Datasets:

Appz7

/

t5-metadata-extraction-dataset3

like 0

Empowering scientifc progress: the vital role of open-access, peer-reviewed methods and protocols.pdf

Cilibrasi BMC Methods (2024) 1:1 https://doi.org/10.1186/s44330-024-00001-8 EDITORIAL Empowering scientific progress: the vital role of open‑access, peer‑reviewed methods and protocols Chiara Cilibrasi1*  Abstract  In the ever-evolving landscape of scientific research, the importance of detailed, accessible methods and step-by-step reusable protocols cannot be overstated. In alignment with this BMC Methods, is dedicated to facilitating the dissemi- nation of open-access, peer-reviewed novel experimental procedures, techniques, and methodologies to promote reproducibility, transparency, and the advancement of scientific methods in the natural sciences. Main In the ever-evolving landscape of scientific research, the importance of detailed, accessible methods and step-by- step reusable protocols cannot be overstated. They are essential for reproducibility, as well as trust in science and scientific advancement. Despite progress in open science, particularly in areas like open access publications, open data, and open code, advances in open methods have lagged behind [1]. This discrepancy raises concerns because the lack of openly accessible detailed methods undermines trust in pub- lished data and severely limits the adoption of new meth- odologies, as well as the use of data. Addressing this challenge requires a cultural shift within the scientific community and a commitment to promoting transpar- ency, openness, and collaboration in research practices. In alignment with this, BMC Methods  (https://​bmcme​ thods.​biome​dcent​ral.​com/)  is dedicated to facilitating the dissemination of open-access, peer-reviewed novel experimental procedures, techniques, and methodolo- gies to promote reproducibility, transparency, and the advancement of scientific methods in the natural sci- ences. To assist our authors in effectively showcasing their innovative techniques and procedures, BMC Meth- ods offers two primary article types, Methodology Arti- cles and Protocols. These article types serve to facilitate the dissemination of innovative experimental and com- putational methods or provide detailed step-by-step descriptions of experimental techniques, respectively. This approach will then enable our readers to scruti- nise, validate, and build upon easily accessible and peer- reviewed methodologies, establishing a foundation of shared knowledge that elevates the integrity of scientific pursuits. We also acknowledge the scientific community’s demand for living protocols, recognizing that the ques- tion about protocols is generally not whether they will change, but when and how they will evolve or be adapted by others. In collaboration with protocols.io (https://​ www.​proto​cols.​io/), we facilitate the deposition of proto- cols on their dynamic platform. This enables versioning or forking as they evolve or are adapted by other research groups, preserving an original version that undergoes peer review and is published with us. Additionally, we offer the opportunity for researchers to publish proto- col extensions in cases of significant advancements or adaptations. Open Access © The Author(s) 2024. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. BMC Methods *Correspondence: Chiara Cilibrasi [email protected] 1 Springer Nature, The Campus, 4 Crinan Street, London N1 9XW, UK Page 2 of 2 Cilibrasi BMC Methods (2024) 1:1 We firmly believe that BMC Methods will play a piv- otal role in addressing the pressing issue of inadequate reporting of methods, a primary factor contributing to the widely recognized ‘reproducibility crisis’. Coined in the early 2010s, this term refers to a significant challenge faced by the scientific community, where a substantial number of published scientific studies and experiments cannot be reliably reproduced by other researchers [2]. A 2016 survey by Nature on 1,576 researchers who took a brief online questionnaire on reproducibility, found that more than 70% of researchers have tried and failed to reproduce another scientist’s experiment results and more than half have failed to reproduce their own experi- ments [3]. Additionally, the “Reproducibility Project: Cancer Biology” sought to replicate findings from 193 high profile experiments in cancer research [4]. No paper contained sufficient methodological details to allow researchers to design and conduct a replication study. Contact with authors was always required to design and conduct replication studies, and many authors were not able to provide helpful information. These examples clearly demonstrate that research findings are important but not useful if the methods used to generate the data are not accessible or not sufficiently detailed to allow reproducibility, understanding and trust. In conclusion BMC Methods, as the first Springer Nature open-access, peer-reviewed journal that will focus on providing updates in methods and lab proto- cols, aims to position itself at the forefront of the cultural shift that will eventually result in elevating the quality and rigour of scientific research. We warmly encourage you to submit your methodologies and step-by-step reus- able protocols to our journal (https://​submi​ssion.​sprin​ gerna​ture.​com/​new-​submi​ssion/​44330/3), embracing the transformative potential of open-access and peer-review to methodologies and protocols, propelling science into a future marked by reproducibility, continual progress and shared discovery. Acknowledgements Not applicable. Authors’ contributions CC conceived and drafted the manuscript. CC read and approved the final manuscript. Funding Not applicable. Availability of data and materials No datasets were generated or analysed during the current study. Declarations Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Competing interests CC is an employee of Springer Nature and the Editor for BMC Methods. Received: 18 January 2024 Accepted: 22 January 2024 References 1. Leite SB, Brooke M, Carusi A, Collings A, Deceuninck P, Dechamp J-F, et al. Promoting Reusable and Open Methods and Protocols (PRO-MaP): Draft recommendations to improve methodological clarity in life sciences publications. OSF Preprints. 2023. Available from: osf.​io/​x85gh. 2. Pashler H, Harris CR. Is the Replicability Crisis Overblown? Three Argu- ments Examined. Perspect Psychol Sci. 2012;7(6):531–6. 3. Baker M. 1,500 scientists lift the lid on reproducibility". Nature (News Feature). Springer Nature. 2016;533(7604):452–4. 4. Errington TM, Denis A, Perfito N, Iorns E, Nosek BA. Challenges for assess- ing replicability in preclinical cancer biology. eLife. 2021;10:e67995. https://​doi.​org/​10.​7554/​eLife.​67995. Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in pub- lished maps and institutional affiliations. Cilibrasi BMC Methods (2024) 1:1 https://doi.org/10.1186/s44330-024-00001-8 EDITORIAL Empowering scientific progress: the vital role of open‑access, peer‑reviewed methods and protocols Chiara Cilibrasi1*  Abstract  In the ever-evolving landscape of scientific research, the importance of detailed, accessible methods and step-by-step reusable protocols cannot be overstated. In alignment with this BMC Methods, is dedicated to facilitating the dissemi- nation of open-access, peer-reviewed novel experimental procedures, techniques, and methodologies to promote reproducibility, transparency, and the advancement of scientific methods in the natural sciences. Main In the ever-evolving landscape of scientific research, the importance of detailed, accessible methods and step-by- step reusable protocols cannot be overstated. They are essential for reproducibility, as well as trust in science and scientific advancement. Despite progress in open science, particularly in areas like open access publications, open data, and open code, advances in open methods have lagged behind [1]. This discrepancy raises concerns because the lack of openly accessible detailed methods undermines trust in pub- lished data and severely limits the adoption of new meth- odologies, as well as the use of data. Addressing this challenge requires a cultural shift within the scientific community and a commitment to promoting transpar- ency, openness, and collaboration in research practices. In alignment with this, BMC Methods  (https://​bmcme​ thods.​biome​dcent​ral.​com/)  is dedicated to facilitating the dissemination of open-access, peer-reviewed novel experimental procedures, techniques, and methodolo- gies to promote reproducibility, transparency, and the advancement of scientific methods in the natural sci- ences. To assist our authors in effectively showcasing their innovative techniques and procedures, BMC Meth- ods offers two primary article types, Methodology Arti- cles and Protocols. These article types serve to facilitate the dissemination of innovative experimental and com- putational methods or provide detailed step-by-step descriptions of experimental techniques, respectively. This approach will then enable our readers to scruti- nise, validate, and build upon easily accessible and peer- reviewed methodologies, establishing a foundation of shared knowledge that elevates the integrity of scientific pursuits. We also acknowledge the scientific community’s demand for living protocols, recognizing that the ques- tion about protocols is generally not whether they will change, but when and how they will evolve or be adapted by others. In collaboration with protocols.io (https://​ www.​proto​cols.​io/), we facilitate the deposition of proto- cols on their dynamic platform. This enables versioning or forking as they evolve or are adapted by other research groups, preserving an original version that undergoes peer review and is published with us. Additionally, we offer the opportunity for researchers to publish proto- col extensions in cases of significant advancements or adaptations. Open Access © The Author(s) 2024. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. BMC Methods *Correspondence: Chiara Cilibrasi [email protected] 1 Springer Nature, The Campus, 4 Crinan Street, London N1 9XW, UK Page 2 of 2 Cilibrasi BMC Methods (2024) 1:1 We firmly believe that BMC Methods will play a piv- otal role in addressing the pressing issue of inadequate reporting of methods, a primary factor contributing to the widely recognized ‘reproducibility crisis’. Coined in the early 2010s, this term refers to a significant challenge faced by the scientific community, where a substantial number of published scientific studies and experiments cannot be reliably reproduced by other researchers [2]. A 2016 survey by Nature on 1,576 researchers who took a brief online questionnaire on reproducibility, found that more than 70% of researchers have tried and failed to reproduce another scientist’s experiment results and more than half have failed to reproduce their own experi- ments [3]. Additionally, the “Reproducibility Project: Cancer Biology” sought to replicate findings from 193 high profile experiments in cancer research [4]. No paper contained sufficient methodological details to allow researchers to design and conduct a replication study. Contact with authors was always required to design and conduct replication studies, and many authors were not able to provide helpful information. These examples clearly demonstrate that research findings are important but not useful if the methods used to generate the data are not accessible or not sufficiently detailed to allow reproducibility, understanding and trust. In conclusion BMC Methods, as the first Springer Nature open-access, peer-reviewed journal that will focus on providing updates in methods and lab proto- cols, aims to position itself at the forefront of the cultural shift that will eventually result in elevating the quality and rigour of scientific research. We warmly encourage you to submit your methodologies and step-by-step reus- able protocols to our journal (https://​submi​ssion.​sprin​ gerna​ture.​com/​new-​submi​ssion/​44330/3), embracing the transformative potential of open-access and peer-review to methodologies and protocols, propelling science into a future marked by reproducibility, continual progress and shared discovery. Acknowledgements Not applicable. Authors’ contributions CC conceived and drafted the manuscript. CC read and approved the final manuscript. Funding Not applicable. Availability of data and materials No datasets were generated or analysed during the current study. Declarations Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Competing interests CC is an employee of Springer Nature and the Editor for BMC Methods. Received: 18 January 2024 Accepted: 22 January 2024 References 1. Leite SB, Brooke M, Carusi A, Collings A, Deceuninck P, Dechamp J-F, et al. Promoting Reusable and Open Methods and Protocols (PRO-MaP): Draft recommendations to improve methodological clarity in life sciences publications. OSF Preprints. 2023. Available from: osf.​io/​x85gh. 2. Pashler H, Harris CR. Is the Replicability Crisis Overblown? Three Argu- ments Examined. Perspect Psychol Sci. 2012;7(6):531–6. 3. Baker M. 1,500 scientists lift the lid on reproducibility". Nature (News Feature). Springer Nature. 2016;533(7604):452–4. 4. Errington TM, Denis A, Perfito N, Iorns E, Nosek BA. Challenges for assess- ing replicability in preclinical cancer biology. eLife. 2021;10:e67995. https://​doi.​org/​10.​7554/​eLife.​67995. Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in pub- lished maps and institutional affiliations.

Title: Empowering scientific progress: the vital role of open-access, peer-reviewed methods and protocols ​ Authors: Chiara Cilibrasi Publisher: Springer Nature ​ Date: 2024-01-22 00:00:00 Abstract: In the ever-evolving landscape of scientific research, the importance of detailed, accessible methods and step-by-step reusable protocols cannot be overstated. ​ In alignment with this BMC Methods, is dedicated to facilitating the dissemination of open-access, peer-reviewed novel experimental procedures, techniques, and methodologies to promote reproducibility, transparency, and the advancement of scientific methods in the natural sciences. ​



