Datasets:

Appz7

/

t5-metadata-extraction-dataset3

like 0

Empowering scientifc progress: the vital role of open-access, peer-reviewed methods and protocols.pdf

Cilibrasi BMC Methods (2024) 1:1 https://doi.org/10.1186/s44330-024-00001-8 EDITORIAL Empowering scientific progress: the vital role of open‑access, peer‑reviewed methods and protocols Chiara Cilibrasi1*  Abstract  In the ever-evolving landscape of scientific research, the importance of detailed, accessible methods and step-by-step reusable protocols cannot be overstated. In alignment with this BMC Methods, is dedicated to facilitating the dissemi- nation of open-access, peer-reviewed novel experimental procedures, techniques, and methodologies to promote reproducibility, transparency, and the advancement of scientific methods in the natural sciences. Main In the ever-evolving landscape of scientific research, the importance of detailed, accessible methods and step-by- step reusable protocols cannot be overstated. They are essential for reproducibility, as well as trust in science and scientific advancement. Despite progress in open science, particularly in areas like open access publications, open data, and open code, advances in open methods have lagged behind [1]. This discrepancy raises concerns because the lack of openly accessible detailed methods undermines trust in pub- lished data and severely limits the adoption of new meth- odologies, as well as the use of data. Addressing this challenge requires a cultural shift within the scientific community and a commitment to promoting transpar- ency, openness, and collaboration in research practices. In alignment with this, BMC Methods  (https://​bmcme​ thods.​biome​dcent​ral.​com/)  is dedicated to facilitating the dissemination of open-access, peer-reviewed novel experimental procedures, techniques, and methodolo- gies to promote reproducibility, transparency, and the advancement of scientific methods in the natural sci- ences. To assist our authors in effectively showcasing their innovative techniques and procedures, BMC Meth- ods offers two primary article types, Methodology Arti- cles and Protocols. These article types serve to facilitate the dissemination of innovative experimental and com- putational methods or provide detailed step-by-step descriptions of experimental techniques, respectively. This approach will then enable our readers to scruti- nise, validate, and build upon easily accessible and peer- reviewed methodologies, establishing a foundation of shared knowledge that elevates the integrity of scientific pursuits. We also acknowledge the scientific community’s demand for living protocols, recognizing that the ques- tion about protocols is generally not whether they will change, but when and how they will evolve or be adapted by others. In collaboration with protocols.io (https://​ www.​proto​cols.​io/), we facilitate the deposition of proto- cols on their dynamic platform. This enables versioning or forking as they evolve or are adapted by other research groups, preserving an original version that undergoes peer review and is published with us. Additionally, we offer the opportunity for researchers to publish proto- col extensions in cases of significant advancements or adaptations. Open Access © The Author(s) 2024. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. BMC Methods *Correspondence: Chiara Cilibrasi [email protected] 1 Springer Nature, The Campus, 4 Crinan Street, London N1 9XW, UK Page 2 of 2 Cilibrasi BMC Methods (2024) 1:1 We firmly believe that BMC Methods will play a piv- otal role in addressing the pressing issue of inadequate reporting of methods, a primary factor contributing to the widely recognized ‘reproducibility crisis’. Coined in the early 2010s, this term refers to a significant challenge faced by the scientific community, where a substantial number of published scientific studies and experiments cannot be reliably reproduced by other researchers [2]. A 2016 survey by Nature on 1,576 researchers who took a brief online questionnaire on reproducibility, found that more than 70% of researchers have tried and failed to reproduce another scientist’s experiment results and more than half have failed to reproduce their own experi- ments [3]. Additionally, the “Reproducibility Project: Cancer Biology” sought to replicate findings from 193 high profile experiments in cancer research [4]. No paper contained sufficient methodological details to allow researchers to design and conduct a replication study. Contact with authors was always required to design and conduct replication studies, and many authors were not able to provide helpful information. These examples clearly demonstrate that research findings are important but not useful if the methods used to generate the data are not accessible or not sufficiently detailed to allow reproducibility, understanding and trust. In conclusion BMC Methods, as the first Springer Nature open-access, peer-reviewed journal that will focus on providing updates in methods and lab proto- cols, aims to position itself at the forefront of the cultural shift that will eventually result in elevating the quality and rigour of scientific research. We warmly encourage you to submit your methodologies and step-by-step reus- able protocols to our journal (https://​submi​ssion.​sprin​ gerna​ture.​com/​new-​submi​ssion/​44330/3), embracing the transformative potential of open-access and peer-review to methodologies and protocols, propelling science into a future marked by reproducibility, continual progress and shared discovery. Acknowledgements Not applicable. Authors’ contributions CC conceived and drafted the manuscript. CC read and approved the final manuscript. Funding Not applicable. Availability of data and materials No datasets were generated or analysed during the current study. Declarations Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Competing interests CC is an employee of Springer Nature and the Editor for BMC Methods. Received: 18 January 2024 Accepted: 22 January 2024 References 1. Leite SB, Brooke M, Carusi A, Collings A, Deceuninck P, Dechamp J-F, et al. Promoting Reusable and Open Methods and Protocols (PRO-MaP): Draft recommendations to improve methodological clarity in life sciences publications. OSF Preprints. 2023. Available from: osf.​io/​x85gh. 2. Pashler H, Harris CR. Is the Replicability Crisis Overblown? Three Argu- ments Examined. Perspect Psychol Sci. 2012;7(6):531–6. 3. Baker M. 1,500 scientists lift the lid on reproducibility". Nature (News Feature). Springer Nature. 2016;533(7604):452–4. 4. Errington TM, Denis A, Perfito N, Iorns E, Nosek BA. Challenges for assess- ing replicability in preclinical cancer biology. eLife. 2021;10:e67995. https://​doi.​org/​10.​7554/​eLife.​67995. Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in pub- lished maps and institutional affiliations. Cilibrasi BMC Methods (2024) 1:1 https://doi.org/10.1186/s44330-024-00001-8 EDITORIAL Empowering scientific progress: the vital role of open‑access, peer‑reviewed methods and protocols Chiara Cilibrasi1*  Abstract  In the ever-evolving landscape of scientific research, the importance of detailed, accessible methods and step-by-step reusable protocols cannot be overstated. In alignment with this BMC Methods, is dedicated to facilitating the dissemi- nation of open-access, peer-reviewed novel experimental procedures, techniques, and methodologies to promote reproducibility, transparency, and the advancement of scientific methods in the natural sciences. Main In the ever-evolving landscape of scientific research, the importance of detailed, accessible methods and step-by- step reusable protocols cannot be overstated. They are essential for reproducibility, as well as trust in science and scientific advancement. Despite progress in open science, particularly in areas like open access publications, open data, and open code, advances in open methods have lagged behind [1]. This discrepancy raises concerns because the lack of openly accessible detailed methods undermines trust in pub- lished data and severely limits the adoption of new meth- odologies, as well as the use of data. Addressing this challenge requires a cultural shift within the scientific community and a commitment to promoting transpar- ency, openness, and collaboration in research practices. In alignment with this, BMC Methods  (https://​bmcme​ thods.​biome​dcent​ral.​com/)  is dedicated to facilitating the dissemination of open-access, peer-reviewed novel experimental procedures, techniques, and methodolo- gies to promote reproducibility, transparency, and the advancement of scientific methods in the natural sci- ences. To assist our authors in effectively showcasing their innovative techniques and procedures, BMC Meth- ods offers two primary article types, Methodology Arti- cles and Protocols. These article types serve to facilitate the dissemination of innovative experimental and com- putational methods or provide detailed step-by-step descriptions of experimental techniques, respectively. This approach will then enable our readers to scruti- nise, validate, and build upon easily accessible and peer- reviewed methodologies, establishing a foundation of shared knowledge that elevates the integrity of scientific pursuits. We also acknowledge the scientific community’s demand for living protocols, recognizing that the ques- tion about protocols is generally not whether they will change, but when and how they will evolve or be adapted by others. In collaboration with protocols.io (https://​ www.​proto​cols.​io/), we facilitate the deposition of proto- cols on their dynamic platform. This enables versioning or forking as they evolve or are adapted by other research groups, preserving an original version that undergoes peer review and is published with us. Additionally, we offer the opportunity for researchers to publish proto- col extensions in cases of significant advancements or adaptations. Open Access © The Author(s) 2024. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. BMC Methods *Correspondence: Chiara Cilibrasi [email protected] 1 Springer Nature, The Campus, 4 Crinan Street, London N1 9XW, UK Page 2 of 2 Cilibrasi BMC Methods (2024) 1:1 We firmly believe that BMC Methods will play a piv- otal role in addressing the pressing issue of inadequate reporting of methods, a primary factor contributing to the widely recognized ‘reproducibility crisis’. Coined in the early 2010s, this term refers to a significant challenge faced by the scientific community, where a substantial number of published scientific studies and experiments cannot be reliably reproduced by other researchers [2]. A 2016 survey by Nature on 1,576 researchers who took a brief online questionnaire on reproducibility, found that more than 70% of researchers have tried and failed to reproduce another scientist’s experiment results and more than half have failed to reproduce their own experi- ments [3]. Additionally, the “Reproducibility Project: Cancer Biology” sought to replicate findings from 193 high profile experiments in cancer research [4]. No paper contained sufficient methodological details to allow researchers to design and conduct a replication study. Contact with authors was always required to design and conduct replication studies, and many authors were not able to provide helpful information. These examples clearly demonstrate that research findings are important but not useful if the methods used to generate the data are not accessible or not sufficiently detailed to allow reproducibility, understanding and trust. In conclusion BMC Methods, as the first Springer Nature open-access, peer-reviewed journal that will focus on providing updates in methods and lab proto- cols, aims to position itself at the forefront of the cultural shift that will eventually result in elevating the quality and rigour of scientific research. We warmly encourage you to submit your methodologies and step-by-step reus- able protocols to our journal (https://​submi​ssion.​sprin​ gerna​ture.​com/​new-​submi​ssion/​44330/3), embracing the transformative potential of open-access and peer-review to methodologies and protocols, propelling science into a future marked by reproducibility, continual progress and shared discovery. Acknowledgements Not applicable. Authors’ contributions CC conceived and drafted the manuscript. CC read and approved the final manuscript. Funding Not applicable. Availability of data and materials No datasets were generated or analysed during the current study. Declarations Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Competing interests CC is an employee of Springer Nature and the Editor for BMC Methods. Received: 18 January 2024 Accepted: 22 January 2024 References 1. Leite SB, Brooke M, Carusi A, Collings A, Deceuninck P, Dechamp J-F, et al. Promoting Reusable and Open Methods and Protocols (PRO-MaP): Draft recommendations to improve methodological clarity in life sciences publications. OSF Preprints. 2023. Available from: osf.​io/​x85gh. 2. Pashler H, Harris CR. Is the Replicability Crisis Overblown? Three Argu- ments Examined. Perspect Psychol Sci. 2012;7(6):531–6. 3. Baker M. 1,500 scientists lift the lid on reproducibility". Nature (News Feature). Springer Nature. 2016;533(7604):452–4. 4. Errington TM, Denis A, Perfito N, Iorns E, Nosek BA. Challenges for assess- ing replicability in preclinical cancer biology. eLife. 2021;10:e67995. https://​doi.​org/​10.​7554/​eLife.​67995. Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in pub- lished maps and institutional affiliations.

Title: Empowering scientific progress: the vital role of open-access, peer-reviewed methods and protocols ​ Authors: Chiara Cilibrasi Publisher: Springer Nature ​ Date: 2024-01-22 00:00:00 Abstract: In the ever-evolving landscape of scientific research, the importance of detailed, accessible methods and step-by-step reusable protocols cannot be overstated. ​ In alignment with this BMC Methods, is dedicated to facilitating the dissemination of open-access, peer-reviewed novel experimental procedures, techniques, and methodologies to promote reproducibility, transparency, and the advancement of scientific methods in the natural sciences. ​



A Novel Hierarchical High‐Dimensional Unsupervised Active Learning Method.pdf

Vol.:(0123456789) International Journal of Computational Intelligence Systems (2024) 17:193 https://doi.org/10.1007/s44196-024-00601-w RESEARCH ARTICLE A Novel Hierarchical High‑Dimensional Unsupervised Active Learning Method Sajad Haghzad Klidbary1   · Mohammad Javadian2 Received: 11 March 2024 / Accepted: 10 July 2024 © The Author(s) 2024 Abstract This paper processes a novel hierarchical high-dimensional clustering algorithm based on the Active Learning Method (ALM), which is a fuzzy-learning algorithm. The hierarchical part of the algorithm is composed of two phases: divisible and agglomerative. The divisible phase, a zooming-in-process, searches for sub-clusters in already-found clusters hierarchically. At each level of the hierarchy, the clusters are found by an ensemble clustering method based on the density of data. This part of the algorithm blurs each data point as multiple one-dimensional fuzzy membership functions called ink-drop patterns; then, it accumulates the ink-drop patterns of all data points on every dimension separately. Next, it performs one-dimensional density partitioning to produce an ensemble of clustering solutions; after that, combining the results is done based on a novel consensus method with the aid of prime numbers. An agglomerative phase is a bottom-up approach that merges clusters based on a novel distance metric, named K2-nearest neighbor. The algorithm is named as the Hierarchical High-Dimensional Unsupervised Active Learning Method (HiDUALM) and is explained in more detail throughout this paper. Although the classical clustering methods are not suitable for high-dimensional data clustering, the proposed method solves the problems related to speed and memory using ensemble learning, while due to its hierarchy and the use of different distance criteria, different levels of the cluster provide the clause. Experiments on synthetic and real-world datasets are presented to show the effectiveness of the proposed-clustering algorithm. Keywords  Machine learning (ML) · Ensemble clustering · High-dimensional clustering · Hierarchical clustering · Unsupervised active learning method (ALM) · Noise elimination Abbreviations 1-D-MF One-dimensional-membership function ALM Active learning method AMI Adjusted mutual information APCGR​ Adaptive projected clustering with graph regularization ARI Adjusted rand index CLIQUE Clustering in QUEst DBSCAN Density-based spatial clustering of applications with noise DOC Density-based optimal projective clustering DPC Discriminative projected clustering EPCH Efficient projective clustering by histograms FCM Fuzzy C-means FUALM Fuzzy unsupervised active learning method HiDUALM Hierarchical high-dimensional unsupervised active learning method IDS Ink drop spread Ir Ink radius IRFLLRR Iterative reweighted Frobenius norm regularized latent low rank representation IRFN Iterative reweighted Frobenius norm LatLRR Latent LRR (low rank representation) LPFCM Locality preserving based fuzzy C-means MAFIA Merging of adaptive finite intervals MV-RTSC Multi-view robust tensor-based subspace clustering NP Narrow path PROCLUS PROjected CLUstering RI Rand index SP Spread UALM Unsupervised active learning method * Sajad Haghzad Klidbary [email protected] 1 Faculty of Engineering, Department of Electrical and Computer Engineering, University of Zanjan, Zanjan, Iran 2 School of Electrical Engineering, Shahid Beheshti University, Tehran, Iran International Journal of Computational Intelligence Systems (2024) 17:193 193   Page 2 of 26 1  Introduction Clustering is unsupervised learning that categorizes similar data into the same category. Various clustering algorithms with different capabilities and structures have been proposed [1–6]. In high-dimensional data, each object has a large num- ber of features. Examples of high-dimensional data types can be found in computer vision applications, pattern recognition [7], and molecular biology [8]. Scalability is one of the major issues in clustering algorithms which often cause difficulties when facing problems with high-dimensional datasets [3, 5, 9]. High- dimensional data, suffers from the curse of dimension- ality. In high-dimensional datasets, the distance between data points become practically indifferentiable. Therefore, it is hard to separate similar data points from dissimilar ones. Some clustering algorithms suffer from high time and space complexity to cluster high-dimensional datasets, which usually results in malfunctioning of the algorithms. In addition to these problems, high-dimensional data has many irrelevant features, meaning clusters are embedded in the subspaces of the entire feature space. Traditional clustering algorithms, such as K-means, hierarchical clus- tering, and DBSCAN, UALM [10], and FUALM [11]are not originally designed for high-dimensional data, and they often failed when applied to such datasets due to the “curse of dimensionality”. Therefore, many concepts are proposed for clustering high-dimensional data, such as: projected clustering, subspace clustering, multi-view clustering (MVC), ensemble clustering and hierarchical clustering for high-dimensional data. Subspace-clustering algorithms, projected clustering algorithms [12–15] and MVC are introduced to tackle with high-dimensional clustering difficulties. The main goal of these algorithms is to find clusters within subspaces of the entire feature space. The subspace-clustering goal is to find all clusters in all subspaces, which means that a data point may belong to multiple clusters [16]. This phenomenon results in overlapping clusters. On the other hand, projected clustering, allocates each point to a unique cluster, thus resulting in non-overlapping clusters. Subspace and projected clustering algorithms have their drawbacks. As subspace- clustering-algorithms produce many large numbers of overlapping clusters, the interpretation of the result is complicated. Despite producing non-overlapping clusters, the projected clustering algorithms still have two limitations. First, the resulting subspace clusters have different dimensionality. Second, they are vulnerable to finding clusters of different shapes and densities [17]. MVC is a subspace clustering that aims to group similar subjects and separate dissimilar subjects by utilizing multiple sources of feature information. The goal is to find consistent clustering across different views. There are two main categories of existing MVC methods: generative (or model-based) approaches and discriminative (or similarity-based) approaches. Generative approaches focus on learning the data distribution and exploit generative models to represent each cluster. Discriminative approaches optimize an objective function that involves pairwise similarities to maximize the average similarity between clusters and minimize the average similarity within clusters [18]. In addition, some of these algorithms have growing time complexity as the dimensions of the datasets increase. Hence, subspace, projected, and MVC clustering have some restrictions in dealing with high-dimensional data. These restrictions of subspace-clustering algorithms show that a flexible high-dimensional clustering algorithm with a reasonable degree of generality is needed. Ensemble clustering is developed as an essential expansion of the classical clustering problem. It overcomes the challenges faced by high-dimensional data and obtains high performance on various datasets. In the face of high-dimensional data; it divides the space into a series of subspaces and clusters each subspace separately. Clustering on the subspace reduces the complexity of clustering. Ensemble clustering combines the results of different clustering on a particular dataset, and finds a single (consensus) clustering result that is better in some sense than existing cluster- ing. Therefore, ensemble clustering integrates clustering results on the same dataset from different sources. In ensemble cluster- ing, finding the final cluster for each point is an NP-complete problem [16]. Hierarchical clustering is a method of clustering high- dimensional data that seeks to build a hierarchy of clus- ters. There are two strategies for hierarchical clustering: agglomerative and divisive. Agglomerative strategy is a “bottom-up” approach, in which each data start in its clus- ter, and clusters are merged hierarchically until all data fall into one cluster. Divisive strategy is a “top-down” approach, where all data start in one cluster, and the clus- ter is split hierarchically until each data fall into a separate cluster. The results of hierarchical clustering are usually presented in a dendrogram. Majority of the mentioned clustering algorithms require the number of clusters to be known in advance while this is not compatible with the nature of many clustering prob- lems. In this paper, we have used ensemble clustering along with hierarchical clustering to overcome problems associated with high-dimensional datasets. The proposed algorithm does not need the number of clusters as an input parameter. The algorithm is developed based on the con- cepts of the Active Learning Method (ALM) [19], while improves the UALM and FUALM-clustering algorithms developed for low-dimensional datasets. International Journal of Computational Intelligence Systems (2024) 17:193 193   Page 24 of 26 not unique prime numbers.” We provide a counterexample to show that the statement is not correct. Counterexample: For a two-dimensional dataset, if the labels of one-dimension are 1, 2, 3 and the labels of another dimension are 4, 5, 6, the results of multiplying the labels will not be unique for each cluster. As shown in Fig. 17a, the labels of two separate partitions are the same and are wrongly considered as one cluster. Therefore, if we want a unique label (multiplication product) for each cluster, the initial labels must be unique prime numbers. Figure 17b shows the same example, while the initial labels are unique prime numbers. As it is shown, the multiplication product for each partition is unique. Acknowledgements  All the experiments and ideas of this research work have been developed in Computer Engineering Department, University of Zanjan, IRAN. Authors Contributions  All authors have accepted responsibility for the entire content of this manuscript and approved its submission. Funding  The author(s) received no financial support for the research, authorship, and/or publication of this paper. Data Availability  The data that support the findings of this study are available from the corresponding author, upon reasonable request. Declarations  Conflict of interest  The authors declare that they have no conflicts of interest with respect to the research, authorship, contribution, and/or publication of this paper. Ethical Approval  This manuscript has not been published nor is it currently under consideration for publication elsewhere. Open Access  This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creat​iveco​mmons.​ org/​licen​ses/​by/4.​0/. References 1. Ezugwu, A.E., et al.: A comprehensive survey of clustering algorithms: state-of-the-art machine learning applications, taxonomy, challenges, and future research prospects. Eng. Appl. Artif. Intell. 110, 104743 (2022) 2. Ray, P., Reddy, S.S., Banerjee, T.: Various dimension reduction techniques for high dimensional data analysis: a review. Artif. Intell. Rev. 54, 3473–3515 (2021) 3. Gan, G., Ma, C., Wu, J.: Data Clustering: Theory, Algorithms, and Applications. SIAM, Philadelphia (2020) 4. Han, J., Pei, J., Tong, H.: Data Mining: Concepts and Techniques. Morgan Kaufmann, Burlington (2022) 5. Jahirabadkar, S., Kulkarni, P.: Clustering for high dimensional data: density based subspace clustering algorithms. Int. J. Comput. Appl. 63(20), 29–35 (2013) 6. Gaur, D., Gaur, S.: Comprehensive analysis of data clustering algorithms. Future Inf. Commun. Technol. Appl. ICFICE 2013, 753–762 (2013) 7. Wang, S., et  al.: Learning deep sparse regularizers with applications to multi-view clustering and semi-supervised classification. IEEE Trans. Pattern Anal. Mach. Intell. 44(9), 5042–5055 (2021) 8. Grabski, I.N., Street, K., Irizarry, R.A.: Significance analysis for clustering with single-cell RNA-sequencing data. Nat. Methods 86, 1–7 (2023) 9. Yan, F., et al.: Adaptive multi-view subspace clustering for high- dimensional data. Pattern Recognit. Lett. 130, 299–305 (2020) 10. Javadian, M., Shouraki, S.B.: UALM: unsupervised active learning method for clustering low-dimensional data. J. Intell. Fuzzy Syst. 32(3), 2393–2411 (2017) 11. Javadian, M., Shouraki, S.B., Kourabbaslou, S.S.: A novel density-based fuzzy clustering algorithm for low dimensional feature space. Fuzzy Sets Syst. 318, 34–55 (2017) 12. Agrawal, R., et  al.: Automatic subspace clustering of high dimensional data for data mining applications. In: Proceedings of the 1998 ACM SIGMOD International Conference on Management of Data (1998) 13. Goil, S., Nagesh, H., Choudhary, A.: Mafia: E±cient and scalable subspace clustering for very large data sets. In: Proceedings of 5th ACM SIGKDD International Conference on Knowledge Discovery and Data Mining, Citeseer. (1999) 14. Aggarwal, C.C., et al.: Fast algorithms for projected clustering. ACM SIGMOD Rec. 28(2), 61–72 (1999) 15. Agarwal, P., Mehta, S.: Analyzing subspace clustering approaches for high dimensional data. Artif. Intell. Sustain. Ind. 4, 169–195 (2021) 16. Moise, G., Sander, J., Ester, M.: Robust projected clustering. Knowl. Inf. Syst. 14, 273–298 (2008) 17. Achtert, E., et al.: Detection and visualization of subspace cluster hierarchies. In: Advances in Databases: Concepts, Systems and Applications: 12th International Conference on Database Systems for Advanced Applications, DASFAA 2007, Bangkok, Thailand, April 9–12, 2007. Proceedings 12. Springer (2007) 18. Chao, G., Sun, S., Bi, J.: A survey on multiview clustering. IEEE Trans. Artif. Intell. 2(2), 146–168 (2021) 19. Shouraki, S.B., Honda, N.: Recursive fuzzy modeling based on fuzzy interpolation. J. Adv. Comput. Intell. Intell. Inform. 3(2), 114–125 (1999) 20. Liu, Z., et al.: LatLRR for subspace clustering via reweighted Frobenius norm minimization. Expert Syst. Appl. 224, 119977 (2023) 21. Nie, F., et al.: Discriminative projected clustering via unsupervised LDA. IEEE Trans. Neural Netw. Learn. Syst. 34, 9466–9480 (2022) 22. Xue, J., Zhang, B.: Adaptive projected clustering with graph regularization. In: 2022 26th International Conference on Pattern Recognition (ICPR), IEEE (2022) 23. Zhou, J., et al.: Projected fuzzy C-means clustering with locality preservation. Pattern Recognit. 113, 107748 (2021) 24. Al-Sharoa, E.M., Al-Wardat, M.A.: Multi-view robust tensor- based subspace clustering. IEEE Access 10, 134292–134306 (2022) 25. Golalipour, K., et al.: From clustering to clustering ensemble selection: A review. Eng. Appl. Artif. Intell. 104, 104388 (2021) International Journal of Computational Intelligence Systems (2024) 17:193 Page 25 of 26  193 26. Alqurashi, T., Wang, W.: Clustering ensemble method. Int. J. Mach. Learn. Cybern. 10, 1227–1246 (2019) 27. Yan, D., et al.: K-nearest neighbor search by random projection forests. IEEE Trans. Big Data 7(1), 147–157 (2019) 28. Ünlü, R., Xanthopoulos, P.: Estimating the number of clusters in a dataset via consensus clustering. Expert Syst. Appl. 125, 33–39 (2019) 29. Sevillano, X., Socoró, J.C., Alías, F.: Parallel hierarchical architectures for efficient consensus clustering on big multimedia cluster ensembles. Inf. Sci. 511, 212–228 (2020) 30. Gionis, A., Mannila, H., Tsaparas, P.: Clustering aggregation. ACM Trans. Knowl. Discov. Data (TKDD) 1(1), 4 (2007) 31. He, Y., Wang, J., Qin, L., Mei, L., Shang, Y., Wang, W.: A HK clustering algorithm based on ensemble learning, pp. 276–281 (2013) 32. Paithankar, R., Tidke, B.: A HK clustering algorithm for high dimensional data using ensemble learning.arXiv preprint arXiv:​ 1501.​02431 (2015) 33. Tidke, B., Mehta, R., Rana, D.: A novel approach for high dimensional data clustering. Int. J. Eng. Sci. Adv. Technol. (IJESAT) 2(3), 645–651 (2012) 34. Huang, Q., Gao, R., Akhavan, H.: An ensemble hierarchical clustering algorithm based on merits at cluster and partition levels. Pattern Recognit. 136, 109255 (2023) 35. Bagherinia, A., et al.: Elite fuzzy clustering ensemble based on clustering diversity and quality measures. Appl. Intell. 49, 1724–1747 (2019) 36. Fern, X.Z., Lin, W.: Cluster ensemble selection. Stat. Anal. Data Min. ASA Data Sci. J. 1(3), 128–141 (2008) 37. Deegalla, S., et al.: Random subspace and random projection nearest neighbor ensembles for high dimensional data. Expert Syst. Appl. 191, 116078 (2022) 38. Kriegel, H.-P., Zimek, A.: Subspace clustering, ensemble clustering, alternative clustering, multiview clustering: what can we learn from each other. In: Proceeding of ACM SIGKDD Workshop MultiClust (2010) 39. Najafi, F., et al.: A new ensemble clustering method based on fuzzy cmeans clustering while maintaining diversity in ensemble. Signal Data Process 17, 103–122 (2021) 40. Li, F., et  al.: Fuzzy ensemble clustering based on self co-association and prototype propagation. IEEE Trans. Fuzzy Syst. 31, 3610–3623 (2023) 41. Ghosh, J., Acharya, A.: Cluster ensembles. Wiley Interdiscip. Rev. Data Min. Knowl. Discov. 1(4), 305–315 (2011) 42. Das, A.K., Das, P.: Graph based ensemble classification for crime report prediction. Appl. Soft Comput. 125, 109215 (2022) 43. Zhou, P., et al.: Clustering ensemble via structured hypergraph learning. Inf. Fusion 78, 171–179 (2022) 44. Coleman, S., Kirk, P.D., Wallace, C.: Consensus clustering for Bayesian mixture models. BMC Bioinform. 23(1), 1–21 (2022) 45. Wang, Z., et al.: Cluster ensemble selection using balanced normalized mutual information. J. Intell. Fuzzy Syst. 39(3), 3033–3055 (2020) 46. Mienye, I.D., Sun, Y., Wang, Z.: An improved ensemble learning approach for the prediction of heart disease risk. Inform. Med. Unlocked 20, 100402 (2020) 47. Abramowicz, K., de Luna, S.S., Strandberg, J.: Nonparametric bagging clustering methods to identify latent structures from a sequence of dependent categorical data. Comput. Stat. Data Anal. 177, 107583 (2023) 48. Dogan, A., Birant, D.: K-centroid link: a novel hierarchical clustering linkage method. Appl. Intell. 52, 5537–5560 (2022) 49. Murakami, M.: Practicality of modeling systems using the IDS method: performance investigation and hardware implementation (2008) 50. Merrikh-Bayat, F., Shouraki, S.B., Rohani, A.: Memristor crossbar-based hardware implementation of the IDS method. IEEE Trans. Fuzzy Syst. 19(6), 1083–1096 (2011) 51. Murakami, M., Honda, N.: A study on the modeling ability of the IDS method: a soft computing technique using pattern-based information processing. Int. J. Approx. Reason. 45(3), 470–487 (2007) 52. Afrakoti, I.E.P., et al.: Using a memristor crossbar structure to implement a novel adaptive real-time fuzzy modeling algorithm. Fuzzy Sets Syst. 307, 115–128 (2017) 53. Bahrpeyma, F., Cranganu, C., Dadaneh, B.Z.: Active learning method for estimating missing logs in hydrocarbon reservoirs. In: Artificial Intelligent Approaches in Petroleum Geosciences, pp. 209–224. Springer, Cham (2015) 54. Ghorbani, M.J., Choudhry, M.A., Feliachi, A.: Distributed multi-agent based load shedding in power distribution systems. In: 2014 IEEE 27th Canadian Conference on Electrical and Computer Engineering (CCECE), IEEE (2014) 55. Klidbary, S.H., Shouraki, S.B., Afrakoti, I.E.P.: An adaptive efficient memristive ink drop spread (IDS) computing system. Neural Comput. Appl. 31, 7733–7754 (2019) 56. Klidbary, S.H., et al.: Outlier robust fuzzy active learning method (ALM). In: 2017 7th International Conference on Computer and Knowledge Engineering (ICCKE), IEEE (2017) 57. Shahdi, S.A., Shouraki, S.B.: Supervised active learning method as an intelligent linguistic controller and its hardware implementation. In: 2nd IASTEAD International Conference on Artificial Intelligence and Applications (AIA'02), Malaga, Spain (2002) 58. Sakurai, Y.: A study of the learning control method using PBALM-a nonlinear modeling method. PhD, The University of Electro-Communications, Tokyo (2005) 59. Firouzi, M., Shouraki, S.B., Conradt, J.: Sensorimotor control learning using a new adaptive spiking neuro-fuzzy machine, spike-ids and STDP. In: Artificial Neural Networks and Machine Learning–ICANN 2014: 24th International Conference on Artificial Neural Networks, Hamburg, Germany, September 15–19, 2014. Proceedings 24. Springer (2014) 60. Bahrpeyma, F., Zakerolhoseini, A., Haghighi, H.: Using IDS fitted Q to develop a real-time adaptive controller for dynamic resource provisioning in Cloud’s virtualized environment. Appl. Soft Comput. 26, 285–298 (2015) 61. Murakami, M., Honda, N.: Classification performance of the IDS method based on the two-spiral benchmark. In: 2005 IEEE International Conference on Systems, Man and Cybernetics, IEEE (2005) 62. Firouzi, M., Shouraki, S.B., Afrakoti, I.E.P.: Pattern analysis by active learning method classifier. J. Intell. Fuzzy Syst. 26(1), 49–62 (2014) 63. Jokar, E., et al.: Hardware-algorithm co-design of a compressed fuzzy active learning method. IEEE Trans. Circuits Syst. I Regul. Pap. 67(12), 4932–4945 (2020) 64. Klidbary, S.H., Shouraki, S.B., Linares-Barranco, B.: Digital hardware realization of a novel adaptive ink drop spread operator and its application in modeling and classification and on-chip training. Int. J. Mach. Learn. Cybern. 10, 2541–2561 (2019) 65. Klidbary, S.H., Shouraki, S.B.: A novel adaptive learning algorithm for low-dimensional feature space using memristor- crossbar implementation and on-chip training. Appl. Intell. 48(11), 4174–4191 (2018) 66. Javadian, M., et al.: Refining membership degrees obtained from fuzzy C-means by re-fuzzification. Iran. J. Fuzzy Syst. 17(4), 85–104 (2020) International Journal of Computational Intelligence Systems (2024) 17:193 193   Page 26 of 26 67. Javadian, M., Hejazi, A., Klidbary, S.H.: Obtaining fuzzy membership function of clusters with the memristor hardware implementation and on-chip learning. IEEE Trans. Emerg. Top. Comput. Intell. 6(4), 1008–1025 (2022) 68. Zaki, M.J., Meira, W.: Data Mining and Analysis: Fundamental Concepts and Algorithms. Cambridge University Press, Cambridge (2014) 69. Xu, Q., et al.: Efficient synthetical clustering validity indexes for hierarchical clustering. Expert Syst. Appl. 151, 113367 (2020) 70. Rendón, E., et al.: Internal versus external cluster validation indexes. Int. J. Comput. Commun. 5(1), 27–34 (2011) Publisher's Note  Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Title: A Novel Hierarchical High-Dimensional Unsupervised Active Learning Method ​ Authors: Sajad Haghzad Klidbary, Mohammad Javadian ​ Publisher: International Journal of Computational Intelligence Systems ​ Date: 2024 ​ Abstract: This paper processes a novel hierarchical high-dimensional clustering algorithm based on the Active Learning Method (ALM), which is a fuzzy-learning algorithm. ​ The hierarchical part of the algorithm is composed of two phases: divisible and agglomerative. ​ The divisible phase, a zooming-in-process, searches for sub-clusters in already-found clusters hierarchically. ​ At each level of the hierarchy, the clusters are found by an ensemble clustering method based on the density of data. ​ This part of the algorithm blurs each data point as multiple one-dimensional fuzzy membership functions called ink-drop patterns; then, it accumulates the ink-drop patterns of all data points on every dimension separately. ​ Next, it performs one-dimensional density partitioning to produce an ensemble of clustering solutions; after that, combining the results is done based on a novel consensus method with the aid of prime numbers. ​ An agglomerative phase is a bottom-up approach that merges clusters based on a novel distance metric, named K 2-nearest neighbor. ​ The algorithm is named as the Hierarchical High-Dimensional Unsupervised Active Learning Method (HiDUALM) and is explained in more detail throughout this paper. ​ Although the classical clustering methods are not suitable for high-dimensional data clustering, the proposed method solves the problems related to speed and memory using ensemble learning, while due to its hierarchy and the use of different distance criteria, different levels of the cluster provide the clause. ​ Experiments on synthetic and real-world datasets are presented to show the effectiveness of the proposed-clustering algorithm. ​

A BCL2 promoter polymorphism rs2279115 is not associated with BCL2 protein expression or patient survival in breast cancer patients.pdf

RESEARCH Open Access A BCL2 promoter polymorphism rs2279115 is not associated with BCL2 protein expression or patient survival in breast cancer patients Claire J Searle1,2, Ian W Brock1, Simon S Cross3, Sabapathy P Balasubramanian4, Malcolm WR Reed4 and Angela Cox1* Abstract The B-cell CLL/lymphoma 2 (BCL2) gene family encodes pro- and anti-apoptotic proteins that are critical regulators of programmed cell death. Higher levels of BCL2 expression in breast tumours have been shown to be an independent prognostic factor for improved survival from breast cancer. The promoter single nucleotide polymorphism (SNP) rs2279115 has been associated with both BCL2 expression and patient survival. The aim of this study was to attempt to replicate these observations in a cohort of 1015 UK women with breast cancer, and to compare genotype frequencies in cases and controls. In this study, 1015 breast cancer cases and 1034 control subjects were genotyped for the rs2279115 SNP by 5’ nuclease PCR. Paraffin embedded tumour tissue for 342 case subjects was assembled into tissue microarrays, and the level of expression of BCL2 was established by immunohistochemistry. Kaplan Meier survival curves and Cox Proportional Hazards models were used to examine the effect of genotype on patient survival. The effect of SNP genotype on tumour BCL2 protein levels and breast cancer susceptibility was assessed by logistic regression. In this study higher BCL2 expression was significantly associated with improved survival from breast cancer (p = 0.015), in keeping with previous reports. The SNP rs2279115 was not found to be associated with tumour expression of BCL2, (p = 0.77), and neither was it associated with case/control status (p = 0.25). There was no significant association between the SNP and overall survival (p = 0.75). In conclusion, we found that higher tumour BCL2 expression is associated with improved survival from breast cancer, in keeping with previous studies. However, in contrast to a previous report, the promoter SNP rs2279115 was not associated with BCL2 expression or overall survival from breast cancer. Keywords: Breast cancer, BCL2, rs2279115, Survival, SNP Background The balance between cell proliferation and levels of apoptosis is frequently disrupted in tumours, with tumorigenesis being promoted by both the loss of pro- apoptotic signals and the gain of anti-apoptotic mechan- isms (Hanahan & Weinberg 2000; Hanahan & Weinberg 2011). The BCL2 family of proteins plays a crucial role in these processes, by integrating the complex pathways incorporating pro- and anti-apoptotic signals at the mitochondrial membrane (Tsujimoto 2002). The BCL-2 family can be categorised into anti-apoptotic and two pro-apoptotic subgroups. The anti-apoptotic members include BCL2 and Bcl-xL. The pro-apoptotic members can be divided into a “multi-BH domain” group includ- ing Bax and Bak and a BH3-only subgroup (Adams & Cory 2002). However, BCL2 itself seems to act as both an oncogene and a tumour suppressor gene in different tumour types. For example, higher levels of tumour BCL2 expression are associated with poor patient sur- vival from chronic lymphocytic leukaemia (CLL), but with improved survival from breast and colon cancer (Faderl et al. 2002) (Buglioni et al. 1999) (Callagy et al. 2008). The BCL2 gene consists of three exons and two pro- moters; it is located on chromosome 18q21.3. The SNP (rs2279115) is located in the inhibitory P2 promotor of * Correspondence: [email protected] 1Department of Oncology, CR-UK/YCR Sheffield Cancer Research Centre, University of Sheffield Medical School, Beech Hill Road, Sheffield, UK Full list of author information is available at the end of the article a SpringerOpen Journal © 2012 Searle et al.; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Searle et al. SpringerPlus 2012, 1:38 http://www.springerplus.com/content/1/1/38 the BCL2 gene (Park et al. 2004). The C allele in com- parison to the A allele displayed significantly increased inhibition of BCL2 promoter activity and binding of nu- clear proteins (Nuckel et al. 2007). In keeping with these findings BCL2 protein expression in B cells from CLL patients carrying the AA genotype was significantly increased compared with CC genotypes (Nuckel et al. 2007). This relationship was also demonstrated in rela- tion to lymph node negative breast cancer in one previ- ous study (Bachmann et al. 2007). In this study higher expression of BCL2 was associated with the A-allele (p = 0.044) and Kaplan-Meier survival analysis revealed a significant association of the AA genotype with improved survival (p = 0.030). This relationship has also been demonstrated in oropharyngeal squamous cell car- cinoma (Lehnerdt et al. 2009) where rs2279115 was sig- nificantly associated with BCL2 expression (p = 0.008) and with overall survival (p = 0.0247). This trend was also demonstrated in renal cancer (Hirata et al. 2009). Many studies have clearly demonstrated that increased BCL2 expression is associated with improved outcome from breast cancer (Yang et al. 2003) (Callagy et al. 2006) (Callagy et al. 2008). (Dawson et al. 2010) (Ali et al. 2012). A multivariate analysis incorporating five pub- lished studies from 11,212 breast cancer cases strongly supported the independent prognostic significance of BCL2 positivity with improved survival (Hazard Ratio (HR) 0.76, 95% Confidence Interval (CI) 0.54-0.74), p <0.001)(Dawson et al. 2010). In addition, expression of BCL2 has been proven to be an independent indicator of favourable prognosis for all types of early-stage breast cancer (Callagy et al. 2008; Dawson et al. 2010). The aim of this study was to use a cohort of breast cancer cases, from the Sheffield Breast Cancer Study (SBCS) to determine whether there is a relationship be- tween the promoter SNP rs2279115 and tumour protein levels of BCL2, and whether this corresponds to any dif- ferences in patient survival. We also confirmed the known association between high levels of tumour BCL2 and improved survival from breast cancer. Materials and methods Subjects Between November 1998 and January 2005, 1274 women with breast cancer and 1271 control subjects were en- rolled in the SBCS. The design and methodology of this case control study have been previously described (Rafii et al. 2002) (Azmy et al. 2004). Briefly, all subjects were residents of South Yorkshire, UK and were of European descent. The breast cancer cases all had histopathologic- ally confirmed breast cancer. The control subjects were women aged between 50 and 65 attending the Sheffield Mammography Screening Service between September 2000 and January 2004, whose mammograms showed no evidence of breast lesions. The study was approved by the South Sheffield Research Ethics Committee (SSREC/ 98/137), and the DNA samples were collected with informed consent from subjects for their use in genetic studies of cancer. Paraffin-embedded tumour tissue was requested from the relevant NHS Histopathology Arch- ive for 342 of the subjects recruited above. Pathological data (including tumour grade, morphology and lymph node status) were obtained from medical pathology records and validated (SSC). Immunohistochemical data for the oestrogen receptor (ER), progesterone receptor (PR), HER2 and cytokeratins 5/6 were available (Blows et al. 2010). Data on all-cause mortality and survival was obtained through the Trent Cancer Registry. Median follow-up for breast cancer cases in September 2009 was 21.6 years including 220 deaths. Determination of BCL2 rs2279115 genotype Blood DNA samples were available from 1015 breast cancer subjects and 1034 controls. These were geno- typed for the SNP rs2279115 using a Taqman 5’ nuclease PCR assay. The Probe sequence was as follows 5’- CTCCCCAGGAGAGAGACAGGGGAGA[G/T]GGGA CGATGAAGGAGCCGGGGACGG-3’, with the FAM probe containing T and the VIC probe containing G. The amplification reaction was performed in a final volume of 5 μL, with 1.0 μL of genomic DNA (10 ng), 0.125 μL of TaqMan™Genotyping Assay, 2.5 μL of Taqman Genotyping Master Mix, and 2.375 μL of water. The thermo- cycling conditions were as follows: 95°C for 10 min followed by 60 cycles of 92°C for 10 s and 60°C for 1 min. Allelic discrimination was carried out using the ABI 7900HT Sequence Detector (Life Technologies) The overall genotype call rate was 96% (980 cases and 981 controls successfully genotyped), and duplicate concordance based on 133 duplicate samples was 99.25%. The observed control genotype frequencies were consistent with Hardy Weinberg equilibrium (p = 0.76). BCL2 immunohistochemistry Tissue micro arrays were constructed from 342 archived paraffin embedded tumour samples from the cancer co- hort. Appropriate regions of tumour (judged by H.&.E staining) were selected from the blocks and 0.6 mm tripli- cate tissue cores were punched out from these regions using a custom precision instrument (Beecher Instrument Inc., Sun Prairie, US). These were then transferred into re- cipient paraffin blocks in a specific orientation. 5 μm sec- tions from the array blocks were dried, deparaffinised and rehydrated before blocking endogenous peroxidase with a solution of 2% hydrogen peroxide in methanol. The sec- tions were then subjected to antigen retrieval by micro- wave treatment in 10 Mm tri-sodium citrate. This was Searle et al. SpringerPlus 2012, 1:38 Page 2 of 8 http://www.springerplus.com/content/1/1/38 (Callagy et al. 2008) (Dawson et al. 2010). Anti-apoptotic BCL2 members act as repressors of apoptosis by block- ing the release of cytochrome c, whereas pro-apoptotic members act as promoters (Ghobrial et al. 2005). The contrasting effect on survival of tumour BCL2 expres- sion in breast cancer as opposed to non-Hodgkin lymph- oma may well be due to the importance of the careful equilibrium between tumour BCL2 protein expression and other pro-apoptotic members such as Bax, rather than on BCL2 tumour protein quantity alone (Reed 1997) (Cory et al. 2003). Unfortunately the exact mech- anism that underpins this difference is not fully under- stood. In vitro studies in a variety of different cell types have found that high levels of BCL2 protein expression in tumours can result in striking growth inhibition (Pietenpol et al. 1994). In human breast cancer cell lines there is an inverse correlation between the expression of BCL2 and mutant p53 and that this relationship could lead to down-regulation of BCL2 tumour protein expres- sion (Haldar et al. 1994). Other studies have suggested a function of BCL2 protein in lengthening the cell cycle (O’Reilly et al. 1996) (Knowlton et al. 1998) (Lipponen et al. 1995). The relationship between tumour BCL2 protein ex- pression and oestrogen has also been widely debated. It has been suggested that the intrinsic and extrinsic path- ways which make up the two main routes involved in breast cancer cell apoptosis regulation, are both induced when oestrogen binds to the oestrogen receptor. Both pathways result in the activation of caspase leading fi- nally to apoptosis (Lewis-Wambi & Jordan 2009). Leung and Wang found that a breast cancer cell line treated with the oestrogen 17β-oestradiol resulted in up- regulation of BCL2 mRNA and protein, but down- regulation of Bcl-x(L) mRNA and protein . They did not find this result with other sex hormones. They specu- lated that different members of the BCL2 family proteins may be regulated through different pathways and that these pathways may be modulated by 17β-oestradiol (Leung & Wang 1999). Tumour BCL2 protein expres- sion status has also been previously strongly associated with PR and ER expression (Nadler et al. 2008) (Lee et al. 1997). Our data are consistent with previous obser- vations that BCL2 is a strong independent prognostic marker for breast cancer survival (Dawson et al. 2010). The SNP rs2279115 has been associated with BCL2 expression in CLL and breast cancer from node negative patients (Bachmann et al. 2007). The study by Bachmann et al. found that higher expression of BCL2 was asso- ciated with the A-allele (P = 0.044) in lymph node negative patients only. This also corresponded to an improved survival in this group (HR (95% CI) 3.2 (1.03,9.93) p = 0.044). Lymph node negative patients who were homozygous for the C allele had a higher risk of death than AA homozygous patients, with heterozygous women being intermediate in risk. In the present data we found no association between rs2279115 and tumour expression of BCL2 in the whole cohort, or when results were subdivided into Table 2 Level of BCL2 protein expression according to lymph node status, tumour grade, morphology, ER, PR, HER2 and CK5/6 status Low BCL2 n (%) High BCL2 n (%) p valuea Node status No nodal Involvement 20 (64.5) 140 (70.0) Nodal Involvement 11 (35.5) 60 (30.0) 0.54 Grade 1 3 (8.8) 51 (24.9) 2 7 (20.6) 114 (55.6) 3 24 (70.6) 40 (19.5) 4x10-9 Morphology Ductal 28 (80.0) 159 (75.7) Lobular 2 (5.7) 22 (10.5) Other 5 (14.3) 29 (13.8) 0.68 ER status Negative 27 (79.4) 31 (15.3) Positive 7 (20.6) 171 (84.7) 1x10-14 PR status Negative 20 (62.5) 53 (26.6) Positive 12 (37.5) 146 (73.4) 5x10-5 HER2 status Negative 29 (82.9) 193 (92.3) Positive 6 (17.1) 16 (7.7) 0.07 CK5/6 status Negative 23 (67.6) 180 (90.5) Positive 11 (32.4) 19 (9.5) 0.0002 BCL2 immunohistochemistry scores were grouped into low (scores 0–1) and high (scores 2–3) a Pearson χ2 test. Table 3 Level of BCL2 protein expression of according to rs2279115 genotype Genotype Low BCL2 n (%) High BCL2 n (%) Odds Ratio 95% CI p value AA 12 (13.3) 78 (86.7) 1.00 AC 19 (15.6) 103 (84.4) 0.83 0.38 1.82 0.65 CC 4 (11.1) 32 (88.9) 1.23 0.37 4.10 0.74 TOTAL 35 (100) 213 (100.0) BCL2 immunohistochemistry scores were grouped into low (scores 0–1) and high (scores 2–3). Table 4 Genotype frequencies for SNP rs2279115 in case and control subjects Genotype controls n (%) cases n (%) Odds Ratio 95% CI p value AA 290 (29.6) 314 (32.0) 1.00 AC 475 (48.4) 477 (48.7) 0.93 0.76 1.14 0.47 CC 216 (22.0) 189 (19.3) 0.81 0.63 1.04 0.098 TOTAL 981 (100) 980 (100.0) Searle et al. SpringerPlus 2012, 1:38 Page 6 of 8 http://www.springerplus.com/content/1/1/38 patient with lymph node positive or lymph node negative disease. We also found no association with survival for the different genotypes. Assuming a base- line survival proportion of 0.84 in lymph node nega- tive cases, our study would have been expected to detect a hazard ratio of 3.2 between homozygous gen- otypes (as was found by Bachmann et al. 2007), hav- ing 80% power to detect hazard ratio of 1.8. However, we are unable to exclude effects smaller than this. It is possible that there may be genotypic effects on sur- vival of similar or smaller magnitude to those of BCL2 expression (Callagy et al. 2008; HR = 1.64); this study is underpowered to detect these. In conclusion we have no evidence to support the SNP rs2279115 as a prognostic biomarker for breast cancer patients. Higher BCL2 expression has been Figure 4 Kaplan-Meier survival functions according to rs2279115 genotype. Overall survival based on 934 case subjects with total time at risk 6765.43 years. Numbers at risk at the end of the 10-year analysis period were 158 (AA), 221 (AC), and 102 (CC). Hazard ratio (95% CI) 1.03 (0.86, 1.24), p = 0.75. Figure 5 Kaplan-Meier survival functions in lymph node negative and positive subjects according to rs2279115 genotype. Overall survival based on 786 subjects with total time at risk 5808.75 years. A shows lymph node negative subjects and B shows lymph node positive subjects. Numbers at risk at the end of the 10-year analysis period were A: 103 (AA), 146 (AC), 79 (CC) and B: 38 (AA), 54 (AC), 18 (CC). Hazard ratios (95% CI) for A were 0.97 (0.73, 1.30), p = 0.85 and for B were 1.20 (0.88, 1.64), p = 0.24. Searle et al. SpringerPlus 2012, 1:38 Page 7 of 8 http://www.springerplus.com/content/1/1/38 conclusively proven to correlate with improved survival and further studies are required to explore its use as a prognostic indicator. Competing interest The authors declare that they have no competing interests. Authors’ contribution The study was designed by AC and MWR. Patient diagnosis and recruitment, and clinical data collection was carried out by MWR and SPB. Pathology data collection and generation of tissue microarrays was carried out by SSC. Genotyping, immunohistochemistry, and scoring of the immunohistochemical data was carried out by CJS and IWB. CJS and AC performed statistical analyses and CJS and AC drafted the manuscript. All authors read and approved the final manuscript. Ethical standards All experiments completed as part of this study comply with the current laws in the United Kingdom. Acknowledgements This project was supported by Yorkshire Cancer Research awards S295 and S299. We would like to thank all the women who took part in the SBCS, and Helen Cramp and Dan Connley for patient recruitment and data management respectively. CJS was funded by an Academic Clinical Fellowship from the UK National Institute of Health Research. Author details 1Department of Oncology, CR-UK/YCR Sheffield Cancer Research Centre, University of Sheffield Medical School, Beech Hill Road, Sheffield, UK. 2Department of Clinical Genetics, Chapel Allerton Hospital, Chapeltown Road, Leeds, UK. 3Academic Unit of Pathology, Department of Neuroscience, University of Sheffield Medical School, Beech Hill Road, Sheffield, UK. 4Academic Unit of Surgical Oncology, CR-UK/YCR Sheffield Cancer Research Centre, University of Sheffield Medical School, Beech Hill Road, Sheffield, UK. Received: 12 September 2012 Accepted: 17 September 2012 Published: 23 October 2012 References Adams J, Cory S (2002) The BCL2 family: regulators of the cellular life-or-death switch. Nat Rev Cancer 2:647–656 Ali H et al (2012) A Ki67/BCL2 index based on immunohistochemistry is highly prognostic in ER-positive breast cancer. J Pathol 226(1):97–107 Azmy IA et al (2004) Role of tumour necrosis factor gne polymorphism (−308 and −238) in breast cancer susceptibility and severity. Breast Cancer Res 6: R395–R400 Azzato E et al (2009) Prevalent cases in observational studies of cancer survival: do they bias hazard ratio estimates? BJC 100:1806–1811 Bachmann HS et al (2007) The AA genotype of the regulatory BCL2 promoter polymorphism (938C > A) is associated with a favorable outcome in lymph node negative invasive breast cancer patients. Clin Cancer Res 13:5790–5797 Blows FM et al (2010) Subtyping of breast cancer by immunohistochemistry to investigate a relationship between subtype and short and long term survival: a collaborative analysis of data for 10,159 cases from 12 studies. PLoS Med 7 (5):e1000279. doi:10.1371/journal.pmed.1000279 Buglioni S et al (1999) Evaluation of multiple bio-pathological factors in colorectal adenocarcinomas: independent prognostic role of p53 and bcl-2. Int J Cancer 84:545–552 Callagy GM et al (2006) BCL2 is a prognostic marker in breast cancer independently of the Nottingham Prognostic Index. Clin Cncer Research 12:2468–2475 Callagy GM et al (2008) Meta-analysis confirms BCL2 is an independent prognostic marker in breast cancer. BMC Cancer 8:153 Cory S, Huang DC, Adams JM (2003) The Bcl-2 family: roles in cell survival and oncogenesis. Oncogene 22(53):8590–8607 Dawson SJ et al (2010) BCL2 in breast cancer: a favourable prognostic marker across molecular subtypes and independent of adjuvant therapy received. Br J Cancer 103(5):668–675 Faderl S et al (2002) Expression profile of 11 proteins and their prognostic significance in patients with chronic lymphocytic leukemia (CLL). Leukemia 16:1045–1052 Ghobrial IM, Witzig TE, Adjei AA (2005) Targeting apoptosis pathways in cancer therapy. CA Cancer J Clin 55:178–197 Haldar S et al (1994) Down-regulation of bcl-2 by p53 in breast cancer cells. Cancer Res 54(8):2095–2097 Hanahan D, Weinberg RA (2000) Hallmarks of cancer. Cell 100:57–70 Hanahan D, Weinberg RA (2011) Hallmarks of cancer: the next generation. Cell 144(5):646–674 Hirata H et al (2009) The bcl2 -938CC genotype has poor prognosis and lower survival in renal cancer. J Urol 182(2):721–727 Knowlton K et al (1998) Bcl-2 slows in vitro breast cancer growth despite its antiapoptotic effect. J Surg Res 76(1):22–26 Lee HD, Koo JY, Jung WH (1997) Correlations of bcl-2 expression with clinicopathological features in breast cancer. Yonsei Med J 38(4):206–211 Lehnerdt GF et al (2009) The regulatory BCL2 promoter polymorphism (−938C > A) is associated with relapse and survival of patients with oropharyngeal squamous cell carcinoma. Ann Oncol 20:1094–1099 Leung LK, Wang TT (1999) Paradoxical regulation of Bcl-2 family proteins by 17beta-oestradiol in human breast cancer cells MCF-7. Br J Cancer 81(3):387–392 Lewis-Wambi JS, Jordan VC (2009) Estrogen regulation of apoptosis: how can one hormone stimulate and inhibit? Breast Cancer Res 11(3):206 Lipponen P et al (1995) Apoptosis suppressing protein bcl-2 is expressed in well-differentiated breast carcinomas with favourable prognosis. J Pathol 177(1):49–55 McShane LM et al (2005) REporting recommendations for tumor MARKer prognostic studies (REMARK). Nat Clin Pract Oncol 2:416–422 Nadler Y et al (2008) Expression patterns and prognostic value of Bag-1 and Bcl-2 in breast cancer. Breast Cancer Res 10(2):R35 Nuckel H et al (2007) Association of a novel regulatory polymorphism (−938C > A) in the BCL2 gene promotor with disease progression and survival in chronic lymphocytic leukemia. Blood 109:290–297 O’Reilly LA, Huang DC, Strasser A (1996) The cell death inhibitor Bcl-2 and its homologues influence control of cell cycle entry. EMBO J 15(24):6979–6990 Park BL et al (2004) Identification of the variant in cycline D1 (CCND1) AND B-cell CLL/lymphoma 2 (BCL2). J Hum Genet 49:449–454 Pietenpol JA et al (1994) Paradoxical inhibition of solid tumor cell growth by bcl2. Cancer Res 54(14):3714–3717 Rafii S et al (2002) A potential role for the XRCC2 R188H polymorphic site in DNA-damage repair and breast cancer. Hum Mol Genet 11:1433–1438 Reed JC (1994) Bcl-2 and the regulation of programmed cell death. J Cell Biol 124(1–2):1–6 Reed JC (1997) Bcl-2 family proteins: regulators of apoptosis and chemoresistance in hematologic malignancies. Semin Hematol 34:9–19 Tsujimoto Y (2002) Bcl-2 family of proteins: life-or-death switch in mitochondria. Biosci Rep 22:47–58 Tsujimoto Y et al (1984) Cloning of the chromosome breakpoint of neoplastic B cells with the t(14;18) chromosome translocation. Science 226(4678):1097–1099 Yang Q et al (2003) Prognostic value of Bcl-2 in invasive breast cancer receiving chemotherapy and endocrine therapy. Oncol Rep 10:121–125 doi:10.1186/2193-1801-1-38 Cite this article as: Searle et al.: A BCL2 promoter polymorphism rs2279115 is not associated with BCL2 protein expression or patient survival in breast cancer patients. SpringerPlus 2012 1:38. Searle et al. SpringerPlus 2012, 1:38 Page 8 of 8 http://www.springerplus.com/content/1/1/38

Title: A BCL2 promoter polymorphism rs2279115 is not associated with BCL2 protein expression or patient survival in breast cancer patients ​ Authors: Claire J Searle, Ian W Brock, Simon S Cross, Sabapathy P Balasubramanian, Malcolm WR Reed, Angela Cox ​ Publisher: SpringerPlus Date: 23 October 2012 ​ Abstract: The B-cell CLL/lymphoma 2 (BCL2) gene family encodes pro-and anti-apoptotic proteins that are critical regulators of programmed cell death. ​ Higher levels of BCL2 expression in breast tumours have been shown to be an independent prognostic factor for improved survival from breast cancer. ​ The promoter single nucleotide polymorphism (SNP) rs2279115 has been associated with both BCL2 expression and patient survival. ​ The aim of this study was to attempt to replicate these observations in a cohort of 1015 UK women with breast cancer, and to compare genotype frequencies in cases and controls. ​ In this study, 1015 breast cancer cases and 1034 control subjects were genotyped for the rs2279115 SNP by 5’ nuclease PCR. ​ Paraffin embedded tumour tissue for 342 case subjects was assembled into tissue microarrays, and the level of expression of BCL2 was established by immunohistochemistry. ​ Kaplan Meier survival curves and Cox Proportional Hazards models were used to examine the effect of genotype on patient survival. ​ The effect of SNP genotype on tumour BCL2 protein levels and breast cancer susceptibility was assessed by logistic regression. ​ In this study higher BCL2 expression was significantly associated with improved survival from breast cancer (p = 0.015), in keeping with previous reports. ​ The SNP rs2279115 was not found to be associated with tumour expression of BCL2, (p = 0.77), and neither was it associated with case/control status (p = 0.25). ​ There was no significant association between the SNP and overall survival (p = 0.75). ​ In conclusion, we found that higher tumour BCL2 expression is associated with improved survival from breast cancer, in keeping with previous studies. ​ However, in contrast to a previous report, the promoter SNP rs2279115 was not associated with BCL2 expression or overall survival from breast cancer. ​

Transdifferentiation of MALME-3M and MCF-7 Cells toward Adipocyte-like Cells is Dependent on Clathrin-mediated Endocytosis.pdf

RESEARCH Open Access Transdifferentiation of MALME-3M and MCF-7 Cells toward Adipocyte-like Cells is Dependent on Clathrin-mediated Endocytosis Jaime Carcel-Trullols†, Cristóbal Aguilar-Gallardo†, Fernando Garcia-Alcalde, Miguel Angel Pardo-Cea, Joaquin Dopazo, Ana Conesa and Carlos Simón* Abstract: Enforced cell transdifferentiation of human cancer cells is a promising alternative to conventional chemotherapy. We previously identified albumin-associated lipid- and, more specifically, saturated fatty acid-induced transdifferentiation programs in human cancer cells (HCCLs). In this study, we further characterized the adipocyte-like cells, resulting from the transdifferentiation of human cancer cell lines MCF-7 and MALME-3M, and proposed a common mechanistic approach for these transdifferentiating programs. We showed the loss of pigmentation in MALME-3M cells treated with albumin-associated lipids, based on electron microscopic analysis, and the overexpression of perilipin 2 (PLIN2) by western blotting in MALME-3M and MCF-7 cells treated with unsaturated fatty acids. Comparing the gene expression profiles of naive melanoma MALME-3M cells and albumin-associated lipid-treated cells, based on RNA sequencing, we confirmed the transcriptional upregulation of some key adipogenic gene markers and also an alternative splicing of the adipogenic master regulator PPARG, that is probably related to the reported up regulated expression of the protein. Most importantly, these results also showed the upregulation of genes responsible for Clathrin (CLTC) and other adaptor-related proteins. An increase in CLTC expression in the transdifferentiated cells was confirmed by western blotting. Inactivation of CLTC by chlorpromazine (CHP), an inhibitor of CTLC mediated endocytosis (CME), and gene silencing by siRNAs, partially reversed the accumulation of neutral lipids observed in the transdifferentiated cells. These findings give a deeper insight into the phenotypic changes observed in HCCL to adipocyte-like transdifferentiation and point towards CME as a key pathway in distinct transdifferentiation programs. Disclosures: Simon C and Aguilar-Gallardo C are co-inventors of the International Patent Application No. PCT/EP2011/004941 entitled “Methods for tumor treatment and adipogenesis differentiation”. Keywords: Cell Transdifferentiation, Unsaturated Fatty Acids, PPARG, Perilipin 2, Loss of Pigmentation, Adipogenic Gene Markers, Clathrin, Clathrin-mediated Endocytosis Introduction Transdifferentiation involves reprogramming one type of adult cell into another mature cell type, without having to generate intermediary stem cells. It has received sig- nificant attention because it may have a considerable number of applications in cell and cancer therapy. Successful transdifferentiation from one cell type to another by overexpressing lineage-specific genes in vivo (Takeuchi & Bruneau 2009; Zhou et al. 2008) and in vitro (Graf & Enver 2009; Ieda et al. 2010) has been previously reported. Not only can cell transdifferentiation be enforced through the overexpression of the appropriate set of genes, but also through the application of specific molecules, which is a promising alternative to conven- tional chemotherapy for cancer treatment, for example, the use of all-trans-Retinoid acid (ATRA) for the treat- ment of acute promyelocitic leukemia (APL) (Kakizuka et al. 1991). The fact that there was no treatment based on cell differentiation therapy for solid tumors prompted us to study whether novel transdifferentiating molecules secreted by human embryonic stem cells (hESCs) could prevent cancer progression. Our studies showed that, * Correspondence: [email protected] †Equal contributors Bioinformatics and Genomics Department, Prince Felipe Research Centre (CIPF), Avda. Autopista del Saler, 16-3 46012, Valencia, Spain a SpringerOpen Journal © 2012 Carcel-Trullols et al.; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Carcel-Trullols et al. SpringerPlus 2012, 1:44 http://www.springerplus.com/content/1/1/44 irrespective of the presence of hESCs, albumin- associated lipids (albuMAXW), and specifically poly- and monounsaturated fatty acids (linoleic, oleic, petroselinic and palmitoleic acids) accounted for the transdifferentia- tion of several distinct human cancer cell lines (HCCLs) into adipocyte-like cells (Ruiz-Vela et al. 2011). Endocytosis regulates the entry of nutrients, hormones and signaling factors into the cell, and serves to regulate the internalization of transmembrane receptors. During endocytosis the plasma membrane invaginates to form a new intracellular vesicle containing various cargo mole- cules and material to be internalized from the external environment (Conner & Schmid 2003). Clathrin (CLTC)- mediated endocytosis (CME) is the major endocytic route and is assumed to regulate ligand mediated signal transduction by disrupting ligand-receptor interactions after their uptake into endosomal compartments (Andersson 2012). It can sequester the receptors in intra- cellular compartments, target ligand-receptor complexes to lysosomes for degradation, or recycle them by sending them back to the cell surface for re-use (Maxfield & McGraw 2004). Several in vitro studies have reported evidence for a relationship between the endocytosis of ligands such as Bone morphogenetic protein 2 (BMP2) and oxidized Low-density lipoprotein (ox-LDL), bound to their respective receptors, and their key roles in dif- ferent transdifferentiation models (Rauch et al. 2002; Yu et al. 2010). Others have shown that the incorporation of insulin regulated glucose transporter 4 (GLUT4) into the cell plasma membrane, a process required for adi- pogenesis, is dependent on clathrin coated vesicles (Huang et al. 2007). However, the existence of a direct correlation between endocytic ligand-receptor complex internalization and the transcription of genes controlling critical physiological events, such as cell transdifferentia- tion or adipogenesis, remains largely uninvestigated. Our previous report identified similar transdifferentia- tion programs in HCCLS of completely different origins such as in cells from ovarian carcinoma, hepatocarci- noma, breast adenocarcinoma and melanoma (Ruiz-Vela et al. 2011). In this study we aimed to characterize the adipocyte-like cells resulting from melanoma MALME-3M and breast carcinoma MCF-7 transdifferentiation pro- grams and to set the key pathways that were concomi- tantly affected in these programs. In order to document induced-transdifferentiation we report the loss of pig- mentation in MALME-3M cells, the upregulation of PLIN2 protein expression in the studied HCCLs and the upregulation of gene expression of PLIN2 and other commonly considered key adipogenic markers such as lipoprotein lipase (LPL) and peroxisome proliferator- activated receptor alpha (PPARA) in MALME-3M cells. These results also revealed an alternative gene splicing of the adipogenic master regulator PPARG that was likely to be related to the upregulation of the protein found in transdifferentiated MALME-3M cells, previously reported by our group (Ruiz-Vela et al. 2011). Most importantly, our results also showed an increase in Clathrin (CLTC) expression and we provided evidence that Clathrin- mediated Endocytosis (CME) was essential for the trans- differentiation programs of the breast adenocarcinoma and melanoma HCCLs we investigated into adipocyte-like cells. Materials and methods Cell culture and transfection MALME-3M melanoma (ATTC# HTB-64) and MCF-7 breast adenocarcinoma (ATTC#HTB-22) cells were cultured in growth media containing RPMI-1640, 10% fetal bovine serum (FBS) and 2 mM glutamine, follow- ing a standard 3 T3 protocol (Todaro & Green 1963). Albumin-associated lipids were obtained by adding GIBCOTM AlbuMAX II from Invitrogen at a concentra- tion of 1.6% w/v in RPMI media containing 10% FBS. To induce cell transdifferentiation, cells were cultured with albumin-associated lipids, whereas mock-treated cells were cultured in RPMI containing 10% FBS. After 24 hours cells were trypsinized, collected in plastic tubes and centrifuged at 5000 rpm. CLTC-targeted siRNA and scrambled siRNA (control siRNA) were obtained from Dharmacon (Dharmacon RNA i Technologies). Sequences from CLTC-targeted siRNA and control siRNA were commercially provided. Cells were seeded according to the manufacturer’s protocol in serum-containing media without antibiotics and transfected with either 50 nM siRNA or 50 nM control siRNA with DharmaFECT (Dharmacon RNA i Technolo- gies) in antibiotic-free media for 72 h. Gene expression analysis Whole genome transcriptional profiles of both control MALME-3M cells and transdifferentiated cells, after 24 hours incubation with albumin-associated lipids, were obtained by RNA-seq. Briefly, total RNA was purified from cell cultures using Quick-RNA MiniPrepTM (Zymo Research) protocol and strand-specific 38 nt pair-end Solexa libraries were prepared following the dUTP method (Parkhomchuk et al. 2009; Levin et al. 2010). Sequencing reads were mapped to the human genome (GRCh37/hg19 assembly) using Tophat 1.1.4 with stand- ard parameters and indicating the corresponding mate inner distance (46 bp for 0 h and 44 bp for 24 h) (Trapnell et al. 2009). Gene counts were estimated using htseq- count (http://www-huber.embl.de/users/anders/HTSeq) with standard parameters, using the human annotations obtained from Ensembl 60. Differentially expressed genes between MALME-3M and adipose cell types were estimated by means of the NOISeq non parametrical Carcel-Trullols et al. SpringerPlus 2012, 1:44 Page 2 of 12 http://www.springerplus.com/content/1/1/44 Izpisua Belmonte 2008) is far more complex than previ- ously anticipated. In addition to maintaining self- renewal and pluripotency in hESCs (Garcia-Gonzalo & Izpisua Belmonte 2008), a role for albumin (Kallee 1996) and its associated lipids (Davis & Dubos 1947; Thomas et al. 1995; Lafond et al. 1994) has been discovered in adipogenesis in other cell types (Schopfer et al. 2005). Our results also indicate that certain albumin complex associated poly- and monounsaturated fatty acids induce terminal differentiation and arrest cancer progression (Ruiz-Vela et al. 2011). Concomitanlty to our studies, Khan et al. have also described the specific growth inhib- ition of esters of oleic acid and ricinoleic acid against the human skin malignant melanoma cell line (SK-MEL-1) (Khan et al. 2012). Despite the important findings that we describe here, many key questions remain un- answered in the identification of novel genes and pro- teins that mediate the terminal transdifferentiation of human cancer cells. To get a better understanding of the mechanisms that lead to transdifferentiation we concen- trated our efforts on the role of those genes that are dif- ferentially regulated during the process. EM revealed a marked loss of pigmentation in the melanoma MALME-3M cells treated with albumin- associated lipids, in accordance with the downregulation of MLANA gene expression. Melan-A is known to form a complex with Pmel17 which affects its expression, sta- bility, trafficking, and the processing which is required for melanosome maturation. Its expression is indispens- able for Pmel17 function and the formation of cell pig- mentation (Hoashi et al. 2005). Quantification of gene expression by RNA-seq led to the characterization of the MALME-3M cells treated with albumin-associated lipids. Several adipocytic mar- kers such as PLIN2, LPL and PPARA were signifi- cantly upregulated. PPARA could be upregulated merely as a consequence of fatty acid accumulation as it has been shown to be involved in the regulation of obesity in rodents by increasing hepatic fatty acid oxi- dation (Kersten et al. 1999). LPL is a well describeda- dipocyte marker as it regulates the hydrolysis of triglycerides in the adipose tissue (Mead et al. 2002). Interestingly, PPARG1, an adipogenesis marker shown to be upregulated upon HCCL to adipocyte transdifferen- tiation (Ruiz-Vela et al. 2011), showed a differential map- ping pattern between the albumin-associated lipid-treated and non-treated cells. The PPARG gene has eight exons which are translated and spliced into different isoforms (http://www.ensembl.org/Homo_sapiens/Gene/Summary? g=ENSG00000132170;r=3:12328867–12475855), with the PPARG1 isoform being the primary transcript expressed in adipocytes. In treated cells, PPARG showed whole tran- script expression, while in mock-treated cells no expres- sion of exons 4 and 5 was evident (Additional file 3: Supporting information B). These two exons encode the Zinc finger binding site domain of the PPARG1 transcrip- tion factor (Finn et al. 2010). The lack or downregulation of these functional domains in the non-treated cells might be indicative of the differential processing of this gene in the MALME-3M cell lines and of differential expression of the protein (Ruiz-Vela et al. 2011). The characterization of the adipocyte-like cells showed that the expression of PLIN2 was increased in MALME- 3M, and in MCF-7 cells treated with albumin-associated lipids and with petroselinic acid. PLIN2 is a principal adi- pocytic marker, which coats lipid droplets in adipocytes (Brasaemle et al. 1997; Heid et al. 1998) and its expres- sion has been linked to PPARG1. We previously reported that PPARG1 expression was increased in MALME-3M cells treated with albumin-associated lipids (Ruiz-Vela et al. 2011). It has been recently reported that pretreat- ment of murine 3T3-L1 preadipocytes with Rosiglita- zone, a potent PPARG1 agonist, decreased lipolysis and increased PLIN2 expression (Kim et al. 2007). Quantification of gene expression by RNA-seq also gave us some clues about the possible mechanistic path- ways involved in transdifferentiation. Among the genes that were identified as differentially expressed between the treated and the untreated conditions, many of them were related to endocytic functions. Albumin-associated lipid induced transdifferentiation was accompanied by the upregulation of CLTC and other important adaptor- related complexes such as AP1B1, AP1G1, AP1S3, AP2A1, Synergin and AP3M1. Adaptor-related proteins (See figure on previous page.) Figure 5 Inhibition of CLTC levels by SiRNA affects LD biogenesis. After silencing CLTC expression, biogenesis was examined by Nile Red (C, D) quantification and Oil Red O semi-quantitative determination (E, F). Experiments were performed in MALME-3M cells (C and E) and in MCF-7 cells (D and F). Cells were transiently transfected with CONT (Control) SiRNA or with CLTC SiRNA for 72 hours prior to the addition of the vehicle 24 hours prior to cell lysation. Cell lysates were then separated in a 4-12% Bis-Tris gel and probed by western blotting with antibodies against CLTC and Actin. The experiment was repeated three times and a representative western blot is shown for MALME-3M cells (A) and for MCF-7 cells (B). For the neutral lipid determinations, after transfection, cells were treated with either the vehicle or petroselinic acid (100 μg/ml) for 24 hours prior to the testing. Nile Red (C, D) and Oil Red O and hematoxylin (E, F) staining were performed as described in Materials and Methods. Quantification was assessed using the FlowJo software. Fold induction was estimated by calculating the ratio between treated conditions (Petroselinic acid) and the untreated condition (vehicle). The average values from three independent analyses are shown. *P <0.05 compared to each control in C and D. Representative photos are shown in E and F. The length of the shown size bars is 20 μm. Carcel-Trullols et al. SpringerPlus 2012, 1:44 Page 10 of 12 http://www.springerplus.com/content/1/1/44 are key components of clathrin coated vesicles that can bind directly to both the clathrin lattice and to the lipid and protein components of membranes (Pearse et al. 2000). AP1 and AP3 are found at the coated vesicles located at the Golgi complex and it has been suggested that both associate with GLUT4 transporting vesicles and mediate distinct intracellular sorting events at the level of the TGN and endosomes in rat adipocytes (Gillingham et al. 1999). The observed upregulation of proteins involved in GLUT4 trafficking could be related to the acquisition of the adipocytic phenotype. Encouraged by the western blot results that showed a clear overexpression of CLTC protein in the transdif- ferentiated MCF-7 and MALME-3M cells, we decided to determine the role of CME in the adipogenic trans- differentiation process in MALME-3M and in MCF-7 cells. Transient CLTC silencing accomplished by siRNA, caused a significant reduction in LD accumulation induced by petroselinic acid, and further microscopic analysis of Oil Red O and hematoxylin stained cells sug- gested that not only LD accumulation but also neutral lipid composition in LDs was affected by CLTC silencing. So far no study has reported the induction of CLTC expression or CME stimulation by monounsaturated fatty acids, although polyunsaturated fatty acids have been found to play a role in the formation of synaptic vesicles and in promoting vesicle budding and mem- brane trafficking (Darios & Davletov 2006; Chernomor- dik et al. 1997; Chernomordik et al. 1999). It was recently reported that α-Synuclein expression, coupled with exposure to physiological levels of polyunsaturated fatty acids, enhanced CLTC mediated endocytosis in neuronal and non-neuronal cultured cells (Ben Gedalya et al. 2009). Transferrin receptor (TfR), whose gene expression was upregulated by a fold change of 3.33 in the albumin- associated lipid-treated MALME-3M cells (Table 1A), is internalized from the cell plasma membrane and recycled back to the cell plasma membrane specifically via CME (Hanover et al. 1984). El-Jack et al. reported that murine 3T3-L1 preadipocytes, in a differentiation media previ- ously described (Stephens et al. 1997), showed a gradual increase in whole cell TfR levels but a decrease in cell surface TfR levels (El-Jack et al. 1999). The results obtained in this study indicated that the differentiation process might account for the observed alterations in internalization and/or TfR recycling. These results may be useful in understanding why CME is of critical im- portance in HCCL to adipocyte transdifferentiation. The clarification of the roles played by the differen- tially expressed genes and proteins in the process of adi- pogenic transdifferentiation in HCCL cultures should provide the basic foundation to develop novel molecules for cancer therapy. Additional files Additional file 1: Supporting information A. Gene expression in the endocytic pathway and at the PPARG locus after treatment with albumin- associated lipids. (A) Downregulated and upregulated genes after treatment with albumin-associated lipids are colored in blue and red, respectively. Intensity is proportional to the log2 of the ratio between the two conditions. Significantly differentially expressed genes are indicated by bold box lines. Additional file 2: Supporting information B. Gene expression in the endocytic pathway and at the PPARG locus after treatment with albumin- associated lipids. (B) Mapped reads of gene expression at the PPARG locus are shown piled up on mapping positions. Expression at exons 4 and 5 in the PPARG1 transcript was observed only after albumin incubation. Additional file 3: Supporting information C. Electron Microscopy at high magnification of melanosome pigmentation in MALME-3M cells mock-treated or treated with Albumin-associated lipids. MALME-3M cells were mock-treated or treated with albumin-associated lipids for 24 hours. The arrows indicate the dark vesicles that are hallmarks of melanosomes and disappear upon albumin-associated lipid treatment. Competing interests Simon C and Aguilar-Gallardo C are co-inventors of the International Patent Application No. PCT/EP2011/004941 entitled “Methods for tumor treatment and adipogenesis differentiation”. Authors’ contributions C-T J and A-G C carried out the cell biology and molecular biology experiments, G-A F, P-C MA and C A participated in the deep sequencing experiments and S C and C-T J drafted the manuscript. All authors read and approved the final manuscript. Acknowledgements This work has been supported by the Regenerative Medicine Program of the CIPF and the Carlos III Institute of Health. Received: 14 August 2012 Accepted: 3 October 2012 Published: 30 October 2012 References Andersson ER (2012) The role of endocytosis in activating and regulating signal transduction. Cell Mol Life Sci 69(11):1755–1771 Ben Gedalya T, Loeb V, Israeli E, Altschuler Y, Selkoe DJ, Sharon R (2009) Alpha- synuclein and polyunsaturated fatty acids promote CLTC-mediated endocytosis and synaptic vesicle recycling. Traffic 10(2):218–234 Benjamini Y, Hochberg Y (1995) Controlling the false discovery rate: a practical and powerful approach to multiple testing. Journal of The Royal Statistical Society Series B 57:289–300 Brasaemle DL, Barber T, Wolins NE, Serrero G, Blanchette-Mackie EJ, Londos C (1997) Adipose differentiation-related protein is an ubiquitously expressed lipid storage droplet-associated protein. J Lipid Res 38(11):2249–2263 Chernomordik LV, Leikina E, Frolov V, Bronk P, Zimmerberg J (1997) An early stage of membrane fusion mediated by the low pH conformation of influenza hemagglutinin depends upon membrane lipids. J Cell Biol 136(1):81–93 Chernomordik LV, Leikina E, Kozlov MM, Frolov VA, Zimmerberg J (1999) Structural intermediates in influenza haemagglutinin-mediated fusion. Mol Membr Biol 16(1):33–42 Conner SD, Schmid SL (2003) Regulated portals of entry into the cell. Nature 422(6927):37–44 Darios F, Davletov B (2006) Omega-3 and omega-6 fatty acids stimulate cell membrane expansion by acting on syntaxin 3. Nature 440(7085):813–817 Davis BD, Dubos RJ (1947) The Binding of Fatty Acids by Serum Albumin, a Protective Growth Factor in Bacteriological Media. J Exp Med 86(3):215–228 De Maziere AM, Muehlethaler K, van Donselaar E, Salvi S, Davoust J, Cerottini JC et al (2002) The melanocytic protein Melan-A/MART-1 has a subcellular localization distinct from typical melanosomal proteins. Traffic 3(9):678–693 Carcel-Trullols et al. SpringerPlus 2012, 1:44 Page 11 of 12 http://www.springerplus.com/content/1/1/44 El-Jack AK, Kandror KV, Pilch PF (1999) The Formation of an Insulin-responsive Vesicular Cargo Compartment Is an Early Event in 3T3-L1 Adipocyte Differentiation. Mol Biol Cell 10(5):1581–1594 Finn RD, Mistry J, Tate J, Coggill P, Heger A, Pollington JE et al (2010) The Pfam protein families database. Nucleic Acids Res 38:211–222 Garcia-Gonzalo FR, Izpisua Belmonte JC (2008) Albumin associated lipids regulate human embryonic stem cell selfrenewal. PLoS One 3(1):e1384 Gillingham AK, Koumanov F, Pryor PR, Reaves BJ, Holman GD (1999) Association of AP1 adaptor complexes with GLUT4 vesicles. J Cell Sci 112(24):4793–4800 Graf T, Enver T (2009) Forcing cells to change lineages. Nature 462(7273):587–594 Greenspan P, Mayer EP, Fowler SD (1985) Nile red: a selective fluorescent stain for intracellular lipid droplets. J Cell Biol 100(3):965–973 Hanover JA, Willingham MC, Pastan I (1984) Kinetics of transit of transferrin and epidermal growth factor through clathrin-coated membranes. Cell 39(2):283–293 Heid HW, Moll R, Schwetlick I, Rackwitz HR, Keenan TW (1998) Perilipin 2 is a specific marker of lipid accumulation in diverse cell types and diseases. Cell Tissue Res 294(2):309–321 Hoashi T, Watabe H, Muller J, Yamaguchi Y, Vieira WD, Hearing VJ (2005) MART-1 is required for the function of the melanosomal matrix protein PMEL17/ GP100 and the maturation of melanosomes. J Biol Chem 280(14):14006–14016 Huang S, Lifshitz LM, Jones C, Bellve KD, Standley C, Fonseca S et al (2007) Insulin stimulates membrane fusion and GLUT4 accumulation in clathrin coats on adipocyte plasma membranes. Mol Cell Biol 27(9):3456–3469 Ieda M, Fu JD, Delgado-Olguin P, Vedantham V, Hayashi Y, Bruneau BG et al (2010) Direct reprogramming of fibroblasts into functional cardiomyocytes by defined factors. Cell 142(3):375–386 Inoue Y, Tanaka N, Tanaka Y, Inoue S, Morita K, Zhuang M et al (2007) CLTC- dependent entry of severe acute respiratory syndrome coronavirus into target cells expressing ACE2 with the cytoplasmic tail deleted. J Virol 81 (16):8722–8729 Kakizuka A, Miller WH Jr, Umesono K et al (1991) Chromosomal translocation t(15;17) in human acute promyelocytic leukemia fuses RAR alpha with a novel putative transcription factor, PML. Cell 66(4):663–74 Kallee E (1996) Bennhold’s analbuminemia: a follow-up study of the first two cases (1953–1992). J Lab Clin Med 127(5):470–480 Kersten S, Seydoux J, Peters JM, Gonzalez FJ, Desvergne B, Wahli WJ (1999) Peroxisome proliferator-activated receptor alpha mediates the adaptive response to fasting. J Clin Invest 103(11):1489–1498 Khan AA, Husain A, Jabeen M, Mustafa J, Owais M (2012) Synthesis and Characterization of Novel n-9 Fatty Acid Conjugates Possessing Antineoplastic Properties. Lipids. doi:10.1007/s1174501237079 Kim HJ, Jung TW, Kang ES, Kim DJ, Ahn CW, Lee KW et al (2007) Depot-specific regulation of perilipin by rosiglitazone in a diabetic animal model. Metabolism 56(5):676–685 Kutt H, Tsaltas TT (1959) Staining properties of oil red O and a method of partial purification of the commercial product. Clin Chem 5(2):149–160 Lafond J, Simoneau L, Savard R, Gagnon MC (1994) Linoleic acid transport by human placental syncytiotrophoblast membranes. Eur J Biochem 226(2):707–713 Levin JZ, Yassour M, Adiconis X, Nusbaum C, Thompson DA et al (2010) Comprehensive comparative analysis of strand-specific RNA sequencing methods. Nat Methods 7(9):709–715 Long G, Pan X, Kormelink R, Vlak JM (2006) Functional entry of baculovirus into insect and mammalian cells is dependent on CLTC-mediated endocytosis. J Virol 80(17):8830–8833 Maxfield FR, McGraw TE (2004) Endocytic recycling. Nat Rev Mol Cell Biol 5 (2):121–132 Mead JR, Irvine SA, Ramji DP (2002) Lipoprotein lipase: structure, function, regulation, and role in disease. Mol Med (Berl) 80(12):753–769 Mersmann HJ, Goodman JR, Brown LJ (1975) Development of swine adipose tissue: morphology and chemical composition. J Lipid Res 16(4):269–279 Parkhomchuk D, Borodina T, Amstislavskiy V, Banaru M, Hallen L, Krobitsch S et al (2009) Transcriptome analysis by strand-specific sequencing of complementary DNA. Nucleic Acids Res 37(18):e123 Pearse BM, Smith CJ, Owen DJ (2000) CLTC coat construction in endocytosis. Curr Opin Struct Biol 10(2):220–228 Raposo G, Marks MS (2007) Melanosomes – dark organelles enlighten endosomal membrane transport. Nat Rev Mol Cell Biol 8(10):786–797 Rauch C, Brunet AC, Deleule J, Farge E (2002) C2C12 myoblast/osteoblast transdifferentiation steps enhanced by epigenetic inhibition of BMP2 endocytosis. Am J Physiol Cell Physiol 283(1):235–243 Ruiz-Vela A, Aguilar-Gallardo C, Simon C (2009) Building a framework for embryonic microenvironments and cancer stem cells. Stem Cell Reviews and Reports 5(4):319–27 Ruiz-Vela A, Aguilar-Gallardo C, Martínez-Arroyo AM, Soriano-Navarro M, Ruiz V et al (2011) Specific Unsaturated Fatty Acids Enforce the Transdifferentiation of Human Cancer Cells toward Adipocyte-like Cells. Stem Cell Reviews and Reports 7(4):898–909 Schopfer FJ, Lin Y, Baker PR, Cui T, Garcia-Barrio M, Zhang J et al (2005) Nitrolinoleic acid: an endogenous peroxisome proliferator-activated receptor gamma ligand. Proc Natl Acad Sci U S A 102(7):2340–2345 Stephens JM, Lee J, Pilch PF (1997) Tumor necrosis factor α-induced insulin resistance in 3T3–L1 adipocytes is accompanied by a loss of insulin receptor substrate-1 and GLUT4 expression without a loss of insulin receptor- mediated signal transduction. J Biol Chem 272(2):971–976 Sullivan AL, Grasso JA, Weintraub LR (1976) Micropinocytosis of transferrin by developing red cells: an electron-microscopic study utilizing ferritin- conjugated transferrin and ferritin-conjugated antibodies to transferrin. Blood 47(1):133–143 Takeuchi JK, Bruneau BG (2009) Directed transdifferentiation of mouse mesoderm to heart tissue by defined factors. Nature 459(7247):708–711 Tarazona S, Garcia-Alcalde F, Ferrer A, Dopazo J, Conesa A (2011) Differential expression in RNA-seq: a matter of depth. Genome Res 21(12):2213–2223 Thomas ME, Morrison AR, Schreiner GF (1995) Metabolic effects of fatty acid- bearing albumin on a proximal tubule cell line. Am J Physiol 268(6):1177–1184 Todaro GJ, Green H (1963) Quantitative studies of the growth of mouse embryo cells in culture and their development into established lines. J Cell Biol 17:299–313 Trapnell C, Pachter L, Salzberg SL (2009) TopHat: discovering splice junctions with RNA-Seq. Bioinformatics 25(9):1105–11 Young MD, Wakefield MJ, Smyth GK, Oshlack A (2010) Gene ontology analysis for RNA-seq: accounting for selection bias. Genome Biol 11(2):R14 Yu J, Li Y, Li M, Qu Z, Ruan Q (2010) Oxidized low density lipoprotein-induced transdifferentiation of bone marrow-derived smooth muscle-like cells into foam-like cells in vitro. Int J Exp Pathol 91(1):24–33 Zhou Q, Brown J, Kanarek A, Rajagopal J, Melton DA (2008) In vivo reprogramming of adult pancreatic exocrine cells to beta-cells. Nature 455 (7213):627–632 doi:10.1186/2193-1801-1-44 Cite this article as: Carcel-Trullols et al.: Transdifferentiation of MALME- 3M and MCF-7 Cells toward Adipocyte-like Cells is Dependent on Clathrin-mediated Endocytosis. SpringerPlus 2012 1:44. Submit your manuscript to a journal and benefi t from: 7 Convenient online submission 7 Rigorous peer review 7 Immediate publication on acceptance 7 Open access: articles freely available online 7 High visibility within the fi eld 7 Retaining the copyright to your article Submit your next manuscript at 7 springeropen.com Carcel-Trullols et al. SpringerPlus 2012, 1:44 Page 12 of 12 http://www.springerplus.com/content/1/1/44

Title: Transdifferentiation of MALME-3M and MCF-7 Cells toward Adipocyte-like Cells is Dependent on Clathrin-mediated Endocytosis ​ Authors: Jaime Carcel-Trullols†, Cristóbal Aguilar-Gallardo†, Fernando Garcia-Alcalde, Miguel Angel Pardo-Cea, Joaquin Dopazo, Ana Conesa, Carlos Simón* ​ Publisher: SpringerPlus Date: October 30, 2012 ​ Abstract: Enforced cell transdifferentiation of human cancer cells is a promising alternative to conventional chemotherapy. ​ We previously identified albumin-associated lipid-and, more specifically, saturated fatty acid-induced transdifferentiation programs in human cancer cells (HCCLs). ​ In this study, we further characterized the adipocyte-like cells, resulting from the transdifferentiation of human cancer cell lines MCF-7 and MALME-3M, and proposed a common mechanistic approach for these transdifferentiating programs. ​ We showed the loss of pigmentation in MALME-3M cells treated with albumin-associated lipids, based on electron microscopic analysis, and the overexpression of perilipin 2 (PLIN2) by western blotting in MALME-3M and MCF-7 cells treated with unsaturated fatty acids. ​ Comparing the gene expression profiles of naive melanoma MALME-3M cells and albumin-associated lipid-treated cells, based on RNA sequencing, we confirmed the transcriptional upregulation of some key adipogenic gene markers and also an alternative splicing of the adipogenic master regulator PPARG, that is probably related to the reported up regulated expression of the protein. ​ Most importantly, these results also showed the upregulation of genes responsible for Clathrin (CLTC) and other adaptor-related proteins. ​ An increase in CLTC expression in the transdifferentiated cells was confirmed by western blotting. ​ Inactivation of CLTC by chlorpromazine (CHP), an inhibitor of CTLC mediated endocytosis (CME), and gene silencing by siRNAs, partially reversed the accumulation of neutral lipids observed in the transdifferentiated cells. ​ These findings give a deeper insight into the phenotypic changes observed in HCCL to adipocyte-like transdifferentiation and point towards CME as a key pathway in distinct transdifferentiation programs. ​



Production of the Bacillus licheniformis SubC protease using Lactococcus lactis NICE expression system.pdf

RESEARCH Open Access Production of the Bacillus licheniformis SubC protease using Lactococcus lactis NICE expression system Aleksandra M Mirończuk1,2, Anna Krasowska2, Anna Murzyn2, Małgorzata Płachetka2 and Marcin Łukaszewicz1,2,3* Abstract In this work the subC gene from Bacillus licheniformis encoding subtilisin was cloned into the nisin-controlled expression (NICE) vectors (pNZ8048 and pNZ8148) with or without the signal peptide SP Usp45 directing extracellular secretion via Sec machinery. Extracellular protease production and activity was tested using Lactococcus lactis NZ9000 as host, which could be used for rennet production. The efficiency of protein production was tested using purified nisin and the supernatant of L. lactis NZ970 nisin producer. Similar results were obtained for 1 ng/ml nisin and 10 000 diluted supernatant. SP Usp45 signal peptide effectively directed extracellular localization of active and stable protease. SubC signal for extracellular localization in B. licheniformis, was also recognized by L. lactis Sec pathway, although with lower efficiency, as shown by a 3-fold lower protease activity in the medium. Protease production and activity was optimized using parameters such as induction time, nutrients (glucose, casitone) supplementation during growth or protease stabilization by calcium ions. The results were also verified in fed-batch bioreactor for further scale-up of the expression system. Keywords: Lactic acid bacteria, Lactococcus lactis, Nisin-controlled expression system, NICE, Bacillus licheniformis, SubC protease Introduction Lactococcus lactis is a Gram-positive, lactic acid bacte- rium that is commonly used in traditional food indus- tries such as in cheese and butter production. In addition, it is increasingly used in modern biotechno- logical applications. Many recent studies have investi- gated the physiology and genetic of this bacterium, therefore a wide variety of genetic tools have been deve- loped. Nowadays several genomes of L. lactis strains are completely sequenced (Bolotin et al. 2001; Siezen et al. 2010; Wegmann et al. 2007). Genetic accessibility and the ease of working with this organism have led to exten- sive study on heterologous protein expression in L. lactis. Since L. lactis is generally recognized as safe (GRAS) it could be used for large-scale production of heterologous proteins (Mierau et al. 2005a; Morello et al. 2008). Most of the laboratory scale examples consist of intracellular ex- pression (Blatny et al. 2003; Kunji et al. 2003) or cell wall bound enzymes (Cibik et al. 2001; Miyoshi et al. 2002; Nouaille et al. 2003). Much less in known about extracel- lular production of the proteins in L. lactis, moreover the protein yield might differ significantly and are strongly case-dependent (Mierau & Kleerebezem 2005). In 1995 Kuipers et al. (1995) published a study on the autoinduction of the expression of nisin in lactococci. This study allowed for the construction of a food grade expression system based on the regulation mechanism of the nisinA operon of L. lactis (Platteeuw et al. 1996), named NICE (nisin-controled gene expression). In this operon the gene product, a small 34 amino acid bac- teriocin, induces its own transcription at very low con- centrations (0.5 – 5 ng/mL) (Kuipers et al. 1998). In this system, nisin induces the regulatory cascade starting with binding to the membrane-bound receptor NisK. Next, the phosphate group from the activated NisK is * Correspondence: [email protected] 1Department of Biotechnology and Food Microbiology, Wrocław University of Environmental and Life Sciences, Chełmońskiego 37/41, Wrocław 51-630, Poland 2Department of Biotransformation, Faculty of Biotechnology, University of Wroclaw, Przybyszewskiego 63-77, Wroclaw 51-148, Poland Full list of author information is available at the end of the article a SpringerOpen Journal © 2012 Mironczuk et al.; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Mirończuk et al. SpringerPlus 2012, 1:54 http://www.springerplus.com/content/1/1/54 transferred to the intracellular response regulator NisR, activating this regulator. Subsequently, NisR, induces the nisin operon at the promoter nisA (Kleerebezem & Quadri 2001). The NisA promoter controls the expres- sion of the genes involved in the nisin biosynthesis (or the gene of interest). Genes of this regulatory system have been inserted in a suitable host strain L. lactis NZ900. The nisin-producing strain L. lactis NZ9700 secretes the nisin into the medium (Kuipers et al. 1995). It was shown that the NICE system can be developed to “food-grade” production of heterologous protein, by replacing the antibiotic resistant gene by another select- able marker (Olempska-Beer et al. 2006), for example lacF, which has been deleted from the host strain, and is essential for growth on lactose (Mierau et al. 2005b). Although for large-scale production nisin usage remains costly, a good alternative is the addition of NZ9700 supernatant. The NICE system is often used in the laboratories for research, while the data on large-scale application of the NICE system for secreted proteins is still very limited. Up to now, only a few reports present usage of this system in industry (Mierau et al. 2005a; Mierau et al. 2005b; Berlec & Strukelj 2009), moreover, efficient systems for the industrial scale production of secrete heterologous proteins have never been described. In this study, we describe the production of secrete heterologous protein SubC in L. lactis using the NICE expression system. SubC is the industrially important Carlsberg-type subtilisin (Jacobs 1995) produced by Bacillus licheniformis. Bacterial subtilisins are multipur- pose alkaline proteases that are frequently used in indus- try (Gupta et al. 2002): common variants include subtilisin from B. amyloliquefaciens, highly alkalophilic B. lentus or from B. licheniformis (Rao et al. 1998; von der Osten et al. 1993). Furthermore, Flavobacterium also produces subtilisin (Morita et al. 1998). Interestingly, al- most two-third of commercial proteases produced in the world originate from microorganisms (Kumar & Takagi 1999; Tremacoldi et al. 2004). Microbial proteases are classified into different groups, according to their activ- ity in acid, neutral or alkaline conditions, and on the characteristics of the active site group of the enzyme (Saeki et al. 2007). Subtilisin-like serine proteases are usually secreted extracellulary for searching nutrients (Aehle et al. 2009). One of the features of this class of proteases (subtilases) is an aromatic or hydrophobic residue, such as leucine, tyrosine or phenylalanine. The highest proteolytic activity is around pH 10, with a molecular weight range of 15–40 kDa and an isoelectric point around pI 9. Moreover, the native form of SubC remains fully stable up to 60°C (Hirata et al. 2003) and it possesses two calcium binding site(s), therefore bound Ca2+ contributes to enzyme stability (Briedigkeit & Frömmel 1989). Our main objective in this study was an improvement of the expression condition for secreted heterologous protein production and the comparison of the gene expression efficiencies using two different NICE expres- sion plasmids. We compared two different NICE vectors and the ability of L. lactis for secretion of heterologous protein. The activity of protease production was tested on milk plates. Subsequently the proteolytic activity assays were performed to investigate the functionality of the secreted protease in the medium. In addition, we present modification of the NICE system, by changing the growth conditions, the induction point, and by extending the logarithmic phase growth of bacteria by supplying further nutrients. Methods Strains and growth conditions The strains and plasmids used in this study are listed in Table 1. Lactococcus lactis strains were grown in M17 broth (Terzaghi & Sandine 1975) supplemented with 0.5% glucose (GM17). Additionally, for strains carrying plas- mid, medium was supplemented with chloramphenicol (5 μg mL-1). Cultures were incubated at 30°C. If required, medium was supplemented with 10% milk or different concentrations of CaCl2, MnCl2, MgCl2 and MgSO4. Additionally, samples were supplemented with 5 μg mL-1 chloramphenicol, if required. Bacterial growth was determined by measuring the optical density (OD) at 600 nm. The cultures were inoculated at optical dens- ity 0.1 or at a different point if mentioned. At the begin- ning of the incubation or when the bacterial growth reached the required cell density, the cultures were stimulated to produce protease by the addition of nisin (Sigma) or by the dilutions of the culture supernatant of the nisin producing strain L. lactis NZ9700 (the range of concentrations or dilutions indicated in Results). The Table 1 Strains used in this study Strain/plasmid Relevant characteristics Reference ATCC 10716 B. licheniformis Laboratory stock NZ9000 L. lactis MG1363 pepN::nisRK (Kuipers et al. 1998) NZ9700 L. lactis Nisin producer (Kuipers et al. 1995) pNZ8048 CmR, inducible expression vector containing the nisA promoter (Kuipers et al. 1998) pNZ8148 PnisA, CmR; replicon of rolling circle plasmid pSH71, basic NICE vector, derivative of pNZ8048 NIZO pNZ45 pNZ8048 carrying SP Usp45 under nisA promoter This study pNZ45subC pNZ45 carrying subC gene This study pNZ48subC pNZ8148 carrying subC gene This study Mirończuk et al. SpringerPlus 2012, 1:54 Page 2 of 10 http://www.springerplus.com/content/1/1/54 proteins production is lactic acid bacteria (LAB) such as Lactococcus lactis (Hugenholtz 2008). They are widely used in industrial fermentations, so much information is available about nutrient requirements, growth conditions etc. Moreover, for L. lactis the genome sequence has been published (Wegmann et al. 2007) and many genetic tools have been developed for LAB, which simplifies the usage of these microorganisms as a cell factory. Add- itionally they do not require aeration and only very limited mixing that significantly reduces production and reactor costs. One of the most popular expression systems in L. lactis is the NICE system (Mierau & Kleerebezem 2005; Kuipers et al. 1995). In this study, we present the modification of the NICE system for heterologous secretion protease production in L. lactis, with possible usage at industrial scale. We used two different NICE vectors; we compared different ranges of nisinA concentration for induction and nu- trient requirements. For that purpose, the subC gene encoding B. licheniformis extracellular alkaline protease was cloned downstream of the strong inducible pro- moter nisA and ranges of diluted supernatant of NZ9700 L. lactis (nisin producer) were used for the induction of secreted enzyme production. In this study, we optimized the growth and NICE- related parameters. Strikingly, laboratory strains of L. lactis possess only 24h 0 50 100 150 200 250 300 350 400 450 proteolytic activity % 2h 3h 4h Figure 5 The proteolytic activity of L. lactis carrying pNZ45subC. The cultures were grown in GM17 medium supplemented with 0.5 mM CaCl2 and 5 μg mL-1 of chloramphenicol. The cultures were induced at OD600 0.7. The samples were taken as indicated on the picture: 2, 3, 4 and 24 hours after induction with 10 000 NZ9700 supernatant. Pale gray bars- strain without induction (values below 1). Black bars- control strain without additional nutrients. Dark gray bars- the strain supplemented with an additional nutrients in two hours after induction. All data are mean values of three independent experiments; error bars indicate standard deviation. 0 20 40 60 80 100 120 140 160 0.0E+00 1.0E+09 2.0E+09 3.0E+09 4.0E+09 5.0E+09 6.0E+09 7.0E+09 8.0E+09 0h 2h 4h 6h 24h 48h Activity U/l Cell number Cell number Activity Figure 6 The proteolytic activity of L. lactis carrying pNZ45subC in 5 L bioreactor (working volume 1.5 L). The culture was grown in GM17 medium supplemented with 10% milk and 5 μg mL-1 of chloramphenicol. The culture was induced at OD600 0.2. The samples were taken as indicated on the picture. Mirończuk et al. SpringerPlus 2012, 1:54 Page 8 of 10 http://www.springerplus.com/content/1/1/54 one exported housekeeping protease, HtrA involved in protein quality control at the cell surface. Moreover, HtrA is responsible for clearing anomalous proteins from the surface, and is induced under several stress conditions (Morello et al. 2008). The expression of heterologous protease might be lethal for L. lactis, however it was recently shown that the use of SP Usp45 also allows the secretion of bacte- riocins which are toxic for cells (Borrero et al. 2009). Therefore to avoid toxicity we added signal peptide of Usp45 to secrete SubC via Sec transporters. Indeed higher protease expression and accumulation within the cell resulted in growth inhibition (data not shown). Here we observed that the addition of lactococcal SP usp45 to the native signal peptide of SubC leads to better secretion, and more importantly, secreted protein remains stable, since both signal peptides are properly cleaved during protein translocation to the medium. Interestingly, a con- struct with two signal peptides results in higher accumu- lation of the protease in extracellular medium. Subsequently, we investigated the media preferences for optimal protein production. The previously described medium (Mierau et al. 2005a) did not increase the pro- tein level. In contrast, medium supplementation with calcium chloride resulted in superior activity of protease in the extracellular environment. Interestingly, we have also noticed that supplementing GM17 medium with other two positive ions, results in elevated proteolytic activity of SubC producer, nonetheless the highest acti- vity was observed in samples supplemented with 0.5 mM CaCl2. After establishing the medium preferences for SubC production, we tested various induction time points. Hitherto, the strains carrying overexpression constructs were induced at the midlog growth phase or at high OD (Mierau et al. 2005a; Maischberger et al. 2010) although we have not confirmed the reports show- ing the results of induction at start point. To this end, the overnight cultures of L. lactis carrying pNZ45subC or pNZ48subC were inoculated into fresh medium, sup- plemented as aforementioned, and induced at OD600 0.1 and 0.6 and with various ranges of NZ9700 super- natant. The samples were tested for proteolytic activity 24 hours after induction. We did not observe significant differences in the proteolytic activity between all sam- ples, which might suggest that the level of functional SubC protease was the same in all cultures. In contrast to other reports (Berlec et al. 2008), we did not observe a correlation between increasing OD and protein pro- duction. One of the most interesting parts of this phenomenon is the problem of the stability/activity of SubC in the extracellular environment. Strikingly, the SDS-PAGE data showed that the level of protein pro- duction in various cultures was unchanged; however the proteolytic activity was different. This could result from various proportions of mature versus immature protease as seen from SubC amino acid sequence determination. Noticeably, the overproduction of protein might also cause stress responses and consequently degradation of the target protein in the cells (Thumm & Gotz 1997). We compared different nisinA concentrations for L. lactis induction. The studied nisin concentration range was from 0.1 to 10.0 ng mL-1 and the highest pro- teolytic activity was obtained when 1 ng mL-1 of nisinA or 10 000 – 20 000 diluted supernatant of L. lactis NZ9700 was used. In comparison, nisin concentration in published data varies from 0.5 to 40 ng mL-1 (Mierau et al. 2005b). Thus induction during inoculation of the bioreactor enables reduction of the inducer amount and simplifies the production process. One of the most inter- esting issues of this study was an extension of the loga- rithmic phase growth of L. lactis, since during this phase the highest activity was observed. Initial experiments showed that L. lactis utilizes most of the 0.5% glucose present in GM17 medium. Conse- quently, the next step was to supply more nitrogen and carbon sources. The cultures were induced at OD600 0.6, the additional nutrients were added in two hours after induction. Interestingly, we observed increased proteo- lytic activity already 2 hours after supplementing with nutrients. The differences between the target strain and the control were between 30-40%, the highest differences were observed in 6 hours after induction, and remained stable up to 24th hour after inductions. In summary, we optimized the NICE expression sys- tem for heterologous secretion protease production. The use of a GRAS expression host for secreted enzyme pro- duction will make it possible to use these proteins much more easily and economically, than in the case of intra- cellular production. The described expression system might be used for industrial production of rennet or direct application of such strain in dairy. Competing interests The authors declare that they have no competing interests. Authors’ contributions AMM carried out the molecular genetic studies, performed the experiments, analyzed the data, wrote the manuscript. AK analyzed the data, drafted the manuscript. AM performed the experiments, analyzed the data, drafted the manuscript. MP performed the experiments, analyzed the data, participated in the sequence alignment, drafted the manuscript. MŁ Contributed reagents/materials/analysis tools, analyzed the data, wrote the manuscript. All authors read and approved the final manuscript. Acknowledgements We thank Oscar P. Kuipers for the gift of L. lactis vectors pNZ8048 and L. lactis NZ9700, and Katarzyna Bednarz for technical support. This work was supported by grant KB/48/13639/IT1-B/U/08 from the Polish National Centre for Research and Development and EU POIG.01.01.02-00- 016/2008. Mirończuk et al. SpringerPlus 2012, 1:54 Page 9 of 10 http://www.springerplus.com/content/1/1/54 Author details 1Department of Biotechnology and Food Microbiology, Wrocław University of Environmental and Life Sciences, Chełmońskiego 37/41, Wrocław 51-630, Poland. 2Department of Biotransformation, Faculty of Biotechnology, University of Wroclaw, Przybyszewskiego 63-77, Wroclaw 51-148, Poland. 3Faculty of Chemistry, Wrocław University of Technology, Gdańska 7/9, Wrocław 50-344, Poland. Received: 4 September 2012 Accepted: 8 November 2012 Published: 29 November 2012 References Aehle W, Bott R, Graycar T, Flickinger MC (2009) Proteolytic Cleavage, Reaction Mechanisms. Encyclopedia of Industrial Biotechnology, John Wiley & Sons, Inc Berlec A, Strukelj B (2009) Large increase in brazzein expression achieved by changing the plasmid /strain combination of the NICE system in Lactococcus lactis. Lett Appl Microbiol 48:750–755 Berlec A, Tompa G, Slapar N, Fonovic UP, Rogelj I, Strukelj B (2008) Optimization of fermentation conditions for the expression of sweet-tasting protein brazzein in Lactococcus lactis. Lett Appl Microbiol 46:227–231 Blatny JM, Ertesvag H, Nes IF, Valla S (2003) Heterologous gene expression in Lactococcus lactis; expression of the Azotobacter vinelandii algE6 gene product displaying mannuronan C-5 epimerase activity. FEMS Microbiol Lett 227:229–235 Bolotin A, Wincker P, Mauger S, Jaillon O, Malarme K, Weissenbach J, Ehrlich SD, Sorokin A (2001) The complete genome sequence of the lactic acid bacterium Lactococcus lactis ssp. lactis IL1403. Genome Res 11:731–753 Borrero J, Jimenez JJ, Gutiez L, Herranz C, Cintas LM, Hernandez PE (2999) Use of the usp45 lactococcal secretion signal sequence to drive the secretion and functional expression of enterococcal bacteriocins in Lactococcus lactis. Appl Microbiol Biotechnol 89:131–143 Briedigkeit L, Frömmel C (1989) Calcium ion binding by thermitase. FEBS Lett 253:83–87 Cibik R, Tailliez P, Langella P, Chapot-Chartier MP (2001) Identification of Mur, an atypical peptidoglycan hydrolase derived from Leuconostoc citreum. Appl Environ Microbiol 67:858–864 Gupta R, Beg QK, Lorenz P (2002) Bacterial alkaline proteases: molecular approaches and industrial applications. Appl Microbiol Biotechnol 59:15–32 Hirata J, Ariese F, Gooijer C, Irth H (2003) Continuous-flow protease assay based on fluorescence resonance energy transfer. Anal Chim Acta 478:1–10 Hugenholtz J (2008) The lactic acid bacterium as a cell factory for food ingredient production. Int Dairy J 18:466–475 Jacobs MF (1995) Expression of the subtilisin Carlsberg-encoding gene in Bacillus licheniformis and Bacillus subtilis. Gene 152:69–74 Kleerebezem M, Quadri LE (2001) Peptide pheromone-dependent regulation of antimicrobial peptide production in Gram-positive bacteria: a case of multicellular behavior. Peptides 22:1579–1596 Kuipers OP, Beerthuyzen MM, de Ruyter PG, Luesink EJ, de Vos WM (1995) Autoregulation of nisin biosynthesis in Lactococcus lactis by signal transduction. J Biol Chem 270:27299–27304 Kuipers OP, de Ruyter PGGA, Kleerebezem M, de Vos WM (1998) Quorum sensing-controlled gene expression in lactic acid bacteria. J Biotechnol 64:15–21 Kumar CG, Takagi H (1999) Microbial alkaline proteases: from a bioindustrial viewpoint. Biotechnol Adv 17:561–594 Kunji ER, Slotboom DJ, Poolman B (2003) Lactococcus lactis as host for overproduction of functional membrane proteins. Biochim Biophys Acta 1610:97–108 Leenhouts KJ, Venema G (1993) Plasmids, a practical approach. Oxford University Press, Oxford, United Kingdom Maischberger T, Mierau I, Peterbauer CK, Hugenholtz J, Haltrich D (2010) High-level expression of Lactobacillus beta-galactosidases in Lactococcus lactis using the food-grade, nisin-controlled expression system NICE. J Agric Food Chem 58:2279–2287 Mierau I, Kleerebezem M (2005) 10 years of the nisin-controlled gene expression system (NICE) in Lactococcus lactis. Appl Microbiol Biotechnol 68:705–717 Mierau I, Olieman K, Mond J, Smid EJ (2005a) Optimization of the Lactococcus lactis nisin-controlled gene expression system NICE for industrial applications. Microb Cell Fact 4:16 Mierau I, Leij P, van Swam I, Blommestein B, Floris E, Mond J, Smid EJ (2005b) Industrial-scale production and purification of a heterologous protein in Lactococcus lactis using the nisin-controlled gene expression system NICE: the case of lysostaphin. Microb Cell Fact 4:15 Miyoshi A, Poquet I, Azevedo V, Commissaire J, Bermudez-Humaran L, Domakova E, Le Loir Y, Oliveira SC, Gruss A, Langella P (2002) Controlled production of stable heterologous proteins in Lactococcus lactis. Appl Environ Microbiol 68:3141–3146 Morello E, Bermudez-Humaran LG, Llull D, Sole V, Miraglio N, Langella P, Poquet I (2008) Lactococcus lactis, an efficient cell factory for recombinant protein production and secretion. J Mol Microbiol Biotechnol 14:48–58 Morita Y, Hasan Q, Sakaguchi T, Murakami Y, Yokoyama K, Tamiya E (1998) Properties of a cold-active protease from psychrotrophic Flavobacterium balustinum P104. Appl Microbiol Biotechnol 50:669–675 Nouaille S, Ribeiro LA, Miyoshi A, Pontes D, Le Loir Y, Oliveira SC, Langella P, Azevedo V (2003) Heterologous protein production and delivery systems for Lactococcus lactis. Genet Mol Res 2:102–111 Olempska-Beer ZS, Merker RI, Ditto MD, DiNovi MJ (2006) Food-processing enzymes from recombinant microorganisms–a review. Regul Toxicol Pharmacol 45:144–158 Pedersen PB, Bjornvad ME, Rasmussen MD, Petersen JN (2002) Cytotoxic potential of industrial strains of Bacillus sp. Regul Toxicol Pharmacol 36:155–161 Platteeuw C, van Alen-Boerrigter I, van Schalkwijk S, de Vos WM (1996) Food-grade cloning and expression system for Lactococcus lactis. Appl Environ Microbiol 62:1008–1013 Rao MB, Tanksale AM, Ghatge MS, Deshpande VV (1998) Molecular and biotechnological aspects of microbial proteases. Microbiol Mol Biol Rev 62:597–635 Saeki K, Ozaki K, Kobayashi T, Ito S (2007) Detergent alkaline proteases: enzymatic properties, genes, and crystal structures. J Biosci Bioeng 103:501–508 Salkinoja-Salonen MS, Vuorio R, Andersson MA, Kampfer P, Andersson MC, Honkanen-Buzalski T, Scoging AC (1999) Toxigenic strains of Bacillus licheniformis related to food poisoning. Appl Environ Microbiol 65:4637–4645 Siezen RJ, Bayjanov J, Renckens B, Wels M, Van Hijum SA, Molenaar D, Van Hylckama Vlieg JE (2010) Complete genome sequence of Lactococcus lactis subsp. lactis KF147, a plant-associated lactic acid bacterium. J Bacteriol 192:2649–2650 Terzaghi BE, Sandine WE (1975) Improved medium for lactic streptococci and their bacteriophages. Appl Microbiol 29:807–813 Thumm G, Gotz F (1997) Studies on prolysostaphin processing and characterization of the lysostaphin immunity factor (Lif) of Staphylococcus simulans biovar staphylolyticus. Mol Microbiol 23:1251–1265 Tremacoldi CR, Watanabe NK, Carmona EC (2004) Production of Extracellular Acid Proteases by Aspergillus Clavatus. World J Microbiol Biotechnol 20:639–642 van Asseldonk M, de Vos WM, Simons G (1993) Functional analysis of the Lactococcus lactis usp45 secretion signal in the secretion of a homologous proteinase and a heterologous alpha-amylase. Mol Gen Genet 240:428–434 von der Osten C, Branner S, Hastrup S, Hedegaard L, Rasmussen MD, Bisgard-Frantzen H, Carlsen S, Mikkelsen JM (1993) Protein engineering of subtilisins to improve stability in detergent formulations. J Biotechnol 28:55–68 Wegmann U, O’Connell-Motherway M, Zomer A, Buist G, Shearman C, Canchaya C, Ventura M, Goesmann A, Gasson MJ, Kuipers OP, van Sinderen D, Kok J (2007) Complete genome sequence of the prototype lactic acid bacterium Lactococcus lactis subsp. cremoris MG1363. J Bacteriol 189:3256–3270 doi:10.1186/2193-1801-1-54 Cite this article as: Mirończuk et al.: Production of the Bacillus licheniformis SubC protease using Lactococcus lactis NICE expression system. SpringerPlus 2012 1:54. Mirończuk et al. SpringerPlus 2012, 1:54 Page 10 of 10 http://www.springerplus.com/content/1/1/54

Title: Production of the Bacillus licheniformis SubC protease using Lactococcus lactis NICE expression system ​ Authors: Aleksandra M. Mirończuk, Anna Krasowska, Anna Murzyn, Małgorzata Płachetka, Marcin Łukaszewicz ​ Publisher: SpringerPlus Date: November 29, 2012 ​ Abstract: In this work, the subC gene from Bacillus licheniformis encoding subtilisin was cloned into the nisin-controlled expression (NICE) vectors (pNZ8048 and pNZ8148) with or without the signal peptide SP Usp45 directing extracellular secretion via Sec machinery. ​ Extracellular protease production and activity were tested using Lactococcus lactis NZ9000 as host, which could be used for rennet production. ​ The efficiency of protein production was tested using purified nisin and the supernatant of L. lactis NZ970 nisin producer. ​ Similar results were obtained for 1 ng/ml nisin and 10,000 diluted supernatant. ​ SP Usp45 signal peptide effectively directed extracellular localization of active and stable protease. ​ SubC signal for extracellular localization in B. licheniformis was also recognized by L. lactis Sec pathway, although with lower efficiency, as shown by a 3-fold lower protease activity in the medium. ​ Protease production and activity were optimized using parameters such as induction time, nutrients (glucose, casitone) supplementation during growth, or protease stabilization by calcium ions. ​ The results were also verified in a fed-batch bioreactor for further scale-up of the expression system. ​ Keywords: Lactic acid bacteria, Lactococcus lactis, Nisin-controlled expression system, NICE, Bacillus licheniformis, SubC protease ​

Cow dung: a potential biomass substrate for the production of detergent-stable dehairing protease by alkaliphilic Bacillus subtilis strain VV.pdf

RESEARCH Open Access Cow dung: a potential biomass substrate for the production of detergent-stable dehairing protease by alkaliphilic Bacillus subtilis strain VV Ponnuswamy Vijayaraghavan1*, Aija Vijayan2, Arumugaperumal Arun3, John Kennady Jenisha3 and Samuel Gnana Prakash Vincent1 Abstract Cow dung, a cheap and easily available source of energy, was used as the substrate for the production of alkaline protease by solid-state fermentation using the Bacillus subtilis strain VV. In order to achieve the maximum yield of this enzyme, the following optimum process parameters are needed: fermentation period (72 h), pH (10.0), moisture content (140%), inoculum (25%), temperature (30–40°C), carbon source (2% (w/w) maltose) and nitrogen source (1% (w/w) urea). The protease was stable over a broad temperature range (30–50°C) and pH (8.0-10.0), with maximum activity at 50°C and pH 10.0. Among the divalent ions tested, Ca2+ (0.01 M) increased enzyme activity. The purified protease, after being subjected to sodium dodecyl sulphate-polyacrylamide gel electrophoresis, was found to have a molecular mass of 38.5 kDa. The enzyme was solvent-and surfactant-stable and showed activity even after 24 h incubation along with various commercially available detergents. This enzyme possessed dehairing properties for animal hide after 16 h of incubation at room temperature. From these results it is evident that cow dung is a potential substrate for the production of a detergent-stable, dehairing protease by B. subtilis. This enzyme has a lot of potential applications in the detergent and leather-processing industries. Keywords: Cow dung, Solid-state fermentation, Bacillus subtilis strain VV, Alkaline protease, Detergent-stable Background Proteases constitute one of the commercially important groups of extra-cellular microbial enzymes and are widely used in the detergent, food, pharmaceutical, chemical and leather industries (Scheuer 1990). These enzymes account for 40% of the total enzyme sales worldwide and this trend is expected to increase in the near future. This has led to increasing attention towards the exploitation of potent microbial strains for the production of alkaline proteases from an industrial point of view (Ellaiah et al. 2002). Although a wide range of microorganisms are known to produce proteases, a large proportion of the commercially available form of these enzymes is derived from Bacillus strains because of their ability to secrete large amounts of alkaline proteases having significant proteolytic activity and stability at considerably higher pH and temperatures (Jacobs 1995; Yang et al. 2000). The leather processing industry contributes significantly to the country’s economic development. Waste from the leather industry leads to environmental pollution. Alkaline proteases have dehairing properties and can be used in the leather processing industry. Conventional methods in leather processing involve the use of hydrogen sulphide and other chemicals which are pollutants. Thus, for envir- onmental reasons, the enzymatic dehairing process has more advantages over the chemical dehairing process (Andersen 1998). Proteases are used during the soaking, dehairing and bating states of preparing skins and hides. Pancreatic proteases are used in the bating process and the use of microbial alkaline proteases are popular (Varela et al. 1997). Alkaline proteases swell hair roots and attack hair follicle proteins, resulting in the easy removal of hair. These enzymes have been widely studied and their production from Bacillus sp. has gained momentum; * Correspondence: [email protected] 1International Centre for Nanobiotechnology, Centre for Marine Science and Technology, Manonmaniam Sundaranar University, Rajakkamangalam–629 502, Kanyakumari DistrictTamil Nadu, India Full list of author information is available at the end of the article a SpringerOpen Journal © 2012 Vijayaraghavan et al.; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Vijayaraghavan et al. SpringerPlus 2012, 1:76 http://www.springerplus.com/content/1/1/76 moreover, the high activity and stability of these enzymes at various temperature and pH ranges have also attracted the attention of researchers. Dehairing proteases have been characterized from various Bacillus sp., e.g. B. subtilis 11QDB32 (Varela et al. 1997), B. amyloliquefaciens (George et al. 1995), B. subtilis K2 (Hameed et al. 1996; Hameed et al. 1999) and B. circulans (Subba Rao et al. 2009). Proteases are generally produced using submerged fer- mentation not only due to its apparent advantages in con- sistent enzyme production but also for its cost- for medium components. From an industrial point of view, it is estimated that around 30-40% of the production cost of industrial enzymes can be attributed to the cost of the growth medium (Joo et al. 2003). Solid-state fermentation (SSF) has gained importance in the production of micro- bial enzymes owing to several economic advantages over submerged fermentation. The advantages of SSF include lower manufacturing costs with increased production, less pre-processing energy and effluent generation, along with easy process management and better product recovery (Prakasham et al. 2006; Oliveira et al. 2006). There are several reports describing the use of agro-industrial resi- dues for the production of alkaline protease (e.g. pigeon pea and Bacillus sp. JB-99 (Johnvesly et al. 2002); green gram husk and Bacillus sp. (Prakasham et al. 2006); Imperata cylindrical grass and potato peel and Bacillus subtilis (Mukherjee et al. 2008). Apart from these agro- industrial residues, increased attention has been paid in recent times to utilize other waste substances, e.g. feather meal, corn steep liquor (De Azeredo et al. 2006) and pro- teinaceous tannery solid waste, for the production of alka- line proteases (Ravindran et al. 2011). Even though cow dung is considered a waste, it contains essential nutrients (Misra et al. 2003); these include carbon, nitrogen, phos- phorus, potassium, calcium, magnesium, sulphur, manga- nese, copper, zinc, chloride, boron, iron and molybdenum. Most of the commercial proteases producing organisms are Bacillus sp. (Abo-Aba et al. 2006). The potential of cow dung as a biomass substrate for the production of alkaline protease by using Bacillus sp. has not yet been completely exploited. The main objective of the present study was the production of alkaline proteases by Bacillus subtilis utilizing cow dung as an energy source, and deter- mination of the optimum conditions necessary for the production of these enzymes. Results and discussion Isolation and identification of a best alkaline protease- producing organism Of the tested isolates, five were found to have the ability to produce alkaline protease. Among the positive isolates, the organism which produced a larger halo zone in re- sponse to the colony diameter was selected. The selected isolate was identified as Bacillus on the basis of various microscopic and biochemical investigations. The organism was a Gram-positive rod, spore-producing, VP-, catalase- and gelatin-positive. It fermented glucose, lactose and sucrose. It reacted negatively in the indole, methyl red, citrate, oxidase, starch and nitrate reduction test. All these results suggest that it belongs to the genus Bacillus. More- over, the organism was confirmed by its 16S rRNA gene sequence and identified as Bacillus subtilis strain VV. The 1071-bp sequence was submitted to GenBank (accession number: JQ 425476). Evaluation of cow dung as a cheap substrate for alkaline protease production This study has indicated that cow dung can be used as a potential substrate for alkaline protease production. En- zyme production by the B. subtilis strain VV was to the tune of 4030 ± 128 U/g solid substrate (cow dung) after 72 h of incubation at 37°C. The selection of a cheap sub- strate in SSF for the production of any metabolites is an im- portant factor from an industrial point of view. Apart from the cost, the availability of the substrate is a critical factor. An ideal substrate is one which is available in large quan- tities and throughout the year too. Although many cheap agro-industrial residues were evaluated (Prakasham et al. 2006; Johnvesly et al. 2002; Gessesse 1997) for the produc- tion of alkaline proteases, the availability of these substrates is seasonal. Apart from agro-industrial wastes, more atten- tion has been paid to the evaluation of solid wastes for the production of alkaline proteases (Ravindran et al. 2011; Ganesh Kumar et al. 2008). Waste water from the manufac- ture of shochu was also tried (Morimura et al. 1994) for production of proteases. In spite of evaluating these sub- strates, the search for a novel substrate continues. Recently, we used cow dung as a substrate for the production of a halo-tolerant alkaline protease using a alkalophilic isolate, Halomonas sp. PV1 (Vijayaraghavan and Vincent 2012). Of all the alkalophilic microorganisms that have been screened for use in various industrial applications, members of the genus Bacillus were found to be predominant and a prolific source of alkaline proteases (Kumar and Takagi 1999). Reports on SSF of cow dung for the production of alkaline protease using Bacillus sp. are limited or perhaps not avail- able. Hence, the present investigation aimed to exploit cow dung that is cheap and globally available for alkaline prote- ase production by Bacillus subtilis. The protein content of the cow dung medium was evaluated before and after fer- mentation. The cow dung possessed 80 ± 12 mg protein/g solid substrate, and the organism utilized 40 ± 4.5% of the protein content for the growth and synthesis of protease. Effect of fermentation period and pH on alkaline protease production To evaluate the effect of fermentation period on prote- ase production, the fermentation experiment was carried Vijayaraghavan et al. SpringerPlus 2012, 1:76 Page 2 of 9 http://www.springerplus.com/content/1/1/76 was added to the fermented substrate. This was placed in an orbital shaker at 150 rpm for 30 min for enzyme ex- traction. After this, the mixture was rapidly filtered using cotton and the cells were further harvested by centrifuga- tion at 10,000 g for 20 min. The supernatant was used as the enzyme source for protease assay. Determination of protease activity Alkaline protease activity was determined by standard assay. The reaction mixture contained 5 mL of casein (prepared in 0.05 M of glycine-NaOH buffer, pH 10.0) and an aliquot of 0.1 mL of the enzyme solution, and this mixture was incubated for 30 min at 37°C. The reac- tion was stopped by adding 5 mL of trichloroacetic acid solution (TCA) (0.11 M) and the mixture was filtered after 30 min. To 2 mL of the filtrate, 5.0 mL of 0.5 M so- dium carbonate and 1.0 mL of Folin-Ciocalteu’s phenol reagent were added, and this mixture was kept undis- turbed for 30 min at 37°C. The optical density of the solution was read against sample blank at 630 nm. One unit of enzyme activity was defined as the amount of en- zyme required to liberate 1 μg of tyrosine per minute under assay conditions (Chopra and Mathur 1985). The total protein content was estimated by Bradford’s method (Bradford 1976). Optimization of process parameters for protease production In the present study, solid-state protease production by the Bacillus subtilis strain VV was optimized by varying the physical parameters and nutrient sources. The prote- ase activity was determined in the fermented medium for every 12 h of fermentation up to 96 h in order to de- termine the fermentation period. To evaluate the effect of temperature on protease production, the substrate inoculated with bacterial culture was incubated at vari- ous temperatures (10–50°C). Addition of buffer (0.1 M) was performed so that the pH of the solid medium was varied from pH 6.0 to 11.0. To study the effect of the initial moisture content on protease production, the initial moisture content of the cow dung was adjusted to 60-180% using glycine-NaOH buffer (pH 10.0). To determine the effect of inoculum size on protease production, the inoculum concentration was increased accordingly (5-30%). In addition to the physical parameters, nutrient para- meters were also optimized. This included the effect of carbon sources (1%, w/w) (glucose, lactose, trehalose, mal- tose, xylose and starch) and nitrogen sources (1%, w/w) (gelatin, ammonium nitrate, peptone, yeast extract, urea, skimmed milk, and casein). The maximum production of protease at various concentrations (0.5-2.5%) of maltose as a carbon source and urea as a nitrogen source was investigated. The effect of the optimum concentration of maltose, urea and their combination on alkaline protease production for 24–96 h was also evaluated. The results reported in this study are averages of triplicate findings. Purification of protease The organism was grown aerobically in an optimized medium for 72 h at 37°C and extracted as described in materials and method section. Samples were centrifuged at 10,000 g for 10 min, and the supernatant was used as a crude enzyme preparation. It was precipitated with ammonium sulphate (40-80% saturation) and the enzyme precipitate obtained was centrifuged at 10,000 g for 10 min at 4°C. The precipitate obtained from the previous step was re-suspended in 5.0 mL of 0.025 M Tris–HCl buffer and dialysed against the same buffer. The dialysed sample was applied to a Sephadex G-75 gel filtration column (0.6 × 45 cm), and eluted with 0.025 M Tris–HCl buffer at pH 8.0, at a flow rate of 0.5 mL/min. Fractions of 2.0 mL were collected and the optical dens- ity of the sample was measured at 280 nm and analysed for proteolytic activity. SDS-PAGE and zymography Sodium dodecyl sulphate-polyacrylamide gel electrophor- esis was carried out according to (Laemmli 1970) using 11% crosslinked polyacrylamide gel. Silver staining was performed to visualize protein bands. Zymographic ana- lysis was performed by the enzyme pattern of proteins, obtained by zymogram with 1% casein substrate and detected using coomassie brilliant blue R-250 (Westergaar et al. 1980). Characterization of protease activity The effect of pH on the activity of the enzyme was studied by assaying the enzyme activity at different pH values ran- ging from 5.0 to11.0. To check the stability of the enzyme at various pH, 100 μL of the enzyme solution was mixed with 900 μL of buffer solutions (pH 5.0-11.0) and the mix- ture was taken to measure the protease activity under standard assay conditions after incubation for 1 h. The ef- fect of temperature on enzyme activity was studied by holding the reactions at various temperatures (30–70°C) using the standard assay method. To evaluate the heat stability of the protease, the sample was denatured at an optimized temperature (50°C) for 0–120 min. To study the effect of ions (0.01 M) on enzyme activity, the sample was pre-incubated with various divalent ions at 37°C for 1 h and the activity evaluated. To examine the effect of solvents, surfactants and detergents on enzyme activity, many agents were added to the enzyme solution at the indicated concentration, allowed to stand for 1 h and 24 h at room temperature and the activity measured. To evalu- ate the dehairing property of an enzyme, fresh goat-hide Vijayaraghavan et al. SpringerPlus 2012, 1:76 Page 7 of 9 http://www.springerplus.com/content/1/1/76 was incubated with 4.0 mg enzyme solution (pH 10.0) for up to 16 h at room temperature. Statistical analysis All experiments were performed in triplicate. Data were analyzed by correlation coefficient (r) and Student’s ‘t’ test. A significance level of 0.05 or less was considered statistically significant. Conclusions In conclusion, cow dung was utilized as a substrate for the production of alkaline protease in SSF. Cow dung is a cheaply available bioresource and this substrate is available in almost every country. So, this biomass could be effect- ively utilized for the production of alkaline protease an in- dustrial scale. Apart from the significance of the substrate, the enzyme secreted by B. subtilis strain VV is useful in the detergent and leather-processing industries. Competing interests The authors declare that they have no competing interests. Authors’ contribution PV designed and executed this project work. AV, AA and JJ gave technical assistance. SGPV guided this project work. All the authors have approved the submission of the manuscript. Acknowledgements One of the authors, P. Vijayaraghavan is thankful to the Council of Scientific and Industrial Research, New Delhi, India for financial support in the form of a Senior Research Fellowship. Author details 1International Centre for Nanobiotechnology, Centre for Marine Science and Technology, Manonmaniam Sundaranar University, Rajakkamangalam–629 502, Kanyakumari DistrictTamil Nadu, India. 2Centre for Marine Science and Technology, Manonmaniam Sundaranar University, Rajakkamangalam–629 502, Kanyakumari District, Tamil Nadu, India. 3Department of Biotechnology, Kalasalingam University, Virudhunagar, Srivilliputtur, 626 126, Tamilnadu, India. Received: 5 October 2012 Accepted: 19 December 2012 Published: 22 December 2012 References Abo-Aba SEM, Soliman EAM, Nivien AA (2006) Enhanced production of extra cellular alkaline protease in Bacillus ciculance through plasmid transfer. Res J Agric Biol Sci 16:526–530 Andersen LP (1998) Method for dehairing of hides or skins by means of enzymes. US Patent 5:834,299 Aravindan R, Saravanabhavan S, Thanikaivelan P, Rao JR, Nair BUA (2007) Chemo enzymatic pathway leads towards zero discharge tanning. J Clean Product 15:1217–1227 Arulmani M, Aparanjini K, Vasanthi K, Arumugam A, Arivuchelvi M, Thangavelu Kalaichelvan PT (2007) Purification and partial characterization of serine protease from thermostable alkalophilic Bacillus laterosporus -AK1. World J Microbiol Biotechnol 23(4):475–481 Bradford MM (1976) A rapid and sensitive method for the quantization of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254 Chopra AK, Mathur DK (1985) Purification and characterization of heat-stable protease from Bacillus stearothermophilus RM-67. J Dairy Sci 68:3202–3211 De Azeredo LA, De Lima MB, Coelho RR, Freire DM (2006) A low-cost fermentation medium for thermophilic protease production by Streptomyces sp. 594 using feather meal and corn steep liquor. Curr Microbiol 53(4):335–339 Ellaiah P, Srinivasulu B, Adinarayana K (2002) A review on microbial alkaline proteases. J Sci Ind Res 61:690–704 Ganesh Kumar A, Nagesh N, Prabhakar TG, Sekaran G (2008) Purification of extracellular acid protease and analysis of fermentation metabolities by Synergistes sp. utilizing proteinaceous solid waste from tanneries. Bioresour Technol 99:2364–2372 Gessesse A (1997) The use of nug meal as a low-cost substrate for the production of alkaline protease by the alkaliphilic Bacillus sp. AR-009 and some properties of the enzyme. Bioresour Technol 62:59–61 George S, Raju V, Krishnan MRV, Subramanian TV, Jayaraman K (1995) Production of protease by Bacillus amyloliquefaciens in solid-state fermentation ant its application in the unhairing of hides and skins. Process Biochem 30:457–462 Ghorbel B, Sellami-Kamoun A, Nasri M (2003) Stability studies of protease from Bacillus cereus BG1. Enzyme Microb Technol 32:513–518 Hameed A, Natt MA, Evans CS (1996) Production of alkaline protease by a new Bacillus subtilis isolate for use as a bating enzyme in leather treatment. World J Microbiol Biotechnol 12:289–291 Hameed A, Keshavarz T, Evans CS (1999) Effect of dissolved oxygen tension and pH on the production of extracellular protease from a new Bacillus subtilis K2, for use in leather processing. J Chem Technol Biotechnol 74:5–8 Jacobs MF (1995) Expression of the subtilisin Carlsberg-encoding gene in Bacillus licheniformis and Bacillus subtilis. Gene 152:67–74 Johnvesly B, Manjunath BR, Naik GR (2002) Pigeon pea waste as a novel, inexpensive, substrate for production of a thermostable alkaline protease from thermoalkalophilic Bacillus sp. JB-99. Bioresour Technol 82:61–64 Jones D, Collins MD (1984) Irregular, nonsporeforming Gram-positive rods. In: Sneath PHA (ed) Bergey’s Manual of systematic bacteriology, Vol. 2. Williams and Wilkins, Baltimore, MD, pp 1261–1434 Joo HS, Kumar CG, Park GC, Paik SR, Chang CS (2003) Oxidant and SDS-stable alkaline protease from Bacillus Clausii I-52: production and some properties. J Appl Microbiol 95:267–272 Kumar CG, Takagi H (1999) Microbial alkaline proteases from a bioindustrial viewpoint. Biotechnol Adv 17:561–594 Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227(5259):680–685 MacFaddin JF (2000) Biochemical tests for identification of medical bacteria. Lippincott Williams and Wilkins, Baltimore, MD Misra RV, Roy RH, Hiraoka (2003) On farm composting method. FAO, Rome Morimura S, Kida K, Sonoda Y (1994) Production of protease using waste-water from the manufacture of shochu. J Ferment Bioeng 77(2):183–187 Mukherjee AK, Adhikari H, Rai SK (2008) Production of alkaline protease by a thermophilic Bacillus subtilis under solid-state fermentation (SSF) condition using Imperata cylindrical grass and potato peel as low cost medium: Characterization and application of enzyme in detergent formulation. Biochem Eng J 39:353–361 Nigam P, Singh D (1994) Solid state (substrate) fermentation system and their applications in biotechnology. J Basic Microbiol 34:405–423 Nilegaonkar SS, Zambare WP, Kanekar PP, Dhakephalkar PK, Sarnaik SS (2007) Production and partial characterization of dehairing protease from Bacillus cereus MCM B-326. Bioresour Technol 98:1238–1245 Oliveira LA, Porto ALF, Tambourgi EB (2006) Production of xylanase and protease by Penicillium janthinellum CRC 87 M-115 from different agricultural wastes. Bioresour Technol 98:1238–1245 Pandey A, Soccol CR, Nigam P, Brand D, Mohan R, Roussos S (2000) Biotechnological potential of coffee pulp and coffee husk for bioprocesses. Biochem Eng J 6:153–162 Prakasham RS, Subba Rao C, Sarma PN (2006) Green gram husk: an inexpensive substrate for alkaline protease production by Bacillus sp. in solid-state fermentation. Bioresour Technol 97:1449–1454 Rajkumar R, Ranishee JK, Ramasamy R (2011) Production and characterizaion of a novel proteases from Bacillus sp. RRM1 under solid state fermentation. J Microbiol Biotechnol 21(6):627–636 Ravindran B, Ganesh Kumar A, Aruna Bhavani PS, Sekaran G (2011) Solid-state fermentation for the production of alkaline protease by Bacillus cereus 1173900 using proteinaceous tannery solid waste. Curr Sci 100(5):726–730 Riffel A, Ortolan S, Brandelli A (2003) De-hairing activity of extracellular proteases produced by keratinolytic bacteria. J Chem Technol Biotechnol 78:855–859 Vijayaraghavan et al. SpringerPlus 2012, 1:76 Page 8 of 9 http://www.springerplus.com/content/1/1/76 Scheuer PJ (1990) Some marine ecological phenomena: chemical basis and biomedical potential. Science 248:173–177 Sivasubramanian S, Murali Manohar B, Rajaram A, Puvanakrishna R (2008) Ecofriendly lime and sulfide free enzymatic dehairing of skins and hides using a bacterial alkaline protease. Chemosphere 70:1015–1024 Sousa F, Ju S, Erbel A, Kokol V, Cavaco-Paulo A, Gubitz GM (2007) A novel metalloprotease from Bacillus cereus for protein fibre processing. Enzyme Microb Technol 40:1772–1781 Subba Rao C, Sathish T, Ravichandra P, Prakasham RS (2009) Characterization of thermo- and detergent stable serine protease from isolated Bacillus circulans and evaluation of eco-friendly applications. Process Biochem 44:262–268 Towatana NH, Painupong A, Suntinanalert P (1999) Purification and characterization of an extracellular protease from alkaliphilic and thermophilic Bacillus sp. PS7. J Biosci Bioeng 87:581–587 Uyar F, Baysal Z (2004) Production and optimization of process parameters for alkaline protease production by a newly isolated Bacillus sp. under solid state fermentation. Process Biochem 39(12):1893–1898 Varela H, Ferrari MD, Belobradjic L, Vazquez A, Loperena ML (1997) Skin unhairing proteases of Bacillus subtilis: production and partial characterization. Biotechnol Lett 19:755–758 Vijayaraghavan P, Vincent SGP (2012) Cow dung as a novel, inexpensive substrate for the production of a halo-tolerant alkaline protease by Halomonas sp. PV1 for eco-friendly applications. Biochem Eng J 69:57–60 Westergaar JL, Hackbarth C, Treuhaft MW, Roberts RC (1980) Detection of proteinases in electrophorograms of complex mixtures. J Immunol Meth 34(2):167–175 Yang JK, Shih IL, Tzeng YM, Wang SL (2000) Production and purification of protease from a Bacillus subtilis that can deproteinize crustacean wastes. Enzyme Microb Technol 26:406–413 doi:10.1186/2193-1801-1-76 Cite this article as: Vijayaraghavan et al.: Cow dung: a potential biomass substrate for the production of detergent-stable dehairing protease by alkaliphilic Bacillus subtilis strain VV. SpringerPlus 2012 1:76. Submit your manuscript to a journal and benefi t from: 7 Convenient online submission 7 Rigorous peer review 7 Immediate publication on acceptance 7 Open access: articles freely available online 7 High visibility within the fi eld 7 Retaining the copyright to your article Submit your next manuscript at 7 springeropen.com Vijayaraghavan et al. SpringerPlus 2012, 1:76 Page 9 of 9 http://www.springerplus.com/content/1/1/76

Title: Cow dung: a potential biomass substrate for the production of detergent-stable dehairing protease by alkaliphilic Bacillus subtilis strain VV ​ Authors: Ponnuswamy Vijayaraghavan, Aija Vijayan, Arumugaperumal Arun, John Kennady Jenisha, Samuel Gnana Prakash Vincent Publisher: SpringerPlus Date: 22 December 2012 ​ Abstract: Cow dung, a cheap and easily available source of energy, was used as the substrate for the production of alkaline protease by solid-state fermentation using the Bacillus subtilis strain VV. ​ In order to achieve the maximum yield of this enzyme, the following optimum process parameters are needed: fermentation period (72 h), pH (10.0), moisture content (140%), inoculum (25%), temperature (30–40°C), carbon source (2% (w/w) maltose) and nitrogen source (1% (w/w) urea). ​ The protease was stable over a broad temperature range (30–50°C) and pH (8.0-10.0), with maximum activity at 50°C and pH 10.0. ​ Among the divalent ions tested, Ca2+ (0.01 M) increased enzyme activity. ​ The purified protease, after being subjected to sodium dodecyl sulphate-polyacrylamide gel electrophoresis, was found to have a molecular mass of 38.5 kDa. ​ The enzyme was solvent-and surfactant-stable and showed activity even after 24 h incubation along with various commercially available detergents. ​ This enzyme possessed dehairing properties for animal hide after 16 h of incubation at room temperature. ​ From these results it is evident that cow dung is a potential substrate for the production of a detergent-stable, dehairing protease by B. subtilis. ​ This enzyme has a lot of potential applications in the detergent and leather-processing industries. ​

Molecular sexing of threatened Gyps vultures: an important strategy for conservation breeding and ecological studies.pdf

RESEARCH Open Access Molecular sexing of threatened Gyps vultures: an important strategy for conservation breeding and ecological studies Prabhakar B Ghorpade1, Praveen K Gupta2, Vibhu Prakash3, Richard J Cuthbert4, Mandar Kulkarni3, Nikita Prakash3, Asit Das1, Anil K Sharma1 and Mohini Saini1* Abstract During the last two decades populations of three resident species of Gyps vulture have declined dramatically and are now threatened with extinction in South Asia. Sex identification of vultures is of key importance for the purpose of conservation breeding as it is desirable to have an equal sex ratio in these monogamous species which are housed together in large colony aviaries. Because vultures are monomorphic, with no differences in external morphology or plumage colour between the sexes, other methods are required for sex identification. Molecular methods for sex identification in birds rely on allelic length or nucleotide sequence discrimination of the chromohelicase-DNA binding (CHD) gene located on male and female chromosomes ZZ and ZW, respectively. We characterized the partial sequences of CHD alleles from Gyps indicus, Gyps bengalensis, Gyps himalayensis and Aegypius monachus and analysed the applicability of five molecular methods of sex identification of 46 individual vultures including 26 known-sex G. bengalensis and G. indicus. The results revealed that W-specific PCR in combination with ZW-common PCR is a quick, accurate and simple method, and is ideal for sex identification of vultures. The method is also suitable to augment ecological studies for identifying sex of these endangered birds during necropsy examinations especially when gonads are not apparent, possibly due to regression during non-breeding seasons. Keywords: Molecular sex identification, Gyps vulture, Cinereous vulture, Vulture conservation, Captive breeding Background Nine species of vultures in the family Accipitridae are found in India, three of which are endemic to South and South-East Asia (the Oriental white-backed vulture (Gyps bengalensis), long-billed (G. indicus) and slender- billed vulture (G. tenuirostris) and are classified as Critically Endangered by the International Union for Conservation of Nature and Natural resources and are at high risk of extinction in the wild (IUCN, 2011). In India, populations of G. bengalensis have declined by more than 99.9% while those of G. indicus and G. tenuirostris have declined by around 97% between the early 1990s and 2007 (Prakash et al. 2007). Similar reductions in vulture populations have been recorded in Pakistan and Nepal (Pain@ et al. 2008). Although the Himalayan griffon (G. himalayensis) is not considered threatened (under category Least Concern) (IUCN, 2011), its population de- cline has been recorded in Nepal (Acharya et al. 2009). The status of another species, the Cinereous Vulture (Aegypius monachus), is classified as Near Threatened as per IUCN (IUCN, 2011). Veterinary use of non-steroidal anti-inflam- matory drugs (NSAIDs) such as diclofenac and ketoprofen have been shown to be toxic to Gyps vultures and are responsible for the decline of these species (Oaks et al. 2004; Green et al. 2006, 2007; Swan et al. 2006; Cuthbert et al. 2009; Naidoo et al. 2009, 2010; Das et al. 2011). In contrast the NSAID meloxicam has been demonstrated to be a safe and effective alternative drug for veterinary use (Swan et al. 2006; Swarup et al. 2007). Although the veter- inary use of diclofenac has been banned in India, Pakistan and Nepal (Kumar 2006; Singh 2008), it’s illegal use is still * Correspondence: [email protected] 1Centre for Wildlife Conservation, Management & Disease Surveillance, Indian Veterinary Research Institute, Izatnagar 243 122, India Full list of author information is available at the end of the article a SpringerOpen Journal © 2012 Ghorpade et al.; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Ghorpade et al. SpringerPlus 2012, 1:62 http://www.springerplus.com/content/1/1/62 apparent, as diclofenac residues are still prevalent in cattle carcasses across India at concentrations sufficient to cause declines in vulture populations (Cuthbert et al. 2011a, 2011b; Saini et al. 2012). Due to the massive scale of the population declines and the continued use of diclofenac, populations of the three Critically Endangered resident Gyps species are being bred in captivity in India, Nepal and Pakistan, with the aim that their progeny will be introduced back in to the wild after ensuring that the environment is safe and diclofenac free (MoEF 2006; Bowden 2009). Vultures are monomorphic monogamous species and hence without knowing the sex of birds it is difficult to maintain the correct sex ratios in aviaries at conservation breeding centres in order to maximise the chances of successful breeding. As well as the key importance of iden- tifying gender for conservation breeding programmes, knowledge of sex is also important to complement forensic studies (An et al. 2007) and investigations on evolution and ecology (Griffiths and Tiwari 1995; Costantini 2008; Fukui et al. 2008). Various techniques have been employed for sex deter- mination of monomorphic birds such as laparotomy (Risser 1971), laparoscopy (Richner 1989), flow cytometry (Nakamura et al. 1990), karyotyping (Hatzofe and Getreide 1990) and Raman spectroscopy (Harz et al. 2008) but mo- lecular methods based on DNA analysis are most prevalent (Fridolfsson and Ellegren 1999). Except for the ratites, that have undifferentiated sex chromosomes, all male birds are homogametic with ZZ sex chromosomes and females are heterogametic with ZW sex chromosomes (Ellegren 1996; Griffiths et al. 1996). The most frequently exploited gene for sex identification is the Chromohelicase DNA binding (CHD) gene that is found conserved on both W and Z chromosomes (Griffiths 2000). Intronic length variation in CHD-Z and CHD-W allelles amplified by Griffiths univer- sal CHD primer pair P2/P8 has formed the basis of gender identification in most avian species (Griffiths et al. 1998; Fridolfsson and Ellegren 1999). However, in certain species of Accipitridae there is an extremely short difference in in- tronic length between CHD-Z and CHD-W P2/P8 ampli- con which makes sex identification more difficult and inaccurate (Ito et al. 2003; Chang et al. 2008). Hence, in order to circumvent the limitation of conventional PCR (Fridolfsson and Ellegren 1999), different approaches detecting small variation in nucleotides like Amplification Refractory Mutation System (ARMS) (Ito et al. 2003), Re- striction Fragment Length Polymorphism (RFLP) (Sacchi et al. 2004), Single strand conformation polymorphism (SSCP) (Ramos et al. 2009), Melting Curve analysis (Chang et al. 2008a), ZW common and W-specific PCR (Chang et al. 2008b), TaqMan Probe-based real time PCR (Chang et al. 2008c; Chou et al. 2010) have been suggested in order to identify gender in these species. Old World vultures along with other birds of prey be- long to the taxonomic order Falconiformes, family Acci- pitridae, and subfamily Accipitrinae (Chang et al. 2008b, 2008c). Due to their position within the Accipitridae it was observed that intronic length variation of CHD-Z and CHD-W amplicon in Griffiths universal CHD primer pair P2/P8 based PCR is unlikely to be suitable for sex discrimination in G. indicus or G. bengalensis (Reddy et al. 2007). However, a similar approach (Kahn et al. 1998) using denaturing polyacrylamide gel electrophor- esis combined with autoradiography has been reported to sex nestlings of these two species (Arshad et al. 2009). In the present study, based upon the chromohelicase gene sequences in male (ZZ) and female birds (ZW), the accuracy and reliability of five different approaches are compared for molecular gender identification in three vul- ture species (G. indicus, G. bengalensis, G. himalayensis) in order to identify an accurate and simple test to support the captive breeding programmes. Results Sequence characterization of CHD-Z and CHD-W sequences The CHD-Z and CHD-W sequences from the four vulture species used in this study were amplified and the sequences were determined. These sequences were sub- mitted to GenBank and accession numbers obtained were HQ236387, HQ236386 (G. indicus); HQ236388, HQ236385 (G. bengalensis); HQ236384, HQ236383 (G. himalayensis); HQ236382 (A. monachus). Independent alignment reports for CHD-Z and CHD-W sequences were prepared (Figure 1A and B), where primer binding regions for P2, P8, NP, MP; ZW-Common and W-specific primers and probes as well as restriction site for BamHI and RsaI were located. The primer binding region for MP and W-specific primers were found in all CHD-W but not in CHD-Z sequences. The recognition sequence for BamHI was found on CHD-Z but was absent on the CHD-W sequence, whereas the RsaI restriction site was located at different positions in the CHD-Z and CHD-W sequences. Based on these identified sequences the applicability and accuracy of PCR-RFLP, ARMS-PCR, W-specific PCR and TaqMan probe based real-time PCR methods for sex iden- tification was tested for all four species of vultures (Table 1). Standardization of PCR-based molecular methods for sex identification i) Conventional PCR-RFLP For standardization of conventional PCR-RFLP, known sex samples from G. bengalensis and G. indicus, G. hima- layensis and A. monachus were used. It was evident from Ghorpade et al. SpringerPlus 2012, 1:62 Page 2 of 12 http://www.springerplus.com/content/1/1/62 Restriction endonuclease RsaI and BamHI sites were selected for sex identification in PCR-RFLP analysis. Standardization of PCR-based molecular methods for sex identification i) Conventional PCR-RFLP Using Griffiths universal CHD primer pair P2/P8, the amplified PCR products were analysed using restriction endonuclease digestion with RsaI and BamHI and sex was identified. The restriction digestion was performed in a 30 μl reaction volume containing 5 μl of amplified PCR product and 2 U of restriction enzymes (RsaI or BamHI) and was incubated at 37°C overnight. The digested products were separated on 3% agarose gel along with 100 bp DNA ladder and analysed. ii) ARMS-PCR ARMS-PCR based on 3’-terminal mismatch primer (MP primer) point mutation conserved among Falconiformes CHD-W and CHD-Z sequences previously reported (Ito et al. 2003) was performed to identify sex in vultures with some modifications. Briefly, PCR was done in a 25 μl reaction volume containing 0.4 μM each of Griffiths univer- sal CHD primer P2 forward primer, another forward primer MP (5’-AGTCACTATCAGATCCGGAA-3’) and reverse primer NP (5’-GAGAAACTGTGCAAAACAG -3’), 100 ng genomic DNA, 0.2 mM each dNTP and 1U of Taq DNA Polymerase (Bangalore Genei, India). PCR amplification cycle involved initial denaturation at 94°C for 90 sec followed by 35 cycles of 94°C for 30 sec, 50°C for 45 sec, 72°C for 30 sec and final extention at 72°C for 5 min. The amplified PCR products were separated on 3% agarose gel along with 100 bp DNA ladder and analysed. iii) W-specific PCR An alternative W-specific sex identification method suggested for Crested Serpent Eagle (Spilornis cheela hoya) (Chang et al. 2008b) was also used in this study, where Griffith’s universal CHD primer P2 was used as a forward primer and CHD-W primer as a reverse primer which anneals to only the CHD-W allele sequence, or ZW-common primer which anneals to both CHD-Z and CHD-W allele sequences. The PCR reaction was performed in a 25 μl volume consisting of 0.4 μM each of Griffith’s universal CHD primer P2 and reverse primer CHD-ZW-common (5’-GATCAGCTTTAATGGA AGTGAAG-3’) or CHD-W specific (5’-GGTTTTCACAC ATGGCACA-3’), 100 ng genomic DNA, 0.2 mM each dNTP, 1.5 μl DMSO and 1U Taq DNA Polymerase (Bangalore Genei, India). The PCR cycling condition employed was an initial denaturation at 94°C for 3 min, followed by 45 repeated cycles of 94°C for 30 sec, 56°C for 30 sec, 72°C for 20 sec, and final extension at 72°C for 5 min. The amplified PCR products were resolved on 3% agarose gel along with 100 bp DNA ladder and analysed for presence (indicating female) or absence (indicating male) of 263 bp W-specific product. iv) TaqMan probe based real-time PCR The TaqMan based qualitative real-time PCR (qPCR) based on allele discrimination option for sex identifica- tion reported earlier for S. cheela hoya (Chang et al. 2008c) was used. This test utilises the considerable difference in composition of the CHD-W and CHD-Z sequences in vultures, with the W-specific probe (5’-FAM-TGTGCCATGTGTGAAAACCACCCA-TAMR A) recognising only the CHD-W region whereas the ZW common probe (5’-HEX-CCCTTCACTTCCAT TAAAGCTGATCTGG-TAMRA) recognises both the Z and W CHD chromosome regions. The PCR reaction mixture in a 20 μl volume consisted of 0.4 μM each of Griffith’s universal CHD primer pair P2/P8, 50–100 ng genomic DNA, 0.2 mM of each dNTP, 20nM each of W-specific and ZW common probes and 1 U of Taq DNA polymerase (Bangalore Genei, India). The DNA template was excluded from no template control (NTC), whereas the probe was excluded from no probe control (NPC). In addition, positive controls (with known male and female DNA samples) were also included in each test. Two steps PCR condition was employed with initial denaturation at 94°C for 4 min, followed by 50 repeated cycles of 92°C for 15 sec, 60°C for 1 min in Mx3005P real-time PCR machine (Agilent, USA). The results were recorded as an amplification plot, with text report and alleles discrimination made using MxPro™QPCR soft- ware (Agilent, USA) and compared with female and male positive controls. Application of the molecular methods for sex identification All molecular methods were employed for sex identifica- tion of vultures using tissue samples obtained during necropsy (n = 17) and blood samples obtained from live birds (n = 9) for which the sex was known. These tests were then employed for analysing eight blood samples and 12 necropsy tissues from unknown-sex vultures. Abbreviations CHD: Chromohelicase-DNA binding gene; IUCN: International Union for Conservation of Nature; NSAIDs: Non-steroidal antiinflammatory drugs; RFLP: Restriction Fragment Length Polymorphism; ARMS: Amplification Refractory Mutation System; SSCP: Single strand conformation polymorphism; qPCR: Qualitative real-time PCR; VCBC: Vulture Conservation Breeding Centre. Ghorpade et al. SpringerPlus 2012, 1:62 Page 10 of 12 http://www.springerplus.com/content/1/1/62 Competing interests The authors declare that they have no competing interests. Authors’ contributions PBG carried out cloning and characterization of sequences, performing tests, preparation of the draft and revision of the manuscript. PKG participated in conceiving the design of the study, performed sequence analysis and interpretations and helped in drafting and revising the manuscript. VP conceived the problem, coordinated the collection of samples from field post-mortems and breeding centres and helped to draft the manuscript. RJC participated in coordination of the study, preparing draft and critically revising the manuscript. MK and NP collected the tissue and blood samples from vultures. AD and AKS participated in collection of one tissue sample from Gyps himalayensis from necropsy examination, design of the study and helped to draft the manuscript. MS contributed in conception of the study, execution of the experiments, analysis and interpretation of data, drafting and revising the manuscript. All authors read and approved the final manuscript. Acknowledgements We thank the Director and Joint Director (Research), IVRI, Izatnagar and the Director, BNHS, Mumbai for providing the necessary facilities and funding to carry out this work. We acknowledge laboratory assistance provided by Mr Mohan Bhat, IVRI. The vulture conservation breeding centres in India are run by the Bombay Natural History Society (BNHS), India in collaboration with the state forest departments and Ministry of Environment and Forests, Government of India and supported by UK based organizations Royal Society for Protection of Birds (RSPB), Darwin Initiative for the survival of species, Zoological Society of London and National Birds of Prey Trust. Author details 1Centre for Wildlife Conservation, Management & Disease Surveillance, Indian Veterinary Research Institute, Izatnagar 243 122, India. 2Division of Veterinary Biotechnology, Indian Veterinary Research Institute, Izatnagar 243 122, India. 3Bombay Natural History Society, Hornbill House, S.B. Singh Road, Mumbai 400 001, India. 4Royal Society for the Protection of Birds, The Lodge, Sandy, Bedfordshire, UK. Received: 18 August 2012 Accepted: 7 December 2012 Published: 12 December 2012 References Acharya R, Cuthbert R, Baral HS, Shah KB (2009) Rapid population declines of Himalayan Griffon Gyps himalayensis in Upper Mustang, Nepal. Bird Conservation International 19:99–107 An J, Lee MY, Min MS, Lee MH, Lee H (2007) A molecular genetic approach for species identification of mammals and sex determination of birds in a forensic case of poaching from South Korea. Forensic Sci Int 167:59–61 Arshad M, Chaudhary MJI, Wink M (2009) High mortality and sex ratio imbalance in a critically declining Oriental White-backed vulture population (Gyps bengalensis) in Pakistan. J Ornithol 150:495–503 Bowden C (2009) The Asian Gyps vulture crisis: the role of captive breeding in India to prevent total extinction. BirdingASIA 12:121–123 Busch JD, Katznerm TE, Bragin E, Keim P (2005) Tetranucleotide microsatellite for Aquila and Haliaeetus eagles. Mol Ecol Notes 5:39–41 Chang HW, Cheng CA, Gu DL, Chang CC, Su SH, Wen CH, Chou CY, Chou TC, Yao CT, Tsai CL, Cheng CC (2008a) High-throughput avian molecular sexing by SYBR green based real-time PCR combined with melting curve analysis. BMC Biotechnol 8:8–12 Chang HW, Chou TC, Gu DL, Cheng CA, Chang CC, Yao CT, Chuang LY, Wen CH, Chou YC, Tan KY, Cheng CC (2008b) An improved PCR method for gender identification of eagles. Mol Cell Probes 22:184–188 Chang HW, Gu DL, Su SH, Chang CC, Cheng CA, Huang HW, Yao CT, Chou TC, Chuang LY, Cheng CC (2008c) High-throughput gender identification of Accipitridae eagles with real-time PCR using TaqMan probes. Theriogenology 70:83–90 Chou TC, Yao CT, Su SH, Hung YC, Chen WS, Cheng CC, Tseng CN, Wang HM, Chou YC, Li SS, Gu DL, Chang HW (2010) Validation of Spilornis cheela hoya TaqMan probes for potential gender identification of many Accipitridae species. Theriogenology 73:404–11 Costantini V, Guaricci AC, Laricchiuta P, Rausa F, Lacalandra GM (2008) DNA sexing in Humboldt Penguins (Spheniscus humboldti) from feather samples. Anim Reproduction Sci 106:162–167 Cuthbert R, Prakash V, Bowden C, Das D, Green RE, Jhala Y, Pain DJ, Senacha KR, Shah N, Taggart MA (2009) Role of veterinary diclofenac in decline of vulture populations in South Asia. Ind Vet Med Journal 29:80–85 Cuthbert R, Taggart MA, Prakash V, Saini M, Swarup D, Upreti S, Mateo R, Chakraborty SS, Deori P, Green RE (2011a) Effectiveness of action in India to reduce exposure of Gyps vultures to the toxic veterinary drug diclofenac. PLoS One 6:e19069 Cuthbert RJ, Prakash V, Saini M, Upreti S, Swarup D, Das A, Green RE, Taggart M (2011b) Are conservation actions reducing the threat to India’s vulture populations? Curr Sci 101:1480–1484 Das D, Cuthbert RJ, Jakati RD, Prakash V (2011) Diclofenac is toxic to the Himalayan vulture Gyps himalayensis. Bird Conservation International 21:72–75 Ellegren H (1996) First gene on the avian W chromosome (CHD) provides a tag for universal sexing of non-ratite birds. Proc Roy Soc Biol Sci 263(1377):1635–1641 Fridolfsson A, Ellegren H (1999) A simple and universal method for molecular sexing of non-ratite birds. J Avian Biol 30:116–121 Fukui E, Sugita S, Yoshizawa M (2008) Molecular sexing of Jungle crow (Corvus macrorhynchos japonensis) and Carrion crow (Corvus corone corone) using a feather. Anim Sci J 79:158–162 Green RE, Taggart MA, Senacha KR, Raghavan B, Pain DJ, Cuthbert R (2007) Rate of decline of the oriental white-backed vulture population in India estimated from a survey of diclofenac residues in carcasses of ungulates. PLoS One 2(8):e686 Green RE, Taggart MA, Das D, Pain DJ, Kumar S, Cunningham AA, Cuthbert R (2006) Collapse of Asian vulture populations: risk of mortality from residues of the veterinary drug diclofenac in carcasses of treated cattle. J Appl Ecol 43:949–956 Griffiths R (2000) Sex identification in birds. Semin Avian Exotic Pet Med 9:14–26 Griffiths R, Daan S, Dijkstra C (1996) Sex identification in birds using two CHD genes. Proc Royal Soc - Biol Sci 263:1251–1256 Griffiths R, Double MC, Orr K, Dawson RJG (1998) A DNA test to sex most birds. Mol Ecol 7:1071–1075 Griffiths R, Tiwari B (1995) Sex of the last wild Spix’s macaw. Nature 375(6531):375–454 Harz M, Krause M, Bartels T, Cramer K, Rosch P, Popp J (2008) Minimal invasive gender determination of birds by means of UV-resonance Raman spectroscopy. Anal Chem 80:1080–1086 Hatzofe O, Getreide S (1990) Sex determination in vultures and other monomorphic raptors. Torgos 8:27–29 Hau M (2001) Timing of breeding in variable environments: tropical birds as model systems. Horm Behav 40:281–290 IUCN (International Union for Conservation of Nature) (2011) Red list of threatened species, Version Version 2011.2. http://www.iucnredlist.org (Downloaded on 25 April 2012) Ito H, Sudo-yamaji A, Abe M, Murase T, Tsubota T (2003) Sex identification by alternative polymerase chain reaction methods in falconiformes. Zoological Sci 20:339–344 Kahn NW, John J, Quinn TW (1998) Chromosome-specific intron size differences in the avian CHD gene provide an efficient method of sex identification in birds. Auk 115:1074–1078 Kumar A (2006) Subject: diclofenac for veterinary use. Letter to ‘All State Drug Controllers’ from the ‘Drug Controller General (India)’, 11th May 2006, F.No. 18-03/2006/DC MOEF (Ministry of Environment and Forests) (2006) Action plan for vulture conservation in India. 28, New Delhi, p 1 Naidoo V, Wolter K, Cromarty D, Diekmann M, Duncan N, Meharg AA, Taggart MA, Venter L, Cuthbert R (2010) Toxicity of NSAIDs to Gyps vultures: a new threat from ketoprofen. Biol Lett 6:339–341 Naidoo V, Wolter K, Cuthbert R, Duncan N (2009) Veterinary diclofenac threatens Africa’s endangered vulture species. Reg Toxicol Pharmacol 53:205–208 Nakamura D, Tiersch TR, Douglas M, Chandler RW (1990) Rapid identification of sex in birds by flow cytometry. Cytogenet Cell Genet 53:201–205 Nazrul Islam M, Tsukahara N, Sugitaa S (2012) Apoptosis-mediated seasonal testicular regression in the Japanese Jungle crow (Corvus macrorhynchos). Theriogenology 77:1854–1865 Ghorpade et al. SpringerPlus 2012, 1:62 Page 11 of 12 http://www.springerplus.com/content/1/1/62 Nesje M, Roed KH (2000) Sex identification in falcons using microsatellite DNA markers. Hereditas 132:261–263 Oaks JL, Gilbert M, Virani MZ, Watson RT, Meteyer CU, Rideout BA, Shivaprasad HL, Ahmed S, Chaudhry MJ, Arshad M, Mahmood S, Ali A, Khan AA (2004) Diclofenac residues as the cause of vulture population decline in Pakistan. Nature 27(6975):630–633 Pain DJ, Bowden CGR, Cunningham AA, Cuthbert R, Das D, Gilbert M, Jakati RD, Jhala Y, Khan AA, Naidoo V, Oaks JL, Parry-Jones J, Prakash V, Rahmani A, Ranade SP, Baral HS, Sanacha KR, Saravanan S, Shah N, Swan G, Swarup D, Taggart MA, Watson RT, Virani MZ, Wolter K, Green R (2008) The race to prevent the extinction of South Asian vultures. Bird Conservation International 18:S30–S48 Prakash V, Green RE, Pain DJ, Ranade SP, Saravanan S, Prakash N, Venkitachalam R, Cuthbert R, Rahmani AR, Cunningham AA (2007) Recent changes in populations of resident Gyps vultures in India. J Bombay Nat His Soc 104(2):129–135 Ramos PS, Bastos E, Mannan RW, Guedes-Pinto H (2009) Polymerase chain reaction-single strand conformation polymorphism applied to sex identification of Accipiter cooperii. Mol Cell Probes 23:115–118 Reddy A, Prakash V, Shivaji S (2007) A rapid, non-invasive, PCR-based method for identification of sex of the endangered Old World vultures (white-backed and long-billed vultures) - implications for captive breeding programmes. Curr Sci 92:659–662 Richner H (1989) Avian laparoscopy as a field technique for sexing birds and an assessment of its effects on wild birds. J Field Ornithol 60(2):137–142 Risser AC (1971) A technique for performing laparotomy on small birds. Condor 73:376–79 Sacchi P, Soglia D, Sandra Maione S, Meneguza G, Campora M, Rasero R (2004) A non-invasive test for sex identification in short-toed eagle (Circaetus gallicus). Mol Cell Probes 18:193–196 Saini M, Taggart MA, Knopp D, Upreti S, Swarup D, Das A, Gupta PK, Niessner R, Prakash V, Mateo R, Cuthbert RJ (2012) Detecting diclofenac in livestock carcasses in India with an ELISA:A tool to prevent widespread vulture poisoning. Environ Pollution 160:11e16 Sharah HA, Buahin GKA, Yusufu SD (2007) Effect of photoperiod changes on breeding activities and weight of sex organs in cattle egrets (Bubulcus ibis L). The Zoologist 5:16–23 Shizuka D, Lyon BE (2008) Improving the reliability of molecular sexing of birds using a W-specific marker. Mol Ecol Resources 8:1249–1253 Singh S (2008) Subject: Prohibition to manufacture, sale and distribution of diclofenac and its formulations for animal use. Letter to ‘Manufacturer’s Associations’ from the ‘Drug Controller General (India)’, 6th August 2008, F. No. 18-01/2007-DC Swan G, Naidoo V, Cuthbert R, Green RE, Pain DJ, Swarup D, Prakash V, Taggart MA, Bekker L, Das D, Diekmann J, Diekmann M, Killian E, Meharg AA, Patra RC, Saini M, Wolter K (2006a) Removing the threat of diclofenac to critically endangered Asian vultures. PLoS Biol 4:395–402 Swan GE, Cuthbert R, Quevedo M, Green RE, Pain DJ, Bartels P, Cunningham AA, Duncan N, Meharg AA, Oaks JL, Parry-Jones J, Shultz S, Taggart MA, Verdoorn G, Wolter K (2006b) Toxicity of diclofenac to Gyps vultures. Biol Lett 2:279–282 Swarup D, Patra RC, Prakash V, Cuthbert R, Das D, Avari P, Pain DJ, Green RE, Sharma AK, Saini M, Das D, Taggart MA (2007) Safety of meloxicam to critically endangered Gyps vultures and other scavenging birds in India. Anim Conserv 10:192–198 CZA (Central Zoo Authority) (2011) Working Manual on Conservation Breeding of Vultures. Available at http://www. cza.nic.in doi:10.1186/2193-1801-1-62 Cite this article as: Ghorpade et al.: Molecular sexing of threatened Gyps vultures: an important strategy for conservation breeding and ecological studies. SpringerPlus 2012 1:62. Submit your manuscript to a journal and benefi t from: 7 Convenient online submission 7 Rigorous peer review 7 Immediate publication on acceptance 7 Open access: articles freely available online 7 High visibility within the fi eld 7 Retaining the copyright to your article Submit your next manuscript at 7 springeropen.com Ghorpade et al. SpringerPlus 2012, 1:62 Page 12 of 12 http://www.springerplus.com/content/1/1/62

Title: Molecular sexing of threatened Gyps vultures: an important strategy for conservation breeding and ecological studies ​ Authors: Prabhakar B Ghorpade, Praveen K Gupta, Vibhu Prakash, Richard J Cuthbert, Mandar Kulkarni, Nikita Prakash, Asit Das, Anil K Sharma, Mohini Saini ​ Publisher: SpringerPlus Date: December 12, 2012 ​ Abstract: During the last two decades populations of three resident species of Gyps vulture have declined dramatically and are now threatened with extinction in South Asia. ​ Sex identification of vultures is of key importance for the purpose of conservation breeding as it is desirable to have an equal sex ratio in these monogamous species which are housed together in large colony aviaries. ​ Because vultures are monomorphic, with no differences in external morphology or plumage colour between the sexes, other methods are required for sex identification. ​ Molecular methods for sex identification in birds rely on allelic length or nucleotide sequence discrimination of the chromohelicase-DNA binding (CHD) gene located on male and female chromosomes ZZ and ZW, respectively. ​ We characterized the partial sequences of CHD alleles from Gyps indicus, Gyps bengalensis, Gyps himalayensis and Aegypius monachus and analysed the applicability of five molecular methods of sex identification of 46 individual vultures including 26 known-sex G. bengalensis and G. indicus. ​ The results revealed that W-specific PCR in combination with ZW-common PCR is a quick, accurate and simple method, and is ideal for sex identification of vultures. ​ The method is also suitable to augment ecological studies for identifying sex of these endangered birds during necropsy examinations especially when gonads are not apparent, possibly due to regression during non-breeding seasons. ​

Deep learning-based approach for high spatial resolution fibre shape sensing.pdf

ARTICLE Deep learning-based approach for high spatial resolution fibre shape sensing Samaneh Manavi Roodsari 1✉, Sara Freund1, Martin Angelmahr2, Carlo Seppi1, Georg Rauter1, Wolfgang Schade2 & Philippe C. Cattin 1 Fiber optic shape sensing is an innovative technology that has enabled remarkable advances in various navigation and tracking applications. Although the state-of-the-art fiber optic shape sensing mechanisms can provide sub-millimeter spatial resolution for off-axis strain mea- surement and reconstruct the sensor’s shape with high tip accuracy, their overall cost is very high. The major challenge in more cost-effective fiber sensor alternatives for providing accurate shape measurement is the limited sensing resolution in detecting shape deforma- tions. Here, we present a data-driven technique to overcome this limitation by removing strain measurement, curvature estimation, and shape reconstruction steps. We designed an end-to-end convolutional neural network that is trained to directly predict the sensor’s shape based on its spectrum. Our fiber sensor is based on easy-to-fabricate eccentric fiber Bragg gratings and can be interrogated with a simple and cost-effective readout unit in the spectral domain. We demonstrate that our deep-learning model benefits from undesired bending- induced effects (e.g., cladding mode coupling and polarization), which contain high-resolution shape deformation information. These findings are the preliminary steps toward a low-cost yet accurate fiber shape sensing solution for detecting complex multi-bend deformations. https://doi.org/10.1038/s44172-024-00166-8 OPEN 1 Department of Biomedical Engineering, University of Basel, Hegenheimermattweg 167C, Allschwil 4123, Switzerland. 2 Department of Fiber Optical Sensor Systems, Fraunhofer Institute for Telecommunications, Heinrich Hertz Institute, HHI, Am Stollen 19H, Goslar 38640, Germany. ✉email: [email protected] COMMUNICATIONS ENGINEERING | (2024) 3:19 | https://doi.org/10.1038/s44172-024-00166-8 | www.nature.com/commseng 1 1234567890():,; F iber optic shape sensing has proven to have great potential, especially in medical applications such as catheter naviga- tion, surgical needle tracking, and flexible endoscope navi- gation. Compared to other common navigation technologies (e.g., optical trackers, electromagnetic sensors, or medical imaging), fiber shape sensing has many advantages, such as immunity to electromagnetic fields, bio-compatibility, and high flexibility. Fiber shape sensors are small in diameter, easily integrable into flexible instruments, and require no line-of-sight. Distributed sensors based on multicore fibers can also provide high- resolution shape measurements1,2. Fiber shape sensors measure off-axis strain, which is then used to compute the directional curvature and reconstruct the sensor’s shape3. Various fiber sensor configurations have been investigated for off-axis strain measurement, including multicore fibers with4–6 or without7–9 fiber Bragg gratings (FBG) in their cores, fibers with cladding waveguide FBGs10, and fiber bundles made from multiple single-mode fibers that contain FBG arrays11–15. Accurate shape reconstruction necessitates high spatial resolution in off-axis strain measurement. With a distributed fiber shape sensor, sub-millimeter spatial resolution can be achieved1. However, these sensors require the use of specialized and costly optical reflectometers to analyze the back-scattered light and retrieve strain variations16–19. Moreover, the signal-to-noise ratio of the back-scattering trace in such sensors depends on the spatial resolution and the level of applied strain. Quasi-distributed sen- sors, on the other hand, have more cost-effective readout unit systems (e.g., FBG interrogators). However, their spatial resolu- tions are limited by the low sensing plane density4,20, making them inapplicable for tracking complex shape deformations. Therefore, there is a need for a cost-effective, high-resolution, and accurate fiber shape sensing technique. Among cost-effective fiber shape sensors interrogated in the spectral domain, eccentric FBG (eFBG) sensors show great capacity for tracking applications, thanks to their unique sensing mechanism21–23. Each sensing plane in eFBG shape sensors consists of three highly localized FBGs, written off-axis in the fiber’s core (also known as edge-FBG triplet), as shown in Fig. 1a21. Shape deformations are commonly computed from the displacement of the fundamental mode-field inside the optical fiber, estimated through spectral intensity modifications (see Fig. 1b, c)21,22. This approach is known as the mode-field dis- placement method (MFD). However, several other effects, including bending-sensitive mode coupling24–27, polarization- dependent losses28–32, and wavelength-dependent bending losses33–39, also modify the spectral profile of eFBGs. These effects cannot be accurately modeled, and their impact on the sensor’s spectra is indistinguishable from the mode-field dis- placements. Further details on the eFBG configuration, sensing mechanism, and bending-induced effects are provided in “Methods”. In this paper, we introduce an end-to-end data-driven mod- eling technique based on deep learning (DL) that effectively identifies meaningful patterns in the eFBG signal, even in the presence of uncontrolled bending-induced effects. By incorpor- ating these additional sources of information, our technique considerably improves the accuracy of shape prediction. More- over, our approach enables high spatial resolution shape esti- mation directly from the eFBG sensor’s signal, eliminating the need for strain measurement, curvature computation, and shape reconstruction steps. Results and discussion Training and testing datasets. The eFBG fiber sensor used in this work is 30 cm long and consists of five sensing planes separated by 5 cm from each other. At each sensing plane, three off-axis FBGs are inscribed at a radial distance of approximately 2 μm from the top, left, and right sides of the fiber’s core. The dataset used for developing the DL-based model is collected using a similar setup reported in our previous work40 (see “Methods” for more detail). We used three normalized spectral scans that were consecutively measured as input data to the proposed DL model. Each scan was recorded from 800 to 890 nm, comprising 190 wavelength components. The target data are the relative coordi- nates of 20 discrete points (reflective markers of the tracking system) measured over the length of the shape sensor (more detail on data preprocessing is available in41). This dataset con- sists of approximately 58,000 samples collected during 30 min of random movement of the fiber sensor. To evaluate the predictive performance of the trained model in an unbiased way, the sam- ples were first shuffled and then split into Train-Validation-Test subsets, with 80% used for training, 10% for validating, and 10% for testing. In the remainder of this paper, we refer to this testing dataset as Test1. A separate set of data, denoted as Test2, con- sisting of approximately 5800 samples, was recorded to evaluate the performance of the trained model for unseen shapes resulting from continuous movement. Additionally, we collected 320 sam- ples, referred to as Test3, in which specific sensor regions were bent. Further details are provided in the Methods section. Neural network design. The DL model needs a specially designed network architecture to extract essential features from the sen- sor’s spectra and to accurately predict its corresponding shape. In this study, we employed an optimization algorithm inspired by the Hyperband optimizer42 to fine-tune the network’s hyper- parameters. These hyperparameters, which cannot be directly determined from the training data, play a crucial role in model performance. Figure 2 illustrates the architecture of the best- performing configuration achieved after hyperparameter tuning (see “Methods” for further details). Shape prediction evaluation. We evaluated the performance of the DL approach using the three testing datasets and compared it with the MFD method. It should be noted that the density of sensing planes in our eFBG shape sensor is insufficient for the MFD method to accurately estimate complex deformations. Nevertheless, we conducted this test to highlight the superiority of the proposed data-driven technique (the DL method). Table 1 presents the shape error metrics, including the tip error, that is, the Euclidean distance between the true and the predicted coordinate of the sensor’s tip and the root-mean-square of the Euclidean distance (RMSE) between the true and the predicted coordinates of the discrete points along the sensor’s length. When using the Test1 dataset, the MFD approach yielded a median tip error of 111.3 mm with an interquartile range (IQR) of 121.5 mm. These error values were reduced to 98.5 and 46 mm when using the Test2 dataset. The performance difference can be attributed to the fact that the Test1 dataset contains more diverse shapes as the samples are randomly selected from a larger dataset, whereas Test2 represents continuous sensor movement over a shorter period. As expected, the error values are considerably high across all testing datasets since there is too little information available for the MFD approach to estimate complex shape deformations accurately. The DL method, on the other hand, considerably improved the accuracy of shape prediction for Test1 samples, resulting in a median tip error of 2.1 mm with an IQR of 2.6 mm. These values increased to 17.1 mm and 12.6 mm on the less diverse Test2 samples. This is because the DL model can only learn to extract the most general and relevant features from the input signal when ARTICLE COMMUNICATIONS ENGINEERING | https://doi.org/10.1038/s44172-024-00166-8 2 COMMUNICATIONS ENGINEERING | (2024) 3:19 | https://doi.org/10.1038/s44172-024-00166-8 | www.nature.com/commseng convolutional layers (Conv1D), the number of fully connected layers (FC), the layer settings, the choice of batch normalization (BN) and downsampling, training settings, and loss function parameters. The search criteria are outlined in Table 2. In the designed network (Fig. 2), input samples with a batch size of 256 are first batch normalized and then fed into a Conv1D layer with 16 channels, followed by a max pooling layer with a kernel size of 3 and a stride of 2. The second Conv1D layer also has 16 channels, followed by a max pooling layer with a kernel size of 2. The third Conv1D layer has 32 channels, followed by a max pooling layer with a kernel size of 3 and a stride of 2. The fourth Conv1D layer also has 32 channels with a stride of 2, followed by a max pooling layer with a kernel size of 3. The last Conv1D layer has 256 channels, followed by batch normalization and a max pooling layer with a kernel size of 2 and a stride of 2. The extracted features are flattened to a 2048-long vector, fed into 5 FC layers, each with 2000 units. The first FC layer is followed by batch normalization, a dropout layer with a probability of 0.37, and two more FC layers. A batch normalization, an FC layer, a dropout layer with a probability of 0.16, and a fifth FC layer are the remaining layers before the final layer. The last layer is an FC layer that maps the output of the fifth FC layer into the target values, the relative coordinates. In all layers of this network architecture, the rectified linear unit (ReLU) serves as the activation function, and the kernel size for the Conv1D layers is 3. In this model, the Adam optimizer with a learning rate of 0.0001 minimizes the SmoothL1 loss function with a threshold of 4.04. Decoding the model’s decisions. Inspired by the concept of Gradient-weighted Class Activation Mapping (Grad-CAM), we Table 2 The search criteria for hyperparameter optimization. Hyperparameter Search space Selected values Number of Conv1D layer min: 1, max: 20, step: 1 5 Number of FC layer min: 1, max: 20, step: 1 5 BN after each layer true, false – Dropout after FC layer true, false – Dropout rate min: 0.1, max: 0.8 – Stride min: 1, max: 2, step: 1 – Kernel size (max pooling layer) min: 2, max: 3, step: 1 – Distribution of initial weights standard, Xavier_uniform, Xavier_normal, Kaiming_uniform, Kaiming_normal Xavier_normal Learning rate 0.01, 0.001, 0.0001, 0.00001 0.0001 Sorting Conv1D layers true, false true L2 regularization 0.1, 0.01, 0.001, 0.0001, 0.00001, 0 0 Threshold in SmoothL1 any values between 0.0 and 5.0 4.04 Conv1D 1D convolutional layer, FC fully connected layer, BN batch normalization. 1 2 5 4 3 6 1 2 3 4 5 6 Tracking Camera Interrogator Fiber Sensor Reflective Marker Curvature Template Protecting Tube Fig. 5 Experimental setup for data acquisition. The motion capture system consisted of five tracking cameras (Oqus 7+, Qualisys AB, Sweden). For protection purposes, the fiber sensor was inserted in a Hytrel furcation tubing with an inner diameter of 425 μm and an outer diameter of 900 μm. Two v-clamps were used to hold the protection tubing securely and to fix the optical fiber in place before the insertion. Reflective markers with a diameter of 6.4 mm and an opening of 1 mm (X12Co., Ltd., Bulgaria) were affixed to the sensor. Additionally, a thermocouple was positioned near the sensor’s base to monitor the temperature throughout the data acquisition process, ensuring that any sudden thermal fluctuations did not impact the sensor’s signal. ARTICLE COMMUNICATIONS ENGINEERING | https://doi.org/10.1038/s44172-024-00166-8 8 COMMUNICATIONS ENGINEERING | (2024) 3:19 | https://doi.org/10.1038/s44172-024-00166-8 | www.nature.com/commseng decoded the decisions made by our CNN (convolutional neural network)-based model. By decoding our model’s decisions, we gained insights into which parts of the input spectra contribute to coordinate predictions. Grad-CAM is a widely used technique in image classification tasks that generates visual explanations from any CNN-based model without requiring re-training or archi- tectural modifications. The gradient is a measure that shows the effect on the output caused by the input, indicating the part of the input with the highest impact on the model’s output. However, the gradient heat map produced by the last Conv1D layer has limited resolution due to the small output dimension in each channel. Therefore, instead of the gradient of the Conv1D layers, we computed the forward finite difference of the model’s loss with respect to the input spectral elements. The spacing constant was chosen to be 0.1, higher than the spectral intensity noise level. In this method, we modified the intensity value of one spectral element and observed the resulting changes in the model’s loss value. We repeated this process for all 190 spectral elements. The resulting color maps are illustrated in Figs. 3b and 4b, representing the impact of the changes in each spectral element on the model’s SmoothL1 loss value. To analyze the contribution of each spectral element to the coordinate prediction of individual markers, we computed the Euclidean distance between the predicted coordinates of each marker before and after spectral modification. This allowed us to identify the spectral elements contributing to the relative coordinate prediction of each marker. By highlighting these spectral elements, we gained a better understanding of the factors influencing the model’s predictions. Data availability The datasets generated during and/or analyzed during the current study are available in the Academic Torrents repository. Code availability The source code is available on GitHub. Received: 24 May 2023; Accepted: 15 January 2024; References 1. Soller, B., Wolfe, M. & Froggatt, M. Polarization resolved measurement of rayleigh backscatter in fiber-optic components. In National Fiber Optic Engineers Conference, NWD3 (Optica Publishing Group, 2005). 2. Meng, Y. et al. Shape sensing using two outer cores of multicore fiber and optical frequency domain reflectometer. J. Lightw. Technol. 39, 6624–6630 (2021). 3. Marowsky, G. Planar waveguides and other confined geometries: Theory, Technology, Production, and Novel Applications, vol. 189 (Springer, New York, 2014). 4. Khan, F. et al. Multi-core optical fibers with bragg gratings as shape sensor for flexible medical instruments. IEEE Sens. J. 19, 5878–5884 (2019). 5. Moore, J. P. & Rogge, M. D. Shape sensing using multi-core fiber optic cable and parametric curve solutions. Opt. Express 20, 2967–2973 (2012). 6. Bronnikov, K. et al. Durable shape sensor based on fbg array inscribed in polyimide-coated multicore optical fiber. Opt. Express 27, 38421–38434 (2019). 7. Nishio, M., Mizutani, T. & Takeda, N. Shape identification of variously- deformed composite laminates using brillouin type distributed strain sensing system with embedded optical fibers. In Sensors and Smart Structures Technologies for Civil, Mechanical, and Aerospace Systems 2008, vol. 6932, 800–808 (SPIE, 2008). 8. Zhao, Z., Soto, M. A., Tang, M. & Thévenaz, L. Distributed shape sensing using brillouin scattering in multi-core fibers. Opt. Express 24, 25211–25223 (2016). 9. Issatayeva, A., Amantayeva, A., Blanc, W., Tosi, D. & Molardi, C. Design and analysis of a fiber-optic sensing system for shape reconstruction of a minimally invasive surgical needle. Sci. Rep. 11, 1–12 (2021). 10. Waltermann, C., Doering, A., Köhring, M., Angelmahr, M. & Schade, W. Cladding waveguide gratings in standard single-mode fiber for 3d shape sensing. Opt. Lett. 40, 3109–3112 (2015). 11. Manavi Roodsari, S., Freund, S., Zam, A., Rauter, G. & Cattin, P. C. Fabrication and characterization of a flexible fbg-based shape sensor using single-mode fibers. IEEE Trans. Biomed. Eng. 69, 2488–2498 (2022). 12. Manavi Roodsari, S. et al. Temperature-compensated fbg-based 3d shape sensor using single-mode fibers. In Integrated Photonics Research, Silicon and Nanophotonics, JTu6C–1 (Optical Society of America, 2018). 13. Moon, H. et al. Fbg-based polymer-molded shape sensor integrated with minimally invasive surgical robots. In 2015 IEEE International Conference on Robotics and Automation (ICRA), 1770–1775 (IEEE, 2015). 14. Ryu, S. C. & Dupont, P. E. Fbg-based shape sensing tubes for continuum robots. In 2014 IEEE International Conference on Robotics and Automation (ICRA), 3531–3537 (IEEE, 2014). 15. Roesthuis, R. J., Janssen, S. & Misra, S. On using an array of fiber bragg grating sensors for closed-loop control of flexible minimally invasive surgical instruments. In 2013 IEEE/Rsj International Conference on Intelligent Robots and Systems, 2545–2551 (IEEE, 2013). 16. Eickhoff, W. & Ulrich, R. Optical frequency domain reflectometry in single- mode fiber. Appl. Phys. Lett. 39, 693–695 (1981). 17. Masoudi, A. & Newson, T. P. Contributed review: Distributed optical fibre dynamic strain sensing. Rev. Sci. Instrum. 87, 011501 (2016). 18. Bao, X. & Chen, L. Recent progress in distributed fiber optic sensors. Sensors 12, 8601–8639 (2012). 19. Yüksel, K. Rayleigh-based optical reflectometry techniques for distributed sensing applications. In International Conference on Engineering Technologies, ICENTE’18 (Selçuk Üniversitesi, 2018). 20. Beisenova, A. et al. Distributed fiber optics 3d shape sensing by means of high scattering np-doped fibers simultaneous spatial multiplexing. Opt. Express 27, 22074–22087 (2019). 21. Waltermann, C. et al. Multiple off-axis fiber bragg gratings for 3d shape sensing. Appl. Opt. 57, 8125–8133 (2018). 22. Bao, W., Rong, Q., Chen, F. & Qiao, X. All-fiber 3d vector displacement (bending) sensor based on an eccentric fbg. Opt. Express 26, 8619–8627 (2018). 23. Rong, Q. et al. Highly sensitive fiber-optic accelerometer by grating inscription in specific core dip fiber. Sci. Rep. 7, 1–9 (2017). 24. Thomas, J. et al. Cladding mode coupling in highly localized fiber bragg gratings: modal properties and transmission spectra. Opt. Express 19, 325–341 (2011). 25. Thomas, J. U. et al. Cladding mode coupling in highly localized fiber bragg gratings ii: complete vectorial analysis. Opt. Express 20, 21434–21449 (2012). 26. Erdogan, T. Cladding-mode resonances in short-and long-period fiber grating filters. JOSA A 14, 1760–1773 (1997). 27. Feng, D., Qiao, X. & Albert, J. Off-axis ultraviolet-written fiber bragg gratings for directional bending measurements. Opt. Lett. 41, 1201–1204 (2016). 28. Galtarossa, A. & Menyuk, C. R. Polarization Mode Dispersion, vol. 296 (Springer, New York, 2005). 29. Smith, A. Birefringence induced by bends and twists in single-mode optical fiber. Appl. Opt. 19, 2606–2611 (1980). 30. Ulrich, R., Rashleigh, S. & Eickhoff, W. Bending-induced birefringence in single-mode fibers. Opt. Lett. 5, 273–275 (1980). 31. Kersey, A. D. et al. Fiber grating sensors. J. Lightw. Technol. 15, 1442–1463 (1997). 32. Block, U. L., Digonnet, M. J., Fejer, M. M. & Dangui, V. Bending-induced birefringence of optical fiber cladding modes. J. Lightw. Technol. 24, 2336 (2006). 33. Marcuse, D. Field deformation and loss caused by curvature of optical fibers. JOSA 66, 311–320 (1976). 34. Faustini, L. & Martini, G. Bend loss in single-mode fibers. J. Lightw. Technol. 15, 671–679 (1997). 35. Valiente, I. & Yassallo, C. New formalism for bending losses in coated single- mode optical fibres. Electron. Lett. 22, 1544–1545 (1989). 36. Harris, A. & Castle, P. Bend loss measurements on high numerical aperture single-mode fibers as a function of wavelength and bend radius. J. Lightw. Technol. 4, 34–40 (1986). 37. Murakami, Y. & Tsuchiya, H. Bending losses of coated single-mode optical fibers. IEEE J. Quant. Electron. 14, 495–501 (1978). 38. Morgan, R., Barton, J., Harper, P. & Jones, J. Temperature dependence of bending loss in monomode optical fibres. Electron. Lett. 13, 937–939 (1990). 39. Renner, H. Bending losses of coated single-mode fibers: a simple approach. J. Lightw. Technol. 10, 544–551 (1992). COMMUNICATIONS ENGINEERING | https://doi.org/10.1038/s44172-024-00166-8 ARTICLE COMMUNICATIONS ENGINEERING | (2024) 3:19 | https://doi.org/10.1038/s44172-024-00166-8 | www.nature.com/commseng 9 40. Manavi Roodsari, S. et al. Using supervised deep-learning to model edge-fbg shape sensors: a feasibility study. In Optical Sensors 2021, vol. 11772, 79–88 (SPIE, 2021). 41. Manavi Roodsari, S. et al. Shape sensing of optical fiber bragg gratings based on deep learning. Mach. Learn. 4, 025037 (2023). 42. Li, L., Jamieson, K., DeSalvo, G., Rostamizadeh, A. & Talwalkar, A. Hyperband: a novel bandit-based approach to hyperparameter optimization. J. Mach. Learn. Res. 18, 6765–6816 (2017). 43. Shao, L.-Y., Xiong, L., Chen, C., Laronche, A. & Albert, J. Directional bend sensor based on re-grown tilted fiber bragg grating. J. Lightw. Technol. 28, 2681–2687 (2010). 44. Renoirt, J.-M. et al. High-refractive-index transparent coatings enhance the optical fiber cladding modes refractometric sensitivity. Opt. Express 21, 29073–29082 (2013). 45. Shi, F. et al. Miniature optical fiber curvature sensor via integration with gan optoelectronics. Commun. Eng. 1, 47 (2022). 46. Morgan, R., Barton, J., Harper, P. & Jones, J. D. Wavelength dependence of bending loss in monomode optical fibers: effect of the fiber buffer coating. Opt. Lett. 15, 947–949 (1990). Acknowledgements We gratefully acknowledge the funding of this work by Werner Siemens Foundation through the MIRACLE project. The authors express their appreciation to Yi Jiang for performing the eFBG calibration. Author contributions All authors participated in the discussions and contributed to the completion of this paper. S.M.R. designed and built the experimental setup, conducted experiments, implemented the deep learning model, and, in collaboration with P.C.C., analyzed the results. C.S. imple- mented the hyperparameter optimization algorithm. M.A. and W.S. supplied the eFBG fiber sensor and validated the analytical MFD approach, serving as the baseline for sensor evaluation. S.F., G.R., and P.C.C. provided supervision throughout the entire research process. S.M.R. and P.C.C. wrote the paper with input from the other co-authors. Competing interests The authors declare no competing interests. Additional information Supplementary information The online version contains supplementary material available at https://doi.org/10.1038/s44172-024-00166-8. Correspondence and requests for materials should be addressed to Samaneh Manavi Roodsari. Peer review information Communications Engineering thanks the anonymous reviewers for their contribution to the peer review of this work. Primary Handling Editors: Mengying Su. A peer review file is available. Reprints and permission information is available at http://www.nature.com/reprints Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/ licenses/by/4.0/. © The Author(s) 2024 ARTICLE COMMUNICATIONS ENGINEERING | https://doi.org/10.1038/s44172-024-00166-8 10 COMMUNICATIONS ENGINEERING | (2024) 3:19 | https://doi.org/10.1038/s44172-024-00166-8 | www.nature.com/commseng

Title: Deep learning-based approach for high spatial resolution fibre shape sensing ​ Authors: Samaneh Manavi Roodsari ​,Sara Freund,Martin Angelmahr,Carlo Seppi,Georg Rauter,Wolfgang Schade,Philippe C. Cattin Publisher: Springer Nature ​ Date: 15 January 2024 ​ Abstract: Fiber optic shape sensing is an innovative technology that has enabled remarkable advances in various navigation and tracking applications. ​ Although the state-of-the-art fiber optic shape sensing mechanisms can provide sub-millimeter spatial resolution for off-axis strain measurement and reconstruct the sensor’s shape with high tip accuracy, their overall cost is very high. ​ The major challenge in more cost-effective fiber sensor alternatives for providing accurate shape measurement is the limited sensing resolution in detecting shape deformations. ​ Here, we present a data-driven technique to overcome this limitation by removing strain measurement, curvature estimation, and shape reconstruction steps. ​ We designed an end-to-end convolutional neural network that is trained to directly predict the sensor’s shape based on its spectrum. ​ Our fiber sensor is based on easy-to-fabricate eccentric fiber Bragg gratings and can be interrogated with a simple and cost-effective readout unit in the spectral domain. ​ We demonstrate that our deep-learning model benefits from undesired bending-induced effects (e.g., cladding mode coupling and polarization), which contain high-resolution shape deformation information. ​ These findings are the preliminary steps toward a low-cost yet accurate fiber shape sensing solution for detecting complex multi-bend deformations.

