extend laterally in opposite directions from the reinforcing protrusion 3 and these lips 7 form together witih the remainder of the shell 2 an inner peripheral edge 20 extending along the entire length of the shell 2 and overlapping the inner surface of the wall 1 while being welded to the latter by the line of welding material 8 it will be noted that the bevelled surfaces 9 also extend along the entire length of each of the shells to form the v groove for receiving the welding material which joins the shells to each other along the entire length. | 4 |
beta emission 40 or auger electron emission in the case of i 125 to stimulate the scintillation agent 1 to emit light photon emission 45 this light 45 is measured as counts in a beta plate counter when the tritiated peptide 35 is unbound it is too distant from the scintillation agent 1 and the energy is dissipated before reaching the bead 5 resulting in low measured counts non radioactive ligands which compete with the tritiated peptide 35 for the same binding site on the mutant phosphatase enzyme 30 will remove and or replace the tritiated peptide 35 from the mutant enzyme 30 resulting in lower counts from the uncompeted peptide control by varying the concentration of the unknown ligand and measuring the resulting lower counts the inhibition at 50 ic 50 for ligand binding to the mutant enzyme 30 can be obtained this then is a measure of the binding ability of the ligand to the mutant enzyme and the wild type enzyme the term 34 complex 34 as used herein refers to the assembly containing the mutant enzyme in its simplest embodiment the complex is a solid support with the mutant enzyme attached to the surface of the support a linker can also be employed as illustrated in fig1 the complex can further comprise a bead fluopolymer anti enzyme gst enzyme gst mutant enzyme ptp1 linking construct immunosorbent protein a and scintillation agent in general the complex requires a solid support beads immunoassay column of e g al 2 o 3 or silica gel to which the mutant enzyme can. | 6 |
toroidal body of revolution in the form of an annular storage tank or chamber having a vertical axis the storage chamber consists of a dish shaped bottom plate 2 preferably curved in a semi elliptical form and of a top plate of a somewhat flatter curved construction the bottom plate 2 has a concave upwardly facing surface while the top plate 3 has a concave downwardly facing surface the radially inner and outer edges of the plates are connected to one another the central opening provided by the annular chamber is covered by a closure member 4 radial fins 5 extending radially outwardly from the vertical axis of the chamber to the crown of the top plate 3 serve as reinforcement and if necessary as a support for a planar top surface not shown if the float construction is used as a platform for a drilling island for the construction of a liquefying plant the outer circumference of the float construction that is the outer peripheral edge of the storage chamber is surrounded by a vertically extending cylindrical wall 6 which extends both above and below the surface of the body of water on which the float member rests below the downwardly facing surface of the lower plate 2 radial partitions 7 extend inwardly from the cylindrical. | 1 |
and move it within the tube so as to adjust the height of the overflow tube 15 when the adjustable overflow tube 15 is located at the desired height the locknut 13 is tightened tightening or turning the locknut clockwise locknut 13 compresses the radial seal 12 against the outside of the overflow tube 15 thus locking the overflow tube 15 to the first overflow tube 11 to hold the adjustable overflow tube 15 in relative position to the first overflow tube 11 the upper end of the adjustable overflow tube 15 is flared 51 such that it provides a larger surface area to admit water in the event of an overflow of water additionally the upper end of the overflow tube provides a gap 49 in the flared overflow tube 15 that provides a latching point for the refill tube clip 19 discussed below the gap 49 provides in general a flat surface 53 interrupted by a ridge 55 the ridge provides a surface for attaching the refill tube clip 19 preferably the various parts of the flush valve 9 and the overflow tubes 11 15 are injection molded using a suitable plastic such as abs trademark plastic or glass filled polypropylene however none of the above materials are considered a limitation of the invention a wide variety of other suitable durable and low cost materials for injection. | 4 |
9 to eliminate oil between the lining and the drum 1 if a punched hole for the strut guide 4 34 is used also as the through aperture 9 and knock pin holes in the apply side bracket 4 are used also as the through apertures 8 it is not necessary to provide a special aperture forming process and the cost of manufacture can be reduced fig3 is a view taken along the direction of arrow c in fig1 to show an arrangement wherein the knock pin holes and the punched hole for the strut guide are used also as oil apertures when the brake band is used in the leading state as shown in fig4 in the non binding state the anchor side of the lining 2 is in contact with the surface of drum 1 and the clearance between the lining 2 and the drum 1 at the apply side is maximum thus the amount of oil film between the lining 2 and the drum 1 is greatest at the time of initial application of the brake to obtain a basically flat friction characteristic from the early stage of binding until the end of binding i e to mitigate the shock during speed change the invention assures that the great amount of oil contained on the apply side may be discharged removed within a short time more particularly in the brake band according to the present invention in order that the oil near the apply side may be rapidly eliminated the number of oil grooves formed in that area of the lining on which the bracket 4 on the apply side is mounted the width of the grooves or the number of through apertures 8 and 9 and the areas thereof are made greater. | 5 |
forks 16 are elevated so that supports 32 engage beam 30 to lift the front end of carrier 12 off the ground simultaneously with auxiliary rear wheels 20 pivoting about axis 19 to come into ground engagement while main rear wheels 18 rise off the ground the assembled apparatus is then movable on wheels 14 20 and 28 and steerable by handle 34 the overall spacing a from front wheel 14 to auxiliary rear wheels 20 when lowered is less than half the length of the carrier 12 and the distance b from supports 32 to wheels 20 is preferably less than one fourth the carrier length carrier length for purposes of the above ratios is defined as the length from beam 30 to rear wheels 28 such close spacing together with the caster mounting of wheels 20 provides a tight turning radius for the assembled apparatus and enables turning without dragging wheels 20 the dolly 10 requires less space for movement than conventional fork lift apparatus referring now to fig2 and 3 there are shown axial sectional views through an assembled dolly 10 and carrier 12 cut through one of the forks 16 helpful in understanding the mode of operation when lifting and lowering in each fork a main rear wheel 18 and auxiliary rear wheel 20 are mounted from pivot 23 on a common pivot arm 19 a fixed rail 34 guides one end of a bellcrank link 36 which is mounted on fork 16 the forks are drivable up or down by hydraulic cylinder 38 and. | 1 |
compounds but further have r 3 and r 4 selected from hydrogen or hydroxy particularly in the position ortho to the substituent having the z group additionally the compounds having the limitations of the more preferred compounds and additionally having z defined as the coor 5 or str75 are the most preferred compounds the activity of the compounds of the formula i is shown in vitro in an nmda receptor binding assay based on the use of 3 h cpp as antagonist ligand in a manner essentially as set out by b e murphy et al in j pharm exp ther 240 778 1987 examples i 1 i 2 and i 3 all exhibit cpp binding activity of ic 50 better than 100 u03bcm the compounds of the present invention can be shown to be antagonists as inhibitors of 3 h tcp tissue binding in an in vitro assay described in eur j pharmacol 123 467 1986 and neurosci lett 76 221 1987 or as inhibitors of glutamate stimulated acetylcholine release from striatal slice preparations as disclosed in j pharm exp ther 240 737 1987 in vivo activity for the compounds of the present invention is shown by selected compounds in the assays of ep publication number 318935 incorporated herein by reference which are generally accepted to establish the utility for the treatment of diseases as noted above therefore the compounds of formula i and their pharmacologically acceptable acid addition salts are effective agents in the prophylaxis and or therapeutic treatment of disorders responsive. | 2 |