A Novel Hierarchical High‐Dimensional Unsupervised Active Learning Method.pdf

Vol.:(0123456789) International Journal of Computational Intelligence Systems (2024) 17:193 https://doi.org/10.1007/s44196-024-00601-w RESEARCH ARTICLE A Novel Hierarchical High‑Dimensional Unsupervised Active Learning Method Sajad Haghzad Klidbary1   · Mohammad Javadian2 Received: 11 March 2024 / Accepted: 10 July 2024 © The Author(s) 2024 Abstract This paper processes a novel hierarchical high-dimensional clustering algorithm based on the Active Learning Method (ALM), which is a fuzzy-learning algorithm. The hierarchical part of the algorithm is composed of two phases: divisible and agglomerative. The divisible phase, a zooming-in-process, searches for sub-clusters in already-found clusters hierarchically. At each level of the hierarchy, the clusters are found by an ensemble clustering method based on the density of data. This part of the algorithm blurs each data point as multiple one-dimensional fuzzy membership functions called ink-drop patterns; then, it accumulates the ink-drop patterns of all data points on every dimension separately. Next, it performs one-dimensional density partitioning to produce an ensemble of clustering solutions; after that, combining the results is done based on a novel consensus method with the aid of prime numbers. An agglomerative phase is a bottom-up approach that merges clusters based on a novel distance metric, named K2-nearest neighbor. The algorithm is named as the Hierarchical High-Dimensional Unsupervised Active Learning Method (HiDUALM) and is explained in more detail throughout this paper. Although the classical clustering methods are not suitable for high-dimensional data clustering, the proposed method solves the problems related to speed and memory using ensemble learning, while due to its hierarchy and the use of different distance criteria, different levels of the cluster provide the clause. Experiments on synthetic and real-world datasets are presented to show the effectiveness of the proposed-clustering algorithm. Keywords  Machine learning (ML) · Ensemble clustering · High-dimensional clustering · Hierarchical clustering · Unsupervised active learning method (ALM) · Noise elimination Abbreviations 1-D-MF One-dimensional-membership function ALM Active learning method AMI Adjusted mutual information APCGR​ Adaptive projected clustering with graph regularization ARI Adjusted rand index CLIQUE Clustering in QUEst DBSCAN Density-based spatial clustering of applications with noise DOC Density-based optimal projective clustering DPC Discriminative projected clustering EPCH Efficient projective clustering by histograms FCM Fuzzy C-means FUALM Fuzzy unsupervised active learning method HiDUALM Hierarchical high-dimensional unsupervised active learning method IDS Ink drop spread Ir Ink radius IRFLLRR Iterative reweighted Frobenius norm regularized latent low rank representation IRFN Iterative reweighted Frobenius norm LatLRR Latent LRR (low rank representation) LPFCM Locality preserving based fuzzy C-means MAFIA Merging of adaptive finite intervals MV-RTSC Multi-view robust tensor-based subspace clustering NP Narrow path PROCLUS PROjected CLUstering RI Rand index SP Spread UALM Unsupervised active learning method * Sajad Haghzad Klidbary [email protected] 1 Faculty of Engineering, Department of Electrical and Computer Engineering, University of Zanjan, Zanjan, Iran 2 School of Electrical Engineering, Shahid Beheshti University, Tehran, Iran International Journal of Computational Intelligence Systems (2024) 17:193 193   Page 2 of 26 1  Introduction Clustering is unsupervised learning that categorizes similar data into the same category. Various clustering algorithms with different capabilities and structures have been proposed [1–6]. In high-dimensional data, each object has a large num- ber of features. Examples of high-dimensional data types can be found in computer vision applications, pattern recognition [7], and molecular biology [8]. Scalability is one of the major issues in clustering algorithms which often cause difficulties when facing problems with high-dimensional datasets [3, 5, 9]. High- dimensional data, suffers from the curse of dimension- ality. In high-dimensional datasets, the distance between data points become practically indifferentiable. Therefore, it is hard to separate similar data points from dissimilar ones. Some clustering algorithms suffer from high time and space complexity to cluster high-dimensional datasets, which usually results in malfunctioning of the algorithms. In addition to these problems, high-dimensional data has many irrelevant features, meaning clusters are embedded in the subspaces of the entire feature space. Traditional clustering algorithms, such as K-means, hierarchical clus- tering, and DBSCAN, UALM [10], and FUALM [11]are not originally designed for high-dimensional data, and they often failed when applied to such datasets due to the “curse of dimensionality”. Therefore, many concepts are proposed for clustering high-dimensional data, such as: projected clustering, subspace clustering, multi-view clustering (MVC), ensemble clustering and hierarchical clustering for high-dimensional data. Subspace-clustering algorithms, projected clustering algorithms [12–15] and MVC are introduced to tackle with high-dimensional clustering difficulties. The main goal of these algorithms is to find clusters within subspaces of the entire feature space. The subspace-clustering goal is to find all clusters in all subspaces, which means that a data point may belong to multiple clusters [16]. This phenomenon results in overlapping clusters. On the other hand, projected clustering, allocates each point to a unique cluster, thus resulting in non-overlapping clusters. Subspace and projected clustering algorithms have their drawbacks. As subspace- clustering-algorithms produce many large numbers of overlapping clusters, the interpretation of the result is complicated. Despite producing non-overlapping clusters, the projected clustering algorithms still have two limitations. First, the resulting subspace clusters have different dimensionality. Second, they are vulnerable to finding clusters of different shapes and densities [17]. MVC is a subspace clustering that aims to group similar subjects and separate dissimilar subjects by utilizing multiple sources of feature information. The goal is to find consistent clustering across different views. There are two main categories of existing MVC methods: generative (or model-based) approaches and discriminative (or similarity-based) approaches. Generative approaches focus on learning the data distribution and exploit generative models to represent each cluster. Discriminative approaches optimize an objective function that involves pairwise similarities to maximize the average similarity between clusters and minimize the average similarity within clusters [18]. In addition, some of these algorithms have growing time complexity as the dimensions of the datasets increase. Hence, subspace, projected, and MVC clustering have some restrictions in dealing with high-dimensional data. These restrictions of subspace-clustering algorithms show that a flexible high-dimensional clustering algorithm with a reasonable degree of generality is needed. Ensemble clustering is developed as an essential expansion of the classical clustering problem. It overcomes the challenges faced by high-dimensional data and obtains high performance on various datasets. In the face of high-dimensional data; it divides the space into a series of subspaces and clusters each subspace separately. Clustering on the subspace reduces the complexity of clustering. Ensemble clustering combines the results of different clustering on a particular dataset, and finds a single (consensus) clustering result that is better in some sense than existing cluster- ing. Therefore, ensemble clustering integrates clustering results on the same dataset from different sources. In ensemble cluster- ing, finding the final cluster for each point is an NP-complete problem [16]. Hierarchical clustering is a method of clustering high- dimensional data that seeks to build a hierarchy of clus- ters. There are two strategies for hierarchical clustering: agglomerative and divisive. Agglomerative strategy is a “bottom-up” approach, in which each data start in its clus- ter, and clusters are merged hierarchically until all data fall into one cluster. Divisive strategy is a “top-down” approach, where all data start in one cluster, and the clus- ter is split hierarchically until each data fall into a separate cluster. The results of hierarchical clustering are usually presented in a dendrogram. Majority of the mentioned clustering algorithms require the number of clusters to be known in advance while this is not compatible with the nature of many clustering prob- lems. In this paper, we have used ensemble clustering along with hierarchical clustering to overcome problems associated with high-dimensional datasets. The proposed algorithm does not need the number of clusters as an input parameter. The algorithm is developed based on the con- cepts of the Active Learning Method (ALM) [19], while improves the UALM and FUALM-clustering algorithms developed for low-dimensional datasets. International Journal of Computational Intelligence Systems (2024) 17:193 193   Page 24 of 26 not unique prime numbers.” We provide a counterexample to show that the statement is not correct. Counterexample: For a two-dimensional dataset, if the labels of one-dimension are 1, 2, 3 and the labels of another dimension are 4, 5, 6, the results of multiplying the labels will not be unique for each cluster. As shown in Fig. 17a, the labels of two separate partitions are the same and are wrongly considered as one cluster. Therefore, if we want a unique label (multiplication product) for each cluster, the initial labels must be unique prime numbers. Figure 17b shows the same example, while the initial labels are unique prime numbers. As it is shown, the multiplication product for each partition is unique. Acknowledgements  All the experiments and ideas of this research work have been developed in Computer Engineering Department, University of Zanjan, IRAN. Authors Contributions  All authors have accepted responsibility for the entire content of this manuscript and approved its submission. Funding  The author(s) received no financial support for the research, authorship, and/or publication of this paper. Data Availability  The data that support the findings of this study are available from the corresponding author, upon reasonable request. Declarations  Conflict of interest  The authors declare that they have no conflicts of interest with respect to the research, authorship, contribution, and/or publication of this paper. Ethical Approval  This manuscript has not been published nor is it currently under consideration for publication elsewhere. Open Access  This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creat​iveco​mmons.​ org/​licen​ses/​by/4.​0/. References 1. Ezugwu, A.E., et al.: A comprehensive survey of clustering algorithms: state-of-the-art machine learning applications, taxonomy, challenges, and future research prospects. Eng. Appl. Artif. Intell. 110, 104743 (2022) 2. Ray, P., Reddy, S.S., Banerjee, T.: Various dimension reduction techniques for high dimensional data analysis: a review. Artif. Intell. Rev. 54, 3473–3515 (2021) 3. Gan, G., Ma, C., Wu, J.: Data Clustering: Theory, Algorithms, and Applications. SIAM, Philadelphia (2020) 4. Han, J., Pei, J., Tong, H.: Data Mining: Concepts and Techniques. Morgan Kaufmann, Burlington (2022) 5. Jahirabadkar, S., Kulkarni, P.: Clustering for high dimensional data: density based subspace clustering algorithms. Int. J. Comput. Appl. 63(20), 29–35 (2013) 6. Gaur, D., Gaur, S.: Comprehensive analysis of data clustering algorithms. Future Inf. Commun. Technol. Appl. ICFICE 2013, 753–762 (2013) 7. Wang, S., et  al.: Learning deep sparse regularizers with applications to multi-view clustering and semi-supervised classification. IEEE Trans. Pattern Anal. Mach. Intell. 44(9), 5042–5055 (2021) 8. Grabski, I.N., Street, K., Irizarry, R.A.: Significance analysis for clustering with single-cell RNA-sequencing data. Nat. Methods 86, 1–7 (2023) 9. Yan, F., et al.: Adaptive multi-view subspace clustering for high- dimensional data. Pattern Recognit. Lett. 130, 299–305 (2020) 10. Javadian, M., Shouraki, S.B.: UALM: unsupervised active learning method for clustering low-dimensional data. J. Intell. Fuzzy Syst. 32(3), 2393–2411 (2017) 11. Javadian, M., Shouraki, S.B., Kourabbaslou, S.S.: A novel density-based fuzzy clustering algorithm for low dimensional feature space. Fuzzy Sets Syst. 318, 34–55 (2017) 12. Agrawal, R., et  al.: Automatic subspace clustering of high dimensional data for data mining applications. In: Proceedings of the 1998 ACM SIGMOD International Conference on Management of Data (1998) 13. Goil, S., Nagesh, H., Choudhary, A.: Mafia: E±cient and scalable subspace clustering for very large data sets. In: Proceedings of 5th ACM SIGKDD International Conference on Knowledge Discovery and Data Mining, Citeseer. (1999) 14. Aggarwal, C.C., et al.: Fast algorithms for projected clustering. ACM SIGMOD Rec. 28(2), 61–72 (1999) 15. Agarwal, P., Mehta, S.: Analyzing subspace clustering approaches for high dimensional data. Artif. Intell. Sustain. Ind. 4, 169–195 (2021) 16. Moise, G., Sander, J., Ester, M.: Robust projected clustering. Knowl. Inf. Syst. 14, 273–298 (2008) 17. Achtert, E., et al.: Detection and visualization of subspace cluster hierarchies. In: Advances in Databases: Concepts, Systems and Applications: 12th International Conference on Database Systems for Advanced Applications, DASFAA 2007, Bangkok, Thailand, April 9–12, 2007. Proceedings 12. Springer (2007) 18. Chao, G., Sun, S., Bi, J.: A survey on multiview clustering. IEEE Trans. Artif. Intell. 2(2), 146–168 (2021) 19. Shouraki, S.B., Honda, N.: Recursive fuzzy modeling based on fuzzy interpolation. J. Adv. Comput. Intell. Intell. Inform. 3(2), 114–125 (1999) 20. Liu, Z., et al.: LatLRR for subspace clustering via reweighted Frobenius norm minimization. Expert Syst. Appl. 224, 119977 (2023) 21. Nie, F., et al.: Discriminative projected clustering via unsupervised LDA. IEEE Trans. Neural Netw. Learn. Syst. 34, 9466–9480 (2022) 22. Xue, J., Zhang, B.: Adaptive projected clustering with graph regularization. In: 2022 26th International Conference on Pattern Recognition (ICPR), IEEE (2022) 23. Zhou, J., et al.: Projected fuzzy C-means clustering with locality preservation. Pattern Recognit. 113, 107748 (2021) 24. Al-Sharoa, E.M., Al-Wardat, M.A.: Multi-view robust tensor- based subspace clustering. IEEE Access 10, 134292–134306 (2022) 25. Golalipour, K., et al.: From clustering to clustering ensemble selection: A review. Eng. Appl. Artif. Intell. 104, 104388 (2021) International Journal of Computational Intelligence Systems (2024) 17:193 Page 25 of 26  193 26. Alqurashi, T., Wang, W.: Clustering ensemble method. Int. J. Mach. Learn. Cybern. 10, 1227–1246 (2019) 27. Yan, D., et al.: K-nearest neighbor search by random projection forests. IEEE Trans. Big Data 7(1), 147–157 (2019) 28. Ünlü, R., Xanthopoulos, P.: Estimating the number of clusters in a dataset via consensus clustering. Expert Syst. Appl. 125, 33–39 (2019) 29. Sevillano, X., Socoró, J.C., Alías, F.: Parallel hierarchical architectures for efficient consensus clustering on big multimedia cluster ensembles. Inf. Sci. 511, 212–228 (2020) 30. Gionis, A., Mannila, H., Tsaparas, P.: Clustering aggregation. ACM Trans. Knowl. Discov. Data (TKDD) 1(1), 4 (2007) 31. He, Y., Wang, J., Qin, L., Mei, L., Shang, Y., Wang, W.: A HK clustering algorithm based on ensemble learning, pp. 276–281 (2013) 32. Paithankar, R., Tidke, B.: A HK clustering algorithm for high dimensional data using ensemble learning.arXiv preprint arXiv:​ 1501.​02431 (2015) 33. Tidke, B., Mehta, R., Rana, D.: A novel approach for high dimensional data clustering. Int. J. Eng. Sci. Adv. Technol. (IJESAT) 2(3), 645–651 (2012) 34. Huang, Q., Gao, R., Akhavan, H.: An ensemble hierarchical clustering algorithm based on merits at cluster and partition levels. Pattern Recognit. 136, 109255 (2023) 35. Bagherinia, A., et al.: Elite fuzzy clustering ensemble based on clustering diversity and quality measures. Appl. Intell. 49, 1724–1747 (2019) 36. Fern, X.Z., Lin, W.: Cluster ensemble selection. Stat. Anal. Data Min. ASA Data Sci. J. 1(3), 128–141 (2008) 37. Deegalla, S., et al.: Random subspace and random projection nearest neighbor ensembles for high dimensional data. Expert Syst. Appl. 191, 116078 (2022) 38. Kriegel, H.-P., Zimek, A.: Subspace clustering, ensemble clustering, alternative clustering, multiview clustering: what can we learn from each other. In: Proceeding of ACM SIGKDD Workshop MultiClust (2010) 39. Najafi, F., et al.: A new ensemble clustering method based on fuzzy cmeans clustering while maintaining diversity in ensemble. Signal Data Process 17, 103–122 (2021) 40. Li, F., et  al.: Fuzzy ensemble clustering based on self co-association and prototype propagation. IEEE Trans. Fuzzy Syst. 31, 3610–3623 (2023) 41. Ghosh, J., Acharya, A.: Cluster ensembles. Wiley Interdiscip. Rev. Data Min. Knowl. Discov. 1(4), 305–315 (2011) 42. Das, A.K., Das, P.: Graph based ensemble classification for crime report prediction. Appl. Soft Comput. 125, 109215 (2022) 43. Zhou, P., et al.: Clustering ensemble via structured hypergraph learning. Inf. Fusion 78, 171–179 (2022) 44. Coleman, S., Kirk, P.D., Wallace, C.: Consensus clustering for Bayesian mixture models. BMC Bioinform. 23(1), 1–21 (2022) 45. Wang, Z., et al.: Cluster ensemble selection using balanced normalized mutual information. J. Intell. Fuzzy Syst. 39(3), 3033–3055 (2020) 46. Mienye, I.D., Sun, Y., Wang, Z.: An improved ensemble learning approach for the prediction of heart disease risk. Inform. Med. Unlocked 20, 100402 (2020) 47. Abramowicz, K., de Luna, S.S., Strandberg, J.: Nonparametric bagging clustering methods to identify latent structures from a sequence of dependent categorical data. Comput. Stat. Data Anal. 177, 107583 (2023) 48. Dogan, A., Birant, D.: K-centroid link: a novel hierarchical clustering linkage method. Appl. Intell. 52, 5537–5560 (2022) 49. Murakami, M.: Practicality of modeling systems using the IDS method: performance investigation and hardware implementation (2008) 50. Merrikh-Bayat, F., Shouraki, S.B., Rohani, A.: Memristor crossbar-based hardware implementation of the IDS method. IEEE Trans. Fuzzy Syst. 19(6), 1083–1096 (2011) 51. Murakami, M., Honda, N.: A study on the modeling ability of the IDS method: a soft computing technique using pattern-based information processing. Int. J. Approx. Reason. 45(3), 470–487 (2007) 52. Afrakoti, I.E.P., et al.: Using a memristor crossbar structure to implement a novel adaptive real-time fuzzy modeling algorithm. Fuzzy Sets Syst. 307, 115–128 (2017) 53. Bahrpeyma, F., Cranganu, C., Dadaneh, B.Z.: Active learning method for estimating missing logs in hydrocarbon reservoirs. In: Artificial Intelligent Approaches in Petroleum Geosciences, pp. 209–224. Springer, Cham (2015) 54. Ghorbani, M.J., Choudhry, M.A., Feliachi, A.: Distributed multi-agent based load shedding in power distribution systems. In: 2014 IEEE 27th Canadian Conference on Electrical and Computer Engineering (CCECE), IEEE (2014) 55. Klidbary, S.H., Shouraki, S.B., Afrakoti, I.E.P.: An adaptive efficient memristive ink drop spread (IDS) computing system. Neural Comput. Appl. 31, 7733–7754 (2019) 56. Klidbary, S.H., et al.: Outlier robust fuzzy active learning method (ALM). In: 2017 7th International Conference on Computer and Knowledge Engineering (ICCKE), IEEE (2017) 57. Shahdi, S.A., Shouraki, S.B.: Supervised active learning method as an intelligent linguistic controller and its hardware implementation. In: 2nd IASTEAD International Conference on Artificial Intelligence and Applications (AIA'02), Malaga, Spain (2002) 58. Sakurai, Y.: A study of the learning control method using PBALM-a nonlinear modeling method. PhD, The University of Electro-Communications, Tokyo (2005) 59. Firouzi, M., Shouraki, S.B., Conradt, J.: Sensorimotor control learning using a new adaptive spiking neuro-fuzzy machine, spike-ids and STDP. In: Artificial Neural Networks and Machine Learning–ICANN 2014: 24th International Conference on Artificial Neural Networks, Hamburg, Germany, September 15–19, 2014. Proceedings 24. Springer (2014) 60. Bahrpeyma, F., Zakerolhoseini, A., Haghighi, H.: Using IDS fitted Q to develop a real-time adaptive controller for dynamic resource provisioning in Cloud’s virtualized environment. Appl. Soft Comput. 26, 285–298 (2015) 61. Murakami, M., Honda, N.: Classification performance of the IDS method based on the two-spiral benchmark. In: 2005 IEEE International Conference on Systems, Man and Cybernetics, IEEE (2005) 62. Firouzi, M., Shouraki, S.B., Afrakoti, I.E.P.: Pattern analysis by active learning method classifier. J. Intell. Fuzzy Syst. 26(1), 49–62 (2014) 63. Jokar, E., et al.: Hardware-algorithm co-design of a compressed fuzzy active learning method. IEEE Trans. Circuits Syst. I Regul. Pap. 67(12), 4932–4945 (2020) 64. Klidbary, S.H., Shouraki, S.B., Linares-Barranco, B.: Digital hardware realization of a novel adaptive ink drop spread operator and its application in modeling and classification and on-chip training. Int. J. Mach. Learn. Cybern. 10, 2541–2561 (2019) 65. Klidbary, S.H., Shouraki, S.B.: A novel adaptive learning algorithm for low-dimensional feature space using memristor- crossbar implementation and on-chip training. Appl. Intell. 48(11), 4174–4191 (2018) 66. Javadian, M., et al.: Refining membership degrees obtained from fuzzy C-means by re-fuzzification. Iran. J. Fuzzy Syst. 17(4), 85–104 (2020) International Journal of Computational Intelligence Systems (2024) 17:193 193   Page 26 of 26 67. Javadian, M., Hejazi, A., Klidbary, S.H.: Obtaining fuzzy membership function of clusters with the memristor hardware implementation and on-chip learning. IEEE Trans. Emerg. Top. Comput. Intell. 6(4), 1008–1025 (2022) 68. Zaki, M.J., Meira, W.: Data Mining and Analysis: Fundamental Concepts and Algorithms. Cambridge University Press, Cambridge (2014) 69. Xu, Q., et al.: Efficient synthetical clustering validity indexes for hierarchical clustering. Expert Syst. Appl. 151, 113367 (2020) 70. Rendón, E., et al.: Internal versus external cluster validation indexes. Int. J. Comput. Commun. 5(1), 27–34 (2011) Publisher's Note  Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Title: A Novel Hierarchical High-Dimensional Unsupervised Active Learning Method ​ Authors: Sajad Haghzad Klidbary, Mohammad Javadian ​ Publisher: International Journal of Computational Intelligence Systems ​ Date: 2024 ​ Abstract: This paper processes a novel hierarchical high-dimensional clustering algorithm based on the Active Learning Method (ALM), which is a fuzzy-learning algorithm. ​ The hierarchical part of the algorithm is composed of two phases: divisible and agglomerative. ​ The divisible phase, a zooming-in-process, searches for sub-clusters in already-found clusters hierarchically. ​ At each level of the hierarchy, the clusters are found by an ensemble clustering method based on the density of data. ​ This part of the algorithm blurs each data point as multiple one-dimensional fuzzy membership functions called ink-drop patterns; then, it accumulates the ink-drop patterns of all data points on every dimension separately. ​ Next, it performs one-dimensional density partitioning to produce an ensemble of clustering solutions; after that, combining the results is done based on a novel consensus method with the aid of prime numbers. ​ An agglomerative phase is a bottom-up approach that merges clusters based on a novel distance metric, named K 2-nearest neighbor. ​ The algorithm is named as the Hierarchical High-Dimensional Unsupervised Active Learning Method (HiDUALM) and is explained in more detail throughout this paper. ​ Although the classical clustering methods are not suitable for high-dimensional data clustering, the proposed method solves the problems related to speed and memory using ensemble learning, while due to its hierarchy and the use of different distance criteria, different levels of the cluster provide the clause. ​ Experiments on synthetic and real-world datasets are presented to show the effectiveness of the proposed-clustering algorithm. ​

A BCL2 promoter polymorphism rs2279115 is not associated with BCL2 protein expression or patient survival in breast cancer patients.pdf