Moderate-coherence sensing with optical cavities: ultra-high accuracy meets ultra-high measurement bandwidth and range.pdf

ARTICLE Moderate-coherence sensing with optical cavities: ultra-high accuracy meets ultra-high measurement bandwidth and range Johannes Dickmann 1,2,3✉, Liam Shelling Neto 1,2,3, Steffen Sauer1,2,3 & Stefanie Kroker2,3,4 Interferometric sensors, renowned for their exceptional accuracy, leverage the wave prop- erties of coherent electromagnetic radiation. The periodicity of the measurement signal often critically limits the measurement range of sensors utilizing interferometry. Here we introduce a cavity-based interferometry concept that capitalizes on a laser with moderate coherence, thereby combining ultra-high accuracy with ultra-high measurement bandwidth and range. To this end mid-fringe detection is combined with measurements of the interferometric visibility. We present experimental results that demonstrate the effectiveness of our approach exemplarily for length sensing. Notably, our system achieves an accuracy of 1 nm with a measurement range of 120 μm (relative uncertainty of 0.00083 %) and a bandwidth ranging from 0 Hz to 20 kHz. These findings support advancements in high-precision sensing applications that demand simultaneous accuracy, measurement range and bandwidth. https://doi.org/10.1038/s44172-024-00164-w OPEN 1 CAVITY technologies UG (haftungsbeschränkt), Wilhelmsgarten 3, 38100 Braunschweig, Germany. 2 Technical University of Braunschweig, Institute for Semiconductor Technology, Hans-Sommer-Str. 66, 38106 Braunschweig, Germany. 3 Laboratory for Emerging Nanometrology (LENA), Langer Kamp 6a/b, 38106 Braunschweig, Germany. 4 Physikalisch-Technische Bundesanstalt, Bundesallee 100, 38116 Braunschweig, Germany. ✉email: [email protected] COMMUNICATIONS ENGINEERING | (2024) 3:17 | https://doi.org/10.1038/s44172-024-00164-w | www.nature.com/commseng 1 1234567890():,; I n the field of sensing and metrology, achieving a balance between accuracy and measurement range has been a long- standing challenge. Interferometric sensors, which rely on the wave properties of coherent electromagnetic radiation, have been at the forefront of high-precision measurements1,2. However, the exceptional accuracy of interferometric sensors often comes at the cost of a limited range due to the inherent periodicity of the interferometer signal. Interferometric gravitational wave detectors have already demonstrated remarkable precision levels better than 10−21 (ref. 3), while ultrastable lasers exhibit precision on the order of 10−17 (refs. 4,5). However, the limited range has hindered their practical utility, preventing them from capturing rapid changes or transient events. A combination of high accu- racy in large measurement ranges is also critical for various other fields including precision manufacturing6–8, biomedical sensing9–11, and structural health monitoring12,13. This research paper introduces a concept called moderate- coherence sensing, which addresses the critical limitation of range in interferometric sensors while preserving their ultra-high accuracy capabilities. By capitalizing on the limited coherence of the measurement laser14, this approach offers the potential to combine high accuracy with ultra-high measurement range, enabling advancements in high-precision sensing applications. This paper showcases the experimental implementation of moderate-coherence sensing and presents measurement results highlighting its effectiveness. The system developed achieves an impressive accuracy of 1 nanometer while maintaining a range of 120 micrometers. By overcoming the long-standing limitations of interferometric sensors, moderate-coherence sensing holds the promise of transforming industries and advancing scientific endeavors that rely on both ultra-high precision, wide range, and high-speed capabilities. Methods Theoretical description. The high precision of interferometric sensors is attributed to the short wavelength of the electro- magnetic radiation used in the micrometer (μm) range and the wavelength’s high stability. The Michelson interferometer15, as a simple example, demonstrates this precision through the appearance of interference fringes. Consequently, with appro- priate laser and readout electronics, sub-nanometer accuracy in length measurements can be easily achieved15. However, the periodic nature of the interference signal, with a period equal to half the wavelength, limits the achievable measurement range. Active methods, such as using a movable mirror controlled by a controller, have been employed to expand the range16. None- theless, these approaches introduce complexity and are con- strained by the maximum control speed thereby limiting the measurement bandwidth. Our method overcomes the limitations of complex and potentially slow active control while maintaining both high accuracy and a wide range. The key principle lies in leveraging not only the sensitive interference signal of the interferometer but also the limited coherence of the laser employed. Specifically, we utilize a Fabry-Pérot laser diode, which is actively temperature- stabilized to maintain a constant wavelength. Figure 1a illustrates the laser’s emission characteristics, where multiple Fabry-Pérot modes are excited, and their output power is weighted by the Gaussian medium gain spectrum. The width of this spectrum inherently restricts the overall coherence of the laser output. General description. To achieve precise length measurements, we employ a low-finesse Fabry-Pérot cavity comprising two wedged silicon wafers. At the laser wavelength of 1.55 μm, the refractive index of silicon is n = 3.475717. Consequently, the intensity reflection of the cavity mirrors is R = 30.6 %18, corresponding to a Lorentzian finesse of 2.6519. To calculate the reflected power of the cavity, we superimpose the individual quasi-coherent emission lines of the laser. For the calculation, we start by expressing the laser gain: GðλÞ ¼ G0 exp  ðλ  λcenterÞ2 Δλ2 FPL
 ; ð1Þ where λcenter = 1.55 μm is the gain center wavelength and ΔλFPL is the gain linewidth. Next, for each emitted mode indexed by i with wavelength λi, we calculate the roundtrip single-pass phase ϕi as a function of the cavity length L19: ϕiðLÞ ¼ 2π L λi : ð2Þ Using these parameters, we can determine the power transmitted through the cavity for each mode i19: Itrans i ¼ ð1  RÞ2 ð1  RÞ2 þ 4Rsin2ϕi ´ GðλiÞ: ð3Þ Finally, we obtain the measurand, which is the total power reflected by all modes: Irefl ¼ 1  ∑ 1 i¼1 Itrans i : ð4Þ The results of the calculation are presented in Fig. 1b, where the classical quasiperiodic interference signal of the cavity is observed. Notably, the periodicity of the signal is disrupted by decreasing visibility. The visibility V, quantified by the relative ratio of the maximum Imax and minimum Imin power values of the fringes, is defined as: VðLÞ ¼ Imax j  Imin j Imax j ð5Þ for a certain fringe j. Figure 1c displays the calculated visibility as a function of the cavity length. A distinctive trend is observed, where an almost linear curve is evident within the range of 10 to 120 μm. Indeed, the combination of the high-sensitivity interference signal and the utilization of visibility plays a critical role in achieving high accuracy with a wide range of length measure- ments while achieving measurement precisions down to sub- nanometer levels. Influence of the laser parameters. The expected interferometer signal is calculated based on defined parameters: an average laser wavelength of λcenter = 1.55 μm and a cavity mirror reflection of R = 30.6 %. The width of the laser gain, ΔλFPL, and the spacing of individual laser lines, Δλspace = λi+1 −λi, are considered as free parameters. A series of numerical simulations explored the dependency of visibility on these parameters. Utilizing equations (1) to (5), the visibility of the interferometer signal was numeri- cally calculated for various combinations of ΔλFPL and Δλspace. Figure 2 illustrates these results. Figure 2a–c visually depicts the influence of these parameters on the laser wavelength spectrum. Figure 2a represents the initial spectrum with ΔλFPL = 3.9 nm and Δλspace = 1 nm. In 2b, the width of the laser gain was reduced to ΔλFPL = 1.9 nm, while the laser line spacing remained constant. Figure 2c showcases the reduction of the laser line spacing to Δλspace = 0.5 nm, while maintaining the original laser gain width at ΔλFPL = 3.9 nm. Figure 2d demonstrates the dependence of calculated visibility V on the width of the laser gain medium, ΔλFPL, varying between 1 nm and 5 nm with a fixed laser line spacing of Δλspace = 0.5 nm. ARTICLE COMMUNICATIONS ENGINEERING | https://doi.org/10.1038/s44172-024-00164-w 2 COMMUNICATIONS ENGINEERING | (2024) 3:17 | https://doi.org/10.1038/s44172-024-00164-w | www.nature.com/commseng precise calculation of its position relative to the original measured cavity length, with an accuracy better than 1 nm. Since the theoretical position of the mid-fringe is known from the earlier theoretical description (see section “Theoretical description"), the precise cavity length can be calculated accordingly using the following equation: Lmeas ¼ Lvis  Offset : ð9Þ The numerically calculated mid-fringe position (see Fig. 7a, b) for the measured visibility (see Fig. 6) is denoted as Lvis. This mid-fringe position can be obtained from the lookup table for both negative and positive mid-fringe increments, available in the Supplementary materials (Table 1). The offset is determined through linear regression. For the measurements in Fig. 6, the results are as follows: 1. Visibility V = 0.897, negative mid-fringe. Using the lookup table, this corresponds to Lvis = 26.988 μm. Linear regres- sion yields an offset of 455 nm. Consequently, the measurement, according to equation (9), results in Lmeas = 26.533 μm. 2. Visibility V = 0.657, negative mid-fringe →Lvis = 62.603 μm, Offset = 317 nm →Lmeas = 62.286 μm. 3. Visibility V = 0.378, positive mid-fringe →Lvis = 103.266 μm, Offset = 484 nm →Lmeas = 102.782 μm. Following the demonstration of real-time measurement, the accuracy and reproducibility of the moderate-coherence sensing presented here will now be assessed. Determination of accuracy and reproducibility. The accuracy and reproducibility of moderate-coherence sensing were assessed for three measurement positions (26.533 μm, 62.286 μm, and 102.782 μm). A nanometer-step experiment was conducted, involving fifty 1 nm steps for each initial position using the piezo stage (Thorlabs NFL5DP20S/M) controlled by the internal strain gauge. Real-time measurements were taken after each step, as described in the preceding section. The results in Fig. 8a–c demonstrate distinguishable steps, indicating that the accuracy of moderate-coherence sensing surpasses 1 nm. Notably, at longer distances (Fig. 8c), the signal exhibits some noise. To achieve an absolute accuracy of one nanometer, the cavity length under measurement should not vary by more than one Fig. 6 Real-time measurement results. a–c illustrates the fast piezoscan spanning 0.8 μm and the corresponding calculated visibility (V). d–f displays the filtered data focused on the half fringe (blue dots), the linear regression analysis (blue line), and the calculated relative position of the half fringe (offset). Fig. 7 Numerical calculation results depicting the mid-fringe position relative to the signal visibility. In Figure a, the relative mid-fringe level is calculated using equations (1)–(8). Figure b illustrates the mid-fringe position’s dependency on visibility for both negative and positive mid-fringe increments. The corresponding lookup table is available in the Supplementary Materials. ARTICLE COMMUNICATIONS ENGINEERING | https://doi.org/10.1038/s44172-024-00164-w 6 COMMUNICATIONS ENGINEERING | (2024) 3:17 | https://doi.org/10.1038/s44172-024-00164-w | www.nature.com/commseng nanometer during the 50 μs measurement time. This equates to a maximum speed of 20 μm/s. Increasing the piezo frequency may enhance measurable speed under specific conditions. To evaluate reproducibility, the three distances were each measured 50 times in succession. Results in Fig. 8d–f show standard deviations: For 26.533 μm, σMCS < ± 0.3 nm; for 62.286 μm, σMCS < ± 0.3 nm; and for the largest distance, 102.782 μm, σMCS < ± 0.6 nm. The increased error for longer cavity lengths is likely due to reduced cavity visibility, leading to smaller mid-fringe increments (see Fig. 6). This reduction contributes to increased error in mid-fringe detection, making offset determination more challenging. In summary, the investigated prototype of moderate-coherence sensing demonstrates accuracy and reproducibility better than 1 nm across a 120 μm measuring range. The corresponding relative length measurement error is thus less than 0.0000083. Discussion In this study, we have presented the concept of moderate- coherence sensing and demonstrated its application in high- accuracy length measurements. The moderate-coherence sensing technique leverages the interference signal of a cavity along with the visibility parameter to achieve high accuracy within a wide measurement range and high measurement bandwidth >20 kHz. Our experimental implementation showcases the effectiveness of this approach in achieving sub-nanometer accuracy in length measurement over a range of 120 μm. The experimental results confirmed the theoretical calculations, demonstrating excellent agreement between the measured visi- bility and the calculated visibility. This agreement validates the dominant effect of coherence modulation in the experiment, suggesting that other factors such as misalignment and laser divergence can be neglected. Moreover, we explored the real-time measurement capabilities of moderate-coherence sensing. By scanning the cavity length over half a wavelength using a ring piezo, we were able to determine the actual cavity length through precise measurement of the mid-fringe position combined with visibility calculations. This real-time mode offers a fast and accurate measurement technique, enabling applications that require dynamic and rapid length monitoring. The versatility of moderate-coherence sensing extends beyond length measurements. Any measurement that can be accessed using cavity length variations can be potentially measured using this technique. Temperature sensors, acceleration sensors, pres- sure sensors, and other sensors relying on the change in cavity length can benefit from the high accuracy and wide range offered by moderate-coherence sensing. In conclusion, moderate-coherence sensing represents a pow- erful and promising approach for high-accuracy measurement applications. The combination of a sensitive interference signal and visibility analysis allows for precise measurements with a wide measurement range and high bandwidth. The experimental results demonstrate the practical feasibility and accuracy of this technique in length measurements and future sensors. The potential for further advancements and applications in various sensing fields makes moderate-coherence sensing a valuable tool for future research and technological developments. Data availability The authors declare that the data supporting the findings of this study are available within the paper. Code availability Computer codes used in the current study are available from the corresponding author upon reasonable request. Received: 8 September 2023; Accepted: 13 January 2024; Fig. 8 Experimental assessment of accuracy and reproducibility. Figures a–c depict results from the nanometer-step experiments, plotting moderate- coherence sensing (MCS) measurements against the integrated strain gauge readings of the piezo stage. Figures d–f represent the repetitive measurements (n = 50) of the same cavity length, displaying mean values and standard deviations. COMMUNICATIONS ENGINEERING | https://doi.org/10.1038/s44172-024-00164-w ARTICLE COMMUNICATIONS ENGINEERING | (2024) 3:17 | https://doi.org/10.1038/s44172-024-00164-w | www.nature.com/commseng 7 References 1. Udem, T., Holzwarth, R. & Hänsch, T. W. Optical frequency metrology. Nature 416, 233–237 (2002). 2. Bailes, M. et al. Gravitational-wave physics and astronomy in the 2020s and 2030s. Nat. Rev. Phys. 3, 344–366 (2021). 3. Abbott, B. P. et al. Observation of gravitational waves from a binary black hole merger. Phys. Rev. Lett. 116, 061102 (2016). 4. Santarelli, G. et al. Quantum projection noise in an atomic fountain: a high stability cesium frequency standard. Phys. Rev. Lett. 82, 4619 (1999). 5. Kessler, T. et al. A sub-40-mhz-linewidth laser based on a silicon single-crystal optical cavity. Nat. Photon. 6, 687–692 (2012). 6. Shirinzadeh, B. et al. Laser interferometry-based guidance methodology for high precision positioning of mechanisms and robots. Robot. Comput. Integr. Manufact. 26, 74–82 (2010). 7. Berardi, M. et al. Optical interferometry based micropipette aspiration provides real-time sub-nanometer spatial resolution. Commun. Biol. 4, 610 (2021). 8. Yang, S. & Zhang, G. A review of interferometry for geometric measurement. Meas. Sci. Technol. 29, 102001 (2018). 9. Mazurek, M., Schreiter, K., Prevedel, R., Kaltenbaek, R. & Resch, K. Dispersion-cancelled biological imaging with quantum-inspired interferometry. Sci. Rep. 3, 1582 (2013). 10. Perchoux, J. et al. Current developments on optical feedback interferometry as an all-optical sensor for biomedical applications. Sensors 16, 694 (2016). 11. Kavčič, A. et al. Deep tissue localization and sensing using optical microcavity probes. Nat. Commun. 13, 1269 (2022). 12. Kosowska, M., Jakóbczyk, P., Rycewicz, M., Vitkin, A. & Szczerska, M. Low- coherence photonic method of electrochemical processes monitoring. Sci. Rep. 11, 12600 (2021). 13. Camassa, D., Vaiana, N. & Castellano, A. Modal testing of masonry constructions by ground-based radar interferometry for structural health monitoring: a mini review. Fronti. Built Environ. 8, 1065912 (2023). 14. Cao, H., Chriki, R., Bittner, S., Friesem, A. A. & Davidson, N. Complex lasers with controllable coherence. Nat. Rev. Phys. 1, 156–168 (2019). 15. Lawall, J. & Kessler, E. Michelson interferometry with 10 pm accuracy. Rev. Sci. Instrum. 71, 2669–2676 (2000). 16. White, R. & Emmony, D. Active feedback stabilisation of a Michelson interferometer using a flexure element. J. Phys. E Sci. Instrum. 18, 658 (1985). 17. Li, H. Refractive index of silicon and germanium and its wavelength and temperature derivatives. J. Phys. Chem. Refer. Data 9, 561–658 (1980). 18. Bass, M. Handbook of Optics: Volume I-geometrical and Physical Optics, Polarized Light, Components and Instruments (McGraw-Hill Education, 2010). 19. Ismail, N., Kores, C. C., Geskus, D. & Pollnau, M. Fabry-pérot resonator: spectral line shapes, generic and related airy distributions, linewidths, finesses, and performance at low or frequency-dependent reflectivity. Opt. Exp. 24, 16366–16389 (2016). Acknowledgements Funded by the Deutsche Forschungsgemeinschaft (DFG, German Research Foundation) under Germany’s Excellence Strategy—EXC-2123 QuantumFrontiers—390837967. J.D. and S.K. also acknowledge partial support from the European Association of National Metrology Institutes. This project (20FUN08 NEXTLASERS) has received funding from the EMPIR program co-financed by the Participating States and from the European Union’s Horizon 2020 research and innovation program. S.K. also thanks funding support from the Deutsche Forschungsgemeinschaft (DFG, German Research Founda- tion) under Germany’s Excellence Strategy within the Cluster of Excellence PhoenixD (EXC 2122, Project No. 390833453). Author contributions J.D.: conceptualization, methodology, investigation, resources, writing, and visualization. L.S.N.: conceptualization, methodology, and investigation. S.S.: conceptualization, methodology, and investigation. S.K.: conceptualization, resources, writing, and supervision. Funding Open Access funding enabled and organized by Projekt DEAL. Competing interests The authors declare no competing interests. The identification of specific instruments in this paper is solely for the purpose of adequately describing the experimental procedure. It is not intended to imply any recommendation or endorsement, nor does it suggest that the instruments identified are necessarily the best available for the stated purpose. Additional information Supplementary information The online version contains supplementary material available at https://doi.org/10.1038/s44172-024-00164-w. Correspondence and requests for materials should be addressed to Johannes Dickmann. Peer review information Communications Engineering thanks the anonymous reviewers for their contribution to the peer review of this work. Primary handling editors: Anastasiia Vasylchenkova and Rosamund Daw. Reprints and permission information is available at http://www.nature.com/reprints Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/ licenses/by/4.0/. © The Author(s) 2024 ARTICLE COMMUNICATIONS ENGINEERING | https://doi.org/10.1038/s44172-024-00164-w 8 COMMUNICATIONS ENGINEERING | (2024) 3:17 | https://doi.org/10.1038/s44172-024-00164-w | www.nature.com/commseng

Title: Moderate-coherence sensing with optical cavities: ultra-high accuracy meets ultra-high measurement bandwidth and range Authors: Johannes Dickmann, Liam Shelling Neto, Steffen Sauer, Stefanie Kroker ​ Publisher: Communications Engineering, Springer Nature Date: January 13, 2024 ​ Abstract: Interferometric sensors, renowned for their exceptional accuracy, leverage the wave properties of coherent electromagnetic radiation. ​ The periodicity of the measurement signal often critically limits the measurement range of sensors utilizing interferometry. ​ Here we introduce a cavity-based interferometry concept that capitalizes on a laser with moderate coherence, thereby combining ultra-high accuracy with ultra-high measurement bandwidth and range. ​ To this end mid-fringe detection is combined with measurements of the interferometric visibility. ​ We present experimental results that demonstrate the effectiveness of our approach exemplarily for length sensing. ​ Notably, our system achieves an accuracy of 1 nm with a measurement range of 120 μm (relative uncertainty of 0.00083 %) and a bandwidth ranging from 0 Hz to 20 kHz. ​ These findings support advancements in high-precision sensing applications that demand simultaneous accuracy, measurement range, and bandwidth. ​

Heterogeneous integration of high-k complex-oxide gate dielectrics on wide band-gap high-electron- mobility transistors.pdf

ARTICLE Heterogeneous integration of high-k complex-oxide gate dielectrics on wide band-gap high-electron- mobility transistors Jongho Ji1,10, Jeong Yong Yang2,10, Sangho Lee 3,4,10, Seokgi Kim5, Min Jae Yeom2, Gyuhyung Lee2,6, Heechang Shin1, Sang-Hoon Bae 7,8, Jong-Hyun Ahn1, Sungkyu Kim5, Jeehwan Kim 3,4,9✉, Geonwook Yoo 2,6✉& Hyun S. Kum 1✉ Heterogeneous integration of dissimilar crystalline materials has recently attracted con- siderable attention due to its potential for high-performance multifunctional electronic and photonic devices. The conventional method for fabricating heterostructures is by hetero- epitaxy, in which epitaxy is performed on crystallographically different materials. However, epitaxial limitations in monolithic growth of dissimilar materials prevent implementation of high quality heterostructures, such as complex-oxides on conventional semiconductor plat- forms (Si, III-V and III-N). In this work, we demonstrate gallium nitride (GaN) high-electron- mobility transistors with crystalline complex-oxide material enabled by heterogeneous inte- gration through epitaxial lift-off and direct stacking. We successfully integrate high-κ com- plex-oxide SrTiO3 in freestanding membrane form with GaN heterostructure via a simple transfer process as the gate oxide. The fabricated device shows steep subthreshold swing close to the Boltzmann limit, along with negligible hysteresis and low dynamic on-resistance, indicating very low defect density between the SrTiO3 gate oxide and GaN heterostructure. Our results show that heterogeneous integration through direct material stacking is a pro- mising route towards fabricating functional heterostructures not possible by conventional epitaxy. https://doi.org/10.1038/s44172-024-00161-z OPEN 1 Department of Electrical and Electronic Engineering, Yonsei University, Seoul, South Korea. 2 Department of Electronic Engineering, Soongsil University, Seoul, South Korea. 3 Department of Mechanical Engineering, Massachusetts Institute of Technology, Cambridge, MA, USA. 4 Research Laboratory of Electronics, Massachusetts Institute of Technology, Cambridge, MA, USA. 5 Department of Nanotechnology and Advanced Materials Engineering, Sejong University, Seoul, South Korea. 6 Department of Intelligent Semiconductors, Soongsil University, Seoul, South Korea. 7 Department of Mechanical Engineering and Materials Science, Washington University in St. Louis, St. Louis, MO, USA. 8 Institute of Materials Science and Engineering, Washington University in St Louis, St Louis, MO, USA. 9 Department of Materials Science and Engineering, Massachusetts Institute of Technology, Cambridge, MA, USA. 10These authors contributed equally: Jongho Ji, Jeong Yong Yang, Sangho Lee. ✉email: [email protected]; [email protected]; [email protected] COMMUNICATIONS ENGINEERING | (2024) 3:15 | https://doi.org/10.1038/s44172-024-00161-z | www.nature.com/commseng 1 1234567890():,; R ecent advances in producing ultrathin freestanding single- crystalline membranes have enabled heterogenous inte- gration of dissimilar crystalline materials in a single elec- trical or photonic device, opening a path towards creation of devices with enhanced performance and functionalities1,2. The focus of recent studies was mainly on the membrane generation method and a rough demonstration of a prototype device fabri- cated via heterogeneous integration3–5. However, to advance this field to the next stage, it is pivotal to demonstrate the possibility of creating a device with state-of-the-art performance. Many aspects of heterogeneous integration of dissimilar materials are unknown, but perhaps the most important is the interface quality between the transferred single-crystalline membrane and the host heterostructure. To verify this, we have fabricated gallium nitride (GaN)-based high-electron-mobility transistors (HEMT) with a heterogeneously integrated SrTiO3 gate oxide layer and char- acterized its performance. We find that with careful fabrication and transfer of the gate oxide membrane, the device performance in regard to the oxide/HEMT interface show excellent quality, matching or exceeding that of conventionally deposited amor- phous gate oxides as well as in-situ grown SiN oxides6–8. GaN-based HEMT is one of the most promising structure for high-power and RF applications owing to its superior properties, such as high electron mobility and high breakdown field9–11. To further improve the performance and reliability beyond conven- tional GaN HEMTs with Schottky metal gate, metal-oxide- semiconductor (MOS)-HEMTs structures have been proposed to suppress gate leakage and passivated the GaN surface from ambi- ent. In this regard, MOS-GaN HEMTs with various dielectric materials such as Al2O3 and HfO2 have been demonstrated12–14. In MOS-HEMT, the crystallization and interfacial quality of the gate dielectric material play a crucial role in determining the performance15. Among various dielectric materials, complex-oxide materials have attracted considerable interest due to their diverse functional properties such as high dielectric constant (high-κ), ferroelec- tricity, magnetism, and superconducting properties making complex-oxides an attractive material system for developing next- generation devices16,17. However, epitaxial limitations in mono- lithic growth of dissimilar materials make it difficult to integrate single-crystalline complex-oxide materials with other material platforms such as GaN. The epitaxy of complex-oxides on sub- strates with different lattice constants and thermal expansion coefficients results in growth of polycrystalline films with inferior material properties. In other words, epitaxial limitations make it difficult to integrate complex-oxide materials onto conventional semiconductors while maintaining its excellent functional properties18. To address this challenge, recent advances in fabricating single- crystalline freestanding complex-oxide membrane techniques have paved the way to seamlessly integrate complex-oxides with any arbitrary semiconductor platforms19–21. In this work, we demonstrate state-of-the-art GaN HEMTs utilizing hetero- geneously integrated single-crystalline strontium titanium oxide (SrTiO3, abbreviated as STO) gate dielectric films. Epitaxial lift- off and direct stacking of freestanding membrane enables inte- gration of crystalline complex-oxide materials on GaN HEMT platforms. STO, a representative perovskite material, exhibits ultrahigh dielectric constant (κ ~ 300 at room temperature) and comparable breakdown field with conventional dielectric materials22,23. This material was recently utilized to demonstrate 2D-FETs successfully24. The fabricated devices show excellent electrical characteristics such as negligible hysteresis (ΔV), low subthreshold swing (SS) close to the Boltzmann limit, and low dynamic on-resistance. We conclude that the pristine interface between the transferred complex-oxide membrane and GaN is attributed to the superior performance of the devices. Results Structure of the STO/GaN HEMTs. Figure 1a–c shows a 3D schematic illustration, photograph, and optical microscope image of the fabricated STO/GaN HEMT device. Centimeter-scale freestanding STO membrane with a thickness of ~25 nm was transferred onto the AlGaN/GaN HEMT heterostructure as the gate insulator. The channel width, channel length, and gate length are 60 µm, 30 µm, and 4 µm, respectively. Figure 1d shows the energy band diagram of the fabricated device (the characteriza- tion and fabrication procedure are shown in Supplementary Figs. 1, 2, respectively). With an estimated valence band offset of ~0.5 eV and conduction band offset of ~0.1 eV, the STO gate insulator forms a type-I straddling band alignment with AlGaN25–31. Typically, the type-I negative band alignment of gate Fig. 1 Structure of the STO/GaN HEMTs. a Schematic illustration, b photograph, c optical microscopy image and d energy band diagram of fabricated AlGaN/GaN high-electron-mobility transistors (HEMT) with SrTiO3 (STO) gate dielectric. ARTICLE COMMUNICATIONS ENGINEERING | https://doi.org/10.1038/s44172-024-00161-z 2 COMMUNICATIONS ENGINEERING | (2024) 3:15 | https://doi.org/10.1038/s44172-024-00161-z | www.nature.com/commseng which showed no defects, airgaps, unexpected interfacial layers or residues at the STO/GaN interface. We suspect that the dangling bonds of the transferred STO membrane may form atomic bonding with the underlying substrate (in our case, GaN HEMT heterostructure) by the thermal annealing process, which con- sistent with the previous works55–59 (the mechanism of the interface bonds formation is schematically illustrated in Supple- mentary Fig. 5). Moreover, the selected area electron diffraction (SAED) pattern (inset) of the STO region, verified the crystalline nature of the transferred STO membrane. We believe these results, along with the electrical analysis of the gate oxide inter- face, strongly support that the reliable operation and excellent performance of the fabricated STO gate oxide HEMT is a result of a pristine interface between highly crystalline STO gate oxide and GaN. Conclusions In summary, we heterogeneously integrated crystalline complex- oxide material on AlGaN/GaN HEMT as a gate dielectric by epitaxial layer transfer approach. Using STO with ultrahigh-κ properties as the gate oxide, we fabricated a MOS-HEMT device. The fabricated devices exhibited a negligible hysteresis (ΔV) at a drain current of 1 µA/mm, and a minimum SS value of 62 mV dec−1. We attribute these results to an extremely clean interface between the STO and GaN, free from interface and border traps. The dynamic on resistance measurements were performed for further interface quality analysis, in which our device only showed a maximum resistance increase of 7%. Finally, we confirmed through TEM that no unwanted inter- facial layer, residues, or airgaps between STO/GaN exists, and that the transferred STO maintains its crystalline nature. Our results demonstrate the potential of heterogeneous integration of complex-oxide materials with mature semiconductor technolo- gies, substantially expanding the possibility of creating high performance electrical and photonic devices with novel functionalities. Methods Material preparation and device fabrication. A GaN HEMT, consisting of GaN capping layer (3 nm), Al0.26Ga0.74N barrier (25 nm), AlN interlayer (1 nm), GaN channel layer (2 μm) and GaN buffer layer (1 μm), was grown via metal-organic chemical vapor deposition (MOCVD) on a Si (111) substrate. The electron mobility and sheet carrier concentrations of the two-dimensional electron gas (2DEG) formed between the AlGaN/GaN interface were >1300 cm2 V−1 s−1 and ~1013 cm−2 at T = 300 K. The integration of STO with AlGaN/GaN HEMT structure begins with the successive epitaxial growth of a water-soluble strontium aluminum oxide (Sr3Al2O6, abbreviated as SAO) sacrificial layer, followed by the growth of STO gate oxide on a single-crystalline STO (001) substrate by pulsed-laser deposition (PLD). It has been reported that the epitaxial growth of oxide film on the SAO template allows the transfer of single-crystalline STO membranes without fundamental thickness limitation60. The single-crystallinity of the epitaxially grown STO film on SAO/ STO substrate is confirmed using X-ray diffraction (XRD) and electron backscatter diffraction (EBSD) map, as shown in Supplementary Fig. 1a–c. After deposition of a poly(methyl methacrylate) (PMMA) supporting layer on the as-grown STO/ SAO/STO substrate via spin-coating, the stack was immersed in deionized (DI) water for ~24 hours to completely dissolve the SAO sacrificial layer61. The freestanding STO membrane with a thickness of ~25 nm was then transferred onto the AlGaN/GaN HEMT structure followed by removal of the supporting layer by acetone and rinsed by isopropyl alcohol (the complex-oxide membrane transfer procedure schematically illustrated in Sup- plementary Fig. 2). The transferred membrane was patterned through standard photolithography and etched using a combination of ion milling and etching in diluted hydrofluoric acid (HF) solution. We believe that the HF etch removes most of the defects caused by the ion milling in the gate oxide membrane, leading to excellent characteristics. Mesa isolation was conducted by inductively coupled plasma reactive ion etching (ICP-RIE) using a mixture of BCl3/Cl2 gas. A Ti/Al/Ti/W (20/120/20/30 nm) stack was deposited for the source/drain electrode via e-beam evaporation, followed by rapid thermal annealing at 500 °C for 2 min in N2 environment. Finally, a Ni film ( ~ 500 nm) was deposited as the gate electrode via plasma sputtering (the low magnification cross- sectional image of the fabricated device is shown in Supplemen- tary Fig. 6). Electrical and material characterizations. The electrical prop- erties of the fabricated devices were measured using a semi- conductor parameter analyzer (Keithley−4200A-SCS) with a 4255-RPM module to apply pulsed signals. The structural and interfacial analysis was performed using a scanning electron microscope (SEM), focused ion beam (FIB), and transmission electron microscopy (TEM). SEM measurements were performed using JEOL high-resolution SEM (IT-500HR), ZEISS SEM with an EBSD detector. The cross-sectional TEM specimens of the fabricated devices were prepared using a Ga-focused ion beam milling (ZEISS crossbeam 540) technique. TEM measurements were performed using a JEOL ARM 200 F (NEOARM). Data availability The data that support the findings of this study are available from the corresponding author upon reasonable request. Fig. 4 TEM characterization of STO/GaN interface. a Plan-view scanning electron microscope (SEM) image of HEMT device, black box represents region of focused ion beam (FIB) milling for transmission electron microscope (TEM) analysis. b Cross-sectional TEM image of SrTiO3 (STO)/GaN interface. The inset shows selected area electron diffraction (SAED) pattern of the transferred STO. COMMUNICATIONS ENGINEERING | https://doi.org/10.1038/s44172-024-00161-z ARTICLE COMMUNICATIONS ENGINEERING | (2024) 3:15 | https://doi.org/10.1038/s44172-024-00161-z | www.nature.com/commseng 5 Received: 29 August 2023; Accepted: 5 January 2024; References 1. Ji, J., Park, S., Do, H. & Kum, H. S. A review on recent advances in fabricating freestanding single-crystalline complex-oxide membranes and its applications. Phys. Scr. 98, 052002 (2023). 2. Ji, J. et al. Understanding the 2D-material and substrate interaction during epitaxial growth towards successful remote epitaxy: a review. Nano Converg. 10, 19 (2023). 3. Chiabrera, F. M. et al. Freestanding perovskite oxide films: Synthesis, challenges, and properties. Ann. Phys. 534, 2200084 (2022). 4. Bouaziz, J., Cancellieri, C., Rheingans, B., Jeurgens, L. P. H. & La Mattina, F. Advanced epitaxial lift-off and transfer procedure for the fabrication of high- quality functional oxide membranes. Adv. Mater. Interfaces 10, 2200084 (2023). 5. Puebla, S. et al. Combining freestanding ferroelectric perovskite oxides with two-dimensional semiconductors for high performance transistors. Nano Lett. 22, 7457–7466 (2022). 6. Jiang, H. et al. Investigation of in situ SiN as gate dielectric and surface passivation for GaN MISHEMTs. IEEE Trans. Electron Devices 64, 832–839 (2017). 7. He, J. et al. Normally-OFF AlGaN/GaN MIS-HEMTs with Low RON and Vth hysteresis by functioning in-situ SiNx in regrowth process. IEEE Electron Device Lett. 43, 529–532 (2022). 8. Zhang, H. et al. Effect of in-situ SiNx grown with different carrier gas on structural and electrical properties of GaN-based MISHEMTs. Appl. Phys. Lett. 122, 173501 (2023). 9. Hoo Teo, K. et al. Emerging GaN technologies for power, RF, digital, and quantum computing applications: Recent advances and prospects. J. Appl. Phys. 130, 160902 (2021). 10. Amano, H. et al. The 2018 GaN power electronics roadmap. J. Phys. D: Appl. Phys. 51, 163001 (2018). 11. Millan, J., Godignon, P., Perpina, X., Perez-Tomas, A. & Rebollo, J. A survey of wide bandgap power semiconductor devices. IEEE Trans. Power Electron. 29, 2155–2163 (2014). 12. Ando, Y., Kaneki, S. & Hashizume, T. Improved operation stability of Al2O3/ AlGaN/GaN MOS high-electron-mobility transistors grown on GaN substrates. Appl. Phys. Express 12, 024002 (2019). 13. Yeom, M. J. et al. Low subthreshold slope AlGaN/GaN MOS-HEMT with spike-annealed HfO2 gate dielectric. Micromachines 12, 1441 (2021). 14. Zhao, Y. P. et al. Comparative study on characteristics of Si-based AlGaN/ GaN recessed MIS-HEMTs with HfO2 and Al2O3 gate insulators. Chinese Phys. B 29, 087304 (2020). 15. Hashizume, T., Nishiguchi, K., Kaneki, S., Kuzmik, J. & Yatabe, Z. State of the art on gate insulation and surface passivation for GaN-based power HEMTs. Mater. Sci. Semicond. 78, 85–95 (2018). 16. Kum, H. S. et al. Heterogeneous integration of single-crystalline complex- oxide membranes. Nature 578, 75–81 (2020). 17. Disa, A. S. et al. Photo-induced high-temperature ferromagnetism in YTiO3. Nature 617, 73–78 (2023). 18. Bae, S. H. et al. Integration of bulk materials with two-dimensional materials for physical coupling and applications. Nat. Mater. 18, 550–560 (2019). 19. Han, S. et al. Freestanding membranes for unique functionality in electronics. ACS Appl. Electron. Mater. 5, 690–704 (2023). 20. Kum, H. et al. Epitaxial growth and layer-transfer techniques for heterogeneous integration of materials for electronic and photonic devices. Nat. Electron. 2, 439–450 (2019). 21. Bakaul, S. R. et al. Single crystal functional oxides on silicon. Nat. Commun. 7, 10547 (2016). 22. Neville, R. C., Hoeneisen, B. & Mead, C. A. Permittivity of strontium titanate. J. Appl. Phys. 43, 2124–2131 (1972). 23. Huang, J. K. et al. High-κ perovskite membranes as insulators for two- dimensional transistors. Nature 605, 262–267 (2022). 24. Yang, A. J. et al. Van der Waals integration of high-κ perovskite oxides and two-dimensional semiconductors. Nat. Electron. 5, 233–240 (2022). 25. Maruska, H. P. & Tietjen, J. J. The preparation and properties of vapor- deposited single-crystal-line GaN. Appl. Phys. Lett. 15, 327–329 (1969). 26. Yim, W. M. et al. Epitaxially grown AlN and its optical band gap. J. Appl. Phys. 44, 292–296 (1973). 27. Koide, Y. et al. Energy band-gap bowing parameter in an AlxGa1-xN alloy. J. Appl. Phys. 61, 4540–4543 (1987). 28. Jung, B. K. et al. GaN schottky barrier MOSFET using transparent source/ drain electrodes for UV-optoelectronic integration. Solid-State Electron. 73, 78–80 (2012). 29. Four, I. & Kameche, M. Optimization of DC and AC performances for Al0.26Ga0.74N/GaN/4H-SiC HEMT with 30nm T-gate. Int. J. Nanoelectron. Mater. 13, 361–372 (2020). 30. Robertson, J. & Falabretti, B. Band offsets of high K gate oxides on III-V semiconductors. J. Appl. Phys. 100, 014111 (2006). 31. Michaelson, H. B. The work function of the elements and its periodicity. J. Appl. Phys. 48, 4729–4733 (1977). 32. Jha, J., Meer, M., Ganguly, S. & Saha, D. Off-state degradation and recovery in Oxide/AlGaN/GaN heterointerfaces: importance of band offset, electron, and hole trapping. ACS Appl. Electron. Mater. 2, 2071–2077 (2020). 33. Meneghini, M. et al. Trapping in GaN-based metal-insulator-semiconductor transistors: Role of high drain bias and hot electrons. Appl. Phys. Lett. 104, 143505 (2014). 34. Yang, J. Y., Ma, J., Lee, C. H. & Yoo, G. Polycrystalline/Amorphous HfO2 bilayer structure as a gate dielectric for β-Ga2O3 MOS capacitors. IEEE Trans. Electron Devices 68, 1011–1015 (2021). 35. Kanamura, M. et al. Suppression of threshold voltage shift for normally-Off GaN MIS-HEMT without post deposition annealing. Proc. Int. Symp. Power Semicond. Devices ICs 411–414 (2013). 36. Kang, H. Y. et al. Epitaxial κ-Ga2O3/GaN heterostructure for high electron- mobility transistors. Mater. Today Phys. 31, 101002 (2023). 37. Wang, H. C. et al. High-Performance LPCVD-SiNx/InAlGaN/GaN MIS- HEMTs with 850-V 0.98-mΩ·cm2 for power device applications. IEEE J. Electron Devices Soc. 6, 1136–1141 (2018). 38. Wang, H. C. et al. AlGaN/GaN MIS-HEMTs with high quality ALD-Al2O3 gate dielectric using water and remote oxygen plasma as oxidants. IEEE J. Electron Devices Soc. 6, 110–115 (2017). 39. Cai, Y. et al. Low ON-state resistance normally-OFF AlGaN/GaN MIS- HEMTs with partially recessed gate and ZrO charge trapping layer. IEEE Trans. Electron Devices 68, 4310–4316 (2021). 40. He, J., Hua, M., Zhang, Z. & Chen, K. J. Performance and VTH stability in E-Mode GaN fully recessed MIS-FETs and partially recessed MIS-HEMTs with LPCVD-SiNx/PECVD-SiNx gate dielectric stack. IEEE Trans. Electron Devices 65, 3185–3191 (2018). 41. Jiang, H., Tang, C. W. & Lau, K. M. Enhancement-Mode GaN MOS-HEMTs with recess-free barrier engineering and High-k ZrO2 gate dielectric. IEEE Electron Device Lett. 39, 405–408 (2018). 42. Chandrasekar, H. et al. Demonstration of wide bandgap AlGaN/GaN negative-capacitance high-electron-mobility transistors (NC-HEMTs) using barium titanate ferroelectric gates. Adv. Electron. Mater. 6, 2000074 (2020). 43. Yang, S. et al. High-quality interface in Al2O3/GaN/GaN/AlGaN/GaN MIS structures with in situ pre-gate plasma nitridation. IEEE Electron Device Lett. 34, 1497–1499 (2013). 44. Dutta Gupta, S. et al. Positive threshold voltage shift in AlGaN/GaN HEMTs and E-Mode operation by AlxTi1-xO based gate stack engineering. IEEE Trans. Electron Devices 66, 2544–2550 (2019). 45. Zhang, H. et al. Room-temperature organic passivation for GaN-on-Si HEMTs with improved device stability. IEEE Trans. Electron Devices 1–5 (2023) 46. Wang, T., Zong, Y., Nela, L. & Matioli, E. Enhancement-mode multi-channel AlGaN/GaN transistors with LiNiO junction Tri-gate. IEEE Electron Device Lett. 43, 1523–1526 (2022). 47. Wang, T., Nikoo, M. S., Nela, L. & Matioli, E. LiNiO gate dielectric with tri- gate structure for high performance E-mode GaN transistors. Proc. Int. Symp. Power Semicond. Devices ICs 135–138 (2021). 48. Wu, N. et al. Enhanced performance of low-leakage-current normally off p-GaN Gate HEMTs using NH3 plasma pretreatment. IEEE Trans. Electron Devices 70, 4560–4564 (2023). 49. Cheng, W.-C. et al. Low trap density of oxygen-rich HfO2/GaN interface for GaN MIS-HEMT applications. J. Vac. Sci. Technol. B 40, 022212 (2022). 50. He, J. et al. Distinguishing various influences on the electrical properties of thin-barrier AlGaN/GaN heterojunctions with in-situ SiNx caps. Mater. Sci. Semicond. Process. 132, 105907 (2021). 51. Lee, H. P. & Bayram, C. Improving current ON/OFF ratio and subthreshold swing of Schottky- Gate AlGaN/GaN HEMTs by postmetallization annealing. IEEE Trans. Electron Devices 67, 2760–2764 (2020). 52. Jin, D., & Del Alamo, J.A. Methodology for the study of dynamic ON- resistance in high-voltage GaN field-effect transistors. IEEE Trans. Electron Devices 60, 3190–3196 (2013). 53. Meneghini, M. et al. Trapping phenomena and degradation mechanisms in GaN-based power HEMTs. Mater. Sci. Semicond. Process. 78, 118–126 (2018). 54. Zhu, J. J. et al. Improved interface and transport properties of AlGaN/GaN MIS-HEMTs with PEALD-grown AlN gate dielectric. IEEE Trans. Electron Devices 62, 512–518 (2015). 55. Yong, G. J. et al. Thermal stability of SrTiO3/SiO2/Si interfaces at intermediate oxygen pressures. J. Appl. Phys. 108, 033502 (2010). 56. Lee, M. et al. Self-sealing complex oxide resonators. Nano Lett. 22, 1475–1482 (2022). 57. Yoon, H. et al. Freestanding epitaxial SrTiO3 nanomembranes via remote epitaxy using hybrid molecular beam epitaxy. Sci. Adv. 8, eadd5328 (2022). ARTICLE COMMUNICATIONS ENGINEERING | https://doi.org/10.1038/s44172-024-00161-z 6 COMMUNICATIONS ENGINEERING | (2024) 3:15 | https://doi.org/10.1038/s44172-024-00161-z | www.nature.com/commseng 58. Li, Y. et al. Stacking and twisting of freestanding complex oxide thin films. Adv. Mater. 34, 2203187 (2022). 59. Hashizume, T. et al. Effects of postmetallization annealing on interface properties of Al2O3/GaN structures. Appl. Phys. Expr. 11, 124102 (2018). 60. Ji, D. et al. Freestanding crystalline oxide perovskites down to the monolayer limit. Nature 570, 87–90 (2019). 61. Lu, D. et al. Synthesis of freestanding single-crystal perovskite films and heterostructures by etching of sacrificial water-soluble layers. Nat. Mater. 15, 1255–1260 (2016). Acknowledgements H.S.K. acknowledge support from the National Research Foundation of Korea (NRF) (grant no. RS-2023-00252720 and grant no. RS-2023-00222070) and the Department of Electrical and Electronic Engineering at Yonsei University (2022-22-0311). G.Y. acknowledge support from the Ministry of Science and ICT (NRF-2021R1A4A1033155) and Ministry of Trade, Industry, and Energy of Korea (RS-2022-00154729). J.K. acknowledge support from the Office of the Director of National Intelligence (ODNI), Intelligence Advanced Research Projects Activity (IARPA), via [2021-210900005]. Author contributions H.S.K., G.Y., J.K., and J.J. conceived this work and designed the experiments. H.S.K. directed the team. J.J., J.Y.Y., S.K., S.-H. Bae, J-H.A., S.K., G.Y. and H.S.K. prepared the manuscript. J.J., J.Y.Y., S.L., S.K., M.J.Y., G.L., and H.S. performed the device fabrication and characterization. J.J. H.S., and S.L. carried out the complex-oxide film growth and transfer fabrication. J.Y.Y., S.K., M.J.Y., and G.L. carried out GaN HEMT device fabri- cation and measurements. S.K. carried out the TEM measurements. All the authors contributed to the discussion and analysis of the results. Competing interests The authors declare no competing interests. Additional information Supplementary information The online version contains supplementary material available at https://doi.org/10.1038/s44172-024-00161-z. Correspondence and requests for materials should be addressed to Jeehwan Kim, Geonwook Yoo or Hyun S. Kum. Peer review information Communications Engineering thanks the anonymous reviewers for their contribution to the peer review of this work. Primary Handling Editors: Liwen Sang, Anastasiia Vasylchenkova and Ros Daw. Reprints and permission information is available at http://www.nature.com/reprints Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/ licenses/by/4.0/. © The Author(s) 2024 COMMUNICATIONS ENGINEERING | https://doi.org/10.1038/s44172-024-00161-z ARTICLE COMMUNICATIONS ENGINEERING | (2024) 3:15 | https://doi.org/10.1038/s44172-024-00161-z | www.nature.com/commseng 7

Title: Heterogeneous integration of high-k complex-oxide gate dielectrics on wide band-gap high-electron-mobility transistors ​ Authors: Jongho Ji, Jeong Yong Yang, Sangho Lee, Seokgi Kim, Min Jae Yeom, Gyuhyung Lee, Heechang Shin, Sang-Hoon Bae, Jong-Hyun Ahn, Sungkyu Kim, Jeehwan Kim, Geonwook Yoo, Hyun S. Kum ​ Publisher: Nature Communications Engineering Date: 5 January 2024 ​ Abstract: Heterogeneous integration of dissimilar crystalline materials has recently attracted considerable attention due to its potential for high-performance multifunctional electronic and photonic devices. ​ The conventional method for fabricating heterostructures is by hetero-epitaxy, in which epitaxy is performed on crystallographically different materials. ​ However, epitaxial limitations in monolithic growth of dissimilar materials prevent implementation of high-quality heterostructures, such as complex-oxides on conventional semiconductor platforms (Si, III-V, and III-N). ​ In this work, we demonstrate gallium nitride (GaN) high-electron-mobility transistors with crystalline complex-oxide material enabled by heterogeneous integration through epitaxial lift-off and direct stacking. ​ We successfully integrate high-κ complex-oxide SrTiO3 in freestanding membrane form with GaN heterostructure via a simple transfer process as the gate oxide. The fabricated device shows steep subthreshold swing close to the Boltzmann limit, along with negligible hysteresis and low dynamic on-resistance, indicating very low defect density between the SrTiO3 gate oxide and GaN heterostructure. ​ Our results show that heterogeneous integration through direct material stacking is a promising route towards fabricating functional heterostructures not possible by conventional epitaxy.

High-throughput and data-driven machine learning techniques for discovering high- entropy alloys.pdf

communications materials Review article https://doi.org/10.1038/s43246-024-00487-3 High-throughput and data-driven machine learning techniques for discovering high- entropy alloys Check for updates Lu Zhichao1,2, Ma Dong2, Liu Xiongjun1,3 & Zhaoping Lu 1,3 High-entropy alloys (HEAs) have attracted extensive attention in recent decades due to their unique chemical, physical, and mechanical properties. An in-depth understanding of the structure–property relationship in HEAs is the key to the discovery and design of new compositions with desirable properties. Related to this, materials genome strategy has been increasingly used for discovering new HEAs with better performance. This review paper provides an overview of key advances in this fast- growing area, along with current challenges and potential opportunities for HEAs. We also discuss related topics, such as high-throughput preparation, characterization, and computation of HEAs, and data-driven machine learning for accelerating alloy development. Finally, future research directions and perspectives for the materials genome-assisted design of HEAs are proposed and discussed. High-entropy alloys (HEAs), also called multi-principal element alloys1–3, are chemically disordered but topologically ordered with the formation of random solid-solution (SS) structures, such as face-centered cubic (FCC), body-centered cubic (BCC), or hexagonal-close-packed (HCP). Under- standingthecomposition–structure–propertiesrelationship haslongbeena topicofgreatinterestinHEAs.Thus,extensivestudieshavebeencarriedout on various HEAs, and many attractive properties have been achieved in the last two decades. These properties include good plasticity, high strength and hardness, outstanding high-temperature-softening resistance, and unique electrical and magnetic properties. In the past few years, besides metallic systems, high entropy materials have expanded to ceramics made of car- bides, borides, or nitrides of IV and V group transition metals, which have remarkable properties4–6. Due to these unique properties and large com- position space, high entropy materials have promising potential applica- tions under extreme conditions, such as, in high-temperature structural components, corrosion-resistant parts, coatings, and nuclear materials7. However, with regard to the property-oriented designs of HEAs, some challenges remain to be solved. (1) Owing to the chemically disordered structure, HEAs are not necessarily equimolar compositions; that is, many potentialelementsintheperiodictablecanconceivablybeincorporatedinto HEAs via microalloying or principal element substitution. Therefore, an essentially infinite number of HEAs are available. Since the compositions of HEAs can be continuously adjustable, the properties of interest can be optimized. Conceptually, this poses a serious challenge—How can potential HEAs with properties of interest be fine-tuned efficiently in such a large composition space rather than in a conventional “trial and error” manner8? (2) Coupled with the factthat fully understanding the complicated interplay between constituents and properties is a prerequisite when designing new HEAs, How can the intrinsic relationship in a vast and complex database be uncovered? To date, inspired by the Materials Genome Initiative (MGI), high-throughput techniques (preparation, characterization, and calcula- tion) and the data-driven machine learning (ML) method have been adopted by synergistically combining experiment, theory, and computation in a tightly integrated and high-throughput manner, and to predict and optimize HEAs at anunparalleledscale and in an effective way 9. These tools canbeusedtoscreenextensivecompositionspaceforadesiredpropertyand simultaneously pinpoint specific alloys with the desired properties. Speci- fically, high-throughput techniques are able to bridge the gap between experiments and ML modeling; that is, high-throughput approaches can provide valuable materials information for the following ML, and vice versa, ML can provide intelligent feedback to the experiments10–12. Through continuing efforts to integrate experiment, computation, and data-driven ML, the underlying structure–property relationships to the materials gen- ome can be revealed and thus seed a new generation of advanced HEAs13. This review aims to present a brief state-of-the-art overview of the materials genome strategy (MGS) applied in HEAs and provide a timely focus on key developments, including challenges and opportunities, in this interdisciplinary area. Specifically, we will give a brief introduction to the development of HEAs and the application of MGI in this field. Additionally, some challenges will also be listed in a brief manner in “Introduction”. In section “High-throughput preparation and characterization of HEAs”, the main high-throughput preparation and characterization techniques for 1Beijing Advanced Innovation Center for Materials Genome Engineering, State Key Laboratory for Advanced Metals and Materials, University of Science and Technology Beijing, Beijing, China. 2Songshan Lake Materials Laboratory, Dongguan, China. 3Institute for Materials Intelligent Technology, Liaoning Academy of Materials, Shenyang, China. e-mail: [email protected]; [email protected] Communications Materials | (2024) 5:76 1 1234567890():,; 1234567890():,; HEAswillbe discussedindetailed and critical issuesneeded to be solved will also be proposed. In section “High-throughput computing for HEAs”, we will present and discuss applications of high-throughput computation method in accelerating the development of HEAs. An in-depth discussion about data-driven ML strategy for HEAs will be provided in section “Data- driven machine learning strategies “. Finally, in “Outlook” section, we will give an outlook of potential research activities to be exploited and main scientific challenges to be addressed in the future. The core purpose underlying the brief review is to provide an important opportunity to advance the understanding of MGS employed in HEAs and to offer researchers a platform to foster new ideas. High-throughput preparation and characterization of HEAs The design of HEAs poses a significant challenge when exploring the phase structure and desirable properties through the vast potential multi- component compositional space available14. As such, unconventional high- throughput preparation techniques are crucially important, particularly for effectively narrowing down the alloys in a wide composition space. Among these, HEAs exploit a variety of preparation techniques, such as, combi- natorial thin film deposition, laser additive manufacturing (LAM), rapid alloying prototype, diffusion multiples, and those based on welding. In what follows, we will give an overview of the different high-throughput techni- ques that were used to prepare multi-component HEAs and point out some critical issues that needed to be resolved. High-throughput preparation techniques for HEAs LAM. Combinatorial LAM endows the process with both high heating and cooling rates, and has been used as an efficient method for the synthesis of HEAs. Among various LAM methods, laser metal deposition (LMD) is the preferred technique used to make HEA combinational libraries. During the LMD process, the feedstock nozzles convey the raw material powder to a rapidly moving melt pool formed by a laser through an inert gas flow. Apparently, LMD is more suitable for high-throughput synthesis owing to the advantage of its real-time and variable feeding system, which applies two or more hoppers with different powder feeders to permit changes in the deposited powder compositions15–21. Combinatorial laser deposition of compositionally graded complex alloys has been regarded as an attractive approach for assessing the composition–microstructure–property relationships of HEAs. LMD is quite capable of synthesizing refractory HEAs that are difficult to make19. Melia et al. prepared a MoNbTaW alloy system by additive manufacturing with commercial refractory elemental powders, which have good spherical morphology,leveragingtheadditivemanufacturingprocessandmechanical testing to enable rapid alloy exploration, as shown in Fig. 1. In the steady state, there was an evident linear spatial trend in the composition and a significantlyvariation of hardness, withcomposition dominated bysolution strengthening (Fig. 1d)19. Compared to other mechanical properties (i.e., strength, plasticity, toughness, etc.), hardness is the simplest one that can be obtained effectively by mechanical testing automatically in areas with dif- ferent compositions of small samples. In view of the hardness–strength relationship (Hv ≈ 3σyðMPaÞ 9:81 )22, hardness allows for indirect and efficient evaluations of mechanical properties. Borkar et al. studied the compositionally graded AlxCrCuFeNi2 (0 <x < 1.5) HEAs produced by laser deposition from a blend of elemental powders, using a double powder feeder with two hoppers containing CrCuFeNi2 and Al2CrCuFeNi2 powders, respectively. The sample of a cylindrical geometry was deposited with a smooth change of alloy com- position in height15. Additionally, an identical laser deposition processing method, laser-engineered net shaping (LENS), was also applied to construct the compositional and microstructural libraries of AlxCoCrFeNi in a high- throughput manner18. The discrepancy between LENS and the above- mentioned case was that the substrate (CoCrFeNi plate) for LENS was priorly made by an arc-melting and copper mold-casting method, while in Borkar’s work, a blend of powders of a nominal composition of CrCuFeNi2 was used. During the LENS process, the laser power and moving speed remained unchanged, and the feeding rateof Al powder for each monolayer patch increased in certain increments. The entire deposition process includes the addition of Al and two subsequent remelting processes per- pendicular to the deposition direction, to improve the mixing and com- positional homogeneity of the alloyed region18. In fact, the design and parameter adjustment of the LMD process has an important effect on sample preparation. For example, the substrate greatly influences the composition and microstructure of the deposited alloys, which can be improved by increasing the stack thickness or a rea- sonable experimental design. The former will not only increase the pre- parationcost,butwillalsoaffectthemicrostructureuniformity.Selectingthe maincomponentofthealloyasthesubstratematerial,depositingthesample in the thickness direction with less affection for the substrate, and a con- trolled composition gradient could form a reasonable experimental design17,23. Combinatorial deposition of thin film materials libraries. Combina- torial thin film synthesis by sputtering using multiple deposition sources is a state-of-the-art route for constructing of materials libraries that are composed of a wide range of gradually changed alloy compositions24,25. Continuous preparation of multiple gradients can be achieved by adjusting the processing parameters, such as the compositions of the targets, the power and angle of each gun, and the material and rotation of the substrate. For HEAs, several approaches based on sputtering have been employed for alloy design by tweaking these parameters25–30. Since HEAs contain more than three principal elements, the preparation of thin film samples is an important part of high-throughput experiments. The composition library can be prepared by stacking multilayers, which were deposited by coordinating the single sputtering source with a removable mask. Due to the characteristics of the system alloys, the homogenization process requires a higher temperature with a long heat treatment duration. The substrate material and the experimental process are desired for higher requirements. The co-sputtering method, that is, using several targets to sputter simultaneously to obtain a composition library through the adjustment of processing parameters, is an ideal way to realize the compositional design of HEAs. However, the number of targetsavailable is often insufficient tomeet the number of constituent elements. Considering the mechanical coordi- nationandcharacterizationaccuracy,thisissuecanbeeffectivelyresolvedby usingtargetsofmultipleelements.Atpresent,thesynthesisofcombinatorial films is widely used in the preparation of a sample library of HEAs. Ludwig et al. reported quinary Ru–Rh–Pd–Ir–Pt composition spread thin-film materials libraries that were co-sputtered from a load-lock-equipped combinatorial magnetron sputtering system. Fig. 2a shows the coverage of a ternary and a quaternary library, and Fig. 2b illustrates co-deposition from five deposition sources and compositional gradients of a co-sputtered quinary materials library. Six composition spread materials libraries were synthesized via target arrangement permutations, each of which comprises composition gradients in different subsections of the quinary composition space. Forty percent of all possible Ru–Rh-Pd–Ir–Pt HEA compositions (defined by 10–35 at.% variations of individual elements) were covered by the materials libraries31. Additionally, Zhang et al. reported the Ti–Al–Cr–Fe–Ni composition library prepared via magnetron co- sputtering using Al, Ti, and CrFeNi targets29. They considered that the Cr, Co, and Fe atomic sizes are similar, and the inclusion of two magnetic components can avoid the interference of the magnetic field. Elements with great differences in sputtering power cannot be placed on the same target simultaneously. Therefore, the components in the alloy are divided into Al, Ti,andCrFeNitargets,witha1:1:1compositionratiooftheCrFeNitarget.A similar method is also applied to the (Cr, Fe, V)–(Ta, W) alloy system28, which is regarded as a pseudo-binary alloy composed of transition group elements Cr, Fe,V, and refractory elements Ta, W. Samples fabricated using https://doi.org/10.1038/s43246-024-00487-3 Review article Communications Materials | (2024) 5:76 2 66. Kim, H.-J. et al. High-throughput analysis of thin-film stresses using arrays of micromachined cantilever beams. Rev. Sci. Instrum. 79, 045112 (2008). 67. Figiel, H., Zogał, O. & Yartys, V. Effect of iron content on the microstructure evolution, mechanical properties and wear resistance of FeXCoCrNi high-entropy alloy system produced via MA-SPS Parisa. J. Alloys Compd. 404, 1 (2005). 68. Arunkumar, S. Overview of small punch test. Met. Mater. Int. 26, 719–738 (2020). 69. Cai, Y. et al. Fracture and wearmechanismsof FeMnCrNiCo + x(TiC) composite high-entropy alloy cladding layers. Appl. Surf. Sci. 543, 148794 (2021). 70. Marshal, A. et al. Combinatorial synthesis of high entropy alloys: introduction of a novel, single phase, body-centered-cubic FeMnCoCrAl solid solution. J. Alloys Compd. 691, 683–689 (2017). 71. Wei, T. et al. Scanning tip microwave near‐field microscope. Appl. Phys. Lett. 68, 3506–3508 (1996). 72. Gao, C., Duewer, F. & Xiang, X.-D. Quantitative microwave evanescent microscopy. Appl. Phys. Lett. 75, 3005–3007 (1999). 73. Turchinskaya, M. et al. Rapid constructing magnetic phase diagrams by magneto-optical imaging of composition spread films. J. Mater. Res. 19, 2546–2548 (2004). 74. Plimpton, S. Fast parallel algorithms for short-range molecular dynamics. J. Comput. Phys. 117, 1–19 (1995). 75. Kresse, G. & Furthmüller, J. Efficiency of ab initio total energy calculations for metals and semiconductors using a plane-wave basis set. Comput. Mater. Sci. 6, 15–50 (1996). 76. Raicu,I.(ed) Many-task Computing: BridgingtheGapBetweenHigh- Throughput Computing and High-performance Computing (University of Chicago, 2009). 77. Ong, S. P. et al. Python materials genomics (pymatgen): a robust, open-source python library for materials analysis. Comput. Mater. Sci. 68, 314–319 (2013). 78. Jain, A. et al. FireWorks: a dynamic workflow system designed for high‐throughput applications. Concurrency Comput. Pract. Exper. 27, 5037–5059 (2015). 79. Mathew, K. et al. Atomate: a high-level interface to generate, execute, and analyze computational materials science workflows. Comput. Mater. Sci. 139, 140–152 (2017). 80. Wang, G. et al. ALKEMIE: an intelligent computational platform for accelerating materials discovery and design. Comput. Mater. Sci. 186, 110064 (2021). 81. Yang, X. et al. MatCloud: a high-throughput computational infrastructure for integrated management of materials simulation, data and resources. Comput. Mater. Sci. 146, 319–333 (2018). 82. Kirklin, S. et al. The open quantum materials database (OQMD): assessing the accuracy of DFT formation energies. npj Comput. Mater. 1, 1–15 (2015). 83. Soven, P. Coherent-potential model of substitutional disordered alloys. Phys. Rev. 156, 809 (1967). 84. Tian, F. A review of solid-solution models of high-entropy alloys based on ab initio calculations. Front. Mater. 4, 36 (2017). 85. Aitken,Z.H.,Sorkin,V.&Zhang,Y.-W.Atomisticmodelingofnanoscale plasticity in high-entropy alloys. J. Mater. Res. 34, 1509–1532 (2019). 86. Santodonato, L. J. et al. Predictive multiphase evolution in Al- containing high-entropy alloys. Nat. Commun. 9, 4520 (2018). 87. C, S. C. A. B. et al. AFLOWLIB.ORG: a distributed materials properties repository from high-throughput ab initio calculations. Comput. Mater. Sci. 58, 227–235 (2012). 88. Lederer, Y. et al. The search for high entropy alloys: a high- throughput ab initio approach. Acta Mater. 159, 364–383 (2018). 89. Kaufman, L. & Bernstein, H. (eds) Computer Calculation of Phase Diagrams. With Special Reference to Refractory Metals (Academic Press, 1970). 90. Zhang, C. et al. Computational thermodynamics aided high-entropy alloy design. JOM 64, 839–845 (2012). 91. Gurao, N. & Biswas, K. In the quest of single phase multi-component multiprincipal high entropy alloys. J. Alloys Compd. 697, 434–442 (2017). 92. Chen, H.-L., Mao, H. & Chen, Q. Database development and Calphad calculations for high entropy alloys: challenges, strategies, and tips. Mater. Chem. Phys. 210, 279–290 (2018). 93. Klaver, T., Simonovic, D. & Sluiter, M. H. Brute force composition scanning with a CALPHAD database to find low temperature body centered cubic high entropy alloys. Entropy 20, 911 (2018). 94. Yang, S. et al. Revisit the VEC rule in high entropy alloys (HEAs) with high-throughput CALPHAD approach and its applications for material design—a case study with Al–Co–Cr–Fe–Ni system. Acta Mater. 192, 11–19 (2020). 95. Feng, R. et al. High-throughput design of high-performance lightweight high-entropy alloys. Nat. Commun. 12, 4329 (2021). 96. Cubuk, E. D. et al. Identifying structural flow defects in disordered solids using machine-learning methods. Phys. Rev. Lett. 114, 108001 (2015). 97. Wang, A. Y.-T. et al. Machine learning for materials scientists: an introductory guide toward best practices. J. Chem. Mater. 32, 4954–4965 (2020). 98. Jablonka, K. M. et al. Big-data science in porous materials: materials genomics and machine learning. Chem. Rev. 120, 8066–8129 (2020). 99. Huang, W., Martin, P. & Zhuang, H. Machine-learning phase prediction of high-entropy alloys. Acta Mater. 169, 225–236 (2019). 100. Pei, Z. et al. Machine-learning informed prediction of high-entropy solid solution formation: beyond the Hume–Rothery rules. npj Comput. Mater. 6, 1–8 (2020). 101. Kaufmann, K. & Vecchio, K. S. Searching for high entropy alloys: a machine learning approach. Acta Mater. 198, 178–222 (2020). A novel high-throughput approach called “ML-HEA” was proposed to predict the solid solutionforming ability by coupling thermodynamic and chemical features with a random forest machine learning model. 102. Sun, Y. et al. Prediction of Ti–Zr–Nb–Ta high-entropy alloys with desirable hardness by combining machine learning and experimental data. Appl. Phys. Lett. 119, 201905 (2021). This work combines a machine learning (ML) model with phase diagram calculations (CALPHAD) to design Ti–Zr–Nb–Ta refractory HEAs with a desirable hardness. 103. Kaufmann, K. et al. Discovery of high-entropy ceramics via machine learning. npj Comput. Mater. 6, 9 (2020). 104. Kim, G. et al. First-principles and machine learning predictions of elasticity in severely lattice-distorted high-entropy alloys with experimental validation. Acta Mater. 181, 124–138 (2019). 105. Roy, A. et al. Machine learned feature identification for predicting phase and Young’s modulus of low-, medium-and high-entropy alloys. Scr. Mater. 185, 152–158 (2020). 106. Guo, S. et al. Effect of valence electron concentration on stability of fcc or bcc phase in high entropy alloys. J. Appl. Phys. 109, 103505 (2011). 107. Crisci, C., Ghattas, B. & Perera, G. A review of supervised machine learning algorithms and their applications to ecological data. Ecol. Modell. 240, 113–122 (2012). 108. Najafabadi, M. M. et al. Deep learning applications and challenges in big data analytics. J. Big Data 2, 1–21 (2015). 109. Islam, N., Huang, W. & Zhuang, H. Machine learning for phase selection in multi-principal element alloys. Comput. Mater. Sci. 150, 230–235 (2018). 110. Jha, R. et al. Combined machine learning and CALPHAD approach for discovering processing-structure relationships in soft magnetic alloys. Comput. Mater. Sci. 150, 202–211 (2018). https://doi.org/10.1038/s43246-024-00487-3 Review article Communications Materials | (2024) 5:76 17 111. Choudhury, A. et al. Structure prediction of multi-principal element alloysusingensemblelearning.Eng. Comput.37, 1003–1022(2020). 112. Zhou, Z. et al. Machine learning guided appraisal and exploration of phase design for high entropy alloys. npj Comput. Mater. 5, 1–9 (2019). 113. Bu, C. & Zhang, Z. Research on overfitting problem and correction in machine learning. J. Phys. Conf. Ser. https://doi.org/10.1088/1742- 6596/1693/1/012100 (2020). 114. Dai, D. et al. Using machine learning and feature engineering to characterize limited material datasets of high-entropy alloys. Comput. Mater. Sci. 175, 109618 (2020). 115. Li, R. et al. High-throughput calculations for high-entropy alloys: a brief review. Front. Mater. 7, 290 (2020). 116. Sparks, T. D. et al. Machine learning for structural materials. Annu. Rev. Mater. Res. 50, 27–48 (2020). 117. Wu, Q. et al. Uncovering the eutectics design by machine learning in the Al–Co–Cr–Fe–Ni high entropy system. Acta Mater. 182, 278–286 (2020). 118. Krishna, Y. V., Jaiswal, U. K. & Rahul, M. Machine learning approach to predict new multiphase high entropy alloys. Scr. Mater. 197, 113804 (2021). 119. Lee, S. Y. et al. Deep learning-based phase prediction of high- entropy alloys: optimization, generation, and explanation. Mater. Des. 197, 109260 (2021). 120. Machaka, R. Machine learning-based prediction of phases in high- entropy alloys. Comput. Mater. Sci. 188, 110244 (2021). 121. Rao, Z. et al. Machine learning-enabled high-entropy alloy discovery. Science 378, 78–85 (2022). 122. Pei, Z. et al. Toward the design of ultrahigh-entropy alloys via mining six million texts. Nat. Commun. 14, 54 (2023). 123. Wen, C. et al. Modeling solid solution strengthening in high entropy alloys using machine learning. Acta Mater. 212, 116917 (2021). 124. Menou, E. et al. Computational design of light and strong high entropy alloys (HEA): obtainment of an extremely high specific solid solution hardening. Scr. Mater. 156, 120–123 (2018). 125. Qiao, L. et al. Modelling and prediction of hardness in multi- component alloys: a combined machine learning, first principles and experimental study. J. Alloy. Compd. 853, 156959 (2021). 126. Wen, C. et al. Machine learning assisted design of high entropy alloys with desired property. Acta Mater. 170, 109–117 (2019). 127. Si, S. et al. Study on strengthening effects of Zr–Ti–Nb–O alloys via high throughput powder metallurgy and data-driven machine learning. Mater. Des. 206, 109777 (2021). 128. Behler, J. Atom-centered symmetry functions for constructing high- dimensional neural network potentials. J. Chem. Phys. 134, 074106 (2011). 129. Bartók, A. P., Kondor, R. & Csányi, G. On representing chemical environments. Phys. Rev. B 87, 184115 (2013). 130. Thompson, A. P. et al. Spectral neighbor analysis method for automated generation of quantum-accurate interatomic potentials. J. Comput. Phys. 285, 316–330 (2015). 131. Chen, C. et al. Accurate force field for molybdenum by machine learning large materials data. Phys. Rev. Mater. 1, 043603 (2017). 132. Li, X.-G. et al. Quantum-accurate spectral neighbor analysis potential modelsforNi–Mobinaryalloysandfccmetals.Phys.Rev.B 98, 094104 (2018). 133. Behler, J. & Parrinello, M. Generalized neural-network representation of high-dimensional potential-energy surfaces. Phys. Rev. Lett. 98, 146401 (2007). 134. Bartók, A. P. et al. Gaussian approximation potentials: the accuracy of quantum mechanics, without the electrons. Phys. Rev. Lett. 104, 136403 (2010). 135. Shapeev, A. V. Moment tensor potentials: a class of systematically improvable interatomic potentials. Multiscale Model. Simul. 14, 1153–1173 (2016). 136. Lei, Z. et al. Enhanced strength and ductility in a high-entropy alloy via ordered oxygen complexes. Nature 563, 546–550 (2018). 137. Ding, Q. et al. Tuning element distribution, structure and properties by composition in high-entropy alloys. Nature 574, 223–227 (2019). 138. Zhang, L. et al. The effect of randomness on the strength of high- entropy alloys. Acta Mater. 166, 424–434 (2019). 139. Meshkov, E. et al. Sublattice formation in CoCrFeNi high-entropy alloy. Intermetallics 112, 106542 (2019). 140. Kostiuchenko, T. et al. Impact of lattice relaxations on phase transitions in a high-entropy alloy studied by machine-learning potentials. npj Comput. Mater. 5, 1–7 (2019). This work proposed an efficient computational method based on machine-learning potentials and combined Monte Carlo simulations to study phase stability, phase transitions, and chemical short-range order of HEAs. 141. Grabowski, B. et al. Ab initio vibrational free energies including anharmonicity for multicomponent alloys. npj Comput. Mater. 5, 1–6 (2019). 142. Balyakin, I. & Rempel, A. Machine learning interatomic potential for molten TiZrHfNb. AIP Conf. Proc. 2313, 030037 (2020). 143. Balyakin, I. et al. Ab initio molecular dynamics and high-dimensional neural network potential study of VZrNbHfTa melt. J. Phys. Condens. Matter 32, 214006 (2020). 144. Li, X.-G. et al. Complex strengthening mechanisms in the NbMoTaW multi-principal element alloy. npj Comput. Mater. 6, 1–10 (2020). 145. Byggmästar, J., Nordlund, K. & Djurabekova, F. Gaussian approximation potentials for body-centered-cubic transition metals. Phys. Rev. Mater. 4, 093802 (2020). 146. Byggmästar, J., Nordlund, K. & Djurabekova, F. Modeling refractory high-entropy alloys with efficient machine-learned interatomic potentials: defects and segregation. Phys. Rev. B 10, 104101 (2021). 147. Jafary-Zadeh, M. et al. Applying a machine learning interatomic potential to unravel the effects of local lattice distortion on the elastic properties of multi-principal element alloys. J. Alloys Compd. 803, 1054–1062 (2019). 148. Kostiuchenko, T. et al. Short-range order in face-centered cubic VCoNi alloys. Phys. Rev. Mater. 4, 113802 (2020). 149. Zhao, L. et al. Anomalous dislocation core structure in shock compressed bcc high-entropy alloys. Acta Mater. 209, 116801 (2021). 150. Behler, J. Perspective: machine learning potentials for atomistic simulations. J. Chem. Phys. 145, 170901 (2016). 151. Podryabinkin, E. V. & Shapeev, A. V. Active learning of linearly parametrized interatomic potentials. Comput. Mater. Sci. 140, 171–180 (2017). 152. Pun, G. P. et al. Physically informed artificial neural networks for atomistic modeling of materials. Nat. Commun. 10, 1–10 (2019). 153. Meng, H. et al. Formation ability descriptors for high-entropy diborides established through high-throughput experiments and machine learning. Acta Mater. 256, 119132 (2023). 154. Jaafreh, R. et al. Machine learning guided discovery of super-hard high entropy ceramics. Mater. Lett. 306, 130899 (2022). 155. Xiong, J., Shi, S.-Q. & Zhang, T.-Y. Machine learning of phases and mechanical properties in complex concentrated alloys. J. Mater. Sci. Technol. 87, 133–142 (2021). 156. Bhandari, U. et al. Yield strength prediction of high-entropy alloys using machine learning. Mater. Today Commun. 26, 101871 (2021). 157. Wang, J. et al. A neural network model for high entropy alloy design. npj Comput. Mater. 9, 60 (2023). Acknowledgements This research was supported by National Natural Science Foundation of China (Nos. 52130108, 52301213, 52071024, and 52271003), Guangdong Basic and Applied Basic Research Foundation (No. 2022A1515110805), National Key R&D Program of China (No. 2022YFA1603801), the Funds for Creative Research Groups of China (No. 51921001), the Open Fund of the https://doi.org/10.1038/s43246-024-00487-3 Review article Communications Materials | (2024) 5:76 18 China Spallation Neutron Source Songshan Lake Science City (No. KFKT2023B11), Program for Changjiang Scholars and Innovative Research Team in University of China (No. IRT_14R05), and State Key Lab of Advanced Metals and Materials (No. 2022-ZD01). Author contributions Zhichao L. and Zhaoping L. conceived the idea and concept, wrote the initial manuscript, and validated the discussion. X.L. revised the paper. D.M. and Zhaoping L. supervised the work, led the project, and contributed to the final writing. All authors discussed and approved the final manuscript. Competing interests The authors declare no competing interests. Additional information Correspondence and requests for materials should be addressed to Liu Xiongjun or Zhaoping Lu. Peer review information Communications Materials thanks Vineeth Venu- gopal, Ben Breitung, and the other, anonymous, reviewer(s) for their con- tribution to the peer review of this work. Primary Handling Editors: Eun Soo Park and John Plummer. Reprints and permissions information is available at http://www.nature.com/reprints Publisher’s note Springer Nature remains neutral withregardtojurisdictional claims in published maps and institutional affiliations. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. © The Author(s) 2024 https://doi.org/10.1038/s43246-024-00487-3 Review article Communications Materials | (2024) 5:76 19

Title: High-throughput and data-driven machine learning techniques for discovering high-entropy alloys Authors: Lu Zhichao, Ma Dong, Liu Xiongjun, Zhaoping Lu Publisher: Communications Materials, Springer Nature Date: 2024-04-03 00:00:00 Abstract: High-entropy alloys (HEAs) have attracted extensive attention in recent decades due to their unique chemical, physical, and mechanical properties. ​ An in-depth understanding of the structure–property relationship in HEAs is the key to the discovery and design of new compositions with desirable properties. ​ Related to this, materials genome strategy has been increasingly used for discovering new HEAs with better performance. ​ This review paper provides an overview of key advances in this fast-growing area, along with current challenges and potential opportunities for HEAs. ​ We also discuss related topics, such as high-throughput preparation, characterization, and computation of HEAs, and data-driven machine learning for accelerating alloy development. ​ Finally, future research directions and perspectives for the materials genome-assisted design of HEAs are proposed and discussed. ​

High-dimensional Poincaré beams generated through cascaded metasurfaces for high-security optical encryption.pdf

Open Access © The Author(s) 2024. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the mate- rial. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​ creat​iveco​mmons.​org/​licen​ses/​by/4.​0/. RESEARCH Ji et al. PhotoniX (2024) 5:13 https://doi.org/10.1186/s43074-024-00125-8 PhotoniX High-dimensional Poincaré beams generated through cascaded metasurfaces for high-security optical encryption Jitao Ji1, Chen Chen1*, Jiacheng Sun1, Xin Ye1, Zhizhang Wang1, Jian Li1, Junyi Wang1, Wange Song1, Chunyu Huang1, Kai Qiu1, Shining Zhu1 and Tao Li1*  Abstract  Optical encryption plays an increasingly important role in the field of information security owing to its parallel processing capability and low power consumption. Employing the ultrathin metasurfaces in optical encryption has promoted the min- iaturization and multifunctionality of encryption systems. Nevertheless, with the few number of degrees of freedom (DoFs) multiplexed by single metasurface, both key space and encoding space are limited. To address this issue, we propose a high-security and large-capacity optical encryption scheme based on perfect high-dimensional Poincaré beams with expanded DoFs. By cascading two arrayed metasurfaces, more beam properties can be independently engineered, which gives rise to the extensively expanded key and encoding spaces. Our work provides a promising strategy for opti- cal encryption with high security level and large information capacity and might facilitate the applications of Poincaré beams in optical communications and quantum information. Keywords:  Poincaré beams, Cascaded metasurfaces, Optical encryption Introduction With the rapid development of information technology, information security is becom- ing of vital significance and so do the derived encryption techniques. Optical encryption possesses the advantages of parallel processing, large capacity and low power consump- tion, and offers an ideal platform for information protection owing to abundant degrees of freedom (DoFs) of the photon [1–5]. However, conventional optical encryption sys- tem commonly involves in a series of complicated optical elements and results in a bulky volume. In addition, due to the limited optical field manipulation capability of traditional optical elements, the multi-dimensional DoFs of light have not been fully exploited. As an ultra-thin planar optical element composed of subwavelength nanostructures, metasurface has shown powerful capability of multi-dimensional optical field manipu- lation and emerges as a promising candidate for optical encryption in a compact form [6–13]. For metasurface-empowered optical encryption system, the key space could be defined as the total number of keys and attributed to both incident and output states. *Correspondence: [email protected]; [email protected] 1 National Laboratory of Solid State Microstructures, Key Laboratory of Intelligent Optical Sensing and Manipulation, Jiangsu Key Laboratory of Artificial Functional Materials, College of Engineering and Applied Sciences, Nanjing University, Nanjing 210093, China Page 2 of 13 Ji et al. PhotoniX (2024) 5:13 While the encoding space refers to the information capacity of the output images or beams through metasurfaces. So far, various DoFs of light, including incident angle [14–16], wavelength [17], polarization [18, 19], orbital angular momentum (OAM) mode [20–23] and so on [24, 25], have been explored to construct key space for opti- cal information security. The combination of multiple DoFs has been demonstrated the capability to enhance the complexity of keys [26–30]. Besides, through encoding infor- mation into optical images in the form of nano-printing or holography, encoding space has also been established and depends on the number of multiplexing channels of meta- surface [31, 32]. To further expand the key and encoding spaces, encryption algorithms and dynamic encryption schemes were aroused for high security and large capacity performance [33–38]. Nevertheless, the above two strategies usually suffer from time- consuming decryption process and the lack of pixelated real-time modulation. Featured with spatial variant polarization states and phase distributions, Poincaré beams gain a great deal of attentions in many applications [39–44], especially in optical encryption and encoding owing to versatile independent DoFs [45–49]. In the recent works, optical information was encoded into the polarization order and ellipticity of perfect hybrid- order Poincaré beams (HyOPBs) [45]. It presents a new scheme of optical encryption to enlarge the encoding space, which is distinguished from conventional nanoprinting or holography encryption. However, such Poincaré beams encryption strategy has con- straints due to limited key space (with only one incident state in essence) and stays a low security level. With the advantages of sub-wavelength modulation capability and inherent ultra-thin size, metasurface also allows spatial multiplexing frameworks such as arrayed metasurface [45] and cascaded metasurfaces [25, 50–52]. Therefore, the combi- nation of cascaded and arrayed metasurfaces boasts great potentials for enhancement of key and encoding spaces towards high-security and large-capacity features. In this work, we propose a high-security and large-capacity optical encryption strategy based on multi-channel perfect high-dimensional Poincaré beams (HDPBs) generated by cascaded metasurfaces. Benefiting from the infinite modes of HDPBs and the scal- ability of arrayed metasurface, both key space and encoding space have been considera- bly expanded. Accordingly, by cascading two arrayed metasurfaces composed of 16 × 10 cells, an optical encryption platform is implemented by encoding information into five independent parameters of HDPBs. Our work provides a promising solution to exten- sively enlarge the key and encoding spaces and may open an avenue towards advanced optical encryption systems. Results Concept and principle of high‑dimensional Poincaré beams encryption Figure 1 schematically illustrates the HDPBs optical encryption scheme using cas- caded metasurfaces, which is capable of generating multi-channel HDPBs with diverse DoFs to encode optical information. In principle, HyOPBs can be described as a linear superposition of right-handed circular polarized (RCP) and left-handed circular polarized (LCP) bases with different topological charges [39]. Here, we gen- eralize a more complex vector vortex beam superposed by two HyOPBs as HDPBs, which can be represented by high-dimensional Poincaré sphere indicated by the magenta or blue sphere in Fig.  1. Taking the blue sphere for instance, the north Page 11 of 13 Ji et al. PhotoniX (2024) 5:13 Then, an electron beam resist (PMMA-A4) with the thickness of 200 nm was spin- coated on top of the ­SiNx layer. The patterns of chiral meta-atoms were subsequently defined on PMMA resist by Electron-beam lithography (EBL) system (ELS-F125, Eli- onix). After development, the generated pattern was transferring to an electron beam evaporated chromium layer, which served as a hard mask for the following dry etch- ing process of ­SiNx layer in a mixture of ­CHF3 and ­SF6 plasma (Oxford Instruments, PlasmaPro100 Cobra300). At last, the remaining chromium mask was removed by a solution of ammonium cerium nitrate. Optical characterization A 470 nm laser was utilized for optical measurement and focused onto the fabricated metasurfaces through an objective (20×, NA = 0.40). The polarization states of the inci- dent light were controlled by the combination of linear polarizer and quarter-wave plate. After illuminating the metasurface/cascaded metasurface, the transmitted light was sub- sequently collected by an objective (20×, NA = 0.40) and analyzed by polarizers. Sub- sequently, the intensity profiles of the generated Poincaré beams were recorded using a CMOS camera. The alignment of two cascaded metasurfaces is detailed in Supplemen- tary Note 5. Abbreviations DOFs Degrees of freedom HDPBs High-dimensional Poincaré beams OAM Orbital angular momentum HyOPBs Hybrid-order Poincaré beams RCP Right-handed circular polarized LCP Left-handed circular polarized H-polarized Horizontal linearly polarized V-polarized Vertical linearly polarized FDTD Finite-difference time domain PML Perfectly matched layer PECVD Plasma-enhanced chemical vapor deposition EBL Electron-beam lithography Supplementary Information The online version contains supplementary material available at https://​doi.​org/​10.​1186/​s43074-​024-​00125-8. Supplementary Material 1.  Acknowledgements Not applicable. Authors’ contributions C.C., J.J. and T.L. conceived the concept. C.C. and J.J. proposed the metasurface design and performed the numeri- cal simulations; J.S. and J.L. fabricated the samples with the help of C.H. and K.Q.; J.J. and C.C. performed the optical measurements with the help of X.Y. and J.W.; J.J., C.C., Z.W., W.S., T.L. and S.Z. discussed the results; J.J., and C.C. wrote the manuscript with the help of Z.W. and W.S.; T.L. supervised the project. Funding The authors acknowledge the funding provided by National Key Research and Development Program of China (2022YFA1404301), National Natural Science Foundation of China (Nos. 62325504, 62305149, 92250304, 62288101), and Dengfeng Project B of Nanjing University. The authors acknowledge the micro-fabrication center of the National Labora- tory of Solid State Microstructures (NLSSM) for technique support. Availability of data and materials The source data are available from the corresponding author upon reasonable request. All data needed to evaluate the conclusion are present in the manuscript and/or the Supplementary Information. Page 12 of 13 Ji et al. PhotoniX (2024) 5:13 Declarations Ethics approval and consent to participate Not applicable. Consent for publication All authors agreed to publish this paper. Competing interests The authors declare no conflicts of interest. Received: 17 January 2024 Revised: 6 March 2024 Accepted: 11 March 2024 References 1. Matoba O, Nomura T, Perez-Cabre E, Millan MS, Javidi B. Optical techniques for information security. Proc IEEE. 2009;97(6):1128–48. 2. Chen W, Javidi B, Chen X. Advances in optical security systems. Adv Opt Photonics. 2014;6(2):120–55. 3. Liu S, Guo C, Sheridan JT. A review of optical image encryption techniques. Opt Laser Technol. 2014;57:327–42. 4. Jiao S, Zhou C, Shi Y, Zou W, Li X. Review on optical image hiding and watermarking techniques. Opt Laser Technol. 2019;109:370–80. 5. Liu S, Liu X, Yuan J, Bao J. Multidimensional information encryption and storage: when the input is light. Res (Wash D C). 2021;2021:7897849. 6. Yu NF, Genevet P, Kats MA, Aieta F, Tetienne JP, Capasso F, et al. Light propagation with phase discontinuities: gener- alized laws of reflection and refraction. Science. 2011;334(6054):333–7. 7. Yu N, Capasso F. Flat optics with designer metasurfaces. Nat Mater. 2014;13(2):139–50. 8. Zhao R, Huang L, Wang Y. Recent advances in multi-dimensional metasurfaces holographic technologies. PhotoniX. 2020;1(1):20. 9. Deng Z-L, Wang Z-Q, Li F-J, Hu M-X, Li X. Multi-freedom metasurface empowered vectorial holography. Nanopho- tonics. 2022;11(9):1725–39. 10. Li T, Chen C, Xiao X, Chen J, Hu S, Zhu S. Revolutionary meta-imaging: from superlens to metalens. Photonics Insights. 2023;2(1):R01. 11. Yang H, Ou K, Wan H, Hu Y, Wei Z, Jia H, et al. Metasurface-empowered optical cryptography. Mater Today. 2023;67:424–45. 12. Jung C, Kim G, Jeong M, Jang J, Dong Z, Badloe T, et al. Metasurface-driven optically variable devices. Chem Rev. 2021;121(21):13013–50. 13. So S, Mun J, Park J, Rho J. Revisiting the design strategies for metasurfaces: fundamental physics, optimization, and beyond. Adv Mater. 2023;35(43):2206399. 14. Kamali SM, Arbabi E, Arbabi A, Horie Y, Faraji-Dana M, Faraon A. Angle-multiplexed metasurfaces: encoding inde- pendent wavefronts in a single metasurface under different illumination angles. Phys Rev X. 2017;7(4):041056. 15. Wan S, Wan C, Dai C, Li Z, Tang J, Zheng G, et al. Angular-multiplexing metasurface: building up independent- encoded amplitude/phase dictionary for angular illumination. Adv Opt Mater. 2021;9(22):2101547. 16. Wan S, Tang J, Wan C, Li Z, Li Z. Angular-encrypted quad-fold display of nanoprinting and meta-holography for opti- cal information storage. Adv Opt Mater. 2022;10(11):2102820. 17. Lim KTP, Liu H, Liu Y, Yang JKW. Holographic colour prints for enhanced optical security by combined phase and amplitude control. Nat Commun. 2019;10(1):25. 18. Yue F, Zhang C, Zang XF, Wen D, Gerardot BD, Zhang S, et al. High-resolution grayscale image hidden in a laser beam. Light Sci Appl. 2018;7:17129. 19. Yang H, Jiang Y, Hu Y, Ou K, Duan H. Noninterleaved metasurface for full-polarization three-dimensional vectorial holography. Laser Photonics Rev. 2022;16(11):2200351. 20. Zhou H, Sain B, Wang Y, Schlickriede C, Zhao R, Zhang X, et al. Polarization-encrypted orbital angular momentum multiplexed metasurface holography. ACS Nano. 2020;14(5):5553–9. 21. Ren H, Fang X, Jang J, Burger J, Rho J, Maier SA. Complex-amplitude metasurface-based orbital angular momentum holography in momentum space. Nat Nanotechnol. 2020;15(11):948–55. 22. Jin L, Huang Y-W, Jin Z, Devlin RC, Dong Z, Mei S, et al. Dielectric multi-momentum meta-transformer in the visible. Nat Commun. 2019;10(1):4789. 23. Ren H, Briere G, Fang X, Ni P, Sawant R, Héron S, et al. Metasurface orbital angular momentum holography. Nat Com- mun. 2019;10(1):2986. 24. Qu G, Yang W, Song Q, Liu Y, Qiu CW, Han J, et al. Reprogrammable meta-hologram for optical encryption. Nat Com- mun. 2020;11(1):5484. 25. Georgi P, Wei QS, Sain B, Schlickriede C, Wang YT, Huang LL, et al. Optical secret sharing with cascaded metasurface holography. Sci Adv. 2021;7(16):eabf9718. 26. Luo X, Hu Y, Li X, Jiang Y, Wang Y, Dai P, et al. Integrated metasurfaces with microprints and helicity-multiplexed holograms for real-time optical encryption. Adv Opt Mater. 2020;8(8):1902020. 27. Kim J, Jeon D, Seong J, Badloe T, Jeon N, Kim G, et al. Photonic encryption platform via dual-band vectorial meta- holograms in the ultraviolet and visible. ACS Nano. 2022;16(3):3546–53. 28. Guo X, Zhong J, Li B, Qi S, Li Y, Li P, et al. Full-color holographic display and encryption with full-polarization degree of freedom. Adv Mater. 2022;34(3):e2103192. Page 13 of 13 Ji et al. PhotoniX (2024) 5:13 29. Li J, Guan Z, Liu HC, He Z, Li Z, Yu S, et al. Metasurface-assisted indirect-observation cryptographic system. Laser Photonics Rev. 2022;17(1):2200342. 30. Yang H, He P, Ou K, Hu Y, Jiang Y, Ou X, et al. Angular momentum holography via a minimalist metasurface for opti- cal nested encryption. Light Sci Appl. 2023;12(1):79. 31. Jin L, Dong Z, Mei S, Yu YF, Wei Z, Pan Z, et al. Noninterleaved Metasurface for (2(6)-1) Spin- and Wavelength- Encoded Holograms. Nano Lett. 2018;18(12):8016–24. 32. Bao Y, Yu Y, Xu H, Lin Q, Wang Y, Li J, et al. Coherent pixel design of metasurfaces for multidimensional optical control of multiple printing-image switching and encoding. Adv Funct Mater. 2018;28(51):1805306. 33 Zheng PX, Dai Q, Li ZL, Ye ZY, Xiong J, Liu HC, et al. Metasurface-based key for computational imaging encryption. Sci Adv. 2021;7(21):eabg0363. 34. Guo X, Li P, Zhong J, Wen D, Wei B, Liu S, et al. Stokes meta-hologram toward optical cryptography. Nat Commun. 2022;13(1):6687. 35. Kim I, Jang J, Kim G, Lee J, Badloe T, Mun J, et al. Pixelated bifunctional metasurface-driven dynamic vectorial holo- graphic color prints for photonic security platform. Nat Commun. 2021;12(1):3614. 36. Xiong B, Xu Y, Wang J, Li L, Deng L, Cheng F, et al. Realizing colorful holographic mimicry by metasurfaces. Adv Mater. 2021;33(21):e2005864. 37. Hu Y, Ou X, Zeng T, Lai J, Zhang J, Li X, et al. Electrically tunable multifunctional polarization-dependent metasur- faces integrated with liquid crystals in the visible Region. Nano Lett. 2021;21(11):4554–62. 38. Gao H, Fan X, Xiong W, Hong M. Recent advances in optical dynamic meta-holography. Opto-Electronic Adv. 2021;4(11):210030. 39. Yi X, Liu Y, Ling X, Zhou X, Ke Y, Luo H, et al. Hybrid-order Poincaré sphere. Phys Rev A. 2015;91(2):023801. 40. Rosales-Guzmán C, Ndagano B, Forbes A. A review of complex vector light fields and their applications. J Opt. 2018;20(12):123001. 41. Bao Y, Ni J, Qiu CW. A minimalist single-layer metasurface for arbitrary and full control of vector vortex beams. Adv Mater. 2020;32(6):e1905659. 42. Jiang ZH, Kang L, Yue T, Xu HX, Yang Y, Jin Z, et al. A Single noninterleaved metasurface for high-capacity and flexible mode multiplexing of higher-order poincare sphere beams. Adv Mater. 2020;32(6):e1903983. 43. Chen Y, Xia KY, Shen WG, Gao J, Yan ZQ, Jiao ZQ, et al. Vector vortex beam emitter embedded in a photonic chip. Phys Rev Lett. 2020;124(15):153601. 44. Yang Y, Ren Y-X, Chen M, Arita Y, Rosales-Guzmán C. Optical trapping with structured light: a review. Adv Photonics. 2021;3(03):034001. 45. Liu M, Huo P, Zhu W, Zhang C, Zhang S, Song M, et al. Broadband generation of perfect Poincare beams via dielec- tric spin-multiplexed metasurface. Nat Commun. 2021;12(1):2230. 46. Dong Z, Chen Y, Wang F, Cai Y, Friberg AT, Setälä T. Encoding higher-order polarization states into robust partially coherent optical beams. Phy Rev Appl. 2022;18(3):034036. 47. Deng L, Jin R, Xu Y, Liu Y. Structured light generation using angle-multiplexed metasurfaces. Adv Opt Mater. 2023;11(16):2300299. 48. Li H, Zheng C, Liu J, Xu H, Song C, Yang F, et al. Binary encoding-inspired generation of vector vortex beams. Sci China Phys Mech Astron. 2023;66(5):254212. 49. Wang S, Wen S, Deng ZL, Li X, Yang Y. Metasurface-based solid poincare sphere polarizer. Phys Rev Lett. 2023;130(12):123801. 50. Jang J, Badloe T, Rho J. Unlocking the future of optical security with metasurfaces. Light Sci Appl. 2021;10(1):144. 51. Cai X, Tang R, Zhou H, Li Q, Ma S, Wang D, et al. Dynamically controlling terahertz wavefronts with cascaded metas- urfaces. Adv Photonics. 2021;3(03):036003. 52. Mei F, Qu G, Sha X, Han J, Yu M, Li H, et al. Cascaded metasurfaces for high-purity vortex generation. Nat Commun. 2023;14(1):6410. 53. Chen C, Gao SL, Song WG, Li HM, Zhu SN, Li T. Metasurfaces with planar chiral meta-atoms for spin light manipula- tion. Nano Lett. 2021;21(4):1815–21. 54. Chen C, Ye X, Sun JC, Chen YX, Huang CY, Xiao XJ, et al. Bifacial-metasurface-enabled pancake metalens with polar- ized space folding. Optica. 2022;9(12):1314–22. Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Title: High-dimensional Poincaré beams generated through cascaded metasurfaces for high-security optical encryption ​ Authors: Jitao Ji, Chen Chen, Jiacheng Sun, Xin Ye, Zhizhang Wang, Jian Li, Junyi Wang, Wange Song, Chunyu Huang, Kai Qiu, Shining Zhu, Tao Li ​ Publisher: Springer Nature ​ Date: 17 April 2024 ​ Abstract: Optical encryption plays an increasingly important role in the field of information security owing to its parallel processing capability and low power consumption. ​ Employing the ultrathin metasurfaces in optical encryption has promoted the miniaturization and multifunctionality of encryption systems. ​ Nevertheless, with the few number of degrees of freedom (DoFs) multiplexed by single metasurface, both key space and encoding space are limited. ​ To address this issue, we propose a high-security and large-capacity optical encryption scheme based on perfect high-dimensional Poincaré beams with expanded DoFs. ​ By cascading two arrayed metasurfaces, more beam properties can be independently engineered, which gives rise to the extensively expanded key and encoding spaces. ​ Our work provides a promising strategy for optical encryption with high security level and large information capacity and might facilitate the applications of Poincaré beams in optical communications and quantum information. ​

Inhibition of cancer cell proliferation by 5-fluoro-2'-deoxycytidine, a DNA methylation inhibitor, through activation of DNA damage response pathway.pdf

RESEARCH Open Access Inhibition of cancer cell proliferation by 5-fluoro-2'-deoxycytidine, a DNA methylation inhibitor, through activation of DNA damage response pathway Quanyi Zhao, Jiadong Fan, Wei Hong, Lianyun Li* and Min Wu* Abstract Multiple epigenetic changes, including alterations in DNA methylation occur during tumorigenesis. Various inhibitors of DNA methylation have been developed to prevent proliferation of cancer cells. 5-fluoro-20- deoxycytidine (FCdR) is one such DNA methylation inhibitor, which is currently in phase II clinical trial. To investigate the molecular mechanism/s by which FCdR might mediate repression of tumor cell proliferation, we analyzed the toxicity of FCdR in various cell lines established from different sarcomas. We found HCT116, a colon cancer cell line, is much more sensitive to FCdR compared to others. FCdR treatment inhibited HCT116 cells at G2/ M check point and up-regulated expression of multiple cancer-related genes, which could be due to its inhibitory activity towards DNA methylation. Furthermore, we found that FCdR activates DNA damage response pathway. Using an inhibitor for ATM and ATR kinases activity, which are required for amplifying the DNA damage repair signal, we show that FCdR induced inhibition of HCT116 cells at G2/M is mediated through activation of DNA damage response pathway. Keywords: FCdR, DNA methylation, DNA damage response, Cell cycle, p53, Cancer Background DNA methylation is a covalent modification of methyl group on the 5C site of cytosine nucleoside (Robertson 2005; Ren et al. 2011) and is dynamically regulated by methylation and demethylation (Carey et al. 2011). High level of DNA methylation on gene promoters is asso- ciated with transcriptional repression of genes. During carcinogenesis, global levels of DNA methylation de- crease along with progression of cancer. Concomitantly, promoters of tumor suppressors gain DNA methylation, which allow cancer cells to grow unrestrained (Robertson 2005; Esteller 2008; Ellis et al. 2009). These observations have led to the development of small molecule inhibitors capable of inhibiting DNA methylation. These are thought to suppress tumorigenesis by activating the expression of tumor suppressor genes. Some of these DNA methylation inhibitors, such as Vidaza (5-azacytidine, 5-azaC) and Decitabine (5-aza-20-deoxycytidine, 5-azaCdR) have been approved by FDA for treatment of myelodysplatic syndrome (Ellis et al. 2009; Ren et al. 2011). Although many other non-nucleoside DNA methylation inhibi- tors have been synthesized, their activities in inhibit- ing DNA methylation and gene activation are relatively weaker and their potential use in clinics still needs to be investigated (Chuang et al. 2005). 5- fluoro-20-deoxycytidine (FCdR, FdCyd) is a well- known DNA methylation inhibitor discovered in early 1990’s and is currently under evaluation in clinical trials of breast cancer and other advanced solid tumors (Gowher and Jeltsch 2004; Ellis et al. 2009; Ren et al. 2011). Like Vidaza and Decitabine, FCdR is a pyrimidine analogue and can integrate into chromatin, and inhibit DNA methylation (Ellis et al. 2009). Fluorine occupies the 5C site of cytidine, which prevents the modification by methyl group (Ren et al. 2011). Additionally, it was demonstrated that FCdR is capable of binding and * Correspondence: [email protected]; [email protected] Hubei Clinical Centre & Key Laboratory of Intestinal and Colorectal Diseases, and College of Life Sciences, Wuhan University, Wuhan, Hubei 430072, China a SpringerOpen Journal © 2012 Zhao et al.; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Zhao et al. SpringerPlus 2012, 1:65 http://www.springerplus.com/content/1/1/65 trapping DNA methyltransferases, and thus can prevent further DNA methylation (Jones and Taylor 1980; Reither et al. 2003). FCdR was found to be not stable in multiple clinical studies (Beumer et al. 2006), but when combined with other drugs, such as tetrahydrouridine (THU) and dihydro-5-azacytidine (DHAC), FCdR showed increased stability and improved activity (Beumer et al. 2008; Kratzke et al. 2008). However, the molecular mech- anism of repression of tumor suppression by FCdR has not been studied in any detail. Upon treatment with DNA methylation inhibitors, tumor suppressor genes are activated, which then lead to cell cycle arrest or apoptosis. p53 is one of the best characterized tumor suppressor gene, mutated in up to 50% of cancers (Royds and Iacopetta 2006). p53 can be activated by various signals, such as irradiation or chem- ical induced DNA damage, abnormal oncogene expres- sion, microtubule inhibitors and other stress conditions (Royds and Iacopetta 2006; Kruse and Gu 2009). Upon activation, p53 is phosphorylated and dissociated from MDM2, which results in its stabilization (Wade et al. 2010). Activated p53 transcribes a number of genes to induce cell cycle arrest, apoptosis, and senescence, all of which help in suppressing tumorigenesis (Vousden and Prives 2009; Speidel 2010; Aylon and Oren 2011). Activation of DNA damage response is one of the most important mechanisms that represses tumorigen- esis (Lord and Ashworth 2012). Malignancy of tumor is frequently associated with damage to chromatin, recom- bination and translocation (Schar 2001). Upon DNA damage, H2AX is phosphorylated by ATM, ATR or DNAPK at the DNA repair sites (Bonner et al. 2008). Phosphorylated H2AX further recruits the above kinases to the damaged foci, which results in amplification of the DNA damage signal (Bonner et al. 2008). ATM and ATR then phosphorylate CHK1, CHK2 and other mole- cules involved in DNA damage response to arrest cell cycle (Kastan and Lim 2000; Cimprich and Cortez 2008). In order to investigate the molecular mechanisms of tumor repression by FCdR, we studied its effect on cell fate, gene expression and activation of signaling path- ways. We found that FCdR represses proliferation of HCT116 at IC50 between 0.025-0.05 μM. FCdR induced cell cycle arrest at G2/M phase and activated both p53 signaling and DNA damage response pathways. Our results suggest that FCdR induced G2/M arrest and sup- pression of cancer cell proliferation is mediated through FCdR’s role in activation of DNA repair pathway. Results and discussion FCdR inhibits proliferation of multiple cancer cell lines FCdR is in phase II clinical trial for treatment of breast cancer and many solid tumors. In order to test if cancer cells other than breast cancer cells are sensitive to FCdR, we chose HCT116, HEPG2, U2OS and KYSE150 cell lines representing colorectal carcinoma, hepatocellular carcinoma, osteosarcoma and oesophageal squamous cell carcinoma, respectively. We treated these cells with a series of FCdR concentrations. Surviving cells after 72 h treatment were then used to assay by MTT assay. FCdR inhibited the proliferation of all the above cell lines, but to different degrees. HCT116 cells showed less than 10% survival rate with 1 μM FCdR and IC50 was between 0.025-0.05 μM (Figure 1A). At the same 1 μM FCdR concentration, the survival rates of HEPG2, U2OS and KYSE150 cells were about 40%, 80% and 30%, respectively. The observations suggest that colorectal tumors might be more sensitive to FCdR, compared to hepatocellular carcinoma, osteosarcoma and oesophageal squamous cell carcinoma. HCT116 cells are more sensitive to FCdR than SAHA and 5-azaC Several small molecules inhibiting epigenetic processes have been developed with an ability to inhibit cancer cells. SAHA and 5-azaC are two such small molecule inhibitors that have been approved by FDA. We tested and compared the cyto-toxicity of FCdR with SAHA and 5-azaC on HCT116 cells, as well as one novel identified H3K9 methylation inhibitor BIX01294. We found that all the drugs tested repressed the proliferation of HCT116, however, their IC50 differed considerably (Figure 1B). IC50 of FCdR was lowest between 0.025- 0.05 μM, whereas for 5-azaC, BIX01294 and SAHA, it was 5 μM, 1.5 μM and 0.25 μM respectively. These find- ings suggested that HCT116 is much more sensitive to FCdR compared to SAHA and 5-azaC, which may prove to be of value in a clinical study. FCdR induces G2/M arrest in HCT116 cell Next we sought to study the effect of FCdR on cell cycle in HCT116 cells. Since drugs targeting DNA methyla- tion are known to induce cell cycle arrest or apoptosis, we first performed cell cycle analysis by PI (Propidium Iodide) staining and analyzed cells with flow cytometry. Cells treated with 0.05 μM FCdR for 48 h showed upto 24% of cells in G2/M phase (Figure 2A), whereas treat- ment with 0.5 μM FCdR increased the percentage of cells in the G2M phase to 75% (Figure 2A). These results suggest that FCdR induces G2/M arrest in HCT116. To further substantiate our conclusion, we analysed the ex- pression of cyclins by western blot (Figure 2B). Treat- ment with 0.5 μM FCdR for 48 h, resulted in significant increase in the total levels of cyclin B1. Persistent cell cycle arrest leads to induction of apop- tosis. However, HCT116 cells treated with FCdR at con- centrations of up to 0.5 μM for 48 h, did not show any obvious apoptotic phenotype as observed by light Zhao et al. SpringerPlus 2012, 1:65 Page 2 of 11 http://www.springerplus.com/content/1/1/65 phosphorylated H2AX, ATM and CHK1, whereas SAHA treatment did not show a significant increase (Figure 5E). This indicated that at least two DNA methy- lation inhibitors, FCdR and 50azaC, are able to activate DNA damage pathway at the indicated concentration. To confirm if DNA damage response is the primary reason for FCdR induced cell cycle arrest, we investi- gated if addition of a small molecule LY294002, an in- hibitor of DNA damage response can suppress the activation of FCdR mediated DNA damage response pathway. LY294002 inhibits the activity of multiple PI3K kinases, including ATM and ATR, the two key kinases involved in DNA damage response. Various combina- tions of different concentrations of FCdR and LY294002 were tested.We found that at concentrations higher than 50 μM, LY294002 inhibits phosphorylation of ATM and CHK1 induced by 0.1 μM FCdR (Figure 5F). We per- formed cell cycle analysis on cells treated with both FCdR and LY294002, and compared with cells treated only with FCdR. We found that G2/M arrest observed in cells treated with 0.1 μM FCdR was completely abol- ished in cells treated additionally with DNA damage response inhibitor LY294002 (Figure 5G). This observa- tion suggests that FCdR induced G2/M arrest is mediated through activation of DNA damage response pathway. Conclusions The inhibitors of DNA methylation and histone deacety- lation have shown similar curative effects and reduced toxicity, compared to traditional chemotherapy drugs in treatment of cancers. To speed up their use in cancer treatment, it is critical to elucidate the cellular response and molecular mechanisms of these drugs. FCdR is a promising drug in clinical trial. However, we know little about the kinds of tumors which are sensitive to FCdR and the molecular mechanisms of FCdR mediated sup- pression of tumorigenesis. We found that HCT116, a colon cancer cell line, was extremely sensitive to FCdR, which suggested that FCdR might be effective in treat- ment of certain types of colon cancer. FCdR inhibits HCT116 proliferation by arresting cell cycle at G2/M phase, without activating the apoptotic pathway. By glo- bal gene expression profiling we found that p53 signaling is activated upon FCdR treatment. Interest- ingly, FCdR induced cell cycle arrest was not dependent on the activation of p53 pathway. Many chemotherapy drugs induce death in cancer cells through p53 activa- tion; however, since p53 is mutated in more than 50% cancers, the curative effects of chemotherapy drugs vary among patients. FCdR might be useful in treating tumors with mutation in p53 gene. Our results show that FCdR treatment causes global changes in gene expression in HCT116 cells, which may help us better understand the molecular mechanisms of FCdR-induced cellular responses. Not only had we observed up regulation of tumor suppressor genes, such as p21 and PUMA, we also observed increase of HRAS and CMYC, two well known oncogene. It will be import- ant to evaluate their roles in FCdR-induced response. Compared with 5-Fu, FCdR caused less genes to express differentially but a higher percentage of upregulated genes. The ability of FCdR to inhibit DNA methylation may explain the observation that most altered genes were upregulated in FCdR treated cells. FCdR also activated DNA damage response pathway, possibly due to its ability to incorporate into chromatin. Since, an inhibitor of ATM/ATR kinases, LY294002, can rescue the cell cycle arrest induced by FCdR, it sug- gested the activation of ATM/ATR pathways is respon- sible for the observed cell cycle arrest. It is likely that FCdR inhibits cell growth primarily by activating the DNA damage response pathway. The activation of p53 is an important consequence of DNA damage response. FCdR induced cell cycle arrest is not dependent on p53 activation, which suggests other molecules downstream of DNA damage pathway might be responsible. Another inhibitor of DNA methylation, 5-azaC also induced DNA damage response, but not SAHA, an inhibitor of histone deacetylation. It will be interesting to investigate if DNA damage response is a common mechanism involved in growth inhibition caused by DNA methyla- tion inhibitors. Materials and methods Cell lines, antibodies and reagents FCdR, 5-azaC, 5-azaCdR and BIX01294 were purchased from Sigma. SAHA (Vorinostat) was purchased from (See figure on previous page.) Figure 5 DNA damage response is responsible for FCdR-induced cell cycle arrest. A. Cells were treated with indicated amount of chemicals for 12 h and damaged DNA was detected by alkaline comet assay. B. Olive tail moment in the previous assay was calculated according to manufacturer’s method and the statistic results were shown. C. HCT116 p53+/+ and p53−/−cells were treated with FCdR. Markers for DNA damage response (pH2AX, pATM and pCHK1) and cell cycle (Cyclin B1, Cyclin D1 and Cyclin E1) were analyzed by western blot. Histone H3 and β-ACTIN were used as loading controls. D. HCT116 p53+/+ and p53−/−cells were treated with FCdR for 8 h and immunofluorescence staining was performed to show FCdR induced H2AX phosphorylation in both cell lines. E. Three drugs were used to treat HCT116 for 8 h and DNA damage responses were investigated by western blotting. FCdR and 5-azaC were able to induce phosphorylation of H2AX, ATM and CHK1, but not SAHA. H3 was used as control. F. The inhibitory effect of LY294002 to FCdR induced DNA damage response was assayed. G. Addition of 50 μM LY294002 restored the G2/M arrest induced by 0.1 μM FCdR. (* p value < 0.05). Zhao et al. SpringerPlus 2012, 1:65 Page 9 of 11 http://www.springerplus.com/content/1/1/65 Cayman. HCT116 and U2OS cells were purchased from ATCC. KYSE150 was purchased from Cell Bank of Chinese Academy of Medical Science. HepG2 was a gift from Dr. Jianguo Wu (Wuhan University). HCT116 p53−/−cell was a gift from Dr. Pengfei Wang of Stowers Institute for Medical Research. The antibodies against Cyclin B1 (Epitomics), Cyclin D1 (Epitomics), Cyclin E1 (Epitomics), p-H2AX (Epitomics), p-ATM (Epitomics), p-CHK1 (Epitomics), β-ACTIN (CWBIO), CASP (Cell Signaling) and H3 (Abcam), were purchased from indicated companies. Rabbit anti-PARP was a gift from Dr. Xiaodong Zhang (Wuhan University). Rabbit anti- p53 was raised in our lab against purified full length pro- tein. The PCR primers are given in Additional file 3: Table S3. MTT assay Cells were split at 1×103 cells per well in 96-well plate. After 24 h cells were treated with drugs and cultured for 72 h. 25 μg MTT was then added to each well and cells incubated for 4 h at 37°C. The medium with the forma- zan sediment was dissolved in 50% DMF and 30% SDS (pH4.7). The absorption was read at 570nM. P value was calculated by t test. Cell cycle assay Cells were split at 2-3×105cells per well in 6-well plates. After 12-14 h cells were treated with drugs and cultured for 48 h. Cells were harvested by 0.05% Trypsin-EDTA digestion and centrifuged after PBS wash. Cells were fixed overnight with 70% ethanol. Flow cytometry ana- lysis was performed after PI staining (50ug/mL) and RNase digestion (100ug/mL) at 37°C for 30 min. Western blot Approximately 2 × 106 Cells were lyzed in 200ul 1×SDS loading buffer () and boiled at 95°C for 10 min. 5-10 μl sample was loaded to SDS PAGE gel for each lane and the separated proteins were transferred to nitrocellular membrane. The membrane was blocked in 5% milk and hybridized with indicated first antibody over night and second antibody for 1 h before developing. Immuno-fluorescence staining Cells were cultured on cover slips, washed twice with PBS and then fixed with chilled methanol. Cells were then washed three times with PBS and blocked in PBS with 1% BSA for 10 min. Cells were incubated with pri- mary and secondary antibodies for one hour, respect- ively. Samples were mounted with prolong anti-fade kit (Invitrogen) and observed on a fluorescent microscope. Reverse transcription and quantitative PCR Cells were scraped and collected by centrifugation. Total RNA was extracted with RNA extraction kit (Yuanpinghao) according to manufacturer’s protocol. Approximately 1ug of total RNA was used for reverse transcription with a first strand cDNA synthesis kit (Toyobo). The amount of mRNA was assayed by quantitative PCR. β-actin was used to normalize the amount of each sample. Assays were repeated at least three times. Data shown were average values ± SD of one representative experiment. P value was calculated by t test. Alkaline comet assay OxiSelect Comet assay kit was purchased from Cell Bio- labs and comet assay was performed according to the manufacturer’s protocol. Briefly, cells were split at 2- 3×105 cells per well in 6-well plate and cultured for 12 h. Drugs were added to the medium and cells were treated for indicated time. Individual cells are mixed with molten agarose and then treated with lysis buffer and alkaline solution. Following electrophoresis, the samples were dried and stained with a DNA dye, then observed with fluorescent microscope. The tail length of each cell was measured manually and the tail DNA per- centage was quantified by using Quantity One software (Bio-rad). Then the Olive tail moment was calculated according to the following formula: Tail DNA% X Tail moment length, as suggested by provided manual. Data shown were average values ± SD. P value was calculated by t test. Next generation sequencing and data analysis The cells were treated with desired drugs for 24 h before collection. Total RNA was extracted and reverse tran- scribed. Then the cDNA were analyzed by BGI. To study the relationship of the differential expressed genes, the values of selected genes were submitted for cluster ana- lysis by using Cluster3.0 and the heatmap was presented by Java Treeview. Additional files Additional file 1: Table S1. Differential Expressed Genes between FCdR-treated and Control Cells. Additional file 2: Table S2. Differential Expressed Genes between 5-Fu- treated and control cells. Additional file 3: Table S3. Information of primers used in the study. Competing interests The authors declare that they have no competing interests. Authors’ contributions QZ performed most of the experiments. JF helped in some of the fluorescence staining experiments. WH helped in some of the MTT assays. MW and LL directed the project. MW wrote the manuscript. All authors read and approved the final manuscript. Zhao et al. SpringerPlus 2012, 1:65 Page 10 of 11 http://www.springerplus.com/content/1/1/65 Acknowledgement We thank Dr. Man Mohan in Stowers Institute for Medical Research for editing the manuscript. This work was supported by grants from the National Basic Research Program of China (973 Program, 2011CB504206, 2012CB518700), the National Natural Science Foundation of China to Min Wu (30971502 and 91019013) and Lianyun Li (30971501, 31200653 and 30921001), Program for New Century Excellent Talents in University to Min Wu (NCET-11-0410). Received: 25 July 2012 Accepted: 27 November 2012 Published: 13 December 2012 References Aylon Y, Oren M (2011) New plays in the p53 theater. Curr Opin Genet Dev 21:86–92 Beumer JH, Eiseman JL, Parise RA, Joseph E, Holleran JL, Covey JM, Egorin MJ (2006) Pharmacokinetics, metabolism, and oral bioavailability of the DNA methyltransferase inhibitor 5-fluoro-2'-deoxycytidine in mice. Clin Cancer Res 12:7483–7491 Beumer JH, Parise RA, Newman EM, Doroshow JH, Synold TW, Lenz HJ, Egorin MJ (2008) Concentrations of the DNA methyltransferase inhibitor 5-fluoro-2'-deoxycytidine (FdCyd) and its cytotoxic metabolites in plasma of patients treated with FdCyd and tetrahydrouridine (THU). Cancer Chemother Pharmacol 62:363–368 Bonner WM, Redon CE, Dickey JS, Nakamura AJ, Sedelnikova OA, Solier S, Pommier Y (2008) GammaH2AX and cancer. Nat Rev Cancer 8:957–967 Carey N, Marques CJ, Reik W (2011) DNA demethylases: a new epigenetic frontier in drug discovery. Drug Discov Today 16:683–690 Chuang JC, Yoo CB, Kwan JM, Li TW, Liang G, Yang AS, Jones PA (2005) Comparison of biological effects of non-nucleoside DNA methylation inhibitors versus 5-aza-2'-deoxycytidine. Mol Cancer Ther 4:1515–1520 Cimprich KA, Cortez D (2008) ATR: an essential regulator of genome integrity. Nat Rev Mol Cell Biol 9:616–627 Ellis L, Atadja PW, Johnstone RW (2009) Epigenetics in cancer: targeting chromatin modifications. Mol Cancer Ther 8:1409–1420 Esteller M (2008) Epigenetics in cancer. N Engl J Med 358:1148–1159 Gowher H, Jeltsch A (2004) Mechanism of inhibition of DNA methyltransferases by cytidine analogs in cancer therapy. Cancer Biol Ther 3:1062–1068 Jones PA, Taylor SM (1980) Cellular differentiation, cytidine analogs and DNA methylation. Cell 20:85–93 Kastan MB, Lim DS (2000) The many substrates and functions of ATM. Nat Rev Mol Cell Biol 1:179–186 Kratzke RA, Wang X, Wong L, Kratzke MG, Green MR, Vokes EE, Vogelzang NJ, Kindler HL, Kern JA (2008) Response to the methylation inhibitor dihydro-5-azacytidine in mesothelioma is not associated with methylation of p16INK4a: results of cancer and leukemia group B 159904. J Thorac Oncol 3:417–421 Kruse JP, Gu W (2009) Modes of p53 regulation. Cell 137:609–622 Lord CJ, Ashworth A (2012) The DNA damage response and cancer therapy. Nature 481:287–294 Reither S, Li F, Gowher H, Jeltsch A (2003) Catalytic mechanism of DNA-(cytosine-C5)-methyltransferases revisited: covalent intermediate formation is not essential for methyl group transfer by the murine Dnmt3a enzyme. J Mol Biol 329:675–684 Ren J, Singh BN, Huang Q, Li Z, Gao Y, Mishra P, Hwa YL, Li J, Dowdy SC, Jiang SW (2011) DNA hypermethylation as a chemotherapy target. Cell Signal 23:1082–1093 Robertson KD (2005) DNA methylation and human disease. Nat Rev Genet 6:597–610 Royds JA, Iacopetta B (2006) p53 and disease: when the guardian angel fails. Cell Death Differ 13:1017–1026 Schar P (2001) Spontaneous DNA damage, genome instability, and cancer–when DNA replication escapes control. Cell 104:329–332 Speidel D (2010) Transcription-independent p53 apoptosis: an alternative route to death. Trends Cell Biol 20:14–24 Vousden KH, Prives C (2009) Blinded by the light: the growing complexity of p53. Cell 137:413–431 Wade M, Wang YV, Wahl GM (2010) The p53 orchestra: Mdm2 and Mdmx set the tone. Trends Cell Biol 20:299–309 doi:10.1186/2193-1801-1-65 Cite this article as: Zhao et al.: Inhibition of cancer cell proliferation by 5-fluoro-2'-deoxycytidine, a DNA methylation inhibitor, through activation of DNA damage response pathway. SpringerPlus 2012 1:65. Submit your manuscript to a journal and benefi t from: 7 Convenient online submission 7 Rigorous peer review 7 Immediate publication on acceptance 7 Open access: articles freely available online 7 High visibility within the fi eld 7 Retaining the copyright to your article Submit your next manuscript at 7 springeropen.com Zhao et al. SpringerPlus 2012, 1:65 Page 11 of 11 http://www.springerplus.com/content/1/1/65

Title: Inhibition of cancer cell proliferation by 5-fluoro-2'-deoxycytidine, a DNA methylation inhibitor, through activation of DNA damage response pathway ​ Authors: Quanyi Zhao, Jiadong Fan, Wei Hong, Lianyun Li, Min Wu ​ Publisher: SpringerPlus Date: December 13, 2012 ​ Abstract: Multiple epigenetic changes, including alterations in DNA methylation, occur during tumorigenesis. ​ Various inhibitors of DNA methylation have been developed to prevent the proliferation of cancer cells. ​ 5-fluoro-2'-deoxycytidine (FCdR) is one such DNA methylation inhibitor, which is currently in phase II clinical trial. ​ To investigate the molecular mechanisms by which FCdR might mediate repression of tumor cell proliferation, we analyzed the toxicity of FCdR in various cell lines established from different sarcomas. ​ We found HCT116, a colon cancer cell line, is much more sensitive to FCdR compared to others. ​ FCdR treatment inhibited HCT116 cells at the G2/M checkpoint and up-regulated the expression of multiple cancer-related genes, which could be due to its inhibitory activity towards DNA methylation. ​ Furthermore, we found that FCdR activates the DNA damage response pathway. ​ Using an inhibitor for ATM and ATR kinases activity, which are required for amplifying the DNA damage repair signal, we show that FCdR-induced inhibition of HCT116 cells at G2/M is mediated through activation of the DNA damage response pathway. ​

Plant growth-promoting traits of biocontrol potential bacteria isolated from rice rhizosphere.pdf

RESEARCH Open Access Plant growth-promoting traits of biocontrol potential bacteria isolated from rice rhizosphere Subramaniam Gopalakrishnan1*, HD Upadhyaya1, Srinivas Vadlamudi1, Pagidi Humayun1, Meesala Sree Vidya1, Gottumukkala Alekhya1, Amit Singh2, Rajendran Vijayabharathi1, Ratna Kumari Bhimineni1, Murali Seema1, Abhishek Rathore1 and Om Rupela1 Abstract Seven isolates of bacteria (SRI-156, SRI-158, SRI-178, SRI-211, SRI-229, SRI-305 and SRI-360) were earlier reported by us as having potential for biocontrol of charcoal rot of sorghum and plant growth promotion (PGP) of the plant. In the present study, the seven isolates were characterized for their physiological traits (tolerance to salinity, pH, temperature and resistance to antibiotics and fungicides) and further evaluated in the field for their PGP of rice. All the seven isolates were able to grow at pH values between 5 and 13, in NaCl concentrations of up to 8% (except SRI-156 and SRI-360), temperatures between 20 and 40°C and were resistant to ampicillin (>100 ppm; except SRI-158 and SRI-178) but sensitive (<10 ppm) to chloramphenicol, kanamycin, nalidixic acid, streptomycin (except SRI-156 and SRI-211) and tetracycline. They were tolerant to fungicides benlate and captan, except SRI-158 and SRI-178, bavistin and sensitive to thiram (except SRI-156 and SRI-211) at field application level. In the field, four of the seven isolates (SRI-158, SRI-211, SRI-229 and SRI-360) significantly enhanced the tiller numbers, stover and grain yields, total dry matter, root length, volume and dry weight over the un-inoculated control. In the rhizosphere soil at harvest, all the isolates significantly enhanced microbial biomass carbon (except SRI-156), microbial biomass nitrogen and dehydrogenase activity (up to 33%, 36% and 39%, respectively) and total N, available P and% organic carbon (up to 10%, 38% and 10%, respectively) compared to the control. This investigation further confirms that the SRI isolates have PGP properties. Keywords: Biocontrol, Plant growth promotion (PGP), Rice, Field evaluation, Rhizosphere bacteria Introduction Plant growth −promoting rhizobacteria (PGPR) are the soil bacteria that colonize the roots of plants and en- hance plant growth. PGPR can directly or indirectly affect plant growth through various mechanisms. Direct stimulation may include fixation of atmospheric nitrogen (Soares et al. 2006), synthesis of various phytohormones and enzymes (Patten and Glick 2002; Penrose and Glick 2003; Cheng et al. 2007) and solubilization of minerals in plants (Basak and Biswas 2009; Panhwar et al. 2012), while indirect stimulation includes inhibiting phyto- pathogens (Hao et al. 2011). Actively growing microbes are greater in number in the rhizosphere as crop plants release root exudates that produce, in addition to simple and complex sugars and growth regulators, different classes of primary and secondary compounds including amino acids, organic acids, phenolic acids, flavonoids, fatty acids, enzymes, steroids, alkaloids and vitamins (Uren 2000). Researchers around the world attempted to isolate PGPR organisms from the rhizospheres of crop plants. Seven isolates of bacteria (SRI-156, SRI-158, SRI-178, SRI-211, SRI-229, SRI-305 and SRI-360), isolated from the rhizospheres of a system of rice intensification (SRI) fields, were earlier reported by us as having potential for biocontrol of charcoal rot of sorghum, caused by Macro- phomina phaseolina (Tassi) Goid. and plant growth pro- motion (PGP) of the plant (Gopalakrishnan et al. 2011a). Also, the selected bacterial strains produced siderophore, indole acetic acid (except SRI-305), hydrocyanic acid (except SRI-158 and SRI-305) and solubilized (except SRI-360) phosphorous (Gopalakrishnan et al. 2011a). In * Correspondence: [email protected] 1International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru 502 324, Andhra Pradesh, India Full list of author information is available at the end of the article a SpringerOpen Journal © 2012 Gopalakrishnan et al.; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Gopalakrishnan et al. SpringerPlus 2012, 1:71 http://www.springerplus.com/content/1/1/71 the SRI method of rice cultivation, certain changes are done in the agronomic practices which include the use of much younger seedlings than are normally trans- planted, planting them singly and carefully in a square pattern with wide spacing in soil that is kept moist but not continuously flooded and with increased amend- ments of organic matter and active aeration of the soil during weed control operation preferably with mechan- ical weeder (Uphoff 2003). The aim of the present study was to characterize and evaluate the PGP potential of seven SRI strains of bacteria in rice, grown under field conditions using the SRI protocols. It was also aimed to evaluate the potential of these PGP strains enhancing tolerance to salinity, pH, high temperature and resist- ance to antibiotics and fungicides. Materials and methods SRI bacterial isolates A total of seven bacteria isolated from rhizosphere of a SRI fields, SRI-156 (Pseudomonas plecoglossicida; NCBI Accession Number: JQ247008), SRI-158 (Brevibacterium antiquum; NCBI Accession Number: JQ247009), SRI- 178 (Bacillus altitudinis; NCBI Accession Number: JQ247010), SRI-211 (Enterobacter ludwigii; NCBI Acces- sion Number: JQ247011), SRI-229 (E. ludwigii; NCBI Accession Number: JQ247012), SRI-305 (Acinetobacter tandoii; NCBI Accession Number: JQ247013) and SRI- 360 (P. monteilii; NCBI Accession number: JQ247014), reported earlier by us as potential for biocontrol and PGP traits in sorghum (Gopalakrishnan et al. 2011a), were further studied in this investigation. Evaluation of SRI isolates for their physiological traits Salinity SRI isolates were streaked on Luria Bertani (LB) agar with various concentrations of NaCl ranging from 0% to 10% at the interval of 2% and incubated at 28°C for 72 h. pH The seven SRI isolates were streaked on LB agar, adjusted to pH 5, 7, 9, 11 and 13 and incubated at 28°C for three days. For pH 3, LB broth was inoculated with the seven SRI strains and at the end of 72 h incubation the intensity of growth was measured at 600 nm in a spectrophotometer. Temperature The seven SRI isolates were streaked on LB agar and incubated at 20, 30 and 40°C for 72 h. For 50°C, the LB broth was inoculated with the seven SRI strains, and at the end of 72 h incubation, the intensity of growth was measured at 600 nm in a spectrophotometer. Antibiotic resistance/susceptible pattern A total of six antibiotics viz. ampicillin, chloramphenicol, kanamycin, nalidixic acid, streptomycin and tetracycline were studied for their resistance/susceptible pattern against the seven SRI isolates. The required quantities of antibiotics were dissolved in sterilized Milli Q water and mixed into Nutrient agar just before pouring into the Petri plates (when the temperature of the media was about 50°C). Upon solidification, the SRI isolates were streaked and incubated at 28°C for 72 h. Fungicide tolerance SRI isolates were evaluated for their tolerance to fungicides at field application level. A total of four fungi- cides viz. benlate (benomyl 50%; methyl [1-[(butylamino) carbonyl]-1H-benzimidazol-2-yl] carbamate), captan (captan 50%; N-trichloromethylthio-4-cyclohexene-1, 2-dicarboximide), bavistin (carbindozim 50%; methyl benzimidazol-2-ylcarbamate) and thiram (dimethylcar- bamothioylsulfanyl N, N-dimethylcarbamodithioate) were evaluated at field application levels at 3000, 2500, 4000, 3000 and 3000 ppm concentrations, respectively. The required quantities of fungicides were dissolved in steri- lized Milli Q water and mixed into LB agar just before pouring into the Petri plates. Upon solidification, the SRI isolates were streaked and incubated at 28°C for 72 h. Responses of the seven SRI isolates to salinity, pH, temperature, antibiotics and fungicide tolerance were recorded as follows: - = no growth; + = slight growth; ++ = moderate growth and +++ = good growth. Evaluation of SRI isolates for PGP traits on rice under field conditions Study site The experiment was conducted in Kharif 2011 (wet sea- son) at ICRISAT, Patancheru, Andhra Pradesh, India (17o53”N latitude, 78o27”E longitude and 545 m altitude) with a medium duration rice variety, Sampada (135 days).. Soils at the experimental site are classified as sandy loam in texture (55% sand, 17% silt and 28% clay) with alkaline pH of 8.5 −9.0. The mineral content of the top 15 cm layer were as follows: available nitrogen 292 kg ha-1, available phosphorus 26 kg ha-1, available potassium 527 kg ha-1 and organic carbon 0.76 −1.27%. Design and treatments The experiment was laid out in a randomized complete block design (RCBD) with three replicates and 10 m × 7.5 m subplots. Rice was grown by the system of rice in- tensification (SRI) method proposed by the Central Rice Research Institute (http://crri.nic.in). The seven SRI iso- lates were grown on a LB broth at 28°C for three days and further evaluated for their PGP traits. The control contained no SRI isolates. Gopalakrishnan et al. SpringerPlus 2012, 1:71 Page 2 of 7 http://www.springerplus.com/content/1/1/71 which the SRI isolates enhanced the morphological observations could be their PGP attributes such as in- dole acetic acid (IAA), siderophore production and phosphate solubilization (Gopalakrishnan et al. 2011a). IAA −producing microorganisms are known to pro- mote root elongation and plant growth (Patten and Glick 2002), while siderophore producers act by binding Fe3+ from the environment and making it available to the plant (Wang et al. 1993). Free-living phosphate- solubilizing microbes release phosphate ions from spar- ing soluble inorganic and organic P compounds in soils and thereby contribute to an increased soil phosphate pool available for the plants (Artursson et al. 2006). The interaction between soil microorganisms and roots and their possible impacts on plant growth have been studied by Birkhofer et al. (2008) and Uphoff et al. (2009). When the soils were made wet and then dry, as in the case of the SRI method of rice cultivation, the levels of available P in the soil solution increased between 185% and 1900% as a result of population dynamics of species of phosphate-solubilizing bacteria and fungi (Turner and Haygarth 2001). Gayathry (2002) found that the counts of bacteria, such as the diazo- trophs, Azospirillum, Azotobacter and phosphobacteria Table 2 Effect of SRI isolates on the morphology and yield potential of rice cultivation No. of Stover Grain Total dry tillers yield yield matter Treatment (m-2) (g m-2) (g m-2) (g m-2) SRI-156 360 558 540 1098 SRI-158 523 685 643 1328 SRI-178 571 635 583 1218 SRI-211 470 663 595 1258 SRI-229 538 684 673 1357 SRI-305 662 605 628 1233 SRI-360 453 683 650 1333 Control 451 604 582 1186 Mean 504 640 612 1251 SE± 31.6*** 19.7** 17.5** 30.0*** LSD (5%) 91.8 59.8 53.1 90.9 CV% 14 5 5 4 SE = standard error; LSD = least significant difference; CV = coefficient of variance; * = statistically significant at 0.05; ** = statistically significant at 0.01; *** = statistically significant at 0.001. Table 3 Effect of SRI isolates on the root development of rice at harvesting stage of rice cultivation Root length (mm-2) Root volume (cm3 m-2) Root dry weight (g m-2) Treatment 0 −15 cm 15 −30 cm 0 −15 cm 15 −30 cm 0 −15 cm 15 −30 cm SRI-156 5312 996 901 152 63.9 8.2 SRI-158 4979 711 859 106 60.2 5.9 SRI-178 5230 817 839 107 59.9 6.6 SRI-211 6542 781 1183 189 82.9 8.6 SRI-229 6389 922 1120 117 89.2 6.4 SRI-305 5004 887 903 112 66.9 6.4 SRI-360 5036 800 1065 112 72.9 6.7 Control 5019 509 840 89 47.1 5.6 Mean 5413 783 953 118 68.9 6.6 SE± 164.9*** 87.1* 27.7*** 11.1** 4.7** 1.1 NS LSD (5%) 516.9 274.2 86.9 35.3 14.9 - CV% 4.6 16.9 4.4 13.9 10.4 25.1 SE = standard error; LSD = least significant difference; CV = coefficient of variation; NS = not significant; * = statistically significant at 0.05; ** = statistically significant at 0.01; *** = statistically significant at 0.001. Table 4 Effect of SRI isolates on soil biological activity at harvesting stage of rice cultivation Microbial Microbial Dehydrogenase biomass carbon biomass nitrogen activity (μg TPF g-1 Treatment (μg g-1 soil) (μg g-1 soil) soil 24 h-1) SRI-156 2625 62 115 SRI-158 2876 71 120 SRI-178 3448 67 152 SRI-211 3129 80 133 SRI-229 3050 68 142 SRI-305 3776 75 131 SRI-360 3774 74 154 Control 2845 58 111 Mean 3190 69 132 SE± 177.3** 2.2*** 8.6* LSD (5%) 567.2 7.0 26.1 CV% 10 5 11 SE = standard error; LSD = least significance difference; CV = coefficient of variance; * = statistically significant at 0.05; ** = statistically significant at 0.01; *** = statistically significant at 0.001. Gopalakrishnan et al. SpringerPlus 2012, 1:71 Page 5 of 7 http://www.springerplus.com/content/1/1/71 and microbial enzyme activity such as dehydrogenase, urease acid phosphatase, alkaline phosphatase and nitrogenase were significantly higher in SRI rhizospheres than those of the same variety of rice plants grown con- ventionally. In the present investigation, such enhanced activities were found only in the SRI isolates-inoculated treatments. Colonization of roots by SRI isolates at the right place and time is essential for enhanced PGP activity. Success- ful interactions depend on sufficient population density, rhizosphere competence, root colonizing ability and PGP ability of the bacteria (Lugtenberg and Dekkers 1999). Although roots were not inspected for colonization in this study, the data on morphological (including roots), biological and chemical studies strongly suggest that SRI isolates had multiplied and colonized the inoculated rice roots. Hence, it can be concluded that the seven SRI isolates used in this study were apparently well adapted to the rice rhizosphere environment and enhanced the plant growth. The seven isolates of SRI used in this study were apparently well adopted not only in the sorghum rhizo- sphere environment (Gopalakrishnan et al. 2011a) but also in the rice rhizosphere where they promoted plant growth. Hence, these isolates could be used as PGP agents in addition to biocontrol agents for the control of charcoal rot. The broad range of PGP and antifungal activities of the seven SRI isolates demonstrates multiple mechanisms of actions including antibiosis, production of cell wall degrading enzymes and plant growth − promoting hormones indicating its broad spectrum activity. Broad spectrum PGP and biocontrol agents (and their secondary metabolites) offer potentially effective novel strategies for controlling multiple patho- gens and insect pests. A few of the available broad spectrum agents, mostly belonging to Pseudomonas spp., have shown broad spectrum antifungal activity by virtue of volatile and diffusible antibiotics (Hass and Keel 2003; Viji et al. 2003). Bacterial strains from diverse habitats of groundnut with broad spectrum PGP and antifungal activity have been isolated, identified and tested as a seed treatment for the control of collar rot in ground- nut with or without thiram (Kishore et al. 2005). Sec- ondary metabolites of P. aeruginosa possess antifungal, PGP and biocontrol activities (Bano and Musarrat 2003). ICRISAT has identified actinomycetes (isolated from various herbal composts) and bacteria that inhibit Fusarium oxysporum f. sp. ciceri, Rhizoctonia batati- cola, M. phaseolina, Helicoverpa armigera and Spo- doptera litura (Gopalakrishnan et al. 2011b,c,d). The seven broad spectrum potential SRI isolates therefore are likely to be the potential candidates for the discovery of novel secondary metabolites which may be of import- ance for both PGP and biocontrol applications. Competing interests All the authors declare that they have no competing interests. Authors’ contributions SG, HDU, SV, PH, MSV, GA, AS, RV, RKB and MS carried out the physiological traits and field studies, AR done the statistical analysis and SG, SV and OP drafted the manuscript. All authors read and approved the final manuscript. Acknowledgements We thank the Department of Biotechnology, Ministry of Science and Technology, Government of India and the National Bureau of Agriculturally Important Microorganisms for providing financial support. We also thank all the staff of the Biocontrol Unit of ICRISAT including M/s PVS Prasad, P Manohar, B Nagappa, D Barath, A Jabbar and S Rohini for their significant inputs in the laboratory and field studies. Author details 1International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru 502 324, Andhra Pradesh, India. 2Department of Plant Breeding, CCS Haryana Agricultural University, Hisar 125 004, Haryana, India. Received: 12 October 2012 Accepted: 13 December 2012 Published: 18 December 2012 References Anderson TH, Domsch KH (1989) Ratios of microbial biomass carbon to total organic carbon in arable soils. Soil Biol Biochem 21:471–479 Artursson V, Finlay RD, Jansson JK (2006) Interactions between arbascular mycorrhizal fungi and bacteria and their potential for stimulating plant growth. Environ Microbiol 8(1):1–10 Bano N, Musarrat J (2003) Characterization of a new Pseudomonas aeruginosa strain Nj-15 as a potential biocontrol agent. Cur Microbiol 46:324–328 Basak BB, Biswas DR (2009) Influence of potassium solubilizing microorganisms (Bacillus mucilaginosus) and waste mica on potassium uptake dynamics by sudan grass (Sorghum vulgare Pers.) grown under two Alfisols. Plant Soil 317:235–255 Birkhofer K, Bezemer TM, Bloem J, Bonokowski M, Chritensen S, Dubois D, Ekelund F, Fliessbach A, Gunst L, Hedlund K, Mader P, Mikola J, Robin C, Setala H, Tatin-Froux F, Van der Putten W, Scheu S (2008) Long-term organic farming fosters below and above ground biota; implications for soil quality, biological control and productivity. Soil Biol Biochem 40:2297–2308 Table 5 Effect of SRI isolates on soil chemical activity at harvesting stage of rice cultivation Total nitrogen Available phosphorous Organic Treatment (ppm) (ppm) carbon (%) SRI-156 2015 116 1.52 SRI-158 1967 121 1.48 SRI-178 2134 117 1.57 SRI-211 1930 106 1.61 SRI-229 2027 102 1.61 SRI-305 2072 91 1.51 SRI-360 1961 88 1.56 Control 1926 87 1.47 Mean 2004 103 1.54 SE± 21.3*** 5.8* 0.027* LSD (5%) 71.2 19.3 0.090 CV% 2 8 4 SE = standard error; LSD = least significance difference; CV = coefficient of variance; * = statistically significant at 0.05; *** = statistically significant at 0.001. Gopalakrishnan et al. SpringerPlus 2012, 1:71 Page 6 of 7 http://www.springerplus.com/content/1/1/71 Brooks PC, Landman A, Pruden G, Jenkinson DS (1985) Chloroform fumigation and the release of soil nitrogen; a rapid direct extraction method to measure microbial biomass nitrogen in soil. Soil Biol Biochem 17:837–842 Casida LE (1977) Microbial metabolic activity in soil as measured by dehydrogenase determinations. Appl Environ Microbiol 34:630–636 Cheng Z, Park E, Glick BR (2007) 1-Aminocyclopropane-1-carboxylate deaminase from Pseudomonas putida UW4 facilitates the growth of canola in the presence of salt. Can J Microbiol 53:912–918 Gayathry G (2002) Studies on dynamics of soil microbes in rice rhizosphere with water saving irrigation and in-situ weed incorporation. Ph.D. Thesis submitted to Tamil Nadu Agricultural University, Coimbatore, India Gopalakrishnan S, Humayun P, Kiran BK, Kannan IGK, Vidya MS, Deepthi K, Rupela O (2011a) Evaluation of bacteria isolated from rice rhizosphere for biological control of sorghum caused by M. phaseolina. World J Microbiol Biotechnol 27:1313–1321 Gopalakrishnan S, Kiran BK, Humayun P, Vidya MS, Deepthi K, Rupela O (2011b) Biocontrol of charcoal-rot of sorghum by actinomycetes isolated from herbal vermi-compost. Afr J Biotechnol 10:18142–18152 Gopalakrishnan S, Pande S, Sharma M, Humayun P, Kiran BK, Sandeep D, Vidya MS, Deepthi K, Rupela O (2011c) Evaluation of actinomycete isolates obtained from herbal vermi-compost for biological control of Fusarium wilt of chickpea. Crop Prot 30:1070–1078 Gopalakrishnan S, Ranga Rao GV, Humayun P, Rao VR, Alekhya G, Jacob S, Deepthi K, Vidya MS, Srinivas V, Mamatha L, Rupela O (2011d) Efficacy of botanical extracts and entomopathogens on control of Helicoverpa armigera and Spodoptera litura. Afr J Biotechnol 10:16667–16673 Hao D, Gao P, Liu P, Zhao J, Wang Y, Yang W, Lu Y, Shi T, Zhang X (2011) AC3- 33, a novel secretory protein, inhibits Elk1 transcriptional activity via ERK pathway. Mol Biol Rep 38:1375–1382 Hass D, Keel C (2003) Regulation of antibiotic production in root-colonized Pseudomonas spp. and relevance for biological control of plant disease. Annu Rev Phytopathol 41:117–153 Kishore GK, Pande S, Podile AR (2005) Biological control of collar rot disease with broad spectrum antifungal bacteria associated with groundnut. Can J Microbiol 51:122–132 Lugtenberg BJJ, Dekkers LC (1999) What makes Pseudomonas bacteria rhizosphere competent? Environ Microbiol 1:9–13 Nelson DW, Sommers LE (1982) Total organic carbon and organic matter. In: Page AL, Miller RH, Keeney DR (eds) ‘Methods of soil analysis’, Part 3, Chemical and microbiological properties. Madison, WI, SSSA, pp 539–579 Novozamsky I, Houba VJG, Van ECKR, vanVark W (1983) A novel digestion technique for multiple element analysis. Commun Soil Sci Plant Anal 14:239–249 Olsen SR, Sommers LE (1982) Phosphorus’. In: Page AL (ed) Methods of soil analysis, Agron No. 9, Part 2, chemical and microbial properties, 2nd edn. Am Soc Agron, Madison, WI, USA, pp 403–430 Panhwar QA, Othman R, Rahman ZA, Meon S, Ismail MR (2012) Isolation and characterization of phosphate-solubilizing bacteria from aerobic rice. Afr J Biotechnol 11:2711–2719 Patten C, Glick CR (2002) Role of Pseudomonas putida indol acetic acid in development of host plant root system. Appl Environ Microbiol 68:3795–3801 Penrose DM, Glick BR (2003) Methods for isolating and characterizing ACC deaminase-containing plant growth-promoting rhizo-bacteria. Physiol Plantarum 118:10–15 Soares RA, Roesch LPW, Zanatta G, Camargo FAD, Passaglia LMP (2006) Occurrence and distribution of nitrogen fixing bacterial community associated with oat (Avena sativa) assessed by molecular and microbiological techniques. Appl Soil Ecol 33:221–234 Turner BL, Haygarth PM (2001) Phosphorous solublization in rewetted soils. Nature 411:258 Uren NC (2000) Types, amounts and possible functions of compounds released into the rhizosphere by soil-grown plants. In: Pinto R, Varanini Z, Nannipieri P (eds) The rhizosphere: biochemistry and organic substances at the soil-plant interface. Marcel Dekker, New York, pp 19–40 Uphoff N (2003) Higher yields with fewer external inputs? The system of rice intensification and potential contributions to agricultural sustainability. Int J Agric Sustain 1:38–50 Uphoff N, Anas I, Rupela OP, Thakur AK, Thyagarajan TM (2009) Learning about positive plant-microbial interactions from the system of rice intensification (SRI). Aspect Appl Biol 98:29–54 Viji G, Uddin W, Romaine CP (2003) Suppression of gray leaf spot (blast) of perennial ryegrass turf by Pseudomonas aeruginosa from spent mushroom substrate. Biol Control 26:379–407 Wang Y, Brown HN, Crowley DE, Szaniszlo P (1993) Evidence for direct utilization of a siderophore, ferrioxamine B, in axenically grown cucumber. Plant Cell Environ 16:579–585 doi:10.1186/2193-1801-1-71 Cite this article as: Gopalakrishnan et al.: Plant growth-promoting traits of biocontrol potential bacteria isolated from rice rhizosphere. SpringerPlus 2012 1:71. Submit your manuscript to a journal and benefi t from: 7 Convenient online submission 7 Rigorous peer review 7 Immediate publication on acceptance 7 Open access: articles freely available online 7 High visibility within the fi eld 7 Retaining the copyright to your article Submit your next manuscript at 7 springeropen.com Gopalakrishnan et al. SpringerPlus 2012, 1:71 Page 7 of 7 http://www.springerplus.com/content/1/1/71

Title: Plant growth-promoting traits of biocontrol potential bacteria isolated from rice rhizosphere ​ Authors: Subramaniam Gopalakrishnan, HD Upadhyaya, Srinivas Vadlamudi, Pagidi Humayun, Meesala Sree Vidya, Gottumukkala Alekhya, Amit Singh, Rajendran Vijayabharathi, Ratna Kumari Bhimineni, Murali Seema, Abhishek Rathore, Om Rupela Publisher: SpringerPlus Date: December 18, 2012 ​ Abstract: Seven isolates of bacteria (SRI-156, SRI-158, SRI-178, SRI-211, SRI-229, SRI-305, and SRI-360) were earlier reported by us as having potential for biocontrol of charcoal rot of sorghum and plant growth promotion (PGP) of the plant. ​ In the present study, the seven isolates were characterized for their physiological traits (tolerance to salinity, pH, temperature, and resistance to antibiotics and fungicides) and further evaluated in the field for their PGP of rice. ​ All the seven isolates were able to grow at pH values between 5 and 13, in NaCl concentrations of up to 8% (except SRI-156 and SRI-360), temperatures between 20 and 40°C, and were resistant to ampicillin (>100 ppm; except SRI-158 and SRI-178) but sensitive (<10 ppm) to chloramphenicol, kanamycin, nalidixic acid, streptomycin (except SRI-156 and SRI-211), and tetracycline. ​ They were tolerant to fungicides benlate and captan, except SRI-158 and SRI-178, bavistin, and sensitive to thiram (except SRI-156 and SRI-211) at field application level. ​ In the field, four of the seven isolates (SRI-158, SRI-211, SRI-229, and SRI-360) significantly enhanced the tiller numbers, stover and grain yields, total dry matter, root length, volume, and dry weight over the un-inoculated control. ​ In the rhizosphere soil at harvest, all the isolates significantly enhanced microbial biomass carbon (except SRI-156), microbial biomass nitrogen, and dehydrogenase activity (up to 33%, 36%, and 39%, respectively) and total N, available P, and % organic carbon (up to 10%, 38%, and 10%, respectively) compared to the control. ​ This investigation further confirms that the SRI isolates have PGP properties. ​

Decolorization and biodegradation of reactive sulfonated azo dyes by a newly isolated Brevibacterium sp. strain VN-15.pdf

RESEARCH Open Access Decolorization and biodegradation of reactive sulfonated azo dyes by a newly isolated Brevibacterium sp. strain VN-15 Elisangela Franciscon, Matthew James Grossman*, Jonas Augusto Rizzato Paschoal, Felix Guillermo Reyes Reyes and Lucia Regina Durrant Abstract Azo dyes constitute the largest and most versatile class of synthetic dyes used in the textile, pharmaceutical, food and cosmetics industries and represent major components in wastewater from these industrial dying processes. Biological decolorization of azo dyes occurs efficiently under low oxygen to anaerobic conditions. However, this process results in the formation of toxic and carcinogenic amines that are resistant to further detoxification under low oxygen conditions. Moreover, the ability to detoxify these amines under aerobic conditions is not a wide spread metabolic activity. In this study we describe the use of Brevibacterium sp. strain VN-15, isolated from an activated sludge process of a textile company, for the sequential decolorization and detoxification of the azo dyes Reactive Yellow 107 (RY107), Reactive Black 5 (RB5), Reactive Red 198 (RR198) and Direct Blue 71 (DB71). Tyrosinase activity was observed during the biotreatment process suggesting the role of this enzyme in the decolorization and degradation process, but no-activity was observed for laccase and peroxidase. Toxicity, measured using Daphnia magna, was completely eliminated. Keywords: Azo dyes, Textile wastewater, Decolorization, Biodegradation, Detoxification, Brevibacterium, Tyrosinase, Carcinogenic aromatic amine Background Azo dyes account for about one-half of all dyes pro- duced and are the most commonly used synthetic dyes in the textile, food, paper making, color paper printing, leather and cosmetic industries (Chang and Lin 2001). The textile industry accounts for two-thirds of the total dyestuff market and during the dyeing process approxi- mately 10% of the dyes used are released into the waste- water (Easton 1995). The amount of dye lost in industrial applications depends on the type of dye used and varies from 2% loss for basic dyes to about 50% loss for certain reactive sulfonated dyes when used with cellulosic fabrics due to the relatively low levels of dye fiber fixation (Shore 1995; McMullan et al. 2001; Pearce et al. 2003; Hai et al. 2007). The high color content of dye process wastewater makes the presence of these dyes obvious and inhibits photosynthetic aquatic plants and algae by absorption of light, and as a result dye decolorization has been a pri- mary goal of dye wastewater treatment processes (Banat et al. 1996). However, beyond color, the presence of these dyes in aqueous ecosystems presents serious envir- onmental and health concerns as a result of the toxicity of the free dyes themselves and their transformation into toxic, mutagenic and carcinogenic amines, primarily as result of anaerobic microbial reductive cleavage of the azo bond (Chung and Cerniglia 1992; Weisburger 2002; Asad et al. 2007). In addition to toxicity, textile dye was- tewaters have high TOC, high salt content and extremes in pH, with reactive dye baths having high pH and acid dye baths have low pH (Golob et al. 2005). Dye wastewaters are treated physically and chemically by flocculation, coagulation, adsorption, membrane fil- tration, precipitation, irradiation, ozonization and Fenton’s oxidation (Lodha and Choudhari 2007; Wong et al. 2007). * Correspondence: [email protected] Department of Food Science, Food Engineering School, University of Campinas, (UNICAMP) Rua Monteiro Lobato 80, Cidade Universitária Zeferino Vaz, Campinas, SP 13083-862, Brazil a SpringerOpen Journal © 2012 Franciscon et al.; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Franciscon et al. SpringerPlus 2012, 1:37 http://www.springerplus.com/content/1/1/37 Although effective in dye removal, particularly for non- ionic dyes, these methods are expensive, add operational complexity to the process and can generate large amounts of dye contaminated sludge that must be disposed of, all of which add significantly to process costs (Lee 2000). Due to the inherent drawbacks of physical, chemical and photochemical approaches to dye removal, the use of biological methods for the treatment of textile waste- waters has received attention as a more cost effective al- ternative (Olukanni Olukanni et al. 2006; Dos Santos et al. 2007). Anaerobic microbial wastewater treatment can be very effective in removing color, primarily by the activity of azo reductases that cleave the azo bond yield- ing the corresponding amines, which are frequently toxic, mutagenic and carcinogenic and resist further degradation under anaerobic conditions (Gottlieb et al. 2003; O’Neill et al. 2000; Pinheiro et al. 2004; Van der Zee et al. 2001; Van der Zee and Villaverde 2005). In this process the azo dye acts as the terminal electron acceptor in anaerobic respiratory oxidation of carbon sources and other electron donors (Carliell et al. 1995; Ryan et al. 2010). In contrast, aerobic biological methods, such as acti- vated sludge processes, are largely ineffective in the treatment of textile wastewaters as a stand alone process, resulting in little or no color removal from azo dyes, with dye removal primarily occurring through ad- sorption to the sludge (Nigam et al. 1996; Brik et al. 2006; Singh et al. 2007). Bacteria capable of aerobic decolorization and mineralization of dyes, specially sul- fonated azo dyes, have proven difficult to isolate and the bacteria need to be specially adapted (McMullan et al. 2001; Pearce et al. 2003). However, both mixed and pure cultures of bacteria have been shown to be able to aerobically degrade and detoxify aromatic amines pro- duced by anaerobic decolorization of azo dyes (Khalid et al. 2009). The first azo reductases identified from anaerobic microorganisms were found to be oxygen sensitive, how- ever, recent work described an Enterococcus gallinarum isolate, obtained from the effluent of a textile industry wastewater treatment plant, capable of decolorizing azo dye DB38 by azoreductase enzyme action under aerobic conditions (Amit et al. 2008). In another example, an azoreductase gene from Bacillus latrosporus RRK1, pro- ducing an azoreductase able to decolorize several azo dyes under aerobic conditions, was cloned and expressed in E. coli, which was then able to decolorize Remazol Red, and a level of 0.8 mg L-1 of dissolved oxygen was required (Sandhya et al. 2008). A number of studies on the degradation of azo dyes by bacteria and fungi have indicated the involvement of extra- cellular oxidative enzymes such as, tyrosinase, lignin and manganese peroxidases and laccase (Fu and Viraraghavan 2001; Shanmugam et al. 2005; Zille et al. 2005; Ulson et al. Ulson de Souza et al. 2007; Kaushik and Malik 2009; Joshi et al. 2010; Kurade et al. 2011). Phenol oxidases, which can be divided into tyrosinases and laccases, are oxidore- ductases that can catalyze the oxidation of phenolic and other aromatic compounds without the use of cofactors. In cultures which have shown the activity of these enzymes during dye degradation it has been observed that the dye structures can be cleaved symmetrically and asym- metrically (Duran et al. 2002; Dawkar et al. 2008; Dhanve et al. 2008). Due to the recalcitrance of azo dyes to strictly aerobic conditions and the production and accumulation of en- vironmentally deleterious amines under anaerobic condi- tions a combination of anaerobic decolorization followed by aerobic degradation of the amines to non-toxic pro- ducts is considered most viable as a biological treatment scheme (Seshadri et al. 1994; Kudlich et al. 1996; Supaka et al. 2004). Moreover, the high salt content and extremes in pH associated with textile dye wastewaters have been shown to inhibit azo dye degradation by was- tewater microbial communities indicating that tolerance to these conditions is also an important parameter to consider for efficient biotransformation of azo dye waste streams (Manu and Chauhari 2003; Sen and Demirer 2003; Asad et al. 2007). However, to achieve this, suit- able strains of microorganisms must be identified and characterized to identify the best conditions for effective biological treatment of azo dyes. Previous studies have shown that strains of Brevibacter- ium are able to degrade aromatic compounds including polynuclear aromatics, dibenzofurans and nitroaromatic compounds (Strubel et al. 1991; Stefan et al. 1994; Jain et al. 2005; Ningthoujam 2005; Onraedt et al. 2005). How- ever, there is only one report of azo dye decolorization by Brevibacterium (Ng et al. 2010). In this case a Brevibacter- ium casei, isolated from sewage sludge from a dyeing factory, was shown to reduce Cr(VI) in the presence of azo dye Acid Orange 7 (AO7), possibly with the dye acting as the electron donor. Further degradation of the decolorized dye was not reported. The present study was focused on the degradation of four reactive sulfonated azo dyes in a successive static/ aerobic process using, exclusively, a Brevibacterium sp. isolated from a textile dye wastewater treatment plant. Dye decolorization was carried out under static conditions until no color was observed. The medium was then aerated by stirring to promote further degradation of the metabo- lites formed by cleavage of the azo bond into non-toxic metabolites. Tyrosinase, laccase and peroxidase enzyme activities as well as total organic carbon (TOC) were moni- tored during the biodegradation process. Biodegradation of the dyes was monitored for decolorization by UV–vis and degradation products were characterized using Franciscon et al. SpringerPlus 2012, 1:37 Page 2 of 10 http://www.springerplus.com/content/1/1/37 measuring the increase in absorbance at 280 nm. One unit of tyrosinase activity was equal to a Δ280nm of 0.001 per min at pH 7.0 at 25°C in a 1.0 mL reaction mix containing 1mM tyrosine solution. Laccase activity was assessed using 0.1 mL of 0.5 mM syringaldazine so- lution in ethanol (due to its limited solubility in aqueous solutions) as substrate, 0.2 mL of 0.05 M citrate phos- phate at pH 5, 0.6 mL of enzyme preparation and 0.1 mL of distilled water in a final volume of 1 mL (Szklarz et al. 1989). The oxidation of syringaldazine was moni- tored spectrophotometrically at 525 nm. Peroxidase ac- tivity was monitored using the same substrate used for laccase with 0.1 mL of 2mM hydrogen peroxide solution instead of distilled water. All enzyme assays were run in triplicate. High performance liquid chromatography mass spectrometry analysis (HPLC-MS) The biodegradation products of azo dye RR198 pro- duced by Brevibacterium sp. strain VN-15 in MMR were analyzed by HPLC-MS. Culture samples were centri- fuged (20,000 × g for 15 min) and filtered through a 0.25 μm pore size filter. Aliquots of 25 μL were injected into a HPLC-MS system consisting of an HPLC system (Waters, USA) coupled to a mass spectrometer with hybrid quadru- pole (Q) and time-of-flight (ToF) mass analyzers from Micromass (Waters, USA), with an electrospray source interface (LC-ESI-MS-MS). Instrument control and data processing were carried out by Masslynx 4.0 software. The mobile phase components used were degassed in an ultrasonic bath (Model USC 700, Unique Thorton, Brazil) before use in the LC system. A Varian reverse phase C18 HPLC column (150 × 2.1 mm, 5 μm particle size) was used to separate the biodeg- radation products. The column temperature was set at 25°C. The mobile phase was composed of water and methanol, using gradient elution. The gradient elution profile, using a flow rate of 0.2 ml min-1, consisted of (in percent by volume; duration (min)) water (100; 30), water:methanol (50:50; 3), ending with methanol (100; 2). The quadrupole analyzer was programmed to select ions with m/z in the range from 50 to 1200 u. The ionization conditions selected were: cone gas flow (150 L h-1), deso- lvation gas flow (350 L h-1), polarity (ESI+), capillary energy (2900 V), sample cone energy (30 V), extraction cone energy (2.0 V), desolvation temperature (350°C), source temperature (120°C), ionization energy (2.0 V), col- lision energy (4 V), and multi-channel plate detector energy (2700 V). Tentative identification of the metabolites from azo dye biodegradation was obtained by comparing the acquired mass spectra to spectra in the MS Database using the Cambridge SoftChem Office 2008 program. TOC measurement The change in organic carbon of the biotreated azo dye cultures was monitored by measuring the Total Organic Carbon (TOC) using a TOC analyzer (Shimadzu 5000A) as previously described in (Franciscon et al. 2009a, 2009b). Toxicity test Daphnia magna is a commonly used bioindicator test aquatic organism in acute and chronic toxicity studies of chemical compounds present in aquatic ecosystems (USEPA 1985). The acute toxicity tests using D. magna were carried as previously described (Franciscon et al. 2009a, 2009b). Competing interests The authors declare they have no competing interests in relation to this article. Authors’ contributions EF participated in the design of the study, performed the microbiology, 16S rRNA gene sequencing, toxicology and enzymology work and participated in the preparation of the manuscript. MJG evaluated the data and prepared the manuscript. JARP and FGRR performed the HPLC-MS analysis. LRD conceived of the study, and participated in its design and coordination. All authors read and approved the final manuscript. Acknowledgements We thank the Coordinator for the Improvement of Personnel in Higher Education (CAPES, Brazil), and the National Council for the Development of Science and Technology (CNPq) for financial support. Received: 31 May 2012 Accepted: 17 October 2012 Published: 23 October 2012 References Amit B, Kannan K, Sivanesan SD, Tapan C (2008) Biological decolourization of C.I. Direct Black 38 by E. gallinarum. J Hazard Mater 157:187–193 Asad S, Amoozegar MA, Pourbabaee AA, Sarbolouki MN, Dastgheib SMM (2007) Decolorization of textile azo dyes by newly isolated halophilic and halotolerant bacteria. Bioresour Technol 98:2082–2088 Ausubel FMR, Kinston RE, Moore DD, Seidman JG, Smith JA, Strhl K (eds) (1989) Current protocols in molecular biology. Jonh Wiley and Sons, New York Banat IM, Nigam P, Singh D, Marchant R (1996) Microbial decolorization of textile-dye-containing effluents: a review. Bioresource Technol 58:217–227 Benson HJ (1985) Microbiological applications: a laboratory manual in general microbiology, 4th edn. Brown Publishers, Dubuque, W. C Brik M, Schoeberl P, Chamam B, Braun R, Fuchs W (2006) Advanced treatment of textile wastewater towards reuse using amembrane bioreactor. Process Biochem 41:1751–1757 Carliell CM, Barclay SJ, Naidoo N, Buckley CA, Mulholland DA, Senior E (1995) Microbial decolourisation of a reactive azo dye under anaerobic conditions. Water SA 21:61–69 Chang SJ, Lin YC (2001) Decolorization kinetics of recombinant Escherichia coli strain harboring azo dye decolorization determinants for Rhodococcus sp. Biotechnol Lett 23:631–636 Chung KT, Cerniglia CE (1992) Mutagenicity of azo dyes: structure–activity relationships. Mutat Res 277:201–220 Chung WK, King GM (2001) Isolation, Characterization, and Polyaromatic Hydrocarbon Degradation Potential of Aerobic Bacteria from Marine Macrofaunal Burrow Sediments and Description of Lutibacterium anuloederans gen. nov, sp. nov, and Cycloclasticus spirillensus sp. nov. Appl Environ Microbiol 12:5585–5592 Hsueh CC, Chen BY (2008) Exploring effects of chemical structure on azo dye decolorization characteristics by Pseudomonas luteola. J Hazard Mater 154:703–710 Franciscon et al. SpringerPlus 2012, 1:37 Page 8 of 10 http://www.springerplus.com/content/1/1/37 Claus H, Filip Z (1990) Enzymatic oxidation of some substituted phenols and aromatic amines, and the behaviour of some phenoloxidases in the presence of soil related adsorbents. Water Sci Technol 22:69–77 Dawkar VV, Jadhav UU, Jadhav SU, Govindwar SP (2008) Biodegradation of disperse textile dye Brown 3REL by newly isolated Bacillus sp. VUS J Appl Microbiol 105:14–24 Dhanve RS, Shedbalkar UU, Jadhav JP (2008) Biodegradation of diazo reactive dye Navy Blue HE2R (Reactive Blue 172) by an isolated Exiguobacterium sp. RD3. Biotechnol Bioproc E 13:53–60 Dos Santos AB, Cervantes JF, Van Lier BJ (2007) Review paper on current technologies for decolourisation of textile wastewaters: Perspectives for anaerobic biotechnology. Bioresour Technol 98:2369–2385 Duran N, Esposito E (2000) Potential applications of oxidative enzymes and phenoloxidase-like compounds in wastewater and soil treatment: a review. Appl Catal B-Environ 28:83–99 Duran N, Rosa MA, D’Annibale A, Gianfreda L (2002) Applications of laccases and tyrosinases (phenoloxidases) immobilized on different supports: a review. Enzyme Microb Tech 31:907–931 Easton J (1995) The dye maker's view. In: Cooper P (ed) Colour in dyehouse effluent. Society of Dyers and Colourists, Bradford, pp 9–21 Euzeby JP (2004) Dictionnaire de bacteriologie veterinaire, Available via http:// www.bacterio.cict.fr/. Accessed 10 Mar 2012 Franciscon E, Zille A, Dias GF, Ragagnin MC, Durrant LR, Cavaco-Paulo A (2009a) Biodegradation of textile azo dyes by a facultative Staphylococcus arlettae strain VN-11 using a sequential microaerophilic/aerobic process. Int Biodeter Biodegr 63:280–288 Franciscon E, Zille A, Durrant LR, Fantinatti GF, Cavaco-Paulo A (2009b) Microaerophilic–aerobic sequential decolourization/biodegradation of textile azo dyes by a facultative Klebsiella sp. Strain VN-31. Process Biochem 44:446–452 Fu YZ, Viraraghavan T (2001) Fungal decolorization of dye wastewaters: a review. Biores Technol 79:251–262 Gasowska B, Kafarski P, Wojtasek H (2004) Interaction of mushroom tyrosinase with aromatic amines, o-diamines and o-aminophenols. Biochim Biophys Acta 1673:170–177 Golob V, Vinder A, Simoni M (2005) Efficiency of the coagulation/flocculation method for the treatment of dyebath effluents. Dye Pigment 67:93–97 Gottlieb A, Shaw C, Smith A, Wheatley A, Forsythe S (2003) The toxicity of textile reactive azo dyes after hydrolysis and decolourisation. J Biotechnol 101(1):49–56 Hai FI, Yamamoto K, Fukushi K (2007) Hybrid treatment systems for dye wastewater. Crit Rev Env Sci Technol 37:315–377 Hong Y, Guo J, Sun G (2008) Characteristics and phylogenetic analysis of the facultative anaerobic dissimilatory azoreducing bacteria from activated sludge. Int Biodeter Biodegr 61:313–318 Jones D, Keddie RM (1986) Genus Brevibacterium. In: Sneath PHA, Mair NS, Sharp ME, Holt JG (eds) Bergey’s manual of systematic bacteriology, vol 2. The Williams & Wilkines Co., Baltimore Joshi S, Inamdar S, Telke A, Tamboli D, Govindwar S (2010) Exploring the potential of natural bacterial consortium to degrade mixture of dyes and textile effluent. Int Biodeter Biodegr 64:622–628 Khalid A, Arshad M, Crowley DE (2009) Biodegradation potential of pure and mixed bacterial cultures for removal of 4-nitroaniline from textile dye wastewater. Water Res 43:1110–1116 Kalme SD, Parshetti GK, Jadhav SU, Govindwar SP (2007a) Biodegradation of Benzidine Based Dye Direct Blue-6 by Pseudomonas desmolyticum NCIM 2112. Biores Technol 98:1405–1410 Kalme S, Ghodake G, Govindwar S (2007b) Red HE7B degradation using desulfonation by Pseudomonas desmolyticum NCIM 2112. Int Biodeter Biodegr 60:327–333 Kamahldin H, Eng WT (2003) Direct spectrophotometric assay of monooxygenase and oxidase activities of mushroom tyrosinase in the presence of synthetic and natural substrates. Anal Biochem 312:23–32 Kaushik P, Malik A (2009) Fungal dye decolourization: Recent advances and future potential. Environ Int 35(1):127–141 Kudlich M, Bishop PL, Knackmuss H-J, Stolz A (1996) Simultaneous anaerobic and aerobic degradation of the sulfonated azo dye Mordant Yellow 3 by immobilized cells from a naphthalenesulfonate-degrading mixed culture. Appl Microbiol Biot 46(5–6):597–603 Kurade MB, Waghmode TR, Govindwar SP (2011) Preferential biodegradation of structurally dissimilar dyes from a mixture by Brevibacillus laterosporus. J Hazard Mater 190(1–3):424–431 Lagesson VD, Lagesson AL, Andrasko J, Baco F (2000) Identification of compounds and specific functional groups in the wavelength region 168– 330 nm using gas chromatography with UV detection. J Chromatogr A 867:187–206 Lane DJ (1991) 16S/23S rRNA sequencing. In: Stackebrandt E, Goodfellow M (eds) Nucleic Acid Techniques in Bacterial Systematics. John Wiley & Sons, Chichester, pp 115–175 Lee R (2000) Coagulation and flocculation in wastewater treatment. Water Wastewater 141:29–32 Lerch K (1995) Tyrosinase: Molecular and Active-Site Structure. In: Lee CY, Whitaker JR (eds) Enzymatic Browning and Its Prevention. ACS Symposium Series 600. American Chemical Society, Washington, DC, pp 64–80 Liu N, Zhang T, Wang YJ, Huang JH, Ou P, Shen A (2004) A heat inducible tyrosinase with distinct properties from Bacillus thuringiensis. Lett Appl Microbiol 3:407–412 Lodha B, Choudhari S (2007) Optimization of Fenton-biological treatment scheme for the treatment of aqueous dye solution. J Hazard Mater 148:459–466 Manu B, Chauhari S (2003) Decolorization of indigo and azo dyes in semicontinuous reactors with long hydraulic retention time. Process Biochem 38:1213–1221 McMullan G, Meehan C, Conneely A, Nirby N, Robinson T, Nigam P, Banat IM, Marchant R, Smyth WF (2001) Mini review: microbial decolorization and degradation of textile dyes. Appl Microbiol Biot 56:81–87 Mielgo I, Moreira MT, Feijoo G, Lema JM (2001) A packed-bed fungal bioreactor for continuous decolourisation of azo-dyes (Orange II). J Biotechnol 89:99–106 Mohana S, Shrivastava S, Divecha J, Madamwar D (2008) Response surface methodology for optimization of medium for decolorization of textile dye Direct Black 22 by a novel bacterial consortium. Bioresource Technol 99:562–569 Nigam P, Banat IM, Singh D, Merchant R (1996) Microbial process for the decolourization of textile effluent containing azo, diazo and reactive dyes. Process Biochem 31:435–442 Ningthoujam D (2005) Isolation and Identification of a Brevibacterium linens strain degrading p-nitrophenol. Afr J Biotechnol 4:256–257 Ng TW, Cai Q, Wong CK, Chow AT, Wong PK (2010) Simultaneous chromate reduction and azo dye decolourization by Brevibacterium casei: azo dye as electron donor for chromate reduction. J Hazard Mater 182(1–3):792–800 Olukanni OD, Osuntoki AA, Gbenle GO (2006) Textile effluent biodegradation potentials of textile effluent-adapted and non-adapted bacteria. Afr J Biotechnol 5:1980–1984 O’Neill C, Lopez A, Esteves S, Hawkes FR, Hawkes DL, Wilcox S (2000) Azo-dye degradation in an anaerobic-aerobic treatment system operating on simulated textile effluent. Appl Microbiol Biot 53:249–254 Onraedt A, Soetaert W, Vandamme E (2005) Industrial importance of the genus Brevibacterium. Biotechnol Lett 27:527–533 Parshetti G, Kalme S, Saratale G, Govindwar S (2006) Biodegradation of Malachite Green by Kocuria rosea MTCC 1532. Acta Chim Slov 53:492–498 Pasti-Grigsby MB, Paszczynski A, Goszczynski S, Crawford DL, Crawford RL (1992) Influence of aromatic substitution patterns on azo dye degradability by Streptomyces spp and Phanerochaete chrysosporium. Appl Environ Microb 58:3605–3613 Pearce CI, Lloyd JR, Guthrie JT (2003) The removal of color from textile wastewater using whole bacterial cells: a review. Dye Pigment 58:179–196 Pinheiro HM, Touraud E, Thomas O (2004) Aromatic amines from azo dye reduction: status review with emphasis on direct UV spectrophotometric detection in textile industry wastewaters. Dye Pigment 61:121–139 Jain RK, Kapur M, Labana S, Lal B, Sarm PM, Bhattacharya D, Thakur IS (2005) Microbial diversity: Application of microorganisms for the biodegradation of xenobiotics. Curr Sci India 89:101–111 Robert P, Andrew K, Lange J, Kirwan DJ (1998) Correlation of fermentation yield with yeast extract composition as characterized by near-infrared spectroscopy. Biotechnol Progr 14:318–325 Ryan A, Wang C, Laurieri N, Westwood I, Sim E (2010) Reaction mechanism of azoreductases suggests convergent evolution with quinone oxidoreductases. Protein Cell 1(8):780–790 Sandhya S, Sarayu K, Uma B, Swaminathan K (2008) Decolorizing kinetics of a recombinant Escherichia coli SS125 strain harboring azoreductase gene from Bacillus latrosporus RRK1. Bioresource Technol 99:2187–2191 Franciscon et al. SpringerPlus 2012, 1:37 Page 9 of 10 http://www.springerplus.com/content/1/1/37 Sen S, Demirer GN (2003) Anaerobic treatment of real textile wastewater with a fluidized bed reactor. Water Res 37:1868–1878 Seshadri S, Bishop PL, Agha AM (1994) Anaerobic/aerobic treatment of selected azo dyes in wastewater. Waste Manage 14(2):127–137 Shanmugam S, Palvannan T, Kumar ST, Michael A (2005) Biological decolourization of textile and paper effluents by Pleurotus florida and Agaricus bisporus (White-rot basidiomycetes). World J Microb Biot 21:1149–1151 Shore J (1995) Dyeing with reactive dyes. In: Shore J (ed) Cellulosic dyeing, Society of Dyers and Colourists., Bradford, p 152 Singh P, Sanghi R, Pandey A, Iyengar L (2007) Decolourization and partial degradation of monoazo dyes in sequential fixed film anaerobic batch reactor (SFABR). Bioresource Technol 98:2053–2056 Stefan PT, Karl HE, Peter F, Hans-Joachim AK (1994) Degradation of fluorene by Brevibacterium sp. Strain DPO 1361: a novel C–C bond cleavage mechanism via 1,10-dihydro-1,10-dihydroxyfluoren-9-one. J Bacteriol 176:789–795 Strubel V, Engesser K-H, Fischer PI, Knackmuss J-H (1991) 3-(2-Hydroxyphenyl) Catechol as Substrate for Proximal meta Ring Cleavage in Dibenzofuran Degradation by Brevibacterium sp. Strain DPO 1361. Journal Bacteriol 173(6):1932–1937 Supaka N, Juntongjin K, Damronglerd S, Delia M-L, Strehaiano P (2004) Microbial decolorization of reactive azo dyes in a sequential anaerobic–aerobic system. Chem Eng J 99:169–176 Szklarz GD, Antibus RK, Sinsabaugaugh RL, Linkins AE (1989) Production of phenoloxidases and peroxidases by wood-rotting fungi. Mycology 81:234–240 Toussaint O, Lerch K (1987) Catalytic oxidation of 2-aminophenols and ortho hydroxylation of aromatic amines by tyrosinase. Biochemistry 26:8567–8571 Ulson de Souza SMAG, Forgiarini E, Souza AAU (2007) Toxicity of textile dyes and their degradation by the enzyme horseradish peroxidase (HRP). J Hazard Mater 147:1073–1078 Umesh U, Jadhav VV, Dawkar Ghodake GS, Govindwar SP (2008) Biodegradation of Direct Red 5B, a textile dye by newly isolated Comamonas sp. UVS J Hazard Mater 158:507–516 United States Environmental Protection Agency (USEPA) (1985) Methods for Measuring the Acute Toxicity of Effluent to Freshwater and Marine Organisms, 3rd edn. United States Environmental Protection Agency, Washington Van der Zee FP, Lettinga G, Field JA (2001) Azo dye decolorization by anaerobic granular sludge. Chemosphere 44:1169–1176 Van der Zee FP, Villaverde S (2005) Combined anaerobic-aerobic treatment of azo dyes—a short review of bioreactor studies. Water Res 39:1425–1440 Weisburger JH (2002) Comments on the history and importance of aromatic and heterocyclic amines in public health. Muta Res 506–507:9–20 Wong PW, Teng TT, Norulaini NARN (2007) Efficiency of the coagulation- flocculation method for the treatment of dye mixtures containing disperse and reactive dye. Water Qual Res J Canada 42(1):54–62 Zille A, Gornacka B, Rehorek A, Cavaco-Paulo A (2005) Degradation of Azo Dyes by Trametes villosa Laccase over Long Periods of Oxidative Conditions. Appl and EnvironMicrobiol 71:6711–6718 doi:10.1186/2193-1801-1-37 Cite this article as: Franciscon et al.: Decolorization and biodegradation of reactive sulfonated azo dyes by a newly isolated Brevibacterium sp. strain VN-15. SpringerPlus 2012 1:37. Submit your manuscript to a journal and benefi t from: 7 Convenient online submission 7 Rigorous peer review 7 Immediate publication on acceptance 7 Open access: articles freely available online 7 High visibility within the fi eld 7 Retaining the copyright to your article Submit your next manuscript at 7 springeropen.com Franciscon et al. SpringerPlus 2012, 1:37 Page 10 of 10 http://www.springerplus.com/content/1/1/37