stirring 33 ml of conc sulfuric acid was slowly added this was refluxed for 15 minutes the clear cooled solution was poured over approx 200 ml of chopped ice the stirred mixture was brought to ph 0 5 1 0 ph meter by portion wise addition of a well stirred suspension of aqueous sodium bicarbonate 83 g sodium bicarbonate plus 600 ml water approx 90 of the suspension was used the acid solution was extracted with 7 u00d7 75 ml ether the combined extracts were dried over sodium sulfate the combined 525 ml extract was vacuum concentrated to approx 175 ml and with stirring a saturated aqueous solution of 1 1 potassium chloride potassium carbonate was added until the ether phase was approximately ph 6 ph paper and the aqueous phase was approximately ph 8 9 and the bubbling had stopped this was filtered through fast filter paper on a buchner funnel washed with a minimum of ice cold acetone and air dried a second crop was obtained by treating the combined 250 ml extract as for crop 1 except that the volume was first reduced to approx 75 ml this yielded 4 60 grams proton nmr dmso d6 no peaks carbon 13. | 2 |
of the solvents may contain from 2 to 8 acyclic carbon atoms typical mixtures which may be used to provide the solvent system especially with methyl ethyl ketone peroxide include various mixtures of c2 to c6 glycols and c3 to c6 trialkyl phosphates for example mixtures of numbers of the following materials ______________________________________ boiling point u00b0 c flast point u00b0 f ethylene glycol 197 2 240 8diethylene glycol 245 0 290dipropylene glycol 233 330hexylene glycol 198 230triethyl phosphate 216 240______________________________________ crude ethylene glycol usually containing quantities of diethylene glycol and triethylene glycol may be used in the solvent system fed by line 16 glycol derivatives such as ethylene glycol acetate may be used in the solvent system the relative proportions of the solvents their number and the difference between their individual boiling points in the solvent system may vary widely and are a matter of choice provided that the overall composition and the individual components conform to the above described parameters the quantity of solvent fed by line 16 should be at least sufficient to maintain a homogeneous reaction mixture throughout the addition of hydrogen peroxide the reaction is carried out at as low a temperature as possible compatible with speed of reaction higher temperatures favour decomposition of the product whereas low temperatures below 10 u00b0 c result in long reaction times the process is carried out at a temperature below about 35 u00b0 c. | 2 |
which characterizes the maximum loading condition to be tolerated the latter reference signal is established by a setpoint network 16 in which part of the supply voltage is adjustably tapped from a dropping resistance 17 and fed to the comparator input in opposing relation to the transducer output signals via lead 16a and through test connection 16b as is shown in fig2 the sensor or strain gage transducer output to circuitry 4 can undergo oscillations such as the transiently decaying oscillations characterized by the trace 17 which represents bridge output voltage versus time viewed in relation to a voltage level 18 which characterizes a signal developed by setpoint network 16 to establish a maximum or 100 safe loading reference it will be evident that the net signal may alternately be of one and another polarity with the result that comparator 13 would be switched alternately and the valve 10 would concomitantly disable and restore operation of the 34 tight 34 hydraulic powering of the load repeatedly such oscillations can be induced by rough handling of a near maximum load for example or by truck movements vibration or the like and the effects can tend to become hazardously regenerative under some conditions these consequences are plainly undesirable and such minor and short period oscillations should not be allowed to cause disabling of the load handling capabilities of the truck and cause. | 1 |
sources illuminating a small area with fall off in illumination toward the edges of the illuminated area a camera 120 is installed within the wall of the cannula 100 two cameras 120 channels are shown to allow for the camera connection to be changed as the need for a different view presents itself or provides for the need for multiple views of the target area this does away with the need for a special cannula for the camera and also allows for a direct view option from the perception of the tools used optionally a single light or a single camera can be used as an alternative embodiment the present invention also allows for more than two cameras as needed fig1 a also shows the distal end of the cannula with use of multiple camera channels 120 of the present invention the number and type of image capture sensors are determined by the optical geometry required by the viewing system for example two camera channels 120 can be placed 180 degrees apart around the circumference of the cannula i e located at opposite ends of the geometric chord of the circumference of a circular cannula corresponding to the diameter of the cannula this geometry would be desirable where maximal field of view would be provided by the joint outputs of both sensors fig1 b shows a camera 130 itself within the cannula miniaturization and cost improvements may allow this embodiment to be preferred for minimizing connections and. | 0 |
c may take many forms need not be part of an entertainment center and it will be understood that it generally is representative of the upper portion of an entertainment center having pocket doors as seen in fig2 and 3 pocket door slide system 110 also is constructed with upper and lower slides with hinges one of which will be described in detail for clarity and ease of viewing again however it will be appreciated by one of skill in the art that the two are complimentary and are essentially configured as a mirror image of each other to achieve a pocket door slide system 110 with respect to left door l system 110 is mounted to the outer surface 0 of left inner wall iw of cabinet c more particularly each of the slides 12 of suspension system 110 is mounted such as by conventional screw type fasteners not shown to the outer surface 0 of left hand inner wall iw of cabinet c slides 12 may be constructed as described in relation to the prior art conventional slides in fig1 having an outer track 14 an inner slide member 16 and ball bearing retainers 18 similarly suspension system 110 further includes a backing plate 20 mounted to inner slide member 16 as described in relation to fig1 each of the slide and hinge systems of pocket door slide system 110 also includes a hinge. | 4 |
presented in fig6 the last step 38 f is to compare the value of g t against the threshold value and declare whether the pixel under examination is a potential edge pixel or not the method of this invention has several advantages one of the advantages is that the edge detection by the method of the present invention is not affected by the change of light intensity on the surface 24 or noise generated by the light source 22 over time this is particularly a problem when luminance generated by the light source 22 is affected by the environment for example if the edge detecting system 20 is installed in an automobile the heat generated by the automobile may reduce the light intensity output as shown in fig1 a and 10 b the directions of background gradient directions n at low light intensity and the direction of background gradient directions n u2032 at high light intensity remain mostly unchanged as a result the background gradient directions t at low light intensity and the background gradient directions t at high light intensity remain mostly unchanged as well therefore the method of detecting an edge of the object of the present invention is not affected by any changes of background light intensity fig1 shows another aspect of the edge detection system 20 according to one embodiment of the present invention in this aspect the edge detection system 20 comprises an initialization image capturing module. | 6 |