RESEARCH Open Access A BCL2 promoter polymorphism rs2279115 is not associated with BCL2 protein expression or patient survival in breast cancer patients Claire J Searle1,2, Ian W Brock1, Simon S Cross3, Sabapathy P Balasubramanian4, Malcolm WR Reed4 and Angela Cox1* Abstract The B-cell CLL/lymphoma 2 (BCL2) gene family encodes pro- and anti-apoptotic proteins that are critical regulators of programmed cell death. Higher levels of BCL2 expression in breast tumours have been shown to be an independent prognostic factor for improved survival from breast cancer. The promoter single nucleotide polymorphism (SNP) rs2279115 has been associated with both BCL2 expression and patient survival. The aim of this study was to attempt to replicate these observations in a cohort of 1015 UK women with breast cancer, and to compare genotype frequencies in cases and controls. In this study, 1015 breast cancer cases and 1034 control subjects were genotyped for the rs2279115 SNP by 5’ nuclease PCR. Paraffin embedded tumour tissue for 342 case subjects was assembled into tissue microarrays, and the level of expression of BCL2 was established by immunohistochemistry. Kaplan Meier survival curves and Cox Proportional Hazards models were used to examine the effect of genotype on patient survival. The effect of SNP genotype on tumour BCL2 protein levels and breast cancer susceptibility was assessed by logistic regression. In this study higher BCL2 expression was significantly associated with improved survival from breast cancer (p = 0.015), in keeping with previous reports. The SNP rs2279115 was not found to be associated with tumour expression of BCL2, (p = 0.77), and neither was it associated with case/control status (p = 0.25). There was no significant association between the SNP and overall survival (p = 0.75). In conclusion, we found that higher tumour BCL2 expression is associated with improved survival from breast cancer, in keeping with previous studies. However, in contrast to a previous report, the promoter SNP rs2279115 was not associated with BCL2 expression or overall survival from breast cancer. Keywords: Breast cancer, BCL2, rs2279115, Survival, SNP Background The balance between cell proliferation and levels of apoptosis is frequently disrupted in tumours, with tumorigenesis being promoted by both the loss of pro- apoptotic signals and the gain of anti-apoptotic mechan- isms (Hanahan & Weinberg 2000; Hanahan & Weinberg 2011). The BCL2 family of proteins plays a crucial role in these processes, by integrating the complex pathways incorporating pro- and anti-apoptotic signals at the mitochondrial membrane (Tsujimoto 2002). The BCL-2 family can be categorised into anti-apoptotic and two pro-apoptotic subgroups. The anti-apoptotic members include BCL2 and Bcl-xL. The pro-apoptotic members can be divided into a “multi-BH domain” group includ- ing Bax and Bak and a BH3-only subgroup (Adams & Cory 2002). However, BCL2 itself seems to act as both an oncogene and a tumour suppressor gene in different tumour types. For example, higher levels of tumour BCL2 expression are associated with poor patient sur- vival from chronic lymphocytic leukaemia (CLL), but with improved survival from breast and colon cancer (Faderl et al. 2002) (Buglioni et al. 1999) (Callagy et al. 2008). The BCL2 gene consists of three exons and two pro- moters; it is located on chromosome 18q21.3. The SNP (rs2279115) is located in the inhibitory P2 promotor of * Correspondence: [email protected] 1Department of Oncology, CR-UK/YCR Sheffield Cancer Research Centre, University of Sheffield Medical School, Beech Hill Road, Sheffield, UK Full list of author information is available at the end of the article a SpringerOpen Journal © 2012 Searle et al.; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Searle et al. SpringerPlus 2012, 1:38 http://www.springerplus.com/content/1/1/38 the BCL2 gene (Park et al. 2004). The C allele in com- parison to the A allele displayed significantly increased inhibition of BCL2 promoter activity and binding of nu- clear proteins (Nuckel et al. 2007). In keeping with these findings BCL2 protein expression in B cells from CLL patients carrying the AA genotype was significantly increased compared with CC genotypes (Nuckel et al. 2007). This relationship was also demonstrated in rela- tion to lymph node negative breast cancer in one previ- ous study (Bachmann et al. 2007). In this study higher expression of BCL2 was associated with the A-allele (p = 0.044) and Kaplan-Meier survival analysis revealed a significant association of the AA genotype with improved survival (p = 0.030). This relationship has also been demonstrated in oropharyngeal squamous cell car- cinoma (Lehnerdt et al. 2009) where rs2279115 was sig- nificantly associated with BCL2 expression (p = 0.008) and with overall survival (p = 0.0247). This trend was also demonstrated in renal cancer (Hirata et al. 2009). Many studies have clearly demonstrated that increased BCL2 expression is associated with improved outcome from breast cancer (Yang et al. 2003) (Callagy et al. 2006) (Callagy et al. 2008). (Dawson et al. 2010) (Ali et al. 2012). A multivariate analysis incorporating five pub- lished studies from 11,212 breast cancer cases strongly supported the independent prognostic significance of BCL2 positivity with improved survival (Hazard Ratio (HR) 0.76, 95% Confidence Interval (CI) 0.54-0.74), p <0.001)(Dawson et al. 2010). In addition, expression of BCL2 has been proven to be an independent indicator of favourable prognosis for all types of early-stage breast cancer (Callagy et al. 2008; Dawson et al. 2010). The aim of this study was to use a cohort of breast cancer cases, from the Sheffield Breast Cancer Study (SBCS) to determine whether there is a relationship be- tween the promoter SNP rs2279115 and tumour protein levels of BCL2, and whether this corresponds to any dif- ferences in patient survival. We also confirmed the known association between high levels of tumour BCL2 and improved survival from breast cancer. Materials and methods Subjects Between November 1998 and January 2005, 1274 women with breast cancer and 1271 control subjects were en- rolled in the SBCS. The design and methodology of this case control study have been previously described (Rafii et al. 2002) (Azmy et al. 2004). Briefly, all subjects were residents of South Yorkshire, UK and were of European descent. The breast cancer cases all had histopathologic- ally confirmed breast cancer. The control subjects were women aged between 50 and 65 attending the Sheffield Mammography Screening Service between September 2000 and January 2004, whose mammograms showed no evidence of breast lesions. The study was approved by the South Sheffield Research Ethics Committee (SSREC/ 98/137), and the DNA samples were collected with informed consent from subjects for their use in genetic studies of cancer. Paraffin-embedded tumour tissue was requested from the relevant NHS Histopathology Arch- ive for 342 of the subjects recruited above. Pathological data (including tumour grade, morphology and lymph node status) were obtained from medical pathology records and validated (SSC). Immunohistochemical data for the oestrogen receptor (ER), progesterone receptor (PR), HER2 and cytokeratins 5/6 were available (Blows et al. 2010). Data on all-cause mortality and survival was obtained through the Trent Cancer Registry. Median follow-up for breast cancer cases in September 2009 was 21.6 years including 220 deaths. Determination of BCL2 rs2279115 genotype Blood DNA samples were available from 1015 breast cancer subjects and 1034 controls. These were geno- typed for the SNP rs2279115 using a Taqman 5’ nuclease PCR assay. The Probe sequence was as follows 5’- CTCCCCAGGAGAGAGACAGGGGAGA[G/T]GGGA CGATGAAGGAGCCGGGGACGG-3’, with the FAM probe containing T and the VIC probe containing G. The amplification reaction was performed in a final volume of 5 μL, with 1.0 μL of genomic DNA (10 ng), 0.125 μL of TaqMan™Genotyping Assay, 2.5 μL of Taqman Genotyping Master Mix, and 2.375 μL of water. The thermo- cycling conditions were as follows: 95°C for 10 min followed by 60 cycles of 92°C for 10 s and 60°C for 1 min. Allelic discrimination was carried out using the ABI 7900HT Sequence Detector (Life Technologies) The overall genotype call rate was 96% (980 cases and 981 controls successfully genotyped), and duplicate concordance based on 133 duplicate samples was 99.25%. The observed control genotype frequencies were consistent with Hardy Weinberg equilibrium (p = 0.76). BCL2 immunohistochemistry Tissue micro arrays were constructed from 342 archived paraffin embedded tumour samples from the cancer co- hort. Appropriate regions of tumour (judged by H.&.E staining) were selected from the blocks and 0.6 mm tripli- cate tissue cores were punched out from these regions using a custom precision instrument (Beecher Instrument Inc., Sun Prairie, US). These were then transferred into re- cipient paraffin blocks in a specific orientation. 5 μm sec- tions from the array blocks were dried, deparaffinised and rehydrated before blocking endogenous peroxidase with a solution of 2% hydrogen peroxide in methanol. The sec- tions were then subjected to antigen retrieval by micro- wave treatment in 10 Mm tri-sodium citrate. This was Searle et al. SpringerPlus 2012, 1:38 Page 2 of 8 http://www.springerplus.com/content/1/1/38 (Callagy et al. 2008) (Dawson et al. 2010). Anti-apoptotic BCL2 members act as repressors of apoptosis by block- ing the release of cytochrome c, whereas pro-apoptotic members act as promoters (Ghobrial et al. 2005). The contrasting effect on survival of tumour BCL2 expres- sion in breast cancer as opposed to non-Hodgkin lymph- oma may well be due to the importance of the careful equilibrium between tumour BCL2 protein expression and other pro-apoptotic members such as Bax, rather than on BCL2 tumour protein quantity alone (Reed 1997) (Cory et al. 2003). Unfortunately the exact mech- anism that underpins this difference is not fully under- stood. In vitro studies in a variety of different cell types have found that high levels of BCL2 protein expression in tumours can result in striking growth inhibition (Pietenpol et al. 1994). In human breast cancer cell lines there is an inverse correlation between the expression of BCL2 and mutant p53 and that this relationship could lead to down-regulation of BCL2 tumour protein expres- sion (Haldar et al. 1994). Other studies have suggested a function of BCL2 protein in lengthening the cell cycle (O’Reilly et al. 1996) (Knowlton et al. 1998) (Lipponen et al. 1995). The relationship between tumour BCL2 protein ex- pression and oestrogen has also been widely debated. It has been suggested that the intrinsic and extrinsic path- ways which make up the two main routes involved in breast cancer cell apoptosis regulation, are both induced when oestrogen binds to the oestrogen receptor. Both pathways result in the activation of caspase leading fi- nally to apoptosis (Lewis-Wambi & Jordan 2009). Leung and Wang found that a breast cancer cell line treated with the oestrogen 17β-oestradiol resulted in up- regulation of BCL2 mRNA and protein, but down- regulation of Bcl-x(L) mRNA and protein . They did not find this result with other sex hormones. They specu- lated that different members of the BCL2 family proteins may be regulated through different pathways and that these pathways may be modulated by 17β-oestradiol (Leung & Wang 1999). Tumour BCL2 protein expres- sion status has also been previously strongly associated with PR and ER expression (Nadler et al. 2008) (Lee et al. 1997). Our data are consistent with previous obser- vations that BCL2 is a strong independent prognostic marker for breast cancer survival (Dawson et al. 2010). The SNP rs2279115 has been associated with BCL2 expression in CLL and breast cancer from node negative patients (Bachmann et al. 2007). The study by Bachmann et al. found that higher expression of BCL2 was asso- ciated with the A-allele (P = 0.044) in lymph node negative patients only. This also corresponded to an improved survival in this group (HR (95% CI) 3.2 (1.03,9.93) p = 0.044). Lymph node negative patients who were homozygous for the C allele had a higher risk of death than AA homozygous patients, with heterozygous women being intermediate in risk. In the present data we found no association between rs2279115 and tumour expression of BCL2 in the whole cohort, or when results were subdivided into Table 2 Level of BCL2 protein expression according to lymph node status, tumour grade, morphology, ER, PR, HER2 and CK5/6 status Low BCL2 n (%) High BCL2 n (%) p valuea Node status No nodal Involvement 20 (64.5) 140 (70.0) Nodal Involvement 11 (35.5) 60 (30.0) 0.54 Grade 1 3 (8.8) 51 (24.9) 2 7 (20.6) 114 (55.6) 3 24 (70.6) 40 (19.5) 4x10-9 Morphology Ductal 28 (80.0) 159 (75.7) Lobular 2 (5.7) 22 (10.5) Other 5 (14.3) 29 (13.8) 0.68 ER status Negative 27 (79.4) 31 (15.3) Positive 7 (20.6) 171 (84.7) 1x10-14 PR status Negative 20 (62.5) 53 (26.6) Positive 12 (37.5) 146 (73.4) 5x10-5 HER2 status Negative 29 (82.9) 193 (92.3) Positive 6 (17.1) 16 (7.7) 0.07 CK5/6 status Negative 23 (67.6) 180 (90.5) Positive 11 (32.4) 19 (9.5) 0.0002 BCL2 immunohistochemistry scores were grouped into low (scores 0–1) and high (scores 2–3) a Pearson χ2 test. Table 3 Level of BCL2 protein expression of according to rs2279115 genotype Genotype Low BCL2 n (%) High BCL2 n (%) Odds Ratio 95% CI p value AA 12 (13.3) 78 (86.7) 1.00 AC 19 (15.6) 103 (84.4) 0.83 0.38 1.82 0.65 CC 4 (11.1) 32 (88.9) 1.23 0.37 4.10 0.74 TOTAL 35 (100) 213 (100.0) BCL2 immunohistochemistry scores were grouped into low (scores 0–1) and high (scores 2–3). Table 4 Genotype frequencies for SNP rs2279115 in case and control subjects Genotype controls n (%) cases n (%) Odds Ratio 95% CI p value AA 290 (29.6) 314 (32.0) 1.00 AC 475 (48.4) 477 (48.7) 0.93 0.76 1.14 0.47 CC 216 (22.0) 189 (19.3) 0.81 0.63 1.04 0.098 TOTAL 981 (100) 980 (100.0) Searle et al. SpringerPlus 2012, 1:38 Page 6 of 8 http://www.springerplus.com/content/1/1/38 patient with lymph node positive or lymph node negative disease. We also found no association with survival for the different genotypes. Assuming a base- line survival proportion of 0.84 in lymph node nega- tive cases, our study would have been expected to detect a hazard ratio of 3.2 between homozygous gen- otypes (as was found by Bachmann et al. 2007), hav- ing 80% power to detect hazard ratio of 1.8. However, we are unable to exclude effects smaller than this. It is possible that there may be genotypic effects on sur- vival of similar or smaller magnitude to those of BCL2 expression (Callagy et al. 2008; HR = 1.64); this study is underpowered to detect these. In conclusion we have no evidence to support the SNP rs2279115 as a prognostic biomarker for breast cancer patients. Higher BCL2 expression has been Figure 4 Kaplan-Meier survival functions according to rs2279115 genotype. Overall survival based on 934 case subjects with total time at risk 6765.43 years. Numbers at risk at the end of the 10-year analysis period were 158 (AA), 221 (AC), and 102 (CC). Hazard ratio (95% CI) 1.03 (0.86, 1.24), p = 0.75. Figure 5 Kaplan-Meier survival functions in lymph node negative and positive subjects according to rs2279115 genotype. Overall survival based on 786 subjects with total time at risk 5808.75 years. A shows lymph node negative subjects and B shows lymph node positive subjects. Numbers at risk at the end of the 10-year analysis period were A: 103 (AA), 146 (AC), 79 (CC) and B: 38 (AA), 54 (AC), 18 (CC). Hazard ratios (95% CI) for A were 0.97 (0.73, 1.30), p = 0.85 and for B were 1.20 (0.88, 1.64), p = 0.24. Searle et al. SpringerPlus 2012, 1:38 Page 7 of 8 http://www.springerplus.com/content/1/1/38 conclusively proven to correlate with improved survival and further studies are required to explore its use as a prognostic indicator. Competing interest The authors declare that they have no competing interests. Authors’ contribution The study was designed by AC and MWR. Patient diagnosis and recruitment, and clinical data collection was carried out by MWR and SPB. Pathology data collection and generation of tissue microarrays was carried out by SSC. Genotyping, immunohistochemistry, and scoring of the immunohistochemical data was carried out by CJS and IWB. CJS and AC performed statistical analyses and CJS and AC drafted the manuscript. All authors read and approved the final manuscript. Ethical standards All experiments completed as part of this study comply with the current laws in the United Kingdom. Acknowledgements This project was supported by Yorkshire Cancer Research awards S295 and S299. We would like to thank all the women who took part in the SBCS, and Helen Cramp and Dan Connley for patient recruitment and data management respectively. CJS was funded by an Academic Clinical Fellowship from the UK National Institute of Health Research. Author details 1Department of Oncology, CR-UK/YCR Sheffield Cancer Research Centre, University of Sheffield Medical School, Beech Hill Road, Sheffield, UK. 2Department of Clinical Genetics, Chapel Allerton Hospital, Chapeltown Road, Leeds, UK. 3Academic Unit of Pathology, Department of Neuroscience, University of Sheffield Medical School, Beech Hill Road, Sheffield, UK. 4Academic Unit of Surgical Oncology, CR-UK/YCR Sheffield Cancer Research Centre, University of Sheffield Medical School, Beech Hill Road, Sheffield, UK. Received: 12 September 2012 Accepted: 17 September 2012 Published: 23 October 2012 References Adams J, Cory S (2002) The BCL2 family: regulators of the cellular life-or-death switch. Nat Rev Cancer 2:647–656 Ali H et al (2012) A Ki67/BCL2 index based on immunohistochemistry is highly prognostic in ER-positive breast cancer. J Pathol 226(1):97–107 Azmy IA et al (2004) Role of tumour necrosis factor gne polymorphism (−308 and −238) in breast cancer susceptibility and severity. Breast Cancer Res 6: R395–R400 Azzato E et al (2009) Prevalent cases in observational studies of cancer survival: do they bias hazard ratio estimates? BJC 100:1806–1811 Bachmann HS et al (2007) The AA genotype of the regulatory BCL2 promoter polymorphism (938C > A) is associated with a favorable outcome in lymph node negative invasive breast cancer patients. Clin Cancer Res 13:5790–5797 Blows FM et al (2010) Subtyping of breast cancer by immunohistochemistry to investigate a relationship between subtype and short and long term survival: a collaborative analysis of data for 10,159 cases from 12 studies. PLoS Med 7 (5):e1000279. doi:10.1371/journal.pmed.1000279 Buglioni S et al (1999) Evaluation of multiple bio-pathological factors in colorectal adenocarcinomas: independent prognostic role of p53 and bcl-2. Int J Cancer 84:545–552 Callagy GM et al (2006) BCL2 is a prognostic marker in breast cancer independently of the Nottingham Prognostic Index. Clin Cncer Research 12:2468–2475 Callagy GM et al (2008) Meta-analysis confirms BCL2 is an independent prognostic marker in breast cancer. BMC Cancer 8:153 Cory S, Huang DC, Adams JM (2003) The Bcl-2 family: roles in cell survival and oncogenesis. Oncogene 22(53):8590–8607 Dawson SJ et al (2010) BCL2 in breast cancer: a favourable prognostic marker across molecular subtypes and independent of adjuvant therapy received. Br J Cancer 103(5):668–675 Faderl S et al (2002) Expression profile of 11 proteins and their prognostic significance in patients with chronic lymphocytic leukemia (CLL). Leukemia 16:1045–1052 Ghobrial IM, Witzig TE, Adjei AA (2005) Targeting apoptosis pathways in cancer therapy. CA Cancer J Clin 55:178–197 Haldar S et al (1994) Down-regulation of bcl-2 by p53 in breast cancer cells. Cancer Res 54(8):2095–2097 Hanahan D, Weinberg RA (2000) Hallmarks of cancer. Cell 100:57–70 Hanahan D, Weinberg RA (2011) Hallmarks of cancer: the next generation. Cell 144(5):646–674 Hirata H et al (2009) The bcl2 -938CC genotype has poor prognosis and lower survival in renal cancer. J Urol 182(2):721–727 Knowlton K et al (1998) Bcl-2 slows in vitro breast cancer growth despite its antiapoptotic effect. J Surg Res 76(1):22–26 Lee HD, Koo JY, Jung WH (1997) Correlations of bcl-2 expression with clinicopathological features in breast cancer. Yonsei Med J 38(4):206–211 Lehnerdt GF et al (2009) The regulatory BCL2 promoter polymorphism (−938C > A) is associated with relapse and survival of patients with oropharyngeal squamous cell carcinoma. Ann Oncol 20:1094–1099 Leung LK, Wang TT (1999) Paradoxical regulation of Bcl-2 family proteins by 17beta-oestradiol in human breast cancer cells MCF-7. Br J Cancer 81(3):387–392 Lewis-Wambi JS, Jordan VC (2009) Estrogen regulation of apoptosis: how can one hormone stimulate and inhibit? Breast Cancer Res 11(3):206 Lipponen P et al (1995) Apoptosis suppressing protein bcl-2 is expressed in well-differentiated breast carcinomas with favourable prognosis. J Pathol 177(1):49–55 McShane LM et al (2005) REporting recommendations for tumor MARKer prognostic studies (REMARK). Nat Clin Pract Oncol 2:416–422 Nadler Y et al (2008) Expression patterns and prognostic value of Bag-1 and Bcl-2 in breast cancer. Breast Cancer Res 10(2):R35 Nuckel H et al (2007) Association of a novel regulatory polymorphism (−938C > A) in the BCL2 gene promotor with disease progression and survival in chronic lymphocytic leukemia. Blood 109:290–297 O’Reilly LA, Huang DC, Strasser A (1996) The cell death inhibitor Bcl-2 and its homologues influence control of cell cycle entry. EMBO J 15(24):6979–6990 Park BL et al (2004) Identification of the variant in cycline D1 (CCND1) AND B-cell CLL/lymphoma 2 (BCL2). J Hum Genet 49:449–454 Pietenpol JA et al (1994) Paradoxical inhibition of solid tumor cell growth by bcl2. Cancer Res 54(14):3714–3717 Rafii S et al (2002) A potential role for the XRCC2 R188H polymorphic site in DNA-damage repair and breast cancer. Hum Mol Genet 11:1433–1438 Reed JC (1994) Bcl-2 and the regulation of programmed cell death. J Cell Biol 124(1–2):1–6 Reed JC (1997) Bcl-2 family proteins: regulators of apoptosis and chemoresistance in hematologic malignancies. Semin Hematol 34:9–19 Tsujimoto Y (2002) Bcl-2 family of proteins: life-or-death switch in mitochondria. Biosci Rep 22:47–58 Tsujimoto Y et al (1984) Cloning of the chromosome breakpoint of neoplastic B cells with the t(14;18) chromosome translocation. Science 226(4678):1097–1099 Yang Q et al (2003) Prognostic value of Bcl-2 in invasive breast cancer receiving chemotherapy and endocrine therapy. Oncol Rep 10:121–125 doi:10.1186/2193-1801-1-38 Cite this article as: Searle et al.: A BCL2 promoter polymorphism rs2279115 is not associated with BCL2 protein expression or patient survival in breast cancer patients. SpringerPlus 2012 1:38. Searle et al. SpringerPlus 2012, 1:38 Page 8 of 8 http://www.springerplus.com/content/1/1/38

Title: A BCL2 promoter polymorphism rs2279115 is not associated with BCL2 protein expression or patient survival in breast cancer patients ​ Authors: Claire J Searle, Ian W Brock, Simon S Cross, Sabapathy P Balasubramanian, Malcolm WR Reed, Angela Cox ​ Publisher: SpringerPlus Date: 23 October 2012 ​ Abstract: The B-cell CLL/lymphoma 2 (BCL2) gene family encodes pro-and anti-apoptotic proteins that are critical regulators of programmed cell death. ​ Higher levels of BCL2 expression in breast tumours have been shown to be an independent prognostic factor for improved survival from breast cancer. ​ The promoter single nucleotide polymorphism (SNP) rs2279115 has been associated with both BCL2 expression and patient survival. ​ The aim of this study was to attempt to replicate these observations in a cohort of 1015 UK women with breast cancer, and to compare genotype frequencies in cases and controls. ​ In this study, 1015 breast cancer cases and 1034 control subjects were genotyped for the rs2279115 SNP by 5’ nuclease PCR. ​ Paraffin embedded tumour tissue for 342 case subjects was assembled into tissue microarrays, and the level of expression of BCL2 was established by immunohistochemistry. ​ Kaplan Meier survival curves and Cox Proportional Hazards models were used to examine the effect of genotype on patient survival. ​ The effect of SNP genotype on tumour BCL2 protein levels and breast cancer susceptibility was assessed by logistic regression. ​ In this study higher BCL2 expression was significantly associated with improved survival from breast cancer (p = 0.015), in keeping with previous reports. ​ The SNP rs2279115 was not found to be associated with tumour expression of BCL2, (p = 0.77), and neither was it associated with case/control status (p = 0.25). ​ There was no significant association between the SNP and overall survival (p = 0.75). ​ In conclusion, we found that higher tumour BCL2 expression is associated with improved survival from breast cancer, in keeping with previous studies. ​ However, in contrast to a previous report, the promoter SNP rs2279115 was not associated with BCL2 expression or overall survival from breast cancer. ​

Transdifferentiation of MALME-3M and MCF-7 Cells toward Adipocyte-like Cells is Dependent on Clathrin-mediated Endocytosis.pdf