Title: Decolorization and biodegradation of reactive sulfonated azo dyes by a newly isolated Brevibacterium sp. ​ strain VN-15 Authors: Elisangela Franciscon, Matthew James Grossman, Jonas Augusto Rizzato Paschoal, Felix Guillermo Reyes Reyes, Lucia Regina Durrant ​ Publisher: SpringerPlus Date: October 23, 2012 ​ Abstract: azo dyes constitute the largest and most versatile class of synthetic dyes used in the textile, pharmaceutical, food, and cosmetics industries and represent major components in wastewater from these industrial dyeing processes. ​ Biological decolorization of azo dyes occurs efficiently under low oxygen to anaerobic conditions. ​ However, this process results in the formation of toxic and carcinogenic amines that are resistant to further detoxification under low oxygen conditions. ​ Moreover, the ability to detoxify these amines under aerobic conditions is not a widespread metabolic activity. ​ In this study, we describe the use of Brevibacterium sp. ​ strain VN-15, isolated from an activated sludge process of a textile company, for the sequential decolorization and detoxification of the azo dyes Reactive Yellow 107 (RY107), Reactive Black 5 (RB5), Reactive Red 198 (RR198), and Direct Blue 71 (DB71). ​ Tyrosinase activity was observed during the biotreatment process, suggesting the role of this enzyme in the decolorization and degradation process, but no activity was observed for laccase and peroxidase. ​ Toxicity, measured using Daphnia magna, was completely eliminated. ​

Partial purification and properties of cyclodextrin glycosiltransferase (CGTase) from alkalophilic Bacillus species.pdf

RESEARCH Open Access Partial purification and properties of cyclodextrin glycosiltransferase (CGTase) from alkalophilic Bacillus species Marlene M Martínez Mora1, Karel Hernández Sánchez1, Reynaldo Villalonga Santana2, Arley Pérez Rojas3, Héctor L Ramírez1 and Juan José Torres-Labandeira4* Abstract Cyclodextrin glucanotransferase (CGTase, EC 2.4.1.9) is an unique enzyme capable of converting starch and related substrates into cyclodextrins (CDs). In this paper, we report an one step gel purification method of CGTase from Bacillus sp. and later enzyme characterization. The Bacillus sp. strain was isolated from a Colocacia esculenta rizospheric soil sample and the CGTase production was carried out in alkaline medium (pH=10). The CGTase purification from the culture supernatant was performed by gel filtration. The enzyme was purified in one step with a recovery of 87.3% activity and 40-fold purification for specific enzymatic activity of 2.24 U/mg. Optimal activity was observed at pH 5.0 in citrate-phosphate buffer, and the enzyme retained almost 100 % of its activity between pH 5.5 and 10 after incubation for 1 h at 4°C. The enzyme exhibited maximum activity at 55°C and showed a T50% of 70°C. The ratio of α:β:γ CD formed by the enzyme was 0.74:1:0.61 for soluble starch and 0.29:1:0.85 for cocoyam starch. Keywords: Cyclodextrins glucanotransferase, Alkalophilic Bacillus sp., Enzyme purification, Enzyme characterization, Cyclodextrin production Background The alkaliphilic bacilli are the best producers of the enzyme cyclodextrin glucanotransferase (CGTase, EC 2.4.1.19). Cyclodextrin glucanotransferase is a multifunc- tional enzyme which catalyzes four related reactions: cyclizing, coupling, disproportionation, and hydrolysis. By means of the cyclizing activity, CGTase is an unique enzyme capable of converting starch and related sub- strates into cyclodextrins (CDs) (Jemli et al. 2007). Cyclodextrins (CDs) are non-reducing cyclic oligosac- charides with the spatial structure of a doughnut. The interior of CDs is hydrophobic and its external surface is hydrophilic. Due to this feature, CDs are able to form in- clusion complexes with either organic or inorganic molecules (Abdel et al. 2011). As a result, CDs can change physical and chemical properties of encapsulated guest compounds. Therefore, CDs are becoming increas- ingly popular and are extensively used in industries such as pharmaceutical, textile, agriculture, cosmetic, chem- ical and food, where CDs help to increase the solubility and stability, reduce volatility, and improve the control of the release of drugs, and mask odours and tastes (Ata- nosova et al. 2008, Hamoudi et al. 2011, Marcon et al. 2009, Sian et al. 2005, Wang et al. 2011). CGTase is an extracellular, inducible enzyme produced only by microbial cells. The roles of CGTase production in microorganisms are still unclear; however, some researchers believe that starch is converted by CGTase into CDs that cannot be used by other competing organ- isms. In this way, the CDs can be used as substrate by the CGTase producer. Most bacterial CGTases mainly produce α-CD, β-CD and γ-CD consisting of six, seven, or eight glucose units, respectively. Thus, CGTase is sometimes classified into three different types (α-, β- and γ-CGTase), depending on the major CD produced. CGTases that synthesize predominantly one type of CD have great commercial * Correspondence: [email protected] 4Department of Pharmacy and Pharmaceutical Technology, University of Santiago de Compostela, Faculty of Pharmacy, Santiago de Compostela 15782, Spain Full list of author information is available at the end of the article a SpringerOpen Journal © 2012 Mora et al.; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Mora et al. SpringerPlus 2012, 1:61 http://www.springerplus.com/content/1/1/61 importance, because separation of one type of CDs from a mixture of products is time-consuming, costly and te- dious (Jemli et al. 2007). The yields and ratios of α-, β- and γ-CD produced from starch differ depending on the origin of the CGTase and the environmental conditions (Schmid 1989). For this reason, purification and characterization of new CGTases attract a great atten- tion in the CDs production field. Alkalophilic bacilli have received the major attention for industrial applica- tions because of their high activity over a wide range of pH and temperatures. The main objective of this study was to purify CGTase from alkalophilic Bacillus species isolated from soil and to characterize some relevant properties of the enzyme. Result and Discussion The CGTase producing strain was identified as Bacillus sp. in previous work Martinez et al. (2012).The CGTase purification from the culture supernatant was performed by gel filtration using Fractogel EMD BioSec(s) as matrix (Figure 1). The active fraction used for the biochemical characterization of the enzyme was located between tube 10 and tube 17, where the enzymatic fraction with the highest purification level was found. In the tube interval from 20 to 30, the concentration in protein (because of the culture medium composition), the cyclodextrin pro- duction and the enzymatic activity were maxima, and the enzyme could not be isolated. The enzyme could be sufficiently purified in one step with a recovery of 87.3% activity and 40-fold purification for specific enzymatic activity of 2.24 U/mg (one unit of enzyme activity refers to the amount of enzyme that cat- alyzes the production of 1 μmol of β-CD per minute under the reaction condition) (Table 1). A similar result has been reported for B. agaradhaerens LS-3C CGTase when sufficiently purified using starch adsorption as the sole purification step with a recovery of 50% activity and 43-fold purification (Martin and Hatti 2002). Enzyme activity was measured at 55°C using the stand- ard assay method by varying the pH values from 3.0 to 10.5. The optimum pH of the purified CGTase was 5.0 (Figure 2), which is in agreement with the values reported for purified CGTases from Bacillus sp. 7–12 (Cao et al. 2005) and B. megaterium (Pishtiyski et al. 2008). Most CGTase exhibit optimum pH ranging from 5.0 to 8.0 (Sian et al. 2005), although the enzyme from Brevibacterium sp. no. 9605 exhibits the highest activity at pH 10.0 (Mori et al. 1994). The enzyme was then incubated for 60 minutes at 4°C under various pH conditions, prior to the determination of residual activity under standard assay conditions. The enzyme retained 85% of its initial activity at pHs be- tween 6 and 10.0. At pH 5.0 the activity retained was 70%; below this pH value a drastic reduction in enzyme activity was observed (Figure 3). When compared to other Bacillus CGTases, a similar behavior was observed Figure 2 0 0,5 1 1,5 2 2,5 3 1 6 11 16 21 26 31 Fraction Numbers / 4ml A 280 0 0,1 0,2 0,3 0,4 0,5 0,6 0,7 Enzimatic Activity AE (U/ml) A280 AE(U/ml) conc.CD Figure 1 Elution profile of the CGTase from gel filtration chromatography column using Fractogel EMD BioSEC (S). Fraction 10–17 was collected and used for subsequent characterization steps. Mora et al. SpringerPlus 2012, 1:61 Page 2 of 6 http://www.springerplus.com/content/1/1/61 Material and Methods Materials α-, β- and γ-Cyclodextrin were purchased from Pharma- cia Biotech. Soluble starch, Fractogel EMD BioSec(s), yeast extract and peptone was purchased from Sigma. Cocoyam starch was of industrial grade. Phenolphthalein was purchased from Merck. All other chemicals were of analytical grade. Screening and Isolation of bacteria Bacteria were isolated from Colocacia esculenta rizospheric soil. Samples were suspended in sterile water, serial diluted, and then plated on Horikoshi II agar plate containing (w/v): 1.0 % soluble starch, 0.5 % yeast extract, 0.5 % peptone, 0.1 % KH2PO4, 0.02 % MgSO4.7H2O, 0.02 % phenolphthalein and 1.0 % Na2CO3 (separately autoclaved). Plates were incubated at 37°C for 24 h. Bacterial colonies which produced the largest clear halo zones were selected for further studies (Illias et al. 2002). CGTase production and purification The selected strain was cultivated in flasks containing 200 mL of Horikoshi II broth culture medium and incu- bated at 37°C during 48 hours at 200 rpm. Cells and in- soluble material were removed by centrifugation at 2012 g for 15 min at 4°C, and the cell-free supernatant was used as the source of the enzyme. The crude extract (25 ml) was concentrated to a final volume of 5 ml by rotoevaporation to 30°C. Later, the sample was purified to 4°C in chromatographic column of gel filtration(1.6X 60cm) using Fractogel EMD BioSec(s) as matrix with mobile phase buffer Tris/HCl pH 8.0 20 mM. The column was washed with the same buffer at flow rate 60 mL/h at fractions of 4ml was collected. The protein concentration was estimated using the Bradford method (Bradford 1976). Cyclizing activity of CGTase The cyclizing activity of CGTase was determined apply- ing the phenolphthalein method, measuring the produc- tion of β-CD spectrophotometrically at 550 nm, on the basis of its ability to form a colourness inclusion com- plex with this dye. Phenolphtalein (4 mM) in ethanol was diluted in 125 mM Na2CO3 pH 11 just before start- ing the assay. 2% Starch in 0.05 M citrate-phosphate buffer pH 5.0 were used as substrate. One unit of CGTase is defined as the amount of enzyme catalyzing the production of 1 μmol of β-CD per minute under the reaction conditions (Goel and Nene 1995). Optimum pH The effect of pH on CGTase activity was measured in the range from 3.0 to 10.5, at 55°C for 10 minutes using 50mM citrate-phosphate (pH 3.0-7.5), 50mM Tris–HCl (pH 8.0-9.0) and 50mM sodium carbonate (pH 9.0–11) buffers. 30 40 50 60 70 80 40 50 60 70 80 90 100 Residual Activity (%) Temperature 0C Figure 4 Optimun temperature of CGTase. 20 30 40 50 60 70 80 90 40 60 80 100 Residual Activity (%) Temperature 0C Figure 5 Thermal stability of CGTase. Figure 6 Production of cyclodextrins on soluble (black) and cocoyam starch (gray). Mora et al. SpringerPlus 2012, 1:61 Page 4 of 6 http://www.springerplus.com/content/1/1/61 Stability against pH Enzyme preparations (0.57 U) were incubated at 4°C in 100mM sodium acetate/acetic acid (pH 3.0-5.5), 100mM K2HPO4/ KH2PO4 (pH 6.0-7.5), 100mM Tris/HCl (pH 8.0-9.0) and Na2CO3 /NaHCO3 (pH 9.5-11.5) buffers. Aliquots were removed after 60 minutes of incubation, diluted in 0.1 M K2HPO4/ KH2PO4 buffer (pH 7.0) and assayed for cyclizing activity of CGTase. Optimum temperature The effect of temperature on CGTase activity was evalu- ated in the range of 35-75°C in 50mM citrate phosphate (pH 5.0) buffer. After incubation for 10 minutes, the cyclizing activity was measured. Thermostability Enzyme preparations (0.57 U) were incubated at differ- ent temperatures between 25°C and 85°C in 50mM so- dium citrate phosphate buffer, pH 5.0. Aliquots were removed after 30 minutes incubation, chilled quickly, and assayed for cyclizing activity. Determination of CDs concentration The enzyme (0.27mg/mL) was incubated at 55°C for 60 minutes with 1.5% starch in 50mM citrate phosphate buffer (pH=5.0). The concentration of the various CDs produced by the action of the purified CGTase on sol- uble and cocoyam starch was colorimetrically deter- mined. The concentration of α-CD was assayed by the decrease in absorbance at 507 nm due to the formation of inclusion complexes with methyl orange (Higuti et al. 2004). The concentration of β-CD was determined according to the method described above (Goel and Nene 1995). The concentration of γ-CD was quantified by measuring the absorbance at 630 nm due to the for- mation of inclusion complexes with bromocresol green (Kato and Horikoshi 1984). All experiments were carried out in triplicate under identical conditions. Abbreviations CGTase: Cyclodextrin glucanotransferase; CDs: Cyclodextrins. Competing interests The authors declare that they have no competing interests. Author's contributions These authors: MMMM, RVS, JJT-L have made substantial contributions to conception and design, or acquisition of data, or analysis and interpretation of data. These authors: KHS, APR, HLR have been involved in drafting the manuscript or revising it critically for important intellectual content. All authors read and approved the final manuscript. Acknowledgements This research was supported by the International Foundation for Science, Stockholm, Sweden, and the Organization for the Prohibition of Chemical Weapons, The Hague, The Netherlands, through a Grant to H. Ramirez (Grant F/3004-67). Author details 1Center for Enzyme Technology, University of Matanzas, Matanzas, C.P. 44740, Cuba. 2Department of Analytical Chemistry, Faculty of Chemistry, Complutense University of Madrid, Madrid, Spain. 3Center for Environmental Studies, University of Matanzas, Matanzas, C.P. 44740, Cuba. 4Department of Pharmacy and Pharmaceutical Technology, University of Santiago de Compostela, Faculty of Pharmacy, Santiago de Compostela 15782, Spain. Received: 10 October 2012 Accepted: 30 November 2012 Published: 12 December 2012 References Jemli S, Messaoud E, Ayadi-Zouari D, Naili B, Khemakhem B, Bejar S (2007) A β- cyclodextrin glycosyltransferase from a newly isolated Paenibacillus pabuli US132 strain: Purification, properties and potential use in bread-making. Biochem Eng J 34:44–50 Abdel M, El H, Abdel A (2011) Biosynthesis of cyclodextrin glucosyltransferase by the free and immobilized cells of Bacillus cereus NRC7 in batch and continuous cultures. J Appl Microbiol 111:1129–1137 Atanosova N, Petrova P, Ivanova V (2008) Isolation of novel alkaliphilic bacillus strains for cyclodextrin glucanotransferase production. Appl Biochem Biotechnol 149:155–167 Hamoudi M, Fattal E, Gueutina C, Nicolas V, Bochota A (2011) Beads made of cyclodextrin and oil for the oral delivery of lipophilic drugs: In vitro studies in simulated gastro-intestinal fluids. Int J Pharm 416:507–514 Marcon F, Mathiron D, Pilard S, Lemaire-Hurtel A, Dubaele J, Djedaini-Pilard F (2009) Development and formulation of a 0.2% oral solution of midazolam containing γ-cyclodextrin. Int J Pharm 379:244–250 Sian H, Said M, Hassan O, Kamaruddin K, Ismail A, Rahman R (2005) Purification and characterization of cyclodextrin glucanotransferase from alkalophilic Bacillus sp. G1. Process Biochem 40:1101–1111 Wang J, Cao Y, Sun B, Wang C (2011) Physicochemical and release characterization of garlic oil- β-cyclodextrin inclusion complexes. Food Chem 127:1680–1685 Schmid G (1989) Cyclodextrin glycosyltransferase production: yield enhancement by overexpression of cloned genes. Trends Biotechnol 7:244–248 Martinez MM, Hernandez K, Berrios G, Villalonga R, Ramirez HL, Cabrera G (2012), http://blast.ncbi.nlm.nih.gov/. Bacillus: JQ688043 Martins R, Hatti R (2002) A new cyclodextrin glucanotransferase from an alkaliphilic Bacillus agaradhaerens isolate: purification and characterization. Enz Microb Tech 30:116–124 Cao X, Jin Z, Wang X, Chen F (2005) A novel cyclodextrin glycosyltransferase from an alkalophilic Bacillus species: purification and characterization. Food Res Int 38:309–314 Pishtiyski I, Popota V, Zhekova B (2008) Characterization of Cyclodextrin Glucanotransferase produced by Bacillus megaterium. Appl Biochem Biotechnol 144:263–272 Mori S, Hirose S, Oya T, Kitahata S (1994) Purification and properties of cyclodextrin glucanotrasferase from Brevibacterium sp. no. 9605. Biosc Biotech Biochem 58:1968–1972 Kitahata S, Tsuyama N, Okada S (1974) Purification and some properties of cyclodextrin glycosyltransferase from a strain of Bacillus species. Agric Biol Chem 38:387–393 Kaneko T, Yoshida M, Yamamoto M, Nakamura N, Horikoshi K (1990) Production of cyclodextrins by simultaneous actions of two CGTases from three strains of Bacillus. Starch 42:277–281 Sabioni JG, Park YK (1992) Cyclodextrin glycosyltransferase production by alkalophilic Bacillus lentus. Rev Microbiol 23:128–132 Gawande B, Patkar A (2001) Alpha-cyclodextrin production using cyclodextrin glycosyltransferase from Klebsiella pneumoniae AS-22. Starch 53:75–83 Illias R, Siew T, Aini N (2002) Cyclodextrin Glucanotransferase Producing Alkalophilic Bacillus sp. G1: its Cultural Condition and Partial Characterization of the Enzyme. Pakistan J Biol Sci 5:688–692 Bradford MM (1976) A rapid and sensitive for the quantitation of microgram quantitites of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254 Goel A, Nene S (1995) Modifications in the phenolphtalein method for spectrophotometric estimation of beta cyclodextrin. Starch 47:399–400 Mora et al. SpringerPlus 2012, 1:61 Page 5 of 6 http://www.springerplus.com/content/1/1/61 Higuti I, Silva P, Papp V, Okiyama M, Alves de Andrade E, Marcondes A, Nascimento A (2004) Colorimetric determination of α and β-cyclodextrins and studies on optimization of CGTase production from B. firmus using factorial designs. Braz Arch Biol Technol 47:837–841 Kato T, Horikoshi K (1984) Colorimetric determination of γ-cyclodextrin. Anal Chem 56:1738–1740 doi:10.1186/2193-1801-1-61 Cite this article as: Mora et al.: Partial purification and properties of cyclodextrin glycosiltransferase (CGTase) from alkalophilic Bacillus species. SpringerPlus 2012 1:61. Submit your manuscript to a journal and benefi t from: 7 Convenient online submission 7 Rigorous peer review 7 Immediate publication on acceptance 7 Open access: articles freely available online 7 High visibility within the fi eld 7 Retaining the copyright to your article Submit your next manuscript at 7 springeropen.com Mora et al. SpringerPlus 2012, 1:61 Page 6 of 6 http://www.springerplus.com/content/1/1/61

Title: Partial purification and properties of cyclodextrin glycosiltransferase (CGTase) from alkalophilic Bacillus species ​ Authors: Marlene M Martínez Mora, Karel Hernández Sánchez, Reynaldo Villalonga Santana, Arley Pérez Rojas, Héctor L Ramírez, Juan José Torres-Labandeira ​ Publisher: SpringerPlus Date: 12 December 2012 ​ Abstract: Cyclodextrin glucanotransferase (CGTase, EC 2.4.1.9) is a unique enzyme capable of converting starch and related substrates into cyclodextrins (CDs). ​ In this paper, we report a one-step gel purification method of CGTase from Bacillus sp. ​ and later enzyme characterization. ​ The Bacillus sp. ​ strain was isolated from a Colocacia esculenta rhizospheric soil sample, and the CGTase production was carried out in an alkaline medium (pH=10). ​ The CGTase purification from the culture supernatant was performed by gel filtration. ​ The enzyme was purified in one step with a recovery of 87.3% activity and 40-fold purification for specific enzymatic activity of 2.24 U/mg. ​ Optimal activity was observed at pH 5.0 in citrate-phosphate buffer, and the enzyme retained almost 100% of its activity between pH 5.5 and 10 after incubation for 1 hour at 4°C. ​ The enzyme exhibited maximum activity at 55°C and showed a T50% of 70°C. ​ The ratio of α:β:γ CD formed by the enzyme was 0.74:1:0.61 for soluble starch and 0.29:1:0.85 for cocoyam starch. ​

Relation between single serum progesterone assay and viability of the first trimester pregnancy.pdf

RESEARCH Open Access Relation between single serum progesterone assay and viability of the first trimester pregnancy Ibrahim A Abdelazim1*, Amro Abo Elezz2 and Mohamed Elsherbiny3 Abstract This study was designed to detect the relation between serum progesterone and viability of pregnancy during the first trimester. Prospective study carried out in Al-Rashid Maternity and Ahmadi Kuwait oil company hospitals, over three years from February 2009 to February 2012. Two hundred and Sixty (260) pregnant women were hospitalized due to vaginal bleeding and/or abdominal pain during the first trimester of their pregnancies and were included in this study. Women included in this study were; sure of dates, conceived spontaneously with no history of infertility and had a positive serum pregnancy test. 2 ml blood samples were taken for women included in this study for serum progesterone assay. Women included in this study were followed by ultrasound for the viability of the pregnancy till the end of first trimester and the outcome of their pregnancy were recorded, while women with exogenous progesterone support or multiple pregnancies or suspected ectopic pregnancy or Hydatiform mole were excluded from this study. Data were collected and statistically analyzed to detect the relationship between serum progesterone level and viability of pregnancy during the first trimester. The mean age of the studied population was 32.7 ± 5.1 years, the mean gestational age at progesterone assay was 9.7 ± 0.5 week and by the end of the first trimester, women included in this study were classified according to the viability of their pregnancies into; viable pregnancy group 178 (68.5%) cases and non-viable pregnancy group (ended by miscarriage) 82 (31.5%) cases. The mean serum progesterone of the studied population was significantly high in viable pregnancy group (46.5 ± 7.4 ng/ml) compared to non-viable pregnancy group (9.9 ± 4.8 ng/ml), (p <0.05). In this study; 6.7% of viable pregnancies had serum progesterone level <10 ng/ ml, while 20.7% of non-viable pregnancies had serum progesterone level >10 ng/ml, the serum progesterone at cut off level 10 ng/ml was 79.3% sensitive to diagnose non-viable pregnancy and was 93.3% specific to diagnose viable pregnancy. Also, in this study; 1.1% of viable pregnancies had serum progesterone level <20 ng/ ml, while 4.8% of non-viable pregnancies had serum progesterone level >20 ng/ml, the serum progesterone at cut off level 20 ng/ml was 95.1% sensitive to diagnose non-viable pregnancy and was 98.9% specific to diagnose viable pregnancy. Serum progesterone is a reliable marker for early pregnancy failure and single assay of its serum level can differentiate between viable and non-viable pregnancies. Keywords: Serum progesterone, Viability, First trimester pregnancy Introduction Ultrasound scanning is probably the best single diagnos- tic and prognostic test available for diagnosing early pregnancy failure. However, there were certain condi- tions where both sonographic and clinical findings were indeterminate or inconclusive (Elson et al. 2003). Progesterone is a C-21 steroid hormone secreted by granulosa cells of the ovary. This hormone is important to promote endometrial decidualization by preparing the uterus for implantation of the blastocyst and to maintain the pregnancy (Hanita & Hanisah 2012). The physio- logical functions of progesterone include; inhibition of smooth muscle contractility and inhibition of immune responses like those involved in graft rejection (Hanita & Hanisah 2012). Recent studies suggest that serum progesterone mea- sured in early pregnancy is the most powerful single pre- dictor of pregnancy outcome in natural conceptions (Elson et al. 2003). Few studies have attempted to use * Correspondence: [email protected] 1Obstetrics & Gynecology, Ain Shams University, Cairo, Egypt and Ahmadi Hospital, Kuwait Oil Company, P.O.Box: 9758, Ahmadi 61008, Kuwait Full list of author information is available at the end of the article a SpringerOpen Journal © 2012 Abdelazim et al.; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abdelazim et al. SpringerPlus 2012, 1:80 http://www.springerplus.com/content/1/1/80 serum progesterone assay to predict the outcome of pregnancy in IVF/ICSI or in natural pregnancies and none has produced convincing conclusions (Homan et al. 2000). It is essential to study women after natural conceptions without exogenous progesterone support, when the relation between serum progesterone and viability of the first trimester pregnancy was evaluated (Vicdan & Zeki Isik 2001; Zainab Ali Abdulla Al 2000). So, this prospective study was designed to detect the re- lation between serum progesterone and viability of the pregnancy during the first trimester. Patients & methods This study was carried out in Al-Rashid Maternity and Ahmadi Kuwait Oil Company hospitals, over 3 years from February 2009 to February 2012. Two hundred and Sixty (260) women were hospitalized due to vaginal bleeding and/or abdominal pain during the first trimes- ter of their pregnancies and were included in this pro- spective study after informed consent and approval of the study protocol by institute ethical committee of both hospitals. Data were collected from women included in this study by direct questioner to detect; age, parity, gesta- tional age (calculated from the 1st day of LMP) and past history of early pregnancy miscarriages. Women included in the study were; sure of dates, conceived spontaneously with no history of infertility and had a positive serum pregnancy test. 2 ml blood samples were taken from women included in this study for serum progesterone assay and the sam- ples were collected without anticoagulant in dry tubes. Serum was separated by centrifugation and stored at 2-8°C until hormonal assay. The assay principle com- bines an enzyme immunoassay competition method with final fluorescent detection. Women included in the study were examined by ultrasound for viability of the preg- nancy and accordingly the results were classified into: viable and non-viable pregnancies. Those with inconclu- sive sonographic findings were re-examined by ultra- sound again after two weeks and according to the findings they were reclassified into viable and non-viable pregnancies (anembryonic or missed miscarriage). Women included in this study were followed by ultra- sound for the viability of the pregnancy till the end of first trimester and the outcome of their pregnancy were recorded, while women with exogenous progesterone support or multiple pregnancies or suspected ectopic pregnancy or Hydatiform mole were excluded from this study. The ultrasound was done by an expert sonographer, who was blinded to the patients’ data, using Philips HD9 with 2D convex probe 4–9 MHz. Data were collected and statistically analyzed to detect the relationship between serum progesterone level and viability of the pregnancy during first trimester. Sample size justification Using data of previous studies (Phipps et al. 2000; Hahlin et al. 1991), setting the type-1 error (α) at 0.05, the power (1-β) at 0.8 and assuming a 5% dropout rate, the number of participants needed to produce a statistically accep- table figure was more than two hundred women. Statistical analysis Data were collected, tabulated then statistically analyzed using Statistical Package for Social Sciences (SPSS); computer software version (15). Numerical variables were presented as mean and standard deviation (±SD), while categorical variables were presented as number and percentage. Chi-square test (X2) was used for comparison between groups as regard qualitative variables. A difference with p value <0.05 was considered statistically significant, otherwise it was insignificant. Sensitivity: is the propor- tional detection of individuals with the disease of inter- est in the population. Specificity: is the proportional detection of individuals without the disease of interest in the population. Results Two hundred and Sixty (260) women were hospitalized due to vaginal bleeding and/or abdominal pain during first trimester of their pregnancy and were included in this study. The mean age of the studied population was 32.7 ± 5.1 years (ranged from 18–38 years), their mean parity was 4.2 ± 5.7 (ranged from 0–9) and the mean gestational age at progesterone assay was 9.7 ± 0.5 weeks (ranged from 7–11 weeks), (Table 1). By the end of first trimester, women included in this study were classified according to the viability of their pregnancies into; viable pregnancy group 178 (68.5%) cases and non-viable pregnancy group (ended by miscar- riages) 82 (31.5%) cases, (Table 2). The mean serum progesterone was significantly high in viable pregnancy group 46.5 ± 7.4 ng/ml (ranged from 18.7 - 86.3 ng/ml), compared with non-viable pregnancy group 9.9 ± 4.8 ng/ml (ranged from 1.67 - 26.2 ng/ml), (Chi-square test, p <0.05), (Table 3). The relations between serum progesterone and mater- nal age or gestational age of the studied populations Table 1 The characteristics of the studied population Variables Mean ± SD Range Age (Year) 32.7 ± 5.1 18 - 38 Parity 4.2 ± 5.7 0 - 9 Gestational age at progesterone assay (Weeks) 9.7 ± 0.5 7 - 11 Abdelazim et al. SpringerPlus 2012, 1:80 Page 2 of 5 http://www.springerplus.com/content/1/1/80 were statistically insignificant, also the relation between serum progesterone and past history of early miscarriage was statistically insignificant (Chi-square test; p >0.05), (Table 4). In this study; 6.7% of viable pregnancies had serum progesterone level <10 ng/ ml, while 20.7% of non-viable pregnancies had serum progesterone level >10 ng/ml, the serum progesterone at cut off level 10 ng/ml was 79.3% sensitive to diagnose non-viable pregnancy and was 93.3% specific to diagnose viable pregnancy. Also, in this study; 1.1% of viable pregnancies had serum proges- terone level <20 ng/ ml, while 4.8% of non-viable preg- nancies had serum progesterone level >20 ng/ml, the serum progesterone at cut off level 20 ng/ml was 95.1% sensitive to diagnose non-viable pregnancy and was 98.9% specific to diagnose viable pregnancy (Table 5). Discussion Recent studies suggest that serum progesterone mea- sured in early pregnancy is the most powerful single pre- dictor of pregnancy outcome in natural conceptions (Elson et al. 2003; Zainab Ali Abdulla Al 2000; Phipps et al. 2000). So, this prospective study was designed to detect the relation between serum progesterone and via- bility of the pregnancy during the first trimester. Two hundred and Sixty (260) women were hospita- lized due to vaginal bleeding and/or abdominal pain dur- ing the first trimester of their pregnancies and were included in this prospective study. The mean age of the studied population was 32.7 ± 5.1 years, the mean gesta- tional age at progesterone assay was 9.7 ± 0.5 week and by the end of the first trimester, women included in this study were classified according to the viability of their pregnancies into; viable pregnancy group 178 (68.5%) cases and non-viable pregnancy group (ended by miscarriages) 82 (31.5%) cases. The mean serum proges- terone of the studied population was significantly high in viable pregnancy group (46.5 ± 7.4 ng/ml) compared to non-viable pregnancy group (9.9 ± 4.8 ng/ml). Progesterone level and daily change in human chori- onic gonadotropin (β-hCG) were determined in the serum of 307 patients with suspected ectopic pregnancy by Hahlin et al., and they found that 99% of the viable intrauterine pregnancies had serum progesterone more than 30 nmol/l (9.42 ng/ml; 1 nmol/1 = 0.314 ng/ml), whereas 75% of the ectopic pregnancy and 81% of the spontaneous abortions had serum progesterone less than 30 nmol/l (9.42 ng/ml), also, serum samples for proges- terone, inhibin A, hCG, and urine beta-core hCG were collected from 220 women presented in the first trimes- ter of pregnancy with complaints of pain, cramping, bleeding or spotting by Phipps and colleagues, to evalu- ate whether those biomarkers could predict viable and non-viable outcomes in pregnancy, and they concluded that serum progesterone was the most specific single biomarker for distinguishing viable from non-viable pregnancies (Hahlin et al. 1991; Phipps et al. 2000). Although, Lijun & colleagues concluded that serum progesterone combined with β-hCG measurements, with a diagnostic accuracy of 85.7%, had the best prognostic reliability for predicting the outcome of threatened miscarriage compared to serum progesterone alone or β-hCG alone (Duan et al. 2011), Daily and colleagues found that the mean serum progesterone was signifi- cantly high for viable pregnancies (22.1 ng/ml) com- pared to non-viable pregnancies (10.1 ng/ml) and they concluded that a serum progesterone assay alone is predictive of pregnancy outcome specially during the first 8 weeks of gestation (Daily et al. 1994), also, Zainab Al Jufairi, found that serum progesterone level was signifi- cantly high in patients with viable pregnancies (20.48 ± 6.066 ng/ml) compared with patient with non-viable pregnancies ended by spontaneous abortion (7.78 ± 2.06 ng/ml) and she concluded that the serum progesterone alone is a reliable marker for prediction of early preg- nancy failure (Zainab Ali Abdulla Al 2000). The relations between serum progesterone and ma- ternal age or gestational age of the studied population were statistically insignificant; also the relation between serum progesterone and past history of early miscar- riage was statistically insignificant. Table 2 Classification of the studied population according to the viability of the pregnancy Ultrasound findings Number (n) Percentage (%) Viable pregnancy group 178 68.5% Non-viable pregnancy group 82 31.5% Missed abortion 53 20.4% Anembryonic (blighted ovum) 29 11.1% Total number of cases 260 100% Table 3 The relation between serum progesterone and viability of the pregnancy Pregnancy outcome Number (%) Serum progesterone (ng/ml) Test used Mean ± SD (range) P value (significance) Viable Pregnancy group 178 (68.5%) 46.5 ± 7.4 (18.7 - 86.3) Chi-square (X2) Non-viable Pregnancy group 82 (31.5%) 9.9 ± 4.8 (1.67 - 26.2) P <0.05 = 0.036 (significant) Abdelazim et al. SpringerPlus 2012, 1:80 Page 3 of 5 http://www.springerplus.com/content/1/1/80 In this study; 6.7% of viable pregnancies had serum progesterone level <10 ng/ ml, while 20.7% of non- viable pregnancies had serum progesterone level >10 ng/ml, the serum progesterone at cut off level 10 ng/ml was 79.3% sensitive to diagnose non-viable pregnancy and was 93.3% specific to diagnose viable pregnancy. Also, in this study; 1.1% of viable pregnancies had serum progesterone level <20 ng/ ml, while 4.8% of non-viable pregnancies had serum progesterone level >20 ng/ml, the serum progesterone at cut off level 20 ng/ml was 95.1% sensitive to diagnose non-viable preg- nancy and was 98.9% specific to diagnose viable pregnancy. Ninety-five (95) pregnant women of 13 weeks or less were recruited as study group and fourteen (14) normal pregnant women were recruited as controls, to deter- mine the role of serum progesterone as a marker of early pregnancy failure after single assay by Hanita and colleagues. They found that the serum progesterone levels were significantly lower in women with non- viable pregnancies compared with women with viable pregnancy (10.7 ng/ml versus 45.9 ng/ml; respectively). Hanita and colleagues, concluded that serum progester- one can be used as a marker for early pregnancy failure and at cut-off value of 32.7ng/ml, serum progesterone had 90% sensitivity with 75% NPV and 92% specificity with 97% PPV to diagnose early pregnancy failure (Hanita & Hanisah 2012). Four hundred and eighty-nine (489) women presenting with singleton pregnancy, vaginal bleeding and/or ab- dominal pain in the first 18 weeks of pregnancy were included in a prospective comparative study was con- ducted by Al-Sebai et al., to assess the role of a single maternal serum progesterone measurement in the im- mediate diagnosis of early pregnancy failure and in the long term prognosis of fetal viability. They found that serum Progesterone levels were significantly lower in the non-continuing and tubal pregnancy groups compared to threatened-continuing groups and a cut-off level at 45 nmol/l (14.13 ng/ml) was found to differentiate between the viable pregnancies and the abnormal (non-continu- ing) pregnancies with 87.6% sensitivity and 87.5% speci- ficity. Al-Sebai and colleagues concluded that a single serum progesterone measurement taken in early preg- nancy is valuable in the immediate diagnosis of early pregnancy failure and the long term prognosis of viabil- ity (Al-Sebai et al. 2005). Also, a prospective study was conducted by Ioannidis and colleagues, to investigate the relation between early (14 days after oocyte recovery) serum progesterone assay Table 4 The relation between serum progesterone and maternal age, gestational age or past history of early miscarriage Variables Total number Serum progesterone Test used (n = 260) (ng/ml) P value Mean ± SD (Significance) Maternal age Chi-square (X2) >35 years old 142 24.62 ± 8.2 P >0.05 = 0.76 < 35 years old 118 18.52 ± 6.8 (Non-significant) Past history of early miscarriage Chi-square (X2) Positive 48 12.26 ± 2.3 P >0.05 = 0.07 Negative 212 27.81 ± 5.7 (Non-significant) Gestational age Chi-square (X2) >10 weeks gestation 77 16.27 ± 4.7 P >0.05 = 0.27 < 10 weeks gestation 183 26.45 ± 3.9 (Non-significant) Table 5 Relations between serum progesterone cut off levels and viability of the pregnancy Variables Viable Non-viable Pregnancy group (Total number = 178) Pregnancy group (Total number = 82) Serum Progesterone at cut off level 10 ng/ml Number of cases with serum progesterone < 10 ng/ml (%) 12 (6.7%) 65 (79.3% = sensitivity) Number of cases with serum progesterone > 10 ng/ml (%) 166 (93.3% = specificity) 17 (20.7%) Serum Progesterone at cut off level 20 ng/ml Number of cases with serum progesterone < 20 ng/ml (%) 2 (1.1%) 78 (95.1% = sensitivity) Number of cases with serum progesterone > 20 ng/ml (%) 176 (98.9% = specificity) 4 (4.8%) Abdelazim et al. SpringerPlus 2012, 1:80 Page 4 of 5 http://www.springerplus.com/content/1/1/80 and pregnancy outcome in women undergoing IVF/ICSI and receiving rectal progesterone supplements. They found that the single progesterone assay on day 14 post- oocyte retrieval was significantly high in women with on-going pregnancies compared to women with an ab- normal pregnancy. Ioannidis and colleagues concluded that single serum progesterone measurement could be a useful indicator of pregnancy outcome in women under- going IVF/ICSI treatment (Ioannidis et al. 2005). Conclusion Serum progesterone is a reliable marker for early preg- nancy failure and single assay of its serum level can dif- ferentiate between viable and non-viable pregnancies. Abbreviations ICSI: Intracytoplasmic sperm injection; IVF: In vitro fertilization; LMP: Last Menstrual period. Competing interest No actual or potential competing interest in relation to this article exists. Authors’ contributions Ibrahim A. Abdelazim is responsible for study design, analysis of data and integrity of this work. Doctor Amro Abo Elezz is responsible for study design, intellectual content, follow up of the patients and Doctor Mohamed Elsherbiny is responsible for most of the ultrasound done for the patients included in this study and final revision before publication. All authors read and approved the final manuscript. Acknowledgement I would like to express my appreciation and acknowledgment to Doctor Amro Abo Elezz and Doctor Mohamed Elsherbiny, for their continuous advice for publication of this manuscript. Author details 1Obstetrics & Gynecology, Ain Shams University, Cairo, Egypt and Ahmadi Hospital, Kuwait Oil Company, P.O.Box: 9758, Ahmadi 61008, Kuwait. 2Assistant Professor of Obstetrics & Gynaecology, Al-Azhar University, Cairo, Egypt and Ahmadi Hospital-Kuwait Oil Company, Kuwait. 3Specialist of ultrasound, Fetal Care unit, Ain Shams University, Ciaro, Egypt. Received: 4 October 2012 Accepted: 22 November 2012 Published: 27 December 2012 References Elson J, Salim R, Tailor A, Banerjee S, Zosmer N, Jurkovic D (2003) Prediction of early pregnancy viability in the absence of an ultrasonically detectable embryo. Ultrasound Obstet Gynecol 21(1):57–61 Hanita O, Hanisah AH (2012) Potential use of single measurement of serum progesterone in detecting early pregnancy failure. Malaysian J Pathol 34 (1):41–46 Homan G, Brown S, Moran J, Homan S, Kerin J (2000) Human chorionic gonadotropin as a predictor of outcome in assisted reproductive technology pregnancies. Fertil Steril 73(2):270–274 Vicdan K, Zeki Isik A (2001) Luteal phase hormonal profile in prediction of pregnancy outcome after assisted reproduction. Eur J Obstet Gynecol Reprod Biol 96(1):98–101 Zainab Ali Abdulla Al J (2000) The value of serum progesterone measurement in early pregnancy, Volume 22nd edn. Bahrain Medical Bulletin, Number 1 Phipps MG, Hogan JW, Peipert JF, Lambert-Messerlian GM, Canick JA, Seifer DB (2000) Progesterone, inhibin, and hCG multiple marker strategy to differentiate viable from nonviable pregnancies. Obstet Gynecol 95(2):227–231 Hahlin M, Sjöblom P, Lindblom B (1991) Combined use of progesterone and human chorionic gonadotropin determinations for differential diagnosis of very early pregnancy. Fertil Steril 55(3):492–496 Duan L, Yan D, Zeng W, Yang X, Wei Q (2011) Predictive power progesterone combined with beta human chorionic gonadotropin measurements in the outcome of threatened miscarriage. Arch Gynecol Obstet 283:431–435 Daily CA, Laurent SL, Nunley WC Jr (1994) The prognostic value of serum progesterone and quantitative beta-human chorionic gonadotropin in early human pregnancy. Am J Obstet Gynecol 171(2):380–384 Al-Sebai MAH, Kingsland CR, Diver M, Hipkin L, McFadyen IR (2005) The role of a single progesterone measurement in the diagnosis of early pregnancy failure and the prognosis of fetal viability. BJOG: Int J Gynecol Obstet 122:364–369 Ioannidis G, Sacks G, Reddy N, Seyani L, Margara R, Lavery S, Trew G (2005) Day 14 maternal serum progesterone levels predict pregnancy outcome in IVF/ ICSI treatment cycles: a prospective study. Hum Reprod 20(3):741–746 doi:10.1186/2193-1801-1-80 Cite this article as: Abdelazim et al.: Relation between single serum progesterone assay and viability of the first trimester pregnancy. SpringerPlus 2012 1:80. Submit your manuscript to a journal and benefi t from: 7 Convenient online submission 7 Rigorous peer review 7 Immediate publication on acceptance 7 Open access: articles freely available online 7 High visibility within the fi eld 7 Retaining the copyright to your article Submit your next manuscript at 7 springeropen.com Abdelazim et al. SpringerPlus 2012, 1:80 Page 5 of 5 http://www.springerplus.com/content/1/1/80

Title: Relation between single serum progesterone assay and viability of the first trimester pregnancy ​ Authors: Ibrahim A Abdelazim, Amro Abo Elezz, Mohamed Elsherbiny ​ Publisher: SpringerPlus Date: 2012-12-27 00:00:00 Abstract: This study was designed to detect the relation between serum progesterone and viability of pregnancy during the first trimester. ​ Prospective study carried out in Al-Rashid Maternity and Ahmadi Kuwait oil company hospitals, over three years from February 2009 to February 2012. ​ Two hundred and Sixty (260) pregnant women were hospitalized due to vaginal bleeding and/or abdominal pain during the first trimester of their pregnancies and were included in this study. ​ Women included in this study were; sure of dates, conceived spontaneously with no history of infertility and had a positive serum pregnancy test. ​ 2 ml blood samples were taken for women included in this study for serum progesterone assay. ​ Women included in this study were followed by ultrasound for the viability of the pregnancy till the end of first trimester and the outcome of their pregnancy were recorded, while women with exogenous progesterone support or multiple pregnancies or suspected ectopic pregnancy or Hydatiform mole were excluded from this study. ​ Data were collected and statistically analyzed to detect the relationship between serum progesterone level and viability of pregnancy during the first trimester. ​ The mean age of the studied population was 32.7 ± 5.1 years, the mean gestational age at progesterone assay was 9.7 ± 0.5 week and by the end of the first trimester, women included in this study were classified according to the viability of their pregnancies into; viable pregnancy group 178 (68.5%) cases and non-viable pregnancy group (ended by miscarriage) 82 (31.5%) cases. ​ The mean serum progesterone of the studied population was significantly high in viable pregnancy group (46.5 ± 7.4 ng/ml) compared to non-viable pregnancy group (9.9 ± 4.8 ng/ml), (p <0.05). ​ In this study; 6.7% of viable pregnancies had serum progesterone level <10 ng/ ml, while 20.7% of non-viable pregnancies had serum progesterone level >10 ng/ml, the serum progesterone at cut off level 10 ng/ml was 79.3% sensitive to diagnose non-viable pregnancy and was 93.3% specific to diagnose viable pregnancy. ​ Also, in this study; 1.1% of viable pregnancies had serum progesterone level <20 ng/ ml, while 4.8% of non-viable pregnancies had serum progesterone level >20 ng/ml, the serum progesterone at cut off level 20 ng/ml was 95.1% sensitive to diagnose non-viable pregnancy and was 98.9% specific to diagnose viable pregnancy. ​ Serum progesterone is a reliable marker for early pregnancy failure and single assay of its serum level can differentiate between viable and non-viable pregnancies. ​

Optimization of Agrobacterium mediated genetic transformation of cotyledonary node explants of Vigna radiata.pdf

RESEARCH Open Access Optimization of Agrobacterium mediated genetic transformation of cotyledonary node explants of Vigna radiata Sushil Kumar Yadav1*, Sweety Katikala1, Varalaxmi Yellisetty1, Annapurna Kannepalle2, Jyothi Lakshmi Narayana1, Vanaja Maddi1, Maheswari Mandapaka1, Arun Kumar Shanker1*, Venkateswarlu Bandi1 and Kirti Pulugurtha Bharadwaja3 Abstract A reproducible and highly efficient protocol for genetic transformation mediated by Agrobacterium has been established for greengram (Vigna radiata L. Wilczek). Double cotyledonary node (DCN) explants were inoculated with Agrobacterium tumefaciens strain LBA 4404 harboring a binary vector pCAMBIA 2301 containing neomycin phosphotransferase (npt II) gene as selectable marker, β-glucuronidase (GUS) as a reporter (uidA) gene and annexin 1 bj gene. Important parameters like optical density of Agrobacterium culture, culture quantity, infection medium, infection and co-cultivation time and acetosyringone concentration were standardized to optimize the transformation frequency. Kanamycin at a concentration of 100 mg/l was used to select transformed cells. Transient and stable GUS expressions were studied in transformed explants and regenerated putative plants, respectively. Transformed shoot were produced on regeneration medium containing 100 mg/l kanamycin and 250 mg/l cefotaxime and rooted on ½ MS medium. Transient and constitutive GUS expression was observed in DCN explants and different tissues of T0 and T1 plants. Rooted T0 and T1 shoots confirming Polymerase Chain Reaction (PCR) positive for npt II and annexin 1bj genes were taken to maturity to collect the seeds. Integration of annexin gene into the greengram genome was confirmed by Southern blotting. Keywords: Agrobacterium mediated transformation, Annexin, Double cotyledonary node, Vigna radiata Background Grain legumes constitute an important dietary consti- tuent for humans and animals. They associate with ni- trogen fixing bacteria and play an important role in low input agricultural production systems; particularly small and marginal farm holdings. Greengram (Vigna radiata L. Wilczek) is an important grain legume grown widely in Southeast Asia, Africa, South Africa and Australia. The crop is grown mainly as a source of vegetable pro- tein for its high protein content (about 25%), which makes it as an excellent supplement to cereal diets. The cultivation of this crop is gaining more popularity by virtue of its early maturity, nutritional value and easy di- gestibility. In India, it is cultivated mainly under limited and erratic rainfall conditions and on marginal and sub- marginal lands where numerous biotic and abiotic stres- ses limit its productivity (Jaiwal and Gulati 1995; Jaiwal and Singh 2003). Conventional breeding for enhancing biotic and abiotic stress tolerance in crop plants has se- veral constraints and since the available genetic variabi- lity is low, transfer of alien genes of proven value offer possible viable option for crop improvement. Legumes in general are recalcitrant to tissue culture and are highly genotype specific (Somers et al. 2003). Reproducible and efficient protocols for shoot regene- ration have been established for greengram (Amutha et al. 2006; Kaviraj et al. 2006; Mahalaxmi et al. 2006; Mundhara and Rashid et al. 2006; Vijayan et al. 2006; Yadav et al. 2010a & 2010b). The immense potential of biotechnological tools for improving against biotic and abiotic stresses can be realized by supplementing the breeding programmes through introduction of alien * Correspondence: [email protected]; [email protected] 1Central Research Institute for Dryland Agriculture, Santoshnagar, Hyderabad 500 059, India Full list of author information is available at the end of the article a SpringerOpen Journal © 2012 Yadav et al.; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Yadav et al. SpringerPlus 2012, 1:59 http://www.springerplus.com/content/1/1/59 genes of recognized relevance into elite germplasm of crop plants (Chandra and Pental, 2003; Somers et al. 2003; Popelka et al. 2004; Dita et al. 2006; Eapen 2008). An efficient regeneration and transformation protocol will be the key to success of genetic transformation. Though there are reports claiming successful transform- ation, owing to their highly recalcitrant nature in culture and very low frequency of regeneration especially after transformation, progress in development of transgenics for various legumes has been very slow (Chandra and Pental, 2003; Somers et al. 2003; Popelka et al. 2004; Dita et al. 2006). In the present study, we describe a re- producible and efficient Agrobacterium mediated genetic transformation protocol for greengram using double cotyledonary node (DCN) explants derived from three day old seedlings with binary vector pCAMBIA 2301 containing annexin gene. Ectopic expression of annexin has been shown to improve tolerance to various biotic and abiotic stresses in tobacco plants (Jami et al. 2008). Annexins are Ca2+ and phospho-lipid binding proteins forming an evolutionary conserved multi-gene family expressed throughout plant kingdom. Annexins play a critical role in plant cell from regulation of Ca2+ dependent biochemical signalling processes to phospho- lipid metabolism. Gene expression of annexins in plants appears to be regulated by developmental and environ- mental signals and is known to be regulated by Ca2+ in stimulus response coupling in many plant cell–signalling pathways. Plant annexins from Medicago sativa and Ara- bidopsis thaliana have been implicated in oxidative stress response. We hypothesis that incorporation of annexin transgene will contribute to better tolerance to oxidative stress as the crop is predominantly grown in conditions which generate ROS. Annexin 1 from Brassica juncea was used in the present study. Results and discussion Earlier, hypocotyl and primary leaves excised from 2-day-old in-vitro grown seedlings produced trans- genic calli on B(5) basal medium supplemented with 5 × 10(−6) M Benzlaminopurine (BAP), 2.5 × 10(−6) M each of 2,4-Dichlorophenoxyacetic Acid (2,4-D) and 1-Napthaleneacetic acid (NAA) and 50 mg l(−1) kanamycin after co-cultivation with Agrobacterium tumefaciens strains, LBA4404 (pTOK233), EHA105 (pBin9GusInt) and C58C1 (pIG121Hm) all containing beta-glucuronidase (gusA) and neomycin phospho- transferase II (nptII) marker genes at a frequency of 0.9% (Jaiwal et al. 2001). However, we in our study for the first time, transformed green shoots showing strong GUS activity regenerated directly from cotyle- donary node explants cultured after co-cultivation with LBA4404 (pTOK233) on B(5) medium containing 6-benzylaminopurine (5 × 10(−7) M) and 100 mg l(−1) kanamycin. Molecular analysis of putative transformed plants revealed the integration and expression of trans- genes in T(0) plants and their seeds. Transformation efficiency observed was 4.2% (Table 1). Various parameters were optimized to establish a re- producible and efficient transformation protocol using at least 10 cotyledonary node explants in three replications for each experiment. The success of transformation was confirmed by transient and stable GUS expression as well as PCR using kanamycin and gene specific primers in transformed explants and regenerated putative plants. Axillary cells of the cotyledonary node explants are known to possess cells that are competent for regene- ration and targeted gene delivery (Chandra and Pental 2003). Transformation of cotyledonary nodes leading to the recovery of transgenic plants has been reported ear- lier in mungbean (Jaiwal et al. 2001). Optimizing kanamycin concentration to select transformants Prior to transformation, an effective concentration of antibiotic for the selection of transformed cells was determined by culturing DCN explants on Murashige and Skoog with B5 vitamins (MSB5) media containing various concentrations of kanamycin (0, 25, 50, 75, 100, 150 mg/l) (Figure 1). The effect of various concentrations of kanamycin on regeneration response is described below (Table 2). Kanamycin over a concentration of 100 mg/l was observed to be effective to select the transformants derived from DCN explants and caused complete necrosis of the untransformed explants within three weeks and thus was successfully used for selection of transformants. Hence kanamycin at a concentration of 100 mg/l was used for transformants. Earlier Phogat et al. (1999) selected transformed calli of Vigna radiata on 100 mg/l of kana- mycin concentration. Factors effecting genetic transformation Experiments were designed to work out the most opti- mal conditions for transformation and carried out with a bacterial concentration of 0.5 O.D. with explants derived from 3-day old seedlings (Yadav et al. 2010a) and varying the parameter under study. Effect of optical density (O.D.) of Agrobacterium culture Explants from 3-day old seedlings were co-cultured with Agrobacterium culture of varying optical density (O.D.560) between 0.5-1.5, keeping pH 5.8 and kanamy- cin concentration 100 mg/l. An O.D. of 0.8 was observed to be the give the best transformation response. This O.D. value might be representing the most active log phase of Agrobacterium growth and thus very effective for trans- formation. Similar results were also reported by Jaiwal et al. (1998, 2001). Contrary to present report, a decline in Yadav et al. SpringerPlus 2012, 1:59 Page 2 of 8 http://www.springerplus.com/content/1/1/59 explants excised and cultured for efficient shoot regene- ration as described by Yadav et al. 2010a. Agrobacterium strain and gene construct The disarmed Agrobacterium strain LBA4404 was used for the genetic transformation of greengram. The gene construct contained a binary vector pCAMBIA 2301 which had β-glucuronidase (GUS) reporter (uidA) gene, a neomycin phosphotransferase (nptII) gene as plant se- lection marker driven by cauliflower mosaic virus (CaMV) 35S promoter. The uidA gene contains an in- tron in the coding region to ensure that the observed GUS activity occurred in the plant cell and not due to residual Agrobacterium cells. Annexin1bj gene cassette (−35S promoter-annexin-nos terminater-) of 1.5 kb in size was cloned in pCAMBIA 2301 vector at Pst I site (Figure 6). The recombined vector was transferred into E. coli (DH5α) by heat- shock method and finally trans- ferred into Agrobacterium tumefaciens strain LBA 4404 by freeze-thaw method. Plasmid DNA isolated from E. coli cell upon digestion with Pst I resulted in re- lease of 1.5 Kb annexin gene cassette. The transformed Agrobacterium strain LBA 4404 was used for genetic transformation of DCN explants of greengram. The cDNA of annexin1bj gene was 954 bp length frag- ments, it had Bam HI restriction site at 5' end and Sal I site at 3' end. Annexin cDNA also had two restriction sites for Hind III enzyme resulting in 3 fragments of 368, 439 and 147 bp lengths (Figure 7). Npt II and annexin1bj gene specific primers were designed which gave 645 and 941 bp product, respectively. Agrobacter- ium strain was grown over night at 28°C in YEB medium containing either 50 mg/l kanamycin. Bacterial cells were pelleted and resuspended in liquid shoot regene- ration medium for further use in standardization of va- rious transformation parameters. Kanamycin kill curve for selection of transformants Prior to transformation, an effective concentration of kanamycin was determined for selection of transfor- mants by culturing untransformed DCN explants on shoot bud induction medium containing various concen- trations of kanamycin (0–150 mg/l). Explant preparation and optimization of conditions for transformation Selected seeds were rinsed with 70% alcohol for 2 min and the surface sterilized with 0.2% aqueous solution of HgCl2 (w/v) for 5 min. The seeds were subsequently washed several times with sterile distill water and cul- tured on MSB5 medium. The best conditions included three-day old DCN explants pre-cultured for 2 days and injured with fine needle at the axillary meristematic re- gion. Over night grown cultures of Agrobacterium (0.8A, 1000 μl) were added to the flask containing infection medium and swirled well. Injured explants were added to the infection medium and swirled for 15 min. Infected explants were kept on co-cultivation medium containing 50, 100 and 200 μM acetosyringone for 2, 3 and 4 days. After co-cultivation explants were washed with cefota- xime (250 mg/l) and cultured on shoot bud induction medium containing 100 mg/l kanamycin as selection agent. Explants were sub-cultured onto fresh medium every 15 days. Figure 6 Schematic representation of T-DNA region of pCAMBIA 2301 having annexin gene (6345bp). Figure 7 Restriction enzyme sites in annexin1bj gene cassetter (1.5Kb). Yadav et al. SpringerPlus 2012, 1:59 Page 6 of 8 http://www.springerplus.com/content/1/1/59 Transformation The conditions optimized for the best regeneration ear- lier were practiced to get the finest transformation re- sponse to develop transgenic greengram with annexin 1bj gene by Agrobacterium mediated approach. The transformation of three day old DCN explants was car- ried out by using LBA 4404 strain of Agrobacterium tumefaciens harbouring pCAMBIA 2301 binary vector containing annexin 1bj gene under the control of CaMV 35S promoter. Experiments were repeated on a regular interval to generate more of independent events for selecting the promising transgenic plants of green gram. Untransformed explants were kept as regeneration con- trol on kanamycin free media. Selection of putative transgenics The transformants were selected on 100 mg/l kanamy- cin in shoot bud induction medium (MS B5 contain- ing BAP and NAA) for first 30 days of culture. Subsequently, the kanamycin concentration was reduced to 50 mg/l for next cycle of 30 days in shoot elongation and proliferation medium (MS B5 contain- ing reduced levels of BAP and NAA). The regenerated shoots were rooted on ½ MS B5 medium and were taken to maturity in a transgenic glass house after pri- mary hardening. GUS histochemical analysis Transient and stable histochemical GUS assay was car- ried out in different tissues essentially as described by Jefferson (1987). PCR Analysis of putative transformants The leaf genomic DNA from T0 and T1 plants was iso- lated by Cetyl Trimethyl Ammonium Bromide (CTAB) method and used for molecular characterization of puta- tive transgenics by PCR using nptII and annexin gene specific primers. T0 plants were analyzed by PCR using npt II/annexin gene specific primers while T1 plants were analyzed using annexin gene specific primers only. The sequence of oligonucleotide for npt II primers was, Forward: 5’ - AAT ATC ACG GGT AGC CAA CG – 3’; Reverse: 5’ - GCT TGG GTG GAG AGG CTA TT - 3’ and annexin gene specific primers was, Forward: 5’- ATG GCG ACT CTT AAG GTT TCT T –3’; Reverse: 5’ - TCA CCG AGA AGT GCG ATG AG– 3’. PCR was carried out with 60 ng of purified genomic DNA, and Dream Taq polymerase (Genetix) in a Applied Bio- systems thermal cycler with previously standardized run conditions which included initial denaturation at 94°C for 5 min followed by 30 cycles of 94°C for 1 min, 55°C for 1 min and 72°C for 30 s and final extension at 72°C for 5 min. Plants confirming positive with PCR were taken to maturity and their seed was collected. The T0 seed so collected was sown in pots to raise T1 plants. The leaf genomic DNA from the T1 plants was analyzed by PCR using annexin gene specific primers. The genomic DNA from the un- transformed control plants and pCAMBIA 2301 annexin were used as negative and positive controls, respectively. The amplified products were separated by electrophoresis on a 0.8% agarose gel and visua- lized with ethidium bromide. Southern Blot Hybridization Leaf genomic DNA was isolated by CTAB method from the putative T0 annexin greengram transgenics deve- loped by Agrobacterium mediated transformation. Inte- gration of foreign gene in the host genome was determined by Southern analysis as per procedure described by Sambrook et al. 1989. Genomic DNA was digested with Pst I restriction enzyme which releases 1.5 kb gene cassette containing 954 bp annexin gene. The restricted DNA was blotted onto a Hybond N + membrane. Probe DNA was prepared from the PCR amplified product (941 bp) of annexin gene. The probe was made hot as per standard procedure with 32P. The Hybond N + membrane was incubated with pre- hybridization solution for 4 hrs and hybridization solu- tion (containing hot annexin 941 bp probe DNA) for 20 hrs. The Hybond N + membrane was washed and dried. Then the Hybond N + membrane was exposed to auto- radiography film for two weeks. DNA isolated from an untransformed control plant was also tested for the presence of annexin gene in order to determine if trans- gene was present. Abbreviations DCN: Double Cotyledonary Node; GUS: β-glucuronidase; PCR: Polymerase Chain Reaction; BAP: Benzlaminopurine; MSB5: Murashige and Skoog with B5 vitamins; CaMV: Cauliflower Mosaic Virus (CaMV); CTAB: Cetyl Trimethyl Ammonium Bromide. Competing interests The authors declare that they have no competing interests Authors’ contributions SKY conceived the study and has contributed to the experimental concept and design. KS, YV, NJL and MV contributed to the acquisition of data by carrying out different experiments. KA has contributed to Southern analysis. MM has made substantial contribution to experimental conception and design and in the initial draft preparation of the manuscript. AKS has helped in critically drafting and revising the manuscript for important intellectual content. BV has been involved in various suggestions while carrying out the study and critically going through the manuscript. PBK has helped in initial concept design and gene construct preparation. All authors read and approved the final manuscript. Acknowledgement Authors are grateful to Department of Biotechnology, New Delhi for providing financial support to part of this work and Centre for Application of Molecular Biology to International Agriculture (CAMBIA), Australia for plasmid 2301. Yadav et al. SpringerPlus 2012, 1:59 Page 7 of 8 http://www.springerplus.com/content/1/1/59 Author details 1Central Research Institute for Dryland Agriculture, Santoshnagar, Hyderabad 500 059, India. 2Division of Microbiology, Indian Agricultural Research Institute, New Delhi 110 012, India. 3Department of Life Sciences, University of Hyderabad, Hyderabad 500 046, India. Received: 11 September 2012 Accepted: 29 November 2012 Published: 10 December 2012 References Amutha S, Muruganantham M, Ganapathi A (2006) Thidiazuron induced high frequency axillary and adventitious shoot regeneration in Vigna radiata L. Wilczek. In Vitro Cell Dev Biol Plant 42:26–30 Bean SJ, Gooding PS, Mullineaux PM, Davies DR (1997) A simple system for pea transformation. Plant Cell Rep 16:513–519 Bidney D, Seelonge C, Martich J, Burrs M, Sims L et al (1992) Microprojectile bombardment of plant tissues increases transformation frequency by Agrobacterium tumefaciens. Plant Mol Biol 18:301–313 Binns AN, Thomashow MF (1988) Cell biology of Agrobacterium infection and transformation of plants. Annu Rev Microbiol 42:575–606 Chandra A, Pental D (2003) Regeneration and genetic transformation of grain legumes: An overview. Curr Sci 84:381–387 Dita MA, Rispail N, Prats E, Rubiales D, Singh KB (2006) Biotechnology approaches to overcome biotic and abiotic stress constraints in legumes. Euphytica 147:1–24 Eapen S (2008) Advances in development of transgenic pulse crops. Biotechnol Adv 26:162–168 Geetha N, Venkatachalam P, Laxmi Sita G (1999) Agrobacterium - mediated genetic transformation of pigeonpea (Cajanus cajan L.) and development of transgenic plants via direct organogenesis. Plant Biotechnol 16:213–218 Holford P, Hernandez N, Newberg HT (1992) Factors influencing the efficiency of T-DNA transfer during co-cultivation of Antirrhinum majus with Agrobacterium tumefaciens. Plant Cell Rep 11:196–199 Jaiwal PK, Gulati A (1995) Current status and future strategies of in vitro culture technique for genetic improvement of mung bean (Vigna radiata). Euphytica 86:167–181 Jaiwal PK, Kumari R, Ignacimuthu S, Potrykus I, Sautter C (2001) Agrobacterium tumefaciens- mediated transformation of mungbean (Agrobacterium L. Wilczek)-a recalcitrant grain legume. Plant Sci 161:239–247 Jaiwal PK, Sautter C, Potrykus I (1998) Agrobacterium rhizogenes mediated gene transfer in mung bean (Vigna radiata (L.) Wilczek). Current Sci 75:41–45 Jaiwal PK, Singh RP (eds) (2003) Improvement strategies for Leguminosae Biotechnology, 10Ath edn, Focus on biotechnology. Kluwer Academic Publisher, Dordrecht Jami SK, Clark GB, Tularpati SA, Handley C, Roux SJ et al (2008) Ectopic expression of an annexin from Brassica juncea confers tolerance to abiotic stress treatments in transgenic tobacco. Plant Physiol Biochem 46:1019–1030 Jefferson RA, Kavanagh TA, Bevan MW (1987) Gus fusion: β-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J 6:3901– 3907 Kaviraj CP, Kiran G, Venugopal RB, Kavikishor PB, Rao S (2006) Effective Somatic embryogenesis and plant regeneration from cotyledonary explants of green gram (Vigna radiata (L) Wilczek)-A recalcitrant grain legume. In Vitro Cell Dev Biol-Plant 42:134–138 Li HY, Zhu YM, Chen Q, Conner RL, Ding XD et al (2004) Production of transgenic sorghum plants with two anti-fungal protein genes via Agrobacterium and particle bombardment. Biol Plant 48:367–374 Mahalakshmi LS, Leela T, Manoj Kumar S, Kiran Kumar B, Naresh B et al (2006) Enhanced genetic transformation efficiency of mungbean by use of primary leaf explants. Curr Sci 91:93–98 Mohan KL, Krishnamurthy KV (2003) Plant regeneration from decapitated mature embryo axis and Agrobacterium mediated genetic transformation of pigeon pea. Biol Plant 46:519–527 Mundhara R, Rashid A (2006) Recalcitrant Grain Legume Vigna radiata, Mung Bean, Made to Regenerate on Change of Hormonal and Cultural Conditions. Plant Cell Tissue Organ Cult 85:265–270 Muthukumar B, Mariamma M, Veluthambi K, Gnanam A (1996) Genetic transformation of cotyledon explants of cowpea (Vigna unguiculata L. Walp.) using Agrobacterium tumefaciens. Plant Cell Rep 15:980–985 Phogat SK, Karthikeyan AS, Veluthambi K (1999) Generation of transformed calli of Vigna radiata (L.) Wilczek by Agrobacterium tumefaciens- mediated transformation. J Plant Biol 26:77–82 Popelka JC, Terryn N, Higgins TJV (2004) Gene technology for grain legumes: Can it contribute to the food challenge in developing countries? Plant Sci 167:195–206 Saini R, Jaiwal PK (2007) Agrobacterium tumefaciens- mediated transformation of blackgram: an assessment of factors influencing the efficacy of uidA gene transfer. Biol Plant 51:69–74 Sambrrok J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Plainview, NY Somers DA, Samac DA, Olhoft M (2003) Recent advances in legume transformation. Plant Physiol 131:892–899 Srivastava T, Sandip D, Sudhir Kuamr S, Srivastava PS (2009) A reliable protocol for transformation of Catharanthus roseus through Agrobacterium tumefaciens. Physiol Mol Biol Plants 15:93–98 Stachel SE, Messens E, Van Montagu M, Zambryski P (1985) Identification of signal molecules produced by wounded plant cells that activate T-DNA vir gene expression. Nature 318:624–629 Uranbey S, Sevimay CS, Kaya MD, Ipek A, Sancak C et al (2007) Influence of different co-cultivation temperatures, periods and media on Agrobacterium tumefaciens mediated gene transfer. Biol Plant 49:53–57 Vijayan S, Beena MR, Kirti PB (2006) Effective and simple regeneration of mungbean (Vigna radiata (L). Wilzcek) using cotyledonary node explants. J Plant Biochem Biotechnol 15:131–134 Yadav SK, Gopala Krishna M, Maheswari M, Vanaja M, Venkateswarlu B (2010a) High frequency induction of multiple shoots and plant regeneration from cotyledonary node explant of mung bean (Vigna radiata L Wilczek). J Plant Biochem Biotech 19:267–270 Yadav SK, Sreenu P, Maheswari M, Vanaja M, Venkateswarlu B (2010b) Efficient shoot regeneration from double cotyledonary node explants of green gram (Vigna radiata L Wilczek). Indian J Biotech 9:403–407 doi:10.1186/2193-1801-1-59 Cite this article as: Yadav et al.: Optimization of Agrobacterium mediated genetic transformation of cotyledonary node explants of Vigna radiata. SpringerPlus 2012 1:59. Submit your manuscript to a journal and benefi t from: 7 Convenient online submission 7 Rigorous peer review 7 Immediate publication on acceptance 7 Open access: articles freely available online 7 High visibility within the fi eld 7 Retaining the copyright to your article Submit your next manuscript at 7 springeropen.com Yadav et al. SpringerPlus 2012, 1:59 Page 8 of 8 http://www.springerplus.com/content/1/1/59

Title: Optimization of Agrobacterium mediated genetic transformation of cotyledonary node explants of Vigna radiata Authors: Sushil Kumar Yadav, Sweety Katikala, Varalaxmi Yellisetty, Annapurna Kannepalle, Jyothi Lakshmi Narayana, Vanaja Maddi, Maheswari Mandapaka, Arun Kumar Shanker, Venkateswarlu Bandi, Kirti Pulugurtha Bharadwaja ​ Publisher: SpringerPlus Date: 2012-12-10 00:00:00 Abstract: A reproducible and highly efficient protocol for genetic transformation mediated by Agrobacterium has been established for greengram (Vigna radiata L. Wilczek). ​ Double cotyledonary node (DCN) explants were inoculated with Agrobacterium tumefaciens strain LBA 4404 harboring a binary vector pCAMBIA 2301 containing neomycin phosphotransferase (npt II) gene as selectable marker, β-glucuronidase (GUS) as a reporter (uidA) gene and annexin 1bj gene. ​ Important parameters like optical density of Agrobacterium culture, culture quantity, infection medium, infection and co-cultivation time and acetosyringone concentration were standardized to optimize the transformation frequency. ​ Kanamycin at a concentration of 100 mg/l was used to select transformed cells. ​ Transient and stable GUS expressions were studied in transformed explants and regenerated putative plants, respectively. ​ Transformed shoot were produced on regeneration medium containing 100 mg/l kanamycin and 250 mg/l cefotaxime and rooted on ½ MS medium. ​ Transient and constitutive GUS expression was observed in DCN explants and different tissues of T0 and T1 plants. ​ Rooted T0 and T1 shoots confirming Polymerase Chain Reaction (PCR) positive for npt II and annexin 1bj genes were taken to maturity to collect the seeds. ​ Integration of annexin gene into the greengram genome was confirmed by Southern blotting. ​

High quality, low molecular weight shrimp and crab chitosans obtained by short‐time holistic high‐power microwave technology.pdf

Vol.:(0123456789) SN Applied Sciences (2023) 5:365 | https://doi.org/10.1007/s42452-023-05602-6 Research Article High quality, low molecular weight shrimp and crab chitosans obtained by short‑time holistic high‑power microwave technology Alaa Ewais1 · R. A. Saber1 · A. Abdel Ghany1 · A. Sharaf1 · Mahmoud Sitohy2  Received: 9 February 2023 / Accepted: 8 November 2023 © The Author(s) 2023    OPEN Abstract The study sought to investigate the impact of a holistic high-power microwave technology during all stages of the extrac- tion on the quality, time of extraction, and degree of deacetylation (DD) of shrimp chitosan (SC) and crab chitosan (KC). The demineralization and deproteinization stages took 7 and 8 min, at 750 and 875 W, respectively. The deacetylation process was conducted at two powers, 875 W and 1250 W, for 10, 15, and 20 min. It only took 25 min at 875 W to suc- cessfully prepare chitosan with a high DD and 30 min to reach the maximum DD. The highest DDs by the potentiomet- ric titration method, FTIR, and 1H NMR of SC were 86.6%, 86.7%, and 83%, compared to 83.8%, 82.7%, and 80% for KC, respectively. Extracted SC had 79% solubility, 14.125 kDa, a 46.57% crystallinity index, 705.40% WBC, and 434.60% FBC, against 74.5%, 16.982 kDa, 74.14%, 689.82%, and 413.20% for KC, respectively. The study proved that 30 min of holistic high-power microwave at 875 W produced low-molecular-weight chitosan with relatively high deacetylation and low content of viscosity, crystallinity, and protein residue. The technique can provide a feasible alternative to the commercial production of low-molecular-weight chitosan in less time and energy. Article Highlights • High-power (875 W) microwave irradiation at 15 min- deacetylation produced Chitosan’s maximum deacety- lation degree (DD). • Holistic microwave irradiation (MW) can successfully produce high DD chitosan, and low molecular weight in 30 min. • The chemical structure of MW-extracted chitosan was confirmed by FTIR and 1H NMR and low crystallinity by X-ray. Keywords  Low-molecular-weight chitosan · Microwave technology · Deacetylation degree · X-ray · FTIR · 1H NMR Supplementary Information  The online version contains supplementary material available at https://​doi.​org/​10.​1007/​s42452-​023-​ 05602-6. *  Mahmoud Sitohy, [email protected] | 1Biochemistry Branch, Soil and Water Science Department, Faculty of Technology and Development, Zagazig University, Zagazig 44519, Egypt. 2Biochemistry Department, Faculty of Agriculture, Zagazig University, Zagazig 44511, Egypt. Vol:.(1234567890) Research Article SN Applied Sciences (2023) 5:365 | https://doi.org/10.1007/s42452-023-05602-6 1  Introduction Generally, optimizing the preparation conditions of biologically active macromolecules is a useful approach to getting the intended product under the least dras- tic and most favorable conditions for good yield while taking into consideration all the influencing factors [1, 2]. Since a variety of processing agents affect chitosan’s physical and chemical properties, it appears that produc- ing highly deacetylated chitosan in the shortest possible time by a simple and economical method on a commer- cial scale is a hard task. Chitosan is a linear amino-polysaccharide derived from the alkaline deacetylation of biopolymer-chitin at high temperatures. During deacetylation, N-acetyl-D- glucosamine units are transformed into D-glucosamine units, including free amino groups that have a positive ionic charge. The free amino groups turn chitosan into a cationic form, with possibly valuable antiviral or anti- bacterial activities like cationic proteins, being reported as antiviral [3, 4] and antibacterial activities [5, 6]. The positive ionic charge of chitosan allows it to chemically bind to fats, and bile acids, and target the bacterial nega- tive cytoplasmic bacterial membrane. This property is the major factor that makes it a versatile tool for a wide range of applications [7, 8]. Additionally, low molecu- lar weight chitosan has been proven to possess high biological activity, allowing it to be employed in many applications such as pharmaceuticals, medical fields, aquaculture, food technology, and water treatment [9]. Several scientists offered various strategies for the production of chitosan through chitin deacetylation; most of these were based on the use of strong solutions of sodium hydroxide at high temperatures, including alkaline high-temperature treatments at high pressures, ultrasound deacetylation, and enzymatic deacetylation. Chitosan was generally developed using traditional heating methods that required a great deal of time and energy. Many authors are currently dealing with chitin and chitosan extraction time problems [10]. Chitosan extraction takes a lot of time and takes a lot of energy by using conventional methods. Microwave technology is considered to be a great alternative to con- ventional methods because it allows for faster reactions, shorter reaction times, reduction of energy consump- tion, and fewer side reactions. Microwave irradiation is gaining traction as a renewable energy source capable of completing chemical transformations in minutes rather than hours or days [10, 11]. Mostly, microwave irradiation was used in the final phase of the chitosan extraction process, converting chitin to chitosan [12]. In addition, the previous studies extracted high molecular chitosan using a low microwave power at the deacetylation step. To get low molecular chitosan the previous methods needed to undergo a subsequent step (depolymeriza- tion), extending the time of preparation, and raising the total costs. This study assumes that using a holistic high- power microwave technique to extract chitosan at all stages of the extraction process will result in high-qual- ity chitosan with a high degree of deacetylation (DD) in a short amount of time. Therefore, this work aimed to obtain chitosan of good quality in a very short time using holistic high-power microwave technology. Developing the process of chi- tosan extraction via using a holistic high-power microwave technology may lead to new products with probably low molecular weight and upgraded physicochemical prop- erties. Thus, it is possible to obtain highly solubilized chi- tosan in the least amount of time and at the lowest cost without using the depolymerization stage. 2  Materials and methods 2.1  Raw materials The shrimp shells (Metapenaeus monoceros (Fabricius)) and crab exoskeletons (Portunus pelagicus) were collected from seafood restaurants in Zagazig, El-Sharkiya Governorate, Egypt. The shrimp shells were collected during the same week while crab exoskeletons samples were collected dur- ing the same day. All samples were frozen until further processing. After removing the residual meat, shells were cleaned with tap water and subsequently distilled water, then left to dry at 65 ºC to a constant weight. The dried material was ground and sifted through a 250 µm sieve, then stored in a freezer until use. 2.2  Chemical reagents All the chemicals and solvents utilized in this investigation were purchased at the highest analytical grade or extra purity. Hydrochloric acid (HCl) and acetic acid ­(CH3COOH) were purchased from SD Fine-Chem Limited, India. Sodium Hydroxide pellets (NaOH), Acetone ­(CH3COCH3), Ethyl alco- hol ­(C2H5OH 95%), and commercial chitosan (75%) were purchased from Loba Chemie Pvt. Ltd. for High-Grade Laboratory Reagents and Fine Chemicals Mumbai, India. Vol.:(0123456789) SN Applied Sciences (2023) 5:365 | https://doi.org/10.1007/s42452-023-05602-6 Research Article References 1. Sitohy M, Taha S, Osman A, Abdel-Hamid M, Hamed A, Abdel- backi A (2020) Antiviral action of native and methylated lactofer- rin and β-lactoglobulin against potato virus Y (PVY) infected into potato plants grown in an open field. Antibiotics 9:430. https://​ doi.​org/​10.​3390/​antib​iotic​s9070​430 2. Sitohy M, Mahgoub S, Osman A (2011) Controlling psychro- trophic bacteria in raw buffalo milk preserved at 4 C with ester- ified legume proteins. LWT-Food Sci Technol 44:1697–1702. https://​doi.​org/​10.​1016/j.​lwt.​2011.​03.​008 3. Chobert JM, Sitohy M, Billaude S, Dalgalarrondo M, Haertlé T (2007) Anticytomegaloviral activity of esterified milk proteins and L-Polylysines. J Mol Microbiol Biotechnol 13:255–258 4. Sitohy M, Taha S, Abdel-Hamid M, Abdelbacki A, Hamed A, Osman A (2021) Protecting potato plants against PVX and PVY viral infections by the application of native and chemically mod- ified legume proteins. J Plant Dis Prot 128:1101–1114. https://​ doi.​org/​10.​1007/​S41348-​021-​00448-9 5. Osman A, El-Didamony G, Sitohy M, Khalifa M, Enan G (2016) Soybean glycinin basic subunit inhibits methicillin resistant- vancomycin intermediate Staphylococcus aureus (MRSA-VISA) in vitro. Int J Appl Res Nat Prod 9:17–26 6. Sitohy M, Mahgoub S, Osman A, El-Masry R, Al-Gaby A (2013) Extent and mode of action of cationic legume proteins against Listeria monocytogenes and Salmonella Enteritidis. Probiot- ics Antimicrob Proteins 5:195–205. https://​doi.​org/​10.​1007/​ s12602-​013-​9134-2 7. Chattopadhyay K, Xavier KM, Balange A, Layana P, Nayak BB (2019) Chitosan gel addition in pre-emulsified fish mince-Effect on quality parameters of sausages under refrigerated storage. LWT 110:283–291. https://​doi.​org/​10.​1016/j.​lwt.​2019.​04.​081 8. Sabu S, Ashita T, Stephy S (2020) Chitosan and lemon peel extract coating on quality and shelf life of yellowfin tuna (Thunnus albacares) meat stored under refrigerated condition. Indian J Fish 67:114–122. https://​doi.​org/​10.​21077/​ijf.​2019.​67.1.​ 91361-​15 9. Minh NC, Van Hoa N, Trung TS (2020) Preparation, properties, and application of low-molecular-weight chitosan. In: Hand- book of Chitin and Chitosan, Elsevier, Amsterdam, vol 1, pp 453–471. https://​doi.​org/​10.​1016/​B978-0-​12-​817970-​3.​00015-8 10. El Knidri H, Belaabed R, Addaou A, Laajeb A, Lahsini A (2018) Extraction, chemical modification and characterization of chitin and chitosan. Int J Biol Macromol 120:1181–1189. https://​doi.​ org/​10.​1016/j.​ijbio​mac.​2018.​08.​139 11. Omara NA, Elsebaie EM, Kassab HE, Salama AA (2019) Produc- tion of chitosan from shrimp shells by microwave technique and its use in minced beef preservation. Slov Vet Res 56:773–780. https://​doi.​org/​10.​26873/​SVR-​818-​2019 12. Al Sagheer FA, Al-Sughayer MA, Muslim S, Elsabee MZ (2009) Extraction and characterization of chitin and chitosan from marine sources in Arabian Gulf. Carbohyd Polym 77:410–419. https://​doi.​org/​10.​1016/j.​carbp​ol.​2009.​01.​032 13. Joshi DR, Adhikari N (2019) An overview on common organic solvents and their toxicity. J Pharm Res Int 28(3):1–18. https://​ doi.​org/​10.​9734/​jpri/​2019/​v28i3​30203 14. AOAC (2000) Association of Official Analytical Chemists. Official Methods of Analysis, seven tenth ed. 15. Xie J, Xie W, Yu J, Xin R, Shi Z, Song L, Yang X (2021) Extraction of chitin from shrimp shell by successive two-step fermenta- tion of Exiguobacterium profundum and Lactobacillus acidophi- lus. Front Microbiol 12:677126. https://​doi.​org/​10.​3389/​fmicb.​ 2021.​677126 16. Czechowska-Biskup R, Jarosińska D, Rokita B, Ulański P, Rosiak JM (2012) Determination of degree of deacetylation of chitosan-comparison of methods. Prog Chem Appl Chitin Deriv 17:5–20 17. Agarwal M, Agarwal MK, Shrivastav N, Pandey S, Gaur P (2018) A simple and effective method for preparation of chitosan from chitin. Int J Life Sci Sci Res 41:1721–1728. https://​doi.​org/​10.​ 21276/​ijlssr.​2018.4.​2.​18 18. Kumari S, Annamareddy SHK, Abanti S, Rath PK (2017) Physico- chemical properties and characterization of chitosan synthe- sized from fish scales, crab and shrimp shells. Int J Biol Macromol 104:1697–1705. https://​doi.​org/​10.​1016/j.​ijbio​mac.​2017.​04.​119 19. Ocloo FCK, Quayson ET, Adu-Gyamfi A, Quarcoo EA, Asare D, Serfor-Armah Y, Woode BK (2011) Physicochemical and func- tional characteristics of radiation-processed shrimp chitosan. Radiat Phys Chem 80:837–841. https://​doi.​org/​10.​1016/j.​radph​ yschem.​2011.​03.​005 20. Norzita Y, Norhashidah T, Maznah M (2013) Determination of viscosity-average molecular weight of chitosan using intrinsic viscosity measurement. J Nuclear Relat Technol 10:39–44 21. Maji TK, Hussain MR, Iman M (2013) Determination of degree of deacetylation of chitosan and their effect on the release behav- ior of essential oil from chitosan and chitosan-gelatin complex microcapsules. Int J Adv Eng Appl. 6:4–12 22. Rout SK (2001) Physicochemical, functional and spectroscopic analysis of crawfish chitin and chitosan as affected by process modification. ‏PhD Thesis, Louisiana State University and Agri- cultural & Mechanical College. https://​digit​alcom​mons.​lsu.​edu/​ grads​chool_​disst​heses/​432 23. Alvarenga ES, de Oliveira CP, Bellato CR (2010) An approach to understanding the deacetylation degree of chitosan. Carbohyd Polym 80:1155–1160. https://​doi.​org/​10.​1016/j.​carbp​ol.​2010.​01.​ 037 24. Liu S, Sun J, Yu L, Zhang C, Bi J, Zhu F, Yang Q (2012) Extraction and characterization of chitin from the beetle Holotrichia paral- lela Motschulsky. Molecules 17:4604–4611. https://​doi.​org/​10.​ 3390/​molec​ules1​70446​04 25. Olafadehan OA, Amoo KO, Ajayi TO, Bello VE (2021) Extraction and characterization of chitin and chitosan from Callinectes amnicola and Penaeus notialis shell wastes. J Chem Eng Mater Sci 12:1–30. https://​doi.​org/​10.​5897/​JCEMS​2020.​0353 26. Hamdi M, Nasri R, Dridi N, Li S, Nasri M (2020) Development of novel high-selective extraction approach of carotenopro- teins from blue crab (Portunus segnis) shells, contribution to the qualitative analysis of bioactive compounds by HR-ESI-MS. Food Chem 302:125334. https://​doi.​org/​10.​1016/j.​foodc​hem.​ 2019.​125334 27. Zhang P, Hu H, Tang H, Yang Y, Liu H, Lu Q, Yao H (2019) In-depth experimental study of pyrolysis characteristics of raw and cook- ing treated shrimp shell samples. Renew Energy 139:730–738. https://​doi.​org/​10.​1016/j.​renene.​2019.​02.​119 28. Rødde RH, Einbu A, Vårum KM (2008) A seasonal study of the chemical composition and chitin quality of shrimp shells obtained from northern shrimp (Pandalus borealis). Carbohyd Polym 71:388–393. https://​doi.​org/​10.​1016/j.​carbp​ol.​2007.​06.​ 006 29. Hahn T, Tafi E, Paul A, Salvia R, Falabella P, Zibek S (2020) Cur- rent state of chitin purification and chitosan production from insects. J Chem Technol Biotechnol 95:2775–2795. https://​doi.​ org/​10.​1002/​jctb.​6533 30. Pighinelli L, Broquá J, Zanin BG, Flach AM, Mallmann C, Taborda FGD, Dias RJSP (2019) Methods of chitin production a short review. Am J Biomed Sci Res 3:307–314. https://​doi.​ org/​10.​34297/​AJBSR.​2019.​03.​000682 31. da Silva Lucas AJ, Oreste EQ, Costa HLG, López HM, Saad CDM, Prentice C (2021) Extraction, physicochemical characteriza- tion, and morphological properties of chitin and chitosan Vol:.(1234567890) Research Article SN Applied Sciences (2023) 5:365 | https://doi.org/10.1007/s42452-023-05602-6 from cuticles of edible insects. Food Chem 343:128550. https://​doi.​org/​10.​1016/j.​foodc​hem.​2020.​128550 32. Samar MM, El-Kalyoubi MH, Khalaf MM, Abd El-Razik MM (2013) Physicochemical, functional, antioxidant and antibac- terial properties of chitosan extracted from shrimp wastes by microwave technique. Ann Agric Sci 58:33–41. https://​doi.​org/​ 10.​1016/j.​foodc​hem.​2020.​128550 33. Knidri HE, Dahmani J, Addaou A, Laajeb A, Lahsini A (2019) Rapid and efficient extraction of chitin and chitosan for scale- up production: effect of process parameters on deacetylation degree and molecular weight. Int J Biol Macromol 139:1092– 1102. https://​doi.​org/​10.​1016/j.​ijbio​mac.​2019.​08.​079 34. Campana-Filho SP, Britto DD, Curti E, Abreu FR, Cardoso MB, Battisti MV, Lavall RL (2007) Extraction, structures and proper- ties of alpha-and beta-chitin. Quim Nova 30:644–650. https://​ doi.​org/​10.​1590/​S0100-​40422​00700​03000​26 35. Lertsutthiwong P, How NC, Chandrkrachang S, Stevens WF (2002) Effect of chemical treatment on the characteristics of shrimp Chitosan. J Metals Mater Min 12:11–18 36. Marei NH, Abd El-Samie E, Salah T, Saad GR, Elwahy AH (2016) Isolation and characterization of chitosan from different local insects in Egypt. Int J Biol Macromol 82:871–877. https://​doi.​ org/​10.​1016/j.​ijbio​mac.​2015.​10.​024 37. Seekaew Y, Arayawut O, Timsorn K, Wongchoosuk C (2019) Synthesis, characterization, and applications of graphene and derivatives. Carbon-based nanofillers and their rubber nano- composites. Elsevier, Amsterdam, pp 259–283. https://​doi.​org/​ 10.​1016/​B978-0-​12-​813248-​7.​00009-2 38. Albuquerque HM, Pinto DC, Silva AM (2021) Microwave irradia- tion: alternative heating process for the synthesis of biologi- cally applicable chromones, quinolones, and their precursors. Molecules 26(20):6293. https://​doi.​org/​10.​3390/​molec​ules2​ 62062​93 39. Santos VP, Maia P, Alencar NDS, Farias L, Andrade RFS, Souza D, Campos-Takaki GM (2019) Recovery of chitin and chitosan from shrimp waste with microwave technique and versatile application. Arq Inst Biol 86:e0982018. https://​doi.​org/​10.​ 1590/​1808-​16570​00982​018 40. El Knidri H, El Khalfaouy R, Laajeb A, Addaou A, Lahsini A (2016) Eco-friendly extraction and characterization of chitin and chitosan from the shrimp shell waste via microwave irra- diation. Process Saf Environ Prot 104:395–405. https://​doi.​org/​ 10.​1016/j.​psep.​2016.​09.​020 41. He X, Li K, Xing R, Liu S, Hu L, Li P (2016) The production of fully deacetylated chitosan by compression method. Egypt J Aquat Res 42:75–81. https://​doi.​org/​10.​1016/j.​ejar.​2015.​09.​003 42. Akpan EI, Gbenebor OP, Adeosun SO, Cletus O (2020) Solubil- ity, degree of acetylation, and distribution of acetyl groups in chitosan. Handbook of Chitin and Chitosan. Elsevier, Amster- dam, pp 131–164. https://​doi.​org/​10.​1016/​B978-0-​12-​817970-​ 3.​00005-5 43. Divya K, Rebello S, Jisha MS (2014) A simple and effective method for extraction of high purity chitosan from shrimp shell waste. In: Proceedings of the international conference on advances in applied science and environmental engineering— ASEE. ‏https://​doi.​org/​10.​15224/​978-1-​63248-​004-0-​93 44. Mohan K, Ganesan AR, Muralisankar T, Jayakumar R, Sathishku- mar P, Uthayakumar V, Revathi N (2020) Recent insights into the extraction, characterization, and bioactivities of chitin and chi- tosan from insects. Trends Food Sci Technol 105:17–42. https://​ doi.​org/​10.​1016/j.​tifs.​2020.​08.​016 45. Rasweefali MK, Sabu S, Sunooj KV, Sasidharan A, Xavier KM (2021) Consequences of chemical deacetylation on physico- chemical, structural and functional characteristics of chitosan extracted from deep-sea mud shrimp. Carbohydr Polym Technol Appl 2:100032. https://​doi.​org/​10.​1016/j.​carpta.​2020.​100032 46. Fernandez-Kim SO (2004) Physicochemical and functional prop- erties of crawfish chitosan as affected by different processing protocols. ‏https://​digit​alcom​mons.​lsu.​edu/​grads​chool_​theses/​ 1338 47. Kucukgulmez A, Celik M, Yanar Y, Sen D, Polat H, Kadak AE (2011) Physicochemical characterization of chitosan extracted from Metapenaeusstebbingi shells. Food Chem 126:1144–1148. https://​doi.​org/​10.​1016/j.​foodc​hem.​2010.​11.​148 48. Cho YI, No HK, Meyers SP (1998) Physicochemical characteristics and functional properties of various commercial chitin and chi- tosan products. J Agric Food Chem 46:3839–3843. https://​doi.​ org/​10.​1021/​jf971​047f 49. Huang YL, Tsai YH (2020) Extraction of chitosan from squid pen waste by high hydrostatic pressure: effects on physicochemical properties and antioxidant activities of chitosan. Int J Biol Mac- romol 160:677–687. https://​doi.​org/​10.​1016/j.​ijbio​mac.​2020.​05.​ 252 50. Gonçalves C, Ferreira N, Lourenço L (2021) Production of low molecular weight chitosan and chitooligosaccharides (COS): a review. Polymers 13:2466. https://​doi.​org/​10.​3390/​polym​13152​ 466 51. Costa CN, Teixeira VG, Delpech MC, Souza JVS, Costa MA (2015) Viscometric study of chitosan solutions in acetic acid/sodium acetate and acetic acid/sodium chloride. Carbohyd Polym 133:245–250. https://​doi.​org/​10.​1016/j.​carbp​ol.​2015.​06.​094 52. El-Sayed ST, Ali AM, Omar NI (2019) A comparative evaluation of antimicrobial activity of chitooligosaccharides with broad spectrum antibiotics on growth of some pathogenic microor- ganisms. Biocatal Agric Biotechnol 22:101382. https://​doi.​org/​ 10.​1016/j.​bcab.​2019.​101382 53. Chang SH, Wu CH, Tsai GJ (2018) Effects of chitosan molecular weight on its antioxidant and antimutagenic properties. Car- bohyd Polym 181:1026–1032. https://​doi.​org/​10.​1016/j.​carbp​ ol.​2017.​11.​047 54. Kaya M, Baran T, Asan-Ozusaglam M, Cakmak YS, Tozak KO, Mol A, Sezen G (2015) Extraction and characterization of chitin and chitosan with antimicrobial and antioxidant activities from cos- mopolitan Orthoptera species (Insecta). J Biotechnol Bioprocess Eng 20:168–179. https://​doi.​org/​10.​1007/​s12257-​014-​0391-z 55. Kim SK (2010) Chitin, chitosan, oligosaccharides and their deriv- atives: biological activities and applications. CRC Press, Boca Raton. https://​doi.​org/​10.​1201/​EBK14​39816​035 56. Sudatta BP, Sugumar V, Varma R, Nigariga P (2020) Extraction, characterization and antimicrobial activity of chitosan from pen shell, Pinna bicolor. Int J Biol Macromol 163:423–430. https://​doi.​ org/​10.​1016/j.​ijbio​mac.​2020.​06.​291 57. Weißpflog J, Vehlow D, Müller M, Kohn B, Scheler U, Boye S, Schwarz S (2021) Characterization of chitosan with different degree of deacetylation and equal viscosity in dissolved and solid state–Insights by various complimentary methods. Int J Biol Macromol 171:242–261. https://​doi.​org/​10.​1016/j.​ijbio​mac.​ 2021.​01.​010 58. Yang J, Shen M, Luo Y, Wu T, Wen H, Xie J (2021) Construction and characterization of Mesonachinensis polysaccharide-chitosan hydrogels, role of chitosan deacetylation degree. Carbohyd Polym 257:117608. https://​doi.​org/​10.​1016/j.​carbp​ol.​2020.​ 117608 59. Apriyanti DT, Susanto H, Rokhati N (2018) Influence of micro- wave irradiation on extraction of chitosan from shrimp shell waste. Reaktor 18:45–50. https://​doi.​org/​10.​14710/​reakt​or.​18.1.​ 45-​50 60. Boudouaia N, Bengharez Z, Jellali S (2019) Preparation and char- acterization of chitosan extracted from shrimp shells waste and chitosan film: application for Eriochrome black T removal from aqueous solutions. Appl Water Sci 9:1–12. https://​doi.​org/​10.​ 1007/​s13201-​019-​0967-z Vol.:(0123456789) SN Applied Sciences (2023) 5:365 | https://doi.org/10.1007/s42452-023-05602-6 Research Article 61. Saeed A, Zahid S, Sajid M, Ud Din S, Alam MK, Chaudhary FA, Abutayyem H (2022) Physico-mechanical properties of com- mercially available tissue conditioner modified with synthesized chitosan oligosaccharide. Polymers 14(6):1233. https://​doi.​org/​ 10.​3390/​polym​14061​233 62. Mourya VK, Inamdar NN, Choudhari YM (2011) Chitooligosac- charides: synthesis, characterization and applications. Polym Sci, Ser A 53:583–612. https://​doi.​org/​10.​1134/​S0965​545X1​10700​66 63. Suryani S, Chaerunisaa AY, Joni IM, Ruslin R, Ramadhan LOAN, Wardhana YW, Sabarwati SH (2022) Production of low molecular weight chitosan using a combination of weak acid and ultra- sonication methods. Polymers 14(16):3417. https://​doi.​org/​10.​ 3390/​polym​14163​417 64. Leke-Aladekoba AA (2018) Comparison of extraction methods and characterisation of chitin and chitosan with antimicrobial and antioxidant properties from black soldier fly (Hermetiail- lucens) meal. ‏http://​hdl.​handle.​net/​10222/​75013 65. Gbenebor OP, Adeosun SO, Lawal GI, Jun S, Olaleye SA (2017) Acetylation, crystalline and morphological properties of struc- tural polysaccharide from shrimp exoskeleton. Eng Sci Technol Int J 20:1155–1165. https://​doi.​org/​10.​1016/j.​jestch.​2017.​05.​002 66. Ibitoye EB, Lokman IH, Hezmee MNM, Goh YM, Zuki ABZ, Jimoh AA (2018) Extraction and physicochemical characterization of chitin and chitosan isolated from house cricket. Biomed Mater 13:025009. https://​doi.​org/​10.​1088/​1748-​605X/​aa9dde 67. De Queiroz ARSCM, Lia Fook BRP, de Oliveira Lima VA, de Farias Rached RÍ, Lima EPN, da Silva Lima RJ, Lia Fook MV (2017) Prep- aration and characterization of chitosan obtained from shells of shrimp (Litopenaeus vannamei Boone). Mar Drugs 15:141. https://​doi.​org/​10.​3390/​md150​50141 68. Jampafuang Y, Tongta A, Waiprib Y (2019) Impact of crystal- line structural differences between α-and β-Chitosan on Their nanoparticle formation via ionic gelation and superoxide radi- cal scavenging activities. Polymers 11:2010. https://​doi.​org/​10.​ 3390/​polym​11122​010 69. Cunha RA, Soares TA, Rusu VH, Pontes FJ, Franca EF, Lins RD (2012) The molecular structure and conformational dynamics of chitosan polymers: an integrated perspective from experi- ments and computational simulations. Complex World Poly- sacch. https://​doi.​org/​10.​5772/​51803 Publisher’s Note  Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Title: High quality, low molecular weight shrimp and crab chitosans obtained by short-time holistic high-power microwave technology ​ Authors: Alaa Ewais, R. A. Saber, A. Abdel Ghany, A. Sharaf, Mahmoud Sitohy ​ Publisher: Springer Nature ​ Date: 2023-11-08 00:00:00 Abstract: The study sought to investigate the impact of a holistic high-power microwave technology during all stages of the extraction on the quality, time of extraction, and degree of deacetylation (DD) of shrimp chitosan (SC) and crab chitosan (KC). ​ The demineralization and deproteinization stages took 7 and 8 min, at 750 and 875 W, respectively. ​ The deacetylation process was conducted at two powers, 875 W and 1250 W, for 10, 15, and 20 min. ​ It only took 25 min at 875 W to successfully prepare chitosan with a high DD and 30 min to reach the maximum DD. ​ The highest DDs by the potentiometric titration method, FTIR, and 1H NMR of SC were 86.6%, 86.7%, and 83%, compared to 83.8%, 82.7%, and 80% for KC, respectively. ​ Extracted SC had 79% solubility, 14.125 kDa, a 46.57% crystallinity index, 705.40% WBC, and 434.60% FBC, against 74.5%, 16.982 kDa, 74.14%, 689.82%, and 413.20% for KC, respectively. ​ The study proved that 30 min of holistic high-power microwave at 875 W produced low-molecular-weight chitosan with relatively high deacetylation and low content of viscosity, crystallinity, and protein residue. ​ The technique can provide a feasible alternative to the commercial production of low-molecular-weight chitosan in less time and energy.

High-harmonic generation in CdTe with ultra-low pump intensity and high photon flux.pdf

ARTICLE High-harmonic generation in CdTe with ultra-low pump intensity and high photon flux Zhe Long1,5, Hang Yang1,5, Kan Tian1, Linzhen He1, Rui Qin2, Zi-Yu Chen 3✉, Qi Jie Wang 4 & Houkun Liang 1✉ An ultra-low pump intensity and high photon flux have been long pursuits of high harmonic generation (HHG) in solids. However, there is lack of a criterion to identify a pristine solid material exhibiting such characteristics. Here, we report systematic investigation into HHG from a cadmium telluride (CdTe) bulk crystal with a flat band dispersion near the Fermi level which leads to a large density of states. The measured pump intensity for the 31st harmonics (229 nm) is only 75 GW/cm2, one order of magnitude lower than that of other pristine crystals including two-dimensional materials reported so far. A comparative measurement shows CdTe has two-to-three orders of magnitude stronger HHG than silicon does, and high HHG yields in the ultraviolet region compared to GaSe. A high photon flux of ~ 6 × 1012 photons/s (5th−8th) with a robust long-time sustainability is obtained. This work offers a route towards compact vacuum ultraviolet laser sources. https://doi.org/10.1038/s42005-023-01354-2 OPEN 1 School of Electronics and Information Engineering, Sichuan University, Chengdu, Sichuan 610064, China. 2 National Key Laboratory of Shock Wave and Detonation Physics, Institute of Fluid Physics, China Academy of Engineering Physics, Mianyang 621999, China. 3 Key Laboratory of High Energy Density Physics and Technology (MoE), College of Physics, Sichuan University, Chengdu 610064, China. 4 School of Electrical & Electronic Engineering & The Photonics Institute, Nanyang Technological University, 639798 Singapore, Singapore. 5These authors contributed equally: Zhe Long, Hang Yang. ✉email: [email protected]; [email protected] COMMUNICATIONS PHYSICS | (2023) 6:228 | https://doi.org/10.1038/s42005-023-01354-2 | www.nature.com/commsphys 1 1234567890():,; H igh harmonic generation (HHG), traditionally occurred in rare-gas atoms irradiated by intense laser pulses, has been extensively explored as coherent light sources with short wavelength in the vacuum-extreme ultraviolet spectral region and ultrashort duration in the attosecond regime. In recent years, HHG in solids has been observed from a wide variety of materials and attracted a great deal of attention. Typical examples include dielectrics such as ZnO1, MgO2, silicon3, SiO24, sapphire5, and GaSe6,7 as well as two-dimensional materials like MoS28, graphene9. In Table 1, we present a survey of representative works of HHG in solids with five categories of materials as bulk, thin films, two-dimensional materials, topologically protected materials, and materials with meta-structures, where the experi- mentally reported key parameters of HHG such as the pump wavelength, the maximal pump intensity, and the highest har- monic energy and order, as well as the corresponding pump intensity, are summarized. Compared to its gas-phase counter- part, HHG in the condensed phase allows more compact coherent ultrafast photonic devices with lower driving laser intensities. The typical laser intensity to drive this extreme nonlinear optical process in solids including bulk and two-dimensional materials is as low as 1011−1012 W/cm2, which is two or three orders of magnitude lower than that in gases. To further lower the pump intensity, near-field enhancement methods based on plasmonic resonances employing metallic or dielectric nanostructures deposited on solid surfaces have been demonstrated10–14. The driving laser intensity at the level of 1010 W/cm2 can be achieved. However, apart from manufacturing difficulties, the nanos- tructures suffer from shortcomings of low damage intensity and small enhancement areas. Moreover, the resonance-based meth- ods can only enhance laser fields with a particular wavelength, determined by the materials and their structural designs. To increase the enhancement volume, epsilon-near-zero materials such as indium-doped CdO thin film have been adopted15. The pump intensity can be further reduced by one order of magni- tude, however, the laser wavelength that can be enhanced is also fixed by the doping level of the material. In addition, the damage threshold of the doped thin film is usually small. Therefore, it is desirable to discover a pristine and versatile solid material exhibiting low pump intensity even without field enhancement and high damage threshold. As the microscopic mechanisms of HHG in solids, both interband (induced by polarization between conduction and valence bands) and intraband (originated from non-parabolic band dispersion) contributions, are closely associated with the electronic structure of the material, a possible approach towards searching for ideal material candidates is to generally examine the band structure at first. Previous theoretical studies have predicted phosphorene (a monolayer black phosphorus) displaying good HHG properties which can be attributed to its unique band structure16. An impressive feature of the band structure of phosphorene is a relatively flat dispersion of the valence band near the Fermi level, which leads to a large density of states (DOS) and thus substantial excitation of electrons. Aside from that, phosphorene has a moderate and direct band gap of ~2.0 eV17 and high free-carrier mobility of ~1000 cm2/V/s18. These theoretical studies shed light on the signatures of materials suitable for HHG, although HHG in phosphorene is difficult to realize experimentally due to the fabrication requirement and unstable characteristics of phosphorene. Fortunately, there do exist materials not only exhibiting similar electronic properties to that of phosphorene (i.e., flat shape of band dispersion near the Fermi level, moderate direct band gap, and high carrier mobility), but also being chemically stable and robust, as well as easy to obtain. Here we report on systematic experimental investigation to demonstrate cadmium telluride (CdTe) being one of such excel- lent candidates. The electronic structures and ultrafast carrier dynamics of CdTe enable ultra-low pump intensity and high- efficiency harmonics emission. In experiment, the measured pump intensity for the 12th and 31st harmonic order is only 30 and 75 GW/cm2, respectively, which is similar to or even smaller than that of the dielectrics with plasmonic meta-structures for the HHG enhancement. The HHG output grows with the pump intensity up to 4.5 TW/cm2 without saturation. A comparative measurement shows CdTe has two-to-three orders of magnitude stronger HHG than that of silicon, and high HHG yields in the ultraviolet region compared to common HHG dielectric such as Table 1 Comparison of HHG in CdTe (yellow) with other commonly used materials of HHG in solids. Materials Pump wavelength (μm) The maximal pump intensity (TW/cm2) The highest harmonic energy (eV) and order (the corresponding pump intensity (TW/cm2)) Reference Si 3.5 6, 17th (0.26) 3 Sapphire 0.8 1.31 20.2, 13th (1.1) 5 ZnO 3.25 5 9.5, 25th (5) 1 GaSe 10 13.7 2.7, 22nd (13.7) 7 Graphene 4.77 1.7 2.3, 9th (1.7) 9 MoS2 4.13 2.2 3.9, 13th (1.8) 8 β-WP2 1.9 1.2 6.5, 10th (0.23) 42 ZnO nanostructure 2~2.3 1 5.4, 9th (1) 14 GaP metamaterial 3.7−4 0.6 2.8, 9th (0.062) 11 Si metamaterial 2.2−2.3 0.3 4.8, 9th (0.2) 10 Si plasmonics 2.1 0.2 5.3, 9th (0.02) 13 Sapphire metamaterial 0.8 0.42 20.2, 13th (0.1) 12 Perovskite thin film 3.5 0.45 4.6, 13th (0.45) 25 Si-sapphire interface 2.2 5.6 7.3, 13th (3.2) 43 WSe2 nanosheet 0.764 0.767 35.6, 22nd (0.767) 26 CdO 2.08 0.014 5, 9th (0.014) 14 Bi2Se3 5 0.054 2.7, 11th (0.054) 27 1 T’ MoSSe 5 1.06 4.96, 20th (1.06) 28 CdTe 7.1 4.5 5.4, 31st (0.075) This work The HHG materials are categorized into bulk (green), two-dimensional materials (blue), materials with meta-structures (pink), thin films (grey), and topologically protected materials (orange). Parameters of the pump wavelength, the maximal pump intensity, and the highest harmonic energy, as well as the corresponding pump intensity, are summarized. ARTICLE COMMUNICATIONS PHYSICS | https://doi.org/10.1038/s42005-023-01354-2 2 COMMUNICATIONS PHYSICS | (2023) 6:228 | https://doi.org/10.1038/s42005-023-01354-2 | www.nature.com/commsphys attributed to intraband mechanism. While for the odd-order harmonics (11th and 13th order), as shown in Fig. 5f, the harmonics polarization exhibits noticeable modulation around the driving laser polarization, similar to the characteristics of odd- order harmonics from TMDCs in ref. 29 which originates from interband contribution. The distinctly different behaviors of HHG polarization angel as a function of MIR polarization angle for different harmonic orders suggest that the even and odd-order harmonics in CdTe may be attributed to different HHG mechanisms. Conclusions In conclusion, we experimentally demonstrate an ultra-low pump intensity and high throughput of HHG emission from the CdTe crystal. The harmonics flux of 6 × 1012 to 1.6 × 1013 photons/s (5th−8th) is obtained, which is sustained for >30 min of exposure. Therefore, a pulse energy of hundreds of nano-joule which could be provided by more compact and cheaper laser apparatus such as Cr:ZnS oscillator and amplifier30 or a single- stage MIR optical parametric amplifier (OPA) is able to excite decent harmonics flux. At meanwhile, thanks to the high damage threshold and centimeter-size crystal aperture, high-harmonics energy could be pursued pumped by the advanced MIR optical parametric chirped-pulse amplifiers with multi-milli-joule pulse energy31–34. Moreover, HHG from CdTe in VUV region could be explored in the near future. In addition, beyond light source, HHG in solids serves as a unique tool to investigate light-induced nonequilibrium phases in materials35,36. Studying light-induced nonequilibrium phases and ultrafast carrier dynamics in CdTe have important applications, such as the development of infrared and gamma photon detec- tors, and solar cell thin film photovoltaic technology as well, Fig. 5 High-harmonics strength from a CdTe crystal as a function of the pump polarization angle θ and the high harmonic generation (HHG) polarization angle φ. a Schematic diagram of the HHG polarization measurement. The pink arrow represents the pump laser polarization, the dashed grey line indicates the symmetry plane of the crystal, θ is the angle between the pump polarization and the symmetry plane of the crystal, and φ is the harmonics polarization angle. The polarization angle φ is measured with a polarizer. b The polar plot of the high harmonic strength with respect to the pump laser polarization. The excitation strength is fixed at around 0.55 TW/cm2. Both even and odd orders are observed to be modulated with a period of 60°, which reveals the sixfold symmetry of CdTe. The intensity is strongest when the pump field is along the CdTe bond direction, i.e., parallel to the mirror plane. c Intensities of the representative 10th to 14th order harmonics in different polarization angle φ for crystal direction θ = 0°. φ = 0 and 180° means harmonic components parallel to the pump polarization. Both the even and odd orders reach their intensity peaks when the harmonic components polarized parallel to the pump. d The same as c, except for θ = 30°. The intensity peaks of even orders (10th, 12th, 14th) rotate by 90° (the perpendicular components) with respect to c. This is attributed to the break of inversion symmetry and Berry curvature term in an intraband semiclassical model. e Odd (11th and 13th in red and orange, respectively) and f, even (12th and 14th in blue and green, respectively) order harmonics polarization angle φ resolved as a function of the MIR pump (in cyan) polarization angle θ. COMMUNICATIONS PHYSICS | https://doi.org/10.1038/s42005-023-01354-2 ARTICLE COMMUNICATIONS PHYSICS | (2023) 6:228 | https://doi.org/10.1038/s42005-023-01354-2 | www.nature.com/commsphys 7 where CdTe is an important material that has been widely used. Moreover, high-quality CdTe epi-layers could be grown by mature semiconductor deposition technologies, such as magne- tron sputtering. Thus, we look forward to HHG and attosecond devices fabricated based on CdTe thin films. CdTe thin films with nanostructures could also be employed to further enhance the HHG yield. Thirdly, the fine HHG property of CdTe induced by its flat shape of band dispersion near the Fermi level, the large DOS, and the high carrier mobility provides a possible criterion in searching for suitable HHG materials, which would definitely trigger more research. In future, materials with similar band dispersion and large band gaps could be investigated to improve the output yields of harmonics above the bandgap, which would benefit applications such as optical coherence tomography in the DUV- VUV region37, UV multispectral imaging38, investigations of sub- cycle quasi-particle collision26, Valence electron high precision imaging39, and ultrafast electron scattering40. Methods Ab-initio TDDFT simulations of HHG in CdTe. The geometric structure relaxation and ground state electronic structure calculation of the CdTe crystal are performed by solving the Kohn–Sham equation using the CASTEP package within the DFT framework with the local density approximation (LDA) for the exchange–correlation function. A plane wave basis set and ultrasoft pseudopotentials are employed. The plane wave cutoff energy is set to be 330 eV. A 7 × 7 × 7 Monkhorst–Pack k-point mesh for Brillouin zone sampling is used for the conventional cell of CdTe, which contains eight atoms. The atomic positions are relaxed until the maximum force on each atom is less than 0.01 eV/A. The optimized lattice constant along each direction is 6.417 Å, which is in agreement with the reported DFT calculation results. Although it is known that LDA functional gives underestimated band gap, it has been demonstrated that it will not considerably affect the HHG spectra16. The atomic coordinates of the computational models could be found in Supplementary dataset 1. The time evolution of electron wave functions and time- dependent electronic current is then investigated by propagating the time-dependent Kohn–Sham equations in real time and real space using the OCTOPUS package within the framework of TDDFT with the adiabatic LDA functional. The grid spacing of the real-space box is 0.4 Bohr, and the time step for time propagation is 6.05 attosecond. A 20 × 20 × 20 Monkhorst–Pack k-point mesh is used for Brillouin zone sampling of the conventional cell. The fully relativistic Hartwigsen, Goedecker, and Hutter pseudopotential is adopted in the calculations. We consider the driving laser field in the velocity gauge with a wavelength of 1600 nm (corresponding to a photon energy of 0.77 eV). The peak laser intensity is 2 × 1011 W/cm2. The laser electric field is linearly polarized in the (111) cutting plane of CdTe crystal. The laser pulse has a sine-square envelope f(t) = sin2(πt/2τ) with τ = 20 fs. The carrier-envelop phase is set to be zero, which has been shown to have no influence on the calculation results. Consideration for the parameters of laser wavelength and pulse duration are mainly for the sake of computational efficiency. After obtaining the total time- dependent electronic current j(r, t) from the time-evolved wavefunctions, the HHG spectrum can be calculated as: HHG ω ð Þ ¼ F.T: ∂ ∂t Z jðr; tÞd3r     2 ; where F.T. denotes the Fourier transform. High-harmonic generation experiment. The pump source of HHG in CdTe is a MIR OPA driven by a commercial Yb-doped regenerative amplifier (Pharos, Light Conversion) with a max- imum 20 W power, 250 fs pulses at 1030 nm wavelength, and 50 kHz repetition rate. The MIR OPA consists of two-stage amplifiers based on LiGaS2 crystals22. The near-infrared seed pulses are obtained through white light continuum generation in a 10-mm-thick YAG crystal. A 2 W fraction of the pump power is used to drive the first OPA stage, which employs an 8-mm-thick LiGaS2 crystal cut for Type I phase matching (θ = 51°) and produces 200 mW signal pulses centered at a wavelength of 1205 nm. The signal pulses are subsequently injected into the second OPA stage, which ultimately produces up to 210 mW 7.1 μm mid-infrared output in another 8-mm-thick LiGaS2 crystal with Type I phase matching (θ = 51°) under 10 W pump power. The LiGaS2 crystals are replaced by KTA crystals to produce the OPA output centered at 3 μm. The mid-infrared power is mea- sured by OPHIR powermeter (StarLite). The temporal duration of the MIR pulse is measured by a home-built interferometric autocorrelator (IAC), and reconstructed through a genetic algo- rithm based on so-called “evolutionary phase retrieval from IAC (EPRIAC)” algorithm. 180 fs pulse width is estimated with more details shown in Supplementary Fig. 2b, c. An infrared camera (Dataray, WinCamD-IR-BB-7.5 system) is employed to check the MIR beam profile and measure the beam size as shown in Sup- plementary Fig. 2d (see Supplementary Note 2). The 3 μm fem- tosecond pump is generated based on the same MIR OPA apparatus but using KTA as the nonlinear crystals. mm-thick CdTe crystal of (111) plane with optical polished surfaces is pumped at a pump intensity ranging from 30 GW/cm2 to 4.5 TW/cm2 focused by zinc selenide (ZnSe) lenses with a focal length of 50–200 mm. The HHG spectra spanning in the mid- infrared, near-infrared, visible, and ultraviolet regions are measured by a scanning-grating monochromator with a liquid- nitrogen-cooled MCT detector, optical spectrum analyzer (YOKOGAWA, AQ6370D) and two different Ocean Optics spectrometers (USB 2000+ and Maya 2000 Pro). The spectra are recorded by directly coupling the emission into a dielectric-coated mid-IR hollow-core fiber with a 500-μm core diameter (HF500MW, OptoKnowledge) and a silica fiber with a 400-μm core diameter at the back surface of the CdTe crystal for the MIR and visible-to-ultraviolet harmonics measurement, respectively. The output power of the 5th to 8th harmonics is measured by coupling the emission into a powermeter (JoinwiT, JW2323C). The harmonics with perpendicular and horizontal polarizations are separated by using a FLP20-VIS polarizer. Data availability The data that support the findings of this study are available from the corresponding author upon request. Received: 31 March 2023; Accepted: 18 August 2023; References 1. Ghimire, S. et al. Observation of high-order harmonic generation in a bulk crystal. Nat. Phys. 7, 138–141 (2011). 2. You, Y. S., Reis, D. A. & Ghimire, S. Anisotropic high-harmonic generation in bulk crystals. Nat. Phys. 13, 345–349 (2017). 3. Vampa, G., et al. Generation of high harmonics from silicon. Preprint at http://arXiv.org/abs/1605.06345 (2016). 4. Luu, T. T. et al. Extreme ultraviolet high-harmonic spectroscopy of solids. Nature 521, 498–502 (2015). ARTICLE COMMUNICATIONS PHYSICS | https://doi.org/10.1038/s42005-023-01354-2 8 COMMUNICATIONS PHYSICS | (2023) 6:228 | https://doi.org/10.1038/s42005-023-01354-2 | www.nature.com/commsphys 5. Kim, H., Han, S., Kim, Y. W., Kim, S. & Kim, S. W. Generation of coherent extreme-ultraviolet radiation from bulk sapphire crystal. ACS Photon. 4, 1627–1632 (2017). 6. Hohenleutner, M. et al. Real-time observation of interfering crystal electrons in high-harmonic generation. Nature 523, 572–575 (2015). 7. Schubert, O. et al. Sub-cycle control of terahertz high-harmonic generation by dynamical Bloch oscillations. Nat. Photon. 8, 119–123 (2014). 8. Liu, H. et al. High-harmonic generation from an atomically thin semiconductor. Nat. Phys. 13, 262–265 (2017). 9. Yoshikawa, N., Tamaya, T. & Tanaka, K. High-harmonic generation in graphene enhanced by elliptically polarized light excitation. Science 356, 736–738 (2017). 10. Liu, H. et al. Enhanced high-harmonic generation from an all-dielectric metasurface. Nat. Phys. 14, 1006–1010 (2018). 11. Shcherbakov, M. R. et al. Generation of even and odd high harmonics in resonant metasurfaces using single and multiple ultra-intense laser pulses. Nat. Commun. 12, 1–6 (2021). 12. Han, S. et al. High-harmonic generation by field enhanced femtosecond pulses in metal–sapphire nanostructure. Nat. Commun. 7, 13105 (2016). 13. Vampa, G. et al. Plasmon-enhanced high-harmonic generation from silicon. Nat. Phys. 13, 659–662 (2017). 14. Sivis, M. et al. Tailored semiconductors for high-harmonic optoelectronics. Science 357, 303–306 (2017). 15. Yang, Y. et al. High-harmonic generation from an epsilon-near-zero material. Nat. Phys. 15, 1022–1026 (2019). 16. Chen, Z. Y. & Qin, R. Strong-field nonlinear optical properties of monolayer black phosphorus. Nanoscale 11, 16377–16383 (2019). 17. Liang, L. et al. Electronic bandgap and edge reconstruction in phosphorene materials. Nano Lett. 14, 6400–6406 (2014). 18. Li, L. et al. Black phosphorus field-effect transistors. Nat. Nanotech. 9, 372–377 (2014). 19. Kranz, L., Buecheler, S. & Tiwari, A. N. Technological status of CdTe photovoltaics. Sol. Energy Mater. Sol. Cells 119, 278–280 (2013). 20. Szeles, C. CdZnTe and CdTe materials for X-ray and gamma ray radiation detector applications. Phys. Status Solidi 241, 783–790 (2004). 21. Canali, C., Martini, M., Ottaviani, G. & Zanio, K. R. Transport properties of CdTe. Phys. Rev. B 4, 422 (1971). 22. He, L. et al. Dual-wavelength spectrum-shaped mid-infrared pulses and steering high-harmonic generation in solids. Ultrafast Sci. 3, No. 0022 (2023). 23. Takahashi, T. & Watanabe, S. Recent progress in CdTe and CdZnTe detectors. IEEE Trans. Nucl. Sci. 48, 950–959 (2001). 24. Langer, F. et al. Symmetry-controlled temporal structure of high-harmonic carrier fields from a bulk crystal. Nat. Photon. 11, 227–231 (2017). 25. Hirori, H. et al. High-order harmonic generation from hybrid organic- inorganic perovskite thin films. APL Mater. 7, 041107 (2019). 26. Langer, F. et al. Lightwave-driven quasiparticle collisions on a subcycle timescale. Nature 533, 225–229 (2016). 27. Heide, C. et al. Probing topological phase transitions using high-harmonic generation. Nat. Photon. 16, 620–624 (2022). 28. Shi, J. et al. Giant room-temperature nonlinearities from a monolayer Janus topological semiconductor. arXiv https://arxiv.org/abs/2304.00750 (2023). 29. Kobayashi, Y. et al. Polarization flipping of even-order harmonics in monolayer transition-metal dichalcogenides. Ultrafast Sci. 2021, 1–9 (2021). 30. Vasilyev, S. et al. Ultrafast middle-IR lasers and amplifiers based on polycrystalline Cr:ZnS and Cr:ZnSe. Opt. Mater. Express 7, 2636–2650 (2017). 31. Mitrofanov, A. V. et al. Subterawatt few-cycle mid-infrared pulses from a single filament. Optica 3, 299–302 (2016). 32. Grafenstein, L. V. et al. 5μm few-cycle pulses with multi-gigawatt peak power at a 1kHz repetition rate. Opt. Lett. 42, 3796–3799 (2017). 33. Sanchez, D. et al. 7 μm, ultrafast, sub-millijoule-level mid-infrared optical parametric chirped pulse amplifier pumped at 2 μm. Optica 3, 147–150 (2016). 34. Zou, X. et al. Flat-top tumped multi-millijoule mid-infrared parametric chirped- pulse amplifier at 10 kHz repetition rate. Laser Photon. Rev. 15, 2000292 (2021). 35. Silva, R. E. F., Blinov, I. V., Rubtsov, A. N., Smirnova, O. & Ivanov, M. High- harmonic spectroscopy of ultrafast many-body dynamics in strongly correlated systems. Nat. Photon. 12, 266–270 (2018). 36. Bionta, M. R. et al. Tracking ultrafast solid-state dynamics using high harmonic spectroscopy. Phys. Rev. Res. 3, 023250 (2021). 37. Fuchs, S. et al. Optical coherence tomography with nanoscale axial resolution using a laser-driven high-harmonic source. Optica 4, 903–906 (2017). 38. Shapiro, D. et al. Chemical composition mapping with nanometre resolution by soft X-ray microscopy. Nat. Photon. 8, 765–769 (2014). 39. Lakhotia, H. et al. Laser picoscopy of valence electrons in solids. Nature 583, 55–59 (2020). 40. Heide, C. et al. Probing electron-hole coherence in strongly driven 2D materials using high-harmonic generation. Optica 9, 512–516 (2022). 41. Chen, Z. Y. & Qin, R. Probing structural chirality of crystals using high-order harmonic generation in solids. Phys. Rev. A 101, 053423 (2020). 42. Lv, Y. Y. et al. High-harmonic generation in Weyl semimetal β-WP2 crystals. Nat. Commun. 12, 1–8 (2021). 43. Vampa, G., Liu, H., Heinz, T. F. & Reis, D. A. Disentangling interface and bulk contributions to high-harmonic emission from solids. Optica 6, 553–556 (2019). Acknowledgements We thank Professor Yongfeng Lu for the useful discussions. This work was supported by the National Natural Science Foundation of China (62075144, U22A2090, 12175157), Sichuan Outstanding Youth Science and Technology Talents (2022JDJQ0031), Engi- neering Featured Team Fund of Sichuan University (2020SCUNG105), and the Fun- damental Research Funds for the Central Universities (YJ202025). Author contributions H.K.L. conceived and designed the experiment. Z.-Y.C. and R.Q. conducted the theo- retical simulation. Z.L. and H.Y. carried out the experiment of HHG measurement. H.K.L. and Z.-Y.C. conducted the data analysis. K.T. built the MIR OPA. L.H. measured the MIR pump temporal profile. Z.-Y.C., Q.J.W., H.K.L., Z.L., and H.Y. wrote the manuscript. Z.L. and H.Y. contribute equally. All authors discussed the results and contributed to the manuscript. Competing interests The authors declare no competing interests. Additional information Supplementary information The online version contains supplementary material available at https://doi.org/10.1038/s42005-023-01354-2. Correspondence and requests for materials should be addressed to Zi-Yu Chen or Houkun Liang. Peer review information Communications Physics thanks the anonymous reviewers for their contribution to the peer review of this work. A peer review file is available. Reprints and permission information is available at http://www.nature.com/reprints Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/ licenses/by/4.0/. © The Author(s) 2023 COMMUNICATIONS PHYSICS | https://doi.org/10.1038/s42005-023-01354-2 ARTICLE COMMUNICATIONS PHYSICS | (2023) 6:228 | https://doi.org/10.1038/s42005-023-01354-2 | www.nature.com/commsphys 9

Title: High-harmonic generation in CdTe with ultra-low pump intensity and high photon flux ​ Authors: Zhe Long, Hang Yang, Kan Tian, Linzhen He, Rui Qin, Zi-Yu Chen, Qi Jie Wang, Houkun Liang ​ Publisher: Nature Communications Date: 2023 Abstract: The document explores high-harmonic generation in CdTe crystal with ultra-low pump intensity and high photon flux, showcasing its potential for compact vacuum ultraviolet laser sources. ​ It highlights the CdTe crystal's strong HHG compared to other materials and its sustained harmonics flux reaching 6 × 10^12 photons/s (5th−8th) for over 30 minutes. ​

Resonant‐mode engineering for additive refective structural colors with high brightness and high color purity.pdf

1 Vol.:(0123456789) Scientific Reports | (2024) 14:13694 | https://doi.org/10.1038/s41598-024-64176-4 www.nature.com/scientificreports Resonant‑mode engineering for additive reflective structural colors with high brightness and high color purity Hojae Kwak 1,4, Incheol Jung 1,4, Dohyun Kim 1,4, Seongcheol Ju 1, Soyoung Choi 1, Cheolhun Kang 1, Hyeonwoo Kim 1, Hyoung Won Baac 2*, Jong G. Ok 3* & Kyu‑Tae Lee 1* We present quad-layered reflective structural color filters generating vivid additive primary colors by controlling a mode number in a Fabry–Perot (FP) cavity and an anti-reflective (AR) coating layer, thus accomplishing high spectral contrast which is highly demanded in creating sharp colors. The reflection brightness of fabricated structural color filters is over 78% and a color gamut is comparable to the standard color gamut (sRGB). Higher-order resonant modes are exploited yielding a narrow passband with strong suppression of the reflection at shorter and longer wavelength ranges for a green color, while red and blue colors are produced by employing fundamental resonant modes. Besides, the structural color filters maintain both high brightness and high color purity at oblique incidence angles up to 40° due to a small angle of refraction by a cavity medium with high refractive index. Moreover, a large-scale fabrication is enabled owing to the simplicity of a device structure, where thin film deposition is used. The scheme presented in this work may open the door to a number of applications, such as reflective displays, imaging devices, colored photovoltaics, and decorations. Keywords  Color filter, Multilayer, Fabry–Perot cavity, Higher-order resonance Color filters are widely used over various areas, such as liquid crystal displays (LCDs), white organic light- emitting diode displays (WOLEDs), image sensors, and anti-counterfeiting ­devices1–4. However, since the existing color implementation is strongly dependent on the absorption of incident light with specific bands of wave- lengths, conventional color filters based on dyes or pigments exhibit poor colors ascribing to their deficiencies in brightness, purity, and stability. To address the aforementioned issues, an enormous amount of effort has been devoted to finding the alternative of the conventional color filters, and structural color filters generating colors via light-matter interactions in which a narrow optical band can be achieved with relatively trivial losses leading to simultaneous achievement of both high brightness and high color purity have gained increasing attention. Numerous approaches based on multi-layered thin ­films5–10, guided-mode ­resonators11–13, plasmonic ­nanostructures14–20, Mie ­resonators21–25, and ­metasurfaces26–31 have been experimentally demonstrated, all of which present their superior color performances over the conventional color filters. Particularly, the multi- layered thin film structures are advantageous in that they can be created by a simple deposition process without a series of complicated and expensive lithographic techniques, thus offering the distinct potential for large-scale applications. While extensive research efforts have brought remarkable improvements in the brightness, purity, and stability, much attention has been devoted to the development of transmission-type additive structural color filters. Reflection-type additive structural color filters have remained unexploited although they play central roles in a variety of applications, such as electro phoretic displays (EPDs), outdoor signages, imaging devices, and automotive coatings. Although several approaches toward the reflective RGB color generation have been demonstrated, they rely on complicated fabrication techniques, and they present low brightness and poor color purity, thus imposing practical limitations on many potential applications. It is accordingly highly demanded OPEN 1Department of Physics, Inha University, Incheon  22111, Republic of Korea. 2Department of Electrical and Computer Engineering, Sungkyunkwan University, Suwon 16419, Republic of Korea. 3Department of Mechanical and Automotive Engineering, Seoul National University of Science and Technology, Seoul  01811, Republic of Korea. 4These authors contributed equally: Hojae Kwak, Incheol Jung and Dohyun Kim. *email: hwbaac@ skku.edu; [email protected]; [email protected] 2 Vol:.(1234567890) Scientific Reports | (2024) 14:13694 | https://doi.org/10.1038/s41598-024-64176-4 www.nature.com/scientificreports/ to explore novel structures that are capable of generating additive colors in reflection with high brightness and high color purity. In this work, we demonstrate engineering a resonant mode in a quad-layered structure consisting of a lossy metal sandwiched by two dielectric layers on a reflective mirror for the structural color filters creating additive primary colors of red (R), green (G), and blue (B) in reflection with high brightness and high color purity. An order of the resonance in the quad-layered structures is well controlled to achieve greatly improved optical properties, where higher-order resonances are employed for the G color whereas fundamental resonances are used for the B and R colors. All three RGB filters show high reflectance over 78% with the improved color purity exhibiting little discrepancy from the standard RGB color space. In addition, high index of refraction of a cavity medium allows the reflective colors to be nearly invariant when the light is incident at large angles of incidence up to 40˚. The simple design approach is expected to find a diversity of applications, such as reflective display technologies, colored solar cells, decorations, imaging devices, and surface coatings for automobiles. Results and discussion Figure 1a shows a schematic view of the proposed reflective RGB structural color filters which consist of the quad-layered thin films with a configuration of dielectric-metal-dielectric-metal (DMDM) on a glass substrate. Silver (Ag) is selected as a bottom layer whose thickness is optically thick providing high reflectivity. Tungsten trioxide ­(WO3) is chosen owing to negligible absorptions and high refractive index in the visible wavelength regime for the dielectric layers that comprise a Fabry–Perot (FP) cavity ­(WO3 #1) and an anti-reflective (AR) coat- ing ­(WO3 #2). The lossy metal, chromium (Cr), is inserted between the two dielectric layers where constructive interference between light waves reflected from a surface of Cr and those reflected from the cavity occurs yielding a peak in the ­reflection32,33. Despite the high reflectance of a bulk Ag that is used at the bottom of the structure contributing to narrowing the full width at half maximum (FWHM), the high absorption of Cr leads to the low reflection and hence a broad reflectance peak thus causing the color performance to be significantly degraded. For the purpose of improving the color purity, the AR layer is well designed which suppresses the reflection of Figure 1.   (a) Schematic diagram of proposed reflective RGB structural color filters. (b) Calculated resonant mode number, which is the net phase shift divided by 2π, in the ­WO3 #1 FP cavity and the ­WO3 #2 AR layer for the RGB. (c) Measured and simulated reflectance spectra of the reflective RGB structural color filters. (d) Optical images of the fabricated RGB color filter samples. (e) Color coordinates calculated from both the measured and simulated reflectance spectra along with the standard RGB color space (sRGB). 7 Vol.:(0123456789) Scientific Reports | (2024) 14:13694 | https://doi.org/10.1038/s41598-024-64176-4 www.nature.com/scientificreports/ Conclusion In conclusion, we have demonstrated the improved brightness and color purity of the quad-layered reflec- tive structural color filters by controlling the order of the resonant mode in the FP cavity and the AR layer. The presented devices attain high brightness over 78% and generates pure reflective RGB colors whose color gamut is analogous to that of the sRGB. Moreover, rigorous analyses on the device structures by exploiting the net phase analysis, optical admittance loci, and electric field intensity distributions are conducted to provide a better understanding. Furthermore, the angular performance of the color filters is investigated, exhibiting that the angle-tolerant characteristic is maintained up to 40° of the incident angle owing to the reduced refraction angle into the cavity by high refractive index of the cavity medium. Additionally, only the thin film deposition is required for the device fabrication, bolstering the readiness of mass-production of the large-scale devices. The demonstrated strategy may pave the way to various applications, such as reflective displays, imaging devices, optical sensors, color solar panels, and decorations. Data availability The datasets used and/or analyzed during the current study available from the corresponding author on reason- able request. Received: 2 April 2024; Accepted: 5 June 2024 References 1. Sabnis, R. W. Color filter technology for liquid crystal displays. Displays 20, 119–129 (1999). 2. Chang, C. H. et al. Enhancing color gamut of white OLED displays by using microcavity green pixels. Org. Electron. 11, 247–254 (2010). 3. Yokogawa, S., Burgos, S. P. & Atwater, H. A. Plasmonic color filters for CMOS image sensor applications. Nano Lett. 12, 4349–4354 (2012). 4. Xuan, Z. et al. Artificial structural colors and applications. Innovation 2, 100081 (2021). 5. Yang, C. et al. Compact multilayer film structure for angle insensitive color filtering. Sci. Rep. 5, 9285 (2015). 6. Lee, K.-T., Seo, S., Lee, J. Y. & Guo, L. J. Strong resonance effect in a lossy medium-based optical cavity for angle robust spectrum filters. Adv. Mater. 26, 6324–6328 (2014). Figure 5.   Measured (a–c) and simulated (d–f) angle-resolved reflectance spectra of the proposed structural color filters. (g) Measured and (h) simulated color coordinate changes with increasing the incident angles under the mean polarization presented on CIE 1931 chromaticity diagram. 8 Vol:.(1234567890) Scientific Reports | (2024) 14:13694 | https://doi.org/10.1038/s41598-024-64176-4 www.nature.com/scientificreports/ 7. Ghobadi, A., Hajian, H., Soydan, M. C., Butun, B. & Ozbay, E. Lithography-free planar band-pass reflective color filter using a series connection of cavities. Sci. Rep. 9, 290 (2019). 8. Yoo, Y. J., Lim, J. H., Lee, G. J., Jang, K. I. & Song, Y. M. Ultra-thin films with highly absorbent porous media fine-tunable for coloration and enhanced color purity. Nanoscale 9, 2986–2991 (2017). 9. Li, Z., Butun, S. & Aydin, K. Large-area, lithography-free super absorbers and color filters at visible frequencies using ultrathin metallic films. ACS Photonics 2, 183–188 (2015). 10. Kim, D. et al. Manipulation of resonance orders and absorbing materials for structural colors in transmission with improved color purity. Opt. Express 30, 11740–11753 (2022). 11. Kaplan, A. F., Xu, T. & Guo, L. J. High efficiency resonance-based spectrum filters with tunable transmission bandwidth fabricated using nanoimprint lithography. Appl. Phys. Lett. 99, 143111 (2011). 12. Uddin, M. J., Khaleque, T. & Magnusson, R. Guided-mode resonant polarization-controlled tunable color filters. Opt. Express 22, 12307–12315 (2014). 13. Shrestha, V. R., Lee, S.-S., Kim, E.-S. & Choi, D.-Y. Polarization-tuned dynamic color filters incorporating a dielectric-loaded aluminum nanowire array. Sci. Rep. 5, 12450 (2015). 14. Xu, T., Wu, Y. K., Luo, X. & Guo, L. J. Plasmonic nanoresonators for high-resolution colour filtering and spectral imaging. Nat. Commun. 1, 59 (2010). 15. Kumar, K. et al. Printing colour at the optical diffraction limit. Nat. Nanotechnol. 7, 557–561 (2012). 16. Roberts, A. S., Pors, A., Albrektsen, O. & Bozhevolnyi, S. I. Subwavelength plasmonic color printing protected for ambient use. Nano Lett. 14, 783 (2014). 17. Li, Z., Clark, A. W. & Cooper, J. M. Dual color plasmonic pixels create a polarization controlled nano color palette. ACS Nano 10, 492–498 (2016). 18. Yang, C. et al. Angle robust reflection/transmission plasmonic filters using ultrathin metal patch array. Adv. Opt. Mater. 4, 1981– 1986 (2016). 19. Shrestha, V. R., Lee, S.-S., Kim, E.-S. & Choi, D. Y. Aluminum plasmonics based highly transmissive polarization-independent subtractive color filters exploiting a nanopatch array. Nano Lett. 14, 6672–6678 (2014). 20. Zeng, B., Gao, Y. & Bartoli, F. J. Ultrathin nanostructured metals for highly transmissive plasmonic subtractive color filters. Sci. Rep. 3, 2840 (2013). 21. Tsai, M. C. et al. Tailor made Mie scattering color filters made by size-tunable titanium dioxide particles. J. Phys. Chem. C 112, 2697–2702 (2008). 22. Wood, T. et al. All-dielectric color filters using SiGe-based Mie resonator arrays. ACS Photonics 4, 873–883 (2017). 23. Jang, J. et al. Spectral modulation through the hybridization of Mie-scatterers and quasi-guided mode resonances: Realizing full and gradients of structural color. ACS Nano 14, 15317–15326 (2020). 24. Alam, A.-M. et al. Generating color from polydisperse, near micron-sized ­TiO2 particles. ACS Appl. Mater. Interfaces 9, 23941– 23948 (2017). 25. Jang, J. et al. Full and gradient structural colouration by lattice amplified gallium nitride Mie-resonators. Nanoscale 12, 21392–21400 (2020). 26. Duan, X., Kamin, S. & Liu, N. Dynamic plasmonic colour display. Nat. Commun. 8, 14606 (2017). 27. Yang, W. et al. All-dielectric metasurface for high-performance structural color. Nat. Commun. 11, 1864 (2020). 28. Park, C.-S. et al. Structural color filters enabled by a dielectric metasurface incorporating hydrogenated amorphous silicon nano- disks. Sci. Rep. 7, 2556 (2017). 29. Galinski, H. et al. Scalable, ultra-resistant structural colors based on network metamaterials. Light Sci. Appl. 6, 16233 (2017). 30. Sun, S. et al. All-dielectric full-color printing with ­TiO2 metasurfaces. ACS Nano 11, 4445–4452 (2017). 31. Yoon, G. et al. Electrically tunable metasurface perfect absorber for infrared frequencies. Nano Converg. 4, 36 (2017). 32. Rana, A. S., Zubair, M., Anwar, M. S., Saleem, M. & Mehmood, M. Q. Engineering the absorption spectra of thin film multilayer absorbers for enhanced color purity in CMY color filters. Opt. Mater. Express 10, 268–281 (2020). 33. Jung, I. et al. Understanding a spectral response in a metal–dielectric–metal cavity structure: The role of constituent metals. Opt. Laser Technol. 158, 108772 (2023). 34. Byrd, R. H., Lu, P., Nocedal, J. & Zhu, C. A limited memory algorithm for bound constrained optimization. SIAM J. Sci. Comput. 16, 1190–1208 (1995). 35. Ohta, K. & Ishida, H. Matrix formalism for calculation of electric field intensity of light in stratified multilayered films. Appl. Opt. 29, 1952–1959 (1990). 36. Ji, C. et al. Engineering light at the nanoscale: Structural color filters and broadband perfect absorbers. Adv. Opt. Mater. 5, 1700368 (2017). Acknowledgements This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea govern- ment (MSIT) (RS-2023-00207828). This work was supported by the grant from the National Research Founda- tion of Korea (NRF) funded by the Korean Government [NRF-2022R1I1A2073224 (Ministry of Education)]. H.W.B. acknowledges the support from the National Research Foundation of Korea (NRF-2022R1A4A3032913). Author contributions H.K., I.J., H.W.B., J.G.O., and K.-T.L. conceived the idea. H.K., I.J., S.J., and S.C. carried out the simulations. H.K., D.K., S.C., and C.K. performed the device fabrications. H.K., D.K., S.J., and H.K. performed the characterizations. H.K., I.J., D.K., S.J., S.C., C.K., H.K., H.W.B., J.G.O., and K.-T.L. analyzed the results. H.K., H.W.B., J.G.O., and K.-T.L. wrote the manuscript. All authors reviewed the manuscript. Competing interests  The authors declare no competing interests. Additional information Supplementary Information The online version contains supplementary material available at https://​doi.​org/​ 10.​1038/​s41598-​024-​64176-4. Correspondence and requests for materials should be addressed to H.W.B., J.G.O. or K.-T.L. Reprints and permissions information is available at www.nature.com/reprints. 9 Vol.:(0123456789) Scientific Reports | (2024) 14:13694 | https://doi.org/10.1038/s41598-024-64176-4 www.nature.com/scientificreports/ Publisher’s note  Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Open Access  This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creat​iveco​mmons.​org/​licen​ses/​by/4.​0/. © The Author(s) 2024

Title: Resonant‑mode engineering for additive reflective structural colors with high brightness and high color purity Authors: Hojae Kwak, Incheol Jung, Dohyun Kim, Seongcheol Ju, Soyoung Choi, Cheolhun Kang, Hyeonwoo Kim, Hyoung Won Baac, Jong G. Ok, Kyu‑Tae Lee ​ Publisher: Scientific Reports Date: 0 Abstract: The paper discusses engineering resonant-mode reflective structural color filters for high brightness and color purity, with applications in reflective displays, imaging devices, colored photovoltaics, and decorations. ​ It introduces quad-layered reflective structural color filters that generate vivid additive primary colors by controlling a mode number in a Fabry–Perot (FP) cavity and an anti-reflective (AR) coating layer, achieving high spectral contrast, reflection brightness, and a color gamut comparable to the standard sRGB. ​

Extraction of high quality and high yield RNA from frozen EDTA blood.pdf

1 Vol.:(0123456789) Scientific Reports | (2024) 14:8628 | https://doi.org/10.1038/s41598-024-58576-9 www.nature.com/scientificreports Extraction of high quality and high yield RNA from frozen EDTA blood Long T. Nguyen *, Carol A. Pollock  & Sonia Saad  Peripheral blood RNA profiling, which can reveal systemic changes in gene expression and immune responses to disease onset and progression, is a powerful tool for diagnosis and biomarker discovery. This technique usually requires high quality RNA, which is only obtainable from fresh blood, or frozen blood that has been collected in special RNA-stabilisation systems. The current study aimed to develop a novel protocol to extract high quality RNA from frozen blood that had been collected in the conventional EDTA tubes. We determined that thawing EDTA blood in the presence of cell lysis/RNA stabilisation buffers (Paxgene or Nucleospin) significantly improved RNA quality (RIN) from below 5 to above 7, which to date has not been shown possible. The EDTA-Nucleospin protocol resulted in 5 times higher yield than the EDTA-Paxgene-PreAnalytix method. The average RIN and mRNA expression levels of five different genes including 18 s, ACTB, MCP1, TNFa and TXNIP using this protocol were also indifferent to those from Paxgene blood, suggesting similar RNA quality and blood transcriptome. Moreover, the protocol allows DNA to be extracted simultaneously. In conclusion, we have developed a practical and efficient protocol to extract high quality, high yield RNA from frozen EDTA blood. Blood is a near unlimited source of biological materials to be used for disease diagnosis and monitoring. Blood is routinely collected from both healthy individuals and patients due to the minimal invasiveness of the procedure. Additionally, in research, blood-derived proteins, metabolites, DNA and RNA can all be used for biomarker discovery and mechanistic investigation of different diseases. For example, blood RNA profiling has been used to identify candidate biomarkers for classification and prognostication of diabetes and ­complications1–4, pulmonary ­disease5, cardiovascular ­disease6,7, neurological ­diseases8,9, and ­cancer10,11. However, RNA is highly susceptible to degradation due to its relatively unstable structure and the ubiquitous presence of RNases in the environment. Suboptimal collection and storage conditions of blood can lead to haemolysis and release of RNases from red blood cells, resulting in RNA degradation. Degraded RNA is generally not recommended for library construction in next generation sequencing, especially when coding regions are of primary interest. Ethylenediaminetetraacetic acid (EDTA)-coated tubes are the conventional containers for blood collection, which although can be used to extract intact RNA from fresh blood, does not contain RNA stabilising chemicals to protect RNA from degradation during freezing and thawing. It is well-known that RNA extracted from frozen EDTA blood not only has a low yield but is also highly ­fragmented12,13. In most cases, blood is collected at the clinic but processed centrally later elsewhere. Freezing can temporarily deactivate RNases but freeze–thaw cycles can result in uncontrolled haemolysis and release of RNases, making RNA degradation inevitable. As such, legacy blood samples that were collected in EDTA tubes are generally deemed not suitable for transcriptional profiling. RNA stabilisation systems such as Paxgene (BD Biosciences) or Tempus (Thermofisher Scientific) are now available to address the issue. In this method, whole blood needs to be mixed with specific buffers at the time of collection to lyse blood cells and inhibit RNases in a well-controlled manner. RNA is precipitated from the solu- tion in these buffers and therefore preserved intact for later purification. However, there have been reports show- ing that RNA extracted from Paxgene tubes contained DNA contamination or inefficient in PCR ­reaction13,14. Moreover, as these kits are expensive and incompatible with other biochemical assays, they are usually not routinely stocked for clinical use unless being specified as part of a clinical trial. This means to extract intact RNA for transcriptional profiling, prospective human studies are generally required, with blood being drawn for storage in tubes suitable for RNA extraction which involves extensive commitment and inevitable cost that otherwise could be avoided. The recruitment of new patient cohorts also means that the use of historic biobanks are not optimally utilised and current and past data cannot be correlated, thus limiting data interpretation. For standard RNA-seq library preparation, the recommended RNA amount and RNA integrity (RIN) is 500 ng and 7–8 respectively. Higher RINs mean that RNA is less degraded. RNA extracted from frozen EDTA blood using traditional methods (e.g. Trizol) tends to have RIN of < ­412,15,16. Beekman and colleagues attempted OPEN Renal Medicine, Kolling Institute, University of Sydney, Camperdown, Australia. *email: long.t.nguyen@sydney. edu.au 2 Vol:.(1234567890) Scientific Reports | (2024) 14:8628 | https://doi.org/10.1038/s41598-024-58576-9 www.nature.com/scientificreports/ to overcome this problem by transferring EDTA blood to PAXgene tubes followed by RNA extraction using a PAXgene-compatible kit. This approach was shown to increase RNA yield and integrity (RIN = 6)12, which may be acceptable for certain applications such as ­microarray12. However, as the impact of suboptimal RIN on RNA sequencing is unclear, RNA with RIN > 7 is still requested by Illunima and most sequencing service providers, particularly when mRNA is of the primary interest. Several groups have attempted to improve the quality of EDTA blood-derived RNA to meet mRNA-Seq ­standards15,16. However, RIN = 6 appears to be the highest achievable value and thus still remain suboptimal. The ability to extract high-quality RNA from frozen EDTA blood will allow researchers to simplify and stand- ardise the sample preparation procedure to achieve the highest efficiency and reproducibility in RNA biomarker research. Legacy cryopreserved blood samples across the world can be used and data generated from the same samples/cohort can be correlated to gain novel insights into different diseases and therapeutic effects. This study aimed to compare different RNA extraction protocols to identify the determining factors to extract high quality RNA from frozen EDTA blood for mRNA-seq. Results The effects of incubation and extraction kits in the EDTA‑to‑PAXgene transfer method on blood RNA quantity and quality First, we assessed the impact of using different kits to extract RNA from EDTA blood that was transferred into Paxgene tubes before extraction. As shown in Table 1, EDTA-Paxgene-PreAnalytix protocol showed a 36% increase in yield compared to the PAXgene PreAnalytix (PP) control method. However, RIN was approximately halved (P < 0.05) and A260/230 was significantly lower (P < 0.01), suggesting the expected poor quality. If the Magmax extraction kit was used instead of PreAnalytix, we found no change in yield, a slightly less drop in RIN (P < 0.01) but a much more significant reduction in A260/230 (P < 0.01). Next, we questioned if varying sample incubation time before RNA extraction would make an impact on RNA quantity and quality. The result showed that there were no improvements in any of the measurements when the blood was incubated for either 2 h or overnight before extraction. Refreezing the blood in − 80 °C also had no effect. The effect of cell lysis/RNA stabilisation buffer As RNA integrity remained low despite blood was transferred to Paxgene system after thawing, we tried to address the key question as to whether RNA degradation occurred during cryopreservation or during the thawing process. If degradation had already occurred during cryopreservation, then attempts to improve RNA integrity would not be fruitful. By adding Paxgene additives to EDTA tubes during thawing instead of vice versus, RIN was significantly improved to 7.3 ± 0.14, while RNA yield remained similar (P < 0.01, Table 2). To confirm that this effect is not specifically attributed to Paxgene additives but to the reverse addition of cell lysis/RNA stabilisation buffer, we tested the Nucleospin blood RNA extraction from Macherey–Nagel. Similar to the EDTA-Paxgene reverse transferring method followed by PreAnalytix extraction kit, adding Nucleospin lysis buffer to EDTA blood before thawing resulted in a significantly improved RIN of 8 ± 0.21 (P < 0.01). At the same time, RNA yield was also 5 times higher than EDTA-PP method (P < 0.01, Table 2). This protocol is referred to as EDTA-mixed thawing-Nucleospin (EmN). Table 1.   RNA extraction following blood transfer from EDTA to Paxgene tubes. EDTA blood was thawed on ice for at least 2 h before transferring to Paxgene tubes. Data are expressed as Mean ± SEM. N = 2. *P < 0.05, **P < 0.01. Protocol Yield (μg RNA/ml blood) % PP-Ctrl RIN 260/280 260/230 Paxgene Ctrl PreAnalytix 1.00 ± 0.31 100.00 8.00 ± 0.2 2.14 ± 0.06 1.54 ± 0.04 EDTA blood transfer to Paxgene tube Kit PreAnalytix 1.38 ± 0.48 136.76 ± 5.74* 4.00 ± 0.3** 2.15 ± 0.08 0.94 ± 0.11* Magmax 1.04 ± 0.23 107.10 ± 9.56 4.55 ± 0.25** 2.15 ± 0.05 0.39 ± 0.14** Incubation 2 h 0.85 ± 0.03 123.07 ± 3.65 4.87 ± 0.30** 2.08 ± 0.01 0.59 ± 0.21** overnight 1.37 ± 0.22 104.83 ± 17.31 3.97 ± 0.15** 2.22 ± 0.01 0.57 ± 0.11** Refreeze No 1.21 ± 0.24 107.27 ± 11.98 4.28 ± 0.23** 2.15 ± 0.04 0.66 ± 0.17** Yes 0.90 ± 0.05 83.60 ± 6.47 4.70 ± 0.57** 2.16 ± 0.06 0.42 ± 0.03** Table 2.   The effect of lysis buffers in Paxgene and Nucleospin kits on blood RNA degradation. Data are expressed as Mean ± SEM. N = 2. **P < 0.01. Blood tube Pretreatment Incubation Extraction %PP-Ctrl RIN EDTA Thaw on ice then transfer to Paxgene tube RT (2 h) Pre-AnalytiX 136.76 ± 5.74 4.00 ± 0.3 EDTA Add Paxgene solution to EDTA tube then thaw on ice RT (2 h) Pre-AnalytiX 148.77 ± 33.79 7.30 ± 0.14** EDTA Add Nucleospin lysis buffer then thaw on ice RT (15 min) Nucleospin 649.77 ± 72.51** 8.00 ± 0.21** 5 Vol.:(0123456789) Scientific Reports | (2024) 14:8628 | https://doi.org/10.1038/s41598-024-58576-9 www.nature.com/scientificreports/ worst case, certain mRNA can be completely lost or degraded during upstream workflow steps, which increases the risk of false-negative results. As such, regardless of whether total RNA-seq or mRNA-seq is used, a high RIN is always preferable. Moreover, compared to total RNA-seq, library preparation can be performed with smaller sample sizes for mRNA-Seq and sequencing depth can be increased, which significantly improves sequencing efficiency and reduces cost. In comparing the Paxgene/PreAnalytix control method and EDTA-Nucleospin, the latter has been shown to improve RNA yield by 5 ­times16. The same result was achieved in the current study, suggesting that Nucleospin is indeed much more efficient in RNA recovery. This is critical when the amount of blood for RNA extraction is limited, which is generally the case if blood is historically stored from clinical trial participants. In addition, we found Nucleospin protocol is much simpler. It has only 8 steps and takes ~ 45 min to complete, compared to PreAnalytix kit which consists of 21 steps and can require up to 2 h of processing time. Regarding RNA quality and expression, our improved protocol showed equivalent RIN and identical expression levels of 5 reference genes, suggesting data of the two methods are likely comparable, although whole transcriptomic sequencing is required to fully assess similarity of the two expression profiles. A potential drawback of the mixing-before-thawing method is that blood in a whole EDTA tube generally needed to be entirely ­thawed16, therefore cannot be saved for other purposes. In most cases this should not be a problem because most blood-based assays such as ELISA and metabolite measurement can only be done on serum/plasma, which requires separation from fresh blood before cryopreservation. Frozen whole blood is pri- marily used for DNA extraction and as we demonstrated in this study, it is also possible to concurrently extract RNA and DNA after the blood is treated with cell lysis buffer from Nucleospin blood RNA kit. A proportion of the lysed blood (up to 1.3 ml) will continue to be used for RNA extraction by the same kit, while the rest can be used for DNA extraction using Nucleospin blood DNA kit. This dual extraction method showed sufficient yield for next-gene sequencing of both RNA and DNA. Although A260/230 of the extracted DNA was relatively low, this could be further addressed by running the samples through Bio-spin columns multiple times until a desirable A260/230 is achieved. In summary, we have optimised a protocol to extract high quality and quantity RNA from EDTA tubes to study gene expression. In addition, Nucleospin blood RNA and DNA kits can be used together to isolate both RNA and DNA from the same extraction. Should the new method be adopted, all legacy EDTA blood can be utilised for gene expression profiling and future studies no longer need to rely on expensive RNA stabilising systems for blood storage. Methods Patients Participants of either sex aged between 18 and 75 years of age were included. Informed consent was obtained from all participants involved in this study. The study was carried out in accordance with relevant guidelines and regulations was approved by the human Ethics committee at Royal North Shore Hospital (Ref: HREC/17/ HAWKE/471). Blood from a volunteer (~ 10 ml/collection) was used to optimise RNA quantity and quality. Then a cohort of six healthy individuals were recruited to compare the novel method with the standard protocol using PAXgene system. Sample collection and storage For each participant, blood was collected by a clinical nurse in one PAXgene tube (2.5 ml) and two EDTA tubes (4 ml/tube) respectively. PAXgene tubes (Becton–Dickinson) were mixed thoroughly and stored in − 20 °C over- night followed by long-term storage in − 80 °C freezer. Blood collected in EDTA tubes (Sarstedt) were directly stored in − 80 °C freezer. Samples were kept at − 80 °C for 2–3 months until RNA extraction. RNA extraction strategies For RNA extraction from original Paxgene tubes, samples were thawed on ice for at least 2 h and PAXgene Blood RNA Kit (PreAnalytix, Hombrechtikon, Switzerland) was used to extract blood RNA according to the manu- facturer’s manual. This method is referred to as Paxgene Control or PP. For EDTA tubes, we had two strategies to optimise the RNA quantity and quality. The first was to replicate and optimise a reference protocol based on transferring EDTA blood to PAXgene tubes before extraction. Several conditions were then tested including (1) Different extraction kits: PAXgene Blood RNA Kit (PreAnalytix, Hombrechtikon, Switzerland) versus MagMAX blood RNA Isolation Kit for PAXgene (Thermofisher Scientific, MA, USA), (2) different post-transfer incubation time: 2 h versus overnight, and (3) same day extraction vs refreezing the samples for later extraction. The second strategy was to optimise the Nucleospin blood RNA extraction kit (Macherey–Nagel, Westfalen, Germany), which was primarily meant to be used for fresh blood but has been shown to produce a much higher yield of RNA compared to other protocols using frozen ­blood15,16. DNA extraction 4 ml of blood was thawed using lysis buffer in Nucleospin blood RNA kit then 2.0 ml of blood was moved into a new centrifuge tube for DNA isolation. Blood DNA was extracted using Nucleospin Blood DNA Midi Kit according to the manufacturer’s instruction, followed by salt clearance using Micro Bio-Spin™ P-30 Gel Columns, Tris Buffer (Bio-rad, CA, USA). RNA/DNA quantity and quality check RNA concentration and quality were measured by TapeStation 4200 (Agilent, CA, USA). DNA concentration was measured by Nanodrop 100. A260/A230 and A280/260 were measured using Nanodrop. 6 Vol:.(1234567890) Scientific Reports | (2024) 14:8628 | https://doi.org/10.1038/s41598-024-58576-9 www.nature.com/scientificreports/ Real‑time qPCR 500 ng of RNA from each sample was used for cDNA synthesis using iScript™ gDNA Clear cDNA Synthesis Kit (Bio-rad, CA, USA) and RT-PCR was run using iTaq™ Universal SYBR® Green Supermix according to the manufacturer’s instructions. In order to compare the mRNA expression profiles of the blood processed by the reference protocol and the novel method, two reference genes including 18 s and β-actin (ACTB) were exam- ined. In addition, Monocyte Chemoattractant Protein 1 (MCP1), Tumour necrosis factor alpha (TNF-α) and Thioredoxin-Interacting Protein (TXNIP) were tested as genes of interest as they are involved in inflammation and diabetes (ref). Statistics For protocol optimisation, each condition was tested in duplicate on two different days using blood from the same volunteer, and data are expressed as Mean ± SEM. For validation, a human cohort of n = 6 was used and data are expressed as Mean ± SD. Unpaired t-tests were used for each comparison and P < 0.05 was considered significant. Data availability The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request. Received: 2 January 2024; Accepted: 1 April 2024 References 1. Reynier, F. et al. Specific gene expression signature associated with development of autoimmune type-I diabetes using whole-blood microarray analysis. Genes Immun. 11, 269–278 (2010). 2. Wu, L. et al. Profiling peripheral microRNAs in obesity and type 2 diabetes mellitus. APMIS 123, 580–585. https://​doi.​org/​10.​ 1111/​apm.​12389 (2015). 3. Liang, Z. et al. RNA sequencing identified specific circulating miRNA biomarkers for early detection of diabetes retinopathy. Am. J. Physiol. Endocrinol. Metab. 315, E374–E385 (2018). 4. Bell, K. J. et al. Metabolite-based dietary supplementation in human type 1 diabetes is associated with microbiota and immune modulation. Microbiome 10, 1–21 (2022). 5. Rhodes, C. J. et al. Whole-blood RNA profiles associated with pulmonary arterial hypertension and clinical outcome. Am. J. Respir. Crit. Care Med. 202, 586–594 (2020). 6. McCaffrey, T. A. et al. RNA sequencing of blood in coronary artery disease: Involvement of regulatory T cell imbalance. BMC Med. Genomics 14, 1–20 (2021). 7. Vanhaverbeke, M. et al. Peripheral blood RNA biomarkers for cardiovascular disease from bench to bedside: A position paper from the EU-CardioRNA COST action CA17129. Cardiovasc. Res. 118, 3183–3197 (2022). 8. Borovecki, F. et al. Genome-wide expression profiling of human blood reveals biomarkers for Huntington’s disease. Proc. Natl. Acad. Sci. 102, 11023–11028 (2005). 9. Craig, D. W. et al. RNA sequencing of whole blood reveals early alterations in immune cells and gene expression in Parkinson’s disease. Nat. Aging 1, 734–747 (2021). 10. Cummins, J. & Velculescu, V. Implications of micro-RNA profiling for cancer diagnosis. Oncogene 25, 6220–6227 (2006). 11. Roskams-Hieter, B. et al. Plasma cell-free RNA profiling distinguishes cancers from pre-malignant conditions in solid and hema- tologic malignancies. NPJ Precis. Oncol. 6, 28 (2022). 12. Beekman, J. M. et al. Recovery of microarray-quality RNA from frozen EDTA blood samples. J. Pharmacol. Toxicol. Methods 59, 44–49. https://​doi.​org/​10.​1016/j.​vascn.​2008.​10.​003 (2009). 13. Chai, V., Vassilakos, A., Lee, Y., Wright, J. A. & Young, A. H. Optimization of the PAXgene blood RNA extraction system for gene expression analysis of clinical samples. J. Clin. Lab. Anal. 19, 182–188. https://​doi.​org/​10.​1002/​jcla.​20075 (2005). 14. Thörn, I. et al. The impact of RNA stabilization on minimal residual disease assessment in chronic myeloid leukemia. Haematologica 90, 1471–1476 (2005). 15. Kim, J. H. et al. Comparison of three different kits for extraction of high-quality RNA from frozen blood. SpringerPlus 3, 76. https://​ doi.​org/​10.​1186/​2193-​1801-3-​76 (2014). 16. Yamagata, H. et al. Optimized protocol for the extraction of RNA and DNA from frozen whole blood sample stored in a single EDTA tube. Sci. Rep. 11, 17075. https://​doi.​org/​10.​1038/​s41598-​021-​96567-2 (2021). 17. Kang, J. E., Hwang, S. H., Lee, J. H., Park, D. Y. & Kim, H. H. Effects of RBC removal and TRIzol of peripheral blood samples on RNA stability. Clin. Chim Acta Int. J. Clin. Chem. 412, 1883–1885. https://​doi.​org/​10.​1016/j.​cca.​2011.​06.​016 (2011). 18. van der Sijde, F. et al. RNA from stabilized whole blood enables more comprehensive immune gene expression profiling compared to RNA from peripheral blood mononuclear cells. PLoS ONE 15, e0235413. https://​doi.​org/​10.​1371/​journ​al.​pone.​02354​13 (2020). 19. Shen, Y. et al. Impact of RNA integrity and blood sample storage conditions on the gene expression analysis. OncoTargets Ther. 11, 3573–3581. https://​doi.​org/​10.​2147/​ott.​S1588​68 (2018). 20. Lefrançois, P. et al. TruSeq-based gene expression analysis of formalin-fixed paraffin-embedded (FFPE) cutaneous T-cell lymphoma samples: Subgroup analysis results and elucidation of biases from FFPE sample processing on the TruSeq platform. Front. Med. 4, 153. https://​doi.​org/​10.​3389/​fmed.​2017.​00153 (2017). Author contributions L.T.N designed and performed experiments, analysed data and wrote the manuscript, C.P managed project funding and reviewed the manuscript, S.S conceptualised and reviewed the manuscript. Competing interests  The authors declare no competing interests. Additional information Correspondence and requests for materials should be addressed to L.T.N. Reprints and permissions information is available at www.nature.com/reprints. 7 Vol.:(0123456789) Scientific Reports | (2024) 14:8628 | https://doi.org/10.1038/s41598-024-58576-9 www.nature.com/scientificreports/ Publisher’s note  Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Open Access  This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creat​iveco​mmons.​org/​licen​ses/​by/4.​0/. © The Author(s) 2024

Title: Extraction of high quality and high yield RNA from frozen EDTA blood ​ Authors: Long T. Nguyen, Carol A. Pollock, Sonia Saad, H. Yamagata, et al. ​ Publisher: Springer Nature ​​​​ Date: 2021 Abstract: The study developed a novel protocol for extracting high-quality RNA from frozen EDTA blood, enabling RNA profiling and biomarker discovery. ​ The protocol significantly improved RNA quality, achieving a RIN above 7, and resulted in 5 times higher RNA yield compared to existing methods. ​ It also allowed for simultaneous DNA extraction, providing a practical approach for gene expression profiling and biomarker research.