a separation equal to two needle spaces additional strikers and are at choice made operative by the setting members of a stop control when one of the additional strikers is in an operative position that striker holds the guide in a central position in particular needle control and stop controls may operate with piezoelectric transducers in this manner it is possible to obtain an extremely large number of patterning possibilities application_number US 98568997 A description fig1 and 2 illustrate a jacquard guide bar 1 having a carrier 2 a first transducer unit 3 comprises an angled segment 4 which is connected to carrier 2 via a connection piece 5 the segment 4 carries sixteen first piezoelectric transducers 6 which each carry a guide 7 at their free end a second transducer entity 8 likewise comprises an angled segment 9 which is attached to carrier 2 via screw 10 the segment carries sixteen second piezoelectric transducers 11 which each have an abutment 12 at the free end thereof second transducer 11 is referred to as a setting means of a striker control means cable bundles 13 and 14 serve to connect the transducer units 3 and 8 with the appropriate control arrangements after their mounting on segments 4 and 9 left stops 13 and right stops 14 are part of a stop means provided to carrier 2 against which the guides 7 may rest under the influence of the appropriate transducer 6 as is shown in fig2 additional stops 15 and 16 also part of a stop means are provided at the lower end of a dual armed lever 17 which is swingable about a fulcrum 18 attached to the bar and whose upper end 19 extends into the region of the. | 3 |
form the rebar is preferably installed criss crossed on 2 foot centers approximately 2 inches above the sand bed for a 4 inch thick slab also to provide anchored eyelet inserts for lifting the slab a combination rebar and eyelet insert chair 30 may be placed adjacent the four corners of the slab as best shown in fig1 11 and 12 the chair 30 comprises a vertical internally threaded stem 31 having depending hook arms 32 and 33 which serve as a support for rebars 34 and 35 in the preferred arrangement four chairs 30 are used for a slab each chair being positioned within the form area equidistant from each corner of the form spaced inwardly approximately 2 feet from the edge of the form for a 4 inch thick concrete slab the chairs 30 are designed so that the hook arms 32 and 33 hold the rebar 2 inches above the sand base when the chairs and rebar have been installed a suitable concrete mixture of desired color and texture is poured into the form and the cement surface is floated and leveled prior to the pour a protective bolt 36 is screwed into each of the threaded stems to prevent their filling with concrete as shown in fig1 the. | 1 |
placed around all four speaker wires 175 next to the speaker connector board 130 the stereo mini cable 170 is then used to connect the computer 39 s line output 173 to the line input of the present invention at the stereo mini jack 174 the power supply connector 160 provides power with respect to fig8 what is shown is a typical computer 39 s volume control the master or main volume control of the computer system and its input volume levels are controlled via the computer 39 s volume control applet 200 by adjusting the sliders and turning on or off the mute buttons the amplified audio levels are achieved the master or main volume control has system audio output level control with respect to fig9 what is shown is one particular version of a circuit diagram descriptive of the present invention the circuit diagram 220 shows the components their values and electrical connections it also shows the signal processing that occurs from the input to the output for left and right channels stereo and shows the power supply voltages used also shown are the three different sets of components for the two thru hole circuits and the one surface mount circuit it should be appreciated by those of skill in the art that. | 6 |
50 respectively that extends forwardly away from mounting surface s each of which merge into left top and bottom front portion 52 54 respectively the right top and bottom legs 44 46 each includes a right outer side portion 56 58 respectively that extends forwardly away from mounting surface s each of which merge into right top and bottom front portion 60 62 respectively the left top and bottom front portions 52 54 of the left top and bottom legs 40 42 extend past the front leg 28 of the receiving member 12 and terminate in a retaining member 64 that extends vertically therebetween the right top and bottom front portions 60 62 of the right top and bottom legs 44 46 extend past the front leg 0 of the receiving member 12 and terminate in a retaining member 66 that extends vertically therebetween the retaining members 64 66 cooperate with appliance receiving member 12 to retain an appliance such as an electric iron securely within the appliance receiving region 18 the organizer 10 further includes a pair of left and right l shaped frame support members 68 70 each having a rearwardly extending horizontal bottom leg 72 74 respectively and a front vertical leg 76 78 attached to and extending between top and bottom legs 40 42 and 44 46 each horizontal bottom leg 72 74 terminates in an offset portion 80 81 to provide for pivotal attachment of a hanging member 82 two or more laterally spaced shelf members 83 connect to and extend between horizontal. | 3 |
the surface to retrieve a marsupial rover the airship could home in the signal from the rover and lower an end effector at the tether end the end effector will attach to the rover and the rover can then be lifted using the winch to rewind the tether line and or by lifting the aircraft 10 higher into the atmosphere the aircraft 10 could also vary its buoyancy using the ballonets etc and land at selected locations for extensive scientific research onsite when finished at one site the aircraft 10 could then increase its buoyancy and take off to fly to another site the aircraft 10 could also lower sensors into lower portions of the atmosphere but without landing the sensors onto the surface for scientific purposes such as sampling of atmospheric conditions imaging etc in the areas below the aircraft 10 in a further embodiment of the invention which may be applicable for high altitude applications on earth the helium or other lifting gas is included within expandable balloons positioned within the larger envelope the larger envelope is pumped or otherwise provided with air which when combined with the helium in the expandable balloons therein maintains the envelope in the desired shape e g airfoil shape the outside air. | 1 |
the illustrated embodiment the unit is formed by cutting out the center and folding the bottom drip flange 108 and a top window enclosing flange 110 from the unitary sheet side portions 112 114 are formed of separate fold and metal pieces which are pushed through the opening from behind and welded brazed or are otherwise sealingly attached to the rest of the unitary sheet 106 at least along an attachment flange 116 provided on each metal piece a portion 118 of the upper window and casing portion 110 is folded around behind the two side extension pieces 116 provided 112 114 and is folded back on itself to interlock this configuration provides a dressed appearance similar to that which is provided by the embodiment using four pieces described above when completed as with an added embodiment in this one also a sealant can be used between the piece 106 and the window 92 such as the adhesive foam tape described above for example with reference now to fig1 and 13 in the case where the exterior treatment comprises stone work 119 a flashing 120 can be configured to direct moisture outward and over the stone work by means of a drip flange 122 similar to that described above. | 4 |
are a result of manufacturing limitations the present invention can be used to minimize the effects of these variations and results in accurate delivery in any type of liquid pump as discussed in the background there is one type of liquid pump with which the present invention is particularly advantageous the miniature piston type pump the piston diaphragm assembly of a miniature pump requires extremely high manufacturing tolerances in order to generate a reproducible dose volume from one pump to the next even with high precision manufacturing a not insignificant variation from one pump to the next of a given design may be present this is less than ideal especially in applications of the pump involving drug delivery or other medicinal applications the present invention provides a simple inexpensive and reliable mechanism and method for minimizing or u201c zeroing out u201d the differences from pump to pump one aspect involves a logic or processor controlled routine that may be thought of as an automatic calibration of the device in a most general sense this involves measuring the volume of a dosage produced by a given pump comparing that dosage to a nominal dosage volume expected for that particular type of pump design and then adjusting the pump output accordingly this can also be accomplished by measuring the flow rate and then adjusting accordingly both volume and flow rate measurement comprise usage of one or more sensors that indicate the presence of. | 5 |