RESEARCH Open Access Transdifferentiation of MALME-3M and MCF-7 Cells toward Adipocyte-like Cells is Dependent on Clathrin-mediated Endocytosis Jaime Carcel-Trullols†, Cristóbal Aguilar-Gallardo†, Fernando Garcia-Alcalde, Miguel Angel Pardo-Cea, Joaquin Dopazo, Ana Conesa and Carlos Simón* Abstract: Enforced cell transdifferentiation of human cancer cells is a promising alternative to conventional chemotherapy. We previously identified albumin-associated lipid- and, more specifically, saturated fatty acid-induced transdifferentiation programs in human cancer cells (HCCLs). In this study, we further characterized the adipocyte-like cells, resulting from the transdifferentiation of human cancer cell lines MCF-7 and MALME-3M, and proposed a common mechanistic approach for these transdifferentiating programs. We showed the loss of pigmentation in MALME-3M cells treated with albumin-associated lipids, based on electron microscopic analysis, and the overexpression of perilipin 2 (PLIN2) by western blotting in MALME-3M and MCF-7 cells treated with unsaturated fatty acids. Comparing the gene expression profiles of naive melanoma MALME-3M cells and albumin-associated lipid-treated cells, based on RNA sequencing, we confirmed the transcriptional upregulation of some key adipogenic gene markers and also an alternative splicing of the adipogenic master regulator PPARG, that is probably related to the reported up regulated expression of the protein. Most importantly, these results also showed the upregulation of genes responsible for Clathrin (CLTC) and other adaptor-related proteins. An increase in CLTC expression in the transdifferentiated cells was confirmed by western blotting. Inactivation of CLTC by chlorpromazine (CHP), an inhibitor of CTLC mediated endocytosis (CME), and gene silencing by siRNAs, partially reversed the accumulation of neutral lipids observed in the transdifferentiated cells. These findings give a deeper insight into the phenotypic changes observed in HCCL to adipocyte-like transdifferentiation and point towards CME as a key pathway in distinct transdifferentiation programs. Disclosures: Simon C and Aguilar-Gallardo C are co-inventors of the International Patent Application No. PCT/EP2011/004941 entitled “Methods for tumor treatment and adipogenesis differentiation”. Keywords: Cell Transdifferentiation, Unsaturated Fatty Acids, PPARG, Perilipin 2, Loss of Pigmentation, Adipogenic Gene Markers, Clathrin, Clathrin-mediated Endocytosis Introduction Transdifferentiation involves reprogramming one type of adult cell into another mature cell type, without having to generate intermediary stem cells. It has received sig- nificant attention because it may have a considerable number of applications in cell and cancer therapy. Successful transdifferentiation from one cell type to another by overexpressing lineage-specific genes in vivo (Takeuchi & Bruneau 2009; Zhou et al. 2008) and in vitro (Graf & Enver 2009; Ieda et al. 2010) has been previously reported. Not only can cell transdifferentiation be enforced through the overexpression of the appropriate set of genes, but also through the application of specific molecules, which is a promising alternative to conven- tional chemotherapy for cancer treatment, for example, the use of all-trans-Retinoid acid (ATRA) for the treat- ment of acute promyelocitic leukemia (APL) (Kakizuka et al. 1991). The fact that there was no treatment based on cell differentiation therapy for solid tumors prompted us to study whether novel transdifferentiating molecules secreted by human embryonic stem cells (hESCs) could prevent cancer progression. Our studies showed that, * Correspondence: [email protected] †Equal contributors Bioinformatics and Genomics Department, Prince Felipe Research Centre (CIPF), Avda. Autopista del Saler, 16-3 46012, Valencia, Spain a SpringerOpen Journal © 2012 Carcel-Trullols et al.; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Carcel-Trullols et al. SpringerPlus 2012, 1:44 http://www.springerplus.com/content/1/1/44 irrespective of the presence of hESCs, albumin- associated lipids (albuMAXW), and specifically poly- and monounsaturated fatty acids (linoleic, oleic, petroselinic and palmitoleic acids) accounted for the transdifferentia- tion of several distinct human cancer cell lines (HCCLs) into adipocyte-like cells (Ruiz-Vela et al. 2011). Endocytosis regulates the entry of nutrients, hormones and signaling factors into the cell, and serves to regulate the internalization of transmembrane receptors. During endocytosis the plasma membrane invaginates to form a new intracellular vesicle containing various cargo mole- cules and material to be internalized from the external environment (Conner & Schmid 2003). Clathrin (CLTC)- mediated endocytosis (CME) is the major endocytic route and is assumed to regulate ligand mediated signal transduction by disrupting ligand-receptor interactions after their uptake into endosomal compartments (Andersson 2012). It can sequester the receptors in intra- cellular compartments, target ligand-receptor complexes to lysosomes for degradation, or recycle them by sending them back to the cell surface for re-use (Maxfield & McGraw 2004). Several in vitro studies have reported evidence for a relationship between the endocytosis of ligands such as Bone morphogenetic protein 2 (BMP2) and oxidized Low-density lipoprotein (ox-LDL), bound to their respective receptors, and their key roles in dif- ferent transdifferentiation models (Rauch et al. 2002; Yu et al. 2010). Others have shown that the incorporation of insulin regulated glucose transporter 4 (GLUT4) into the cell plasma membrane, a process required for adi- pogenesis, is dependent on clathrin coated vesicles (Huang et al. 2007). However, the existence of a direct correlation between endocytic ligand-receptor complex internalization and the transcription of genes controlling critical physiological events, such as cell transdifferentia- tion or adipogenesis, remains largely uninvestigated. Our previous report identified similar transdifferentia- tion programs in HCCLS of completely different origins such as in cells from ovarian carcinoma, hepatocarci- noma, breast adenocarcinoma and melanoma (Ruiz-Vela et al. 2011). In this study we aimed to characterize the adipocyte-like cells resulting from melanoma MALME-3M and breast carcinoma MCF-7 transdifferentiation pro- grams and to set the key pathways that were concomi- tantly affected in these programs. In order to document induced-transdifferentiation we report the loss of pig- mentation in MALME-3M cells, the upregulation of PLIN2 protein expression in the studied HCCLs and the upregulation of gene expression of PLIN2 and other commonly considered key adipogenic markers such as lipoprotein lipase (LPL) and peroxisome proliferator- activated receptor alpha (PPARA) in MALME-3M cells. These results also revealed an alternative gene splicing of the adipogenic master regulator PPARG that was likely to be related to the upregulation of the protein found in transdifferentiated MALME-3M cells, previously reported by our group (Ruiz-Vela et al. 2011). Most importantly, our results also showed an increase in Clathrin (CLTC) expression and we provided evidence that Clathrin- mediated Endocytosis (CME) was essential for the trans- differentiation programs of the breast adenocarcinoma and melanoma HCCLs we investigated into adipocyte-like cells. Materials and methods Cell culture and transfection MALME-3M melanoma (ATTC# HTB-64) and MCF-7 breast adenocarcinoma (ATTC#HTB-22) cells were cultured in growth media containing RPMI-1640, 10% fetal bovine serum (FBS) and 2 mM glutamine, follow- ing a standard 3 T3 protocol (Todaro & Green 1963). Albumin-associated lipids were obtained by adding GIBCOTM AlbuMAX II from Invitrogen at a concentra- tion of 1.6% w/v in RPMI media containing 10% FBS. To induce cell transdifferentiation, cells were cultured with albumin-associated lipids, whereas mock-treated cells were cultured in RPMI containing 10% FBS. After 24 hours cells were trypsinized, collected in plastic tubes and centrifuged at 5000 rpm. CLTC-targeted siRNA and scrambled siRNA (control siRNA) were obtained from Dharmacon (Dharmacon RNA i Technologies). Sequences from CLTC-targeted siRNA and control siRNA were commercially provided. Cells were seeded according to the manufacturer’s protocol in serum-containing media without antibiotics and transfected with either 50 nM siRNA or 50 nM control siRNA with DharmaFECT (Dharmacon RNA i Technolo- gies) in antibiotic-free media for 72 h. Gene expression analysis Whole genome transcriptional profiles of both control MALME-3M cells and transdifferentiated cells, after 24 hours incubation with albumin-associated lipids, were obtained by RNA-seq. Briefly, total RNA was purified from cell cultures using Quick-RNA MiniPrepTM (Zymo Research) protocol and strand-specific 38 nt pair-end Solexa libraries were prepared following the dUTP method (Parkhomchuk et al. 2009; Levin et al. 2010). Sequencing reads were mapped to the human genome (GRCh37/hg19 assembly) using Tophat 1.1.4 with stand- ard parameters and indicating the corresponding mate inner distance (46 bp for 0 h and 44 bp for 24 h) (Trapnell et al. 2009). Gene counts were estimated using htseq- count (http://www-huber.embl.de/users/anders/HTSeq) with standard parameters, using the human annotations obtained from Ensembl 60. Differentially expressed genes between MALME-3M and adipose cell types were estimated by means of the NOISeq non parametrical Carcel-Trullols et al. SpringerPlus 2012, 1:44 Page 2 of 12 http://www.springerplus.com/content/1/1/44 Izpisua Belmonte 2008) is far more complex than previ- ously anticipated. In addition to maintaining self- renewal and pluripotency in hESCs (Garcia-Gonzalo & Izpisua Belmonte 2008), a role for albumin (Kallee 1996) and its associated lipids (Davis & Dubos 1947; Thomas et al. 1995; Lafond et al. 1994) has been discovered in adipogenesis in other cell types (Schopfer et al. 2005). Our results also indicate that certain albumin complex associated poly- and monounsaturated fatty acids induce terminal differentiation and arrest cancer progression (Ruiz-Vela et al. 2011). Concomitanlty to our studies, Khan et al. have also described the specific growth inhib- ition of esters of oleic acid and ricinoleic acid against the human skin malignant melanoma cell line (SK-MEL-1) (Khan et al. 2012). Despite the important findings that we describe here, many key questions remain un- answered in the identification of novel genes and pro- teins that mediate the terminal transdifferentiation of human cancer cells. To get a better understanding of the mechanisms that lead to transdifferentiation we concen- trated our efforts on the role of those genes that are dif- ferentially regulated during the process. EM revealed a marked loss of pigmentation in the melanoma MALME-3M cells treated with albumin- associated lipids, in accordance with the downregulation of MLANA gene expression. Melan-A is known to form a complex with Pmel17 which affects its expression, sta- bility, trafficking, and the processing which is required for melanosome maturation. Its expression is indispens- able for Pmel17 function and the formation of cell pig- mentation (Hoashi et al. 2005). Quantification of gene expression by RNA-seq led to the characterization of the MALME-3M cells treated with albumin-associated lipids. Several adipocytic mar- kers such as PLIN2, LPL and PPARA were signifi- cantly upregulated. PPARA could be upregulated merely as a consequence of fatty acid accumulation as it has been shown to be involved in the regulation of obesity in rodents by increasing hepatic fatty acid oxi- dation (Kersten et al. 1999). LPL is a well describeda- dipocyte marker as it regulates the hydrolysis of triglycerides in the adipose tissue (Mead et al. 2002). Interestingly, PPARG1, an adipogenesis marker shown to be upregulated upon HCCL to adipocyte transdifferen- tiation (Ruiz-Vela et al. 2011), showed a differential map- ping pattern between the albumin-associated lipid-treated and non-treated cells. The PPARG gene has eight exons which are translated and spliced into different isoforms (http://www.ensembl.org/Homo_sapiens/Gene/Summary? g=ENSG00000132170;r=3:12328867–12475855), with the PPARG1 isoform being the primary transcript expressed in adipocytes. In treated cells, PPARG showed whole tran- script expression, while in mock-treated cells no expres- sion of exons 4 and 5 was evident (Additional file 3: Supporting information B). These two exons encode the Zinc finger binding site domain of the PPARG1 transcrip- tion factor (Finn et al. 2010). The lack or downregulation of these functional domains in the non-treated cells might be indicative of the differential processing of this gene in the MALME-3M cell lines and of differential expression of the protein (Ruiz-Vela et al. 2011). The characterization of the adipocyte-like cells showed that the expression of PLIN2 was increased in MALME- 3M, and in MCF-7 cells treated with albumin-associated lipids and with petroselinic acid. PLIN2 is a principal adi- pocytic marker, which coats lipid droplets in adipocytes (Brasaemle et al. 1997; Heid et al. 1998) and its expres- sion has been linked to PPARG1. We previously reported that PPARG1 expression was increased in MALME-3M cells treated with albumin-associated lipids (Ruiz-Vela et al. 2011). It has been recently reported that pretreat- ment of murine 3T3-L1 preadipocytes with Rosiglita- zone, a potent PPARG1 agonist, decreased lipolysis and increased PLIN2 expression (Kim et al. 2007). Quantification of gene expression by RNA-seq also gave us some clues about the possible mechanistic path- ways involved in transdifferentiation. Among the genes that were identified as differentially expressed between the treated and the untreated conditions, many of them were related to endocytic functions. Albumin-associated lipid induced transdifferentiation was accompanied by the upregulation of CLTC and other important adaptor- related complexes such as AP1B1, AP1G1, AP1S3, AP2A1, Synergin and AP3M1. Adaptor-related proteins (See figure on previous page.) Figure 5 Inhibition of CLTC levels by SiRNA affects LD biogenesis. After silencing CLTC expression, biogenesis was examined by Nile Red (C, D) quantification and Oil Red O semi-quantitative determination (E, F). Experiments were performed in MALME-3M cells (C and E) and in MCF-7 cells (D and F). Cells were transiently transfected with CONT (Control) SiRNA or with CLTC SiRNA for 72 hours prior to the addition of the vehicle 24 hours prior to cell lysation. Cell lysates were then separated in a 4-12% Bis-Tris gel and probed by western blotting with antibodies against CLTC and Actin. The experiment was repeated three times and a representative western blot is shown for MALME-3M cells (A) and for MCF-7 cells (B). For the neutral lipid determinations, after transfection, cells were treated with either the vehicle or petroselinic acid (100 μg/ml) for 24 hours prior to the testing. Nile Red (C, D) and Oil Red O and hematoxylin (E, F) staining were performed as described in Materials and Methods. Quantification was assessed using the FlowJo software. Fold induction was estimated by calculating the ratio between treated conditions (Petroselinic acid) and the untreated condition (vehicle). The average values from three independent analyses are shown. *P <0.05 compared to each control in C and D. Representative photos are shown in E and F. The length of the shown size bars is 20 μm. Carcel-Trullols et al. SpringerPlus 2012, 1:44 Page 10 of 12 http://www.springerplus.com/content/1/1/44 are key components of clathrin coated vesicles that can bind directly to both the clathrin lattice and to the lipid and protein components of membranes (Pearse et al. 2000). AP1 and AP3 are found at the coated vesicles located at the Golgi complex and it has been suggested that both associate with GLUT4 transporting vesicles and mediate distinct intracellular sorting events at the level of the TGN and endosomes in rat adipocytes (Gillingham et al. 1999). The observed upregulation of proteins involved in GLUT4 trafficking could be related to the acquisition of the adipocytic phenotype. Encouraged by the western blot results that showed a clear overexpression of CLTC protein in the transdif- ferentiated MCF-7 and MALME-3M cells, we decided to determine the role of CME in the adipogenic trans- differentiation process in MALME-3M and in MCF-7 cells. Transient CLTC silencing accomplished by siRNA, caused a significant reduction in LD accumulation induced by petroselinic acid, and further microscopic analysis of Oil Red O and hematoxylin stained cells sug- gested that not only LD accumulation but also neutral lipid composition in LDs was affected by CLTC silencing. So far no study has reported the induction of CLTC expression or CME stimulation by monounsaturated fatty acids, although polyunsaturated fatty acids have been found to play a role in the formation of synaptic vesicles and in promoting vesicle budding and mem- brane trafficking (Darios & Davletov 2006; Chernomor- dik et al. 1997; Chernomordik et al. 1999). It was recently reported that α-Synuclein expression, coupled with exposure to physiological levels of polyunsaturated fatty acids, enhanced CLTC mediated endocytosis in neuronal and non-neuronal cultured cells (Ben Gedalya et al. 2009). Transferrin receptor (TfR), whose gene expression was upregulated by a fold change of 3.33 in the albumin- associated lipid-treated MALME-3M cells (Table 1A), is internalized from the cell plasma membrane and recycled back to the cell plasma membrane specifically via CME (Hanover et al. 1984). El-Jack et al. reported that murine 3T3-L1 preadipocytes, in a differentiation media previ- ously described (Stephens et al. 1997), showed a gradual increase in whole cell TfR levels but a decrease in cell surface TfR levels (El-Jack et al. 1999). The results obtained in this study indicated that the differentiation process might account for the observed alterations in internalization and/or TfR recycling. These results may be useful in understanding why CME is of critical im- portance in HCCL to adipocyte transdifferentiation. The clarification of the roles played by the differen- tially expressed genes and proteins in the process of adi- pogenic transdifferentiation in HCCL cultures should provide the basic foundation to develop novel molecules for cancer therapy. Additional files Additional file 1: Supporting information A. Gene expression in the endocytic pathway and at the PPARG locus after treatment with albumin- associated lipids. (A) Downregulated and upregulated genes after treatment with albumin-associated lipids are colored in blue and red, respectively. Intensity is proportional to the log2 of the ratio between the two conditions. Significantly differentially expressed genes are indicated by bold box lines. Additional file 2: Supporting information B. Gene expression in the endocytic pathway and at the PPARG locus after treatment with albumin- associated lipids. (B) Mapped reads of gene expression at the PPARG locus are shown piled up on mapping positions. Expression at exons 4 and 5 in the PPARG1 transcript was observed only after albumin incubation. Additional file 3: Supporting information C. Electron Microscopy at high magnification of melanosome pigmentation in MALME-3M cells mock-treated or treated with Albumin-associated lipids. MALME-3M cells were mock-treated or treated with albumin-associated lipids for 24 hours. The arrows indicate the dark vesicles that are hallmarks of melanosomes and disappear upon albumin-associated lipid treatment. Competing interests Simon C and Aguilar-Gallardo C are co-inventors of the International Patent Application No. PCT/EP2011/004941 entitled “Methods for tumor treatment and adipogenesis differentiation”. Authors’ contributions C-T J and A-G C carried out the cell biology and molecular biology experiments, G-A F, P-C MA and C A participated in the deep sequencing experiments and S C and C-T J drafted the manuscript. All authors read and approved the final manuscript. Acknowledgements This work has been supported by the Regenerative Medicine Program of the CIPF and the Carlos III Institute of Health. Received: 14 August 2012 Accepted: 3 October 2012 Published: 30 October 2012 References Andersson ER (2012) The role of endocytosis in activating and regulating signal transduction. Cell Mol Life Sci 69(11):1755–1771 Ben Gedalya T, Loeb V, Israeli E, Altschuler Y, Selkoe DJ, Sharon R (2009) Alpha- synuclein and polyunsaturated fatty acids promote CLTC-mediated endocytosis and synaptic vesicle recycling. Traffic 10(2):218–234 Benjamini Y, Hochberg Y (1995) Controlling the false discovery rate: a practical and powerful approach to multiple testing. Journal of The Royal Statistical Society Series B 57:289–300 Brasaemle DL, Barber T, Wolins NE, Serrero G, Blanchette-Mackie EJ, Londos C (1997) Adipose differentiation-related protein is an ubiquitously expressed lipid storage droplet-associated protein. J Lipid Res 38(11):2249–2263 Chernomordik LV, Leikina E, Frolov V, Bronk P, Zimmerberg J (1997) An early stage of membrane fusion mediated by the low pH conformation of influenza hemagglutinin depends upon membrane lipids. J Cell Biol 136(1):81–93 Chernomordik LV, Leikina E, Kozlov MM, Frolov VA, Zimmerberg J (1999) Structural intermediates in influenza haemagglutinin-mediated fusion. Mol Membr Biol 16(1):33–42 Conner SD, Schmid SL (2003) Regulated portals of entry into the cell. Nature 422(6927):37–44 Darios F, Davletov B (2006) Omega-3 and omega-6 fatty acids stimulate cell membrane expansion by acting on syntaxin 3. Nature 440(7085):813–817 Davis BD, Dubos RJ (1947) The Binding of Fatty Acids by Serum Albumin, a Protective Growth Factor in Bacteriological Media. J Exp Med 86(3):215–228 De Maziere AM, Muehlethaler K, van Donselaar E, Salvi S, Davoust J, Cerottini JC et al (2002) The melanocytic protein Melan-A/MART-1 has a subcellular localization distinct from typical melanosomal proteins. Traffic 3(9):678–693 Carcel-Trullols et al. SpringerPlus 2012, 1:44 Page 11 of 12 http://www.springerplus.com/content/1/1/44 El-Jack AK, Kandror KV, Pilch PF (1999) The Formation of an Insulin-responsive Vesicular Cargo Compartment Is an Early Event in 3T3-L1 Adipocyte Differentiation. Mol Biol Cell 10(5):1581–1594 Finn RD, Mistry J, Tate J, Coggill P, Heger A, Pollington JE et al (2010) The Pfam protein families database. Nucleic Acids Res 38:211–222 Garcia-Gonzalo FR, Izpisua Belmonte JC (2008) Albumin associated lipids regulate human embryonic stem cell selfrenewal. PLoS One 3(1):e1384 Gillingham AK, Koumanov F, Pryor PR, Reaves BJ, Holman GD (1999) Association of AP1 adaptor complexes with GLUT4 vesicles. J Cell Sci 112(24):4793–4800 Graf T, Enver T (2009) Forcing cells to change lineages. Nature 462(7273):587–594 Greenspan P, Mayer EP, Fowler SD (1985) Nile red: a selective fluorescent stain for intracellular lipid droplets. J Cell Biol 100(3):965–973 Hanover JA, Willingham MC, Pastan I (1984) Kinetics of transit of transferrin and epidermal growth factor through clathrin-coated membranes. Cell 39(2):283–293 Heid HW, Moll R, Schwetlick I, Rackwitz HR, Keenan TW (1998) Perilipin 2 is a specific marker of lipid accumulation in diverse cell types and diseases. Cell Tissue Res 294(2):309–321 Hoashi T, Watabe H, Muller J, Yamaguchi Y, Vieira WD, Hearing VJ (2005) MART-1 is required for the function of the melanosomal matrix protein PMEL17/ GP100 and the maturation of melanosomes. J Biol Chem 280(14):14006–14016 Huang S, Lifshitz LM, Jones C, Bellve KD, Standley C, Fonseca S et al (2007) Insulin stimulates membrane fusion and GLUT4 accumulation in clathrin coats on adipocyte plasma membranes. Mol Cell Biol 27(9):3456–3469 Ieda M, Fu JD, Delgado-Olguin P, Vedantham V, Hayashi Y, Bruneau BG et al (2010) Direct reprogramming of fibroblasts into functional cardiomyocytes by defined factors. Cell 142(3):375–386 Inoue Y, Tanaka N, Tanaka Y, Inoue S, Morita K, Zhuang M et al (2007) CLTC- dependent entry of severe acute respiratory syndrome coronavirus into target cells expressing ACE2 with the cytoplasmic tail deleted. J Virol 81 (16):8722–8729 Kakizuka A, Miller WH Jr, Umesono K et al (1991) Chromosomal translocation t(15;17) in human acute promyelocytic leukemia fuses RAR alpha with a novel putative transcription factor, PML. Cell 66(4):663–74 Kallee E (1996) Bennhold’s analbuminemia: a follow-up study of the first two cases (1953–1992). J Lab Clin Med 127(5):470–480 Kersten S, Seydoux J, Peters JM, Gonzalez FJ, Desvergne B, Wahli WJ (1999) Peroxisome proliferator-activated receptor alpha mediates the adaptive response to fasting. J Clin Invest 103(11):1489–1498 Khan AA, Husain A, Jabeen M, Mustafa J, Owais M (2012) Synthesis and Characterization of Novel n-9 Fatty Acid Conjugates Possessing Antineoplastic Properties. Lipids. doi:10.1007/s1174501237079 Kim HJ, Jung TW, Kang ES, Kim DJ, Ahn CW, Lee KW et al (2007) Depot-specific regulation of perilipin by rosiglitazone in a diabetic animal model. Metabolism 56(5):676–685 Kutt H, Tsaltas TT (1959) Staining properties of oil red O and a method of partial purification of the commercial product. Clin Chem 5(2):149–160 Lafond J, Simoneau L, Savard R, Gagnon MC (1994) Linoleic acid transport by human placental syncytiotrophoblast membranes. Eur J Biochem 226(2):707–713 Levin JZ, Yassour M, Adiconis X, Nusbaum C, Thompson DA et al (2010) Comprehensive comparative analysis of strand-specific RNA sequencing methods. Nat Methods 7(9):709–715 Long G, Pan X, Kormelink R, Vlak JM (2006) Functional entry of baculovirus into insect and mammalian cells is dependent on CLTC-mediated endocytosis. J Virol 80(17):8830–8833 Maxfield FR, McGraw TE (2004) Endocytic recycling. Nat Rev Mol Cell Biol 5 (2):121–132 Mead JR, Irvine SA, Ramji DP (2002) Lipoprotein lipase: structure, function, regulation, and role in disease. Mol Med (Berl) 80(12):753–769 Mersmann HJ, Goodman JR, Brown LJ (1975) Development of swine adipose tissue: morphology and chemical composition. J Lipid Res 16(4):269–279 Parkhomchuk D, Borodina T, Amstislavskiy V, Banaru M, Hallen L, Krobitsch S et al (2009) Transcriptome analysis by strand-specific sequencing of complementary DNA. Nucleic Acids Res 37(18):e123 Pearse BM, Smith CJ, Owen DJ (2000) CLTC coat construction in endocytosis. Curr Opin Struct Biol 10(2):220–228 Raposo G, Marks MS (2007) Melanosomes – dark organelles enlighten endosomal membrane transport. Nat Rev Mol Cell Biol 8(10):786–797 Rauch C, Brunet AC, Deleule J, Farge E (2002) C2C12 myoblast/osteoblast transdifferentiation steps enhanced by epigenetic inhibition of BMP2 endocytosis. Am J Physiol Cell Physiol 283(1):235–243 Ruiz-Vela A, Aguilar-Gallardo C, Simon C (2009) Building a framework for embryonic microenvironments and cancer stem cells. Stem Cell Reviews and Reports 5(4):319–27 Ruiz-Vela A, Aguilar-Gallardo C, Martínez-Arroyo AM, Soriano-Navarro M, Ruiz V et al (2011) Specific Unsaturated Fatty Acids Enforce the Transdifferentiation of Human Cancer Cells toward Adipocyte-like Cells. Stem Cell Reviews and Reports 7(4):898–909 Schopfer FJ, Lin Y, Baker PR, Cui T, Garcia-Barrio M, Zhang J et al (2005) Nitrolinoleic acid: an endogenous peroxisome proliferator-activated receptor gamma ligand. Proc Natl Acad Sci U S A 102(7):2340–2345 Stephens JM, Lee J, Pilch PF (1997) Tumor necrosis factor α-induced insulin resistance in 3T3–L1 adipocytes is accompanied by a loss of insulin receptor substrate-1 and GLUT4 expression without a loss of insulin receptor- mediated signal transduction. J Biol Chem 272(2):971–976 Sullivan AL, Grasso JA, Weintraub LR (1976) Micropinocytosis of transferrin by developing red cells: an electron-microscopic study utilizing ferritin- conjugated transferrin and ferritin-conjugated antibodies to transferrin. Blood 47(1):133–143 Takeuchi JK, Bruneau BG (2009) Directed transdifferentiation of mouse mesoderm to heart tissue by defined factors. Nature 459(7247):708–711 Tarazona S, Garcia-Alcalde F, Ferrer A, Dopazo J, Conesa A (2011) Differential expression in RNA-seq: a matter of depth. Genome Res 21(12):2213–2223 Thomas ME, Morrison AR, Schreiner GF (1995) Metabolic effects of fatty acid- bearing albumin on a proximal tubule cell line. Am J Physiol 268(6):1177–1184 Todaro GJ, Green H (1963) Quantitative studies of the growth of mouse embryo cells in culture and their development into established lines. J Cell Biol 17:299–313 Trapnell C, Pachter L, Salzberg SL (2009) TopHat: discovering splice junctions with RNA-Seq. Bioinformatics 25(9):1105–11 Young MD, Wakefield MJ, Smyth GK, Oshlack A (2010) Gene ontology analysis for RNA-seq: accounting for selection bias. Genome Biol 11(2):R14 Yu J, Li Y, Li M, Qu Z, Ruan Q (2010) Oxidized low density lipoprotein-induced transdifferentiation of bone marrow-derived smooth muscle-like cells into foam-like cells in vitro. Int J Exp Pathol 91(1):24–33 Zhou Q, Brown J, Kanarek A, Rajagopal J, Melton DA (2008) In vivo reprogramming of adult pancreatic exocrine cells to beta-cells. Nature 455 (7213):627–632 doi:10.1186/2193-1801-1-44 Cite this article as: Carcel-Trullols et al.: Transdifferentiation of MALME- 3M and MCF-7 Cells toward Adipocyte-like Cells is Dependent on Clathrin-mediated Endocytosis. SpringerPlus 2012 1:44. Submit your manuscript to a journal and benefi t from: 7 Convenient online submission 7 Rigorous peer review 7 Immediate publication on acceptance 7 Open access: articles freely available online 7 High visibility within the fi eld 7 Retaining the copyright to your article Submit your next manuscript at 7 springeropen.com Carcel-Trullols et al. SpringerPlus 2012, 1:44 Page 12 of 12 http://www.springerplus.com/content/1/1/44