Extendable high gain low current high pulse modifed quadratic–SEPIC converter for water treatment applications.pdf

1 Vol.:(0123456789) Scientific Reports | (2024) 14:4899 | https://doi.org/10.1038/s41598-024-55708-z www.nature.com/scientificreports Extendable high gain low current/high pulse modified quadratic–SEPIC converter for water treatment applications P. Sumathy 1, J. Divya Navamani 1*, Jagabar Sathik Mohamed Ali 1, A. Lavanya 1, Pradeep Vishnuram 1, Mohit Bajaj 2,3,4,5*, Shir Ahmad Dost Mohammadi 6* & Lukas Prokop 7 Substantial attention has been drawn over the past few years by high step-up dc-dc converters owing to their applications in a wide range. Apart from renewable energy applications, high voltage/ high pulse converters are efficiently used in water treatment applications. The converter suggested a combination of Quadratic and SEPIC converters with a diode-capacitor cell. This topology generates high-voltage repetitive pulses with a single semiconductor switch and reduced component count. The stress across the components is less than the high-gain converters reported in the literature. The topology has an extendable feature by increasing the number of diode-capacitor cells without affecting the stress. The superiority of the high pulse generating topology is validated with a similar converter in the literature. This paper discusses the nL5 simulator results for the proposed rated topology required for water treatment. A scaled-down 50 W prototype is tested for various input voltages to generate high voltage pulse, and the analytical study is validated. Keywords  Water treatment, High voltage pulse, High gain, Multiplier cell, HPSQB Abbreviations GV Voltage gain GI Current gain M Number of Multiplier cell CDVM Capacitor–diode voltage multiplier PEF Pulsed Electric Field PFN Pulse Forming Network D Duty Cycle Vg Input voltage Vo Output voltage VGate Gate pulse VC Capacitor voltage VL Inductor voltage RL Internal resistance of the inductor RO Load resistance CCM Continuous conduction mode HPSQB High pulse SEPIC–Quadratic Boost OPEN 1Department of Electrical Engineering, SRM Institute of Science and Technology, Kattankulathur, Chennai, India. 2Department of Electrical Engineering, Graphic Era (Deemed to be University), Dehradun  248002, India. 3Hourani Center for Applied Scientific Research, Al-Ahliyya Amman University, Amman, Jordan. 4Graphic Era Hill University, Dehradun 248002, India. 5Applied Science Research Center, Applied Science Private University, Amman  11937, Jordan. 6Department of Electrical and Electronics, Faculty of Engineering, Alberoni University, Kapisa, Afghanistan. 7ENET Centre, VSB—Technical University of Ostrava, 708 00 Ostrava, Czech Republic. *email: [email protected]; [email protected]; [email protected] 2 Vol:.(1234567890) Scientific Reports | (2024) 14:4899 | https://doi.org/10.1038/s41598-024-55708-z www.nature.com/scientificreports/ The necessity for water treatment is increasing due to various reasons like water pollution, climatic changes result- ing from global warming, drinking water shortage, mainly due to the growing population, etc. Water treatment is crucial in protecting the terrestrial environment from contaminated water from industrial chemicals. The common methods for elimination of microbial contamination in water are chemical ­treatment1–4, application of intense ­heat5, filtration by ­UV6,7, ­electrodialysis8 and reverse osmosis ­process9. Conventional water treatment techniques have harmful chemical by-products during their processing. The appropriate solution to overcome the demerits of old water treatment techniques is the implementation of power electronic pulse generators, which can be used effectually for bacterial decontamination in water treatment applications. Three key water treatment techniques are involved: Electrolysis, Pulse discharging power technique and Pulse Electric field technique. The electrolysis technique used in wastewater treatment is based on the electrochemical reaction. Pulsed electric field techniques with high-voltage pulses are used to sterilize drinking water. Pulse discharge water treatment is utilized for sewage water treatment. The applications of these techniques in various water treatment sectors are illustrated in Fig. 1. High gain conversion is generally achieved by increasing the multiplier cell stages. Topologies discussed in the literature include a modular bipolar high-voltage pulse generator capable of generating bipolar pulses with high voltage and output ­flexibility10–13. A two-stage high-voltage pulse generator converter topology with key features like scalability, modularity, and redundancy is used for electroporation applications is ­discussed14. Sequential pulse generators producing repetitive pulses were discussed as suitable for disinfection ­applications15. Pulsed Electric Field (PEF) method has had promising applications in several fields in the last few years. Pathogenic bacteria and other antibiotic–resistant microorganisms are treated with the high pulse of the electric field. For water treatment applications, pulsed arc discharge and underwater pulsed streamer corona discharge are the two main types of Pulsed Electric Field (PEF) ­treatments16,17. The effect of microorganisms and their removal by comparing the two methods is presented ­in17. It is also observed from the literature that the underwater pulsed streamer corona discharge requires lesser power compared to pulsed arc discharge. The application of bipolar pulses is even more effective compared to its counterpart. Even though electroporation successfully applies pulsed electric fields, permanent cell membrane damage is caused by the electric voltage of very ­high18–20. Generally, the pulse generation for water treatment based on power electronic switches can be classified into two types precisely classical and solid-state pule generation methodology. Different pulse generation methodologies are depicted in Fig. 2. The Chopper and Marx circuits generate pulses with capacitor storage in classical methods. In Magnetic Pulse Compressor (MPC), a storage capacitor and a magnetic switch is employed for pulse generation. PFL is a crucial method to generate high-power short pulses of the nanoseconds pulse width. For generating rectangular pulses with a pulse width greater than 500 ns, PFL is unsuitable; therefore, Pulse Forming Network (PFN) is used. Small and medium power pulses are generated in a dual resonant Tesla transformer circuit. In solid-state pulse generation methodology, solid-state switches generate definite pulses. DC-DC isolated and non-isolated converters generate high-voltage pulses with single or multiple controls. This methodology can be used wherever high-voltage pulses are required in water treatment applications. Capacitor–diode voltage multipli- ers (CDVMs) are also used in electric pulse generators which are highly reliable, efficient, lightweight, and smaller in ­size19. However, they pose a risk of increasing voltage ripples of capacitors and falling output pulse frequency. Low pulsed dc voltages effectively deactivating microbes generally found diffused in water from dead animals Pulse Generating techniques - Water treatment Leather Factory Printing Industry 2.Electrolysis 1.Pulse Discharging Power Sewage Sludge Sewage Pharmaceutic al Sewage Domestic Sewage Municipal Drinking water Fresh water 3.Pulse Electric Field Dyeing Industry Paper Industry Figure 1.   Water treatment techniques. 18 Vol:.(1234567890) Scientific Reports | (2024) 14:4899 | https://doi.org/10.1038/s41598-024-55708-z www.nature.com/scientificreports/ Data availability The datasets used and/or analysed during the current study available from the corresponding author on reason- able request. Received: 14 January 2024; Accepted: 27 February 2024 References 1. Bergeron, S., Raj, B., Nathaniel, R., Corbin, A. & LaFleur, G. Presence of antibiotic resistance genes in raw source water of a drink- ing water treatment plant in a rural community of USA. Int. Biodeterior. Biodegrad. 124, 3–9 (2017). 2. Escobar-Hoyos, L. F. et al. Genotoxic and clastogenic effects of monohaloacetic acid drinking water disinfection by-products in primary humanm lymphocytes. Water Res. 47(10), 3282–3290 (2013). 3. Gorito, A. M., Ribeiro, A. R., Gomes, C. R., Almeida, C. M. R. & Silva, A. M. T. Constructed wetland microcosms for the removal of organic micropollutants from freshwater aquaculture effluents. Sci. Total Environ. 10(644), 1171–1180 (2018). 4. Yuan, Q. B., Guo, M. T. & Yang, J. Fate of antibiotic resistant bacteria and genes during wastewater chlorination: Implication for antibiotic resistance control. PLoS One 10(3), e0119403 (2015). 5. Cao, Y., Æsay, V. & Liang, Q. Green ballast water treatment utilizing waste heat recovery, OCEANS 2016 - Shanghai, pp. 1–7 (2016). 6. Rizzo, L. et al. Effect of solar simulated N-doped TiO2 photocatalysis on the inactivation and antibiotic resistance of an E. coli strain in biologically treated urban wastewater. Appl. Catal. B: Environ. 144, 369–378 (2014). 7. Saien, J., Osali, M. & Soleymani, A. R. UV/persulfate and UV/hydrogen peroxide processes for the treatment of salicylic acid: Effect ofoperating parameters, kinetic, and energy consumption. Desalin. WaterTreat. 56(11), 3087–095 (2015). 8. Abhishek, L., Karthick, R. A., Kumar, K. D. & Sivakumar, G. Efficient water treatment using smart materials. Int. Conf. Smart Struct. Syst. 2014, 94–99 (2014). 9. Tiwari, J., Singh, A. K., Yadav, A., & Jha, R. K. Sustainable power production and purification of water. In 2014 International Conference on Advances in Computing, Communications and Informatics (ICACCI) pp. 2258–2263 (2014). 10. Barcelon, L., Landicho, J., Lim, C., Tampis, D., Magwili, G. & Garcia, R. Implementation of multi-module high voltagepulse generator based on DC-DC boost converter and capacitor-diode voltage multipliers for elimination of Escherichia coli O157:H7 inwater. AIP Conference Proceedings. 2045. (2018) 11. Malviya, D. & Veerachary, M. A boost converter-based high-voltage pulsed-power supply. IEEE Trans. IndustryAppl. 56(5), 5222– 5233 (2020). 12. Elserougi, A., Massoud, A. & Ahmed, S. Multimodule boost-converter-based pulse generators: Design and operation. IEEETrans. Plasma Sci. 48(1), 219–227 (2020). 13. Navamani, D., Krishnasamy, V. & Jegatheesan, R. Non-isolated high gain DC-DC converter by quadraticboost converter and voltage multiplier cell. Ain Shams Eng. J. https://​doi.​org/​10.​1016/j.​asej.​2016.​09.​007 (2016). 14. Delshad, M. R., Rezanejad, M. & Sheikholeslami, A. A new modular bipolar high-voltage pulse generator. IEEE Trans. Ind. Electron. 64(2), 1195–1203 (2017). 15. Elgenedy, M. A., Massoud, A. M., Ahmed, S., Williams, B. W. & High-Gain, A. High-voltage pulse generator using sequentially chargedmodular multilevel converter submodules, for water disinfection applications. IEEE J. Emerg. Sel. Topics Power Electron. 6(3), 1394–1406 (2018). Table 11.   Specification of voltage considered for testing the sample. Sl.no Real time treatment conditions Simulation and prototype obtained pulsed voltages 360 V (prototype output) 5 kV (simulation output) 1 Frequency of Pulses 500 Hz 500 Hz 2 Pulse width 168 μs 169 μs 3 Distance between the electrodes 9.87 mm 9.87 mm 4 Current 0.4 A 0.1 A 5 Treatment time 6 min 6 min 6 Type of electrode Stainless steel Stainless steel 7 Sample description Raw water Raw water 8 Place of collection Kitchen Kitchen 9 Treatment temperature 26 °C 29 °C 10 Treatment chamber Static Static Table 12.   Microbes identified in the sample and the test results. Sl.no Microbes identified Sample-raw water (Municipality water collected from kitchen) Before treatment Treated under 360 V pulsed DC Treated under 5000 V pulsed DC 1 Coliform bacteria 10 cfu/gm 02 cfu/gm Absent 2 Staphylococcus auerus/gm 06 cfu/gm Absent Absent 3 Salmonella 02 cfu/gm Absent Absent 4 Escherichia coli 08 cfu/gm Absent Absent 19 Vol.:(0123456789) Scientific Reports | (2024) 14:4899 | https://doi.org/10.1038/s41598-024-55708-z www.nature.com/scientificreports/ 16. Dang, T. H., Denat, A., Lesaint, O. & Teissedre, G. Pulsed electrical discharges in water for removal of organic pollutants: A com- parative study. Eur. Phys. J. Appl. Phys. 47(2), 1–7 (2009). 17. Yang, Y. Plasma discharge in water and its application for industrial cooling water treatment, PhD Thesis, Drexel University, (2011). 18. Elserougi, A., Ahmed, S., & Massoud, A. High-voltage pulse generator based on capacitor-diode voltage multiplier centrally fed from dc-dc boost converter. In 8th IET International Conference on Power Electronics, Machines and Drives (PEMD 2016), Glasgow, UK, pp. 1–4 (2016). 19. Elserougi, A., Ahmed, S., Massoud, A. High voltage pulse generator based on DC-to-DC boost converter with capacitor-diode voltage multipliers for bacterial decontamination, In IECON 2015 - 41st Annual Conference of the IEEE Industrial Electronics Society, pp. 000322–000326 (2015). 20. Elserougi, A., Abdel-Khalik, A. S., Ahmed, S., & Massoud, A. M. AC-powered multi-module high-voltage pusle-generator with sinusoidalinput current for water treatment via underwater pulsed arc discharge. In 2017 11th IEEE International Conference on Compatibility, PowerElectronics and Power Engineering (CPE-POWERENG), Cadiz, Spain, pp. 163–168 (2017). 21. Tirono, M., Hananto, F. S. & Abtokhi, A. Pulse voltage electrical stimulation for bacterial inactivation and wound healing in mice with diabetes. Avicenna J. Med. Biotechnol. 14(1), 95–101. https://​doi.​org/​10.​18502/​ajmb.​v14i1.​8175 (2022). 22. Zhu, N. et al. Inactivation of Pichia rhodanensis in relation to membrane and intracellular compounds due to microchip pulsed electric field (MPEF) treatment. PLoS One 13(6), e0198467. https://​doi.​org/​10.​1371/​journ​al.​pone.​01984​67.​PMID:​29939​985;​ PMCID:​PMC60​16922 (2018). 23. Wu, M. et al. High-voltage, pulsed electric fields eliminate Pseudomonas aeruginosa stable infection in a mouse burn model. Adv. Wound Care (New Rochelle) 10(9), 477–489. https://​doi.​org/​10.​1089/​wound.​2019.​1147 (2021). 24. Malviya, D., & Veerachary, M. A novel boost converter based high-voltage pulsed-power supply. In 2019 IEEE international conference on sustainable energy technologies and systems (ICSETS), Bhubaneswar, India, pp. 353–358 (2019). 25. Nami, A., Sakamoto, T., Akiyama, M., & Akiyama, H. Development of a boost converter topology for a high repetition pulsed power generator. In 2011 IEEE Pulsed Power Conference, Chicago, IL, USA, pp. 1336–1341 (2011) 26. Veerachary, M. Design and analysis of a new quadratic boost converter. In 2017 National Power Electronics Conference (NPEC), Pune, India, pp. 307–313 (2017) 27. Yu, C. H., Jang, S. R., Kim, H. S., Bae, J. S., & Kim, S. Pulse Generator with fast switching speed and short pulse width based on semiconductor switches for wide applications. In IECON 2018-44th Annual Conference of the IEEE Industrial Electronics Society. IEEE, pp. 1418–1423. doi: https://​doi.​org/​10.​1109/​IECON.​2018.​85926​88 (2018). 28. Babaei, E., Mashinchi Maheri, H., Sabahi, M. & Hosseini, S. H. Extendable nonisolated high gain DC–DC converter based on active–passive inductor cells. IEEE Trans. Ind. Electron. 65(12), 9478–9487 (2018). 29. Shanthi, T., Prabha, S. U. & Sundaramoorthy, K. Non-isolated n-stage high step-up DC-DC converter for low voltage DC source integration. IEEE Trans. Energy Convers. 36(3), 1625–1634 (2021). 30. Elserougi, A., Massoud, A. M., Ibrahim, A. M. & Ahmed, S. A high voltage pulse-generator based on DC-to-DC converters and capacitor-diode voltage multipliers for water treatment applications. IEEE Trans. Dielectr. Electr. Insulation 22(6), 3290–3298. https://​doi.​org/​10.​1109/​TDEI.​2015.​005376 (2015). 31. Abadi, M. R. Q. R., Marzebali, M. H., Abolghasemi, V. & Anisi, M. H. High-voltage pulse generators for electroporation applica- tions: A systematic review. IEEE Access 10, 64933–64951 (2022). 32. Gu, Y., Zhang, C., Bian, W., Wu, S. & Xu, Z. A novel modular pulse generator with high voltage gain and reduced number of capacitors. IEEE Trans. Plasma Sci. 50(2), 394–400 (2022). 33. Sumathy, P. et al. PV powered high voltage pulse converter with switching cells for food processing application. Energies 16, 1010 (2023). 34. Lavanya, A., Divya Navamani, J., Nihal, A., Narain, A., & Aashi. Novel High Voltage Pulse Generator Structure for Water Treatment Applications. https://​doi.​org/​10.​1007/​978-​981-​19-​7728-2_8. (2023). 35. Koç, Y., Birbir, Y. & Bodur, H. Non-isolated high step-up DC/DC converters—An overview. Alex. Eng. J. 61, 1091–1132 (2021). 36. Li, Z., Liu, H., Jiang, S., Guo, L. & Rao, J. A high-current all solid-state pulse generator based on Marx structure. IEEE Trans. Plasma Sci. 48(10), 3629–3636 (2020). 37. Rahimi, T., Ding, L., Gholizadeh, H., Shahrivar, R. S. & Faraji, R. An ultrahigh step-up DC–DC converter based on the boost, Luo, and voltage doubler structure: Mathematical expression, simulation, and experimental, IEEE. Access 9, 132011–132024 (2021). 38. Subhani, N. et al. An improved non-isolated quadratic DC-DC boost converter with ultra high gain ability. IEEE Access 11, 11350–11363 (2023). Acknowledgements This article has been produced with the financial support of the European Union under the REFRESH – Research Excellence For Region Sustainability and High-tech Industries project number CZ.10.03.01/00/22_003/0000048 via the Operational Programme Just Transition and paper was supported by the following project TN02000025 National Centre for Energy II. Author contributions S.P., D.N.J., J.S.M.A., L.A.: Conceptualization, Methodology, Software, Visualization, Investigation, Writing- Original draft preparation. P.V.: Data curation, Validation, Supervision, Resources, Writing—Review & Editing. M.B., L.P. and S.A.D.M.: Project administration, Supervision, Resources, Writing—Review & Editing. Competing interests  The authors declare no competing interests. Additional information Correspondence and requests for materials should be addressed to J.D.N., M.B. or S.A.D.M. Reprints and permissions information is available at www.nature.com/reprints. Publisher’s note  Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. 20 Vol:.(1234567890) Scientific Reports | (2024) 14:4899 | https://doi.org/10.1038/s41598-024-55708-z www.nature.com/scientificreports/ Open Access  This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creat​iveco​mmons.​org/​licen​ses/​by/4.​0/. © The Author(s) 2024

Title: Extendable high gain low current/high pulse modified quadratic–SEPIC converter for water treatment applications ​ Authors: P. Sumathy, J. Divya Navamani, Jagabar Sathik Mohamed Ali, A. Lavanya, Pradeep Vishnuram, Shir Ahmad Dost Mohammadi, Lukas Prokop, Mohit Bajaj ​ Publisher: Nature Scientific Reports ​ Date: 2024-02-27 00:00:00 Abstract: Substantial attention has been drawn over the past few years by high step-up dc-dc converters owing to their applications in a wide range. ​ Apart from renewable energy applications, high voltage/high pulse converters are efficiently used in water treatment applications. ​ The converter suggested a combination of Quadratic and SEPIC converters with a diode-capacitor cell. ​ This topology generates high-voltage repetitive pulses with a single semiconductor switch and reduced component count. ​ The stress across the components is less than the high-gain converters reported in the literature. ​ The topology has an extendable feature by increasing the number of diode-capacitor cells without affecting the stress. ​ The superiority of the high pulse generating topology is validated with a similar converter in the literature. ​ This paper discusses the nL5 simulator results for the proposed rated topology required for water treatment. ​ A scaled-down 50 W prototype is tested for various input voltages to generate high voltage pulse, and the analytical study is validated. ​

High performance platinum contacts on high‐fux CdZnTe detectors.pdf

1 Vol.:(0123456789) Scientific Reports | (2023) 13:17963 | https://doi.org/10.1038/s41598-023-45331-9 www.nature.com/scientificreports High performance platinum contacts on high‑flux CdZnTe detectors Manuele Bettelli 1*, Silvia Zanettini 2, Leonardo Abbene 3, Francesca Casoli 1, Lucia Nasi 1, Giovanna Trevisi 1, Fabio Principato 3, Antonino Buttacavoli 3 & Andrea Zappettini 1 The need for direct X-ray detection under high photon flux with moderate or high energies (30– 100 keV range) has strongly increased with the rise of the 4th Generation Synchrotron Light Sources, characterised by extremely brilliant beamlines, and of other applications such as spectral computed tomography in medicine and non-destructive tests for industry. The novel Cadmium Zinc Telluride (CZT) developed by Redlen Technologies can be considered the reference material for high-flux applications (HF-CZT). The enhanced charge transport properties of the holes allow the mitigation of the effects of radiation induced polarization phenomena, typically observed in standard CZT materials (LF-CZT) under high photon flux. However, standard LF-CZT electrical contacts led to inacceptable high dark leakage currents on HF-CZT devices. In this work, a detailed study on the characteristics of new optimized sputtered platinum electrical contacts on HF-CZT detectors is reported. The results from electrical and spectroscopic investigations, showed the best performances on HF-CZT detectors with platinum anode, coupled with both platinum or gold cathode. The morphology, structure, and composition of Pt/CZT contact have been analysed by means of Transmission Electron Microscopy (TEM) on microscopic lamellas obtained by Focused Ion Beam (FIB), highlighting the presence of ­CdTeO3 oxide at the metal semiconductor interface. Despite several decades of progress in developing CdZnTe-based radiation detectors, both crystal growth and contact deposition can still be considered hot topics in this field of research. Recently, Redlen Technologies (Canada) proposed a new grade of CdZnTe material able to withstand high radiation fluxes to satisfy the ever- growing needs of application fields like medical and security ­imaging1. The high-flux CdZnTe (HF-CZT) can operate at continuous X-ray fluxes > ­108 photons/mm2/s2 and at far higher levels of instantaneous flux tested with extreme intensities delivered by a free electron laser (FEL)3. HF-CZT is also characterized by excellent spatial ­uniformity4, outstanding linear response and time stability at fluxes up to ­1010 photons/mm2/s5 as was recently tested. It has been well demonstrated by now that such astonishing performances at intense radiation fluxes are related to a hole’s lifetime increase of an order of magnitude ( τh ∼2.5 µs)6–8 with respect to standard grade CZT (LF-CZT) and a hole’s mobility-lifetime product µhτ h exceeding ­10–4 ­cm2/V9. The development and improvement of new contact deposition techniques is stimulated by the availability of new promising materials. One of the main challenges posed by CdZnTe is the fact that the same contact deposi- tion procedure may lead to strongly different results on CZT crystals with slightly different physico-chemical properties, trap characteristics and Fermi-level ­position10. Selecting the appropriate electrode material is essential for minimizing the leakage currents. Despite several studies have been carried out reporting electrical charac- terization of contacts on standard LF-CZT ­detectors11–16, only few studies were performed on HF-CZT17. The first attempts in realising blocking contacts on this material by means of the technique developed at IMEM-CNR, i.e., gold electroless deposition technique from alcoholic ­solutions13, were unsuccessful. This deposi- tion technique allowed to obtain performing and robust contacts on both boron-encapsulated vertical-Bridgman grown CZT and Redlen LF-CZT, as shown in previous ­publications18–20, but producing sensors with extremely high leakage currents even at low bias voltage when used on HF-CZT. The platinum electroless contacts devel- oped by IMEM-CNR and reported in Bettelli et al.16 were also tested. However, similarly to the gold electroless contacts, these contacts induced excessively high leakage currents, making them unsuitable for radiation detec- tor applications. OPEN 1IMEM-CNR, 43124  Parma, Italy. 2due2lab S.R.L., 42019  Scandiano, RE, Italy. 3Department of Physics and Chemistry (DiFC) ‑ Emilio Segrè, University of Palermo, 90128  Palermo, Italy. *email: manuele.bettelli@ imem.cnr.it 2 Vol:.(1234567890) Scientific Reports | (2023) 13:17963 | https://doi.org/10.1038/s41598-023-45331-9 www.nature.com/scientificreports/ This limitation stimulated the development of new optimized contacts for HF-CZT detectors. In this context, we developed new platinum sputtered contacts, obtaining HF-CZT detectors with low leakage currents and interesting spectroscopic performance. Methods Sample preparation Several detectors were fabricated on HF-CZT, with different electrode configurations. HF-CZT crystals, provided by Redlen Technologies, are oriented along the <111> crystallographic direction and have two polar faces, A-face or Cd-face (cadmium-rich face) and B-face or Te-face (tellurium-rich face). Usually Cd-face is more p-type and is conventionally chosen as anode, while Te-face is more n-type and typically chosen as ­cathode21. As discussed in the introduction, the transport properties of HF-CZT differ from those of standard spectroscopic CZT (LF- CZT), with mobility-lifetime products of ­10–3 and ­10–4 ­cm2/V for electrons and holes, ­respectively6. Detectors equipped with platinum sputtered contacts and gold electroless contacts were realised. Platinum contacts were deposited at IMEM-CNR using the sputtering technique (base vacuum: 3 × ­10–8 mbar; Ar pres- sure: 8 × ­10–3 mbar, target voltage: 1000 V). The resulting Pt layer appears homogeneous, shiny, and off-white. The layer thickness is about 100 nm, the surface roughness is 5.0 nm and 4.0 nm for ­Rq and ­Ra respectively as measured with AFM (see Fig. SI_1 in Supplementary Info). Gold contacts were instead deposited following the electroless procedure developed by Benassi et al.13 that ensures high mechanical stability. Four detectors were fabricated starting from a single chip of HF-CZT cut into four 5 × 5 × 1.5 ­mm3 crystals oriented along the <111> direction. Each sample was lapped and polished before depositing the contacts. The detectors had a full-area cathode and a customised pixelated anode as shown in Fig. 1. Pixel size is 500 µm, gaps between pixels and guardpad are 200 µm large. Pixels area is 0.25 ­mm2. The pattern is composed of two single isolated pixels (surrounded by guardpad) and a 2 × 2 pixel matrix. The four detectors had the same geometry (Fig. 1) but different combinations of metal contacts at the anode (Cd-face) and cathode (Te-face). We carried out a comparative study to evaluate their characteristics. All possible electrode configurations were tested and, subsequently, the best detectors were investigated extensively to characterise their behaviour. Samples are named reporting their cathode/CZT/anode structure in the following way: 1. Pt/CZT/Pt detector, where both contacts were made of platinum, is called PP. 2. Au/CZT/Au detector, where both contacts were gold, is called AA. 3. Au/CZT/Pt detector, where cathode was gold, while anode was platinum, is called AP. 4. Pt/CZT/Au detector, where cathode was platinum while anode was gold, is called PA. Current–voltage measurements and modelling Preliminary electrical characterization was performed at IMEM-CNR Parma (Italy), in order to first check leakage currents of the detectors. Current–voltage (I–V) measurements were carried out in a probe station equipped with a metallic plate and two probe tips mounted on micromanipulators and connected to a Keithley 2410 sourcemeter and a Keithley 6548 picoammeter. The system is located inside a Faraday cage that allows to ensure dark measurement conditions and to reach very low noise levels. To investigate the electrical properties of the detectors at different temperatures, a second set of electrical measurements was performed at the Department of Physics and Chemistry (DiFC) of University of Palermo by using a temperature-controlled system. The I–V curves were measured with the CAEN NDT1471 power supply connected to the cathode and the Keithley 2635B, configured as an electrometer, connected to the pixel anode. The guard electrode was forced to the ground potential. I–V measurements were performed in both reverse (i.e., by applying a negative voltage to the full-area electrode) and forward biasing (i.e., by applying a positive voltage to the full-area electrode). All measurements were performed with the detectors enclosed in a shielded box under a nitrogen atmosphere with a temperature control system. Figure 1.   Ramm3D model of Pt anode (left); photograph of the Pt full-area cathode and the pixellated Pt anode (right). 9 Vol.:(0123456789) Scientific Reports | (2023) 13:17963 | https://doi.org/10.1038/s41598-023-45331-9 www.nature.com/scientificreports/ Data availability All data necessary to replicate the experiments are included in the paper. Datasets generated and acquired during the current study are available from the corresponding author on a reasonable request. Received: 30 August 2023; Accepted: 18 October 2023 Figure 10.   (a) 109Cd, (b) 241Am, (c) 57Co energy spectra of a tested pixel of the AP detector. Figure 11.   Time stability of 241Am energy spectra. 10 Vol:.(1234567890) Scientific Reports | (2023) 13:17963 | https://doi.org/10.1038/s41598-023-45331-9 www.nature.com/scientificreports/ References 1. Iniewski, K. CZT sensors for computed tomography: From crystal growth to image quality. J. Instrum. 11, C12034 (2016). 2. Prokesch, M., Soldner, S. A. & Sundaram, A. G. CdZnTe detectors for gamma spectroscopy and X-ray photon counting at 250 × 106 photons/(mm2 s). J. Appl. Phys. 124, 044503 (2018). 3. Veale, M. C. et al. Cadmium zinc telluride pixel detectors for high-intensity X-ray imaging at free electron lasers. J. Phys. Appl. Phys. 52, 085106 (2019). 4. Veale, M. C. et al. Characterization of the uniformity of high-flux CdZnTe material. Sensors 20, 2747 (2020). 5. Baussens, O. et al. Characterization of high-flux CdZnTe with optimized electrodes for 4th generation synchrotrons. J. Instrum. 17, C11008 (2022). 6. Thomas, B. et al. Characterisation of Redlen high-flux CdZnTe. J. Instrum. 12, C12045 (2017). 7. Li, Y. et al. Effects of deep-level traps on the transport properties of high-flux X-ray CdZnTe detectors. Mater. Sci. Semicond. Process. 133, 105974 (2021). 8. Abbene, L. et al. Dual-polarity pulse processing and analysis for charge-loss correction in cadmium–zinc–telluride pixel detectors. J. Synchrotron. Radiat. 25, 1078–1092 (2018). 9. Buttacavoli, A. et al. Incomplete charge collection at inter-pixel gap in low- and high-flux cadmium zinc telluride pixel detectors. Sensors 22, 1441 (2022). 10. Ünal, M. & Turan, R. A path to produce high-performance CdZnTe crystals for radiation detection applications: Crystal growth by THM, surface preparation, and electrode deposition. In High-Z Materials for X-ray Detection: Material Properties and Charac- terization Techniques (eds Abbene, L. & Iniewski, K.) 227–243 (Springer, 2023). 11. Bolotnikov, A. E. et al. Properties of Pt Schottky type contacts on high-resistivity CdZnTe detectors. Nucl. Instrum. Methods Phys. Res. Sect. Accel. Spectrom. Detect. Assoc. Equip. 482, 395–407 (2002). 12. Turturici, A. A. et al. Electrical properties of Au/CdZnTe/Au detectors grown by the boron oxide encapsulated Vertical Bridgman technique. Nucl. Instrum. Methods Phys. Res. Sect. Accel. Spectrom. Detect. Assoc. Equip. 830, 243–250 (2016). 13. Benassi, G. et al. Strong mechanical adhesion of gold electroless contacts on CdZnTe deposited by alcoholic solutions. J. Instrum. 12, P02018 (2017). 14. Yu, J., Xu, L., Zhang, B., Zha, G. & Jie, W. On the current transport mechanism in metal–semiconductor–metal structured CdZnTe radiation detectors. Nucl. Instrum. Methods Phys. Res. Sect. Accel. Spectrom. Detect. Assoc. Equip. 957, 163445 (2020). 15. Yu, J., Xu, L., Li, Y., Zha, G. & Jie, W. Bias-induced relaxation phenomena in current temporal behaviors of CdZnTe radiation detectors. Nucl. Instrum. Methods Phys. Res. Sect. Accel. Spectrom. Detect. Assoc. Equip. 1002, 165295 (2021). 16. Bettelli, M. et al. Improved electroless platinum contacts on CdZnTe X- and γ-rays detectors. Sci. Rep. 10, 13762 (2020). 17. Principato, F., Bettelli, M., Zappettini, A. & Abbene, L. A novel extraction procedure of contact characteristic parameters from current–voltage curves in CdZnTe and CdTe detectors. Sensors 23, 6075 (2023). 18. Abbene, L. et al. Digital fast pulse shape and height analysis on cadmium–zinc–telluride arrays for high-flux energy-resolved X-ray imaging. J. Synchrotron. Radiat. 25, 257–271 (2018). 19. Buttacavoli, A. et al. Room-temperature performance of 3 mm-thick cadmium–zinc–telluride pixel detectors with sub-millimetre pixelization. J. Synchrotron. Radiat. 27, 1180–1189 (2020). 20. Tsigaridas, S. et al. Fabrication of small-pixel CdZnTe sensors and characterization with X-rays. Sensors 21, 2932 (2021). 21. Chen, H. et al. CZT device with improved sensitivity for medical imaging and homeland security applications. In Hard X-Ray, Gamma-Ray, and Neutron Detector Physics XI Vol. 7449, 15–31 (SPIE, 2009). 22. Wu, C. Interfacial layer-thermionic-diffusion theory for the Schottky barrier diode. J. Appl. Phys. 53, 5947–5950 (1982). 23. Wu, C. Interfacial layer theory of the Schottky barrier diodes. J. Appl. Phys. 51, 3786–3789 (2008). 24. Del Sordo, S. et al. Spectroscopic performances of 16×16 pixel CZT imaging hard-X-ray detectors. Il Nuovo Cimento B 119, 257–270 (2004). 25. Zha, G., Jie, W., Tan, T., Zhang, W. & Xu, F. The interface reaction and Schottky barrier between metals and CdZnTe. J. Phys. Chem. C 111, 12834–12838 (2007). 26. Guillén-Cervantes, A. et al. Structural and optical properties of CdTe + CdTeO3 nanocomposite films with broad blueish photo- luminescence. J. Mater. Sci. Mater. Electron. 31, 7133–7140 (2020). Acknowledgements This work was supported by EU STRONG-2020 project (Grant Agreement No. 824093) and by the project Bio- MoNTANS funded by Cariparma (DIT.AD002.175). M.B, A.Z. and G.T. acknowledge financial support from PNRR MUR project ECS_00000033_ECOSISTER. This work was also supported by the Italian Ministry for University and Research (MUR), under PRIN2022 project CUP B53D23004720006, by the European Union (EU) under the project—FESR o FSE, PON Ricerca e Innovazione 2014–2020—DM 1062/2021 and FFR2023. Author contributions A.Z., M.B. and S.Z. planned the experiments. M.B., S.Z., F.C. and G.T. contributed to samples preparation. G.T. and L.N. performed the structural characterization. M.B., S.Z., L.A., F.P. and A.B. performed the electrical char- acterization. F.P., L.A. and A.B. tested the spectroscopic performance of samples. A.Z. supervised the project. M.B. and S.Z. wrote the manuscript with input from all authors. All authors discussed the results and reviewed the manuscript. Competing interests  The authors declare no competing interests. Additional information Supplementary Information The online version contains supplementary material available at https://​doi.​org/​ 10.​1038/​s41598-​023-​45331-9. Correspondence and requests for materials should be addressed to M.B. Reprints and permissions information is available at www.nature.com/reprints. Publisher’s note  Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. 11 Vol.:(0123456789) Scientific Reports | (2023) 13:17963 | https://doi.org/10.1038/s41598-023-45331-9 www.nature.com/scientificreports/ Open Access  This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creat​iveco​mmons.​org/​licen​ses/​by/4.​0/. © The Author(s) 2023

Title: High performance platinum contacts on high-flux CdZnTe detectors ​ Authors: Manuele Bettelli, Silvia Zanettini, Leonardo Abbene, Francesca Casoli, Lucia Nasi, Giovanna Trevisi, Fabio Principato, Antonino Buttacavoli, Andrea Zappettini ​ Publisher: Nature Scientific Reports Date: 2023-10-18 00:00:00 Abstract: The need for direct X-ray detection under high photon flux with moderate or high energies (30–100 keV range) has strongly increased with the rise of the 4th Generation Synchrotron Light Sources, characterized by extremely brilliant beamlines, and of other applications such as spectral computed tomography in medicine and non-destructive tests for industry. ​ The novel Cadmium Zinc Telluride (CZT) developed by Redlen Technologies can be considered the reference material for high-flux applications (HF-CZT). ​ The enhanced charge transport properties of the holes allow the mitigation of the effects of radiation-induced polarization phenomena, typically observed in standard CZT materials (LF-CZT) under high photon flux. ​ However, standard LF-CZT electrical contacts led to unacceptable high dark leakage currents on HF-CZT devices. ​ In this work, a detailed study on the characteristics of new optimized sputtered platinum electrical contacts on HF-CZT detectors is reported. ​ The results from electrical and spectroscopic investigations showed the best performances on HF-CZT detectors with platinum anode, coupled with both platinum or gold cathode. ​ The morphology, structure, and composition of Pt/CZT contact have been analyzed by means of Transmission Electron Microscopy (TEM) on microscopic lamellas obtained by Focused Ion Beam (FIB), highlighting the presence of CdTeO3 oxide at the metal-semiconductor interface.

Computer aided tool for diagnosis of ENT pathologies using digital signal processing of speech and stroboscopic images (1).pdf

RESEARCH Open Access Computer aided tool for diagnosis of ENT pathologies using digital signal processing of speech and stroboscopic images Amaia Méndez Zorrilla1*, Begoña García Zapirain1 and Agustín Pérez Izquierdo2 Abstract The development of computer software and other technologies greatly facilitates the evaluation of pathological voice patients. This fact allows to reduce exploration time, improves the reproducibility of results and creates the possibility of test protocol standardization needed for the intercommunication between the different voice specialists. The proposed application encompasses the most important aspects which should be taken into account regarding dysphonic patients. It is a multidimensional scope which involves subjective questionnaires and perceptual, aerodynamic, acoustic and stroboscopic evaluations. In this system, the authors have designed and created simple tools for recording and automatic acoustic analysis for the acquisition and edition of stroboscopic images. The purpose is to work with all necessary tools running on a single application, without having to export and import data from other computer programs. Therefore, the objective is to synthetize the basic voice and the exploration of the vocal folds, simplifying it through the design of a program which helps us to analyze step-by -step each aspect of the vocal pathology. The evaluation of the tool has been performed by the otolaryngologists through periodical (medical) appointments on 25 patients for one year a year, and the results are promising either for the professionals as well as for the patients which receive a detailed report with the objective information concerning the features of their voice and vocal cords. Keywords: Vocal pathologies, Otolaryngologist, Software application, Objective parameters, Diagnosis Introduction Considering the number of people suffering voice path- ologies: between 3% and 9% in USA (Nerrière et al. 2009), and 5% in Spain (SEORL, SEORL. http://www. seorl.net/. Accessed 26 August 2012), it is clear that these kinds of problems affect a very high percentage of the population. This is the reason why the authors be- lieve that the study and development of techniques for the detection of vocal pathologies is important. The advances in the area of diagnosis of otorhino- laryngology and speech therapy have been focusing in improving image acquisition devices, aimed at the obser- vation of vocal folds and their functioning. Initially the ENT (Ear-Nose and Throat) specialist used a laryngeal mirror and performed the evaluation and diagnosis based on the information they could obtain with this de- vice. Today we have other techniques for the acquisition and recording of images, which allow a posteriori evalu- ation, being Videolaryngostroboscopy (VLS) and Digital High-Speed videoendoscopy (HSV) the main ones. It is important that the specialist knows the limitations the techniques used present, as VLS is only capable of capturing images at the speed of 25–30 frames/s (Lee et al. 2001). These limitations affect mainly to the diag- nosis of movement related pathologies and to the ana- lysis of vocal fold vibration cycle, which in the case of VLS images it is only a human eye optical illusion. However, HSV (Kiritani et al. 1986; Kiritani et al. 1993) captures images at the speed of 5000–8000 frames/s, thus providing a great amount of physiological and movement- related vocal fold information. Its general use is limited. There are very few hospitals which own the necessary hard- ware and the price is very high, unlike VLS. There is an intermediate solution called Videokimography (VKG) * Correspondence: [email protected] 1DeustoTech-LIFE Unit, DeustoTech Institute of Technology, University of Deusto 24, Bilbao 48007, Spain Full list of author information is available at the end of the article a SpringerOpen Journal © 2012 Zorrilla et al.; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Zorrilla et al. SpringerPlus 2012, 1:64 http://www.springerplus.com/content/1/1/64 which provides high resolution images at a high speed with a more accessible price than VLS (Kim et al. 2003). Videolaryngostroboscopy is the most used technique for the diagnosis of some vocal pathologies (Braunschweig et al. 2008) and the most common in the hospitals. Due to that reason, we have chosen it for the purpose of this study. Against this background, it is necessary to provide objective parameters and tools for the practice of ENT specialists, not only in the area of vocal pathology diag- nosis but also in the evaluation of the evolution of a re- habilitation process or a chirurgic intervention. ENTs as well as speech therapists use more informa- tion than that obtained merely through image acquisi- tion for their daily practice. Acoustic analysis is another one of their information sources, and although it does not serve as a diagnostic method by itself (Hadjitodorov and Mitev 2002), the pitch, jitter, shimmer and harmonics-to-noise ratio (HNR) parameters are accepted for the evaluation of voice quality and to measure the ef- ficiency of the rehabilitation. Both techniques are used for diagnosis and treatment, as in the majority of cases people go to ENT and speech therapist appointments due to hoarseness. The main aim of this work is to speed up the habitual practice of the specialists during the appointments through the automation of study methods, in response to the lack of applications which include audio and video processing functionalities together with the patient´s psychological aspect and result analysis. The authors of this work have chosen VLS images (nevertheless assuming its limitations for the detection of some pathologies) because its use is widely spread in otorhinolaryngology (and the instrumentation is avail- able in most hospitals), and focus in providing objective acoustic parameters plus VLS image information related mainly with organic dysphonia. This being the main aim, a number of secondary objectives are described as follows:  To design and develop a tool combining acoustic analysis and digital image processing which provides a report of final results according to the ELS (European Laryngological Society) guidelines.  To include different digital signal processing algorithms developed by the authors in previous works in the tool (Méndez et al. Mendez et al. 2009; Mendez et al. 2012), (García et al. 2009). The article is organized as follows: Section 2 describes materials, methods and functionalities of the designed and evaluated software. Section 3 shows the experimen- tal results of the otolaryngologists in their daily practice using the application, and finally the authors offer con- cluding remarks in Section 4. Materials and methods In this section the technical and human resources used during the development of the application are de- scribed, together with the methodology followed in its design to provide the professional with a useful tool for the daily practice. Technical resources The proposed software is developed using a combination of Java (for the user interface) and Octave (to develop the signal processing algorithms). Among the elements more widely used for the implementation of this soft- ware are databases developed in XML (eXtensible Markup Language) and image processing libraries such as JMF (Java Media Framework). The necessary hard- ware is detailed as follows: 1. PC with integrated or external video capture device. 2. Stroboscope 3. Endoscopic Camera 4. Microphone for PC Human resources In this study, 25 patients have participated during a year and all the obtained data has been registered. 18 of the 25 patients included in the study were women (72%), while 7 were men (28%), with an average age of 42, being the youngest 19 and the oldest 58 (standard devi- ation 11,43). All the patients whose sessions (voices and images) are recorded in the Hospital have signed the ethical consent to be included in this study. Methodology One of the aims of the developed tool is to provide the professional (in this case medical) with openness regarding where the data resides and how does the sys- tem work with it. In order to fulfill that purpose the interface has been designed as simple as possible, with a pleasant user-friendly visual aspect and easy to use for not technical potential users. The design of the application (made in collaboration with otolaryngologists) encompasses all the tests to be done during an appointment for voice exploration, which are organized following a comprehensive sequen- tial structure. This design follows the structure proposed by the protocols (Teatinos) as well as other internationally accepted standards such as VHI (Rodríguez et al. Rodríguez-Parra et al. 2009), Dejonkere (ELS), all assumed by the SEORL (Spanish Society of Otorhinolaryngology and Cervico-facial Pathology) (Nuñez Batalla, Núñez 2007) in its Basic Protocol for the functional evaluation of vocal pathology. The Basic Protocol proposes five basic Zorrilla et al. SpringerPlus 2012, 1:64 Page 2 of 10 http://www.springerplus.com/content/1/1/64 Figure 5 Example of vocal profile of a pathological patient. Figure 6 Audiovisual Gallery Screen. Zorrilla et al. SpringerPlus 2012, 1:64 Page 8 of 10 http://www.springerplus.com/content/1/1/64 the demarcation of the red circle, while the pathological values appear located outside the threshold circle. Thus a multidimensional graph of the patient is obtained in which the larger the area of the graph, the greater the vocal lesion, and the smaller the area of the diagram indicates a lower vocal pathology. The parameters included in the vocal profile are: 1. Subjective quality 2. Subjective repercussion 3. Perception G 4. Perception R 5. Perception B 6. MFT 7. Jitter 8. Shimmer 9. HRN 10. Stroboscopy: Close 11. Stroboscopy: Mucosal wave 12. Stroboscopy: Regularity 13. Stroboscopy: Symmetry Audiovisual gallery The audiovisual gallery is a virtual library of stroboscopic images , recorded voices and their associated diagnostic with primarily didactic purposes, since performing these exercises helps us to properly assess the patient data that will be studied in the program (see Figure 6). It is advisable to consult the audiovisual gallery to ob- tain the maximum efficiency from the studies. It consists of four libraries: 1. Stroboscopic Parameters: Models of stroboscopic images are shown with the scores of the various parameters. 2. Vocal Pathology: consist of laryngoscopic video recordings with their corresponding lesion diagnoses. 3. Perceptual Evaluation: includes audio recordings of pathological voices with evaluations of the GRBAS parameters. 4. Spectrograms: standard images consisting of different types of pathological spectrograms (I-IV) according to the criteria of Yanagihara. Subjective results Beside the objective results corresponding to the acous- tic parameters analyzed, or related to the features of the vocal cords, the software has been reviewed and analyzed by experts in otolaryngology which this way help the authors in the continuous improvement of the application. The feedback of the otolaryngologists was collected through some opinion questionnaires attached below (Table 7), and from which some conclusions were extracted. Each one of the evaluated Items has been valued from 1 to 5, being 5 totally agree and 1 totally agree, and 1 totally. As it can be seen in the Table, otolaryngologists evalu- ate especially well the graphic representations provided by the software (4,55 and 4,18), which allow to detect abnormalities in the voice and/ or in the vocal cords in a very visual way. Regarding the ease of use of ANALISISVOX and its interface the evaluation remains good 3,53 and 3,14 re- spectively. The adaptation of the software to the man- agement of the software is below one week, and the Table 7 Survey made to otolaryngologists Item Average Marks The use of the AnalisisVOX software is easy 3,53 Friendly interface 3,14 The acoustic parameters analyzed are appropriate 3,97 The graphic representation of the acoustic parameters is appropriate 4,18 The analyzed parameters of the vocal fold images are appropriate 3,82 The graphic representation of the parameters obtained automatically through the images is appropriate 4,5 Quality of the generated reports 4,47 Table 8 Comparative features of ANALISISVOX Features of the current applications Features of the ANALISISVOX application Insufficient. They do not provide the complete information the specialist doctor needs when carrying out a medical consultation. Complete. It is integrated within a single application, just the needed analyses the specialist doctor requires to diagnose (according to the ELS protocol). Inefifcient. They do not provide the specific information necessary for the specialist doctor. Efficient. An automated system is established, sequential, which makes the consultation easy and rapid /quick. Lead to the specialist doctor to carry out the exploration in parts, gathering the information through different methods, generating files and documents of different programs which occupy usable memory of the computer, and moreover slowing down the process of the study. It can be accessed to the files of any patient, without having to seek manually on the hard disk any kind of information Too technical when showing the calculated information. Shows the values obtained in a graphic and easy way to digest. Zorrilla et al. SpringerPlus 2012, 1:64 Page 9 of 10 http://www.springerplus.com/content/1/1/64 provided feedback is more related to the inclusion of new functionalities which, with problems related to those developed ones. Conclusions There are plenty of programs (Matassini and Manfredi 2002; Hadjitodorov and Mitev 2002; Gelzinis et al. 2008) which serve as a tool for doctors who study the voice dur- ing an appointment. In most cases these are applications that allow you to record your voice and emit certain fre- quency parameters, or to analyze independently the features of the voice and of the vocal fold images. However, these applications are insufficient (as it can be seen in a compari- son in Table 8) and often inefficient even when performing a medical consultation, since they do not provide complete information but only part of it. Therefore, doctors are forced to perform the exploration separately, gathering the information with different methods, generating files and documents from different software programs that fill the useful computer memory and in addition slowing the study process. It is noticeable that there is great interest aroused by these applications in the field of ENT, speech pathologists and speech therapists, but the big question is how many of them respond to the needs of specialists. In the case of the proposed tool the vision of the experts who have participated throughout the development process has been implemented, therefore its applicability is granted. The proposed application performs a post-processing of the signals supplied during a clinic session, and it uni- fies concepts and results which are usually analyzed in- dependently. The preparation of all reports with all the provided objective parameters allows the study of the evolution of the patients during the rehabilitation process or after surgery. We could even evaluate the ef- fectiveness of treatments and suggest modifications. Competing interests The authors declare that they have no competing interests. Authors' contributions These authors: AMZ, BGZ have made substantial contributions to design and development, or acquisition of algorithms and software application. The authors: API has been involved in the conception of the tool, and in revising and testing it critically. All authors read and approved the final manuscript. Acknowledgements The authors wish to acknowledge the University of Deusto, which kindly lent infrastructures and material for this research work. This research is partially supported by the Basque Country Department of Education, Universities and Research. It is also important to remark the support provided by Ainara Sudupe. Author details 1DeustoTech-LIFE Unit, DeustoTech Institute of Technology, University of Deusto 24, Bilbao 48007, Spain. 2Basurto Hospital, Bilbao, Spain. Received: 1 September 2012 Accepted: 8 December 2012 Published: 13 December 2012 References Braunschweig T, Flaschka J, Schelhorn-Neise P, Döllinger M (2008) High-speed video analysis of the phonation onset, with an application to the diagnosis of functional dysphonias. Med Eng Phys 30(1):59–66 Eysholdt U, Rosanowski F, Hoppe U (2003) Vocal fold vibration irregularities caused by different types of laryngeal asymmetry. European Arch Otorhinolaryngol 260(1):412–417 García B, Ruiz I, Méndez A, Mendezona M (2009) Objective characterization of oesophageal voice supporting medical diagnosis, rehabilitation and monitoring. Comput Biol Med 39:97–105 Gelzinis A, Verikas A, Bacauskiene M (2008) Automated speech analysis applied to laryngeal disease categorization. Comput Methods Programs Biomed 91 (1):36–47 Hadjitodorov S, Mitev P (2002) A computer system for acoustic analysis of pathological voices and laryngeal diseases screening. Med Eng Phys 24(6):419–429 Hsiung M-W, Pai L, Wang H-W (2002) Correlation between voice handicap index and voice laboratory measurements in dysphonic patients. Eur Arch Otorhinolaryngol 259(2):97–99 Kim DY, Kim LS, Kim KH, Sung MW, Roh JL, Kwon TK, Lee SJ, Choi SH, Wang SG, Sung MY (2003) Videostrobokymographic analysis of benign vocal fold lesions. Acta Otolaryngol 123(9):1102–1109 Kiritani S, Honda K, Imagawa H, Hirose H (1986) Simultaneous high-speed digital recording of vocal fold vibration and speech signal. Proc IEEE ICASSP'86 11:1633–1636 Kiritani S, Hirose H, Imagawa H (1993) High-speed digital image analysis of vocal cord vibration in diplophonia. J Speech Commun 13:23–32 Lee JS, Kim E, Sung MW, Kim KH, Park KS (2001) A method for assessing the regional vibratory pattern of vocal folds by analysing the video recording of stroboscopy. Med Biol Eng Comput 39(3):273–278 Matassini L, Manfredi C (2002) Software corrections of vocal disorders. Comput Methods Programs Biomed 68(2):135–145 Mendez A, Ismaili Alaoui EM, García B, Ibn-ElHaj E (2009) Glottal Space Segmentation from Motion Estimation and Gabor Filtering. Minneapolis, USA, Proceedings of EMBC09 Mendez A, Lopetegui E, Garcia B (2012) Vocal Folds Paralysis Classification using FLDA and PCA algorithms suported by an Adapted Block Matching Algorithm, Proceedings of ISCCSP12., Rome, Italy Nerrière E, Vercambre ML, Gilbert F, Kovess-Masféty V (2009) Voice disorders and mental health in teachers: a cross-sectional nationwide study. BMC Publ Health 9:370 Núñez BF (2007) Validación de la versión traducida al español del índice de incapacidad vocal (voice handicap index). Acta Otorrinolaringol Esp 58(9):385 Rodríguez-Parra MJ, Adrián JA, Casado JC (2009) Voice therapy used to test a basic protocol for multidimensional assessment of dysphonia. J Voice 23(3):304–318 SEORL (2012), http://www.seorl.net/. Accessed 26 August Weigelt S, Krischke S, Klotz M, Hoppe U, Köllner V, Eysholdt U, Rosanowski F (2004) Voice handicap in patients with organic and functional dysphonia. HNO 52(8):751–756 Yanagihara N (1967) Significance of harmonic changes and noise components in hoarseness. J Speech Hear Res 10:531–541 doi:10.1186/2193-1801-1-64 Cite this article as: Zorrilla et al.: Computer aided tool for diagnosis of ENT pathologies using digital signal processing of speech and stroboscopic images. SpringerPlus 2012 1:64. Zorrilla et al. SpringerPlus 2012, 1:64 Page 10 of 10 http://www.springerplus.com/content/1/1/64

Title: Computer aided tool for diagnosis of ENT pathologies using digital signal processing of speech and stroboscopic images ​ Authors: Amaia Méndez Zorrilla, Begoña García Zapirain, Agustín Pérez Izquierdo ​ Publisher: SpringerPlus Date: 13 December 2012 ​ Abstract: The development of computer software and other technologies greatly facilitates the evaluation of pathological voice patients. ​ This fact allows to reduce exploration time, improves the reproducibility of results and creates the possibility of test protocol standardization needed for the intercommunication between the different voice specialists. ​ The proposed application encompasses the most important aspects which should be taken into account regarding dysphonic patients. ​ It is a multidimensional scope which involves subjective questionnaires and perceptual, aerodynamic, acoustic and stroboscopic evaluations. ​ In this system, the authors have designed and created simple tools for recording and automatic acoustic analysis for the acquisition and edition of stroboscopic images. The purpose is to work with all necessary tools running on a single application, without having to export and import data from other computer programs. ​ Therefore, the objective is to synthetize the basic voice and the exploration of the vocal folds, simplifying it through the design of a program which helps us to analyze step-by-step each aspect of the vocal pathology. ​ The evaluation of the tool has been performed by the otolaryngologists through periodical (medical) appointments on 25 patients for one year a year, and the results are promising either for the professionals as well as for the patients which receive a detailed report with the objective information concerning the features of their voice and vocal cords. ​

Computer aided tool for diagnosis of ENT pathologies using digital signal processing of speech and stroboscopic images.pdf

RESEARCH Open Access Complement anaphylatoxins C3a and C5a induce a failing regenerative program in cardiac resident cells. Evidence of a role for cardiac resident stem cells other than cardiomyocyte renewal David Lara-Astiaso1†, Alberto Izarra1†, Juan Camilo Estrada1, Carmen Albo1, Isabel Moscoso1, Enrique Samper1, Javier Moncayo2, Abelardo Solano2, Antonio Bernad1* and Antonio Díez-Juan1,2* Abstract Cardiac healing, which follows myocardial infarction, is a complex process guided by intricate interactions among different components. Some resident cell populations with a potential role in cardiac healing have already been described in cardiac tissues. These non-cardiomyocyte cell subsets, globally described as cardiac pluripotent/ progenitor cells (CPCs), are able to differentiate into all three major cardiac cell lineages (endothelial, smooth muscle and cardiomyocyte cells) in experimental settings. Nevertheless, physiological cardiac healing results in a fibrous scar, which remains to be fully modelled experimentally. Since a role for complement anaphylatoxins (C3a and C5a) has been described in several regeneration/repair processes, we examined the effects that C3a and C5a exert on a defined population of CPCs. We found that C3a and C5a are able to enhance CPC migration and proliferation. In vitro studies showed that this effect is linked to activation of telomerase mRNA and partial preservation of telomere length, in an NFκB-dependent manner. In addition, anaphylatoxin signalling modulates the CPC phenotype, increasing myofibroblast differentiation and reducing endothelial and cardiac gene expression. These findings may denote that C3a and C5a are able to maintain/increase the cardiac stem cell pool within the heart, whilst simultaneously facilitating and modulating resident cell differentiation. We found that this modulation was directed towards scar forming cells, which increased fibroblast/myofibroblast generation and suggests that both these anaphylatoxins could play a relevant role in the damage-coupled activation of resident cells, and regulation of the cardiac healing process after injury. Introduction The cardiac healing process is guided by intricate interactions between different components; following myocardial infarction (MI), injury, inflammation, regen- eration, and repair are all interconnected processes. It is known that these processes are inadequate and over- complicated, since certain pathological or damaging factors, such as cardiomyocyte replacement cannot be repaired. The inflammatory response represents one critical element of the cardiac healing process and is triggered by cell stress and death caused during cardiac injury. The abolition of the inflammatory response using corticosteroids not only decreases the number of infil- trating leukocytes, but also delays healing and collagen deposition (Kloner et al. 1978). Moreover it has been shown that cardiac tissue reperfusion improves overall tissue repair and that this outcome is mediated by im- proving the inflammatory reaction (Frangogiannis 2012). Over the last 30 years, the complement system has been shown to play a major role in myocardial inflammation and tissue injury following MI (Hill and Ward 1971; Walport 2001) has been experimentally inhibited at differ- ent levels, including that of anaphylatoxin (C3a, C5a) sig- nalling, to reduce ischemic injury. Experiments using * Correspondence: [email protected]; [email protected] †Equal contributors 1Centro Nacional de Investigaciones Cardiovasculares Carlos III, Madrid 28029, Spain 2Vascular Repair and Regeneration Laboratory, Centro de Investigaciones, Principe Felipe, Eduardo Primo Yúfera, Valencia 46013, Spain a SpringerOpen Journal © 2012 Lara-Astiaso et al.; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Lara-Astiaso et al. SpringerPlus 2012, 1:63 http://www.springerplus.com/content/1/1/63 animal models have shown that anaphylatoxin C5a inhib- ition protects against ischemia reperfusion (I/R) injury in diverse organs including myocardium (Vakeva et al. 1998). While anaphylatoxin C5a has been shown to be a potent activator of inflammation (Walport 2001), the upstream role of anaphylatoxin C3a has shown mixed results in ani- mal models of I/R injury. In mouse models of renal and cerebral I/R injury, C3a appears to play a key role in medi- ating inflammation (Mocco et al. 2006; Thurman et al. 2007), whereas other studies suggest it is less important (Busche and Stahl 2010; Proctor et al. 2004). Moreover, in mammals, anaphylatoxins are critical for hepatocyte proliferation and liver regeneration (Strey et al. 2003). C3a promotes homing, chemotaxis, and retention of hematopoietic stem and progenitor cells in the bone mar- row (Ratajczak et al. 2004); the anaphylatoxin receptors (C3aR, C5aR) positively regulate adult neurogenesis as well as the quantity of replacement neurons produced following cerebral ischemia (Rahpeymai et al. 2006). Re- cently, a novel and unexpected function for C3a and its receptor C3aR has also been revealed in the mutual cell-cell attraction (named co-attraction), required for maintaining cohesive clusters of migrating mesenchymal cells during early development (Carmona-Fontaine et al. 2011). The authors proposed that co-attraction and con- tact inhibition must act in concert to allow cell clusters to self-organise and respond efficiently to external signals, such as chemoattractants and repellents. There- fore anaphylatoxins seem to play both positive and nega- tive roles depending on the physiopathological context; hence their artificial modulation to improve healing still requires further research. The adult myocardium has recently been shown to harbour multipotent progenitor cells that can give rise to both myogenic and vasculogenic lineages, which can both contribute to myocardial repair (reviewed in (Barile et al. 2007; Laflamme and Murry 2011)). On the other hand, since the myocardium has a low endogenous re- generative competence, loss of a substantial amount of cardiac muscle ultimately results in scar formation. In- flammatory signals are required to guarantee the opti- mal creation of a supportive scar in the injured tissue, modulating phenotype function and gene expression in fibroblasts, endothelial cells, and leukocytes which to- gether control collagen, fibroblast/myofibroblast depos- ition and vascular network formation. An optimal inflammatory reaction leads to stable scar formation, and the low regenerative potential of cardiac tissue indicates that, at least in a physiological situation, CPCs should behave preferentially as a healing cell popu- lation that participates in scar formation, since they have a very low potential for cardiomyocyte replacement. Telomerase-competent CPCs with long telomeres are present in the atria and apex storage regions of the heart; following activation by growth factors they migrate to damaged areas, where they although have the potential to create a population of young myocytes (Itzhaki-Alfia et al. 2009) their contribution to regenerated cardiac tis- sue is very low. Experimental data suggest that the regen- erative potential of endogenous adult stem cells is low, and multiple reports show that defects in telomere maintenance impairs organ regeneration like liver (Hartmann et al. 2011) or in haematopoietic stem cell maintenance (Calado and Young 2008). In addition, telomere shortening during progenitor cell proliferation affects the function of the brain, pancreas, bone marrow, and heart, pointing to stem cell dysfunction as a critical determinant of organ aging/regeneration (Beausejour and Campisi 2006; Harrington and Greider 1991). There- fore efficient pro-regenerative signalling should modulate telomerase activation, allowing efficient cell proliferation, and also modulation of cell differentiation towards a healing phenotype. In this work we describe the role of complement anaphylatoxins in CPC biology and prove that C3a and C5a are able to enhance cell migration and proliferation. This effect is linked to telomerase mRNA activity and ac- tivation, and a partial preservation of telomere length. Conversely anaphylatoxin stimulation influences CPC fate, pushing them towards myofibroblast differentiation, reduces endothelial gene expression, and increases colla- gen and smooth muscle gene expression, thus supporting a role for them in cardiac scar formation. Hence, enhanced proliferation ability and telomere length maintenance could denote that both C3a and C5a anaphylatoxins can help to maintain the cardiac resi- dent cell pool within the heart during injury, and fa- cilitate their function as scar forming cells. Results CPC culture and characterisation Small biopsies of murine adult hearts were placed on gelatin/fibronectin plates (Figure 1A (1)). Following an ini- tial outgrowth of fibroblast-like cells, within 5–7 days of explant plating, small, round and poorly adherent cells appeared and expanded (Figure 1A (2)). These cells, called explant-derived cells (EDCs) could be detached by gently pipetting, and were harvested and cultured to form cardiospheres (Figure 1A (3)). Using immunofluorescence, EDCs were found to express the cardiac markers, Nkx2.5, Gata4, Cx43, and Mef2c (Figure 1B) and also cell surface makers c-kit and Sca-1 (Figure 1B). During cardiosphere culture, proliferative cells (Ki67 positive) were found pri- marily in the external part of the sphere, in contrast to the CPC marker c-kit predominately found in the core. Sca-1 was more homogenously expressed throughout the whole culture. EDCs showed a very low expression for the vascu- lar markers CD31 and aSMA. Lara-Astiaso et al. SpringerPlus 2012, 1:63 Page 2 of 15 http://www.springerplus.com/content/1/1/63 et al. 2002). Although clinical and biological data shows that the heart has a very low endogenous capacity for re- generation when severe damage is inflicted, multiple en- dogenous putative cardiac stem cell or progenitor cell populations have been identified and isolated. Markers, traditionally associated with blood, bone marrow or pluri- potent stem cells, have been used by several independent groups to identify these cells in adult or postnatal hearts in humans and other mammalian species (Smith et al. 2008). We have worked with a population (CPCs), as described by Messina et al. (Messina et al. 2004), this population expresses the cardiac markers, Nkx2.5, Gata4, Cx43 and Mef2c (Figure 1B) and therefore had a putative cardiogenic potential. Thus our first task was to under- stand why, if these cells have the potential to differentiate in cardiomyocytes, physiological cardiac healing usually results as a fibrotic scar and shows very low levels of cardiomyocyte replacement. We investigated the potential of these cells to differentiate to all three lineages described, and facilitated differentiation by using 10% FBS to improve myofibroblast differentiation, and EGM on Matrigel to increase endothelial lineage differentiation. Interestingly anaphylatoxins repress Gata4 expression and increase the expression of some early cardiac markers (Nkx2.5, Tbx3, Tbx5, Actc1) in CPCs. Endothelial cell (EC) lineage differ- entiation was clearly improved by culture on Matrigel using EGM media and in these conditions, stimulation with C3a and C5a anaphylatoxins reduced endothelial gene expression. In agreement with this data, immunofluores- cence also showed the absence of ECs in the presence of anaphylatoxins. Inhibition of EC differentiation is paralleled by induction of Twist and Snail genes together with Fsp1 expression. Fsp1 is one of the markers of fibro- blast formation and is a cytoskeletal protein belonging to the calmodulin-S100-troponin C superfamily of intracellu- lar calcium binding proteins associated with cytoskeletal fibres, cell motility, and mesenchymal phenotype (Zimmer et al. 1995). Therefore the expression of Snail1 and Twist1 genes, together with the significant increase in Fsp1 ex- pression, indicated that an endMT-like differentiation event might be occurring in CPCs. In addition, anaphy- latoxins induce the expression of an array of genes asso- ciated with myofibroblasts that probably abolishes their role in regeneration but hints at their relevance in the car- diac healing process that follows MI. In this scenario, com- plement anaphylatoxins would activate migration of CPCs to the damaged area, induce their proliferation and finally, upon persistence of local signalling, would promote their differentiation into myofibroblast cells that would be able to fill and quickly repair the damaged heart area, preven- ting further cardiac complications. Gata4 has been proved to be a critical early factor in cardiogenesis, it lays upstream of Tbx5, Nkx2.5, and Act1 in the cardiogenic transcription network, and acts together with Baf60c to generate a chromatin state competent for cardiogenic differentiation (Takeuchi and Bruneau 2009). Therefore C3a and C5a may block cardiomyocyte differen- tiation by repressing Gata4 expression. The cardiogenic factors Nkx2.5, Actc1 and specially Tbx3 and Tbx5 may have roles other than their cardiogenic ones, including modulating the response of CPCs to complement anaphylatoxins, for instance they might be involved in the C3a/C5a dependent myofibroblast differentiation process. It is known that several mesodermal cells (cardiomyocytes and myofibroblasts) share parts of their transcriptional dif- ferentiation networks, supporting the existence of a com- mon myocardial and smooth muscle cell precursor in the developing embryo. This is consistent with in vivo studies, which show the co-expression of numerous smooth muscle genes in myocardial progenitor cells (Wu et al. 2006). Therefore Tbx3 and Tbx5 would be common to both cell types, and Gata4 levels would be critical in modu- lating the fate decision of progenitor cells. Interestingly it has been proposed that Gata4 expression can play a role in the developmental regulation of cardiac fibroblasts and has a function in the maintenance of cardiac-resident progenitors (Jankowski 2009). This raises the hypothesis that C3a and C5a are factors that affect CPC fate by switching the balance of different lineage specific factors: they shut down the expression of endothelial and cardiac factors and induce the expression of myofibroblast factors (TCF21, SM22α and Myocardin), irreversibly pushing CPCs towards the myofibroblast fate. Taken together, these findings shed some light onto what have been described as endogenous cardiac stem cells and some mechanistic insight about the limited po- tential of CPCs to generate new cardiomyocytes after cardiac injury. We can hypothesize that anaphylatoxin release at early time after cardiac injury is able to in- crease CPC numbers and to promote migration towards the site of injury. This signal also increases CPC poten- tial to differentiate into myofibroblast lineages that would participate in scar formation. This situation gives an advantage to cardiac tissue promoting a fast healing in MI. Differentiation toward myofibroblast in CPCs would make available a higher number of myofibroblasts to contribute to other sources of myofribroblasts (Krenning et al. 2010) during the resolution stage of MI. This situation is different from physiological cardiac cell turnover. During life possibly other signals in absence of inflammatory signals will permit cardiomyocyte differen- tiation to replace exhausted cells. Interestingly recent evidence reported by Jianqin Ye et al. (2012) have shown that there is a significant increase in the proliferative capacity of CS-forming cells isolated from the “middle aged” heart following acute MI resulting in a significant rise in the number of CSs in vitro and this increase is most pronounced within the first week post-MI. In Lara-Astiaso et al. SpringerPlus 2012, 1:63 Page 13 of 15 http://www.springerplus.com/content/1/1/63 addition they show that show for the first time that the CS cells obtained from 1-week post-MI hearts engraft in ischemic myocardium and restore cardiac function at 25 days post-injection in vivo. However, we did not find evidence for differentiation of these cells into mature cardiomyocytes or new vessels althouhgt promoted angiogenesis in vivo. Their data suggest that early signals that happens after MI would commit these cells to a more healing phenotype instead of regenerative fate. To heal the heart adding new cardiomyocyte probably is a more delicate and time-consuming situation that mammalian wounded heart cannot go through in a wild environment. Thus the signals involved in cardiac healing have been selected to permit a fast healing situ- ation increasing myofibroblast differentiation but in other hand this impairs cardiomyocyte renewal. Deeper understanding of these mechanisms would help to im- prove wounded heart regeneration. Competing interests The authors indicate no potential conflicts of interests. Authors’ contributions ADJ, DLA and AI drafted the manuscript and performed Q-PCR, cell culture validation and IF experiments. CA, JCA and ES developed TRAP and FISH experiments. IM, JM and AS perform CHIP and cell culture. ADJ and AB conceived the project, read, and interpreted the results. All authors read and approved the final manuscript. Acknowledgements We thank Dr Alfonso Luque for immortalized mouse endothelial cells. All members of Diez-Juan laboratory for their helpful discussions and technical support, specialy to Virginia Zorita, Nuria Martí and Vanessa Blanca, Microscopy and Cellomics Units, at CIPF and Maria Ledran at EFL for Scientific editing. Funding This work was supported by grant to ADJ from the Ministry of Science and Innovation (SAF 2009–1000) and a MICCIN "Ramon y Cajal" contract and by a grant to ABM from GENOMA ESPAÑA (Spain) part of the MACIA research project. Received: 18 October 2012 Accepted: 30 November 2012 Published: 12 December 2012 References Amsterdam EA, Stahl GL, Pan HL, Rendig SV, Fletcher MP, Longhurst JC (1995) Limitation of reperfusion injury by a monoclonal antibody to C5a during myocardial infarction in pigs. Am J Physiol 268:H448–H457 Arslan F, de Kleijn DP, Pasterkamp G (2011) Innate immune signaling in cardiac ischemia. Nat Rev Cardiol 8:292–300 Banerjee PP, Jagadeesh S (2009) Non-radioactive assay methods for the assessment of telomerase activity and telomere length. Methods Mol Biol 523:383–394 Barile L, Messina E, Giacomello A, Marban E (2007) Endogenous cardiac stem cells. Prog Cardiovasc Dis 50:31–48 Beausejour CM, Campisi J (2006) Ageing: balancing regeneration and cancer. Nature 443:404–405 Bergmann O, Bhardwaj RD, Bernard S, Zdunek S, Barnabe-Heider F, Walsh S, Zupicich J, Alkass K, Buchholz BA, Druid H et al (2009) Evidence for cardiomyocyte renewal in humans. Science 324:98–102 Brown K, Gerstberger S, Carlson L, Franzoso G, Siebenlist U (1995) Control of I kappa B-alpha proteolysis by site-specific, signal-induced phosphorylation. Science 267:1485–1488 Busche MN, Stahl GL (2010) Role of the complement components C5 and C3a in a mouse model of myocardial ischemia and reperfusion injury. Ger Med Sci 8, doi:pii: Doc20. PubMed PMID: 20930931; PubMed Central PMCID: PMC2940219. http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2940219/ Calado RT, Young NS (2008) Telomere maintenance and human bone marrow failure. Blood 111:4446–4455 Carmona-Fontaine C, Theveneau E, Tzekou A, Tada M, Woods M, Page KM, Parsons M, Lambris JD, Mayor R (2011) Complement fragment C3a controls mutual cell attraction during collective cell migration. Dev Cell 21:1026–1037 Choi SH, Jung SY, Kwon SM, Baek SH (2012) Perspectives on stem cell therapy for cardiac regeneration. Advances and challenges. Circ J 76:1307–1312 Choudhary B, Karande AA, Raghavan SC (2012) Telomere and telomerase in stem cells: relevance in ageing and disease. Front Biosci (Schol Ed) 4:16–30 Diez-Juan A, Andres V (2003) Coordinate control of proliferation and migration by the p27Kip1/cyclin-dependent kinase/retinoblastoma pathway in vascular smooth muscle cells and fibroblasts. Circ Res 92:402–410 Frangogiannis NG (2012) Regulation of the inflammatory response in cardiac repair. Circ Res 110:159–173 Harrington LA, Greider CW (1991) Telomerase primer specificity and chromosome healing. Nature 353:451–454 Hartmann D, Srivastava U, Thaler M, Kleinhans KN, N'Kontchou G, Scheffold A, Bauer K, Kratzer RF, Kloos N, Katz SF et al (2011) Telomerase gene mutations are associated with cirrhosis formation. Hepatology 53:1608–1617 Hill JH, Ward PA (1971) The phlogistic role of C3 leukotactic fragments in myocardial infarcts of rats. J Exp Med 133:885–900 Hortelano S, Lopez-Fontal R, Traves PG, Villa N, Grashoff C, Bosca L, Luque A (2010) ILK mediates LPS-induced vascular adhesion receptor expression and subsequent leucocyte trans-endothelial migration. Cardiovasc Res 86:283–292 Huber MA, Kraut N, Beug H (2005) Molecular requirements for epithelial-mesenchymal transition during tumor progression. Curr Opin Cell Biol 17:548–558 Itzhaki-Alfia A, Leor J, Raanani E, Sternik L, Spiegelstein D, Netser S, Holbova R, Pevsner-Fischer M, Lavee J, Barbash IM (2009) Patient characteristics and cell source determine the number of isolated human cardiac progenitor cells. Circulation 120:2559–2566 Jankowski M (2009) GATA4, a new regulator of cardiac fibroblasts, is sensitive to natriuretic peptides. Cardiovasc Res 84:176–177 Kloner RA, Fishbein MC, Lew H, Maroko PR, Braunwald E (1978) Mummification of the infarcted myocardium by high dose corticosteroids. Circulation 57:56–63 Kohl J (2001) Anaphylatoxins and infectious and non-infectious inflammatory diseases. Mol Immunol 38:175–187 Krenning G, Zeisberg EM, Kalluri R (2010) The origin of fibroblasts and mechanism of cardiac fibrosis. J Cell Physiol 225:631–637 Laflamme MA, Murry CE (2011) Heart regeneration. Nature 473:326–335 Martinez P, Blasco MA (2011) Telomeric and extra-telomeric roles for telomerase and the telomere-binding proteins. Nat Rev Cancer 11:161–176 Messeguer X, Escudero R, Farre D, Nunez O, Martinez J, Alba MM (2002) PROMO: detection of known transcription regulatory elements using species-tailored searches. Bioinformatics 18:333–334 Messina E, De Angelis L, Frati G, Morrone S, Chimenti S, Fiordaliso F, Salio M, Battaglia M, Latronico MV, Coletta M et al (2004) Isolation and expansion of adult cardiac stem cells from human and murine heart. Circ Res 95:911–921 Mocco J, Mack WJ, Ducruet AF, Sosunov SA, Sughrue ME, Hassid BG, Nair MN, Laufer I, Komotar RJ, Claire M et al (2006) Complement component C3 mediates inflammatory injury following focal cerebral ischemia. Circ Res 99:209–217 Monsinjon T, Gasque P, Chan P, Ischenko A, Brady JJ, Fontaine MC (2003) Regulation by complement C3a and C5a anaphylatoxins of cytokine production in human umbilical vein endothelial cells. FASEB J 17:1003–1014 Pan ZK (1998) Anaphylatoxins C5a and C3a induce nuclear factor kappaB activation in human peripheral blood monocytes. Biochim Biophys Acta 1443:90–98 Proctor LM, Arumugam TV, Shiels I, Reid RC, Fairlie DP, Taylor SM (2004) Comparative anti-inflammatory activities of antagonists to C3a and C5a receptors in a rat model of intestinal ischaemia/reperfusion injury. Br J Pharmacol 142:756–764 Rahpeymai Y, Hietala MA, Wilhelmsson U, Fotheringham A, Davies I, Nilsson AK, Zwirner J, Wetsel RA, Gerard C, Pekny M, Pekna M (2006) Complement: a novel factor in basal and ischemia-induced neurogenesis. EMBO J 25:1364–1374 Ratajczak J, Reca R, Kucia M, Majka M, Allendorf DJ, Baran JT, Janowska-Wieczorek A, Wetsel RA, Ross GD, Ratajczak MZ (2004) Mobilization studies in mice deficient in either C3 or C3a receptor (C3aR) reveal a novel role for complement in retention of hematopoietic stem/progenitor cells in bone marrow. Blood 103:2071–2078 Lara-Astiaso et al. SpringerPlus 2012, 1:63 Page 14 of 15 http://www.springerplus.com/content/1/1/63 Samper E, Flores JM, Blasco MA (2001) Restoration of telomerase activity rescues chromosomal instability and premature aging in Terc−/−mice with short telomeres. EMBO Rep 2:800–807 Schraufstatter IU, Discipio RG, Zhao M, Khaldoyanidi SK (2009) C3a and C5a are chemotactic factors for human mesenchymal stem cells, which cause prolonged ERK1/2 phosphorylation. J Immunol 182:3827–3836 Shinjyo N, Stahlberg A, Dragunow M, Pekny M, Pekna M (2009) Complement- derived anaphylatoxin C3a regulates in vitro differentiation and migration of neural progenitor cells. Stem Cells 27:2824–2832 Simonsen JL, Rosada C, Serakinci N, Justesen J, Stenderup K, Rattan SI, Jensen TG, Kassem M (2002) Telomerase expression extends the proliferative life-span and maintains the osteogenic potential of human bone marrow stromal cells. Nat Biotechnol 20:592–596 Smith LL, Coller HA, Roberts JM (2003) Telomerase modulates expression of growth-controlling genes and enhances cell proliferation. Nat Cell Biol 5:474–479 Smith RR, Barile L, Messina E, Marban E (2008) Stem cells in the heart: what's the buzz all about?–Part 1: preclinical considerations. Hear Rhythm 5:749–757 Stampfer MR, Garbe J, Levine G, Lichtsteiner S, Vasserot AP, Yaswen P (2001) Expression of the telomerase catalytic subunit, hTERT, induces resistance to transforming growth factor beta growth inhibition in p16INK4A(−) human mammary epithelial cells. Proc Natl Acad Sci U S A 98:4498–4503 Strey CW, Markiewski M, Mastellos D, Tudoran R, Spruce LA, Greenbaum LE, Lambris JD (2003) The proinflammatory mediators C3a and C5a are essential for liver regeneration. J Exp Med 198:913–923 Sun Y, Kiani MF, Postlethwaite AE, Weber KT (2002) Infarct scar as living tissue. Basic Res Cardiol 97:343–347 Takeuchi JK, Bruneau BG (2009) Directed transdifferentiation of mouse mesoderm to heart tissue by defined factors. Nature 459:708–711 Testa L, Van Gaal WJ, Bhindi R, Biondi-Zoccai GG, Abbate A, Agostoni P, Porto I, Andreotti F, Crea F, Banning AP (2008) Pexelizumab in ischemic heart disease: a systematic review and meta-analysis on 15,196 patients. J Thorac Cardiovasc Surg 136:884–893 Thurman JM, Lenderink AM, Royer PA, Coleman KE, Zhou J, Lambris JD, Nemenoff RA, Quigg RJ, Holers VM (2007) C3a is required for the production of CXC chemokines by tubular epithelial cells after renal ishemia/reperfusion. J Immunol 178:1819–1828 Vakeva AP, Agah A, Rollins SA, Matis LA, Li L, Stahl GL (1998) Myocardial infarction and apoptosis after myocardial ischemia and reperfusion: role of the terminal complement components and inhibition by anti-C5 therapy. Circulation 97:2259–2267 Van Beek J, Bernaudin M, Petit E, Gasque P, Nouvelot A, MacKenzie ET, Fontaine M (2000) Expression of receptors for complement anaphylatoxins C3a and C5a following permanent focal cerebral ischemia in the mouse. Exp Neurol 161:373–382 van der Pals J, Koul S, Andersson P, Gotberg M, Ubachs JF, Kanski M, Arheden H, Olivecrona GK, Larsson B, Erlinge D (2010) Treatment with the C5a receptor antagonist ADC-1004 reduces myocardial infarction in a porcine ischemia- reperfusion model. BMC Cardiovasc Disord 10:45 Walport MJ (2001) Complement second of two parts. N Engl J Med 344:1140–1144 Wu SM, Fujiwara Y, Cibulsky SM, Clapham DE, Lien CL, Schultheiss TM, Orkin SH (2006) Developmental origin of a bipotential myocardial and smooth muscle cell precursor in the mammalian heart. Cell 127:1137–1150 Ye J, Boyle A, Shih H, Sievers RE, Zhang Y, Prasad M, Su H, Zhou Y, Grossman W, Bernstein HS, Yeghiazarians Y (2012) Sca-1+ cardiosphere-derived cells are enriched for Isl1-expressing cardiac precursors and improve cardiac function after myocardial injury. PLoS One 7:e30329 Zhang H, Qin G, Liang G, Li J, Barrington RA, Liu DX (2007) C5aR-mediated myocardial ischemia/reperfusion injury. Biochem Biophys Res Commun 357:446–452 Zimmer DB, Cornwall EH, Landar A, Song W (1995) The S100 protein family: history, function, and expression. Brain Res Bull 37:417–429 doi:10.1186/2193-1801-1-63 Cite this article as: Lara-Astiaso et al.: Complement anaphylatoxins C3a and C5a induce a failing regenerative program in cardiac resident cells. Evidence of a role for cardiac resident stem cells other than cardiomyocyte renewal. SpringerPlus 2012 1:63. Submit your manuscript to a journal and benefi t from: 7 Convenient online submission 7 Rigorous peer review 7 Immediate publication on acceptance 7 Open access: articles freely available online 7 High visibility within the fi eld 7 Retaining the copyright to your article Submit your next manuscript at 7 springeropen.com Lara-Astiaso et al. SpringerPlus 2012, 1:63 Page 15 of 15 http://www.springerplus.com/content/1/1/63

Title: Complement anaphylatoxins C3a and C5a induce a failing regenerative program in cardiac resident cells. ​ Evidence of a role for cardiac resident stem cells other than cardiomyocyte renewal Authors: David Lara-Astiaso, Alberto Izarra, Juan Camilo Estrada, Carmen Albo, Isabel Moscoso, Enrique Samper, Javier Moncayo, Abelardo Solano, Antonio Bernad, Antonio Díez-Juan Publisher: SpringerPlus Date: December 12, 2012 ​ Abstract: Cardiac healing, which follows myocardial infarction, is a complex process guided by intricate interactions among different components. ​ Some resident cell populations with a potential role in cardiac healing have already been described in cardiac tissues. ​ These non-cardiomyocyte cell subsets, globally described as cardiac pluripotent/progenitor cells (CPCs), are able to differentiate into all three major cardiac cell lineages (endothelial, smooth muscle, and cardiomyocyte cells) in experimental settings. ​ Nevertheless, physiological cardiac healing results in a fibrous scar, which remains to be fully modeled experimentally. ​ Since a role for complement anaphylatoxins (C3a and C5a) has been described in several regeneration/repair processes, we examined the effects that C3a and C5a exert on a defined population of CPCs. ​ We found that C3a and C5a are able to enhance CPC migration and proliferation. ​ In vitro studies showed that this effect is linked to activation of telomerase mRNA and partial preservation of telomere length, in an NFκB-dependent manner. ​ In addition, anaphylatoxin signaling modulates the CPC phenotype, increasing myofibroblast differentiation and reducing endothelial and cardiac gene expression. ​ These findings may denote that C3a and C5a are able to maintain/increase the cardiac stem cell pool within the heart, whilst simultaneously facilitating and modulating resident cell differentiation. ​ We found that this modulation was directed towards scar-forming cells, which increased fibroblast/myofibroblast generation and suggests that both these anaphylatoxins could play a relevant role in the damage-coupled activation of resident cells, and regulation of the cardiac healing process after injury. ​

Laser-induced etching of few-layer graphene synthesized by Rapid-Chemical Vapour Deposition on Cu thin films.pdf

a SpringerOpen Journal Piazzi et al. SpringerPlus 2012, 1:52 http://www.springerplus.com/content/1/1/52 RESEARCH Open Access Laser-induced etching of few-layer graphene synthesized by Rapid-Chemical Vapour Deposition on Cu thin films Marco Piazzi1,2*, Luca Croin1,3, Ettore Vittone2 and Giampiero Amato1 Abstract The outstanding electrical and mechanical properties of graphene make it very attractive for several applications, Nanoelectronics above all. However a reproducible and non destructive way to produce high quality, large-scale area, single layer graphene sheets is still lacking. Chemical Vapour Deposition of graphene on Cu catalytic thin films represents a promising method to reach this goal, because of the low temperatures (T < 950°C−1000°C) involved during the process and of the theoretically expected monolayer self-limiting growth. On the contrary such self-limiting growth is not commonly observed in experiments, thus making the development of techniques allowing for a better control of graphene growth highly desirable. Here we report about the local ablation effect, arising in Raman analysis, due to the heat transfer induced by the laser incident beam onto the graphene sample. Keywords: CVD graphene, Copper, Laser induced etching, Heating ablation effects PAC Codes: 61.80.Ba, 81.15.Gh, 61.48.Gh, 81.05.ue Background Graphene (a single bidimensional layer of carbon atoms arranged in an hexagonal lattice) has attracted a major interest in the last few years because of its astonishing electrical (Castro Neto et al. 2009; Peres 2010; Peres et al. 2006), mechanical (Lee at al. 2008) and chemical properties (Elias et al. 2009; Wang et al. 2009a), that make it a good candidate for the future development of nanoelectronics devices. Although the main properties of this material are nowadays well known from a theo- retical point of view, an efficient and highly reproducible method to grow high quality, large-scale area, single layer graphene films, suitable for practical applications, is still lacking. For this reason, several techniques have been developed in the last years in order to achieve this goal: the most important are the epitaxial growth of graphene by thermal sublimation of SiC (de Heer et al. 2007; Emtsev et al. 2009; Hass et al. 2008; Sprinkle et al. 2009; Varchon *Correspondence: [email protected] 1Quantum Research Laboratory, Istituto Nazionale di Ricerca Metrologica, Strada delle Cacce 91, 10135 Turin, Italy 2Department of Physics, NIS Centre of Excellence and CNISM, University of Turin, Via Pietro Giuria 1, 10125 Turin, Italy Full list of author information is available at the end of the article et al. 2007), the Chemical Vapour Deposition (CVD) synthesis of graphene on various metal catalysts (Reina et al. 2009; Lee et al. 2010; Liu et al. 2010; Kim et al. 2012; Nandamuri et al. 2010; Somani et al. 2006; Li et al. 2009a; 2009b; Tao et al. 2012) and the chemical reduction of graphene oxide (Gilje et al. 2007; Lee at al. 2009; Paredes et al. 2008; Schniepp et al. 2006). Among these, CVD technique seems to be one of the most promising meth- ods because of the reported possibility (Liu et al. 2010) of obtaining highly uniform, defect-free graphene flakes as large as ∼100 μm2 in a reproducible, highly accessible and inexpensive way. Since CVD synthesis needs a catalyst to activate the chemical decomposition of the carbon precursor (usually methane or ethylene) used for graphene growth at low temperatures (T < 950°C – 1000°C), the use of many metals (Ir (Coraux et al. 2008), Ru (Martoccia et al. 2008), Pt (Sasaki et al. 2000; Starr et al. 2006), Fe (Kondo et al. 2010), Ag (Di et al. 2008), Ni (Liu et al. 2010; Kim et al. 2009; Obraztsov et al. 2007), Cu (Bae et al. 2010; Li et al. 2009a; Tao et al. 2012) as catalysts during the process has been reported in litera- ture. Cu is one of the most promising catalyst (Mattevi et al. 2011) because of the low C solid solubility in it © 2012 Piazzi et al.; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Piazzi et al. SpringerPlus 2012, 1:52 Page 2 of 10 http://www.springerplus.com/content/1/1/52 (0.001 −0.008 weight % at ∼1084°C): this property brings to the formation of only soft (not covalent) bonds between the π electrons of 2pz orbitals of sp2 hybridized C atoms and the 4s electrons of Cu, without formation of any carbide phase during the growth process. As a con- sequence, formation of graphene should stop after one single layer has been formed: this makes CVD growth of graphene on Cu very attractive. Nonetheless, many exper- iments show that actually such a self-limiting behaviour is hardly observed, since few-layered graphitic structures are usually grown on Cu substrates. For this reason, to obtain monolayer graphene, several post processing techniques have been proposed to selec- tively etch atomic graphene layers. Among the various approaches (e.g. heat-induced etching by oxygen (Liu et al. 2008), e-beam lithography assisted technique (Novoselov et al. 2004; Zhang et al. 2005), graphene cutting by carbon- soluble metals (Campos et al. 2009; Datta et al. 2008) the thinning of atomic carbon multilayers by laser irra- diation (Han et al. 2011) can be a promising method to obtain monolayer graphene. In this last work, authors show how the central rˆole in graphene etching is held both by the laser irradiation used for the Confocal Raman Spec- troscopy performed on the samples, and by the SiO2/Si substrate on top of which few-layered graphene has been transferred: the heat produced by the irradiation “burns” (in presence of oxygen) locally the outermost C layers, while the innermost layer (the one bound to the substrate) is left unetched because of the presence of the SiO2 layer acting as heat sink. Cu, being a metal, has thermal conductivity higher than SiO2 and can represent therefore an enhanced heat sink, so it can be expected to observe a similar behaviour also for graphene grown by CVD on it. Here we report the change in shape and position of the G and 2D peaks observed in Raman spectra acquired at different time intervals on the same spot of a graphene sample synthesized by CVD on Cu thin films: the evolution of the spectra, indicating that the structure of graphene is changing during the exposure to the laser used during Raman analysis, is compati- ble with a decrease in the number of graphene layers present on the substrate. This decrease may be attributed to the same laser-induced etching effect observed on graphene deposited onto SiO2/Si substrates. If this is the case, an efficient and easy graphene etching technique can be developed and a promising way to obtain high uniform, large-scale area, monolayer graphene can be envisaged. Methods Cu deposition The samples subjected to CVD process have been pre- pared by e-beam evaporation of 500 nm Cu thin film on top of a p-type (100) oriented Si wafer (∼1 cm2) with ∼300 nm thermal SiO2. The deposition has been carried out in a load-lock chamber at a base pressure of ∼10−8 mbar and deposition pressure of ∼10−6 mbar, with an average growth rate of 3 −5 ˚A/s. The thickness d of deposited Cu film has been chosen in order to limit the known problem (Mattevi et al. 2011) of dewetting occurring on very thin films (d < 500 nm) at temperatures ≳800°C. Scanning Electron Microscopy (SEM) images of the samples (taken with a FEI InspectF Scanning Electron Microprobe) after Cu deposition show a uniform cover- age of the SiO2 surface characterized by a Cu polycrys- talline structure with grains of ∼90 nm as typical size (Figure 1(a)). Moreover, Scanning Tunneling Microscopy (STM) scanning an area of ∼10−2 μm2 allowed us to eval- uate the roughness of the Cu surface (Figure 1(b)). The resulting root mean square (RMS) of ∼2 nm (an order of magnitude higher than single layer graphene thickness, ∼ 3.3 ˚A), together with the topographic behaviours obtained for certain scanning directions (Figure 1(c)), showing among others height variations as small as few angstroms, makes ineffective the use of Atomic Force Microscopy (AFM) to detect any change in the number of graphene layers eventually present on Cu: the changes in height pro- duced by the latter effect would be hardly distinguishable from topographic changes due to the roughness of the substrate’s surface. CVD growth process Before undergoing CVD process, samples have been care- fully cleaned in acetone and isopropanol. CVD has been then performed in a Rapid Thermal Annealing (RTA) sys- tem (Jipelec JetFIRST 100) suitable for depositions in Low Vacuum conditions (pmin ∼10−2 mbar) up to Tmax ∼ 1300°C. The system is equipped with four gas lines con- trolled through mass flow meters and it is characterized by a small heat capacity allowing for fast cooling-down processes, up to ∼300°C/min (see Figure 2). The temperature of the system is controlled by a pyrom- eter, exposed to the back of the sample holder (a 4” Si wafer) and calibrated by means of a thermocouple in con- tact with it (Figure 2). The pyrometer sets the power of the lamps. Since the Cu sample undergoing the CVD process is directly exposed to the lamps, the temperature reading by the pyrometer (correct in absence of Cu) is probably lower than the temperature reached by the surface during the process. Therefore, the real deposition temperature may be underestimated. We are performing some studies on this topic in order to solve this ambiguity in the future. However, at the temperature reached during the process as read by the pyrometer dissociation of CH4 and subse- quent graphene formation take place, while the undesired Cu dewetting effect is prevented. Piazzi et al. SpringerPlus 2012, 1:52 Page 8 of 10 http://www.springerplus.com/content/1/1/52 Figure 9 Phenomenological model for local overheating and etching of multilayer graphene. Schematic model representing the possible origin of local overheating and etching of outermost graphene layers grown on Cu films. The heat provided by the focused laser beam is dissipated through in-plane (horizontal arrows) and out-of-plane (vertical arrows) channels. Though the in-plane channel is dominant in graphene, the finite size of outer layers makes out-of-plane dissipation significant and reduces the in-plane contribution, thus causing local overheating and subsequent etching of the layers. The innermost layer is instead prevented from etching by the presence of the Cu substrate acting as heat sink. with respect to the case of transferred graphene onto SiO2. At such photon energies other mechanisms, like molec- ular desorption of chemical species, cannot be a priori excluded, but they can hardly affect the Raman signature and they can be detected through electrical measurements (Sun et al. 2012). The fact that the G peak position is almost unaffected by the laser irradiation can be explained as a result of two competing effects: the local enhancement of temperature (due to overheating), bringing to a redshift of the G peak (Cai et al. 2010; Calizo et al. 2007) and the decrease in the number of graphene layers (due to etching), resulting instead in a blueshift of the G peak (Wang et al. 2009b). The unexpected unaltered intensity of the G peak (that should decrease as the number of graphene layers decreases) can be explained in two ways. A first effect, applying to Raman measurements performed both on transferred and not transferred graphene samples, relies on the increase in temperature of graphene layers upon laser irradiation, likely resulting in an effect similar to what observed in experiments concerning the evolution of graphene Raman signature upon controlled annealing at high temperatures (Ni et al. 2008a). As pointed out in this work, the G peak intensity is not changing between few- and monolayer graphene sheets after the annealing process, meaning that in these experimental conditions G peak intensity cannot be regarded as a fingerprint to distinguish number of graphene layers. A second reason- ing, applying only on graphene samples over Cu, relies on the roughness of the Cu surface, determining a light trap- ping effect close to the substrate’s surface that results in an enhanced number of multiple reflections of the laser light between Cu and graphene layers: as a consequence, the number of C atoms detected by the unfocused beam is always comparable to the number of C atoms present in multilayer graphene, although the number of graphene layers is decreasing. As reported in (Ni et al. 2008b) the G band intensity for a number of graphene layers exceeding ∼15 is in this case decreasing by increasing number of layers and then constant, as observed in our spectra. The origin of the prominent D peak (increasing in intensity as the number of acquisitions increases) is not completely clear yet: it can be attributed to the acquisition of the spectra on a point of the sample lying on a grain boundary of the Cu substrate (resulting in a change of the crystallographic orientation of graphene flake through it) or to defects (terrace boundaries) produced in graphene crystal structure by the laser etching. Raman analysis performed on transferred graphene samples using the same experimental setup (laser at 442 nm, power P = 1 mW and exposure time t = 80 s) con- firms the behaviour observed in the spectra acquired on graphene/Cu substrates. A similar evolution in shape and position of the peaks is obtained for subsequent spectrum acquisitions, as shown in Figure 7(b) and Figure 8(b). Conclusions In summary, a possible way to locally etch graphene lay- ers based on laser heating released during Raman analysis, has been presented. Graphene structure (crystallization degree and number of layers) evolution can be monitored and inferred by looking at the Raman spectra acquired on the sample. The technique is suitable in particular for etching layers of graphene grown by CVD on a metal catalyst. In our case we have reported results obtained with Cu: by lightening the sample with incident laser light at quite high power (≳1mW) for short time periods (∼80 s) a clear sharpening and lowering of the 2D peak position is observed in Raman spectra, together with a decrease in the IG/I2D ratio. These results are compatible with a decrease in the number of graphene layers grown on the metallic substrate. D peak increases in intensity as function of the laser exposure, meaning an increasing of defects in the graphene structure. We believe that the method can be easily applied to other metallic substrates: since the technique deeply relies Piazzi et al. SpringerPlus 2012, 1:52 Page 9 of 10 http://www.springerplus.com/content/1/1/52 on the dispersion of the heat provided by laser irradia- tion through the substrate, the most important feature required for the substrate is its high thermal conductivity. Although some catalysts, like Cu, are very promising for CVD synthesis of graphene because of the expected self- limited mono-layered growth of this material on them, a few-layered structure is often found in experiments. Laser etching here reported can therefore provide an in- situ technique to get rid of this problem. However, laser can also have an active rˆole in inducing unwanted defects, such as vacancies in pristine graphene films: for this rea- son the proposed method shall be further developed. We finally envisage the application of the photo-etching pro- cess here reported to large areas if efficient and uniform illumination conditions, as those used in our RTA system, are employed. Abbreviations CVD: Chemical vapour deposition; SEM: Scanning electron microscopy; STM: Scanning tunneling microscopy; RMS: Root mean square; AFM: Atomic force microscopy; RTA: Rapid thermal annealing; PMMA: poly(methyl-methacrylate); XRD: X-Ray diffraction. Competing interests The authors declare that they have no competing interests. Authors’ contributions MP has been responsible for data analysis and modeling and for Cu e-beam evaporation, helping also in the theoretical interpretation of the results. LC coordinated all the experimental work, in particular the Cu e-beam evaporation and the CVD process, participating also in Raman analysis. EV and GA coordinated all the work and have been responsible for the theoretical interpretation of the results. All authors read and approved the final manuscript. Acknowledgements The authors acknowledge the Nanofacility Piemonte and the Compagnia di San Paolo for financial supports. Thin films evaporation, graphene deposition and SEM analysis on the samples have been performed at Quantum Laboratories - Nanofacility Piemonte present at I.N.Ri.M. - Turin. Raman characterization has been performed with the help of A. Damin at the NIS Centre of Excellence - University of Turin. The help of A. Battiato and E. Olivetti with XPS and XRD analyses is gratefully acknowledge. Author details 1Quantum Research Laboratory, Istituto Nazionale di Ricerca Metrologica, Strada delle Cacce 91, 10135 Turin, Italy. 2Department of Physics, NIS Centre of Excellence and CNISM, University of Turin, Via Pietro Giuria 1, 10125 Turin, Italy. 3Department of Applied Science and Technology, Politecnico of Turin, Corso Duca deli Abruzzi 24, 10129 Turin, Italy. Received: 6 August 2012 Accepted: 5 November 2012 Published: 27 November 2012 References Bae S, Kim H, Lee Y, Xu X, Park JS, Zheng Y, Balakrishnan J, Lei T, Kim HR, Song YI, Kim YJ, Kim KS, ¨Ozyilmaz B, Ahn J H, Hong B H, Iijima S (2010) Roll-to-roll production of 30-inch graphene films for transparent electrodes. Nat Nanotechnol 5: 574–578 Balandin AA, Ghosh S, Bao W, Calizo I, Teweldebrhan D, Miao F, Lau CN (2008) Superior thermal conductivity of single-layer graphene. Nano Lett 8: 902–907 Cai W, Moore AL, Zhu Y, Li X, Chen S, Shi L, RuoffRS (2010) Thermal transport in suspended and supported monolayer graphene grown by chemical vapor deposition. Nano Lett 10: 1645–1651 Calizo I, Balandin AA, Bao W, Miao F, Lau CN (2007) Temperature dependence of the raman spectra of graphene and graphene multilayers. Nano Lett 7: 2645–2649 Campos LC, Manfrinato VR, Sanchez-Yamagishi JD, Kong J, Jarillo-Herrero P (2009) Anisotropic etching and nanoribbon formation in single-layer graphene. Nano Lett 9: 2600–2604 Castro Neto AH, Guinea F, Peres NMR, Novoselov KS, Geim AK (2009) The electronic properties of graphene. Rev Mod Phys 81: 109–162 Coraux J, N’Diaye AT, Busse C, Michely T (2008) Structural coherency of graphene on Ir(111). Nano Lett 8: 565–570 Datta SS, Strachan DR, Khamis SM, Charlie Johnson A T (2008) Crystallographic etching of few-layer graphene. Nano Lett 8: 1912–1915 de Heer WA, Berger C, Wu X, First PN, Conrad EH, Li X, Li T, Sprinkle M, Hass J, Sadowski ML, Potemski M, Martinez G (2007) Epitaxial graphene. Solid State Commun 143: 92–100 Di C, Wei D, Yu G, Liu Y, Guo Y, Zhu D (2008) Patterned graphene as source/drain electrodes for bottom-contact organic field-effect transistors. Adv Mater 20: 3289–3293 Elias DC, Nair RR, Mohiuddin TMG, Morozov SV, Blake P, Halsall MP, Ferrari AC, Boukhvalov DW, Katsnelson MI, Geim AK, Novoselov KS (2009) Control of graphene’s properties by reversible hydrogenation: evidence for Graphane. Science 323: 610–613 Emtsev KV, Bostwick A, Horn K, Jobst J, Kellogg GL, Ley L, McChesney JL, Ohta T, Reshanov SA, R¨ohrl J, Rotenberg E, Schmid AK, Waldmann D, Weber HB, Seyller T (2009) Towards wafer-size graphene layers by atmospheric pressure graphitization of silicon carbide. Nat Mater 8: 203–207 Ferrari AC, Meyer JC, Scardaci V, Casiraghi C, Lazzeri M, Mauri F, Piscanec S, Jiang D, Novoselov KS, Roth S, Geim AK (2006) Raman spectrum of graphene and graphene layers. Phys Rev Lett 187401(1)–187401(4) Gilje S, Han S, Wang M, Wang KL, Kaner RB (2007) A chemical route to graphene for device applications. Nano Lett 7: 3394–3398 Han GH, Chae SJ, Kim ES, G¨unes¸ F, Lee IH, Lee SW, Lee SY, Lim SC, Jeong HK, Jeong MS, Lee YH (2011) Laser thinning for monolayer graphene formation: heat sink and interference effect. ACS Nano 5: 263–268 Hass J, de Heer WA, Conrad EH (2008) The growth and morphology of epitaxial multilayer graphene. J Phys-Condens Mat 20: 323202(1)–323202(27) Ismach A, Druzgalski C, Penwell S, Schwartzberg A, Zheng M, Javey A, Bokor J, Zhang Y (2010) Direct chemical vapor deposition of graphene on dielectric surfaces. Nano Lett 10: 1542–1548 Kim H, Mattevi C, Calvo MR, Oberg JO, Artiglia L, Agnoli S, Hirjibehedin CF, Chhowalla M, Saiz E (2012) Activation energy paths for graphene nucleation and growth on Cu. ACS Nano 6: 3614–3623 Kim KS, Zhao Y, Jang H, Lee SY, Kim JM, Kim KS, Ahn JH, Kim P, Choi JY, Hong BH (2009) Large-scale pattern growth of graphene films for stretchable transparent electrodes. Nature 457: 706–710 Kondo D, Sato S, Yagi K, Harada N, Sato M, Nihei M, Yokoyama N (2010) Low-temperature synthesis of graphene and fabrication of top-gated field effect transistors without using transfer processes. Appl Phys Expr 3: 025102(1)–025102(3) Lee Y, Bae S, Jang H, Jang S, Zhu SE, Sim SH, Song YI, Hong BH, Ahn JH (2010) Wafer-scale synthesis and transfer of graphene films. Nano Lett 10: 490–493 Lee CG, Park S, RuoffRS, Dodabalapur A (2009) Integration of reduced graphene oxide into organic field-effect transistors as conducting electrodes and as a metal modification layer. Appl Phys Lett 95: 023304(1)–023304(3) Lee C, Wei X, Kysar JW, Hone J (2008) Measurement of the elastic properties and intrinsic strength of monolayer graphene. Science 321: 385–388 Li X, Cai W, An J, Kim S, Nah J, Yang D, Piner R, Velamakanni A, Jung I, Tutuc E, Banerjee SK, Colombo L, RuoffRS (2009a) Large-area synthesis of high-quality and uniform graphene films on copper foils. Science 324: 1312–1314 Li X, Cai W, Colombo L, RuoffRS (2009b) Evolution of graphene growth on Ni and Cu by carbon isotope labeling. Nano Lett 9: 4268–4272 Liu W, Chung CH, Miao CQ, Wang YJ, Li BY, Ruan LY, Patel K, Park YJ, Woo J, Xie YH (2010) Chemical vapor deposition of large area few layer graphene on Si catalyzed with nickel films. Thin Solid Films 518: S128–S132 Liu L, Ryu S, Tomasik MR, Stolyarova E, Jung N, Hybertsen MS, Steigerwald ML, Brus LE, Flynn GW (2008) Graphene oxidation: thickness-dependent etching and strong chemical doping. Nano Lett 8: 1965–1970 Malard LM, Pimenta MA, Dresselhaus G, Dresselhaus MS (2009) Raman spectroscopy in graphene. Phys Rep 473: 51–87 Piazzi et al. SpringerPlus 2012, 1:52 Page 10 of 10 http://www.springerplus.com/content/1/1/52 Martoccia D, Willmott PR, Brugger T, Bj¨orck M, G¨unther S, Schlep¨utz CM, Cervellino A, Pauli SA, Patterson BD, Marchini S, Wintterlin J, Moritz W, Greber T (2008) Graphene on Ru(0001): a 25 × 25 supercell. Phys Rev Lett 101: 126102(1)–126102(4) Mattevi C, Kim H, Chhowalla M (2011) A review of chemical vapor deposition of graphene on copper. J Mater Chem 21: 3324–3334 Miao C, Zheng C, Liang O, Xie YH (2011) Chemical vapor deposition of graphene. In: Mikhailov S (ed) Physics and applications of graphene - experiments. In Tech Rijeka, pp 37–54 Nandamuri G, Roumimov S, Solanki R (2010) Chemical vapor deposition of graphene films. Nanotechnology 21: 145604(1)–145604(4) Ni ZH, Wang HM, Ma Y, Kasim J, Wu YH, Shen ZX (2008a) Tunable stress and controlled thickness modification in graphene by annealing. ACS Nano 2: 1033–1039 Ni ZH, Wang YY, Yu T, Shen ZX (2008b) Raman spectroscopy and imaging of Graphene. Nano Res 1: 273–291 Novoselov KS, Geim AK, Morozov SV, Jiang D, Zhang Y, Dubonos SV, Grigorieva IV, Firsov AA (2004) Electric field effect in atomically thin carbon films. Science 306: 666–669 Obraztsov AN, Obraztsov EA, Tyurnina AV, Zolotukhin AA (2007) Chemical vapor deposition of thin graphite films of nanometer thickness. Carbon 45: 2017–2021 Paredes JI, Villar-Rodil S, Mart´ınez-Alonso A, Tasc´on JMD (2008) Graphene oxide dispersions in organic solvents. Langmuir 24: 10560–10564 Peres NMR (2010) The transport properties of graphene: an introduction. Rev Mod Phys 82: 2673–2700 Peres NMR, Guinea F, Castro Neto AH (2006) Electronic properties of disordered two-dimensional carbon. Phys Rev B 73: 125411(1)–125411(23) Reina A, Jia X, Ho J, Nezich D, Son H, Bulovic V, Dresselhaus MS, Kong J (2009) Large area, few-layer graphene films on arbitrary substrates by chemical vapor deposition. Nano Lett 9: 30–35 Sasaki M, Yamada Y, Ogiwara Y, Yagyu S, Yamamoto S (2000) Moir´e contrast in the local tunneling barrier height images of monolayer graphite on Pt(111). Phys Rev B 61: 15653–15656 Schniepp HC, Li JL, McAllister MJ, Sai H, Herrera-Alonso M, Adamson DH, Prud’homme RK, Car R, Saville DA, IAv Aksay (2006) Functionalized single graphene sheets derived from splitting graphite oxide. J Phys Chem B 110: 8535–8539 Somani PR, Somani SP, Umeno M (2006) Planes nano-graphenes from camphor by CVD. Chem Phys Lett 430: 56–59 Sprinkle M, Siegel D, Hu Y, Hicks J, Tejeda A, Taleb-Ibrahimi A, Le F´evre P, Bertran F, Vizzini S, Enriquez H, Chiang S, Soukiassian P, Berger C, de Heer WA, Lanzara A, Conrad EH (2009) First direct observation of a nearly ideal graphene band structure. Phys Rev Lett 103: 226803(1)–226803(4) Starr DE, Pazhetnov EM, Stadnichenko AI, Boronin AI, Shaikhutdinov SK (2006) Carbon films grown on Pt(111) as supports for model gold catalysts. Surf Sci 600: 2688–2695 Su CY, Lu AY, Wu CY, Li YT, Liu KK, Zhang W, Lin SY, Juang ZY, Zhong YL, Chen FR, Li LJ (2011) Direct formation of wafer scale graphene thin layers on insulating substrates by chemical vapor deposition. Nano Lett 11: 3612–3616 Sun PZ, Zhu M, Wang KL, Zhong ML, Wei JQ, Wu DH, Cheng Y, Zhu HW (2012) Photoinduced molecular desorption from graphene films. Appl Phys Lett 101: 053107(1)–053107(4) Tao L, Lee J, Chou H, Holt M, RuoffRS, Akinwande D (2012) Synthesis of high quality monolayer graphene at reduced temperature on hydrogen-enriched evaporated copper (111) films. ACS Nano 6: 2319–2325 Varchon F, Feng R, Hass J, Li X, Ngoc Nguyen B, Naud C, Mallet P, Veuillen JY, Berger C, Conrad EH, Magaud L (2007) Electronic structure of epitaxial graphene layers on SiC: effect of the substrate. Phys Rev Lett 99: 126805(1)–126805(4) Wang X, Li X, Zhang L, Yoon Y, Weber PK, Wang H, Guo J, Dai H (2009a) N-Doping of graphene through electrothermal reactions with ammonia. Science 324: 768–771 Wang H, Wang Y, Cao X, Feng M, Lan G (2009b) Vibrational properties of graphene and graphene layers. J Raman Spectrosc 40: 1791–1796 Zhang Y, Tan YW, Stormer HL, Kim P (2005) Experimental observation of the quantum hall effect and Berry’s phase in graphene. Nature 438: 201–204 doi:10.1186/2193-1801-1-52 Cite this article as: Piazzi et al.: Laser-induced etching of few-layer graphene synthesized by Rapid-Chemical Vapour Deposition on Cu thin films. SpringerPlus 2012 1:52. Submit your manuscript to a journal and benefi t from: 7 Convenient online submission 7 Rigorous peer review 7 Immediate publication on acceptance 7 Open access: articles freely available online 7 High visibility within the fi eld 7 Retaining the copyright to your article Submit your next manuscript at 7 springeropen.com

Title: Laser-induced etching of few-layer graphene synthesized by Rapid-Chemical Vapour Deposition on Cu thin films ​ Authors: Marco Piazzi, Luca Croin, Ettore Vittone, Giampiero Amato ​ Publisher: SpringerOpen Date: 27 November 2012 ​ Abstract: The outstanding electrical and mechanical properties of graphene make it very attractive for several applications, Nanoelectronics above all. ​ However, a reproducible and non-destructive way to produce high-quality, large-scale area, single-layer graphene sheets is still lacking. ​ Chemical Vapour Deposition of graphene on Cu catalytic thin films represents a promising method to reach this goal, because of the low temperatures (T < 950°C−1000°C) involved during the process and of the theoretically expected monolayer self-limiting growth. ​ On the contrary, such self-limiting growth is not commonly observed in experiments, thus making the development of techniques allowing for a better control of graphene growth highly desirable. ​ Here we report about the local ablation effect, arising in Raman analysis, due to the heat transfer induced by the laser incident beam onto the graphene sample. ​

Mycobacterium avium subsp. paratuberculosis lipophilic antigen causes Crohn’s disease-type necrotizing colitis in Mice.pdf

RESEARCH Open Access Mycobacterium avium subsp. paratuberculosis lipophilic antigen causes Crohn’s disease-type necrotizing colitis in Mice Eiichi Momotani1*, Hiroshi Ozaki2, Masatoshi Hori2, Shizuo Yamamoto3, Takashi Kuribayashi3, Shigetoshi Eda4 and Masahiro Ikegami5 Abstract Background: A 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced murine colitis model was developed to investigate the pathogenesis and to evaluate a method of treating human Crohn’s disease. This experimental model rapidly induces colitis similar to human Crohn’s disease lesion in a reproducible manner. However, natural exposure of the human digestive tract to TNBS is unrealistic. A novel animal model based on realistic data is eagerly anticipated in future research on pathogenesis of CD. Method: We evaluated the potency of Map antigen molecules in an effort to develop a novel colitis model using a more realistic source than TNBS. We prepared the Map antigen by ethanol extraction and developed a mouse model in a manner similar to that of the well-known TNBS-induced colitis in mice. In the experiment, seven days after subcutaneous (SC) injection of the antigen into normal C57BL/6 mice, the same antigen in 50% ethanol was injected into the colon by the transanal route with a fine cannula. Results: On the fifth day after the transanal injection, histopathological examination revealed full-thickness necrotizing colitis with erosion and ulcers; severe infiltration with neutrophils, lymphocytes, macrophages, and perforation. However, no change was detected with each single Map-antigen injection. Conclusion: The present results provide a novel animal model for research on CD and may be the key to clarifying the relationship between CD and Map. This is the first evidence that mycobacterium antigen induces necrotizing colitis. Keywords: Mycobacterium, Paratuberculosis, Crohn’s disease, IBD, Mice, Necrotizing colitis, TNBS Background The number of studies attempting to detect clues to the mystery of Crohn’s disease (CD), a chronic intractable in- testinal disease, has recently increased (Lakatos 2009; Momotani et al. 2012; Simmons 2010). Althoug various symptomatic treatments and approaches to diet restric- tion half of CD patients require surgery within 10 years after diagnosis. The risk of postoperative recurrence is 44 to 55% after 10 years (Peyrin-Biroulet et al. 2010). The globally rising rate of pediatric CD is also a major issue (Benchimol et al. 2011; Jakobsen et al. 2008; Phavichitr et al. 2003). No convincing explanation of the pathogen- esis of CD currently exists; however, various environmen- tal factors (e.g., pathogenic or non-pathogenic microbes, lifestyle, hygiene factors, diet, and stress) have been sug- gested (Economou and Pappas 2008; Glasser and Darfeuille-Michaud 2008; Lakatos 2009; Momotani et al. 2012; Neuman and Nanau 2012). Responsible host genes such as the famous NOD2 and a genetic predisposition to CD have been suspected as well (Economou and Pap- pas 2008; Glasser and Darfeuille-Michaud 2008; Umeno et al. 2011; Vora et al. 2012). The focus in recent years has been on Mycobacterium avium subsp. paratuberculo- sis (Map) (Behr and Kapur 2008; Eltholth et al. 2009; Momotani et al. 2012), due to the reported pathological similarities of CD and paratuberculosis (Ptb), accumulat- ing reports of frequent detection of Map IS900 DNA, and much less isolation of Map from CD lesions (Abu- bakar et al. 2008; Chiodini 1989; Feller et al. 2007; Momotani et al. 2012). Detection of live Map and Map IS900 DNA in children with early-onset CD has been reported (Kirkwood et al. 2009). * Correspondence: [email protected] 1Research Area of Pathology and Pathophysiology, National Institute of Animal Health, 3-1-5 Kan-nondai, Tsukuba 305-0856, Japan Full list of author information is available at the end of the article a SpringerOpen Journal © 2012 Momotani et al.; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Momotani et al. SpringerPlus 2012, 1:47 http://www.springerplus.com/content/1/1/47 Paratuberculosis is a chronic and progressive granuloma- tous enteritis that affects livestock and wild animals world- wide (Chiodini et al. 1984; Momotani et al. 2012; Nielsen and Toft 2009; Raizman et al. 2009; Stabel et al. 2009). However, differences between CD and Ptb have been pointed out (Momotani et al. 2012; Van Kruiningen 1999). An additional mystery is the “invisible Map” that sup- posedly grows in CD lesions (Momotani et al. 2012; Pierce 2009; Van Kruiningen 1999). This phenomenon has been explained by isolation of a cell-wall-deficient, spheroplastic form of Map from human CD lesions (Wall et al. 1993). However, even immunohistochemical staining for cytoplas- mic and cell-wall components of Map could not detect Map in CD lesions (Kobayashi et al. 1989; Momotani et al. 2012; Pierce 2009; Sartor 2005; Van Kruiningen 1999). In contrast to the hypothesis that Map infection causes CD, there are no reports of CD-like Ptb lesions in natural or ex- perimental infection with Map (Chiodini 1989; Chiodini et al. 1984). Furthermore, intestinal lesions in Ptb of cyno- molgus were very similar to those of bovine but differed histopathologically from human CD (McClure et al. 1987). An experimental colitis model using mice or rats with haptenizing agent 2,4,6-trinitrobenzene sulfonic acid (TNBS) yields pathological findings similar to those of human CD (Arita et al. 2005; Neurath et al. 2000; te Velde et al. 2006). However, natural exposure of the human digestive tract to TNBS is unrealistic. In contrast, exposure of the human digestive tract to Map antigen is realistic (Behr and Kapur 2008; Eltholth et al. 2009; Over et al. 2011), since frequently detected Map IS900 DNA in CD patients (Abubakar et al. 2008; Chiodini 1989; Feller et al. 2007; Momotani et al. 2012) is considered to be evidence of Map antigen exposure, rather than Map infection. In the present study, we prepared a lipophilic antigen of Map, and TNBS in the previous TNBS colitis model (Arita et al. 2005) was replaced with the Map antigen. Histopathological evaluation revealed severe necrotizing colitis that is very similar to that in the well- known TNBS colitis model. The present study proposes a new CD model and a novel hypothesis on the patho- genesis of human CD. Results Clinical findings and gross pathology During the experiment period, only a few mice exhibited in- activation and a rough coat. During the autopsy, thickening of the colon wall with congestion was observed in the 6 cases exhibited total score than 15 (Figure 1A). Histopathology Stacked bar graphs present histopathological findings regarding degree (Figure 1B), distribution of lesions (Figure 1B), and types of infiltrating cells (Figure 1C). All sections were stained with hematoxylin and eosin (H&E), and the magnification of photos is indicated as a bar. Group 1 Histopathological findings caused by TNBS are pre- sented in Figure 2. Three severe (cases T3-5, Figure 2A) and two mild (cases T1 and 2, Figure 2A) colitis cases were observed. Case T-4 exhibited the most severe full- thickness necrotizing colitis (Figure 2A-D). The most se- verely damaged tissue was shaped like an erupting vol- cano (Figure 2A, arrow). The colitis included various degrees of erosion, ulceration, and infiltration with neu- trophils, lymphocytes, and macrophages in laminapro- pria mucosa (Figure 2B-F). Atypical epithelial cells including irregularly shaped, vacuolated, and regenerat- ing cells were observed (Figure 2B-F). Epithelium was sometimes infiltrated with neutrophils (Figure 2C, arrows). Granulation (g), an early stage of fibrosis, was observed with ulcer formation (Figures 2B and C). Intes- tinal epithelial cells and crypt (c) structure on the necro- tizing area disappeared or were modified by inflammation and granulation (Figure 2B-F). Neutrophils were the predominant infiltrating cells (Figure 2C); how- ever, other cell types also contributed. Edema (ed) of the muscle layer (m) was observed (Figure 2A and B). Medium infiltration and edema (ed) in the lamina pro- pria mucosa and sub-mucosa (sm) were observed (Figure 2D). Erosion and ulceration were observed in cases T-2 (Figure 2E) and T-3 (Figure 2F). Group 2 Histopathological findings of group 2 are presented in Figure 3. The most severe findings (Figures 3A-F) were observed in case M100-2. Figures 3G and H are from case M100-3. Case M100-2 exhibited severe full- thickness destructive enteritis (Figures 3A-F). The most severe changes were deep ulcer and necrotizing enteritis (ne) (Figures 3A and B). Accumulation of inflammatory cells (aic), debris, and edema (e) were seen as a pseudo- membrane (Figures 3A and B). The normal structure of the mucosa completely disappeared (Figure 3, arrow); however, the severity differed from area to area for the same case (Figures 3A and B). In some areas of the colon, the structure of the epithelium was maintained, but infiltration and edema were characteristically observed in the muscle layer (ml) (Figures 3C and D). Cellular infiltration is observed between circular muscu- lar fibers (Figure 3E). Edema and cellular infiltration of the longitudinal muscle (lm) and the serosal membrane (Figures 3D and F) were observed. Fibrin deposition (f) was observed on the serosal membrane (sm) (Figure 3F). Full-thickness necrotizing enteritis was observed in case M100-3 (Figure 3G). The pseudomem- brane (pm) was also observed (Figure 3F). Infiltration in Momotani et al. SpringerPlus 2012, 1:47 Page 2 of 10 http://www.springerplus.com/content/1/1/47 The probability that people having some genetic predis- position will ingest live Map in food is minimal, but the chance of exposure by heat-killed Map antigen may be very frequent. Although the heating process of dairy products eliminates live Map (Stabel 2000; Stabel and Lambertz 2004; Stabel et al. 1997), it may not elimin- ate hazards to human health. Of course, we should not neglect the possibility of human Map infection (Hermon-Taylor 2009; Singh et al. 2010). Conclusions The present study proposed a novel mouse model for CD-like colitis and the ability of Map antigen to induce necrotizing colitis, which may be the key to understand- ing the relationship between CD and Map. This model may help clarify the pathogenesis of CD, as well as other diseases with a suspected etiological relationship to Map (e.g., irritable bowel syndrome (Scanu et al. 2007), mul- tiple sclerosis (Cossu et al. 2011), and type-1 diabetes mellitus (Paccagnini et al. 2009)). Also, this is the first evidence that mycobacterium antigen induces necrotiz- ing colitis. In addition, the authors recommend that people who may have a genetic predisposition (Econo- mou and Pappas 2008; Economou et al. 2004; Glasser and Darfeuille-Michaud 2008; Henderson et al. 2011; Lakatos 2009; Tsianos et al. 2012; Tuci et al. 2011; Umeno et al. 2011) to CD (i.e., if a relative has CD) should avoid dairy products possibly contaminated with the Map antigen (Eltholth et al. 2009; Foods 2010; Hermon-Taylor et al. 2000; Millar et al. 1996; Patel and Shah 2011) because no other measures for preventing CD are known. Methods Antigen preparation Mycobacterium avium subspecies paratuberculosis (ATCC 19698) was grown in Middle brook 7H9 liquid medium (Difco Laboratories, MD, USA) enriched with BBL Middle brook OADC (Becton Dickinson, Tokyo, Japan) and 2mg/L of mycobactin J (Allied Laboratory, MO, USA) for two weeks. Next, 90 ml of the culture was centrifuged at 2,200xg for 20min, the supernatant was removed, and the culture was re-suspended in phos- phate buffer saline (PBS). After washing twice with PBS, wet bacilli (1g wet weight) were collected. Surface lipo- philic antigen was isolated by a previous method (Speer et al. 2006). The bacilli were suspended in 12ml of 80% ethanol by vortex at room temperature for 1min. The suspension was centrifuged, and the resulting super- natant was collected. The dried material weighed 20mg; thus, the concentration was calculated as 1.7mg/ml in 80% ethanol. The material (Map-L antigen) was dis- solved with 50% ethanol and used as MAP-L100 antigen (0.68μg/μl). Antigens serially diluted 10 times were used as MAP-L10 (0.068μg/μl) and MAP-L1 antigen (0.0068μg/μl). Preparation of the culture and isolation of the antigen were carried out in laboratory certified as a biosafety level 2 (BSL2-TS-49) in NIAH. Experimental animals C57BL/6Cr Slc female mice at 10 weeks old were pur- chased from Japan SLC, Inc., and kept in a specific- pathogen-free (SPF) environment under the conditions described above. The mice were fed ad libitum during the experiments. Experiment procedure This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Animal Health. The protocol was approved by the Committee of the Ethics of Animal Experiments of the NIAH (Per- mit Numbers: 08–118, 09–130 and A10-025), and all efforts were made to minimize suffering. All treatments were performed under general anesthesia with Avertin (2,2,-Tribromoethanol) (Arita et al. 2005). The mice were divided into six groups and injected twice with different antigens (Figure 1A). The primary injection was performed subcutaneously. The secondary antigen injections to the colon were performed through the trans-anal route with a fine urinary catheter (Atom Multipurpose Tube, 1.35mm in diameter, Atom Medical Corporation, Tokyo). Feeding was stopped 24 h before the secondary injection. This experimental procedure was basically accorded to previously reported TNBS colitis model by Arita et al. (Arita et al. 2005), because of the the favorable reproducibility. Group 1 mice, TNBS positive control group were trea- ted subcutaneously with 2.5% TNBS in 50% ethanol and then injected with 10% TNBS in ethanol by the transanal route. All mice in groups 2, 3, and 4 were subcutane- ously injected with 25.5μg/150μl of MAP-L antigen in 50% ethanol (Map-L100 antigen). Seven days after treat- ment, the same antigen with three different concentra- tions (2.5 (MAP-L100), 0.25 (MAP-L10), and 0.025μg (MAP-L1)/150μl in 50% ethanol) were injected into the colon. Group 5 mice were pretreated subcutaneously with 50% ethanol, and then 25μg of MAP-L100 antigen per 150μl in 50% ethanol was injected into the colon. Group 6 mice were treated with 50% ethanol by SC in- jection and then by injection into the colon as a non- antigen control. Five days after the injection, the mice were put down by carbon dioxide gas. Colon tissues were sampled and fixed in 20% buffered formalin solu- tion for histopathological examination. The fixative was gently injected into the lumen of the intestine by syringe with a 21 gauge needle. Momotani et al. SpringerPlus 2012, 1:47 Page 8 of 10 http://www.springerplus.com/content/1/1/47 All experiment protocols used in this study were approved by the Ethics Review Committee for Animal Experimentation of NIAH (approval Nos. 08–118 and 09–130). Histopathology Tissues fixed for three days were trimmed to be round slices and embedded in paraffin blocks. Sections were cut 4μm thick and stained with hematoxylin and eosin (H&E) and then observed under a microscope. The find- ings were recorded, and the degree of changes were expressed as 0 to 3 and made stacked bar graphs. (Figures A1-3). Abbreviations CD: Crohn’s disease; UC: Ulcerative colitis; Map: Mycobacterium avium subsp. paratuberculosis; Ptb: Paratuberculosis; TNBS: 2,4,6-trinitrobenzene sulfonic acid; OADC: Oleic Acid-Albumin Fraction V-Dextrose-Catalase enrichment; SPF: Specific-pathogen-free. Competing interests The authors declare that they have no competing interests. Author’s contributions EM, HO, MH and MI conceived and designed the experiments. SE purified the antigen. EM, SE, SY and TK performed the experiments. EM, HO, MH, SE and MI analyzed the data. EM, HO, MH, and SE contributed reagents, materials, or analysis tools. EM, SE, SY and MI wrote the paper. All authors read and approved the final manuscript. Acknowledgements This work was supported by Grants-in-Aid for Scientific Research from the Japanese Ministry of Education No. 23240061(to EM) and No. 20228005 (to H O), and the Bio-oriented Technology Research Advancement Institute (BRAIN) (to EM). We thank Mr. M. Kobayashi and Ms. M. Shimada for preparing excellent histopathological sections. Author details 1Research Area of Pathology and Pathophysiology, National Institute of Animal Health, 3-1-5 Kan-nondai, Tsukuba 305-0856, Japan. 2Department of Veterinary Pharmacology Graduate School of Agriculture and Life Sciences, the University of Tokyo, Tokyo 113-8657, Japan. 3Laboratories of Immunology, School of Life and Environmental Science, Azabu University, Fuchinobe 1-17-71, Chuo-ku, Sagamihara, Kanagawa 252-5201, Japan. 4Center for Wildlife Health, Department of Forestry, Wildlife and Fisheries, the University of Tennessee, Knoxville, Tennessee 37996-1071, USA. 5Department of Pathology, the Jikei University School of Medicine, Minato-ku, Tokyo, Japan. Received: 12 September 2012 Accepted: 29 October 2012 Published: 8 November 2012 References Abubakar I, Myhill D, Aliyu SH, Hunter PR (2008) Detection of Mycobacterium avium subspecies paratuberculosis from patients with Crohn's disease using nucleic acid-based techniques: a systematic review and meta-analysis. Inflamm Bowel Dis 14:401–410 Alonso-Hearn M, Molina E, Geijo M, Vazquez P, Sevilla I, Garrido JM, Juste RA (2009) Isolation of Mycobacterium avium subsp. paratuberculosis from muscle tissue of naturally infected cattle. Foodborne Pathog Dis 6:513–518 Arita M, Yoshida M, Hong S, Tjonahen E, Glickman JN, Petasis NA, Blumberg RS, Serhan CN (2005) Resolvin E1, an endogenous lipid mediator derived from omega-3 eicosapentaenoic acid, protects against 2,4,6-trinitrobenzene sulfonic acid-induced colitis. Proc Natl Acad Sci USA 102:7671–7676 Baumgart DC, Sandborn WJ (2007) Inflammatory bowel disease: clinical aspects and established and evolving therapies. Lancet 369:1641–1657 Behr MA, Kapur V (2008) The evidence for Mycobacterium paratuberculosis in Crohn's disease. Curr Opin Gastroenterol 24:17–21 Benchimol EI, Fortinsky KJ, Gozdyra P, Van den Heuvel M, Van Limbergen J, Griffiths AM (2011) Epidemiology of pediatric inflammatory bowel disease: a systematic review of international trends. Inflamm Bowel Dis 17:423–439 Black CA (1999) Delayed type hypersensitivity: current theories with an historic perspective. Dermatol Online J 5:7 Chiodini RJ (1989) Crohn's disease and the mycobacterioses: a review and comparison of two disease entities. Clin Microbio Rev 2:90–117 Chiodini RJ, Van Kruiningen HJ, Merkal RS (1984) Ruminant paratuberculosis (Johne's disease): the current status and future prospects. Cornell Vet 74:218–262 Cossu D, Cocco E, Paccagnini D, Masala S, Ahmed N, Frau J, Marrosu MG, Sechi LA (2011) Association of Mycobacterium avium subsp. paratuberculosis with multiple sclerosis in Sardinian patients. PLoS One 6:e18482 Economou M, Pappas G (2008) New global map of Crohn's disease: Genetic, environmental, and socioeconomic correlations. Inflamm Bowel Dis 14:709–720 Economou M, Trikalinos TA, Loizou KT, Tsianos EV, Ioannidis JP (2004) Differential effects of NOD2 variants on Crohn's disease risk and phenotype in diverse populations: a meta analysis. Am J Gastroenterol 99:2393–2404 Eltholth MM, Marsh VR, Van Winden S, Guitian FJ (2009) Contamination of food products with Mycobacterium avium paratuberculosis: a systematic review. J Appl Microbiol 107:1061–1071 Feller M, Huwiler K, Stephan R, Altpeter E, Shang A, Furrer H, Pfyffer GE, Jemmi T, Baumgartner A, Egger M (2007) Mycobacterium avium subspecies paratuberculosis and Crohn's disease: a systematic review and meta-analysis. Lancet Infect Dis 7:607–613 Foods NACoMCf (2010) Assessment of food as a source of exposure to Mycobacterium avium subspecies paratuberculosis (MAP). J Food Prot 73:1357–1397 Gill CO, Saucier L, Meadus WJ (2011) Mycobacterium avium subsp. paratuberculosis in dairy products, meat, and drinking water. J Food Prot 74:480–499 Glasser AL, Darfeuille-Michaud A (2008) Abnormalities in the handling of intracellular bacteria in Crohn's disease: a link between infectious etiology and host genetic susceptibility. Arch Immunol Ther Exp (Warsz) 56:237–244 Henderson P, van Limbergen JE, Wilson DC, Satsangi J, Russell RK (2011) Genetics of childhood-onset inflammatory bowel disease. Inflamm Bowel Dis 17:346–361 Hermon-Taylor J (2009) Mycobacterium avium subspecies paratuberculosis, Crohn's disease and the Doomsday scenario. Gut Pathog 1:15 Hermon-Taylor J, Bull TJ, Sheridan JM, Cheng J, Stellakis ML, Sumar N (2000) Causation of Crohn's disease by Mycobacterium avium subspecies paratuberculosis. Can J Gastroenterol 14:521–539 Jakobsen C, Wewer V, Urne F, Andersen J, Faerk J, Kramer I, Stagegaard B, Pilgaard B, Weile B, Paerregaard A (2008) Incidence of ulcerative colitis and Crohn's disease in Danish children: still rising or levelling out? J Crohns Colitis 2:152–157 Kirkwood CD, Wagner J, Boniface K, Vaughan J, Michalski WP, Catto-Smith AG, Cameron DJ, Bishop RF (2009) Mycobacterium avium subspecies paratuberculosis in children with early-onset Crohn's disease. Inflamm Bowel Dis 15:1643–1655 Klanicova B, Slana I, Vondruskova H, Kaevska M, Pavlik I (2011) Real-time quantitative PCR detection of Mycobacterium avium subspecies in meat products. J Food Prot 74:636–640 Kobayashi K, Blaser MJ, Brown WR (1989) Immunohistochemical examination for mycobacteria in intestinal tissues from patients with Crohn's disease. Gastroenterol 96:1009–1015 Kobayashi K, Kaneda K, Kasama T (2001) Immunopathogenesis of delayed-type hypersensitivity. Microsc Res Tech 53:241–245 Lakatos PL (2006) Recent trends in the epidemiology of inflammatory bowel diseases: up or down? World J Gastroenterol 12:6102–6108 Lakatos PL (2009) Environmental factors affecting inflammatory bowel disease: have we made progress? Dig Dis 27:215–225 Loddenkemper C (2009) Diagnostic standards in the pathology of inflammatory bowel disease. Dig Dis 27:576–583 Lowe AM, Yansouni CP, Behr MA (2008) Causality and gastrointestinal infections: Koch, Hill, and Crohn's. Lancet Infect Dis 8:720–726 McClure HM, Chiodini RJ, Anderson DC, Swenson RB, Thayer WR, Coutu JA (1987) Mycobacterium paratuberculosis infection in a colony of stumptail macaques (Macaca arctoides). J Infect Dis 155:1011–1019 Momotani et al. SpringerPlus 2012, 1:47 Page 9 of 10 http://www.springerplus.com/content/1/1/47 Millar D, Ford J, Sanderson J, Withey S, Tizard M, Doran T, Hermon-Taylor J (1996) IS900 PCR to detect Mycobacterium paratuberculosis in retail supplies of whole pasteurized cows' milk in England and Wales. Appl Environ Microbiol 62:3446–3452 Momotani E, Romona NM, Yoshihara K, Momotani Y, Hori M, Ozaki H, Eda S, Ikegami M (2012) Molecular pathogenesis of bovine paratuberculosis and human inflammatory bowel diseases. Vet Immunol Immunopathol 148:55–68 Neuman MG, Nanau RM (2012) Inflammatory bowel disease: role of diet, microbiota, life style. Transl Res 160:29–44 Neurath M, Fuss I, Strober W (2000) TNBS-colitis. Int Rev Immunol 19:51–62 Nielsen SS, Toft N (2009) A review of prevalences of paratuberculosis in farmed animals in Europe. Prev Vet Med 88:1–14 Olsen I, Tollefsen S, Aagaard C, Reitan LJ, Bannantine JP, Andersen P, Sollid LM, Lundin KE (2009) Isolation of Mycobacterium avium subspecies paratuberculosis reactive CD4 T cells from intestinal biopsies of Crohn's disease patients. PLoS One 4:e5641 Over K, Crandall PG, O'Bryan CA, Ricke SC (2011) Current perspectives on Mycobacterium avium subsp. paratuberculosis, Johne's disease, and Crohn's disease: a review. Crit Rev Microbiol 37:141–156 Paccagnini D, Sieswerda L, Rosu V, Masala S, Pacifico A, Gazouli M, Ikonomopoulos J, Ahmed N, Zanetti S, Sechi LA (2009) Linking chronic infection and autoimmune diseases: Mycobacterium avium subspecies paratuberculosis, SLC11A1 polymorphisms and type-1 diabetes mellitus. PLoS One 4:e7109 Patel A, Shah N (2011) Mycobacterium avium subsp paratuberculosis-Incidences in milk and milk products, their isolation, enumeration, characterization, and role in human health. J Microbiol Immunol Infect 44:473–479 Peyrin-Biroulet L, Loftus EV Jr, Colombel JF, Sandborn WJ (2010) The natural history of adult Crohn's disease in population-based cohorts. Am J Gastroenterol 105:289–297 Phavichitr N, Cameron DJ, Catto-Smith AG (2003) Increasing incidence of Crohn's disease in Victorian children. J Gastroenterol Hepatol 18:329–332 Pierce ES (2009) Where are all the Mycobacterium avium subspecies paratuberculosis in patients with Crohn's disease? PLoS Pathog 5:e1000234 Raizman EA, Fetrow JP, Wells SJ (2009) Loss of income from cows shedding Mycobacterium avium subspecies paratuberculosis prior to calving compared with cows not shedding the organism on two Minnesota dairy farms. J Dairy Sci 92:4929–4936 Romero C, Hamdi A, Valentine JF, Naser SA (2005) Evaluation of surgical tissue from patients with Crohn's disease for the presence of Mycobacterium avium subspecies paratuberculosis DNA by in situ hybridization and nested polymerase chain reaction. Inflamm Bowel Dis 11:116–125 Sartor RB (2005) Does Mycobacterium avium subspecies paratuberculosis cause Crohn's disease? Gut 54:896–898 Scanu AM, Bull TJ, Cannas S, Sanderson JD, Sechi LA, Dettori G, Zanetti S, Hermon-Taylor J (2007) Mycobacterium avium subspecies paratuberculosis infection in cases of irritable bowel syndrome and comparison with Crohn's disease and Johne's disease: common neural and immune pathogenicities. J Clin Microbiol 45:3883–3890 Simmons A (2010) Crohn's disease: Genes, viruses and microbes. Nature 466:699–700 Singh AV, Singh SV, Singh PK, Sohal JS (2010) Is Mycobacterium avium subsp. paratuberculosis, the cause of Johne's disease in animals, a good candidate for Crohn's disease in man? Indian J Gastroenterol 29:53–58 Speer CA, Scott MC, Bannantine JP, Waters WR, Mori Y, Whitlock RH, Eda S (2006) A novel enzyme-linked immunosorbent assay for diagnosis of Mycobacterium avium subsp. paratuberculosis infections (Johne's Disease) in cattle. Clin Vaccine Immunol 13:535–540 Stabel JR (2000) Johne's disease and milk: do consumers need to worry? J Dairy Sci 83:1659–1663 Stabel JR, Lambertz A (2004) Efficacy of pasteurization conditions for the inactivation of Mycobacterium avium subsp. paratuberculosis in milk. J Food Prot 67:2719–2726 Stabel JR, Steadham EM, Bolin CA (1997) Heat inactivation of Mycobacterium paratuberculosis in raw milk: are current pasteurization conditions effective? Appl Environ Microbiol 63:4975–4977 Stabel JR, Palmer MV, Harris B, Plattner B, Hostetter J, Robbe-Austerman S (2009) Pathogenesis of Mycobacterium avium subsp. paratuberculosis in neonatal calves after oral or intraperitoneal experimental infection. Vet Microbiol 136:306–313 te Velde AA, Verstege MI, Hommes DW (2006) Critical appraisal of the current practice in murine TNBS-induced colitis. Inflamm Bowel Dis 12:995–999 Tsianos EV, Katsanos KH, Tsianos VE (2012) Role of genetics in the diagnosis and prognosis of Crohn's disease. World J Gastroenterol 18:105–118 Tuci A, Tonon F, Castellani L, Sartini A, Roda G, Marocchi M, Caponi A, Munarini A, Rosati G, Ugolini G, Fuccio L, Scagliarini M, Bazzoli F, Belluzzi A (2011) Fecal Detection of Mycobacterium avium Paratuberculosis Using the IS900 DNA Sequence in Crohn's Disease and Ulcerative Colitis Patients and Healthy Subjects. Dig Dis Sci 56:2957–2962 Umeno J, Asano K, Matsushita T, Matsumoto T, Kiyohara Y, Iida M, Nakamura Y, Kamatani N, Kubo M (2011) Meta-analysis of published studies identified eight additional common susceptibility loci for Crohn's disease and ulcerative colitis. Inflamm Bowel Dis 17:2407–2415 Van Kruiningen HJ (1999) Lack of support for a common etiology in Johne's disease of animals and Crohn's disease in humans. Inflamm Bowel Dis 5:183–191 Veazey RS, Taylor HW, Horohov DW, Krahenbuhl JL, Oliver JL 3rd, Snider TG 3rd (1995) Histopathology of C57BL/6 mice inoculated orally with Mycobacterium paratuberculosis. J Comp Pathol 113:75–80 Vora P, Shih DQ, McGovern DP, Targan SR (2012) Current concepts on the immunopathogenesis of inflammatory bowel disease. Front Biosci (Elite Ed) 4:1451–1477 Wakefield AJ, Sawyerr AM, Dhillon AP, Pittilo RM, Rowles PM, Lewis AA, Pounder RE (1989) Pathogenesis of Crohn's disease: multifocal gastrointestinal infarction. Lancet 2:1057–1062 Wall S, Kunze ZM, Saboor S, Soufleri I, Seechurn P, Chiodini R, McFadden JJ (1993) Identification of spheroplast-like agents isolated from tissues of patients with Crohn's disease and control tissues by polymerase chain reaction. J Clin Microbiol 31:1241–1245 Watanabe Y, Watari E, Matsunaga I, Hiromatsu K, Dascher CC, Kawashima T, Norose Y, Shimizu K, Takahashi H, Yano I, Sugita M (2006) BCG vaccine elicits both T-cell mediated and humoral immune responses directed against mycobacterial lipid components. Vaccine 24:5700–5707 Wirtz S, Neufert C, Weigmann B, Neurath MF (2007) Chemically induced mouse models of intestinal inflammation. Nat Protoc 2:541–546 doi:10.1186/2193-1801-1-47 Cite this article as: Momotani et al.: Mycobacterium avium subsp. paratuberculosis lipophilic antigen causes Crohn’s disease-type necrotizing colitis in Mice. SpringerPlus 2012 1:47. Submit your manuscript to a journal and benefi t from: 7 Convenient online submission 7 Rigorous peer review 7 Immediate publication on acceptance 7 Open access: articles freely available online 7 High visibility within the fi eld 7 Retaining the copyright to your article Submit your next manuscript at 7 springeropen.com Momotani et al. SpringerPlus 2012, 1:47 Page 10 of 10 http://www.springerplus.com/content/1/1/47

Title: Mycobacterium avium subsp. ​ paratuberculosis lipophilic antigen causes Crohn’s disease-type necrotizing colitis in Mice ​ Authors: Eiichi Momotani, Hiroshi Ozaki, Masatoshi Hori, Shizuo Yamamoto, Takashi Kuribayashi, Shigetoshi Eda, Masahiro Ikegami ​ Publisher: SpringerPlus Date: November 8, 2012 ​ Abstract: Background: A 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced murine colitis model was developed to investigate the pathogenesis and to evaluate a method of treating human Crohn’s disease. ​ This experimental model rapidly induces colitis similar to human Crohn’s disease lesion in a reproducible manner. ​ However, natural exposure of the human digestive tract to TNBS is unrealistic. ​ A novel animal model based on realistic data is eagerly anticipated in future research on pathogenesis of CD. ​ Method: We evaluated the potency of Map antigen molecules in an effort to develop a novel colitis model using a more realistic source than TNBS. ​ We prepared the Map antigen by ethanol extraction and developed a mouse model in a manner similar to that of the well-known TNBS-induced colitis in mice. ​ In the experiment, seven days after subcutaneous (SC) injection of the antigen into normal C57BL/6 mice, the same antigen in 50% ethanol was injected into the colon by the transanal route with a fine cannula. ​ Results: On the fifth day after the transanal injection, histopathological examination revealed full-thickness necrotizing colitis with erosion and ulcers; severe infiltration with neutrophils, lymphocytes, macrophages, and perforation. ​ However, no change was detected with each single Map-antigen injection. ​ Conclusion: The present results provide a novel animal model for research on CD and may be the key to clarifying the relationship between CD and Map. ​ This is the first evidence that mycobacterium antigen induces necrotizing colitis. ​

A secularly varying hemispheric climate-signal propagation previously detected in instrumental and proxy data not detected in CMIP3 data base.pdf

RESEARCH Open Access A secularly varying hemispheric climate-signal propagation previously detected in instrumental and proxy data not detected in CMIP3 data base Marcia Glaze Wyatt1* and John M Peters2 Abstract Results of previous studies support the existence of a spatially coherent, secularly varying climate signal, propagating through a network of synchronized climate indices across the Northern Hemisphere during the 20th century. The signal was identified in both instrumental and proxy data sets. In this present study, we seek to detect this same low-frequency signal propagating hemispherically through networks of model-simulated climate indices. These simulated climate indices were reconstructed from a data set generated by models of the third Coupled Model Intercomparison Project (CMIP3). Methods used in the earlier studies on climate-signal propagation guide the strategy for this companion study, for which 60 network analyses were performed. Most analyses focused on 20th century behavior, several on pre-industrial conditions. None succeeded in reproducing a hemispherically propagating signal. In light of previous results, we offer possible reasons for this finding. Among them is speculation on whether mechanisms relevant to signal propagation might be missing from this suite of general circulation models. Keywords: Climate, Network, Synchronize, CMIP3, Stadium-wave, Signal propagation 1 Introduction Recent work using instrumental data of the 20th century suggests that a spatially coherent, low-frequency climate signal propagates across the Northern Hemisphere (Wyatt et al. 2011). Authors of this 2011 paper analyzed a lagged covariance structure of a network of eight cli- mate indices. Their results detailed the transmission of a multidecadal-scale climate signal propagating through- out the Northern Hemisphere through a sequence of synchronizeda atmospheric and lagged oceanic telecon- nections. The authors termed this signal propagation the ‘stadium wave’ - a term alluding to the behavior often seen in a sports arena, where successive groups of spec- tators stand with arms raised, and then sit, giving the visual impression of a wave passing through the crowd. Subsequent dissertation work by Wyatt ((2012) and sub- mitted manuscript (2013)) probes both spatially expanded data sets of geophysical indices and temporally expanded data sets of proxies (1700 to 2000). Hemispheric signal propagation is found in all sets. All network combinations of twentieth-century data, both proxy and instrumental, reflect consistent results of apparent quasi-periodicity and signal propagation. Prior to 1850, signal propagation is evident; yet time scale of variability in the proxy-index networks differs slightly from the time scale of variability exhibited by the signal seen in all data sets post-1850. This latter observation brings up an important point. The significant finding regarding the ‘stadium-wave’ signal identified in these diverse index sets is its propagating sig- nature. Timescale of its variability can be characterized as low-frequency, but we stop short of claiming periodicity, or even quasi-periodicity. This we cannot statistically as- sess. While all 20th-century data sets - the originally used eight-member instrumental set, the 20th century portion of the proxy set, and the spatially expanded instrumental set - reflect similar secular-scaleb variability centered at ~64 years over this century-scale interval; a one-hundred- year time series is too short a quantity over which to claim identification of a statistically significant multi-decadal- scale periodicity. In addition, proxy data sets, while longer, * Correspondence: [email protected] 1Department of Geologic Sciences, CIRES/INSTAAR, Benson Earth Sciences Building, University of Colorado-Boulder, Boulder, CO 80309, USA Full list of author information is available at the end of the article a SpringerOpen Journal © 2012 Wyatt and Peters; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Wyatt and Peters SpringerPlus 2012, 1:68 http://www.springerplus.com/content/1/1/68 are inherently noisy, thereby adding challenge to statistical significance assessment. These points made, it is hard to ignore the pervasiveness of multidecadal (~50 to 70-year) fluctuations identified in records of diverse, and perhaps indirectly related indices: from numerous and varied climate-related parameters (e.g. Kushnir 1994; Minobe 1997, Minobe 1999; Klyashtorin and Lyubushin 2007; Frolov et al. 2009 and references therein; Nowak et al. 2011; Chambers Don et al. 2012) to similarly cadenced variations in commercial-fish populations (Beamish and Bouillon 1993; Beamish et al. 1997, 1999; Chavez et al. 2003; Klyashtorin 1998; Klyashtorin and Lyubushin 2007; Klyashtorin et al. 2009), cosmogenic nuclide accumulations (Ogurtsov et al. 2002; Patterson et al. 2004), geomagnetic- field intensity (Courtillot et al. 2007, Roberts et al. 2007), Earth’s rotational-rate anomalies (Beamish et al. 1999; Sidorenkov et al. 2005; Sidorenkov 2005, Sidorenkov 2009), and solar-related aurora records of the mid-latitudes (Scafetta 2011). While the authors of the previous stadium-wave studies were unable to assign statistical significance to a quasi-oscillatory nature of the identified signal in observed and proxy data, they were able to quantify the likelihood that a low-frequency signal, characterized by delayed alignment of spatially and dynamically diverse indices, i.e. a hemispherically propagating signal, could be due to mere random chance. That likelihood was found to be less than 5% in observational data sets for the 20th century. Beyond instrumental and proxy data, the last realm of data available to us is model-generated data. We want to know if further support for the stadium-wave signal can be identified by applying our statistical methods to simu- lated indices reconstructed from model-generated raw variables. Section 2 details the methods and data; section 3 pro- vides the results; section 4 offers discussion of results; and 5 presents the conclusion. 2 Approach, data sets, and methods 2.1 Approach The strategy underlying all stadium-wave studies involves evaluating collective behavior within a network of syn- chronized interacting nodes. In the case of climate, these nodes represent climate indices - regional patterns of ocean, atmosphere, or ice dynamics, for examples. View- ing systems as networks is common in many disciplines, from biology to electronics to social sciences. Funda- mental to networks is the observation that behavior of a system does not equal merely a sum of component parts. The difference between the collective behavior of interacting parts versus a collection of behaviors of individual parts can be traced to how those parts (nodes) are linked (coupled). The latter determines communication. Communication is at the core of a net- work’s breadth and stability (e.g. see Pikovsky et al. 2003). This present model-based inquiry is an extension of pre- vious instrumental and proxy work on the ‘stadium-wave’ climate signal. We repeat here the methodology followed in those studies and use those results to guide our inter- pretation of results derived from the model data. 2.2 Data sets Five steps were involved in data preparation. Details follow. 2.2.1 Acquiring the raw model-simulated data Data sets of model-generated raw variables - e.g. sea- surface temperature (SST), sea-level pressure (SLP), sea-surface height (SSH), wind strength and direction, etc. - were obtained from the third Coupled Model Intercomparison Project (CMIP3: Meehl et al. 2007) web site (https://esg.llnl.gov:8443/about/registration.do) - a site comprising a vast collection of data sets generated by atmospheric-oceanic general circulation models used in Intergovernmental Panel on Climate Change (IPCC)- related projects. Acquisition of data from this site is available to all researchers, requiring only registration for its use. Twenty-two models are represented by CMIP3. Doz- ens of experiments have been performed by each model, most with several runs each. Two experiments were of interest to us: 1) 20th-century runs and 2) control runs. Twentieth-century CMIP-model runs generally cover the historical period 1850 to 2000. Such model runs in- corporate observed radiative forcings (greenhouse gases (with CO2 increases of 1% per year), aerosols, volcanic eruptions, etc.) throughout the period, the exact levels and proportions of forcings differing among models (Reichler and Kim 2007). In contrast, control experi- ments, also termed “long controls”, generally cover 500-plus years. Incorporated in the long controls are at- mospheric forcings that are held constant, in particular, that of CO2, which is held at pre-industrial levels of 280 parts per million (ppm). We considered all 22 models participating in the CMIP data base. For most model runs, data are available on daily, monthly, and annual bases. We were interested in monthly records. Data were extracted via varied codes custom-tailored to the format and size of data files. Once downloaded, these data were compiled in variable- specific files for subsequent use. Upon completion of this data-acquisition step, we had successfully extracted data from 21 of 22 models. Information from one model was unavailable. We evaluated at least one 20th- century experiment for each of the 21 models. For several of these, analysis of a second run of the 20th- century experiment was performed. In addition, for six Wyatt and Peters SpringerPlus 2012, 1:68 Page 2 of 25 http://www.springerplus.com/content/1/1/68 impacts of these winds are a function of, among other things, the geographical placement of the polar-high. This placement indirectly scripts regional sea-ice inven- tory, distribution, spatial pattern of ice thickness, and sea-ice export. Kwok examined groups of models. He found the overall CMIP3 simulations of sea-ice dynam- ics and related features to be poor, with some models performing better than others. He suggests the culprit is the significant displacement of the mean high-pressure pattern in the southern Beaufort region. Its modeled position tends to be skewed toward the central Arctic Basin rather than its observed mean position in the southern Beaufort Sea. Misplacement of related large- scale mean features of the circulation pattern follows. Other influences on the Arctic freshwater balance derive from sea-ice extent north of the Bering Strait. This, too, has been linked to non-static geographical placement of the Aleutian Low (Niebauer 1998). And according to (Jun et al. 2008), errors related to sea-ice north of the Bering Strait are common among models: GFDL, GISS, NCAR, and UKMO. Geographical placement of centers-of-action and dy- namics of western-boundary currents are but two identi- fied features that appear to determine whether a regional circulation pattern’s reach remains regional or extends be- yond, via direct or indirect means. These features are examples of small variations begetting disproportionately large results. The classic work on network theory by soci- ologist Mark Granovetter (1973) points to such small links yielding profound consequences. In his seminal work, he describes the crucial role of weak ties in enlarging and sta- bilizing a network. He describes the phenomenon in terms of societal behavior; yet this concept applies to any network. We suggest the “weak-tie” details of inter- connectivity within the climate network may be a neces- sary ingredient for hemispheric signal propagation. It may be that regional patterns are well modeled. But is their connectivity equally well modeled, be that through geo- graphical positioning of oceanic and atmospheric centers- of-action; western-boundary currents, their extensions, and their relationship to overlying jet-stream tracks; or other such “small-scale” features? And finally, along that same vein, (Van den Berge et al. 2011) have considered connectivity among nodes when modeling climate. They invoke the influential work done by (Pecora and Carroll 1990) on non-linear systems, applying principles of synchronized theory to modeling climate. In essence, they have found that with a limited amount of information exchanged, a system’s behavior can be reconstructed. This information ex- change is accomplished by connecting each variable of a model to each variable of two other models. By linking chaotic systems, synchronization of the network of sys- tems follows (Pecora and Carroll 1990). Here, consistent with what we see in stadium-wave dynamics, links be- tween nodes are critical to capturing the full spatio- temporal signature of the climate network. 5 Conclusion Analyses performed on indices reconstructed from data generated by models archived in the CMIP3 database failed to detect a statistically significant stadium-wave climate signal. Results were the same for both 20th-cen- tury experiments and long-control runs of pre-industrial experiments. We cannot offer an explanation for this, only speculation. In previous stadium-wave studies, this signal was identified for the 20th century in a wide variety of geographically and dynamically diverse instrumental and proxy-reconstructed geophysical indices. Ocean- ice-atmospheric coupling is hypothesized as lying at the heart of signal propagation (Wyatt 2012; submitted manuscript (2013). Weak ties in network behavior are critical to network stability and function. Weak ties within the climate net- work appear to include, among other things, geographical positioning of oceanic and atmospheric centers-of-action. These features have been shown to be poorly represented in many models. This may offer insight to a physical mechanism that may be relevant to signal propagation that appears to be missing from this suite of models. Endnotes aSynchronization refers to the matching of rhythms of self-sustained quasi-oscillators (our intrinsically variable climate indices); whereas synchronous is distinct from synchronization. Synchronous means “same timing”. The stadium-wave signal involves a network of synchro- nized climate indices. bOccurring one or fewer times per century. c(NHT, AMO, NAO, NINO3.4, NPO, PDO, and ALPI) dIn the original study, we used M=20, but in addition, M was varied. No changes in outcome resulted; thus we justify use of only M=20 for the window size in this study. eThe majority of other indices in this network had much lower auto-correlation values, suggesting our esti- mated degrees-of-freedom may be on the low side, im- plying the statistical-significance of the stadium-wave signal in observed data may be larger than is stated here. fThe term ‘centers-of-action’ (COA) refers to circula- tion centers. In the atmosphere, the Aleutian Low and Icelandic Low are examples of COAs. In the ocean, the subpolar and subtropical gyres are COAs. Competing interests The authors declare they have no competing interests. Wyatt and Peters SpringerPlus 2012, 1:68 Page 23 of 25 http://www.springerplus.com/content/1/1/68 Authors’ contributions JP wrote Matlab codes for reading and preparing downloaded data. MW carried out the network analyses, collated results, and drafted the paper. All authors read and approved the final manuscript. Acknowledgements We thank Sergey Kravtsov for his tremendous support throughout this project. We also thank Anastasios Tsonis, Peter Molnar, and Roger Pielke, Sr. for their useful feedback, encouragement, and editorial suggestions. Author details 1Department of Geologic Sciences, CIRES/INSTAAR, Benson Earth Sciences Building, University of Colorado-Boulder, Boulder, CO 80309, USA. 2Department of Mathematical Sciences, Atmospheric Sciences Group, University of Wisconsin-Milwaukee, Milwaukee, WI 53201-0413, USA. Received: 20 November 2012 Accepted: 4 December 2012 Published: 15 December 2012 References Allen MR, Robertson AW (1996) Distinguishing modulated oscillations from coloured noise in multivariate datasets. Climate Dynamics 12:775–784 Beamish RJ, Bouillon DR (1993) Pacific salmon production trends in relation to climate. Canadian Journ Fish and Aquat Sci 50:1002–1016 Beamish RJ, Neville CM, Cass AJ (1997) Production of Fraser River sockeye salmon (Oncorhynchus nerka) in relation to decadal-scale changes in the climate and the ocean. Canadian Journ Fish and Aquat Sci 54:543–554 Beamish RJ, Noakes D, McFarlane GA, Klyashtorin L, Ivanov VV, Kurashov V (1999) The regime concept and natural trends in the production of Pacific salmon. Can J Fish Aquat Sci 56:516–526 Broomhead DS, King GP (1986) Extracting qualitative dynamics from experimental data. Physica D 20:217–236 Bretherton CS, Widmann M, Dymnikov VP, Wallace JM, Blade I (1999) The effective number of spatial degrees of freedom of a time-varying field. J Climate 12:1990–2009 Chambers Don P, Merrifield Mark A, Steven NR (2012) Is there a 60-year oscillation in global mean sea level? Geophys Res Lett 39:L18607. doi:10.1029/2012GL052885 Chavez PF, Ryan J, Lluch-Cota SE, Niquen MC (2003) From Anchovies to Sardines and back: multidecadal change in the Pacific Ocean. Science 299:217–221 Courtillot V, Gallet Y, Le Mouel JL, Fluteau F, Genevey A (2007) Are there connections between the Earth’s magnetic field and climate? Earth Planetary Sci Lett 253:328–339 Dima M, Lohmann G (2007) A hemispheric mechanism for the atlantic multidecadal oscillation. J Climate 20:2706–2719. doi:10.1175/JCL14174.1 Dong S, Kelly K (2004) Heat budget in the gulf stream region: the importance of heat storage and advection. J Phys Ocean 34:1214–1231 Elsner JB, Tsonis AA (1996) Singular Spectrum Analysis: A New Tool in Time Series Analysis. Plenum Press, New York, p 177 Enfield DB, Mestas-Nuñez AM, Trimble PJ (2001) The Atlantic multidecadal oscillation and its relation to rainfall and river flows in the continental U S. Geophys Res Lett 28:277–280 Frankignoul C, Sennechael N, Kwon Y, Alexander M (2011) Influence of the meridional shifts of the kuroshio and the oyashio extensions on the atmospheric circulation. J Clim 24:762–777. doi:10.1175/2010 JCLI 3731.1 Frolov IE, Gudkovich AM, Karklin BP, Kvalev EG, Smolyanitsky VM (2009) Climate Change in Eurasian Arctic Shelf Seas. Springer-Praxis Book, p 165. ISBN 978-3-540-85874-4 Georgieva K, Kirov B, Tonev P, Guineva V, Atanasov D (2007) Long-term variations in the correlation between NAO and solar activity: the importance of north– south solar activity asymmetry for atmospheric circulation. Adv Space Res 40:1152–1166. doi:10.1016/j.asr.2007.02.091 Ghil M, Allen MR, Dettinger MD, Ide K, Kondrashov D, Mann ME, Robertson AW, Saunders A, Tian Y, Varadi F, Yiou P (2002) Advanced spectral methods for climatic time series. Rev Geophys 40(1):3. doi:10.1029/2000GR000092, 1–3.41 Granovetter MS (1973) The strength of weak ties. Am J Sociol 78(6):1360–1380 Hurrell JW (1995) Decadal trends in the north Atlantic oscillation: regional temperatures and precipitation. Science 269:676–679 Jones PD, Moberg A (2003) Hemispheric and large-scale surface air temperature variations: an extensive revision and an update to 2001. J Clim 16:206–223. doi:10.1175/1520-0442(2003) Jun M, Knutti R, Nychka DW (2008) Local eigenvalue analysis of CMIP3 climate model errors. Tellus 60A(5):992–1000. doi:10.1111/j.1600-0870.2008.00356.x Kelly K, Dong S (2004) The Relationship of Western Boundary Current Heat Transport and Storage to Midlatitude Ocean–atmosphere Interaction. In: Wang C, Xie S-P, James A (eds) Earth’s Climate: Ocean–atmosphere Interaction. Carton, Geophysical Monograph Series 147. AGU, Washington D. C.. doi:10.1029/147GM19 Kelly K, Small RJ, Samelson RM, Qiu B, Joyce TM, Kwon Y-O, Cronin MF (2010) Western boundary currents and frontal air-sea interaction: gulf stream and kuroshio extension. J Climate 23:5644–5667. doi:10.1175/2010JLCI3346.1 Kerr RA (2000) A north Atlantic climate pacemaker for the centuries. Science 288:1984–1986. doi:10.1126/science.288.5473.1984 Kirov B, Georgieva K (2002) Long-term variations and interrelations of ENSO, NAO, and solar activity. Phys Chem Earth 27:441–448 Klyashtorin LB (1998) Long-term climate change and main commercial fish production in the Atlantic and Pacific. Fish Res 37:115–125 Klyashtorin LB, Lyubushin AA (2007) In: Gary D, Sharp, Center for Climate/Ocean Resources Study, Salinas, CA. USA (eds) Cyclic Climate Changes and Fish Productivity. VNIRO Publishing, Moscow, p 223 Klyashtorin LB, Borisov V, Lyubushin AA (2009) Cyclic changes of climate and major commercial stocks of the Barents Sea. Mar Biol Res 5:4–17 Kushnir Y (1994) Interdecadal variations in north Atlantic sea surface temperature and associated atmospheric conditions. J Climate 7(1):141–157 Kwok R (2011) Observational assessment of Arctic Ocean sea ice motion, export, and thickness in CMIP3 climate simulations. J Geophy Res 116:C00D05. doi:10.1029/2011JC))7004 Kwon YO, Alexander MA, Bond NA, Frankignoul C, Nakamura H, Qiu B, Thompson L (2010) Role of the Gulf Stream and Kuroshio-Oyashio Systems in Large- Scale Atmosphere-Ocean Interaction: A Review. J Climate 23(special collection):3249–3281. doi:10.1175/2010JCL13343.1 Mantua NJ, Hare SR, Zhang Y, Wallace JM, Francis RC (1997) A Pacific interdecadal climate oscillation with impacts on salmon production. Bull Amer Meteor Soc 78:1069–1079 Meehl GA, Covey C, Delworth T, Latif M, McAveney B, Mitchell JFB, Stouffer RJ, Taylor KE (2007) The WCRP CMIP3 multimodel dataset: a new era in climate change research. Bull Amer Meteo Soc 88(9):1383–1394. doi:10.1175/BAMS-88-9-1383 Minobe S (1997) A 50-70-year climatic oscillation over the north Pacific and north America. Geophys Res Lett 24:683–686 Minobe S (1999) Resonance in bidecadal and pentadecadal climate oscillations over the North Pacific: role in climatic regime shifts. Geophys Res Lett 26:855–858 Msadek R, Frankignoul C, Li LZX (2010) Mechanisms of the atmospheric response to north Atlantic multidecadal variability: a model study. Climate Dyn. doi:10.1007/s00382-010-0958-0 Niebauer H (1998) Variability in Bering sea ice cover as affected by a regime shift in the north Pacific in the period 1947–1996. J Geophys Res 103(C12):27717–27737 North GR, Bell TL, Cahalan RF, Moeng FJ (1982) Sampling errors in the estimation of empirical orthogonal functions. Mon Wea Rev 110:669–706 Nowak K, Hoerling M, Rajagopalan B, Zagona E (2011) Colorado River Basin Hydro-Climatic Variability., in press Journ Climate Ogurtsov MG, Nagovitsyn YA, Kocharov GE, Jungner H (2002) Long-period cycles of the Sun’s activity recorded in direct solar data and proxies. Solar Physics 211:371–394 Patterson RT, Prokoph A, Chang A (2004) Late Holocene sedimentary response to solar and cosmic ray activity influenced climate variability in the NE Pacific. Sedimentary Geology 172:6784 Pecora L, Carroll T (1990) Synchronization in chaotic systems. Phys Rev Lett 64:824–824 Pikovsky A, Rosenblum M, Kurths J (2003) Synchronization: A universal concept in nonlinear sciences. Cambridge University Press, p 370, 2001; reprinted 2003. ISBN 0 521 59285 2 Polonsky AB, Basharin DV, Voskresenskaya EN, Worley SJ, Yurovsky AV (2004) Relationship between the north Atlantic Oscillation. Euro-Asian climate anomalies and Pacific variability. Marine Meteorology. Pacific Oceanography 2(1–2):52–66 Preisendorfer RW (1988) Principal component analysis in Meteorology and Oceanography. Elsevier, Amsterdam, 425 pp Rayner NA, Brohan P, Parker DE, Folland CK, Kennedy J, Vanicek M, Ansell T, Tett SFB (2006) Improved analyses of changes and uncertainties in sea-surface temperature measured in situ since the mid-nineteenth century. J Climate 19:446–469. doi:10.1175/JCLI3637.1 Wyatt and Peters SpringerPlus 2012, 1:68 Page 24 of 25 http://www.springerplus.com/content/1/1/68 Reichler T, Kim J (2007) How Well do Coupled Models Simulate Today’s Climate? Bull AMS. doi:10.1175BA<S-89-3-303 Roberts PH, Yu ZJ, Russell CT (2007) On the 60-year signal from the core. Geophys Astrophysical Fluid Dyn 101:11–35 Scafetta N (2011) A shared frequency set between the historical mid-latitude aurora records and the global surface temperature. Jour Atm and Solar- Terrestrial Physics, in press Sidorenkov NS (2005) Physics of the Earth’s rotation instabilities. AstronAstrophysical T 24(5):425–439. doi:10.1080/10556790600593506 Sidorenkov NS, Lutsenko OV, Bryazgin NN (2005) Variation of the mass of the sheet of Antarctica and instability of the Earth’s rotation. Russ Meteorol Hydrol 8:5–13 Sidorenkov NS (2009) The interaction between Earth’s rotation and geophysical processes. WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim, 305 pp Sugimoto S, Hanawa K (2009) Decadal and interdecadal variations of the aleutian low activity and their relation to upper oceanic variations over the north Pacific. J Meteorol Soc Jpn 87(4):601–614. doi:10.2151/jmsj.87.601 Sutton RT, Hodson DLR (2003) Influence of the ocean on north Atlantic climate variability 1871–1999. J Climate 16:3296–3313. doi:10.1175/1520-0442(2003) Trenberth K (1997) The definition of El Niño. BAMS 78(12):2771–2777 Van den Berge LA, Selten FM, Wiegerinck W, Duane GS (2011) A multi-model ensemble method that combines imperfect models through learning. Earth Syst Dyn 2:161–177. doi:10.5194/esd-2-161-2011 Wang L, Chen W, Huang R (2007) Changes in the variability of north Pacific oscillation around 1975/1976 and its relationship with East Asian winter climate. J Geophys Res 112:D11110. doi:10.1029/2006JD008054 Wyatt MG, Kravtsov S, Tsonis AA (2011) Atlantic multidecadal oscillation and northern Hemisphere’s climate variability. Clim Dyn. doi:10.1007/s00382-011-1071-8 Wyatt MG, Curry JA (2013): Dynamics of the propagation of a secularly varying hemispheric climate signal during the 20th century. Climate Dyn, manuscript submitted 2013 Wyatt MG (2012): A Multidecadal Climate Signal Propagating Across the Northern Hemisphere through Indiced of a Synchronized Network. Ph.D. Dissertation. University of Colorado, Boulder, CO, 201 pp. Available from UMI ProQuest. Publication #UMI3527373 Ann Arbor, MI. doi:10.1186/2193-1801-1-68 Cite this article as: Wyatt and Peters: A secularly varying hemispheric climate-signal propagation previously detected in instrumental and proxy data not detected in CMIP3 data base. SpringerPlus 2012 1:68. Submit your manuscript to a journal and benefi t from: 7 Convenient online submission 7 Rigorous peer review 7 Immediate publication on acceptance 7 Open access: articles freely available online 7 High visibility within the fi eld 7 Retaining the copyright to your article Submit your next manuscript at 7 springeropen.com Wyatt and Peters SpringerPlus 2012, 1:68 Page 25 of 25 http://www.springerplus.com/content/1/1/68

Title: A secularly varying hemispheric climate-signal propagation previously detected in instrumental and proxy data not detected in CMIP3 data base ​ Authors: Marcia Glaze Wyatt and John M Peters ​ Publisher: SpringerPlus Date: December 15, 2012 ​ Abstract: Results of previous studies support the existence of a spatially coherent, secularly varying climate signal, propagating through a network of synchronized climate indices across the Northern Hemisphere during the 20th century. ​ The signal was identified in both instrumental and proxy data sets. ​ In this present study, we seek to detect this same low-frequency signal propagating hemispherically through networks of model-simulated climate indices. ​ These simulated climate indices were reconstructed from a data set generated by models of the third Coupled Model Intercomparison Project (CMIP3). ​ Methods used in the earlier studies on climate-signal propagation guide the strategy for this companion study, for which 60 network analyses were performed. ​ Most analyses focused on 20th century behavior, several on pre-industrial conditions. ​ None succeeded in reproducing a hemispherically propagating signal. ​ In light of previous results, we offer possible reasons for this finding. ​ Among them is speculation on whether mechanisms relevant to signal propagation might be missing from this suite of general circulation models. ​ Keywords: Climate, Network, Synchronize, CMIP3, Stadium-wave, Signal propagation ​

RNAi-mediated abrogation of trehalase expression does not affect trehalase activity in sugarcane.pdf

RESEARCH Open Access RNAi-mediated abrogation of trehalase expression does not affect trehalase activity in sugarcane Brian P O’Neill1,2, Matthew P Purnell1,2, Lars K Nielsen1 and Stevens M Brumbley1,2,3* Abstract To engineer trehalose metabolism in sugarcane (Saccharum spp. hybrids) two transgenes were introduced to the genome: trehalose-6-phosphate synthase- phosphatase (TPSP), to increase trehalose biosynthesis and an RNAi transgene specific for trehalase, to abrogate trehalose catabolism. In RNAi-expressing lines trehalase expression was abrogated in many plants however no decrease in trehalase activity was observed. In TPSP lines trehalase activity was significantly higher. No events of co-integration of TPSP and RNAi transgenes were observed. We suggest trehalase activity is essential to mitigate embryonic lethal effects of trehalose metabolism and discuss the implications for engineering trehalose metabolism. Keywords: RNA-interference, Saccharum, Sucrose-derivatives, Sugarcane biofactory, Trehalase, Trehalose Background Trehalose is a two glucose disaccharide and is recognized by the US Food and Drug Administration as a safe food additive. Significant trehalose accumulation may not occur in vivo in angiosperms and other higher plants due to catabolism by trehalase (Glasziou and Gayler 1969). Tre- halose metabolism – particularly its intermediate com- pound trehalose-6-phosphate (T6P) – plays a regulatory role in growth and carbon utilization (Paul et al. 2008; Smeekens et al. 2011) and is associated with abiotic stress tolerance in both native plants (viz. resurrection plants in arid landscapes) and metabolically engineered plants (Fernandez et al. 2010; Lopez-Gomez and Lluch 2012; Wingler 2002). In this study we investigated engineering trehalase activity to increase abiotic stress tolerance in sugarcane. Numerous studies have increased abiotic stress tolerance in plants by over-expression of heterologous trehalose metabolic pathways; predominately trehalose-6-phosphate synthase (TPS, E.C.2.4.1.15) ± trehalose-6-phosphate phosphatase (TPP, E.C.3.1.3.12) from E. coli, yeast or Arabidopsis. Pleiotropic effects resulting in develop- mental abnormalities due to constitutive expression of these genes have been reported in tobacco, potato and tomato (Cortina and Culianez-Macia 2005; Jun et al. 2005; Yeo et al. 2000). T6P may be responsible for these effects because engineering strategies that minimize free T6P concentrations report the absence of negative pleiotropic effects. Heterologous bacterial enzymes that synthesize treha- lose independently of an intermediate have successfully increased abiotic stress tolerance in sugarcane and tobacco without negative pleiotropic effects on growth or development. Similar effects are observed due to tissue specific expression of heterologous TPS (± TPP) in rice and tobacco (Jang et al. 2003; Karim et al. 2007; Lee et al. 2003). Constitutive (i.e. ultimately cytosolic), chloroplast or stress inducible (ABA response) expres- sion of TPSP (a fusion of E. coli TPS and TPP creating a single bi-functional enzyme, trehalose-6-phosphate synthase- phosphatase) in rice also caused no stunting of growth or other phenotypic abnormalities (Garg et al. 2002; Jang et al. 2003). The regulatory effects mediated by the trehalose synthesis pathway are largely unknown. Arabidopsis TPS (AtTps1) null mutants indicate that T6P is required for Arabidopsis embryo development and glycolytic regulation in embryonic * Correspondence: [email protected] 1Australian Institute for Bioengineering and Nanotechnology, The University of Queensland, Brisbane, Queensland 4072, Australia 2BSES Limited, PO Box 86, Indooroopilly, Queensland 4068, Australia Full list of author information is available at the end of the article a SpringerOpen Journal © 2012 O'Neill et al.; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. O’Neill et al. SpringerPlus 2012, 1:74 http://www.springerplus.com/content/1/1/74 (Eastmond et al. 2002; Schluepmann et al. 2003) as well as vegetative tissues (Gomez et al. 2010). Schluepmann et al. (2012) propose a model of the growth regulation of T6P and carbon utilization via inhibition of the sucrose-nonfermentation1-related protein kinase1 (SnRK1) as demonstrated by Zhang et al. (Zhang et al. 2009). In sugarcane varieties engineered to over-produce isomaltulose, increased levels of T6P are associated with higher sucrose content via inhibition of SnRK1 (Wu and Birch 2010). Trehalose metabolism affects starch biosynthesis. Exoge- nous trehalose increases ADP-glucose pyrophosphorylase (AGPase) activity and starch accumulation in the shoots of Arabidopsis (Fritzius et al. 2001; Wingler et al. 2000) and in isolated Arabidopsis plastids (Kolbe et al. 2005; Lunn et al. 2006). Furthermore, trehalose affects expression of the tran- scription factor ABI4 that is known to affects starch meta- bolism (Ramon et al. 2007). Trehalose metabolism may also act as a sugar sensor; T6P concentration is inversely related to sucrose concentration during carbon starvation and treha- lose concentration has been shown to correlate with increa- sing sucrose concentration in sugarcane internodes during maturation (Glassop et al. 2007; Lunn et al. 2006). These data suggest that trehalose metabolism enables light-independent control of starch synthesis in response to sugar status. It may also provide a possible mechanism for how trehalose meta- bolism affects growth and carbon utilization whereas T6P acts as a signaling metabolite between the sucrose concentra- tion in the cytosol and starch synthesis in the chloroplast. In the present study, metabolic engineering of treha- lose metabolism in sugarcane was investigated. To in- crease trehalose biosynthesis TPSP was over-expressed and attempts were made to abrogate trehalase activity using RNA-interference (RNAi). Results obtained sug- gest that trehalose biosynthesis and catabolism are co- ordinated to enable successful embryogenesis and that alternate trehalase activities are present in sugarcane. Overall, this work supports that trehalose metabolism acts as a sugar-sensing and signaling is supported. Results Trehalose metabolism in sugarcane variety Q117 (Saccharum spp. hybrids) was engineered for value adding properties and to enhance abiotic stress tolerance. DNA constructs encoding the trehalose biosynthesis pathway (TPSP) and an RNA silencing vector targeting trehalase (the trehalose catabolic pathway) were introduced into the genomic DNA of embryogenic Q117 callus. Using these constructs, three engineering strategies were envisaged: TPSP and RNAi single transformants and TPSP + RNAi dual-transformants. To assess the metabolic effects of these transgenes, the in- tegration, expression and activity of the enzymes was tested in the transgenic lines. Plants were recovered that harbored either the TPSP or RNAi construct, but not both. The total transgenic population tested was TPSP transformants (n = 26) and RNAi transformants (n = 30). A further 45 NptII positive lines (the selection plasmid) were used as transgenic negative controls for comparison. The soluble carbohy- drate content in both transgenic populations was not significantly different from the negative control popula- tion when comparing sucrose, glucose, fructose or tre- halose (data not shown). Trehalase activity was measured in young leaves of trans- genic lines (Figure 1). Negative control type and RNAi posi- tive lines (51.0 ± 7.3 and 46.9 ± 4.2 μg/hr/g FW, respectively) were not significantly different (P = 0.616) whilst TPSP posi- tive lines (79.3 ± 9.6 μg/hr/g FW) had significantly increased trehalase activity compared to the negative control popula- tion (P = 0.047). Trehalase activity was measured in an extended time course. This assay demonstrated that after 96 hours trehalase activity remained linear (91.5 ± 6 μg/hr/g FW). This result was verified using a porcine trehalase stand- ard curve (0.002 U produced 152.5 μg/hr per assay). The trehalase inhibitor, validamycin A, was sufficient to wholly abrogate porcine trehalase activity however sugarcane trehalase activity was only reduced by 88.0 ± 1.0% (n = 6). To ascertain the effects of the constructs on trehalase ex- pression RT-PCR coupled with Southern blotting was used to identify the presence of the trehalase coding sequence (CDS) or the portion of the transcript encoding the pStarling 50-untranslated region (50-UTR) and the adjacent 50 region of the trehalase CDS (Table 1). Total cDNA was synthesized from DNaseI treated RNA extracted from young leaves. Genomic DNA contamination was ruled out by performing RT-PCR with primers spanning an intron in β-actin that differentiated between genomic and mRNA amplification based upon a 331 bp size difference. The 0 Treatment TPSP RNAi WT B A A Trehalase activity (μg glucose / hr / g FW) 40 80 120 Figure 1 Trehalase activity in young leaves. Boxes represent the middle half of the data where the horizontal line is the median. Whiskers extend along the ‘typical’ range of data values. Probable outliers are represented as open circles. Statistically different populations are denoted with different capital letters (P < 0.05). The population sizes are: WT n = 30, TPSP n = 9 and RNAi n = 26. FW, fresh weight; Hr, hour; WT, wild type. O’Neill et al. SpringerPlus 2012, 1:74 Page 2 of 6 http://www.springerplus.com/content/1/1/74 in the presence of validamycin A. Whilst the difference in inhibition may be attributed to competitive binding of the inhibitor to other targets within the crude enzyme extract, the concentration of inhibitor was effective to completely abrogating porcine trehalase activity with a higher activity than observed in sugarcane leaves thus this concentration should be sufficient to abrogate sugarcane trehalase activity. If contamination is ruled out because so- dium azide was present in extracts, unknown trehalase ac- tivity not inhibited by validamycin A may be responsible for the production of glucose from trehalose as observed in the assay. In assays on tobacco leaves, validamycin A is sufficient to reduce > 99% of trehalase activity (Goddijn et al. 1997). Comparatively, extracts prepared from flowers of Arabidopsis show a 10-fold reduction in trehalase acti- vity in the presence of validamycin A whereas leaf and root extracts are completely inhibited (Muller et al. 2001). In Lotus japonica trehalase activity was reduced by 65% when plants were cultured in the presence of validamycin A (Lopez et al. 2006). These tissue specific trehalase activities suggest that trehalose metabolism is subjected to unknown variations in regulation and expression. If trehalose biosynthesis is embryonic lethal then TPSP over-expressing lines may have been recovered that had elevated trehalose biosynthesis activity that was not high enough to cause lethality. Concurrently, RNAi lines that were recovered may have had reduced trehalase activity that was viable only in the presence of reduced trehalose biosynthesis activity. This suggests that TPS and trehalase activity are co-ordinately regulated. The data presented suggest trehalose metabolism is regulated to enable successful embryogenesis and alter- nate trehalase activities are present in sugarcane, supporting the role of trehalose metabolism in sugar- sensing and signaling pathways. Our data suggest that the transgenes of interest have a molecular phenotype in engineered sugarcane lines although they do not correlate with soluble carbohydrate content or enzyme expression and activity of the genes of interest. Peer studies have demonstrated enhanced abiotic stress tolerance in sugarcane, tomato and rice that did not correlate with these properties (Cortina and Culianez-Macia 2005; Jang et al. 2003; Zhang et al. 2006). Because there is a correlation between sucrose and trehalose content and trehalose is known to effect carbon metabolism, then applications such as high-early sugar varieties may be able to exploit trehalose metabolism in situations where sucrose metabolism is engineered. We conclude that the engineering of trehalose meta- bolism to impart value-adding properties requires stra- tegies to circumvent the embryonic lethal phenotype of increased trehalose metabolism. Secondly, because trehalose biosynthesis and trehalase activity may be co- ordinately regulated and no negative pleiotropic effects were observed, future experiments will be conducted to determine if the RNAi transgene can enhance abiotic stress tolerance in sugarcane. Materials and methods Sugarcane transformation was performed as per Chong et al. (2007). Embryogenic sugarcane callus was co- bombarded with constructs encoding TPSP, trehalase RNAi or TPSP + trehalase RNAi. pSB-TPSP and the RNAi vector, pStarling, were obtained under agreements from Myongji University (Republic of Korea) and the Common- wealth Scientific and Industrial Research Organisation (Canberra, Australia), respectively. The sugarcane CDS was compiled from expressed sequence tag (EST) clones via a BLAST_N search (http://www.ncbi.nlm.nih.gov/) using the putative rice trehalase gene as query (Genbank Accession Number NM_197396). EST CA142592 was obtained from the Institute of Chemistry, University of Sao Paulo (Brazil). A 314 bp region of the trehalase coding sequence was amplified via PCR using the following primers: forward arm, Treh-F, b53+ b60 (50-GGATCCC AGCGGGTGCAGTCGGAG-30 + 50-GGCGCGCCCGC GCCAGTTGCTTCCAC-30) and reverse arm, Treh-R, b55 + b56 50-GGTACCCAGCGGGTGCAGTCGGAG-30 + 50-ACTAGTCGCGCCAGTTGCTTCCAC-30). Each arm was sequentially sub-cloned to yield pStarling-trehalase. Genomic DNA transgene incorporation was confirmed by PCR. Custom oligonucleotide primers were supplied from Sigma-Genosys (Castle Hill, New South Wales, Australia) Total RNA was extracted from young leaf lamina (~50 mg) using the RNeasy Plant Kit (Qiagen, Doncaster, Victoria, Australia), DNaseI treated with RQ1 RNase-Free DNase (Promega, Annandale, New South Wales, Australia) and cDNA synthesized using the Improm-II Reverse Tran- scription System (Promega). Amplification of gene specific products from cDNA used the PCR cycle: initial denatur- ation 95°C 2 mins, denature (95°C), anneal (55°C) and extend (72°C) for 15 seconds each for 72 cycles and final extension 72°C 10 mins). β–actin primers b100 + b101 (50- GGGATGACATGGAGAAAATCTGGC-30 + 50-TGGATG GCTGGAAGAGGACC-30) nested in the CDS spanning an intron were utilized as a positive control. The trehalase CDS was amplified using b53 + b60 and a vector-trehalase specific product amplified with b94 (50-CGGAGCGCACA CACACACAACCAGATCTCC-30) + b60. RT-PCR products were transferred from agarose gels to a Hybond XL membrane (GE Healthcare, Rydalmere, New South Wales, Australia) using a Biorad Model 785 Vacuum Blotter (Biorad, Gladesville, New South Wales, Australia) with 0.4 M NaOH transfer solution. A DIG system was used to detect DNA fragments of interest as O’Neill et al. SpringerPlus 2012, 1:74 Page 4 of 6 http://www.springerplus.com/content/1/1/74 per manufacturer’s instructions (Roche Applied Science, Castle Hill, New South Wales, Australia). The DNA probe - a 154 bp fragment specific to Treh-F (amplified with primers b98 + b99 50-TCCTGTCCCGCTACTTC G-30 + 50-GCCAGTTGCTTCCACAGC-30) - was synthesized using DIG-labeled dNTPs in an otherwise standard PCR of 100 μL final volume. The DIG-labeled probe was gel purified and quantified using a Qubit Fluorometer and DNA Quant-It BR Assay Kit (Invitrogen, Mount Waverly, Victoria, Australia). The hybridization procedure was carried out as per manufactures instruction using a Hybaid oven (Thermo Scientific, Noble Park, Victoria, Australia). The CDP-star la- beled membrane was affixed to the inside of a dark-room cassette and Kodak Biomax MS Film (Kodak, Collingwood, Victoria, New South Wales, Australia) placed on top. All steps involving film were conducted in a dark room under red-light conditions. The membrane and film were incubated in the dark for 1 minute. The film was exposed by washing in Kodak GBX Developer and Replenisher, and Kodak GBX Fixer and Replenisher then rinsed in water prior to air-drying. Crude enzyme extracts were prepared from 1000 mg of leaf tissue as per Chong et al. (2007). Trehalase activity in crude enzyme extracts was measured as the production of glucose from the sole assay substrate, trehalose. Assays were performed in McIlvaine’s buffer (pH 6.2) and 5 mM trehalose at 30°C for 96 hours using dH20 with sodium azide (0.02% w/v) to prevent contamination. The specifi- city and linear range of the reaction were tested via inhib- ition with 1 mM validamycin A (Scientifix, Cheltenham, Victoria, Australia) and in comparison to a porcine trehalase standard (Sigma-Aldrich, Castle Hill, New South Wales, Australia). Glucose production was analyzed using a Shimadzu HPLC system with a refractive index detector using a Shodex Sugar KS-01 S-DVB gel (300 mm × 7.8 mm) Carbohydrate column (Phenomenex, Lane Cove, New South Wales, Australia). Separation was performed via injecting 20 μL of sample and eluting with MilliQ water at 0.9 mL min-1 for 15 minutes at 65°C. The Statistix 8.0 software package (Analytical Software, Tallahassee, Florida, USA) was used to analyze data. Significant differences were deemed to be present when P < 0.05. Data was analyzed using a one-way analysis of variance using the Tukey HSD method. Abbreviations CDS: Coding sequence; EST: Expressed sequence tag; RNAi: RNA-interference; T6P: Trehalose-6-phosphate; TPP: Trehalose-6-phosphate phosphatase; TPS: Trehalose-6-phosphate synthase; TPSP: Trehalose-6-phosphate synthase- phosphatase; UTR: Untranslated region. Competing interests The authors declare that they have no competing interests. Authors’ contributions BPO carried out all experiments and drafted the manuscript; MPP, LKN and SMB supervised experiments and revised the manuscript. All authors read and approved the final manuscript. Acknowledgements The authors acknowledge the analytical chemistry contributions of Niall Masel, Michael Perkins (BSES Limited, Indooroopilly) and Peter Abeydeera (The University of Queensland), and thank Scott Herman (BSES Limited, Indooroopilly) for his discussions on the molecular biology aspects of this paper. This work was funded by an Australian Research Council grant awarded to LKN (grant number LP0210658). Author details 1Australian Institute for Bioengineering and Nanotechnology, The University of Queensland, Brisbane, Queensland 4072, Australia. 2BSES Limited, PO Box 86, Indooroopilly, Queensland 4068, Australia. 3Department of Biological Sciences, University of North Texas, 1155 Union Circle #305220, Denton, TX 76203-5017, USA. Received: 7 September 2012 Accepted: 1 December 2012 Published: 21 December 2012 References Alexander AG (1973) Studies on trehalase in Saccharum spp. leaf and storage tissues. Plant Cell Physiol 14:157–168 Avonce N, Leyman B, Thevelein J, Iturriaga G (2005) Trehalose metabolism and glucose sensing in plants. Biochem Soc Trans 33:276–279 Baud S, Graham IA (2006) A spatiotemporal analysis of enzymatic activities associated with carbon metabolism in wild-type and mutant embryos of Arabidopsis using in situ histochemistry. Plant J 46:155–169 Chong BF, Bonnett GD, Glassop D, O’Shea MG, Brumbley SM (2007) Growth and metabolism in sugarcane are altered by the creation of a new hexose- phosphate sink. Plant Biotech J 5:240–253 Cortina C, Culianez-Macia FA (2005) Tomato abiotic stress enhanced tolerance by trehalose biosynthesis. Plant Sci 169:75–82 Eastmond PJ, van Dijken AJH, Spielman M, Kerr A, Tissier AF, Dickinson HG, Jones JDG, Smeekens SC, Graham IA (2002) Trehalose-6-phosphate synthase 1, which catalyses the first step in trehalose synthesis, is essential for Arabidopsis embryo maturation. Plant J 29:225–235 Fernandez O, Betencourt L, Quero A, Sangwan RS, Clement C (2010) Trehalose and plant stress responses: friend or foe? Trends Plant Sci 15(7):409–417 Fritzius T, Aeschbacher R, Wiemken A, Wingler A (2001) Induction of ApL3 expression by trehalose complements the starch-deficient Arabidopsis mutant adg2-1 lacking ApL1, the large subunit of ADP-glucose pyrophosphorylase. Plant Physiol 126:883–889 Garg AK, Kim JK, Owens TG, Ranwala AP, Do Choi Y, Kochian LV, Wu RJ (2002) Trehalose accumulation in rice plants confers high tolerance levels to different abiotic stresses. Proc Natl Acad Sci USA 99:15898–15903 Glassop D, Roessner U, Bacic A, Bonnett GD (2007) Changes in the sugarcane metabolome with stem development. Are they related to sucrose accumulation? Plant Cell Physiol 48:573–584 Glasziou KT, Gayler KR (1969) Sugar transport - occurrence of trehalase activity in sugar cane. Planta 85:299–302 Goddijn OJM, Verwoerd TC, Voogd E, Krutwagen P, de Graaf P, Poels J, van Dun K, Ponstein AS, Damm B, Pen J (1997) Inhibition of trehalase activity enhances trehalose accumulation in transgenic plants. Plant Physiol 113:181–190 Gomez LD, Gilday A, Feil R, Lunn JE, Graham IA (2010) AtTPS1-mediated trehalose-6-phosphate synthesis is essential for embryogenic and vegetative growth and responsiveness to ABA in germinating seeds and stomatal guard cells. Plant J 64(1):1–13 Jang IC, Oh SJ, Seo JS, Choi WB, Song SI, Kim CH, Kim YS, Seo HS, Do Choi Y, Nahm BH, Kim JK (2003) Expression of a bifunctional fusion of the Escherichia coli genes for trehalose-6-phosphate synthase and trehalose-6-phosphate phosphatase in transgenic rice plants increases trehalose accumulation and abiotic stress tolerance without stunting growth. Plant Physiol 131:516–524 Jun SS, Yang JY, Choi HY, Kim NR, Park MC, Hong YN (2005) Altered physiology in trehalose-producing transgenic tobacco plants: Enhanced tolerance to drought and salinity stresses. J Plant Biol 48:456–466 O’Neill et al. SpringerPlus 2012, 1:74 Page 5 of 6 http://www.springerplus.com/content/1/1/74 Karim S, Aronsson H, Ericson H, Pirhonen M, Leyman B, Welin B, Mantyla E, Palva ET, Van Dijck P, Holmstrom KO (2007) Improved drought tolerance without undesired side effects in transgenic plants producing trehalose. Plant Mol Biol 64:371–386 Kolbe A, Tiessen A, Schluepmann H, Paul M, Ulrich S, Geigenberger P (2005) Trehalose 6-phosphate regulates starch synthesis via posttranslational redox activation of ADP-glucose pyrophosphorylase. Proc Natl Acad Sci USA 102:11118–11123 Lee SB, Kwon HB, Kwon SJ, Park SC, Jeong MJ, Han SE, Byun MO, Daniell H (2003) Accumulation of trehalose within transgenic chloroplasts confers drought tolerance. Mol Breed 11:1–13 Lopez-Gomez M, Lluch C (2012) Trehalose and abiotic stress tolerance. In: Ahmad P, Prasad MNV (eds) Abiotic stress responses in plants: metabolism, productivity and sustainability. Springer, New York Lopez M, Herrera-Cervera JA, Lluch C, Tejera NA (2006) Trehalose metabolism in root nodules of the model legume Lotus japonicus in response to salt stress. Physiol Plant 128:701–709 Lunn JE, Feil R, Hendriks JHM, Gibon Y, Morcuende R, Osuna D, Scheible WR, Carillo P, Hajirezaei MR, Stitt M (2006) Sugar-induced increases in trehalose 6- phosphate are correlated with redox activation of ADP-glucose pyrophosphorylase and higher rates of starch synthesis in Arabidopsis thaliana. Biochem J 397:139–148 Muller J, Aeschbacher RA, Wingler A, Boller T, Wiemken A (2001) Trehalose and trehalase in Arabidopsis. Plant Physiol 125:1086–1093 Paul MJ, Pellny TK (2003) Carbon metabolite feedback regulation of leaf photosynthesis and development. J Exp Bot 54:539–547 Paul MJ, Primavesi LF, Jhurreea D, Zhang Y (2008) Trehalose metabolism and signaling. Ann Rev Plant Biol 59:417–441 Ramon M, Rolland F, Thevelein JM, Van Dijck P, Leyman B (2007) ABI4 mediates the effects of exogenous trehalose on Arabidopsis growth and starch breakdown. Plant Mol Biol 63:195–206 Schluepmann H, Berke L, Sanchez-Perez GF (2012) Metabolism control over growth: a case for trehalose-6-phosphate in plants. J Exp Bot 63:3379–3390 Schluepmann H, Pellny T, van Dijken A, Smeekens S, Paul M (2003) Trehalose 6-phosphate is indispensable for carbohydrate utilization and growth in Arabidopsis thaliana. Proc Natl Acad Sci USA 100:6849–6854 Schluepmann H, van Dijken A, Aghdasi M, Wobbes B, Paul M, Smeekens S (2004) Trehalose mediated growth inhibition of Arabidopsis seedlings is due to trehalose-6-phosphate accumulation. Plant Physiol 135:879–890 Smeekens S, M a J, Rolland F, Hanson J (2011) Sugar signals and molecular networks controlling plant growth. Cur Op Plant Biol 13(3):273–278 van Vaeck C, Wera S, van Dijck P, Thevelein JM (2001) Analysis and modification of trehalose 6-phosphate levels in the yeast Saccharomyces cerevisiae with the use of Bacillus subtilis phosphotrehalase. Biochem J 353:157–162 Wingler A (2002) The function of trehalose biosynthesis in plants. Phytochem 60:437–440 Wingler A, Fritzius T, Wiemken A, Boller T, Aeschbacher RA (2000) Trehalose induces the ADP-glucose pyrophosphorylase gene, ApL3, and starch synthesis in Arabidopsis. Plant Physiol 124:105–114 Wu, Birch RG (2010) Physiological basis for enhanced sucrose accumulation in an engineered sugarcane cell line. Funct Plant Biol 34(6):526–549 Yeo ET, Kwon HB, Han SE, Lee JT, Ryu JC, Byun MO (2000) Genetic engineering of drought resistant potato plants by introduction of the trehalose-6-phosphate synthase (TPS1) gene from Saccharomyces cerevisiae. Mol Cells 10:263–268 Zhang SZ, Yang BP, Feng CL, Chen RK, Luo JP, Cai WW, Liu FH (2006) Expression of the Grifola frondosa trehalose synthase gene and improvement of drought-tolerance in sugarcane (Saccharum officinarum L.). J Integrat Plant Biol 48:453–459 Zhang Y, Primavesi LF, Jhurreea D, Adralojc PJ, Mitchell RA, Powers SJ, Schuluepmann H, Delatte T, Wingler A, Paul MJ (2009) Inhibition of SNF1- related protein kinase1 activity and regulation of metabolic pathways by trehalose-6-phosphate. Plant Physiol 149(4):1860–1871 doi:10.1186/2193-1801-1-74 Cite this article as: O’Neill et al.: RNAi-mediated abrogation of trehalase expression does not affect trehalase activity in sugarcane. SpringerPlus 2012 1:74. Submit your manuscript to a journal and benefi t from: 7 Convenient online submission 7 Rigorous peer review 7 Immediate publication on acceptance 7 Open access: articles freely available online 7 High visibility within the fi eld 7 Retaining the copyright to your article Submit your next manuscript at 7 springeropen.com O’Neill et al. SpringerPlus 2012, 1:74 Page 6 of 6 http://www.springerplus.com/content/1/1/74

Title: RNAi-mediated abrogation of trehalase expression does not affect trehalase activity in sugarcane ​ Authors: Brian P O’Neill, Matthew P Purnell, Lars K Nielsen, Stevens M Brumbley ​ Publisher: SpringerPlus Date: December 21, 2012 ​ Abstract: To engineer trehalose metabolism in sugarcane (Saccharum spp. ​ hybrids) two transgenes were introduced to the genome: trehalose-6-phosphate synthase-phosphatase (TPSP), to increase trehalose biosynthesis and an RNAi transgene specific for trehalase, to abrogate trehalose catabolism. ​ In RNAi-expressing lines trehalase expression was abrogated in many plants however no decrease in trehalase activity was observed. ​ In TPSP lines trehalase activity was significantly higher. ​ No events of co-integration of TPSP and RNAi transgenes were observed. ​ We suggest trehalase activity is essential to mitigate embryonic lethal effects of trehalose metabolism and discuss the implications for engineering trehalose metabolism. ​

Sniper2L is a high-fidelity Cas9 variant with high activity.pdf

Nature Chemical Biology | Volume 19 | August 2023 | 972–980 972 nature chemical biology Article https://doi.org/10.1038/s41589-023-01279-5 Sniper2L is a high-fidelity Cas9 variant with high activity Young-hoon Kim1,2,3,4,20, Nahye Kim2,5,20, Ikenna Okafor6,20, Sungchul Choi2, Seonwoo Min7, Joonsun Lee1, Seung-Min Bae1, Keunwoo Choi1, Janice Choi8, Vinayak Harihar    8, Youngho Kim1, Jin-Soo Kim    9, Benjamin P. Kleinstiver    10,11,12, Jungjoon K. Lee    1  , Taekjip Ha    8,13,14,15  & Hyongbum Henry Kim    2,4,5,16,17,18,19  Although several high-fidelity SpCas9 variants have been reported, it has been observed that this increased specificity is associated with reduced on-target activity, limiting the applications of the high-fidelity variants when efficient genome editing is required. Here, we developed an improved version of Sniper–Cas9, Sniper2L, which represents an exception to this trade-off trend as it showed higher specificity with retained high activity. We evaluated Sniper2L activities at a large number of target sequences and developed DeepSniper, a deep learning model that can predict the activity of Sniper2L. We also confirmed that Sniper2L can induce highly efficient and specific editing at a large number of target sequences when it is delivered as a­ r­ib­onucleoprotein complex. Mechanically, the high specificity of Sniper2L originates from its superior ability to avoid unwinding a target DNA containing even a single mismatch. We envision that Sniper2L will be useful when efficient and specific genome editing is required. Applications of SpCas9-induced genome editing are often restricted due to off-target effects or insufficient on-target editing. Several high-fidelity variants, such as eSpCas9(1.1)1, Cas9–HF12, HypaCas93, Cas9_R63A/Q768A4, evoCas95, HiFi Cas96 and Sniper–Cas9 (referred to in this manuscript as Sniper1)7, have been developed. However, the modifications introduced in these variants to decrease off-target cleav- age also hamper their general on-target cleavage activities, such that a trade-off between the general activity and specificity8 is observed when the variants are tested with a large number of target sequences. A high-fidelity variant that exhibits a general activity level similar to that of SpCas9 would facilitate applications of SpCas9-based genome editing in areas including gene therapy and genetic screening. In this study, we developed Sniper2L, a next-generation high-fidelity variant, using directed evolution of Sniper1. To evaluate Received: 11 May 2022 Accepted: 2 February 2023 Published online: 9 March 2023 Check for updates 1Toolgen, Seoul, Republic of Korea. 2Department of Pharmacology, Yonsei University College of Medicine, Seoul, Republic of Korea. 3Graduate Program of Biomedical Engineering, Yonsei University College of Medicine, Seoul, Republic of Korea. 4Graduate Program of NanoScience and Technology, Yonsei University, Seoul, Republic of Korea. 5Graduate School of Medical Science, Brain Korea 21 Project, Yonsei University College of Medicine, Seoul, Republic of Korea. 6Department of Biology, Johns Hopkins University, Baltimore, MD, USA. 7LG AI Research, Seoul, Republic of Korea. 8Department of Biophysics, Johns Hopkins University, Baltimore, MD, USA. 9Department of Biochemistry and NUS Synthetic Biology for Clinical & Technological Innovation (SynCTI), National University of Singapore, Singapore, Singapore. 10Center for Genomic Medicine, Massachusetts General Hospital, Boston, MA, USA. 11Department of Pathology, Massachusetts General Hospital, Boston, MA, USA. 12Department of Pathology, Harvard Medical School, Boston, MA, USA. 13Department of Biophysics and Biophysical Chemistry, Johns Hopkins University, Baltimore, MD, USA. 14Department of Biomedical Engineering, Johns Hopkins University, Baltimore, MD, USA. 15Howard Hughes Medical Institute, Baltimore, MD, USA. 16Center for Nanomedicine, Institute for Basic Science, Seoul, Republic of Korea. 17Yonsei–Institute for Basic Science Institute, Yonsei University, Seoul, Republic of Korea. 18Severance Biomedical Science Institute, Yonsei University College of Medicine, Seoul, Republic of Korea. 19Institute for Immunology and Immunological Diseases, Yonsei University College of Medicine, Seoul, Republic of Korea. 20These authors contributed equally: Young-hoon Kim, Nahye Kim, Ikenna Okafor.  e-mail: [email protected]; [email protected]; [email protected] Nature Chemical Biology | Volume 19 | August 2023 | 972–980 973 Article https://doi.org/10.1038/s41589-023-01279-5 of on-target indels with many different single-guide RNAs (sgRNAs) compared with Clone-2 and Clone-3, which showed low on-target indel efficiencies with the same sgRNAs. High indel frequencies were observed when these variants were tested with the sgRNA EMX1.3, which was used in the Sniper screen. To distinguish SpCas9 variants with reduced on-target activities, such as Clone-2 and Clone-3, from those with maintained on-target activities, we needed to perform the Sniper screen with an sgRNA that would result in low on-target indel effi- ciencies with Clone-2 and Clone-3 while retaining wild-type (WT)-level indel efficiencies with Clone-1. When we used EMX1.6 sgRNA, which was previously used to determine the specificity of SpCas9 (ref. 9), we found that the on-target activities of Clone-2 and Clone-3 were dra- matically decreased as compared with that of Clone-1 (Supplementary Fig. 2). Thus, we chose EMX1.6 sgRNA for screening in the current study. Because the mismatches in the previous Sniper screen were at positions 5–7 (proximal to the PAM) and positions 17 and 18 (distal to the PAM), we attempted to make a mismatch in the previously untested middle region, which spans positions 8–16. The center of the middle region would include positions 11–13 or 10–14. Among these positions, a previ- ous study showed that the induction of C to U mutations at position 13 of an EMX1.6 sgRNA resulted in the highest relative cleavage efficiency9. In addition, this mismatch induces wobble base pairing, which gener- ally results in high relative activities at mismatched targets (that is, low specificity) by SpCas9 and its variants8. Thus, as the sgRNA and the specificity and activity of Sniper2L at a large number of target sequences, we delivered it together with guide RNA (gRNA) using two different methods: lentiviral expression and electroporation of ribo- nucleoprotein (RNP) complexes, a therapeutically relevant method. Our high-throughput evaluations showed that Sniper2L exhibits higher fidelity than Sniper1 while retaining its general level of activity, similar to that of SpCas9, overcoming the trade-off between activity and speci- ficity regardless of the delivery method. We believe that Sniper2L will facilitate applications of genome editing due to its high general activity and low levels of off-target effects. Results Directed evolution of Sniper1 Previously, we used ‘Sniper screen’ for directed evolution of SpCas9 in Escherichia coli (E. coli)7 (Supplementary Fig. 1). In brief, both posi- tive (SpCas9-mediated cleavage of a plasmid containing a lethal gene (ccdB)) and negative (lack of E. coli-killing cleavage at a mismatched off-target genomic site) selection pressure were applied to SpCas9 mutant libraries, in which the entire SpCas9-encoding sequence con- tained random errors (library complexity, up to 107); a fragment of the human EMX1 gene was used for the matched and mismatched target sequences. The initial Sniper screen resulted in the identification of three SpCas9 variants named Clone-1, Clone-2 and Clone-3 (ref. 7). We selected Clone-1 (that is, Sniper1) because it induced high frequencies a b c P = 0.032 P = 0.014 0 1 2 3 4 Relative indel frequency (normalized to SpCas9) Relative indel frequency (normalized to SpCas9) 2.0 1.5 1.0 0.5 0 SpCas9 Indel frequencies (%) Specificity On target Of target 0 0.4 0.5 0.6 0.7 0.8 20 40 60 Sniper1 SpCas9 Sniper1 E1007A E1007R E1007A E1007R E1007L E1007P E1007S E1007Y SpCas9 Sniper1 E1007A E1007R E1007L E1007P E1007S E1007Y E1007N ZSCAN2 E1007D E1007C E1007Q E1007G E1007H E1007I E1007L E1007K E1007M E1007F E1007P E1007S E1007T E1007W E1007Y E1007V Fig. 1 | Schematics for hit identification using Sniper screen and hit optimization using site saturation mutagenesis. a, Indel frequencies at on- target (blue) and off-target (orange) sequences and specificities determined after transfection of plasmids encoding SpCas9 or Sniper1 variants into HEK293T cells. Sniper1 variants were generated by site saturation mutagenesis at the 1,007th amino acid codon (originally a Glu codon); the resulting amino acids at that position are shown on the x axis. Indel frequencies and specificities are shown on the left and right y axes, respectively. Specificity was calculated as 1 − (indel frequencies at off-target sequences divided by those at on-target sequences). The averages of three replicates are indicated by dark blue and red horizontal lines. The name of the gene in which the target sequence is located is indicated at the top of the graph. The number of independent transfections (n) is n = 3. Statistical significances are shown (no statistical significance (P > 0.05) unless specified in the figure; Kruskal–Wallis test). b,c, Indel frequencies induced by SpCas9 and Sniper1 variants based on plasmid delivery at on-target (b) and off-target (c) sequences in HEK293T cells. The results for each target sequence are shown in Supplementary Fig. 5. The boxes represent the 25th, 50th and 75th percentiles; whiskers show the 10th and 90th percentiles. The number of analyzed target sequences n = 8.