made to determine whether more input strings which are supported by the server need to have tables or table entries generated 0026 fig6 shows a chain of tables corresponding to a particular input string such as the uri 88 shown in the figure there are six segments 90 92 94 96 98 99 into which the uri 88 or portion of the uri is divided a key for each segment is calculated and designated as key 1 100 key 2 102 key 3 104 key 4 106 key 5 108 and key 6 109 a table entry location is calculated for each key based on the table base address the key and the size of the entry for segment 1 table base address 122 for table 1 110 is used and the entry location 124 for that segment is table 1 _base_address entry size key the tables 110 112 114 116 118 and 119 are linked in the order of the segments that make up the string by entering the proper base address into the next table pointer of an entry in a previous table in the final table table 5 119 in the figure the data object pointer 126 is set to point to the data object 120 corresponding to the uri and there is no entry or it is set to null for the next table pointer 128 this process is repeated for each string that the server supports the final result is a u201c tree u201d of tables with entries for each segment of each uri for example referring to fig7 which shows a chain of tables 130 132 134 136 138 140 142 corresponding to two. | 6 |
was partitioned between ethyl acetate and water the aqueous layer was further extracted twice with ethyl acetate the combined organic extracts were dried over magnesium sulfate and after filtration the solvent was removed under reduced pressure the residue was then chromatographed over silica gel using 10 methylene chloride hexane as eluent to afford 1 66 g of the title compound which was homogeneous by thin layer chromatography 5 by volume of ethyl acetate hexane on silica gel plates 1 h nmr cdcl 3 u03b47 73 6 90 m 7h 4 03 t 2h 3 50 t 2h and 2 22 quintet 2h the title compound was prepared by the method of example 4 using 1 naphthol 1 80 g 12 5 mmol in place of 2 naphthol after chromatography there was obtained 0 80 g of the title compound which was homogeneous by thin layer chromatography 10 by volume of toluene hexane on silica gel plates 1 h nmr cdcl 3 u03b48 40 6 77 m 7h 4 22 t 2h 3 65 t 2h and 2 38 quintet 2h a mixture of 3 26 g 20 mmol of 3 4 dichlorophenol 20 2 g 100 mmol of 1 3 dibromopropane 6 80 g 20 mmol of tetra n butyl ammonium hydrogen sulfate 40 ml of 1n sodium hydroxide and 40 ml of methylene chloride was stirred rapidly at reflux after 2 hours the mixture was allowed to cool and the layers were separated the organic layer was washed with. | 2 |
among the natural fibers particularly useful are fibers of sisal sugar cane molasses of cocoa of pia u00e7ava of soy of jute of ramie and of curau u00e1 among the lignocellulosic residues particularly useful are wood dust or rice hull the composite material according to this embodiment may additionally comprise approximately 0 01 to approximately 15 in weight of an elastomeric impact modifier approximately 0 01 to approximately 0 5 in weight of an auxiliary processing agent dispersant and approximately 0 01 to approximately 2 in weight of one or more pigments the present invention also refers to a process for the preparation of a composite material the process starts after the choice of the formulation of the composite material in accordance with the ranges defined above after the definition of the formulations of the composite it is necessary to proceed with i the uniformization of the fiber length as it is well known for those skilled in the art the natural fibers have different lengths and sometimes the length is above the desired whereby an uniformization of its length is advantageous to better make use of them in the process of the present invention the uniformization operation of the fiber length may be carried out by any adequate means for example in a hammer mill with an appropriate set of knifes and controlled speed operation to avoid the formation of fines undesired in the production of composite granulate a particularly adequate fiber length for the process of the present invention is between about 1 mm and about 8 mm more particularly between about 2 mm and about 6. | 1 |
be captured from steam forming and used as a reactant in urea synthesis however many smaller ammonia plants and plants that operate independently of urea production simply vent these fumes to the atmosphere and even plants that recycle carbon dioxide emissions in the synthesis process where the gas is not as easily captured the intergovernmental panel on climate change ipcc notes that the only plants that do not release carbon dioxide during the synthesis process are those that use a pure hydrogen feedstock rather than natural gas which makes up a very marginal percentage of plants various configurations depicting the above features and benefits as disclosed herein are shown and described further below mitigation of the environmental effects of ammonia and urea synthesis are depicted in an example apparatus shown and disclosed below alternate approaches to embody the disclosed principles conventional approaches for ammonia and urea synthesis employ the well known haber process this conventional approach uses methane gas ch 4 and water 2h 2 o as the sources of hydrogen giving off co 2 4h 2 however methane can be expensive and limiting to the process it also produces one mole of co 2 as a result of the production of one mole of ammonia nh 3 configurations herein employ only water h 2 o for the ammonia synthesis this process will invoke the wgs reaction as the hydrogen producing step this process will require the use. | 2 |
or an injection molded part positioning elements 45 having the form of a flange are integrally formed on in lower housing part 47 a perforation 49 in the form of a wall opening 50 is arranged through this wall opening 50 inner chamber 51 which is bordered by lower housing part 47 and upper housing part 48 can be completely injected with an elastomeric material this material forms now a large volume damping element 52 which projects beyond supporting surface 35 and underside 53 of bearing element 12 in the region of wall opening 50 by a distance 46 by determining the size of distance 46 the maximal oscillation amplitude of damping device 14 relative to surface 10 of ski 1 can be decided by which a damping without jerks and a relative movement is made possible with a suitable matching of the hardness or the elastic deformation properties of the elastomeric material in connection with distance 46 the damping characteristics for high frequency oscillations with high amplitude or respectively low frequency oscillations with low amplitude can be set thus a damping of high frequency oscillations with high amplitude is for example possible when a relatively low shore hardness of the elastomeric material is used at a relatively great distance 46 on the other hand it is possible that oscillations with greater energy can be better dampened in that a greater shore hardness of. | 0 |
trapped thereby reducing the amount of lubricant available for lubrication of the bearing assemblies 16 18 the openings 76 can be holes 80 slots 82 or notches 84 in this embodiment the slots 82 are disposed in the second section 66 and the holes 80 are disposed in the third section 72 preferably the openings are disposed within the second and third sections 66 72 however the openings 76 may be disposed within any non deforming section of the spacer 26 these openings allow lubricant to fill the cavity 78 as the wheel hub 12 is filled and substantially eliminate potential oil starvation of the bearing assemblies 16 18 the openings 76 can be of any shape or configuration that does not reduce the structural integrity of the spacer 26 the invention includes a method of adjusting a length 90 between bearing assemblies 16 18 referring to fig5 the wheel hub assembly 10 is shown in cross section the method includes the installation of the spacer 26 between the inner and outer bearing assemblies 16 18 along with the wheel hub 12 onto a fixture 92 the fixture 92 is of the same size and configuration as a spindle or drive axle to which the wheel hub assembly 10 is to be installed a force indicated by arrow b along the axis 34 is applied to the outer bearing assembly 18 the magnitude of the force is predetermined to exert sufficient pressure to deform the spacer 26 at the thin wall 62 a predetermined level in response to the predetermined level of force the length 90 of the spacer 26 is changed to a deformed length 94 the deformed length 94 is the proper distance between the bearing assemblies 16 18 for that. | 5 |