Title: Transdifferentiation of MALME-3M and MCF-7 Cells toward Adipocyte-like Cells is Dependent on Clathrin-mediated Endocytosis ​ Authors: Jaime Carcel-Trullols†, Cristóbal Aguilar-Gallardo†, Fernando Garcia-Alcalde, Miguel Angel Pardo-Cea, Joaquin Dopazo, Ana Conesa, Carlos Simón* ​ Publisher: SpringerPlus Date: October 30, 2012 ​ Abstract: Enforced cell transdifferentiation of human cancer cells is a promising alternative to conventional chemotherapy. ​ We previously identified albumin-associated lipid-and, more specifically, saturated fatty acid-induced transdifferentiation programs in human cancer cells (HCCLs). ​ In this study, we further characterized the adipocyte-like cells, resulting from the transdifferentiation of human cancer cell lines MCF-7 and MALME-3M, and proposed a common mechanistic approach for these transdifferentiating programs. ​ We showed the loss of pigmentation in MALME-3M cells treated with albumin-associated lipids, based on electron microscopic analysis, and the overexpression of perilipin 2 (PLIN2) by western blotting in MALME-3M and MCF-7 cells treated with unsaturated fatty acids. ​ Comparing the gene expression profiles of naive melanoma MALME-3M cells and albumin-associated lipid-treated cells, based on RNA sequencing, we confirmed the transcriptional upregulation of some key adipogenic gene markers and also an alternative splicing of the adipogenic master regulator PPARG, that is probably related to the reported up regulated expression of the protein. ​ Most importantly, these results also showed the upregulation of genes responsible for Clathrin (CLTC) and other adaptor-related proteins. ​ An increase in CLTC expression in the transdifferentiated cells was confirmed by western blotting. ​ Inactivation of CLTC by chlorpromazine (CHP), an inhibitor of CTLC mediated endocytosis (CME), and gene silencing by siRNAs, partially reversed the accumulation of neutral lipids observed in the transdifferentiated cells. ​ These findings give a deeper insight into the phenotypic changes observed in HCCL to adipocyte-like transdifferentiation and point towards CME as a key pathway in distinct transdifferentiation programs. ​



Production of the Bacillus licheniformis SubC protease using Lactococcus lactis NICE expression system.pdf

RESEARCH Open Access Production of the Bacillus licheniformis SubC protease using Lactococcus lactis NICE expression system Aleksandra M Mirończuk1,2, Anna Krasowska2, Anna Murzyn2, Małgorzata Płachetka2 and Marcin Łukaszewicz1,2,3* Abstract In this work the subC gene from Bacillus licheniformis encoding subtilisin was cloned into the nisin-controlled expression (NICE) vectors (pNZ8048 and pNZ8148) with or without the signal peptide SP Usp45 directing extracellular secretion via Sec machinery. Extracellular protease production and activity was tested using Lactococcus lactis NZ9000 as host, which could be used for rennet production. The efficiency of protein production was tested using purified nisin and the supernatant of L. lactis NZ970 nisin producer. Similar results were obtained for 1 ng/ml nisin and 10 000 diluted supernatant. SP Usp45 signal peptide effectively directed extracellular localization of active and stable protease. SubC signal for extracellular localization in B. licheniformis, was also recognized by L. lactis Sec pathway, although with lower efficiency, as shown by a 3-fold lower protease activity in the medium. Protease production and activity was optimized using parameters such as induction time, nutrients (glucose, casitone) supplementation during growth or protease stabilization by calcium ions. The results were also verified in fed-batch bioreactor for further scale-up of the expression system. Keywords: Lactic acid bacteria, Lactococcus lactis, Nisin-controlled expression system, NICE, Bacillus licheniformis, SubC protease Introduction Lactococcus lactis is a Gram-positive, lactic acid bacte- rium that is commonly used in traditional food indus- tries such as in cheese and butter production. In addition, it is increasingly used in modern biotechno- logical applications. Many recent studies have investi- gated the physiology and genetic of this bacterium, therefore a wide variety of genetic tools have been deve- loped. Nowadays several genomes of L. lactis strains are completely sequenced (Bolotin et al. 2001; Siezen et al. 2010; Wegmann et al. 2007). Genetic accessibility and the ease of working with this organism have led to exten- sive study on heterologous protein expression in L. lactis. Since L. lactis is generally recognized as safe (GRAS) it could be used for large-scale production of heterologous proteins (Mierau et al. 2005a; Morello et al. 2008). Most of the laboratory scale examples consist of intracellular ex- pression (Blatny et al. 2003; Kunji et al. 2003) or cell wall bound enzymes (Cibik et al. 2001; Miyoshi et al. 2002; Nouaille et al. 2003). Much less in known about extracel- lular production of the proteins in L. lactis, moreover the protein yield might differ significantly and are strongly case-dependent (Mierau & Kleerebezem 2005). In 1995 Kuipers et al. (1995) published a study on the autoinduction of the expression of nisin in lactococci. This study allowed for the construction of a food grade expression system based on the regulation mechanism of the nisinA operon of L. lactis (Platteeuw et al. 1996), named NICE (nisin-controled gene expression). In this operon the gene product, a small 34 amino acid bac- teriocin, induces its own transcription at very low con- centrations (0.5 – 5 ng/mL) (Kuipers et al. 1998). In this system, nisin induces the regulatory cascade starting with binding to the membrane-bound receptor NisK. Next, the phosphate group from the activated NisK is * Correspondence: [email protected] 1Department of Biotechnology and Food Microbiology, Wrocław University of Environmental and Life Sciences, Chełmońskiego 37/41, Wrocław 51-630, Poland 2Department of Biotransformation, Faculty of Biotechnology, University of Wroclaw, Przybyszewskiego 63-77, Wroclaw 51-148, Poland Full list of author information is available at the end of the article a SpringerOpen Journal © 2012 Mironczuk et al.; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Mirończuk et al. SpringerPlus 2012, 1:54 http://www.springerplus.com/content/1/1/54 transferred to the intracellular response regulator NisR, activating this regulator. Subsequently, NisR, induces the nisin operon at the promoter nisA (Kleerebezem & Quadri 2001). The NisA promoter controls the expres- sion of the genes involved in the nisin biosynthesis (or the gene of interest). Genes of this regulatory system have been inserted in a suitable host strain L. lactis NZ900. The nisin-producing strain L. lactis NZ9700 secretes the nisin into the medium (Kuipers et al. 1995). It was shown that the NICE system can be developed to “food-grade” production of heterologous protein, by replacing the antibiotic resistant gene by another select- able marker (Olempska-Beer et al. 2006), for example lacF, which has been deleted from the host strain, and is essential for growth on lactose (Mierau et al. 2005b). Although for large-scale production nisin usage remains costly, a good alternative is the addition of NZ9700 supernatant. The NICE system is often used in the laboratories for research, while the data on large-scale application of the NICE system for secreted proteins is still very limited. Up to now, only a few reports present usage of this system in industry (Mierau et al. 2005a; Mierau et al. 2005b; Berlec & Strukelj 2009), moreover, efficient systems for the industrial scale production of secrete heterologous proteins have never been described. In this study, we describe the production of secrete heterologous protein SubC in L. lactis using the NICE expression system. SubC is the industrially important Carlsberg-type subtilisin (Jacobs 1995) produced by Bacillus licheniformis. Bacterial subtilisins are multipur- pose alkaline proteases that are frequently used in indus- try (Gupta et al. 2002): common variants include subtilisin from B. amyloliquefaciens, highly alkalophilic B. lentus or from B. licheniformis (Rao et al. 1998; von der Osten et al. 1993). Furthermore, Flavobacterium also produces subtilisin (Morita et al. 1998). Interestingly, al- most two-third of commercial proteases produced in the world originate from microorganisms (Kumar & Takagi 1999; Tremacoldi et al. 2004). Microbial proteases are classified into different groups, according to their activ- ity in acid, neutral or alkaline conditions, and on the characteristics of the active site group of the enzyme (Saeki et al. 2007). Subtilisin-like serine proteases are usually secreted extracellulary for searching nutrients (Aehle et al. 2009). One of the features of this class of proteases (subtilases) is an aromatic or hydrophobic residue, such as leucine, tyrosine or phenylalanine. The highest proteolytic activity is around pH 10, with a molecular weight range of 15–40 kDa and an isoelectric point around pI 9. Moreover, the native form of SubC remains fully stable up to 60°C (Hirata et al. 2003) and it possesses two calcium binding site(s), therefore bound Ca2+ contributes to enzyme stability (Briedigkeit & Frömmel 1989). Our main objective in this study was an improvement of the expression condition for secreted heterologous protein production and the comparison of the gene expression efficiencies using two different NICE expres- sion plasmids. We compared two different NICE vectors and the ability of L. lactis for secretion of heterologous protein. The activity of protease production was tested on milk plates. Subsequently the proteolytic activity assays were performed to investigate the functionality of the secreted protease in the medium. In addition, we present modification of the NICE system, by changing the growth conditions, the induction point, and by extending the logarithmic phase growth of bacteria by supplying further nutrients. Methods Strains and growth conditions The strains and plasmids used in this study are listed in Table 1. Lactococcus lactis strains were grown in M17 broth (Terzaghi & Sandine 1975) supplemented with 0.5% glucose (GM17). Additionally, for strains carrying plas- mid, medium was supplemented with chloramphenicol (5 μg mL-1). Cultures were incubated at 30°C. If required, medium was supplemented with 10% milk or different concentrations of CaCl2, MnCl2, MgCl2 and MgSO4. Additionally, samples were supplemented with 5 μg mL-1 chloramphenicol, if required. Bacterial growth was determined by measuring the optical density (OD) at 600 nm. The cultures were inoculated at optical dens- ity 0.1 or at a different point if mentioned. At the begin- ning of the incubation or when the bacterial growth reached the required cell density, the cultures were stimulated to produce protease by the addition of nisin (Sigma) or by the dilutions of the culture supernatant of the nisin producing strain L. lactis NZ9700 (the range of concentrations or dilutions indicated in Results). The Table 1 Strains used in this study Strain/plasmid Relevant characteristics Reference ATCC 10716 B. licheniformis Laboratory stock NZ9000 L. lactis MG1363 pepN::nisRK (Kuipers et al. 1998) NZ9700 L. lactis Nisin producer (Kuipers et al. 1995) pNZ8048 CmR, inducible expression vector containing the nisA promoter (Kuipers et al. 1998) pNZ8148 PnisA, CmR; replicon of rolling circle plasmid pSH71, basic NICE vector, derivative of pNZ8048 NIZO pNZ45 pNZ8048 carrying SP Usp45 under nisA promoter This study pNZ45subC pNZ45 carrying subC gene This study pNZ48subC pNZ8148 carrying subC gene This study Mirończuk et al. SpringerPlus 2012, 1:54 Page 2 of 10 http://www.springerplus.com/content/1/1/54 proteins production is lactic acid bacteria (LAB) such as Lactococcus lactis (Hugenholtz 2008). They are widely used in industrial fermentations, so much information is available about nutrient requirements, growth conditions etc. Moreover, for L. lactis the genome sequence has been published (Wegmann et al. 2007) and many genetic tools have been developed for LAB, which simplifies the usage of these microorganisms as a cell factory. Add- itionally they do not require aeration and only very limited mixing that significantly reduces production and reactor costs. One of the most popular expression systems in L. lactis is the NICE system (Mierau & Kleerebezem 2005; Kuipers et al. 1995). In this study, we present the modification of the NICE system for heterologous secretion protease production in L. lactis, with possible usage at industrial scale. We used two different NICE vectors; we compared different ranges of nisinA concentration for induction and nu- trient requirements. For that purpose, the subC gene encoding B. licheniformis extracellular alkaline protease was cloned downstream of the strong inducible pro- moter nisA and ranges of diluted supernatant of NZ9700 L. lactis (nisin producer) were used for the induction of secreted enzyme production. In this study, we optimized the growth and NICE- related parameters. Strikingly, laboratory strains of L. lactis possess only 24h 0 50 100 150 200 250 300 350 400 450 proteolytic activity % 2h 3h 4h Figure 5 The proteolytic activity of L. lactis carrying pNZ45subC. The cultures were grown in GM17 medium supplemented with 0.5 mM CaCl2 and 5 μg mL-1 of chloramphenicol. The cultures were induced at OD600 0.7. The samples were taken as indicated on the picture: 2, 3, 4 and 24 hours after induction with 10 000 NZ9700 supernatant. Pale gray bars- strain without induction (values below 1). Black bars- control strain without additional nutrients. Dark gray bars- the strain supplemented with an additional nutrients in two hours after induction. All data are mean values of three independent experiments; error bars indicate standard deviation. 0 20 40 60 80 100 120 140 160 0.0E+00 1.0E+09 2.0E+09 3.0E+09 4.0E+09 5.0E+09 6.0E+09 7.0E+09 8.0E+09 0h 2h 4h 6h 24h 48h Activity U/l Cell number Cell number Activity Figure 6 The proteolytic activity of L. lactis carrying pNZ45subC in 5 L bioreactor (working volume 1.5 L). The culture was grown in GM17 medium supplemented with 10% milk and 5 μg mL-1 of chloramphenicol. The culture was induced at OD600 0.2. The samples were taken as indicated on the picture. Mirończuk et al. SpringerPlus 2012, 1:54 Page 8 of 10 http://www.springerplus.com/content/1/1/54 one exported housekeeping protease, HtrA involved in protein quality control at the cell surface. Moreover, HtrA is responsible for clearing anomalous proteins from the surface, and is induced under several stress conditions (Morello et al. 2008). The expression of heterologous protease might be lethal for L. lactis, however it was recently shown that the use of SP Usp45 also allows the secretion of bacte- riocins which are toxic for cells (Borrero et al. 2009). Therefore to avoid toxicity we added signal peptide of Usp45 to secrete SubC via Sec transporters. Indeed higher protease expression and accumulation within the cell resulted in growth inhibition (data not shown). Here we observed that the addition of lactococcal SP usp45 to the native signal peptide of SubC leads to better secretion, and more importantly, secreted protein remains stable, since both signal peptides are properly cleaved during protein translocation to the medium. Interestingly, a con- struct with two signal peptides results in higher accumu- lation of the protease in extracellular medium. Subsequently, we investigated the media preferences for optimal protein production. The previously described medium (Mierau et al. 2005a) did not increase the pro- tein level. In contrast, medium supplementation with calcium chloride resulted in superior activity of protease in the extracellular environment. Interestingly, we have also noticed that supplementing GM17 medium with other two positive ions, results in elevated proteolytic activity of SubC producer, nonetheless the highest acti- vity was observed in samples supplemented with 0.5 mM CaCl2. After establishing the medium preferences for SubC production, we tested various induction time points. Hitherto, the strains carrying overexpression constructs were induced at the midlog growth phase or at high OD (Mierau et al. 2005a; Maischberger et al. 2010) although we have not confirmed the reports show- ing the results of induction at start point. To this end, the overnight cultures of L. lactis carrying pNZ45subC or pNZ48subC were inoculated into fresh medium, sup- plemented as aforementioned, and induced at OD600 0.1 and 0.6 and with various ranges of NZ9700 super- natant. The samples were tested for proteolytic activity 24 hours after induction. We did not observe significant differences in the proteolytic activity between all sam- ples, which might suggest that the level of functional SubC protease was the same in all cultures. In contrast to other reports (Berlec et al. 2008), we did not observe a correlation between increasing OD and protein pro- duction. One of the most interesting parts of this phenomenon is the problem of the stability/activity of SubC in the extracellular environment. Strikingly, the SDS-PAGE data showed that the level of protein pro- duction in various cultures was unchanged; however the proteolytic activity was different. This could result from various proportions of mature versus immature protease as seen from SubC amino acid sequence determination. Noticeably, the overproduction of protein might also cause stress responses and consequently degradation of the target protein in the cells (Thumm & Gotz 1997). We compared different nisinA concentrations for L. lactis induction. The studied nisin concentration range was from 0.1 to 10.0 ng mL-1 and the highest pro- teolytic activity was obtained when 1 ng mL-1 of nisinA or 10 000 – 20 000 diluted supernatant of L. lactis NZ9700 was used. In comparison, nisin concentration in published data varies from 0.5 to 40 ng mL-1 (Mierau et al. 2005b). Thus induction during inoculation of the bioreactor enables reduction of the inducer amount and simplifies the production process. One of the most inter- esting issues of this study was an extension of the loga- rithmic phase growth of L. lactis, since during this phase the highest activity was observed. Initial experiments showed that L. lactis utilizes most of the 0.5% glucose present in GM17 medium. Conse- quently, the next step was to supply more nitrogen and carbon sources. The cultures were induced at OD600 0.6, the additional nutrients were added in two hours after induction. Interestingly, we observed increased proteo- lytic activity already 2 hours after supplementing with nutrients. The differences between the target strain and the control were between 30-40%, the highest differences were observed in 6 hours after induction, and remained stable up to 24th hour after inductions. In summary, we optimized the NICE expression sys- tem for heterologous secretion protease production. The use of a GRAS expression host for secreted enzyme pro- duction will make it possible to use these proteins much more easily and economically, than in the case of intra- cellular production. The described expression system might be used for industrial production of rennet or direct application of such strain in dairy. Competing interests The authors declare that they have no competing interests. Authors’ contributions AMM carried out the molecular genetic studies, performed the experiments, analyzed the data, wrote the manuscript. AK analyzed the data, drafted the manuscript. AM performed the experiments, analyzed the data, drafted the manuscript. MP performed the experiments, analyzed the data, participated in the sequence alignment, drafted the manuscript. MŁ Contributed reagents/materials/analysis tools, analyzed the data, wrote the manuscript. All authors read and approved the final manuscript. Acknowledgements We thank Oscar P. Kuipers for the gift of L. lactis vectors pNZ8048 and L. lactis NZ9700, and Katarzyna Bednarz for technical support. This work was supported by grant KB/48/13639/IT1-B/U/08 from the Polish National Centre for Research and Development and EU POIG.01.01.02-00- 016/2008. Mirończuk et al. SpringerPlus 2012, 1:54 Page 9 of 10 http://www.springerplus.com/content/1/1/54 Author details 1Department of Biotechnology and Food Microbiology, Wrocław University of Environmental and Life Sciences, Chełmońskiego 37/41, Wrocław 51-630, Poland. 2Department of Biotransformation, Faculty of Biotechnology, University of Wroclaw, Przybyszewskiego 63-77, Wroclaw 51-148, Poland. 3Faculty of Chemistry, Wrocław University of Technology, Gdańska 7/9, Wrocław 50-344, Poland. Received: 4 September 2012 Accepted: 8 November 2012 Published: 29 November 2012 References Aehle W, Bott R, Graycar T, Flickinger MC (2009) Proteolytic Cleavage, Reaction Mechanisms. Encyclopedia of Industrial Biotechnology, John Wiley & Sons, Inc Berlec A, Strukelj B (2009) Large increase in brazzein expression achieved by changing the plasmid /strain combination of the NICE system in Lactococcus lactis. Lett Appl Microbiol 48:750–755 Berlec A, Tompa G, Slapar N, Fonovic UP, Rogelj I, Strukelj B (2008) Optimization of fermentation conditions for the expression of sweet-tasting protein brazzein in Lactococcus lactis. Lett Appl Microbiol 46:227–231 Blatny JM, Ertesvag H, Nes IF, Valla S (2003) Heterologous gene expression in Lactococcus lactis; expression of the Azotobacter vinelandii algE6 gene product displaying mannuronan C-5 epimerase activity. FEMS Microbiol Lett 227:229–235 Bolotin A, Wincker P, Mauger S, Jaillon O, Malarme K, Weissenbach J, Ehrlich SD, Sorokin A (2001) The complete genome sequence of the lactic acid bacterium Lactococcus lactis ssp. lactis IL1403. Genome Res 11:731–753 Borrero J, Jimenez JJ, Gutiez L, Herranz C, Cintas LM, Hernandez PE (2999) Use of the usp45 lactococcal secretion signal sequence to drive the secretion and functional expression of enterococcal bacteriocins in Lactococcus lactis. Appl Microbiol Biotechnol 89:131–143 Briedigkeit L, Frömmel C (1989) Calcium ion binding by thermitase. FEBS Lett 253:83–87 Cibik R, Tailliez P, Langella P, Chapot-Chartier MP (2001) Identification of Mur, an atypical peptidoglycan hydrolase derived from Leuconostoc citreum. Appl Environ Microbiol 67:858–864 Gupta R, Beg QK, Lorenz P (2002) Bacterial alkaline proteases: molecular approaches and industrial applications. Appl Microbiol Biotechnol 59:15–32 Hirata J, Ariese F, Gooijer C, Irth H (2003) Continuous-flow protease assay based on fluorescence resonance energy transfer. Anal Chim Acta 478:1–10 Hugenholtz J (2008) The lactic acid bacterium as a cell factory for food ingredient production. Int Dairy J 18:466–475 Jacobs MF (1995) Expression of the subtilisin Carlsberg-encoding gene in Bacillus licheniformis and Bacillus subtilis. Gene 152:69–74 Kleerebezem M, Quadri LE (2001) Peptide pheromone-dependent regulation of antimicrobial peptide production in Gram-positive bacteria: a case of multicellular behavior. Peptides 22:1579–1596 Kuipers OP, Beerthuyzen MM, de Ruyter PG, Luesink EJ, de Vos WM (1995) Autoregulation of nisin biosynthesis in Lactococcus lactis by signal transduction. J Biol Chem 270:27299–27304 Kuipers OP, de Ruyter PGGA, Kleerebezem M, de Vos WM (1998) Quorum sensing-controlled gene expression in lactic acid bacteria. J Biotechnol 64:15–21 Kumar CG, Takagi H (1999) Microbial alkaline proteases: from a bioindustrial viewpoint. Biotechnol Adv 17:561–594 Kunji ER, Slotboom DJ, Poolman B (2003) Lactococcus lactis as host for overproduction of functional membrane proteins. Biochim Biophys Acta 1610:97–108 Leenhouts KJ, Venema G (1993) Plasmids, a practical approach. Oxford University Press, Oxford, United Kingdom Maischberger T, Mierau I, Peterbauer CK, Hugenholtz J, Haltrich D (2010) High-level expression of Lactobacillus beta-galactosidases in Lactococcus lactis using the food-grade, nisin-controlled expression system NICE. J Agric Food Chem 58:2279–2287 Mierau I, Kleerebezem M (2005) 10 years of the nisin-controlled gene expression system (NICE) in Lactococcus lactis. Appl Microbiol Biotechnol 68:705–717 Mierau I, Olieman K, Mond J, Smid EJ (2005a) Optimization of the Lactococcus lactis nisin-controlled gene expression system NICE for industrial applications. Microb Cell Fact 4:16 Mierau I, Leij P, van Swam I, Blommestein B, Floris E, Mond J, Smid EJ (2005b) Industrial-scale production and purification of a heterologous protein in Lactococcus lactis using the nisin-controlled gene expression system NICE: the case of lysostaphin. Microb Cell Fact 4:15 Miyoshi A, Poquet I, Azevedo V, Commissaire J, Bermudez-Humaran L, Domakova E, Le Loir Y, Oliveira SC, Gruss A, Langella P (2002) Controlled production of stable heterologous proteins in Lactococcus lactis. Appl Environ Microbiol 68:3141–3146 Morello E, Bermudez-Humaran LG, Llull D, Sole V, Miraglio N, Langella P, Poquet I (2008) Lactococcus lactis, an efficient cell factory for recombinant protein production and secretion. J Mol Microbiol Biotechnol 14:48–58 Morita Y, Hasan Q, Sakaguchi T, Murakami Y, Yokoyama K, Tamiya E (1998) Properties of a cold-active protease from psychrotrophic Flavobacterium balustinum P104. Appl Microbiol Biotechnol 50:669–675 Nouaille S, Ribeiro LA, Miyoshi A, Pontes D, Le Loir Y, Oliveira SC, Langella P, Azevedo V (2003) Heterologous protein production and delivery systems for Lactococcus lactis. Genet Mol Res 2:102–111 Olempska-Beer ZS, Merker RI, Ditto MD, DiNovi MJ (2006) Food-processing enzymes from recombinant microorganisms–a review. Regul Toxicol Pharmacol 45:144–158 Pedersen PB, Bjornvad ME, Rasmussen MD, Petersen JN (2002) Cytotoxic potential of industrial strains of Bacillus sp. Regul Toxicol Pharmacol 36:155–161 Platteeuw C, van Alen-Boerrigter I, van Schalkwijk S, de Vos WM (1996) Food-grade cloning and expression system for Lactococcus lactis. Appl Environ Microbiol 62:1008–1013 Rao MB, Tanksale AM, Ghatge MS, Deshpande VV (1998) Molecular and biotechnological aspects of microbial proteases. Microbiol Mol Biol Rev 62:597–635 Saeki K, Ozaki K, Kobayashi T, Ito S (2007) Detergent alkaline proteases: enzymatic properties, genes, and crystal structures. J Biosci Bioeng 103:501–508 Salkinoja-Salonen MS, Vuorio R, Andersson MA, Kampfer P, Andersson MC, Honkanen-Buzalski T, Scoging AC (1999) Toxigenic strains of Bacillus licheniformis related to food poisoning. Appl Environ Microbiol 65:4637–4645 Siezen RJ, Bayjanov J, Renckens B, Wels M, Van Hijum SA, Molenaar D, Van Hylckama Vlieg JE (2010) Complete genome sequence of Lactococcus lactis subsp. lactis KF147, a plant-associated lactic acid bacterium. J Bacteriol 192:2649–2650 Terzaghi BE, Sandine WE (1975) Improved medium for lactic streptococci and their bacteriophages. Appl Microbiol 29:807–813 Thumm G, Gotz F (1997) Studies on prolysostaphin processing and characterization of the lysostaphin immunity factor (Lif) of Staphylococcus simulans biovar staphylolyticus. Mol Microbiol 23:1251–1265 Tremacoldi CR, Watanabe NK, Carmona EC (2004) Production of Extracellular Acid Proteases by Aspergillus Clavatus. World J Microbiol Biotechnol 20:639–642 van Asseldonk M, de Vos WM, Simons G (1993) Functional analysis of the Lactococcus lactis usp45 secretion signal in the secretion of a homologous proteinase and a heterologous alpha-amylase. Mol Gen Genet 240:428–434 von der Osten C, Branner S, Hastrup S, Hedegaard L, Rasmussen MD, Bisgard-Frantzen H, Carlsen S, Mikkelsen JM (1993) Protein engineering of subtilisins to improve stability in detergent formulations. J Biotechnol 28:55–68 Wegmann U, O’Connell-Motherway M, Zomer A, Buist G, Shearman C, Canchaya C, Ventura M, Goesmann A, Gasson MJ, Kuipers OP, van Sinderen D, Kok J (2007) Complete genome sequence of the prototype lactic acid bacterium Lactococcus lactis subsp. cremoris MG1363. J Bacteriol 189:3256–3270 doi:10.1186/2193-1801-1-54 Cite this article as: Mirończuk et al.: Production of the Bacillus licheniformis SubC protease using Lactococcus lactis NICE expression system. SpringerPlus 2012 1:54. Mirończuk et al. SpringerPlus 2012, 1:54 Page 10 of 10 http://www.springerplus.com/content/1/1/54