Title: Sniper2L is a high-fidelity Cas9 variant with high activity ​ Authors: Young-hoon Kim, Nahye Kim, Ikenna Okafor, Sungchul Choi, Seonwoo Min, Joonsun Lee, Seung-Min Bae, Keunwoo Choi, Janice Choi, Vinayak Harihar, Youngho Kim, Jin-Soo Kim, Benjamin P. Kleinstiver, Jungjoon K. Lee, Taekjip Ha, Hyongbum Henry Kim ​ Publisher: Nature Chemical Biology Date: 9 March 2023 ​ Abstract: Although several high-fidelity SpCas9 variants have been reported, it has been observed that this increased specificity is associated with reduced on-target activity, limiting the applications of the high-fidelity variants when efficient genome editing is required. ​ Here, we developed an improved version of Sniper–Cas9, Sniper2L, which represents an exception to this trade-off trend as it showed higher specificity with retained high activity. ​ We evaluated Sniper2L activities at a large number of target sequences and developed DeepSniper, a deep learning model that can predict the activity of Sniper2L. ​ We also confirmed that Sniper2L can induce highly efficient and specific editing at a large number of target sequences when it is delivered as a ribonucleoprotein complex. ​ Mechanically, the high specificity of Sniper2L originates from its superior ability to avoid unwinding a target DNA containing even a single mismatch. ​ We envision that Sniper2L will be useful when efficient and specific genome editing is required. ​

A high-density and high-confinement tokamak plasma regime for fusion energy.pdf

Nature  |  Vol 629  |  16 May 2024  |  555 Article A high-density and high-confinement tokamak plasma regime for fusion energy S. Ding1 ✉, A. M. Garofalo1, H. Q. Wang1, D. B. Weisberg1, Z. Y. Li1, X. Jian1, D. Eldon1, B. S. Victor2, A. Marinoni3,4, Q. M. Hu5, I. S. Carvalho1, T. Odstrčil1, L. Wang6, A. W. Hyatt1, T. H. Osborne1, X. Z. Gong6, J. P. Qian6, J. Huang6, J. McClenaghan1, C. T. Holcomb2 & J. M. Hanson7 The tokamak approach, utilizing a toroidal magnetic field configuration to confine a hot plasma, is one of the most promising designs for developing reactors that can exploit nuclear fusion to generate electrical energy1,2. To reach the goal of an economical reactor, most tokamak reactor designs3–10 simultaneously require reaching a plasma line-averaged density above an empirical limit—the so-called Greenwald density11—and attaining an energy confinement quality better than the standard high-confinement mode12,13. However, such an operating regime has never been verified in experiments. In addition, a long-standing challenge in the high- confinement mode has been the compatibility between a high-performance core and avoiding large, transient edge perturbations that can cause very high heat loads on the plasma-facing-components in tokamaks. Here we report the demonstration of stable tokamak plasmas with a line-averaged density approximately 20% above the Greenwald density and an energy confinement quality of approximately 50% better than the standard high-confinement mode, which was realized by taking advantage of the enhanced suppression of turbulent transport granted by high density- gradients in the high-poloidal-beta scenario14,15. Furthermore, our experimental results show an integration of very low edge transient perturbations with the high normalized density and confinement core. The operating regime we report supports some critical requirements in many fusion reactor designs all over the world and opens a potential avenue to an operating point for producing economically attractive fusion energy. Fusion energy is the ultimate energy source for humanity16. A promis- ing approach is a steady-state fusion reactor using magnetic confine- ment in the tokamak configuration17,18. With a deeper understanding of tokamak plasma physics and the development of reactor-relevant technologies, many fusion reactor designs have been proposed3–10. When the ion temperature is above 13 keV (1.5 × 108 K) in D–T fusion reactions, the thermonuclear power density19 Pfus = nfuel 2⟨σv⟩E/4 is pro- portional to the fuel density (nfuel) squared, as the change of normalized reaction rate ⟨σv⟩ with temperature is relatively small. Here, E is the fusion energy released per reaction. Detailed definitions of all vari- ables mentioned in this paper can be found in Extended Data Table 1. Therefore, to achieve attractive fusion goals, most of the recent fusion pilot plant (FPP) designs require very high plasma densities, higher than the empirical edge density limit known as the Greenwald density11 (nGr), in tokamak high-confinement mode (H-mode) plasmas13. The energy confinement quality, represented by the H-factor20 (for example, H98y2), is believed to be the highest leverage parameter for fusion capital cost8. H98y2 is usually required to exceed the standard H-mode level (H98y2 = 1.0) for good fusion economy. FPP designs3–10 simultaneously require 1 ≤ Greenwald fraction (fGr) ≤ 1.3 and 1 ≤ H98y2 ≤ 1.65. However, such a tokamak operating regime is an uncharted area that has never been verified in experiments. The empirical nGr is a density limit for the pedestal density in an H-mode plasma21,22. The pedestal is a narrow region of plasma at the edge with suppressed turbulent transport and a steep pressure gra- dient. When approaching nGr at the pedestal, various unfavourable phenomena can be observed in experiments. These cause a strong decrease of the confinement quality or even a sudden, complete loss of plasma energy (disruption)22. A peaked core density profile is, there- fore, required to achieve a line-averaged density above the pedestal density limit. Possible approaches include relying on the natural peak- ing at low collisionality23 and the potential inward particle pinch24. The previous DIII-D experiment24 can achieve a transient fGr of about 1.4 with D2 gas puffing. A large pinch velocity has been measured. H98y2 in this case is around 1. ASDEX Upgrade experiments took a different approach by using pellet injection to improve the core fuelling. The experimental results show a transient fGr ≈ 1.5 with pellet injection25,26. However, the H98y2 values in those discharges were less than 1. More examples with https://doi.org/10.1038/s41586-024-07313-3 Received: 25 July 2023 Accepted: 14 March 2024 Published online: 24 April 2024 Open access Check for updates 1General Atomics, San Diego, CA, USA. 2Lawrence Livermore National Laboratory, Livermore, CA, USA. 3University of California San Diego, La Jolla, CA, USA. 4Plasma Science and Fusion Center, Massachusetts Institute of Technology, Cambridge, MA, USA. 5Princeton Plasma Physics Laboratory, Princeton University, Princeton, NJ, USA. 6Institute of Plasma Physics, Chinese Academy of Sciences, Hefei, China. 7Department of Applied Mathematics and Applied Physics, Columbia University, New York, NY, USA. ✉e-mail: [email protected] 556  |  Nature  |  Vol 629  |  16 May 2024 Article H98y2 < 1 at high density are well documented22. As no tokamak experi- ment has yet attained a sustained fGr above 1 and H98y2 well above 1 (for example, 1.5) at the same time, experimentally verifying the desired operating regime in FPP designs is a great challenge for the magnetic confinement fusion community. Another challenge with H-mode reactor plasmas is the very high transient heat load produced by quasi-periodic edge magnetohydro- dynamic (MHD) instabilities known as type-I edge-localized-modes (ELMs). Without control, ELMs in a reactor can severely damage plasma-facing-components, for example, the first wall27,28. ELM con- trol is an active research area and various approaches have been pro- posed29–33. However, compatibility among small/no ELM solutions, high density (above nGr) and high confinement quality (H98y2 well above 1, for example, 1.5) has not been demonstrated in experiments. We report a new experimental approach for achieving a line-averaged density above nGr. It exploits an operating regime recently established in the DIII-D tokamak that allows simultaneous fGr > 1.0, H98y2 ≈ 1.5 and small ELMs and could support many existing designs for future reac- tors3–10. The approach elevates the plasma density in the core while keeping the pedestal fraction of the Greenwald density at moderate levels (for example, fGr,ped ≈ 0.7), thus not violating the empirical density limit. It does so by exploiting self-organized internal transport barriers (ITBs) at large minor radius in the high poloidal-beta (βP) scenario15,34–36. More information about the high-βP research can be found in Methods. In experiments, the on-axis fraction of the Greenwald density (fGr,0) can reach up to 1.7, resulting in a line-averaged fGr of 1.3. ITBs in the density and temperature profiles also greatly improve the energy confinement quality (H98y2 up to 1.8), compared to the standard H mode (H98y2 = 1) at the same engineering and operating parameters. Figure 1 shows a plot of the DIII-D database and illustrates the pro- gress made in extending the plasma operating space towards high fGr and high H98y2. The 2019 high-βP experiments with impurity injec- tion15 have simultaneously achieved fGr > 1.0 and H98y2 > 1.0. However, in these experiments, too much impurity injection also increases the radiative energy loss in the plasma core, limiting H98y2 at high density. Of the violet diamonds in Fig. 1, some have H98y2 ≤ 1.2 when fGr ≥ 1.15. However, these results are not good enough for FPP designs. A major improvement in the 2022 DIII-D high-βP experiment used additional D2 gas puffing (Fig. 2) instead of impurity injection. This approach effectively reduces the core radiation and improves H98y2, as shown in Fig. 1 (blue squares). Thus, this paper reports a clear experimental demonstration of an accessible operating point in an existing tokamak that can meet a few of the FPP requirements, including simultaneous fGr > 1 and H98y2 ≈ 1.5. For comparison, other scenarios presented run on DIII-D have not achieved such simultaneous normalized performance (yellow circles). Figure 2 shows detailed data from an example discharge (190904) in 2022. The striking feature in this discharge is the dynamic synergy between energy confinement quality and plasma density. That is, H98y2 increased along with fGr (Fig. 2a) until the ramping down of the heat- ing power (Extended Data Fig. 1e). This is opposite to the common observation of reduced energy confinement quality in higher density H modes22, especially for experiments close to the Greenwald den- sity. The plasma was maintained at fGr > 1.0 and H98y2 > 1.0 for about 2.2 s, which was 2.2 times the current diffusion time (τR) or 24 times the energy confinement time (τE). Thus, the high normalized density and confinement phase was not transient, which is imperative for application in future long-pulse FPPs. A normalized plasma pressure βN ≈ 3.5 and βP ≈ 2.9 was achieved at safety factor q95 ≈ 8.5 (Fig. 2b) with plasma current Ip = 0.73 MA and toroidal magnetic field BT = 1.89 T, and with mixed co- and counter-Ip neutral beam injection (NBI). Note that nGr = 6.7 × 1019 m−3 in this discharge, close to the Greenwald density of the ITER 9 MA steady-state scenario at 7.2 × 1019 m−3. The dedicated D2 gas puffing time trace is shown in vermillion in Fig. 2c. This approach ensures that there is a sufficient source of particles in the plasma, and it pushes the plasma density to a higher level, regardless of the change in the feedback gas (black line in Fig. 2c). Profiles of the temperature and density for electrons, deute- rium (main ion) and carbon (main impurity) are shown in Fig. 2f–i and Extended Data Fig. 2a. The evolution of the on-axis densities for electrons, deuterium and carbon is displayed in Extended Data Fig. 1c. One can see that ITBs developed in all density channels. The increased deuterium density in this experiment suggests the prom- ising application of this scenario in future FPPs, as it can attain a higher fuel density to give a higher fusion power. A related piece of experimental evidence is shown in Extended Data Fig. 1d. It is clear that with increased plasma density and energy confinement, the neu- tron rate, an indicator of fusion performance, increased substantially (67% higher, from 0.6 × 1015 to 1.0 × 1015 s−1) from 2 to 4.8 s, whereas the injected power (blue line in Extended Data Fig. 1e) was almost constant. Moreover, a very mild increase of the radiated power was observed in the very-high-density phase of the experiment (Extended Data Fig. 1e). The core radiated power as a fraction of the injected power increased from 10% to 20% as fGr increased from 0.7 to 1.1. The edge radiation remained about 25% of the injected power. Note that for either Bremsstrahlung radiation or impurity line emission, the radiated power was roughly proportional to the electron den- sity squared. Therefore, some increase in the radiated power was expected even with the same impurity level, when the plasma density was increased significantly. Regarding the impurity behaviour, one can see a well-developed ITB at large radius in the carbon density profiles (Fig. 2i). Despite the ITB at large radius, the carbon density inside the ITB did not have a significant central peak, which would usually cause a large amount of core radiation and a reduction of core performance. The ratio between carbon density and electron density stayed around 4–5% during the evolution (Extended Data Fig. 2b). This is consistent with the well-controlled radiated power in the phase with fGr > 1.0. Attractive FPP designs DIII-D data; 3,600+ discharges 0 0.5 1.0 1.5 2.0 2.5 0 0.5 1.0 1.5 fGr 2019–2022 non-high-EP experiments 2022 high-EP experiments without impurity injection 2019 high-EP experiments with impurity injection H98y2 Fig. 1 | Database of H98y2 and fGr for DIII-D discharges. More than 3,600 discharges are included. Violet diamonds show high-βP experiments performed in 2019 with impurity injection. Blue squares are the new high-βP experiments performed in 2022 without impurity injection. Yellow circles represent all other experiments performed in 2019–2022. The area shaded in orange indicates the parameter space for attractive FPP designs. Vertical and horizontal dashed lines show fGr = 1.0 and H98y2 = 1.0, respectively. Article 0 2 4 6 DIII-D # 190904 nD (1019 m-3) a 0 2 4 6 8 10 0.00 0.04 0.06 0.02 nC/ne b Safety factor c 0.0 0.2 0.4 0.6 0.8 1.0  Extended Data Fig. 2 | Additional profiles for DIII-D # 190904. Deuterium density profiles in (a), ratio between carbon density and electron density in (b) and safety factor profiles (q-profiles) in (c). Different color indicates the time slice shown in Fig. 2a. Additionally, profiles for a pre-ITB time slice (1.89 s) shown in gray dashed line are added. Extended Data Fig. 3 | Spatial and temporal evolution of electron temperature at the divertor plates, measured by Langmuir probes. ψN is normalized poloidal flux. ψN < 1.0 locates within the private flux region. Color coding shows the measured Te,div. Dashed lines indicate the actual positions of Langmuir probes. Article Extended Data Table 1 | Terminology

Title: A high-density and high-confinement tokamak plasma regime for fusion energy ​ Authors: S. Ding, A. M. Garofalo, H. Q. Wang, D. B. Weisberg, Z. Y. Li, X. Jian, D. Eldon, B. ​ S. Victor, A. Marinoni, Q. M. Hu, I. S. Carvalho, T. Odstrčil, L. Wang, A. W. Hyatt, T. H. Osborne, X. ​ Z. Gong, J. P. Qian, J. Huang, J. McClenaghan, C. T. Holcomb, J. M. Hanson ​ Publisher: Nature Date: 2024-04-24 00:00:00 Abstract: The tokamak approach, utilizing a toroidal magnetic field configuration to confine a hot plasma, is one of the most promising designs for developing reactors that can exploit nuclear fusion to generate electrical energy. ​ To reach the goal of an economical reactor, most tokamak reactor designs simultaneously require reaching a plasma line-averaged density above an empirical limit—the so-called Greenwald density—and attaining an energy confinement quality better than the standard high-confinement mode. ​ However, such an operating regime has never been verified in experiments. ​ In addition, a long-standing challenge in the high-confinement mode has been the compatibility between a high-performance core and avoiding large, transient edge perturbations that can cause very high heat loads on the plasma-facing components in tokamaks. ​ Here we report the demonstration of stable tokamak plasmas with a line-averaged density approximately 20% above the Greenwald density and an energy confinement quality of approximately 50% better than the standard high-confinement mode, which was realized by taking advantage of the enhanced suppression of turbulent transport granted by high density gradients in the high-poloidal-beta scenario. ​ Furthermore, our experimental results show an integration of very low edge transient perturbations with the high normalized density and confinement core. ​ The operating regime we report supports some critical requirements in many fusion reactor designs all over the world and opens a potential avenue to an operating point for producing economically attractive fusion energy. ​


Observations of high-order multiplicity in a high-mass stellar protocluster.pdf

Nature Astronomy | Volume 8 | April 2024 | 472–481 472 nature astronomy Article https://doi.org/10.1038/s41550-023-02181-9 Observations of high-order multiplicity in a high-mass stellar protocluster Shanghuo Li    1  , Patricio Sanhueza2,3, Henrik Beuther    1, Huei-Ru Vivien Chen    4, Rolf Kuiper    5, Fernando A. Olguin    4, Ralph E. Pudritz    6, Ian W. Stephens    7, Qizhou Zhang    8, Fumitaka Nakamura    2,3, Xing Lu    9, Rajika L. Kuruwita10, Takeshi Sakai    11, Thomas Henning    1, Kotomi Taniguchi    2 & Fei Li12 The dominant mechanism forming multiple stellar systems in the high-mass regime (M* ≳ 8 M⊙) remained unknown because direct imaging of multiple protostellar systems at early phases of high-mass star formation is very challenging. High-mass stars are expected to form in clustered environments containing binaries and higher-order multiplicity systems. So far only a few high-mass protobinary systems, and no definitive higher-order multiples, have been detected. Here we report the discovery of one quintuple, one quadruple, one triple and four binary protostellar systems simultaneously forming in a single high-mass protocluster, G333.23–0.06, using Atacama Large Millimeter/submillimeter Array high-resolution observations. We present a new example of a group of gravitationally bound binary and higher-order multiples during their early formation phases in a protocluster. This provides the clearest direct measurement of the initial configuration of primordial high-order multiple systems, with implications for the in situ multiplicity and its origin. We find that the binary and higher-order multiple systems, and their parent cores, show no obvious sign of disk-like kinematic structure. We conclude that the observed fragmentation into binary and higher-order multiple systems can be explained by core fragmentation, indicating its crucial role in establishing the multiplicity during high-mass star cluster formation. High-mass stars in the Milky Way are overwhelmingly (>80%; refs. 1–6) found in binaries or higher-order multiplicity systems that play a key role in governing cluster dynamics and stellar evolution7,8. However, it is yet unclear whether they are predominantly formed from in situ fragmentation at various scales (for example, disks9,10, cores11,12 or filaments13) or subsequent stellar capture in clusters14 because direct measurements of their initial configuration and properties at the early phases of cluster formation have been unattainable15–27. Received: 20 October 2023 Accepted: 11 December 2023 Published online: 15 January 2024 Check for updates 1Max Planck Institute for Astronomy, Heidelberg, Germany. 2National Astronomical Observatory of Japan, National Institutes of Natural Sciences, Tokyo, Japan. 3Department of Astronomical Science, School of Physical Science, SOKENDAI (The Graduate University for Advanced Studies), Tokyo, Japan. 4Institute of Astronomy and Department of Physics, National Tsing Hua University, Hsinchu, Taiwan. 5Faculty of Physics, University of Duisburg-Essen, Duisburg, Germany. 6Origins Institute and Department of Physics and Astronomy, McMaster University, Hamilton, Ontario, Canada. 7Department of Earth, Environment, and Physics, Worcester State University, Worcester, MA, USA. 8Center for Astrophysics, Harvard & Smithsonian, Cambridge, MA, USA. 9Shanghai Astronomical Observatory, Chinese Academy of Sciences, Shanghai, P.R. China. 10Heidelberg Institute for Theoretical Studies, Heidelberg, Germany. 11Graduate School of Informatics and Engineering, The University of Electro-Communications, Tokyo, Japan. 12School of Astronomy and Space Science, Nanjing University, Nanjing, P.R. China.  e-mail: [email protected] Nature Astronomy | Volume 8 | April 2024 | 472–481 473 Article https://doi.org/10.1038/s41550-023-02181-9 the simulation of multiple star formation via core fragmentation29. The ambient gas masses (Mamb) of these multiple systems range from 0.19 to 1.47 M⊙ on the basis of the thermal dust emission (Methods). These masses are regarded as lower limits because the observations suffered from missing flux in the interferometer data. We focus primar- ily on the multiple systems that are embedded in a single dense core (typical radius of ∼2,100 AU; Fig. 1). The quintuple system consists of a small group of condensations (C1–C4–C5–C16), which is tightly con- nected as seen in dust continuum emission, and a condensation (C3) slightly separated. That is nevertheless part of the original parental core (Fig. 1). The quadruple system includes two binary configurations (C10–C14 and C8–C17), and the triple system composes three slightly separated condensations (C6, C12 and C26). The binary systems are C11–C29, C22–C38, C39–C42 and C35–C40. We report the direct imaging of one quintuple, one quadruple, one triple and four binary systems in the high-mass protocluster G333.23– 0.06 (hereafter G333) using Atacama Large Millimeter/submillim- eter Array (ALMA) long-baseline observations (Fig. 1 and Extended Data Fig. 1). These binary and higher-order systems are detected in the high-resolution (angular resolution of θ ≈ 0.05″, equivalent to 260 AU at the source distance of 5.2 kpc; ref. 28) 1.3 mm dust continuum image. The detected condensations have radii between 153 and 678 AU (Table 1). We refer to both binary and higher-order systems simply as multiple systems in what follows, and we only make an explicit distinc- tion between the two when necessary. The projected separations of these multiple systems are between 327 and 1,406 AU, with a mean value of 731 AU (Extended Data Fig. 2), in good agreement with the typical projected separation of 700 AU in 6 5 4 3 2 1 dec. (ICRS) Continuum flux density (mJy per beam) 12’’ 16’’ 20’’ 51.8 s 51.6 s 51.4 s 51.2 s RA (ICRS) 51.0 s 50.8 s 16 h 19 m 50.6 s X condensation ALMA (high-resolution) ALMA (high-resolution) ALMA (low-resolution) ALMA (high-resolution) ALMA (high-resolution) ATCA 8000 AU 260 AU 260 AU 1500 AU 260 AU 260 AU 260 AU ALMA (high-resolution) C22 C38 C39 C42 C35 C40 0 dense core + Class II CH3OH b a c d e f g no. 1 no. 15 no. 17 no. 3 no. 2 no. 7 no. 30 no. 1 no. 17 no. 2 no. 3 no. 15 no. 30 no. 7 –50°15’06’’ –50°15’04’’ 7 08’’ 0.014 0.012 Continuum flux density (Jy per beam) Continuum flux density (mJy per beam) 1 2 3 4 5 6 7 0.010 0.008 0.006 0.004 0.002 09’’ 12’’ 15’’ 18’’ 52 s 16 h 19 m 51 s no. 21 C26 C12 C6 C17 C10 C29 C13 C15 C11 C16 C5 C4 C1 C3 C8 C14 C9 no. 27 no. 28 no. 23 no. 22 no. 16 no. 19 no. 25 no. 18 no. 6 no. 4 no. 13 no. 12 no. 11 no. 9 no. 8 no. 14 no. 20 no. 29 no. 5 Fig. 1 | Continuum images of ATCA (3.3 mm), ALMA low-resolution (1.3 mm) and ALMA high-resolution (1.3 mm) observations. a, ATCA 3.3 mm continuum image (θ ≈ 2.42″). The contour levels are [5, 8, 11, 14, 17, 20, 23, 26, 29] × σ, where root mean squared (rms) noise of continuum image is σ = 0.6 mJy per beam. b, ALMA low-resolution (θ ≈ 0.32″) 1.3 mm continuum image. The contour is the 7σ, where σ = 0.16 mJy per beam. The ellipses show the identified cores based on the low-resolution continuum image. The red pluses are the Class II CH3OH maser42. c–g, ALMA high-resolution (θ ≈ 0.05″) 1.3 mm continuum image for multiple systems. The green crosses present the identified condensations based on the ALMA high-resolution continuum image. The contour is the 7σ, where σ = 0.05 mJy per beam. The dense cores (no. 1, no. 2, no. 3, …) and condensations (C1, C2, C3, …) are numbered in order of descending integrated intensity. c, Dense core no. 2 fragments into quadruple condensation system (C8, C10, C14, C17) and dense core no. 3 fragments into triple condensation system (C6, C12, C26). d, Dense core no. 1 fragments into quintuple condensation system (C1, C3, C4, C5, C16) and dense core no. 7 fragments into binary condensation system (C11, C29). e, Dense core no. 17 fragments into binary condensation (C22, C38). f, Dense core no. 30 fragments into binary condensation (C39, C42). g, Dense core no. 15 fragments into binary condensation (C35, C40). The white ellipses in the lower left corner of each panel denote the synthesized beam of continuum images. ICRS, International Celestial Reference System. Nature Astronomy Article https://doi.org/10.1038/s41550-023-02181-9 Extended Data Fig. 6 | Intensity-weighted velocity maps derived from the high-resolution data toward multiple systems. a–c, Intensity-weighted velocity maps of CH3CN 124 − 114 (a), 13CH3CN 133 - 123 (b), and CH3OCHO 200,20 − 190,19 (c) for the quadruple system. d-e, Intensity-weighted velocity maps of CH3OH 42,2 − 31,2 (d) and SO 5, 6 − 4, 5 (e) for the triple and the binary systems, respectively. The black and magenta ellipses show the condensations and their parent cores, respectively. The red plusses marks the Class II CH3OH maser positions. The grey contours show the velocity-integrated intensity maps with levels of [5, 10, 15, 20, 30] × σrms, where the σrms is 9 mJy beam−1 km s−1 for a–c and 6 mJy beam−1 km s−1 for d–e. The black ellipses in the lower left corner of each panel denote the synthesized beam of lines images. Nature Astronomy Article https://doi.org/10.1038/s41550-023-02181-9 Extended Data Fig. 7 | Intensity-weighted velocity maps of CH3CN 124 − 114 for two velocity ranges of [-98, -91] km s−1 and [-90, -84] km s−1. The black and magenta ellipses show the condensations and their parent cores, respectively. The red plusses marks the Class II CH3OH maser positions. The grey contours show the velocity-integrated intensity maps with levels of [5, 10, 15, 20, 30] × σrms, where the σrms is 6 mJy beam−1 km s−1. The black ellipses in the lower left corner of each panel denote the synthesized beam of lines images. Nature Astronomy Article https://doi.org/10.1038/s41550-023-02181-9 Extended Data Fig. 8 | Molecular outflows seen in SiO emission in the ALMA low-resolution data. SiO redshifted and blueshifted contours overlaid on the ALMA low-resolution 1.3 mm continuum. The green and magenta arrows present the blueshifted and redshifted directions of the SiO outflow. The cyan ellipses show the dense cores. In panel a, the SiO emission shows a prominent blueshifted, a clear redshifted, and a weak redshifted component from dense core #1. In panel b, the SiO emission reveals complicated outflow spatial morphologies toward dense cores #2 and #3. Dense core #3 drives two blueshifted outflows. Dense core #2 drives at least two blueshifted and two redshifted outflows. Contours levels start at 3 σrms and increase in step of 1.5 σrms interval, where σrms is 0.023 Jy beam−1 km s−1. The synthesized beam size of 1.3 mm continuum image present in the lower left corner. The detected misaligned outflows further suggest that the quintuple, quadruple, and triple systems are formed from core fragmentation54.

Title: Observations of high-order multiplicity in a high-mass stellar protocluster ​ Authors: Shanghuo Li, Patricio Sanhueza, Henrik Beuther, Huei-Ru Vivien Chen, Rolf Kuiper, Fernando A. Olguin, Ralph E. Pudritz, Ian W. Stephens, Qizhou Zhang, Fumitaka Nakamura, Xing Lu, Rajika L. Kuruwita, Takeshi Sakai, Thomas Henning, Kotomi Taniguchi, Fei Li ​ Publisher: Nature Astronomy Date: 2024-01-15 00:00:00 Abstract: The dominant mechanism forming multiple stellar systems in the high-mass regime (M* ≳ 8 M⊙) remained unknown because direct imaging of multiple protostellar systems at early phases of high-mass star formation is very challenging. ​ High-mass stars are expected to form in clustered environments containing binaries and higher-order multiplicity systems. ​ So far only a few high-mass protobinary systems, and no definitive higher-order multiples, have been detected. ​ Here we report the discovery of one quintuple, one quadruple, one triple and four binary protostellar systems simultaneously forming in a single high-mass protocluster, G333.23–0.06, using Atacama Large Millimeter/submillimeter Array high-resolution observations. ​ We present a new example of a group of gravitationally bound binary and higher-order multiples during their early formation phases in a protocluster. ​ This provides the clearest direct measurement of the initial configuration of primordial high-order multiple systems, with implications for the in situ multiplicity and its origin. ​ We find that the binary and higher-order multiple systems, and their parent cores, show no obvious sign of disk-like kinematic structure. ​ We conclude that the observed fragmentation into binary and higher-order multiple systems can be explained by core fragmentation, indicating its crucial role in establishing the multiplicity during high-mass star cluster formation. 


Molecular docking studies of quercetin and its analogues against human inducible nitric oxide synthase (1).pdf

RESEARCH Open Access Molecular docking studies of quercetin and its analogues against human inducible nitric oxide synthase Salam Pradeep Singh* and Bolin Kumar Konwar Abstract Nitric oxide synthases (NOS) catalyze to produce nitric oxide (NO) from L-arginine. The isoform of NOS i.e. inducible nitric oxide synthases (iNOS) expression is observed in various human malignant tumors such as breast, lung, prostate and bladder, colorectal cancer, and malignant melanoma. Also an increased level of iNOS expression and activity has been found in the tumor cells of gynecological malignancies, stroma of breast cancer and tumor cells of head and neck cancer. Because of its importance in causing tumors and cancer, iNOS enzyme has become a new target in finding novel inhibitors as anti cancer agents. The present work focuses on the molecular docking analysis of quercetin and its analogues against iNOS enzyme. Earlier there are reports of quercetin inhibiting iNOS enzyme in certain experiments as anti cancer agent. But the clinical use of quercetin is limited by its low oral bioavailability and therefore needed its molecular modification to improve its pharmacological properties. In the present study ten analogues of quercetin were found to be docked at the active site cavity with favorable ligand-protein molecular interaction and interestingly from the ADME-Toxicity analysis these analogues have enhanced pharmacological properties than quercetin. Keywords: Inducible iNOS, Molecular docking, Molecular modification, Cancer, Analogues Background Nitric oxide synthases (NOS) (EC 1.14.13.39) are a family of enzymes that catalyze producing nitric oxide (NO) from L-arginine. It is an important cellular signaling molecule, having a role in various cellular processes. The free radical (NO) is an important effector molecule in the nervous, immune and cardio vascular systems (Garthwaite and Boulton 1995; MacMicking et al. 1997; Michel and Feron, 1997). Mammals contain three isoforms of NOS that pro- duce NO and citrulline by catalyzing NADPH and O2 dependent oxidation of L-arginine (Griffith and Stuehr 1995; Marletta et al. 1997). Two isoforms of NOS are expressed in cells such as neurons (nNOS) and endothe- lium (eNOS) which are activated by Ca+2 dependent cal- modulin (CaM) binding and the third inducible isoform (iNOS) is induced by cytokines which binds CaM inde- pendently (Ghosh et al., 1999). The iNOS isoform is a homodimer (Michal 1999) and the iNOS gene is located on chromosome 17 (Xu et al. 1994). iNOS exerts its func- tions independent of Ca+2 while calmodulin remains non- covalently bound to the iNOS complex and forms an essential subunit of the isoform (Knowles and Moncada 1994, Cho et al. 1992). Regulating NO production via iNOS necessarily occurs during transcription and transla- tion, for once active, iNOS synthesizes large amounts of NO until substrate depletion (Hickey et al. 2001). The role of NO affects the expression and activity of oncogenes, which are vital to the cell cycle and apoptosis (Forrester et al. 1996; Messmer et al. 1994; Sandau et al. 1997). For- rester et al. observed an up regulation of the tumor sup- pressor gene p53 after the exposure of cells to NO donors which might be a reaction due to NO mediated DNA damage (Forrester et al. 1996). Also, the p53 gene is an important inhibitor for iNOS expression as it regulates NO production by a negative feedback loop mechanism. The non-mutant p53 protein (wild-type form) binds to a site on the iNOS gene, preventing its transcription (Brennan and Moncada 2002). Thus, suggesting the wild- type p53 is vital for the control of NO mediated * Correspondence: [email protected] Department of Molecular Biology and Biotechnology, Tezpur University, Tezpur, 784028, Assam, India a SpringerOpen Journal © 2012 Singh and Konwar; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Singh and Konwar SpringerPlus 2012, 1:69 http://www.springerplus.com/content/1/1/69 genotoxicity (Forrester et al., 1996). Certain experiments with mutant p53 animal tumors have found out there is an increase in NOS activity in such cancers which grew faster with greater angiogenic potential. Thus, promoting cancer progression by providing a selective growth advan- tage to tumor cells (Ambs et al. 1998a). NO could also be shown to activate p53 resulting in anti-carcinogenic effects, mutagenic and increase cancer risk (Goodman et al. 2004, Rao 2004). The multifactorial process involved in carcinogenesis requires mutations in somatic cells and subsequent alterations of morphology and growth pattern, eventually resulting in transformation, local invasion, and metastasis (Lirk et al. 2002). The expression of iNOS can be observed in a various human malignant tumors such as breast (Vakkala et al. 2000), lung (Marrogi et al. 2000), prostate (Aaltoma et al. 2001; Aaltomaa et al. 2000; Uotila et al., 2001) and bladder (Swana et al. 1999; Hayashi et al. 2001), colorectal cancer (Kojima et al. 1999), and malig- nant melanoma (Massi et al. 2001). However, there are many conflicting reports that increased levels of iNOS are not a ubiquitous finding in human cancer and its expres- sion depends on the histological type or grade of the tumor and the tumor stage (Crowell et al. 2003; Kinaci et al. 2012). Various studies have also found out the expression and the activity of iNOS in human cancer (Weiming et al. 2002; James et al. 2003). An increased level of iNOS expression and activity has been found in the tumor cells of gynecological malignancies, (Thomsen et al., 1994) in the stroma of breast cancer, (Thomsen et al. 1995) and in the tumor cells of head and neck cancer (Gallo et al. 1998; Franchi et al. 2002). Several studies have reported an increase of iNOS expression in tumor tissue when compared with normal mucosa (Ambs et al. 1998b; Ambs et al. 1999; Ropponen et al. 2000; Yagihashi et al. 2000; Kojima et al. 1999; Hao et al. 2001). The present work aims on molecular docking analysis of iNOS enzyme against a class of flavonoid (quercetin and its analogues) which is present in fruits, vegetables, leaves and grains and is reported to have effective anti-cancer property. Scientists have long considered quercetin and flavonoids present in fruits, vegetables, leaves and grains important in cancer prevention. There are also reports of lower risk of cancer in people who eat more fruits and vegetables. (Verschoyle et al. 2007; Rietjens et al. 2005; van der Woude et al. 2005; Chen et al. 2001). Interestingly, quercetin inhibiting against iNOS as anti cancer agents has been reported by García-Mediavilla et al. and Raso et al. (García-Mediavilla et al. 2007; Raso et al. 2001). But the clinical use of quercetin is limited by its low oral bio- availability (Peng et al. 2008) and therefore compels its molecular modification to enhance its pharmacological properties. In the present study the best docking hit analo- gues were undergo ADME–Toxicity prediction (absorp- tion, distribution, metabolism, and toxicity) to evaluate its pharmacological properties to be an orally active com- pound. Here in the present work, we are reporting for the first time the analogues of quercetin as iNOS inhibitors with enhanced pharmacological properties. Results and discussion Molecular docking analysis Quercetin (3,3’,4’,5,7-pentahydroxylflavone) is a plant derived flavonoid which is present in the plant kingdom as a secondary metabolite. It is the most well defined group of polyphenolic compounds (Murakami et al., 2008). The flavonoids contain a basic skeleton of Table 1 Docking score of the top docking hits and quercetin SN Ligand MolDocka Rerankb Interactionc Internald HBonde LE1f LE3g 1 5281604 −129.14 −104.75 −148.27 19.14 −11.81 −5.61 −4.55 2 5315126 −122.90 −102.63 −146.11 23.21 −15.38 −4.55 −3.80 3 9818879 −133.99 −95.04 −150.44 16.46 −9.33 −5.58 −3.96 4 5481966 −122.87 −93.67 −141.73 18.86 −2.43 −4.55 −3.47 5 5282154 −116.71 −93.58 −135.98 19.27 −14.02 −4.86 −3.90 6 13964550 −113.94 −93.40 −130.62 16.68 −4.56 −5.18 −4.25 7 5281691 −124.63 −92.63 −144.57 19.94 −7.95 −5.42 −4.03 8 11834044 −116.92 −91.50 −140.67 23.75 −13.46 −5.08 −3.98 9 6477685 −130.50 −91.09 −144.13 13.63 −4.18 −5.67 −3.96 10 Quercetin −77.29 −65.79 −97.17 19.88 −8.42 −3.51 −2.99 a - Moldock score is derived from the PLP scoring functions with a new hydrogen bonding term and new charge schemes. (Thomsen and Christensen 2006). b - The rerank score is a linear combination of E-inter (steric, Van der Waals, hydrogen bonding, electrostatic) between the ligand and the protein, and E-intra. (torsion, sp2-sp2, hydrogen bonding, Van der Waals, electrostatic) of the ligand weighted by pre-defined coefficients. (Thomsen and Christensen 2006). c - The total interaction energy between the pose and the protein (kJ mol−1). d - The internal energy of the pose. e - Hydrogen bonding energy (kJ mol−1). f - Ligand Efficiency 1: MolDock Score divided by Heavy Atoms count. g - Ligand Efficiency 3: Rerank Score divided by Heavy Atoms count. Singh and Konwar SpringerPlus 2012, 1:69 Page 2 of 10 http://www.springerplus.com/content/1/1/69 site was set inside a restriction sphere of radius 15 Å (X 0.28, Y 99.79, Z 8.70) using MVD. The 85 analogues retrieved from the NCBI PubChem database were imported in the Molegro Virtual Docker (MVD). Bond flexibility of the compounds was set along and the side chain flexibility of the protein for the active site residues (Trp372, Glu377, Trp463, Phe476) was set with a tolerance of 1.10 and strength of 0.90 for docking simulations. RMSD threshold for multiple cluster poses was set at 2.00 Å. The docking algorithm was set at a maximum iteration of 1,500 with a simplex evolution size of 50 and a minimum of 10 runs were performed for each compound. The best pose of each compound was selected for the subsequent ligand–protein interaction energy analysis. Molecular docking was carried out using Molegro Virtual Docker. MVD is based on a differential evolution algorithm; the solution of the algorithm considers the sum of the intermolecular interaction energy between the ligand and the protein and the intramolecular interaction energy of the ligand. The docking energy scoring function is based on the modified piecewise linear potential (PLP) with new hydrogen bonding and electrostatic terms included. Full description of the algorithm and its reliabi- lity compared to other common docking algorithm is described by Thomsen et al. (Thomsen and Christensen 2006). ADME-toxicity prediction ADME-Toxicity for the top docking hits and quercetin was predicted using QikProp (Schrödinger 2012). Qik- Prop predicts physically significant descriptors and pharmaceutically relevant properties of organic mole- cules, either individually or in batches. QikProp provides ranges for comparing a particular molecule’s properties with those of 95% of known drugs. In the present study QikProp properties and descriptors such as apparent MDCK cell permeability (QPPMDCK), IC50 value for blockage of HERG K+ (QPlogHERG), Caco-2 cell perme- ability (QPPCaco), Lipinski rule of five (Lipinski et al. 1997; Lipinski 2008), brain/blood partition coefficient (QPlogBB), human oral absorption on 0 to 100% scale (Percent Huma- nOralAbsorption), aqueous solubility (QPlogS) for the top docking hits and quercetin was predicted to obtain the ADME properties of the compounds. Additionally LD50 mouse and probability of health effects predictions for the top docking hits were calculated using ACD/ I-Lab 2.0 (Advanced Chemistry Development, Inc 1994 ) which is a web-based service that provides instant access to spectral and chemical databases, and predicts properties including physicochemical, ADME, toxicity characteristics. Also a comparative analysis were performed for LD50 mouse (intraperitoneal, oral, intravenous, subcuta- neous) and probability of health effect of blood, cardiovas- cular system, gastrointestinal system, kidney, liver and lung for the top docking hits. Abbreviations NO: Nitric oxide; NOS: Nitric oxide synthases; iNOS: Inducible Nitric oxide synthase; eNOS: Endothelium Nitric oxide synthases; (nNOS): Neurons Nitric oxide synthase; CaM: Ca+2 –dependent calmodulin; MVD: Moegro Virtual Docker; ADME–Toxicity: Absorbtion distribution metabolism excretion and toxicity; NCBI: National Centre for Biotechnology Information; ACD: Advance Chemistry Development. Competing interest The authors declare that they have no competing interests. Author’s contribution SPS carried out the molecular docking studies and ADME-toxicity analysis. SPS and BKK conceived of the study, and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript. Figure 6 Comparative analysis on probability of health effect on blood, cardiovascular system, gastrointestinal system, kidney, liver and lung for Compound ID (5281604, 5315126, 9818879, 5481966, 5282154, 13964550, 5281691, 11834044, 6477685 and quercetin). Singh and Konwar SpringerPlus 2012, 1:69 Page 8 of 10 http://www.springerplus.com/content/1/1/69 Acknowledgement SPS thanks Vice-Chancellor, Tezpur University, Assam, India for the necessary support. Received: 16 October 2012 Accepted: 11 December 2012 Published: 17 December 2012 References Aaltoma SH, Lipponen PK, Kosma VM (2001) Inducible nitric oxide synthase (iNOS) expression and its prognostic value in prostate cancer. Anticancer Res 21:3101–3106 Aaltomaa SH, Lipponen PK, Viitanen J, Kankkunen JP, Ala-Opas MY, Kosma VM (2000) The prognostic value of inducible nitric oxide synthase in local prostate cancer. BJU Int 86:234–239 Advanced Chemistry Development, Inc (1994) ACD/ I-Lab, Version 2.0., Toronto, ON, Canada Ambs S, Merriam WG, Bennett WP, Felley-Bosco E, Ogunfusika MO, Oser SM, Klein S, Shields PG, Billiar TR, Harris CC (1998a) Frequent nitric oxide synthase-2 expression in human colon adenomas: implication for tumor angiogenesis and colon cancer progression. Cancer Res 58:334–341 Ambs S, Merriam WG, Ogunfusika MO, Bennett WP, Ishibe N, Hussain SP, Tzeng EE, Geller DA, Billiar TR, Harris CC (1998b) p53 and vascular endothelial growth factor regulate tumor growth of NOS2-expressing human carcinoma cells. Nat Med 4:1371–1376 Ambs S, Bennett WP, Merriam WG, Ogunfusika MO, Sean MO, Harrington AM, Shields PG, Felley-Bosco E, Hussain SP, Harris CC (1999) Relationship between p53 mutations and inducible nitric oxide synthase expression in human colorectal cancer. J Natl Cancer Inst 91:86–88 Bolton E, Wang Y, Thiessen PA, Bryant SH (2008) PubChem: integrated platform of small molecules and biological activities, 4th edn, Annual reports in computational chemistry. American Chemical Society, Washington, DC, chapt 12 Brennan PA, Moncada S (2002) From pollutant gas to biological messenger: the diverse actions of nitric oxide in cancer. Ann R Coll Surg Engl 84:75–78 ChemOffice (2010) CambridgeSoft Corporation, 875 Massachusetts Ave, Cambridge, MA 02139, USA Chen YC, Shen SC, Lee WR, Hou WC, Yang LL, Lee TJ (2001) Inhibition of nitric oxide synthase inhibitors and lipopolysaccharide induced inducible NOS and cyclooxygenase-2 gene expressions by rutin, quercetin, and quercetin pentaacetate in RAW 264.7 macrophages. J Cell Biochem 82:537–548 Cho HJ, Xie QW, Calaycay J, Mumford RA, Swiderek KM, Lee TD, Nathan C (1992) Calmodulin is a subunit of nitric oxide synthase from macrophages. J Exp Med 176:599–604 Crowell JA, Steele VE, Sigman CC, Fay JR (2003) Is inducible nitric oxide synthase a target for chemoprevention? Mol Cancer Ther 2:815–823 Fischmann TO, Hruza A, Niu XD, Fossetta JD, Lunn CA, Dolphin E, Prongay AJ, Reichert P, Lundell DJ, Narula SK, Weber PC (1999) Structural characterization of nitric oxide synthase isoforms reveals striking active-site conservation. Nat Struct Biol 6:233–242 Forrester K, Ambs S, Lupold SE, Kapust RB, Spillare EA, Weinberg WC, Felley-Bosco E, Wang XW, Geller DA, Tzeng E, Billiar TR, Harris CC (1996) Nitric oxide- induced p53 accumulation and regulation of inducible nitric oxide synthase expression by wild-type p53. Proc Natl Acad Sci USA 93:2442–2447 Franchi A, Gallo O, Paglierani M, Sardi I, Magnelli L, Masini E, Santucci M (2002) Inducible nitric oxide synthase expression in laryngeal neoplasia: correlation with angiogenesis. Head Neck 24:16–23 Freitas MP (2006) MIA-QSAR modelling of anti-HIV-1 activities of some 2-amino-6- arylsulfonylbenzonitriles and their thio and sulfinyl congeners. Org Biomol Chem 4:1154–1159 Gallo O, Masini E, Morbidelli L, Franchi A, Fini-Storchi I, Vergari WA, Ziche M (1998) Role of nitric oxide in angiogenesis and tumor progression in head and neck cancer. J Natl Cancer Inst 90:587–596 García-Mediavilla V, Crespo I, Collado PS, Esteller A, Sánchez-Campos S, Tuñón MJ, González-Gallego J (2007) The anti-inflammatory flavones quercetin and kaempferol cause inhibition of inducible nitric oxide synthase, cyclooxygenase-2 and reactive C-protein, and down-regulation of the nuclear factor kappaB pathway in Chang Liver cells. Eur J Pharmacol 557:221–229 Garthwaite J, Boulton CL (1995) Nitric oxide signaling in the central nervous system. Annu Rev Physiol 57:683–706 Gehlhaar DK, Verkhivker G, Rejto PA, Fogel DB, Fogel LJ, Freer ST (1995) Docking Conformationally Flexible Small Molecules Into a Protein Binding Site Through Evolutionary Programming. Proceedings of the Fourth International Conference on Evolutionary Programming. Lect Notes Comput Sci 1447:449–461 Gehlhaar DK, Bouzida D, Rejto PA (1998) Fully Automated And Rapid Flexible Docking of Inhibitors Covalently Bound to Serine Proteases. Proceedings of the Seventh International Conference on Evolutionary Programming. Springer-Verlag, London, UK, pp 449–461 Ghosh DK, Crane BR, Ghosh S, Wolan D, Gachhui R, Crooks C, Presta A, Tainer JA, Getzoff ED, Stuehr DJ (1999) Inducible nitric oxide synthase: role of the N- terminal beta-hairpin hook and pterin-binding segment in dimerization and tetrahydrobiopterin interaction. EMBO J 18:6260–6270 Goodman JE, Hofseth LJ, Hussain SP, Harris CC (2004) Nitric oxide and p53 in cancer-prone chronic inflammation and oxyradical overload disease. Environ Mol Mutagen 44:3–9 Griffith OW, Stuehr DJ (1995) Nitric oxide synthases: properties and catalytic mechanism. Annu Rev Physiol 57:707–736 Hao XP, Pretlow TG, Rao JS, Pretlow TP (2001) Inducible nitric oxide synthase (iNOS) is expressed similarly in multiple aberrant crypt foci and colorectal tumors from the same patients. Cancer Res 61:419–422 Hayashi H, Kuwahara M, Fujisaki N, Furihata M, Ohtsuki Y, Kagawa S (2001) Immunohistochemical findings of nitric oxide synthase expression in urothelial transitional cell carcinoma including dysplasia. Oncol Rep 8:1275–1279 Hickey MJ, Granger DN, Kubes P (2001) Inducible nitric oxide synthase (iNOS) and regulation of leucocyte/endothelial cell interactions: studies in iNOS-deficient mice. Acta Physiol Scand 173:119–126 James A, Crowell VES, Caroline CS, Judith RF (2003) Is inducible nitric oxide synthase a target for chemoprevention? Mol Cancer Ther 2:815–823 Kinaci MK, Erkasap N, Kucuk A, Koken T, Tosun M (2012) Effects of quercetin on apoptosis, NF-κB and NOS gene expression in renal ischemia/reperfusion injury. Exp Ther Med 3:249–254 Knowles RG, Moncada S (1994) Nitric oxide synthases in mammals. Biochem J 298:249–258 Kojima M, Morisaki T, Tsukahara Y, Uchiyama A, Matsunari Y, Mibu R, Tanaka M (1999) Nitric oxide synthase expression and nitric oxide production in human colon carcinoma tissue. J Surg Oncol 70:222–229 Lipinski CA (2008) Drug-like properties and the causes of poor solubility and poor permeability. J Pharm Toxicol Methods 44:235–249 Lipinski CA, Lombardo F, Dominy BW, Feeney PJ (1997) Experimental and computational approaches to estimate solubility and permeability in drug discovery and development settings. Adv Drug Del Rev 23:3–25 Lirk P, Hoffmann G, Rieder J (2002) Inducible nitric oxide synthase–time for reappraisal. Curr Drug Targets Inflamm Allergy 1:89–108 MacMicking J, Xie QW, Nathan C (1997) Nitric oxide and macrophage function. Annu Rev Immunol 15:323–350 Marletta MA, Hurshman AR, Rusche KM (1997) Catalysis by nitric oxide synthase. Curr Opin Chem Biol 2:656–663 Marrogi AJ, Travis WD, Welsh JA, Khan MA, Rahim H, Tazelaar H, Pairolero P, Trastek V, Jett J, Caporaso NE, Liotta LA, Harris CC (2000) Nitric oxide synthase, cyclooxygenase 2, and vascular endothelial growth factor in the angiogenesis of non-small cell lung carcinoma. Clin Cancer Res 6:4739–4744 Massi D, Franchi A, Sardi I, Magnelli L, Paglierani M, Borgognoni L, Maria Reali U, Santucci M (2001) Inducible nitric oxide synthase expression in benign and malignant cutaneous melanocytic lesions. J Pathol 194:194–200 Messmer UK, Ankarcrona M, Nicotera P, Brüne B (1994) p53 expression in nitric oxide-induced apoptosis. FEBS Lett 355:23–26 Michal G (1999) Biochemical pathways. John Wiley & Sons, New York Michel T, Feron O (1997) Nitric oxide synthases: which, where, how, and why? J Clin Invest 100:2146–2152 Molegro APS (2011) MVD 5.0 Molegro Virtual Docker., DK-8000 Aarhus C, Denmark Murakami A, Ashida H, Terao J (2008) Multitargeted cancer prevention by quercetin. Cancer Lett 269:315–325 Peng Y, Deng Z, Wang C (2008) Preparation and prodrug studies of quercetin pentabenzensulfonate. Yakugaku Zasshi 128:1845–1849 Rao CV (2004) Nitric oxide signaling in colon cancer chemoprevention. Mutat Res 555:107–119 Raso GM, Meli R, Di Carlo G, Pacilio M, Di Carlo R (2001) Inhibition of inducible nitric oxide synthase and cyclooxygenase-2 expression by flavonoids in macrophage J774A.1. Life Sci 68:921–931 Singh and Konwar SpringerPlus 2012, 1:69 Page 9 of 10 http://www.springerplus.com/content/1/1/69 Rietjens IM, Boersma MG, van der Woude H, Jeurissen SM, Schutte ME, Alink GM (2005) Flavonoids and alkenylbenzenes: mechanisms of mutagenic action and carcinogenic risk. Mutat Res 574:124–138 Ropponen KM, Kellokoski JK, Lipponen PK, Eskelinen MJ, Alanne L, Alhava EM, Kosma VM (2000) Expression of inducible nitric oxide synthase in colorectal cancer and its association with prognosis. Scand J Gastroenterol 11:1204–1211 Sandau K, Pfeilschifter J, Brüne B (1997) The balance between nitric oxide and superoxide determines apoptotic and necrotic death of rat mesangial cells. J Immunol 158:4938–4946 Schrödinger LLC (2012) QikProp, version 3.5., New York, NY Swana HS, Smith SD, Perrotta PL, Saito N, Wheeler MA, Weiss RM (1999) Inducible nitric oxide synthase with transitional cell carcinoma of the bladder. J Urol 161:630–634 Thomsen R, Christensen MH (2006) MolDock: a new technique for high-accuracy molecular docking. J Med Chem 49:3315–3321 Thomsen LL, Lawton FG, Knowles RG, Beesley JE, Riveros-Moreno V, Moncada S (1994) Nitric oxide synthase activity in human gynecological cancer. Cancer Res 54:1352–1354 Thomsen LL, Miles DW, Happerfield L, Bobrow LG, Knowles RG, Moncada S (1995) Nitric oxide synthase activity in human breast cancer. Br J Cancer 72:41–44 Ulrich B, Norman LA (1982) Molecular mechanics (ACS Monograph 177). American Chemical Society, Washington, DC Uotila P, Valve E, Martikainen P, Nevalainen M, Nurmi M, Härkönen P (2001) Increased expression of cyclooxygenase-2 and nitric oxide synthase-2 in human prostate cancer. Urol Res 29:23–28 Vakkala M, Kahlos K, Lakari E, Pääkkö P, Kinnula V, Soini Y (2000) Inducible nitric oxide synthase expression, apoptosis, and angiogenesis in in situ and invasive breast carcinomas. Clin Cancer Res 6:2408–2416 van der Woude H, Alink GM, van Rossum BE, Walle K, van Steeg H, Walle T, Rietjens IM (2005) Formation of transient covalent protein and DNA adducts by quercetin in cells with and without oxidative enzyme activity. Chem Res Toxicol 18:1907–1916 Verschoyle RD, Steward WP, Gescher AJ (2007) Putative cancer chemopreventive agents of dietary origin-how safe are they? Nature Cancer 59:152–162 Wang Y, Bolton E, Dracheva S, Karapetyan K, Shoemaker SA, Suzek TO, Wang J, Xiao J, Zhang J, Bryant SH (2010) An overview of the PubChem BioAssay resource. Nucleic Acids Res 38:D255–D266 Weiming X, Li ZL, Marilena L, Mohamed A, Ian GC (2002) The role of nitric oxide in cancer. Cell Res 12:311–320 Xu W, Charles IG, Moncada S, Gorman P, Sheer D, Liu L, Emson P (1994) Mapping of the genes encoding human inducible and endothelial nitric oxide synthase (NOS2 and NOS3) to the pericentric region of chromosome 17 and to chromosome 7, respectively. Genomics 21:419–422 Yagihashi N, Kasajima H, Sugai S, Matsumoto K, Ebina Y, Morita T, Murakami T, Yagihashi S (2000) Increased in situ expression of nitric oxide synthase in human colorectal cancer. Virchows Arch 436:109–114 Yang JM, Chen CC (2004) GEMDOCK: a generic evolutionary method for molecular docking. Proteins 55:288–304 doi:10.1186/2193-1801-1-69 Cite this article as: Singh and Konwar: Molecular docking studies of quercetin and its analogues against human inducible nitric oxide synthase. SpringerPlus 2012 1:69. Submit your manuscript to a journal and benefi t from: 7 Convenient online submission 7 Rigorous peer review 7 Immediate publication on acceptance 7 Open access: articles freely available online 7 High visibility within the fi eld 7 Retaining the copyright to your article Submit your next manuscript at 7 springeropen.com Singh and Konwar SpringerPlus 2012, 1:69 Page 10 of 10 http://www.springerplus.com/content/1/1/69

Title: Molecular docking studies of quercetin and its analogues against human inducible nitric oxide synthase ​ Authors: Salam Pradeep Singh, Bolin Kumar Konwar Publisher: SpringerPlus Date: December 17, 2012 ​ Abstract: Nitric oxide synthases (NOS) catalyze to produce nitric oxide (NO) from L-arginine. ​ The isoform of NOS i.e. ​ inducible nitric oxide synthases (iNOS) expression is observed in various human malignant tumors such as breast, lung, prostate and bladder, colorectal cancer, and malignant melanoma. ​ Also an increased level of iNOS expression and activity has been found in the tumor cells of gynecological malignancies, stroma of breast cancer and tumor cells of head and neck cancer. ​ Because of its importance in causing tumors and cancer, iNOS enzyme has become a new target in finding novel inhibitors as anti cancer agents. ​ The present work focuses on the molecular docking analysis of quercetin and its analogues against iNOS enzyme. ​ Earlier there are reports of quercetin inhibiting iNOS enzyme in certain experiments as anti cancer agent. ​ But the clinical use of quercetin is limited by its low oral bioavailability and therefore needed its molecular modification to improve its pharmacological properties. ​ In the present study ten analogues of quercetin were found to be docked at the active site cavity with favorable ligand-protein molecular interaction and interestingly from the ADME-Toxicity analysis these analogues have enhanced pharmacological properties than quercetin. ​

Molecular docking studies of quercetin and its analogues against human inducible nitric oxide synthase.pdf

RESEARCH Open Access Alkaloids from single skins of the Argentinian toad Melanophryniscus rubriventris (ANURA, BUFONIDAE): An unexpected variability in alkaloid profiles and a profusion of new structures H Martin Garraffo1*, Nirina R Andriamaharavo1, Marcos Vaira2,3, María F Quiroga4, Cecilia Heit5 and Thomas F Spande1 Abstract GC-MS analysis of single-skins of ten Melanophryniscus rubriventris toads (five collections of two toads each) captured during their breeding season in NW Argentina has revealed a total of 127 alkaloids of which 56 had not been previously detected in any frog or toad. Included among these new alkaloids are 23 new diastereomers of previously reported alkaloids. What is particularly distinguishing about the alkaloid profiles of these ten collections is the occurrence of many of the alkaloids, whether known or new to us, in only one of the ten skins sampled, despite two skins being obtained from each breeding site of the five populations. Many of the alkaloids are of classes known to have structures with branched-chains (e.g. pumiliotoxins and tricyclic structures) that are considered to derive from dietary mites. A large number of previously reported and new alkaloids are also of unclassified structures. Only a very few 3,5-disubstituted-indolizidine or -pyrrolizidine alkaloids are observed that have a straight-chain carbon skeleton and are likely derived from ant prey. The possible relationship of these collections made during the toad’s brief breeding episodes to sequestration of dietary arthropods and individual alkaloid profiles is discussed. Keywords: Alkaloids, Gas chromatography–mass spectrometry, Melanophryniscus Toads, Reproduction, Sequestration Introduction Nine of the 25 currently known species (Frost, 2011) of South American bufonid toads of the genus Melanophry- niscus have been surveyed for lipophilic alkaloids in skin glands. These alkaloids are considered to provide a defense against predation, particularly during the mainly diurnal breeding episodes of the toads (Santos and Grant 2010a). The toads examined for alkaloids are M. atroluteus (Mebs et al. 2007), M. cupreuscapularis (Daly et al. 2008a), M. devincenzii (Mebs et al. 2007), M. klappenbachi (Daly et al. 2008a), M. moreirae (Daly et al. 1984), M. montevidensis (Garraffo et al. 1993a; Mebs et al. 2005), M. rubriventris (Daly et al. 2007), and M. stelzneri (Garraffo et al. 1993a; Daly et al. 2007). The Brazilian species, M. simplex has recently been investigated and contains both known and new alkaloids (Grant et al. 2012). A tenth spe- cies, M. cambaraensis from southern Brazil, is reported to have “defensive chemicals” in skin, not proven, however, to be alkaloids (Colombo and Grant, cited in Santos and Grant 2010a). Eighty-one skins of a Uruguayan Melanophryniscus toad, M. montevidensis from six southeastern sites were individually examined and had widely varying amounts of pumiliotoxin (PTX) 251D ranging from none, or scarcely detectible, to as much as 1 mg per toad. Traces of six other PTX alkaloids (Mebs et al. 2005) were also seen as well as traces of indolizidines that were not characterized. From two northern Uruguayan toads, M. atroluteus and M. devincenzii, PTX 251D was the major alkaloid identi- fied along with five known trace PTX alkaloids and * Correspondence: [email protected] 1Laboratory of Bioorganic Chemistry, NIDDK, NIH, DHHS, Bethesda, MD 20892, USA Full list of author information is available at the end of the article a SpringerOpen Journal © 2012 Garraffo et al; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Garraffo et al. SpringerPlus 2012, 1:51 http://www.springerplus.com/content/1/1/51 another trace PTX congener (Mebs et al. 2007). Skins of the remaining six Melanophryniscus species that are known to have alkaloids, are reported to have many more alkaloids, ranging from 10–25 alkaloids (Daly et al. 2007) to as many as 36 (Daly et al. 2008a), all with 251D and other alkaloids of the PTX class, several di- and tri- substituted indolizidines, disubstituted pyrrolizidines, di- substituted quinolizidines and tricyclic alkaloids. Some classes, considered from their straight-chain structures to derive from ants, were significant in a 1989 collection of M. stelzneri from Córdoba, Argentina, (Garraffo et al. 1993a) but were scarce in a collection from the same site made ten years later (Daly et al. 2007). Combined skin collections from four populations of M. rubriventris likewise reflected temporal variation (Daly et al. 2007). Melanophryniscus rubriventris, the subject of the current study, is a species of aposematic toads with a snout vent length (SVL) of 32–43 mm and restricted to the NW Argentinian provinces of Salta and Jujuy and temperate interandean valleys of south- ern Bolivia (Frost 2011). Although the species was first for- mally described as a toad with a black background and bright orange coloration covering the scapular region and partially the head, dorsum and flanks, with a uniform red ventral coloration (Vellard 1947), subsequent studies on population color variations in Argentina showed that they differed significantly in dorsal and ventral coloration pat- terns (Vaira 2002). Northern and central populations (Salta and central east of Jujuy province) have individuals with bright uniform dorsum, differing mainly in the extent of black patches, whereas the southern population (southeast of Jujuy province) has toads that predominately showed a more cryptic olive to black dorsal pattern. Concomitant individuals from northern and central populations have a mostly uniform yellow to red belly whereas the southern population has toads with well-demarcated yellow, red and black speckled bellies (see Figure 1). Earlier work on four M. rubriventris multi-skin collections made in 2002 from two sites in Salta province and two in Jujuy province (see Figure 2) indicated all contained various representatives of the PTX class but only two populations (Canto del Monte, Salta and Tiraxi, Jujuy) contained pumi- liotoxin 251D, normally found in Melanophryniscus (bufo- nid) toads and common also to some dendrobatid, Mantella (mantellid) and Pseudophryne (myobatrachid) frogs. The Tiraxi two-skin collection had alkaloid 267A, the only occur- rence of an allopumiliotoxin among the four collections in this earlier study. Extreme variability was also seen in the following izidine (Iz) classes detected from the 2002 collec- tions. All four collections had 195G (5-propyl-6,8-dimethy- lindolizidine) or other 5,6,8-trisubstituted indolizidines and only two collections of the four had 5,8-disubstiuted indolizi- dines, however none of these shared common structures. Likewise, all collections had several izidines (Iz) or tricyclic structures but none of these alkaloids were shared. The present study analyzing single skins of M. rubriventris, focuses on alkaloid profiles of a single species of toad from undisturbed contiguous and non-contiguous sites and whether any conclusions can be drawn as to the variety of arthropod prey consumed during their explosive breeding bouts that might allow a comparison in alkaloid compos- ition with earlier collections taken during non-breeding periods. We have deviated considerably from the data formats we used earlier in other journals in that we have included much more original data such as GC retention times, high reso- lution EIMS, CIMS, total-ion mass chromatograms and complete EIMS mass spectra (not just major peaks). We think this is important in appreciating the unexpected complexity and variation in the toad skin alkaloids of this species and the unique time and place of these collec- tions. Almost half have never been seen before in any Old or New World frog or toad. The new alkaloids are not the result of improved analytical sensitivity or more concen- trated samples as we have used basically the same protocols and instruments as in our earlier work on single-skins of mantellid frogs (Daly et al., 2008b). The corrected GC retention times are necessary to con- firm that a particular alkaloid is either new or a new dia- stereomer of a known alkaloid. In an effort to assist other investigators, this data (see Additional file 1 Tables S1-S10) will also update our earlier review that included approxi- mately 800 poison frog alkaloids then known, with their corrected GC retention times (Daly et al. 2005). The total ion current (TIC) chromatograms (Additional file 3 Figure S1-S10) are critically illustrative here because of the alkal- oid variability observed and also because of the wide range in alkaloid amounts. Because so many alkaloids are new, we cannot, as is usual, simply refer to characterization cita- tions in previously published papers on poison frog or toad alkaloids. So we chose to enter the whole of our mass spec- tral data here in hopes of stimulating further work and as an explanation for the departure of these toads from expected analytical results, where only half a dozen or so new alkaloids would have been expected. With the current state of the art of electronic publishing, there is no good reason to depict the mass spectra in any other format but the graphical one, which is the best to compare with new data to be obtained in the future. Methods and materials Two toads were collected at each of five sites: three sites in Salta province of NW Argentina and two sites in the contiguous province of Jujuy (see Figure 2). Both pro- vinces border Bolivia (see inset, Figure 2). The two speci- mens from each site were captured within an area of roughly 4 m x 4 m at the dates indicated in the footnotes to Additional file 1 Tables S1-S11. Table S11 provides GPS coordinates and elevations of the sites along with the size Garraffo et al. SpringerPlus 2012, 1:51 Page 2 of 15 http://www.springerplus.com/content/1/1/51 (M. F. Quiroga and M. Vaira unpub. data). This state- ment is supported by the following two experiments: 1) A laboratory test of stomach passage time was per- formed in a similarly sized frog, Eleutherodactylus coqui, ranging in snout-to-vent length from 25 to 50 mm. The results indicate that prey items pass out of a frog stomach in 10–14 h after being ingested (Woolbright & Stewart, 1987). So, given that Melanophryniscus rubriventris is active early in the morning (around 7 am) we can expect that in these toads, foraging during the daylight, the stom- ach would be empty by midnight (see next). 2) During 2007/2008 some of us (MFQ and MV) col- lected 71 M. rubriventris toads and analyzed the stomach contents by the stomach-flushing method (Leger and Sullivan, 1979; Solếet al. 2005) with approximately equal number of toads taken at 3 pm, 7 pm and 1 am the next day, defined as afternoon, evening and night, respectively. By flushing, the stomach eliminates all the contents (full stomach) in one bolus or almost nothing when the sto- machs are empty. The proportions of full stomachs over all the frogs taken in each period, afternoon, evening and night, were 66%, 48% and 9%, respectively. Therefore, it seems clear to state that toads feed mainly during the morning until afternoon hours, although we found a few specimens still active at night (around 1 to 2 am). The major problem with inferences from stomach contents is that such results represent the last meal or two of the toad, while the observed skin alkaloids are accumulated over a much longer time, likely an adult’s lifetime. Also the softer bodied prey items will be digested more rapidly than the hard-bodied mites and ants. Nevertheless, stomach content analyses do provide presumptive evidence of the dietary preferences of the poison frogs (Clark et al. 2005; Woodhead et al. 2007; Saporito et al. 2012) and toads so far examined. Of more limited application has been the analysis of toad feces using electron microscopy techniques to identify un- digested body parts of prey (Mebs et al. 2005). A sex-link with alkaloids in M. rubriventris toads? Of the ten skins examined, nine were from males and only one from a female (#8, Tablada site). While earlier studies of the dendrobatid frog Dendrobates (Oophaga) pumilio (Saporito et al. 2008) indicated some significant differences with sex in alkaloid profiles in both amounts and components, the present study, reveals no obvious differences in variety of alkaloids when all the toad males are considered. The M. stelzneri collection of 2001 reported in 2007 (Daly et al. 2007) examined two com- bined male and two combined female skins and the results neither in amounts (male, 9 major/minor alka- loids; female 8 major/minor alkaloids) nor variety (male 23 alkaloids total; female, 22 alkaloids total) resembled the results found in studies with mantellid (Daly et al. 2008b) or dendrobatid frogs (Saporito et al. 2010), where the slightly larger and presumably wider ranging females had skin alkaloids in both larger amounts and greater variety. The lack of a sex link seen with currently inves- tigated toad alkaloid profiles, although from very limited samples (in fact, only one female toad), suggests that the male and female Melanophriniscus toads may not separ- ate significantly during foraging. Conclusion The present ten collections were made during the lengthy, hot, spring-summer breeding season of these toads (November to February) where toads were cap- tured as pairs in small (ca. 4 m x 4 m) areas with ponds (Additional file 2: Figure S27). The Salta and Jujuy regions where these toads are found are of a typical sub- tropical humid montane/woodland forest that is mature and well-structured. Moisture and occasional fog arise from ascending air currents and promote a lush epi- phytic growth of bromeliads, ferns, mosses and liver- worts. Temporary ponds and streams where breeding occurs arise from runoff from higher elevations during the rainy season (October to April) when average yearly rainfall is over 2 m, but are short-lived due to the steep slopes and porous soils (Vaira, 2005). Several breeding periods occur during the rainy season. The fact that specimens collected from the same site have more alkaloids shared than toads from different sites, suggests that during the approximately three-day breeding period, arthropods are being consumed at or near the site, but overlaying this fresh input from a lim- ited area will be a larger background of previous alkaloid sequestration that likely represents foraging from a more extensive area in the forest as supported by some pre- liminary observations of ours. The varying profiles of contents of stomach analyses also implies this. At the moment, it is not clear how extensive is the territorial range of the toads that just happen to be collected at the same time in the same small pond. Proximity of the col- lected toads in the present study, in any case, is mislead- ing since foraging during intermittent breeding, both close to and more remote from such ponds, has been observed by us. Work is underway to determine more exactly the territorial range of toads on land or adjacent swamp areas before and during their typical three-day breeding bouts in the ponds. Of the 48 previously reported alkaloids (i.e. those hav- ing codes followed by no asterisk in Table 1, Additional file 1 Tables S1-S10) observed in the present survey of the skin alkaloids from M. rubriventris toads, most were seen before in more than one of the other anuran fam- ilies. The Venn diagram of Additional file 5 Figure S28 indicates that 22 of the 48 alkaloids were seen earlier in skin extracts of dendrobatid and/or mantellid poison Garraffo et al. SpringerPlus 2012, 1:51 Page 13 of 15 http://www.springerplus.com/content/1/1/51 frogs, while only 9 alkaloids were previously reported from bufonids alone. Thus, it appears that we are begin- ning to find more similarity in alkaloid structures be- tween these poison toads of South America and the poison frog families of both hemispheres. This impli- cates common dietary prey and the common evolution of an alkaloid uptake system between toad and frog. The six previously reported bufonid alkaloids shared with dendrobatids include one 5,8-disubstituted indolizidine, one izidine and one tricyclic, all likely alkaloids with skeletal branch points and of probable mite origin. Inter- estingly, there are currently no known mantellid alka- loids shared only with bufonids. There are, however, 11 alkaloids shared among bufonids, mantellids and den- drobatids. Only two (223H, 223AB) are known to have structures with a linear carbon-chain; the rest have branch points. Very recent work (Grant et al. 2012) on eleven M. simplex skins from three sites in Brazil indicates the occurrence of many new alkaloids or diastereomers of known dendrobatid alkaloids as we have observed with the Argentinian M. rubriventris. Fourteen of the total of 47 alkaloids or new diastereomers they report are shared with our collections but the overall pattern they observe has many more alkaloids (eleven) likely seques- tered from ants. Pumiliotoxins and various izidines dom- inate their collections but they also include nine alkaloids of unclassified structures, two that we also report. Santos and Grant have recently studied in detail the reproduction of a Brazilian Melanophryniscus species and concluded that the observed strongly diurnal reproduction preference likely preceded the development of sequestra- tion of toxic alkaloids in these and other bufonids and in poison frogs in general (Santos and Grant 2010). What is not clear at the moment is at what stage in evolution, did coloration begin to play a role to advertise toxicity. Additional files Additional file 1: Table S1-S10. The Rt (obs) of the known alkaloids in the present study was corrected to compare with the corresponding retention times of our most recent summary (Daly et al.2005). A simple plot with observed vs. corrected retention times of the known alkaloids, selected from several of the tables below, generates a straight line; the corrected retention times for the unknowns are obtained using the observed values and interpolating within this line. Both values, Rt (obs.) and Rt (corr.), were fairly reproducible among the tables S1-S10 for any repeated alkaloid. Table S11: Collection information on skins of Melanophyriscus rubriventris. Table S12: GC-eims ion current intensities. Table S13: Effect of proximity between 2002 and 2008 collections-Salta province. Table S14: Effect of proximity between 2002 and 2008 collections-Jujuy province. Additional file 2: Figure S27. Typical ponds where collections were made: a) Cedral de Baritú, Salta; b) Los Paños, Jujuy. The blue parallelogram indicates the average collection area. Additional fle 3: Figures S1-S10. Total mass spectral ion current chromatograms for the alkaloid extracts of toad skin samples #1-10. Additional file 4: Figures S11-S26. Mass spectra of all the alkaloids (127) found in this study, 8 spectra per page (total of 16 pages) in increasing order of MW, with the exception of alkaloid 195N added at the end. Additional file 5: Figure S28. Venn diagram showing occurrence and overlaps of previously known anuran skin alkaloids (N = 48) detected in the Argentinian toad Melanophryniscus rubriventris of this study with those previously seen in bufonid toads, dendrobatid or mantellid frogs. See Supplemental Information of Daly et al. 2005 for alkaloids and sources. The asterisk in the dendrobatid/mantellid alkaloid overlap indicates two occurrences also in myobatrachid frogs of Australia. Competing interest The authors declare that they have no competing interests. Authors’ contribution MV and MFQ collected specimens; NRA prepared skin extracts; CH undertook some preliminary analyses; NRA and HMG performed detailed GC-MS analyses; TFS organized most of the data; MV, HMG and TFS drafted the manuscript. All authors read and approved the final manuscript. Acknowledgments HMG, NRA and TFS wish to thank NIDDK, NIH, HHS for support. Part of the project was supported by a research fellowship from Universidad Nacional de Jujuy to MFQ, and was supported also by a Secter-UNJu grant #D-037. Permits for sample collection of the species were provided by the Delegación Técnica de Parques Nacionales, Regional Noroeste and Dirección Provincial de Políticas Ambientales y Recursos Naturales, Jujuy. Author details 1Laboratory of Bioorganic Chemistry, NIDDK, NIH, DHHS, Bethesda, MD 20892, USA. 2CIBA, Facultad de Ingeniería, Universidad Nacional de Jujuy, Gorriti 237, Jujuy 4600, Argentina. 3Instituto de Bio y Geociencias del NOA, Universidad Nacional de Salta, Mendoza 2, Salta, Argentina. 4Facultad de Ciencias Agrarias, Universidad Nacional de Jujuy, Alberdi 47, Jujuy, Argentina. 5Laboratorio de Análisis de Residuos y Trazas (LAnaRT), Zorrilla de San Martín, 2170, Jujuy, Argentina. Received: 12 September 2012 Accepted: 16 November 2012 Published: 23 November 2012 References Bonansea MI, Vaira M (2007) Geographic variation of the diet of Melanophryniscus rubriventris (Anura: Bufonidae) in Northwestern Argentina. J Herpetol 41:230–236 Clark VC, Raxworthy CJ, Rakotomalala V, Sierwald P, Fisher BL (2005) Convergent evolution of chemical defense in poison frogs and arthropod prey between Madagascar and the Neotropics. Proc Natl Acad Sci USA 102:11617–11622 Clark VC, Rakotomalala V, Ramilijaona O, Abrell L, Fisher BL (2006) Individual variation in alkaloid content of poison frogs of Madagascar (Mantella; Mantellidae). J Chem Ecol 32:2219–2233 Daly JW, Highet RJ, Myers CW (1984) Occurrence of skin alkaloids in non- dendrobatid frogs from Brazil (Bufonidae), Australia (Myobatrachidae) and Madagascar (Mantellinae). Toxicon 22:905–919 Daly JW, Garraffo HM, Jain P, Spande TF, Snelling RR, Jaramillo C, Rand AS (2000) Arthropod-frog connection: Decahydroquinoline and pyrrolizidine alkaloids common to microsympatric myrmicine ants and dendrobatid frogs. J Chem Ecol 26:73–85 Daly JW, Garraffo HM, Spande TF, Clark VC, Ma J, Ziffer H, Cover JF JR (2003) Evidence for an enantioselective pumiliotoxin 7-hydroxylase in dendrobatid poison frogs of the genus Dendrobates. Proc Natl Acad Sci USA 100:11092–11097 Daly JW, Spande TF, Garraffo HM (2005) Alkaloids from amphibian skin: A tabulation of over eight-hundred compounds. J Nat Prod 68:1556–1575 Daly JD, Wilham JM, Spande TF, Garraffo HM, Gil RR, Silva GL, Vaira M (2007) Alkaloids in bufoinid toads (Melanophryniscus): Temporal and geographic determinants for two Argentinian species. J Chem Ecol 33:871–887, This paper on pages 883 and 889 has a significant printing error in the reported quantitation of 251D by Mebs, et al. 2005 in that the intended μg was replaced by g Garraffo et al. SpringerPlus 2012, 1:51 Page 14 of 15 http://www.springerplus.com/content/1/1/51 Daly JW, Garraffo HM, Spande TF, Yeh HJC, Peltzer PM, Cacivio PM, Baldo JD, Faivovich J (2008a) Indolizidine 239Q and quinolizidine 275I. Major alkaloids in two Agentinian bufonid toads (Melanophryniscus). Toxicon 52:858–870 Daly JW, Garraffo HM, Spande TF, Giddings L-A, Saporito RA, Vieites DR, Vences M (2008b) Individual and geographic variation of skin alkaloids in three species of Madagascan poison frogs (Mantella). J Chem Ecol 34:252–279 Fitch RW, Garraffo HM, Spande TF, Yeh HJC, Daly JW (2003) Bioassay-guided isolation of epiquinamide, a novel quinolizidine alkaloid and nicotinic agonist from an Ecuadoran poison frog Epipedobates tricolor. J Nat Prod 66:1345–1350 Frost DR (2011) Amphibian species of the world: An online reference. Version 5.5. (31 January, 2011). American Museum of Natural History, New York, USA, Electronic Database accessible at http://research.amnh.org/vz/herpetology/ amphibia/ Garraffo HM, Spande TF, Daly JW, Baldessari A, Gros EG (1993a) Alkaloids from bufonid toads (Melanophryniscus): Decahydroquinolines, pumiliotoxins and quinolizidines. J Nat Prod 56:357–373 Garraffo HM, Caceres J, Daly JW, Spande TF, Andriamaharavo NR, Andriantsiferana M (1993b) Alkaloids in Madagascan Frogs (Mantella): Pumiliotoxins, indolizidines, quinolizidines, and pyrrolizidines. J Nat Prod 56:1016–1038 Grant T, Colombo P, Verrastro L, Saporito RA (2012) The occurrence of defensive alkaloids in non-integumentary tissues of the Brazilian red-belly toad, Melanophryniscus simplex (Bufonidae), Chemoecology-Special issue Sequestered Chemical Defenses in Vertebrates, Dedicated to JW Daly. 22:169–178 Jones TH, Gorman JST, Snelling RR, Delabie JHC, Blum MS, Garraffo HM, Jain P, Daly JW, Spande TF (1999) Further alkaloids common to ants and frogs: Decahydroquinolines and a quinolizidine. J Chem Ecol 25:1179–1193 Leger JM, Sullivan LJ (1979) The application of stomach-flushing to lizards and anurans. Herpetologica 35:107–110 Mebs D, Pogoda W, Maneyro R, Kwet A (2005) Studies on the poisonous skin secretion of individual red bellied toads, Melanophryniscus montevidensis (Anura, Bufonidae) from Uruguay. Toxicon 46:641–650 Mebs D, Maneyro R, Pogoda W (2007) Further studies on pumiliotoxin 251D and hydroquinone content of the skin secretion of Melanophryniscus species (Anura, Bufonidae), from Uruguay. Toxicon 50:165–169 Quiroga MF, Bonansea MI, Vaira M (2011) Population diet variation and individual specialization in the poison toad, Melanophryniscus rubriventris (Vellard, 1947). Amphibia-Reptilia 32:261–265 Rodriguez A, Poth D, Schulz S, Vences M et al (2010) Discovery of skin alkaloids in a miniaturized eleutherodactylid frog from Cuba. Biology Lett B :414–418 Santos RR, Grant T (2010) Diel pattern of migration in a poisonous toad from Brazil and the evolution of chemical defenses in diurnal amphibians. Evol Ecol 25:249–258 Santos RR, Leonardi SB, Carosi VZ, Grant T (2010b) Directional orientation of migration in an aseasonal explosive-breeding toad from Brazil. J Tropical Ecol 26:415–421 Saporito RA, Garraffo HM, Donnelly MA, Edwards AL, Longino JT, Daly JW (2004) Formicine ants: An arthropod source for the pumiliotoxin alkaloids of dendrobatid poison frogs. Proc Nat Acad USA 101:8045–8050 Saporito RA, Donnelly MA, Garraffo HM, Spande TF, Daly JW (2006) Geographic and seasonal variation in alkaloid-based chemical defenses of Dendrobates pumilio from Bocas del Toro. Panamá J Chem Ecol 32:795–814 Saporito RA, Donnelly MA, Norton RA, Garraffo HM, Spande TF, Daly JW (2007) Oribatid mites as a major dietary source for alkaloids in poison frogs. Proc Nat Acad USA 104:8885–8890 Saporito RA, Spande TF, Garraffo HM, Donnelly MA (2009) Arthropod alkaloids in poison frogs: a review of the dietary hypothesis. Heterocycles 79:277–297 Saporito RA, Donnelly MA, Madden AA, Garraffo HM, Spande TF (2010) Sex- Related differences in alkaloid chemical defenses of the dendrobatid frog Oophaga pumilio from Cayo Nancy, Bocas del Toro, Panamá. J Nat Prod 73:317–321 Saporito RA, Donnelly MA, Spande TF, Garraffo HM (2012) A review of chemical ecology in poison frogs. Chemoecol 22:158–169 Smith BP, Tyler MJ, Kaneko T, Garraffo HM, Spande TF, Daly JW (2002) Evidence for biosynthesis of pseudophrynamine alkaloids by an Australian myobatrachid frog (Pseudophryne) and sequestration of dietary pumiliotoxins. J Nat Prod 65:439–447 SolếM, Beckmann O, Pelzi B, Kwet A, Engels W (2005) Stomach-flushing for diet analysis in anurans: an improved protocol evaluated in a case study in Araucaria forests, southern Brazil. Studies on Neotropical Fauna and Environment 40:23–28 Spande TF, Jain P, Garraffo HM, Pannell LK, Yeh HJC, Daly JW, Fukumoto S, Imamura K, Tokuyama T, Torres JA, Snelling RR, Jones TH (1999) Occurrence and significance of decahydroquinolines from dendrobatid poison frogs and a myrmicine ant: Use of 1H and 13C NMR in their conformational analysis. J Nat Prod 62:5–21 Vaira M (2002) Variación de la coloración en poblaciones argentinas de Melanophryniscus rubriventris (Vellard, 1947). Cuad Herpetol 16:151–163 Vaira M (2005) Annual variation of breeding patterns of Melanophryniscus rubriventris (Vellard, 1947). Amphibia-Reptilia 26:193–199 Vellard J (1947) Un nuevo batracio del Norte Argentino: Acta Zool. Lilloana 4:115–119 Woolbright L, Stewart MM (1987) Foraging success of the tropical frog, Eleutherodactylus coqui: The cost of calling. Copeia 1987:69–75 Woodhead C, Vences M, Vieites DR, Gamboni I, Fisher B, Griffiths RA (2007) Specialist or generalist? Feeding ecology of the Malagasy poison frog Mantella aurantiaca. Herp J 17:225–236 doi:10.1186/2193-1801-1-51 Cite this article as: Garraffo et al.: Alkaloids from single skins of the Argentinian toad Melanophryniscus rubriventris (ANURA, BUFONIDAE): An unexpected variability in alkaloid profiles and a profusion of new structures. SpringerPlus 2012 1:51. Submit your manuscript to a journal and benefi t from: 7 Convenient online submission 7 Rigorous peer review 7 Immediate publication on acceptance 7 Open access: articles freely available online 7 High visibility within the fi eld 7 Retaining the copyright to your article Submit your next manuscript at 7 springeropen.com Garraffo et al. SpringerPlus 2012, 1:51 Page 15 of 15 http://www.springerplus.com/content/1/1/51

Title: Alkaloids from single skins of the Argentinian toad Melanophryniscus rubriventris (ANURA, BUFONIDAE): An unexpected variability in alkaloid profiles and a profusion of new structures ​ Authors: H Martin Garraffo, Nirina R Andriamaharavo, Marcos Vaira, María F Quiroga, Cecilia Heit, Thomas F Spande ​ Publisher: SpringerPlus Date: November 23, 2012 ​ Abstract: True, or traction, esophageal diverticulum (TED) is seen in the middle one third of the thoracic esophagus in a peribronchial location, occurs secondary to mediastinal inflammatory lesions such as tuberculosis or histoplasmosis. ​ The resultant desmoplastic reaction in the paraesophageal tissue causes full thickness pinching on the esophageal wall, producing a conical, broad-mouthed true diverticulum. ​ They often project to the right side because subcarinal lymph nodes in this area are closely associated with the right anterior wall of the esophagus. ​ TED usually presents with symptoms such as dysphagia, postural regurgitation, belching, retrosternal pain, heartburn, and epigastric pain. ​ As in patients with pharyngoesophageal (Zenker’s) diverticula, pulmonary symptoms are often present but underestimated in TED patients. ​ These symptoms range from mild nocturnal cough to life-threatening massive aspiration. ​ In this particular report we describe a rare case of TED presenting as a symptomatic upper gastrointestinal bleeding. ​ Diagnostic evaluation of TED includes chest X-ray, barium esophagogram and manometry. ​ A significant proportion of lower esophageal diverticula are associated with motility disorders. ​ Management of TED include treating the underlying cause sometimes a surgical resection of diverticulum along with esophageal myotomy is necessitated in symptomatic patients. ​GC-MS analysis of single-skins of ten Melanophryniscus rubriventris toads (five collections of two toads each) captured during their breeding season in NW Argentina has revealed a total of 127 alkaloids of which 56 had not been previously detected in any frog or toad. ​ Included among these new alkaloids are 23 new diastereomers of previously reported alkaloids. ​ What is particularly distinguishing about the alkaloid profiles of these ten collections is the occurrence of many of the alkaloids, whether known or new to us, in only one of the ten skins sampled, despite two skins being obtained from each breeding site of the five populations. ​ Many of the alkaloids are of classes known to have structures with branched-chains (e.g. ​ pumiliotoxins and tricyclic structures) that are considered to derive from dietary mites. ​ A large number of previously reported and new alkaloids are also of unclassified structures. ​ Only a very few 3,5-disubstituted-indolizidine or -pyrrolizidine alkaloids are observed that have a straight-chain carbon skeleton and are likely derived from ant prey. ​ The possible relationship of these collections made during the toad’s brief breeding episodes to sequestration of dietary arthropods and individual alkaloid profiles is discussed. ​ 


Traction esophageal diverticulum: a rare cause of gastro-intestinal bleeding.pdf

RESEARCH Open Access Traction esophageal diverticulum: a rare cause of gastro-intestinal bleeding Umashankar K Ballehaninna1, Jason P Shaw2 and Igor Brichkov2* Abstract Esophageal diverticula are uncommon lesions that are usually classified according to their location (cervical, thoracic, or epiphrenic), or underlying pathogenesis (pulsion or traction), and their morphology (true or false).The majority of esophageal diverticula are acquired lesions that occur predominantly in elderly adults. Pulsion, or false, diverticula are the most commonly encountered type of esophageal diverticula noticed at the level of cricopharyngeus muscle, occur as a localized outpouchings that lacks a muscular coat, and as such their wall is formed entirely by mucosa and submucosa. True, or traction, esophageal diverticulum (TED) is seen in the middle one third of the thoracic esophagus in a peribronchial location, occurs secondary to mediastinal inflammatory lesions such as tuberculosis or histoplasmosis. The resultant desmoplastic reaction in the paraesophageal tissue causes full thickness pinching on the esophageal wall, producing a conical, broad-mouthed true diverticulum. They often project to the right side because subcarinal lymph nodes in this area are closely associated with the right anterior wall of the esophagus. TED usually presents with symptoms such as dysphagia, postural regurgitation, belching, retrosternal pain, heartburn, and epigastric pain. As in patients with pharyngoesophageal (Zenker’s) diverticula, pulmonary symptoms are often present but underestimated in TED patients. These symptoms range from mild nocturnal cough to life-threatening massive aspiration. In this particular report we describe a rare case of TED presenting as a symptomatic upper gastrointestinal bleeding. Diagnostic evaluation of TED includes chest X-ray, barium esophagogram and manometry. A significant proportion of lower esophageal diverticula are associated with motility disorders. Management of TED include treating the underlying cause sometimes a surgical resection of diverticulum along with esophageal myotomy is necessitated in symptomatic patients. Traction esophageal diverticulum: a rare cause of gastro-intestinal bleeding A 61-year-old male with multiple co-morbidities includ- ing atrial fibrillation managed with beta blockers and anticoagulation presented with recurrent hemetemesis and melena. After resuscitation, an upper endoscopy revealed a large esophageal diverticulum 22 cm from the incisors with ulceration and minimal bleeding (Figure 1). The patient also had recurrent cough and a chest x-ray showed a right upper lobe infiltrate. A subsequent CT scan of the chest suggested an esophageal traction diver- ticulum and erosion into the apical segment of right upper lobe. A barium esophagram confirmed a bronchoesopha- geal fistula (Figures 2 and 3). Simultaneous bronchoscopy and esophagoscopy revealed thick mucoid secretions and a fistula emanating from the esophageal diverticulum. Both endobronchial and esophageal biopsies revealed mu- coid cells and chronic inflammatory changes. In view of this patient’s extensive co-morbidities, nasoesophageal and percutaneous endoscopic gastrostomy tubes were placed to aid healing of the fistula. A repeat contrast study performed after 3 months revealed complete resolution of the fistula and a persistent diverticulum. Traction esophageal diverticula (TED) are true diver- ticula that occur as a result of contracture from chronic inflammation involving mediastinal structures in close proximity to the esophageal wall. Most TEDs occur in the mid esophagus. Common causes include tubercu- losis, histoplasmosis and malignancy (Do Nascimento et al. 2006). TEDs usually present with dysphagia or re- current aspiration. We describe here a rare presentation of upper gastro-intestinal bleeding resulting from * Correspondence: [email protected] 2Department of Thoracic Surgery, Maimonides Medical Center, 4802 10th Avenue 4th Floor, Brooklyn, New York 11219, USA Full list of author information is available at the end of the article a SpringerOpen Journal © 2012 Ballehaninna et al.; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Ballehaninna et al. SpringerPlus 2012, 1:50 http://www.springerplus.com/content/1/1/50 ulceration and fistulization of the TED. Symptomatic TED are managed by local excision of the diverticulum via thoracotomy or thoracoscopy with concomitant treatment of the underlying inflammatory cause. Bronchoesophageal fistulae all require treatment by di- vision of the fistula and reinforcement of the esophageal repair with a pedicled graft (López et al. 2003). Non- operative management with salivary diversion and en- teral feeding may be successful in selected patients who are not candidates for surgical repair. Competing interests The authors declare that they have no competing interests. Authors’ contributions UKB: Designing the study, Collecting, analyzing, and interpreting the data, Writing the report. JS: Making the decision to submit for publication. IB: Designing the study, Collecting, analyzing, and interpreting the data,Writing the report, Making the decision to submit for publication. All authors read and approved the final manuscript. Acknowledgements This article fully meets the requirements of Maimonides Medical Center on informed consent and IRB review. Author details 1Department of Surgery, Maimonides Medical Center, Brooklyn, New York 11219, USA. 2Department of Thoracic Surgery, Maimonides Medical Center, 4802 10th Avenue 4th Floor, Brooklyn, New York 11219, USA. Received: 13 September 2012 Accepted: 8 November 2012 Published: 21 November 2012 References Do Nascimento FA, Lemme EM, Costa MM (2006) Esophageal diverticula: pathogenesis, clinical aspects, and natural history. Dysphagia 21(3):198–205 López A, Rodríguez P, Santana N, Freixinet J (2003) Esophagobronchial fistula caused by traction esophageal diverticulum. Eur J Cardiothorac Surg 23(1):128–130 doi:10.1186/2193-1801-1-50 Cite this article as: Ballehaninna et al.: Traction esophageal diverticulum: a rare cause of gastro-intestinal bleeding. SpringerPlus 2012 1:50. Submit your manuscript to a journal and benefi t from: 7 Convenient online submission 7 Rigorous peer review 7 Immediate publication on acceptance 7 Open access: articles freely available online 7 High visibility within the fi eld 7 Retaining the copyright to your article Submit your next manuscript at 7 springeropen.com Figure 1 An upper GI endoscopy revealed ulcerated esophageal diverticulum with minimal bleeding. Figure 2 CT scan of the chest was suggestive of an esophageal diverticulum communicating with apical segment of right upper lobe. Figure 3 Barium esophagram revealing traction esophageal diverticulum with communication into right upper lobe segmental bronchi. Ballehaninna et al. SpringerPlus 2012, 1:50 Page 2 of 2 http://www.springerplus.com/content/1/1/50 RESEARCH Open Access Traction esophageal diverticulum: a rare cause of gastro-intestinal bleeding Umashankar K Ballehaninna1, Jason P Shaw2 and Igor Brichkov2* Abstract Esophageal diverticula are uncommon lesions that are usually classified according to their location (cervical, thoracic, or epiphrenic), or underlying pathogenesis (pulsion or traction), and their morphology (true or false).The majority of esophageal diverticula are acquired lesions that occur predominantly in elderly adults. Pulsion, or false, diverticula are the most commonly encountered type of esophageal diverticula noticed at the level of cricopharyngeus muscle, occur as a localized outpouchings that lacks a muscular coat, and as such their wall is formed entirely by mucosa and submucosa. True, or traction, esophageal diverticulum (TED) is seen in the middle one third of the thoracic esophagus in a peribronchial location, occurs secondary to mediastinal inflammatory lesions such as tuberculosis or histoplasmosis. The resultant desmoplastic reaction in the paraesophageal tissue causes full thickness pinching on the esophageal wall, producing a conical, broad-mouthed true diverticulum. They often project to the right side because subcarinal lymph nodes in this area are closely associated with the right anterior wall of the esophagus. TED usually presents with symptoms such as dysphagia, postural regurgitation, belching, retrosternal pain, heartburn, and epigastric pain. As in patients with pharyngoesophageal (Zenker’s) diverticula, pulmonary symptoms are often present but underestimated in TED patients. These symptoms range from mild nocturnal cough to life-threatening massive aspiration. In this particular report we describe a rare case of TED presenting as a symptomatic upper gastrointestinal bleeding. Diagnostic evaluation of TED includes chest X-ray, barium esophagogram and manometry. A significant proportion of lower esophageal diverticula are associated with motility disorders. Management of TED include treating the underlying cause sometimes a surgical resection of diverticulum along with esophageal myotomy is necessitated in symptomatic patients. Traction esophageal diverticulum: a rare cause of gastro-intestinal bleeding A 61-year-old male with multiple co-morbidities includ- ing atrial fibrillation managed with beta blockers and anticoagulation presented with recurrent hemetemesis and melena. After resuscitation, an upper endoscopy revealed a large esophageal diverticulum 22 cm from the incisors with ulceration and minimal bleeding (Figure 1). The patient also had recurrent cough and a chest x-ray showed a right upper lobe infiltrate. A subsequent CT scan of the chest suggested an esophageal traction diver- ticulum and erosion into the apical segment of right upper lobe. A barium esophagram confirmed a bronchoesopha- geal fistula (Figures 2 and 3). Simultaneous bronchoscopy and esophagoscopy revealed thick mucoid secretions and a fistula emanating from the esophageal diverticulum. Both endobronchial and esophageal biopsies revealed mu- coid cells and chronic inflammatory changes. In view of this patient’s extensive co-morbidities, nasoesophageal and percutaneous endoscopic gastrostomy tubes were placed to aid healing of the fistula. A repeat contrast study performed after 3 months revealed complete resolution of the fistula and a persistent diverticulum. Traction esophageal diverticula (TED) are true diver- ticula that occur as a result of contracture from chronic inflammation involving mediastinal structures in close proximity to the esophageal wall. Most TEDs occur in the mid esophagus. Common causes include tubercu- losis, histoplasmosis and malignancy (Do Nascimento et al. 2006). TEDs usually present with dysphagia or re- current aspiration. We describe here a rare presentation of upper gastro-intestinal bleeding resulting from * Correspondence: [email protected] 2Department of Thoracic Surgery, Maimonides Medical Center, 4802 10th Avenue 4th Floor, Brooklyn, New York 11219, USA Full list of author information is available at the end of the article a SpringerOpen Journal © 2012 Ballehaninna et al.; licensee Springer. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Ballehaninna et al. SpringerPlus 2012, 1:50 http://www.springerplus.com/content/1/1/50 ulceration and fistulization of the TED. Symptomatic TED are managed by local excision of the diverticulum via thoracotomy or thoracoscopy with concomitant treatment of the underlying inflammatory cause. Bronchoesophageal fistulae all require treatment by di- vision of the fistula and reinforcement of the esophageal repair with a pedicled graft (López et al. 2003). Non- operative management with salivary diversion and en- teral feeding may be successful in selected patients who are not candidates for surgical repair. Competing interests The authors declare that they have no competing interests. Authors’ contributions UKB: Designing the study, Collecting, analyzing, and interpreting the data, Writing the report. JS: Making the decision to submit for publication. IB: Designing the study, Collecting, analyzing, and interpreting the data,Writing the report, Making the decision to submit for publication. All authors read and approved the final manuscript. Acknowledgements This article fully meets the requirements of Maimonides Medical Center on informed consent and IRB review. Author details 1Department of Surgery, Maimonides Medical Center, Brooklyn, New York 11219, USA. 2Department of Thoracic Surgery, Maimonides Medical Center, 4802 10th Avenue 4th Floor, Brooklyn, New York 11219, USA. Received: 13 September 2012 Accepted: 8 November 2012 Published: 21 November 2012 References Do Nascimento FA, Lemme EM, Costa MM (2006) Esophageal diverticula: pathogenesis, clinical aspects, and natural history. Dysphagia 21(3):198–205 López A, Rodríguez P, Santana N, Freixinet J (2003) Esophagobronchial fistula caused by traction esophageal diverticulum. Eur J Cardiothorac Surg 23(1):128–130 doi:10.1186/2193-1801-1-50 Cite this article as: Ballehaninna et al.: Traction esophageal diverticulum: a rare cause of gastro-intestinal bleeding. SpringerPlus 2012 1:50. Submit your manuscript to a journal and benefi t from: 7 Convenient online submission 7 Rigorous peer review 7 Immediate publication on acceptance 7 Open access: articles freely available online 7 High visibility within the fi eld 7 Retaining the copyright to your article Submit your next manuscript at 7 springeropen.com Figure 1 An upper GI endoscopy revealed ulcerated esophageal diverticulum with minimal bleeding. Figure 2 CT scan of the chest was suggestive of an esophageal diverticulum communicating with apical segment of right upper lobe. Figure 3 Barium esophagram revealing traction esophageal diverticulum with communication into right upper lobe segmental bronchi. Ballehaninna et al. SpringerPlus 2012, 1:50 Page 2 of 2 http://www.springerplus.com/content/1/1/50

Title: Traction esophageal diverticulum: a rare cause of gastro-intestinal bleeding ​ Authors: Umashankar K Ballehaninna, Jason P Shaw, Igor Brichkov Publisher: SpringerPlus Date: 2012-11-21 00:00:00 Abstract: Esophageal diverticula are uncommon lesions that are usually classified according to their location (cervical, thoracic, or epiphrenic), or underlying pathogenesis (pulsion or traction), and their morphology (true or false). ​ The majority of esophageal diverticula are acquired lesions that occur predominantly in elderly adults. ​ Pulsion, or false, diverticula are the most commonly encountered type of esophageal diverticula noticed at the level of cricopharyngeus muscle, occur as localized outpouchings that lacks a muscular coat, and as such their wall is formed entirely by mucosa and submucosa. ​

Exploring high corrosion-resistant refractory high-entropy alloy via a combined experimental and simulation study.pdf

npj | materials degradation Article Published in partnership with CSCP and USTB https://doi.org/10.1038/s41529-024-00495-1 Exploring high corrosion-resistant refractory high-entropy alloy via a combined experimental and simulation study Check for updates Xinpeng Zhao1, Haiyou Huang1,2 , Yanjing Su1,2, Lijie Qiao1,2 & Yu Yan 1,2 Refractory high-entropy alloys (HEAs) have attracted considerable attention due to their stable phase structure and excellent high-temperature properties. In this work, we performed first-principles calculations, coupled with experiments, to explore HEAs with high corrosion resistance. The results revealed that TiNbTa-based HEAs exhibited a lower tendency for corrosion. However, the appearance of local chemical fluctuations (LCFs) increased the corrosion tendency of TiNbTa-based HEAs. Comprehensive SHapley Additive exPlanations analyses uncovered that in a sample with configurational LCFs, the atomic order near the surface was altered. Therefore, corrosion behavior was affected. Based on experiments, the annealed samples exhibited typical chemical segregation and declined corrosion resistance. High-entropy alloys (HEAs) have attracted increasing attention due to their disordered atomic structure, exhibiting numerous desirable properties that cannot be achievable by traditional alloys1–3. The elevated configurational entropy in HEAs plays a pivotal role in stabilizing the formation of simple solid solution phases while impeding the development of detrimental intermetallic compounds4,5. The demand for new structural alloys with commendable mechanical properties and excellent corrosion resistance is particularly pronounced in application sectors such as aerospace, clean power,and biomedicalindustries.RefractoryHEAs,composed of refractory metals, generally exhibit superior mechanical properties and resistance to general corrosion6–8, presenting promising prospects for diverse applica- tions. Several refractory HEAs have demonstrated significant potential due to their remarkable strength. For example, during room temperature deformation, HEAs such as NbMoTaW and VNbMoTaW alloys have shown high yield stress values of 1058 and 1246 MPa, respectively9. Recent studies have shown that exploration of chemical heterogeneity during the heat treatment process, such as short-range order and local chemical fluc- tuations (LCFs), has opened up a new avenue for the development of high- strength HEAs10–12. A recent study reported evidence of consequential effects in NiCoCr, with the yield strength further increasing by 76% after annealing at 2073 K for 24 h13. When the annealing duration of the TiZrHfNb alloy at 673 K was prolonged to 40 h, the hardness increased by 25%14. Meanwhile, LCFs could lower the configurational entropy from its maximum value, corresponding to a random alloy, and change the expressions for free energy. LCFs was also found to decrease the enthalpy of the system, influencing defect energetics and potentially affecting physical properties. Consequently, chemical heterogeneity may affect the corrosion properties of HEAs. It is well known that chemical heterogeneity is the primary cause of localized galvanic corrosion. Compared with a chemically homogeneous single-phase solid solution, the occurrence of elemental segregation beha- vior leads to the formation of different electrochemical potential regions within the alloy, which undoubtedly significantly increases its sensitivity to corrosion15. However, it is worth noting that certain chemical hetero- geneities can enhance the corrosion resistance of an alloy. Taking the NiCoVAlx alloy as an example, an increase in the content of Al leads to a higher proportion of the B2 phase, which has a higher Volta potential, thereby improving the overall corrosion resistance of the alloy16. Since the emergence of LCFs is widely considered to be the origin of elemental segregation17, it is particularly important to conduct in-depth research on the impact of LCFs on the corrosion performance of alloys. However, only a few studies have reported on the corrosion behavior of refractory HEAs, with a significant gap in research on the effect of LCFs on corrosion properties. Equiatomic TiZr(Hf, Ta, Nb) medium entropy alloys have been developed to achieve superiorcorrosion resistance compared with pure Ti18. MoNbTaTiZr HEAs have exhibited a distinctive combination of friction 1Institute for Advanced Materials and Technology, University of Science and Technology Beijing, Beijing, 100083, China. 2Beijing Advanced Innovation Center for Materials Genome Engineering, University of Science and Technology Beijing, Beijing, 100083, China. e-mail: [email protected]; [email protected] npj Materials Degradation | (2024) 8:77 1 1234567890():,; 1234567890():,; and corrosion resistance, outstanding mechanical properties, and bio- compatibility, positioning them as potential bioimplants19. Recently, non- equiatomic TiNbTaZrMo HEAs with good biocompatibility have been designed20. Consequently, non-equiatomic HEAs, with extensive and unexplored composition spaces, present an opportunity to obtain highly corrosion-resistant alloys. However, systematic research on the effect of various elements and the corrosion resistance of refractory HEAs has remained insufficient, creating a bottleneck in designing corrosion-resistant HEAs.Theabilityto freelyadjustalloycompositioninHEAs,resultinginan enormous composition space, significantly complicates the determination of corrosion resistance of new materials. Therefore, an efficient and rapid forecasting method for corrosion resistance is urgently needed to guide experimental synthesis. The Monte Carlo (MC) molecular dynamics (MD) simulation method has proven useful for chemical heterogeneity investigations21,22. However, limitationsinpotentialavailabilitymakeitchallengingtosimulateinvarious composition models using the MD/MC method. Reliable interatomic potentials are considered essential for MD simulations23. However, only a limited numberof potentialshave beendeveloped forHEAs, due to the brief history of HEAs and the substantial workload required to develop multi- elemental interatomic potentials. Density functional theory (DFT) has emerged as a promising solution for addressing this challenge, as it can handle multi-elemental systems24,25. The effect of chemical heterogeneity on the mechanical properties of HEAs has been extensively investigated via the DFT/MC method26,27, indicating that it will have a significant effect on critical parameters, notably the stacking-fault energy26 and dislocation mobility27. In this work, we elucidated the chemical heterogeneity and corrosion resistance of Ti(Nb,Zr)(Zr,Nb,Ta)(Ta,Ha,V,Cr,Mo,W) quaternary refrac- toryHEAsthroughacombinationofMCsimulationsand experiments.The effectofLCFsonthecorrosionbehaviorofrefractoryHEAswasinvestigated using the DFT/MC method to determine the reasons for corrosion resis- tance variations. Results and discussion Generation of appropriate surface structures The calculated formation energies for the (110) surfaces of the bcc and (111) surfaces of the fcc in 16 refractory HEAs are presented in Fig. 1, namely TiNbTaCr (TNTC), TiNbTaHf (TNTH), TiNbTaMo (TNTM), TiNbTaV (TNTV), TiNbTaW (TNTW), TiZrNbCr (TZNC), TiZrNbHf (TZNH), TiZrNbMo (TZNM), TiZrNbTa (TZNT), TiZrNbV (TZNV), TiZrNbW (TZNW), TiZrTaCr (TZTC), TiZrTaHf (TZTH), TiZrTaMo (TZTM), TiZrTaV (TZTV), and TiZrTaW (TZTW). A substantial number of atoms in the bcc and fcc slab structures had been observed, and the calculated formation energies highlighted the stability of the generated structures. The bcc structure, with the lowest formation energy, was selected for corrosion behavior studies. Following electronic self-consistent calculations, the magnetic character of the initially set magnetic alloying element Cr per- sisted, while other systems became non-magnetic. Therefore, in subsequent calculations, only the magnetism of the alloying element Cr was considered. To computationally examine the effect of local chemical order on the corrosion behavior of these refractory HEAs, realistic models in the system were developed. Previous studies employed a systematic cluster expansion approach to explore local chemical heterogeneity in the TiZrNb, TiZrHfNb, and TiZrHfNbTa bcc refractory HEAs28. Although these studies indicated that LCFs were expected to affect the mechanical properties, no systematic study has been conducted encompassing all refractory elements to explain the effect on the corrosion behavior of refractory HEAs. In this work, the DFT/MC method was employed to develop models for refractory HEAs solid solutions with varying degrees of LCFs. The most significant trends in potentialenergychangebasedontheDFT-basedMCsimulationsareshown in Fig. 2a. Despite the relatively small number of swap trials per atom compared with classical MC simulations, the potential energy curves appeared to converge. The appearance of LCFs reduced the free energy primarily by lowering the formation energy with a range from 38 to 447 meV per atom. Simul- taneously, it had a significant effect on the microstructure of the alloy. To describe the trends in local chemical ordering obtained by the MC simu- lations, we employed Warren-Cowley parameter (WCP) to characterize. A positive value of WCP indicated that the atomic pair was unfavorable, while a negative value indicated that the atomic pair was favorable. The resulting indicatedthesegregationofdifferentelements,withsomeelementsshowing significantly stronger segregation than others. This tendency was captured by the WCP in Fig. 2b–d, where some elements had a propensity to form clusters, and others favored neighbors of other types. As shown in Fig. 2b, therewasastrongtendencytoformX-Tapairs(WCP < 0)inTiNbTa-based HEAs, except for Hf. By contrast, the Ti-X and X-X pairs were unfavorable (WCP > 0). However, the results showed that the Ti-Hf pair was favorable (WCP=−0.71),whiletheHf-Tapairwasunfavorable(WCP = 0.44),which was attributed to the large atomic size of Hf, leading to segregation on the surface. Similar trends were also observed for the TiZrNb-based HEAs, where the Nb-X pair was favored (WCP < 0), and Zr-Cr, Zr-Mo, Zr-V, and Ti-Hf exhibited a strong trend to form pairs. Preferred atomic pairings betweenX-Ta,Ti-Hf,Zr-Cr,Zr-Mo,andZr-VwereobservedintheTiZrTa- based HEAs as the WCP values were negative, confirming the energetic preference in the refractory alloys. Therefore, this result provided another perspective for understanding the corrosion behavior of refractory HEAs. Thus, the experimental identification of chemical heterogeneity in the refractory HEAs requires further investigation. Work function effects of refractory HEAs A high surface work function, derived from the electron potential energy, typically indicates a high corrosion potential and corrosion resistance for materials according to traditional theory29–31. For refractory HEAs with random compositional disorder, the calculated values of the work function are shown in Fig. 3a. The calculated work function values for different samples displayed a large range,spanning from 3.95 to 4.57 eV. Notably, the group of TiNbTa-based refractory HEAs exhibited a higher work function, suggesting potentially better corrosion resistance compared to the other two groups. The work function in the refractory HEAs could be quantitatively correlated with the degree of LCFs, reflected by the total nonproportional number of local atomic pairs, WCPsum, as shown in Fig. 3b–d. For most HEAs, the work function was smaller in the more ordered sample, and a lower work function implied a higher probability of electron loss and a Fig. 1 | Calculated formation energies for the (110) surfaces of the bcc and (111) surfaces of the fcc in various refractory HEAs. The squares and diamonds repre- sent the formation energies, with the former excluding and the latter including the initial magnetic properties of the elements in considered. The red line and the blue line respectively denote the bcc and fcc structures of the various refractory HEAs. https://doi.org/10.1038/s41529-024-00495-1 Article npj Materials Degradation | (2024) 8:77 2 auxiliary electrode. The samples were mounted in contact with copper wire embedded in epoxy resin, then polished, degreased in alcohol, cleaned, and dried in warm air. Prior to the potentiodynamic polarization scan tests, cathodicpre-polarizationat−1.0VSCEfor600 swasappliedtospontaneously remove the air-formed oxides. Subsequently, the open circuit potential was measured for 30 min to ensure a steady-state potential. Potentiodynamic polarization curves were obtained ata scanning rate of 1 mV/s from an initial potential of −0.6 VSCE versus Ecorr to a final potential of 1 VSCE. A transmission electron microscope (TEM, FEI Talos F200X) equip- ped with an energy dispersive spectrometer (EDS) was used to further analyze the nanoscale microstructure in the HEAs. Data availability The raw/processed data required to reproduce these findings can be obtained by contacting the corresponding author. Code availability Thecoderequiredtoreproducethesefindingscanbeobtainedbycontacting the corresponding author. Received: 7 May 2024; Accepted: 7 July 2024; References 1. Ma,C. L., Li, J. G., Tan, Y., Tanaka, R.& Hanada, S. Microstructureand mechanical properties of Nb/Nb5Si3 in situ composites in Nb–Mo–Si and Nb–W–Si systems. Mater. Sci. Eng. A 386, 375–383 (2004). 2. Miracle, D. B. & Senkov, O. N. A critical review of high entropy alloys and related concepts. Acta Mater. 122, 448–511 (2017). 3. Li, T. et al. CALPHAD-aided design for superior thermal stability and mechanical behavior in a TiZrHfNb refractory high-entropy alloy. Acta Mater. 246, 118728 (2023). 4. DiStefano, J. R. & Hendricks, J. W. Oxidation rates of niobium and tantalum alloys at low pressures. Oxid. Met. 41, 365–376 (1994). 5. Kim, B. G., Kim, G. M. & Kim, C. J. Oxidation behavior of TiAl-X (X= Cr, V, Si, Mo or Nb) intermetallics at elevated temperature. Scr. Metall. Mater. 33, 1117–1125 (1995). 6. Senkov, O. N., Miracle, D. B., Chaput, K. J. & Couzinie, J. P. Development and exploration of refractory high entropy alloys—A review. J. Mater. Res. 33, 3092–3128 (2018). 7. Zhou, Q. et al. Corrosion behavior of Hf0.5Nb0.5Ta0.5Ti1.5Zr refractory high-entropy in aqueous chloride solutions. Electrochem. Commun. 98, 63–68 (2019). 8. Yang, W., Liu, Y., Pang, S., Liaw, P. K. & Zhang, T. Bio-corrosion behavior and in vitro biocompatibility of equimolar TiZrHfNbTa high- entropy alloy. Intermetallics 124, 106845 (2020). 9. Senkov, O. N., Wilks, G. B., Scott, J. M. & Miracle, D. B. Mechanical properties of Nb25Mo25Ta25W25 and V20Nb20Mo20Ta20W20 refractory high entropy alloys. Intermetallics 19, 698–706 (2011). 10. Lei, Z. et al. Enhanced strength and ductility in a high-entropy alloy via ordered oxygen complexes. Nature 563, 546–550 (2018). 11. Schuh,B. et al. Thermodynamic instability of a nanocrystalline, single- phase TiZrNbHfTa alloy and its impact on the mechanical properties. Acta Mater. 142, 201–212 (2018). 12. Huang, X. et al. Atomistic simulation of chemical short-range order in HfNbTaZr high entropy alloy based on a newly-developed interatomic potential. Mater. Des. 202, 109560 (2021). 13. Maiti, S. & Steurer, W. Structural-disorder and its effect on mechanical properties in single-phase TaNbHfZr high-entropy alloy. Acta Mater. 106, 87–97 (2016). 14. Wang, S. D. et al. Chemical short-range ordering and its strengthening effect in refractory high-entropy alloys. Phys. Rev. B 103, 104107 (2021). 15. Zhang, J. Y. et al. High-entropy alloys: a critical review of aqueous corrosion behavior and mechanisms. High. Entropy Alloy. Mater. 1, 1–65 (2023). 16. Pan, Z. et al. Tailoring microstructure and corrosion behavior of CoNiVAlx medium entropy alloys via Al addition. Corros. Sci. 207, 110570 (2022). 17. Leong, Z., Ramamurty, U. & Tan, T. L. Microstructural and compositional design principles for Mo-V-Nb-Ti-Zr multi-principal element alloys: a high-throughput first-principles study. Acta Mater. 213, 116958 (2021). 18. Wang, Z. et al. Corrosion and tribocorrosion behavior of equiatomic refractory medium entropy TiZr(Hf, Ta, Nb) alloys in chloride solutions. Corros. Sci. 199, 110166 (2022). 19. Shittu, J. et al. Biocompatible high entropy alloys with excellent degradation resistance in a simulated physiological environment. ACS Appl. Bio. Mater. 3, 8890–8900 (2020). Fig. 10 | TEM results of the Ti-rich regions in the annealed TiNbTaMo. a High magnification EDS element distribution mapping; b TEM dark-field image showing the precipitates; c concentration profiles along the LS1, as depicted in panel b; and d high-resolution TEM image of the precipitate region, and associated FFT images for the R1 and R2 regions. https://doi.org/10.1038/s41529-024-00495-1 Article npj Materials Degradation | (2024) 8:77 9 20. Hori, T., Nagase, T., Todai, M., Matsugaki, A. & Nakano, T. Development of non-equiatomic Ti-Nb-Ta-Zr-Mo high-entropy alloys for metallic biomaterials. Scr. Mater. 172, 83–87 (2019). 21. Ding, Q. et al. Tuning element distribution, structure and properties by composition in high-entropy alloys. Nature 574, 223–227 (2019). 22. Chen, S. et al. Simultaneously enhancing the ultimate strength and ductility of high-entropy alloys via short-range ordering. Nat. Commun. 12, 4953 (2021). 23. Cao, G. et al. Liquid metal for high-entropy alloy nanoparticles synthesis. Nature 619, 1–5 (2023). 24. Tamm, A., Aabloo, A., Klintenberg, M., Stocks, M. & Caro, A. Atomic- scale properties of Ni-based FCC ternary, and quaternary alloys. Acta Mater. 99, 307–312 (2015). 25. Yin, S., Ding, J., Asta, M. & Ritchie, R. O. Ab initio modeling of the energy landscapefor screwdislocationsin body-centered cubic high- entropy alloys. npj Comput. Mater. 6, 110 (2020). 26. Ding, J., Yu, Q., Asta, M. & Ritchie, R. O. Tunable stacking fault energies by tailoring local chemical order in CrCoNi medium-entropy alloys. Proc. Natl Acad. Sci. 115, 8919–8924 (2018). 27. Li, Q. J., Sheng, H. & Ma, E. Strengthening in multi-principal element alloys with local-chemical-order roughened dislocation pathways. Nat. Commun. 10, 3563 (2019). 28. Xun, K. et al. Local chemical inhomogeneities in TiZrNb-based refractory high-entropy alloys. J. Mater. Sci. Technol. 135, 221–230 (2023). 29. Guillaumin, V., Schmutz, P. & Frankel, G. S. Characterization of corrosion interfaces by the scanning Kelvin probe force microscopy technique. J. Electrochem. Soc. 148, B163 (2001). 30. Li, W. & Li, D. Y. Variations of work function and corrosion behaviors of deformed copper surfaces. Appl. Surf. Sci. 240, 388–395 (2005). 31. Tao, S. & Li, D. Y. Nanocrystallization effect on the surface electron work function of copper and its corrosionbehaviour.Philos. Mag. Lett. 88, 137–144 (2008). 32. Gong, S. et al. Calibrating DFT formation enthalpy calculations by multifidelity machine learning. JACS Au 2, 1964–1977 (2022). 33. Lu, T., Li, H., Li, M., Wang, S. & Lu, W. Inverse design of hybrid organic–inorganic perovskites with suitable bandgaps via proactive searching progress. ACS omega 7, 21583–21594 (2022). 34. Breiman, L. Random forests. Mach. Learn. 45, 5–32 (2021). 35. Svetnik,V. et al. Randomforest: a classification and regression tool for compound classification and QSAR modeling. J. Chem. Inf. Comput. Sci. 43, 1947–1958 (2003). 36. Loh, W. Y. Classification and regression trees. Wiley Interdiscip. Rev. 1, 14–23 (2011). 37. Cutler, A., Cutler, D. R. & Stevens, J. R. Random Forests. In Ensemble Machine Learning (ed. Zhang, C. & Ma, Y.) 157-175 (Springer, 2012). 38. Loh, W. Y. Fifty years of classification and regression trees. Int. Stat. Rev. 82, 329–348 (2014). 39. Lundberg, S. M. et al. From local explanations to global understanding with explainable AI for trees. Nat. Mach. Intell. 2, 56–67 (2020). 40. Osei-Agyemang, E. & Balasubramanian, G. Surface oxidation mechanism of a refractory high-entropy alloy. npj Mater. Degrad 3, 20 (2019). 41. Searson, P., Nagarkar, P. & Laianision, R. The effect of density of states, work function and exchange integral of polycrystalline and single crystal surfaces on the hydrogen evolution reaction. Int. J. Hydrog. Energy 14, 131–136 (1989). 42. Kadowaki, M. et al. First-principles analysis of the inhibitive effect of interstitial carbon on an active dissolution of martensitic steel. Corros. Sci. 163, 108251 (2020). 43. Chen, S. et al. Chemical-affinity disparity and exclusivity drive atomic segregation, short-range ordering, and cluster formation in high- entropy alloys. Acta Mater. 206, 116638 (2021). 44. Chen, X. et al. Direct observation of chemical short-range order in a medium-entropy alloy. Nature 592, 712–716 (2021). 45. Walsh, F., Zhang, M., Ritchie, R. O., Minor, A. M. & Asta, M. Extra electron reflections in concentrated alloys do not necessitate short- range order. Nat. Mater. 22, 926–929 (2021). 46. Byggmästar, J., Nordlund, K. & Djurabekova, F. Modeling refractory high-entropy alloys with efficient machine-learned interatomic potentials: Defects and segregation. Phys. Rev. B 104, 104101 (2021). 47. Saroukhani, S. & Warner, D. H. Investigating dislocation motion through a field of solutes with atomistic simulations and reaction rate theory. Acta Mater. 128, 77–86 (2017). 48. Ding, Q. et al. Ritchie, Real-time nanoscale observation of deformation mechanisms in CrCoNi-based medium- to high-entropy alloys at cryogenic temperatures. Mater. Today 25, 21–27 (2019). 49. Tong, Y. et al. Severe local lattice distortion in Zr-and/or Hf-containing refractorymulti-principalelementalloys.ActaMater.183,172–181(2020). 50. Fantin, A. et al. Short-range chemical order and local lattice distortion in a compositionally complex alloy. Acta Mater. 193, 329–337 (2020). 51. Liu, X. & Curtin, W. A. Atomistic simulations reveal strength reductions due to short-range order in alloys. Acta Mater. 263, 119471 (2024). 52. Hastings, W. K. Monte Carlo sampling methods using Markov chains and their applications. Biometrika 57, 97–109 (1970). 53. Kohn, W. & Sham, L. J. Self-consistent equations including exchange and correlation effects. Phys. Rev. 140, A1133 (1965). 54. Kresse, G. & Hafner, J. Ab initio molecular dynamics for open-shell transition metals. Phys. Rev. B 48, 13115 (1993). 55. Kresse, G. & Furthmüller, J. Efficient iterative schemes for ab initio total-energy calculations using a plane-wave basis set. Phys. Rev. B 54, 11169 (1996). 56. Blöchl, P. E. Projector augmented-wave method. Phys. Rev. B 50, 17953 (1994). 57. Perdew, J. P., Burke, K. & Ernzerhof, M. Generalized gradient approximation made simple. Phys. Rev. Lett. 77, 3865 (1996). 58. Monkhorst, H. J. & Pack, J. D. Special points for Brillouin-zone integrations. Phys. Rev. B 13, 5188 (1976). 59. Kresse, G. & Joubert, D. From ultrasoft pseudopotentials to the projector augmented-wave method. Phys. Rev. B 59, 1758 (1999). 60. Cowley, J. M. X-ray measurement of order in single crystals of Cu3Au. J. Appl. Phys. 21, 24–30 (1950). Acknowledgements This research was funded by the Guangdong Province Key Area R&D Program (Grant nos. 2019B030302011 and 2019B010940001), the National Natural Science Foundation of China (Grant no. 52371050), and the China National Nuclear. Corporation (Grant no. WDZC-2023-AW-0303). Author contributions XinpengZhao:Conceptualization,Datacuration,Investigation,Writing-original draft, Writing-review & editing; Haiyou Huang: Conceptualization, Data cura- tion, Investigation, Methodology, Supervision, Validation, Funding acquisition, Writing-review & editing; Yanjing Su: Data curation, Writing-review; Lijie Qiao: Conceptualization, Investigation, Writing-review & editing; Yu Yan: Super- vision, Project administration, Funding acquisition, Writing-review & editing. Competing Interests The authors declare no competing interests. Additional information Correspondence and requests for materials should be addressed to Haiyou Huang or Yu Yan. Reprints and permissions information is available at http://www.nature.com/reprints Publisher’s note Springer Nature remains neutral withregardtojurisdictional claims in published maps and institutional affiliations. https://doi.org/10.1038/s41529-024-00495-1 Article npj Materials Degradation | (2024) 8:77 10 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. © The Author(s) 2024 https://doi.org/10.1038/s41529-024-00495-1 Article npj Materials Degradation | (2024) 8:77 11

Title: Exploring high corrosion-resistant refractory high-entropy alloy via a combined experimental and simulation study Authors: Xinpeng Zhao, Haiyou Huang, Yanjing Su, Lijie Qiao, Yu Yan Publisher: Published in partnership with CSCP and USTB ​ Date: 2024-07-07 00:00:00 Abstract: Refractory high-entropy alloys (HEAs) have attracted considerable attention due to their stable phase structure and excellent high-temperature properties. ​ In this work, we performed first-principles calculations, coupled with experiments, to explore HEAs with high corrosion resistance. ​ The results revealed that TiNbTa-based HEAs exhibited a lower tendency for corrosion. ​ However, the appearance of local chemical fluctuations (LCFs) increased the corrosion tendency of TiNbTa-based HEAs. ​ Comprehensive SHapley Additive exPlanations analyses uncovered that in a sample with configurational LCFs, the atomic order near the surface was altered. ​ Therefore, corrosion behavior was affected. ​ Based on experiments, the annealed samples exhibited typical chemical segregation and declined corrosion resistance.

Inspiration4 data access through the NASA Open Science Data Repository.pdf

npj | microgravity Brief communication Published in cooperation with the Biodesign Institute at Arizona State University, with the support of NASA https://doi.org/10.1038/s41526-024-00393-5 Inspiration4 data access through the NASA Open Science Data Repository Check for updates Lauren M. Sanders 1,2, Kirill A. Grigorev1,2, Ryan T. Scott 1,3, Amanda M. Saravia-Butler1,3, San-huei Lai Polo 1,3, Rachel Gilbert 1,3, Eliah G. Overbey 4,5,6, JangKeun Kim 4,5, Christopher E. Mason 4,5,7 & Sylvain V. Costes 1 The increasing accessibility of commercial and private space travel necessitates a profound understanding of its impact on human health. The NASA Open Science Data Repository (OSDR) provides transparent and FAIR access to biological studies, notably the SpaceX Inspiration4 (I4) mission, which amassed extensive data from civilian astronauts. This dataset encompasses omics and clinical assays, facilitating comprehensive research on space-induced biological responses. These data allow for multi-modal, longitudinal assessments, bridging the gap between human and model organism studies. Crucially, community-driven data standards established by NASA’s OSDR Analysis Working Groups empower artificial intelligence and machine learning to glean invaluable insights, guiding future mission planning and health risk mitigation. This article presents a concise guide to access and analyze I4 data in OSDR, including programmatic access through GLOpenAPI. This pioneering effort establishes a precedent for post-mission health monitoring programs within space agencies, propelling research in the burgeoning field of commercial space travel’s impact on human physiology. The increased accessibility of commercial and private spaceflight travel has made it imperative to understand the short- and long-term effects of space stressors on human health. The NASA Open Science Data Repository (OSDR)1–3providesopenandFAIR4accesstospaceflightandspace-relevant biological studies from the past decades. Research enabled by OSDR data has revealed a complex network of molecular and physiological effects of spaceflight across living systems, from microbes to plants to mammals (https://osdr.nasa.gov/bio/data/publications.html). Most prior research using OSDR data has focused on model organisms such as rodents, worms, and fruit flies. These valuable measurements provide insight into the response of neuromuscular, immune, and developmental biosystems to the stressors and hazards of spaceflight. Integrating human in vivo data takes these studies one step further and map previously characterized model organisms’ biological responses to the limited knowledge on human phy- siology in space. The 2021 SpaceX Inspiration4 (I4) mission collected a com- prehensive atlas of biological measurements from four civilian astronauts, providing a wealth of data to characterize the effects of spaceflight on the human body. In the current special Nature package titled “The Second Space Age: Omics, Platforms, and Medicine Across Orbits,” a wide battery of analyses of these data have already provided valuable insights (Mason et al., Nature. 2023). The I4 mission stands as a significant milestone,amassing an extensive collection of biological measurements from four civilian astronauts, thereby adding an invaluable series of datasets for deciphering the repercussions of spaceflight on human health. The open access of these datasets in the NASA OSDR provides a unique opportunity for the scientific community, citizen scientists, researchers, and students to continue using OSDR resources to further unlock profound insights into the consequences of space travel on the human body. In this short article, we guide the readers on how to best conduct future analysis by presenting a series of vignettes illustrating pathways for accessing metadata and data from this rich resource through OSDR. We hope these guidelines will help the community contribute fur- therto the vast compendium of findings already published from OSDR data and enable new hypotheses to be tested with both the human and model organism data. 1Space Biosciences Research Branch, NASA Ames Research Center, Moffett Field, CA, USA. 2Blue Marble Space, Seattle, WA, USA. 3KBR, Houston, TX, USA. 4Department of Physiology and Biophysics, Weill Cornell Medicine, New York, NY, USA. 5The HRH Prince Alwaleed Bin Talal Bin Abdulaziz Alsaud Institute for Computational Biomedicine, Weill Cornell Medicine, New York, NY, USA. 6Center for STEM, University of Austin, Austin, TX, USA. 7The WorldQuant Initiative for Quantitative Prediction, Weill Cornell Medicine, New York, NY, USA. e-mail: [email protected] npj Microgravity | (2024) 10:56 1 1234567890():,; 1234567890():,; Compared to traditional model organisms used for research, one unique aspect of these data is the breadth of longitudinal measurements available from several human astronauts. Such temporal information for several individuals is unprecedented and pushes further the well-known “NASA’s Twin Study”5 where a single astronaut was monitored over 340 days on the international space station, referred to as a “N of 1” experiment. In contrast, even though the duration of the I4 mission was much shorter (3 days), it was at a higher altitude (590 km vs. 420 km), and since it featured four individuals monitored with such biological depth, the data opens the door to new and innovative follow-up studies (e.g. Polaris Dawn missions). Incorporating environmental data with microbiome data and a wide variety of phenotypic and high-throughput sequencing assays provides a rare opportunity for multi-modal, longitudinal assessment of short-term and long-term spaceflight effects on humans. These datasets also provide a much-needed abilityto compare human spaceflight effects to the previously characterized spaceflight consequences in model organisms. The analyses conducted thus far on the I4 mission’s data have already yielded substantial revelations, shedding light on the intricate interplay between space stressors and the immune system, cell-specific responses to spaceflight, rapid microbial interchange of the crew, and detailed maps of the changes in the skin from astronauts (Overbey et al., Nature 2023; Tierney et al., Nature Microbiology 2023; Kim et al., Nature 2023). These analyses demonstrate the great potential of these data for future knowledge. The inclusion of multi-modal data, suchas the blood datasets, which cover a diverse array of measurements (OSD-569, −570, −571, −575), also pre- sents an exciting avenue for future exploration. This broader scope for analysis could unveil deeper connections between different biological responses and offer a more comprehensive understanding of the body’s adaptations to the space environment. Combining omics and medical assay dataisthefirststeptounderstandingthebiologicalsignificanceofintegrated findings. Translating them into actionable insights for space health will be our next step, which remains challenging but, for the first time, attainable. Looking ahead, integrating artificial intelligence and machine learning (AI/ML) in the analysis of biomedical data from the I4 mission also holds great promise. With all OSDR data accessible in a cloud-based public repository, standardized metadata, and a robust API query system, this effort demonstrates AI readiness and empowers our user community to explore beyond current findings. The sheer volume and complexity of the data call for advanced computational approaches that can uncoverpatterns, correlations, and anomalies that might otherwise remain hidden. Powerful techniques, such as machine learning and deep learning, hold the potential to extractmeaningful but complex insights from the vast dataset, facilitating the identification of subtle trends and potential health risks associated with space travel. NASA OSDR’s commitment to FAIR practices ensures that researchers across the globe can harness the power of AI to conduct cutting- edgeanalyses, fostering collaborationand accelerating the pace of discovery. Finally, this work sets a precedent for space agencies to establish compre- hensive, post-mission health monitoring programs, incorporating omics and medical assay data, while informing future mission planning and health risk mitigation strategies. Methods In the realm of scientific inquiry involving I4 data, it is imperative to note that publicly accessible information pertains solely to processed data, given that raw data pertaining to individual human subjects, encompassing genetic sequence data among other facets, necessitate an application pro- cedure that mandates approval from an ethical oversight board for access. The protocol for controlled data access has been meticulously devised, drawing inspiration from established guidelines within the Database of Genotypes and Phenotypes (dbGAP) and incorporating best practices derived from the United Kingdom Biobank. This comprehensive frame- work encompasses an expansive array of data and sample categories, as illustrated in Fig. 1. These data are captured across eight studies, delineated by tissue and sample type, and includes omics assays such as direct RNA sequencing (RNA-seq), single nuclei ATAC-seq and RNA-seq, metagenomics/meta- transcriptomics, spatial transcriptomics, and proteomics to comprehensive metabolic and immune panels. Moreover, clinical assays for blood profiling, suchascompletebloodcount(CBC)andmetabolicpanels,arealsoincluded in the data resource. All subjects were consented at an informed consent briefing (ICB) at SpaceX (Hawthorne, CA), and samples were collected and processed under the approval of the Institutional Review Board (IRB) at Weill Cornell Medicine, under Protocol 21-05023569. All crew members have consented for data and sample sharing. Reporting summary Further information on research design is available in the Nature Research Reporting Summary linked to this article. Data records For illustration purposes, a single dataset will be used as an example for researcher access of I4 data from OSDR: OSD-572, which holds Fig. 1 | Overview of available I4 data in OSDR across 10 studies separated by tissue. I4 mission data are separated into 10 OSD studies based on sample/tissue type as shown above. For each OSD, the associated omics and non-omics data are listed under the GLDS-ID (light gray) and LSDS-ID (dark gray), respectively. The time points samples were collected for each OSD are color-coded in the I4 mission timeline at the top. L Launch, F Flight, R Return, d Days. https://doi.org/10.1038/s41526-024-00393-5 Brief communication npj Microgravity | (2024) 10:56 2 As it is common for differential expression analyses, sample names are column names in the data table, and gene names are row names. Gene names always come first, so we pass “row.names=1” to the get.csv() function. The header of the data table consists of three lines (accession, assay name, sample name), but as we are working with a single assay, we can skip the first two lines: q = "id=OSD-569&file.datatype=unnormalized counts" url = paste0(GLOPENAPI, "data/?", URLencode(q)) data = get.csv( url, check.names=F, skip=2, row.names=1 ) Differential expression and pathway enrichment analysis At this point, the data is ready to be ingested into standard analysis tools, for example, DESeq27and fgsea8 with the use of MSigDb9 pathways. For DESeq2, sample names in the metadata should be represented as row names; and if, for example, we want to classify all timestamps into “preflight” (anything before launch, i.e. timestamps starting with “L-“), “postflight” (immediately after landing, “R+1”) and “recovery” (all other timestamps starting with “R+“), we also add a “status” column: rownames(metadata) = metadata$sample.name metadata$status = sapply(metadata$timestamp, function (t) { ifelse(t=="R+1", "postflight", ifelse(startsWith(t, "R+"), "recovery", "preflight")) }) Finally, we run the analyses and visualize enrichment of a particular MSigDb pathway (DIAZ_CHRONIC_MYELOGENOUS_LEUKE- MIA_UP) with result displayed in Fig. 4: library(DESeq2) dds = DESeqDataSetFromMatrix( round(na.omit(data)), # DESeq2 requires integer values and absence of NaNs metadata, ~status+subject, ) lrt = DESeq(dds, test="LRT", reduced=~subject) deg = results(lrt, contrast=c("status", "postflight", "preflight")) library(msigdbr) C2 = msigdbr(species="human", category="C2") pathways = split(x=C2$ensembl_gene, f=C2$gs_name) library(fgsea) deg$rank = deg$padj * sign(deg$log2FoldChange) ranks = with(na.omit(deg), setNames(rank, rownames(na.omit(deg)))) plotEnrichment(pathways$DIAZ_CHRONIC_MYELOGENOUS_ LEUKEMIA_UP, ranks) Technical validation The establishment of standardized data formats, uniform units of mea- surement, ontological frameworks, and comprehensive metadata fields is imperative to ensure the seamless integration of new data types into a repository and to enhance the capacity for cross-study biological analyses. Further, the integration of medical assays with multi-omics data, including Fig. 4 | Enrichment analysis. Enrichment of the DIAZ_CHRONIC_MYELOGENOUS_LEUKEMIA_UP MSigDb pathway in the RNA-Seq data associated with dataset OSD-569 at the postflight timestamp compared to preflight conditions, analyzed and visualized from data retrieved via GLOpenAPI. https://doi.org/10.1038/s41526-024-00393-5 Brief communication npj Microgravity | (2024) 10:56 5 genomics, proteomics, metabolomics, and other data modalities, facilitates meta-analyses geared towards better understanding of the human response to the space environment. The correlation between omicsdata and clinically significant endpoints derived from medical data holds paramount sig- nificance in elucidating health implications. Nonetheless, the integration of disparate data types remains a persistent challenge in the biomedical research domain, exacerbated by inconsistencies across laboratories and studies, as well as inherent variability in individual responses. Moreover, space missions like I4, which encompass multiple data collection points (pre-flight, in-flight, post-flight, etc.), provide longitudinal datasets that enable the intricate yet potent exploration of space-induced responses over time. Over the five years, the OSDR Analysis Working Groups (AWGs) were convened in order to ensure the reusability and standardization of data available within OSDR. These AWGs consist of diverse OSDR data stakeholders, including investigators, commercial entities, academic researchers, and students. Each AWG is dedicated to a distinct data category or domain of expertise, including animals, artificial intelligence, microbes, multi-omics, phenotypic data, and plants. Professionals within these AWGs contributed their expertise towards the formulation of standardized data processing pipelines and the development of assay metadata configurations tailored to each new data type. Consequently, OSDR was well-equipped to receive, curate, standardize, and process the wide spectrum of medical and omics data collected during the I4 mission. Medical data serves as a crucial resource for gaining insights into biological responses. However, balancing the imperative to protect sensitive health information of astronauts while enabling data sharing for research necessitates the robust implementation of privacy and security protocols. OSDR has introduced an innovative capability, allowing users to access metadata associated with private medical datasets, albeit without direct access to the data itself. OSDR’s dedication to comprehensive and unam- biguous metadata, coupled with the utilization of the GLOpenAPI, under- scores its readiness for analysis and artificial intelligence applications. The data query method illustrated here marks an initial step toward realizing the goal of Precision Space Health10,11. In cases where users seek to employ private medical datasets such as those collected on I4 for research purposes, an application process is in place that mandates approval from an institu- tional review board (IRB). Data availability All data are available on the NASA Open Science Data Repository. OSD- 569, OSD-570, OSD-571, OSD-572, OSD-573, OSD-574, OSD-575, OSD- 630, OSD-656, OSD-687: Code availability GeneLab processed data is generated using the pipelines that are publicly availableontheGeneLabDataProcessingGitHubpage:https://github.com/ nasa/GeneLab_Data_Processing. Received: 14 December 2023; Accepted: 3 April 2024; References 1. Berrios, D. C., Galazka, J., Grigorev, K., Gebre, S. & Costes, S. V. NASA GeneLab: interfaces for the exploration of space omics data. Nucleic Acids Res. 49, D1515–D1522 (2021). 2. Scott, R. T. et al. Advancing the integration of biosciences data sharing to further enable space exploration. Cell Rep. 33, 108441 (2020). 3. Ray, S. et al. GeneLab: Omics database for spaceflight experiments. Bioinformatics 35, 1753–1759 (2019). 4. Berrios, D. C., Beheshti, A. & Costes, S. V. FAIRness and usability for open-access Omics data systems. AMIA Annu. Symp. Proc. 2018, 232–241 (2018). 5. Garrett-Bakelman, F. E. et al. The NASA Twins Study: A multidimensional analysis of a year-long human spaceflight. Science 364, eaau8650 (2019). 6. González-Beltrán, A., Maguire, E., Sansone, S.-A. & Rocca-Serra, P. linkedISA: semantic representation of ISA-Tab experimental metadata. BMC Bioinforma. 15, S4 (2014). 7. Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014). 8. Korotkevich, G., Sukhov, V. & Sergushichev, A. Fast gene set enrichment analysis. bioRxiv 060012 (2019) https://doi.org/10.1101/ 060012. 9. Castanza, A. S. et al. Extending support for mouse data in the Molecular Signatures Database (MSigDB). Nat. Methods 20, 1619–1620 (2023). 10. Scott, R. T. et al. Biomonitoring and precision health in deep space supported by artificial intelligence. Nat. Mach. Intell. 5, 196–207 (2023). 11. Morris, J. H. et al. The scalable precision medicine open knowledge engine (SPOKE): a massive knowledge graph of biomedical information. Bioinformatics 39, btad080 (2023). Acknowledgements OSDR is funded by the NASA Space Biology Program, part of the NASA Biological and Physical Sciences Division within the NASA Science Mission Directorate; non-omics data are also partially supported by the NASA Human Research Program (HRP). C.E.M. thanks WorldQuant, the GI Research Foundation, NASA (NNX14AH50G, NNX17AB26G, NNH18ZTT001N-FG2, 80NSSC22K0254, 80NSSC23K0832), the National Institutes of Health (R01MH117406), and the LLS (MCL7001- 18, LLS 9238-16, 7029-23). J.K. was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (RS-2023-00241586). J.K. acknowledges Boryung for their financial support and research enhancement ground, provided through their Global Space Healthcare Initiative, Humans In Space, including mentorship and access to relevant expert networks. Author contributions Study design: S.V.C., L.M.S. and K.A.G. wrote the main manuscript. R.T.S., A.M.S.-B., E.O., J.K., and C.E.M. provided figures and expert review. All authors reviewed the final manuscript. Competing interests CEM is a co-Founder of Onegevity, Twin Orbit, and Cosmica Biosciences. All other authors declare no competing interests. Additional information Supplementary information The online version contains supplementary material available at https://doi.org/10.1038/s41526-024-00393-5. Correspondence and requests for materials should be addressed to Sylvain V. Costes. Reprints and permissions information is available at http://www.nature.com/reprints Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. https://doi.org/10.1038/s41526-024-00393-5 Brief communication npj Microgravity | (2024) 10:56 6 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. This is a U.S. Government work and not under copyright protection in the US; foreign copyright protection may apply 2024 https://doi.org/10.1038/s41526-024-00393-5 Brief communication npj Microgravity | (2024) 10:56 7

Title: Inspiration4 data access through the NASA Open Science Data Repository ​ Authors: Lauren M. Sanders, Kirill A. Grigorev, Ryan T. Scott, Amanda M. Saravia-Butler, San-huei Lai Polo, Rachel Gilbert, Eliah G. Overbey, Jang Keun Kim, Christopher E. Mason, Sylvain V. Costes Publisher: Published in cooperation with the Biodesign Institute at Arizona State University, with the support of NASA Date: 2024-05-14 00:00:00 Abstract: The increasing accessibility of commercial and private space travel necessitates a profound understanding of its impact on human health. ​ The NASA Open Science Data Repository (OSDR) provides transparent and FAIR access to biological studies, notably the SpaceX Inspiration4 (I4) mission, which amassed extensive data from civilian astronauts. ​ This dataset encompasses omics and clinical assays, facilitating comprehensive research on space-induced biological responses. ​ These data allow for multi-modal, longitudinal assessments, bridging the gap between human and model organism studies. ​ Crucially, community-driven data standards established by NASA’s OSDR Analysis Working Groups empower artificial intelligence and machine learning to glean invaluable insights, guiding future mission planning and health risk mitigation. ​ This article presents a concise guide to access and analyze I4 data in OSDR, including programmatic access through GLOpenAPI. ​ This pioneering effort establishes a precedent for post-mission health monitoring programs within space agencies, propelling research in the burgeoning field of commercial space travel’s impact on human physiology.