saw 121 as shown in revolutions per minute may optionally be provided in addition a tool advancing control is provided to control the speed of advance of the drill bit 151 into the casing 200 u2032 and the blade 121 of the band saw 120 into the casing 200 u2032 corresponding positioning devices 127 shown in fig1 and 156 shown in fig4 are provided for the band saw 121 and the drill assembly 150 these positioning devices 126 156 in one aspect represent telescoping hydraulic cylinders these devices permit the drill bit 151 of the drill assembly 150 and the blade 121 of the band saw 120 to be independently selectively advanced towards the casing 200 u2032 during the respective drilling and cutting operations and then withdrawn in addition both the band saw 120 and the drill assembly 150 optionally include pressure sensors to determine the amount of pressure placed upon the casing by the rotating drill bit 151 or the rotating saw blade 121 gauges may be provided at the control panel 125 indicating pressures on the drill bit 151 or the rotating saw blade 121 for example core heads and saw blades provided by mirage tool co ltd u k and core heads from alf i larsen norway may be used the clamp assembly 130 also has controls that are located on the control panel 125 for instance the clamp assembly 130 includes a panel mounted control which opens and closes the gate 135 located on the clamp assembly 130 optionally a gauge indicating pressure between the casing 200 u2032 and a clamp 140 may be provided and pressure of the clamps 140 a corresponding sensor is positioned on at. | 4 |
has an electrical terminal extending therefrom an anode structure in accordance with a second embodiment of the invention is similar to that of the first embodiment with the exception that the spaces between the lithium anode elements of the anode structure of the second embodiment are filled with a heat absorbing porous insulative separator material application_number US 31981281 A description referring now to fig1 there is shown a primary electrochemical cell 1 employing a plurality of anode structures 2 in accordance with the present invention the electrochemical cell 1 and the electrochemical system therefor may be constructed in accordance with the teachings of the aforementioned u s pat no 4 086 397 and generally includes a rectangular metal housing 3 a battery stack 4 disposed within the housing 3 an electrolytic solution 5 in contact with the battery stack 4 and a top cover assembly 6 the housing 3 may be of stainless steel and have typical outer dimensions of approximately 18 inches height u00d7 13 inches width u00d7 10 inches depth the battery stack 4 as employed within the housing 3 comprises a plurality of generally rectangular cell components these components include in addition to the aforementioned plurality of anode structures 2 a plurality of carbon cathode current collector electrodes 8 and a plurality of insulative separators 10 between the anode structures 2 and the carbon cathode current collector electrodes 8 although not specifically shown in the drawing each of the carbon cathode current collector electrodes 8 comprises an aggregation of porous semi rigid carbon globules or conglomerates pressed into a flat expanded metal e g nickel grid or screen to be supported thereby the grids of the electrodes 8 also serve as current collector members for the cell 1 during. | 7 |
is journalled in the power leg casing 70 which includes a flange 72 having a part spherical surface seating inside the head and extending through a slot therein the slot has parallel sides and semi circular ends and extends at least from the position vertically below the centre of the head around the head that is rearwardly and upwardly being symmetrical of a vertical plane containing the axis of shaft 24 the ends of the slot are indicated by references 74 76 fig3 flange 72 has a part spherical concave upper surface 78 fig2 and 3 lying normally of the shaft 64 axis and is trapped between slipper blocks 80 and the head interior and the blocks are bolted in place at 82 and bearing shims 84 which might be belleville sping washers are located between the slippers and the said surface 78 fig2 the flange is thus held against the head but permitted to turn about the centre to take the power leg along the slot a seal ring 85 is located at the periphery of the slot and may be of elastomeric material the angle of inclination of the power leg to the transom is controlled e g by a ram 86 fig1 coupled between the leg and the transom and associated with valve means holding fluid pressure in the ram to control its effective length and in the event of the leg hitting an underwater obstacle this may apply a load sufficient to overcome the valve and allow the ram to extend and the leg to pivot along the slot alternatively spring loaded catches may be employed to the. | 1 |
amino acids and more preferably of at least about 14 amino acids it is also preferable that these oligopeptides peptides or fragments are identical to a portion of the amino acid sequence of the natural protein and contain the entire amino acid sequence of a small naturally occurring molecule short stretches of antigen amino acids may be fused with those of another protein such as klh and antibodies to the chimeric molecule may be produced monoclonal antibodies to an antigen may be prepared using any technique that provides for the production of antibody molecules by continuous cell lines in culture these include but are not limited to the hybridoma technique the human b cell hybridoma technique and the ebv hybridoma technique see for example kohler et al 1975 nature 256 495 497 kozbor et al 1985 j immunol methods 81 31 42 cote et al 1983 proc natl acad sci 80 2026 2030 and cole et al 1984 mol cell biol 62 109 120 various methods such as scatchard analysis in conjunction with radioimmunoassay techniques may be used to assess the affinity of antibodies for an antigen affinity is expressed as an association constant k a which is defined as the molar concentration of antigen antibody complex divided by the molar concentrations of free antigen and free antibody under equilibrium conditions the k a determined for a preparation of polyclonal antibodies which are heterogeneous in their affinities for multiple antigen epitopes represents the average affinity or avidity. | 8 |
apparatuses of the present invention the materials used to form the core and sheath portions of the fibers formed in the present invention are placed into solution before being introduced into the apparatuses that are used for fiber formation the core polymer solution preferably has a viscosity of between 1 and 100 000 centipoise and is preferably pumped through the inner vessel 210 at rates of between 0 01 and 1000 milliliters per hour per centimeter more preferably between 5 and 200 milliliters per hour per centimeter a voltage preferably between 1 and 250 kv more preferably between 20 100 kv is applied the positive electrode of the power supply is preferably connected to one or both of the vessels 210 270 such that a potential exists between one or both of the vessels and a grounded collector that is placed at a distance in alternate embodiments the collector is oppositely charged relative to the polymer solution s in some embodiments the collector 250 includes one or more grounded or oppositely charged points for example two grounded points separated by a space and fibers collect around the one or more points and or between them upon application of a sufficient voltage taylor cones 240 and electrospinning jets 241 will form at the exposed surface of core and or sheath polymer solution s 230 260 and the jets will attract towards the collector in preferred embodiments core and or sheath polymer solutions 230 260. | 3 |