Title: Production of the Bacillus licheniformis SubC protease using Lactococcus lactis NICE expression system ​ Authors: Aleksandra M. Mirończuk, Anna Krasowska, Anna Murzyn, Małgorzata Płachetka, Marcin Łukaszewicz ​ Publisher: SpringerPlus Date: November 29, 2012 ​ Abstract: In this work, the subC gene from Bacillus licheniformis encoding subtilisin was cloned into the nisin-controlled expression (NICE) vectors (pNZ8048 and pNZ8148) with or without the signal peptide SP Usp45 directing extracellular secretion via Sec machinery. ​ Extracellular protease production and activity were tested using Lactococcus lactis NZ9000 as host, which could be used for rennet production. ​ The efficiency of protein production was tested using purified nisin and the supernatant of L. lactis NZ970 nisin producer. ​ Similar results were obtained for 1 ng/ml nisin and 10,000 diluted supernatant. ​ SP Usp45 signal peptide effectively directed extracellular localization of active and stable protease. ​ SubC signal for extracellular localization in B. licheniformis was also recognized by L. lactis Sec pathway, although with lower efficiency, as shown by a 3-fold lower protease activity in the medium. ​ Protease production and activity were optimized using parameters such as induction time, nutrients (glucose, casitone) supplementation during growth, or protease stabilization by calcium ions. ​ The results were also verified in a fed-batch bioreactor for further scale-up of the expression system. ​ Keywords: Lactic acid bacteria, Lactococcus lactis, Nisin-controlled expression system, NICE, Bacillus licheniformis, SubC protease ​

Cow dung: a potential biomass substrate for the production of detergent-stable dehairing protease by alkaliphilic Bacillus subtilis strain VV.pdf