Na in diamond: high spin defects revealed by the ADAQ high-throughput computational database.pdf

npj | computational materials Article Published in partnership with the Shanghai Institute of Ceramics of the Chinese Academy of Sciences https://doi.org/10.1038/s41524-024-01292-9 Na in diamond: high spin defects revealed by the ADAQ high-throughput computational database Check for updates Joel Davidsson , William Stenlund, Abhijith S. Parackal, Rickard Armiento & Igor A. Abrikosov Color centers in diamond are at the forefront of the second quantum revolution. A handful of defects are in use, and finding ones with all the desired properties for quantum applications is arduous. By using high-throughput calculations, we screen 21,607 defects in diamond and collect the results in the ADAQ database. Upon exploring this database, we find not only the known defects but also several unexplored defects. Specifically, defects containing sodium stand out as particularly relevant because of their high spins and predicted improved optical properties compared to the NV center. Hence, we studied these in detail, employing high-accuracy theoretical calculations. The single sodium substitutional (NaC) has various charge states with spin ranging from 0.5 to 1.5, ZPL in the near- infrared, and a high Debye-Waller factor, making it ideal for biological quantum applications. The sodium vacancy (NaV) has a ZPL in the visible region and a potential rare spin-2 ground state. Our results show sodium implantation yields many interesting spin defects that are valuable additions to the arsenal of point defects in diamond studied for quantum applications. Of all point defects in diamond, the NV center1–3 stands out as the most studied and used in quantum applications with many ongoing parallel efforts. It fulfills many of the defect properties listed for various quantum applications4. The NV center is the main defect considered as a computa- tional qubit5,6 with recent advancements in fault-tolerant operation7. While more work is needed before it can be realized at large scale8, it has already demonstrated promise as a flying qubit by transmitting quantum infor- mation over long distance9 and multinode network capabilities10,11, which goes towards the quantum internet12,13. It has also been demonstrated as memoryforquantuminformation14,15.Recentadvancesinquantumsensing with NV centers include magnetrometry16 at extreme conditions17, nano- scale nuclear magnetic resonance18–20, relaxometry21, and biological applications22–24. These are just some of the explored and proposed appli- cations for the NV center. It is a genuinely versatile defect that is also well understoodfromthetheoreticalside25,26withknownpropertiessuchasspin- 1, many-body structure etc. However, the NV center does have some drawbacks. It has a Zero Phonon Line (ZPL) in the visible range (outside the first and second biological window27,28 as well as the telecom region29) with a low Debye-Waller factor (~3.2%30) and is affected by spectral diffusion31–33. Other defects in diamond improve on these aspects. The group 14 (Si34–37, Ge38,39, Sn40,41, and Pb42,43) vacancy centers44 have a wide range of ZPLs from near-infrared to visible with higher Debye-Waller factors, from about 20% to 70%45. Since the dopant sits between two vacancy positions, known as a split-vacancy configuration, these defects have D3d symmetry, specifically inversion, that suppresses spectral diffusion. This property, combined with the high Debye-Waller factor, makes these defects ideal for photonics46–48. They are also considered spin qubits, and as the ion size increases, the ground state splitting becomes larger, providing coherent spin control as demonstrated for the SnV49,50. However, the group 14 vacancy centers also have some drawbacks. They are spin-1/2, one of the defect states are below or just above to the valence band edge, and the ZPLs are in the visible range. There are a handful of other less studied defects in diamond, mainly other vacancy complexes in a split-vacancy configuration. Theoretically suggesteddefects include the group 13 (Al, Ga,In, and Tl) vacancycenters51. These centers have spin-1 and ZPLs in the visible region with Debye-Waller factors from about 15% to 43%. Another vacancy defect is the MgV center with spin-1/2 in the negative charge state with a Debye-Waller factor of 54%52. This defect is found along with single substitutional Mg during Mg implantation53. Yet another vacancy complex is the NiV with spin-1/2, ZPL in the near-infrared range, and predicted Debye-Waller factor between28% and 74%54. Recent experimental study announced the Debye-Waller factor for this defect is 51%55. The NiC (W8) is a related defect with notably spin-3/2 56,57. This defect is one of the few with spin-3/2 reported in diamond. Themoststudiedspin-3/2defectisthesiliconvacancyinSiC58.Thehighspin gives unique sensing opportunities for strain and temperature which are Department of Physics, Chemistry and Biology, Linköping University, Linköping, Sweden. e-mail: [email protected] npj Computational Materials | (2024) 10:109 1 1234567890():,; 1234567890():,; universal for defects with spin larger or equal to spin-3/2 59. So far, no spin-2 defectindiamondhasbeenreported.Morediamonddefectscanbefoundin Refs. 60,61. High-throughput experimental search has studied known defects in diamond62. Apart from the known defects in diamonds, there are many unknown defects63. Notable examples include: ST1 (spin-0, ZPL in the visible range, oxygenrelated)64–66; TR12(spin0,ZPLinthe visiblerange,staticJahn-Teller distortion)67,68; implanted defects with F (ZPL in the visible range, possibly FV center with spin-1/2 or spin-1)69, and Xe (ZPL in the ultraviolet range with high Debye Waller around 74%, possibly XeV center with spin-1/2 or spin-1)70. Given all these defects, has the best defect in diamond been found? To answer this, we turn to theoretical high-throughput methods. Previous such studies systematically looked at vacancy center complexes71. However, this study limits the dopants to p-elements and the defects to vacancy centers. The large space of point defects in diamond remains unexplored. In this paper, we screen defects in diamond using the high-throughput framework ADAQ (Automatic Defect Analysis and Qualification)72,73, whichinturnusesthehigh-throughputtoolkit(httk)74.TheADAQsoftware package is a culmination of a series of publications related to SiC58,75–77 that focus on accurately calculating magneto-optical propertiesfor point defects, such as ZPL. ADAQ has been successfully applied to SiC and CaO, where modified silicon vacancy78 and XCaVO defects with X = Sb, Bi, and I79 were found. In this paper, we turn our attention to diamond to investigate single and double defects consisting of vacancies as well as substitutional and interstitial s- and p-elements, however, we do exclude interstitial-interstitial clusters (due to sheer size of them, about 90000 defects). We include defects that are separated up to 2.6 Å, which roughly corresponds to second nearest neighbors and we only make double defects with one external dopant. The result is a total of 21,607 defects to consider. These defects were screened at the PBE DFT level (see “Discussion” for more on the workflow and cal- culational details), and the results were stored to the ADAQ database. The stored properties include: formation energy, charge transition levels, defect levels, defect spin, zero phonon line with radiative lifetime and transition dipole moment (including polarization), ΔQ (relaxation between ground and excited state), and more. This paper is organized as follows: “Results” is divided into two main parts, database searches and spin defects with sodium. “Database Search: Intro”describeshowthemoststabledefectsarefoundonthedefecthull,and discusses ZPL accuracy for the previously known defects in diamond. Here, we also narrow down the number of relevant defects for quantum appli- cations by multiple searches that filter out defects with NV-like properties (spin-1 and a bright ZPL, “Database Search: NV-like Spin-1 Defects”), higher spin states (spin-3/2 “Database Search: Spin-3/2 Defects” and spin-2 “DatabaseSearch:Spin-2Defects”),orhighDebye-Wallerfactors(Database Search: Spin Defects With a High Debye-Waller Factor). Whenconsidering all these properties, the sodium substitutional and vacancy center stand out. Hence, in “Sodium Substitutional NaC” and “Sodium Vacancy (NaV)”, we studied these defects further with higher-order methods (such as HSE DFT calculation) to confirm their properties. Results This section is divided into two main parts: several sections exploring dif- ferent point defects in diamonds and two more sections examining spin defects with sodium in more detail. Database search: intro The most stable defects are located on the defect hull—the lowest formation energy per stoichiometry and per Fermi energy78,80. In the ADAQ database, all known defects, consisting of s- and p-elements, mentioned in the introduction are found on the defect hull. In this section, we discuss these defects and their optical properties compared with experiments and other theoretical calculations. ADAQ predicts the ZPL of defects with at least one occupied and unoccupied defect state within the band gap. However, due to the use of the PBE functional, they are systematically underestimated. For the NV center, ADAQ predicts a ZPL of 1.700 eV (see Table 1), whereas the experimental value is 1.945 eV1 (a difference of 0.245 eV). For the group 14 vacancy defects;SiV, GeV,and SnV do not have a ZPL inthedatabasebecause one of the defect states involved in the transition is below the valence band edge45. However, as the dopant gets larger, the defect state enters the band gap45. Hence, the PbV center does have a state in the band gap, which ADAQ finds and predicts a ZPL of 2.122 eV, which is close to the measured 2.384 eV (520 nm)42 (a difference of 0.263 eV). In general, we find from comparing the ADAQ ZPL predictions from the screening workflow to experimentally measured defects that the ZPLs are underestimated by around 0.25 eV (mean difference). Similar mean difference and variation are observed for defects in SiC72,75,78. One can also compare the ADAQ ZPL predictions with other theo- retical results. For the group 13 vacancy defects, the ADAQ ZPLs are AlV 1.00 eV, GaV 1.72 eV, InV 1.87 eV, and TlV 2.31 eV (see Table 1). When comparing with the HSE calculations done in ref. 51, the ZPLs are for GaV 1.82 eV (difference 0.1 eV), InV 2.12 eV (difference 0.25 eV), and TlV 2.84 eV (0.53 eV). The ZPL for the AlV center is not reported due to numerical convergence issues51. Finally, the MgV center is on the defect hull, and ADAQ reports a ZPL of 0.31 eV.In the screeningworkflow,ADAQcalculates onlyone excitation. This excitation for the MgV defect matches with the theoretical results in ref. 52, where the lowest excitation (2Eg −2Eu in the doublet state without Jahn–Teller effect) has an adsorption value of 0.7 eV. Database search: NV-like Spin-1 defects To look for NV-like defects, we search for spin-1 defects on the defect hull with a ZPL larger than 0.5 eV and a transition dipole moment (TDM) larger than 3 debye. We find 15 unique defects, seeTable 1. Apart from the already discussed substitutional vacancy complexes (the NV center and group 13 vacancies), there are also vacancy centers consisting of Li and Ba. Both of these show similar properties as the NV center, but with lower ZPL and ΔQ for both, and higher brightness for the Ba defect. The Ba defect has a large formation energy, about 20 eV, which is similar to the XeCVacC. Large formation energy is not necessarily a problem since XeV is suggested to be the most probable defect after Xe implantation70. ADAQ supports this conclusion since the single Xe sub- stitutional has a higher formation energy of around 29 eV. Table 1 | Spin-1 defects on defect hull with ZPL larger than 0.5 eV and TDM larger than 3 debye Defect Defect Charge ZPL TDM ΔQ Type [eV] [debye] [amu1/2Å] XV (known) NCVacC −1 1.70 6.66 0.56 AlCVacC −1 1.0 5.92 0.51 GaCVacC −1 1.72 5.33 0.48 InCVacC −1 1.88 6.31 0.33 TlCVacC −1 2.31 3.61 0.46 XV LiCVacC 1 0.64 4.38 0.41 BaCVacC 0 1.29 11.17 0.42 XCIntC ICIntC −1 0.57 3.34 0.80 BrCIntC −1 0.63 7.91 0.51 XCIntX KCIntK 0 0.82 7.62 0.78 XCXC MgCMgC 0 0.63 3.55 0.58 XC KC −1 0.6 3.77 0.96 KC 1 0.78 5.74 0.24 XeC 0 0.73 5.78 0.49 FC −1 1.20 9.83 0.42 HC −1 1.29 6.86 0.60 https://doi.org/10.1038/s41524-024-01292-9 Article npj Computational Materials | (2024) 10:109 2 2.4. The isosurface level used in Fig. 2 c) is 0.025 Å−3, same as ref. 89, while the isolevel in b) is ffiffiffiffiffiffiffiffiffiffiffi 0:025 p Å−3/2 = 0.1581 Å−3/2, meaning the a1 orbital in b) has the exact same shape as ∣a1∣2. Data availability FormoreinformationabouttheADAQdatabase,seehttps://httk.org/adaq/. Code availability For more information about the ADAQ source code, see https://httk.org/ adaq/. Received: 22 June 2023; Accepted: 11 May 2024; References 1. Davies, G., Hamer, M. F. & Price, W. C. Optical studies of the 1.945 eV vibronic band in diamond. Proc. R. Soc. A Math. Phys. Sci. 348, 285–298 (1976). 2. Gruber,A. etal. Scanningconfocal opticalmicroscopyandmagnetic resonance on single defect centers. Science 276, 2012–2014 (1997). 3. Jelezko, F. et al. Single spin states in a defect center resolved by optical spectroscopy. Appl. Phys. Lett. 81, 2160–2162 (2002). 4. Wolfowicz, G. et al. Quantum guidelines for solid-state spin defects. Nat. Rev. Mater. 6, 906–925 (2021). 5. Nizovtsev, A. P. et al. A quantum computer based on NV centers in diamond: optically detected nutations of single electron and nuclear spins. Opt. Spectrosc. 99, 233–244 (2005). 6. Weber, J. R. et al. Quantum computing with defects. PNAS 107, 8513–8518 (2010). 7. Abobeih, M. H. et al. Fault-tolerant operation of a logical qubit in a diamond quantum processor. Nature 606, 884–889 (2022). 8. Pezzagna, S. & Meijer, J. Quantum computer based on color centers in diamond. Appl. Phys. Rev. 8, 011308 (2021). 9. Hensen, B. et al. Loophole-free bell inequality violation using electron spins separated by 1.3 kilometres. Nature 526, 682–686 (2015). 10. Pompili, M. et al. Realization of a multinode quantum network of remote solid-state qubits. Science 372, 259–264 (2021). 11. Bartling, H. P. et al. Entanglement of spin-pair qubits with intrinsic dephasing times exceeding a minute. Phys. Rev. X 12, 011048 (2022). 12. Kimble, H. J. The quantum internet. Nature 453, 1023–1030 (2008). 13. Wehner, S., Elkouss, D. & Hanson, R. Quantum internet: a vision for the road ahead. Science 362, eaam9288 (2018). 14. Childress, L. et al. Coherent dynamics of coupled electron and nuclear spin qubits in diamond. Science 314, 281–285 (2006). 15. Bradley, C. E. et al. A ten-qubitsolid-statespin registerwithquantum memory up to one minute. Phys. Rev. X 9, 031045 (2019). 16. Happacher, J. et al. Low-temperature photophysics of single nitrogen-vacancy centers in diamond. Phys. Rev. Lett. 128, 177401 (2022). 17. Hilberer, A. et al. Nv center magnetometry up to 130 gpa as if at ambient pressure. https://arxiv.org/abs/2301.05094 (2023). 18. Abobeih, M. H. et al. Atomic-scale imaging of a 27-nuclear-spin cluster using a quantum sensor. Nature 576, 411–415 (2019). 19. Allert, R. D., Briegel, K. D. & Bucher, D. B. Advances in nano- and microscale nmr spectroscopy using diamond quantum sensors. Chem. Commun. 58, 8165–8181 (2022). 20. Liu, K. S. et al. Surface nmr using quantum sensors in diamond. PNAS 119, e2111607119 (2022). 21. Mzyk, A., Sigaeva, A. & Schirhagl, R. Relaxometry with nitrogen vacancy (nv) centers in diamond. Acc. Chem. Res. 55, 3572–3580 (2022). 22. Lovchinsky, I. et al. Nuclear magnetic resonance detection and spectroscopy of single proteins using quantum logic. Science 351, 836–841 (2016). 23. Xie, M. et al. Biocompatible surface functionalization architecture for a diamond quantum sensor. PNAS 119, e2114186119 (2022). 24. Smits, J. et al. Two-dimensional nuclear magnetic resonance spectroscopy with a microfluidic diamond quantum sensor. Sci. Adv. 5, eaaw7895 (2019). 25. Doherty, M. W., Manson, N. B., Delaney, P. & Hollenberg, L. C. L. The negatively charged nitrogen-vacancy centre in diamond: the electronic solution. NJP 13, 025019 (2011). 26. Gali, A. Ab initio theory of the nitrogen-vacancy center in diamond. Nanophotonics 8, 1907–1943 (2019). 27. Weissleder, R. A clearer vision for in vivo imaging. Nat. Biotechnol. 19, 316–317 (2001). 28. Smith, A. M., Mancini, M. C. & Nie, S. Second window for in vivo imaging. Nat. Nanotechnol. 4, 710–711 (2009). 29. Gasca, L. From o to l: the future of optical-wavelength bands. Broadband Prop. 6, 83–85 (2008). 30. Alkauskas, A., Buckley, B. B., Awschalom, D. D. & de Walle, C. G. V. First-principles theory of the luminescence lineshape for the triplet transition in diamond NV centres. NJP 16, 073026 (2014). 31. Wolters, J., Sadzak, N., Schell, A. W., Schröder, T. & Benson, O. Measurement of the ultrafast spectral diffusion of the optical transition of nitrogen vacancy centers in nano-size diamond using correlation interferometry. Phys. Rev. Lett. 110, 027401 (2013). 32. Siyushev, P. et al. Optically controlled switching of the charge state of a single nitrogen-vacancy center in diamond at cryogenic temperatures. Phys. Rev. Lett. 110, 167402 (2013). 33. McCullian, B., Cheung, H., Chen, H. & Fuchs, G. Quantifying the spectral diffusion of n-v centers by symmetry. Phys. Rev. Appl. 18, 064011 (2022). 34. Wang, C., Kurtsiefer, C., Weinfurter, H. & Burchard, B. Single photon emission from siv centres in diamond produced by ion implantation. J. Phys. B Mol. Opt. Phys. 39, 37 (2005). 35. Neu, E. et al. Single photon emission from silicon-vacancy colour centres in chemical vapour deposition nano-diamonds on iridium. NJP 13, 025012 (2011). 36. Müller, T. et al. Optical signatures of silicon-vacancy spins in diamond. Nat. Commun. 5, 3328 (2014). 37. Rose, B. C. et al. Observation of an environmentally insensitivesolid- state spin defect in diamond. Science 361, 60–63 (2018). 38. Palyanov, Y. N., Kupriyanov, I. N., Borzdov, Y. M. & Surovtsev, N. V. Germanium: a new catalyst for diamond synthesis and a new optically active impurity in diamond. Sci. Rep. 5, 14789 (2015). 39. Iwasaki, T. et al. Germanium-vacancy single color centers in diamond. Sci. Rep. 5, 12882 (2015). 40. Iwasaki, T. et al. Tin-vacancy quantum emitters in diamond. Phys. Rev. Lett. 119, 253601 (2017). 41. Tchernij, S. D. et al. Single-photon-emitting optical centers in diamond fabricated upon sn implantation. ACS Photonics 4, 2580–2586 (2017). 42. Trusheim, M. E. et al. Lead-related quantum emitters in diamond. Phys. Rev. B 99, 075430 (2019). 43. Ditalia Tchernij, S. et al. Single-photon emitters in lead-implanted single-crystal diamond. ACS Photonics 5, 4864–4871 (2018). 44. Bradac, C., Gao, W., Forneris, J., Trusheim, M. E. & Aharonovich, I. Quantum nanophotonics with group iv defects in diamond. Nat. Commun. 10, 5625 (2019). 45. Thiering, Gm. H. & Gali, A. Ab initio magneto-optical spectrum of group-iv vacancy color centers in diamond. Phys. Rev. X 8, 021063 (2018). 46. Sipahigil, A. et al. An integrated diamond nanophotonics platform for quantum-optical networks. Science 354, 847–850 (2016). 47. Bhaskar, M. K. et al. Quantum nonlinear optics with a germanium- vacancy color center in a nanoscale diamond waveguide. Phys. Rev. Lett. 118, 223603 (2017). https://doi.org/10.1038/s41524-024-01292-9 Article npj Computational Materials | (2024) 10:109 7 48. Guo, X. et al. Tunable and transferable diamond membranes for integrated quantum technologies. Nano Lett. 21, 10392–10399 (2021). 49. Görlitz, J. et al. Coherence of a charge stabilised tin-vacancy spin in diamond. Npj Quantum Inf. 8, 45 (2022). 50. Debroux, R. et al. Quantum control of the tin-vacancy spin qubit in diamond. Phys. Rev. X 11, 041041 (2021). 51. Harris, I., Ciccarino, C. J., Flick, J., Englund, D. R. & Narang, P. Group-iii quantum defects in diamond are stable spin-1 color centers. Phys. Rev. B 102, 195206 (2020). 52. Pershin, A., Barcza, G., Legeza, Ö. & Gali, A. Highly tunable magneto-optical response from magnesium-vacancy color centers in diamond. Npj Quantum Inf. 7, 99 (2021). 53. Corte, E. et al. Magnesium-vacancy optical centers in diamond. ACS Photonics 10, 101–110 (2023). 54. Thiering, Gm. H. & Gali, A. Magneto-optical spectra of the split nickel-vacancy defect in diamond. Phys. Rev. Res. 3, 043052 (2021). 55. Morris, I.et al. Electronic structure, spin properties, and charge state stability of the negatively charged nickel vacancy center in diamond. BAPS. https://meetings.aps.org/Meeting/MAR23/Session/F74. 8 (2023). 56. Nazaré, M., Lopes, J. & Neves, A. Nickel related defects in diamond: the 2.51 ev band. Phys. B: Condens. Matter 308-310, 616–620 (2001). 57. Chanier, T. & Gali, A. Ab initio characterization of a ni-related defect in diamond: the w8 center. Phys. Rev. B 87, 245206 (2013). 58. Ivády, V. et al. Identification of si-vacancy related room-temperature qubits in 4h silicon carbide. Phys. Rev. B 96, 161114 (2017). 59. Soykal, O. O. & Reinecke, T. L. Quantum metrology with a single spin- 3 2 defect in silicon carbide. Phys. Rev. B 95, 081405 (2017). 60. Aharonovich, I. et al. Diamond-based single-photon emitters. Rep. Prog. Phys. 74, 076501 (2011). 61. Thiering, G., Gali, A. Color centers in diamond for quantum applications. In: Nebel, C. E., Aharonovich, I., Mizuochi, N. & Hatano, M. (eds.) Diamond for Quantum Applications Part 1, Vol. 103 of Series Semiconductors and Semimetals, 1–36 (Elsevier, 2020). https://www.sciencedirect.com/science/article/pii/ S0080878420300016. 62. Lühmann, T. et al. Screening and engineering of colour centres in diamond. J. Phys. D Appl. Phys. 51, 483002 (2018). 63. Zaitsev, A. M. Optical Properties of Diamond: a Data Handbook (Springer Science & Business Media, 2013). 64. Lee, S.-Y. et al. Readout and control of a single nuclear spin with a metastable electron spin ancilla. Nat. Nanotechnol. 8, 487–492 (2013). 65. Balasubramanian, P. et al. Discovery of st1 centers in natural diamond. Nanophotonics 8, 1993–2002 (2019). 66. Lühmann, T., Diziain, S., Meijer, J. & Pezzagna, S. Identification and creation of the room-temperature coherently controllable st1 spin center in diamond. ACS Photonics 9, 1691–1699 (2022). 67. Davies, G., Foy, C. & O’Donnell, K. The tr12 vibronic band in diamond. J. Phys. C Solid State Phys. 14, 4153 (1981). 68. Foglszinger, J. et al. Tr12 centers in diamond as a room temperature atomic scale vector magnetometer. Npj Quantum Inf. 8, 65 (2022). 69. Ditalia Tchernij, S. et al. Fluorine-based color centers in diamond. Sci. Rep. 10, 21537 (2020). 70. Sandstrom, R. et al. Optical properties of implanted Xe color centers in diamond. Opt. Commun. 411, 182–186 (2018). 71. Goss, J. P., Briddon, P. R., Rayson, M. J., Sque, S. J. & Jones, R. Vacancy-impuritycomplexesand limitations for implantation doping of diamond. Phys. Rev. B 72, 035214 (2005). 72. Davidsson, J., Ivády, V., Armiento, R. & Abrikosov, I. A. Adaq: Automatic workflows for magneto-optical properties of point defects in semiconductors. Comput. Phys. Commun. 269, 108091 (2021). 73. Adaq. (2022). https://httk.org/adaq/. Accessed: 4 April 2022. 74. Armiento, R. Database-driven high-throughput calculations and machine learning models for materials design. In Schütt, K. T. et al. (eds.)MachineLearning MeetsQuantumPhysics, Vol. 968 of Lecture Notes in Physics (Springer International Publishing, Cham, 2020). 75. Davidsson, J. et al. First principles predictions of magneto-optical data for semiconductor point defect identification: the case of divacancy defects in 4h–SiC. NJP 20, 023035 (2018). 76. Davidsson, J. et al. Identification of divacancy and silicon vacancy qubits in 6h-sic. Appl. Phys. Lett. 114, 112107 (2019). 77. Ivády, V. et al. Stabilization of point-defect spin qubits by quantum wells. Nat. Commun. 10, 5607 (2019). 78. Davidsson, J. et al. Exhaustive characterization of modified si vacancies in 4h-sic. Nanophotonics 11, 4565–4580 (2022). 79. Davidsson, J., Onizhuk, M., Vorwerk, C. & Galli, G. Discovery of atomic clock-like spin defects in simple oxides from first principles. https://arxiv.org/abs/2302.07523 (2024). (Accepted to Nature Communications) 80. Davidsson, J. Color Centers in Semiconductors for Quantum Applications: A High-Throughput Search of Point Defects in SiC. (Ph.D. thesis) (Linköping UniversityElectronic Press, 2021). http://urn. kb.se/resolve?urn=urn%3Anbn%3Ase%3Aliu%3Adiva-173108. 81. Deák, P., Aradi, B., Kaviani, M., Frauenheim, T. & Gali, A. Formation of nv centers in diamond: a theoretical study based on calculated transitions and migration of nitrogen and vacancy related defects. Phys. Rev. B 89, 075203 (2014). 82. Kirui,J., vanWyk,J. &Hoch,M. Esrstudiesofthenegativedivacancy in irradiated type-i diamonds. DRM 8, 1569–1571 (1999). 83. Prawer, S., Uzan-Saguy, C., Braunstein, G. & Kalish, R. Can n-type doping of diamond be achieved by Li or Na ion implantation? Appl. Phys. Lett. 63, 2502–2504 (1993). 84. Popovici, G. & Prelas, M. Prospective n-type impurities and methods of diamond doping. DRM 4, 1305–1310 (1995). 85. Hunn, J., Parikh, N., Swanson, M. & Zuhr, R. Conduction in ion- implanted single-crystal diamond. DRM 2, 847–851 (1993). 86. Lombardi, E. B., Mainwood, A. & Osuch, K. Ab initio study of lithium and sodium in diamond. Phys. Rev. B 76, 155203 (2007). 87. Goss, J. P. & Briddon, P. R. Theoretical study of li and na as n-type dopants for diamond. Phys. Rev. B 75, 075202 (2007). 88. Lombardi, E. & Mainwood, A. A first-principles study of lithium, sodium and aluminum in diamond. DRM 17, 1349–1352 (2008). 89. Udvarhelyi, P. et al. Spectrally stable defect qubits with no inversion symmetry for robust spin-to-photon interface. Phys. Rev. Appl. 11, 044022 (2019). 90. Abtew, T. A. et al. Dynamic jahn-teller effect in the nv−center in diamond. Phys. Rev. Lett. 107, 146403 (2011). 91. Thiering, Gm. H. & Gali, A. Ab initio calculation of spin-orbit coupling for an nv center in diamond exhibiting dynamic jahn-teller effect. Phys. Rev. B 96, 081115 (2017). 92. Bersuker, I. The Jahn-Teller Effect (Cambridge University Press, 2006). 93. Herrero-Saboya, G., Martin-Samos, L., Richard, N. & Hemeryck, A. Common defects in diamond lattices as instances of the general t ⨂(e + t2) jahn-teller effect. Phys. Rev. Mater. 6, 034601 (2022). 94. Thiering, G. & Gali, A. Spin–orbit coupling and jahn–teller effect in t d symmetry: an ab initio study on the substitutional nickel defect in diamond. Philos. Trans. R. Soc. A. 382, 20220310 (2024). 95. Turiansky, M. E., Parto, K., Moody, G. & de Walle, C. G. V. Rational design of efficient defect-based quantum emitters. https://arxiv.org/ abs/2402.08257 (2024). 96. Mukherjee, S. et al. A telecom o-band emitter in diamond. Nano Lett. 23, 2557–2562 (2023). 97. Udvarhelyi, P. et al. Vibronic states and their effect on the temperature and strain dependence of silicon-vacancy qubits in 4h- SiC. Phys. Rev. Appl. 13, 054017 (2020). https://doi.org/10.1038/s41524-024-01292-9 Article npj Computational Materials | (2024) 10:109 8 98. Lee, J. H. et al. Strong zero-phonon transition from point defect- stacking fault complexes in silicon carbide nanowires. Nano Lett. 21, 9187–9194 (2021). 99. Stenlund, W. Symmetry Analysis of Orbitals in a Plane Wave Basis: A Study on Molecules and Defects in Solids (Master’s thesis). https:// urn.kb.se/resolve?urn=urn:nbn:se:liu:diva-180194 (2022). 100. Stenlund, W., Davidsson, J., Ivády, V., Armiento, R. & Abrikosov, I. A. Adaq-sym: Automated symmetry analysis of defect orbitals. [cond- mat.mtrl-sci] https://arxiv.org/abs/2307.04381 (2023). 101. Kresse, G. & Hafner, J. Ab initio molecular-dynamics simulation of the liquid-metal-amorphous-semiconductor transition in germanium. Phys. Rev. B 49, 14251–14269 (1994). 102. Kresse, G. & Furthmüller, J. Efficient iterative schemes for ab initio total-energy calculations using a plane-wave basis set. Phys. Rev. B 54, 11169–11186 (1996). 103. Blöchl, P. E. Projector augmented-wave method. Phys. Rev. B 50, 17953–17979 (1994). 104. Kresse, G. & Joubert, D. From ultrasoft pseudopotentials to the projector augmented-wave method. Phys. Rev. B 59, 1758–1775 (1999). 105. Perdew, J. P., Burke, K. & Ernzerhof, M. Generalized gradient approximation made simple. Phys. Rev. Lett. 77, 3865–3868 (1996). 106. Heyd, J., Scuseria, G. E. & Ernzerhof, M. Hybrid functionals based on a screened coulomb potential. J. Chem. Phys. 118, 8207–8215 (2003). 107. Heyd, J., Scuseria, G. E. & Ernzerhof, M. Erratum: “hybrid functionals based on a screened coulomb potential” [J. Chem. Phys. 118, 8207 (2003)]. J. Chem. Phys. 124, 219906 (2006). 108. Togo, A. & Tanaka, I. First principlesphonon calculationsin materials science. Scr. Mater. 108, 1–5 (2015). 109. Togo, A. First-principles phonon calculations with phonopy and phono3py. J. Phys. Soc. 92, 012001 (2023). 110. Gali, A., Janzén, E., Deák, P., Kresse, G. & Kaxiras, E. Theory of spin- conserving excitation of the n−V−center in diamond. Phys. Rev. Lett. 103, 186404 (2009). 111. Tawfik, S. A. & Russo, S. P. PyPhotonics: A python package for the evaluation of luminescence properties of defects. Comput. Phys. Commun. 273, 108222 (2022). 112. Ivády, V., Simon, T., Maze, J. R., Abrikosov, I. A. & Gali, A. Pressure and temperature dependence of the zero-field splitting in the ground state of nv centers in diamond: a first-principles study. Phys. Rev. B 90, 235205 (2014). 113. Hicks, D. et al. AFLOW-SYM: platform for the complete, automatic and self-consistent symmetry analysis of crystals. Acta Cryst. A 74, 184–203 (2018). 114. Davidsson, J. Theoretical polarization of zero phonon lines in point defects. J. Condens. Matter Phys. 32, 385502 (2020). 115. Zheng, Q. Qijingzheng/vaspbandunfolding (2022). https://github. com/QijingZheng/VaspBandUnfolding. Acknowledgements We acknowledge support from the Knut and Alice Wallenberg Foundation (Grant no. 2018.0071). Support from the Swedish Government Strategic Research Area Swedish e-science Research Centre (SeRC) and the Swedish Government Strategic Research Area in Materials Science on Functional Materials at Linköping University (Faculty Grant SFO-Mat-LiU No. 2009 00971) are gratefully acknowledged. This work was partially sup- portedby the KnutandAlice Wallenberg Foundationthrough the Wallenberg Centre for Quantum Technology (WACQT). J.D. and R.A. acknowledge support from the Swedish Research Council (VR) Grant no. 2022-00276 and 2020-05402, respectively. The computations were enabled by resources provided by the National Academic Infrastructure for Supercomputing in Sweden (NAISS) and the Swedish National Infrastructure for Computing (SNIC) at NSC, partially funded by the Swedish Research Council through grant agreement nos. 2022-06725 and no. 2018-05973. Author contributions J.D. conceptualized the project in discussion with R.A., analyzed the data, and wrote the manuscript. W.S. performed the sodium defects calculations and made the figures. A.P. performedthe high-throughputcalculations. R.A. and I.A.A. supervised the project and reviewed the manuscript. Funding Open access funding provided by Linköping University. Competing interests The authors declare no competing interests. Additional information Supplementary information The online version contains supplementary material available at https://doi.org/10.1038/s41524-024-01292-9. Correspondence and requests for materials should be addressed to Joel Davidsson. Reprints and permissions information is available at http://www.nature.com/reprints Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. © The Author(s) 2024 https://doi.org/10.1038/s41524-024-01292-9 Article npj Computational Materials | (2024) 10:109 9

Title: Na in diamond: high spin defects revealed by the ADAQ high-throughput computational database ​ Authors: Joel Davidsson, William Stenlund, Abhijith S. Parackal, Rickard Armiento, Igor A. Abrikosov ​ Publisher: Published in partnership with the Shanghai Institute of Ceramics of the Chinese Academy of Sciences ​ Date: 2024-05-11 00:00:00 Abstract: Color centers in diamond are at the forefront of the second quantum revolution. ​ A handful of defects are in use, and finding ones with all the desired properties for quantum applications is arduous. ​ By using high-throughput calculations, we screen 21,607 defects in diamond and collect the results in the ADAQ database. ​ Upon exploring this database, we find not only the known defects but also several unexplored defects. ​ Specifically, defects containing sodium stand out as particularly relevant because of their high spins and predicted improved optical properties compared to the NV center. ​ Hence, we studied these in detail, employing high-accuracy theoretical calculations. ​ The single sodium substitutional (NaC) has various charge states with spin ranging from 0.5 to 1.5, ZPL in the near-infrared, and a high Debye-Waller factor, making it ideal for biological quantum applications. ​ The sodium vacancy (NaV) has a ZPL in the visible region and a potential rare spin-2 ground state. ​ Our results show sodium implantation yields many interesting spin defects that are valuable additions to the arsenal of point defects in diamond studied for quantum applications. ​

High-entropy superparaelectrics with locally diverse ferroic distortion for high-capacitive energy storage.pdf

Article https://doi.org/10.1038/s41467-024-51058-6 High-entropy superparaelectrics with locally diverse ferroic distortion for high-capacitive energy storage Jianhong Duan1, Kun Wei1, Qianbiao Du1, Linzhao Ma1, Huifen Yu2, He Qi 2 , Yangchun Tan3, Gaokuo Zhong 3 & Hao Li 1 Superparaelectrics are considered promising candidate materials for achiev- ing superior energy storage capabilities. However, due to the complicated local structural design, simultaneously achieving high recoverable energy density (Wrec) and energy storage efficiency (η) under high electric fields remains a challenge in bulk superparaelectrics. Here, we propose utilizing entropy engineering to disrupt long-range ferroic orders into local poly- morphic distortion disorder with multiple BO6 tilt types and diverse hetero- geneous polarization configurations. This strategy reduces the switching barriers, thereby facilitating the emergence of superparaelectric behaviors with ideal polarization forms. Furthermore, it enables high polarization response, negligible remnant polarization, delayed polarization saturation, and enhanced breakdown electric fields (Eb) in high-entropy superpara- electrics. Consequently, an extraordinary Wrec of 15.48 J cm–3 and an ultrahigh η of 90.02% are achieved at a high Eb of 710 kV cm–1, surpassing the compre- hensive energy storage performance of previously reported bulk superpara- electrics. This work demonstrates that entropy engineering is a viable strategy for designing high-performance superparaelectrics. With an increasing international focus on environmental protection, efficient energy storage technologies have become a focal point of societal concern1–3. Dielectric ceramic capacitors, with their ultrafast charge/discharge rate and ultrahigh power density, are extensively studied as a potential solution for energy storage4–6. However, the relatively low recoverable energy density (Wrec) and energy storage efficiency (η) of dielectric ceramic capacitors hinder their development towards miniaturization and integration7–9. Therefore, there is an urgent need to develop lead-free bulk ceramics with both ultrahigh Wrec and η. In recent years, numerous lead-free bulk ceramics have been developed for capacitive energy storage. For instance, high Wrec of 11.4 J cm–3 and 18.5 J cm–3 have been realized in AgNbO3 (AN)-based and NaNbO3 (NN)-based antiferroelectric (AFE) ceramics, respectively10,11. Nevertheless, their η values are capped at or below 80%, which is mainly caused by the AFE-ferroelectric (FE) phase transition. Similar low η phenomena are often observed in FEs or relaxor ferroelectrics (RFEs), such as K0.5Na0.5NbO3 (KNN)-based, Bi0.5K0.5TiO3 (BKT)-based, and BiFeO3 (BF)-based ceramics12–14. Although a high η (>90%) can be obtained in some linear dielectrics, such as CaTiO3 (CT)-based and SrTiO3 (ST)-based ceramics15–18, the relatively low intrinsic polarization leads to their Wrec usually being <7 J cm–3. In addition, although an increasein the electricfield contributes to an enhancement of Wrec, it is usually accompanied by an increase in remnant polarization (Pr), hys- teresis losses, and leakage currents, all of which have negative impacts on η7,19. Therefore, the trade-off between Wrec and η has become a primary challenge in designing high-performance dielectric ceramics. Recently, superparaelectrics (SPEs) developed in RFEs have been considered as promising candidate materials for energy storage20–22. Received: 13 April 2024 Accepted: 30 July 2024 Check for updates 1College of Electrical and Information Engineering, Hunan University, Changsha 410082, China. 2Beijing Advanced Innovation Center for Materials Genome Engineering, Department of Physical Chemistry, University of Science and Technology Beijing, Beijing 100083, China. 3Shenzhen Institute of Advanced Technology, Chinese Academy of Sciences, Shenzhen 518055, China. e-mail: [email protected]; [email protected]; [email protected] Nature Communications| (2024) 15:6754 1 1234567890():,; 1234567890():,; The state of SPEs appears within the temperature range from Tm (the temperature corresponding to the maximum dielectric constant) to TB (the Burns temperature) and is characterized by weakly coupled polar nanoregions (PNRs). Therefore, SPEs not only maintain a high max- imum polarization (Pm) but also allow for flexible polarization redir- ection with small hysteresis, leading to a higher η compared to conventional RFEs. Based on SPE engineering23,24, Bi0.5Na0.5TiO3 (BNT)- based ceramics achieved a Wrec of 7.2 J cm–3 and a η of 86% at a breakdown electric field (Eb) of 430 kV cm–1, and further, BaTiO3- Bi0.5Na0.5TiO3-NaNbO3 (BT-BNT-NN) ternary ceramics reached a Wrec of 10.59 J cm–3 and a η of 87.6% at a relatively high Eb of 550 kV cm–1. Despite advancements in researching SPEs, the challenge of simulta- neously achieving ultrahigh energy density (Wrec ≥15 J cm–3) and minimal losses (η ≥90%) under high electric fields in bulk SPEs persists due to the lack of precise local structural design. From a thermo- dynamic perspective, when the long-range FE order in RFE materials shrinks down to nanodomains (or PNRs), the switching energy barriers also decrease. As the energy barrier diminishes to a level comparable to or lower than the thermal disturbance energy (kBT, where kB represents the Boltzmann constant), nanodomains (or PNRs) can undergo flexible switching processes with minimal hysteresis, thus exhibiting ideal polarization form with SPE properties on the macro- scopic scale25,26. In this sense, it should be feasible to design ideal SPEs by disrupting long-range FE order to construct flexible local polariza- tion configurations, thereby lowering the switching energy barriers. Here, we consider that entropy engineering has been demon- strated as an advanced strategy for regulating FE polarization in pie- zoelectric and energy storage dielectrics27–30. This is primarily due to the disordered component distribution leading to unmatched atomic size, mass, valence state, and electronegativity, which induce random local strain and electric fields, providing infinite possibilities for tuning the local polarization configurations. Therefore, we design high- entropy SPEs with superior comprehensive energy storage performance through entropy engineering, as shown in Fig. 1. To ensure a large polarization response, Bi0.47Na0.47Ba0.06TiO3 (BNBT), known for its high polarization characteristics, is selected as the base material. The coexistence of tetragonal (T) and rhombohedral (R) phases in BNBT can reduce polarization anisotropy and promote polarization rotation, thereby lowering the switching energy barriers. Meanwhile, Sr0.7La0.2Ta0.2Ti0.75O3 (SLTT) is added to BNBT to regulate configuration entropy (Sconfig) and create the (1 – x)BNBT-xSLTT sys- tem (abbreviated as SLTT-x). The high-entropy effect, combined with the small Pr, the low hysteresis loss of SrTiO3, and the large bandgap (Eg) of La2O3 (5.0 eV) and Ta2O5 (4.0 eV), further enhances the energy storage performance. Through entropy engineering, the long-range order is effectively disrupted, resulting in the formation of locally diverse ferroic distortions. These distortions encompass rich hetero- geneous polarization configurations of R, T, and monoclinic (M)-like phases embedded in a cubic (C) matrix, as well as in-phase tilted, anti- phase tilted, and non-tilted BO6 types. The induction of these het- erogeneous configurations leads to the eventual realization of ideal SPE behavior, while the engineered multiple BO6 tilt types effectively prevent premature polarization saturation. As expected, the high- entropy SPE (SLTT-0.30) exhibits a slender P-E loop at a large Eb of 710 kV cm–1, yielding an impressive Wrec of 15.48 J cm–3 and an ultrahigh η of 90.02%. These results signify a breakthrough in achieving superior energy storage capacities for bulk SPE ceramics. Results and discussion Induction of SPE state As shown in Supplementary Table 1, the Sconfig values of the SLTT-x system are 0.88 R (x = 0), 1.47 R (x = 0.20), 1.54 R (x = 0.25), 1.61 R (x = 0.30), and 1.66 R (x = 0.35), respectively. Supplementary Fig. 1 illustrates the entropy-dependent dielectric properties. When Sconfig reaches 1.61 (SLTT-0.30) and 1.66 R (SLTT-0.35), the Tm drops below room temperature, indicating that both samples have reached room Polarization (μC cm-2) Low Eb Large Pr Large Pm Electric field (kV cm-1) [010] [100] [001] Bi Na Ba Ti O Sr La Ta y p o rt n e g nis a e r c n I Temperature (℃) Dielectric constant (εr) Tm TB Room temperature High temperature SPE state Temperature (℃) Dielectric constant (εr) Tm SPE state Room temperature Polarization (μC cm-2) Electric field (kV cm-1) Inducing strong disorder SPE state and ferroic distortion Superior performance Long-range ferroic orders Heterogeneous configurations Various BO6 tilt types Diverse ferroic distortions R-PNRs C-matrix M-PNRs T-PNRs Low Wrec and η Ehanced Eb Reduced Pr Delayed polarization saturation RFE Ultrahigh Wrec and η SPE Large atomic differences - + - + TB Fig. 1 | Schematic diagram of using entropy engineering to achieve excellent comprehensive energy storage performance. Article https://doi.org/10.1038/s41467-024-51058-6 Nature Communications| (2024) 15:6754 2 synergistic effects, the energy storage performance of SLTT-0.30 ceramic demonstrates excellent stability at different temperatures and frequencies. As illustrated in Supplementary Fig. 14a, b, the unipolar P-E loops maintain slim shapes at different temperatures and fre- quencies. Therefore, the SLTT-0.30 ceramic achieves superior tem- perature insensitivity over the temperature range of 25–175 °C, with Wrec ≈6.59 ± 0.51 J cm–3 and η ≈90.55 ± 2.84% (Fig. 4f). It also exhibits significant frequency insensitivity over the frequency range of 1–500 Hz, with Wrec ≈7.43 ± 0.22 J cm–3 and η ≈87.58 ± 0.91% (Supple- mentary Fig. 14c). These superior stabilities are superior to most reported high-performance lead-free bulk ceramics32,34,55–58. Supplementary Fig. 15 shows the excellent charge-discharge properties of the SLTT-0.30 high-entropy SPE. It achieves a high dis- charge energy density (Wdis = 2.37 J cm–3) in an ultrafast time (t0.9 = 33 ns) under 320 kV cm–1. The maximum current (Imax), current density (CD), and power density (PD) reach 19.5 A, 621.7 A cm–2, and 93.3 MW cm–3 under an electric field of 300 kV cm–1, respectively. Additionally, the charge-discharge parameters demonstrate excellent temperature stability at 240 kV cm–1. Minimal change in performance even at temperatures from 25 °C – 150 °C, with Wdis ≈1.42 ± 0.05 J cm–3, t0.9 ≈31 ± 2 ns, Imax ≈13.37 ± 0.02 A, CD ≈425.56 ± 0.78 A cm–2, and PD ≈46.83 ± 0.09 MW cm–3. Overall, the SLTT-0.30 ceramic shows great promise as a dielectric for energy storage capacitors due to its stability and impressive charge-discharge performance. In summary, a lead-free bulk SPE has been developed using entropy engineering, demonstrating exceptional comprehensive energy storage performance with a large Wrec of ~15.48 J cm–3 and an ultrahigh η of ~90.02% at 710 kV cm–1. This performance represents the best reported to date for bulk SPEs. Moreover, the high-entropy SPE exhibits remarkable temperature stability, frequency stability, and superior charge-discharge performance. The impressive performance is attributed to the induction of locally diverse ferroic distortion by entropy engineering, including various BO6 tilt types and hetero- geneous symmetries, resulting in a room temperature SPE state with simultaneous lower Pr, improved Eb, and delayed polarization satura- tion. This work provides valuable insights into the interplay between entropy engineering, SPE behavior, local structure, and energy storage performance. Methods Sample preparation The (1 – x)BNBT-xSLTT system (abbreviated as SLTT-x, x = 0, 0.20, 0.25, 0.30, 0.35) was fabricated by raw powders of Bi2O3 (purity of ≥99%), Na2CO3 (purity of 99.99%), BaCO3 (purity of 99.8%), TiO2 (purity of 99.5%), SrCO3 (purity of 99.5%), La2O3 (purity of 99.9%), and Ta2O5 (purity of 99.5%) through a conventional solid-state reaction. The corresponding raw material powders were weighed according to the chemical formulas of BNBT and SLTT, with 1 mol% of Bi2O3 and Na2CO3 added to BNBT to prevent the volatilization of Bi and Na. The BNBT and SLTT raw material powders were dispersed for 18 h by ball milling with zirconia balls in ethanol, respectively, and then dried. The dried BNBT slurry was calcined at 850 °C for 5 h, while the dried SLTT slurry was calcined at 1000 °C for 5 h. Subse- quently, the calcined powders of both materials were mixed and ball- milled for 20 h, followed by drying. The dried powder was mixed with polyvinyl alcohol (PVA) binder and pressed into pellets with a dia- meter of ~10 mm and a thickness of ~1 mm. The pellets were held at 600 °C for 3 h to volatilize PVA, then sintered at 1050–1180 °C for 2 h to obtain ceramic samples. Structural characterization The phase structures of the ceramics at room temperature were examined by X-ray powder diffraction (XRD, Philips X’Pert Pro MPD, Netherlands). The surface microstructure of the ceramics after thin- ning, polishing, and thermal etching was analyzed using field emission scanning electron microscopy (SEM, FEI, Quanta FEG250, USA). Selected area electron diffraction (SAED), domain morphology, and lattice fringes were examined by transmission electron microscopy (TEM, JEOL, JEM-2100, Japan). The response of domain structure to electric fields was characterized using piezoresponse force micro- scopy (PFM, Asylum Research, MFP-3D-Infinity, USA). The local struc- ture of well-polished ceramics was analyzed by a Raman scattering spectrometer (Renishaw, inViaTM, UK). To analyze temperature- dependent structural properties, Raman spectra were obtained using a Raman spectrometer (Horiba Jobin Yvon HR800, France) with a heating stage (Linkam, THM 600, UK) under 532 nm excitation, ran- ging from 25 °C to 250 °C, on the polished SLTT-0.30 ceramic samples. Additionally, temperature-dependent X-ray diffraction (XRD) of SLTT- 0.30 ceramic was obtained using CuKα radiation at temperatures ranging from 25 °C to 250 °C with an XRD instrument (X’pert PRO, PANalytical, Netherlands). To analyze polarization vectors, ampli- tudes, and angles, high-angle annular dark-field (HAADF) atomic-scale images of the SLTT-0.30 ceramic were obtained using atomic- resolution STEM (aberration-corrected Titan Themis 3300), and cus- tom MATLAB scripts were employed for analysis. Electrical performance measurement For energy storage measurements, the samples were thinned and polished to ~0.05 ± 0.01 mm thickness, and gold electrodes with a diameter of 1.5 mm were prepared on their surfaces using ion sput- tering. The ferroelectric analyzer (Aix ACCT, TF analyzer 1000, Germany) was utilized to measure the unipolar P-E loops at room temperature and 10 Hz frequency. Additionally, the same equipment was employed to measure unipolar P-E loops at different temperatures and frequencies to calculate the temperature-dependent and frequency-dependent energy storage performance. The dielectric properties were tested by a dielectric analysis instrument (Tongguo Technology, HCT1821, China). The charge-discharge performance of the ceramics were investigated using a charge-discharge tester (Tongguo Technology, CFD-003, China). Absorption spectrum To obtain the bandgap of the samples, the absorption spectra ranging from 200 to 800 nm wavelength were measured using an ultraviolet- visible (UV-Vis) spectrophotometer (Cary 5000; Agilent, USA). Finite element simulation Details of the finite element simulation are elaborated in the Supple- mentary information. Data availability All data supporting this study and its findings are available within the article and its Supplementary Information. Any data deemed relevant are available from the corresponding author upon request. References 1. Chen, J. et al. Ladderphane copolymers for high-temperature capacitive energy storage. Nature 615, 62–66 (2023). 2. Kim, J. et al. Ultrahigh capacitive energy density in ion-bombarded relaxor ferroelectric films. Science 369, 81–84 (2020). 3. Peddigari, M. et al. Giant energy density via mechanically tailored relaxor ferroelectric behavior of PZT thick film. Adv. Mater. 9, 2302554 (2023). 4. Li, J. et al. Grain-orientation-engineered multilayer ceramic capa- citors for energy storage applications. Nat. Mater. 19, 999–1005 (2020). 5. Yang, L. et al. Perovskite lead-free dielectrics for energy storage applications. Prog. Mater. Sci. 102, 72–108 (2019). 6. Li, J. et al. Multilayer lead‐free ceramic capacitors with ultrahigh energy density and efficiency. Adv. Mater. 30, 1802155 (2018). Article https://doi.org/10.1038/s41467-024-51058-6 Nature Communications| (2024) 15:6754 6 7. Zhao, P. et al. High-performance relaxor ferroelectric materials for energy storage applications. Adv. Energy Mater. 9, 1803048 (2019). 8. Wang, G. et al. Electroceramics for high-energy density capacitors: current status and future perspectives. Chem. Rev. 121, 6124–6172 (2021). 9. Luo, H. et al. Outstanding energy-storage density together with efficiency of above 90% via local structure design. J. Am. Chem. Soc. 146, 460–467 (2024). 10. Chen, L. et al. Compromise optimized superior energy storage performance in lead‐free antiferroelectrics by antiferroelectricity modulation and nanodomain engineering. Small 20, 2306486 (2023). 11. Jiang, J. et al. Ultrahigh energy storage density in lead-free relaxor antiferroelectric ceramics via domain engineering. Energy Storage Mater. 43, 383–390 (2021). 12. Wang, H. et al. Significantly enhanced energy storage performance in high hardness BKT-based ceramic via defect engineering and relaxor tuning. ACS Appl. Mater. Interfaces 14, 54021–54033 (2022). 13. Chai, Q. et al. Superior energy storage properties and optical transparency in K0.5Na0.5NbO3-based dielectric ceramics via mul- tiple synergistic strategies. Small 19, 2207464 (2023). 14. Wang, M. et al. Energy storage properties under moderate electric fields in BiFeO3-based lead-free relaxor ferroelectric ceramics. Chem. Eng. J. 440, 135789 (2022). 15. Liu, J. et al. A synergistic two-step optimization design enables high capacitive energy storage in lead-free Sr0.7Bi0.2TiO3-based relaxor ferroelectric ceramics. J. Mater. Chem. A 11, 609–620 (2023). 16. Liu, L. et al. Multi-scale collaborative optimization of SrTiO3-based energy storage ceramics with high performance and excellent stability. Nano Energy 109, 108275 (2023). 17. Li, C. et al. Superior energy storage capability and stability in lead- free relaxors for dielectric capacitors utilizing nanoscale polariza- tion heterogeneous regions. Small 19, 2206662 (2023). 18. Pu, Y. et al. Enhancing the energy storage properties of Ca0.5Sr0.5TiO3-based lead-free linear dielectric ceramics with excellent stability through regulating grain boundary defects. J. Mater. Chem. C. 7, 14384–14393 (2019). 19. Sun, Z. et al. Strong local polarization fluctuations enabled high electrostatic energy storage in Pb-free. Relaxors. J. Am. Chem. Soc. 146, 13467–13476 (2024). 20. Wang, K. et al. Superparaelectric (Ba0.95,Sr0.05)(Zr0.2,Ti0.8)O3 ultra- capacitors. Adv. Energy Mater. 10, 2001778 (2020). 21. Pan, H. et al. Ultrahigh energy storage in superparaelectric relaxor ferroelectrics. Science 374, 100–104 (2021). 22. Chu, Y.-H. et al. The superparaelectric battery. Science 374, 33–344 (2021). 23. Zheng, Q.et al. Remarkable energy storage properties in (Bi0.5Na0.5) TiO3-based quasilinear relaxor ferroelectrics via superparaelectric regulation. Chem. Eng. J. 483, 149154 (2024). 24. Chen, L. et al. Local diverse polarization optimized comprehensive energy-storage performance in lead-free superparaelectrics. Adv. Mater. 34, 2205787 (2022). 25. Lan, S. et al. Constructing superparaelectric polar structure for dielectric energy storage. Appl. Phys. Lett. 124, 090501 (2024). 26. Bell, A. Calculations of dielectric properties from the superpara- electric model of relaxors. J. Phys. Condens. Matter 5, 8773 (1993). 27. Chen, L. et al. Giant energy-storage density with ultrahigh efficiency in lead-free relaxors via high-entropy design. Nat. Commun. 13, 3089 (2022). 28. Liu, Y. et al. Flexible polarization configuration in high-entropy piezoelectrics with high performance. Acta Mater. 236, 118115 (2022). 29. Qiao, W. et al. High-performance energy storage in BNST-based lead-free ferroelectric ceramics achieved through high-entropy engineering. Chem. Eng. J. 477, 147167 (2023). 30. Yang, B. et al. High-entropy enhanced capacitive energy storage. Nat. Mater. 21, 1074–1080 (2022). 31. Yang, B. et al. Engineering relaxors by entropy for high energy storage performance. Nat. Energy 8, 956–964 (2023). 32. Li, D. et al. Lead-free relaxor ferroelectric ceramics with ultrahigh energy storage densities via polymorphic polar nanoregions design. Small 19, 2206958 (2022). 33. Yan, F. et al. Superior energy storage properties and excellent stability achieved in environment-friendly ferroelectrics via com- position design strategy. Nano Energy 75, 105012 (2020). 34. Yan, F. et al. Optimization of polarization and electric field of bis- muth ferrite-based ceramics for capacitor applications. Chem. Eng. J. 417, 127945 (2021). 35. Wang, Z. et al. (Bi0.5Na0.5)TiO3-based relaxor ferroelectrics with medium permittivity featuring enhanced energy-storage density and excellent thermal stability. Chem. Eng. J. 427, 131989 (2022). 36. Jo, W. et al. On the phase identity and its thermal evolution of lead free (Bi1/2Na1/2)TiO3-6 mol% BaTiO3. J. Appl. Phys. 110, 074106 (2011). 37. Ma, Q. et al. Excellent energy‐storage performance in lead‐free capacitors with highly dynamic polarization heterogeneous nanor- egions. Small 19, 2303768 (2023). 38. Liu, H. et al. Local chemical clustering enabled ultrahigh capacitive energy storage in Pb-free relaxors. J. Am. Chem. Soc. 145, 19396–19404 (2023). 39. Kang, R. et al. Enhanced energy storage performance in Sr0.7La0.2Zr0.15Ti0.85O3-modified Bi0.5Na0.5TiO3 ceramics via con- structing local phase coexistence. Chem. Eng. J. 446, 137105 (2022). 40. Qi, H. et al. Superior energy‐storage capacitors with simultaneously giant energy density and efficiency using nanodomain engineered BiFeO3‐BaTiO3‐NaNbO3 lead‐free bulk ferroelectrics. Adv. Energy Mater. 10, 1903338 (2019). 41. Sun, Z. et al. Superior capacitive energy-storage performance in Pb- free relaxors with a simple chemical composition. J. Am. Chem. Soc. 145, 6194–6202 (2023). 42. Chen, L. et al. Near‐zero energy consumption capacitors by con- trolling inhomogeneous polarization configuration. Adv. Mater. 36, 2313285 (2024). 43. Zhang, Y. et al. High‐performance ferroelectric based materials via high‐entropy strategy: design, properties, and mechanism. InfoMat 5, 12488 (2023). 44. Zhang, Y. et al. Ultrahigh piezoelectric performance benefiting from quasi-isotropic local polarization distribution in complex lead- based perovskite. Nano Energy 104, 107910 (2022). 45. Li, D. et al. A high-temperature performing and near-zero energy loss lead-free ceramic capacitor. Energy Environ. Sci. 16, 4511–4521 (2023). 46. Guo, J. et al. Multi-symmetry high-entropy relaxor ferroelectric with giant capacitive energy storage. Nano Energy 112, 108458 (2023). 47. Zhao, W. et al. Broad-high operating temperature range and enhanced energy storage performances in lead-free ferroelectrics. Nat. Commun. 14, 5725 (2023). 48. Liu, J. et al. Giant comprehensive capacitive energy storage in lead- free quasi-linear relaxor ferroelectrics via local heterogeneous polarization configuration. J. Mater. Chem. A 11, 15931–15942 (2023). 49. Chen, L. et al. Large energy capacitive high-entropy lead-free fer- roelectrics. Nano Micro Lett. 15, 65 (2023). 50. Wang, W. et al. Enhancing energy storage performance in Na0.5Bi0.5TiO3-based lead-free relaxor ferroelectric ceramics along a stepwise optimization route. J. Mater. Chem. A 11, 2641–2651 (2023). 51. Zhang, M. et al. Ultrahigh energy storage in high-entropy ceramic capacitors with polymorphic relaxor phase. Science 384, 185–189 (2024). Article https://doi.org/10.1038/s41467-024-51058-6 Nature Communications| (2024) 15:6754 7 52. Xie, A. et al. NaNbO3-(Bi0.5Li0.5)TiO3 lead-free relaxor ferroelectric capacitors with superior energy-storage performances via multiple synergistic design. Adv. Energy Mater. 11, 2101378 (2021). 53. Zhang, Y. et al. Superior energy-storage properties in Bi0.5Na0.5TiO3-based lead-free ceramics via simultaneously manipulating multiscale structure and field-induced structure transition. ACS Appl. Mater. Interfaces 14, 40043–40051 (2022). 54. Zhao, J. et al. Delayed polarization saturation induced superior energy storage capability of BiFeO3-based ceramics via introduc- tion of non-isovalent ions. Small 19, 2206840 (2023). 55. Luo, N. et al. Constructing phase boundary in AgNbO3 antiferro- electrics: pathway simultaneously achieving high energy density and efficiency. Nat. Commun. 11, 4824 (2020). 56. Li, S. et al. Giant energy density and high efficiency achieved in silver niobate-based lead-free antiferroelectric ceramic capacitors via domain engineering. Energy Storage Mater. 34, 417–426 (2021). 57. Chen, L. et al. Outstanding energy storage performance in high‐ hardness(Bi0.5K0.5)TiO3‐based lead‐free relaxors via multi‐scale synergistic design. Adv. Funct. Mater. 32, 2110478 (2022). 58. Chen, Z. et al. Phase engineering in NaNbO3 antiferroelectrics for high energy storage density. J. Materiomics. 8, 753–762 (2022). Acknowledgements This work was supported by the National Natural Science Foundation of China (No.52102129, H.L.), the Hunan Provincial Natural Science Foun- dation of China (No.2023JJ30138, H.L.), the Science and Technology Innovation Program of Hunan Province (2023RC3094, H.L.), and the Shenzhen Science and Technology Program (Grant No. RCYX20200714114733204 and JCYJ20200109115219157, G.K.Z.). Author contributions This work was conceived and designed by J.H.D., H.Q., G.K.Z., and H.L. Sample fabrication was performed by J.H.D. and K.W., who also con- ducted energy storage, dielectric, and charge-discharge performance tests, as well as analyzed relevant data. Finite element simulations of breakdown characteristics were conducted by H.F.Y. SEM and Raman spectroscopy were performed by H.L. and L.Z.M. UV-Vis data was col- lected and processed by H.L. PFM images were captured and processed by G.K.Z. HAADF-STEM imaging was carried out by H.Q. and processed accordingly. Temperature-dependent Raman and XRD data were col- lected by H.Q. and analyzed by J.H.D. XRD testing and corresponding data analysis were carried out by Y.C.T. The manuscript was drafted by J.H.D. and revised by H.L., Q.B.D., H.Q., G.K.Z., and Y.C.T. All authors participated in data analysis and discussions. Competing interests The authors declare no competing interests Additional information Supplementary information The online version contains supplementary material available at https://doi.org/10.1038/s41467-024-51058-6. Correspondence and requests for materials should be addressed to He Qi, Gaokuo Zhong or Hao Li. Peer review information Nature Communications thanks Dibakar Das, Jigong Hao and the other anonymous reviewer(s) for their contribution to the peer review of this work. A peer review file is available. Reprints and permissions information is available at http://www.nature.com/reprints Publisher’s note Springer Nature remains neutral with regard to jur- isdictional claims in published maps and institutional affiliations. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/ licenses/by/4.0/. © The Author(s) 2024 Article https://doi.org/10.1038/s41467-024-51058-6 Nature Communications| (2024) 15:6754 8

Title: High-entropy superparaelectrics with locally diverse ferroic distortion for high-capacitive energy storage ​ Authors: Jianhong Duan, Kun Wei, Qianbiao Du, Linzhao Ma, Huifen Yu, He Qi, Yangchun Tan, Gaokuo Zhong, Hao Li ​ Publisher: Nature Communications Date: 2024 Abstract: Superparaelectrics are considered promising candidate materials for achieving superior energy storage capabilities. ​ However, due to the complicated local structural design, simultaneously achieving high recoverable energy density (Wrec) and energy storage efficiency (η) under high electric fields remains a challenge in bulk superparaelectrics. ​ Here, we propose utilizing entropy engineering to disrupt long-range ferroic orders into local polymorphic distortion disorder with multiple BO6 tilt types and diverse heterogeneous polarization configurations. ​ This strategy reduces the switching barriers, thereby facilitating the emergence of superparaelectric behaviors with ideal polarization forms. ​ Furthermore, it enables high polarization response, negligible remnant polarization, delayed polarization saturation, and enhanced breakdown electric fields (Eb) in high-entropy superparaelectrics. ​ Consequently, an extraordinary Wrec of 15.48 J cm–3 and an ultrahigh η of 90.02% are achieved at a high Eb of 710 kV cm–1, surpassing the comprehensive energy storage performance of previously reported bulk superparaelectrics. ​ This work demonstrates that entropy engineering is a viable strategy for designing high-performance superparaelectrics. 


High-Q cavity interface for color centers in thin film diamond.pdf

Article https://doi.org/10.1038/s41467-024-50667-5 High-Q cavity interface for color centers in thin film diamond Sophie W. Ding 1 , Michael Haas1, Xinghan Guo 2, Kazuhiro Kuruma1,3, Chang Jin 1, Zixi Li 2, David D. Awschalom 2,4, Nazar Delegan 2,4, F. Joseph Heremans 2,4, Alexander A. High 2,4 & Marko Loncar 1 Quantum information technology offers the potential to realize unprece- dented computational resources via secure channels distributing entangle- ment between quantum computers. Diamond, as a host to optically-accessible spin qubits, is a leading platform to realize quantum memory nodes needed to extend such quantum links. Photonic crystal (PhC) cavities enhance light- matter interaction and are essential for an efficient interface between spins and photons that are used to store and communicate quantum information respectively. Here, we demonstrate one- and two-dimensional PhC cavities fabricated in thin-film diamonds, featuring quality factors (Q) of 1.8 × 105 and 1.6 × 105, respectively, the highest Qs for visible PhC cavities realized in any material. Importantly, our fabrication process is simple and high-yield, based on conventional planar fabrication techniques, in contrast to the previous with complex undercut processes. We also demonstrate fiber-coupled 1D PhC cavities with high photon extraction efficiency, and optical coupling between a single SiV center and such a cavity at 4 K achieving a Purcell factor of 18. The demonstrated photonic platform may fundamentally improve the perfor- mance and scalability of quantum nodes and expedite the development of related technologies. Diamond, as a host to atom-like defects with optically accessible long-lived spin qubits, has emerged as a compelling platform for applications in quantum sensing1–4 and communication5–8. Among diamond color centers, nitrogen vacancies (NV)1–5, silicon vacancies (SiV)6,7,9–11, and tin vacancies (SnV)8,12–14 are particularly promising and have enabled many state-of-the-art demonstrations of quantum communication. Fundamentally, practical quantum com- munication requires fast and low-loss transfer of quantum informa- tion between spins (stationary qubits/quantum memory) and photons (flying qubits), which translates to figures of merit like bandwidth and fidelity. Therefore, achieving efficient spin-photon interfaces is crucial for a wide range of applications. In diamonds, these interfaces have been realized by embedding the emitters within optical structures, including microcavities15, micro rings/ microdisks16, waveguides8,11,17, and nanophotonic cavities6,9,12,13,18,19, which have been enabled by steady progress in diamond fabrication techniques. Among all structures, photonic crystal (PhC) cavities are one of the most efficient spin-photon interfaces because they sup- port optical modes with high-quality factors (Q) and small mode volumes (V), which greatly enhances light-matter interactions and allow for efficient control and readout of the emitter spin state. As a result, PhC cavities have been utilized in a diverse range of qubit platforms, including quantum dots20, defects in Si or SiC21–23, and rare-earth ions in host materials24–26. Received: 6 February 2024 Accepted: 17 July 2024 Check for updates 1John A. Paulson School of Engineering and Applied Sciences, Harvard University, Cambridge, Massachusetts, USA. 2Pritzker School of Molecular Engi- neering, University of Chicago, Chicago, IL, USA. 3Research Center for Advanced Science and Technology, The University of Tokyo, Meguro-ku, Tokyo, Japan. 4Center for Molecular Engineering and Materials Science Division, Argonne National Laboratory, Lemont, IL, USA. e-mail: [email protected]; [email protected]; [email protected] Nature Communications| (2024) 15:6358 1 1234567890():,; 1234567890():,; Several methods have been developed to fabricate diamond nanophotonic structures from bulk diamond substrates, including the focused-ion-beam (FIB) milling19, Faraday-cage angled etching27, and approaches based on reactive-ion-beam (RIE) angled etching6,9 (Fig. 1a) or quasi-isotropic etching12,13,18 (Fig. 1b). Both angled and quasi-isotropic etching are the state-of-the-art methods and most popular as a result. However, despite great efforts, these methods typically result in visible PhC cavities with Q factors up to the low ~ 104 range, much lower than the simulated values > 106, likely limited by fabrication imperfections such as roughness of etched surfaces induced by complex under- cutting processes28. In parallel, diamond thin films generated by sub- strate thinning and ion-slicing followed by regrowth are explored as the tried-and-true method, due to their potential to simplify and improve fabrication by eliminating undercutting. However, the PhC cavity Qs fabricated using these approaches have been limited to ~103, due to thickness variation and imperfect diamond crystal quality29–31. They are usually incompatible with quantum networking demonstrations for practical reasons, so the bulk machining methods are still the work- horse in the quantum diamond photonics community today. There- fore, a new thin-film platform and fabrication pathway that improves fabrication capability and maintains high diamond quality are needed to enhance the performance of photonic components in diamond. In this paper, we demonstrate a thin film diamond photonic platform and realize optical cavities in the visible wavelength range featuring record-high Q factors coupled to stable SiV centers. In our approach, we use a high-quality and homogenous thin film diamond bonded to a silicon oxide/silicon handle wafer. The film is created through ion implantation in bulk diamond, regrowth, electro- chemical etching, and transfer printing32. We design and fabricate 1D and 2D PhC diamond cavities operating at 737 nm wavelength range and measure a Q-factor up to 1.8 × 105, a record for visible PhC cav- ities fabricated in any material (Table 1). We also fabricate 1D PhCs critically coupled to a feeding waveguide and measure loaded Q of 8.4 × 104 (intrinsic Q ~ 1.8 × 105) and a waveguide-cavity coupling efficiency of ~65%. We show that this fabrication method exhibits high yield and uniformity: 93% (53 out of 57) of the cavities feature high-Q modes with resonances matched closely to the designed resonances. Finally, we demonstrate the coupling of implanted SiVs to fabricated diamond cavities and observe the three-fold reduction of their radiative lifetime, achieving a Purcell factor of 13. We expect the exceptional cavity performance, high-yield fabrication process, and excellent SiV properties of this new platform to further advance the field of quantum photonics as efficient spin-photon interfaces for color centers in diamond and beyond. Fig. 1 | State-of-art high-Q suspended PhC cavities fabrication methods. a Angled etch of a 1D PhC cavity. The structure has a characteristic triangular cross-section due to the nature of the fabrication process. Due to the shallow angle of the ion beam, which would graze the top edge of nearby structures, dense patterns are prohibited. b Quasi-isotropic etch of a 1D PhC cavity. The suspension is achieved by an isotropic O2 reactive-ion etch process. The disadvantage of this method is the long undercutting time that scales with beam width. In both (a) and (b), the structure is carved out of a bulk diamond and usually has visible artifacts/ roughness on the bottom of the nanobeam due to the undercutting. c This work: thin film fabrication of 1D and 2D PhC cavities. This approach relies on top-down etching and undercutting of the handle substrate, so it simplifies the fabrication and avoids the roughness of the bottom surface. As a result, this approach leads to exceedingly higher Qs and also allows for more versatile photonic circuits to be realized. Table 1 | Visible and telecom wavelength suspended diamond PhCs and visible wavelength suspended PhCs in other low-loss visible photonic materials Cavity type, material Wavelength (nm) Q V (λ/n)3 Method Reference 1D, diamond 737 8.3 × 104/1.8 × 105 0.5 Thin film This work 1D, diamond 637 1.4 × 104 ~ 1 Quasi-isotropic etching Mouradian18 1D, diamond 737 2.0 × 104 0.5 Angle etching Bhaskar6 1D, diamond 660 2.4 × 104 0.5 Photoelectrochemical etching Lee31 1D, diamond 1529 (telecom) 1.8 × 105/2.7 × 105 0.57 Angle etching Burek42 1D, SiN 780 1.1 × 105 0.4 Thin film Samutpraphoot45 1D, AlN 403 6.9 × 103 1.6 Thin film Sergent46 1D, 4H-SiC 700 7 × 103 0.5 Photoelectrochemical etching Bracher47 1D, GaP 744 3.0 × 104 ~ 1 Monolithic Chakravarthi48 1D, InGaP 841 2.1 × 104 0.64 Monolithic Saber49 2D, diamond 746 1.6 × 105 2.18 Thin film This work 2D, diamond 645 8 × 103 0.35 Fib Jung19 2D, diamond 1470 (telecom) 1.8 × 103 2.15 Thin film Kuruma29 Article https://doi.org/10.1038/s41467-024-50667-5 Nature Communications| (2024) 15:6358 2 phonon line (ZPL) FZPL is estimated to be 13 (see “Methods”). This value is much smaller than the theoretical Purcell factor (see “Methods”), likely due to the large displacement of SiV position with respect to the cavity field maximum as a result of random bulk implantation. To further improve the Purcell factor, the SiVs can be implanted at the cavity region using the well-established masked implantation technique6,7. We estimate that for SiV mask-implanted at the cavity regions, the cooperativity C, an important figure-of-merit for evaluat- ing the emitter-cavity coupled system, could reach > 960 (under- coupled, Q ~ 1.8 × 105) or > 440 (critically coupled, Q ~ 8.4 × 104) with experimental values (see “Methods”), which are 9 or 4 times higher than the highest value reported in a previous work6. The realization of such a large C as a result of the high-Q cavity is highly advantageous for high fidelity of control of the spin/nuclear states and networking applications. Discussion We have demonstrated high-Q 1D and 2D PhC cavities using the thin film diamond approach. We achieved Q factors up to 1.8 × 105, which is a record high in visible-wavelength PhC cavities in any materials. We also fabricated high-Q 2D PhC cavities thatwere previously challenging using conventional diamond bulk machining approaches and also achieved record-high Q values up to 1.6 × 105. Finally, of interest for practical applications and demonstrations of efficient spin-photon interface, we demonstrated waveguide-coupled 1D PhD cavities fea- turing intrinsic (loaded) Q up to 1.8 × 105 (8.3 × 104) and coupling effi- ciency of 65%. The significant improvement of the experimental Q factors in this work can be attributed to the use of a high-optical- quality thin film diamond membrane with a smooth surface roughness < 0.3 nm and small thickness variation ~ 1 nm32. Still, Qs are one order of magnitude lower than theoretical predictions, indicating that there is room for improvement. The difference could be due to surface absorption38 and/or optical scatterings due to fabrication imperfec- tions such as lithography error of the air holes in position or radius, surface roughness, sidewall roughness/tilt of air holes39. Lastly, we demonstrated optical coupling between the realized high Q cavity and a single SiV, with a measured Purcell factor of 13, and therefore the immediate compatibility of this platform with color- center cavity QED. Using masked implantation, better overlap between SiV and optical mode can be achieved, resulting in cooperativities > 440 at ~ 100 mK (see “Method”). The lower loss and design flexibility in this platform can fundamentally enhance color-center-based tech- nologies, by allowing for higher single photon rates, higher gate fide- lities, more integrated functionalities, etc. In combination with the robust, high uniformity, and high-yield fabrication process, our thin- film diamond platform will hopefully unlock new opportunities for color-center applications for quantum information. Our platform and fabrication approach based on a thin-film dia- mond can be applied to a variety of other micro/nanostructures that are important in diamond integrated photonic applications, such as nonlinear photonics40,41 and diamond phononics42,43. In addition, the flexibility of direct bonding makes this approach easily applicable to other substrates besides Si/SiO2 32, which enables the heterogeneous integration of the diamond platform containing color centers onto existing and emerging integrated photonic circuits for quantum net- works, including thin-film lithium niobate11, aluminum nitride10, and CMOS-compatible platforms44. Methods Confocal photoluminescence measurement setup In Fig. 3, both spectra for 1D and 2D devices are measured using a commercial spectrometer system with free-space off-resonance Fig. 5 | SiV characterization and its optical coupling to the PhC cavity at 4 K. a An illustration of SiV placed close to the center of PhC cavity (SEM image). SiV is an interstitial defect consisting of Si atoms positioned between two sites with missing carbon atoms in a diamond lattice. b A simplified level diagram of SiV, featuring A ~ D, 4 optical transitions around 737 nm. c Second-order autocorrela- tion measurement of the C line under on-resonant excitation. The g2(0) < 0.5 con- firms the single-photon nature of the emitter. d Top panel: the stability of the C line of a SiV over two hours. The plot shows normalized intensity over time. The drift is much less than a linewidth; bottom panel: a scan of the C line at 120 min. e The photoluminescence (PL) spectra of the SiV as the cavity is tuned closer to the C and D lines. Each spectrum is normalized to the highest peak. The D line is getting much brighter as the cavity is tuned into resonance. f The measured lifetime of the SiV on and off-resonance (bulk) with the cavity, which shows a factor of 3 reductions. The two lifetimes correspond to the initial and final PL spectra in (e) of the same colors. Article https://doi.org/10.1038/s41467-024-50667-5 Nature Communications| (2024) 15:6358 6 excitation and collection. A green diode laser (523 nm) is used to scatter off of the cavities via an objective (x100), and the scatter light is sent through a 1800 gr/mm grating and collected by a Si CCD camera cooled to 4 K. The spectrometer used is SpectraPro HRS-750, the supercontinuum laser is SuperK EXTREME. Cross-polarized measurement setup In Fig. 4, the visible scanning laser is M Squared, which can stabilize in 710–790 nm, and the APD is SPCM-AGRH-14-FC from Perkin Elmer. For these measurements, the input polarizer is aligned to the cavity polarization (TE), the half-wave plate is set to 23.5° so that the laser polarization is 45° relative to the cavity polarization, and the output polarization is set to be perpendicular to the cavity polarization. The working principle behind the measurement is that the cavity acts as a polarization filter when the incident light is resonant with the cavity. As such, off-resonant light is fully blocked by the cross-polarization between P1 and P2, but the light resonant with the cavity has a non-zero polarization component in the direction of P2, resulting in a Lorentzian peak in reflection corre- sponding to the cavity resonance. Fiber-coupling measurement setup The waveguide-coupled 1D PhC cavities are measured via fiber- coupled reflection measurements (shown in Fig. 4e. These measure- ments are performed by inputting light from a tunable laser (M Squared) into the diamond waveguide via a tapered optical fiber (S630 HP)33 and measuring the reflected light from the optical cavity. Data availability The data supporting this study’s findings are available from the cor- responding author (S.W.D.) upon request. References 1. Miller, B. S. et al. Spin-enhanced nanodiamond biosensing for ultrasensitive diagnostics. Nature 587, 588–593 (2020). 2. Mamin, H. J. et al. Nanoscale nuclear magnetic resonance with a nitrogen-vacancy spin sensor. Science 339, 557–560 (2013). 3. Zhao, N. et al. Sensing single remote nuclear spins. Nat. Nano- technol. 7, 657–662 (2012). 4. Glenn, D. R. et al. High-resolution magnetic resonance spectro- scopy using a solid-state spin sensor. Nature 555, 351–354 (2018). 5. Hermans,S. L.N. et al.Qubit teleportationbetween non-neighbouring nodes in a quantum network. Nature 605, 663–668 (2022). 6. Bhaskar, M. K. et al. Experimental demonstration of memory- enhanced quantum communication. Nature 580, 60–64 (2020). 7. Stas, P.-J. et al. Robust multi-qubit quantum network node with integrated error detection. Science 378, 557–560 (2022). 8. Parker, R. A. et al. A diamond nanophotonic interface with an opti- cally accessible deterministic electronuclear spin register. Nat. Photonics 18, 1–6 (2023). 9. Zhang, J. L. et al. Strongly cavity-enhanced spontaneous emission from silicon-vacancy centers in diamond. Nano Lett. 18, 1360–1365 (2018). 10. Maity, S. et al. Coherent acoustic control of a single silicon vacancy spin in diamond. Nat. Commun. 11, 193 (2020). 11. Riedel, D. et al. Efficient photonic integration of diamond color centers and thin-film lithium niobate. ACS Photonics 10, 4236–4243 (2023). 12. K. Kuruma. et al. Coupling of a single tin-vacancy center to a pho- tonic crystal cavity in diamond. Appl. Phys. Lett. 118, 230601 (2021). 13. Rugar, A. E. et al. Quantum photonic interface for tin-vacancy centers in diamond. Phys. Rev. X 11, 031021 (2021). 14. Guo, X. et al. Microwave-based quantum control and coherence protection of tin-vacancy spin qubits in a strain-tuned diamond- membrane heterostructure. Phys. Rev. X 13, 041037 (2023). 15. Ruf, M., Weaver, M. J., van Dam, S. B. & Hanson, R. Resonant exci- tation and purcell enhancement of coherent nitrogen-vacancy centers coupled to a fabry-perot microcavity. Phys. Rev. Appl. 15, 024049 (2021). 16. Khanaliloo, B., Mitchell, M., Hryciw, A. C. & Barclay, P. E. High-Q/V monolithic diamond microdisks fabricated with quasi-isotropic etching. Nano Lett. 15, 5131–5136 (2015). 17. Khanaliloo, B. et al. Single-crystal diamond nanobeam waveguide optomechanics. Phys. Rev. X 5, 041051 (2015). 18. Mouradian, S., Wan, N. H., Schröder, T. & Englund, D. Rectangular photonic crystal nanobeam cavities in bulk diamond. Appl. Phys. Lett. 111, 021103 (2017). 19. Jung, T. et al. Spin measurements of NV centers coupled to a photonic crystal cavity. APL Photonics 4, 120803 (2019). 20. Sun, S., Kim, H., Luo, Z., Solomon, G. S. & Waks, E. A single-photon switch and transistor enabled by a solid-state quantum memory. Science 361, 57–60 (2018). 21. Saggio, V., et al. Cavity-enhanced single artificial atoms in silicon. Nat Commun 15, 5296 (2024). 22. Lukin, D. M. et al. 4H-silicon-carbide-on-insulator for integrated quantum and nonlinear photonics. Nat. Photonics 14, 330–334 (2019). 23. Crook, A. L. et al. Purcell enhancement of a single silicon carbide color center with coherent spin control. Nano Lett. 20, 3427–3434 (2020). 24. Yang, L., Wang, S., Shen, M., Xie, J. & Tang, H. X. Controlling single rare earth ion emission in an electro-optical nanocavity. Nat. Com- mun. 14, 1718 (2023). 25. Zhong, T., Kindem, J. M., Miyazono, E. & Faraon, A. Nanophotonic coherent light-matter interfaces based on rare-earth-doped crys- tals. Nat. Commun. 6, 8206 (2015). 26. Raha, M. et al. Optical quantum nondemolition measurement of a single rare earth ion qubit. Nat. Commun. 11, 1605 (2020). 27. Burek, M. J. et al. High quality-factor optical nanocavities in bulk single-crystal diamond. Nat. Commun. 5, 5718 (2014). 28. Chia, C. Quantum optomechanics with color centers in diamond. (Harvard University, (2021). 29. Kuruma, K. et al. Telecommunication-wavelength two-dimensional photonic crystal cavities in a thin single-crystal diamond mem- brane. Appl. Phys. Lett. 119, 171106 (2021). 30. Jung, T. et al. Reproducible fabrication and characterization of diamond membranes for photonic crystal cavities. Phys. Status Solidi 213, 3254–3264 (2016). 31. Lee, J. C. et al. Deterministic coupling of delta-doped nitrogen vacancy centers to a nanobeam photonic crystal cavity. Appl. Phys. Lett. 105, 261101 (2014). 32. Guo, X. et al. Direct-bonded diamond membranes for hetero- geneous quantum and electronic technologies. Preprint at arXiv https://doi.org/10.48550/arXiv.2306.04408 (2023). 33. Burek, M. J. et al. Fiber-coupled diamond quantum nanophotonic interface. Phys. Rev. Appl. 8, 024026 (2017). 34. Zeng, B. et al. Cryogenic packaging of nanophotonic devices with a low coupling loss<1 dB. Appl. Phys. Lett. 123, 161106 (2023). 35. Evans, R. E., Sipahigil, A., Sukachev, D. D., Zibrov, A. S. & Lukin, M. D. Narrow-linewidth homogeneous optical emitters in diamond nanostructures via silicon ion implantation. Phys. Rev. Appl. 5, 044010 (2016). 36. Guo, X. et al. Tunable and transferable diamond membranes for integrated quantum technologies. Nano Lett. 21, 10392–10399 (2021). 37. Meesala, S. et al. Strain engineering of the silicon-vacancy center in diamond. Phys. Rev. B Condens. Matter 97, 205444 (2018). 38. Asano, T., Ochi, Y., Takahashi, Y., Kishimoto, K. & Noda, S. Photonic crystal nanocavity with a Q factor exceeding eleven million. Opt. Express 25, 1769–1777 (2017). Article https://doi.org/10.1038/s41467-024-50667-5 Nature Communications| (2024) 15:6358 7 39. Asano, T., Song, B.-S. & Noda, S. Analysis of the experimental Q factors (~ 1 million) of photonic crystal nanocavities. Opt. Express 14, 1996–2002 (2006). 40. Hausmann, B. J. M., Bulu, I., Venkataraman, V., Deotare, P. & Lon- čar, M. Diamond nonlinear photonics. Nat. Photonics 8, 369–374 (2014). 41. Latawiec,P. et al.On-chip diamondRaman laser.Optica 2, 924 (2015). 42. Burek, M. J. et al. Diamond optomechanical crystals. Optica 3, 1404–1411 (2016). 43. Ovartchaiyapong, P., Lee, K. W., Myers, B. A. & Jayich, A. C. B. Dynamic strain-mediated coupling of a single diamond spin to a mechanical resonator. Nat. Commun. 5, 4429 (2014). 44. Kim, D. et al. A CMOS-integrated quantum sensor based on nitrogen–vacancy centres. Nat. Electron. 2, 284–289 (2019). 45. Samutpraphoot, P. et al. Strong coupling of two individually con- trolled atoms via a nanophotonic cavity. Phys. Rev. Lett. 124, 063602 (2020). 46. Sergent, S. et al. High‐ Q AlN ladder‐structure photonic crystal nanocavity fabricated by layer transfer. Phys. Status Solidi C 10, 1517–1520 (2013). 47. Bracher, D. O. & Hu, E. L. Fabrication of High-Q nanobeam photonic crystals in epitaxially grown 4H-SiC. Nano Lett. 15, 6202–6207 (2015). 48. Chakravarthi, S. et al. Hybrid integration of GaP photonic crystal cavities with silicon-vacancy centers in diamond by stamp-transfer. Nano Lett. 23, 3708–3715 (2023). 49. Saber, I. et al. Photonic crystal nanobeam cavities with optical resonances around 800 nm. JOSA B 36, 1823–1828 (2019). Acknowledgements The authors thank Dr. C. De-Eknamkul, Dr. B. Pingault, and Dr. R. Katsumi for their helpful discussions. Research reported in this publication was supported as part of the AWS Center for Quantum Networking’s research alliance with the Harvard Quantum Initiative (or HQI), NSF ERC (EEC-1941583), ONR (N00014-20-1-2425), AFOSR (FA9550-20-1-0105 and MURI on Quantum Phononics), ARO MURI (W911NF1810432). The membrane synthesis is funded through Q-NEXT, supported by the U.S. Department of Energy, Office of Science, and National Quantum Infor- mation Science Research Centers. The membrane bonding work is supported by NSF award AM-2240399 and made use of the Pritzker Nanofabrication Facility (Soft and Hybrid Nanotechnology Experimental Resource, NSF ECCS-2025633) and the Materials Research Science and Engineering Center (NSF DMR-2011854) at the University of Chicago. Diamond growth-related efforts were supported by the U.S. Department of Energy, Office of Basic Energy Sciences, Materials Science and Engineering Division (N.D.) Author contributions S.W.D., K.K., and M.L. conceived the experiment; S.W.D. fabricated the devices; M.H., S.W.D., and C.J. performed cavity and SiV measurements; S.W.D and M.H. performed data analysis. X.G. and Z.L. prepared the thin- film sample; K.K. performed the FDTD simulation; N.D. performed the diamond synthesis; S.W.D wrote the manuscript with input from all co- authors. M.L., A.H., D.D.A., and F.J.H. participated in and supervised the project. Competing interests The authors declare no competing interests. Additional information Supplementary information The online version contains supplementary material available at https://doi.org/10.1038/s41467-024-50667-5. Correspondence and requests for materials should be addressed to Sophie W. Ding, Alexander A. High or Marko Loncar. Peer review information Nature Communications thanks the anon- ymous, reviewers for their contribution to the peer review of this work. A peer review file is available. Reprints and permissions information is available at http://www.nature.com/reprints Publisher’s note Springer Nature remains neutral with regard to jur- isdictional claims in published maps and institutional affiliations. Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence toshare adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http:// creativecommons.org/licenses/by-nc-nd/4.0/. © The Author(s) 2024 Article https://doi.org/10.1038/s41467-024-50667-5 Nature Communications| (2024) 15:6358 8

Title: High-Q cavity interface for color centers in thin film diamond Authors: Sophie W. Ding, Michael Haas, Xinghan Guo, Kazuhiro Kuruma, Chang Jin, Zixi Li, David D. Awschalom, Nazar Delegan, F. Joseph Heremans, Alexander A. High, Marko Loncar ​ Publisher: Nature Communications Date: 2024-07-28 00:00:00 Abstract: Quantum information technology offers the potential to realize unprecedented computational resources via secure channels distributing entanglement between quantum computers. ​ Diamond, as a host to optically-accessible spin qubits, is a leading platform to realize quantum memory nodes needed to extend such quantum links. ​ Photonic crystal (PhC) cavities enhance light-matter interaction and are essential for an efficient interface between spins and photons that are used to store and communicate quantum information respectively. ​ Here, we demonstrate one-and two-dimensional PhC cavities fabricated in thin-film diamonds, featuring quality factors (Q) of 1.8 × 10^5 and 1.6 × 10^5, respectively, the highest Qs for visible PhC cavities realized in any material. ​ Importantly, our fabrication process is simple and high-yield, based on conventional planar fabrication techniques, in contrast to the previous with complex undercut processes. ​ We also demonstrate fiber-coupled 1D PhC cavities with high photon extraction efficiency, and optical coupling between a single SiV center and such a cavity at 4 K achieving a Purcell factor of 18. ​ The demonstrated photonic platform may fundamentally improve the performance and scalability of quantum nodes and expedite the development of related technologies. ​



Defect Passivation on Lead‐Free CsSnI3 Perovskite Nanowires Enables High‐Performance Photodetectors with Ultra‐High Stability.pdf

Vol.:(0123456789) 1 3 Defect Passivation on Lead‑Free ­CsSnI3 Perovskite Nanowires Enables High‑Performance Photodetectors with Ultra‑High Stability Zheng Gao1,2,3, Hai Zhou1 *, Kailian Dong2, Chen Wang2, Jiayun Wei3, Zhe Li2, Jiashuai Li2, Yongjie Liu2, Jiang Zhao3 *, Guojia Fang2 * HIGHLIGHTS • Through materials analysis and theoretical calculations, the defects of ­CsSnI3 nanowires (NWs) were effectively passivated via incor- porating 1-butyl-2,3-dimethylimidazolium chloride into perovskites. • The high-performance ­CsSnI3 NW photodetectors (PDs) were achieved with a responsivity of up to 0.237 A ­W−1, a high detectivity of 1.18 × ­1012 Jones and a linear dynamic range of 180 dB. These values are comparable to the reported high-performance Pb-based perovskite PDs and higher than those of the Pb-free perovskite PDs. • Our unpackaged devices exhibit ultra-high stability with no degradation after 60 days of storage in air (25 °C, 50% humidity). ABSTRACT  In recent years, Pb-free ­CsSnI3 perovskite materials with excel- lent photoelectric properties as well as low toxicity are attracting much atten- tion in photoelectric devices. However, deep level defects in ­CsSnI3, such as high density of tin vacancies, structural deformation of ­SnI6 − octahedra and oxidation of ­Sn2+ states, are the major challenge to achieve high-performance ­CsSnI3-based photoelectric devices with good stability. In this work, defect pas- sivation method is adopted to solve the above issues, and the ultra-stable and high-performance ­CsSnI3 nanowires (NWs) photodetectors (PDs) are fabricated via incorporating 1-butyl-2,3-dimethylimidazolium chloride salt (BMIMCl) into perovskites. Through materials analysis and theoretical calculations, ­BMIM+ ions can effectively passivate the Sn-related defects and reduce the dark cur- rent of ­CsSnI3 NW PDs. To further reduce the dark current of the devices, the polymethyl methacrylate is introduced, and finally, the dual passivated ­CsSnI3 NWPDs show ultra-high performance with an ultra-low dark current of 2 × ­10–11 A, a responsivity of up to 0.237 A ­W−1, a high detectivity of 1.18 × ­1012 Jones and a linear dynamic range of 180 dB. Furthermore, the unpackaged devices exhibit ultra-high stability in device performance after 60 days of storage in air (25 °C, 50% humidity), with the device performance remaining above 90%. KEYWORDS  Pb-free; Perovskite; CsSnI3; Photodetector; Nanowire e-ISSN 2150-5551 CN 31-2103/TB ARTICLE Cite as Nano-Micro Lett. (2022) 14:215 Received: 11 September 2022 Accepted: 18 October 2022 Published online: 7 November 2022 © The Author(s) 2022 https://doi.org/10.1007/s40820-022-00964-9 * Hai Zhou, [email protected]; Jiang Zhao, [email protected]; Guojia Fang, [email protected] 1 International School of Microelectronics, Dongguan University of Technology, Dongguan 523808, Guangdong, People’s Republic of China 2 Key Lab of Artificial Micro‑ and Nano‑Structures of Ministry of Education of China, School of Physics and Technology, Wuhan University, Wuhan 430072, People’s Republic of China 3 Faculty of Physics and Electronic Science, Hubei University, Wuhan 430062, People’s Republic of China Nano-Micro Lett. (2022) 14:215 215  Page 2 of 10 https://doi.org/10.1007/s40820-022-00964-9 © The authors 1  Introduction Because of excellent photoelectronic properties and low fabrication cost, organic–inorganic hybrid perovskites have become a hot topic in recent years and are widely used in solar cells [1–4], photodetectors (PDs) [5–7], light-emitting diodes (LEDs) [8, 9], etc. Until now, the highest certified power conversion efficiency of perovskite solar cells has exceeded 25% [10, 12], and the LEDs based on lead-con- taining perovskite materials also show high performance; for example, the highest external quantum efficiency of green LEDs has exceeded 20% [13–15]. However, the presence of heavy metal lead severely limits the commercialization of lead halide materials, which will face security risks of heavy metal lead leakage during mass production, transportation, installation and operation. In this context, lead-free perovskite materials based on tin (Sn) [14], bismuth [15], germanium [16], antimony [17] or copper [18] have attracted much attention. Among these lead-free perovskite materials, ­CsSnI3 is more popular in photovoltaic applications due to its similar crystal and elec- tronic structure to its Pb-based counterpart. Besides, inor- ganic perovskite ­CsSnI3 has a narrow optical band gap close to the Shockley–Queisser limit, with long lifetime and high charge carrier mobility [19, 20]. Moreover, the melting point of the ­CsSnI3 is up to 451 °C, which means that it has excel- lent inherent thermal stability. Therefore, the development of the inorganic perovskite ­CsSnI3 shows great prospect, and many scientists have achieved meaningful results [21–23]. Jin et al. [24] reported the growth of ­CsSnX3 (X = Br, I) per- ovskite semiconductors with controlled orientation and size by high-temperature vapor-phase epitaxy on mica sheets. Yang et al. [25] reported the preparation of ­CsSnX3 (X = Cl, Br, and I) perovskite nanowire (NW) arrays by chemical vapor deposition with a responsivity of 54 mA ­W−1, a detectivity of 3.85 × ­10–5 Jones, and fast rise and decay time constants of 83.8 and 243.4 ms, respectively. However, the efficiency of the solution-processed ­CsSnI3 devices was much lower than that of the Pb-based analogs, mainly due to the weak Sn-I bond of inorganic ­CsSnI3, which causes lower tin vacancy formation energy and the easy oxidation of ­Sn2+ to ­Sn4+, leading to a high level of self-P doping in inorganic ­CsSnI3 perovskites, and the reduction in the device performance and the decrease in the output stability [26]. Therefore, strategies to passivate the Sn defects in inorganic ­CsSnI3 perovskites while maintaining their environmental stability are urgently needed. In this work, 1-butyl-2,3-dimethylimidazolium chloride (BMIMCl) salt is introduced to passivate the defects of per- ovskite ­CsSnI3 NWs. Through materials analysis and theo- retical calculations, the BMIMCl has a strong passivating effect on Sn-related defects via large π-bonds in N–C = N, and the lone pair of electrons in large π-bonds enhances the electron density around ­Sn2+ in ­CsSnI3 and protects it from oxidation to ­Sn4+; thus, the fabricated ­CsSnI3 NWs with BMIMCl show high light absorption, low defect density and air stability. To further reduce the dark current of the devices, the polymethyl methacrylate (PMMA) was applied, and finally, the dual passivated ­CsSnI3 NW PDs show ultra- high performance with an ultra-low dark current of 2 × ­10–11 A, a high responsivity of 0.237 A ­W−1, a high detectivity of 1.18 × ­1012 Jones and a linear dynamic range (LDR) of 180 dB. Besides, our unpackaged devices exhibit good sta- bility with less than 10% degradation in device performance after 60 days of storage in air (25 °C, 50% humidity), dem- onstrating good application potential. 2  Experimental and Calculation 2.1  Device Fabrication A pre-etched indium-tin oxide (ITO) glass substrate was ultrasonically cleaned with detergent, deionized water, ethanol and iso-propyl alcohol for 15 min, respectively. To prepare the ­SnO2 precursor solution, the ­SnO2 stock solu- tion (1 mL) was diluted in deionized water (4 mL). The as- cleaned ITO substrate was treated with UV ozone at 100 °C for 10 min. A compact layer of ­SnO2 was spin-coated on top of the ITO at 4000 rpm for 30 s. Then, it was heated at 150 °C for 30 min in air. After that, the samples were treated with UV ozone for 10 min. Subsequently, the samples were transferred into a ­N2 filled glovebox with ­H2O and ­O2 con- centrations of < 0.1 ppm. A layer of ­PbI2 film was fabri- cated by spin-coating ­PbI2/BMIMCl (1 mol ­mL−1/0, 5, 8, 10 and 15 mg ­mL−1) in DMF at 3000 rpm for 30 s, followed by annealing at 70 °C for 10 min. Then, the substrate was soaked in the prepared CsI/SnI2/SnF2 (5 /4 /0.4 mg ­mL−1) solution in anhydrous methanol for 2 h. After that, the sub- strates were placed in an isopropyl alcohol solution for 20 s and then annealed at 180 °C for 10 min. Finally, a layer of Nano-Micro Lett. (2022) 14:215 215  Page 8 of 10 https://doi.org/10.1007/s40820-022-00964-9 © The authors that the introduction of the BMIMCl and PMMA not only enhances the optoelectronic performance of the device, but also improves the stability of the device. 4  Conclusions In conclusion, the BMIMCl was introduced in ­CsSnI3 NWs to passivate the Sn vacancies and reduce the dark current of the ­CsSnI3 NWPDs. Experimental analysis and theoretical calculation demonstrate that ­BMIM+ ions can effectively suppress the oxidation of ­Sn2+ to ­Sn4+ in the BMIMCl + ­CsSnI3 sample. For further reduce the dark cur- rent of the devices, the PMMA was applied, and finally, the dual passivated ­CsSnI3 NW PDs show ultra-high per- formance with an ultra-low dark current of 2 × ­10–11 A, a responsivity of up to 0.237 A ­W−1, a high detectivity of 1.18 × ­1012 Jones and a linear dynamic range of 180 dB. Fur- thermore, our unpackaged devices exhibit ultra-high stabil- ity in device performance after 60 days of storage in air (25 °C, 50% humidity), with the device performance remain- ing above 90%. This work provides a simple and effective method for the preparation of high-performance, highly sta- ble Pb-free perovskite photoelectric devices. Acknowledgements  We acknowledge grants from the National Natural Science Foundation of China (Nos. 51972101, 62074117, 12134010) and the Shenzhen Fundamental Research Program (No. JCYJ20190808152609307). Funding  Open access funding provided by Shanghai Jiao Tong University. Open Access  This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Com- mons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Com- mons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creat​iveco​mmons.​org/​licen​ses/​by/4.​0/. Supplementary Information  The online version contains supplementary material available at https://​doi.​org/​10.​1007/​ s40820-​022-​00964-9. References 1. P. Guo, H. Zhu, W. Zhao, C. Liu, L. Zhu et al., Interfacial embedding of laser-manufactured fluorinated gold clusters enabling stable perovskite solar cells with efficiency over 24%. Adv. Mater. 33(36), 2101590 (2021). https://​doi.​org/​10.​1002/​ adma.​20210​1590 2. Y. Zhang, Y. Ma, Y. Wang, X. Zhang, C. Zuo et al., Lead-free perovskite photodetectors: progress, challenges, and opportu- nities. Adv. Mater. 33(26), 2006691 (2021). https://​doi.​org/​10.​ 1002/​adma.​20200​6691 3. B.B. Yu, Z. Chen, Y. Zhu, Y. Wang, B. Han et al., Heterogene- ous 2D/3D tin-halides perovskite solar cells with certified con- version efficiency breaking 14%. Adv. Mater. 33(36), 2102055 (2021). https://​doi.​org/​10.​1002/​adma.​20210​2055 4. C. Li, Y. Ma, Y. Xiao, L. Shen, L. Ding, Advances in perovs- kite photodetectors. InfoMat 2(6), 1247–1256 (2020). https://​ doi.​org/​10.​1002/​inf2.​12141 5. N. Ma, J. Jiang, Y. Zhao, L. He, Y. Ma et al., Stable and sensi- tive tin-lead perovskite photodetectors enabled by azobenzene derivative for near-infrared acousto-optic conversion commu- nications. Nano Energy 86, 21106113 (2021). https://​doi.​org/​ 10.​1016/j.​nanoen.​2021.​106113 6. Z. Shuang, H. Zhou, D. Wu, X. Zhang, B. Xiao et al., Low- temperature process for self-powered lead-free ­Cs2AgBiBr 6 perovskite photodetector with high detectivity. Chem. Eng. Fig. 5   Stability of the PD under different conditions in air (25 °C, 50% humidity): a stability for long-time testing; b stability in long- term storage Nano-Micro Lett. (2022) 14:215 Page 9 of 10  215 1 3 J. 433, 22134544 (2022). https://​doi.​org/​10.​1016/j.​cej.​2022.​ 134544 7. L. Zhang, X. Pan, L. Liu, L. Ding, Star perovskite materials. J. Semiconduct. 43(3), 030203 (2022). https://​doi.​org/​10.​ 1088/​1674-​4926/​43/3/​030203 8. X. Tang, H. Zhou, X. Pan, R. Liu, D. Wu et al., All-inorganic halide perovskite alloy nanowire network photodetectors with high performance. ACS Appl. Mater. Interfaces 12(4), 4843–4848 (2020). https://​doi.​org/​10.​1021/​acsami.​9b216​66 9. Z. Chu, Q. Ye, Y. Zhao, F. Ma, Z. Yin et al., Perovskite light- emitting diodes with external quantum efficiency exceeding 22% via small-molecule passivation. Adv. Mater. 33(18), 2007169 (2020). https://​doi.​org/​10.​1002/​adma.​20200​7169 10. H. Min, D.Y. Lee, J. Kim, G. Kim, K.S. Lee et al., Perovs- kite solar cells with atomically coherent interlayers on ­SnO2 electrodes. Nature 598(7881), 444–450 (2021). https://​doi.​ org/​10.​1038/​s41586-​021-​03964-8 11. X. Pan, J. Zhang, H. Zhou, R. Liu, D. Wu et al., Single- layer ZnO hollow hemispheres enable high-performance self-powered perovskite photodetector for optical commu- nication. Nano-Micro Lett. 13, 70 (2021). https://​doi.​org/​10.​ 1007/​s40820-​021-​00596-5 12. J.J. Yoo, G. Seo, M.R. Chua, T.G. Park, Y. Lu et al., Effi- cient perovskite solar cells via improved carrier manage- ment. Nature 590(7847), 587–593 (2021). https://​doi.​org/​ 10.​1038/​s41586-​021-​03285-w 13. Z. Liu, W. Qiu, X. Peng, G. Sun, X. Liu et al., Perovskite light-emitting diodes with EQE exceeding 28% through a synergetic dual-additive strategy for defect passivation and nanostructure regulation. Adv. Mater. 33(43), 2103268 (2021). https://​doi.​org/​10.​1002/​adma.​20210​3268 14. T. Ye, K. Wang, Y. Hou, D. Yang, N. Smith et al., Ambient- air-stable lead-free CsSnI3 solar cells with greater than 7 5% efficiency. J. Am. Chem. Soc. 143(11), 4319–4328 (2021). https://​doi.​org/​10.​1021/​jacs.​0c130​69 15. N.K. Tailor, P. Maity, S. Satapathi, Observation of negative photoconductivity in lead-free ­Cs3Bi2Br9 perovskite single crystal. ACS Photon. 8(8), 2473–2480 (2021). https://​doi.​ org/​10.​1021/​acsph​otoni​cs.​1c007​02 16. L.J. Chen, Synthesis and optical properties of lead-free cesium germanium halide perovskite quantum rods. RSC Adv. 8(33), 18396–18399 (2018). https://​doi.​org/​10.​1039/​ c8ra0​1150h 17. A. Singh, P.T. Lai, A. Mohapatra, C.Y. Chen, H.W. Lin et al., Panchromatic heterojunction solar cells for Pb-free all-inorganic antimony based perovskite. Chem. Eng. J. 419, 21129424 (2021). https://​doi.​org/​10.​1016/j.​cej.​2021.​129424 18. C. Pareja-Rivera, D. Solis-Ibarra, Reversible and irreversible thermochromism in copper-based halide perovskites. Adv. Opt. Mater. 9(15), 2100633 (2021). https://​doi.​org/​10.​1002/​ adom.​20210​0633 19. H.H. Fang, S. Adjokatse, S. Shao, J. Even, M.A. Loi, Long- lived hot-carrier light emission and large blue shift in for- mamidinium tin triiodide perovskites. Nat. Commun. 9, 243 (2018). https://​doi.​org/​10.​1038/​s41467-​017-​02684-w 20. M.A. Kamarudin, D. Hirotani, Z. Wang, K. Hamada, K. Nishimura et al., Suppression of charge carrier recombina- tion in lead-free tin halide perovskite via lewis base post- treatment. J. Phys. Chem. Lett. 10(17), 5277–5283 (2019). https://​doi.​org/​10.​1021/​acs.​jpcle​tt.​9b020​24 21. I. Chung, B. Lee, J. He, R.P. Chang, M.G. Kanatzidis, All- solid-state dye-sensitized solar cells with high efficiency. Nature 485(7399), 486–489 (2012). https://​doi.​org/​10.​1038/​ natur​e11067 22. K. Marshall, M. Walker, R. Walton, R. Hatton, Enhanced stability and efficiency in hole-transport-layer-free ­CsSnI3 perovskite photovoltaics. Nat. Energy 1, 16178 (2016). https://​doi.​org/​10.​1038/​nener​gy.​2016.​178 23. T. Ye, L. Pan, Y. Yang, Q. Liang, Y. Lu et al., Synthesis of highly-oriented black ­CsPbI3 microstructures for high- performance solar cells. Chem. Mater. 32(7), 3235–3244 (2020). https://​doi.​org/​10.​1021/​acs.​chemm​ater.​0c004​27 24. J. Chen, Z. Luo, Y. Fu, X. Wang, K.J. Czech et al., Tin(IV)- tolerant vapor-phase growth and photophysical properties of aligned cesium tin halide perovskite ­(CsSnX3, X = Br, I) nanowires. ACS Energy Lett. 4(5), 1045–1052 (2019). https://​doi.​org/​10.​1021/​acsen​ergyl​ett.​9b005​43 25. M. Han, J. Sun, M. Peng, N. Han, Z. Chen et al., Control- lable growth of lead-free all-inorganic perovskite nanowire array with fast and stable near-infrared photodetection. J. Phys. Chem. C 123(28), 17566–17573 (2019). https://​doi.​ org/​10.​1021/​acs.​jpcc.​9b032​89 26. M. Konstantakou, T. Stergiopoulos, A critical review on tin halide perovskite solar cells. J. Mater. Chem. A 5(23), 11518–11549 (2017). https://​doi.​org/​10.​1039/​c7ta0​0929a 27. M. Lai, Q. Kong, C.G. Bischak, Y. Yu, L. Dou et al., Struc- tural, optical, and electrical properties of phase-controlled cesium lead iodide nanowires. Nano Res. 10(4), 1107–1114 (2017). https://​doi.​org/​10.​1007/​s12274-​016-​1415-0 28. Y. Zhou, J. Luo, Y. Zhao, C. Ge, C. Wang et al., Flexible linearly polarized photodetectors based on all-inorganic per- ovskite ­CsPbI3 nanowires. Adv. Opt. Mater. 6(22), 1800679 (2018). https://​doi.​org/​10.​1002/​adom.​20180​0679 29. M. Li, W.W. Zuo, Y.G. Yang, M.H. Aldamasy, Q. Wang et al., Tin halide perovskite films made of highly oriented 2D crystals enable more efficient and stable lead-free per- ovskite solar cells. ACS Energy Lett. 5(6), 1923–1929 (2020). https://​doi.​org/​10.​1021/​acsen​ergyl​ett.​0c007​82 30. T. Ye, B. Zhou, F. Zhan, F. Yuan, S. Ramakrishna et al., Below 200 °C fabrication strategy of black-phase ­CsPbI3 film for ambient-air-stable solar cells. Solar RRL 4(5), 2000014 (2020). https://​doi.​org/​10.​1002/​solr.​20200​0014 31. T. Ye, A. Bruno, G. Han, T.M. Koh, J. Li et al., Efficient and ambient-air-stable solar cell with highly oriented 2D@ 3D perovskites. Adv. Funct. Mater. 28(30), 1801654 (2018). https://​doi.​org/​10.​1002/​adfm.​20180​1654 32. X. Zheng, Y. Hou, C. Bao, J. Yin, F. Yuan et al., Manag- ing grains and interfaces via ligand anchoring enables 22 3%-efficiency inverted perovskite solar cells. Nat. Energy 5(2), 131–140 (2020). https://​doi.​org/​10.​1038/​ s41560-​019-​0538-4 Nano-Micro Lett. (2022) 14:215 215  Page 10 of 10 https://doi.org/10.1007/s40820-022-00964-9 © The authors 33. H. Zhou, Z. Song, C.R. Grice, C. Chen, J. Zhang et al., Self- powered CsPbBr3 nanowire photodetector with a vertical structure. Nano Energy 53, 880–886 (2018). https://​doi.​org/​ 10.​1016/j.​nanoen.​2018.​09.​040 34. J. Zeng, C. Meng, X. Li, Y. Wu, S. Liu, H. Zhou, H. Wang, H. Zeng, Interfacial-tunneling-effect-enhanced CsPbBr 3 photo- detectors featuring high detectivity and stability. Adv. Funct. Mater. 29(51), 1904461 (2019). https://​doi.​org/​10.​1002/​adfm.​ 20190​4461 35. C. Bao, J. Yang, S. Bai, W. Xu, Z. Yan et al., High perfor- mance and stable all-inorganic metal halide perovskite-based photodetectors for optical communication applications. Adv. Mater. 30(38), 1803422 (2018). https://​doi.​org/​10.​1002/​adma.​ 20180​3422 36. J. Li, G. Zhang, Z. Zhang, J. Li, Z. Uddin et al., Defect pas- sivation via additive engineering to improve photodetection performance in ­CsPbI2Br perovskite photodetectors. ACS Appl. Mater. Interfaces 13(47), 56358–56365 (2021). https://​ doi.​org/​10.​1021/​acsami.​1c193​23 37. X. Li, D. Yu, F. Cao, Y. Gu, Y. Wei et al., Healing all-inor- ganic perovskite films via recyclable dissolution–recyrstalli- zation for compact and smooth carrier channels of optoelec- tronic devices with high stability. Adv. Funct Mater. 26(32), 5903–5912 (2016). https://​doi.​org/​10.​1002/​adfm.​20160​1571 38. Z. Li, X. Liu, C. Zuo, W. Yang, X. Fang, Supersaturation- controlled growth of monolithically integrated lead-free hal- ide perovskite single-crystalline thin film for high-sensitivity photodetectors. Adv. Mater. 33(41), 2103010 (2021). https://​ doi.​org/​10.​1002/​adma.​20210​3010 39. S.K. Shil, F. Wang, Z. Lai, Y. Meng, Y. Wang et al., Crystal- line all-inorganic lead-free ­Cs3Sb2I9 perovskite microplates with ultra-fast photoconductive response and robust thermal stability. Nano Res. 14(11), 4116–4124 (2021). https://​doi.​org/​ 10.​1007/​s12274-​021-​3351-x 40. A. Waleed, M.M. Tavakoli, L. Gu, Z. Wang, D. Zhang et al., Lead-free perovskite nanowire array photodetectors with dras- tically improved stability in nanoengineering templates. Nano Lett. 17(1), 523–530 (2017). https://​doi.​org/​10.​1021/​acs.​nanol​ ett.​6b045​87 41. J. Wang, S. Xiao, W. Qian, K. Zhang, J. Yu et al., Self-driven perovskite narrowband photodetectors with tunable spectral responses. Adv. Mater. 33(3), 2005557 (2021). https://​doi.​org/​ 10.​1002/​adma.​20200​5557 42. X. Wu, J. Sun, H. Shao, Y. Zhai, L. Li et al., Self-powered UV photodetectors based on ­CsPbCl3 nanowires enabled by the synergistic effect of acetate and lanthanide ion passivation. Chem. Eng. J. 426, 131310 (2021). https://​doi.​org/​10.​1016/j.​ cej.​2021.​131310 43. X. Xu, C. Fan, Z. Qi, S. Jiang, Q. Xiao et al., ­CsCu2I3 nanorib- bons on various substrates for UV photodetectors. ACS Appl. Nano Mater. 4(9), 9625–9634 (2021). https://​doi.​org/​10.​1021/​ acsanm.​1c020​41 44. F. Zhu, G. Lian, B. Yu, T. Zhang, L. Zhang et al., Pressure- enhanced vertical orientation and compositional control of ruddlesden–popper perovskites for efficient and stable solar cells and self-powered photodetectors. ACS Appl. Mater. Interfaces 14(1), 1526–1536 (2021). https://​doi.​org/​10.​1021/​ acsami.​1c185​22

Title: Defect Passivation on Lead‑Free CsSnI3 Perovskite Nanowires Enables High‑Performance Photodetectors with Ultra‑High Stability ​ Authors: Zheng Gao, Hai Zhou, Kailian Dong, Chen Wang, Jiayun Wei, Zhe Li, Jiashuai Li, Yongjie Liu, Jiang Zhao, Guojia Fang ​ Publisher: Nano-Micro Letters ​ Date: 7 November 2022 ​ Abstract: In recent years, Pb-free CsSnI3 perovskite materials with excellent photoelectric properties as well as low toxicity are attracting much attention in photoelectric devices. ​ However, deep level defects in CsSnI3, such as high density of tin vacancies, structural deformation of SnI6 − octahedra and oxidation of Sn2+ states, are the major challenge to achieve high-performance CsSnI3-based photoelectric devices with good stability. ​ In this work, defect passivation method is adopted to solve the above issues, and the ultra-stable and high-performance CsSnI3 nanowires (NWs) photodetectors (PDs) are fabricated via incorporating 1-butyl-2,3-dimethylimidazolium chloride salt (BMIMCl) into perovskites. ​ Through materials analysis and theoretical calculations, BMIM+ ions can effectively passivate the Sn-related defects and reduce the dark current of CsSnI3 NW PDs. ​ To further reduce the dark current of the devices, the polymethyl methacrylate is introduced, and finally, the dual passivated CsSnI3 NWPDs show ultra-high performance with an ultra-low dark current of 2 ×10–11 A, a responsivity of up to 0.237 A W−1, a high detectivity of 1.18×1012 Jones and a linear dynamic range of 180 dB. ​ Furthermore, the unpackaged devices exhibit ultra-high stability in device performance after 60 days of storage in air (25 °C, 50% humidity), with the device performance remaining above 90%. ​


High‐Entropy Layered Oxide Cathode Enabling High‐Rate for Solid‐State Sodium‐Ion Batteries (1).pdf

Vol.:(0123456789) 1 3 e-ISSN 2150-5551 CN 31-2103/TB ARTICLE Cite as Nano-Micro Lett. (2024) 16:10 Received: 28 June 2023 Accepted: 28 September 2023 © The Author(s) 2023 https://doi.org/10.1007/s40820-023-01232-0 High‑Entropy Layered Oxide Cathode Enabling High‑Rate for Solid‑State Sodium‑Ion Batteries Tianxun Cai1,3, Mingzhi Cai2, Jinxiao Mu1,3, Siwei Zhao2, Hui Bi1, Wei Zhao1,4, Wujie Dong1, Fuqiang Huang1,2,3 * HIGHLIGHTS • High-entropy oxides O3-Na0.95Li0.06Ni0.25Cu0.05Fe0.15Mn0.49O2 cathode constructed by compatible radius and different Fermi level ions was designed for solid-state Na-ion batteries. • Na0.95Li0.06Ni0.25Cu0.05Fe0.15Mn0.49O2 cathode exhibits high-rate performance, air stability and electrochemically thermal stability. • A series of characterizations were performed to explore energy storage mechanism of ­Na0.95Li0.06Ni0.25Cu0.05Fe0.15Mn0.49O2. ABSTRACT  Na-ion O3-type layered oxides are prospective cathodes for Na-ion batteries due to high energy density and low-cost. Nevertheless, such cathodes usually suffer from phase transi- tions, sluggish kinetics and air instability, making it difficult to achieve high performance solid-state sodium-ion batteries. Herein, the high-entropy design and Li doping strategy alleviate lattice stress and enhance ionic conductivity, achieving high-rate performance, air stability and electrochemically thermal stability for ­Na0.95Li0.06Ni0.25Cu0.05Fe0.15Mn0.49O2. This cathode delivers a high reversible capacity (141 mAh ­g−1 at 0.2C), excellent rate capability (111 mAh ­g−1 at 8C, 85 mAh ­g−1 even at 20C), and long-term stability (over 85% capacity retention after 1000 cycles), which is attributed to a rapid and reversible O3–P3 phase transition in regions of low voltage and suppresses phase transition. Moreover, the compound remains unchanged over seven days and keeps thermal stability until 279 ℃. Remarkably, the polymer solid-state sodium battery assembled by this cathode provides a capacity of 92 mAh ­g−1 at 5C and keeps retention of 96% after 400 cycles. This strategy inspires more rational designs and could be applied to a series of O3 cathodes to improve the performance of solid-state Na-ion batteries. KEYWORDS  High-entropy; High-rate performance; Li–TM interaction; Air stability; O3 layered oxide cathode * Fuqiang Huang, [email protected] 1 State Key Laboratory of High Performance Ceramics and Superfine Microstructure, Shanghai Institute of Ceramics, Chinese Academy of Sciences, Shanghai 200050, People’s Republic of China 2 State Key Laboratory of Rare Earth Materials Chemistry and Applications, College of Chemistry and Molecular Engineering, Peking University, Beijing 100871, People’s Republic of China 3 Center of Materials Science and Optoelectronics Engineering, University of Chinese Academy of Sciences, Beijing 100049, People’s Republic of China 4 Zhongke Institute of Strategic Emerging Materials, Yixing 214213, Jiangsu, People’s Republic of China Nano-Micro Lett. (2024) 16:10 10   Page 2 of 12 https://doi.org/10.1007/s40820-023-01232-0 © The authors 1  Introduction Sodium-ion batteries (SIBs) have attracted huge attention as a prospective alternative to lithium-ion batteries (LIBs), particularly in large-scale energy storage because of the abundance and low price of Na resources, as well as simi- lar chemical properties to the commercial LIB [1–3]. The Na-ion layered oxide materials, ­NaxTMO2 have consider- able potential as cathode materials for NIBs owing to the notable benefits including high energy density, facile pro- duction and cost-effectiveness. Designing cathode materi- als possessing high Na content and rapid diffusion kinetics is a crucial aspect in achieving commercial application. Compared with P2-type cathodes, O3-type materials pos- sess higher sodium content, rendering them desirable to couple with sodium-free anode [4, 5]. Nevertheless, the potential for their actual application is constrained by some significant limitations, namely, the complex phase transitions, the sluggish ­Na+ diffusion kinetics and the inherent sensitivity to air. Layered O3-type ­NaxTMO2 displays more complex phase transitions in comparison with its Li analogs due to larger ­Na+ ions associated with charge ordering and the ordering arrangement between ­Na+ and vacancies [5, 6]. The slower sodium-ion kinetics of O3-type material is an inherent characteristic due to its narrower spacing between sodium interlayers. In O3 framework, the migration of ­Na+ between octahedral sites must pass via a tetrahedral site, resulting in a high energy barrier owing to the difference in size between the large Na-ion and confined tetrahedral voids [7, 8]. On the other hand, in the presence of air, O3 materials experience the generation of active Na on the surface. This process is accompanied by the structure aberration and the oxidation of transition metal ions within the bulk. The segregated Na undergoes a fast reaction with ­H2O/CO2 in ambient air. This reaction leads to the creation of NaOH or ­Na2CO3 on the surface of active materials, hence causing the deterio- rated battery performance [7, 9, 10]. Therefore, searching for a strategy to resolve these unfavorable factors is critical for realizing high performance solid-state Na-ion batteries. Some investigations have demonstrated that the appro- priate element substitutions (such as ­Ti4+, ­Mg2+, ­Cu2+, ­Al3+, ­Sn4+, ­Zn2+, etc.) considerably suppress the irrevers- ible phase transition and improve ­Na+ diffusion coefficient of O3-type oxides [11–15]. However, in order to achieve better performance, the O3-type material is still needed to be optimized. High-entropy oxides (HEOs) have gained significant attention in the realm of electrochemical energy storage, owing to its distinctive structure and exceptional performance [16–20]. HEOs are regarded as a stable solid solution phase consisting of five or more elements in equi- molar or nearly equimolar ratios (each element content is within the range of 5–35%) [21, 22]. Zhao et al. suc- cessfully prepared a high-entropy O3-type layered oxide ­NaNi0.12Cu0.12Mg0.12Fe0.15Co0.15Mn0.1Ti0.1Sn0.1Sb0.04O2 cathode. The HEO cathode exhibited remarkable cycling stability, with a capacity retention of 83% after 500 cycles and enhanced rate performance, retaining 80% capacity at 5C. Furthermore, the researchers also revealed that the high-entropy structure can prolong the phase transition, which is beneficial to improve the cycling stability of cath- ode materials [20]. Inspired by HEOs in electrochemical energy storage, we designed a novel five-component layered HEO O3-Na0.95 Li0.06Ni0.25Cu0.05Fe0.15Mn0.49O2 as a cathode for SIBs, the schematic diagram is shown in Fig. 1a. The HEO cathode constructed by compatible radius and different Fermi level ions is effective for preventing charge ordering and reduc- ing the electronic localization [12]. Meanwhile, ionic con- ductivity can be enhanced through disorder, which con- tributes to energetically favorable routes in high-entropy lattices [23]. Owing to the poor overlap between Li: 1s and O: 2p orbitals, the bonding between Li and O is pre- dominantly ionic, resulting in an improved interaction of the TM center with oxygen orbitals and transfer of charge from sodium to oxygen. The strength of the TM-O and Na–O bonds for ­Na0.95Li0.06Ni0.25Cu0.05Fe0.15Mn0.49O2 enhances structure stability. Although ionic bonds are not as strong as covalent bonds, they repair themselves when broken. The combination of ionic and covalent bonds with hardness and softness alleviates stress. Moreover, the ­Li+ and ­Cu2+ with low valence doping increases the valence of manganese ions, which impedes the Jahn–Teller effect. The introduction of Na vacancies decreases the tetrahedral site energy via increased interlayer distance due to the decreased shielding effect [7, 24]. In consequence, this HEO O3-type cathode exhibits excel- lent rate performance and keeps highly reversible structure evolution during cycling, delivering a high reversible capac- ity of 111.4 mAh ­g−1 at 1600 mA ­g−1 and retaining capacity of 83.2% after 500 cycles. Even at 4000 mA ­g−1, this HEO Nano-Micro Lett. (2024) 16:10 10   Page 10 of 12 https://doi.org/10.1007/s40820-023-01232-0 © The authors cycling and rate performance of ­Na0.95LNCFM PSE battery is almost comparable to those of the Liquid battery, demon- strating a promising practical application of SIBs. 4  Conclusion In summary, we report a novel high-entropy O3-type layered cathode for solid-state sodium-ion batteries. The design of high-entropy structure and Li–TM interaction alleviate lattice stress and enhance ionic conductivity, enabling a rapid and reversible O3–P3 phase transition at low voltage regions and suppressing phase transition, thus leading to excellent rate and cycling performances. Meanwhile, due to the strengthened ­TMO2 framework and Na–O binding energy, ­Na0.95LNCFM exhibits remark- able air stability and thermal stability. The combination of high-entropy and Li–TM interaction conceptions is an effective strategy to regulate the phase evolution, air stability and thermal stability. Therefore, we believe that such strategy may also be extensively applied to a series of cathodes to improve the performance of solid-state Na- ion batteries. Acknowledgements  This work was supported by National Natural Science Foundation of China (52202327), Science and Technology Commission of Shanghai Municipality (22ZR1471300), National Science Foundation of China (Grant 51972326) and Youth Innova- tion Promotion Association CAS, Foundation Strengthening Pro- ject, and Program of Shanghai Academic Research Leader (Grant 22XD1424300). Funding  Open access funding provided by Shanghai Jiao Tong University. Declarations  Conflict of interest  The authors declare no conflict of interest. They have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Open Access  This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Com- mons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Com- mons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creat​iveco​mmons.​org/​licen​ses/​by/4.​0/. Supplementary Information  The online version contains supplementary material available at https://​doi.​org/​10.​1007/​ s40820-​023-​01232-0. Fig. 5   Electrochemical performance of ­Na0.95LNCFM PSE battery. a Schematic illustration for ­Na0.95LNCFM PSE battery. b Rate performance. Charge/discharge profiles at various rates. c, d Long-term cycling performance at 2C rate and at 5C rate Nano-Micro Lett. (2024) 16:10 Page 11 of 12  10 1 3 References 1. X.L. Deng, K.Y. Zou, R. Momen, P. Cai, J. Chen et al., High content anion (S/Se/P) doping assisted by defect engineering with fast charge transfer kinetics for high-performance sodium ion capacitors. Sci. Bull. 66(18), 1858–1868 (2021). https://​ doi.​org/​10.​1016/j.​scib.​2021.​04.​042 2. R. Usiskin, Y.X. Lu, J. Popovic, M. Law, P. Balaya et al., Fun- damentals, status and promise of sodium-based batteries. Nat. Rev. Mater. 6(11), 1020–1035 (2021). https://​doi.​org/​10.​1038/​ s41578-​021-​00324-w 3. Z. Guo, G. Qian, C. Wang, G. Zhang, R. Yin et al., Progress in electrode materials for the industrialization of sodium-ion batteries. Prog. Nat. Sci. Mater. 33, 1 (2022). https://​doi.​org/​ 10.​1016/j.​pnsc.​2022.​12.​003 4. P.F. Wang, Y. You, Y.X. Yin, Y.G. Guo, Layered oxide cath- odes for sodium-ion batteries: phase transition, air stability, and performance. Adv. Energy Mater. 8(8), 23 (2018). https://​ doi.​org/​10.​1002/​aenm.​20170​1912 5. K. Kubota, S. Kumakura, Y. Yoda, K. Kuroki, S. Komaba, Electrochemistry and solid-state chemistry of ­NaMeO2 (Me=3d transition metals). Adv. Energy Mater. 8(17), 40 (2018). https://​doi.​org/​10.​1002/​aenm.​20170​3415 6. W. Zhu, J.C. Zhang, J.W. Luo, C.H. Zeng, H. Su et al., Ultra- fast non-equilibrium synthesis of cathode materials for li-ion batteries. Adv. Mater. 35(2), 9 (2023). https://​doi.​org/​10.​1002/​ adma.​20220​8974 7. X.G. Yuan, Y.J. Guo, L. Gan, X.A. Yang, W.H. He et al., A universal strategy toward air-stable and high-rate ­O3 layered oxide cathodes for na-ion batteries. Adv. Funct. Mater. 32(17), 11 (2022). https://​doi.​org/​10.​1002/​adfm.​20211​1466 8. M.H. Han, E. Gonzalo, G. Singh, T. Rojo, A comprehensive review of sodium layered oxides: powerful cathodes for na-ion batteries. Energy Environ. Sci. 8(1), 81–102 (2015). https://​ doi.​org/​10.​1039/​c4ee0​3192j 9. X.W. Li, X. Shen, J.M. Zhao, Y. Yang, Q.Q. Zhang et al., O3-NaFe((1/3−x))Ni(1/3)Mn(1/3)AlxO(2) cathodes with improved air stability for na-ion batteries. ACS Appl. Mater. Interfaces 13(28), 33015–33023 (2021). https://​doi.​org/​10.​ 1021/​acsami.​1c075​54 10. F.X. Ding, Q.S. Meng, P.F. Yu, H.B. Wang, Y.S. Niu et al., Additive-free self-presodiation strategy for high-performance na-ion batteries. Adv. Funct. Mater. 31(26), 9 (2021). https://​ doi.​org/​10.​1002/​adfm.​20210​1475 11. Y.M. Li, Z.Z. Yang, S.Y. Xu, L.Q. Mu, L. Gu et al., Air-stable copper-based P2-Na7/9Cu2/9Fe1/9Mn2/3O2 as a new positive electrode material for sodium-ion batteries. Adv. Sci. 2(6), 7 (2015). https://​doi.​org/​10.​1002/​advs.​20150​0031 12. P.F. Wang, H.R. Yao, X.Y. Liu, J.N. Zhang, L. Gu et al., Ti-substituted ­NaNi0.5Mn0.5−xTixO2 cathodes with reversible O3–P3 phase transition for high-performance sodium-ion batteries. Adv. Mater. 29(19), 7 (2017). https://​doi.​org/​10.​ 1002/​adma.​20170​0210 13. X.Q. Huang, D.L. Li, H.J. Huang, X. Jiang, Z.H. Yang et al., Fast and highly reversible na+ intercalation/extraction in zn/mg dual-doped P2-Na0.67MnO2 cathode material for high-performance na-ion batteries. Nano Res. 14(10), 3531– 3537 (2021). https://​doi.​org/​10.​1007/​s12274-​021-​3715-2 14. Y.X. Wang, L.G. Wang, H. Zhu, J. Chu, Y.J. Fang et al., Ultralow-strain zn-substituted layered oxide cathode with suppressed P2–O2 transition for stable sodium ion storage. Adv. Funct. Mater. 30(13), 9 (2020). https://​doi.​org/​10.​1002/​ adfm.​20191​0327 15. H.R. Yao, P.F. Wang, Y. Gong, J.N. Zhang, X.Q. Yu et al., Designing air-stable O3-type cathode materials by combined structure modulation for na-ion batteries. J. Am. Chem. Soc. 139(25), 8440–8443 (2017). https://​doi.​org/​10.​1021/​jacs.​ 7b051​76 16. X.Y. Du, Y. Meng, H.Y. Yuan, D. Xiao, High-entropy sub- stitution: a strategy for advanced sodium-ion cathodes with high structural stability and superior mechanical properties. Energy Storage Mater. 56, 132–140 (2023). https://​doi.​org/​ 10.​1016/j.​ensm.​2023.​01.​010 17. F. Fu, X. Liu, X.G. Fu, H.W. Chen, L. Huang et al., Entropy and crystal-facet modulation of P2-type layered cathodes for long-lasting sodium-based batteries. Nat. Commun. 13(1), 12 (2022). https://​doi.​org/​10.​1038/​s41467-​022-​30113-0 18. L.B. Yao, P.C. Zou, C.Y. Wang, J.H. Jiang, L. Ma et al., High-entropy and superstructure-stabilized layered oxide cathodes for sodium-ion batteries. Adv. Energy Mater. 12(41), 9 (2022). https://​doi.​org/​10.​1002/​aenm.​20220​1989 19. F.X. Ding, C.L. Zhao, D.D. Xiao, X.H. Rong, H.B. Wang et al., Using high-entropy configuration strategy to design Na-ion layered oxide cathodes with superior electrochemi- cal performance and thermal stability. J. Am. Chem. Soc. 144(18), 8286–8295 (2022). https://​doi.​org/​10.​1021/​jacs.​ 2c023​53 20. C.L. Zhao, F.X. Ding, Y.X. Lu, L.Q. Chen, Y.S. Hu, High- entropy layered oxide cathodes for sodium-ion batteries. Angew. Chem. Int. Ed. 59(1), 264–269 (2020). https://​doi.​ org/​10.​1002/​anie.​20191​2171 21. C.M. Rost, E. Sachet, T. Borman, A. Moballegh, E.C. Dickey et al., Entropy-stabilized oxides. Nat. Commun. 6, 8 (2015). https://​doi.​org/​10.​1038/​ncomm​s9485 22. A. Sarkar, L. Velasco, D. Wang, Q.S. Wang, G. Talasila et al., High entropy oxides for reversible energy storage. Nat. Com- mun. 9, 9 (2018). https://​doi.​org/​10.​1038/​s41467-​018-​05774-5 23. M. Botros, J. Janek, Embracing disorder in solid-state batter- ies. Science 378(6626), 1273–1274 (2022). https://​doi.​org/​10.​ 1126/​scien​ce.​adf33​83 24. H.J. Wang, X. Gao, S. Zhang, Y. Mei, L.S. Ni et al., High- entropy na-deficient layered oxides for sodium-ion batteries. ACS Nano 17, 12530 (2023). https://​doi.​org/​10.​1021/​acsna​no.​ 3c022​90 25. S.Y. Zhang, Y.J. Guo, Y.N. Zhou, X.D. Zhang, Y.B. Niu et al., P3/O3 integrated layered oxide as high-power and long-life cathode toward na-ion batteries. Small 17(10), 7 (2021). https://​doi.​org/​10.​1002/​smll.​20200​7236 26. J.Y. Hwang, S.M. Oh, S.T. Myung, K.Y. Chung, I. Belharouak et al., Radially aligned hierarchical columnar structure as a cathode material for high energy density sodium-ion batteries. Nano-Micro Lett. (2024) 16:10 10   Page 12 of 12 https://doi.org/10.1007/s40820-023-01232-0 © The authors Nat. Commun. 6, 9 (2015). https://​doi.​org/​10.​1038/​ncomm​ s7865 27. P.F. Zhou, Z.N. Che, J. Liu, J.K. Zhou, X.Z. Wu et al., High- entropy P2/O3 biphasic cathode materials for wide-tempera- ture rechargeable sodium-ion batteries. Energy Storage Mater. 57, 618–627 (2023). https://​doi.​org/​10.​1016/j.​ensm.​2023.​03.​ 007 28. L.X. Shen, Y. Jiang, Y.F. Liu, J.L. Ma, T.R. Sun et al., High- stability monoclinic nickel hexacyanoferrate cathode materials for ultrafast aqueous sodium ion battery. Chem. Eng. J. 388, 9 (2020). https://​doi.​org/​10.​1016/j.​cej.​2020.​124228 29. W.J. Dong, B. Ye, M.Z. Cai, Y.Z. Bai, M. Xie et al., Superwet- table high-voltage ­LiCOO2 for low- temperature lithium ion batteries. ACS Energy Lett. 8(2), 881–888 (2023). https://​doi.​ org/​10.​1021/​acsen​ergyl​ett.​2c024​34 30. C. Zeng, C. Duan, Z. Guo, Z. Liu, S. Dou et al., Ultrafastly activated needle coke as electrode material for supercapaci- tors. Prog. Nat. Sci. Mater. Inter. 32(6), 786–792 (2022). https://​doi.​org/​10.​1016/j.​pnsc.​2022.​10.​008 31. Y.Y. Xie, G.L. Xu, H.Y. Che, H. Wang, K. Yang et al., Prob- ing thermal and chemical stability of ­NaxNi1/3Fe1/3Mn1/3O2 cathode material toward safe sodium-ion batteries. Chem. Mat. 30(15), 4909–4918 (2018). https://​doi.​org/​10.​1021/​acs.​chemm​ ater.​8b000​47 32. H.R. Yao, X.G. Yuan, X.D. Zhang, Y.J. Guo, L.T. Zheng et al., Excellent air storage stability of na-based transition metal oxide cathodes benefiting from enhanced na-o binding energy. Energy Storage Mater. 54, 661–667 (2023). https://​doi.​org/​10.​ 1016/j.​ensm.​2022.​11.​005 33. W.H. Zuo, J.M. Qiu, X.S. Liu, F.C. Ren, H.D. Liu et al., The stability of p2-layered sodium transition metal oxides in ambi- ent atmospheres. Nat. Commun. 11(1), 12 (2020). https://​doi.​ org/​10.​1038/​s41467-​020-​17290-6 34. Y.J. Guo, P.F. Wang, Y.B. Niu, X.D. Zhang, Q.H. Li et al., Boron-doped sodium layered oxide for reversible oxygen redox reaction in na-ion battery cathodes. Nat. Commun. 12(1), 11 (2021). https://​doi.​org/​10.​1038/​s41467-​021-​25610-7 35. F.X. Ding, C.L. Zhao, D. Zhou, Q.S. Meng, D.D. Xiao et al., A novel ni-rich ­O3-na ­Ni0.60Fe0.25M0.15 O-2 cathode for na-ion batteries. Energy Storage Mater. 30, 420–430 (2020). https://​ doi.​org/​10.​1016/j.​ensm.​2020.​05.​013 36. J. Pan, S.M. Xu, T.X. Cai, L.L. Hu, X.L. Che et al., Boosting cycling stability of polymer sodium battery by “rigid- flex- ible” coupled interfacial stress modulation. Nano Lett. 23(8), 3630–3636 (2023). https://​doi.​org/​10.​1021/​acs.​nanol​ett.​2c048​ 54

Title: High-Entropy Layered Oxide Cathode Enabling High-Rate for Solid-State Sodium-Ion Batteries ​ Authors: Tianxun Cai, Mingzhi Cai, Jinxiao Mu, Siwei Zhao, Hui Bi, Wei Zhao, Wujie Dong, Fuqiang Huang Publisher: Nano-Micro Letters Date: 2023-09-28 00:00:00 Abstract: Na-ion O3-type layered oxides are prospective cathodes for Na-ion batteries due to high energy density and low-cost. ​ Nevertheless, such cathodes usually suffer from phase transitions, sluggish kinetics, and air instability, making it difficult to achieve high-performance solid-state sodium-ion batteries. ​ Herein, the high-entropy design and Li doping strategy alleviate lattice stress and enhance ionic conductivity, achieving high-rate performance, air stability, and electrochemically thermal stability for Na0.95Li0.06Ni0.25Cu0.05Fe0.15Mn0.49O2. ​ This cathode delivers a high reversible capacity (141 mAh g−1 at 0.2C), excellent rate capability (111 mAh g−1 at 8C, 85 mAh g−1 even at 20C), and long-term stability (over 85% capacity retention after 1000 cycles), which is attributed to a rapid and reversible O3–P3 phase transition in regions of low voltage and suppresses phase transition. ​ Moreover, the compound remains unchanged over seven days and keeps thermal stability until 279 ℃. ​ Remarkably, the polymer solid-state sodium battery assembled by this cathode provides a capacity of 92 mAh g−1 at 5C and keeps retention of 96% after 400 cycles. ​ This strategy inspires more rational designs and could be applied to a series of O3 cathodes to improve the performance of solid-state Na-ion batteries. ​

Overtone photothermal microscopy for high-resolution and high-sensitivity vibrational imaging.pdf

Article https://doi.org/10.1038/s41467-024-49691-2 Overtone photothermal microscopy for high-resolution and high-sensitivity vibrational imaging Le Wang1,4, Haonan Lin 1,4, Yifan Zhu2, Xiaowei Ge 1, Mingsheng Li1, Jianing Liu1, Fukai Chen3, Meng Zhang1 & Ji-Xin Cheng 1,2,3 Photothermal microscopy is a highly sensitive pump-probe method for map- ping nanostructures and molecules through the detection of local thermal gradients. While visible photothermal microscopy and mid-infrared photo- thermal microscopy techniques have been developed, they possess inherent limitations. These techniques either lack chemical specificity or encounter significant light attenuation caused by water absorption. Here, we present an overtone photothermal (OPT) microscopy technique that offers high chemical specificity, detection sensitivity, and spatial resolution by employing a visible probe for local heat detection in the C-H overtone region. We demonstrate its capability for high-fidelity chemical imaging of polymer nanostructures, depth-resolved intracellular chemical mapping of cancer cells, and imaging of multicellular C. elegans organisms and highly scattering brain tissues. By bridging the gap between visible and mid-infrared photothermal microscopy, OPT establishes a new modality for high-resolution and high-sensitivity che- mical imaging. This advancement complements large-scale shortwave infrared imaging approaches, facilitating multiscale structural and chemical investi- gations of materials and biological metabolism. The shortwave infrared (SWIR) window, typically spanning from 900 nm to 2 µm in the electromagnetic spectrum, offers distinct advantages for bioimaging. Compared to the mid-infrared window, the SWIR window has an ~20–5000 times (wavelength-dependent) smaller water absorption coefficient1. Furthermore, SWIR imaging allows for unprecedentedly large penetration depth attributed to much-reduced light scattering2,3. This depth is wavelength-dependent and can extend to the millimeter level4,5. With the rich chemical information based on overtone absorption, SWIR spectroscopy emerges as an appealing analytical tool6. Several SWIR imaging methods have been developed, including hyperspectral reflectance/transmittance imaging7–9, diffuse optical spectroscopic imaging (DOSI)10–12, and photoacoustic micro- scopy (PAM)13,14. SWIR hyperspectral imaging, which measures reflec- tance or transmittance, primarily serves in the qualitative spectral characterization of samples at the macroscale, focusing on properties related to absorption and scattering. To probe macroscopic sample areas for improved representative sampling, this technique generally sacrifices spatial resolution in favor of a larger field-of-view (FOV) due to the space-bandwidth product limit, thereby leading to resolutions on the order of ten micrometers. Diffraction-limited spectroscopic imaging can be attained by magnifying the FOV onto the camera or implementing a laser point-scanning design15,16. DOSI, adopting a wide- field approach, measures the combined effects of broadband optical absorption and scattering. It has proven successful in the study of thick tissues, such as functional information of bone sarcomas and breast tumor hemodynamic responses. This method offers a sub-millimeter lateral resolution and a penetration depth of generally a few milli- meters. PAM utilizes an objective lens as the focusing element and Received: 30 June 2023 Accepted: 11 June 2024 Check for updates 1Department of Electrical and Computer Engineering, Boston University, Boston, MA 02215, USA. 2Department of Chemistry, Boston University, Boston, MA 02215, USA. 3Department of Biology, Boston University, Boston, MA 02215, USA. 4These authors contributed equally: Le Wang, Haonan Lin. e-mail: [email protected] Nature Communications| (2024) 15:5374 1 1234567890():,; 1234567890():,; collects acoustic waves with an ultrasonic transducer to achieve opti- cal resolution. SWIR PAM was first developed for imaging lipids based on the 2nd overtone of the C-H bond14 and more recently imaging water at 1930 nm17, whereas the sensitivity is heavily reliant on the quality of the ultrasonic transducer employed18. Here, we introduce a technique named overtone photothermal (OPT) microscopy, which excites the sample in the SWIR window and employs a visible probe to detect the thermal lensing effect caused by overtone vibrational absorption. Specifically, we utilized a fem- tosecond laser tunable in the C-H 2nd overtone window and a 520 nm probe beam through the second harmonic generation of a 1040 nm femtosecond laser. Both pulses were chirped to picose- cond to minimize photodamage. Compared to existing SWIR ima- ging methods, OPT microscopy provides simultaneous high resolution and high sensitivity. Spectroscopic OPT imaging was successfully demonstrated on polymer nanostructures. In conjunc- tion with spectral unmixing algorithms, depth-resolved OPT map- ping of protein and fatty acids in cancer cells, C. elegans, and brain tissues was performed at intracellular and multicellular levels. These results underscore the potential of OPT microscopy as a valuable technique for investigating chemical structures at high resolution in biological systems and materials. Results OPT microscope setup and signal extraction Figure 1a illustrates a lab-built OPT microscope. The specific optical components and signal extraction methods are detailed in the Meth- ods Section. In brief, the OPT microscope utilizes a pulsed SWIR pump beam, tunable in the range of 1080 nm to 1280 nm, and a 520 nm probe beam generated from the second harmonic generation of the 1040 nm output. Both pump and probe beams are chirped to picose- cond duration by glass rods. The beams are treated as pseudo- continuous waves with a repetition rate of 80 MHz, and the excitation beam is modulated at desirable frequency (hundreds of kHz to 1 MHz) and duty cycle (10% to 50%) based on the sample’s thermal decay properties. The two beams are delivered collinearly to a laser-scanning upright microscope and focused onto the sample plane using a water immersion objective with a numerical aperture (NA) of 1.2. Upon the SWIR illumination, the sample’s selective absorption within the focal volume leads to a local temperature rise and a thermal gradient, inducing a subtle decrease in the local refractive index at the pump beam focus. To efficiently generate photothermal signals, an axial focus displacement between the two beams is implemented, as depicted in Fig. 1b19. In this scenario, the induced thermal lens modifies the propagation of the 520 nm probe beam, causing it to diverge or converge depending on its focal position relative to the pump focus. When there is no axial offset, the thermal lens forms precisely at the focal position of the probe beam. Therefore, the ray locus of the probe beam will not be modified, and the photothermal signal vanishes. By incorporating an iris with an adjustable NA on the collection condenser, the intensity modulation of the probe beam, correspond- ing to the selective absorption, can be read out by a photodiode and demodulated using a lock-in amplifier. As shown in Fig. 1c, the green curve represents the transient probe beam intensity change as a function of periodic heating and cooling processes. The direction of the probe intensity change is determined by the direction of the ver- tical focus displacement of the excitation and probe beams. For the provided thermodynamic trace of dimethyl sulfoxide (DMSO) shown in Fig. 1c, the focus of the probe beam is positioned above that of the excitation beam, resulting in an equivalently divergent lens and a decreased probe intensity on the photodiode. The OPT signal at the modulation frequency is extracted by a lock-in amplifier (Fig. 1d). Spectroscopic OPT imaging is performed by tuning the SWIR wave- length and recording OPT images through laser scanning facilitated by 2D galvo mirrors. Fig. 1 | Operational scheme of overtone photothermal (OPT) microscopy. a Schematics and optical components of the setup. HWP half-wave plate, PBS polarization beam splitter, AOM acousto-optic modulator, LBO lithium triborate crystal, DBS dichroic beam splitter, OBJ objective, PD photodiode. The inset is a vibrational potential energy diagram. b Beam propagation in OPT microscopy. The pulsed SWIR excitation beam and the continuous 520 nm probe beam are colli- nearly propagated and tightly focused onto the sample plane. The axial foci of the two beams have an offset of ΔZ f . c The waveforms of probe intensity as a function of periodic heating and cooling processes. The sign of the probe intensity change is determined by the sign of the axial offset between the excitation and probe foci. The shown thermodynamic trace was measured on DMSO. d Signal extraction in OPT microscopy. The probe intensity change was captured by a photodiode and converted into an electronic voltage signal. After passing through electronic filters and amplifiers, the periodic signal was demodulated by a lock-in amplifier and then registered as OPT signals per imaging pixel. Article https://doi.org/10.1038/s41467-024-49691-2 Nature Communications| (2024) 15:5374 2 ≥96%, Sigma-Aldrich), triglyceride (TAG, purity ≥97%, Sigma-Aldrich), and deionized water were collected, serving as the pure spectral references for protein, fatty acids, and water, respectively. Collection of NIR absorption spectra via UV-Vis-NIR spectrophotometer Standard NIR absorption spectra for both polystyrene and ethylene glycol were acquired utilizing the Cary 5000 UV-Vis-NIR Spectro- photometer (Agilent) following established protocols. Polystyrene (Mw = 35,000, Sigma-Aldrich) was dissolved in toluene, and 3 mL of the resulting solution was transferred into a quartz cuvette for inser- tion into the spectrophotometer. An absorption spectrum of toluene was acquired and subsequently utilized for baseline correction. Similarly, 3 mL ethylene glycol (purity 99.8%, Sigma-Aldrich) was introduced into a separate quartz cuvette, with ambient air as the reference baseline. The measurement parameters include a spectral bandwidth of 2 nm, an integration time of 0.1 s, and a wavelength interval of 1 nm. Preparation of phase separation patterns of PS and PMMA blends To prepare the polymer stock solution, 51.4 mg PS (Mw = 35,000, Sigma-Aldrich) and 15.4 mg PMMA (Mw = 35,000, Sigma-Aldrich) were dissolved in 2 mL toluene and allowed to settle. To observe the phase separation pattern of PS-PMMA blends, a coverslip substrate with a thickness of 130 µm was cleaned with acetone and isopropanol, fol- lowed by drying using nitrogen gas. A 40 µL mixture solution was spin- coated onto the coverslip substrate using a spinner (Headway Research, CB-15 & PWM32) at 500 revolutions per minute (rpm) for 10 seconds, followed by 1000 rpm for 50 seconds. Fabrication of PMMA striped structures The fabrication of PMMA stripes was achieved using electron-beam lithography (EBL) on a 130 µm thick coverslip substrate. Prior to fab- rication, the substrate underwent a thorough cleaning process invol- ving acetone and isopropanol, nitrogen drying, and baking at 110 °C. A 950-PMMA 6% in anisole solution was spin-coated onto the substrate to achieve a PMMA thickness of 600 nm as per the recipe used. The sample was subjected to a hard bake at 180 °C before a conduction layer of Au nanoparticles was sputtered onto the top surface. EBL was performed at 30 keV after a dose test to pattern the sample. The fab- rication process was completed by soaking the PMMA in a solution of methyl isobutyl ketone/isopropanol (MIBK/IPA) 1:3 for 70 s, followed by rinsing with IPA and a wet etch to remove the sputtered Au. OVCAR-5 cancer cells The OVCAR-5 cells used in this experiment were a generous gift from Dr. Daniela Matei of Northwestern University. The cells were cultured in RPMI 1640 media (Gibco) supplemented with 10% fetal bovine serum (Gibco), 2 mM L-Glutamine, and 1% penicillin-streptomycin. The cell line was incubated at 37 °C with 5% CO2. For imaging purposes, the cells were seeded at a density of 0.2 million per dish on glass-bottom dishes and fixed in 10% neutral buffered formalin (Sigma-Aldrich) after 24 h of culturing. Prior to imaging, the cells were washed three times with either H2O PBS or D2O PBS. OPT images were obtained by directly immersing the objective into the medium in the glass-bottom dish. C. elegans preparation C. elegans N2 wild-type isolates were purchased from the Cae- norhabditis Genetics Center (CGC). The worms were maintained in a 20 °C incubator and propagated on Nematode Growth Medium (NGM) agar plates supplemented with the auxotrophic Escherichia coli mutant strain OP50. To immobilize worms for imaging, worms were harvested and washed using phosphate-buffered saline (PBS) solution (Gibco) and then fixed by 10% neutral buffered formalin solution (Sigma- Aldrich). The C. elegans worms were washed using D2O PBS or H2O PBS three times and then carefully sandwiched between two cover glasses for imaging. Throughout the measurement process, PBS media was gently added along the edge of the top coverslip to maintain hydration. Mouse brain tissue preparation The brain tissue utilized in this work was from an adult C57BL/6 J mouse. The mouse was sacrificed and subsequently perfused with PBS solution (1X, Thermo Fisher Scientific). The brain was carefully extracted and immersed in 10% formalin solution for a fixation period of 48 hours. Following fixation, an oscillating tissue slicer (OTS-4500, Electron Microscopy Sciences) was employed to section the brain into 200-µm-thick coronal slices. The brain slices were washed three times with PBS solution before measurement. For OPT imaging, the brain tissue was submerged in PBS and sandwiched between two cover glasses, while for mid-IR imaging, it was positioned between a cover- slip and a CaF2 substate. MIP imaging of brain slices A tunable quantum-cascade laser (QCL, MIRcat-2400, Daylight Solutions) was utilized to effectively excite the vibrational modes within the sample. Simultaneously, a continuous-wave laser of 532 nm (Samba 532 nm, Cobolt) was used to probe the local thermal changes. The mid-IR beam operated at a repetition rate of 200 kHz, with a pulse width of 500 ns. The average mid-IR power applied to the sample was approximately 3 mW, while the probe power was set at 45 mW. The two beams were collinearly focused onto the sample plane through a reflective objective, and an objective Z-piezo stage controlled the axial position to acquire multi-depth images. The forward propagating probe photons were detected by a biased photodiode (DET100A2, Thorlabs). The photocurrent generated by the photodiode underwent amplification through a low-noise amplifier (SA-251F6, NF Corporation) and was subsequently direc- ted to a lock-in amplifier (HF2LI, Zurich Instruments) for signal demodulation. A multichannel data acquisition card registers the data for real-time signal processing. Data availability All data supporting the findings of this study are available within the main article and the Supplementary Information file. The raw data are available from the corresponding author upon request. Code availability MATLAB code for LASSO spectral unmixing is available on the fol- lowing website: https://github.com/buchenglab. References 1. Hale, G. M. & Querry, M. R. Optical constants of water in the 200-nm to 200-μm wavelength region. Appl. Opt. 12, 555–563 (1973). 2. Shi, L., Sordillo, L. A., Rodríguez‐Contreras, A. & Alfano, R. Trans- mission in near‐infrared optical windows for deep brain imaging. J. Biophotonics 9, 38–43 (2016). 3. Horton, N. G. et al. In vivo three-photon microscopy of subcortical structures within an intact mouse brain. Nat. Photonics 7, 205–209 (2013). 4. Padalkar, M. & Pleshko, N. Wavelength-dependent penetration depth of near infrared radiation into cartilage. Analyst 140, 2093–2100 (2015). 5. Lammertyn, J., Peirs, A., De Baerdemaeker, J. & Nicolaı, B. Light penetration properties of NIR radiation in fruit with respect to non- destructive quality assessment. Postharvest Biol. Technol. 18, 121–132 (2000). 6. Wilson, R. H., Nadeau, K. P., Jaworski, F. B., Tromberg, B. J. & Durkin, A. J. Review of short-wave infrared spectroscopy and imaging Article https://doi.org/10.1038/s41467-024-49691-2 Nature Communications| (2024) 15:5374 11 methods for biological tissue characterization. J. Biomed. Opt. 20, 030901–030901 (2015). 7. Goetz, A. F., Vane, G., Solomon, J. E. & Rock, B. N. Imaging spec- trometry for earth remote sensing. Science 228, 1147–1153 (1985). 8. Manley, M. Near-infrared spectroscopy and hyperspectral imaging: non-destructive analysis of biological materials. Chem. Soc. Rev. 43, 8200–8214 (2014). 9. Boldrini, B., Kessler, W., Rebner, K. & Kessler, R. W. Hyperspectral imaging: a review of best practice, performance and pitfalls for in- line and on-line applications. J. Infrared Spectrosc. 20, 483–508 (2012). 10. Peterson, H. M. et al. In vivo, noninvasive functional measurements of bone sarcoma using diffuse optical spectroscopic imaging. J. Biomed. Opt. 22, 121612–121612 (2017). 11. Tank, A. et al. Diffuse optical spectroscopic imaging reveals distinct early breast tumor hemodynamic responses to metronomic and maximum tolerated dose regimens. Breast Cancer Res. 22, 1–10 (2020). 12. Zhao, Y. et al. Shortwave-infrared meso-patterned imaging enables label-free mapping of tissue water and lipid content. Nat. Commun. 11, 5355 (2020). 13. Zhang, H. F., Maslov, K., Stoica, G. & Wang, L. V. Functional pho- toacoustic microscopy for high-resolution and noninvasive in vivo imaging. Nat. Biotechnol. 24, 848–851 (2006). 14. Wang, H.-W. et al. Label-free bond-selective imaging by listening to vibrationally excited molecules. Phys. Rev. Lett. 106, 238106 (2011). 15. Yeh, K. et al. Infrared spectroscopic laser scanning confocal microscopy for whole-slide chemical imaging. Nat. Commun. 14, 5215 (2023). 16. Mittal, S. et al. Simultaneous cancer and tumor microenvironment subtyping using confocal infrared microscopy for all-digital mole- cular histopathology. Proc. Natl. Acad. Sci. 115, E5651–E5660 (2018). 17. Shi, J. et al. Hybrid optical parametrically-oscillating emitter at 1930 nm for volumetric photoacoustic imaging of water content. eLight 2, 6 (2022). 18. Yao, J. & Wang, L. V. Photoacoustic microscopy. Laser Photonics Rev. 7, 758–778 (2013). 19. Uchiyama, K., Hibara, A., Kimura, H., Sawada, T. & Kitamori, T. Thermal lens microscope. Jpn. J. Appl. Phys. 39, 5316 (2000). 20. Zong, H. et al. Background-suppressed high-throughput mid- infrared photothermal microscopy via pupil engineering. ACS Photonics 8, 3323–3336 (2021). 21. Li, Z., Aleshire, K., Kuno, M. & Hartland, G. V. Super-resolution far- field infrared imaging by photothermal heterodyne imaging. J. Phys. Chem. B 121, 8838–8846 (2017). 22. Pavlovetc, I. M. et al. Infrared photothermal heterodyne imaging: contrast mechanism and detection limits. J. Appl. Phys. 127, 165101 (2020). 23. Dabov, K., Foi, A., Katkovnik, V. & Egiazarian, K. Image denoising by sparse 3-D transform-domain collaborative filtering. IEEE Trans. Image Process. 16, 2080–2095 (2007). 24. Harris, J. & Dovichi, N. Thermal lens calorimetry. Anal. Chem. 52, 695A–706A (1980). 25. Adhikari, S. et al. Photothermal microscopy: imaging the optical absorption of single nanoparticles and single molecules. ACS Nano 14, 16414–16445 (2020). 26. Zhang, D. et al. Depth-resolved mid-infrared photothermal imaging of living cells and organisms with submicrometer spatial resolution. Sci. Adv. 2, e1600521 (2016). 27. Selmke, M., Braun, M. & Cichos, F. Photothermal single-particle microscopy: detection of a nanolens. Acs Nano 6, 2741–2749 (2012). 28. Yim, K.-H. et al. Phase-separated thin film structures for efficient polymer blend light-emitting diodes. Nano Lett. 10, 385–392 (2010). 29. Chiu, M. Y., Jeng, U. S., Su, C. H., Liang, K. S. & Wei, K. H. Simulta- neous use of small‐and wide‐angle X‐ray techniques to analyze nanometerscale phase separation in polymer heterojunction solar cells. Adv. Mater. 20, 2573–2578 (2008). 30. Mrđenović, D. A. et al. Visualizing surface phase separation in PS- PMMA polymer blends at the nanoscale. ACS Appl. Mater. Inter- faces 14, 24938–24945 (2022). 31. Menendez, J. A. & Lupu, R. Fatty acid synthase and the lipogenic phenotype in cancer pathogenesis. Nat. Rev. Cancer 7, 763–777 (2007). 32. Wu, X., Daniels, G., Lee, P. & Monaco, M. E. Lipid metabolism in prostate cancer. Am. J. Clin. Exp. Urol. 2, 111 (2014). 33. Tibshirani, R. Tibshirani, R. Regression shrinkage and selection via the lasso. J. R. Statist. Soc. B 58, 267–288 (1996). 34. Lin, H. et al. Microsecond fingerprint stimulated Raman spectro- scopic imaging by ultrafast tuning and spatial-spectral learning. Nat. Commun. 12, 3052 (2021). 35. Cao, Q., Zhegalova, N. G., Wang, S. T., Akers, W. J. & Berezin, M. Y. Multispectral imaging in the extended near-infrared window based on endogenous chromophores. J. Biomed. Opt. 18, 101318–101318 (2013). 36. Wang, Y. et al. Measurement of absorption spectrum of deuterium oxide (D2O) and its application to signal enhancement in multi- photon microscopy at the 1700-nm window. Appl. Phys. Lett. 108, 021112 (2016). 37. Chen, X., Barclay, J. W., Burgoyne, R. D., Morgan, A. & Using, C. elegans to discover therapeutic compounds for ageing-associated neurodegenerative diseases. Chem. Cent. J. 9, 1–20 (2015). 38. Mullaney, B. C. & Ashrafi, K. C. elegans fat storage and metabolic regulation. Biochim. Biophys. Acta-Mol. Cell Biol. Lipids 1791, 474–478 (2009). 39. Richards, L. J., Plachez, C. & Ren, T. Mechanisms regulating the development of the corpus callosum and its agenesis in mouse and human. Clin. Genet. 66, 276–289 (2004). 40. Ji, M. et al. Rapid, label-free detection of brain tumors with stimu- lated Raman scattering microscopy. Sci. Transl. Med. 5, 201ra119–201ra119 (2013). 41. Le, S. Q. et al. Myelin and lipid composition of the corpus callosum in mucopolysaccharidosis type I mice. Lipids 55, 627–637 (2020). 42. Fleming, C. P., Eckert, J., Halpern, E. F., Gardecki, J. A. & Tearney, G. J. Depth resolved detection of lipid using spectroscopic optical coherence tomography. Biomed. Opt. Express 4, 1269–1284 (2013). 43. Gaiduk, A., Yorulmaz, M., Ruijgrok, P. & Orrit, M. Room-temperature detection of a single molecule’s absorption by photothermal con- trast. Science 330, 353–356 (2010). 44. Berciaud, S., Cognet, L., Blab, G. A. & Lounis, B. Photothermal het- erodyne imaging of individual nonfluorescent nanoclusters and nanocrystals. Phys. Rev. Lett. 93, 257402 (2004). 45. Bai, Y., Yin, J. & Cheng, J.-X. Bond-selective imaging by optically sensing the mid-infrared photothermal effect. Sci. Adv. 7, eabg1559 (2021). 46. Xia, Q., Yin, J., Guo, Z. & Cheng, J.-X. Mid-infrared photothermal microscopy: principle, instrumentation, and applications. J. Phys. Chem. B 126, 8597–8613 (2022). 47. Aleshire, K. et al. Far-field midinfrared superresolution imaging and spectroscopy of single high aspect ratio gold nanowires. Proc. Natl Acad. Sci. 117, 2288–2293 (2020). 48. Chatterjee, R., Pavlovetc, I. M., Aleshire, K., Hartland, G. V. & Kuno, M. Subdiffraction infrared imaging of mixed cation perovskites: Probing local cation heterogeneities. ACS Energy Lett. 3, 469–475 (2018). 49. Xu, J., Li, X., Guo, Z., Huang, W. E. & Cheng, J.-X. Fingerprinting bacterial metabolic response to erythromycin by Raman-integrated mid-infrared photothermal microscopy. Anal. Chem. 92, 14459–14465 (2020). 50. Lima, C., Muhamadali, H., Xu, Y., Kansiz, M. & Goodacre, R. Imaging isotopically labeled bacteria at the single-cell level using high- Article https://doi.org/10.1038/s41467-024-49691-2 Nature Communications| (2024) 15:5374 12 resolution optical infrared photothermal spectroscopy. Anal. Chem. 93, 3082–3088 (2021). 51. Guo, Z., Bai, Y., Zhang, M., Lan, L. & Cheng, J.-X. High-throughput antimicrobial susceptibility testing of Escherichia coli by wide-field mid-infrared photothermal imaging of protein synthesis. Anal. Chem. 95, 2238–2244 (2023). 52. Lim, J. M. et al. Cytoplasmic protein imaging with mid-infrared photothermal microscopy: cellular dynamics of live neurons and oligodendrocytes. J. Phys. Chem. Lett. 10, 2857–2861 (2019). 53. Klementieva, O. et al. Super‐resolution infrared imaging of poly- morphic amyloid aggregates directly in neurons. Adv. Sci. 7, 1903004 (2020). 54. He, H. et al. Mapping enzyme activity in living systems by real-time mid-infrared photothermal imaging of nitrile chameleons. Nat. Methods 21, 342–352 (2024). 55. Katz, O., Small, E. & Silberberg, Y. Looking around corners and through thin turbid layers in real time with scattered incoherent light. Nat. Photonics 6, 549–553 (2012). 56. Schmitt, J., Knüttel, A. & Yadlowsky, M. Confocal microscopy in turbid media. JOSA A 11, 2226–2235 (1994). Acknowledgements This work was supported by NIH grants R35GM136223, R33CA261726, R01EB032391, and R01EB035429 to J.X.C. Author contributions J.X.C. generated the idea and guided the overall research; L.W. built the imaging flatform, performed OPT data collection, and analyzed all data; H.L. conceived the idea of introducing SHG probe beam and developed pixel-wise LASSO spectral unmixing algorithm; Y.Z. and X.G. conducted the initial explorations of 3rd overtone absorption; M.L. prepared brain slices and collected mid-infrared photothermal images; J.L. fabricated the PMMA striped nanostructures; F.C. provided the OVCAR-5 cancer cells; M.Z. provided the C. elegans worms. L.W. prepared the manuscript with input from the authors. Competing interests The authors declare no competing interests. Additional information Supplementary information The online version contains supplementary material available at https://doi.org/10.1038/s41467-024-49691-2. Correspondence and requests for materials should be addressed to Ji-Xin Cheng. Peer review information Nature Communications thanks Mikhail Berezin, Garth Simpson and the other, anonymous, reviewer(s) for their con- tribution to the peer review of this work. A peer review file is available. Reprints and permissions information is available at http://www.nature.com/reprints Publisher’s note Springer Nature remains neutral with regard to jur- isdictional claims in published maps and institutional affiliations. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/ licenses/by/4.0/. © The Author(s) 2024 Article https://doi.org/10.1038/s41467-024-49691-2 Nature Communications| (2024) 15:5374 13

Title: Overtone photothermal microscopy for high-resolution and high-sensitivity vibrational imaging ​ Authors: Le Wang, Haonan Lin, Yifan Zhu, Xiaowei Ge, Mingsheng Li, Jianing Liu, Fukai Chen, Meng Zhang, Ji-Xin Cheng Publisher: Nature Communications Date: 2024-06-25 00:00:00 Abstract: Photothermal microscopy is a highly sensitive pump-probe method for mapping nanostructures and molecules through the detection of local thermal gradients. ​ While visible photothermal microscopy and mid-infrared photothermal microscopy techniques have been developed, they possess inherent limitations. These techniques either lack chemical specificity or encounter significant light attenuation caused by water absorption. ​ Here, we present an overtone photothermal (OPT) microscopy technique that offers high chemical specificity, detection sensitivity, and spatial resolution by employing a visible probe for local heat detection in the C-H overtone region. ​ We demonstrate its capability for high-fidelity chemical imaging of polymer nanostructures, depth-resolved intracellular chemical mapping of cancer cells, and imaging of multicellular C. elegans organisms and highly scattering brain tissues. ​ By bridging the gap between visible and mid-infrared photothermal microscopy, OPT establishes a new modality for high-resolution and high-sensitivity chemical imaging. ​ This advancement complements large-scale shortwave infrared imaging approaches, facilitating multiscale structural and chemical investigations of materials and biological metabolism.

Hybridizing carbonate and ether at molecular scales for high-energy and high- safety lithium metal batteries.pdf

Article https://doi.org/10.1038/s41467-024-47448-5 Hybridizing carbonate and ether at molecular scales for high-energy and high- safety lithium metal batteries Jiawei Chen1, Daoming Zhang2, Lei Zhu1, Mingzhu Liu3, Tianle Zheng 4, Jie Xu 1, Jun Li2, Fei Wang 1, Yonggang Wang 1, Xiaoli Dong 1 & Yongyao Xia 1 Commonly-used ether and carbonate electrolytes show distinct advantages in active lithium-metal anode and high-voltage cathode, respectively. While these complementary characteristics hold promise for energy-dense lithium metal batteries, such synergy cannot be realized solely through physical blending. Herein, a linear functionalized solvent, bis(2-methoxyethyl) carbonate (BMC), is conceived by intramolecularly hybridizing ethers and carbonates. The integration of the electron-donating ether group with the electron- withdrawing carbonate group can rationalizes the charge distribution, imparting BMC with notable oxidative/reductive stability and relatively weak solvation ability. Furthermore, BMC also offers advantages including the ability to slightly dissolve LiNO3, excellent thermostability and nonflamm- ability. Consequently, the optimized BMC-based electrolyte, even with typical concentrations in the single solvent, demonstrates high-voltage tolerance (4.4 V) and impressive Li plating/stripping Coulombic efficiency (99.4%). Moreover, it fulfills practical lithium metal batteries with satisfactory cycling performance and exceptional tolerance towards thermal/mechanical abuse, showcasing its suitability for safe high-energy lithium metal batteries. The ambitious goal of achieving carbon neutrality has been driving the advancement of energy-dense battery chemistry, particularly in the realm of high-voltage lithium metal batteries (LMBs)1–4. However, their practical implementation poses demanding requirements for the electrolytes, which must simultaneously satisfy the aggressive high- voltage cathode, the hyperactive Li anode and safety performance5–7 As the most successful electrolyte system in commercial lithium-ion batteries (LIBs), carbonate-based electrolytes have demonstrated excellent oxidative stability of ~4.3 V vs. Li+/Li, accommodating the well operation of high-voltage cathode8. Nevertheless, the conjugated electron-withdrawing effect of the carbonyl oxygen results in a pro- nounced positive charge on the carbonyl carbon. The electron- deficient feature of carbonyl carbon makes carbonates tend to gain electrons and thus exhibit poor reductive stability9. Consequently, continuous severe parasitic reactions will occur when coupling carbonate-based electrolytes with hyperactive Li anode, generating organic-rich solid-electrolyte-interphase (SEI) that is non-uniform, unstable and mechanically fragile5. Additionally, the formation of nasty Li dendrites is easily triggered by inhomogeneous distributions of Li+ flux and further fuels the parasitic reactions10,11. Ultimately, the resul- tant accumulation of resistive ‘dead Li’ and decreased Coulombic efficiency (CE) upon repeated Li plating/stripping processes would lead to the poor cycle life of LMBs using carbonate-based electrolytes5,12. By contrast, electrolytes based on ether solvents have long stood out for their exceptional reductive stability in supporting Li anode Received: 20 August 2023 Accepted: 27 March 2024 Check for updates 1Department of Chemistry and Shanghai Key Laboratory of Molecular Catalysis and Innovative Materials, Institute of New Energy, iChEM (Collaborative Innovation Center of Chemistry for Energy Materials), Fudan University, Shanghai 200433, China. 2Sinopec Shanghai Research Institute of Petrochemical Technology Co., Ltd., Shanghai 201208, China. 3School of Chemistry, South China Normal University, Guangzhou 510006, China. 4Department of Chemistry, College of Sciences, Shanghai University, Shanghai 200444, China. e-mail: [email protected]; [email protected] Nature Communications| (2024) 15:3217 1 1234567890():,; 1234567890():,; among various types of solvents5,6,9. Nevertheless, the lone pair elec- trons on ether oxygen have a strong donating tendency, which renders routine ether-based electrolytes exhibit limited oxidative stability beyond ~4.0 V vs. Li+/Li13, thereby failing to support state-of-the-art high-voltage LMBs. Although common strategies such as high/loca- lized high concentration electrolytes (HCEs/LHCEs) can be imple- mented to alter solvation structures and establish a superior cathode- electrolyte-interphase (CEI) to compensate the shortcomings of ethers14–16, the practical application of these approaches is still hin- dered by their associated costs and environmental burdens17. Recently, several researches also demonstrated the utilization of ether-based electrolytes in high-voltage LMBs through the incorporation of fluorinated functional groups into ethers18,19. In fact, the upgraded oxidative stability can be regarded as the benefits from the reduced electron cloud density on ether oxygen owing to the electron- withdrawing fluorinated groups. Regrettably, above strategies rarely take into account that the modified solvent molecules are still volatile and flammable with low flash points, which can easily intertwine with short circuits induced by Li dendrites, thus exposing LMBs to thermal runaway and even catastrophic safety accidents20,21. Therefore, how to design a solvent simultaneously possessing high redox stability and high safety through molecular engineering presents a significant challenge. Herein, we revisit ethers and carbonates from the molecule level, both of which are sort of like Yin and Yang with opposite properties in Chinese culture who can complement each other to compose integral Tai Chi. By hybridizing the electron-withdrawing carbonate bond and the electron-donating ether bond within a single molecule, it is pos- sible to precisely adjust their respective charge distributions, an achievement that cannot be attained through mere physical blending of ethers and carbonates. In this way, an intramolecularly hybridized linear solvent, bis(2-methoxyethyl) carbonate (BMC), was conceived and synthesized successfully, exhibiting considerable redox stability and relatively weak solvation power. Beyond that, the deliberate elongation of the molecular chain for increasing the intermolecular van der Waals forces brings about an elevated thermal stability and a heightened flash point for BMC as expect. Despite the recent report on the use of BMC in safe graphite-based LIBs22, we initiated a funda- mental understanding on the molecular hybridization and a compre- hensive investigation of BMC for hyperactive Li metal anode and high- voltage LMBs. Paired with the general concentration of lithium bis(- fluorosulfonyl)imide (LiFSI), the optimized single-solvent BMC-based electrolyte fulfills a high average dendrite-free Li plating/stripping CE of 99.4%, surpassing those obtained in routine ether-based and carbonate-based electrolytes. Moreover, it adapts to the well opera- tion of LiNi0.8Co0.1Mn0.1O2 (NCM811) under high voltage of 4.4 V. These merits thus enable 92% capacity retention in Li | |high-loading- NCM811 (4.8 mAh cm−2) full cell after 150 cycles. Respectable cycling performance with BMC-based electrolyte can also be attained even with the more demanding anode-free Cu | |NCM811 coin and pouch cells. More importantly, Li metal pouch cells come through the nail penetration test and exhibit improved thermal safety temperature up to 155 °C, strongly manifesting the critical property of BMC as a safe solvent. The molecular design concept put forward in this work can offer an additional train of thought towards the development of pro- mising electrolytes for future commercial LMBs. Results Molecular design and physicochemical property In order to bolster the performance and ensure the safety of high- voltage LMBs, it is a pressing necessity to employ an electrolyte showcasing commendable redox stability and intrinsic safety. Never- theless, the prevailing ether-based and carbonate-based electrolytes, presently predominant in lithium battery chemistry, encounter obstacles in harmoniously integrating these coveted characteristics. Specifically, ether solvents, exemplified by the commonly used linear 1,2-dimethoxyethane (DME, Fig. 1a), typically exhibit favorable reduc- tive stability. Coupled with its merit to dissolve LiNO3—a critical addi- tive for stabilizing the Li interface but scarcely soluble in carbonates— DME demonstrates its applicability for Li anode10,23,24. Nevertheless, the lone pair electrons of charge-concentrated ether-oxygen (see elec- trostatic potential (ESP) map) impart DME with electron-donating characteristics and make it prone to oxidation. Conversely, carbonate solvents like linear dimethyl carbonate (DMC, Fig. 1b) exhibit opposite behavior, highlighting their suitability for high-voltage cathodes with commendable oxidative stability. However, conjugate electron- withdrawing effect of the carbonyl oxygen results in the low electron density at carbonyl carbon, rendering it electropositive (as observed in the ESP map) and susceptible to gain electron (poor reductive stabi- lity). Given the complementary merits of ethers and carbonates, it is δ- + δ- Physical blending  Poor oxidative and reductive stability  Volatile and flammable δ+ c DME DMC Molecular hybridization: BMC vs 0.03 eV 0.02 eV 0.01 eV 0.01 eV 0.02 eV 0.03 eV d δ+ δ- δ-  Considerable oxidative and reductive stability  Relatively weak solvating power  Non-volatile and non-flammable Suitable for safe and high-voltage Li metal battery a  Good reductive stability  LiNO3-solubility  Poor oxidative stability  Volatile and flammable Electron-rich δ- δ- Ether: DME  Better for Li anode b Carbonate: DMC  Good oxidative stability  Poor reductive stability  Volatile and flammable Better for high-voltage cathode Electron-deficient δ+  Fig. 1 | Schematic illustration of BMC molecule design. Molecular structures, electrostatic potential (ESP) maps and characteristics of (a) DME (representative linear ether) and (b) DMC (representative linear carbonate). c The intuitively phy- sical blending of DME and DMC. d Well-designed BMC solvent by molecularly hybridizing ether oxygen and ester carbonyl groups into a linear molecule. The meticulously engineered molecular hybridization results in a solvent capable of satisfying the demands for high-voltage and high-safety LMBs, a feat unattainable through mere physical blending of ethers and carbonates. Article https://doi.org/10.1038/s41467-024-47448-5 Nature Communications| (2024) 15:3217 2 step of 1.0 femtosecond (fs). The systems were equilibrated for at least 20 picoseconds (ps) in the NVT ensemble, followed by production runs conducted in an NPT ensemble for 200 ps using the Berendsen baro- stat to maintain a pressure of 0.1 GPa with a decay constant of 0.1 ps. All steps were conducted under a Nosé thermostat with target tem- peratures set at 298 K. The simulation time was sufficient to ensure that the electrolyte system reached equilibrium. The reliability of the MD simulation results was confirmed by comparing the calculated densities of electrolytes from simulation with their experimentally measured counterparts as follows: 1.2 m DME(MD) = 0.964 g cm-3 com- pared to 1.2 m DME(Exp) = 0.956 g cm-3, 1.2 m DMC(MD) = 1.148 g cm-3 compared to 1.2 m DMC(Exp) = 1.137 g cm-3, and 1.2 m BMC(MD) = 1.210 g cm-3 compared to 1.2 m BMC(Exp) = 1.202 g cm-3, respectively, with discrepancies remaining within a margin of less than 1%. Material characterizations 1H and 13C NMR spectra were acquired using a 400 MHz NMR spec- trometer (AVANCE NEO, Bruker) and 7Li NMR spectra were obtained on a 600 MHz NMR spectrometer (AVANCE NEO, Bruker) at 25 °C. Raman spectra were carried out on an automated confocal Raman microscopy system (WITec Apyron, WITec) with an excitation wave- length of 532 nm and a laser power of 50 mW. The spectral data were analyzed using the WITec Project Plus software. To investigate the morphology of deposited Li, cycled NCM811 cathode and Al collectors, SEM images were obtained through Hitachi S4800 (Hitachi) with the accelerating voltage of 1 kV. In order to investigate the behavior divergence of Li plating, in-situ optical observation was conducted using an electro-chemical reaction visualizing confocal system (ECCS B310, Lasertec). The in-situ cells were assembled using Cu foil (working electrode), Li foil (counter and reference electrode) and Celgard 2400 separator in the clamp with a certain pressure. The cells were then cut into cross-sections with special cutting tools for observation. The current of Li plating/stripping was fixed at 0.5 mA, while the Li plating capacity was fixed at 0.25 mAh. For XPS and TOF-SIMS mea- surements, Cu electrodes retrieved from Li | |Cu cells after one cycle of plating/stripping at 0.5 mA cm-2 and 5 mA cm-2 were transferred to instrumental chambers from an Ar-filled glove box without exposure to air. XPS depth profiles were collected on a Nexsa instrument (Thermo Fisher Scientific) using a monochromatic Al Ka X-ray source (excitation energy = 1468.6 eV) and Ar+ sputtering at 1 kV for 0, 10, 30 and 60 s. TOF-SIMS analyses were carried out on an IONTOF M6 (IONTOF) instrument in high mass resolution mode, utilizing a 30 keV Bi3+ ion beam for the acquisition phase and a 2 keV Cs+ ion beam for the sputter phase. The typical areas analyzed and sputtered were 100 μm × 100 μm and 300 μm × 300 μm, respectively. Prior to con- ducting morphology and composition characterizations, all retrieved electrodes underwent a triple rinse with DME in order to eliminate any residual electrolyte. Subsequently, the electrodes were dried for 12 h at room temperature. The viscosity tests were conducted on a rotational rheometer (HAAKE MARS III). TG curves of the electrolytes (~10 mg per sample) were recorded using a heating rate of 10 °C min-1 from 30 to 130 °C on TG 201 F1 Libra (Netzsch). DSC measurements were con- ducted using a DSC 200 F3 Maia (Netzsch) instrument with N2 as the method gas. The DSC curve of pure BMC was recorded ata heating rate of 5 °C min-1 from -50 to 250 °C. Prior to testing, ~10 mg of the sample was sealed in a stainless-steel sample pan and weighed, followed by cooling down to -50 °C and maintaining for 5 min with liquid nitrogen as coolant. DSC curves of cycled NCM811 powders (around 10 mg) mixed with different electrolytes (around 10 mg) were recorded at a heating rate of 5 °C min-1 from 25 to 300 °C. Before test, the NCM811 powders were retrieved from 100 μm Li | |NCM811 full coin cells that were fully charged to 4.3 V after 2 formation cycles and then sealed in a stainless-steel sample pan with the electrolyte. The flash points of electrolytes were investigated on flash point analyzers (MINIFLASH FPH VISION (10 ~ 400 °C) and MINIFLASH FP VISION (−45 ~ 120 °C), Grabner Instruments) according to ASTM D6450 standard. All mea- surements were conducted using a sample volume of 1 mL and repe- ated for three times to ensure the reliability. The initial temperature was typically set at 18 °C below the anticipated flash point, and the heating rate was maintained at 5.5 ± 0.5 °C per minute. An electric arc with high voltage was applied as the ignition source, operating at a frequency of 1 °C per minute. Following each flash test, a short air pulse from a small membrane compressor introduced ~1.5 ± 0.5 mL of air into the test chamber. Flash detection in the chamber relied on detecting an increase in pressure after ignition occurs. The limit for successful flash point detection was set at a pressure increase of 20 kPa, which corresponded to approximately a flame volume of 1.5 mL above barometric pressure. Further detailed testing process can be referred in previous literature40. Accelerating rate calorimetry (ARC, THT) was utilized to monitor the real-time temperature changes of pouch cells. The test temperature range was set at 30–300 °C. Before ARC test, industrial Li | |NCM811 (500 mAh, N/P = 1.33/1, Electrolyte/ Cathode = 2.5 g Ah-1) pouch cells were charged to 4.3 V after 2 forma- tion cycles. The nail penetration test for pouch cells was conducted at room temperature in an open-air environment using a M01-005 nail penetration testing system (Dongguan Saice). Before nail penetration test, 5 Ah Li | |NCM811 (4 mAh cm-2, N/P = 2.5/1, Electrolyte/Cathode = 2 g Ah-1) pouch cells were charged to 3.8 V after 2 formation cycles.The cell was vertically penetrated by a steel nail with a diameter of 3 mm at a speed of 25 mm s-1 during the test. The ionic conductivity of elec- trolytes at different temperatures was measured and calculated via electrochemical impedance spectroscopy (EIS) using two stainless- steel sheets (1 cm2) symmetrically placed in the electrolytes. Electrochemical measurements The anodic stability of electrolytes was determined by analyzing the LSV curves of Al and Pt in a three-electrode device with lithium metal serving as both counter and reference electrodes, using a scan rate of 1 mV s-1. To acquire the Li+ transference number of electrolytes, a constant voltage bias of 10 mV was applied to Li | |Li symmetric cells. For Al corrosion testing, Li | |Al half-cells were subjected to various voltages for 22 h, with each voltage being maintained for 2 h. The Li electrode potentials (ELi) in various electrolytes were revealed with the CV curves of ferrocene (Fc), which were obtained using three- electrode devices consisting of Pt as a working electrode and lithium metal as both counter and reference electrodes, at a scan rate of 5 mV s-1. It was assumed that the potential of Fc+/Fc remained constant according to IUPAC recommendations30,31. The LSV, CV, EIS and CA measurements were all conducted on VMP3 potentiostats (BioLogic). For CE tests of Li plating/stripping, Li | |Cu (CIVEN Metal, 10 μm) cells were assembled, and tested following a similar protocol as previously reported5,6. Specifically, an initial formation cycle was conducted with a plating/stripping capacity of 5 mAh cm-2 at 0.5 mA cm-2, followed by the plating of 5 mAh cm-2 Li (Qp) on Cu at 0.5 mA cm-2 as a reservoir. A fixed capacity (Qc = 1.0 mAh cm-2) of Li was then repeatedly stripped/ plated at 0.5 mA cm-2 for n cycles, and the residual Li (Qr) was subse- quently stripped to 1 V at the same current density. The average CE can be calculated using the following equation: CE = nQc + Qr nQc + Qp For calendar ageing test, after 10 cycles of normal Li plating/ stripping in Li | |Cu cells at 0.5 mA cm-2 and 1 mAh cm-2, different ageing intervals (10 h, 24 h, 48 h and a week) were introduced in every alter- nate cycle when 1 mAh cm-2 Li had been plated. For Li | |NCM811 (thickness: 24 μm, areal capacity: 1.2 ~ 1.3 mAh cm-2) half cells, 100 μm Li | |NCM811 (thickness: 82 μm, areal capacity: 4.8 mAh cm-2) full coin cells, and anode-free Cu | |NCM811 (thickness: 36 μm, areal capacity: Article https://doi.org/10.1038/s41467-024-47448-5 Nature Communications| (2024) 15:3217 9 2.0 mAh cm-2) coin cells, the cathode (diameter: 12 mm, area: 1.13 cm2) was prepared by mixing NCM811 powder (Shenzhen Kejing Star Technology Co. Ltd.), acetylene black, and polyvinylidene difluoride (PVDF) in a ratio of 96:2:2 using N-methyl-2-pyrrolidone (NMP) as the solvent. All NCM811 coin cells were cycled at a charge rate of 0.2 C and discharge rate of 0.3 C (1 C = 200 mAh g-1) between voltage ranges of 3 V to 4.3 V or up to 4.4 V. For the coin cell configurations, each CR- 2032 type coin cell was fabricated using Celgard 2400 (polypropylene, thickness: 25 μm, diameter: 18 mm) as the separator and 50 μL elec- trolyte (unless otherwise specified). To suppress corrosion from the electrolyte, Al-Clad coin cell case (Hohsen) was used for NCM811 cathode. Both thick (1000 μm) and thin (100 μm) Li foils were pur- chased from China Energy Lithium Co., Ltd. Industrial Li | |NCM811 and anode-free Cu | |NCM811 pouch cells were purchased from Li-Fun Technology Co. Ltd. Following two formation cycles at a 0.1 C charge/ discharge, pouch cells underwent cycling at a 0.2 C charge/1 C dis- charge between 3 and 4.3 V. Additionally, pouch cell cycling was con- ducted using a constant-current-constant-voltage protocol (cells were charged to the maximum voltage and held until current dropped below 0.1 C) together with a pressure of 200 kPa. The CE measure- ments of Li plating/stripping and cycling performance of cells were carried out on a standard battery tester (CT4008, Neware). Reporting summary Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article. Data availability The data generated in this study are provided in the Supplementary Information/Source data file. Source data are provided with this paper. References 1. Lin, D., Liu, Y. & Cui, Y. Reviving the lithium metal anode for high- energy batteries. Nat. Nanotechnol. 12, 194–206 (2017). 2. Albertus, P., Babinec, S., Litzelman, S. & Newman, A. Status and challenges in enabling the lithium metal electrode for high-energy and low-cost rechargeable batteries. Nat. Energy 3, 16–21 (2018). 3. Kim, S. C. et al. High-entropy electrolytes for practical lithium metal batteries. Nat. Energy 8, 814–826 (2023). 4. Zhang, Q.-K. et al. Homogeneous and mechanically stable solid–electrolyte interphase enabled by trioxane-modulated elec- trolytes for lithium metal batteries. Nat. Energy 8, 725–735 (2023). 5. Yu, Z. et al. Molecular design for electrolyte solvents enabling energy-dense and long-cycling lithium metal batteries. Nat. Energy 5, 526–533 (2020). 6. Yu, Z. et al. Rational solvent molecule tuning for high-performance lithium metal battery electrolytes. Nat. Energy 7, 94–106 (2022). 7. Yin, Y. et al. Fire-extinguishing, recyclable liquefied gas electrolytes for temperature-resilient lithium-metal batteries. Nat. Energy 7, 548–559 (2022). 8. Xu, K. Electrolytes and interphases in Li-ion batteries and beyond. Chem. Rev. 114, 11503–11618 (2014). 9. Yuan, S. et al. Revisiting the designing criteria of advanced solid electrolyte interphase on lithium metal anode under practical condition. Nano Energy 83, 105847 (2021). 10. Liu, Y. et al. Solubility-mediated sustained release enabling nitrate additive in carbonate electrolytes for stable lithium metal anode. Nat. Commun. 9, 3656 (2018). 11. Xia, Y. et al. Designing an asymmetric ether-like lithium salt to enable fast-cycling high-energy lithium metal batteries. Nat. Energy 8, 934–945 (2023). 12. Yuan, S. et al. Advanced electrolyte design for high-energy-density Li-metal batteries under practical conditions. Angew. Chem. Int. Ed. 60, 25624–2563 (2021). 13. Ruan, D. et al. Solvent versus anion chemistry: unveiling the structure-dependent reactivity in tailoring electrochemical inter- phases for lithium-metal batteries. JACS Au 3, 953–963 (2023). 14. Ren, X. et al. High-concentration ether electrolytes for stable high- voltage lithium metal batteries. ACS Energy Lett. 4, 896–902 (2019). 15. Chen, S. et al. High-voltage lithium-metal batteries enabled by localized high-concentration electrolytes. Adv. Mater. 30, 1706102 (2018). 16. Chen, S. et al. High-efficiency lithium metal batteries with fire- retardant electrolyte. Joule 2, 1548–1558 (2018). 17. Huang, Y. et al. Eco-friendly electrolytes via a robust bond design for high-energy Li metal batteries. Energy Environ. Sci. 15, 4349–4361 (2022). 18. Zhou, T., Zhao, Y., Kazzi, M. E., Choi, J. W. & Coskun, A. integrated ring-chain design of a new fluorinated ether solvent for high- voltage lithium-metal batteries. Angew. Chem. Int. Ed. 61, e202115884 (2022). 19. Zhao, Y. et al. Fluorinated ether electrolyte with controlled solvation structure for high voltage lithium metal batteries. Nat. Commun. 13, 2575 (2022). 20. Zhang, Q.-K. et al. Regulating solvation structure in nonflammable amide-based electrolytes for long-cycling and safe lithium metal batteries. Adv. Energy Mater. 12, 2200139 (2022). 21. Zhang, Q.-K., Zhang, X.-Q., Yuan, H. & Huang, J.-Q. Thermally stable and nonflammable electrolytes for lithium metal batteries: pro- gress and perspectives. Small Sci. 1, 2100058 (2021). 22. Lee, J. et al. Molecularly engineered linear organic carbonates as practically viable nonflammable electrolytes for safe Li-ion bat- teries. Energy Environ. Sci. 16, 2924–2933 (2023). 23. Yan, C. et al. Lithium nitrate solvation chemistry in carbonate electrolyte sustains high-voltage lithium metal batteries. Angew. Chem. Int. Ed. 57, 14055–14059 (2018). 24. Zheng, T. et al. When audience takes stage: Pseudo-localized-high- concentration electrolyte with lithium nitrate as the only salt enables lithium metal batteries with excellent temperature and cathode adaptability. Energy Storage Mater. 59, 102782 (2023). 25. Wang, J. et al. Fire-extinguishing organic electrolytes for safe bat- teries. Nat. Energy 3, 22–29 (2018). 26. Chen, S. et al. Unveiling the critical role of ion coordination con- figuration of ether electrolytes for high voltage lithium metal bat- teries. Angew. Chem. Int. Ed. 62, e202219310 (2023). 27. Chen, Y. et al. Steric effect tuned ion solvation enabling stable cycling of high-voltage lithium metal battery. J. Am. Chem. Soc. 143, 18703–1871 (2021). 28. Tian, Z. et al. Electrolyte solvation structure design for sodium ion batteries. Adv. Sci. 9, 2201207 (2022). 29. Yao, Y.-X. et al. Regulating interfacial chemistry in lithium-ion bat- teries by a weakly solvating electrolyte. Angew. Chem. Int. Ed. 60, 4090–4097 (2021). 30. Ko, S. et al. Electrode potential influences the reversibility of lithium-metal anodes. Nat. Energy 7, 1217–1224 (2022). 31. Mozhzhukhina, N. & Calvo, E. J. Perspective—the correct assess- ment of standard potentials of reference electrodes in non-aqueous solution. J. Electrochem. Soc. 164, A2295–A2297 (2017). 32. Zhang, X.-Q. et al. Highly stable lithium metal batteries enabled by regulating the solvation of lithium ions in nonaqueous electrolytes. Angew. Chem. Int. Ed. 57, 5301–5305 (2018). 33. Kim, S. et al. Stable electrode-electrolyte interfaces constructed by fluorine-and nitrogen-donating ionic additives for high- performance lithium metal batteries. Energy Storage Mater. 45, 1–13 (2022). 34. Chen, J. et al. High energy density Na-metal batteries enabled by a tailored carbonate-based electrolyte. Energy Environ. Sci. 15, 3360–3368 (2022). Article https://doi.org/10.1038/s41467-024-47448-5 Nature Communications| (2024) 15:3217 10 35. Ren, X. et al. Guided lithium metal deposition and improved lithium coulombic efficiency through synergistic effects of LiAsF6 and cyclic carbonate additives. ACS Energy Lett. 3, 14–19 (2018). 36. Cao, W., Li, Q., Yu, X. & Li, H. Controlling Li deposition below the interface. eScience 2, 47–78 (2022). 37. Pan, J. et al. A Quasi-double-layer solid electrolyte with adjustable interphases enabling high-voltage solid-state batteries. Adv. Mater. 34, 2107183 (2022). 38. Jiang, F.-N. et al. Thermoresponsive electrolytes for safe lithium metal batteries. Adv. Mater. 35, 2209114 (2023). 39. Klepalová, I. et al. Vanadocene and niobocene dihalides containing electron-withdrawing substituents in the cyclopentadienyl rings: synthesis, characterization and cytotoxicity. Inorg. Chim. Acta 402, 109–115 (2013). 40. Balasubramonian, S. et al. Flash point prediction for the binary mixture of phosphatic solvents and n-dodecane from UNIFAC group contribution model. J. Loss Prev. Proc. 33, 183–187 (2015). Acknowledgements This work is supported by the National Key Research and Development Program of China (2022YFB2402200 X.D.), National Natural Science Foundation of China (21935003 Y.X., 22109028 X.D., 22379028 X.D.), Natural Science Foundation of Shanghai (22ZR1404400 X.D.), Chen- guang Program sponsored by Shanghai Education Development Foun- dation and Shanghai Municipal Education Commission (19CG01 X.D.). Author contributions X.D. and Y.X. conceived the idea and designed the experiments. J.C. and J.X. synthesized the molecule. J.C. carried out material characterizations and electrochemical measurements. D.Z. performed in situ ECCS opti- cal observations. L.Z. conducted ARC and nail penetration tests. M.L. conducted DFT calculations. T.Z. performed MD simulations. All authors engaged in result discussions. J.C., J.L., F.W., Y.W., X.D. and Y.X. co- wrote the manuscript with input from all authors. Competing interests A patent related to the work has been submitted (application number CN202210168155.0) by Fudan University. The inventors are X.D., J.C., J.X. and Y.X. The patent refers to the methodology described in this paper, but it offers a greater variety of analogous solvents compared to this work. Other authors declare no competing interests. Additional information Supplementary information The online version contains supplementary material available at https://doi.org/10.1038/s41467-024-47448-5. Correspondence and requests for materials should be addressed to Xiaoli Dong or Yongyao Xia. Peer review information Nature Communications thanks the anon- ymous reviewers for their contribution to the peer review of this work. A peer review file is available. Reprints and permissions information is available at http://www.nature.com/reprints Publisher’s note Springer Nature remains neutral with regard to jur- isdictional claims in published maps and institutional affiliations. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/ licenses/by/4.0/. © The Author(s) 2024 Article https://doi.org/10.1038/s41467-024-47448-5 Nature Communications| (2024) 15:3217 11

Title: Hybridizing carbonate and ether at molecular scales for high-energy and high-safety lithium metal batteries ​ Authors: Jiawei Chen, Daoming Zhang, Lei Zhu, Mingzhu Liu, Tianle Zheng, Jie Xu, Jun Li, Fei Wang, Yonggang Wang, Xiaoli Dong, Yongyao Xia ​ Publisher: Nature Communications Date: 15 April 2024 ​ Abstract: Commonly-used ether and carbonate electrolytes show distinct advantages in active lithium-metal anode and high-voltage cathode, respectively. ​ While these complementary characteristics hold promise for energy-dense lithium metal batteries, such synergy cannot be realized solely through physical blending. ​ Herein, a linear functionalized solvent, bis(2-methoxyethyl) carbonate (BMC), is conceived by intramolecularly hybridizing ethers and carbonates. ​ The integration of the electron-donating ether group with the electron-withdrawing carbonate group rationalizes the charge distribution, imparting BMC with notable oxidative/reductive stability and relatively weak solvation ability. ​ Furthermore, BMC also offers advantages including the ability to slightly dissolve LiNO3, excellent thermostability, and nonflammability. ​ Consequently, the optimized BMC-based electrolyte, even with typical concentrations in the single solvent, demonstrates high-voltage tolerance (4.4 V) and impressive Li plating/stripping Coulombic efficiency (99.4%). ​ Moreover, it fulfills practical lithium metal batteries with satisfactory cycling performance and exceptional tolerance towards thermal/mechanical abuse, showcasing its suitability for safe high-energy lithium metal batteries. ​