this lock in is analogous to that described above with the description of the analog two phase lock in amplifier fig3 here however the unreliable analog multipliers 24 of fig3 are replaced by digital mixers or multipliers 40 which are immune to effects of temperature frequency and bleed through present in analog multipliers eliminating these as error sources and providing a high fidelity output signal also note that as mentioned above because the entire lock in is digital and is described by software any aspect of it can be upgraded or changed by simply reprogramming the fpga this includes changing the detection scheme entirely for example experiments which require the amplitude of the cantilever to be calculated on a cycle by cycle basis such as a fast ac or intermittent contact mode the lock in programmed into the fpga can be replaced instead with a peak detector program all without the need for modifications or additions to the controller hardware all aspects of all of the signal chains in the disclosed controller involve the fpga accordingly any modifications bug fixes new features etc that might need to be made to any of the signal processing hardware during the normal course of the controller 39 s life can now be made by a simple program change digital signal processor the dsp 32 forming part of the disclosed controller is located inside the controller itself rather than inside the interface computer as has been the case with other. | 6 |
permitted due to the difference in diameters between the circular mouth 224 and the circumferential neck 212 alternatively or additionally the circular mouth 224 may be a relatively tight fit around the circumferential neck 212 with rotation being permitted due to the resilient nature of the retaining clip 206 the head 204 may be of any relevant lever in a brake assembly for example it may be the head of an adaptor lever as shown or the head of an op shaft equally the push rod 202 may be the push rod of an actuator or an adaptor thus in other embodiments the push rod 202 may have the circumferential neck 212 at both the first and second hemispherical ends 208 and 210 respectively to be releasably secured to both an adaptor lever and an op shaft lever the push rod 202 can be disassembled from the head 204 by axially pulling it with sufficient force to widen the circular mouth 224 to pass over the hemispherical head 208 the force required to disassemble the push rod 202 from the head 204 is significantly higher than the tension forces that the joint between the two will experience in use thus making it extremely difficult for the components to become separated accidentally fig8 shows part of an alternative retaining clip 300 substantially similar to the retaining clip 206 but with projecting fingers 302 spaced circumferentially around an orifice 304 at the base of a frustroconical projection 306 an orifice outer periphery 308 has a diameter larger than a push rod cylindrical portion diameter not shown whereas an inner periphery 310 defined by distal ends of the projecting fingers 302 has a diameter. | 5 |
of the invention showing a sectional view along line a a of fig3 in this embodiment the sliding switch 13 is accessed through the sliding switch aperture 15 to slide the heat coil 16 out of body portion 11 to position switch connector plate 17 in the heat position being lock 20 the circuit board 23 completes a circuit of the heat coil 16 and the rechargeable battery 22 a user can slide the switch slide body 21 along the switch connector plate 17 to the off position being lock 19 or to the charge position being lock 18 fig1 is one embodiment of the invention showing a sectional view along line a a of fig3 in this embodiment the sliding switch 13 is accessed through the sliding switch aperture 15 to slide the heat coil 16 into body portion 11 to position switch connector plate 17 in the off position being lock 19 the circuit board 23 breaks a circuit of the heat coil 16 and the rechargeable battery 22 in an embodiment of the invention the sliding switch extends 0 0 2 0 cm outside the body portion through a sliding switch aperture that is cut to fit the sliding switch only when slid to the off position the charge position or the heat position the sliding switch is accessed through the sliding switch aperture and slid to the desired position where is locks into place in the sliding switch aperture while the invention has been described in its preferred form or embodiment with some degree of particularity it is understood that this description has. | 5 |
flower buds u2014 length about 8 mm diameter about 8 mm color 39d unopened flower buds are globose with six distinct lines of dehiscence where they split to reveal the flower sepals u2014 arrangement quantity single whorl of six fused sepals length about 9 mm width about 4 mm shape elliptical apex acute margin entire texture upper and lower surfaces smooth glabrous color when opening upper surface 37b when opening lower surface 144c fully opened upper surface 37b fully opened lower surface 144c pedicels u2014 about 7 mm in length 1 mm in diameter 178b in color and no pubescence calyx u2014 about 9 mm in length about 1 1 cm in diameter 36a in color on both surfaces and no pubescence arrangement appearance u2014 usually 6 or 7 per flower petal length u2014 about 1 9 cm petal width u2014 about 1 3 cm petal shape u2014 fan shaped petal apex u2014 ruffled rounded petal base u2014 sagittate petal margin u2014 undulate petal texture upper and lower surfaces u2014 glabrous petal color u2014 upper and lower surfaces are 155c quantity arrangement u2014 about 25 to 30 short stamens clustered in the center about 8 mm long filament color is 2c and anther color is 13a the short stamens are surrounded by 6 longer stamens about 1 2 cm long filament color is 63a and anther color is n199c the stamens are not pubescent pollen u2014 produced in moderate quantities and is 13b in color on the short stamens and 144c in color on the long stamens quantity u2014 one superior. | 0 |
a threshold voltage level during a period of there on states simultaneously it can be judged with the clamp diode dn 1 having changed into the short circuit state fig2 shows the current route of a short circuit current when the clamp diode dn 2 in a switching leg changes into a short circuit state as shown in fig2 when the switching element q 6 turns on a short circuit current flows by the route of u2212 e 3 potential terminal to dn 2 q 6 and u2212 e potential terminal therefore when the voltage vce of the switching element q 6 exceeds a threshold voltage level during a period of its on state it can be judged with the clamp diode dn 2 having changed into the short circuit state as mentioned above it becomes possible like the case of three level inverter in the second embodiment what is necessary to detect the over current failure of a clamp diode is just to detect that any of the voltage vce of both ends of switching element exceeding the threshold voltage level during a period of there on states if the voltages vce of adjoined switching elements of both ends are also supervised during a period of there on states the part which changed into a short circuit state may be specified in the case of n level inverter the clamp diode which has made a short circuit failure may be specified by supervising voltages vce of n 3 adjoined switching elements of both ends fig2 shows one example of the internal circuit diagram of a logic operation circuit 7 c used for the power converter concerning the fourth embodiment of this invention to the same parts of the fourth embodiment. | 7 |
146b underneath the receiving pocket 118 and surrounding each spring 148a 148b and locking pin 144a 144b the anchor also includes weep hole 150a 150b for draining rainwater etc from around the respective springs 148a 148b and locking pins 144a 144b referring now to fig9 when the member 120 is struck by a vehicle it is forced backward thus thrusting the member 120 into one of the detent devices 116a 116b as shown detent device 116b has been impacted when the member 120 impacts the detent device 116b the detent device 116b is pushed back further into receiving pocket 118 as a result the spring 148b is free to thrust the locking pin 144b upward when the locking pin 144b is released it passes through hole 122 in the member 120 and is stopped by plate 114b thus the member 120 precast concrete anchor 110 and receiving pocket 118 are interconnected by the locking pin 144b into an immovable structure the third embodiment however allows for locking of the member 120 regardless of whether the impact comes from either side of the gate i e from a first inbound direction or a second outbound direction because of the presence of the second impact triggered. | 4 |