RESEARCH Open Access Cow dung: a potential biomass substrate for the production of detergent-stable dehairing protease by alkaliphilic Bacillus subtilis strain VV Ponnuswamy Vijayaraghavan1*, Aija Vijayan2, Arumugaperumal Arun3, John Kennady Jenisha3 and Samuel Gnana Prakash Vincent1 Abstract Cow dung, a cheap and easily available source of energy, was used as the substrate for the production of alkaline protease by solid-state fermentation using the Bacillus subtilis strain VV. In order to achieve the maximum yield of this enzyme, the following optimum process parameters are needed: fermentation period (72 h), pH (10.0), moisture content (140%), inoculum (25%), temperature (30–40°C), carbon source (2% (w/w) maltose) and nitrogen source (1% (w/w) urea). The protease was stable over a broad temperature range (30–50°C) and pH (8.0-10.0), with maximum activity at 50°C and pH 10.0. Among the divalent ions tested, Ca2+ (0.01 M) increased enzyme activity. The purified protease, after being subjected to sodium dodecyl sulphate-polyacrylamide gel electrophoresis, was found to have a molecular mass of 38.5 kDa. The enzyme was solvent-and surfactant-stable and showed activity even after 24 h incubation along with various commercially available detergents. This enzyme possessed dehairing properties for animal hide after 16 h of incubation at room temperature. From these results it is evident that cow dung is a potential substrate for the production of a detergent-stable, dehairing protease by B. subtilis. This enzyme has a lot of potential applications in the detergent and leather-processing industries. Keywords: Cow dung, Solid-state fermentation, Bacillus subtilis strain VV, Alkaline protease, Detergent-stable Background Proteases constitute one of the commercially important groups of extra-cellular microbial enzymes and are widely used in the detergent, food, pharmaceutical, chemical and leather industries (Scheuer 1990). These enzymes account for 40% of the total enzyme sales worldwide and this trend is expected to increase in the near future. This has led to increasing attention towards the exploitation of potent microbial strains for the production of alkaline proteases from an industrial point of view (Ellaiah et al. 2002). Although a wide range of microorganisms are known to produce proteases, a large proportion of the commercially available form of these enzymes is derived from Bacillus strains because of their ability to secrete large amounts of alkaline proteases having significant proteolytic activity and stability at considerably higher pH and temperatures (Jacobs 1995; Yang et al. 2000). The leather processing industry contributes significantly to the country’s economic development. Waste from the leather industry leads to environmental pollution. Alkaline proteases have dehairing properties and can be used in the leather processing industry. Conventional methods in leather processing involve the use of hydrogen sulphide and other chemicals which are pollutants. Thus, for envir- onmental reasons, the enzymatic dehairing process has more advantages over the chemical dehairing process (Andersen 1998). Proteases are used during the soaking, dehairing and bating states of preparing skins and hides. Pancreatic proteases are used in the bating process and the use of microbial alkaline proteases are popular (Varela et al. 1997). Alkaline proteases swell hair roots and attack hair follicle proteins, resulting in the easy removal of hair. These enzymes have been widely studied and their production from Bacillus sp. has gained momentum; * Correspondence: [email protected] 1International Centre for Nanobiotechnology, Centre for Marine Science and Technology, Manonmaniam Sundaranar University, Rajakkamangalam–629 502, Kanyakumari DistrictTamil Nadu, India Full list of author information is available at the end of the article a SpringerOpen Journal © 2012 Vijayaraghavan et al.; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Vijayaraghavan et al. SpringerPlus 2012, 1:76 http://www.springerplus.com/content/1/1/76 moreover, the high activity and stability of these enzymes at various temperature and pH ranges have also attracted the attention of researchers. Dehairing proteases have been characterized from various Bacillus sp., e.g. B. subtilis 11QDB32 (Varela et al. 1997), B. amyloliquefaciens (George et al. 1995), B. subtilis K2 (Hameed et al. 1996; Hameed et al. 1999) and B. circulans (Subba Rao et al. 2009). Proteases are generally produced using submerged fer- mentation not only due to its apparent advantages in con- sistent enzyme production but also for its cost- for medium components. From an industrial point of view, it is estimated that around 30-40% of the production cost of industrial enzymes can be attributed to the cost of the growth medium (Joo et al. 2003). Solid-state fermentation (SSF) has gained importance in the production of micro- bial enzymes owing to several economic advantages over submerged fermentation. The advantages of SSF include lower manufacturing costs with increased production, less pre-processing energy and effluent generation, along with easy process management and better product recovery (Prakasham et al. 2006; Oliveira et al. 2006). There are several reports describing the use of agro-industrial resi- dues for the production of alkaline protease (e.g. pigeon pea and Bacillus sp. JB-99 (Johnvesly et al. 2002); green gram husk and Bacillus sp. (Prakasham et al. 2006); Imperata cylindrical grass and potato peel and Bacillus subtilis (Mukherjee et al. 2008). Apart from these agro- industrial residues, increased attention has been paid in recent times to utilize other waste substances, e.g. feather meal, corn steep liquor (De Azeredo et al. 2006) and pro- teinaceous tannery solid waste, for the production of alka- line proteases (Ravindran et al. 2011). Even though cow dung is considered a waste, it contains essential nutrients (Misra et al. 2003); these include carbon, nitrogen, phos- phorus, potassium, calcium, magnesium, sulphur, manga- nese, copper, zinc, chloride, boron, iron and molybdenum. Most of the commercial proteases producing organisms are Bacillus sp. (Abo-Aba et al. 2006). The potential of cow dung as a biomass substrate for the production of alkaline protease by using Bacillus sp. has not yet been completely exploited. The main objective of the present study was the production of alkaline proteases by Bacillus subtilis utilizing cow dung as an energy source, and deter- mination of the optimum conditions necessary for the production of these enzymes. Results and discussion Isolation and identification of a best alkaline protease- producing organism Of the tested isolates, five were found to have the ability to produce alkaline protease. Among the positive isolates, the organism which produced a larger halo zone in re- sponse to the colony diameter was selected. The selected isolate was identified as Bacillus on the basis of various microscopic and biochemical investigations. The organism was a Gram-positive rod, spore-producing, VP-, catalase- and gelatin-positive. It fermented glucose, lactose and sucrose. It reacted negatively in the indole, methyl red, citrate, oxidase, starch and nitrate reduction test. All these results suggest that it belongs to the genus Bacillus. More- over, the organism was confirmed by its 16S rRNA gene sequence and identified as Bacillus subtilis strain VV. The 1071-bp sequence was submitted to GenBank (accession number: JQ 425476). Evaluation of cow dung as a cheap substrate for alkaline protease production This study has indicated that cow dung can be used as a potential substrate for alkaline protease production. En- zyme production by the B. subtilis strain VV was to the tune of 4030 ± 128 U/g solid substrate (cow dung) after 72 h of incubation at 37°C. The selection of a cheap sub- strate in SSF for the production of any metabolites is an im- portant factor from an industrial point of view. Apart from the cost, the availability of the substrate is a critical factor. An ideal substrate is one which is available in large quan- tities and throughout the year too. Although many cheap agro-industrial residues were evaluated (Prakasham et al. 2006; Johnvesly et al. 2002; Gessesse 1997) for the produc- tion of alkaline proteases, the availability of these substrates is seasonal. Apart from agro-industrial wastes, more atten- tion has been paid to the evaluation of solid wastes for the production of alkaline proteases (Ravindran et al. 2011; Ganesh Kumar et al. 2008). Waste water from the manufac- ture of shochu was also tried (Morimura et al. 1994) for production of proteases. In spite of evaluating these sub- strates, the search for a novel substrate continues. Recently, we used cow dung as a substrate for the production of a halo-tolerant alkaline protease using a alkalophilic isolate, Halomonas sp. PV1 (Vijayaraghavan and Vincent 2012). Of all the alkalophilic microorganisms that have been screened for use in various industrial applications, members of the genus Bacillus were found to be predominant and a prolific source of alkaline proteases (Kumar and Takagi 1999). Reports on SSF of cow dung for the production of alkaline protease using Bacillus sp. are limited or perhaps not avail- able. Hence, the present investigation aimed to exploit cow dung that is cheap and globally available for alkaline prote- ase production by Bacillus subtilis. The protein content of the cow dung medium was evaluated before and after fer- mentation. The cow dung possessed 80 ± 12 mg protein/g solid substrate, and the organism utilized 40 ± 4.5% of the protein content for the growth and synthesis of protease. Effect of fermentation period and pH on alkaline protease production To evaluate the effect of fermentation period on prote- ase production, the fermentation experiment was carried Vijayaraghavan et al. SpringerPlus 2012, 1:76 Page 2 of 9 http://www.springerplus.com/content/1/1/76 was added to the fermented substrate. This was placed in an orbital shaker at 150 rpm for 30 min for enzyme ex- traction. After this, the mixture was rapidly filtered using cotton and the cells were further harvested by centrifuga- tion at 10,000 g for 20 min. The supernatant was used as the enzyme source for protease assay. Determination of protease activity Alkaline protease activity was determined by standard assay. The reaction mixture contained 5 mL of casein (prepared in 0.05 M of glycine-NaOH buffer, pH 10.0) and an aliquot of 0.1 mL of the enzyme solution, and this mixture was incubated for 30 min at 37°C. The reac- tion was stopped by adding 5 mL of trichloroacetic acid solution (TCA) (0.11 M) and the mixture was filtered after 30 min. To 2 mL of the filtrate, 5.0 mL of 0.5 M so- dium carbonate and 1.0 mL of Folin-Ciocalteu’s phenol reagent were added, and this mixture was kept undis- turbed for 30 min at 37°C. The optical density of the solution was read against sample blank at 630 nm. One unit of enzyme activity was defined as the amount of en- zyme required to liberate 1 μg of tyrosine per minute under assay conditions (Chopra and Mathur 1985). The total protein content was estimated by Bradford’s method (Bradford 1976). Optimization of process parameters for protease production In the present study, solid-state protease production by the Bacillus subtilis strain VV was optimized by varying the physical parameters and nutrient sources. The prote- ase activity was determined in the fermented medium for every 12 h of fermentation up to 96 h in order to de- termine the fermentation period. To evaluate the effect of temperature on protease production, the substrate inoculated with bacterial culture was incubated at vari- ous temperatures (10–50°C). Addition of buffer (0.1 M) was performed so that the pH of the solid medium was varied from pH 6.0 to 11.0. To study the effect of the initial moisture content on protease production, the initial moisture content of the cow dung was adjusted to 60-180% using glycine-NaOH buffer (pH 10.0). To determine the effect of inoculum size on protease production, the inoculum concentration was increased accordingly (5-30%). In addition to the physical parameters, nutrient para- meters were also optimized. This included the effect of carbon sources (1%, w/w) (glucose, lactose, trehalose, mal- tose, xylose and starch) and nitrogen sources (1%, w/w) (gelatin, ammonium nitrate, peptone, yeast extract, urea, skimmed milk, and casein). The maximum production of protease at various concentrations (0.5-2.5%) of maltose as a carbon source and urea as a nitrogen source was investigated. The effect of the optimum concentration of maltose, urea and their combination on alkaline protease production for 24–96 h was also evaluated. The results reported in this study are averages of triplicate findings. Purification of protease The organism was grown aerobically in an optimized medium for 72 h at 37°C and extracted as described in materials and method section. Samples were centrifuged at 10,000 g for 10 min, and the supernatant was used as a crude enzyme preparation. It was precipitated with ammonium sulphate (40-80% saturation) and the enzyme precipitate obtained was centrifuged at 10,000 g for 10 min at 4°C. The precipitate obtained from the previous step was re-suspended in 5.0 mL of 0.025 M Tris–HCl buffer and dialysed against the same buffer. The dialysed sample was applied to a Sephadex G-75 gel filtration column (0.6 × 45 cm), and eluted with 0.025 M Tris–HCl buffer at pH 8.0, at a flow rate of 0.5 mL/min. Fractions of 2.0 mL were collected and the optical dens- ity of the sample was measured at 280 nm and analysed for proteolytic activity. SDS-PAGE and zymography Sodium dodecyl sulphate-polyacrylamide gel electrophor- esis was carried out according to (Laemmli 1970) using 11% crosslinked polyacrylamide gel. Silver staining was performed to visualize protein bands. Zymographic ana- lysis was performed by the enzyme pattern of proteins, obtained by zymogram with 1% casein substrate and detected using coomassie brilliant blue R-250 (Westergaar et al. 1980). Characterization of protease activity The effect of pH on the activity of the enzyme was studied by assaying the enzyme activity at different pH values ran- ging from 5.0 to11.0. To check the stability of the enzyme at various pH, 100 μL of the enzyme solution was mixed with 900 μL of buffer solutions (pH 5.0-11.0) and the mix- ture was taken to measure the protease activity under standard assay conditions after incubation for 1 h. The ef- fect of temperature on enzyme activity was studied by holding the reactions at various temperatures (30–70°C) using the standard assay method. To evaluate the heat stability of the protease, the sample was denatured at an optimized temperature (50°C) for 0–120 min. To study the effect of ions (0.01 M) on enzyme activity, the sample was pre-incubated with various divalent ions at 37°C for 1 h and the activity evaluated. To examine the effect of solvents, surfactants and detergents on enzyme activity, many agents were added to the enzyme solution at the indicated concentration, allowed to stand for 1 h and 24 h at room temperature and the activity measured. To evalu- ate the dehairing property of an enzyme, fresh goat-hide Vijayaraghavan et al. SpringerPlus 2012, 1:76 Page 7 of 9 http://www.springerplus.com/content/1/1/76 was incubated with 4.0 mg enzyme solution (pH 10.0) for up to 16 h at room temperature. Statistical analysis All experiments were performed in triplicate. Data were analyzed by correlation coefficient (r) and Student’s ‘t’ test. A significance level of 0.05 or less was considered statistically significant. Conclusions In conclusion, cow dung was utilized as a substrate for the production of alkaline protease in SSF. Cow dung is a cheaply available bioresource and this substrate is available in almost every country. So, this biomass could be effect- ively utilized for the production of alkaline protease an in- dustrial scale. Apart from the significance of the substrate, the enzyme secreted by B. subtilis strain VV is useful in the detergent and leather-processing industries. Competing interests The authors declare that they have no competing interests. Authors’ contribution PV designed and executed this project work. AV, AA and JJ gave technical assistance. SGPV guided this project work. All the authors have approved the submission of the manuscript. Acknowledgements One of the authors, P. Vijayaraghavan is thankful to the Council of Scientific and Industrial Research, New Delhi, India for financial support in the form of a Senior Research Fellowship. Author details 1International Centre for Nanobiotechnology, Centre for Marine Science and Technology, Manonmaniam Sundaranar University, Rajakkamangalam–629 502, Kanyakumari DistrictTamil Nadu, India. 2Centre for Marine Science and Technology, Manonmaniam Sundaranar University, Rajakkamangalam–629 502, Kanyakumari District, Tamil Nadu, India. 3Department of Biotechnology, Kalasalingam University, Virudhunagar, Srivilliputtur, 626 126, Tamilnadu, India. Received: 5 October 2012 Accepted: 19 December 2012 Published: 22 December 2012 References Abo-Aba SEM, Soliman EAM, Nivien AA (2006) Enhanced production of extra cellular alkaline protease in Bacillus ciculance through plasmid transfer. Res J Agric Biol Sci 16:526–530 Andersen LP (1998) Method for dehairing of hides or skins by means of enzymes. US Patent 5:834,299 Aravindan R, Saravanabhavan S, Thanikaivelan P, Rao JR, Nair BUA (2007) Chemo enzymatic pathway leads towards zero discharge tanning. J Clean Product 15:1217–1227 Arulmani M, Aparanjini K, Vasanthi K, Arumugam A, Arivuchelvi M, Thangavelu Kalaichelvan PT (2007) Purification and partial characterization of serine protease from thermostable alkalophilic Bacillus laterosporus -AK1. World J Microbiol Biotechnol 23(4):475–481 Bradford MM (1976) A rapid and sensitive method for the quantization of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254 Chopra AK, Mathur DK (1985) Purification and characterization of heat-stable protease from Bacillus stearothermophilus RM-67. J Dairy Sci 68:3202–3211 De Azeredo LA, De Lima MB, Coelho RR, Freire DM (2006) A low-cost fermentation medium for thermophilic protease production by Streptomyces sp. 594 using feather meal and corn steep liquor. Curr Microbiol 53(4):335–339 Ellaiah P, Srinivasulu B, Adinarayana K (2002) A review on microbial alkaline proteases. J Sci Ind Res 61:690–704 Ganesh Kumar A, Nagesh N, Prabhakar TG, Sekaran G (2008) Purification of extracellular acid protease and analysis of fermentation metabolities by Synergistes sp. utilizing proteinaceous solid waste from tanneries. Bioresour Technol 99:2364–2372 Gessesse A (1997) The use of nug meal as a low-cost substrate for the production of alkaline protease by the alkaliphilic Bacillus sp. AR-009 and some properties of the enzyme. Bioresour Technol 62:59–61 George S, Raju V, Krishnan MRV, Subramanian TV, Jayaraman K (1995) Production of protease by Bacillus amyloliquefaciens in solid-state fermentation ant its application in the unhairing of hides and skins. Process Biochem 30:457–462 Ghorbel B, Sellami-Kamoun A, Nasri M (2003) Stability studies of protease from Bacillus cereus BG1. Enzyme Microb Technol 32:513–518 Hameed A, Natt MA, Evans CS (1996) Production of alkaline protease by a new Bacillus subtilis isolate for use as a bating enzyme in leather treatment. World J Microbiol Biotechnol 12:289–291 Hameed A, Keshavarz T, Evans CS (1999) Effect of dissolved oxygen tension and pH on the production of extracellular protease from a new Bacillus subtilis K2, for use in leather processing. J Chem Technol Biotechnol 74:5–8 Jacobs MF (1995) Expression of the subtilisin Carlsberg-encoding gene in Bacillus licheniformis and Bacillus subtilis. Gene 152:67–74 Johnvesly B, Manjunath BR, Naik GR (2002) Pigeon pea waste as a novel, inexpensive, substrate for production of a thermostable alkaline protease from thermoalkalophilic Bacillus sp. JB-99. Bioresour Technol 82:61–64 Jones D, Collins MD (1984) Irregular, nonsporeforming Gram-positive rods. In: Sneath PHA (ed) Bergey’s Manual of systematic bacteriology, Vol. 2. Williams and Wilkins, Baltimore, MD, pp 1261–1434 Joo HS, Kumar CG, Park GC, Paik SR, Chang CS (2003) Oxidant and SDS-stable alkaline protease from Bacillus Clausii I-52: production and some properties. J Appl Microbiol 95:267–272 Kumar CG, Takagi H (1999) Microbial alkaline proteases from a bioindustrial viewpoint. Biotechnol Adv 17:561–594 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227(5259):680–685 MacFaddin JF (2000) Biochemical tests for identification of medical bacteria. Lippincott Williams and Wilkins, Baltimore, MD Misra RV, Roy RH, Hiraoka (2003) On farm composting method. FAO, Rome Morimura S, Kida K, Sonoda Y (1994) Production of protease using waste-water from the manufacture of shochu. J Ferment Bioeng 77(2):183–187 Mukherjee AK, Adhikari H, Rai SK (2008) Production of alkaline protease by a thermophilic Bacillus subtilis under solid-state fermentation (SSF) condition using Imperata cylindrical grass and potato peel as low cost medium: Characterization and application of enzyme in detergent formulation. Biochem Eng J 39:353–361 Nigam P, Singh D (1994) Solid state (substrate) fermentation system and their applications in biotechnology. J Basic Microbiol 34:405–423 Nilegaonkar SS, Zambare WP, Kanekar PP, Dhakephalkar PK, Sarnaik SS (2007) Production and partial characterization of dehairing protease from Bacillus cereus MCM B-326. Bioresour Technol 98:1238–1245 Oliveira LA, Porto ALF, Tambourgi EB (2006) Production of xylanase and protease by Penicillium janthinellum CRC 87 M-115 from different agricultural wastes. Bioresour Technol 98:1238–1245 Pandey A, Soccol CR, Nigam P, Brand D, Mohan R, Roussos S (2000) Biotechnological potential of coffee pulp and coffee husk for bioprocesses. Biochem Eng J 6:153–162 Prakasham RS, Subba Rao C, Sarma PN (2006) Green gram husk: an inexpensive substrate for alkaline protease production by Bacillus sp. in solid-state fermentation. Bioresour Technol 97:1449–1454 Rajkumar R, Ranishee JK, Ramasamy R (2011) Production and characterizaion of a novel proteases from Bacillus sp. RRM1 under solid state fermentation. J Microbiol Biotechnol 21(6):627–636 Ravindran B, Ganesh Kumar A, Aruna Bhavani PS, Sekaran G (2011) Solid-state fermentation for the production of alkaline protease by Bacillus cereus 1173900 using proteinaceous tannery solid waste. Curr Sci 100(5):726–730 Riffel A, Ortolan S, Brandelli A (2003) De-hairing activity of extracellular proteases produced by keratinolytic bacteria. J Chem Technol Biotechnol 78:855–859 Vijayaraghavan et al. SpringerPlus 2012, 1:76 Page 8 of 9 http://www.springerplus.com/content/1/1/76 Scheuer PJ (1990) Some marine ecological phenomena: chemical basis and biomedical potential. Science 248:173–177 Sivasubramanian S, Murali Manohar B, Rajaram A, Puvanakrishna R (2008) Ecofriendly lime and sulfide free enzymatic dehairing of skins and hides using a bacterial alkaline protease. Chemosphere 70:1015–1024 Sousa F, Ju S, Erbel A, Kokol V, Cavaco-Paulo A, Gubitz GM (2007) A novel metalloprotease from Bacillus cereus for protein fibre processing. Enzyme Microb Technol 40:1772–1781 Subba Rao C, Sathish T, Ravichandra P, Prakasham RS (2009) Characterization of thermo- and detergent stable serine protease from isolated Bacillus circulans and evaluation of eco-friendly applications. Process Biochem 44:262–268 Towatana NH, Painupong A, Suntinanalert P (1999) Purification and characterization of an extracellular protease from alkaliphilic and thermophilic Bacillus sp. PS7. J Biosci Bioeng 87:581–587 Uyar F, Baysal Z (2004) Production and optimization of process parameters for alkaline protease production by a newly isolated Bacillus sp. under solid state fermentation. Process Biochem 39(12):1893–1898 Varela H, Ferrari MD, Belobradjic L, Vazquez A, Loperena ML (1997) Skin unhairing proteases of Bacillus subtilis: production and partial characterization. Biotechnol Lett 19:755–758 Vijayaraghavan P, Vincent SGP (2012) Cow dung as a novel, inexpensive substrate for the production of a halo-tolerant alkaline protease by Halomonas sp. PV1 for eco-friendly applications. Biochem Eng J 69:57–60 Westergaar JL, Hackbarth C, Treuhaft MW, Roberts RC (1980) Detection of proteinases in electrophorograms of complex mixtures. J Immunol Meth 34(2):167–175 Yang JK, Shih IL, Tzeng YM, Wang SL (2000) Production and purification of protease from a Bacillus subtilis that can deproteinize crustacean wastes. Enzyme Microb Technol 26:406–413 doi:10.1186/2193-1801-1-76 Cite this article as: Vijayaraghavan et al.: Cow dung: a potential biomass substrate for the production of detergent-stable dehairing protease by alkaliphilic Bacillus subtilis strain VV. SpringerPlus 2012 1:76. Submit your manuscript to a journal and benefi t from: 7 Convenient online submission 7 Rigorous peer review 7 Immediate publication on acceptance 7 Open access: articles freely available online 7 High visibility within the fi eld 7 Retaining the copyright to your article Submit your next manuscript at 7 springeropen.com Vijayaraghavan et al. SpringerPlus 2012, 1:76 Page 9 of 9 http://www.springerplus.com/content/1/1/76

Title: Cow dung: a potential biomass substrate for the production of detergent-stable dehairing protease by alkaliphilic Bacillus subtilis strain VV ​ Authors: Ponnuswamy Vijayaraghavan, Aija Vijayan, Arumugaperumal Arun, John Kennady Jenisha, Samuel Gnana Prakash Vincent Publisher: SpringerPlus Date: 22 December 2012 ​ Abstract: Cow dung, a cheap and easily available source of energy, was used as the substrate for the production of alkaline protease by solid-state fermentation using the Bacillus subtilis strain VV. ​ In order to achieve the maximum yield of this enzyme, the following optimum process parameters are needed: fermentation period (72 h), pH (10.0), moisture content (140%), inoculum (25%), temperature (30–40°C), carbon source (2% (w/w) maltose) and nitrogen source (1% (w/w) urea). ​ The protease was stable over a broad temperature range (30–50°C) and pH (8.0-10.0), with maximum activity at 50°C and pH 10.0. ​ Among the divalent ions tested, Ca2+ (0.01 M) increased enzyme activity. ​ The purified protease, after being subjected to sodium dodecyl sulphate-polyacrylamide gel electrophoresis, was found to have a molecular mass of 38.5 kDa. ​ The enzyme was solvent-and surfactant-stable and showed activity even after 24 h incubation along with various commercially available detergents. ​ This enzyme possessed dehairing properties for animal hide after 16 h of incubation at room temperature. ​ From these results it is evident that cow dung is a potential substrate for the production of a detergent-stable, dehairing protease by B. subtilis. ​ This enzyme has a lot of potential applications in the detergent and leather-processing industries. ​

Molecular sexing of threatened Gyps vultures: an important strategy for conservation breeding and ecological studies.pdf