High‐Entropy Layered Oxide Cathode Enabling High‐Rate for Solid‐State Sodium‐Ion Batteries.pdf

Vol.:(0123456789) 1 3 e-ISSN 2150-5551 CN 31-2103/TB ARTICLE Cite as Nano-Micro Lett. (2024) 16:10 Received: 28 June 2023 Accepted: 28 September 2023 © The Author(s) 2023 https://doi.org/10.1007/s40820-023-01232-0 High‑Entropy Layered Oxide Cathode Enabling High‑Rate for Solid‑State Sodium‑Ion Batteries Tianxun Cai1,3, Mingzhi Cai2, Jinxiao Mu1,3, Siwei Zhao2, Hui Bi1, Wei Zhao1,4, Wujie Dong1, Fuqiang Huang1,2,3 * HIGHLIGHTS • High-entropy oxides O3-Na0.95Li0.06Ni0.25Cu0.05Fe0.15Mn0.49O2 cathode constructed by compatible radius and different Fermi level ions was designed for solid-state Na-ion batteries. • Na0.95Li0.06Ni0.25Cu0.05Fe0.15Mn0.49O2 cathode exhibits high-rate performance, air stability and electrochemically thermal stability. • A series of characterizations were performed to explore energy storage mechanism of ­Na0.95Li0.06Ni0.25Cu0.05Fe0.15Mn0.49O2. ABSTRACT  Na-ion O3-type layered oxides are prospective cathodes for Na-ion batteries due to high energy density and low-cost. Nevertheless, such cathodes usually suffer from phase transi- tions, sluggish kinetics and air instability, making it difficult to achieve high performance solid-state sodium-ion batteries. Herein, the high-entropy design and Li doping strategy alleviate lattice stress and enhance ionic conductivity, achieving high-rate performance, air stability and electrochemically thermal stability for ­Na0.95Li0.06Ni0.25Cu0.05Fe0.15Mn0.49O2. This cathode delivers a high reversible capacity (141 mAh ­g−1 at 0.2C), excellent rate capability (111 mAh ­g−1 at 8C, 85 mAh ­g−1 even at 20C), and long-term stability (over 85% capacity retention after 1000 cycles), which is attributed to a rapid and reversible O3–P3 phase transition in regions of low voltage and suppresses phase transition. Moreover, the compound remains unchanged over seven days and keeps thermal stability until 279 ℃. Remarkably, the polymer solid-state sodium battery assembled by this cathode provides a capacity of 92 mAh ­g−1 at 5C and keeps retention of 96% after 400 cycles. This strategy inspires more rational designs and could be applied to a series of O3 cathodes to improve the performance of solid-state Na-ion batteries. KEYWORDS  High-entropy; High-rate performance; Li–TM interaction; Air stability; O3 layered oxide cathode * Fuqiang Huang, [email protected] 1 State Key Laboratory of High Performance Ceramics and Superfine Microstructure, Shanghai Institute of Ceramics, Chinese Academy of Sciences, Shanghai 200050, People’s Republic of China 2 State Key Laboratory of Rare Earth Materials Chemistry and Applications, College of Chemistry and Molecular Engineering, Peking University, Beijing 100871, People’s Republic of China 3 Center of Materials Science and Optoelectronics Engineering, University of Chinese Academy of Sciences, Beijing 100049, People’s Republic of China 4 Zhongke Institute of Strategic Emerging Materials, Yixing 214213, Jiangsu, People’s Republic of China Nano-Micro Lett. (2024) 16:10 10   Page 2 of 12 https://doi.org/10.1007/s40820-023-01232-0 © The authors 1  Introduction Sodium-ion batteries (SIBs) have attracted huge attention as a prospective alternative to lithium-ion batteries (LIBs), particularly in large-scale energy storage because of the abundance and low price of Na resources, as well as simi- lar chemical properties to the commercial LIB [1–3]. The Na-ion layered oxide materials, ­NaxTMO2 have consider- able potential as cathode materials for NIBs owing to the notable benefits including high energy density, facile pro- duction and cost-effectiveness. Designing cathode materi- als possessing high Na content and rapid diffusion kinetics is a crucial aspect in achieving commercial application. Compared with P2-type cathodes, O3-type materials pos- sess higher sodium content, rendering them desirable to couple with sodium-free anode [4, 5]. Nevertheless, the potential for their actual application is constrained by some significant limitations, namely, the complex phase transitions, the sluggish ­Na+ diffusion kinetics and the inherent sensitivity to air. Layered O3-type ­NaxTMO2 displays more complex phase transitions in comparison with its Li analogs due to larger ­Na+ ions associated with charge ordering and the ordering arrangement between ­Na+ and vacancies [5, 6]. The slower sodium-ion kinetics of O3-type material is an inherent characteristic due to its narrower spacing between sodium interlayers. In O3 framework, the migration of ­Na+ between octahedral sites must pass via a tetrahedral site, resulting in a high energy barrier owing to the difference in size between the large Na-ion and confined tetrahedral voids [7, 8]. On the other hand, in the presence of air, O3 materials experience the generation of active Na on the surface. This process is accompanied by the structure aberration and the oxidation of transition metal ions within the bulk. The segregated Na undergoes a fast reaction with ­H2O/CO2 in ambient air. This reaction leads to the creation of NaOH or ­Na2CO3 on the surface of active materials, hence causing the deterio- rated battery performance [7, 9, 10]. Therefore, searching for a strategy to resolve these unfavorable factors is critical for realizing high performance solid-state Na-ion batteries. Some investigations have demonstrated that the appro- priate element substitutions (such as ­Ti4+, ­Mg2+, ­Cu2+, ­Al3+, ­Sn4+, ­Zn2+, etc.) considerably suppress the irrevers- ible phase transition and improve ­Na+ diffusion coefficient of O3-type oxides [11–15]. However, in order to achieve better performance, the O3-type material is still needed to be optimized. High-entropy oxides (HEOs) have gained significant attention in the realm of electrochemical energy storage, owing to its distinctive structure and exceptional performance [16–20]. HEOs are regarded as a stable solid solution phase consisting of five or more elements in equi- molar or nearly equimolar ratios (each element content is within the range of 5–35%) [21, 22]. Zhao et al. suc- cessfully prepared a high-entropy O3-type layered oxide ­NaNi0.12Cu0.12Mg0.12Fe0.15Co0.15Mn0.1Ti0.1Sn0.1Sb0.04O2 cathode. The HEO cathode exhibited remarkable cycling stability, with a capacity retention of 83% after 500 cycles and enhanced rate performance, retaining 80% capacity at 5C. Furthermore, the researchers also revealed that the high-entropy structure can prolong the phase transition, which is beneficial to improve the cycling stability of cath- ode materials [20]. Inspired by HEOs in electrochemical energy storage, we designed a novel five-component layered HEO O3-Na0.95 Li0.06Ni0.25Cu0.05Fe0.15Mn0.49O2 as a cathode for SIBs, the schematic diagram is shown in Fig. 1a. The HEO cathode constructed by compatible radius and different Fermi level ions is effective for preventing charge ordering and reduc- ing the electronic localization [12]. Meanwhile, ionic con- ductivity can be enhanced through disorder, which con- tributes to energetically favorable routes in high-entropy lattices [23]. Owing to the poor overlap between Li: 1s and O: 2p orbitals, the bonding between Li and O is pre- dominantly ionic, resulting in an improved interaction of the TM center with oxygen orbitals and transfer of charge from sodium to oxygen. The strength of the TM-O and Na–O bonds for ­Na0.95Li0.06Ni0.25Cu0.05Fe0.15Mn0.49O2 enhances structure stability. Although ionic bonds are not as strong as covalent bonds, they repair themselves when broken. The combination of ionic and covalent bonds with hardness and softness alleviates stress. Moreover, the ­Li+ and ­Cu2+ with low valence doping increases the valence of manganese ions, which impedes the Jahn–Teller effect. The introduction of Na vacancies decreases the tetrahedral site energy via increased interlayer distance due to the decreased shielding effect [7, 24]. In consequence, this HEO O3-type cathode exhibits excel- lent rate performance and keeps highly reversible structure evolution during cycling, delivering a high reversible capac- ity of 111.4 mAh ­g−1 at 1600 mA ­g−1 and retaining capacity of 83.2% after 500 cycles. Even at 4000 mA ­g−1, this HEO Nano-Micro Lett. (2024) 16:10 10   Page 10 of 12 https://doi.org/10.1007/s40820-023-01232-0 © The authors cycling and rate performance of ­Na0.95LNCFM PSE battery is almost comparable to those of the Liquid battery, demon- strating a promising practical application of SIBs. 4  Conclusion In summary, we report a novel high-entropy O3-type layered cathode for solid-state sodium-ion batteries. The design of high-entropy structure and Li–TM interaction alleviate lattice stress and enhance ionic conductivity, enabling a rapid and reversible O3–P3 phase transition at low voltage regions and suppressing phase transition, thus leading to excellent rate and cycling performances. Meanwhile, due to the strengthened ­TMO2 framework and Na–O binding energy, ­Na0.95LNCFM exhibits remark- able air stability and thermal stability. The combination of high-entropy and Li–TM interaction conceptions is an effective strategy to regulate the phase evolution, air stability and thermal stability. Therefore, we believe that such strategy may also be extensively applied to a series of cathodes to improve the performance of solid-state Na- ion batteries. Acknowledgements  This work was supported by National Natural Science Foundation of China (52202327), Science and Technology Commission of Shanghai Municipality (22ZR1471300), National Science Foundation of China (Grant 51972326) and Youth Innova- tion Promotion Association CAS, Foundation Strengthening Pro- ject, and Program of Shanghai Academic Research Leader (Grant 22XD1424300). Funding  Open access funding provided by Shanghai Jiao Tong University. Declarations  Conflict of interest  The authors declare no conflict of interest. They have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Open Access  This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Com- mons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Com- mons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creat​iveco​mmons.​org/​licen​ses/​by/4.​0/. Supplementary Information  The online version contains supplementary material available at https://​doi.​org/​10.​1007/​ s40820-​023-​01232-0. Fig. 5   Electrochemical performance of ­Na0.95LNCFM PSE battery. a Schematic illustration for ­Na0.95LNCFM PSE battery. b Rate performance. Charge/discharge profiles at various rates. c, d Long-term cycling performance at 2C rate and at 5C rate Nano-Micro Lett. (2024) 16:10 Page 11 of 12  10 1 3 References 1. X.L. Deng, K.Y. Zou, R. Momen, P. Cai, J. Chen et al., High content anion (S/Se/P) doping assisted by defect engineering with fast charge transfer kinetics for high-performance sodium ion capacitors. Sci. Bull. 66(18), 1858–1868 (2021). https://​ doi.​org/​10.​1016/j.​scib.​2021.​04.​042 2. R. Usiskin, Y.X. Lu, J. Popovic, M. Law, P. Balaya et al., Fun- damentals, status and promise of sodium-based batteries. Nat. Rev. Mater. 6(11), 1020–1035 (2021). https://​doi.​org/​10.​1038/​ s41578-​021-​00324-w 3. Z. Guo, G. Qian, C. Wang, G. Zhang, R. Yin et al., Progress in electrode materials for the industrialization of sodium-ion batteries. Prog. Nat. Sci. Mater. 33, 1 (2022). https://​doi.​org/​ 10.​1016/j.​pnsc.​2022.​12.​003 4. P.F. Wang, Y. You, Y.X. Yin, Y.G. Guo, Layered oxide cath- odes for sodium-ion batteries: phase transition, air stability, and performance. Adv. Energy Mater. 8(8), 23 (2018). https://​ doi.​org/​10.​1002/​aenm.​20170​1912 5. K. Kubota, S. Kumakura, Y. Yoda, K. Kuroki, S. Komaba, Electrochemistry and solid-state chemistry of ­NaMeO2 (Me=3d transition metals). Adv. Energy Mater. 8(17), 40 (2018). https://​doi.​org/​10.​1002/​aenm.​20170​3415 6. W. Zhu, J.C. Zhang, J.W. Luo, C.H. Zeng, H. Su et al., Ultra- fast non-equilibrium synthesis of cathode materials for li-ion batteries. Adv. Mater. 35(2), 9 (2023). https://​doi.​org/​10.​1002/​ adma.​20220​8974 7. X.G. Yuan, Y.J. Guo, L. Gan, X.A. Yang, W.H. He et al., A universal strategy toward air-stable and high-rate ­O3 layered oxide cathodes for na-ion batteries. Adv. Funct. Mater. 32(17), 11 (2022). https://​doi.​org/​10.​1002/​adfm.​20211​1466 8. M.H. Han, E. Gonzalo, G. Singh, T. Rojo, A comprehensive review of sodium layered oxides: powerful cathodes for na-ion batteries. Energy Environ. Sci. 8(1), 81–102 (2015). https://​ doi.​org/​10.​1039/​c4ee0​3192j 9. X.W. Li, X. Shen, J.M. Zhao, Y. Yang, Q.Q. Zhang et al., O3-NaFe((1/3−x))Ni(1/3)Mn(1/3)AlxO(2) cathodes with improved air stability for na-ion batteries. ACS Appl. Mater. Interfaces 13(28), 33015–33023 (2021). https://​doi.​org/​10.​ 1021/​acsami.​1c075​54 10. F.X. Ding, Q.S. Meng, P.F. Yu, H.B. Wang, Y.S. Niu et al., Additive-free self-presodiation strategy for high-performance na-ion batteries. Adv. Funct. Mater. 31(26), 9 (2021). https://​ doi.​org/​10.​1002/​adfm.​20210​1475 11. Y.M. Li, Z.Z. Yang, S.Y. Xu, L.Q. Mu, L. Gu et al., Air-stable copper-based P2-Na7/9Cu2/9Fe1/9Mn2/3O2 as a new positive electrode material for sodium-ion batteries. Adv. Sci. 2(6), 7 (2015). https://​doi.​org/​10.​1002/​advs.​20150​0031 12. P.F. Wang, H.R. Yao, X.Y. Liu, J.N. Zhang, L. Gu et al., Ti-substituted ­NaNi0.5Mn0.5−xTixO2 cathodes with reversible O3–P3 phase transition for high-performance sodium-ion batteries. Adv. Mater. 29(19), 7 (2017). https://​doi.​org/​10.​ 1002/​adma.​20170​0210 13. X.Q. Huang, D.L. Li, H.J. Huang, X. Jiang, Z.H. Yang et al., Fast and highly reversible na+ intercalation/extraction in zn/mg dual-doped P2-Na0.67MnO2 cathode material for high-performance na-ion batteries. Nano Res. 14(10), 3531– 3537 (2021). https://​doi.​org/​10.​1007/​s12274-​021-​3715-2 14. Y.X. Wang, L.G. Wang, H. Zhu, J. Chu, Y.J. Fang et al., Ultralow-strain zn-substituted layered oxide cathode with suppressed P2–O2 transition for stable sodium ion storage. Adv. Funct. Mater. 30(13), 9 (2020). https://​doi.​org/​10.​1002/​ adfm.​20191​0327 15. H.R. Yao, P.F. Wang, Y. Gong, J.N. Zhang, X.Q. Yu et al., Designing air-stable O3-type cathode materials by combined structure modulation for na-ion batteries. J. Am. Chem. Soc. 139(25), 8440–8443 (2017). https://​doi.​org/​10.​1021/​jacs.​ 7b051​76 16. X.Y. Du, Y. Meng, H.Y. Yuan, D. Xiao, High-entropy sub- stitution: a strategy for advanced sodium-ion cathodes with high structural stability and superior mechanical properties. Energy Storage Mater. 56, 132–140 (2023). https://​doi.​org/​ 10.​1016/j.​ensm.​2023.​01.​010 17. F. Fu, X. Liu, X.G. Fu, H.W. Chen, L. Huang et al., Entropy and crystal-facet modulation of P2-type layered cathodes for long-lasting sodium-based batteries. Nat. Commun. 13(1), 12 (2022). https://​doi.​org/​10.​1038/​s41467-​022-​30113-0 18. L.B. Yao, P.C. Zou, C.Y. Wang, J.H. Jiang, L. Ma et al., High-entropy and superstructure-stabilized layered oxide cathodes for sodium-ion batteries. Adv. Energy Mater. 12(41), 9 (2022). https://​doi.​org/​10.​1002/​aenm.​20220​1989 19. F.X. Ding, C.L. Zhao, D.D. Xiao, X.H. Rong, H.B. Wang et al., Using high-entropy configuration strategy to design Na-ion layered oxide cathodes with superior electrochemi- cal performance and thermal stability. J. Am. Chem. Soc. 144(18), 8286–8295 (2022). https://​doi.​org/​10.​1021/​jacs.​ 2c023​53 20. C.L. Zhao, F.X. Ding, Y.X. Lu, L.Q. Chen, Y.S. Hu, High- entropy layered oxide cathodes for sodium-ion batteries. Angew. Chem. Int. Ed. 59(1), 264–269 (2020). https://​doi.​ org/​10.​1002/​anie.​20191​2171 21. C.M. Rost, E. Sachet, T. Borman, A. Moballegh, E.C. Dickey et al., Entropy-stabilized oxides. Nat. Commun. 6, 8 (2015). https://​doi.​org/​10.​1038/​ncomm​s9485 22. A. Sarkar, L. Velasco, D. Wang, Q.S. Wang, G. Talasila et al., High entropy oxides for reversible energy storage. Nat. Com- mun. 9, 9 (2018). https://​doi.​org/​10.​1038/​s41467-​018-​05774-5 23. M. Botros, J. Janek, Embracing disorder in solid-state batter- ies. Science 378(6626), 1273–1274 (2022). https://​doi.​org/​10.​ 1126/​scien​ce.​adf33​83 24. H.J. Wang, X. Gao, S. Zhang, Y. Mei, L.S. Ni et al., High- entropy na-deficient layered oxides for sodium-ion batteries. ACS Nano 17, 12530 (2023). https://​doi.​org/​10.​1021/​acsna​no.​ 3c022​90 25. S.Y. Zhang, Y.J. Guo, Y.N. Zhou, X.D. Zhang, Y.B. Niu et al., P3/O3 integrated layered oxide as high-power and long-life cathode toward na-ion batteries. Small 17(10), 7 (2021). https://​doi.​org/​10.​1002/​smll.​20200​7236 26. J.Y. Hwang, S.M. Oh, S.T. Myung, K.Y. Chung, I. Belharouak et al., Radially aligned hierarchical columnar structure as a cathode material for high energy density sodium-ion batteries. Nano-Micro Lett. (2024) 16:10 10   Page 12 of 12 https://doi.org/10.1007/s40820-023-01232-0 © The authors Nat. Commun. 6, 9 (2015). https://​doi.​org/​10.​1038/​ncomm​ s7865 27. P.F. Zhou, Z.N. Che, J. Liu, J.K. Zhou, X.Z. Wu et al., High- entropy P2/O3 biphasic cathode materials for wide-tempera- ture rechargeable sodium-ion batteries. Energy Storage Mater. 57, 618–627 (2023). https://​doi.​org/​10.​1016/j.​ensm.​2023.​03.​ 007 28. L.X. Shen, Y. Jiang, Y.F. Liu, J.L. Ma, T.R. Sun et al., High- stability monoclinic nickel hexacyanoferrate cathode materials for ultrafast aqueous sodium ion battery. Chem. Eng. J. 388, 9 (2020). https://​doi.​org/​10.​1016/j.​cej.​2020.​124228 29. W.J. Dong, B. Ye, M.Z. Cai, Y.Z. Bai, M. Xie et al., Superwet- table high-voltage ­LiCOO2 for low- temperature lithium ion batteries. ACS Energy Lett. 8(2), 881–888 (2023). https://​doi.​ org/​10.​1021/​acsen​ergyl​ett.​2c024​34 30. C. Zeng, C. Duan, Z. Guo, Z. Liu, S. Dou et al., Ultrafastly activated needle coke as electrode material for supercapaci- tors. Prog. Nat. Sci. Mater. Inter. 32(6), 786–792 (2022). https://​doi.​org/​10.​1016/j.​pnsc.​2022.​10.​008 31. Y.Y. Xie, G.L. Xu, H.Y. Che, H. Wang, K. Yang et al., Prob- ing thermal and chemical stability of ­NaxNi1/3Fe1/3Mn1/3O2 cathode material toward safe sodium-ion batteries. Chem. Mat. 30(15), 4909–4918 (2018). https://​doi.​org/​10.​1021/​acs.​chemm​ ater.​8b000​47 32. H.R. Yao, X.G. Yuan, X.D. Zhang, Y.J. Guo, L.T. Zheng et al., Excellent air storage stability of na-based transition metal oxide cathodes benefiting from enhanced na-o binding energy. Energy Storage Mater. 54, 661–667 (2023). https://​doi.​org/​10.​ 1016/j.​ensm.​2022.​11.​005 33. W.H. Zuo, J.M. Qiu, X.S. Liu, F.C. Ren, H.D. Liu et al., The stability of p2-layered sodium transition metal oxides in ambi- ent atmospheres. Nat. Commun. 11(1), 12 (2020). https://​doi.​ org/​10.​1038/​s41467-​020-​17290-6 34. Y.J. Guo, P.F. Wang, Y.B. Niu, X.D. Zhang, Q.H. Li et al., Boron-doped sodium layered oxide for reversible oxygen redox reaction in na-ion battery cathodes. Nat. Commun. 12(1), 11 (2021). https://​doi.​org/​10.​1038/​s41467-​021-​25610-7 35. F.X. Ding, C.L. Zhao, D. Zhou, Q.S. Meng, D.D. Xiao et al., A novel ni-rich ­O3-na ­Ni0.60Fe0.25M0.15 O-2 cathode for na-ion batteries. Energy Storage Mater. 30, 420–430 (2020). https://​ doi.​org/​10.​1016/j.​ensm.​2020.​05.​013 36. J. Pan, S.M. Xu, T.X. Cai, L.L. Hu, X.L. Che et al., Boosting cycling stability of polymer sodium battery by “rigid- flex- ible” coupled interfacial stress modulation. Nano Lett. 23(8), 3630–3636 (2023). https://​doi.​org/​10.​1021/​acs.​nanol​ett.​2c048​ 54

Title: High-Entropy Layered Oxide Cathode Enabling High-Rate for Solid-State Sodium-Ion Batteries ​ Authors: Tianxun Cai, Mingzhi Cai, Jinxiao Mu, Siwei Zhao, Hui Bi, Wei Zhao, Wujie Dong, Fuqiang Huang Publisher: Nano-Micro Letters Date: 2023-09-28 00:00:00 Abstract: Na-ion O3-type layered oxides are prospective cathodes for Na-ion batteries due to high energy density and low-cost. ​ Nevertheless, such cathodes usually suffer from phase transitions, sluggish kinetics, and air instability, making it difficult to achieve high-performance solid-state sodium-ion batteries. ​ Herein, the high-entropy design and Li doping strategy alleviate lattice stress and enhance ionic conductivity, achieving high-rate performance, air stability, and electrochemically thermal stability for Na0.95Li0.06Ni0.25Cu0.05Fe0.15Mn0.49O2. ​ This cathode delivers a high reversible capacity (141 mAh g−1 at 0.2C), excellent rate capability (111 mAh g−1 at 8C, 85 mAh g−1 even at 20C), and long-term stability (over 85% capacity retention after 1000 cycles), which is attributed to a rapid and reversible O3–P3 phase transition in regions of low voltage and suppresses phase transition. ​ Moreover, the compound remains unchanged over seven days and keeps thermal stability until 279 ℃. ​ Remarkably, the polymer solid-state sodium battery assembled by this cathode provides a capacity of 92 mAh g−1 at 5C and keeps retention of 96% after 400 cycles. ​ This strategy inspires more rational designs and could be applied to a series of O3 cathodes to improve the performance of solid-state Na-ion batteries. ​

Molecular anchoring of free solvents for high-voltage and high-safety lithium metal batteries.pdf

Article https://doi.org/10.1038/s41467-024-46186-y Molecular anchoring of free solvents for high-voltage and high-safety lithium metal batteries Zhuangzhuang Cui1, Zhuangzhuang Jia2, Digen Ruan1, Qingshun Nian 1, Jiajia Fan1, Shunqiang Chen1, Zixu He1, Dazhuang Wang1, Jinyu Jiang1, Jun Ma1, Xing Ou 3, Shuhong Jiao 1, Qingsong Wang 2 & Xiaodi Ren 1 Constraining the electrochemical reactivity of free solvent molecules is pivotal for developing high-voltage lithium metal batteries, especially for ether sol- vents with high Li metal compatibility but low oxidation stability ( <4.0 V vs Li+/ Li). The typical high concentration electrolyte approach relies on nearly saturated Li+ coordination to ether molecules, which is confronted with severe side reactions under high voltages ( >4.4 V) and extensive exothermic reac- tions between Li metal and reactive anions. Herein, we propose a molecular anchoring approach to restrict the interfacial reactivity of free ether solvents in diluted electrolytes. The hydrogen-bonding interactions from the anchoring solvent effectively suppress excessive ether side reactions and enhances the stability of nickel rich cathodes at 4.7 V, despite the extremely low Li+/ether molar ratio (1:9) and the absence of typical anion-derived interphase. Fur- thermore, the exothermic processes under thermal abuse conditions are mitigated due to the reduced reactivity of anions, which effectively postpones the battery thermal runaway. Lithium (Li) metal is an ideal anode material with an extremely high specific capacity (3860 mAh g−1), and the lowest electrochemical potential (−3.04 V vs reversible hydrogen electrode)1–3. However, the lack of high-efficiency electrolytes has hindered the development of high-voltage Li metal batteries (>4.0 V, vs Li/Li+, same hereinafter)4–7. Conventional carbonate electrolytes are highly reactive to Li anode, and the derived porous and heterogeneous solid-electrolyte inter- phase (SEI) cannot prevent further side reactions of the electrolyte, which would lead to continuous Li consumption and dendrite growth2,8–10. In contrast, ether electrolytes stand out as a promising solution because of their superior reduction stability, lower viscosity, and faster Li+ transport dynamics11–13. Unfortunately, the oxidation stability of conventional ether electrolytes (~1 M) is very limited (<4.0 V), thus severely restricting their application with high-voltage cathodes, especially nickel (Ni)-rich cathodes with highly reactive surface sites (such as Ni3+/4+)14–17. Recently, extensive efforts have been made to address the com- patibility issue between ether-based electrolytes and high-voltage cathodes18–21. Apart from artificial cathode-electrolyte interphases (CEIs) that prevent direct contact between high-voltage cathodes and free ether molecules by physical isolation or nanopore-based de- solvation22,23, the fundamental challenge lies in reducing the reactivity of free solvents at the electrode-electrolyte interface. High- concentration electrolytes (HCE) and localized high-concentration electrolytes (LHCE) with high salt/solvent ratios minimize the popu- lation of labile-free ether molecules by using the Li+ coordination Received: 31 July 2023 Accepted: 18 February 2024 Check for updates 1Hefei National Research Center for Physical Sciences at the Microscale, CAS Key Laboratory of Materials for Energy Conversion, Department of Materials Science and Engineering, University of Science and Technology of China, Hefei, Anhui 230026, China. 2State Key Laboratory of Fire Science, University of Science and Technology of China, Hefei, Anhui 230026, China. 3Engineering Research Center of the Ministry of Education for Advanced Battery Materials, School of Metallurgy and Environment, Central South University, No.932 South Lushan Road, Changsha, Hunan 410083, PR China. e-mail: [email protected]; [email protected] Nature Communications| (2024) 15:2033 1 1234567890():,; 1234567890():,; strategy. More importantly, the enrichment of anions in the inner solvation sheath promotes the formation of inorganic-rich electrode- electrolyte interphases, which was found to be essential as the kinetic barrier for side reactions between reactive anodes/cathodes and ether- based electrolytes1,24. For example, Li fluoride (LiF) has been identified as a crucial component of CEI due to its excellent electron-insulating properties as well as physical and electrochemical stability25–28. Despite the encouraging developments of ether-based HCEs or LHCEs, they are still restricted by limited anodic stability (<4.5 V), low ion transport kinetics arising from strong Li+-anion interactions, high salt cost, and unsatisfactory low-temperature performance29,30. Furthermore, the safety issue of Li metal batteries (LMBs) using concentrated electrolytes with reactive anions has rarely been dis- cussed. Several recent studies have concluded that the safety of elec- trolytes cannot be justified solely on the basis of their non- flammability31–33. Exothermic reactions between the electrolyte and electrode materials are crucial for inducing battery thermal runaway reactions34,35. Ouyang and co-workers reported that battery thermal runaway was triggered by the huge amount of heat released by the reaction between the graphite anode and Li salt in concentrated electrolytes, even though a flame-retarding phosphate ester solvent was used36. Similarly, Xu and co-workers found that the heat released by the reaction between the electrolyte and the charged cathode (Li iron phosphate after Li+ removal) or anode (graphite after Li insertion) is positively correlated with the Li salt concentration37. Despite the LHCE reduces the nominal concentration of Li salts (to 1–1.5 M) with the addition of diluents, the temperature of the battery rises sharply during the puncture test to damage the battery structure due to the enhanced reactivity of anions in LHCE. The reaction between Li salts and Li metal anode in concentrated electrolytes could potentially release a large amount of heat to induce the thermal runaway ava- lanche reaction due to the low melting point (180 °C) and highly reactive nature of Li metal. Therefore, it is urgent to develop effective strategies to design ether-based electrolytes with high Li metal Cou- lombic efficiency (CE), high-voltage stability, and, last but not least, suppressed exothermic reactions with Li metal to improve the safety of LMBs. Herein, we propose a molecular anchoring diluent electrolyte (MADE, down to 0.19 M) with a wide electrochemical stability window (>4.7 V on NMC811 cathode) and greatly increased thermal runaway temperature for LMBs. In contrast to the widely-used approach of restricting free solvents through Li+ coordination in concentrated electrolytes, we exploit the strong non-conventional hydrogen bond interactions with oxidation-resistant hydrofluoroether and ether molecules to improve the oxidation resistivity of ether solvents. The MADE design with decreased anion reactivity not only demonstrates enhanced oxidation stability (>4.7 V) compared to LHCE, which rely on extensive anion sacrificial decomposition, but also fosters a more flexible SEI layer to accommodate volume changes of Li metal during cycling. Furthermore, the thermal runaway temperature of LMBs is greatly increased (from 141 to 209 °C) due to suppressed exothermic side reactions with Li metal. This work sheds light on a promising approach to expanding the electrochemical stability window and enhancing the safety of electrolytes for LMB applications. Results and discussion The dilute electrolyte design with molecular anchoring To investigate the impact of hydrofluoroether molecular “anchor” (e.g., 1,1,2,2-tetrafluoroethyl-2,2,3,3-tetrafluoropropylether, TTE) on the electrochemical stability of the ether solvent (1,2-dimethox- yethane, DME), we formulated the electrolytes with a high TTE to DME molar ratio of 3:1, while the ratio of the Li bis(fluorosulfonyl)imide (LiFSI) salt was kept low to minimize the ion-solvent interactions. Therefore, electrolytes with low molar ratios of LiFSI: DME: TTE, 1:9:27 (~0.19 M), 2:9:27(~0.38 M), and 3:9:27 (~0.56 M) were prepared and labeled as MADE-1, MADE-2, and MADE-3, respectively. To gain insight into the thermodynamic interaction between DME and TTE molecules, the heat of mixing was measured using isothermal titration calorimetry (ITC). Upon the addition of DME into TTE, distinct exothermic peaks were detected, with each drop estimated to release 706.1 cal mo1−1 of heat (Fig. 1a and Supplementary Fig. 1). By contrast, significantly reduced heat release (185.9 cal mol−1) was observed when HCE (LiFSI- 1.2DME in molar ratio) was added into TTE. This suggests that the DME- TTE interaction is greatly eliminated when most DME molecules are strongly confined in the inner solvation sheath (Li+-O(DME) coordination). Meanwhile, the dominant interaction between DME and TTE in MADEs is not from the pseudo hydrogen bond between H(DME) and F(TTE). As shown in Fig. 1b, despite the 1H-19F coupling signals observed in two-dimensional nuclear magnetic resonance (NMR), the pseudo H bonds between C-H (DME)…F-C (TTE) are weaker than those between H(TTE) and O(DME) 38,39. Further 1H NMR results indicate the H bond between O(DME) and H(TTE) accounts for the apparent heat release observed in the ITC (Supplementary Fig. 2). When DME was mixed with TTE, the chemical shifts of H(TTE) increased while those of H(DME) decreased, indicating that H(TTE) acts as the H bond donor with O(DME) as the acceptor40. Although the spatial proximity of H(DME) and F(TTE) induces relatively weak interactions, which would potentially cause the 1H chemical shift of DME to a higher value (H(DME) as the H bond donor instead), the dominant force is the H bond between H(TTE) and O(DME) and the resulting 1H chemical shift of DME is toward a lower value. Further geometry optimizations of DME-TTE com- plexes by density-functional theory (DFT) also suggest that the H(TTE)…O(DME) interactions are favored compared to H(DME)…F(TTE) interactions (Supplementary Fig. 3), which is consistent with pre- vious studies39. To further verify the hydrogen-bonding between TTE and ether molecules, we carried out Fourier-transform infrared spectroscopy (FT-IR) analysis in CCl4 solutions. To study the effect of hydrogen- bonding on the C-H vibration in TTE while avoiding the interference of C-H bonds in ether (overlapping signals), deuterated tetrahydrofuran (THF-d8) was selected because of its characteristic ethereal moiety and easy accessibility. As shown in Fig. 1c, after adding THF-d8 to the TTE solution, the CF2-H vibration peak shifts noticeably from 3000 to 3010 cm−1, which aligns with the featured blue-shifting vibration of CF2-H after H bond formation reported in the literature38,41,42. In addi- tion, we study the interaction between TTE and DMSO, which is often selected to study the C-H…O hydrogen bond as it contains no hydrogen donor43. Similarly, upon adding DMSO-d6, a noticeable blue shift of the CF2-H signal in TTE was also observed, which can demon- strate the hydrogen bond donating ability of TTE. Moreover, with the content of TTE increasing, the 17O-NMR signal of DME shifts to a lower chemical shift (Supplementary Fig. 4), which agrees with the previous study that hydrogen-bonding induces an upfield chemical shift of oxygen atoms44. In contrast, there is no apparent shift of the 17O-NMR signal for the oxygen atom in TTE. These findings support the con- clusion that TTE forms hydrogen bonds with DME through interactions between the CF2-H(TTE) and O(DME). Furthermore, DFT calculations were employed to obtain more detailed coordination configurations (Supplementary Fig. 5a). From the deformation electron density, the interaction for DME-TTE, or DME-DME complexes could be identified with the overlapping defor- mation electron density, while the interaction between the C-H(TTE) and C-F(TTE) is not observed on the 0.03 a.u. isovalue map for the TTE- TTE complex. Meanwhile, as shown in the electrostatic potential mapping (ESP) (Supplementary Fig. 5b), the minimum electrostatic potential energy in the vicinity of oxygen of DME increases notably after its coordination with TTE (from −42.75 to −17.22 kcal mol−1), which has substantial effects on the oxidative stability of the molecules45. Article https://doi.org/10.1038/s41467-024-46186-y Nature Communications| (2024) 15:2033 2 LiFSI, 100 DME, and 300 TTE molecules. For LHCE, the box contains 100 LiFSI, 120 DME, and 300 TTE molecules. The electrolyte systems were first simulated annealing between 600 and 300 K using an NTV ensemble for 15 cycles and optimized the structure after each annealing. The structure with the lowest energy is selected for the next dynamics simulations. The electrolyte systems were equilibrated in the isothermal-isobaric ensemble (constant NPT) using the Berendsen barostat to maintain the pressure of 0.0001 GPa for 500 ps, aiming to make the systems have proper density. Then, the last frame from the NPT simulation ran for 800 ps in the canonical ensemble (NVT) at 298 K. Thereafter, the radial distribution function was obtained by dynamic simulation of the optimized model and calculated the mole- cular coordination number by the following formula: n r0 ð Þ = 4Πρ Z r0 0 gðrÞr2dr ð1Þ ρ is the Number density of certain types of atoms. The atomic coordinates of the initial and final configurations of the MD simulation could be found in the source data. Density-functional theory (DFT) calculation The DFT calculation was conducted on the Gaussian16 package61. The initial geometry structures are derived from molecular dynamics simulations. All molecules and complexes were optimized by the B3LYP method at 6–311 + + G (d,p) basis set. Frequency analysis was performed to guarantee that all the structures were the minimum points on the potential energy surface. Calculation of oxidation potential were performed under an implicit solvation model with dielectric properties of Aniline (dielectric constant = 7.3). The oxida- tion potential Eox vs. Li/Li+ was calculated as follows: EOX = G M +    G M ð Þ F  1:4V ð2Þ where G(M) and G(M+) are the free energy of species M, its oxidized forms at 298.15 K, respectively. F is the Faraday constant. The defor- mation charge density was calculated using Dmol3 in Materials Studio software. The extreme points of ESP are achieved through Multiwfn software45 combined with VMD programming. The atomic coordinates of the optimized geometries could be found in the source data. Reporting summary Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article. Data availability The experiment data that support the findings of this study are avail- able from the corresponding authors upon reasonable request. Source data are provided with this paper. References 1. Cao, X., Jia, H., Xu, W. & Zhang, J.-G. Review—localized high- concentration electrolytes for lithium batteries. J. Electrochem. Soc. 168, 010522 (2021). 2. Xu, K. Nonaqueous liquid electrolytes for lithium-based recharge- able batteries. Chem. Rev. 104, 4303–4418 (2004). 3. Niu, C. et al. Balancing interfacial reactions to achieve long cycle life in high-energy lithium metal batteries. Nat. Energy 6, 723–732 (2021). 4. Wang, H. et al. Liquid electrolyte: the nexus of practical lithium metal batteries. Joule 6, 588–616 (2022). 5. Kim, S. et al. Lithium metal batteries: from fndamental research to industrialization. Adv. Mater. 35, 2206625 (2022). 6. Lin, D., Liu, Y. & Cui, Y. Reviving the lithium metal anode for high- energy batteries. Nat. Nanotechnol. 12, 194–206 (2017). 7. Zhang, Y. et al. Towards better Li metal anodes: challenges and strategies. Mater. Today 33, 56–74 (2020). 8. Hou, L.-P. et al. Modification of nitrate ion enables stable solid electrolyte interphase in lithium metal batteries. Angew. Chem. Int. Ed. 61, e202201406 (2022). 9. Liu, S. et al. An inorganic-rich solid electrolyte interphase for advanced lithium-metal batteries in carbonate electrolytes. Angew. Chem. Int. Ed. 60, 3661–3671 (2021). 10. Aurbach, D., Zinigrad, E., Cohen, Y. & Teller, H. A short review of failure mechanisms of lithium metal and lithiated graphite anodes in liquid electrolyte solutions. Solid State Ion. 148, 405–416 (2002). 11. Zhang, W. et al. Engineering a passivating electric double layer for high performance lithium metal batteries. Nat. Commun. 13, 2029 (2022). 12. Jiang, L.-L. et al. Inhibiting solvent co-intercalation in a graphite anode by a localized high-concentration electrolyte in fast- charging batteries. Angew. Chem. Int. Ed. 60, 3402–3406 (2021). 13. Holoubek, J. et al. Tailoring electrolyte solvation for Li metal batteries cycled at ultra-low temperature. Nat. Energy 6, 303–313 (2021). 14. Cui, Z., Li, X., Bai, X., Ren, X. & Ou, X. A comprehensive review of foreign-ion doping and recent achievements for nickel-rich cath- ode materials. Energy Storage Mater. 57, 14–43 (2023). 15. Ren, X. et al. Role of inner solvation sheath within salt–solvent complexes in tailoring electrode/electrolyte interphases for lithium metal batteries. Proc. Natl Acad. Sci. USA 117, 28603–28613 (2020). 16. Ren, X. et al. Enabling high-voltage lithium-metal batteries under practical conditions. Joule 3, 1662–1676 (2019). 17. Jiao, S. et al. Stable cycling of high-voltage lithium metal batteries in ether electrolytes. Nat. Energy 3, 739–746 (2018). 18. Yang, S.-J. et al. Formation mechanism of the solid electrolyte interphase in different ester electrolytes. J. Mater. Chem. A 9, 19664–19668 (2021). 19. Ren, X. et al. High-concentration ether electrolytes for stable high- voltage lithium metal batteries. ACS Energy Lett. 4, 896–902 (2019). 20. Ren, X. et al. Localized high-concentration sulfone electrolytes for high-efficiency lithium-metal batteries. Chem 4, 1877–1892 (2018). 21. Liu, Q. et al. An inorganic-dominate molecular diluent enables safe localized high concentration electrolyte for high-voltage lithium- metal batteries. Adv. Funct. Mater. 33, 2209725 (2023). 22. Cui, Z. et al. Durable semi-crystalline interphase engineering to stabilize high voltage Ni-rich cathode in dilute ether electrolyte. J. Energy Chem. 79, 110–117 (2023). 23. Chang, Z. et al. A liquid electrolyte with de-solvated lithium ions for lithium-metal battery. Joule 4, 1776–1789 (2020). 24. Chen, L. et al. High-safety and high-efficiency electrolyte design for 4.6 V-class lithium-ion batteries with a non-solvating flame-retar- dant. Chem. Sci. 14, 1184–1193 (2023). 25. Chen, J. et al. Electrolyte design for Li metal-free Li batteries. Mater. Today 39, 118–126 (2020). 26. Cao, X. et al. Monolithic solid–electrolyte interphases formed in fluorinated orthoformate-based electrolytes minimize Li depletion and pulverization. Nat. Energy 4, 796–805 (2019). 27. Chen, S. et al. High-efficiency lithium metal batteries with fire- retardant electrolytes. Joule 2, 1548–1558 (2018). 28. Fan, X. et al. All-temperature batteries enabled by fluorinated electrolytes with non-polar solvents. Nat. Energy 4, 882–890 (2019). 29. Liu, D.-H. et al. Developing high safety Li-metal anodes for future high-energy Li-metal batteries: strategies and perspectives. Chem. Soc. Rev. 49, 5407–5445 (2020). 30. Yamada, Y., Wang, J., Ko, S., Watanabe, E. & Yamada, A. Advances and issues in developing salt-concentrated battery electrolytes. Nat. Energy 4, 269–280 (2019). 31. Chu, Z. et al. Non-destructive fast charging algorithm of lithium-ion batteries based on the control-oriented electrochemical model. Appl. Energ. 204, 1240–1250 (2017). Article https://doi.org/10.1038/s41467-024-46186-y Nature Communications| (2024) 15:2033 10 32. Feng, X., Lu, L., Ouyang, M., Li, J. & He, X. A 3D thermal runaway propagation model for a large format lithium ion battery module. Energy 115, 194–208 (2016). 33. Li, Y. et al. Thermal runaway mechanism of lithium-ion battery with LiNi0.8Mn0.1Co0.1O2cathodematerials.NanoEnergy85,105878(2021). 34. Feng, X. et al. Thermal runaway mechanism of lithium ion battery for electric vehicles: a review. Energy Storage Mater. 10, 246–267 (2018). 35. Hou, J. et al. Unlocking the self-supported thermal runaway of high- energy lithium-ion batteries. Energy Storage Mater. 39, 395–402 (2021). 36. Hou, J. et al. Thermal runaway of Lithium-ion batteries employing LiN(SO2F)2-based concentrated electrolytes. Nat. Commun. 11, 5100 (2020). 37. Jia, H. et al. Is nonflammability of electrolyte overrated in the overall safety performance of lithium ion batteries? A sobering revelation from a completely nonflammable electrolyte. Adv. Energy Mater. 13, 2203144 (2023). 38. Zafrani, Y. et al. CF2H, a functional group-dependent hydrogen- bond donor: is it a more or less lipophilic bioisostere of OH, SH, and CH3? J. Med. Chem. 62, 5628–5637 (2019). 39. Zhang, G., He, W. & Chen, D. On difference of properties between organic fluorine hydrogen bond C–H···F–C and conventional hydrogen bond. Mol. Phys. 112, 1736–1744 (2014). 40. Meier, T. et al. Structural independence of hydrogen-bond sym- metrisation dynamics at extreme pressure conditions. Nat. Com- mun. 13, 3042 (2022). 41. Sessler, C. D. et al. CF2H, a hydrogen bond donor. J. Am. Chem. Soc. 139, 9325–9332 (2017). 42. Nagels, N., Geboes, Y., Pinter, B., De Proft, F. & Herrebout, W. A. Tuning the halogen/hydrogen bond competition: a spectroscopic and conceptual DFT study of some model complexes involving CHF2I. Chem. Eur. J. 20, 8433–8443 (2014). 43. Wang, B., Hinton, J. F. & Pulay, P. C−H···O hydrogen bond between N-methyl maleimide and dimethyl sulfoxide: a combined NMR and Ab initio study. J. Phys. Chem. A. 107, 4683–4687 (2003). 44. Reuben, J. Hydrogen-bonding effects on oxygen-17 chemical shifts. J. Am. Chem. Soc. 91, 5725–5729 (1969). 45. Lu, T. & Chen, F. Multiwfn: a multifunctional wavefunction analyzer. J. Comput. Chem. 33, 580–592 (2012). 46. Tan, L. et al. Intrinsic nonflammable ether electrolytes for ultrahigh- voltage lithium metal batteries enabled by chlorine functionality. Angew. Chem. Int. Ed. 61, e202203693 (2022). 47. Fawdon, J., Ihli, J., Mantia, F. L. & Pasta, M. Characterising lithium-ion electrolytes via operando Raman microspectroscopy. Nat. Com- mun. 12, 4053 (2021). 48. Xiao, N., McCulloch, W. D. & Wu, Y. Reversible dendrite-free potassium plating and stripping electrochemistry for potassium secondary batteries. J. Am. Chem. Soc. 139, 9475–9478 (2017). 49. Yoshida, H. & Matsuura, H. Density functional study of the con- formations and vibrations of 1,2-dimethoxyethane. J. Phys. Chem. A. 102, 2691–2699 (1998). 50. Xia, M. et al. Rational design of electrolyte solvation structure for stable cycling and fast charging lithium metal batteries. J. Power Sources 548, 232106 (2022). 51. Zhang, J. et al. Diluent decomposition-assisted formation of LiF-rich solid-electrolyte interfaces enables high-energy Li-metal batteries. J. Energy Chem. 78, 71–79 (2023). 52. Tian, Z. et al. Electrolyte solvation structure design for sodium ion batteries. Adv. Sci. 9, 2201207 (2022). 53. Fang, S., Yan, M. & Hamers, R. J. Cell design and image analysis for in situ Raman mapping of inhomogeneous state-of-charge profiles in lithium-ion batteries. J. Power Sources 352, 18–25 (2017). 54. Chen, S. et al. Unveiling the critical role of ion coordination con- figuration of ether electrolytes for high voltage lithium metal bat- teries. Angew. Chem. Int. Ed. 62, e202219310 (2023). 55. Ding, J.-F. et al. Review on lithium metal anodes towards high energy density batteries. Green. Energy Environ. 8, 1509–1530 (2022). 56. Sim, R., Su, L. & Manthiram, A. A high energy-density, cobalt-free, low-nickel LiNi0.7Mn0.25Al0.05O2 cathode with a high-voltage elec- trolyte for lithium-metal batteries. Adv. Energy Mater. 13, 2300096 (2023). 57. Su, L., Jarvis, K., Charalambous, H., Dolocan, A. & Manthiram, A. Stabilizing high-nickel cathodes with high-voltage electrolytes. Adv. Funct. Mater. 33, 2213675 (2023). 58. Zhang, Q.-K. et al. Homogeneous and mechanically stable solid–electrolyte interphase enabled by trioxane-modulated elec- trolytes for lithium metal batteries. Nat. Energy 8, 725–735 (2023). 59. Shen, X. et al. The failure of solid electrolyte interphase on Li metal anode: structural uniformity or mechanical strength? Adv. Energy Mater. 10, 1903645 (2020). 60. Chen, Y. et al. Origin of dendrite-free lithium deposition in con- centrated electrolytes. Nat. Commun. 14, 2655 (2023). 61. Frisch, M. J. et al. Gaussian 16, Revision C.01 (Gaussian, Inc., 2016). Acknowledgements This study was supported by the National Natural Science Foundation of China, grant Nos. 22179124 (X.R.), 21905265 (X.R.), CAS Project for Young Scientists in Basic Research, grant No. YSBR-098 (Q.W.), the Fundamental Research Funds for the Central Universities, grant No. WK3430000007 (X.R.), and 2021 Anhui Energy Internet Joint Fund Project, grant No. 2108085UD04 (Q.W. and X.R.). XAS tests were per- formed at beamlines BL12B-a and BL12B-b in the National Synchrotron Radiation Laboratory (NSRL) in Hefei, China. The numerical calculations in this paper have been done at Hefei Advanced Computing Center. In addition, the authors are grateful for resources from the High Perfor- mance Computing Center of Central South University and the Center for Micro and Nanoscale Research and Fabrication at USTC. We are also thankful for the helpful discussion about NMR tests and analysis with Dr. Ke Gong from the Instruments Center for Physical Science at USTC. Author contributions Z.C. and X.R. conceived the idea and designed the experiments. Z.C. performed the main research work with the help of D.R., Q.N., J.F., and S.C. Z.J. and Q.W. conducted the ARC tests. Z.C., D.W., and X.O. per- formed the theoretical calculations. Z.H. and S.J. conducted the AFM test. J.J. performed the Raman test. J.M. carried out the DSC test. Z.C. and X.R. wrote the manuscript, and all authors discussed the results and revised the manuscript. Competing interests The authors declare no competing interests. Additional information Supplementary information The online version contains supplementary material available at https://doi.org/10.1038/s41467-024-46186-y. Correspondence and requests for materials should be addressed to Qingsong Wang or Xiaodi Ren. Peer review information Nature Communications thanks Jianhui Wang and the other anonymous reviewers for their contribution to the peer review of this work. A peer review file is available. Reprints and permissions information is available at http://www.nature.com/reprints Publisher’s note Springer Nature remains neutral with regard to jur- isdictional claims in published maps and institutional affiliations. Article https://doi.org/10.1038/s41467-024-46186-y Nature Communications| (2024) 15:2033 11 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/ licenses/by/4.0/. © The Author(s) 2024 Article https://doi.org/10.1038/s41467-024-46186-y Nature Communications| (2024) 15:2033 12

Title: Molecular anchoring of free solvents for high-voltage and high-safety lithium metal batteries ​ Authors: Zhuangzhuang Cui, Zhuangzhuang Jia, Digen Ruan, Qingshun Nian, Jiajia Fan, Shunqiang Chen, Zixu He, Dazhuang Wang, Jinyu Jiang, Jun Ma, Xing Ou, Shuhong Jiao, Qingsong Wang, Xiaodi Ren Publisher: Nature Communications Date: 2024-03-06 00:00:00 Abstract: Constraining the electrochemical reactivity of free solvent molecules is pivotal for developing high-voltage lithium metal batteries, especially for ether solvents with high Li metal compatibility but low oxidation stability (<4.0 V vs Li+/Li). ​ The typical high concentration electrolyte approach relies on nearly saturated Li+ coordination to ether molecules, which is confronted with severe side reactions under high voltages (>4.4 V) and extensive exothermic reactions between Li metal and reactive anions. ​ Herein, we propose a molecular anchoring approach to restrict the interfacial reactivity of free ether solvents in diluted electrolytes. ​ The hydrogen-bonding interactions from the anchoring solvent effectively suppress excessive ether side reactions and enhance the stability of nickel-rich cathodes at 4.7 V, despite the extremely low Li+/ether molar ratio (1:9) and the absence of typical anion-derived interphase. ​ Furthermore, the exothermic processes under thermal abuse conditions are mitigated due to the reduced reactivity of anions, which effectively postpones the battery thermal runaway.

Sub-volt high-speed silicon MOSCAP microring modulator driven by high-mobility conductive oxide (1).pdf

Article https://doi.org/10.1038/s41467-024-45130-4 Sub-volt high-speed silicon MOSCAP microring modulator driven by high-mobility conductive oxide Wei-Che Hsu1,2, Nabila Nujhat1, Benjamin Kupp 1, John F. Conley Jr 1, Haisheng Rong 3, Ranjeet Kumar 3 & Alan X. Wang 1,2 Silicon microring modulator plays a critical role in energy-efficient optical interconnect and optical computing owing to its ultra-compact footprint and capability for on-chip wavelength-division multiplexing. However, existing silicon microring modulators usually require more than 2 V of driving voltage (Vpp), which is limited by both material properties and device structures. Here, we present a metal-oxide-semiconductor capacitor microring modulator through heterogeneous integration between silicon photonics and titanium- doped indium oxide, which is a high-mobility transparent conductive oxide (TCO) with a strong plasma dispersion effect. The device is co-fabricated by Intel’s photonics fab and our in-house TCO patterning processes, which exhibits a high modulation efficiency of 117 pm/V and consequently can be driven by a very low Vpp of 0.8 V. At a 11 GHz modulation bandwidth where the modulator is limited by the RC bandwidth, we obtained 25 Gb/s clear eye diagrams with energy efficiency of 53 fJ/bit. Optical microring resonators have emerged as a key building block of photonic integrated circuits (PICs) that can function as versatile optical devices, including modulators, wavelength filters and mul- tiplexers, in comb lasers, weight banks for neuromorphic comput- ing, and optical sensors1–3. They are playing increasingly critical roles in optical communication, optical interconnects, optical computing, and biomedical sensing due to their ultra-compact footprint and capability for on-chip wavelength-division multi- plexing (WDM)4. Although optical microring resonators have been implemented on various platforms such as thin-film LiNbO3 5, silicon nitride6, and plasmonics7, active silicon microring modulators (Si- MRMs) that can perform high-speed electro-optic (E-O) modulation as the photonic engine for future PICs remains as the climax of research8–10. Silicon photonics provides a mature, cost-effective platform to integrate Si-MRMs with lasers, photodetectors, passive optical devices, and even microelectronic circuits through standard foundry fabrication, which is still the only feasible solution to build large-scale PICs with both active and passive devices for complex systems11,12. Existing Si-MRMs available in the foundry process are based on reversed PN junctions, which can achieve ultra-high modulation bandwidth but usually require more than 2 V of driving voltage (Vpp)13–16. Such high Vpp is induced by the relatively weak plasma dis- persion effect of silicon and the small capacitance per unit length of the reversed PN-junction, which is usually less than 2 fF/μm17,18. The high Vpp makes it unfeasible to drive Si-MRMs directly by CMOS logic circuits. For example, today’s 5 nm CMOS has a core supply of 0.65 V and input/output supply of 1 V19. Therefore, high voltage-swing CMOS transmitter (TX) circuits that consume hundreds of milliwatts of power must be used to drive the Si-MRMs, and the energy consumption of the Si-MRM is insignificant compared with that of its CMOS driver20. For instance, the 106 Gb/s 2.5 Vpp Si-MRM driver using 28 nm CMOS pro- cess consumes 1.33 pJ/bit energy with Pulse-amplitude modulation 4-level (PAM-4) while the Si-MRM itself usually consumes less than 100 fJ/bit energy21. Therefore, reducing the driving voltage of the mod- ulator not only lowers the power consumption of the modulator itself, but also enables energy-efficient and high-speed modulator drivers using advanced CMOS nodes that cannot support the high driving Received: 29 August 2023 Accepted: 12 January 2024 Check for updates 1School of Electrical Engineering and Computer Science, Oregon State University, Corvallis, OR, USA. 2Department of Electrical and Computer Engineering, Baylor University, Waco, TX, USA. 3Intel Corporation, 3600 Juliette Ln, Santa Clara, CA, USA. e-mail: [email protected] Nature Communications| (2024) 15:826 1 1234567890():,; 1234567890():,; voltage of existing silicon photonic modulators22. As a comparison, MOSCAP-driven Si-MRMs can achieve a much larger capacitance density using ultra-thin high dielectric constant insulators such as HfO2. In addition, MOSCAP devices allow heterogeneous integration of more E-O efficient gate materials with Si waveguide such as III-V compound semiconductors and graphene23–30. In the past two dec- ades, high-speed MOSCAP Si-MRMs, including heterogeneously inte- grated functional materials, have been demonstrated (Supplementary Information I)7,10,31–37. Nevertheless, there is still a strong desire to develop high-speed Si-MRMs with sub-volt Vpp and large E-O mod- ulation efficiency. In this article, we demonstrate a highly efficient MOSCAP Si- MRM heterogeneously integrated with titanium-doped indium oxide (ITiO), a TCO with high carrier mobility. The focus of this study is to achieve sub-volt Vpp modulation with a high E-O bandwidth, which requires optimization of the quality factor (Q- factor) and the E-O efficiency of the MRM. A higher Q-factor allows for narrower resonant spectra, enabling lower Vpp. How- ever, it also leads to a longer photon lifetime, which imposes a limitation on the modulation bandwidth. Therefore, enhancing the E-O efficiency of the MRM through other mechanisms using more efficient gate material and higher capacitance density becomes crucial. The ITiO-gated MOSCAP Si-MRM in this work improved the E-O efficiency by narrowing the microring wave- guide width, which effectively improved the overlapping factor between the accumulated carriers and the optical mode profile38. The utilization of high-mobility ITiO reduces the optical wave- guide absorption, enabling a balanced Q-factor for sub-volt Vpp modulation while still supporting a large photon lifetime-limited bandwidth. Additionally, the high-mobility ITiO, along with opti- mized doping on the Si microring waveguide and metal electrode patterning, improved the RC bandwidth significantly compared with all previous work39,40. As a result, the ITiO-gated MOSCAP Si- MRM can be driven by 0.8 Vpp with 11 GHz E-O bandwidth, demonstrating a clear eye diagram at 25 Gb/s with an energy efficiency of 53 fJ/bit. In addition, we would like to point out that TCOs have emerged as a new E-O modulation material for inte- grated photonics in recent years41. Although high bandwidth was claimed42,43, these devices only demonstrated small-signal RF modulation and no clear eye diagrams have been reported above 5 Gb/s. In this work, the ITiO-gated MOSCAP Si-MRM represents the first TCO modulator capable of high-speed E-O modulation with clear eye diagrams exceeding 25 Gb/s, which marks a significant milestone in the development of TCO modulators. Through further optimization of the device structure to enhance the RC bandwidth, which is the primary constraint on our current device, we propose a high-mobility TCO to enable a much higher bandwidth while operating at even lower driving voltages. This advancement holds the potential for high-speed E-O modulation with sub-volt driving voltages, thereby paving the way for future advancements in energy-efficient optical communication and computation systems. Results Device design Figure 1 illustrates the design of the ITiO-gated MOSCAP Si-MRM, including a 3D schematic diagram and a cross-sectional view of the active region. The device comprises a 300 nm thick Si rib waveguide with a 100 nm slab thickness. A waveguide width of 300 nm is selected to enhance the E-O efficiency, while a radius of 8 μm is chosen to reduce the bending loss (Supplementary Information II). The Si doping profile of p (1 × 1017cm−3), p+ (3 × 1018cm−3), and p ++ (1 × 1020cm−3) are designed to reduce the series resistance without compromising the optical absorption in the Si waveguide. The entire device has a back- ground Si p-doping, and the p+ region covers the top of the ring waveguide and part of the Si slab. The p ++ region is placed 600 nm away from the ring waveguide to maintain the Q-factor. Such a doping design allows the passive Si microring resonator to achieve a high Q-factor of 20,000 near the critical coupling condition. The active E-O modulation region, which represents approximately 62.5% of the microring circumference (L = 31.4 μm), consists of a 10 nm thick HfO2 insulator layer and a 14 nm ITiO layer on the top. The Ni/Au electrodes traverse the bus waveguide via the top SiO2 waveguide cladding, forming ohmic contacts with the ITiO gate and the Si substrate of the MOSCAP. Figure 2a shows the simulated carrier density distribution in the cross-sectional waveguide of the ITiO-gated MOSCAP Si-MRM in the active region. When a negative bias is applied, holes and electrons accumulate at the Si/HfO2 and HfO2/ITiO interfaces, respectively. Accumulated electrons within the ITiO layer is less than 1 nm thick, which is significantly thinner than the hole accumulation layer in the Si waveguide due to the different Debye lengths caused by the varying carrier concentration and dielectric constant44. Figure 2b presents the optical mode profile of the transverse-electric (TE) mode in the ITiO-gated MOSCAP Si-MRM. Due to the bending ring waveguide, the optical mode profile shifts toward the outer sidewall of the waveguide. Upon a nega- tive bias, the optical mode interacts with the accumulation charges in both ITiO and Si, enabling E-O modulation and blue- shifting the resonant wavelength (Δλres). Our previous studies have discussed that phase modulation with moderate index change is majorly determined by the total charge variation, allowing us to simplify the simulation model to a uniform dis- tribution with 1 nm thick accumulation layers, aligning well with experimental results45,46. Therefore, Fig. 2b also provides a zoomed-in view of the optical mode profile at the HfO2/ITiO interfaces, showcasing examples at 0 V and −1 V biases with a 1 nm thick uniform accumulation layer. Figure 2c shows the simulated transmission spectra under different gate biases. Our simulation assumes a dielectric constant of 12 for HfO2 and carrier mobility Si (P) Si (P+) Si (P++) HfO2 ITiO Ni Au 300 nm Top Cladding (SiO2) Bus Waveguide Fig. 1 | 3D schematic diagram of an ITiO-gated MOSCAP Si-MRM. The dashed line box shows the cross-sectional view in the active region of the ITiO-gated MOSCAP Si-MRM. Article https://doi.org/10.1038/s41467-024-45130-4 Nature Communications| (2024) 15:826 2 Data availability All data generated or analyzed during this study are included in this published article and its supplementary information files. The experi- mental data generated in this study are provided in the Source Data files. Source data are provided in this paper. References 1. Xu, Q., Schmidt, B., Pradhan, S. & Lipson, M. Micrometre-scale silicon electro-optic modulator. Nature 435, 325–327 (2005). 2. Bogaerts, W. et al. Silicon microring resonators. Laser Photonics Rev. 6, 47–73 (2012). 3. Xu, Q., Fattal, D. & Beausoleil, R. G. Silicon microring resonators with 1.5-µm radius. Opt. Express 16, 4309–4315 (2008). 4. Dong, P. Silicon photonic integrated circuits for wavelength- division multiplexing applications. IEEE J. Sel. Top. Quantum Elec- tron. 22, 370–378 (2016). 5. Guarino, A., Poberaj, G., Rezzonico, D., Degl’Innocenti, R. & Günter, P. Electro–optically tunable microring resonators in lithium niobate. Nat. Photonics 1, 407–410 (2007). 6. Lu, X., Moille, G., Rao, A., Westly, D. A. & Srinivasan, K. Efficient photoinduced second-harmonic generation in silicon nitride pho- tonics. Nat. Photonics 15, 131–136 (2021). 7. Eppenberger, M. et al. Resonant plasmonic micro-racetrack mod- ulators with high bandwidth and high temperature tolerance. Nat. Photonics 17, 360–367 (2023). 8. Fathololoumi, S. et al. 1.6 Tbps silicon photonics integrated circuit and 800 Gbps photonic engine for switch co-packaging demon- stration. J. Light. Technol. 39, 1155–1161 (2021). 9. Chan, D. W. U., Wu, X., Lu, C., Lau, A. P. T. & Tsang, H. K. Efficient 330-Gb/s PAM-8 modulation using silicon microring modulators. Opt. Lett. 48, 1036–1039 (2023). (a) (b) (c) 6dB (ER) 3dB (IL) f3dB = 52 GHz 300 nm 400 nm Si (P) (1×1018 cm-3) HfO2 IHO Ni Au Si (P+) (1×1019 cm-3) Si (P++) (1×1020 cm-3) Top Cladding (SiO2) Fig. 7 | Device optimization for improved performance. a The cross-sectional view in the active region of the MRM with TCO only covering the outer sidewall of the ring. b Static simulation of the shifted spectra under −1.5 V and −2.0 V. c Simulated E-O response (S21) of the MRM with 52 GHz bandwidth. The E-O response simulation setup is shown in Supplementary Information VII. Fig. 8 | Schematic of high-speed testing setups. a Eye diagrams testing. b E-O response testing. Article https://doi.org/10.1038/s41467-024-45130-4 Nature Communications| (2024) 15:826 7 10. Zhang, Y. et al. 240 Gb/s optical transmission based on an ultrafast silicon microring modulator. Photonics Res. 10, 1127–1133 (2022). 11. Margalit, N. et al. Perspective on the future of silicon photonics and electronics. Appl. Phys. Lett. 118, 220501 (2021). 12. Siew, S. Y. et al. Review of silicon photonics technology and plat- form development. J. Light. Technol. 39, 4374–4389 (2021). 13. Chan, D. W. U. et al. Ultra-wide free-spectral-range silicon microring modulator for high capacity WDM. J. Light. Technol. 40, 7848–7855 (2022). 14. Yuan, Y. et al. A 100 Gb/s PAM4 two-segment silicon microring resonator modulator using a standard foundry process. ACS Pho- tonics 9, 1165–1171 (2022). 15. Pandey, A., Dwivedi, S., Zhenzhou, T., Pan, S. & Van Thourhout, D. Nonreciprocal Light Propagation in a Cascaded All-Silicon Micror- ing Modulator. ACS Photonics 8, 1997–2006 (2021). 16. Liu, J. et al. Ultrahigh extinction ratio silicon micro-ring modulator by MDM resonance for high speed PAM-4and PAM-8 signaling. Opt. Express 30, 25672–25684 (2022). 17. Streshinsky, M. et al. Low power 50 Gb/s silicon traveling wave Mach-Zehnder modulator near 1300 nm. Opt. Express 21, 30350–30357 (2013). 18. Yong, Z. et al. U-shaped PN junctions for efficient silicon Mach- Zehnder and microring modulators in the O-band. Opt. Express 25, 8425–8439 (2017). 19. Sicard, E. & Trojman, L. Introducing 5-nm FinFET technology in Microwind. URL:https://hal.science/hal-03254444 (2021). 20. Li, H. et al. A 3-D-integrated silicon photonic microring-based 112- Gb/s PAM-4 transmitter with nonlinear equalization and thermal control. IEEE J. Solid-State Circuits 56, 19–29 (2021). 21. Li, H. et al. A 106 Gb/s 2.5 Vppd linear microring modulator driver with integrated photocurrent sensor in 28 nm CMOS. in OFC M2D.1 (2022). 22. Levy, C. et al. A 3D-integrated 8λ × 32 Gbps λ silicon photonic microring-based DWDM transmitter. in 2023 IEEE Custom Inte- grated Circuits Conference (CICC) 1–2 (2023). 23. Liu, A. et al. A high-speed silicon optical modulator based on a metal-oxide-semiconductor capacitor. Nature 427, 615–618 (2004). 24. Hiraki, T. et al. Heterogeneously integrated III-V/Si MOS capacitor Mach-Zehnder modulator. Nat. Photonics 11, 482–485 (2017). 25. Cheung, S. et al. Demonstration of a 17 × 25 Gb/s heterogeneous III- V/Si DWDM transmitter based on (De-) interleaved quantum dot optical frequency combs. J. Light. Technol. 40, 6435–6443 (2022). 26. Thiessen, T. et al. 30 GHz heterogeneously integrated capacitive InP- on-Si Mach-Zehnder modulators. Opt. Express 27, 102–109 (2019). 27. Sorianello, V. et al. Graphene–silicon phase modulators with giga- hertz bandwidth. Nat. Photonics 12, 40–44 (2018). 28. Wood, M. G. et al. Gigahertz speed operation of epsilon-near-zero silicon photonic modulators. Optica 5, 233–236 (2018). 29. Li, E., Gao, Q., Chen, R. T. & Wang, A. X. Ultracompact silicon- conductive oxide nanocavity modulator with 0.02 lambda-cubic active volume. Nano Lett. 18, 1075–1081 (2018). 30. Ma, Z., Li, Z., Liu, K., Ye, C. & Sorger, V. J. Indium-tin-oxide for high- performance electro-optic modulation. Nanophotonics 4, 198–213 (2015). 31. Timurdogan, E. et al. An ultralow power athermal silicon modulator. Nat. Commun. 5, 4008 (2014). 32. Sakib, M. et al. A high-speed micro-ring modulator for next gen- eration energy-efficient optical networks beyond 100 Gbaud. in CLEO SF1C.3 (2021). 33. Campenhout, J. Van et al. Low-voltage, low-loss, multi-Gb/s silicon micro-ring modulator based on a MOS capacitor. in OFC OM2E.4 (2012). 34. Gevorgyan, H., Khilo, A., Wade, M. T., Stojanović, V. M. & Popović, M. A. Miniature, highly sensitive MOSCAP ring modulators in co- optimized electronic-photonic CMOS. Photon. Res. 10, A1–A7 (2022). 35. Zhang, W. et al. Harnessing plasma absorption in silicon MOS ring modulators. Nat. Photonics 17, 273–279 (2023). 36. Liang, D. et al. An energy-efficient and bandwidth-scalable DWDM heterogeneous silicon photonics integration platform. IEEE J. Sel. Top. Quantum Electron. 28, 1–19 (2022). 37. Kong, D., Liu, Y., Ding, Y., Hu, H. & Luan, C. Ultrahigh-modulation- efficiency graphene-silicon micro-ring modulator. https://doi.org/ 10.21203/rs.3.rs-2921645/v1 (2023). 38. Hsu, W.-C., Nujhat, N., Kupp, B., Conley, J. F. & Wang, A. X. On-chip wavelength division multiplexing filters using extremely efficient gate-driven silicon microring resonator array. Sci. Rep. 13, 5269 (2023). 39. Zhou, B., Li, E., Bo, Y. & Wang, A. X. High-speed plasmonic-silicon modulator driven by Epsilon-near-zero. Conduct. Oxide. J. Light. Technol. 38, 3338–3345 (2020). 40. Li, E., Zhou, B., Bo, Y. & Wang, A. X. High-speed femto-Joule per bit silicon-conductive oxide nanocavity. Modulator. J. Light. Technol. 39, 178–185 (2021). 41. Sinatkas, G., Christopoulos, T., Tsilipakos, O. & Kriezis, E. E. Electro- optic modulation. Integr. Photonics J. Appl. Phys. 130, 10901 (2021). 42. Huang, Y. et al. High-bandwidth Si/In2O3 hybrid plasmonic wave- guide modulator. APL Photonics 7, 51301 (2022). 43. Zemtsov, D. S. et al. Plasmon-assisted Si-ITO integrated electro- optical Rib-shape modulator. J. Light. Technol. 40, 6310–6314 (2023). 44. Hsu, W.-C., Zhou, B. & Wang, A. X. MOS capacitor-driven silicon modulators: a mini review and comparative analysis of modulation efficiency and optical loss. IEEE J. Sel. Top. Quantum Electron. 28, 1–11 (2022). 45. Li, E. & Wang, A. X. Theoretical analysis of energy efficiency and bandwidth limit of silicon photonic modulators. J. Light. Technol. 37, 5801–5813 (2019). 46. Hsu, W.-C., Li, E., Zhou, B. & Wang, A. X. Characterization of field- effect mobility at optical frequency by microring resonators. Pho- tonics Res. 9, 615–621 (2021). 47. Sun, C. et al. Single-chip microprocessor that communicates directly using light. Nature 528, 534–538 (2015). 48. Müller, J. et al. Optical peaking enhancement in high-speed ring modulators. Sci. Rep. 4, 6310 (2014). 49. Koida, T., Ueno, Y. & Shibata, H. In2O3-based transparent conducting oxide films with high electron mobility fabricated at low process temperatures. Phys. Status Solidi 215, 1700506 (2018). 50. Ackermann, M., Merget, F. & Witzens, J. Sub-wavelength tunneling barrier in rib waveguide microring modulators with vanishing bending losses. Opt. Lett. 47, 2626–2629 (2022). Acknowledgements This work is supported by the Intel URC project 76084461, the NSF GOALI project 2240352, the AFOSR MURI project FA9550-17-1-0071, and the NASA ESI program 80NSSC23K0195. Besides, we would like to thank the DURIP grant FA9550-20-1-0151 and Baylor University Mearse Endowment for equipment support of high-speed optoelectronics characterization, Materials Synthesis and Characterization Facility (MaSC) and the Electron Microscopy Facility at Oregon State University for our device fabrication. MaSC is part of the Northwest Nanotechnol- ogy Infrastructure, a National Nanotechnology Coordinated Infra- structure site at Oregon State University supported in part by the National Science Foundation (grant NNCI-1542101). We acknowledge Meer Sakib for the helpful discussion in design and characterization, Duanni Huang, James Jaussi, and Pavan Kumar Hanumolu for technical discussions. Article https://doi.org/10.1038/s41467-024-45130-4 Nature Communications| (2024) 15:826 8 Author contributions W.H. and A.X.W. were involved in the design, experiments, and manu- script writing. N.N. was involved in device fabrication. B.K. and J.F.C. were involved in atomic layer deposition. H.R. and R.K. were involved in the design. All authors reviewed the manuscript. Competing interests The authors declare no competing interests. Additional information Supplementary information The online version contains supplementary material available at https://doi.org/10.1038/s41467-024-45130-4. Correspondence and requests for materials should be addressed to Alan X. Wang. Peer review information Nature Communications thanks Manuel Ack- ermann, and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. A peer review file is available. Reprints and permissions information is available at http://www.nature.com/reprints Publisher’s note Springer Nature remains neutral with regard to jur- isdictional claims in published maps and institutional affiliations. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/ licenses/by/4.0/. © The Author(s) 2024 Article https://doi.org/10.1038/s41467-024-45130-4 Nature Communications| (2024) 15:826 9

Title: Sub-volt high-speed silicon MOSCAP microring modulator driven by high-mobility conductive oxide ​ Authors: Wei-Che Hsu, Nabila Nujhat, Benjamin Kupp, John F. Conley Jr, Haisheng Rong, Ranjeet Kumar, Alan X. Wang ​ Publisher: Nature Communications Date: anuary 27, 2024 Abstract: Silicon microring modulators are essential for energy-efficient optical interconnects and optical computing due to their compact size and capability for on-chip wavelength-division multiplexing. ​ However, current silicon microring modulators typically require driving voltages exceeding 2 V, constrained by material properties and device structures. ​ This study introduces a metal-oxide-semiconductor capacitor microring modulator, integrating silicon photonics with titanium-doped indium oxide, a high-mobility transparent conductive oxide with a strong plasma dispersion effect. ​ Co-fabricated by Intel’s photonics fab and in-house TCO patterning processes, the device demonstrates a high modulation efficiency of 117 pm/V and operates with a low Vpp of 0.8 V. At an 11 GHz modulation bandwidth, limited by the RC bandwidth, the modulator achieves 25 Gb/s clear eye diagrams with an energy efficiency of 53 fJ/bit. ​ This advancement marks a significant milestone in the development of TCO modulators, paving the way for future high-speed, energy-efficient optical communication and computation systems. ​

Sub-volt high-speed silicon MOSCAP microring modulator driven by high-mobility conductive oxide.pdf

Article https://doi.org/10.1038/s41467-024-45732-y Manufacturing of high strength and high conductivity copper with laser powder bed fusion Yingang Liu 1,11, Jingqi Zhang 1,11, Ranming Niu 2,3 , Mohamad Bayat4, Ying Zhou5, Yu Yin 1, Qiyang Tan 1, Shiyang Liu1, Jesper Henri Hattel4, Miaoquan Li6, Xiaoxu Huang 7,8, Julie Cairney 2,3, Yi-Sheng Chen 2,3, Mark Easton 9, Christopher Hutchinson 10 & Ming-Xing Zhang 1 Additive manufacturing (AM), known as 3D printing, enables rapid fabrication of geometrically complex copper (Cu) components for electrical conduction and heat management applications. However, pure Cu or Cu alloys produced by 3D printing often suffer from either low strength or low conductivity at room and elevated temperatures. Here, we demonstrate a design strategy for 3D printing of high strength, high conductivity Cu by uniformly dispersing a minor portion of lanthanum hexaboride (LaB6) nanoparticles in pure Cu through laser powder bed fusion (L-PBF). We show that trace additions of LaB6 to pure Cu results in an improved L-PBF processability, an enhanced strength, an improved thermal stability, all whilst maintaining a high conductivity. The presented strategy could expand the applicability of 3D printed Cu compo- nents to more demanding conditions where high strength, high conductivity and thermal stability are required. The ability to fabricate fully dense, highly conductive, and mechani- cally robust copper (Cu) components is essential for electrical con- duction and heat management applications. Additive manufacturing (AM)1–11, or 3D printing, offers unprecedented opportunities for pro- ducing Cu components with complex geometry and tailored perfor- mance which are inaccessible by conventional manufacturing processes. However, pure Cu has a high reflectivity for infrared lasers and hence pure Cu components fabricated by the most commonly used laser AM machines often suffers from high porosity12–14, leading to poor mechanical and conductivity properties. Although AM using green lasers or electron beams enables the fabrication of pure Cu components with relatively high density15–17, the intrinsically low strength of pure Cu at room temperature and its inability to resist thermal softening hinders the applications of additively manufactured Cu components in demanding mechanical loading and high tem- perature conditions. Alloying Cu with elements such as Cr and Zr improves the laser absorptivity and strengthens the metal12,18,19, but this approach degrades the conductivity due to their high solid solubility in Cu20. An alternative approach is to add immiscible foreign particles to reinforce the Cu while maintaining the high conductivity21,22. In practice, it has proven exceedingly difficult to achieve a sufficiently well dispersed Received: 12 May 2023 Accepted: 1 February 2024 Check for updates 1School of Mechanical and Mining Engineering, The University of Queensland, St. Lucia, QLD, Australia. 2Australian Centre for Microscopy and Microanalysis, The University of Sydney, Sydney, NSW, Australia. 3School of Aerospace, Mechanical and Mechatronic Engineering, The University of Sydney, Sydney, NSW, Australia. 4Department of Mechanical Engineering, Technical University of Denmark, Lyngby, Denmark. 5State IJR Center of Aerospace Design and Additive Manufacturing, Northwestern Polytechnical University, Xi’an, China. 6School of Materials Science and Engineering, Northwestern Polytechnical University, Xi’an, China. 7International Joint Laboratory for Light Alloys (Ministry of Education), College of Materials Science and Engineering, Chongqing University, Chongqing, China. 8Shenyang National Laboratory for Materials Science, Chongqing University, Chongqing, China. 9Centre for Additive Manufacturing, School of Engineering, RMIT University, Melbourne, VIC, Australia. 10Department of Materials Science and Engineering, Monash University, Clayton, VIC, Australia. 11These authors contributed equally: Yingang Liu, Jingqi Zhang. e-mail: [email protected]; [email protected]; [email protected] Nature Communications| (2024) 15:1283 1 1234567890():,; 1234567890():,; and uniform distribution of externally added nanoparticles to obtain a significant strengthening increment, without particle agglomeration degrading the ductility and damage tolerance21,23. The challenge of simultaneously obtaining high strength and high conductivity in 3D printed Cu parts limits its applications where a good balance of mechanical and physical properties is required. Here, we present a design strategy that enables laser AM of Cu parts with high density and high performance through the addition of minute amounts of lanthanum hexaboride (LaB6) nanoparticles. Our LaB6-doped Cu exhibits a yield strength of 347 ± 2 MPa (which is 3.7 times higher than pure Cu), together with an elongation to failure of 22.8 ± 1.2%, electrical conductivity of 98.4% IACS (International Annealed Copper Standard), thermal conductivity of 387 W m−1 K−1 and the ability to resist softening at 1050 °C. Additionally, we further demonstrate the applicability of our design strategy to geometrically complex components. Results Design strategy The key feature of our design strategy is that we select additives, of which the constituent elements have negligible solubility in solid Cu (and therefore have negligible detrimental effects on the con- ductivity), but will dissolve in the melt pools during laser melting (therefore not too high melting point) and subsequently re-precipitate with a very fine dispersion during solidification (and hence provide excellent strengthening). Criteria are as follows: (1) the constituent elements of the particles should have negligible solid solubility in Cu in order to minimize their detrimental influence on the conductivity19,20,24,25 and to maximize the re- precipitation of nanoparticles; (2) particles should have a relatively low melting point26, to maximize the chance of dissolution in the melt pool and to minimise coar- sening of the re-precipitated nanoparticles during solidifica- tion; and (3) particles should possess a low wetting angle with liquid Cu27, minimizing nanoparticle clustering in the liquid Cu. Microstructural characterization Following this design strategy, we identified LaB6 as a suitable additive candidate. LaB6 met the criteria due to its lower melting point, minimal solid solubility of constituent elements in Cu, and low wetting angle with molten Cu (see Supplementary Note 1). The initial LaB6 particles that were added to the pure Cu powder feedstock exhibited an irre- gular morphology and sizes up to 300 nm (Supplementary Fig. 1). The laser reflectivity test clearly demonstrates that pure Cu powder exhi- bits exceptionally high laser reflectivity within the infrared laser range (Fig. 1b), specifically at a wavelength of 1060 nm, as used by the laser powder bed fusion (L-PBF) system in our study. The reflectivity was noticeably decreased upon the incorporation of 1.0 weight per cent (wt%) LaB6 nanoparticles. This reduction can be attributed to two factors: the inherently low laser reflectivity of LaB6 and the introduc- tion of LaB6 nanoparticles, which enhance the surface roughness of pure Cu particles, facilitating multiple reflections within the pow- der bed. We then produced pure Cu parts using L-PBF and compared them with parts produced from Cu with 1 wt% LaB6 nanoparticles (hereafter denoted as 1.0LaB6-Cu) (see Methods). Despite the rela- tively high energy density being used for laser melting, the pure Cu parts produced by L-PBF shows discontinuous scanning tracks with a rough surface (Fig. 1a2), indicating a balling effect resulting from the high reflectivity of infrared lasers12,13,28. This leads to lack-of- fusion defects when successive layers are fused29. Micro-computed tomography (Micro-CT) shows pores with a diameter range of 10- 130 μm (Supplementary Fig. 2a, b). In contrast, the 1.0LaB6-Cu part demonstrates well-defined scanning tracks and no obvious defects (Fig. 1a3), which were attributed to the increased laser absorptivity due to the LaB6 addition (Fig. 1b). Micro-CT and electron back- scatter diffraction (EBSD) confirm the much higher density (Sup- plementary Fig. 2e, f) and relatively large grains of the 1.0LaB6-Cu as compared with pure Cu (Fig. 1a3). With an improvement in laser processability, highly dense 1.0LaB6-Cu parts can be fabricated effectively over a broader laser power range, spanning 325 W to 400 W (Supplementary Fig. 3). a BD Surface morphology Elemental mapping Electron backscatter diffraction map Pure Cu particle LaB6-doped Cu particle LaB6 Laser beam b a1 a2 a3 Fig. 1 | Laser AM of Cu and LaB6-doped Cu. a A schematic diagram of laser AM process (a1), and top surface morphology, cross-sectional EDS elemental mapping and EBSD inverse pole figure map of the L-PBF fabricated pure Cu (a2) and 1.0LaB6- Cu (a3). The pores are visible in pure Cu and high density can be achieved after addition of LaB6. b Laser reflectivity of pure Cu, LaB6 and 1.0 wt% LaB6 nanoparticles doped Cu powder feedstock at various laser wavelengths. After introducing 1.0 wt% LaB6 nanoparticles, the powder mixture shows lower laser reflectivity compared with pure Cu powder, indicating the increased laser absorptivity. SD Scanning direction, BD Building direction. Source data are pro- vided as a Source Data file. Article https://doi.org/10.1038/s41467-024-45732-y Nature Communications| (2024) 15:1283 2 and the nanoparticle agglomeration was observed in the 2.0LaB6-Cu due to the excessive addition (Supplementary Fig. 7d), leading to a reduction in the strength and ductility. After the feedstock prepara- tion, the powder mixture was characterized in a SEM (Hitachi SU3500) equipped with EDS. LaB6 nanoparticles electrostatically adhere to almost all Cu particles with uniform distribution (Supplementary Fig. 1). As a comparison to the experiment, high purity (99.9%) TiB2 nanoparticles with an average size of 100 nm were also mixed with pure Cu powder (Supplementary Fig. 13a). Furthermore, micrometre- scaled LaB6 powder with particle size ranging from 1 µm to 10 µm was also employed as the additive and mixed with pure Cu powder to show the microstructure and property response (Supplementary Fig. 7a). The laser reflectivity of the as-received powder and powder mixtures was measured using a double-beam UV-Visible-NIR Lambda 1050 Per- kinElmer spectrophotometer equipped with a 150 mm integrating sphere in the 400–2000 nm wavelength range. Pure Cu powder and the powder mixtures were subsequently subjected to laser powder bed fusion (L-PBF) AM in an SLM125HL system and the processing para- meters are listed in Supplementary Table 1. The L-PBF fabricated dog- bone-shaped blocks with gauge length of 10 mm, gauge width of 2.5 mm, and thickness of 40 mm were used for tensile testing54. The chemical compositions of the L-PBF fabricated samples were mea- sured using inductively coupled plasma atomic emission spectroscopy (ICP-AES) for metallic elements and using LECO combustion analysis for non-metallic elements, as listed in Supplementary Table 2. More- over, in order to analyse the microstructure of directly solidified metal, single-track samples were prepared with the same L-PBF processing parameters as the bulk sample on a pure Cu substrate (Fig. 2e). In addition, the sheet-based gyroid lattice with porosity of 70% and overall dimension of 30 mm (length) × 30 mm (width) × 30 mm (height) was designed to contain 5 × 5 × 5 arrays of unit cells and fab- ricated by L-PBF using both pure Cu and LaB6 nanoparticles doped Cu powder feedstocks for compression tests (Fig. 5a). Heat treatment In order to show the thermal stability of the L-PBF fabricated 1.0LaB6- Cu, annealing treatments were performed at various temperatures ranging from550 °C to 1050 °C for 1 h in a vacuum furnace, followed by furnace cooling at a cooling rate of 5 °C min−1 to ambient temperature. Hardness of heat-treated samples was measured in a LECO Vickers hardness tester at a load of 3 kg and a dwell time of 12 s. Six random positions were tested to obtain the average value for each sample. Microstructure characterization All metallographic samples were firstly ground using SiC papers fol- lowed by polishing with Struers OP-S suspension and finally etching with 50 ml HCl, 20 ml Fe3Cl, and 30 ml C2H5OH for 3 s. The micro- structure was examined in a Hitachi SU3500A SEM. Grain size, grain morphology and crystallographic orientation were characterized through electron backscatter diffraction (EBSD) analysis at a scan step size of 1.2 µm in a JEOL JSM-7800F field emission SEM and the corre- sponding geometrically necessary dislocation (GND) density was cal- culated. The detailed description of the method used for GND density calculation can be found in ref. 55. Prior to EBSD, surfaces of samples were electropolished in a Struers electrolyte D2. In addition, typical element distributions in the samples were analysed using EDS in the SEM operated at an accelerating voltage of 20 kV. To examine the nanoparticle distribution, the electropolished samples were etched with gallium ions using a focused ion beam (FIB), and SEM images were acquired at a 52° tilt to expose the nanoparticles in a FEI Scios FIB-SEM. Phase analysis of the L-PBF fabricated samples was accomplished using XRD in a Brücker D8 Advance system at a scan rate of 1° min−1 and step size of 0.02° with the diffraction angle 2θ ranging from 20° to 100°. FIB was used to prepare the TEM thin foils. A Hitachi HF5000 TEM, equipped with a probe aberration corrector and symmetrically opposed dual EDS detectors and operated at an acceleration voltage of 200 kV, was used for in-depth characterization of the L-PBF fabricated 1.0LaB6-Cu. The diondo d2 micro-CT system was used to analyse the micropores in the L-PBF fabricated samples. 2D slice image data were acquired through an X-ray source with the voltage of 120 kV and cur- rent of 100 µA. The exposure time was 2000 ms with a spatial solu- tion of 4 μm. Atom probe tomography The nanoscale elemental distribution in the L-PBF fabricated 1.0LaB6-Cu was analysed using APT in a local electrode atom probe CAMECA LEAP 4000X SI, which has a detection rate of 57%. APT matchstick specimens with dimension of 1.0 mm × 1.0 mm × 10 mm were first cut from the as- built sample, and then electropolished using alternating current under voltages of 5 V, 3 V and 1 V. The electrolyte was 70% orthophosphoric acid in water, as suggested by ref. 31. The electropolished APT samples were then annular polished using a Thermo Fisher G4 Plasma FIB-SEM. A Xe+ beam with a voltage of 5 kV and a current of 30 pA were used to finalize the APT sample preparation. The laser APT experiment was conducted under a high vacuum of 2 × 10−11 torr, at a temperature of 50 K, a laser pulse frequency of 200 kHz, and a laser pulse energy of 70 pJ. The APT data was reconstructed using a CAMECA integrated visualization and analysis software (AP Suite version 6.1.0.29). Mechanical property testing The tensile specimens with gauge dimension of 10 mm (length) × 2.5 mm (width) × 2 mm (thickness) were cut from the as-built blocks54. Tensile testing was performed perpendicular to the building direction on an Instron 5584 universal testing machine equipped with an advanced Instron video extensometer at a constant strain rate of 0.001 s−1. Four tensile samples were tested for each L-PBF fabricated part with the same addition and heat treatment conditions, and the average value was used as the testing result. After tensile testing, the fracture surface was examined in an SEM. Uniaxial compression tests of the sheet-based gyroid lattices were conducted along the building direction on the same Instron machine. During compression, the samples were centrally located between two pressure plates at a strain rate of 0.001 s−1 in accordance with standard ISO13314-2011. The compression process was recorded using a video camera at a rate of 50 frames per second. Frames extracted from these videos were then correlated with features in the associated stress-strain data, providing detailed information regarding the failure modes of both pure Cu and LaB6-doped Cu. All lattices were compressed until densification. Electrical conductivity testing The resistance of pure Cu and 1.0LaB6-Cu was measured on three samples with dimension of 15 mm (length) × 2 mm (width) × 5 mm (height) using a four-point probe method on a ZEM-3 electric resis- tance measurement system at room temperature. Because the length according to ASTM standard (300 mm) is far beyond the currently available L-PBF machine’s capacity to build, the non-standard length was used56. The volume resistivity can be calculated as follows: ρν = ðA=lÞr ð1Þ where ρv is the volume resistivity (Ω mm2 m−1), A is the cross-sectional area (mm2), l is the gage length (6 mm), and r is the measured resistance (Ω). The volume resistivity was determined to be 0.019527 Ω mm2 m−1 for the L-PBF fabricated pure Cu, and 0.017528 Ω mm2 m−1 for 1.0LaB6-Cu. The electrical conductivity σ can be expressed as follows: σ = 1 ρν = l Ar ð2Þ Article https://doi.org/10.1038/s41467-024-45732-y Nature Communications| (2024) 15:1283 7 Accordingly, the electrical conductivity was calculated to be 5.121 × 107S m−1 for the pure Cu, and 5.705 × 107S m−1 for 1.0LaB6-Cu. In addition, based on ASTM B193, 100% IACS (International Annealed Copper Standard) is defined as the electrical conductivity corre- sponding to a volume resistivity at 293 K of 0.017241 Ω mm2 m−1. Therefore, it is 88.3% IACS for the L-PBF fabricated pure Cu, and 98.4% IACS for 1.0LaB6-Cu. Thermal conductivity calculation The thermal conductivity of the L-PBF fabricated pure Cu and 1.0LaB6- Cu can be calculated through their electrical conductivity based on the Wiedemann-Franz law57. κ=σ = KL ð3Þ where κ is the thermal conductivity (W m−1 K−1), σ is the electrical con- ductivity (S m−1), K is the absolute temperature (K), and L is a Lorenz constant (W Ω K−2). For the annealed pure Cu with the electrical con- ductivity of 5. 916 × 107S m−1 and thermal conductivity of 401 W m−1 K−1, Lorenz constant can be calculated to be 2.31 × 10−8W Ω K−2. Therefore, the thermal conductivity of the L-PBF fabricated pure Cu and 1.0LaB6-Cu can be estimated to be 347 W m−1 K−1 and 387 W m−1 K−1, respectively. Data availability The experimental data generated in this study have been deposited in Dryad58. Source data are provided with this paper. References 1. DebRoy, T. et al. Additive manufacturing of metallic components – process, structure and properties. Prog. Mater. Sci. 92, 112–224 (2018). 2. Kürnsteiner, P. et al. High-strength Damascus steel by additive manufacturing. Nature 582, 515–519 (2020). 3. Gu, D. et al. Material-structure-performance integrated laser-metal additive manufacturing. Science 372, eabg1487 (2021). 4. Zhu, Y. et al. Ultrastrong nanotwinned titanium alloys through additive manufacturing. Nat. Mater. 21, 1258–1262 (2022). 5. Hou, H. et al. Fatigue-resistant high-performance elastocaloric materials made by additive manufacturing. Science 366, 1116–1121 (2019). 6. Wang, Y. M. et al. Additively manufactured hierarchical stainless steels with high strength and ductility. Nat. Mater. 17, 63–71 (2018). 7. DebRoy, T., Mukherjee, T., Wei, H. L., Elmer, J. W. & Milewski, J. O. Metallurgy, mechanistic models and machine learning in metal printing. Nat. Rev. Mater. 6, 48–68 (2021). 8. Zhao, C. et al. Critical instability at moving keyhole tip generates porosity in laser melting. Science 370, 1080–1086 (2020). 9. Martin, J. H. et al. 3D printing of high-strength aluminium alloys. Nature 549, 365–369 (2017). 10. Zhang, D. et al. Additive manufacturing of ultrafine-grained high- strength titanium alloys. Nature 576, 91–95 (2019). 11. Zhang, J. et al. Designing against phase and property hetero- geneities in additively manufactured titanium alloys. Nat. Commun. 13, 4660 (2022). 12. Jadhav, S. D. et al. Surface modified copper alloy powder for reli- able laser-based additive manufacturing. Addit. Manuf. 35, 101418 (2020). 13. Jadhav, S. D., Goossens, L. R., Kinds, Y., Van Hooreweder, B. & Vanmeensel, K. Laser-based powder bed fusion additive manu- facturing of pure copper. Addit. Manuf. 42, 101990 (2021). 14. Qu, S. et al. High-precision laser powder bed fusion processing of pure copper. Addit. Manuf. 48, 102417 (2021). 15. Gruber, S., Stepien, L., López, E., Brueckner, F. & Leyens, C. Physical and geometrical properties of additively manufactured pure cop- per samples using a green laser source. Materials 14, 3642 (2021). 16. Kang, S. -G. et al. Green laser powder bed fusion based fabrication and rate-dependent mechanical properties of copper lattices. Mater. Des. 231, 112023 (2023). 17. Lin, Z., Dadbakhsh, S. & Rashid, A. Developing processing windows for powder pre-heating in electron beam melting. J. Manuf. Process. 83, 180–191 (2022). 18. Kini, A. R. et al. In-situ synthesis via laser metal deposition of a lean Cu-3.4Cr-0.6Nb(at.%) conductive alloy hardened by Cr nano-scale precipitates and by Laves phase micro-particles. Acta Mater. 197, 330–340 (2020). 19. Guan, P. et al. Effect of selective laser melting process parameters and aging heat treatment on properties of CuCrZr alloy. Mater. Res. Express 6, 1165 (2019). 20. Rositter, P. L. The Electrical Resistivity of Metals and Alloys. (Cam- bridge University Press, Cambridge, 1991). 21. Bahador, A. et al. Deformation mechanism and enhanced proper- ties of Cu-TiB2 composites evaluated by the in-situ tensile test and microstructure characterization. J. Alloy. Compd. 847, 156555 (2020). 22. Ďurišinová, K., Ďurišin, J., Orolínová, M., Ďurišin, M. & Szabó, J. Effect of mechanical milling on nanocrystalline grain stability and prop- erties of Cu-Al2O3 composite prepared by thermo-chemical tech- nique and hot extrusion. J. Alloy. Compd. 618, 204–209 (2015). 23. Liu, G. et al. Nanostructured high-strength molybdenum alloys with unprecedented tensile ductility. Nat. Mater. 12, 344–350 (2013). 24. Wang, J., Zhou, X. & Li, J. Evolution of microstructures and prop- erties of SLM-manufactured Cu-15Ni-8Sn alloy during heat treat- ment. Addit. Manuf. 37, 101599 (2020). 25. Zhang, S. et al. Microstructure and properties in QCr0.8 alloy pro- duced by selective laser melting with different heat treatment. J. Alloy. Compd. 800, 286–293 (2019). 26. Sunagawa I. Crystals Growth, Morphology and Perfection. (Cam- bridge University Press, Cambridge, 2005). 27. Chen, L.-Y. et al. Processing and properties of magnesium con- taining a dense uniform dispersion of nanoparticles. Nature 528, 539–543 (2015). 28. Pogson, S. R., Fox, P., Sutcliffe, C. J. & O’Neill, W. The production of copper parts using DMLR. Rapid. Prototyp. J. 9, 334–343 (2003). 29. Bauereiß, A., Scharowsky, T. & Körner, C. Defect generation and propagation mechanism during additive manufacturing by selec- tive beam melting. J. Mater. Process. Technol. 214, 2522–2528 (2014). 30. Murakami, K., Adachi, T., Kuroda, T. & Nakamura, S. An atom-probe analysis of the LaB6(001) plane: II. Effect of hydrogen gas atmo- sphere. Surf. Sci. 176, 327–335 (1986). 31. Gault, B., Moody, M. P., Cairney, J. M. & Ringer, S. P. Atom Probe Microscopy. (Springer Science & Business Media, New York, 2012). 32. Zhang, M. X. & Kelly, P. M. Crystallographic features of phase transformations in solids. Prog. Mater. Sci. 54, 1101–1170 (2009). 33. Zhang, W. Z. & Weatherly, G. C. On the crystallography of pre- cipitation. Prog. Mater. Sci. 50, 181–292 (2005). 34. Yan, X. et al. Microstructure and mechanical properties of pure copper manufactured by selective laser melting. Mater. Sci. Eng. A 789, 139615 (2020). 35. Huang, J. et al. Pure copper components fabricated by cold spray (CS) and selective laser melting (SLM) technology. Surf. Coat. Technol. 395, 125936 (2020). 36. Jadhav, S. D., Vleugels, J., Kruth, J.-P., Van Humbeeck, J. & Van- meensel, K. Mechanical and electrical properties of selective laser- melted parts produced from surface-oxidized copper powder. Mater. Des. Process. Commun. 2, 94 (2019). 37. Li, Z. et al. Enhanced strengthening and hardening via self- stabilized dislocation network in additively manufactured metals. Mater. Today 50, 79–88 (2021). Article https://doi.org/10.1038/s41467-024-45732-y Nature Communications| (2024) 15:1283 8 38. Jadhav, S. D. et al. Influence of carbon nanoparticle addition (and impurities) on selective laser melting of pure copper. Materials 12, 2469 (2019). 39. Ventura, A. P. et al. Mechanical properties and microstructural characterization of Cu-4.3 pct Sn fabricated by selective laser melting. Metall. Mater. Trans. A 48, 178–187 (2017). 40. Ventura, A. P. et al. The effect of aging on the microstructure of selective laser melted Cu-Ni-Si. Metall. Mater. Trans. A 48, 6070–6082 (2017). 41. Gradl, P. R. et al. in AIAA Propulsion and Energy 2019 Forum AIAA Propulsion and Energy Forum (American Institute of Aeronautics and Astronautics, 2019). 42. Yang, M., Weng, L., Zhu, H., Fan, T. & Zhang, D. Simultaneously enhancing the strength, ductility and conductivity of copper matrix composites with graphene nanoribbons. Carbon 118, 250–260 (2017). 43. Zhang, X. et al. A powder-metallurgy-based strategy toward three- dimensional graphene-like network for reinforcing copper matrix composites. Nat. Commun. 11, 2775 (2020). 44. Li, Z. M. et al. Cuboidal γ‘ phase coherent precipitation- strengthened Cu–Ni–Al alloys with high softening temperature. Acta Mater. 203, 116458 (2021). 45. Sun, Y. et al. Effects of Mg addition on the microstructure and softening resistance of Cu–Cr alloys. Mater. Sci. Eng. A 776, 139009 (2020). 46. Tian, B. et al. Microstructure and properties at elevated temperature of a nano-Al2O3 particles dispersion-strengthened copper base composite. Mater. Sci. Eng. A 435–436, 705–710 (2006). 47. Xiao, Z. Heat Transfer, Fluid Transport and Mechanical Properties of Porous Copper Manufactured by Lost Carbonate Sintering. (Uni- versity of Liverpool, Liverpool, 2013). 48. Ahmed, Y. M. Z., Riad, M. I., Zaky, A. I., Abdel-Aziz, M. & Shalabi, M. M. H. Investigation on the mechanical properties of sintered porous copper compacts. China Particuol. 5, 391–394 (2007). 49. Cheng, K. et al. In-situ deposition of diamond on functionally gra- ded copper scaffold for improved thermal conductivity and mechanical properties. Mater. Lett. 299, 130050 (2021). 50. Ma, Z. et al. Lattice structures of Cu-Cr-Zr copper alloy by selective laser melting: microstructures, mechanical properties and energy absorption. Mater. Des. 187, 108406 (2020). 51. Singh, G. & Pandey, P. M. Topological ordered copper graphene composite foam: fabrication and compression properties study. Mater. Lett. 257, 126712 (2019). 52. Karabulut, Y. & Ünal, R. Additive manufacturing of ceramic particle- reinforced aluminum‐based metal matrix composites: a review. J. Mater. Sci. 57, 19212–19242 (2022). 53. Mosallanejad, M. H., Niroumand, B., Aversa, A. & Saboori, A. In-situ alloying in laser-based additive manufacturing processes: a critical review. J. Alloy. Compd. 872, 159567 (2021). 54. Liu, Y. et al. Additive manufacturing of high strength copper alloy with heterogeneous grain structure through laser powder bed fusion. Acta Mater. 220, 117311 (2021). 55. Muránsky, O. et al. On the measurement of dislocations and dis- location substructures using EBSD and HRSD techniques. Acta Mater. 175, 297–313 (2019). 56. Lu, L., Shen, Y., Chen, X., Qian, L. & Lu, K. Ultrahigh strength and high electrical conductivity in copper. Science 304, 422–426 (2004). 57. Jones, W. & March, N. H. Theoretical Solid State Physics. (Courier Corporation, New York, 1985). 58. Liu, Y. et al. Data from “Manufacturing of high strength and high conductivity copper with laser powder bed fusion” [Dataset]. Dryad https://doi.org/10.5061/dryad.9cnp5hqrp (2024). Acknowledgements This work was supported by the Australian Research Council (ARC, grant number: DP210103162). We thank Meng Li of The University of Queens- land for undertaking the electrical conductivity test. M.B. acknowledge the funding from Independent Research Fund Denmark, DIGI-3D project (Contract number: 0136–00210B). The authors from Northwestern Polytechnical University thank the State Key Laboratory of Solidification Processing in NWPU for funding support (Grant number: SKLSP202319). The authors from The University of Queensland thank Australian Micro- scopy & Microanalysis Research Facility at the Centre for Microscopy and Microanalysis (CMM), The University of Queensland for the facilities and technical assistance. The authors are grateful for the scientific and technical support from the Australian Centre for Microscopy and Microanalysis (ACMM) as well as the Microscopy Australia Node at the University of Sydney. Author contributions Y.L., J.Z., C.H. and M.-X.Z. conceived the concept and designed the experiments. M.-X.Z. supervised the project. Y.L. and J.Z. carried out the main experiments. R.N., J.C. and Y.-S.C. conducted the APT character- ization. M.B. and J.H.H. contributed idea for the research. Y.Z. conducted dataanalysis and lattice experiment. Q.T. and J.Z. prepared TEM samples and conducted the TEM characterization. Y.Y., Y.L. and S.L. prepared EBSD samples and carried out the EBSD characterization. Y.L., J.Z., Y.Z., M.L., X.H., M.E., C.H. and M.-X.Z. wrote the manuscript. All authors contributed to the discussion of the data. Competing interests The authors declare no competing interests. Additional information Supplementary information The online version contains supplementary material available at https://doi.org/10.1038/s41467-024-45732-y. Correspondence and requests for materials should be addressed to Ranming Niu, Christopher Hutchinson or Ming-Xing Zhang. Peer review information Nature Communications thanks Raiyan Seede, Katsuyoshi Kondoh and the other, anonymous, reviewer for their con- tribution to the peer review of this work. A peer review file is available. Reprints and permissions information is available at http://www.nature.com/reprints Publisher’s note Springer Nature remains neutral with regard to jur- isdictional claims in published maps and institutional affiliations. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/ licenses/by/4.0/. © The Author(s) 2024 Article https://doi.org/10.1038/s41467-024-45732-y Nature Communications| (2024) 15:1283 9

Title: Manufacturing of high strength and high conductivity copper with laser powder bed fusion Authors: Yingang Liu, Jingqi Zhang, Ranming Niu, Mohamad Bayat, Ying Zhou, Yu Yin, Qiyang Tan, Shiyang Liu, Jesper Henri Hattel, Miaoquan Li, Xiaoxu Huang, Julie Cairney, Yi-Sheng Chen, Mark Easton, Christopher Hutchinson, Ming-Xing Zhang Publisher: Nature Communications Date: 2024-02-12 00:00:00 Abstract: Additive manufacturing (AM), known as 3D printing, enables rapid fabrication of geometrically complex copper (Cu) components for electrical conduction and heat management applications. ​ However, pure Cu or Cu alloys produced by 3D printing often suffer from either low strength or low conductivity at room and elevated temperatures. ​ Here, we demonstrate a design strategy for 3D printing of high strength, high conductivity Cu by uniformly dispersing a minor portion of lanthanum hexaboride (LaB6) nanoparticles in pure Cu through laser powder bed fusion (L-PBF). ​ We show that trace additions of LaB6 to pure Cu results in an improved L-PBF processability, an enhanced strength, an improved thermal stability, all whilst maintaining a high conductivity. ​ The presented strategy could expand the applicability of 3D printed Cu components to more demanding conditions where high strength, high conductivity and thermal stability are required. ​


Pixel-wise programmability enables dynamic high-SNR cameras for high-speed microscopy.pdf

Article https://doi.org/10.1038/s41467-024-48765-5 Pixel-wise programmability enables dynamic high-SNR cameras for high-speed microscopy Jie Zhang1,2 , Jonathan Newman1,2, Zeguan Wang2,3, Yong Qian2,3, Pedro Feliciano-Ramos1,2, Wei Guo1,2, Takato Honda 1,2, Zhe Sage Chen 4, Changyang Linghu 5, Ralph Etienne-Cummings6, Eric Fossum7, Edward Boyden 2,3 & Matthew Wilson 1,2 High-speed wide-field fluorescence microscopy has the potential to capture biological processes with exceptional spatiotemporal resolution. However, conventional cameras suffer from low signal-to-noise ratio at high frame rates, limiting their ability to detect faint fluorescent events. Here, we introduce an image sensor where each pixel has individually programmable sampling speed and phase, so that pixels can be arranged to simultaneously sample at high speed with a high signal-to-noise ratio. In high-speed voltage imaging experi- ments, our image sensor significantly increases the output signal-to-noise ratio compared to a low-noise scientific CMOS camera (~2–3 folds). This signal-to- noise ratio gain enables the detection of weak neuronal action potentials and subthreshold activities missed by the standard scientific CMOS cameras. Our camera with flexible pixel exposure configurations offers versatile sampling strategies to improve signal quality in various experimental conditions. Wide-field fluorescence microscopy enables direct observation of physiological processes, such as cell signaling and local chemical concentrations. In neuroscience, this method has revolutionized the study of the neural basis of behavior by capturing the dynamics of thousands of cells in behaving animals1. However, challenges still remain in using functional fluorescence microscopy to sample fast neural dynamics2–6, such as the membrane potential that reflects neural activity occurring at millisecond timescales. High sampling speeds (1 kHz) of fluorescence indicators increase pixel readout noise and limit the number of flourescence photons integrated during each sampling period. These factors lead to a low signal-to- noise ratio (SNR) for detecting fluorescence activities associated with spiking events and subthreshold activity. Imaging setups can use high excitation power to maintain the SNR, but suffer from many caveats, such as photobleaching, heat, and cytotoxicity. Currently, experiments at kHz camera speed were conducted only in head-fixed animals using high-performance but bulky micro- scopes and were limited to a few minutes in duration5,6, which was insufficient to observe many behavioral states and their associated neural mechanisms. While many efforts have focused on improving the imaging sys- tems’ optics7,8 and finding denoising algorithmic solutions9,10, the key trade-offs of speed and SNR are also fundamentally linked to the image sensor. In this work, we examine and address the limitations of SNR at high speed by introducing a pixel design and sampling method. Advancements in sensor technology will complement ongoing inno- vations in optics and denoising algorithms. Together, they will enhance our fluorescence imaging technology to enable the tracking of neural activity at millisecond resolution across a large number of neurons, over long experimental durations. Received: 17 June 2023 Accepted: 30 April 2024 Check for updates 1Picower Institute for Learning and Memory, MIT, Cambridge, MA, USA. 2Department of Brain and Cognitive Sciences, MIT, Cambridge, MA, USA. 3McGovern Institute for Brain Research, MIT, Cambridge, MA, USA. 4Department of Psychiatry, NYU Grossman School of Medicine, New York, NY, USA. 5Department of Cell and Developmental Biology, University of Michigan, Ann Arbor, MI, USA. 6Department of Electrical and Computer Engineering, Johns Hopkins University, Baltimore, MD, USA. 7Thayer School of Engineering, Dartmouth College, Hanover, NH, USA. e-mail: [email protected] Nature Communications| (2024) 15:4480 1 1234567890():,; 1234567890():,; Results A fundamental trade-off exists between a pixel’s sampling speed and SNR. Fast sampling speeds lead to high readout noise, shortened exposure time, and fewer collected photons, inevitably lowering the SNR. The CMOS image sensor, which uniformly exposes and samples an array of pixels, is subject to the same SNR and speed limitation. High frame rates result in low SNR, and low frame rates with long pixel exposure lead to signal aliasing (Fig. 1a, b). Programmable pixel-wise exposure CMOS image sensor Despite this trade-off, physiological signals, such as the membrane voltage of a cell soma, are often spatially correlated, and the same signal can be redundantly captured by multiple pixels within a region of interest (ROI). We demonstrate a CMOS image sensor with pixel- wise programmable exposures (PE-CMOS) to take advantage of the highly correlated nature of microscopy scenes. The PE-CMOS permits flexible exposure at each pixel. This feature allows versatile pixel configurations to increase temporal resolution at sampling physiolo- gical signals without sacrificing SNR. In one configuration, the PE- CMOS staggered pixels’ exposure in time to acquire fast-spiking events at multiple phases (Fig. 1c), resolving temporal details finer than the sampling period and exposure time. Importantly, this increase in temporal resolution is achieved without raising the pixel sampling rate or reducing exposure time, therefore avoiding sacrificing the SNR. In another configuration, the PE-CMOS samples the ROI with pixels at different speeds, capturing high-frequency events (spiking activity) and weak signals (subthreshold potentials) that are difficult to acquire simultaneously at a fixed frame rate (Fig. 1c). The flexible pixel-wise exposure configuration is not achievable in conventional CMOS architecture, as all the pixels must have the same exposure, limited by the frame rate, and are sampled concurrently (global shutter) or sequentially in lines (rolling shutter). PE-CMOS circuit architecture The PE-CMOS sensor design enables pixel-wise programmability without compromising pixel sensitivity, which is determined by the percentage of effective photodiode area within each pixel (fill factor). Prior approaches to achieve pixel configurability required a high number of pixel-level circuits11–13 (~25 transistors), which occupied valuable pixel area and reduced the photodiode fill factor (38% and 45% for pixel pitches of 12.6 and 11.2 μm, respectively12,13). In contrast, the PE-CMOS achieves pixel-wise programmability using only six transistors per pixel, enabling high sensitivity (75% and 52% fill factor for smaller pixel pitch of 10 μm and 6.5 μm), comparable to high- performance CMOS sensors (Fig. 1d, e). For the PE-CMOS with a 10 µm pitch, the measured conversion gain is 110 μV/e-, with a read noise of 2.67 e-, measured at room temperature without active cooling. The quantum efficiency (QE) of the pixel is 68% without on-chip micro- lens array. The PE-CMOS chip was fabricated using the 180 nm CMOS image sensor process from XFAB, a commercial foundry service. Two pro- totype designs were produced with pixel arrays containing a 6.5 µm (Chip A) and 10 µm (Chip B) pixel pitch (Supplementary Fig. 1a and Methods). The pixel array is arranged in rows and columns, with readout circuitry at each column (Supplementary Fig. 1b and Meth- ods). Each column readout circuitry comprises a programmable gain amplifier (PGA), correlated-double sampling (CDS) circuits, and an analog-to-digital converter (ADC). The PGA offers a variable gain of 8 – 64 to the pixel output. The amplified signal is then processed by the CDS circuits to reduce flicker (1/f) noise before being sampled by the 10-bit ADC. The row-wise signals (RST, TX, and SEL) multiplex pixels to the readout circuits at each column. These signals also control pixel reset (RST), charge transfer (TX), and row-wise multiplex (SEL) operations. In a single readout period (0.9 ms in our implementation), each column readout circuit selects pixels of the column that end the exposure and converts their outputs to digital bits that are then sent off-chip. The PE-CMOS pixel design (Fig. 1d) comprises 6 transistors (T1–T6) and one pinned photodiode (PD). T1 to T4 form the standard rolling shutter 4T-pixel design14. During pixel exposure, the PD con- verts incoming photons into electrons. When the PD is ready to be sampled, T3, controlled by a row reset (RST) signal, first resets the voltage on the floating diffusion (FD) node. T4 (controlled by TX) then moves the electrons from the PD to FD, producing a change in voltage. The voltage signal is buffered by T1 and connected to the readout circuits by T2 (controlled by SEL), where the column readout circuitry samples it. We incorporated two additional transistors (T5 and T6) into the PE- CMOS pixel design to enable pixel-level exposure programmability. T5 and T6 operate as switches with input driven by column signals, EX. In PE-CMOS, each set of row signals (TX, RST, SEL) selects K rows of pixels as candidates for readout (K = 8 in Chip A, K = 4 in Chip B). At each column, out of these K pixels, only the pixel with both T5 and T6 acti- vated will end its exposure phase and be sampled by the column cir- cuitry. Meanwhile, the other pixels, with their T5 and T6 remaining off, will continue their exposure. T5 and T6 are controlled by column bus lines EX < 1:K> placed at each column. Pixel-wise exposure control can be achieved by synchronizing the EX signals with row signals (RST, SEL, and TX). An example pixel-wise operation diagram is shown in Sup- plementary Fig. 1d. For a group of K pixels, the pixel ends its exposure (at the time marked by dotted red line in Supplementary Fig. 1d) whenever its corresponding EX signal is high during the readout operation initiated by the signals: RST < N > , TX < N> and SEL < N>. Flexible pixel-wise configuration We can configure the pixels into custom exposure and sampling pat- terns by controlling the EX-signals at each pixel column, accomplished through a high-speed I/O interface on the PE-CMOS chip. Supple- mentary Fig. 2 illustrates various examples of pixel arrangements, with each color representing a unique temporal configuration. In a tiled spatial arrangement, pixels of different configurations are uniformly arranged in 2 × 2 windows, enabling uniform sampling of the entire array across four distinct temporal configurations (Supplementary Fig. 2a, b). Alternatively, arranging pixels of different exposures in a random spatial configuration can maximize the incoherence property desirable in a compressed sensing imaging framework15. Pixel config- urations can be updated instantaneously via on-chip control. This enables the optimization of local spatiotemporal resolution and SNR in real-time. For example, the pixels can be organized in ROI-dependent spatial patterns (Supplementary Fig. 2a). Since many fluorescence proteins are predominantly expressed on the cell membrane, we can encircle the bright outer contour of the cell ROI with fast pixels with short exposure times and high sampling rates while employing slower pixels in the dimmer regions of the ROI to enhance the SNR. Sampling voltage signals at high temporal resolution with phase-shifted long exposure pixels To demonstrate that the PE-CMOS can sample a high-temporal reso- lution voltage signal with low-speed pixels at different phase-offset, we compared PE-CMOS’s performance with a scientific CMOS camera (Hamamatsu Orca Flash 4.0 v3 sCMOS). Both sensors were used to simultaneously image (through a 50/50 beamsplitter) the spontaneous activity of cultured mouse hippocampal neurons expressing the ASAP3 genetically encoded voltage indicator (GEVI)3 (Fig. 2). We set the sCMOS camera to have a 1.25 ms exposure duration, which also determines its temporal resolution and sampling rate (Fs) of 800 Hz. In the PE-CMOS camera, we used a longer exposure time of 5 ms to integrate over the full spike width (half-width of the action potential generated by ASAP3 spikes is ~ 6 ms). We shift pixel exposures at phase offsets in multiples of 1.25 ms (Fig. 1c). This sets the PE-CMOS temporal Article https://doi.org/10.1038/s41467-024-48765-5 Nature Communications| (2024) 15:4480 2 where En 2 RM × L denotes the sampling matrix representing pixel exposure and sampling operation that converts the fluorescent signal vn 2 RL into the pixel outputs, yn 2 RM. Now, we can define an arbitrary signal, vROI, and rewrite each yn as: yn = En vROI + Enðvn  vROIÞ Note that we do not make the assumption that vROI is the average of the pixels. if we write the difference term φn = En vn vROI   , we can then concatenate the output of all of the N pixels into one vector: y = EvROI + φ ð6Þ where y = y1 .. . yN 2 64 3 75,E = E1 .. . EN 2 64 3 75and φ = φ1 .. . φN 2 64 3 75 and Given Eq. 6, we can find vROI using a ridge regression by enforcing a L2 norm penalty: vROI = minvROI 1 2 y  EvROI 2 2 + λridge vROI 2 2 and further derive its closed-form solution: ^vROI = ETE + λridgeI  1 ETy ð7Þ where ^vROI is the least-squared estimate of vROI, and the hyperpara- meter, λridge, controls the trade-off between the L2-norm of vROI and reconstruction error, denoted by ky  EvROIk2 = kφk2. Solving this regression should push vROI to be close to the average of the pixels ð  vROI = 1 N PN n = 1vnÞ, which by definition, minimizes the L2 norm of ky  EvROIk2. However, in the presence of noise, setting λridge could have a risk of overfitting. To avoid this, in the interpolation method used in our manuscript, we set λridge to be large, which con- servatively underfit our approximation for vROI. With a large λridge, the term ETE + λridgeI  1 will approximate a scaled identity matrix, and Eq. 7 becomes ^vROI ≈ETy ð8Þ which is equal to up-sampling and interpolation of the pixel outputs y. We can reinforce our analysis with a simple example in Supple- mentary Fig. 8. Here, the time series of 4 pixels, v1 … v4, contains uncorrelated signal, with vROI representing the average of these sig- nals. We mimic the exposure and phase-shifted sampling of these pixels to get y1 … y4. We do this by convolving phase-shifted version of v1 … v4 with a box function of length 4, followed by 4 x down-sam- pling. We can see that down-sampling aliases the high-frequency part of the signal of y2, especially at the peak of the spike (Supplementary Fig. 8 black arrow). We can apply our interpolation outlined in Eq. 8, which results in ^vROI. We can see that ^vROI is proportional to vROI, but underfits the spike at the location pointed by the black arrow in Supplementary Fig. 8. This is because we only sampled y2 at a single phase since y2 is uncorrelated with other pixels. This example shows that even with uncorrelated pixels, inter- polating them yields an approximation of the ROI average. As shown, the selection of large λridge in the ridge regression minimizes the overfitting of noise during interpolation. Voltage imaging in dissociated neuron cultures Neuron culture preparation and AAV transduction. All procedures involving animals were performed in accordance with National Insti- tute of Health Guide for Laboratory Animals and approved by the Massachusetts Institute of Technology Committee on Animal. Dis- sociated hippocampal neurons were prepared from postnatal day 0 or 1 Swiss Webster mice (Taconic) without regard to sex following the protocol28. Dissected hippocampal tissue was digested with 50 units of papain (Worthington Biochem) for 6–8 min, and the digestion was stopped with ovomucoid trypsin inhibitor (Worthington Biochem). Cells were plated at a density of 40,000–60,000 per glass coverslip coated with Matrigel (BD Biosciences). Neurons were seeded in 200 µl plating medium containing MEM (Life Technologies), glucose (33 mM, Sigma), transferrin (0.01%, Sigma), Hepes (10 mM, Sigma), Glutagro (2 mM, Corning), Insulin (0.13%, Millipore), B27 supplement (2%, Gibco), and heat inactivated FBS (7.5%, Corning). After cell adhesion, additional plating medium was added. AraC (0.002 mM, Sigma) was added when glia density was 50–70% of confluence. Neurons were grown at 37 °C and 5% CO2 in a humidified atmosphere. We transduce cultured neurons at 5–7 days in vitro (DIV) by administering ~ 1010 viral particles of AAV9-hSyn-ASAP3 (Janelia Viral Tools) per well (of 24-well plate). Voltage imaging was performed 7–14 days after transduction. Microscope setup (without patch clamp). Cultured hippocampal neurons expressing ASAP3 were imaged on a customized upright fluorescent microscope with a 20 × 1.0NA objective lens (Olympus). The light from a 470 nm LED (Thorlabs) was cleaned with a 469/35 nm band pass filter (Semrock) for excitation. A 488 nm long pass dichroic mirror and a 496 nm long pass filter were used for illumination and emission. Using a 50/50 beam splitter (Thorlabs), the sample image was evenly split onto both the Hamamatsu sCMOS camera and our PE- CMOS sensor for side-by-side comparison. Whole cell patch clamp and imaging. Intracelluar recordings were acquired using the multiclamp 700B amplifier and pCLAMP 10.0 soft- ware (Molecular Devices), filtered at 2 kHz and digitized at 10 kHz. Cultured neurons were patched with pipettes filled with a potassium gluconate-based intracellular solution containing the following (in mm): 135 mM K-gluconate, 0.1 mM CaCl2, 0.6 mM MgCl2, 1 mM EGTA, 10 mM HEPES, 4 mM Mg-ATP, 0.4 mM Na-GTP, and 4 mM NaCl, with dropwise addition of 5 M KOH to adjust the pH to 7.2 and addition of potassium gluconate in increments of 25 mg until the final osmolarity reached 290–295 mosmol/kg H2O. The open pipette resistance in these experiments was 3–6 mΩ. The current step protocol consisted of 200-ms-long constant level current steps from + 600 pA–0 pA with gradually decreasing 40 pA steps. During patch clamp, the ASAP3 expressing neuron are simultaneously imaged through a 40 x / 0.6 NA objective lens. Using a 50/50 beam splitter (Thorlabs), the sample image was evenly split onto both the Hamamatsu sCMOS camera and our PE-CMOS sensor for side-by-side comparison. ROI time series extraction. We hand selected the ROI using the max projection image of the PE-CMOS and sCMOS videos. Due to differ- ences in pixel size (PE-CMOS: 10 µm pixel pitch, sCMOS: 6.5 µm), sCMOS ROI contains ~2.3 x more pixels than that of the PE-CMOS ROI. PE-CMOS pixels are arranged in the tile configuration (Supplemen- tary Fig. 2). For the sCMOS, we computed the ROI time series by averaging all the pixels values. We then filtered the ROI time-series using a band- Article https://doi.org/10.1038/s41467-024-48765-5 Nature Communications| (2024) 15:4480 10 pass filter to remove photo-bleaching effects and high-frequency content too close to the sampling Nyquist frequency (Filter para- meters: 4th-order IIR, with high-pass cut-off at 0.5 Hz and low-pass cut- off at 360 Hz, 90% of the Nyquist bandwidth, 400 Hz, half of pixel sampling speed). For visualization purpose, we invert the time series as ASAP3 GEVI has negative going action potential waveforms. For the PE-CMOS, we first computed sub-ROI time series for pixels with the same TE and Δ. We then filtered each sub-ROI time series using a band-pass filter to remove photo-bleaching effects and high- frequency content too close to the sampling Nyquist frequency. The filter parameters used in Fig. 2, 3 are: 4th-order IIR, with high-pass cut- off at 0.5 Hz and low-pass cut-off at 90 Hz, 90% of the pixel Nyquist bandwidth 100 Hz. The same filter is used in Fig. 4, but with low-pass cut-off changed to 234 Hz, 117 Hz, 58 Hz, and 29 Hz, corresponding to different pixel Nyquist bandwidth 260, 130, 65 and 33 Hz. The ROI time series representing the ROI average are interpolated from sub-ROI time-series using method described earlier. No additional filters are used for the PE-CMOS ROI time-series. To compare the sCMOS output to that of the PE-CMOS atdifferent Δ in Fig. 2, which compose of ~1/4 pixels of the ROI, we computed four sCMOS sub-ROI time series each using only 1/4 ROI pixels extracted through spatial downsampling. The average of these 4 sub-ROI time series is equal to the ROI time series. Noise estimation. To estimate the noise of the times series, we find a section of the signal with at least 2 seconds in duration that does not contain any spikes. We then high-pass filter this trace to remove slow subthreshold oscillations (Filter parameters: 4th-order IIR, fcutoff = 50 Hz). The root-mean squared (rms) noise is then calculated as the standard deviation of the filtered time-series. This value is referred to as 1 SNR in the figures and text. Putative spike detection. ROI times-series are first high-pass filtered to remove high amplitude oscillations at low frequency (Filter para- meters: 4th IIR filter, fcutoff = 2 Hz). From the filtered PE-CMOS time series, we detected events with SNR > 5 and record their SNR and time of occurrence. We then record the highest SNR in the sCMOS times series within the corresponding time window. We set a 30 ms window centering at the peak time of PE-CMOS to avoid mismatching the peak SNR between PE-CMOS and sCMOS time series. General imaging applications using PE-CMOS We demonstrated two general imaging examples that benefits from using the PE-CMOS. In the first example, the PE-CMOS pixels are con- figured to have fixed exposure with TE = 40 ms and Δ = 0, 10, 20, 30 ms (Supplementary Fig. 6a) This corresponds to pixel sampling speed of 25 Hz. We imaged the motion of bouncing ball with static background (Supplementary Fig. 6b). Staggered exposure embeds the motion within full resolution frames (Supplementary Fig. 6b). We split each frame into four subframe organized according to pixel phase, which yields a 100 Hz equivalent video at 1/4 spatial resolution. From the high-speed video, we can track the motion of the bouncing ball with temporal precision of 10 ms (Supplementary Fig. 6d), which is not possible using a conventional camera where pixels are uniformly sampled at 25 Hz. Reporting summary Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article. Data availability The raw data generated in this study have been deposited in the Zenodo database under accession code https://zenodo.org/records/ 10826791. The PE-CMOS image sensor prototypes are available upon request. We will provide all the information required to replicate the design. However, the design documents use proprietary circuit models and files from the commercial foundry that are protected under the NDA. We can share the design with the interested party after they have secured the same NDA with XFAB. To interface with the chip, we used open-source hardware, firmware and software API from the Open- Ephys ONIX16 project and Bonsai16. Code availability The script for generating the figures have been deposited in the public repository: https://github.com/jz0229/PE-CMOS. References 1. Kim, T. H. & Schnitzer, M. J. Fluorescence imaging of large-scale neural ensemble dynamics. Cell 185, 9–41 (2022). 2. Abdelfattah, A. S. et al. Bright and photostable chemigenetic indi- cators for extended in vivo voltage imaging. Science (1979) https://doi.org/10.1126/science.aav6416 (2019). 3. Villette, V. et al. Ultrafast two-photon imaging of a high-gain voltage indicator in awake behaving mice. Cell 179, 1590–1608.e23 (2019). 4. Piatkevich, K. D. et al. A robotic multidimensional directed evolution approach applied to fluorescent voltage reporters article. Nat. Chem. Biol. https://doi.org/10.1038/s41589-018-0004-9 (2018). 5. Kannan, M. et al. Dual-polarity voltage imaging of the concurrent dynamics of multiple neuron types. Science (1979) 378, eabm8797 (2022). 6. Fan, L. Z. et al. All-optical physiology resolves a synaptic basis for behavioral timescale plasticity. Cell 186, 543–559.e19 (2023). 7. Kim, S. et al. Optical segmentation-based compressed readout of neuronal voltage dynamics. Preprint at bioRxiv https://doi.org/10. 1101/2023.11.10.566599 (2023). 8. Bowman, A. J., Huang, C., Schnitzer, M. J. & Kasevich, M. A. Wide- field fluorescence lifetime imaging of neuron spiking and sub- threshold activity in vivo. Science (1979) 380, 1270–1275 (2023). 9. Eom, M. et al. Statistically unbiased prediction enables accurate denoising of voltage imaging data. Nat. Methods https://doi.org/10. 1038/s41592-023-02005-8 (2023). 10. Platisa, J. et al. High-speed low-light in vivo two-photon voltage imaging of large neuronal populations. Nat. Methods 20, 1095–1103 (2023). 11. Zhang, J., Xiong, T., Tran, T., Chin, S. & Etienne-Cummings, R. Compact all-CMOS spatiotemporal compressive sensing video camera with pixel-wise coded exposure. Opt. Express 24, 9013 (2016). 12. Sarhangnejad, N. et al. Dual-tap pipelined-code-memory coded- exposure-pixel CMOS image sensor for multi-exposure single- frame computational imaging. Dig. Tech. Pap. IEEE Int Solid State Circuits Conf. 2019-Febru, 102–104 (2019). 13. Luo, Y. & Mirabbasi, S. A 30-fps 192 × 192 CMOS image sensor with per-frame spatial-temporal coded exposure for compressive focal- stack depth sensing. IEEE J. Solid-State Circuits 57, 1661–1672 (2022). 14. Fossum, E. & Hondongwa, D. B. A review of the pinned photodiode for CCD and CMOS image sensors. IEEE J. Electron Devices Soc. 2, 33–43 (2014). 15. Hitomi, Y., Gu, J., Gupta, M., Mitsunaga, T. & Nayar, S. K. Video from a single coded exposure photograph using a learned over-complete dictionary. In Proc. 2011 International Conference on Computer Vision 287–294 (IEEE, 2011). 16. Newman, J. P. et al. A unified open-source platform for multimodal neural recording and perturbation during naturalistic behavior. Preprint at bioRxiv https://doi.org/10.1101/2023.08.30.554672 (2023). Article https://doi.org/10.1038/s41467-024-48765-5 Nature Communications| (2024) 15:4480 11 17. Lopes, G. et al. Bonsai: An event-based framework for processing and controlling data streams. Front Neuroinform. https://doi.org/ 10.3389/fninf.2015.00007 (2015). 18. Yang, R., Weber, T. D., Witkowski, E. D., Davison, I. G. & Mertz, J. Neuronal imaging with ultrahigh dynamic range multiphoton microscopy. Sci. Rep. 7, 5817 (2017). 19. Zhang, J. et al. A closed-loop, all-electronic pixel-wise adaptive imaging system for high dynamic range videography. IEEE Trans. Circuits Syst. I: Regul. Pap. 67, 1803–1814 (2020). 20. Nevian, T., Larkum, M. E., Polsky, A. & Schiller, J. Properties of basal dendrites of layer 5 pyramidal neurons: A direct patch-clamp recording study. Nat. Neurosci. 10, 206–214 (2007). 21. Nguyen, C. et al. Simultaneous voltage and calcium imaging and optogenetic stimulation with high sensitivity and a wide field of view. Biomed. Opt. Express 10, 789–806 (2019). 22. Ghosh, K. K. et al. Miniaturized integration of a fluorescence microscope. Nat. Methods 8, 871–878 (2011). 23. Juneau, J. et al. MiniFAST: a sensitive and fast miniaturized micro- scope for in vivo neural recording. Preprint at bioRxiv https://doi. org/10.1101/2020.11.03.367466 (2020). 24. Guo, C. et al. Miniscope-LFOV: a large field of view, single cell resolution, miniature microscope for wired and wire-free imaging of neural dynamics in freely behaving animals. Sci. Adv. https://doi. org/10.1101/2021.11.21.469394 (2023). 25. Scherrer, J. R., Lynch, G. F., Zhang, J. J. & Fee, M. S. An optical design enabling lightweight and large field-of-view head-mounted microscopes. Nat. Methods https://doi.org/10.1038/s41592-023- 01806-1 (2023). 26. Lee, A. K. & Wilson, M. A. Memory of sequential experience in the hippocampus during slow wave sleep. Neuron 36, 1183–1194 (2002). 27. Newman, J. P. et al. Optogenetic feedback control of neural activity. Elife 4, e07192 (2015). 28. Klapoetke, N. C. et al. Independent optical excitation of distinct neural populations. Nat. Methods 11, 338–346 (2014). Acknowledgements We thank S. Chin and G. Brown for discussion and development of additional sparse devolution algorithms. We thank J. Liu, G.F. Lynch, and A. Khalifa for comments on the manuscript. The chip fabrication was funded by support by the Louis B. Thalheimer Fund for Transla- tional Research, and the NIH (R21 EY028381-01). JZ, ZC and MAW acknowledge additional funding through the NIH (MH118928). ZW acknowledges the Alana Foundation. ESB acknowledges HHMI, Lisa Yang, John Doerr, NIH 1R01MH123977, NIH R01DA029639, NIH R01MH122971, NIH RF1NS113287. Author contributions J.Z., J.P.N., M.A.W. conceptualize the ideas. J.Z., J.P.N. and C.L. con- ducted proof of concept testing. J.Z. designed the image sensor with input from E.F. and R.E.C. J.Z. and JPN implemented the acquisition hardware and firmware to steam the imaging data. J.Z., J.P.N., Z.W., and Y.Q. conducted the in vitro experiments using cultured neurons. P.F.R. conducted the patch clamp recording experiment with help from T.H. J.Z., W.G. and Z. C. processed the imaging data. All authors contributed to the manuscript. J.Z. wrote the manuscript with input from all authors. M.A.W. and E.S.B. supervised the project. Competing interests The authors declare no competing interests. Additional information Supplementary information The online version contains supplementary material available at https://doi.org/10.1038/s41467-024-48765-5. Correspondence and requests for materials should be addressed to Jie Zhang. Peer review information Nature Communications thanks the anon- ymous, reviewer(s) for their contribution to the peer review of this work. A peer review file is available. Reprints and permissions information is available at http://www.nature.com/reprints Publisher’s note Springer Nature remains neutral with regard to jur- isdictional claims in published maps and institutional affiliations. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. © The Author(s) 2024 Article https://doi.org/10.1038/s41467-024-48765-5 Nature Communications| (2024) 15:4480 12

Title: Pixel-wise programmability enables dynamic high-SNR cameras for high-speed microscopy Authors: JJie Zhang1,2 , Jonathan Newman1,2, ZeguanWang2,3, Yong Qian2,3,Pedro Feliciano Ramos1,2, WeiGuo1,2, Takato Honda 1,2, Zhe Sage Chen 4,Changyang Linghu 5, Ralph Etienne-Cummings6, Eric Fossum7,Edward Boyden 2,3 & Matthew Wilson 1,2 Publisher: Nature Communications Date: 27 May 2024 ​ Abstract: High-speed wide-field fluorescence microscopy has the potential to capturebiological processes with exceptional spatiotemporal resolution. However,conventional cameras suffer from low signal-to-noise ratio at high frame rates,limiting their ability to detect faint fluorescent events. Here, we introduce animage sensor where each pixel has individually programmable sampling speedand phase, so that pixels can be arranged to simultaneously sample at highspeed with a high signal-to-noise ratio. In high-speed voltage imaging experiments,our image sensor significantly increases the output signal-to-noise ratiocompared to a low-noise scientific CMOS camera (~2–3 folds). This signal-tonoiseratio gain enables the detection of weak neuronal action potentials andsubthreshold activities missed by the standard scientific CMOS cameras. Our camera with flexible pixel exposure configurations offers versatile sampling strategies to improve signal quality in various experimental conditions​

Harness High‐Temperature Thermal Energy via Elastic Thermoelectric Aerogels.pdf

Vol.:(0123456789) 1 3 e-ISSN 2150-5551 CN 31-2103/TB ARTICLE Cite as Nano-Micro Lett. (2024) 16:151 Received: 5 December 2023 Accepted: 24 January 2024 © The Author(s) 2024 https://doi.org/10.1007/s40820-024-01370-z Harness High‑Temperature Thermal Energy via Elastic Thermoelectric Aerogels Hongxiong Li1, Zhaofu Ding1, Quan Zhou1, Jun Chen2, Zhuoxin Liu1, Chunyu Du1, Lirong Liang1 *, Guangming Chen1 * HIGHLIGHTS • A thermoelectric aerogel of highly elastic, flame-retardant and high-temperature-resistant PEDOT:PSS/SWCNT composite is fabricated. • The assembled thermoelectric generator generates a maximum output power of 400 μW at a temperature difference of 300 K. • The self-powered wearable sensing glove can achieve wide-range temperature detection, complex hand motion recognition and high- temperature warning. • The intelligent fire warning system enables highly sensitive and repeatable monitoring and alarm capabilities for high-temperature fire sources. ABSTRACT  Despite notable progress in thermoelectric (TE) materials and devices, developing TE aerogels with high-temperature resistance, superior TE performance and excellent elasticity to enable self-powered high-temperature monitoring/warning in industrial and wearable applications remains a great challenge. Herein, a highly elastic, flame-retardant and high-temperature-resistant TE aerogel, made of poly(3,4-ethylene dioxythiophene):poly(styrenesulfonate)/single-walled carbon nanotube (PEDOT:PSS/ SWCNT) composites, has been fabricated, displaying attractive compression-induced power factor enhancement. The as-fabricated sensors with the aerogel can achieve accu- rately pressure stimuli detection and wide temperature range monitoring. Subsequently, a flexible TE generator is assembled, consisting of 25 aerogels connected in series, capable of delivering a maximum output power of 400 μW when subjected to a temperature dif- ference of 300 K. This demonstrates its outstanding high-temperature heat harvesting capability and promising application prospects for real-time temperature monitoring on industrial high-temperature pipelines. Moreover, the designed self-powered wearable sensing glove can realize precise wide-range temperature detection, high-temperature warning and accurate recognition of human hand gestures. The aerogel-based intelligent wear- able sensing system developed for firefighters demonstrates the desired self-powered and highly sensitive high-temperature fire warning capability. Benefitting from these desirable properties, the elastic and high-temperature-resistant aerogels present various promising applications including self-powered high-temperature monitoring, industrial overheat warning, waste heat energy recycling and even wearable healthcare. KEYWORDS  Thermoelectrics; Aerogel; Self-powered; High-temperature monitoring; High-temperature warning Hongxiong Li and Zhaofu Ding have contributed equally to this work. * Lirong Liang, [email protected]; Guangming Chen, [email protected] 1 College of Materials Science and Engineering, Shenzhen University, Shenzhen 518055, People’s Republic of China 2 Department of Bioengineering, University of California, Los Angeles, CA 90095, USA Nano-Micro Lett. (2024) 16:151 151   Page 2 of 15 https://doi.org/10.1007/s40820-024-01370-z © The authors 1  Introduction The advent of the Internet of Things (IoT) for industrial management has spurred the demand for intelligent sensors that could be harnessed for high-temperature monitoring/ warning to preemptively mitigate potential safety risks and equipment failures. High-temperature environments can pose potential safety risks and equipment failures, making early detection and appropriate action crucial for preventing accidents and ensuring the safety of personnel and equip- ment. However, traditional high-temperature monitoring and warning systems face challenges such as unstable energy supply, complex wiring requirements and maintenance dif- ficulties [1, 2]. A ray of hope emerges through the utiliza- tion of high-temperature thermoelectric (TE) materials that possess the remarkable ability to directly convert thermal energy into electrical energy [3, 4]. This breakthrough holds the promise of surmounting these challenges. Moreover, with the rapid advancement of IoT technology, integrating high-temperature monitoring/warning systems based on durable TE materials with IoT enables real-time data acqui- sition, data transmission, remote monitoring and warning functions, providing a novel solution for safety management in high-temperature environments. Given the unique structural advantages (such as three- dimensional porous network structure, light weight and large specific surface area) and the impressive low thermal conductivity of organic aerogels, aerogel-based TE materi- als are attracting more and more attentions [5–8]. Their TE performance mainly depends on a dimensionless figure of merit, ZT = S2σT/κ, where S, σ, κ, T and S2σ are the Seebeck coefficient, electrical conductivity, thermal conductivity, absolute temperature and power factor (PF = S2σ), respec- tively [9, 10]. Various TE aerogels have been prepared using a wide range of materials, including polymers such as poly(3,4-ethylenedioxythiophene):poly(styrenesulfon ate) (PEDOT:PSS), polyaniline (PANI) [11, 12] and some insulating polymers (cellulose or polyurethane), carbon- based materials like graphene and carbon nanotubes [8, 13, 14], as well as their composite and hybrid counterparts [15–18]. Among them, polymer/carbon nanotube composite TE aerogels possess high electrical conductivity, excellent structural and mechanical properties, providing great poten- tial in mechanically deformable TE materials and devices. For instance, a low κ of 0.055 W ­m−1 ­K−1 and highly elastic single-walled carbon nanotube/polyurethane (SWCNT/ PU) TE sponge was obtained by a convenient dipping–dry- ing process, which led to a PF value of 3.87 nW ­m−1 ­K−2 at room temperature [19]. Moreover, their TE properties revealed a unique pressure-driven response, generating an enhanced PF of 11.01 nW ­m−1 ­K−2 at compression strain of 80%. Yao et al. [12] successfully obtained elastic PANI/ graphene composite aerogels with an ultrahigh PF value of 20.3 μW ­m−1 ­K−2 (at 127 °C) by in-situ oxidative polym- erization of aniline on three-dimensional graphene. Despite the reported advancements in various TE aerogel materials, the development of high-temperature-resistant TE aerogels and their performance for broader applications in the future remain highly challenging. Leveraging the compressibility, conductivity, Seebeck effect and exceptional heat-to-electricity conversion capa- bility of TE aerogels, they find versatile applications as piezoresistive pressure/strain sensors, temperature sensors or TE generators [7, 20–24]. For the realization of these functional applications, temperature is a critical param- eter that not only affects the TE properties of the aerogel itself but also determines its performance and practical application as a sensor or generator. Cho et al. [19] devel- oped an elastic SWCNT/PU sponged-based TE generator with 8 p-n couples, generating a large output power of 2.09 μW at a temperature difference (ΔT) of 55 K under compressive strain of 80%. Based on the TE mechanism of polydimethylsiloxane-supported PANI/CNT composite aerogel (17.1 μV ­K−1), it can achieve temperature sensing within a ΔT of 100 K [21]. Considering the human body as a constant temperature heat source and the demand for self-powered wearable electronic devices, some progress has been made in aerogel-based self-powered wearable temperature sensors, pressure sensors and TE generators [23–26]. For instance, Zhang et al. [26] realized a self- powered wearable temperature–pressure dual-parameter sensors using microstructure PU-supported PEDOT:PSS. However, the reported usage or testing temperatures of organic aerogel-based temperature sensors or TE gen- erators are mostly below 150 °C, and studies to further develop excellent high-temperature-resistant TE aerogels and explore their applications in high-temperature sce- narios are still needed to promote practical applications. Therefore, the development of TE aerogels with a wide temperature range application is not only capable of col- lecting human body heat or high-temperature heat energy, Nano-Micro Lett. (2024) 16:151 Page 13 of 15  151 1 3 is composed of energy collection (TE aerogels), amplifier, ADC (Analog-to-Digital Converter), buzzer and Bluetooth module (Fig. S16). To confirm the usability of the designed system in a fire scenario, we test this system with open flames indoors. As shown in Video S4, when no flames are in proximity, everything remains calm and undisturbed. However, once a flame is detected and reaches the default threshold, the alarm system is immediately triggered, acti- vating an alert to remind firefighters to stay away from the fire source or evacuate safely. Simultaneously, a Bluetooth module will transmit the information in real-time to a smart- phone or computer, allowing other firefighters to monitor the personal safety of the current firefighter and provide timely support. As shown in Fig. 6d, the self-powered fire warning system, designed to intermittently expose the alcohol lamp flame at 30 s cycle periods, consistently generates an aver- age output voltage of 2.48 mV with a small standard devia- tion of 2.2%. This indicates the reliable repeatability of the aerogel-based fire warning system. Therefore, the developed intelligent wearable sensing system, based on high-tempera- ture-resistant TE aerogel, exhibits the desired capabilities of self-powering and ultrasensitive high-temperature warning, making it well-suited for firefighters. The highly elastic and high-temperature-resistant PEDOT:PSS/SWCNT composite aerogels proposed in this work exhibit great potential in the fields of strain sensor, wide-range temperature heat harvest- ing, as well as self-powered high-temperature monitoring/ warning in wearable electronics. 4  Conclusion In summary, ultralight weight, elastic, flame retardancy and high-temperature-resistant PEDOT:PSS/SWCNT composite TE aerogels are fabricated via a convenient solvent displace- ment, solution mixing and subsequent freeze-drying pro- cess, exhibiting a large Seebeck coefficient of 38.9 μV ­K−1 and a relatively low thermal conductivity of 0.074 W ­m−1 ­K−1. The aerogels reveal a remarkable enhancement in both electrical and thermal conductivities as the com- pressive strain increases, while the Seebeck coefficient can be well maintained, leading to a greatly enhanced power factor of 0.58 μW ­m−1 ­K−2 at the strain of 80%. Benefit- ing from the high elasticity, excellent TE performance and high-temperature resistance of the aerogels, the fabricated aerogel-based sensors demonstrate the capability to accu- rately detect pressure stimuli and achieve wide-range tem- perature monitoring. A flexible TE generator is subsequently fabricated by connecting 25 aerogels in series, generating a maximum output power of 400 μW at a high-temperature difference of 300 K. Notably, the testing or application tem- peratures of our fabricated TE aerogel and its TE generator are significantly higher than that of mostly reported aero- gels and their generators. Moreover, the reported ultralight high-temperature-resistant TE aerogel can also serve as a self-powered wearable sensing glove for wide-range tem- perature detection and complex hand gestures recognition. The designed self-powered intelligent fire warning system, incorporated into firefighting cloths, enables highly sensitive and repeatable monitoring and alarm capabilities for high- temperature fire sources. With all these desirable properties, the elastic, flame retardancy and high-temperature-resistant aerogel holds promising applications in wide-range tempera- ture heat harvesting, high-temperature monitoring/warning, and self-powered wearable electronics. Acknowledgements  This work was financially supported by the Guangdong Basic and Applied Basic Research Foundation (2022A1515110296, 2022A1515110432), the Shenzhen Science and Technology Program (20231120171032001) and the National Natural Science Foundation of China (No. 52242305). The authors also thank the Instrumental Analysis Center of Shenzhen Univer- sity (Lihu Campus) for their assistance of SEM observations. Declarations  Conflict of interest  The authors declare no interest conflict. They have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Guangming Chen is an editorial board member for Nano-Micro Letters and was not involved in the editorial review or the decision to publish this article. All authors declare that there are no competing interests. Open Access  This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Com- mons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Com- mons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain Nano-Micro Lett. (2024) 16:151 151   Page 14 of 15 https://doi.org/10.1007/s40820-024-01370-z © The authors permission directly from the copyright holder. To view a copy of this licence, visit http://​creat​iveco​mmons.​org/​licen​ses/​by/4.​0/. Supplementary Information  The online version contains supplementary material available at https://​doi.​org/​10.​1007/​ s40820-​024-​01370-z. References 1. L.-Y. Lv, C.-F. Cao, Y.-X. Qu, G.-D. Zhang, L. Zhao et al., Smart fire-warning materials and sensors: design principle, performances, and applications. Mater. Sci. Eng. R. Rep. 150, 100690 (2022). https://​doi.​org/​10.​1016/j.​mser.​2022.​100690 2. Y. Fang, G. Chen, M. Bick, J. Chen, Smart textiles for per- sonalized thermoregulation. Chem. Soc. Rev. 50, 9357–9374 (2021). https://​doi.​org/​10.​1039/​d1cs0​0003a 3. H. He, Y. Qin, Z. Zhu, Q. Jiang, S. Ouyang et al., Temper- ature-arousing self-powered fire warning E-textile based on p-n segment coaxial aerogel fibers for active fire protection in firefighting clothing. Nano-Micro Lett. 15, 226 (2023). https://​ doi.​org/​10.​1007/​s40820-​023-​01200-8 4. Z. Ding, C. Du, W. Long, C.-F. Cao, L. Liang et al., Thermo- electrics and thermocells for fire warning applications. Sci. Bull. 68, 3261–3277 (2023). https://​doi.​org/​10.​1016/j.​scib.​ 2023.​08.​057 5. X. Wang, P. Liu, Q. Jiang, W. Zhou, J. Xu et al., Efficient DMSO-vapor annealing for enhancing thermoelectric perfor- mance of PEDOT:PSS-based aerogel. ACS Appl. Mater. Inter- faces 11, 2408–2417 (2019). https://​doi.​org/​10.​1021/​acsami.​ 8b191​68 6. N. Okada, K. Sato, M. Yokoo, E. Kodama, S. Kanehashi et al., Thermoelectric properties of poly(3-hexylthiophene) nanofiber aerogels with a giant seebeck coefficient. ACS Appl. Polym. Mater. 3, 455–463 (2021). https://​doi.​org/​10.​ 1021/​acsapm.​0c011​85 7. S. Han, N.U.H. Alvi, L. Granlöf, H. Granberg, M. Berggren et al., A multiparameter pressure-temperature-humidity sensor based on mixed ionic-electronic cellulose aerogels. Adv. Sci. 6, 1802128 (2019). https://​doi.​org/​10.​1002/​advs.​20180​2128 8. L. Liang, X. Wang, Z. Liu, G. Sun, G. Chen, Recent advances in organic, inorganic, and hybrid thermoelectric aerogels. Chin. Phys. B 31, 027903 (2022). https://​doi.​org/​10.​1088/​ 1674-​1056/​ac2802 9. Z. Fan, Y. Zhang, L. Pan, J. Ouyang, Q. Zhang, Recent devel- opments in flexible thermoelectrics: from materials to devices. Renewable Sustainable Energy Rev. 137, 110448 (2021). https://​doi.​org/​10.​1016/j.​rser.​2020.​110448 10. Q. Zhu, S. Wang, X. Wang, A. Suwardi, M.H. Chua et al., Bottom-up engineering strategies for high-performance ther- moelectric materials. Nano-Micro Lett. 13, 119 (2021). https://​ doi.​org/​10.​1007/​s40820-​021-​00637-z 11. N. Yanagishima, S. Kanehashi, H. Saito, K. Ogino, T. Shi- momura, Thermoelectric properties of PEDOT:PSS aerogel secondary-doped in supercritical ­CO2 atmosphere with low thermal conductivity. Polymer 206, 122912 (2020). https://​ doi.​org/​10.​1016/j.​polym​er.​2020.​122912 12. L. Wang, H. Bi, Q. Yao, D. Ren, S. Qu et al., Three-dimen- sional tubular graphene/polyaniline composites as high-per- formance elastic thermoelectrics. Compos. Sci. Technol. 150, 135–140 (2017). https://​doi.​org/​10.​1016/j.​comps​citech.​2017.​ 07.​001 13. C. Yu, H. Kim, J.R. Youn, Y.S. Song, Enhancement of struc- tural stability of graphene aerogel for thermal energy harvest- ing. ACS Appl. Energy Mater. 4, 11666–11674 (2021). https://​ doi.​org/​10.​1021/​acsaem.​1c023​90 14. C. Yu, Y.S. Song, Analysis of thermoelectric energy harvest- ing with graphene aerogel-supported form-stable phase change materials. Nanomaterials 11, 2192 (2021). https://​doi.​org/​10.​ 3390/​nano1​10921​92 15. X. Qi, T. Miao, C. Chi, G. Zhang, C. Zhang et al., Ultralight PEDOT:PSS/graphene oxide composite aerogel sponges for electric power harvesting from thermal fluctuations and moist environment. Nano Energy 77, 105096 (2020). https://​doi.​org/​ 10.​1016/j.​nanoen.​2020.​105096 16. F. Jia, R. Wu, C. Liu, J. Lan, Y.-H. Lin et al., High thermo- electric and flexible PEDOT/SWCNT/BC nanoporous films derived from aerogels. ACS Sustainable Chem. Eng. 7(14), 12591–12600 (2019). https://​doi.​org/​10.​1021/​acssu​schem​eng.​ 9b025​18 17. X. Sun, Y. Wei, J. Li, J. Zhao, L. Zhao et al., Ultralight con- ducting PEDOT:PSS/carbon nanotube aerogels doped with silver for thermoelectric materials. Sci. China Mater. 60, 159–166 (2017). https://​doi.​org/​10.​1007/​s40843-​016-​5132-8 18. H. He, J. Liu, Y. Wang, Y. Zhao, Y. Qin et al., An ultralight self-powered fire alarm e-textile based on conductive aerogel fiber with repeatable temperature monitoring performance used in firefighting clothing. ACS Nano 16, 2953–2967 (2022). https://​doi.​org/​10.​1021/​acsna​no.​1c101​44 19. J. Kim, E.J. Bae, Y.H. Kang, C. Lee, S.Y. Cho, Elastic ther- moelectric sponge for pressure-induced enhancement of power generation. Nano Energy 74, 104824 (2020). https://​doi.​org/​ 10.​1016/j.​nanoen.​2020.​104824 20. X.-Z. Gao, F.-L. Gao, J. Liu, Y. Li, P. Wan et al., Self-powered resilient porous sensors with thermoelectric poly(3,4-ethyle nedioxythiophene):poly(styrenesulfonate) and carbon nano- tubes for sensitive temperature and pressure dual-mode sens- ing. ACS Appl. Mater. Interfaces 14, 43783–43791 (2022). https://​doi.​org/​10.​1021/​acsami.​2c128​92 21. Y. Wang, H. Mao, Y. Wang, P. Zhu, C. Liu et al., 3D geometri- cally structured PANI/CNT-decorated polydimethylsiloxane active pressure and temperature dual-parameter sensors for man–machine interaction applications. J. Mater. Chem. A 8, 15167–15176 (2020). https://​doi.​org/​10.​1039/​D0TA0​5651K 22. X. He, Y. Hao, M. He, X. Qin, L. Wang et al., Stretchable thermoelectric-based self-powered dual-parameter sensors with decoupled temperature and strain sensing. ACS Appl. Mater. Interfaces 13, 60498–60507 (2021). https://​doi.​org/​10.​ 1021/​acsami.​1c204​56 Nano-Micro Lett. (2024) 16:151 Page 15 of 15  151 1 3 23. F.-L. Gao, P. Min, X.-Z. Gao, C. Li, T. Zhang et al., Integrated temperature and pressure dual-mode sensors based on elastic PDMS foams decorated with thermoelectric PEDOT:PSS and carbon nanotubes for human energy harvesting and electronic- skin. J. Mater. Chem. A 10, 18256–18266 (2022). https://​doi.​ org/​10.​1039/​D2TA0​4862K 24. D. Zhang, Y. Mao, P. Bai, Q. Li, W. He et al., Multifunc- tional superelastic graphene-based thermoelectric sponges for wearable and thermal management devices. Nano Lett. 22, 3417–3424 (2022). https://​doi.​org/​10.​1021/​acs.​nanol​ett.​2c006​ 96 25. X. Wang, L. Liang, H. Lv, Y. Zhang, G. Chen, Elastic aerogel thermoelectric generator with vertical temperature-difference architecture and compression-induced power enhancement. Nano Energy 90, 106577 (2021). https://​doi.​org/​10.​1016/j.​ nanoen.​2021.​106577 26. F. Zhang, Y. Zang, D. Huang, C.-A. Di, D. Zhu, Flexible and self-powered temperature-pressure dual-parameter sensors using microstructure-frame-supported organic thermoelectric materials. Nat. Commun. 6, 8356 (2015). https://​doi.​org/​10.​ 1038/​ncomm​s9356 27. W. Deng, L. Deng, Z. Li, Y. Zhang, G. Chen, Synergisti- cally boosting thermoelectric performance of PEDOT:PSS/ SWCNT composites via the ion-exchange effect and promot- ing SWCNT dispersion by the ionic liquid. ACS Appl. Mater. Interfaces 13, 12131–12140 (2021). https://​doi.​org/​10.​1021/​ acsami.​1c010​59 28. L. Wang, J. Zhang, Y. Guo, X. Chen, X. Jin et al., Fabrication of core-shell structured poly(3,4-ethylenedioxythiophene)/car- bon nanotube hybrids with enhanced thermoelectric power factors. Carbon 148, 290–296 (2019). https://​doi.​org/​10.​ 1016/j.​carbon.​2019.​03.​088 29. S. Han, P. Wang, Y. Zhou, Q. Meng, M. Aakyiir et al., Flex- ible, mechanically robust, multifunctional and sustainable cellulose/graphene nanocomposite films for wearable human- motion monitoring. Compos. Sci. Technol. 230, 109451 (2022). https://​doi.​org/​10.​1016/j.​comps​citech.​2022.​109451 30. X. Zhao, W. Wang, Z. Wang, J. Wang, T. Huang et al., Flexible PEDOT:PSS/polyimide aerogels with linearly responsive and stable properties for piezoresistive sensor applications. Chem. Eng. J. 395, 125115 (2020). https://​doi.​org/​10.​1016/j.​cej.​2020.​ 125115 31. X. Zhao, Z. Chen, H. Zhuo, Y. Hu, G. Shi et al., Thermoelec- tric generator based on anisotropic wood aerogel for low-grade heat energy harvesting. J. Mater. Sci. Technol. 120, 150–158 (2022). https://​doi.​org/​10.​1016/j.​jmst.​2021.​12.​039 32. H. Li, Y. Zong, J. He, Q. Ding, Y. Jiang et al., Wood-inspired high strength and lightweight aerogel based on carbon nano- tube and nanocellulose fiber for heat collection. Carbohydr. Polym. 280, 119036 (2022). https://​doi.​org/​10.​1016/j.​carbp​ol.​ 2021.​119036 33. U. Ail, Z.U. Khan, H. Granberg, F. Berthold, R. Parasuraman et al., Room temperature synthesis of transition metal sili- cide-conducting polymer micro-composites for thermoelectric applications. Synth. Met. 225, 55–63 (2017). https://​doi.​org/​ 10.​1016/j.​synth​met.​2017.​01.​007 34. Y. Wang, H. Wu, L. Xu, H. Zhang, Y. Yang et al., Hierarchi- cally patterned self-powered sensors for multifunctional tactile sensing. Sci. Adv. 6, eabb9083 (2020). https://​doi.​org/​10.​1126/​ sciadv.​abb90​83 35. Y. Yin, Y. Wang, H. Li, J. Xu, C. Zhang et al., A flexible dual parameter sensor with hierarchical porous structure for fully decoupled pressure–temperature sensing. Chem. Eng. J. 430, 133158 (2022). https://​doi.​org/​10.​1016/j.​cej.​2021.​133158 36. C. Zhang, S. Song, Q. Li, J. Wang, Z. Liu et al., One-pot facile fabrication of covalently cross-linked carbon nanotube/PDMS composite foam as a pressure/temperature sensor with high sensitivity and stability. J. Mater. Chem. C 9, 15337–15345 (2021). https://​doi.​org/​10.​1039/​D1TC0​3523A 37. C. Jiang, J. Chen, X. Lai, H. Li, X. Zeng et al., Mechani- cally robust and multifunctional polyimide/MXene composite aerogel for smart fire protection. Chem. Eng. J. 434, 134630 (2022). https://​doi.​org/​10.​1016/j.​cej.​2022.​134630 38. H. Cheng, Y. Du, B. Wang, Z. Mao, H. Xu et al., Flexible cellulose-based thermoelectric sponge towards wearable pres- sure sensor and energy harvesting. Chem. Eng. J. 338, 1–7 (2018). https://​doi.​org/​10.​1016/j.​cej.​2017.​12.​134 39. C. Du, M. Cao, G. Li, Y. Hu, Y. Zhang et al., Toward preci- sion recognition of complex hand motions: Wearable ther- moelectrics by synergistic 2D nanostructure confinement and controlled reduction. Adv. Funct. Mater. 32, 2206083 (2022). https://​doi.​org/​10.​1002/​adfm.​20220​6083

Title: Harness High‑Temperature Thermal Energy via Elastic Thermoelectric Aerogels Authors: Hongxiong Li1, Zhaofu Ding1, Quan Zhou1, Jun Chen2, Zhuoxin Liu1, Chunyu Du1,Lirong Liang1 *, Guangming Chen1 * Publisher: Nano-Micro Letters ​ Date: 2024-01-24 00:00:00 Abstract: Despite notable progress in thermoelectric (TE) materials and devices, developing TE aerogels with high-temperature resistance, superior TE performance and excellent elasticity to enable self-powered high-temperature monitoring/warning in industrial and wearable applications remains a great challenge. Herein, a highly elastic, flame-retardant and high-temperature-resistant TE aerogel, made of poly(3,4-ethylene dioxythiophene):poly(styrenesulfonate)/single-walled carbon nanotube (PEDOT:PSS/ SWCNT) composites, has been fabricated, displaying attractive compression-induced power factor enhancement. The as-fabricated sensors with the aerogel can achieve accurately pressure stimuli detection and wide temperature range monitoring. Subsequently, a flexible TE generator is assembled, consisting of 25 aerogels connected in series, capable of delivering a maximum output power of 400 μW when subjected to a temperature difference of 300 K. This demonstrates its outstanding high-temperature heat harvesting capability and promising application prospects for real-time temperature monitoring on industrial high-temperature pipelines. Moreover, the designed self-powered wearable sensing glove can realize precise wide-range temperature detection, high-temperature warning and accurate recognition of human hand gestures. The aerogel-based intelligent wearable sensing system developed for firefighters demonstrates the desired self-powered and highly sensitive high-temperature fire warning capability. Benefitting from these desirable properties, the elastic and high-temperature-resistant aerogels present various promising applications including self-powered high-temperature monitoring, industrial overheat warning, waste heat energy recycling and even wearable healthcare.