of skill in the art in an alternative embodiment the second rail mount 8 screws into a torso plate sewn into the h gear vest rather than using the removable h gear bracket it should be understood that although these attachment mechanisms have been described in relation to h gear that other vests jackets belts suspenders or other articles of heavy clothing could be substituted in another embodiment the portable shooting platform attaches to the shooter 39 s support arm with for example straps or velcro or some combination of both there are many suitable ways of attaching the arm support bracket to the shooter 39 s arm however for example one could also use the h gear attachment mechanism of the prior embodiment except in this instance the h gear bracket would be secured by restraining loops attached to the underside of the shooter 39 s arm rather than those present on the h gear vest or boiled to a plate embedded within the arm portion of clothing it will be appreciated that although specific parts have been shown here for sake of clarity there are numerous alternatives that can be substituted for example instead of using the combination of the extension rods 4 6 and extension mounts 3 7 a telescoping tube that. | 5 |
to the actually spindle 41 the bearing cap can be embodied as a metal plastic or composite part a bearing cap 300 assumes the radial positioning at location 310 and the axial positioning at a location 320 and or 330 of the spindle on the side opposite from the bearing cap 200 the radial positioning 310 in the bearing cap 300 corresponds to that in the bearing cap 200 the axial positioning 220 and or 230 is not executed as a point abutment but forms a flat abutment depending on the application case the abutment surfaces 320 or 330 can optionally be used for positioning ideally axial positioning is accomplished via the abutment surface 330 since in this case the frictional radius is smaller and the friction losses are therefore reduced a suitable selection of material and surface quality can allow a thrust washer to be dispensed with if need be ideally prior to assembly of the spindle component 40 one of the bearing caps 200 or 300 is already pre mounted in the support 100 e g by rolling up or another connecting process wherein the connection shall be selected such that it can support at least the operating forces that occur with respect to the bearing cap 300 the connection must be selected such that the crash forces occurring must also be supported along with the operating forces a minimum of the operating forces must be supported on the bearing cap 200 since the spindle component 40 in the case of a loose bearing cap 300 in a crash can be supported by the fastening bolt 50 projecting. | 1 |
of entrapped obstacles when the actual speed of the motor reaches to an entrapment judgment speed which is set lower than the target speed the control unit sets a threshold speed which is higher than the target speed and outputs an output duty to the motor for achieving the target speed by feedback control the control unit switches the output duty after the actual speed of the motor becomes higher than the threshold speed to an output by feedforward control based on the target speed application_number US 40826303 A description a preferred embodiments of the present invention will be explained referring to drawings 0021 fig1 shows a back door 10 of a vehicle which corresponds to an opening and closing member the back door 10 is hinged on a body 17 of the vehicle and is driven by a drive unit 13 so as to open and close a rear opening of the body 17 the drive unit 13 fixed to the body 17 and includes a motor 14 and a driving mechanism 15 unitary connected one another the driving mechanism 15 is connected to the back door 10 through door arms 11 12 when the motor 14 is operated by a control device 16. | 4 |
that a separate connecting element 17 e g in the form of a rhombus is created which can be affixed in the corresponding grooves so that a male connecting element or a plug part is created the difficulty in putting this toy together increases with increasing number of plug parts that must be connected by being put together with a corresponding plug socket or groove in addition the arrangement and number of plug parts or grooves acting as plug sockets on the individual elements 2 and 3 in each case can be varied moreover the divided arrangement of the two types of individual elements 2 and 3 may be varied the greater the number of single elements 2 and 3 is which require a specific positioning dependent on the nature of the individual elements and the arrangement and number of connecting means grooves projections the greater is the difficulty in joining them together since the corresponding female plug socket parts i e therefore the grooves and the plug parts fitting them must necessarily be found in order to obtain a complete connection to form the e g spherical toy body the number of block shaped single elements 2 and 3 in each case can be determined in order to obtain the desired toy body when joined together in addition the number and arrangement of the plug parts projections and plug sockets grooves may be arranged differently on the five and six side faces 14 and 6 respectively of the individual elements 3 and 2 in each case so that the difficulty in joining them together to form the toy body can be adjusted accordingly the individual elements 2 3 can preferably be designed with curved base faces 5 3 i e be shaped in accordance with a part of. | 0 |
{"publication_number": "US-2016002233-A1", "abstract": "a process for preparation of - sulfuric acid mono - carbonyl ]- 7 - oxo - 1 , 6 - diaza - bi - cyclo - oct - 6 - yl | 2 |
being equal in arms 64 and 66 as depicted in fig2 when battery gases are discharged from cell 12b into manifold 10 or when gases are vented through the manifold to above cell 12b the gas pressure builds up in tube 44b and thus in chamber 52 the gas buildup forces water 70 from trap 58 into chamber 50 remote from cell 12b as seen in fig3 because of the difference in diameters the flow of water 70 into chamber 50 reduces the water head blocking the gases when the gas pressure is sufficient to overcome the water head a burst of gases flow through the trap into chamber 50 and thus into tube 44a water displaced from trap 58 by the burst splashes into chamber 50 but is not carried through the chamber because of its relatively large size the gas escape reduces the pressure in chamber 52 and the water drains into trap 58 to reestablish the seal when an explosion is ignited in manifold 10 adjacent cell 12b the resulting increase in gas pressure temporarily brakes the liquid seal in flame arrestor 48 however the water 70 has sufficient inertia to quench the flame prior to releasing the gases thus flame arrestor 48 prevents the explosion from spreading while safely venting gases to reduce the damage to cell 12b most probably the water physically blocks the flame from reaching the explosive gases in chamber 50 it is believed that the gas release through the seal and water drainage to reestablish the seal occur concurrently as a result the gases in chambers 50 and 52 are never in direct communication. | 7 |
front portion of the atv 100 also includes a bumper 160 a front grille 175 and headlamps 185 in addition the cross referenced u s patent application ser no 09 057 652 includes a more complete description of other details and advantages of the clearance area in addition to other general features of the atv 100 although the present invention is described in reference to a step through vehicle the present invention may be utilized with other types of recreational vehicles further as shown in fig2 the atv 100 includes a rear storage compartment 200 that is positioned above the rear wheels 104 and behind the seat 106 the storage compartment 200 may be manufactured using a rotomolding process which is known in the art although the rotomolding process can produce a storage compartment that is sturdy strong and durable it is also possible to manufacture the storage compartment 200 using another process such as injection molding the rear storage compartment 200 includes a generally flat floor portion 202 better visible in the top plan view of fig4 side wall portions 204 a front wall portion 206 and a rear wall portion 208 the wall portions 204 206 208 extend upwardly away from the floor portion 202 to define a compartment as better shown in fig4 the rear wall portion 208 may be pivotably connected to the bottom or side wall portions 202 204 like a tailgate a pair of retaining members 209 fig1 hold the rear wall portion 208 in the upright position it is also contemplated that the storage compartment 200 may be in the form of a substantially flat bed for this embodiment not shown it is contemplated that the wall portions 204 208 may be significantly reduced in height or eliminated altogether alternatively. | 1 |