RESEARCH Open Access Molecular sexing of threatened Gyps vultures: an important strategy for conservation breeding and ecological studies Prabhakar B Ghorpade1, Praveen K Gupta2, Vibhu Prakash3, Richard J Cuthbert4, Mandar Kulkarni3, Nikita Prakash3, Asit Das1, Anil K Sharma1 and Mohini Saini1* Abstract During the last two decades populations of three resident species of Gyps vulture have declined dramatically and are now threatened with extinction in South Asia. Sex identification of vultures is of key importance for the purpose of conservation breeding as it is desirable to have an equal sex ratio in these monogamous species which are housed together in large colony aviaries. Because vultures are monomorphic, with no differences in external morphology or plumage colour between the sexes, other methods are required for sex identification. Molecular methods for sex identification in birds rely on allelic length or nucleotide sequence discrimination of the chromohelicase-DNA binding (CHD) gene located on male and female chromosomes ZZ and ZW, respectively. We characterized the partial sequences of CHD alleles from Gyps indicus, Gyps bengalensis, Gyps himalayensis and Aegypius monachus and analysed the applicability of five molecular methods of sex identification of 46 individual vultures including 26 known-sex G. bengalensis and G. indicus. The results revealed that W-specific PCR in combination with ZW-common PCR is a quick, accurate and simple method, and is ideal for sex identification of vultures. The method is also suitable to augment ecological studies for identifying sex of these endangered birds during necropsy examinations especially when gonads are not apparent, possibly due to regression during non-breeding seasons. Keywords: Molecular sex identification, Gyps vulture, Cinereous vulture, Vulture conservation, Captive breeding Background Nine species of vultures in the family Accipitridae are found in India, three of which are endemic to South and South-East Asia (the Oriental white-backed vulture (Gyps bengalensis), long-billed (G. indicus) and slender- billed vulture (G. tenuirostris) and are classified as Critically Endangered by the International Union for Conservation of Nature and Natural resources and are at high risk of extinction in the wild (IUCN, 2011). In India, populations of G. bengalensis have declined by more than 99.9% while those of G. indicus and G. tenuirostris have declined by around 97% between the early 1990s and 2007 (Prakash et al. 2007). Similar reductions in vulture populations have been recorded in Pakistan and Nepal (Pain@ et al. 2008). Although the Himalayan griffon (G. himalayensis) is not considered threatened (under category Least Concern) (IUCN, 2011), its population de- cline has been recorded in Nepal (Acharya et al. 2009). The status of another species, the Cinereous Vulture (Aegypius monachus), is classified as Near Threatened as per IUCN (IUCN, 2011). Veterinary use of non-steroidal anti-inflam- matory drugs (NSAIDs) such as diclofenac and ketoprofen have been shown to be toxic to Gyps vultures and are responsible for the decline of these species (Oaks et al. 2004; Green et al. 2006, 2007; Swan et al. 2006; Cuthbert et al. 2009; Naidoo et al. 2009, 2010; Das et al. 2011). In contrast the NSAID meloxicam has been demonstrated to be a safe and effective alternative drug for veterinary use (Swan et al. 2006; Swarup et al. 2007). Although the veter- inary use of diclofenac has been banned in India, Pakistan and Nepal (Kumar 2006; Singh 2008), it’s illegal use is still * Correspondence: [email protected] 1Centre for Wildlife Conservation, Management & Disease Surveillance, Indian Veterinary Research Institute, Izatnagar 243 122, India Full list of author information is available at the end of the article a SpringerOpen Journal © 2012 Ghorpade et al.; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Ghorpade et al. SpringerPlus 2012, 1:62 http://www.springerplus.com/content/1/1/62 apparent, as diclofenac residues are still prevalent in cattle carcasses across India at concentrations sufficient to cause declines in vulture populations (Cuthbert et al. 2011a, 2011b; Saini et al. 2012). Due to the massive scale of the population declines and the continued use of diclofenac, populations of the three Critically Endangered resident Gyps species are being bred in captivity in India, Nepal and Pakistan, with the aim that their progeny will be introduced back in to the wild after ensuring that the environment is safe and diclofenac free (MoEF 2006; Bowden 2009). Vultures are monomorphic monogamous species and hence without knowing the sex of birds it is difficult to maintain the correct sex ratios in aviaries at conservation breeding centres in order to maximise the chances of successful breeding. As well as the key importance of iden- tifying gender for conservation breeding programmes, knowledge of sex is also important to complement forensic studies (An et al. 2007) and investigations on evolution and ecology (Griffiths and Tiwari 1995; Costantini 2008; Fukui et al. 2008). Various techniques have been employed for sex deter- mination of monomorphic birds such as laparotomy (Risser 1971), laparoscopy (Richner 1989), flow cytometry (Nakamura et al. 1990), karyotyping (Hatzofe and Getreide 1990) and Raman spectroscopy (Harz et al. 2008) but mo- lecular methods based on DNA analysis are most prevalent (Fridolfsson and Ellegren 1999). Except for the ratites, that have undifferentiated sex chromosomes, all male birds are homogametic with ZZ sex chromosomes and females are heterogametic with ZW sex chromosomes (Ellegren 1996; Griffiths et al. 1996). The most frequently exploited gene for sex identification is the Chromohelicase DNA binding (CHD) gene that is found conserved on both W and Z chromosomes (Griffiths 2000). Intronic length variation in CHD-Z and CHD-W allelles amplified by Griffiths univer- sal CHD primer pair P2/P8 has formed the basis of gender identification in most avian species (Griffiths et al. 1998; Fridolfsson and Ellegren 1999). However, in certain species of Accipitridae there is an extremely short difference in in- tronic length between CHD-Z and CHD-W P2/P8 ampli- con which makes sex identification more difficult and inaccurate (Ito et al. 2003; Chang et al. 2008). Hence, in order to circumvent the limitation of conventional PCR (Fridolfsson and Ellegren 1999), different approaches detecting small variation in nucleotides like Amplification Refractory Mutation System (ARMS) (Ito et al. 2003), Re- striction Fragment Length Polymorphism (RFLP) (Sacchi et al. 2004), Single strand conformation polymorphism (SSCP) (Ramos et al. 2009), Melting Curve analysis (Chang et al. 2008a), ZW common and W-specific PCR (Chang et al. 2008b), TaqMan Probe-based real time PCR (Chang et al. 2008c; Chou et al. 2010) have been suggested in order to identify gender in these species. Old World vultures along with other birds of prey be- long to the taxonomic order Falconiformes, family Acci- pitridae, and subfamily Accipitrinae (Chang et al. 2008b, 2008c). Due to their position within the Accipitridae it was observed that intronic length variation of CHD-Z and CHD-W amplicon in Griffiths universal CHD primer pair P2/P8 based PCR is unlikely to be suitable for sex discrimination in G. indicus or G. bengalensis (Reddy et al. 2007). However, a similar approach (Kahn et al. 1998) using denaturing polyacrylamide gel electrophor- esis combined with autoradiography has been reported to sex nestlings of these two species (Arshad et al. 2009). In the present study, based upon the chromohelicase gene sequences in male (ZZ) and female birds (ZW), the accuracy and reliability of five different approaches are compared for molecular gender identification in three vul- ture species (G. indicus, G. bengalensis, G. himalayensis) in order to identify an accurate and simple test to support the captive breeding programmes. Results Sequence characterization of CHD-Z and CHD-W sequences The CHD-Z and CHD-W sequences from the four vulture species used in this study were amplified and the sequences were determined. These sequences were sub- mitted to GenBank and accession numbers obtained were HQ236387, HQ236386 (G. indicus); HQ236388, HQ236385 (G. bengalensis); HQ236384, HQ236383 (G. himalayensis); HQ236382 (A. monachus). Independent alignment reports for CHD-Z and CHD-W sequences were prepared (Figure 1A and B), where primer binding regions for P2, P8, NP, MP; ZW-Common and W-specific primers and probes as well as restriction site for BamHI and RsaI were located. The primer binding region for MP and W-specific primers were found in all CHD-W but not in CHD-Z sequences. The recognition sequence for BamHI was found on CHD-Z but was absent on the CHD-W sequence, whereas the RsaI restriction site was located at different positions in the CHD-Z and CHD-W sequences. Based on these identified sequences the applicability and accuracy of PCR-RFLP, ARMS-PCR, W-specific PCR and TaqMan probe based real-time PCR methods for sex iden- tification was tested for all four species of vultures (Table 1). Standardization of PCR-based molecular methods for sex identification i) Conventional PCR-RFLP For standardization of conventional PCR-RFLP, known sex samples from G. bengalensis and G. indicus, G. hima- layensis and A. monachus were used. It was evident from Ghorpade et al. SpringerPlus 2012, 1:62 Page 2 of 12 http://www.springerplus.com/content/1/1/62 Restriction endonuclease RsaI and BamHI sites were selected for sex identification in PCR-RFLP analysis. Standardization of PCR-based molecular methods for sex identification i) Conventional PCR-RFLP Using Griffiths universal CHD primer pair P2/P8, the amplified PCR products were analysed using restriction endonuclease digestion with RsaI and BamHI and sex was identified. The restriction digestion was performed in a 30 μl reaction volume containing 5 μl of amplified PCR product and 2 U of restriction enzymes (RsaI or BamHI) and was incubated at 37°C overnight. The digested products were separated on 3% agarose gel along with 100 bp DNA ladder and analysed. ii) ARMS-PCR ARMS-PCR based on 3’-terminal mismatch primer (MP primer) point mutation conserved among Falconiformes CHD-W and CHD-Z sequences previously reported (Ito et al. 2003) was performed to identify sex in vultures with some modifications. Briefly, PCR was done in a 25 μl reaction volume containing 0.4 μM each of Griffiths univer- sal CHD primer P2 forward primer, another forward primer MP (5’-AGTCACTATCAGATCCGGAA-3’) and reverse primer NP (5’-GAGAAACTGTGCAAAACAG -3’), 100 ng genomic DNA, 0.2 mM each dNTP and 1U of Taq DNA Polymerase (Bangalore Genei, India). PCR amplification cycle involved initial denaturation at 94°C for 90 sec followed by 35 cycles of 94°C for 30 sec, 50°C for 45 sec, 72°C for 30 sec and final extention at 72°C for 5 min. The amplified PCR products were separated on 3% agarose gel along with 100 bp DNA ladder and analysed. iii) W-specific PCR An alternative W-specific sex identification method suggested for Crested Serpent Eagle (Spilornis cheela hoya) (Chang et al. 2008b) was also used in this study, where Griffith’s universal CHD primer P2 was used as a forward primer and CHD-W primer as a reverse primer which anneals to only the CHD-W allele sequence, or ZW-common primer which anneals to both CHD-Z and CHD-W allele sequences. The PCR reaction was performed in a 25 μl volume consisting of 0.4 μM each of Griffith’s universal CHD primer P2 and reverse primer CHD-ZW-common (5’-GATCAGCTTTAATGGA AGTGAAG-3’) or CHD-W specific (5’-GGTTTTCACAC ATGGCACA-3’), 100 ng genomic DNA, 0.2 mM each dNTP, 1.5 μl DMSO and 1U Taq DNA Polymerase (Bangalore Genei, India). The PCR cycling condition employed was an initial denaturation at 94°C for 3 min, followed by 45 repeated cycles of 94°C for 30 sec, 56°C for 30 sec, 72°C for 20 sec, and final extension at 72°C for 5 min. The amplified PCR products were resolved on 3% agarose gel along with 100 bp DNA ladder and analysed for presence (indicating female) or absence (indicating male) of 263 bp W-specific product. iv) TaqMan probe based real-time PCR The TaqMan based qualitative real-time PCR (qPCR) based on allele discrimination option for sex identifica- tion reported earlier for S. cheela hoya (Chang et al. 2008c) was used. This test utilises the considerable difference in composition of the CHD-W and CHD-Z sequences in vultures, with the W-specific probe (5’-FAM-TGTGCCATGTGTGAAAACCACCCA-TAMR A) recognising only the CHD-W region whereas the ZW common probe (5’-HEX-CCCTTCACTTCCAT TAAAGCTGATCTGG-TAMRA) recognises both the Z and W CHD chromosome regions. The PCR reaction mixture in a 20 μl volume consisted of 0.4 μM each of Griffith’s universal CHD primer pair P2/P8, 50–100 ng genomic DNA, 0.2 mM of each dNTP, 20nM each of W-specific and ZW common probes and 1 U of Taq DNA polymerase (Bangalore Genei, India). The DNA template was excluded from no template control (NTC), whereas the probe was excluded from no probe control (NPC). In addition, positive controls (with known male and female DNA samples) were also included in each test. Two steps PCR condition was employed with initial denaturation at 94°C for 4 min, followed by 50 repeated cycles of 92°C for 15 sec, 60°C for 1 min in Mx3005P real-time PCR machine (Agilent, USA). The results were recorded as an amplification plot, with text report and alleles discrimination made using MxPro™QPCR soft- ware (Agilent, USA) and compared with female and male positive controls. Application of the molecular methods for sex identification All molecular methods were employed for sex identifica- tion of vultures using tissue samples obtained during necropsy (n = 17) and blood samples obtained from live birds (n = 9) for which the sex was known. These tests were then employed for analysing eight blood samples and 12 necropsy tissues from unknown-sex vultures. Abbreviations CHD: Chromohelicase-DNA binding gene; IUCN: International Union for Conservation of Nature; NSAIDs: Non-steroidal antiinflammatory drugs; RFLP: Restriction Fragment Length Polymorphism; ARMS: Amplification Refractory Mutation System; SSCP: Single strand conformation polymorphism; qPCR: Qualitative real-time PCR; VCBC: Vulture Conservation Breeding Centre. Ghorpade et al. SpringerPlus 2012, 1:62 Page 10 of 12 http://www.springerplus.com/content/1/1/62 Competing interests The authors declare that they have no competing interests. Authors’ contributions PBG carried out cloning and characterization of sequences, performing tests, preparation of the draft and revision of the manuscript. PKG participated in conceiving the design of the study, performed sequence analysis and interpretations and helped in drafting and revising the manuscript. VP conceived the problem, coordinated the collection of samples from field post-mortems and breeding centres and helped to draft the manuscript. RJC participated in coordination of the study, preparing draft and critically revising the manuscript. MK and NP collected the tissue and blood samples from vultures. AD and AKS participated in collection of one tissue sample from Gyps himalayensis from necropsy examination, design of the study and helped to draft the manuscript. MS contributed in conception of the study, execution of the experiments, analysis and interpretation of data, drafting and revising the manuscript. All authors read and approved the final manuscript. Acknowledgements We thank the Director and Joint Director (Research), IVRI, Izatnagar and the Director, BNHS, Mumbai for providing the necessary facilities and funding to carry out this work. We acknowledge laboratory assistance provided by Mr Mohan Bhat, IVRI. The vulture conservation breeding centres in India are run by the Bombay Natural History Society (BNHS), India in collaboration with the state forest departments and Ministry of Environment and Forests, Government of India and supported by UK based organizations Royal Society for Protection of Birds (RSPB), Darwin Initiative for the survival of species, Zoological Society of London and National Birds of Prey Trust. Author details 1Centre for Wildlife Conservation, Management & Disease Surveillance, Indian Veterinary Research Institute, Izatnagar 243 122, India. 2Division of Veterinary Biotechnology, Indian Veterinary Research Institute, Izatnagar 243 122, India. 3Bombay Natural History Society, Hornbill House, S.B. Singh Road, Mumbai 400 001, India. 4Royal Society for the Protection of Birds, The Lodge, Sandy, Bedfordshire, UK. Received: 18 August 2012 Accepted: 7 December 2012 Published: 12 December 2012 References Acharya R, Cuthbert R, Baral HS, Shah KB (2009) Rapid population declines of Himalayan Griffon Gyps himalayensis in Upper Mustang, Nepal. Bird Conservation International 19:99–107 An J, Lee MY, Min MS, Lee MH, Lee H (2007) A molecular genetic approach for species identification of mammals and sex determination of birds in a forensic case of poaching from South Korea. Forensic Sci Int 167:59–61 Arshad M, Chaudhary MJI, Wink M (2009) High mortality and sex ratio imbalance in a critically declining Oriental White-backed vulture population (Gyps bengalensis) in Pakistan. J Ornithol 150:495–503 Bowden C (2009) The Asian Gyps vulture crisis: the role of captive breeding in India to prevent total extinction. BirdingASIA 12:121–123 Busch JD, Katznerm TE, Bragin E, Keim P (2005) Tetranucleotide microsatellite for Aquila and Haliaeetus eagles. Mol Ecol Notes 5:39–41 Chang HW, Cheng CA, Gu DL, Chang CC, Su SH, Wen CH, Chou CY, Chou TC, Yao CT, Tsai CL, Cheng CC (2008a) High-throughput avian molecular sexing by SYBR green based real-time PCR combined with melting curve analysis. BMC Biotechnol 8:8–12 Chang HW, Chou TC, Gu DL, Cheng CA, Chang CC, Yao CT, Chuang LY, Wen CH, Chou YC, Tan KY, Cheng CC (2008b) An improved PCR method for gender identification of eagles. Mol Cell Probes 22:184–188 Chang HW, Gu DL, Su SH, Chang CC, Cheng CA, Huang HW, Yao CT, Chou TC, Chuang LY, Cheng CC (2008c) High-throughput gender identification of Accipitridae eagles with real-time PCR using TaqMan probes. Theriogenology 70:83–90 Chou TC, Yao CT, Su SH, Hung YC, Chen WS, Cheng CC, Tseng CN, Wang HM, Chou YC, Li SS, Gu DL, Chang HW (2010) Validation of Spilornis cheela hoya TaqMan probes for potential gender identification of many Accipitridae species. Theriogenology 73:404–11 Costantini V, Guaricci AC, Laricchiuta P, Rausa F, Lacalandra GM (2008) DNA sexing in Humboldt Penguins (Spheniscus humboldti) from feather samples. Anim Reproduction Sci 106:162–167 Cuthbert R, Prakash V, Bowden C, Das D, Green RE, Jhala Y, Pain DJ, Senacha KR, Shah N, Taggart MA (2009) Role of veterinary diclofenac in decline of vulture populations in South Asia. Ind Vet Med Journal 29:80–85 Cuthbert R, Taggart MA, Prakash V, Saini M, Swarup D, Upreti S, Mateo R, Chakraborty SS, Deori P, Green RE (2011a) Effectiveness of action in India to reduce exposure of Gyps vultures to the toxic veterinary drug diclofenac. PLoS One 6:e19069 Cuthbert RJ, Prakash V, Saini M, Upreti S, Swarup D, Das A, Green RE, Taggart M (2011b) Are conservation actions reducing the threat to India’s vulture populations? Curr Sci 101:1480–1484 Das D, Cuthbert RJ, Jakati RD, Prakash V (2011) Diclofenac is toxic to the Himalayan vulture Gyps himalayensis. Bird Conservation International 21:72–75 Ellegren H (1996) First gene on the avian W chromosome (CHD) provides a tag for universal sexing of non-ratite birds. Proc Roy Soc Biol Sci 263(1377):1635–1641 Fridolfsson A, Ellegren H (1999) A simple and universal method for molecular sexing of non-ratite birds. J Avian Biol 30:116–121 Fukui E, Sugita S, Yoshizawa M (2008) Molecular sexing of Jungle crow (Corvus macrorhynchos japonensis) and Carrion crow (Corvus corone corone) using a feather. Anim Sci J 79:158–162 Green RE, Taggart MA, Senacha KR, Raghavan B, Pain DJ, Cuthbert R (2007) Rate of decline of the oriental white-backed vulture population in India estimated from a survey of diclofenac residues in carcasses of ungulates. PLoS One 2(8):e686 Green RE, Taggart MA, Das D, Pain DJ, Kumar S, Cunningham AA, Cuthbert R (2006) Collapse of Asian vulture populations: risk of mortality from residues of the veterinary drug diclofenac in carcasses of treated cattle. J Appl Ecol 43:949–956 Griffiths R (2000) Sex identification in birds. Semin Avian Exotic Pet Med 9:14–26 Griffiths R, Daan S, Dijkstra C (1996) Sex identification in birds using two CHD genes. Proc Royal Soc - Biol Sci 263:1251–1256 Griffiths R, Double MC, Orr K, Dawson RJG (1998) A DNA test to sex most birds. Mol Ecol 7:1071–1075 Griffiths R, Tiwari B (1995) Sex of the last wild Spix’s macaw. Nature 375(6531):375–454 Harz M, Krause M, Bartels T, Cramer K, Rosch P, Popp J (2008) Minimal invasive gender determination of birds by means of UV-resonance Raman spectroscopy. Anal Chem 80:1080–1086 Hatzofe O, Getreide S (1990) Sex determination in vultures and other monomorphic raptors. Torgos 8:27–29 Hau M (2001) Timing of breeding in variable environments: tropical birds as model systems. Horm Behav 40:281–290 IUCN (International Union for Conservation of Nature) (2011) Red list of threatened species, Version Version 2011.2. http://www.iucnredlist.org (Downloaded on 25 April 2012) Ito H, Sudo-yamaji A, Abe M, Murase T, Tsubota T (2003) Sex identification by alternative polymerase chain reaction methods in falconiformes. Zoological Sci 20:339–344 Kahn NW, John J, Quinn TW (1998) Chromosome-specific intron size differences in the avian CHD gene provide an efficient method of sex identification in birds. Auk 115:1074–1078 Kumar A (2006) Subject: diclofenac for veterinary use. Letter to ‘All State Drug Controllers’ from the ‘Drug Controller General (India)’, 11th May 2006, F.No. 18-03/2006/DC MOEF (Ministry of Environment and Forests) (2006) Action plan for vulture conservation in India. 28, New Delhi, p 1 Naidoo V, Wolter K, Cromarty D, Diekmann M, Duncan N, Meharg AA, Taggart MA, Venter L, Cuthbert R (2010) Toxicity of NSAIDs to Gyps vultures: a new threat from ketoprofen. Biol Lett 6:339–341 Naidoo V, Wolter K, Cuthbert R, Duncan N (2009) Veterinary diclofenac threatens Africa’s endangered vulture species. Reg Toxicol Pharmacol 53:205–208 Nakamura D, Tiersch TR, Douglas M, Chandler RW (1990) Rapid identification of sex in birds by flow cytometry. Cytogenet Cell Genet 53:201–205 Nazrul Islam M, Tsukahara N, Sugitaa S (2012) Apoptosis-mediated seasonal testicular regression in the Japanese Jungle crow (Corvus macrorhynchos). Theriogenology 77:1854–1865 Ghorpade et al. SpringerPlus 2012, 1:62 Page 11 of 12 http://www.springerplus.com/content/1/1/62 Nesje M, Roed KH (2000) Sex identification in falcons using microsatellite DNA markers. Hereditas 132:261–263 Oaks JL, Gilbert M, Virani MZ, Watson RT, Meteyer CU, Rideout BA, Shivaprasad HL, Ahmed S, Chaudhry MJ, Arshad M, Mahmood S, Ali A, Khan AA (2004) Diclofenac residues as the cause of vulture population decline in Pakistan. Nature 27(6975):630–633 Pain DJ, Bowden CGR, Cunningham AA, Cuthbert R, Das D, Gilbert M, Jakati RD, Jhala Y, Khan AA, Naidoo V, Oaks JL, Parry-Jones J, Prakash V, Rahmani A, Ranade SP, Baral HS, Sanacha KR, Saravanan S, Shah N, Swan G, Swarup D, Taggart MA, Watson RT, Virani MZ, Wolter K, Green R (2008) The race to prevent the extinction of South Asian vultures. Bird Conservation International 18:S30–S48 Prakash V, Green RE, Pain DJ, Ranade SP, Saravanan S, Prakash N, Venkitachalam R, Cuthbert R, Rahmani AR, Cunningham AA (2007) Recent changes in populations of resident Gyps vultures in India. J Bombay Nat His Soc 104(2):129–135 Ramos PS, Bastos E, Mannan RW, Guedes-Pinto H (2009) Polymerase chain reaction-single strand conformation polymorphism applied to sex identification of Accipiter cooperii. Mol Cell Probes 23:115–118 Reddy A, Prakash V, Shivaji S (2007) A rapid, non-invasive, PCR-based method for identification of sex of the endangered Old World vultures (white-backed and long-billed vultures) - implications for captive breeding programmes. Curr Sci 92:659–662 Richner H (1989) Avian laparoscopy as a field technique for sexing birds and an assessment of its effects on wild birds. J Field Ornithol 60(2):137–142 Risser AC (1971) A technique for performing laparotomy on small birds. Condor 73:376–79 Sacchi P, Soglia D, Sandra Maione S, Meneguza G, Campora M, Rasero R (2004) A non-invasive test for sex identification in short-toed eagle (Circaetus gallicus). Mol Cell Probes 18:193–196 Saini M, Taggart MA, Knopp D, Upreti S, Swarup D, Das A, Gupta PK, Niessner R, Prakash V, Mateo R, Cuthbert RJ (2012) Detecting diclofenac in livestock carcasses in India with an ELISA:A tool to prevent widespread vulture poisoning. Environ Pollution 160:11e16 Sharah HA, Buahin GKA, Yusufu SD (2007) Effect of photoperiod changes on breeding activities and weight of sex organs in cattle egrets (Bubulcus ibis L). The Zoologist 5:16–23 Shizuka D, Lyon BE (2008) Improving the reliability of molecular sexing of birds using a W-specific marker. Mol Ecol Resources 8:1249–1253 Singh S (2008) Subject: Prohibition to manufacture, sale and distribution of diclofenac and its formulations for animal use. Letter to ‘Manufacturer’s Associations’ from the ‘Drug Controller General (India)’, 6th August 2008, F. No. 18-01/2007-DC Swan G, Naidoo V, Cuthbert R, Green RE, Pain DJ, Swarup D, Prakash V, Taggart MA, Bekker L, Das D, Diekmann J, Diekmann M, Killian E, Meharg AA, Patra RC, Saini M, Wolter K (2006a) Removing the threat of diclofenac to critically endangered Asian vultures. PLoS Biol 4:395–402 Swan GE, Cuthbert R, Quevedo M, Green RE, Pain DJ, Bartels P, Cunningham AA, Duncan N, Meharg AA, Oaks JL, Parry-Jones J, Shultz S, Taggart MA, Verdoorn G, Wolter K (2006b) Toxicity of diclofenac to Gyps vultures. Biol Lett 2:279–282 Swarup D, Patra RC, Prakash V, Cuthbert R, Das D, Avari P, Pain DJ, Green RE, Sharma AK, Saini M, Das D, Taggart MA (2007) Safety of meloxicam to critically endangered Gyps vultures and other scavenging birds in India. Anim Conserv 10:192–198 CZA (Central Zoo Authority) (2011) Working Manual on Conservation Breeding of Vultures. Available at http://www. cza.nic.in doi:10.1186/2193-1801-1-62 Cite this article as: Ghorpade et al.: Molecular sexing of threatened Gyps vultures: an important strategy for conservation breeding and ecological studies. SpringerPlus 2012 1:62. Submit your manuscript to a journal and benefi t from: 7 Convenient online submission 7 Rigorous peer review 7 Immediate publication on acceptance 7 Open access: articles freely available online 7 High visibility within the fi eld 7 Retaining the copyright to your article Submit your next manuscript at 7 springeropen.com Ghorpade et al. SpringerPlus 2012, 1:62 Page 12 of 12 http://www.springerplus.com/content/1/1/62

Title: Molecular sexing of threatened Gyps vultures: an important strategy for conservation breeding and ecological studies ​ Authors: Prabhakar B Ghorpade, Praveen K Gupta, Vibhu Prakash, Richard J Cuthbert, Mandar Kulkarni, Nikita Prakash, Asit Das, Anil K Sharma, Mohini Saini ​ Publisher: SpringerPlus Date: December 12, 2012 ​ Abstract: During the last two decades populations of three resident species of Gyps vulture have declined dramatically and are now threatened with extinction in South Asia. ​ Sex identification of vultures is of key importance for the purpose of conservation breeding as it is desirable to have an equal sex ratio in these monogamous species which are housed together in large colony aviaries. ​ Because vultures are monomorphic, with no differences in external morphology or plumage colour between the sexes, other methods are required for sex identification. ​ Molecular methods for sex identification in birds rely on allelic length or nucleotide sequence discrimination of the chromohelicase-DNA binding (CHD) gene located on male and female chromosomes ZZ and ZW, respectively. ​ We characterized the partial sequences of CHD alleles from Gyps indicus, Gyps bengalensis, Gyps himalayensis and Aegypius monachus and analysed the applicability of five molecular methods of sex identification of 46 individual vultures including 26 known-sex G. bengalensis and G. indicus. ​ The results revealed that W-specific PCR in combination with ZW-common PCR is a quick, accurate and simple method, and is ideal for sex identification of vultures. ​ The method is also suitable to augment ecological studies for identifying sex of these endangered birds during necropsy examinations especially when gonads are not apparent, possibly due to regression during non-breeding seasons. ​

Deep learning-based approach for high spatial resolution fibre shape sensing.pdf

"ARTICLE Deep learning-based approach for high spatial resolution fibre shape sensing Samaneh Manav(...TRUNCATED)

"Title: Deep learning-based approach for high spatial resolution fibre shape sensing ​\nAuthors: S(...TRUNCATED)

"Moderate-coherence sensing with optical cavities: ultra-high accuracy meets ultra-high measurement (...TRUNCATED)

"ARTICLE Moderate-coherence sensing with optical cavities: ultra-high accuracy meets ultra-high meas(...TRUNCATED)

"Title: Moderate-coherence sensing with optical cavities: ultra-high accuracy meets ultra-high measu(...TRUNCATED)

"Heterogeneous integration of high-k complex-oxide gate dielectrics on wide band-gap high-electron-(...TRUNCATED)

"ARTICLE Heterogeneous integration of high-k complex-oxide gate dielectrics on wide band-gap high-el(...TRUNCATED)

"Title: \nHeterogeneous integration of high-k complex-oxide gate dielectrics on wide band-gap high-e(...TRUNCATED)