the probe beam reaches spectrometer 110 for the particular implementation of fig1 the probe and reference beams are recombined using the same beam splitter 108 used to cause their separation in the preferred implementation an objective 124 is placed in the reference path objectives 114 and 124 are similar as possible so that they impart the same chromatic phase retardation this arrangement is found in linnik microscopes the position of mirror 122 is controlled by a piezo actuator 126 both the piezo actuator 126 and the spectrometer operate under control of a processor 128 by changing the position of mirror 122 the length of the path traveled by the reference beam may be controlled the recombination of the probe and reference beams creates interference between the two beams changing the path length traveled by the reference beam i e moving mirror 122 modulates this interference in general it is also possible to modulate the interference pattern by varying the path length traveled by the probe beam while holding the path length traveled by the reference beam fixed this can be done for example by moving subject 112 processor 128 controls this modulation and synchronously samples the output of spectrometer 110 for typical implementations spectrometer 110 includes a photodiode or ccd array that measures multiple wavelengths simultaneously this enables processor 128 to obtain samples from spectrometer 110 that are resolved in both time and wavelength processor 128 calculates a complex reflection coefficient r k for each subject 112 that is measured r k is related to the output s k x of spectrometer 110 by the following equation s u2061 k x u222b uf603 a u2061 k u2032 u2062 r u2061 k u2032 b u2061 k u2032 u2062 e. | 6 |
the full height of the towel at some point after the first two wash locations are completed the leading edge of the towel reaches the dryer section 8 location this triggers the start of the electric heaters 48 when the heat has reached a certain level the drying fan 22 starts a moisture sensor detects when drying is sufficient and releases the mechanism to advance once the next wash location has completed this then repeats for the full height of the towel if the alternate u v lights 50 are employed in the design they are activated when the first section of towel reaches the light station and deactivated when the towel is complete safety sensors and devices prevent overheating of the towel in the dryer section 8 when the towel has completely processed an alarm signals the user the user can then retrieve the washed sanitized dried and warmed towel an alternate process would be the warming of a clean towel in this case the user would press a u201c feed warm u201d or similar button and all the above processes would engage except for the wash wash support features and the dryer fan 22 instead of a moisture indicator triggering the advance of the towel a simple timer or thermal sensor would be used the same safety features would be used to prevent overheating of the towel the operation of the towel washing and drying unit 1 would involve a person feeding a dirty towel into the machine before the start of a bath or shower the machine washes sanitizes dries and therefore warms the towel after two minutes the towel is. | 3 |
of fig1 of the housing 1 the paper feeding section 10 includes a paper cassette 11 removably attached to the one side portion of the housing 1 a paper supply roller 12 in rolling contact with the uppermost one of sheets p contained in the paper cassette 11 and capable of delivering the sheets p one by one into the housing 1 and a sheet bypass guide 13 for manual paper supply each sheet p delivered from the paper feeding section 10 is regulated for feed timing by a pair of aligning rollers 15 and fed so as to be in rolling contact with the photoconductive drum 2 in a transfer section the photoconductive drum 2 is also surrounded by a pre transfer charger 9 a transfer charger 16 for transferring the developing agent to the sheet to form a visible image thereon and a separation charger 17 for separating the sheet from the photoconductive drum 2 after transfer the transfer section is defined between the photoconductive drum 2 and the transfer charger 16 after the developing agent image visible image is transferred to the sheet the sheet is guided to a fixing unit 20 by a conveyor belt 19 the developing agent is fixed by the pressure and heat of a pair of heat rollers 21 which constitute the fixing unit 20 after the fixation the sheet is discharged onto a tray 23 by a pair of exit rollers 22 after the transfer operation the developing agent remaining on the surface of the photoconductive drum 2 is removed by a cleaning unit 18 the developing apparatus 8. | 6 |
ch 2 ch 2 o n so 3 na polyoxyethylene carboxylic ester phosphate type str13 and u03b2 naphthalene sulfonic acid formaldehyde polycondensate type str14 examples of the nonionic surface active agents which are advantageously used herein include those of polyoxy ethylene alkyl ether type r o ch 2 ch 2 o n h polyoxyethtlene alkylaryl ether type str15 polyoxyethylene alkyl amine type str16 polyoxyethylene alkyl amide type str17 polyoxyethylene sorbitan fatty ester type str18 wherein r 39 represents an alkyl having 6 to 25 carbon atoms and m an integer having the value of 5 to 50 pluronic type ho ch 2 ch 2 o a ch 3 chch 2 o b ch 2 ch 2 o c h wherein a b and c each have a value greater that 1 and the sum of a b and c has a value of 20 to 300 the tetronic type str19 wherein x through x 34 39 each have a value greater than 1 y through y 34 39 each have a value greater than 1 and the sum of x x 39 x 34 x 34 39 y y 39 y 34 39 and y 34 39 has a value of 20 to 600 these anionic and nonionic surface active agents can be used either singly or in the form of a varying combination of anion anion nonion nonion or anion nonion agents although the selection of an anionic and or nonionic surface active agent is not particularly liminted it is desired to be such that. | 3 |
second embodiment of the invention in which the winch 40 is eliminated and is replaced by a connecting ring 48 outside the lever housing 25 that is connected to the cable 39 the cable 39 extending outside the lever housing 25 with there being a cable roller 49 inside the lever housing 25 that facilities the pulling of the cable 39 by the connecting ring 48 to operate the mechanism 10 the connecting ring 48 is pulled by an external pulling device such as an underwater vehicle or a cable lowered into the sea from a winch on a ship on the ocean surface fig1 a through 10d show a third embodiment of the invention in which adjacent to the inflatable plug clamp 18 the fluid transfer pipe 12 is cut and connected together by a flexible joint 50 the flexible joint 50 being secured to both pieces of the cut fluid transfer pipe 12 by a pair of joint clamps 51 the purpose of the flexible joint 50 is to enable the inflatable plug assembly 16 to reposition itself inside a pipe p if the inflatable plug assembly 16 is not positioned centrally in the pipe p when it is inserted into the pipe p insertion of the inflatable plug assembly 16 into the pipe p requires that the cut fluid transfer pipe 12 and the flexible joint 50 are held stationary during the insertion and for that purpose there is a collar 52 on the fluid transfer pipe 12 and over the flexible joint 50 and joint clamps 51 the collar 52 abutting against both the joint clamps 51 to minimize movement of the flexible joint 50 the collar 52 has a collar hinge 53 that connects together two collar half sections 54 and opposite the hinge 53. | 4 |
be offset from the longitudinal axis of the terminal pin 14 as shown in fig3 a typical series 34 d 34 connector includes a female receptacle 24 a cover 26 and optionally a strain relief 28 a multiconductor flat insulated cable 30 comprising a plurality of insulated conductors 32 disposed in coplanar side by side relation is inserted into the connector with the conductors 32 in alignment with slots 20 of their respective terminals 12 in practice terminals 12 of a series 34 d 34 connector are arranged in staggered parallel rows as shown so that the center spacing of terminal slots 20 is 0 0545 inches 1 37 mm the typical center spacing of the conductors 32 of a flat cable 30 is 0 050 inches 1 27 mm according to the present invention the terminals 12 are rotated about their longitudinal axes to a predetermined angle u03b1 relative to the transverse axis of base 10 so that the center spacing of slots 20 shown as 34 d 34 in fig2 coincide with the center spacing of conductors 32 the angle u03b1 may be determined by principles of plane geometry known to those skilled in the art as shown in fig2 the rows of terminals are disposed in opposed orientation to each. | 7 |
Subsets and Splits