Small-size temperature high-pressure integrated sensor via flip-chip method.pdf

Huang et al. Microsystems & Nanoengineering (2024) 10:104 Microsystems & Nanoengineering https://doi.org/10.1038/s41378-024-00723-3 www.nature.com/micronano A R T I C L E O p e n A c c e s s Small-size temperature/high-pressure integrated sensor via flip-chip method Mimi Huang1,2,3,4, Xiaoyu Wu4, Libo Zhao 1,2,3,5,6, Xiangguang Han1,2,3,5✉, Yong Xia1,2,3,5✉, Yi Gao1,2,3,4, Zeyu Cui1,2,3,5, Cheng Zhang1,2,3,4, Xiaokai Yang1,2,3,4, Zhixia Qiao1,2,3,4,7, Zhikang Li 1,2,3,5, Feng Han1,2,3,5, Ping Yang1,2,3,4,5 and Zhuangde Jiang1,2,3,4 Abstract Hydraulic technology with smaller sizes and higher reliability trends, including fault prediction and intelligent control, requires high-performance temperature and pressure-integrated sensors. Current designs rely on planar wafer- or chip-level integration, which is limited by pressure range, chip size, and low reliability. We propose a small-size temperature/high-pressure integrated sensor via the flip-chip technique. The pressure and temperature units are arranged vertically, and the sensing signals of the two units are integrated into one plane through silicon vias and gold–gold bonding, reducing the lateral size and improving the efficiency of signal transmission. The flip-chip technique ensures a reliable electrical connection. A square diaphragm with rounded corners is designed and optimised with simulation to sense high pressure based on the piezoresistive effect. The temperature sensing unit with a thin-film platinum resistor measures temperature and provides back-end high-precision compensation, which will improve the precision of the pressure unit. The integrated chip is fabricated by MEMS technology and packaged to fabricate the extremely small integrated sensor. The integrated sensor is characterised, and the pressure sensor exhibits a sensitivity and sensitivity drift of 7.97 mV/MPa and −0.19% FS in the range of 0–20 MPa and −40 to 120 °C. The linearity, hysteresis, repeatability, accuracy, basic error, and zero-time drift are 0.16% FS, 0.04% FS, 0.06% FS, 0.18% FS, ±0.23% FS and 0.04% FS, respectively. The measurement error of the temperature sensor and temperature coefficient of resistance is less than ±1 °C and 3142.997 ppm/°C, respectively. The integrated sensor has broad applicability in fault diagnosis and safety monitoring of high-end equipment such as automobile detection, industrial equipment, and oil drilling platforms. Introduction Hydraulic fluid transmission is one of the most widely utilised transmission technologies in aerospace, engi- neering, robotics, and other industries. Hydraulic systems have evolved to be lighter in weight, smaller in size, with a higher pressure range, higher power density, and more intelligent, with the need for higher reliability and safety. The detection of hydraulic system faults is critical for avoiding system failure. As a typical hydraulic system, an electro-hydrostatic actuator (EHA) is an important growth path with advantages such as small size, high hydraulic output force, and flexible control 1–4. However, owing to the lack of multi-parameter in-situ testing and the bulk and quality requirements of the testing parts, the ability to predict EHA faults is limited. The high-level integration of the EHA places additional demands on system safety. In a hydraulic system, the load size determines the operating pressure. It must operate within a specified pressure range to ensure the system operates safely and normally. Oil is utilised as the hydraulic transmission medium to achieve energy con- version. High oil temperatures cause a decrease in the fluid viscosity, leakage, accelerated ageing of parts, and other difficulties that result in various hydraulic system © The Author(s) 2024 OpenAccessThisarticleislicensedunderaCreativeCommonsAttribution4.0InternationalLicense,whichpermitsuse,sharing,adaptation,distributionandreproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Correspondence: Xiangguang Han ([email protected]) or Yong Xia ([email protected]) 1State Key Laboratory for Manufacturing Systems Engineering, International Joint Laboratory for Micro/Nano Manufacturing and Measurement Technologies, Xi’an Jiaotong University, Xi’an 710049, China 2Xi’an Jiaotong University (Yantai) Research Institute for Intelligent Sensing Technology and System, Xi’an Jiaotong University, Xi’an 710049, China Full list of author information is available at the end of the article These authors contributed equally: Mimi Huang, Xiaoyu Wu 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; failures5. Hence, temperature and pressure are two critical parameters related to hydraulic system safety with the miniaturisation and intelligent development of hydraulic systems. It is necessary to detect the temperature and pressure simultaneously to monitor system safety and avoid the occurrence of faults. Therefore, temperature and pressure-integrated sensors have broad application prospects and have garnered significant attention. Inte- grated sensors can be divided into flexible, fibre-optic, and silicon-based sensors based on the sensing materials. Flexible sensors are mostly used in the fields of robot skin and biomedicine, and their pressure–temperature range is relatively small6–10. Although optical fibre sensors have the advantages of anti-interference, electrical insulation, corrosion resistance, and long-distance signal transmis- sion, their signal processing requires special regulators, which increases the cost of post-processing11–15. How- ever, sensors made of flexible and optical materials have problems such as a non-standard fabrication process and poor repeatability. Based on MEMS techniques, silicon-based temperature/ pressure integrated sensors have the features of small size, high repeatability, and a large linear measuring range and are widely utilised in industrial applications. Integrating sensors can be divided into two categories based on integration methods. The first is chip-level stacking16. Although flexible in integration, it greatly increases the cost and packaging size owing to its low efficiency and difficulty in small-die handling. The second is monolithic integration. According to the application requirements, multisensors are fabricated on the same silicon substrate using MEMS techniques. The pressure units in the integrated sensors designed by Lin17 and Chien18 were based on the capacitive effect, and the sensitivities in the ranges of 20–120 kPa and 20–100 kPa were 0.969 fF/kPa and 0.200 fF/kPa, respec- tively. Lin’s resistance temperature detector had a sensitivity of 0.26%/°C in the range of 25–85 °C. Chien used a diode temperature sensor, and the sensitivity was 0.82 mV/°C at 25–85 °C. Although capacitive pressure sensors have high temperatures and long-term stabilities, they are sensitive to the parasitic capacitance introduced by packaging structures, measurement mediums, and circuits. Cheng19 designed an integrated sensor with a resonant pressure unit and a Pt resistor temperature unit. Two parts with differential and static pressures were designed for the pressure sensing units. The sensitivity of the differential pressure part was 79.76 Hz/kPa in the range of 0–100 kPa, and the measurement accuracy of the static pressure component was 0.02% FS in the range of 110–200 kPa. The temperature unit was a Pt resistor with a sensitivity of 6.22 Ω/°C in the range of −20 to 60 °C. Although the resonant type is highly precise, the fabrication process is complicated, and the pressure range is narrow. The integrated sensor designed by Li20 used polysilicon for both pressure and temperature sensors. The pressure range was 0–450 kPa, and the full output was 45.9 mV, the linearity was ±0.84% FS. The temperature coefficient of resistance (TCR) of the temperature sensor was −578 ppm/°C. The final chip size was 2.5 × 2.5 × 0.84 mm3. Zhao21 designed an integrated sensor in which both pressure and temperature used the piezoresistors. The sensitivity of the pressure sensor was 0.020 mV/V/kPa with a non-linearity of 0.4% FS in the range of 0–200 kPa. The sensitivity of the temperature sensor was 5.617 Ω/°C with a non-linearity of 0.48% FS in the range of −30 to 150 °C. The final chip size was 4 × 6 × 0.9 mm3. The existing monolithic integrated sensors are tiled, and all the sensing units are arranged in a plane. Conse- quently, the fabrication process should be compatible with every sensing unit, however, the performance of the sensing units may inevitably be lost. In addition, because the chips are packaged by wire-bonding, the size of the packaged sensor is large, and the reliability of the elec- tronic connection is poor in harsh environments, such as strong vibrations. Here, we propose a vertically integrated temperature/ pressure sensor based on leadless packaging techniques. The integrated sensor uses piezoresistors and platinum thin-film resistors as the pressure and temperature- sensing elements, respectively. The pressure and tem- perature units are arranged vertically and closely bonded with through-silicon vias (TSV) and Au–Au thermo- compression bonding processes, ensuring electrical con- nections and saving planar space. A square diaphragm with rounded corners for pressure sensing is designed and optimised based to the numerical simulation results of the structure’s diaphragm stress and natural frequency. Finally, an integrated sensor is fabricated, and its perfor- mance is characterised. The results reveal that a sensor with a small size has high sensitivity, linearity, repeat- ability, and basic error. Material and methods Model and structure The designed integrated sensor is shown in Fig. 1a. There are two components: a pressure-sensing unit and a temperature-sensing unit. To reduce the lateral size of the chip and avoid mutual interference, two units are placed on Silicon Wafers I and II. Three types of elastic dia- phragms are used in the pressure sensors: circular, rec- tangular, and square. A circular diaphragm is not conducive to mass production. The maximum stress area of the rectangular diaphragm is located at the centre of the elastic diaphragm, and the maximum stress area of the square diaphragm is at the centre of the four sides of the elastic diaphragm. In the case of the same short side, the stress difference of the rectangular diaphragm is smaller Huang et al. Microsystems & Nanoengineering (2024) 10:104 Page 2 of 10 Experimental test results An experimental platform was built to test the perfor- mance of the integrated sensor, as illustrated in Fig. 5a. The sensor was placed in a temperature chamber (FDW 701 P) with a control accuracy of ±0.5 °C to maintain the different temperatures. The piston pressure gauge (CW- 600T) with control accuracy of 0.02% provided different pressures in the range of 0–20 MPa utilising weights with a pressure interval of 4 MPa. During the tests, a source table (Keithley 2612B) provided a constant voltage of 5 V to the pressure unit of the integrated sensor. A multi- meter (Keithley DAQ6510) detected the changes in the output voltage of the pressure sensor, whereas another multimeter recorded the changes in the resistance of the temperature sensor. The performance of the pressure unit in the integrated sensor was tested at 25 °C with the built experimental platform. Two rounds of travel tests were conducted on the sensor at 0–20 MPa. The experimental data are pre- sented in Table 1, and the test curves are shown in Fig. 5b. Via the above data, the linearity of the pressure sensor at room temperature was 0.16% FS, the hysteresis was 0.04% FS, the repeatability was 0.06% FS, the basic error was ±0.23% FS, accuracy was 0.18% FS. The full-scale output and sensitivity were 159.42 mV and 7.97 mV/MPa, respectively. Compared with the theoretical data, the errors were within 3%. The zero output of the pressure unit was measured at room temperature. The sampling interval was 1 s, and the sampling time was 30 min. The output signal curve is shown in Fig. 5c. The zero-drift coefficient was calculated to be 0.04% FS utilising Eq. 5. dz ¼ ðyd max  yd minÞ=yFS ´ 100% ð5Þ where ydmax is the maximum value in 30 min, and ydmin is the minimum value in 30 min. The piezoresistive coefficient of silicon is a function of temperature, and the sensitivity of the pressure unit changes with temperature. Therefore, a different tem- perature environment was provided by a thermal chamber to test the sensitivity performance of the sensor at −40, 0, 40, 80, and 120 °C. The test was performed after holding for 30 min at each temperature to ensure temperature stability. The output values of the sensor at different temperatures are presented in Table 2, and Fig. 5d illus- trates the corresponding characteristic curves. The sen- sitivities of the pressure unit in the integrated sensor at different temperatures were calculated, as illustrated in Fig. 5e. The temperature sensitivity drift of the pressure unit was calculated to be −0.19% FS by Eq. 6, and the sensi- tivity of the sensor gradually decreased with increasing temperature. Subsequently, the sensitivity of the pressure sensor was compensated according to this law. β ¼ yFSðt2Þ  yFSðt1Þ yFSðt1Þðt2  t1Þ ´ 100% ð6Þ where t1 is the lowest temperature; t2 is the highest temperature; yFS(t1) is the full-scale output at the lowest Table 1 Calibration date at 25 °C Pressure (MPa) Voltage output (mV) 1st Round 2nd Round Upward Downward Upward Downward 0 87.42 87.47 87.47 87.47 4 119.00 118.96 119.03 118.97 8 150.78 150.72 150.83 150.74 12 182.68 182.63 182.73 182.72 16 214.72 214.69 214.76 214.74 20 246.84 246.84 246.82 246.82 Table 2 Calibration date at different temperatures Pressure (MPa) Voltage output (mV) −40 °C 0 °C 40 °C 80 °C 120 °C 0 84.98 77.54 73.70 69.63 68.90 4 122.22 110.87 103.66 97.50 94.57 8 159.83 144.43 133.77 125.83 120.60 12 197.56 178.14 164.51 153.83 146.71 16 235.47 211.98 194.98 181.90 172.80 20 273.38 245.96 225.47 210.20 199.12 Table 3 Resistance of temperature unit at different temperatures T/°C Test resistance/ kΩ Fitting resistance/ kΩ Resistance deviation/kΩ Temperature deviation/°C −40 1.395 1.394 −0.001 −0.275 0 1.595 1.594 −0.001 −0.196 40 1.791 1.794 0.003 0.683 80 1.993 1.995 0.002 0.363 120 2.197 2.195 −0.002 −0.355 Huang et al. Microsystems & Nanoengineering (2024) 10:104 Page 8 of 10 temperature, and yFS(t2) is the full-scale output at the highest temperature. The resistance of the temperature sensor was also tested in the temperature range of −40 to 120 °C, and the least square method was employed to fit it. The variations in platinum resistance at different temperatures are pre- sented in Table 3. The TCR obtained from Eq. 730 was 3142.997 ppm/°C. TCR ¼ Rt2  Rt1 Rt1ðt2  t1Þ ´ 106 ð7Þ where Rt2 is the resistance at t2; Rt1 is the resistance at t1; t1 is 0 °C, and t2 is the highest temperature of the test. The data were fitted to a straight line, as illustrated in Fig. 5f, and the relationship between the platinum resistance and temperature is shown in Eq. 8. RT ¼ 0:00501T þ 1:594 ð8Þ The calculated temperature sensor sensitivity was 5.01 Ω/°C, the nonlinearity was 0.16% FS, accuracy was 0.32% FS, and the measurement error was less than ±1 °C. The outputs of the temperature sensor under different pressures are shown in Fig. 5g. It can be seen that the pressure does not affect the output of the temperature sensor. The indices of the temperature and pressure integrated sensors are listed in Table 4. Compared with the pub- lished literature, our integrated sensor chip had a small size, large pressure range, and high linearity and precision; however, there was still a gap compared with mature products. The temperature measurement unit also exhibited high sensitivity. Conclusion A leadless temperature and pressure integrated sensor based on TSV and Au–Au bonding processes is proposed. The pressure and temperature units are connected long- itudinally via the TSV and Au–Au bonding processes, which reduces the lateral dimension and avoids signal interference between the two units. The pressure unit adopts a simple and reliable flat film structure, and applies pressure to the back, effectively reducing the pressure medium requirements. The addition of the fillet design increases the natural frequency. A platinum resistor with a stable chemical performance and high precision is selected as the temperature unit. Instead of conventional metal ball welding, a solder ball effectively improves the reliability of the electrical connection of the sensor. The chip is fabricated with a reasonable and reliable process and packaged as an integrated sensor. Finally, the sensi- tivity of the pressure unit in the integrated sensor is 7.97 mV/MPa in the range of 0–20 MPa, and the linearity is 0.16% FS. The hysteresis is 0.04% FS, the repeatability is 0.06% FS, the basic error is ±0.23%FS, the accuracy is 0.18% FS, the zero-time drift is 0.04% FS, and the thermal sensitivity drift is −0.20% FS at −40 to 120 °C. The TCR of the platinum resistor in the temperature unit is 3142.997 ppm/°C and the measurement error is less than ±1 °C. Acknowledgements This work was supported in part by the National Key Research & Development (R&D) Plan (2022YFB3205800), the National Natural Science Foundation of China (52305618). Author details 1State Key Laboratory for Manufacturing Systems Engineering, International Joint Laboratory for Micro/Nano Manufacturing and Measurement Technologies, Xi’an Jiaotong University, Xi’an 710049, China. 2Xi’an Jiaotong University (Yantai) Research Institute for Intelligent Sensing Technology and System, Xi’an Jiaotong University, Xi’an 710049, China. 3Shandong Laboratory of Yantai Advanced Materials and Green Manufacturing, Yantai 265503, China. 4School of Mechanical Engineering, Xi’an Jiaotong University, 710049 Xi’an, China. 5School of Instrument Science and Technology, Xi’an Jiaotong University, 710049 Xi’an, China. 6Chongqing Key Laboratory of Micro-Nano Systems and Intelligent Sensing, Chongqing Academician Workstation, Chongqing 2011 Collaborative Innovation Center of Micro/Nano Sensing and Intelligent Ecological Internet of Things, Chongqing Technology and Business University, Nan’an District, Chongqing 400067, China. 7Xi’an Aerospace Yuanzheng Fluid Control Co. Ltd., Xi’an 710049, China Author contributions Mimi Huang: Conceptualisation, Methodology, Validation, Formal analysis, Investigation, Writing—Original Draft; Xiaoyu Wu, Libo Zhao, Xiangguang Han, Yong Xia, Zhikang Li, Feng Han: Validation, Investigation, Resources, Data Curation, Writing—Review & Editing; Yi Gao, Zeyu Cui, Cheng Zhang, Xiaokai Yang, Zhixia Qiao: Data Curation, Resources, Writing—Review & Editing, Supervision; Ping Yang, Zhuangde Jiang: Project administration, Supervision, Funding acquisition. Conflict of interest The authors declare no competing interests. Table 4 Performance parameters comparison with published literature Source Chip size (mm) Pressure range Linearity Basic error Temperature range (°C) TCR Our work 1.8 × 1.8 × 0.75 0–20 MPa 0.16% FS ±0.23% FS −40 to 120 3142.997 ppm/°C Wang et al.20 2.5 × 2.5 × 0.84 0–450 kPa 0.84% FS / / −578 ppm/°C Xu et al.21 4.0 × 6.0 × 0.9 0–200 kPa 0.40% FS / −30 to 150 / Mansoor et al.31 3.8 × 3.8 0–75 kPa 0.25% FS / 20–300 / Huang et al. Microsystems & Nanoengineering (2024) 10:104 Page 9 of 10 Received: 26 December 2023 Revised: 1 May 2024 Accepted: 22 May 2024 References 1. Cologni, A. L. et al. Modeling and identification of an electro-hydrostatic actuator. Ifac Proc. Vol. https://doi.org/10.3182/20100913-3-US-2015.00020 (2010). 2. Alle, N. et al. Review on electro hydrostatic actuator for flight control. Int. J. Fluid Power https://doi.org/10.1080/14399776.2016.1169743 (2016). 3. Hagen, D., Padovani, D. & Choux, M. A comparison study of a novel self- contained electro-hydraulic cylinder versus a conventional valve-controlled actuator-part 1: motion control. Actuators https://doi.org/10.3390/ACT8040079 (2019). 4. Hagen, D., Padovani, D. & Choux, M. A. A comparison study of a novel self- contained electro-hydraulic cylinder versus a conventional valve-controlled actuator—part 2: energy efficiency. Actuators https://doi.org/10.3390/ act8040078 (2019). 5. Junhui, Z. et al. Churning losses analysis on the thermal-hydraulic model of a high-speed electro-hydrostatic actuator pump. Int. J. Heat. Mass Transf. 127, 1023–30, https://doi.org/10.1016/j.ijheatmasstransfer.2018.06.133 (2018). 6. Zu, G. et al. Superhydrophobic ultraflexible triple-network graphene/poly- organosiloxane aerogels for high-performance multifunctional temperature/ strain/pressure sensing array. Chem. Mater. https://doi.org/10.1021/acs. chemmater.9b02437 (2019). 7. Han, S., Jiao, F., Khan, Z. U., Edberg, J., Fabiano, S. & Crispin, X. Thermoelectric polymer aerogels for pressure-temperature sensing applications. Adv. Funct. Mater. 27, 1703549, https://doi.org/10.1002/adfm.201703549 (2017). 8. Gui, Q., He, Y., Gao, N., Tao, X. & Wang, Y. A skin-inspired integrated sensor for synchronous monitoring of multiparameter signals. Adv. Funct. Mater. 27, 1702050, https://doi.org/10.1002/adfm.201702050 (2017). 9. Wang, Z., Zhang, L., Liu, J. & Li, C. A flexible bimodal sensor based on an electrospun nanofibrous structure for simultaneous pressure temperature detection. Nanoscale 11, 14242–9, https://doi.org/10.1039/C9NR03098K (2019). 10. Zhu, P., Wang, Y., Wang, Y., Mao, H., Zhang, Q. & Deng, Y. Flexible 3D archi- tectured piezo/thermoelectric bimodal tactile sensor array for E-skin applica- tion. Adv. Energy Mater. 10, 2001945, https://doi.org/10.1002/aenm.202001945 (2020). 11. Li, Z. et al. A high sensitivity temperature sensing probe based on microfiber Fabry-Perot interference. Sensors 19, 1819, https://doi.org/10.3390/s19081819 (2019). 12. Hu, Jianyang. et al. Fiber Mach-Zehnder-interferometer-based liquid crystal biosensor for detecting enzymatic reactions of penicillinase. Appl. Opt. 58, 4806–11, https://doi.org/10.1364/AO.58.004806 (2019). 13. Liu, Y. et al. Fabrication of dual-parameter fiber-optic sensor by cascading FBG with FPI for simultaneous measurement of temperature and gas pressure. Opt. Commun. 443, 166–71, https://doi.org/10.1016/j.optcom.2019.03.034 (2019). 14. Dong, N. et al. Pressure and temperature sensor based on graphene dia- phragm and fiber Bragg gratings. IEEE Photonics Technol. Lett. https://doi.org/ 10.1109/LPT.2017.2786292 (2018). 15. Fu, D. et al. A simple, highly sensitive fiber sensor for simultaneous mea- surement of pressure and temperature. IEEE Photonics Technol. Lett. https://doi. org/10.1109/LPT.2020.2993836 (2020). 16. Tian, L. et al. Oil-filled high-temperature and high-pressure composite sensors of pressure and temperature. Micronanoelectron. Technol. 50, 776–778, https:// doi.org/10.3969/j.issn.1671-4776.2013.12.006 (2013). 17. Lin, Y. C. et al. Monolithic integration of pressure/humidity/temperature sen- sors for CMOS-mems environmental sensing hub with structure designs for performances enhancement. 2020 IEEE 33rd International Conference on Micro Electro Mechanical Systems (MEMS). (IEEE, 2020). https://doi.org/10.1109/ MEMS46641.2020.9056401. 18. Chien, T. L. et al. Fabrication and integration of SOC environment sensing hub with gas/pressure/temperature sensors. 2022 IEEE 35th International Conference on Micro Electro Mechanical Systems Conference (MEMS). (IEEE, 2022) 138–41. https://doi.org/10.1109/MEMS51670.2022.9699821. 19. Cheng, C. et al. A MEMS resonant differential pressure sensor with high accuracy by integrated temperature sensor and static pressure sensor. IEEE Electron Device Lett. 43, 2157–60, https://doi.org/10.1109/LED.2022.3211886 (2022). 20. Wang, Q. et al. On-chip integration of acceleration, pressure, and temperature composite sensor with a single-sided micromachining technique. J. Micro- electromech. Syst. 20, 42–52, https://doi.org/10.1109/JMEMS.2010.2100031 (2011). 21. Xu, J. et al. A monolithic silicon multi-sensor for measuring three-axis accel- eration, pressure and temperature. J. Mech. Sci. Technol. 22, 731–9, https://doi. org/10.1007/s12206-008-0105-6 (2008). 22. Bao, M.-H. Basic mechanics of beam and diaphragm structures. Handbook of Sensors and Actuators. (Elsevier, New York, NY, USA, 2000) pp. 23–88. https:// doi.org/10.1016/S1386-2766(00)80016-X. 23. Huang, M. et al. MEMS-based Pt film temperature sensor chip on silicon substrate. Meas. Sci. Technol. 33, 125113, https://doi.org/10.1088/1361-6501/ ac90dd (2022). 24. Su, W. et al. Thermal compensation system for silicon piezoresistive pressure sensors based on surface fitting and wild horse algorithm. IEEE Sens. J. https:// doi.org/10.1109/JSEN.2024.3365469. 25. Gao, C., Hua, X. & Zhang, D. Design and analysis of high-performance and small-size piezoresistive pressure sensors. IEEE Sens. J. 23, 6649–59, https://doi. org/10.1109/JSEN.2023.3248579 (2023). 26. Kim, N. H. et al. Electrical and thermal properties of platinum thin films pre- pared by DC magnetron sputtering for micro-heater of microsensor appli- cations after CMP process. Solid State Phenomena https://doi.org/10.4028/ www.scientific.net/SSP.124-126.267 (2007). 27. Tiggelaar, R. M. et al. Stability of thin platinum films implemented in high- temperature microdevices. Sens. Actuators A Phys. 152, 39–47, https://doi.org/ 10.1016/j.sna.2009.03.017 (2009). 28. Ekkels, P. et al. Evaluation of platinum as a structural thin film material for RF- MEMS devices. J. Micromech. Microeng. 19, 065010, https://doi.org/10.1088/ 0960-1317/19/6/065010 (2009). 29. Boguhn, D. & Koepke, M. Typical, R(T90) characteristics of platinum thin- film resistance thermometers in the temperature range from 50 °C to +660 °C. Int. J. Thermophys. 32, 2379–87, https://doi.org/10.1007/s10765- 011-1088-6 (2011). 30. Gao, C. & Zhang, D. Establishment and verification of resistance temperature coefficient model of P-type non-uniformly doped resistance. J. Micromech. Microeng. 32, 105006, https://doi.org/10.1088/1361-6439/ac8aa4 (2022). 31. Mansoor, M. et al. An SOI CMOS-based multi-sensor MEMS chip for fluidic applications. Sensors 16, 1608, https://doi.org/10.3390/s16111608 (2016). Huang et al. Microsystems & Nanoengineering (2024) 10:104 Page 10 of 10

Title: Small-size temperature/high-pressure integrated sensor via flip-chip method ​ Authors: Mimi Huang, Xiaoyu Wu, Libo Zhao, Yi Gao, Xiangguang Han, Yong Xia, Zeyu Cui, Cheng Zhang, Zhixia Qiao, Xiaokai Yang, Zhikang Li, Feng Han, Ping Yang, Zhuangde Jiang ​ Publisher: Microsystems & Nanoengineering, Nature Publishing Group ​ Date: 2024-07-23 00:00:00 Abstract: Hydraulic technology with smaller sizes and higher reliability trends, including fault prediction and intelligent control, requires high-performance temperature and pressure-integrated sensors. ​ Current designs rely on planar wafer- or chip-level integration, which is limited by pressure range, chip size, and low reliability. ​ We propose a small-size temperature/high-pressure integrated sensor via the flip-chip technique. ​ The pressure and temperature units are arranged vertically, and the sensing signals of the two units are integrated into one plane through silicon vias and gold–gold bonding, reducing the lateral size and improving the efficiency of signal transmission. ​ The flip-chip technique ensures a reliable electrical connection. ​ A square diaphragm with rounded corners is designed and optimised with simulation to sense high pressure based on the piezoresistive effect. ​ The temperature sensing unit with a thin-film platinum resistor measures temperature and provides back-end high-precision compensation, which will improve the precision of the pressure unit. ​ The integrated chip is fabricated by MEMS technology and packaged to fabricate the extremely small integrated sensor. ​ The integrated sensor is characterised, and the pressure sensor exhibits a sensitivity and sensitivity drift of 7.97 mV/MPa and −0.19% FS in the range of 0–20 MPa and −40 to 120 °C. ​ The linearity, hysteresis, repeatability, accuracy, basic error, and zero-time drift are 0.16% FS, 0.04% FS, 0.06% FS, 0.18% FS, ±0.23% FS and 0.04% FS, respectively. ​ The measurement error of the temperature sensor and temperature coefficient of resistance is less than ±1 °C and 3142.997 ppm/°C, respectively. ​ The integrated sensor has broad applicability in fault diagnosis and safety monitoring of high-end equipment such as automobile detection, industrial equipment, and oil drilling platforms. ​

Tailoring high-refractive-index nanocomposites for manufacturing of ultraviolet metasurfaces.pdf

Kang et al. Microsystems & Nanoengineering (2024) 10:53 Microsystems & Nanoengineering https://doi.org/10.1038/s41378-024-00681-w www.nature.com/micronano A R T I C L E O p e n A c c e s s Tailoring high-refractive-index nanocomposites for manufacturing of ultraviolet metasurfaces Hyunjung Kang1, Dongkyo Oh 1, Nara Jeon1, Joohoon Kim 1, Hongyoon Kim1, Trevon Badloe 2 and Junsuk Rho 1,3,4,5,6✉ Abstract Nanoimprint lithography (NIL) has been utilized to address the manufacturing challenges of high cost and low throughput for optical metasurfaces. To overcome the limitations inherent in conventional imprint resins characterized by a low refractive index (n), high-n nanocomposites have been introduced to directly serve as meta-atoms. However, comprehensive research on these nanocomposites is notably lacking. In this study, we focus on the composition of high-n zirconium dioxide (ZrO2) nanoparticle (NP) concentration and solvents used to produce ultraviolet (UV) metaholograms and quantify the transfer fidelity by the measured conversion efficiency. The utilization of 80 wt% ZrO2 NPs in MIBK, MEK, and acetone results in conversion efficiencies of 62.3%, 51.4%, and 61.5%, respectively, at a wavelength of 325 nm. The analysis of the solvent composition and NP concentration can further enhance the manufacturing capabilities of high-n nanocomposites in NIL, enabling potential practical use of optical metasurfaces. Introduction Metasurfaces are composed of subwavelength struc- tures in a two-dimensional arrangement and have elec- tromagnetic (EM) properties that can be engineered for applications such as holography1–8, lenses9–13, bio- sensors14–17, and structural color printing18–23. Ultravio- let (UV) metasurfaces exhibit distinct characteristics that enable control of UV light in various applications, including imaging24–26, display27,28, and biosensing29,30. However, as UV metasurfaces must have structures that are significantly smaller than the wavelength of UV radiation, costly nanopatterning techniques are required to achieve nanoscale resolution and high aspect ratios, with additional challenges related to the limited selection of materials with high transparency in the UV region. Metasurfaces are usually fabricated using well-established methods such as atomic layer deposition and electron- beam lithography (EBL), which achieve high resolution; however, the patterning area is small, the operational costs are very high, and additional complex processing steps may be required, making these approaches unsui- table for mass production. Nanoimprint lithography (NIL) has emerged as a solution to overcome these limitations for practical applications31–35. Nevertheless, the inher- ently low refractive index (n) of the conventional imprint resins (≈1.5) commonly employed in NIL results in a low conversion efficiency of the metasurfaces36. To address this challenge, a one-step NIL fabrication method for metasurfaces utilizing high-n nanocomposites of dielectric nanoparticles (NPs) to enhance the effective n of the printed structures while replicating mold patterns as effectively as conventional resins has been intro- duced37–43. The choice of NP depends on the target wavelength range; for instance, titanium dioxide (TiO2)44 and silicon (Si)45 NPs have been utilized for the visible and infrared (IR) regions, respectively. Notably, a straightforward printing platform employing zirconium dioxide (ZrO2) to realize high-efficiency metaholograms that function in the near-to-deep UV range has recently been demonstrated46. As the high-n nanocomposite is © The Author(s) 2024 OpenAccessThisarticleislicensedunderaCreativeCommonsAttribution4.0InternationalLicense,whichpermitsuse,sharing,adaptation,distributionandreproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Correspondence: Junsuk Rho ([email protected]) 1Department of Mechanical Engineering, Pohang University of Science and Technology (POSTECH), Pohang, Republic of Korea 2Graduate School of Artificial Intelligence, Pohang University of Science and Technology (POSTECH), Pohang, Republic of Korea Full list of author information is available at the end of the article These authors contributed equally: Hyunjung Kang, Dongkyo Oh, Nara Jeon. 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; directly employed as meta-atoms, research on the com- position (i.e., NP concentration, solvent, etc.) needed to achieve high-fidelity metasurfaces is significant but lacking. Understanding the influence of the diverse constituents in nanocomposites on the transfer fidelity is crucial for establishing a robust and reliable metasurface fabrication process. Each type of NP exhibits variations in n, the adhesion strength, and the dispersibility in solvents, necessitating the development of distinct fabrication conditions47,48. For example, the maximum NP con- centration is limited due to particle agglomeration, and the interactions between the solvent and mold, such as swelling and surface roughness, must be considered. In this study, we investigate the impact of the NP con- centration and solvent selection on the transfer fidelity, which is evaluated through the conversion efficiency of metaholograms replicated using ZrO2 nanocomposites. We compare the metasurfaces printed with ZrO2 NP concentrations ranging from 20 to 90 wt% to establish the optimal NP concentration to maximize the effective n (≈ 1.8 at λ = 325 nm) with high transfer fidelity. Subse- quently, while maintaining the NP concentration at the determined value, we explore different solvents, including methyl isobutyl ketone (MIBK), methyl ethyl ketone (MEK), acetone, toluene, and n-hexane. As a demon- stration of the tailored ZrO2 nanocomposites, the con- version efficiencies of metaholograms operating at 325 nm are experimentally measured to quantify the transfer fidelity. These findings hold promise for refining the fabrication process and broadening the potential appli- cations of nanocomposites in NIL. Results A schematic of the NIL process employed to fabricate UV metaholograms using ZrO2 nanocomposites is depicted in Fig. 1a (details in the Materials and Methods). To generate metaholograms operating at λ = 325 nm, first, a master mold is fabricated using the standard EBL process (Fig. 1b). This master mold is then covered with a hard-polydimethylsiloxane (h-PDMS)/PDMS bilayer and cured to form a soft mold (Fig. 1c). A uniform ZrO2 nanocomposite film is then coated on the soft mold, and then, pressure and UV exposure are applied. The soft mold is detached to leave the UV metahologram on the substrate (Fig. 1d). Nanocomposite films with different ZrO2 NP concentrations are uniformly coated onto a glass substrate, and the n and extinction coefficient (k) are measured using ellipsometry (Figs. S1, S2). The results are shown in Fig. 2a, b. As expected, higher ZrO2 NP con- centrations yield higher values of n, while in the deep-UV region (~280 nm), the measured k is suppressed for higher ZrO2 NP concentrations and is consistently zero at 325 nm. Optimizing the NP concentration is essential for closely mimicking the shape of the master mold. At 20 and 50 wt %, there are not enough NPs to adequately support the structures during imprinting, leading to low transfer fidelity (Fig. 3a, b). At 80 wt%, the optimal conditions are met, as enough NPs are present to create the desired structure without any particle agglomeration (Fig. 3c, d). Conversely, at 90 wt%, the NP concentration is excessive, and particle agglomeration occurs within the nano- composite, leading to clusters larger than the cavity size of the soft mold. This disrupts the formation of the intended structures, yielding indistinct or inaccurate patterns (Fig. 3e). These results highlight the critical parameter of the NP concentration in the nanocomposite for achieving high transfer fidelity and structural stability. During the NIL process, swelling occurs when the nanocomposite film is coated on the soft mold, thus degrading the quality of the resin layer, as it distorts the form in the soft mold49,50. Although the influence of swelling on NIL is widely recognized, more research and quantitative evaluation are needed. MIBK has been used as a solvent for nanocomposites due to its effective resin dissolution properties44–46. However, swelling of the soft mold is apparent during the replication process, which is attributed to interactions between the solvent and the PDMS, leading to fabrication imperfections that can negatively affect the functionality of the replicated nanostructures. To explore potential solvents for high-n nanocomposites, n-hexane, toluene, MEK, and acetone are assessed (details in the Materials and Methods) with regard to PDMS swelling, which is defined as the ratio between the weight of the swollen PDMS (Wswell) and its initial dry weight (Wdry) (Fig. 4a). The measured weights are provided in Table S1. MEK and acetone exhibit swelling ratios of 1.11 and 1.07, respectively, which are both lower than the corresponding value of 1.15 for MIBK (Fig. 4b). These values are visualized in images of the apparent swelling of the PDMS soaked in MIBK, MEK, and acetone (Fig. 4c–e). While maintaining the NP con- centration at 80 wt%, the transfer fidelity obtained with each solvent is assessed by varying only the solvent to demonstrate how the interaction between the solvent and PDMS affects the transfer fidelity. PDMS, which is composed of the recurring unit -Si(CH3)2-O-, is relatively nonpolar due to the well- balanced silicon-oxygen bonds, thus lacking distinct anodic or cathodic properties. MEK and acetone tend to be polar, with polarity indices of 4.7 and 5.1, respectively (Table S2). These solvents have moderate to relatively high polar contributions. In contrast, toluene and n-hexane are nonpolar with polarity indices of 2.4 and 0.0, respectively. Additionally, MEK, acetone, toluene, and n-hexane have solubility parameters of 9.3, 9.9, 8.9, and 7.3 cal1/2cm−3/2, respectively51. This parameter can be Kang et al. Microsystems & Nanoengineering (2024) 10:53 Page 2 of 8 The MIBK- and acetone-based nanocomposites yield conversion efficiencies of 62.3% and 61.5%, respectively, whereas the MEK-based nanocomposite exhibits a lower conversion efficiency of 51.4% (Fig. 6b). The UV meta- holograms replicated with the MIBK-based (Fig. 6c) and acetone-based (Fig. 6e) nanocomposites exhibit much clearer and more vibrant images than those replicated with the MEK-based nanocomposite (Fig. 6d). These results highlight that acetone demonstrates high transfer fidelity, leading to a performance comparable to that of MIBK. Discussion In summary, we explored tailoring ZrO2 nanocompo- sites to manufacture high-fidelity UV metaholograms using NIL. By varying the ZrO2 NP concentration and investigating different solvents in the nanocomposite, the optimal conditions were identified. We determined that an 80 wt% ZrO2 NP concentration offered the most favorable conditions for producing metaholograms, yielding both high n and high transfer fidelity. An insuf- ficient NP concentration led to reduced pattern definition and transfer fidelity due to inadequate mechanical sup- port during NIL. Conversely, an excessive NP con- centration caused particle agglomeration within the nanocomposite, leading to NP clusters larger than the cavity size in the soft mold. Furthermore, while main- taining an 80 wt% concentration, the interactions between different solvents and PDMS were also examined with regard to transfer fidelity. To intuitively demonstrate the swelling effect, we fabricated microscale soft molds and evaluated the degree of pattern distortion caused by the absorption of each solvent. Although both acetone- and MEK-based nanocomposites demonstrated a lower swel- ling ratio than MIBK, only acetone achieved successful pattern transfer with high fidelity. MEK unfavorably modified the PDMS surface properties, creating surface segregation and altering the solubility, resulting in increased surface roughness of the soft mold. This yielded an uneven nanocomposite coating, leading to non-uniform pressure on the substrate, which adversely affected the transfer fidelity and diminished the accuracy of the fine pattern details. Consequently, the MEK-based nano- composite did not uniformly spread across the soft mold, significantly reducing the pattern definition and hindering the formation of meta-atoms. The conversion efficiency of metaholograms created using MIBK-, acetone-, and MEK-based nanocomposites was measured to quantify the transfer fidelity. The metaholograms replicated using MIBK- and acetone-based nanocomposites exhibited much clearer and more vibrant images than those repli- cated using MEK, with measured conversion efficiencies of 62.3%, 61.5%, and 51.4%. These results emphasize that acetone, in addition to MIBK, holds potential as a promising solvent for high-n nanocomposites to realize high-fidelity metasurfaces using NIL. These findings hold significant promise for optimizing the fabrication process and broadening the potential applications of nano- composites in NIL. While the concept of ZrO2 nano- composites has been previously introduced, there has been a lack of research explicitly detailing how factors such as the NP concentration and solvent in the nano- composites precisely influence the outcomes of the NIL process. This study specifically addresses the influence of these factors, revealing potential advancements in NIL. Such UV metasurfaces composed of ZrO2 nanocomposite structures fabricated using a straightforward printing method offer additional benefits, such as a high throughput and a low fabrication cost. The integration of nanocomposite meta-atoms with conventional tuning techniques enables the development of multifunctional metaholograms, highlighting their potential for incor- poration into holographic display technology and appli- cations with augmented and virtual reality devices. Materials and methods Materials ZrO2 nanocomposites were prepared from a solution with 30 wt% 10 nm ZrO2 NPs dispersed in MIBK, which were purchased from Ditto Technology (DT-ZROSOL- 30MIBK (N10)). Dipentaerythritol penta-/hexa-acrylate and 1-hydroxycyclohexyl phenyl ketone were purchased from Sigma‒Aldrich and used as a monomer and a pho- toinitiator, respectively. MIBK, MEK, and acetone were purchased from Duksan General Science. h-PDMS, a vinylmethyl copolymer (VDT-731), a platinum catalyst (SIP6831.2), and a siloxane-based silane reducing agent (HMS-301) were purchased from Gelest. 2,4,6,8-Tetra- methyl-2,4,6,8-tetravinylcyclotetrasiloxane and toluene, which were used as a modulator and a solvent, were purchased from Sigma‒Aldrich and Samchun Chemicals, respectively. PDMS, a silicone elastomer base, and a sili- cone elastomer curing agent were purchased from Dow Corning (SYLGARD™184 Silicone Elastomer Kit). The trichloro(1H,1H,2H,2H-perfluorooctyl)silane used for hydrophobic coating was purchased from Sigma‒Aldrich. Toluene and n-hexane were purchased from Samchun Chemicals. Fabrication of the master mold The fabrication process began with a Si substrate as the master mold. Meta-atoms were then transferred onto a bilayer of two positive tone photoresists (495 PMMA A6, MicroChem & 950 PMMA A2, MicroChem) using the standard electron beam lithography (EBL) process with an ELIONIX ELS-7800 system operating at an acceleration voltage of 80 kV and a beam current of 100 pA. After exposure, the patterns were developed using a mixed Kang et al. Microsystems & Nanoengineering (2024) 10:53 Page 6 of 8 solution of MIBK/IPA (1:3). An 80 nm chromium (Cr) layer was then deposited on the photoresist patterns through electron beam evaporation (KVT, KVE- ENS4004). The lifted-off Cr meta-atoms then served as an etching mask for the Si substrate. Transfer of Cr patterns onto the Si substrate was achieved using a dry etching process with a silicon/metal hybrid etcher (DMS). Finally, the remaining Cr etching mask was removed using a suitable Cr etchant (CR-7). Fabrication of the soft mold A h-PDMS solution was prepared by mixing 3.4 g of the vinylmethyl copolymer, 18 μL of the platinum catalyst, 0.1 g of the modulator, 2 g of toluene, and 1 g of the siloxane-based silane reducing agent. The solution was spin-coated on the master mold at 2000 rpm for 60 s and then cured at 70 °C for 2 h. After baking, degassed PDMS solution, in which the silicone elastomer base and its curing agent were mixed at a weight ratio of 10:1, was poured on the h-PDMS layer and baked at 70 °C for 2 h. The cured soft mold was removed from the original master mold. To enable easy separation from the cured structure, the surface of the detached mold was coated with a hydrophobic self-assembled monolayer (SAM). Preparation of ZrO2 nanocomposites In each chosen solvent, a monomer and a photoinitiator were dissolved at concentrations of 7 wt% and 3 wt%, respectively. DT-ZROSOL-30MIBK (N10) was used as the NP solution without any modifications to the solvent. The diluted or dispersed solutions were blended in the required proportions at the desired ratio. Nanoimprint lithography process To improve the adhesion of the substrate, a PMMA solution was carefully applied to the cleaned and oxygen plasma-treated surface, resulting in a hydrophilic mod- ification. Next, the ZrO2 nanocomposite, which consisted of a monomer, an initiator, and NPs, was gently drop- coated onto the soft mold. The coated mold was left at room temperature for approximately 5 min, enabling the nanocomposite solvent to spontaneously evaporate. Finally, the coated mold was cured under 5 bar of pressure and 15 min of UV irradiation. Swelling experiments The initial weight of the PDMS elastomers was mea- sured prior to immersion in solvents. Approximately 30 mL of each solvent was placed in separate beakers. The PDMS elastomers were then immersed in the individual solvents for 15 min. The weight of the swollen PDMS elastomers was subsequently measured. This process involved recording the weight of each PDMS elastomer both before and after immersion. The swelling ratio, defined as the ratio between the weight of the swollen PDMS and its initial dry weight, was calculated. These PDMS swelling experiments were repeated five times for each solvent. Optical measurement The beam of a 325 nm laser (helium cadmium laser, Kimmon Koha Co., Ltd.) was passed through a linear polarizer (linear polarizer, Thorlabs) and a quarter-wave plate (quarter-wave plate, Thorlabs) to form circularly polarized light. A 500 µm diameter pinhole [P500HD – Ø1/2 in. (12.7 mm) mounted pinhole, Thorlabs] was used to block unnecessary light. A photodiode power sensor (S120C, Thorlabs) and a compact power and energy meter console (PM100D, Thorlabs) were used to measure the intensity of the light. Holographic images were extracted through a UV sensor card [laser viewing card (VRC1), Thorlabs]. Acknowledgements This work was financially supported by the POSCO-POSTECH-RIST Convergence Research Center program funded by POSCO, the National Research Foundation (NRF) grants (NRF-2022M3C1A3081312, NRF- 2019R1A5A8080290, NRF-2021M3H4A1A04086554) funded by the Ministry of Science and ICT (MSIT) of the Korean government, and the Korea Evaluation Institute of Industrial Technology (KEIT) grant (no. 1415179744/20019169, Alchemist project) funded by the Ministry of Trade, Industry and Energy (MOTIE) of the Korean government. D.K.O. acknowledges the Hyundai Motor Chung Mong-Koo fellowship. N.J. acknowledges the POSTECHIAN fellowship. J.K. and H.Y.K. acknowledge the Presidential Science fellowship funded by the MSIT of the Korean government, and the Asan Foundation Biomedical Science fellowship. T.B. acknowledges the Institute of Information & Communications Technology Planning & Evaluation (IITP) grant (no. 2019-0-01906, the POSTECH Artificial Intelligence Graduate School program) funded by the MSIT of the Korean government, and the POSTECH PIURI fellowship. Author details 1Department of Mechanical Engineering, Pohang University of Science and Technology (POSTECH), Pohang, Republic of Korea. 2Graduate School of Artificial Intelligence, Pohang University of Science and Technology (POSTECH), Pohang, Republic of Korea. 3Department of Chemical Engineering, Pohang University of Science and Technology (POSTECH), Pohang, Republic of Korea. 4Department of Electrical Engineering, Pohang University of Science and Technology (POSTECH), Pohang, Republic of Korea. 5POSCO-POSTECH-RIST Convergence Research Center for Flat Optics and Metaphotonics, Pohang, Republic of Korea. 6National Institute of Nanomaterials Technology (NINT), Pohang, Republic of Korea Author contributions J.R. conceived the idea and initiated the project. H.J.K. and N.J. performed the nanoimprinting experiments. H.Y.K. performed the optical simulations. D.K.O. fabricated the master molds using electron beam lithography. H.J.K. and J.K. performed the optical measurements and data analysis. H.J.K., N.J., and D.K.O. mainly wrote the manuscript. T.B. was partially involved in writing the manuscript. All authors confirmed the final manuscript. J.R. guided the entire work. Conflict of interest The authors declare no competing interests. Supplementary information The online version contains supplementary material available at https://doi.org/10.1038/s41378-024-00681-w. Kang et al. Microsystems & Nanoengineering (2024) 10:53 Page 7 of 8 Received: 28 August 2023 Revised: 9 February 2024 Accepted: 19 February 2024 References 1. Kim, J. et al. Geometric and physical configurations of meta-atoms for advanced metasurface holography. InfoMat 3, 739–754 (2021). 2. Huang, L. et al. Three-dimensional optical holography using a plasmonic metasurface. Nat. Commun. 4, 2808 (2013). 3. So, S. et al. Multicolor and 3D holography generated by inverse-designed single-cell metasurfaces. Adv. Mater. 35, 2208520 (2023). 4. Wang, Q. et al. Reflective chiral meta-holography: multiplexing holograms for circularly polarized waves. Light Sci. Appl. 7, 25 (2018). 5. Qu, G. et al. Reprogrammable meta-hologram for optical encryption. Nat. Commun. 11, 5484 (2020). 6. Li, X. et al. Multicolor 3D meta-holography by broadband plasmonic mod- ulation. Sci. Adv. 2, e1601102 (2016). 7. Ren, H. et al. Metasurface orbital angular momentum holography. Nat. Commun. 10, 2986 (2019). 8. Park, C. et al. High-throughput fabrication of large scale metaholograms via one-step printing. Adv. Opt. Mater. 12, 2301562 (2024). 9. Wang, S. et al. A broadband achromatic metalens in the visible. Nat. Nano- technol. 13, 227–232 (2018). 10. Khorasaninejad, M. et al. Achromatic metasurface lens at telecommunication wavelengths. Nano Lett. 15, 5358–5362 (2015). 11. Badloe, T., Seong, J. & Rho, J. Trichannel spin-selective metalenses. Nano Lett. 23, 6958–6965 (2023). 12. Balli, F., Sultan, M., Lami, S. K. & Hastings, J. T. A hybrid achromatic metalens. Nat. Commun. 11, 3892 (2020). 13. Kim, J. et al. Scalable manufacturing of high-index atomic layer–polymer hybrid metasurfaces for metaphotonics in the visible. Nat. Mater. 22, 474–481 (2023). 14. Tittl, A. et al. Imaging-based molecular barcoding with pixelated dielectric metasurfaces. Science 360, 1105–1109 (2018). 15. Kim, I. et al. Metasurfaces-driven hyperspectral imaging via multiplexed plas- monic resonance energy transfer. Adv. Mater. 35, 2300229 (2023). 16. Iwanaga, M. All-dielectric metasurface fluorescence biosensors for high- sensitivity antibody/antigen detection. ACS Nano 14, 17458–17467 (2020). 17. Zeng, S. et al. Graphene–gold metasurface architectures for ultrasensitive plasmonic biosensing. Adv. Mater. 27, 6163–6169 (2015). 18. Song, M. et al. Versatile full-colour nanopainting enabled by a pixelated plasmonic metasurface. Nat. Nanotechnol. 18, 71–78 (2023). 19. Badloe, T. et al. Liquid crystal-powered Mie resonators for electrically tunable photorealistic color gradients and dark blacks. Light Sci. Appl. 11, 118 (2022). 20. Zhu, X., Yan, W., Levy, U., Mortensen, N. A. & Kristensen, A. Resonant laser printing of structural colors on high-index dielectric metasurfaces. Sci. Adv. 3, e1602487 (2017). 21. Jang, J. et al. Spectral modulation through the hybridization of Mie-scatterers and quasi-guided mode resonances: realizing full and gradients of structural color. ACS Nano 14, 15317–15326 (2020). 22. Sun, S. et al. All-dielectric full-color printing with TiO2 metasurfaces. ACS Nano 11, 4445–4452 (2017). 23. Ko, B. et al. Humidity-responsive RGB-pixels via swelling of 3D nanoimprinted polyvinyl alcohol. Adv. Sci. 10, 2204469 (2023). 24. Song, W. et al. Ultraviolet metasurface-assisted photoacoustic microscopy with great enhancement in DOF for fast histology imaging. Photoacoustics 32, 100525 (2023). 25. Zhang, C. et al. High resolution UV spectral imaging and bio-detection with magnetic dipole quasi-BIC resonant dielectric metasurfaces. Opt. Commun. 530, 129173 (2023). 26. Kim, J. et al. 8″ wafer-scale, centimeter-sized, high-efficiency metalenses in the ultraviolet. Mater. Today 73, 9–15 (2024). 27. Zhang, C. et al. Tantalum pentoxide: a new material platform for high- performance dielectric metasurface optics in the ultraviolet and visible region. Light Sci. Appl. 13, 23 (2024). 28. Huang, K. et al. Ultraviolet metasurfaces of ≈80% efficiency with anti- ferromagnetic resonances for optical vectorial anti-counterfeiting. Laser Pho- tonics Rev. 13, 1800289 (2019). 29. Day, R. N. & Davidson, M. W. The fluorescent protein palette: tools for cellular imaging. Chem. Soc. Rev. 38, 2887–2921 (2009). 30. Sharma, B. et al. Aluminum film-over-nanosphere substrates for deep-UV surface-enhanced resonance Raman spectroscopy. Nano Lett. 16, 7968–7973 (2016). 31. Oh, D. K. et al. Nanoimprint lithography for high-throughput fabrication of metasurfaces. Front. Optoelectron. 14, 229–251 (2021). 32. Einck, V. J. et al. Scalable nanoimprint lithography process for manufacturing visible metasurfaces composed of high aspect ratio TiO2 meta-atoms. ACS Photonics 8, 2400–2409 (2021). 33. Ko, B. et al. Tunable metasurfaces via the humidity responsive swelling of single-step imprinted polyvinyl alcohol nanostructures. Nat. Commun. 13, 6256 (2022). 34. Gupta, V. et al. Nanoimprint lithography facilitated plasmonic-photonic cou- pling for enhanced photoconductivity and photocatalysis. Adv. Funct. Mater. 31, 2105054 (2021). 35. Li, H. et al. Disposable ultrasound-sensing chronic cranial window by soft nanoimprinting lithography. Nat. Commun. 10, 4277 (2019). 36. Higashihara, T. & Ueda, M. Recent progress in high refractive index polymers. Macromolecules 48, 1915–1929 (2015). 37. Jo, H. B. et al. Fabrication of ZnO nano-structures using UV nanoimprint lithography of a ZnO nano-particle dispersion resin. J. Mater. Chem. 22, 20742–20746 (2012). 38. Choi, J. H. et al. Fabrication of TiO2 nano-to-microscale structures using UV nanoimprint lithography. Nanotechnology 24, 195301 (2013). 39. Kothari, R. et al. Direct patterning of robust one-dimensional, two-dimensional, and three-dimensional crystalline metal oxide nanostructures using imprint lithography and nanoparticle dispersion inks. Chem. Mater. 29, 3908–3918 (2017). 40. Yang, Y. et al. Integrated metasurfaces for re-envisioning a near-future dis- ruptive optical platform. Light Sci. Appl. 12, 152 (2023). 41. Kuznetsov, A. I. et al. Roadmap for optical metasurfaces. ACS Photonics 11, 816–865 (2024). 42. Seong, J. et al. Cost-effective and environmentally friendly mass manufactur- ing of optical metasurfaces. Int. J. Precis. Eng. Manuf.-Green Technol. 11, 685–706 (2024). 43. Moon, S. et al. Wafer-scale manufacturing of near-infrared metalenses. Laser Photonics Rev. 18, 2300929 (2024). 44. Kim, J. et al. Metasurface holography reaching the highest efficiency limit in the visible via one-step nanoparticle-embedded-resin printing. Laser Photonics Rev. 16, 2200098 (2022). 45. Yoon, G. et al. Printable nanocomposite metalens for high-contrast near- infrared imaging. ACS Nano 15, 698–706 (2021). 46. Kim, J. et al. One-step printable platform for high-efficiency metasurfaces down to the deep-ultraviolet region. Light Sci. Appl. 12, 68 (2023). 47. Shrestha, S., Wang, B. & Dutta, P. Nanoparticle processing: Understanding and controlling aggregation. Adv. Colloid Interface Sci. 279, 102162 (2020). 48. Younes, H. et al. Nanofluids: Key parameters to enhance thermal conductivity and its applications. Appl. Therm. Eng. 207, 118202 (2022). 49. Kim, L. et al. Contact printing of quantum dot light-emitting devices. Nano Lett. 8, 4513–4517 (2008). 50. Carlson, A. et al. Transfer printing techniques for materials assembly and micro/nanodevice fabrication. Adv. Mater. 24, 5284–5318 (2012). 51. Lee, J. N. et al. Solvent compatibility of poly (dimethylsiloxane)-based micro- fluidic devices. Anal. Chem. 75, 6544–6554 (2003). 52. Chen, J. et al. Solvent effects on polymer surface structure. Surf. Interface Anal. 31, 713–720 (2001). Kang et al. Microsystems & Nanoengineering (2024) 10:53 Page 8 of 8

Title: Tailoring high-refractive-index nanocomposites for manufacturing of ultraviolet metasurfaces ​ Authors: Hyunjung Kang, Dongkyo Oh, Nara Jeon, Joohoon Kim, Hongyoon Kim, Trevon Badloe, Junsuk Rho ​ Publisher: Microsystems & Nanoengineering Date: 2024-04-22 00:00:00 Abstract: Nanoimprint lithography (NIL) has been utilized to address the manufacturing challenges of high cost and low throughput for optical metasurfaces. ​ To overcome the limitations inherent in conventional imprint resins characterized by a low refractive index (n), high-n nanocomposites have been introduced to directly serve as meta-atoms. ​ However, comprehensive research on these nanocomposites is notably lacking. ​ In this study, we focus on the composition of high-n zirconium dioxide (ZrO2) nanoparticle (NP) concentration and solvents used to produce ultraviolet (UV) metaholograms and quantify the transfer fidelity by the measured conversion efficiency. ​ The utilization of 80 wt% ZrO2 NPs in MIBK, MEK, and acetone results in conversion efficiencies of 62.3%, 51.4%, and 61.5%, respectively, at a wavelength of 325 nm. ​ The analysis of the solvent composition and NP concentration can further enhance the manufacturing capabilities of high-n nanocomposites in NIL, enabling potential practical use of optical metasurfaces. ​

Elasto-inertial microfluidic separation of microspheres with submicron resolution at high-throughput (1).pdf

Jeon et al. Microsystems & Nanoengineering (2024) 10:15 Microsystems & Nanoengineering https://doi.org/10.1038/s41378-023-00633-w www.nature.com/micronano A R T I C L E O p e n A c c e s s Elasto-inertial microfluidic separation of microspheres with submicron resolution at high-throughput Hyunwoo Jeon1, Song Ha Lee1, Jongho Shin2, Kicheol Song2, Nari Ahn2 and Jinsoo Park1✉ Abstract Elasto-inertial microfluidic separation offers many advantages including high throughput and separation resolution. Even though the separation efficiency highly depends on precise control of the flow conditions, no concrete guidelines have been reported yet in elasto-inertial microfluidics. Here, we propose a dimensionless analysis for precise estimation of the microsphere behaviors across the interface of Newtonian and viscoelastic fluids. Reynolds number, modified Weissenberg number, and modified elastic number are used to investigate the balance between inertial and elastic lift forces. Based on the findings, we introduce a new dimensionless number defined as the width of the Newtonian fluid stream divided by microsphere diameter. The proposed dimensionless analysis allows us to predict whether the microspheres migrate across the co-flow interface. The theoretical estimation is found to be in good agreement with the experimental results using 2.1- and 3.2-μm-diameter polystyrene microspheres in a co-flow of water and polyethylene oxide solution. Based on the theoretical estimation, we also realize submicron separation of the microspheres with 2.1 and 2.5 μm in diameter at high throughput, high purity (>95%), and high recovery rate (>97%). The applicability of the proposed method was validated by separation of platelets from similar-sized Escherichia coli (E.coli). Introduction Sample preparation is an essential step in the overall chemical analysis process; it improves analytical results by enriching the target material or removing contaminants before analysis1. Particle manipulation techniques have received increasing research attention owing to their applications in sample filtration2, flow cytometry3, and separation4. Various microfluidic manipulation techni- ques with high throughput, resolution, and efficiency have been developed. In particular, regarding resolution, techniques for the precise sample separation such as red blood cells (7–8 μm)5, platelets (1.5–3 μm)6, and bacteria (1–3 μm)7 are highly required. However, the submicron- resolution separation of micro-objects is difficult because most of the forces moving the particles in the lateral direction are proportional to the sample size8. Polymer microspheres have been widely utilized as model objects for bio-particles9,10. Passive manipulation techniques rely on internal hydrodynamic forces acting on suspended objects, whereas in active techniques, forces are applied to the objects from external actuation devices. The typical examples of the passive techniques include inertial flow focusing based on fluid inertial force11,12, pinched flow13 and Dean flow fractionation based on Dean drag force generated in curved pipes14,15, and deterministic lateral displacement (DLD) based on the streamline of flow along the structures16. These techni- ques allow simple device configuration and manipulation, offer high single-chip throughput, and enable paralleli- zation. However, numerous parameters such as the microchannel geometry, fluid properties, and flow con- ditions need to be strictly tuned; otherwise, the accuracy of sample separation, efficiency, and throughput may be © The Author(s) 2024 OpenAccessThisarticleislicensedunderaCreativeCommonsAttribution4.0InternationalLicense,whichpermitsuse,sharing,adaptation,distributionandreproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Correspondence: Jinsoo Park ([email protected]) 1Department of Mechanical Engineering, Chonnam National University, 77 Yongbong-ro Buk-gu, Gwangju 61186, Republic of Korea 2Analytical Engineering Team, Samsung Display Co., Ltd., 181 Samsung-ro, Tangjeong-myeon, Asan-si, Chungcheongnam-do 31454, Republic of Korea 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; compromised. Conversely, in active techniques, opto- phoresis17, dielectrophoresis18, magnetophoresis19, and acoustophoresis20 are applied to manipulate the target samples in an on-demand manner. Despite high precision, the device configuration and parallelization are complex, and high-cost and sophisticated equipment are usually required compared to the passive approaches. Elasto-inertial microfluidics using viscoelastic fluids can offer a breakthrough by providing increased sample manipulation performance in addition to the advantages of conventional inertial microfluidics. In a viscoelastic fluid flow, the difference in the non-uniform normal stress acting on the suspended objects generates an elastic lift force (Fel), an additional force that enables the lateral migration of the object21–23. Micro-objects, mostly on microspheres, manipulation studies using viscoelastic fluids24–26 have achieved a single equilibrium position of the microspheres9,27, in contrast with conventional iner- tial microfluidics, where particles have more than two equilibrium positions28. Moreover, elasto-inertial micro- fluidic separation using a co-flow of Newtonian and vis- coelastic fluids have been recently conducted to improve the sample separation performance29–34. The co-flow allows the wall-induced lift force (Fw) and shear-gradient lift force (Fs), which drive the lateral displacement of the particles suspended in the Newtonian fluid, to promote or suppress the migration of the particles owing to the generation of Fel; this force can be used to increase the separation resolution. To identify the correlation between these forces under various flow conditions, dimensionless numbers can be applied. In general, in the co-flow of Newtonian and viscoelastic fluids, Reynolds number (Re)29, Weissenberg number (Wi)35, and elastic number (El = Wi/Re)29,36 have been previously applied for theo- retical analysis. However, from the viewpoint of particle behaviors, we found that these dimensionless numbers have limitations, especially in the co-flow configuration of elasto-inertial microfluidics. In this study, we introduced modified Wi (Wim) and modified El (Elm = Wim/Re) for investigation of the microsphere lateral migration across the interface of Newtonian and viscoelastic fluids. For thorough valida- tion, we conduct a series of experiments with polystyrene (PS) particles with diameters of 2.1 and 3.2 μm under varying flow conditions, in which the proposed modified El is found to provide a better understanding of the sus- pended object behavior in the co-flow elasto-inertial microfluidics. We further introduce a new dimensionless number defined as the Newtonian fluid stream width divided by the microsphere diameter. Based on this dimensionless number, we determine three regimes of inertial focusing, elasto-inertial transition, and elastic focusing for the lateral migration of microspheres from Newtonian to viscoelastic fluids across the interface. Based on theoretical findings, we could precisely predict the microsphere behavior and thus achieve the submicron separation of the PS microspheres with diameters of 2.1 and 2.5 μm, as well as 2.5 and 3.2 μm at high throughput, high purity, and high recovery rate. The proposed elasto- inertial microfluidic separation was applied for separation of similar-sized bio-particles: platelets and Escherichia coli (E. Coli) to validate the practical applicability. Working mechanism Device configuration and elasto-inertial separation of microspheres Figure 1a schematizes the microfluidic device, com- posed of two inlet ports and three outlet ports, for the elasto-inertial separation of microspheres. A sample fluid (DI water solution with suspended PS microspheres) and a sheath fluid (dilute polyethylene oxide (PEO) solution) were introduced through inlets 1 and 2, respectively. The sample fluid flow, represented in sky blue in Fig. 1, was bifurcated at the upstream to sandwich the sheath fluid in the center, presented in orange, at midstream to form a three-layered co-flow of the sample/sheath/sample fluids. Figure 1b represents the sequential transfer of the microspheres along the microchannel in the regions i–iv marked in Fig. 1a. The microspheres suspended in the Newtonian fluid are initially aligned along the two side- walls of the microchannel by the viscoelastic sheath fluid flow (Fig. 1b (i)). The microspheres near the walls experience a wall-induced lift force (Fw) owing to the increased pressure between the wall and the microspheres and consequently migrate away from the wall toward the Newtonian/viscoelastic fluid interface. Because Fw is proportional to the microsphere diameter (d) such that Fw ∝d6, the larger microspheres experience Fw with greater magnitude and thus migrate faster away from the wall compared with the smaller microspheres (Fig. 1b (ii))37. The larger microspheres positioned across the New- tonian/viscoelastic fluid interface begin to experience an elastic lift force (Fel) induced by the elastic effect of the viscoelastic fluid. The elastic lift force can be expressed as Fel = Celd3∇N1, where Cel is the elastic lift coefficient, N1 = σxx – σyy is the first normal stress difference, and σxx and σyy are the stress tensor of the normal and transverse directions in the fluid flow, respectively. The first normal stress difference can be expressed as N1 = 2μpλγ̇2, where μp is the polymeric contribution to the solution viscosity, λ is the relaxation time, and γ̇ is the average fluid shear rate obtained using the Oldroyd-B constitutive model38. Fel acts toward the side wall when the majority of the microspheres are located in the Newtonian fluid (Fig. 1b (ii)), whereas it acts toward the microchannel center when the majority of the microspheres are located in the vis- coelastic fluid (Fig. 1b (iii))33. The smaller microspheres approach the Newtonian/viscoelastic fluid interface after Jeon et al. Microsystems & Nanoengineering (2024) 10:15 Page 2 of 14 precise prediction of the microsphere migration phe- nomenon across a co-flow of Newtonian and viscoelastic fluids. The proposed analysis is based on Reynolds num- ber, modified Weissenberg number, modified elastic number, and newly introduced dimensionless number defined as the Newtonian fluid width divided by the microsphere diameter. Using these dimensionless num- bers, we categorize the elasto-inertial microsphere lateral migration phenomenon into three regimes of inertial focusing, elasto-inertial transition, and elastic focusing based on particle equilibrium positions with reference to a co-flow interface of Newtonian and viscoelastic fluids. We experimentally validated the proposed analysis method with 2.1 and 3.2 μm PS microspheres under various flow conditions. We found that our estimation method can better characterize the microsphere lateral migration in elasto-inertial microfluidics. In addition to high-efficiency (>99%) separation of 2.1 and 3.2 μm microspheres, we further achieved the submicron-resolution separation of 2.1 and 2.5 μm, as well as 2.5 and 3.2 μm, PS microspheres at high throughput, purity, and recovery rate. For valida- tion of practical applicability, we applied the proposed method for separation of similar-sized bio-particles: pla- telets from E. coli. We believe that the proposed dimen- sionless analysis can provide guidelines for the successful working conditions and estimation prior to experiments in the field of elasto-inertial microfluidic sample separa- tion and purification. Experimental section Device fabrication A master mold to fabricate Polydimethylsiloxane (PDMS) microchannels was prepared by a photo- lithography process using a negative photoresist E. coli Platelet Purity Recovery rate E. coli Platelet Performance (%) Minor axis (m) Major axis (m) E. coli 10.0kV 10.1mm×5.00k SE(UL) 10.0kV 10.2mm×5.00k SE(UL) 10.0um 10.0um Platelet 5 4 3 2 1 0 100 75 50 25 0 0 1 2 3 4 5 6 e d b a c Side outlet Center outlet Fluorescent image Fluorescent image Filtered image Filtered image E. coli only Platelet only Fig. 7 Escherichia coli and Platelet separaion. a Scanning electron microscope images of E. coli on the left side and platelet on the right side. b The length of major and minor axis of E. coli (black circle) and platelet (red circle). c The trajectories of E. coli and platelet under volumetric flow rate condition of Qn = 10 μL min−1 and Qve = 50 μL min−1. E. coli and platelet move toward the side outlet and center outlet, respectively. Scale bar = 100 μm. d The efficiencies of E. coli and platelet separation in terms of purity and recovery rate. e The hemocytometer images of E. coli and platelet collected from the side outlet and center outlet. Scale bar = 50 μm Jeon et al. Microsystems & Nanoengineering (2024) 10:15 Page 12 of 14 (SU-2050, Kayaku, japan). The microchannel with a rec- tangular cross-section was fabricated by a soft lithography replica molding process. The PDMS base and curing agent (Sylard 184 A and 184B, Dow Corning, USA) were mixed in a ratio of 10:1 (w/w%), poured into the master mold, and left in an oven at 80 °C for 2 h. The PDMS stamp, in which the microchannel was patterned, was bonded with a slide glass by oxygen plasma bonding (Covance, Femto Science, Korea). The microfluidic chip was placed in an oven at 65 °C for 2 h to further enhance the bonding strength. The main-microchannel was fabricated with a uniform height of 50 μm. The midstream microchannel, where the Newtonian and viscoelastic fluid co-flow is formed, was designed with a width of 20 μm. The channel length for the particles to have the equilibrium position in a rec- tangular channel was calculated by Lf = πμh2/ρUmd2Cli— where Um is the maximum flow velocity37—to be 11.87 mm at the slowest flow condition (Qtotal = 2 μL min−1) and the smallest particle diameter (d = 2.1 μm) used in this experiment. The length of the midstream microchannel L was designed to be 15 mm so that all particles have the equilibrium position in the channel. In this study, we approximated that each particle has an equilibrium position under all flow conditions. Sample preparation Two types of viscoelastic fluid with a concentration of 100 ppm were prepared by mixing PEO (Mw = 600 kDa, Sigma Aldrich, USA) powder in DI water for microsphere separation and 1× phosphate buffered saline (PBS) for bio-particle separation. The PEO solution was used after mixing with a magnetic stirrer for more than 24 h to ensure the complete dissolution of the PEO powder. Relaxation time of the 100 ppm PEO solution was obtained by the empirical formula λ = 18λZ(c/c*)0.65 (ref. 43). Overlapping concentration is expressed as c* = 0.77/[μ], and Zimm relaxation time λZ = F[μ]Mwμs/ NAkBT—where F is the pre-factor 0.463, μs is the solution viscosity, NA is Avogadro’s number, and kB is Boltzmann’s constant—is determined according to Zimm’s theory44,45. The theoretical values of c* and λZ can be obtained using the intrinsic viscosity [μ] = 0.072Mw 0.65 for the PEO solution according to the Mark–Houwink relationship46. The λ value of the 100-ppm PEO solution was calculated as 0.123 ms. We used the theoretical viscosity value of 100-ppm PEO solution for universal application of dimensionless analysis. The viscosity of PEO solution was calculated by 1.041 mPa∙s using polymer solution viscosity formula μ = μs + μp where μs is the solvent viscosity and μp = [μ]cμs is the polymeric contribution to the viscosity. The density of the synthesized PEO solution was mea- sured using a density meter (DMA 35 Basic, Anton Paar, Austria). The microsphere sample fluid was prepared by mixing PS particles with DI water. For particle trajectory analysis, the sample fluids were the mixture of d = 2.1 μm (green fluorescent particle, Thermo Fisher, USA) and 3.2 μm (red fluorescent particle, Thermo Fisher, USA) particles. Each sample used for submicron-resolution particle separation was mixed with d = 2.1 vs 2.5 μm (non-fluorescent par- ticle, Thermo Fisher, USA) and 2.5 vs 3.2 μm particles. In all sample fluids, the concentration of each sized particle was 1 × 107 particles mL−1, and the final particle con- centration of the sample fluid was 2 × 107 particles mL−1. For all microsphere sample fluids, Tween 20 (Sigma Aldrich, USA) was mixed at a concentration of 0.1 v/v% to prevent particle aggregation. Optionally, PEO coating inside the microchannel47 and device manufacture with copolymers PDMS-polyethylene glycol48 could be used to prevent adsorption of particles to the channel walls, but these methods were not used in this study due to the sufficient Re. The platelets were provided from the Kor- ean Red Cross and stored in shaker-incubator (ES-20, Grant bio, UK) at 22 °C. Before the experiments, the platelets were dyed with red fluorescence by using an antibody labeling kit (Alexa FluorTM 568, Invitrogen, USA) and diluted 20 times with 1× PBS. The E. coli sample was cultured in a sterilized Luria-Bertani (LB) broth (L2542, Sigma Aldrich, USA) on a shaker-incubator at 37 °C for 24 h and diluted 10 times with 1× PBS. Flow visualization and measurements The Newtonian/viscoelastic fluid interface was visua- lized by dispersing d = 300 nm (red fluorescent, Thermo Fisher, USA) PS particles in DI water at a concentration of 1 × 108 particles mL−1. PS particles with d = 300 nm were injected in the direction of inlet 1 using a syringe pump (neMESYS Cetoni GmbH, Germany). Under the experi- mental conditions of this study, nanoparticles cannot migrate in the direction of the viscoelastic fluid owing to the Fel caused by the PEO solution. In addition, the Newtonian/viscoelastic fluid interface was measured at 100 μm near the upstream of the midstream micro- channel. Therefore, the diffusion effect was not con- sidered. Visualized images were precisely captured with a resolution of 0.0562 μm pixel−1 using an inverted microscope (IX73, Olympus, Japan), a CCD camera (E3ISPM, RisingCam, Japan). Microsphere trajectories were observed at the down- stream of the microchannel using an inverted microscope and captured via a high-speed camera (VEO 710 L, Phantom, USA). Images of the submicron-resolution separation were obtained by simultaneously using a halogen lamp and a mercury lamp, with fluorescent par- ticles (2.1 and 3.2 μm) showing white color and non- fluorescent mono particles (2.5 μm) showing black color (Fig. 6a). Jeon et al. Microsystems & Nanoengineering (2024) 10:15 Page 13 of 14 Acknowledgements This work was supported in part by Samsung Display Company Ltd. and in part by the National Research Foundation of Korea (NRF) grants funded by the Korean government (MSIT) (Nos. RS-2023-00210891 and 2020R1A5A8018367). Author contributions H.J. and J.P. initiated and conceived the proof-of-concept experiments; H.J. designed and fabricated the microchannel; H.J., J.S., K.S., N.A., and J.P. characterized the devices and analyzed the results; H.J. and S.L. performed bio- particle experiments; H.J. and J.P. wrote the manuscript. All authors reviewed the manuscript. Competing interests The authors declare no competing interests. Supplementary information The online version contains supplementary material available at https://doi.org/10.1038/s41378-023-00633-w. Received: 30 May 2023 Revised: 23 October 2023 Accepted: 8 November 2023 References 1. Hyötyläinen, T. Critical evaluation of sample pretreatment techniques. Anal. Bioanal. Chem. 394, 743–758 (2009). 2. Broyles, B. S., Jacobson, S. C. & Ramsey, J. M. Sample filtration, concentration, and separation integrated on microfluidic devices. Anal. Chem. 75, 2761–2767 (2003). 3. Olsen, L. R., Leipold, M. D., Pedersen, C. B. & Maecker, H. T. The anatomy of single cell mass cytometry data. Cytom. A 95, 156–172 (2019). 4. Smith, R. M. Before the injection—modern methods of sample preparation for separation techniques. J. Chromatogr. A 1000, 3–27 (2003). 5. Roggan, A., Friebel, M., Do¨rschel, K., Hahn, A. & Mu¨ller, G. Optical properties of circulating human blood in the wavelength range 400–2500 nm. J. Biomed. Opt. 4, 36–46 (1999). 6. Robier, C. Platelet morphology. J. Lab. Med. 44, 231–239 (2020). 7. Reshes, G., Vanounou, S., Fishov, I. & Feingold, M. Cell shape dynamics in Escherichia coli. Biophys. J. 94, 251–264 (2008). 8. Song, Y., Li, D. & Xuan, X. Recent advances in multimode microfluidic separation of particles and cells. Electrophoresis 44, 910–937 (2023). 9. Zhou, J. & Papautsky, I. Viscoelastic microfluidics: progress and challenges. Microsyst. Nanoeng. 6, 113 (2020). 10. Zhang, J. et al. Fundamentals and applications of inertial microfluidics: a review. Lab Chip 16, 10–34 (2016). 11. Bhagat, A. A. S., Kuntaegowdanahalli, S. S. & Papautsky, I. Enhanced particle filtration in straight microchannels using shear-modulated inertial migration. Phys. Fluids 20, 101702 (2008). 12. Wang, X., Zandi, M., Ho, C.-C., Kaval, N. & Papautsky, I. Single stream inertial focusing in a straight microchannel. Lab Chip 15, 1812–1821 (2015). 13. Lu, X. & Xuan, X. Inertia-enhanced pinched flow fractionation. Anal. Chem. 87, 4560–4565 (2015). 14. Bhagat, A. A. S., Kuntaegowdanahalli, S. S. & Papautsky, I. Continuous particle separation in spiral microchannels using dean flows and differential migration. Lab Chip 8, 1906–1914 (2008). 15. Zhou, Y., Ma, Z. & Ai, Y. Sheathless inertial cell focusing and sorting with serial reverse wavy channel structures. Microsyst. Nanoeng. 4, 5 (2018). 16. Huang, L. R., Cox, E. C., Austin, R. H. & Sturm, J. C. Continuous particle separation through deterministic lateral displacement. Science 304, 987–990 (2004). 17. Ren, Y. et al. Plasmonic optical tweezers for particle manipulation: principles, methods, and applications. ACS Nano 15, 6105–6128 (2021). 18. Chen, Q. & Yuan, Y. J. A review of polystyrene bead manipulation by dielec- trophoresis. RSC Adv. 9, 4963–4981 (2019). 19. Alnaimat, F., Dagher, S., Mathew, B., Hilal-Alnqbi, A. & Khashan, S. Microfluidics based magnetophoresis: a review. Chem. Rec. 18, 1596–1612 (2018). 20. Destgeer, G. et al. Microchannel anechoic corner for size-selective separation and medium exchange via traveling surface acoustic waves. Anal. Chem. 87, 4627–4632 (2015). 21. Ho, B. P. & Leal, L. G. Migration of rigid spheres in a two-dimensional uni- directional shear flow of a second-order fluid. J. Fluid Mech. 76, 783–799 (1976). 22. D’Avino, G., Maffettone, P. L., Greco, F. & Hulsen, M. A. Viscoelasticity-induced migration of a rigid sphere in confined shear flow. J. Non-Newton. Fluid Mech. 165, 466–474 (2010). 23. Leshansky, A. M., Bransky, A., Korin, N. & Dinnar, U. Tunable nonlinear viscoe- lastic “focusing” in a microfluidic device. Phys. Rev. Lett. 98, 234501 (2007). 24. Nam, J. et al. Microfluidic device for sheathless particle focusing and separa- tion using a viscoelastic fluid. J. Chromatogr. A 1406, 244–250 (2015). 25. Li, D., Lu, X. & Xuan, X. Viscoelastic separation of particles by size in straight rectangular microchannels: a parametric study for a refined understanding. Anal. Chem. 88, 12303–12309 (2016). 26. Yang, S. H., Lee, D. J., Youn, J. R. & Song, Y. S. Multiple-line particle focusing under viscoelastic flow in a microfluidic device. Anal. Chem. 89, 3639–3647 (2017). 27. Seo, K. W., Byeon, H. J., Huh, H. K. & Lee, S. J. Particle migration and single-line particle focusing in microscale pipe flow of viscoelastic fluids. RSC Adv. 4, 3512–3520 (2014). 28. Di Carlo, D. Inertial microfluidics. Lab Chip 9, 3038–3046 (2009). 29. Nam, J., Lim, H., Kim, D., Jung, H. & Shin, S. Continuous separation of micro- particles in a microfluidic channel via the elasto-inertial effect of non- Newtonian fluid. Lab Chip 12, 1347–1354 (2012). 30. Ha, B., Park, J., Destgeer, G., Jung, J. H. & Sung, H. J. Transfer of microparticles across laminar streams from non-Newtonian to Newtonian Fluid. Anal. Chem. 88, 4205–4210 (2016). 31. Tian, F. et al. Label-free isolation of rare tumor cells from untreated whole blood by interfacial viscoelastic microfluidics. Lab Chip 18, 3436–3445 (2018). 32. Liu, P. et al. Separation and enrichment of yeast saccharomyces cerevisiae by shape using viscoelastic microfluidics. Anal. Chem. 93, 1586–1595 (2021). 33. Tian, F. et al. Microfluidic co-flow of Newtonian and viscoelastic fluids for high- resolution separation of microparticles. Lab Chip 17, 3078–3085 (2017). 34. Zhang, T. et al. Microfluidic separation and enrichment of Escherichia coli by size using viscoelastic flows. Anal. Chem. 95, 2561–2569 (2023). 35. D’Avino, G. & Maffettone, P. L. Particle dynamics in viscoelastic liquids. J. Non- Newton. Fluid Mech. 215, 80–104 (2015). 36. Denn, M. M. Fifty years of non-Newtonian fluid dynamics. AICHE J. 50, 2335–2345 (2004). 37. Amini, H., Lee, W. & Di Carlo, D. Inertial microfluidic physics. Lab Chip 14, 2739–2761 (2014). 38. James, D. F. Boger fluids. Annu. Rev. Fluid Mech. 41, 129–142 (2009). 39. Di Carlo, D., Edd, J. F., Humphry, K. J., Stone, H. A. & Toner, M. Particle segre- gation and dynamics in confined flows. Phys. Rev. Lett. 102, 094503 (2009). 40. Zhou, J. & Papautsky, I. Fundamentals of inertial focusing in microchannels. Lab Chip 13, 1121–1132 (2013). 41. Pitt, W. G. et al. Rapid separation of bacteria from blood—review and outlook. Biotechnol. Prog. 32, 823–839 (2016). 42. Kim, J., Campbell, A. S., de Ávila, B. E.-F. & Wang, J. Wearable biosensors for healthcare monitoring. Nat. Biotechnol. 37, 389–406 (2019). 43. Tirtaatmadja, V., McKinley, G. H. & Cooper-White, J. J. Drop formation and breakup of low viscosity elastic fluids: effects of molecular weight and con- centration. Phys. Fluids 18, 043101 (2006). 44. Graessley, W. W. Polymer chain dimensions and the dependence of viscoe- lastic properties on concentration, molecular weight and solvent power. Polymer 21, 258–262 (1980). 45. Zimm, B. H. Dynamics of polymer molecules in dilute solution: viscoelasticity, flow birefringence and dielectric loss. J. Chem. Phys. 24, 269–278 (1956). 46. Rodd, L. E., Scott, T. P., Boger, D. V., Cooper-White, J. J. & McKinley, G. H. The inertio-elastic planar entry flow of low-viscosity elastic fluids in micro- fabricated geometries. J. Non-Newton. Fluid Mech. 129, 1–22 (2005). 47. Lee, S. H., Cha, B., Ko, J., Afzal, M. & Park, J. Acoustofluidic separation of proteins from platelets in human blood plasma using aptamer-functionalized micro- particles. Biomicrofluidics 17, 024105 (2023). 48. Gökaltun, A., Kang, Y. B., Yarmush, M. L., Usta, O. B. & Asatekin, A. Simple surface modification of poly(dimethylsiloxane) via surface segregating smart polymers for biomicrofluidics. Sci. Rep. 9, 7377 (2019). Jeon et al. Microsystems & Nanoengineering (2024) 10:15 Page 14 of 14

Title: Elasto-inertial microfluidic separation of microspheres with submicron resolution at high-throughput ​ Authors: Hyunwoo Jeon, SongHa Lee, Jongho Shin, Kicheol Song, Nari Ahn, Jinsoo Park ​ Publisher: Microsystems & Nanoengineering, Nature Publishing Group ​ Date: 22 January 2024​ Abstract: Elasto-inertial microfluidic separation offers many advantages including high throughput and separation resolution. ​ Even though the separation efficiency highly depends on precise control of the flow conditions, no concrete guidelines have been reported yet in elasto-inertial microfluidics. ​ Here, we propose a dimensionless analysis for precise estimation of the microsphere behaviors across the interface of Newtonian and viscoelastic fluids. ​ Reynolds number, modified Weissenberg number, and modified elastic number are used to investigate the balance between inertial and elastic lift forces. ​ Based on the findings, we introduce a new dimensionless number defined as the width of the Newtonian fluid stream divided by microsphere diameter. ​ The proposed dimensionless analysis allows us to predict whether the microspheres migrate across the co-flow interface. ​ The theoretical estimation is found to be in good agreement with the experimental results using 2.1-and 3.2-μm-diameter polystyrene microspheres in a co-flow of water and polyethylene oxide solution. ​ Based on the theoretical estimation, we also realize submicron separation of the microspheres with 2.1 and 2.5 μm in diameter at high throughput, high purity (>95%), and high recovery rate (>97%). ​ The applicability of the proposed method was validated by separation of platelets from similar-sized Escherichia coli (E. coli).

High-angle deflection of metagrating-integrated laser emission for high-contrast microscopy (1).pdf

Juodėnas et al. Light: Science & Applications (2023) 12:251 Official journal of the CIOMP 2047-7538 https://doi.org/10.1038/s41377-023-01286-0 www.nature.com/lsa A R T I C L E O p e n A c c e s s High-angle deflection of metagrating-integrated laser emission for high-contrast microscopy Mindaugas Juodėnas 1✉, Erik Strandberg2, Alexander Grabowski 2, Johan Gustavsson2, Hana Šípová-Jungová1, Anders Larsson2 and Mikael Käll 1✉ Abstract Flat metaoptics components are looking to replace classical optics elements and could lead to extremely compact biophotonics devices if integrated with on-chip light sources and detectors. However, using metasurfaces to shape light into wide angular range wavefronts with high efficiency, as is typically required in high-contrast microscopy applications, remains a challenge. Here we demonstrate curved GaAs metagratings integrated on vertical-cavity surface-emitting lasers (VCSELs) that enable on-chip illumination in total internal reflection and dark field microscopy. Based on an unconventional design that circumvents the aspect ratio dependent etching problems in monolithic integration, we demonstrate off-axis emission centred at 60° in air and 63° in glass with > 90% and > 70% relative deflection efficiency, respectively. The resulting laser beam is collimated out-of-plane but maintains Gaussian divergence in-plane, resulting in a long and narrow illumination area. We show that metagrating-integrated VCSELs of different kinds can be combined to enable rapid switching between dark-field and total internal reflection illumination. Our approach provides a versatile illumination solution for high-contrast imaging that is compatible with conventional microscopy setups and can be integrated with biophotonics devices, such as portable microscopy, NIR-II range bioimaging, and lab-on-a-chip devices. Introduction Wavefront engineering using collections of sub- wavelength nanostructures—or metasurfaces—started with simple demonstrations of lensing and anomalous refraction1,2 but has now evolved toward a variety of complex applications, including ranging3, polarization imaging4, holography5, optical manipulation6, and non- linear photonics7. However, metaoptics are so far mostly used as stand-alone components, even though one of the most enticing advantages over traditional optics—fabri- cation process compatibility—intuitively suggests direct integration with optoelectronic devices. Indeed, recent reports demonstrated such integration on LED8, OLED displays9, and semiconductor lasers10. One application area that could significantly benefit from further progress in this direction is optical biosensing and microscopy, which still heavily rely on bulky external components such as lasers and compound microscopes. Flat metaop- tics integrated with on-chip light sources, detectors, and microfluidics, could lead to extremely compact and cost- effective biophotonics devices able to drastically facilitate life-science research and applications. In recent years, the field of biophotonics has placed significant emphasis on label-free techniques for analyz- ing individual nanoscopic objects like biological nano- particles, biomacromolecules, and drug carriers, primarily utilizing light scattering methods11–15. The scattering cross-section of sub-wavelength particles decreases rapidly with decreasing particle size, which necessitates efficient reduction of background caused by unscattered light. The traditional means of achieving this are various types of dark-field (DF) or total internal reflection (TIR) © The Author(s) 2023 OpenAccessThisarticleislicensedunderaCreativeCommonsAttribution4.0InternationalLicense,whichpermitsuse,sharing,adaptation,distributionandreproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Correspondence: Mindaugas Juodėnas ([email protected]) or Mikael Käll ([email protected]) 1Department of Physics, Chalmers University of Technology, 412 96 Gothenburg, Sweden 2Department of Microtechnology and Nanoscience, Chalmers University of Technology, 412 96 Gothenburg, Sweden 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; illumination setups based on ultrahigh numerical aperture (NA) immersion optics or waveguides coupled to bulky external light sources16–18. Full integration of a miniature light source into a planar chip for such high-contrast illumination has not yet been demonstrated, though a recent report on metasurface-coupled TIR microscopy based on an external light source indicates its feasibility19. In this work, we present curved metagratings mono- lithically integrated on vertical cavity surface-emitting lasers (VCSELs) with the aim to produce efficient emis- sion at high deflection angles for high-contrast DF and TIR microscopy (Fig. 1). The VCSEL is a semiconductor emitter that, because of its high efficiency and suitability for wafer-scale produc- tion, is widely used in face recognition, proximity sensors, augmented reality, among other applications. VCSELs are well-suited for monolithic integration with metasurfaces because they can be designed for single-mode emission normal to the epitaxial structure of the chip, which means that the beam shaping structure can be easily integrated in the process flow for fabrication of bottom-emitting VCSELs on transparent substrates. There have been sev- eral reports on structures etched into the VCSEL facet that modify its emission, for example into beam arrays20, orbital angular momentum beams21, and deflected cir- cularly polarized beams22. Nanostructures have also been integrated with the mirrors of the VCSEL cavity to pro- vide both optical feedback and to generate orbital angular momentum23 or circularly polarized output24. The most widely used and the most general form of a beam shaping metastructure is a phase-gradient meta- surface. It consists of discrete building blocks placed on the nodes of a uniform, subwavelength lattice by matching their calculated phase and amplitude response to the phase map of the intended functionality. Pioneering results on monolithic integration of such phase-gradient metaoptics and VCSELs was provided by Genevet and co- workers25–27. They showed on-chip beam shaping, including collimation, deflection, Bessel and OAM beam generation, etc. The phase mapping approach works well in the paraxial regime, where angles of deflection are small, but it fails at high deflection angles. In such high NA conditions, the spatial extent that encompasses a 2π linear phase gradient becomes comparable to the sub- wavelength unit cell size of the metasurface, leading to either insufficient or varying spatial sampling rate28. It is in principle possible to circumvent this problem by optimizing a full (2π phase space) super-unit cell28,29, but this approach generally leads to open areas of varying width between structures which, in the case of mono- lithically integrated metasurfaces, is problematic because of the effect known as aspect-ratio dependent etching (ARDE). Metasurfaces are typically fabricated by a top-down process—etching the high-index material (e.g., silicon on a fused silica substrate) through a lithographically defined mask. The process of etching, especially at the nanoscale, is often limited by ARDE, which manifests as a reduction of etch rate as the ratio of the etched depth to the opening in the mask becomes larger. An etch-stop layer is the common solution, because it allows to prolong the etch time and let smaller openings to catch up. In this case it means depositing another material on the backside of the VCSEL chip with reasonable etching selectivity against GaAs. However, this would inevitably lead to a less effi- cient device and negate the advantages of monolithic fabrication on a pristine GaAs crystal because of defect induced absorption, refractive index and thermal expan- sion discontinuities. Here we circumvent this problem by instead using metagratings, or subwavelength binary high-contrast gratings, which can be considered a proto-concept of metasurface flat optics30–35. The metagratings are opti- mized such that all etched trenches have equal width, which completely eliminates ARDE and results in >90% deflection efficiency. Furthermore, based on a simple axicon concept, we introduced grating curvature able to collimate the inherently divergent VCSEL emission out- of-plane while in-plane divergence is maintained. The fabricated structures are interfaced to microfluidic chips for proof-of-concept DF and TIR microscopy of nano- particles. We also demonstrate switchable DF/TIR over a wide field-of-view using on-chip illumination. Results Concept of an offset axicon metagrating The metasurface concept that we use in this paper is based on a uniform metagrating with constant period and unit cell size across the sample. Such a metagrating can be transformed into an axicon by curving the ridges into Top mirror VCSEL Dark Field/TIR Imaging Oxide aperture Bottom mirror GaAs substrate Gaussian beam Integrated curved metagrating 5 m 50 m Fig. 1 Overview of the metagrating-integrated laser for microscopy concept. Schematic illustration of an oxide-confined GaAs-VCSEL and its integration with a metagrating that produces off- axis emission at high angles for high-contrast DF and TIR microscopy Juodėnas et al. Light: Science & Applications (2023) 12:251 Page 2 of 9 curvature in the metagratings to change the illuminated area size, the location of the area of interest can be facilitated before switching to a more concentrated illu- mination with full collimation. Such integrated multi- functional light source can become a versatile platform for rapid screening of samples without the need of full microscope reconfiguration, e.g., switching between TIR and DF condensers. Ideally, our proposed illumination module would be combined with fluorescence imaging, but there is so-far a lack of efficient fluorophores operating at ~1000 nm wavelength. However, this is an actively researched area because excitation within the NIR-II range (1000–2000 nm) features dramatically reduced auto- fluorescence and light toxicity compared to conventional visible-range excitation. We therefore expect our demonstration to prove useful also for fluorescence ima- ging, once suitable functional fluorophores are readily available39–41. Finally, the metagrating concept demonstrated here can easily be reoptimized and integrated with both, InP-based VCSELs42 that emit at longer wavelengths, as well as with VCSELs emitting in the visible wavelength spectrum, though these are still at an early development stage43,44. Materials and methods Grating simulations Metagratings were simulated using the Wave Optics module of COMSOL Multiphysics software in 2D. Peri- odic boundary conditions were defined on the sides of the computation domain, while the bottom and top bound- aries were assigned as exciting and receiving ports with in-plane polarization. To find the optimal structure, the optimization module was used with the Nelder-Mead algorithm and the transmittance of +1 diffraction order as the figure of merit. Depending on the unit cell size, either three or four trenches were defined in the calculation domain and were allowed to change their position within the unit cell freely, as well as their width and height. The trenches were constrained to be equal width. The opti- mization was allowed to run until converged. GaAs refractive index data was taken from Papatryfonos et al45. VCSEL fabrication The VCSEL epitaxial structure is grown by MOCVD and features an active region with three strained InGaAs quantum wells sandwiched between two distributed Bragg reflectors (DBR), with 28 and 20 AlAs/GaAs and/or AlGaAs/GaAs pairs on the topside and substrate side, respectively, for bottom emission through the GaAs substrate. The top DBR has one AlGaAs layer with a 98% aluminium content which is selectively oxidized to form an oxide aperture for lateral current and optical mode confinement. The VCSELs were fabricated using standard processing steps of oxide confined GaAs-based VCSELs. First, Ti/Pt/Au top contact rings were evaporated on a highly doped p-type layer on the top DBR. After which alignment marks are transferred to the backside of the chip to align the metagrating with the centre of the VCSEL. A VCSEL mesa with 21 µm diameter is then dry Switchable TIR/DF Mode (Water) 20× 1 m 50 m 50 m 2 3 1 2 3 1 10 m 10 m 10 m 10 m VCSEL a b c d e f g h i 625 1000 460 Thickness, m TIR TIR DF-TIR BF BF-TIR DF-TIR TIR DF Glass Slide Cover Slip Cover Slip Au Colloid Fig. 5 VCSEL with an integrated metagrating in a mirror-symmetric configuration provides clean TIR illumination. a 3D render of the integrated mirrored metagrating concept; b SEM micrograph of the fabricated metagrating; c Schematic of the on-chip microscopy setup, where Au nanoparticles in a colloid solution are illuminated by only TIR laser light; d, e Optical micrographs of light scattered by colloidal Au nanorods (180 × 88 nm2) by combined DF/TIR illumination (d) and TIR illumination only (e), insets show corresponding intensity cuts; f–i Optical micrographs (60× objective) of a sample with nanorod-incubated cells: bright field (f), bright field with TIR (g), DF-TIR (h), and TIR only (i) modes Juodėnas et al. Light: Science & Applications (2023) 12:251 Page 7 of 9 etched by an inductively coupled plasma (ICP) reactive ion etching (RIE) using Ar/SiCl4 gas mixture. The oxide aperture is created by selective wet oxidization at 420 °C. The targeted aperture size is 2 µm to achieve single-mode lasing. After oxidation, a Ge/Ni/Au bottom contact is evaporated and annealed to create an ohmic contact to the n-doped bottom mirror. The VCSEL chip is passi- vated by a 350 nm thick layer of SiNx which is dry etched to open connections to large, sputtered Ti/Au pads for electrical injection. Finally, 250 nm of SiNx is sputtered to protect the VCSELs during the following metasurface fabrication. More details can be found in the supple- mentary information. Metasurface fabrication Either semi-insulating GaAs substrates or VCSEL chips in the bottom-emitting configuration were used to fabri- cate monolithic metagratings. SiO2 layer was sputtered on the substrate to serve as an etching mask. Optimized patterns were exposed in positive ArP 6200.13 e-beam resist. After development, Ni was evaporated and lifted- off. Patterns were then etched into SiO2 in CF4/O2 plasma. Finally, GaAs was etched using a switching pro- cess, alternating between SiCl4 and O2 plasma processing steps. Since there is no etch-stop layer, the etching depth was controlled by timing and stopping the process manually. More details can be found in the supplementary information. Optical setup The fabricated metasurfaces on GaAs substrates and integrated on VCSEL chips were characterized using a custom-built optical microscope equipped with 40× NA = 0.95 dry objective. GaAs substrates were illumi- nated using a loosely focused, linearly polarized 976 nm laser beam. A lens focused on the back-focal plane of the objective could be inserted for Fourier plane imaging. The relative efficiency of the metagratings was determined by capturing Fourier images, subtracting the background, integrating the pixel values in the corresponding areas of the Fourier plane, and referencing to the total sum of pixel values on the image. DF and TIR images of nanoparticles and cells were taken in the same setup using a 20×, NA = 0.5 and 60×, NA = 0.7 dry objectives respectively. Free space measurements The power in each diffraction order was captured using large-area silicon photodiode, Hamamatsu S2281-01. Three IPV measurements were performed for each device, one for each diffraction order of the VCSEL with the metagrating, by placing the photodiode at the appropriate angle for each diffraction order. The beam profiles were measured by illuminating a diffusive plate, Ophir WB-I SWIR. The image on the diffusive plate was then focused and captured by a CCD camera, Ophir SP932U. Acknowledgements This work was funded by the Knut and Alice Wallenberg Foundation and performed in part at Myfab Chalmers. The authors acknowledge Emelie Tornéus for assistance preparing the cell samples and Ruggero Verre for assistance with the nanofabrication. Cell samples were a kind gift from Caroline Adiels. Nanorods were synthesized by Lei Shao. Author contributions M.J. proposed, optimized, fabricated, and characterized the metagratings, designed and carried out the dark field and total internal reflectance experiments, analyzed the metagrating and microscopy data; E.S. fabricated and characterized the VCSELs without the integrated metagratings and analyzed the VCSEL data; M.J. and E.S. characterized the VCSELs with the integrated metagratings and co-wrote the initial draft; A.G. supervised the VCSEL fabrication; A.G., J.G., and A.L. co-designed the VCSEL architecture; H.Š.-J. assisted with cell microscopy experiments; M.K. supervised the project, proposed the microscopy applications and edited the paper. All authors commented on and revised the final version of the draft. Funding Open access funding provided by Chalmers University of Technology. Data availability The data supporting the findings of this study are available from the corresponding author on reasonable request. Conflict of interest The authors declare no competing interests. Supplementary information The online version contains supplementary material available at https://doi.org/10.1038/s41377-023-01286-0. Received: 26 May 2023 Revised: 14 September 2023 Accepted: 14 September 2023 References 1. Yu, N. et al. Light Propagation with Phase Discontinuities: Generalized Laws of Reflection and Refraction. Science 334, 333–337 (2011). 2. Bomzon, Z. et al. E. Space-variant Pancharatnam–Berry phase optical elements with computer-generated subwavelength gratings. Opt. Lett. 27, 1141–1143 (2002). 3. Martins, R. J. et al. Metasurface-enhanced light detection and ranging tech- nology. Nat. Commun. 13, 5724 (2022). 4. Rubin, N. A. et al. Matrix Fourier optics enables a compact full-Stokes polar- ization camera. Science 365, eaax1839 (2019). 5. Zheng, Y. Q. et al. Enriching Metasurface Functionalities by Fully Employing the Inter-Meta-Atom Degrees of Freedom for Double-Key-Secured Encryption. Adv. Mater. Technol. 8, 2201468 (2023). 6. Li, X. Y. et al. Experimental demonstration of optical trapping and manipula- tion with multifunctional metasurface. Opt. Lett. 47, 977–980 (2022). 7. Tseng, M. L. et al. Vacuum ultraviolet nonlinear metalens. Sci. Adv. 8, eabn5644 (2022). 8. Khaidarov, E. et al. Control of LED Emission with Functional Dielectric Meta- surfaces. Laser Photon. Rev. 14, 1900235 (2020). 9. Joo, W. J. et al. Metasurface-driven OLED displays beyond 10,000 pixels per inch. Science 370, 459–463 (2020). 10. Wen, D. D. & Crozier, K. B. Semiconductor lasers with integrated metasurfaces for direct output beam modulation, enabled by innovative fabrication methods. Nanophotonics 12, 1443–1457, https://doi.org/10.1515/nanoph- 2022-0585 (2023). Juodėnas et al. Light: Science & Applications (2023) 12:251 Page 8 of 9 11. Filipe, V., Hawe, A. & Jiskoot, W. Critical Evaluation of Nanoparticle Tracking Analysis (NTA) by NanoSight for the Measurement of Nanoparticles and Protein Aggregates. Pharm. Res. 27, 796–810 (2010). 12. Rupert, D. L. M. et al. Effective Refractive Index and Lipid Content of Extra- cellular Vesicles Revealed Using Optical Waveguide Scattering and Fluores- cence Microscopy. Langmuir 34, 8522–8531 (2018). 13. Taylor, R. W. & Sandoghdar, V. Interferometric Scattering Microscopy: Seeing Single Nanoparticles and Molecules via Rayleigh Scattering. Nano Lett. 19, 4827–4835 (2019). 14. Kashkanova, A. D. et al. Precision size and refractive index analysis of weakly scattering nanoparticles in polydispersions. Nat. Methods 19, 586–593 (2022). 15. Špačková, B. et al. Label-free nanofluidic scattering microscopy of size and mass of single diffusing molecules and nanoparticles. Nat. Methods 19, 751–758 (2022). 16. Tayal, S. et al. Design and development of integrated TIRF and common-path quantitative phase microscopic health care system with high stability. Opt. Lasers Eng. 155, 107057 (2022). 17. Tripathy, S. P. et al. Femtomolar detection of SARS-CoV-2 via peptide beacons integrated on a miniaturized TIRF microscope. Sci. Adv. 8, eabn2378 (2022). 18. Ramachandran, S. et al. High performance, LED powered, waveguide based total internal reflection microscopy. Sci. Rep. 3, 2133 (2013). 19. Gortari, A. N. et al. Metasurface-based total internal reflection microscopy. Biomed. Opt. Express 11, 1967–1976 (2020). 20. Shitrit, N. et al. Ultracompact Structured Light System of Vertical-Cavity Sur- face-Emitting Lasers Combining Metagratings. 2020 Conference on Lasers and Electro-Optics (CLEO). 1–2 (San Jose: IEEE, 2020). 21. Sun, Y. Q. et al. Direct Generation of Orbital Angular Momentum Beams by Integrating All-Dielectric Metasurface to Vertical-Cavity Surface-Emitting Laser. 2017 Asia Communications and Photonics Conference (ACP). 1–3 (Guangzhou: IEEE, 2017). 22. Wen, D. D. et al. VCSELs with On-Facet Metasurfaces for Polarization State Generation and Detection. Adv. Opt. Mater. 9, 2001780 (2021). 23. Seghilani, M. S. et al. Vortex Laser based on III-V semiconductor metasurface: direct generation of coherent Laguerre-Gauss modes carrying controlled orbital angular momentum. Sci. Rep. 6, 38156 (2016). 24. Jia, X. L. et al. Circularly-Polarized Emission from Electrically-Pumped VCSELs with Chiral-Metasurface Reflectors. 2022 28th International Semiconductor Laser Conference (ISLC). Matsue: IEEE, 2022, 1–2, https://doi.org/10.23919/ ISLC52947.2022.9943380 (2022). 25. Xie, Y. Y. et al. Metasurface-integrated vertical cavity surface-emitting lasers for programmable directional lasing emissions. Nat. Nanotechnol. 15, 125–130 (2020). 26. Ni, P. N. et al. Spin-decoupling of vertical cavity surface-emitting lasers with complete phase modulation using on-chip integrated Jones matrix meta- surfaces. Nat. Commun. 13, 7795 (2022). 27. Wang, Q. H. et al. On-Chip Generation of Structured Light Based on Metasurface Optoelectronic Integration. Laser Photon. Rev. 15, 2000385 (2021). 28. Byrnes, S. J. et al. Designing large, high-efficiency, high-numerical-aperture, transmissive meta-lenses for visible light. Opt. Express 24, 5110–5124 (2016). 29. Paniagua-Domínguez, R. et al. A Metalens with a Near-Unity Numerical Aperture. Nano Lett. 18, 2124–2132 (2018). 30. Haidner, H. et al. Design of a blazed grating consisting of metallic sub- wavelength binary grooves. Opt. Commun. 98, 5–10 (1993). 31. Haidner, H., Sheridan, J. T. & Streibl, N. Dielectric binary blazed gratings. Appl. Opt. 32, 4276–4278 (1993). 32. Collischon, M. et al. Binary blazed reflection gratings. Appl. Opt. 33, 3572–3577 (1994). 33. Lalanne, P. et al. Blazed binary subwavelength gratings with efficiencies larger than those of conventional échelette gratings. Opt. Lett. 23, 1081–1083 (1998). 34. Lalanne, P. Waveguiding in blazed-binary diffractive elements. J. Opt. Soc. Am. A 16, 2517–2520 (1999). 35. Li, K. et al. Monolithic high-contrast metastructure for beam-shaping VCSELs. Optica 5, 10–13 (2018). 36. Zhong, Q. H. et al. Focusing-curved subwavelength grating couplers for ultra- broadband silicon photonics optical interfaces. Opt. Express 22, 18224–18231 (2014). 37. Zeitner, U. D. et al. High performance diffraction gratings made by e-beam lithography. Appl. Phys. A 109, 789–796 (2012). 38. Paiè, P. et al. Microfluidic Based Optical Microscopes on Chip. Cytom. Part A 93, 987–996 (2018). 39. Oliinyk, O. S. et al. Deep-tissue SWIR imaging using rationally designed small red-shifted near-infrared fluorescent protein. Nat. Methods 20, 70–74 (2023). 40. Miao, Y. W. et al. Recent Progress in Fluorescence Imaging of the Near-Infrared II Window. ChemBioChem 19, 2522–2541 (2018). 41. Carr, J. A. et al. Shortwave infrared fluorescence imaging with the clinically approved near-infrared dye indocyanine green. Proc. Natl Acad. Sci. USA 115, 4465–4470 (2018). 42. Ortsiefer, M. et al. Long-Wavelength VCSELs with Buried Tunnel Junction. in VCSELs: Fundamentals, Technology and Applications of Vertical-Cavity Surface- Emitting Lasers (ed Michalzik, R.) 321–351 (Berlin: Springer, 2013). https:// doi.org/10.1007/978-3-642-24986-0_10. 43. Mei, Y. et al. Quantum dot vertical-cavity surface-emitting lasers covering the ‘green gap’. Light Sci. Appl. 6, e16199 (2017). 44. Yu, H. et al. Progress and prospects of GaN-based VCSEL from near UV to green emission. Prog. Quant. Electron. 57, 1–19 (2018). 45. Papatryfonos, K. et al. Refractive indices of MBE-grown AlxGa(1−x)As ternary alloys in the transparent wavelength region. AIP Adv. 11, 025327 (2021). Juodėnas et al. Light: Science & Applications (2023) 12:251 Page 9 of 9

Title: High-angle deflection of metagrating-integrated laser emission for high-contrast microscopy ​ Authors: Mindaugas Juodėnas, Erik Strandberg, Alexander Grabowski, Johan Gustavsson, Hana Šípová-Jungová, Anders Larsson, Mikael Käll ​ Publisher: Science & Applications, Official journal of the CIOMP Date: 2023-10-13 00:00:00 Abstract: Flat metaoptics components are looking to replace classical optics elements and could lead to extremely compact biophotonics devices if integrated with on-chip light sources and detectors. ​ However, using metasurfaces to shape light into wide angular range wavefronts with high efficiency, as is typically required in high-contrast microscopy applications, remains a challenge. ​ Here we demonstrate curved GaAs metagratings integrated on vertical-cavity surface-emitting lasers (VCSELs) that enable on-chip illumination in total internal reflection and dark field microscopy. ​ Based on an unconventional design that circumvents the aspect ratio dependent etching problems in monolithic integration, we demonstrate off-axis emission centred at 60° in air and 63° in glass with > 90% and > 70% relative deflection efficiency, respectively. ​ The resulting laser beam is collimated out-of-plane but maintains Gaussian divergence in-plane, resulting in a long and narrow illumination area. ​ We show that metagrating-integrated VCSELs of different kinds can be combined to enable rapid switching between dark-field and total internal reflection illumination. ​ Our approach provides a versatile illumination solution for high-contrast imaging that is compatible with conventional microscopy setups and can be integrated with biophotonics devices, such as portable microscopy, NIR-II range bioimaging, and lab-on-a-chip devices. ​

Characterizing photopolymer resins for high‐temperature vat photopolymerization.pdf

Vol.:(0123456789) Progress in Additive Manufacturing https://doi.org/10.1007/s40964-023-00562-0 FULL RESEARCH ARTICLE Characterizing photopolymer resins for high‑temperature vat photopolymerization Viswanath Meenakshisundaram1,2 · Keyton Feller2 · Nicholas Chartrain2,3 · Timothy Long4 · Christopher Williams1,2  Received: 11 September 2023 / Accepted: 25 December 2023 © The Author(s) 2024 Abstract The availability of engineering polymers for vat photopolymerization (VP) additive manufacturing is limited. This limitation primarily stems from the inability of standard VP systems to recoat high-viscosity resins (> 3 Pa s). High-temperature vat photopolymerization is a new process-based VP platform that enables processing of viscous photopolymer resins (viscosity > 3 Pa s). Research in this area has been focused on demonstrating expanded access to new polymer families, and studying the effect of printing temperature on mechanical and esthetic performance of printed parts. However, methods to determine the printing temperature that prevents the occurrence of thermally induced polymerization (i.e., thermal stability) in the resin have not been established. In this work, the authors have applied characterization techniques such as thermogravimetric analysis, Rheology and differential scanning calorimetry to determine the printing temperature for processing viscous photopolymer resins. As a case study, the developed characterization techniques are applied to: (1) photopolymer that is solid at room temperature, (2) polymer with viscosity of 21 Pa s at room temperature, and the temperature at which the resins can be printed without triggering thermally induced polymerization is successfully determined. The results of this work will act as a materials’ characterization and process parameter development guide for high-temperature VP systems, thus enabling expansion of VP materials catalogue to engineering materials that were previously unprocessable. Keywords  Hot lithography · Vat photopolymerization · Stereolithography · Viscous photopolymers 1  Introduction Vat photopolymerization (VP) is a polymer additive manu- facturing (AM) process wherein the resin surface is selec- tively exposed to ultra-violet (UV) light to convert irradiated regions from a liquid to solid state [1, 2]. VP is commonly used to prototype complex geometries because of its ability to manufacture parts with attributes such as: high-feature resolution, superior surface finish, and high-manufacturing speed [3–5]. While VP systems have been able to meet these manufacturing metrics for prototypes by using low viscosity resins (< 3 Pa s) [6], meeting the demand for manufactur- ing end use products with complex geometries and superior material properties has necessitated the migration towards the development and use of engineering photopolymers [1, 2]. Among the different strategies available for vat pho- topolymerization of engineering photopolymers, the route of using high-viscosity resins to access engineering poly- mers has become popular because it offers the following advantages: * Christopher Williams [email protected] Viswanath Meenakshisundaram [email protected] Keyton Feller [email protected] Nicholas Chartrain [email protected] Timothy Long [email protected] 1 Department of Mechanical Engineering, Virginia Tech, Blacksburg, VA 24061, USA 2 Macromolecules Innovation Institute, Virginia Tech, Blacksburg, VA 24061, USA 3 Department of Material Science and Engineering, Virginia Tech, Blacksburg, VA 24061, USA 4 School of Molecular Sciences, Arizona State University, Tempe, AZ 85281, USA Progress in Additive Manufacturing 1. Improvement in thermo-mechanical performance High viscosity photopolymers often use blends of high molecular weight backbones with oligomeric moieties. These inclusions can positively affect the mechanical performance in areas such as toughness, elongation at break, and modulus. This strategy offers a path to use photopolymers for engineering applications [7] 2. Predictable control of geometry Reduction in use of viscosity modifiers such as volatile monomers, solvents (reactive and unreactive) [8, 9] reduces evaporative losses during post-processing and lowers post-process complexity. Reduced shrinkage allows the use of simple design compensation techniques such as global scaling, uniform Z-compensation to predictably manufacture complex parts with features across comparable size scales. Traditional VP systems find it challenging to handle high- viscosity polymers. One of the sources for this limitation is the fluid dynamics occurring during the recoating step. In passive recoating systems where resin is allowed to settle under self-weight (Top Down or free-surface VP systems) or allowed to flow due to pressure head (Bottom up or constrained surface VP system), the rate of flow, settling time, and distance of resin travel are dependent on the viscosity of the resin [10]. Increase in resin viscosity increases settling time, lowers recoat quality and manufacturing throughput. While addition of active elements such as recoating blades, recirculation units, or tilting elements help mitigate the issues, the complex fluid dynamic interactions introduced by the inclusion of such elements (i.e., drag force on the printed parts, pressure differentials created by hollow areas) still make them inefficient while processing viscous resins [10–14]. Another challenge with viscous photopolymers is poor/slow reaction kinetics. Highly viscous photopolymer systems offer low mobility to reactive species which leads to poor conversion or insufficient curing that results in green parts that are incapable of supporting self-weight or shape [15] Hot lithography, or high-temperature VP, is a VP platform wherein the photopolymer resin is heated to elevated temperatures to lower the resin viscosity within the processible limits of the VP apparatus. The use of high-temperature VP apparatus for manufacturing complex, high-resolution features with highly viscous resins has already been demonstrated [16–18]. Majority of the high-temperature VP research has been focused on understanding the effect of elevated printing temperature on the % conversion and thermo-mechanical properties of the printed parts [19]. While prior research has been successful in demonstrating the ability of high-temperature VP systems to handle viscous photopolymers, the tools and techniques to help VP users study, characterize and develop printing parameters for high temperature VP systems remain unexplored. This exploration is even more pertinent given that it is known that acrylate systems have a tendency to undergo thermally induced polymerization at high- temperatures [20]. To this end, the primary objective of this work is to present a set of characterization techniques that can be used to determine the safe printing temperature for high- temperature VP systems. Specifically, this work details the application of the proposed characterization techniques to two case unique high-viscosity photopolymer systems. The methods to analyze and interpret the characterization results for process parameter selection are presented. The proposed methods are then validated using the predicted printing parameters for actual part fabrication using a custom high-temperature VP setup. The results of this work will help provide insight into the thermal stability of photopolymer resins and enable successful printing of previously inaccessible polymers. 2  Materials and methods Two material systems exhibiting the following characteristics were selected as case studies: (1) high viscosity at room temperature (urethane acrylate), and (2) solid at room temperature (Bisphenol A dimethacrylate) (Sect. 2.1). Characterization techniques developed to determine safe processing temperatures, i.e., process these materials without initiating thermally induced polymerization are outlined in Sect. 2.2. The design and construction of the high-temperature VP apparatus is outlined in Supplementary Information (SI) Section S1. Methods for specimen fabrication and post-processing are detailed in Sect. 2.3. 2.1  Materials 2.1.1  Solid photopolymer resin (BPADMA) Bisphenol-A-dimethacrylate (BPADMA), a solid at room temperatures, was procured from Sigma Aldrich (SKU: 156329). Diphenyl (2,4,6-trimethylbenzoyl) phosphine oxide (TPO), a photoinitiator, was procured from TCI chemicals (D3358). BPADMA was heated to 100 ◦ C (melting point: 72–74 ◦ C) and brought to liquid state. TPO (melting point: 88–92 ◦ C) was then added to the liquid BPADMA in the ratio of 1:100 by weight (TPO:BPADMA). The mixture was cooled to room temperature before printing. 2.1.2  High‑viscosity photopolymer resin (EBECRYL‑242) A premixed resin containing aliphatic urethane acrylate oligomer and isobornyl acrylate (IBOA) (30 wt% IBOA) Progress in Additive Manufacturing Parts printed with EBECRYL-242 were immersed in ethanol (maintained at room temperature) for removal of cleaning and removal of uncured resin. Immersed parts did not exhibit signs of warping when they were quenched in ethanol immediately after printing at 75 ◦ C. Since the printed parts remain under volatilization temperature, it is hypothesized that the EBECRYL-242 network remains plasticized by uncured IBOA and urethane acrylate oligomers, enabling it to reconfigure and relieve the thermal stresses, therefore preventing the warping of parts during quenching. Comparison of EBECRYL-242 parts quenched in hot olive oil and room temperature ethanol did not reveal visually identifiable difference in the Honeycomb structure. Finally, self-initiated, cured fragments were not observed in the resins even after subjecting them to five thermal and printing cycles. While five cycles of reuse may not be sufficient to fully explore resin degradation at elevated temperatures, it provides confidence to the user that the developed resin characterization techniques are an appropriate means of identifying the printing temperature for safely processing photopolymers at elevated temperatures. It must be noted that the post-process steps indicated in this work were developed for demonstration purposes only (i.e., that successful parts can be fabricated with characterization techniques presented in this work). While the development of appropriate post-processing methods, and reformulation strategies are highly formulation and application specific and is beyond the scope of this work, the following guidelines are proposed as a starting step for the users of high-viscosity resins and high-temperature VP systems: 1. Resin removal step: given the high viscosity of the resin, cleaning and removal of uncured resin from complex geometries may be more efficient when the part is hot. Users may consider the use of a hot cleaning medium (e.g., hot mineral oils) and physical agitation to remove residual resin from the parts. 2. UV post-curing step: UV post-curing may be used to foster the conversion of unreacted moieties in the green part and improve the mechanical properties of the printed parts. 3. Secondary thermal treatment step: additional heating and cooling cycles in an oven could be employed if warping or distortion is observed in the parts after UV post-curing. 4. Iteration step: Users may want to consider altering the printing parameters such as printing temperature, printing intensity, UV dosage or repeating the post- processing steps in different order to achieve desirable results. 3.4  Broader impacts of high‑temperature vat photopolymerization and high‑viscosity resins In its current state, vat photopolymerization enables users to quickly prototype complex geometries with high resolution and surface finish. The use of simple acrylate, or methacrylate monomers blended with simple oligomeric backbones helps meet the requirements of the target audience. However, these simple photopolymer systems contain short chain monomers, and photoinitiators that are prone to extraction in aqueous media. These leachables pose a serious threat to human health and pose a challenge for safe disposal. While increased post-curing can help lower these risks by increasing the crosslinking in the polymer matrix, the variability in commercial photopolymers and lack of standardization in the post-process and material composition continue to elevate the risk of handling and disposing cured photopolymers [24]. It must be noted that the high-viscosity resins are not immune to the problems of excess leachables. While high molecular weight polymers used in viscous resins may be harder to extract in aqueous media, the viscous nature of the resin lowers polymer and radical mobility when processed with traditional VP systems. This often leads to the incomplete curing, low double bond conversion, and increased leachables in cured parts [15]. High-temperature vat photopolymerization systems not only allow for easy processing of viscous resins, but the method of processing the resins at elevated temperatures lends the following advantages: 1. Processing the resin at elevated temperatures lowers the resin viscosity, thus increasing the mobility of radicals and polymers. This increased mobility increases the likelihood of photopolymerization events, thus increasing the crosslink density, double bond conversion and simultaneously lowers the leachables 2. The combination of increased cross link density and low resin viscosity increases the green strength of the printed parts. This allows for printing of high resolution, high aspect ratio features which would have been previously inaccessible in traditional VP systems. This increase in design freedom allows for the use of structural optimization for generating engineered solutions for end use applications [5, 16, 19] 3. Processing photopolymers at elevated temperatures often alters the curing parameters, namely the critical energy(Ec ) and the depth of penetration ( Dp ). Parts often need lower exposure time at elevated temperatures, thus leading to the formation of more pronounced layer lines in the part surface. This deterioration in surface finish may lower increase anisotropic behavior in the print direction. However, an overall improvement in geometric accuracy could be expected [19]. Progress in Additive Manufacturing 4. The removal of viscous resin from the printed parts often necessitates the use of heated post-processing procedures such as hot solvent/mineral oil wash (as described in Sec. 2.3.4) These post-processing of the parts at elevated temperatures provides more time for the polymer matrix to undergo rearrangement, thus allowing the fabrication of parts with minimal warping and internal stresses While high-temperature vat photopolymerization offers several processing advantages, it must be noted that the selection of the polymer backbone, the final resin formulation, and the post-processing conditions have a strong influence on the performance and safety of the printed device. Given that the advancements in high temperature VP systems and performance photopolymers are fairly recent, the number of commercial machines and materials for high temperature VP are fairly limited and expensive. However, the growing interest to use polymer AM for manufacturing of mass customized products is expected to increase the research and development, and commercialization interests in the area of high-temperature vat photopolymerization. 4  Conclusion The primary objective of this work was to develop a set of characterization techniques that helped determine the printing temperature that does not induce thermally initiated polymerization. To this end, two high- temperature VP resins, EBECRYL-242 and BPADMA, were formulated. First, TGA was used to determine the degradation and volatilization temperatures of the resins. Then, variable-temperature rheology was used to determine the temperature at which thermally induced polymerization occurred. Then, isothermal DSC was used to determine the time for which the resin remained thermally stable at different printing temperatures. A framework for interpreting and applying the characterization results for developing printing parameters was presented. The framework was applied to the EBECRYL-242 and BPADMA resins and the appropriate printing temperatures were determined to be 75 and 90 ◦ C, respectively. The findings were validated using the predicted printing temperatures for successfully fabricating test specimens with BPADMA and EBECRYL-242 resins. In conclusion, the successful fabrication of specimens with previously inaccessible photopolymers provides evidence to support the use of the presented resin characterization techniques for determining the printing temperatures for high-temperature VP systems. 5  Supplementary information Additional information about construction of the custom high-temperature VP system, working curves, and additional DSC isotherms can be found in the supplementary information. Supplementary Information  The online version contains supplemen- tary material available at https://​doi.​org/​10.​1007/​s40964-​023-​00562-0. Acknowledgements  The authors would like to thank Allnex for provid- ing a free sample of EBECRYL-242 polymer. The authors would like to thank the Materials Characterization Lab and Macromolecules Innovation Institute for providing access to the characterization instruments used in this work. Funding  This material is based upon work supported by the National Science Foundation under Grant No.: CMMI - 1762712. Data availability  Data available within the article or its supplementary materials. Additional data avaialable on request. Declarations  Conflict of interest  The authors have no relevant financial or non-fi- nancial interests to disclose. Open Access  This article is licensed under a Creative Commons Attri- bution 4.0 International License, which permits use, sharing, adapta- tion, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. References 1. Appuhamillage GA, Chartrain N, Meenakshisundaram V, Feller KD, Williams CB, Long TE (2019) 110th Anniversary: vat pho- topolymerization-based additive manufacturing: current trends and future directions in materials design. Ind Eng Chem Res 58(33):15109–15118. https://​doi.​org/​10.​1021/​acs.​iecr.​9b026​79 2. Tariq A, Arif ZU, Khalid MY, Hossain M, Rasool PI, Umer R, Ramakrishna S (2023) Recent advances in the additive manu- facturing of stimuli-responsive soft polymers. Adv Eng Mater. https://​doi.​org/​10.​1002/​adem.​20230​1074 3. Ippolito R, Iuliano L, Gatto A (1995) Benchmarking of rapid prototyping techniques in terms of dimensional accuracy and surface finish. CIRP Ann Manuf Technol 44(1):157–160. https://​doi.​org/​10.​1016/​S0007-​8506(07)​62296-3 4. Tumbleston JR, Shirvanyants D, Ermoshkin N, Janusziewicz R, Johnson AR, Kelly D, Chen K, Pinschmidt R, Rolland JP, Ermoshkin A, Samulski ET, DeSimone JM (2015) Con- tinuous liquid interface production of 3D objects. Science 347(6228):1349–1352 Progress in Additive Manufacturing 5. Arif ZU, Khalid MY, Noroozi R, Sadeghianmaryan A, Jalalvand M, Hossain M (2022) Recent advances in 3D-printed polylac- tide and polycaprolactone-based biomaterials for tissue engi- neering applications. Int J Biol Macromol 218:930–968. https://​ doi.​org/​10.​1016/j.​ijbio​mac.​2022.​07.​140 6. Griffith M, Halloran J (1996) Freeform fabrication of ceramics via stereolithography. J Am Ceram Soc 79(10):2601–2608 7. Patel DK, Sakhaei AH, Layani M, Zhang B, Ge Q, Magdassi S (2017) Highly stretchable and UV curable elastomers for digi- tal light processing based 3D printing. Adv Mater 29(15):1–7. https://​doi.​org/​10.​1002/​adma.​20160​6000 8. Hegde M, Meenakshisundaram V, Chartrain N, Sekhar S, Tafti D, Williams CB, Long TE (2017) 3D printing all-aromatic pol- yimides using mask-projection stereolithography: processing the nonprocessable. Adv Mater. https://​doi.​org/​10.​1002/​adma.​ 20170​1240 9. Herzberger J, Meenakshisundaram V, Williams CB, Long TE (2018) 3D printing all-aromatic polyimides using stereolitho- graphic 3D printing of polyamic acid salts. ACS Macro Lett 7(4):493–497. https://​doi.​org/​10.​1021/​acsma​crole​tt.​8b001​26 10. Li X, Mao H, Pan Y, Chen Y (2019) Mask video projection-based stereolithography with continuous resin flow. J Manuf Sci Eng Trans ASME 141(8):1–10. https://​doi.​org/​10.​1115/1.​40437​65 11. Renap K, Kruth JP (1995) Recoating issues in stereolithography. Rapid Prototyp J 1(3):4–16. https://​doi.​org/​10.​1108/​13552​54951​ 00942​23 12. Song X, Chen Y, Lee TW, Wu S, Cheng L (2015) Ceramic fabri- cation using mask-image-projection-based stereolithography inte- grated with tape-casting. J Manuf Process 20:456–464. https://​doi.​ org/​10.​1016/j.​jmapro.​2015.​06.​022 13. Hafkamp T, Baars G, Jager B, Etman P (2017) A trade-off/analysis of recoating methods for vat photopolymerization of ceramics. In: Solid freeform fabrication symposium, pp 1–25 14. Pan Y, Zhou C, Chen Y (2012) Rapid manufacturing in minutes: the development of a mask projection stereolithography process for high-speed fabrication. In: ASME 2012 international manu- facturing science and engineering conference, p 405 . https://​doi.​ org/​10.​1115/​MSEC2​012-​7232. http://​proce​edings.​asmed​igita​lcoll​ ection.​asme.​org/​proce​eding.​aspx?​doi=​10.​1115/​MSEC2​012-​7232 15. Dickens SH, Stansbury JW, Choi KM, Floyd CJE (2003) Photopo- lymerization kinetics of methacrylate dental resins. Macromol- ecules 36(16):6043–6053. https://​doi.​org/​10.​1021/​ma021​675k 16. Schüller-Ravoo S, Zant E, Feijen J, Grijpma DW (2014) Prepa- ration of a designed poly(trimethylene carbonate) microvascular network by stereolithography. Adv Healthc Mater 3(12):2004– 2011. https://​doi.​org/​10.​1002/​adhm.​20140​0363 17. Gmeiner R (2018) Method and device for lithography-based gen- erative production of three-dimensional moulds. https://​paten​ts.​ google.​com/​patent/​EP328​4583A1/​en?​oq=​EP+​32845​83+​A1 18. Li X, Xie B, Jin J, Chai Y, Chen Y (2018) 3D Printing temporary crown and bridge by temperature controlled mask image projec- tion stereolithography. Procedia Manuf 26:1023–1033. https://​doi.​ org/​10.​1016/j.​promfg.​2018.​07.​134 19. Steyrer B, Busetti B, Harakály G, Liska R, Stampfl J (2018) Hot lithography vs. room temperature DLP 3D-printing of a dimeth- acrylate. Addit Manuf 21(January):209–214. https://​doi.​org/​10.​ 1016/j.​addma.​2018.​03.​013 20. Riazi H, Shamsabadi A, Grady MC, Rappe AM, Soroush M (2018) Experimental and theoretical study of the self-initiation reaction of methyl acrylate in free-radical polymerization. Ind Eng Chem Res 57(2):532–539. https://​doi.​org/​10.​1021/​acs.​iecr.​ 7b046​48 21. Jacobs PF (1992) Rapid prototyping and manufacturing. Funda- mentals of stereolithography, 1st edn. Society of Manufacturing Engineers (1992) 22. Ors JA, La Perriere DM (1986) Thermogravimetric profile of decomposition of acrylate systems based on bornyl acrylate monomers. Polymer 27(12):1999–2002. https://​doi.​org/​10.​1016/​ 0032-​3861(86)​90197-7 23. Pham QT, Hsu JM, Pan JP, Wang TH, Chern CS (2013) Kinetics of free radical polymerization of bisphenol A diglycidyl ether diacrylate initiated by barbituric acid. Thermochim Acta 573:121– 129. https://​doi.​org/​10.​1016/j.​tca.​2013.​09.​002 24. Carve M, Wlodkowic D (2018) 3D-printed chips: compatibility of additive manufacturing photopolymeric substrata with biologi- cal applications. Micromachines 9(2):91. https://​doi.​org/​10.​3390/​ mi902​0091 Publisher's Note  Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Title: Characterizing photopolymer resins for high‑temperature vat photopolymerization ​ Authors: Viswanath Meenakshisundaram, Keyton Feller, Nicholas Chartrain, Timothy Long, Christopher Williams ​ Publisher: Springer Nature ​ Date: 2024 Abstract: The availability of engineering polymers for vat photopolymerization (VP) additive manufacturing is limited. ​ This limitation primarily stems from the inability of standard VP systems to recoat high-viscosity resins (> 3 Pa s). ​ High-temperature vat photopolymerization is a new process-based VP platform that enables processing of viscous photopolymer resins (viscosity > 3 Pa s). ​ Research in this area has been focused on demonstrating expanded access to new polymer families, and studying the effect of printing temperature on mechanical and esthetic performance of printed parts. ​ However, methods to determine the printing temperature that prevents the occurrence of thermally induced polymerization (i.e., thermal stability) in the resin have not been established. ​ In this work, the authors have applied characterization techniques such as thermogravimetric analysis, Rheology and differential scanning calorimetry to determine the printing temperature for processing viscous photopolymer resins. ​ As a case study, the developed characterization techniques are applied to: (1) photopolymer that is solid at room temperature, (2) polymer with viscosity of 21 Pa s at room temperature, and the temperature at which the resins can be printed without triggering thermally induced polymerization is successfully determined. ​ The results of this work will act as a materials’ characterization and process parameter development guide for high-temperature VP systems, thus enabling expansion of VP materials catalogue to engineering materials that were previously unprocessable. ​

Clinical outcome of Mantle Cell Lymphoma patients with high-risk disease (high-risk MIPI-c or high p53 expression).pdf

ARTICLE OPEN LYMPHOMA Clinical outcome of Mantle Cell Lymphoma patients with high-risk disease (high-risk MIPI-c or high p53 expression) Gabriel Scheubeck 1✉, Linmiao Jiang 2, Olivier Hermine3, Hanneke C. Kluin-Nelemans4, Christian Schmidt1, Michael Unterhalt1, Andreas Rosenwald5, Wolfram Klapper 6, Andrea Evangelista7, Marco Ladetto8, Mats Jerkeman 9, Simone Ferrero 10, Martin Dreyling1,11 and Eva Hoster 1,2,11 © The Author(s) 2023 Currently, treatment allocation of patients with Mantle Cell Lymphoma (MCL) is mainly based on age and medical fitness. The combined MCL International Prognostic Index (MIPI-c) allows to predict prognosis using clinical factors (MIPI) and the Ki-67 index. However, high p53 expression as surrogate for TP53 alterations has demonstrated to be an independent predictor for poor outcome. We aimed to define a clear high-risk group based on the combination of MIPI, Ki-67 and p53 expression/TP53 alteration. A total of 684 patients from the prospective European MCL-Younger and MCL-Elderly trials were evaluable. The classification of high- risk disease (HRD) as high-risk MIPI-c or p53 expression >50% versus low-risk disease (LRD) as low, low-intermediate or high- intermediate MIPI-c and p53 expression ≤50% allowed to characterize two distinct groups with highly divergent outcome. Patients with HRD had significantly shorter median failure-free survival (FFS) (1.1 vs. 5.6 years, p < 0.0001) and overall survival (OS) (2.2 vs. 13.2 years, p < 0.0001) compared to those with LRD. These major differences were confirmed in two validation cohorts from the Italian MCL0208 and the Nordic-MCL4 trials. The results suggest that this subset of HRD patients is not sufficiently managed with the current standard treatment and is asking for novel treatment strategies. Leukemia (2023) 37:1887–1894; https://doi.org/10.1038/s41375-023-01977-y INTRODUCTION Mantle cell lymphoma (MCL) is a rare and commonly aggressive subtype of B-cell lymphoma characterized by the translocation t(11;14) with consecutive cyclin D1 overexpression. The clinical course is heterogeneous and marked by recurring relapses. Novel therapeutic strategies such as the addition of high-dose cytar- abine to the induction treatment prior to autologous stem cell transplantation (aSCT), Rituximab (R) maintenance and the approval of Bruton’s tyrosine kinase inhibitors (BTKi) substantially improved the survival of patients [1–3]. Currently, patients are allocated for treatment mainly considering age, stage and performance status. The Mantle Cell Lymphoma International Prognostic Index (MIPI) allows for discriminating prognostic risk groups based on age, performance status, lactate dehydrogenase (LDH) and leukocyte count [4], the combined MIPI-c additionally incorporates the Ki-67 index [5]. In prospective trials, the biological risk factors Ki-67, blastoid or pleomorphic cytology [5], and TP53 alterations [6–8] were associated with inferior outcome independent of MIPI. The prognostic relevance of MCL cytology is closely correlated to the Ki-67 index, which is generally increased in blastoid MCL [5, 9, 10]. P53 expression is a widely applicable diagnostic method serving as surrogate marker for TP53 alterations [11, 12]. In univariate analyses TP53 alterations, such as mutations and deletions, were both validated as negative predictor for outcome in the Nordic MCL2, MCL3, and MCL4 as well as in the European MCL Younger and Elderly trial cohort [7, 8, 13]. Thus, even more intensive regimens including high-dose cytarabine and aPBSCT fail to overcome the dismal prognosis of TP53 alterations [7, 8]. New concepts are urgently needed to define a more refined high-risk population and identify effective treatment strategies for these patients. In this study, we aimed to define a combination of MIPI, Ki-67 and p53 expression/TP53 alterations that reliably identifies a high-risk group. Received: 5 March 2023 Revised: 28 June 2023 Accepted: 17 July 2023 Published online: 26 July 2023 1Department of Medicine III, LMU University Hospital, Munich, Germany. 2Institute for Medical Information Processing, Biometry, and Epidemiology, LMU Munich, Munich, Germany. 3University Hospital, Paris, France. 4Department of Hematology, University Medical Center Groningen, University of Groningen, Groningen, Netherlands. 5Institute of Pathology, University of Wuerzburg, Wuerzburg, Germany. 6Department of Pathology, Hematopathology Section, University Hospital Schleswig-Holstein, Campus Kiel, Kiel, Germany. 7Unit of Clinical Epidemiology, Azienda Ospedaliera Universitaria Città della Salute e della Scienza and CPO Piemonte, Turin, Italy. 8Hematology, Azienda Ospedaliera SS Antonio e Biagio e Cesare Arrigo, Alessandria, Italy. 9Skane University Hospital, Lund, Sweden. 10Division of Hematology, Department of Molecular Biotechnologies and Health Sciences University of Torino/AOU “Città della Salute e della Scienza di Torino”, Turin, Italy. 11These authors contributed equally: Martin Dreyling, Eva Hoster. Presented in abstract form at the 61st American Society of Hematology (ASH 2019) Annual Meeting. ✉email: [email protected] www.nature.com/leu Leukemia 1234567890();,: METHODS Patients A total of 1183 MCL patients with confirmed MCL and Ann Arbor stage II to IV were registered in the MCL Younger [14] (NCT00209222) and MCL- Elderly trial [15] (NCT00209209) of the European MCL Network from 2004–2010 serving as training cohort. Patients without available Ki-67 and p53 data were excluded from this analysis. All patients gave written informed consent to participation in the trials. Two independent series of 300 patients from the MCL0208 trial [16] and 51 patients from the Nordic-MCL4 trial [17] were included in this study as validation cohort. The MCL0208 cohort considered TP53 mutation or del(17p) and the Nordic-MCL4 cohort only TP53 mutation status instead of p53 expression data. Immunohistochemistry Immunohistochemistry was performed centrally on either tissue micro- arrays or whole tissue sections. P53 was stained with a mouse monoclonal antibody (Leica/NovoCastra clone DO7) and scored as negative (0%), low (1–10%), intermediate (10–50%) or high (>50%) by one observer based on visual assessment as described [6]. Ki-67 index was centrally assessed in accordance with established guidelines [18]. Pathology Formalin-fixed paraffin-embedded (FFPE) diagnostic biopsy material was classified as classical or pleomorphic/blastoid variant by cytomorphological features confirmed by the central pathology review of a pathology reference center (European MCL Pathology Panel). Risk variables Biological risk variables Ki-67 and p53 expression along with the clinical prognostic tool MIPI were investigated in various combinations. MIPI score is the weighted sum of MIPI prognostic factors weighted by the regression coefficients from the defining Cox regression model [4]. The equally weighted combination of MIPI with the dichotomized Ki-67 index at the validated 30% cutoff defines the MIPI-c [5]. It was previously reported that none of the patients in the MCL Younger and Elderly cohort with complete absence of p53 expression did display TP53 deletions [6, 8]. For this reason, we focused on the cutoff for p53 expression at 50% serving as biomarker indicating a TP53 mutation with altered functions [11, 19]. Combinations tested to define high-risk disease (HRD) were p53 expression >50% or Ki-67 ≥30% (definition 1), p53 expression >50% or high, high-intermediate MIPI-c (definition 2), or p53 expression >50% or high MIPI-c (definition 3). Accordingly, low-risk disease (LRD) was defined by p53 expression ≤50% and Ki-67 < 30% (definition 1), p53 expression ≤50% and low, low-intermediate MIPI-c (definition 2) or p53 expression ≤50% and low, low-intermediate, high-intermediate MIPI-c (definition 3). For the validation cohort, presence of TP53 mutation and del(17p) (only MCL0208 cohort) defined HRD instead of high p53 expression. Statistical methods Cases with missing data for both Ki-67 and p53 expression or TP53 mutation/deletion, respectively, were excluded from the analysis. If one high-risk feature applies, missing data for the other variable is allowed. For the classification of LRD all variables must be available. The percentages of HRD in the study population were estimated based on complete cases, where patients with missing data in either Ki-67 or p53 expression were excluded in order to minimize bias. The number of complete cases is significantly smaller but is more reliable to estimate the true proportion of MCL patients with HRD. Analyses for the outcomes were performed on all the classifiable patients with available outcome data. In addition, we performed sensitivity analyses with complete cases. We estimated and compared failure-free survival (FFS, defined as time from treatment start to stable disease, progression, or death from any cause, whichever occurred first) and overall survival (OS, defined as time from study registration to death from any cause) stratified by Ki-67 index (</≥30%), cytology (blastoid versus non blastoid), p53 expression (≤/>50%), the combination of Ki-67 and p53 and MIPI-c and p53 using Kaplan-Meier-plots, logrank tests, and Cox regression. Five-year FFS and OS probabilities were reported along with median FFS and OS times. Quantification of follow-up was done by the reversed Kaplan-Meier method. Status of the clinical data was that of July 08, 2021, the latest available time point of medically reviewed data from MCL Younger and MCL-Elderly trials. RESULTS Six hundred eighty-four patients (MCL Younger n = 390, MCL Elderly n = 294) out of 1183 registered study patients with MCL from the training cohort had evaluable data either for Ki-67 or p53 (Supplemental Fig. 1). Among these, low-risk MIPI was more frequent (43% vs. 27%), whereas high-risk MIPI was significantly less frequent (24% vs. 44%, p < 0.0001) compared to those without evaluable data (Table 1). Accordingly, median FFS and OS was superior in the subgroup of patients with available data (4.4 vs. 3.2 years, p = 0.0066 and 9.6 vs. 6.6 years, p = 0.0013) (Supplemental Fig. 2). This difference is mainly explained by an overrepresenta- tion of patients with available pathology data from the MCL Younger trial (57% vs 45%) who had a better overall outcome. Of note, there was no difference in outcome of patients with a high MIPI comparing those with available data for Ki-67/p53 vs. unavailable data for Ki-67 and p53. Apart from MIPI parameters, patient characteristics were equally distributed among the two groups (Table 1). High MIPI-c was seen in 63 of 612 cases (10%) and high p53 expression in 54 of 348 (16%) cases. High p53 expression was associated with inferior median FFS (1.5 vs. 4.6 years; p < 0.0001) and OS (2.8 vs. 10.7 years, p < 0.0001) compared to p53 expression ≤50% (data not shown). Blastoid cytology was no negative predictor in patients with low Ki-67 (Supplementary Fig. 3). Using Ki-67 ≥30% or high p53 expression to define HRD (definition 1) resulted in a relatively large high-risk group with 37% of complete cases. Median FFS and OS was 1.8 vs. 6.0 years (HR 2.01, p < 0.0001) and 4.0 vs. 14.4 years (HR 2.57, p < 0.0001) compared to LRD (Supplemental Fig. 4). Considering also clinical factors, we tested the impact of high, high-intermediate MIPI-c or high p53 expression (definition 2) on outcome. This high-risk definition includes 41% of complete cases and revealed similar results (median FFS: 1.7 vs. 6.0 years, HR 2.40, p < 0.0001; median OS: 3.6 vs. 15.4 years, HR 3.24, p < 0.0001) (Supplemental Fig. 5). The combination of high MIPI-c or high p53 expression (definition 3) defined the smallest group of high-risk patients and had the highest discriminatory power between HRD and LRD in terms of the hazard ratios for FFS and OS, why we chose that definition for further analyses. Based on the selection process of definition 3, 22% complete cases could be assigned to the HRD group (n = 60) and 78% (n = 216) had confirmed LRD. After a median follow-up of 9.6 (FFS) and 9.4 (OS) years the median FFS (1.1 years vs. 5.6 years; HR 2.97, p < 0.0001; Fig. 1A) and OS (2.2 vs. 13.2 years, HR 3.69, p < 0.0001; Fig. 1B) was significantly decreased in the high-risk compared with the low-risk group. 5-year and 10- year FFS probabilities were 18% vs. 51% and 10% vs. 37%; 5-year and 10-year OS probabilities were 31% vs. 72% and 15% vs. 59% for HRD vs. LRD, respectively. Sensitivity analyses in complete cases showed similar results to the analyses in classifiable cases. These aforementioned significant differences were observed consistently across both trial groups, regardless of whether patients received conventionally dosed immunochemo- and maintenance therapy in MCL Elderly (median FFS: 0.8 vs. 3.9 years, p < 0.0001; median OS: 1.9 vs 9.7 years, p < 0.0001) or received induction with intention to high-dose chemotherapy followed by aSCT in MCL Younger (median FFS: 1.9 vs. 6.7 years, p < 0.0001; median OS: 3.0 years vs. median not reached, p < 0.0001) (Fig. 2). Subgroup analyses showed that R-CHOP compared to R-FC in MCL Elderly (median OS 1.1 vs. 2.3 years; HR 3.61 vs. 3.50) as well as R-CHOP/R-DHAP induction compared to R-CHOP induction in MCL Younger (median OS 1.5 vs. 5.6 years; HR 5. 94 vs. 3.06.) could partially mitigate the dismal prognosis of HRD. However, the G. Scheubeck et al. 1888 Leukemia (2023) 37:1887 – 1894 transplantation was carried out in some patients of the Younger trial, only a minority received targeted therapies such as a BTKi (1–3% in the MCL Younger, 7–10% in the MCL-Elderly trial) [24, 25]. Hence, the efficacy of novel therapies in HRD patients can hardly be inferred from these trials as the numbers are too small. Of note, also the immunomodulatory drug lenalidomide trial did not overcome the adverse impact of TP53 mutations in combination with R-bendamustine [13]. The general validity of the biology-based HRD model was confirmed in the FIL-MCL0208 and the Nordic-MCL4 trial with significant inferior PFS and higher risk for death in high-risk patients. Interestingly, in relapsed or refractory MCL even the potent BTKi ibrutinib does not overcome the poor prognosis that is linked to TP53 mutations and high MIPI-c [26–28]. A benefit of ibrutinib for progression-free survival in the first line treatment of elderly patients was recently reported in the SHINE study (ClinicalTrials.- gov Identifier: NCT01776840) [29]. However, the addition of ibrutinib to rituximab and bendamustine did not show a clear benefit in patients with TP53 mutations or a MIPI score indicating high-risk [29]. The benefit of ibrutinib in combination with chemotherapy in treatment-naive transplant eligible patients has been recently reported for the TRIANGLE study, but longer follow- up is required to evaluate whether this combination fully overcomes the biological risk factors [30]. Of note, neither Ki- 67 ≥50%, TP53 mutation, nor intermediate or high MIPI had any negative prognostic value for 6-months PFS in relapsed or refractory patients treated with the novel CD19 directed CAR-T- cell therapy KTE-X19 [31], suggesting that cellular immunotherapy might overcome the poor prognosis in high-risk patients. As MCL patients with HRD defined by high MIPI-c or high p53 expression/TP53 alteration had a dismal clinical course of the disease, we recommend to incorporate these factors in routine diagnostic practice as suggested by the WHO 5th edition and the International Consensus Classification (ICC) to identify patients with need for novel therapeutic strategies [32, 33]. At present, HRD MCL patients should be treated with ibrutinib-containing induction based on the SHINE and TRIANGLE data [29, 30]. However, we think that this approach will not completely overcome the dismal prognosis of high MIPI-c or high p53/TP53 mutation and clinical trials are needed that particularly address HRD patients. In conclusion, the combination of the prognostic MIPI index with the biological risk factors TP53 mutation and high Ki-67 expression reliably defines a subset of MCL patients with dismal prognosis. On the other hand, patients without these high-risk features achieve an excellent outcome with an overall survival over a decade with the current standard of care. Furthermore, these results will allow risk stratification in clinical trials, to hopefully develop innovative therapies especially for the high-risk MCL population which has the greatest medical need. Fig. 3 Prognostic impact of high MIPI-c or high p53 expression on overall survival stratified by treatment groups of the MCL Younger and the MCL Elderly trial. Kaplan–Meier estimates of OS among patients treated with R-CHOP induction and aPBSCT (A), alternating R-CHOP/ R-DHAP induction and aPBSCT (B), R-FC and IFN maintenance (C) and R-CHOP + R maintenance (D) stratified by the presence of high MIPI-c or p53 expression >50% (high-risk disease) compared to low, low-intermediate or high-intermediate MIPI-c and p53 expression <50% (low-risk disease). The number at risk is based on all classifiable patients. G. Scheubeck et al. 1892 Leukemia (2023) 37:1887 – 1894 DATA AVAILABILITY The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request. REFERENCES 1. Castellino A, Wang Y, Larson MC, Maurer MJ, Link BK, Farooq U, et al. Evolving frontline immunochemotherapy for mantle cell lymphoma and the impact on survival outcomes. Blood Adv. 2022;6:1350–60. 2. Zhou K, Zou D, Zhou J, Hu J, Yang H, Zhang H, et al. Zanubrutinib monotherapy in relapsed/refractory mantle cell lymphoma: a pooled analysis of two clinical trials. J Hematol Oncol. 2021;14:167. 3. Visco C, Di Rocco A, Evangelista A, Quaglia FM, Tisi MC, Morello L, et al. Outcomes in first relapsed-refractory younger patients with mantle cell lymphoma: results from the MANTLE-FIRST study. Leukemia. 2021;35:787–95. 4. Hoster E, Dreyling M, Klapper W, Gisselbrecht C, van Hoof A, Kluin-Nelemans HC, et al. A new prognostic index (MIPI) for patients with advanced-stage mantle cell lymphoma. Blood. 2008;111:558–65. 5. Hoster E, Rosenwald A, Berger F, Bernd HW, Hartmann S, Loddenkemper C, et al. Prognostic value of Ki-67 index, cytology, and growth pattern in mantle-cell lymphoma: results from randomized trials of the European Mantle Cell Lym- phoma Network. J Clin Oncol. 2016;34:1386–94. 6. Aukema SM, Hoster E, Rosenwald A, Canoni D, Delfau-Larue MH, Rymkiewicz G, et al. Expression of TP53 is associated with the outcome of MCL independent of MIPI and Ki-67 in trials of the European MCL Network. Blood. 2018;131:417–20. 7. Eskelund CW, Dahl C, Hansen JW, Westman M, Kolstad A, Pedersen LB, et al. TP53 mutations identify younger mantle cell lymphoma patients who do not benefit from intensive chemoimmunotherapy. Blood. 2017;130:1903–10. 8. Delfau-Larue MH, Klapper W, Berger F, Jardin F, Briere J, Salles G, et al. High-dose cytarabine does not overcome the adverse prognostic value of CDKN2A and TP53 deletions in mantle cell lymphoma. Blood. 2015;126:604–11. 9. Raty R, Franssila K, Joensuu H, Teerenhovi L, Elonen E. Ki-67 expression level, histological subtype, and the International Prognostic Index as outcome pre- dictors in mantle cell lymphoma. Eur J Haematol. 2002;69:11–20. 10. Geisler CH, Kolstad A, Laurell A, Jerkeman M, Raty R, Andersen NS, et al. Nordic MCL2 trial update: six-year follow-up after intensive immunochemotherapy for untreated mantle cell lymphoma followed by BEAM or BEAC + autologous stem- cell support: still very long survival but late relapses do occur. Br J Haematol. 2012;158:355–62. 11. Stefancikova L, Moulis M, Fabian P, Ravcukova B, Vasova I, Muzik J, et al. Loss of the p53 tumor suppressor activity is associated with negative prognosis of mantle cell lymphoma. Int J Oncol. 2010;36:699–706. 12. Ferrero S, Rossi D, Rinaldi A, Bruscaggin A, Spina V, Eskelund CW, et al. KMT2D mutations and TP53 disruptions are poor prognostic biomarkers in mantle cell lymphoma receiving high-dose therapy: a FIL study. Haematologica. 2020;105:1604–12. 13. Eskelund CW, Albertsson-Lindblad A, Kolstad A, Laurell A, Raty R, Pedersen LB, et al. Lenalidomide plus bendamustine-rituximab does not overcome the adverse impact of TP53 mutations in mantle cell lymphoma. Haematologica. 2018;103:e541–e3. 14. Hermine O, Hoster E, Walewski J, Bosly A, Stilgenbauer S, Thieblemont C, et al. Addition of high-dose cytarabine to immunochemotherapy before autologous stem-cell transplantation in patients aged 65 years or younger with mantle cell lymphoma (MCL Younger): a randomised, open-label, phase 3 trial of the Eur- opean Mantle Cell Lymphoma Network. Lancet. 2016;388:565–75. 15. Kluin-Nelemans HC, Hoster E, Hermine O, Walewski J, Trneny M, Geisler CH, et al. Treatment of older patients with mantle-cell lymphoma. N Engl J Med. 2012;367:520–31. 16. Ladetto M, Cortelazzo S, Ferrero S, Evangelista A, Mian M, Tavarozzi R, et al. Lenalidomide maintenance after autologous haematopoietic stem-cell trans- plantation in mantle cell lymphoma: results of a Fondazione Italiana Linfomi (FIL) multicentre, randomised, phase 3 trial. Lancet Haematol. 2021;8:e34–e44. 17. Albertsson-Lindblad A, Kolstad A, Laurell A, Raty R, Gronbaek K, Sundberg J, et al. Lenalidomide-bendamustine-rituximab in patients older than 65 years with untreated mantle cell lymphoma. Blood. 2016;128:1814–20. 18. Klapper W, Hoster E, Determann O, Oschlies I, van der Laak J, Berger F, et al. Ki-67 as a prognostic marker in mantle cell lymphoma-consensus guidelines of the pathology panel of the European MCL Network. J Hematop. 2009;2:103–11. 19. Hernandez L, Fest T, Cazorla M, Teruya-Feldstein J, Bosch F, Peinado MA, et al. p53 gene mutations and protein overexpression are associated with aggressive variants of mantle cell lymphomas. Blood. 1996;87:3351–9. 20. Vousden KH. Outcomes of p53 activation-spoilt for choice. J Cell Sci. 2006;119:5015–20. 21. Hainaut P, Hollstein M. p53 and human cancer: the first ten thousand mutations. Adv Cancer Res. 2000;77:81–137. 22. Rodrigues JM, Hassan M, Freiburghaus C, Eskelund CW, Geisler C, Räty R, et al. p53 is associated with high-risk and pinpoints TP53 missense mutations in mantle cell lymphoma. Br J Haematol. 2020;191:796–805. 23. Nolan J, Murphy C, Dinneen K, Lee G, Higgins E, Bacon L, et al. p53 immuno- histochemistry must be confirmed by TP53 next generation sequencing for accurate risk stratification of patients with mantle cell lymphoma. Leuk Lym- phoma. 2022;63:3504–7. 24. Kluin-Nelemans HC, Hoster E, Hermine O, Walewski J, Geisler CH, Trneny M, et al. Treatment of older patients with mantle cell lymphoma (MCL): long-term follow- up of the randomized European MCL elderly trial. Journal of Clinical Oncology. 2020;38:248–56. 25. Hermine O, Jiang L, Walewski J, Bosly A, Szymczyk M, Thieblemont C, et al. Addition of high-dose cytarabine to immunochemotherapy before autologous stem-cell transplantation in patients aged 65 years or younger with mantle cell lymphoma (MCL Younger): a long-term follow-up of the randomized, open-label, phase 3 trial of the European Mantle Cell Lymphoma Network. Blood. 2021;138:380–380. 26. Rule S, Dreyling M, Goy A, Hess G, Auer R, Kahl B, et al. Outcomes in 370 patients with mantle cell lymphoma treated with ibrutinib: a pooled analysis from three open-label studies. Br J Haematol. 2017;179:430–8. 27. Rule S, Dreyling M, Goy A, Hess G, Auer R, Kahl B, et al. Ibrutinib for the treatment of relapsed/refractory mantle cell lymphoma: extended 3.5-year follow up from a pooled analysis. Haematologica. 2019;104:e211–e4. 28. Dreyling M, Goy A, Hess G, Kahl BS, Hernández-Rivas J, Schuier N, et al. Long-term outcomes with ibrutinib treatment for patients with relapsed/refractory mantle cell lymphoma: a pooled analysis of 3 clinical trials with nearly 10 years of follow- up. Hemasphere. 2022;6:e712. 29. Wang ML, Jurczak W, Jerkeman M, Trotman J, Zinzani PL, Belada D, et al. Ibrutinib plus bendamustine and rituximab in untreated mantle-cell lymphoma. N Engl J Med. 2022. https://doi.org/10.1056/NEJMoa2201817 30. Dreyling M, Doorduijn JK, Gine E, Jerkeman M, Walewski J, Hutchings M, et al. Efficacy and safety of ibrutinib combined with standard first-line treatment or as substitute for autologous stem cell transplantation in younger patients with mantle cell lymphoma: results from the randomized triangle trial by the Eur- opean MCL Network. Blood. 2022;140:1–3. 31. Wang M, Munoz J, Goy A, Locke FL, Jacobson CA, Hill BT, et al. KTE-X19 CAR T-cell therapy in relapsed or refractory mantle-cell lymphoma. N Engl J Med. 2020;382:1331–42. 32. Campo E, Jaffe ES, Cook JR, Quintanilla-Martinez L, Swerdlow SH, Anderson KC, et al. The international consensus classification of mature lymphoid neoplasms: a report from the Clinical Advisory Committee. Blood. 2022;140:1229–53. 33. Alaggio R, Amador C, Anagnostopoulos I, Attygalle AD, Araujo IBDO, Berti E, et al. The 5th edition of the World Health Organization classification of haematolym- phoid tumours: lymphoid neoplasms. Leukemia. 2022;36:1720–48. ACKNOWLEDGEMENTS We thank the European MCL Network, the Italian Lymphoma Foundation (FIL) and the Nordic Lymphoma Group (NLG) for participation in this study. AUTHOR CONTRIBUTIONS GS, LJ and EH wrote the manuscript, LJ performed the statistical analysis; AR and WK collected material; CS, MU, HK-N, OH, AE, ML, SF and MJ provided clinical data; AR and WK performed the immunohistochemistry analysis; OH, HK-N, EH and MD designed the study; and all authors approved the final version of the manuscript. FUNDING Open Access funding enabled and organized by Projekt DEAL. COMPETING INTERESTS GS, LJ, OH, HCK-N, CS, MU, AR, WK, ML, AE and EH: None. MJ—Honoraria: Abbvie, Astra Zeneca, BMS, Genmab, Gilead, Pierre Fabre, Janssen, Roche. Research support: Abbvie, Astra Zeneca, BMS, Gilead, Janssen, Roche. SF—Research funding: Janssen, Morphosys, Gilead, Beigene. Consultancy: EusaPharma, Janssen, Sandoz, Abbvie. Advisory Board: EusaPharma, Janssen, Clinigen, Incyte, Italfarmaco. Speakers Honoraria: Janssen, EusaPharma, Servier, Gentili. MD—Research Support (institution): Abbvie, Bayer, BMS/Celgene, Gilead/Kite, Janssen, Roche. - Employee: -Major Stockholder: -Speakers Bureau: -Speakers Honoraria: Amgen, Astra Zeneca, Gilead/ Kite, Janssen, Lilly, Novartis, Roche. - Scientific Advisory Board: Astra Zeneca, Beigene, BMS/Celgene, Gilead/Kite, Janssen, Lilly/Loxo, Novartis, Roche. G. Scheubeck et al. 1893 Leukemia (2023) 37:1887 – 1894 ADDITIONAL INFORMATION Supplementary information The online version contains supplementary material available at https://doi.org/10.1038/s41375-023-01977-y. Correspondence and requests for materials should be addressed to Gabriel Scheubeck. Reprints and permission information is available at http://www.nature.com/ reprints Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http:// creativecommons.org/licenses/by/4.0/. © The Author(s) 2023 G. Scheubeck et al. 1894 Leukemia (2023) 37:1887 – 1894

Title: Clinical outcome of Mantle Cell Lymphoma patients with high-risk disease (high-risk MIPI-c or high p53 expression) ​ Authors: Gabriel Scheubeck, Linmiao Jiang, Olivier Hermine, Hanneke C. Kluin-Nelemans, Christian Schmidt, Michael Unterhalt, Wolfram Klapper, Andrea Evangelista, Marco Ladetto, Mats Jerkeman, Simone Ferrero, Martin Dreyling, and Eva Hoster ​ Publisher: Nature Date: July 26, 2023 ​ Abstract: Currently, treatment allocation of patients with Mantle Cell Lymphoma (MCL) is mainly based on age and medical fitness. ​ The combined MCL International Prognostic Index (MIPI-c) allows predicting prognosis using clinical factors (MIPI) and the Ki-67 index. ​ However, high p53 expression as a surrogate for TP53 alterations has demonstrated to be an independent predictor for poor outcome. ​ We aimed to define a clear high-risk group based on the combination of MIPI, Ki-67, and p53 expression/TP53 alteration. ​ A total of 684 patients from the prospective European MCL-Younger and MCL-Elderly trials were evaluable. ​ The classification of high-risk disease (HRD) as high-risk MIPI-c or p53 expression >50% versus low-risk disease (LRD) as low, low-intermediate, or high-intermediate MIPI-c and p53 expression ≤50% allowed characterizing two distinct groups with highly divergent outcomes. ​ Patients with HRD had significantly shorter median failure-free survival (FFS) (1.1 vs. 5.6 years, p < 0.0001) and overall survival (OS) (2.2 vs. 13.2 years, p < 0.0001) compared to those with LRD. ​ These major differences were confirmed in two validation cohorts from the Italian MCL0208 and the Nordic-MCL4 trials. ​ The results suggest that this subset of HRD patients is not sufficiently managed with the current standard treatment and is asking for novel treatment strategies. ​

3D printing of plasmonic nanofocusing tip enabling high resolution, high throughput and high contrast optical near-field imaging.pdf

Long et al. Light: Science & Applications (2023) 12:219 Official journal of the CIOMP 2047-7538 https://doi.org/10.1038/s41377-023-01272-6 www.nature.com/lsa A R T I C L E O p e n A c c e s s 3D printing of plasmonic nanofocusing tip enabling high resolution, high throughput and high contrast optical near-field imaging Li Long1, Qiurong Deng1, Rongtao Huang1, Jiafang Li 2 and Zhi-Yuan Li1,3✉ Abstract Scanning near-field optical microscopy (SNOM) offers a means to reach a fine spatial resolution down to ~ 10 nm, but unfortunately suffers from low transmission efficiency of optical signal. Here we present design and 3D printing of a fiber-bound polymer-core/gold-shell spiral-grating conical tip that allows for coupling the inner incident optical signal to the outer surface plasmon polariton with high efficiency, which then adiabatically transport, squeeze, and interfere constructively at the tip apex to form a plasmonic superfocusing spot with tiny size and high brightness. Numerical simulations and optical measurements show that this specially designed and fabricated tip has 10% transmission efficiency, ~ 5 nm spatial resolution, 20 dB signal-to-noise ratio, and 7000 pixels per second fast scanning speed. This high-resolution, high throughput, and high contrast SNOM would open up a new frontier of high spatial-temporal resolution detecting, imaging, and monitoring of single-molecule physical, chemical, and biological systems, and deepen our understanding of their basic science in the single-molecule level. Introduction Optical microscopy offers a bridge connecting macro- scopic and microscopic world through imaging, spectro- scopy, and other means in space-time domain. But it also determines the spatial resolution of optical imaging to be micrometer scale at best, thanks to the diffraction effect of light wave, and this becomes the biggest disadvantage of conventional optical microscopy. In recent decades there has been increasing demand to lift this limitation and push the resolution down to nanometer scale, thus effectively upgrading optical microscopy into optical nanoscopy. Meanwhile, it is also highly desired that the advancement in the imaging resolution of nanoscopy is not in the price of severe degradation in many other advantages of conventional optical microscopy. History tells us that this is never an easy task. Among different means of super-resolution optical imaging schemes and technologies, scanning near-field optical microscopy (SNOM) is a purely optical technique that can effectively lift the diffraction limit of resolution1–4. In early 1980s, the great success of scanning tunneling microscopy (STM) and atomic force microscopy (AFM) stimulated the invention of SNOM5–9, and since then a wide variety of SNOM instruments have been developed, advanced, and placed into applications for basic sciences10,11. The classical SNOM techniques can be classified into the “aperture SNOM” (a-SNOM)3–8 and “aptertureless or scattering SNOM” (s-SNOM)9,12–19 categories. As sche- matically illustrated in Fig. 1a, a-SNOM can have high resolution and high contrast by reducing the aperture size, but suffers low throughput, while the s-SNOM, as sche- matically illustrated in Fig. 1b, can have high resolution by reducing the tip apex size, but suffers both low through- put and low signal contrast. Many schemes have been developed and adopted to relieve the difficulty of very low transmission efficiency intrinsic with classical a-SNOM and s-SNOM instruments. In regard to metal-coated © The Author(s) 2023 OpenAccessThisarticleislicensedunderaCreativeCommonsAttribution4.0InternationalLicense,whichpermitsuse,sharing,adaptation,distributionandreproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Correspondence: Zhi-Yuan Li ([email protected]) 1School of Physics and Optoelectronics, South China University of Technology, Guangzhou 510641, China 2School of Physics, Beijing Institute of Technology, Beijing 100081, China Full list of author information is available at the end of the article 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; tapered fiber tip in a-SNOM, Xu et al. adopted complex- shape aperture such as H-shaped and bowtie-shaped aperture other than regular circular aperture and the transmission efficiency could increase by one order of magnitude20. Zhang et al. integrated a 100 nm nanoa- perture surrounded by a circular through grating that resembles a plasmonic lens on the metal coating of a conic SNOM tip21. With a balance of luminous flux and aperture size, these deliberately designed probes still have very low optical throughput, resulting in weak signal light in use. Besides, the resolution is limited due to aperture size, at about 50-100 nm. Two major problems exist for apertureless s-SNOM, one is the weak transmission efficiency of signal light for use, the other is the strong background signal and thus bad signal-to-noise ratio (SNR) level. Ropers et al. d a b X Y Z 5 µm µm c e f g h i k j Aperture (25–100 nm) Sample XYZ Scanning probe Apertureless tip Top view Single mode Fiber SPPs Superfocusing spot 20 m 2 m 25 m 5 m 5 m 500 nnm 500 nnm Fig. 1 Principle for design and fabrication of plasmonic nanofucsing tip for SNOM near-field imaging. a Principle of operation for a classical a-SNOM. b Principle of operation for a classic s-SNOM. c Principle of operation for the current gold spiral-grating conical tip. d Schematic of plasmon nanofocusing conical tip directly built on the facet of optical fiber to serve as a high-performance SNOM tip under internal illumination. e Top-view optical microscope image of the fabricated SNOM tip. The outer dashed circle means the optical fiber edge, and the inner dashed square denotes the location of the center conical tip. f, g Top view and side view respectively of the optical image against a nanofocusing light spot at 785 nm emitting from the tip apex, as observed by a dark-field microscope objective. h–k Scanning electron microscopy (SEM) image of the fabricated spiral- grating conical tip in different scale ranges of view Long et al. Light: Science & Applications (2023) 12:219 Page 2 of 9 SNOM imaging experiments. Ideally this standard sample has an infinitely sharp edge of air and chrome in geometry, and should also show a sharp edge of bright and dark region with zero cross-over distance w in the SNOM imaging with ideally infinitely fine resolution. But when the SNOM has finite resolution, the sharp edge would has a smooth cross- over distance from dark to bright region in the image. In more mathematical terms, the line groove profile can be thought of as the so-called edge response function (ERF), and the characteristic width w of an ERF is known as the line spread function (LSF). The LSF represents an image of a linear object, usually a Gaussian function centered on the material boundary. The width of the LSF determines the resolution according to some specific standard such as Rayleigh criterion popularly used to evaluate the resolution of conventional optical microscope, which is just about half wavelength. Careful theoretical calculations presented in Methods Sec. S7 and Fig. S5 indicate that the resolution of SNOM is nearly equal to the size of the SNOM tip nano- focusing spot used to illuminate the standard chrome grating sample. Based on these theoretical knowledges, we have the capability to determine the nanofocusing spot size as well as the SNOM imaging resolution. The standard chrome grating sample is observed by our home-modified SNOM instrument armed with the gold spiral-grating conical tip operating in the illumination mode. The near-field optical imaging is made at a scan- ning speed of 15 μm s-1 and a step size of 2 nm, corre- sponding to a scanning pixel speed of 7000 pixel s-1 and 0.13 ms per pixel. This is a very fast near-field image acquiring speed and it can be only attributed to the ~10% high throughput of the SNOM tip. The 2D pictures of near-field scanning image obtained for this standard chrome grating sample is shown in Fig. 4d. The bright region for each perforated slit domain and dark region for other intact chrome thin film domains is distinct. According to the edge curve distribution of Fig. S5b in the supporting material, we use the Boltzmann distribution to fit the experimental data. The 1D scanning curve of near field picture across a slit as displayed in Fig. 4e-f shows a near-field imaging resolution of about 5.7 nm for this SNOM tip, which clearly shows that this tip can push the SNOM resolution well below 10 nm. To further demonstrate the excellent performance of our home-made SNOM tip, including its independence upon the incident light polarization, we change the standard sample to a logo pattern composed of four let- ters as “SCUT” perforated into a 80 nm thick chrome thin film, again by using the FIB lithography. Each letter consists of line grooves (slits) orienting in different directions, including the orthogonal X and Y direction. The SEM image is shown in Fig. 5a, where the slit width is set to be 198 nm. A typical 2D SNOM imaging picture recorded at the same scanning speed of 15 μm s-1 and scanning step of 2 nm for this complicated sample is displayed in Fig. 5b. Since in principle SEM can only reflect the surface morphology of the sample, it cannot disclose the detailed structure inside the sample slit. To determine this subtle local 3D geometric configuration, we image the slit with a standard AFM instrument. The 2D AFM picture for the letter “S” is shown in Fig. 5c, and the 1D curve representing two white dotted lines R1 and R2 across the letter are displayed in Fig. 5d. There appear apparent unevenness at the edges of the FIB sculptured lines, indicating that the slits do not have ideally sharp edges in geometry, but rather involve smooth cross-over regions. This geometry apparently will cause some pattern unevenness in the SNOM imaging picture that has been illustrated in Fig. 5b. The existence of the cross-over region within a slit makes the SNOM image of this slit, a bright line, narrower than the ideal slit with sharp edge and no cross-over region, in good agreement with the observed SNOM picture. This confirms once again that this home-made SNOM tip indeed has a very fine reso- lution so that it can reveal clearly such kind of 3D geo- metric unevenness within the inner space of a slit. To accurately examine the resolution of the home-made SNOM tip against the complex pattern, we select two cross sections within the letters as marked in Fig. 5b, one is L1 along the vertical Y direction, and the other is L2 along the horizontal X direction. The corresponding 1D curves plotting the near-field imaging data are displayed in Fig. 5e, f. The results show that the spatial resolution in the 2D scan for the complex 2D logo pattern can reach a very high value up to 4.5 nm in Y direction and 4.7 nm in X direction. No wonder this tip can reveal the geometric unevenness within practical slits sculptured within the chrome thin film in a level matching up the powerful classical AFM instrument. When looking back at the near-field imaging picture displayed in Fig. 4d for 1D grating slits, the unevenness within the picture, i.e., some parts of slit wider and some parts of slit narrower, now can be attributed to the geometric unevenness in various regions of slits across the practical grating sample perforated in the chrome thin film. These data suggest the FIB nanofabrication technol- ogy should be improved to provide better standard samples for more reliable SNOM experiments. Discussion In summary, we have presented the design and 3D printing nanofabrication of a fiber-bound polymer-core/ gold-shell spiral-grating conical tip to serve as SNOM near- field imaging probe, in a wish to achieve simultaneously high resolution, high throughput, and high contrast that are highly desirable but very difficult to accomplish in previous schemes of a-SNOM and s-SNOM. Our design of SNOM tip is to introduce a gold spiral grating at the surface of dielectric conical tip and help to offer flexible momentum Long et al. Light: Science & Applications (2023) 12:219 Page 7 of 9 matching condition for coupling the inner optical signal coming from optical fiber via SPP excitation to the outer air-metal interface of gold conical tip with high efficiency and independent on the incident light polarization. Such a 3H SNOM tip and SNOM instrument would open up a new frontier of high spatial-temporal resolution detecting, imaging, and monitoring of single-molecule physical, che- mical, and biological systems, and deepen our under- standing of their basic science in the single-molecule level. Materials and methods Sample fabrications The direct-laser writing (DLW) 3D printing nanofabrica- tion technology used in this study is based on two-photon polymerization (2PP) technique that is implemented by using a commercial instrument system (Photonic Profes- sional, Nanoscribe GmbH), and by a homemade magnetron- sputtering technique. In fabrication, a 780 nm femtosecond laser beam (with pulse width 120 fs and repetition rate 80 MHz) is focused into a negative photoresist (IP-L-780, Nanoscribe GmbH) by a high numerical aperture (NA) oil- immersion objective (63×, NA = 1.4, Zeiss). Detailed opera- tion steps can refer to supplementary information Sec. S1. Numerical simulation FDTD simulations of electromagnetic field for 1D grating To calculate the electromagnetic field distribution for 1D model gold grating, we adopt 2D FDTD technique. Periodic boundary are added along all-directions, the mesh size is 2 nm, and the plane wave of p-polarization is incident at a b c e Normalized intensity(a.u.) Height(nm) Normalized height(nm) Normalized intensity(a.u.) Normalized intensity(a.u.) d f 1 m 1 m L1 L2 400 nm 0 80 0 0.2 0.4 0.6 0.8 1.0 1.2 0 100 200 300 -100 -200 -300 0 0.2 0.4 0.6 0.8 1.0 0 200 Y(nm) X(nm) X(nm) 400 600 4.5 nm 205 nm 4.7 nm 198 nm R2 R1 R2 R1 L1 L2 200 400 600 0 0.2 0.4 0.6 0.8 1.0 0 1 Fig. 5 Experimental characterization of home-made SNOM tip resolution by performing near-field imaging upon 2D letters of lamellar slits perforated in chrome thin film. a SEM image of the “SCUT” logo pattern sample sculptured and perforated into 80 nm thick chromium film. b The SNOM scan image for the “SCUT” logo sample. c AFM height image engraved with the letter “S”. d AFM image for the 1D profile taken along the white dotted lines R1 and R2 as marked in (c). e, f 1D near-field image curves scanned along white dotted lines L1 and L2 as marked in (b) Long et al. Light: Science & Applications (2023) 12:219 Page 8 of 9 different angles with the wavelength 785 nm. The grating period is 750 nm and the semi-ellipse corrugation width is 580 nm. The gold film has a thickness 80 nm, and the refractive index of the polymer (photoresist) is 1.52. FDTD simulations of electromagnetic field for 3D spiral- grating conical tip The 3D FDTD method is used for the calculation of electromagnetic fields for the 3D spiral-grating conical tip. Perfectly matched layers (PML) are added along all- directions. The grid size is set as 5 nm to reduce the computation cost. The thickness of gold thin film is 80 nm and the refractive index of the polymer (photoresist) is 1.52. The conical tip is excited by a Gaussian laser beam of a field intensity of 1 Vm−1, 10 μm in diameter size and 5 μm in full width at half maximum (FWHM) diameter, in agreement with experiments. Both femtosecond pulse and continuous wave laser are used for full examination of the optical signal transport, SPP excitation and couplings, SPP transport and focus at the tip apex to form a nanofocusing spot. And See more details on methods and materials from supplementary information Sec. S5. Funding The authors are grateful for the financial support from Guangdong Innovative and Entrepreneurial Research Team Program (2016ZT06C594), National Key R&D Program of China (2018YFA 0306200), and Science and Technology Project of Guangdong (2020B010190001). Author details 1School of Physics and Optoelectronics, South China University of Technology, Guangzhou 510641, China. 2School of Physics, Beijing Institute of Technology, Beijing 100081, China. 3State Key Laboratory of Luminescent Materials and Devices, South China University of Technology, Guangzhou 510640, China Author contributions Z. Y. L. supervised the project. Z. Y. L. and L. L. conceived the 1D scheme for tip design, L. L. performed the theoretical design of 3D tip, made the 3D printing nanofabrication of designed tip, and performed near-field imaging experiments. Q. D. offered assistance in numerical simulations and SNOM experiments, R. H. offered assistance in experiments, and J. Li offered assistance in FIB fabrication of chrome samples. Z. Y. L. and L. L. provided theoretical and experimental analyses, and wrote the manuscript. All authors participated in the discussion of results and reviewed the manuscript. Data availability All data needed to evaluate the conclusions in the paper are present in the main text. Conflict of interest The authors declare no competing interests. Supplementary information The online version contains supplementary material available at https://doi.org/10.1038/s41377-023-01272-6. Received: 4 August 2023 Revised: 8 August 2023 Accepted: 22 August 2023 References 1. Heinzelmann, H. & Pohl, D. W. Scanning near-field optical microscopy. Appl. Phys. A 59, 89–101 (1994). 2. Betzig, E. & Trautman, J. K. Near-field optics: microscopy, spectroscopy, and surface modification beyond the diffraction limit. Science 257, 189–195 (1992). 3. Synge, E. H. XXXVIII. A suggested method for extending microscopic resolu- tion into the ultra-microscopic region. Lond., Edinb., Dublin Philos. Mag. J. Sci. 6, 356–362 (1928). 4. Ash, E. A. & Nicholls, G. Super-resolution aperture scanning microscope. Nature 237, 510–512 (1972). 5. Pohl, D. W., Denk, W. & Lanz, M. Optical stethoscopy: Image recording with resolution λ/20. Appl. Phys. Lett. 44, 651–653 (1984). 6. Lewis, A. et al. Development of a 500 Å spatial resolution light microscope: I. light is efficiently transmitted through λ/16 diameter apertures. Ultramicro- scopy 13, 227–231 (1984). 7. Betzig, E., Isaacson, M. & Lewis, A. Collection mode near‐field scanning optical microscopy. Appl. Phys. Lett. 51, 2088–2090 (1987). 8. Betzig, E. et al. Breaking the diffraction barrier: optical microscopy on a nanometric scale. Science 251, 1468–1470 (1991). 9. Inouye, Y. & Kawata, S. Near-field scanning optical microscope with a metallic probe tip. Opt. Lett. 19, 159–161 (1994). 10. Abate, Y. et al. Nanoscopy reveals surface-metallic black phosphorus. Light- SciAppl. 5, e16162 (2016). 11. Hachtel, J. A. et al. Spatially and spectrally resolved orbital angular momentum interactions in plasmonic vortex generators. LightSciAppl 8, 33 (2019). 12. Zenhausern, F., Martin, Y. & Wickramasinghe, H. K. Scanning interferometric apertureless microscopy: optical imaging at 10 angstrom resolution. Science 269, 1083–1085 (1995). 13. Knoll, B. & Keilmann, F. Near-field probing of vibrational absorption for che- mical microscopy. Nature 399, 134–137 (1999). 14. Hillenbrand, R., Taubner, T. & Keilmann, F. Phonon-enhanced light–matter interaction at the nanometre scale. Nature 418, 159–162 (2002). 15. Rang, M. et al. Optical near-field mapping of plasmonic nanoprisms. Nano Lett. 8, 3357–3363 (2008). 16. Chen, J. N. et al. Optical nano-imaging of gate-tunable graphene plasmons. Nature 487, 77–81 (2012). 17. Zhang, R. et al. Chemical mapping of a single molecule by plasmon-enhanced Raman scattering. Nature 498, 82–86 (2013). 18. Zhang, Y. et al. Visualizing coherent intermolecular dipole–dipole coupling in real space. Nature 531, 623–627 (2016). 19. Chen, X. Z. et al. Modern scattering-type scanning near-field optical micro- scopy for advanced material research. Adv. Mater. 31, 1804774 (2019). 20. Wang, L. & Xu, X. F. High transmission nanoscale bowtie-shaped aperture probe for near-field optical imaging. Appl. Phys. Lett. 90, 261105 (2007). 21. Wang, Y. et al. Plasmonic nearfield scanning probe with high transmission. Nano Lett. 8, 3041–3045 (2008). 22. Ropers, C. et al. Grating-coupling of surface plasmons onto metallic tips: a nanoconfined light source. Nano Lett. 7, 2784–2788 (2007). 23. Berweger, S. et al. Adiabatic tip-plasmon focusing for nano-raman spectro- scopy. J. Phys. Chem. Lett. 1, 3427–3432 (2010). 24. Lindquist, N. C. et al. Three-dimensional plasmonic nanofocusing. Nano Lett. 10, 1369–1373 (2010). 25. Wang, X. K. et al. Terahertz near-field microscopy based on an air-plasma dynamic aperture. LightSciAppl 11, 129 (2022). 26. Xu, Q. Y. et al. Effects of edge on graphene plasmons as revealed by infrared nanoimaging. LightSciAppl 6, e16204 (2017). 27. Li, J. F. et al. Direct laser writing of symmetry-broken spiral tapers for polarization-insensitive three-dimensional plasmonic focusing. Laser Photonics Rev. 8, 602–609 (2014). 28. Jiang, R. H. et al. Near-field plasmonic probe with super resolution and high throughput and signal-to-noise ratio. Nano Lett. 18, 881–885 (2018). 29. Auslender, M. & Hava, S. Scattering-matrix propagation algorithm in full- vectorial optics of multilayer grating structures. Opt. Lett. 21, 1765–1767 (1996). 30. Kawata, S. et al. Finer features for functional microdevices. Nature 412, 697–698 (2001). 31. Long, L. et al. Plasmonic enhanced fluorescence via 3D printing spiral conical tapered gold tip bound to optical fiber. APL Photonics 7, 046107 (2022). Long et al. Light: Science & Applications (2023) 12:219 Page 9 of 9

Title: 3D printing of plasmonic nanofocusing tip enabling high resolution, high throughput and high contrast optical near-field imaging ​ Authors: Li Long, Qiurong Deng, Rongtao Huang, Jiafang Li, and Zhi-Yuan Li ​ Publisher: Science & Applications, Official journal of the CIOMP ​ Date: 2023-09-06 00:00:00 Abstract: Scanning near-field optical microscopy (SNOM) offers a means to reach a fine spatial resolution down to ~10 nm, but unfortunately suffers from low transmission efficiency of optical signal. ​ Here we present design and 3D printing of a fiber-bound polymer-core/gold-shell spiral-grating conical tip that allows for coupling the inner incident optical signal to the outer surface plasmon polariton with high efficiency, which then adiabatically transport, squeeze, and interfere constructively at the tip apex to form a plasmonic superfocusing spot with tiny size and high brightness. ​ Numerical simulations and optical measurements show that this specially designed and fabricated tip has 10% transmission efficiency, ~5 nm spatial resolution, 20 dB signal-to-noise ratio, and 7000 pixels per second fast scanning speed. ​ This high-resolution, high throughput, and high contrast SNOM would open up a new frontier of high spatial-temporal resolution detecting, imaging, and monitoring of single-molecule physical, chemical, and biological systems, and deepen our understanding of their basic science at the single-molecule level. ​

Elasto-inertial microfluidic separation of microspheres with submicron resolution at high-throughput.pdf

Jeon et al. Microsystems & Nanoengineering (2024) 10:15 Microsystems & Nanoengineering https://doi.org/10.1038/s41378-023-00633-w www.nature.com/micronano A R T I C L E O p e n A c c e s s Elasto-inertial microfluidic separation of microspheres with submicron resolution at high-throughput Hyunwoo Jeon1, Song Ha Lee1, Jongho Shin2, Kicheol Song2, Nari Ahn2 and Jinsoo Park1✉ Abstract Elasto-inertial microfluidic separation offers many advantages including high throughput and separation resolution. Even though the separation efficiency highly depends on precise control of the flow conditions, no concrete guidelines have been reported yet in elasto-inertial microfluidics. Here, we propose a dimensionless analysis for precise estimation of the microsphere behaviors across the interface of Newtonian and viscoelastic fluids. Reynolds number, modified Weissenberg number, and modified elastic number are used to investigate the balance between inertial and elastic lift forces. Based on the findings, we introduce a new dimensionless number defined as the width of the Newtonian fluid stream divided by microsphere diameter. The proposed dimensionless analysis allows us to predict whether the microspheres migrate across the co-flow interface. The theoretical estimation is found to be in good agreement with the experimental results using 2.1- and 3.2-μm-diameter polystyrene microspheres in a co-flow of water and polyethylene oxide solution. Based on the theoretical estimation, we also realize submicron separation of the microspheres with 2.1 and 2.5 μm in diameter at high throughput, high purity (>95%), and high recovery rate (>97%). The applicability of the proposed method was validated by separation of platelets from similar-sized Escherichia coli (E.coli). Introduction Sample preparation is an essential step in the overall chemical analysis process; it improves analytical results by enriching the target material or removing contaminants before analysis1. Particle manipulation techniques have received increasing research attention owing to their applications in sample filtration2, flow cytometry3, and separation4. Various microfluidic manipulation techni- ques with high throughput, resolution, and efficiency have been developed. In particular, regarding resolution, techniques for the precise sample separation such as red blood cells (7–8 μm)5, platelets (1.5–3 μm)6, and bacteria (1–3 μm)7 are highly required. However, the submicron- resolution separation of micro-objects is difficult because most of the forces moving the particles in the lateral direction are proportional to the sample size8. Polymer microspheres have been widely utilized as model objects for bio-particles9,10. Passive manipulation techniques rely on internal hydrodynamic forces acting on suspended objects, whereas in active techniques, forces are applied to the objects from external actuation devices. The typical examples of the passive techniques include inertial flow focusing based on fluid inertial force11,12, pinched flow13 and Dean flow fractionation based on Dean drag force generated in curved pipes14,15, and deterministic lateral displacement (DLD) based on the streamline of flow along the structures16. These techni- ques allow simple device configuration and manipulation, offer high single-chip throughput, and enable paralleli- zation. However, numerous parameters such as the microchannel geometry, fluid properties, and flow con- ditions need to be strictly tuned; otherwise, the accuracy of sample separation, efficiency, and throughput may be © The Author(s) 2024 OpenAccessThisarticleislicensedunderaCreativeCommonsAttribution4.0InternationalLicense,whichpermitsuse,sharing,adaptation,distributionandreproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Correspondence: Jinsoo Park ([email protected]) 1Department of Mechanical Engineering, Chonnam National University, 77 Yongbong-ro Buk-gu, Gwangju 61186, Republic of Korea 2Analytical Engineering Team, Samsung Display Co., Ltd., 181 Samsung-ro, Tangjeong-myeon, Asan-si, Chungcheongnam-do 31454, Republic of Korea 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; compromised. Conversely, in active techniques, opto- phoresis17, dielectrophoresis18, magnetophoresis19, and acoustophoresis20 are applied to manipulate the target samples in an on-demand manner. Despite high precision, the device configuration and parallelization are complex, and high-cost and sophisticated equipment are usually required compared to the passive approaches. Elasto-inertial microfluidics using viscoelastic fluids can offer a breakthrough by providing increased sample manipulation performance in addition to the advantages of conventional inertial microfluidics. In a viscoelastic fluid flow, the difference in the non-uniform normal stress acting on the suspended objects generates an elastic lift force (Fel), an additional force that enables the lateral migration of the object21–23. Micro-objects, mostly on microspheres, manipulation studies using viscoelastic fluids24–26 have achieved a single equilibrium position of the microspheres9,27, in contrast with conventional iner- tial microfluidics, where particles have more than two equilibrium positions28. Moreover, elasto-inertial micro- fluidic separation using a co-flow of Newtonian and vis- coelastic fluids have been recently conducted to improve the sample separation performance29–34. The co-flow allows the wall-induced lift force (Fw) and shear-gradient lift force (Fs), which drive the lateral displacement of the particles suspended in the Newtonian fluid, to promote or suppress the migration of the particles owing to the generation of Fel; this force can be used to increase the separation resolution. To identify the correlation between these forces under various flow conditions, dimensionless numbers can be applied. In general, in the co-flow of Newtonian and viscoelastic fluids, Reynolds number (Re)29, Weissenberg number (Wi)35, and elastic number (El = Wi/Re)29,36 have been previously applied for theo- retical analysis. However, from the viewpoint of particle behaviors, we found that these dimensionless numbers have limitations, especially in the co-flow configuration of elasto-inertial microfluidics. In this study, we introduced modified Wi (Wim) and modified El (Elm = Wim/Re) for investigation of the microsphere lateral migration across the interface of Newtonian and viscoelastic fluids. For thorough valida- tion, we conduct a series of experiments with polystyrene (PS) particles with diameters of 2.1 and 3.2 μm under varying flow conditions, in which the proposed modified El is found to provide a better understanding of the sus- pended object behavior in the co-flow elasto-inertial microfluidics. We further introduce a new dimensionless number defined as the Newtonian fluid stream width divided by the microsphere diameter. Based on this dimensionless number, we determine three regimes of inertial focusing, elasto-inertial transition, and elastic focusing for the lateral migration of microspheres from Newtonian to viscoelastic fluids across the interface. Based on theoretical findings, we could precisely predict the microsphere behavior and thus achieve the submicron separation of the PS microspheres with diameters of 2.1 and 2.5 μm, as well as 2.5 and 3.2 μm at high throughput, high purity, and high recovery rate. The proposed elasto- inertial microfluidic separation was applied for separation of similar-sized bio-particles: platelets and Escherichia coli (E. Coli) to validate the practical applicability. Working mechanism Device configuration and elasto-inertial separation of microspheres Figure 1a schematizes the microfluidic device, com- posed of two inlet ports and three outlet ports, for the elasto-inertial separation of microspheres. A sample fluid (DI water solution with suspended PS microspheres) and a sheath fluid (dilute polyethylene oxide (PEO) solution) were introduced through inlets 1 and 2, respectively. The sample fluid flow, represented in sky blue in Fig. 1, was bifurcated at the upstream to sandwich the sheath fluid in the center, presented in orange, at midstream to form a three-layered co-flow of the sample/sheath/sample fluids. Figure 1b represents the sequential transfer of the microspheres along the microchannel in the regions i–iv marked in Fig. 1a. The microspheres suspended in the Newtonian fluid are initially aligned along the two side- walls of the microchannel by the viscoelastic sheath fluid flow (Fig. 1b (i)). The microspheres near the walls experience a wall-induced lift force (Fw) owing to the increased pressure between the wall and the microspheres and consequently migrate away from the wall toward the Newtonian/viscoelastic fluid interface. Because Fw is proportional to the microsphere diameter (d) such that Fw ∝d6, the larger microspheres experience Fw with greater magnitude and thus migrate faster away from the wall compared with the smaller microspheres (Fig. 1b (ii))37. The larger microspheres positioned across the New- tonian/viscoelastic fluid interface begin to experience an elastic lift force (Fel) induced by the elastic effect of the viscoelastic fluid. The elastic lift force can be expressed as Fel = Celd3∇N1, where Cel is the elastic lift coefficient, N1 = σxx – σyy is the first normal stress difference, and σxx and σyy are the stress tensor of the normal and transverse directions in the fluid flow, respectively. The first normal stress difference can be expressed as N1 = 2μpλγ̇2, where μp is the polymeric contribution to the solution viscosity, λ is the relaxation time, and γ̇ is the average fluid shear rate obtained using the Oldroyd-B constitutive model38. Fel acts toward the side wall when the majority of the microspheres are located in the Newtonian fluid (Fig. 1b (ii)), whereas it acts toward the microchannel center when the majority of the microspheres are located in the vis- coelastic fluid (Fig. 1b (iii))33. The smaller microspheres approach the Newtonian/viscoelastic fluid interface after Jeon et al. Microsystems & Nanoengineering (2024) 10:15 Page 2 of 14 precise prediction of the microsphere migration phe- nomenon across a co-flow of Newtonian and viscoelastic fluids. The proposed analysis is based on Reynolds num- ber, modified Weissenberg number, modified elastic number, and newly introduced dimensionless number defined as the Newtonian fluid width divided by the microsphere diameter. Using these dimensionless num- bers, we categorize the elasto-inertial microsphere lateral migration phenomenon into three regimes of inertial focusing, elasto-inertial transition, and elastic focusing based on particle equilibrium positions with reference to a co-flow interface of Newtonian and viscoelastic fluids. We experimentally validated the proposed analysis method with 2.1 and 3.2 μm PS microspheres under various flow conditions. We found that our estimation method can better characterize the microsphere lateral migration in elasto-inertial microfluidics. In addition to high-efficiency (>99%) separation of 2.1 and 3.2 μm microspheres, we further achieved the submicron-resolution separation of 2.1 and 2.5 μm, as well as 2.5 and 3.2 μm, PS microspheres at high throughput, purity, and recovery rate. For valida- tion of practical applicability, we applied the proposed method for separation of similar-sized bio-particles: pla- telets from E. coli. We believe that the proposed dimen- sionless analysis can provide guidelines for the successful working conditions and estimation prior to experiments in the field of elasto-inertial microfluidic sample separa- tion and purification. Experimental section Device fabrication A master mold to fabricate Polydimethylsiloxane (PDMS) microchannels was prepared by a photo- lithography process using a negative photoresist E. coli Platelet Purity Recovery rate E. coli Platelet Performance (%) Minor axis (m) Major axis (m) E. coli 10.0kV 10.1mm×5.00k SE(UL) 10.0kV 10.2mm×5.00k SE(UL) 10.0um 10.0um Platelet 5 4 3 2 1 0 100 75 50 25 0 0 1 2 3 4 5 6 e d b a c Side outlet Center outlet Fluorescent image Fluorescent image Filtered image Filtered image E. coli only Platelet only Fig. 7 Escherichia coli and Platelet separaion. a Scanning electron microscope images of E. coli on the left side and platelet on the right side. b The length of major and minor axis of E. coli (black circle) and platelet (red circle). c The trajectories of E. coli and platelet under volumetric flow rate condition of Qn = 10 μL min−1 and Qve = 50 μL min−1. E. coli and platelet move toward the side outlet and center outlet, respectively. Scale bar = 100 μm. d The efficiencies of E. coli and platelet separation in terms of purity and recovery rate. e The hemocytometer images of E. coli and platelet collected from the side outlet and center outlet. Scale bar = 50 μm Jeon et al. Microsystems & Nanoengineering (2024) 10:15 Page 12 of 14 (SU-2050, Kayaku, japan). The microchannel with a rec- tangular cross-section was fabricated by a soft lithography replica molding process. The PDMS base and curing agent (Sylard 184 A and 184B, Dow Corning, USA) were mixed in a ratio of 10:1 (w/w%), poured into the master mold, and left in an oven at 80 °C for 2 h. The PDMS stamp, in which the microchannel was patterned, was bonded with a slide glass by oxygen plasma bonding (Covance, Femto Science, Korea). The microfluidic chip was placed in an oven at 65 °C for 2 h to further enhance the bonding strength. The main-microchannel was fabricated with a uniform height of 50 μm. The midstream microchannel, where the Newtonian and viscoelastic fluid co-flow is formed, was designed with a width of 20 μm. The channel length for the particles to have the equilibrium position in a rec- tangular channel was calculated by Lf = πμh2/ρUmd2Cli— where Um is the maximum flow velocity37—to be 11.87 mm at the slowest flow condition (Qtotal = 2 μL min−1) and the smallest particle diameter (d = 2.1 μm) used in this experiment. The length of the midstream microchannel L was designed to be 15 mm so that all particles have the equilibrium position in the channel. In this study, we approximated that each particle has an equilibrium position under all flow conditions. Sample preparation Two types of viscoelastic fluid with a concentration of 100 ppm were prepared by mixing PEO (Mw = 600 kDa, Sigma Aldrich, USA) powder in DI water for microsphere separation and 1× phosphate buffered saline (PBS) for bio-particle separation. The PEO solution was used after mixing with a magnetic stirrer for more than 24 h to ensure the complete dissolution of the PEO powder. Relaxation time of the 100 ppm PEO solution was obtained by the empirical formula λ = 18λZ(c/c*)0.65 (ref. 43). Overlapping concentration is expressed as c* = 0.77/[μ], and Zimm relaxation time λZ = F[μ]Mwμs/ NAkBT—where F is the pre-factor 0.463, μs is the solution viscosity, NA is Avogadro’s number, and kB is Boltzmann’s constant—is determined according to Zimm’s theory44,45. The theoretical values of c* and λZ can be obtained using the intrinsic viscosity [μ] = 0.072Mw 0.65 for the PEO solution according to the Mark–Houwink relationship46. The λ value of the 100-ppm PEO solution was calculated as 0.123 ms. We used the theoretical viscosity value of 100-ppm PEO solution for universal application of dimensionless analysis. The viscosity of PEO solution was calculated by 1.041 mPa∙s using polymer solution viscosity formula μ = μs + μp where μs is the solvent viscosity and μp = [μ]cμs is the polymeric contribution to the viscosity. The density of the synthesized PEO solution was mea- sured using a density meter (DMA 35 Basic, Anton Paar, Austria). The microsphere sample fluid was prepared by mixing PS particles with DI water. For particle trajectory analysis, the sample fluids were the mixture of d = 2.1 μm (green fluorescent particle, Thermo Fisher, USA) and 3.2 μm (red fluorescent particle, Thermo Fisher, USA) particles. Each sample used for submicron-resolution particle separation was mixed with d = 2.1 vs 2.5 μm (non-fluorescent par- ticle, Thermo Fisher, USA) and 2.5 vs 3.2 μm particles. In all sample fluids, the concentration of each sized particle was 1 × 107 particles mL−1, and the final particle con- centration of the sample fluid was 2 × 107 particles mL−1. For all microsphere sample fluids, Tween 20 (Sigma Aldrich, USA) was mixed at a concentration of 0.1 v/v% to prevent particle aggregation. Optionally, PEO coating inside the microchannel47 and device manufacture with copolymers PDMS-polyethylene glycol48 could be used to prevent adsorption of particles to the channel walls, but these methods were not used in this study due to the sufficient Re. The platelets were provided from the Kor- ean Red Cross and stored in shaker-incubator (ES-20, Grant bio, UK) at 22 °C. Before the experiments, the platelets were dyed with red fluorescence by using an antibody labeling kit (Alexa FluorTM 568, Invitrogen, USA) and diluted 20 times with 1× PBS. The E. coli sample was cultured in a sterilized Luria-Bertani (LB) broth (L2542, Sigma Aldrich, USA) on a shaker-incubator at 37 °C for 24 h and diluted 10 times with 1× PBS. Flow visualization and measurements The Newtonian/viscoelastic fluid interface was visua- lized by dispersing d = 300 nm (red fluorescent, Thermo Fisher, USA) PS particles in DI water at a concentration of 1 × 108 particles mL−1. PS particles with d = 300 nm were injected in the direction of inlet 1 using a syringe pump (neMESYS Cetoni GmbH, Germany). Under the experi- mental conditions of this study, nanoparticles cannot migrate in the direction of the viscoelastic fluid owing to the Fel caused by the PEO solution. In addition, the Newtonian/viscoelastic fluid interface was measured at 100 μm near the upstream of the midstream micro- channel. Therefore, the diffusion effect was not con- sidered. Visualized images were precisely captured with a resolution of 0.0562 μm pixel−1 using an inverted microscope (IX73, Olympus, Japan), a CCD camera (E3ISPM, RisingCam, Japan). Microsphere trajectories were observed at the down- stream of the microchannel using an inverted microscope and captured via a high-speed camera (VEO 710 L, Phantom, USA). Images of the submicron-resolution separation were obtained by simultaneously using a halogen lamp and a mercury lamp, with fluorescent par- ticles (2.1 and 3.2 μm) showing white color and non- fluorescent mono particles (2.5 μm) showing black color (Fig. 6a). Jeon et al. Microsystems & Nanoengineering (2024) 10:15 Page 13 of 14 Acknowledgements This work was supported in part by Samsung Display Company Ltd. and in part by the National Research Foundation of Korea (NRF) grants funded by the Korean government (MSIT) (Nos. RS-2023-00210891 and 2020R1A5A8018367). Author contributions H.J. and J.P. initiated and conceived the proof-of-concept experiments; H.J. designed and fabricated the microchannel; H.J., J.S., K.S., N.A., and J.P. characterized the devices and analyzed the results; H.J. and S.L. performed bio- particle experiments; H.J. and J.P. wrote the manuscript. All authors reviewed the manuscript. Competing interests The authors declare no competing interests. Supplementary information The online version contains supplementary material available at https://doi.org/10.1038/s41378-023-00633-w. Received: 30 May 2023 Revised: 23 October 2023 Accepted: 8 November 2023 References 1. Hyötyläinen, T. Critical evaluation of sample pretreatment techniques. Anal. Bioanal. Chem. 394, 743–758 (2009). 2. Broyles, B. S., Jacobson, S. C. & Ramsey, J. M. Sample filtration, concentration, and separation integrated on microfluidic devices. Anal. Chem. 75, 2761–2767 (2003). 3. Olsen, L. R., Leipold, M. D., Pedersen, C. B. & Maecker, H. T. The anatomy of single cell mass cytometry data. Cytom. A 95, 156–172 (2019). 4. Smith, R. M. Before the injection—modern methods of sample preparation for separation techniques. J. Chromatogr. A 1000, 3–27 (2003). 5. Roggan, A., Friebel, M., Do¨rschel, K., Hahn, A. & Mu¨ller, G. Optical properties of circulating human blood in the wavelength range 400–2500 nm. J. Biomed. Opt. 4, 36–46 (1999). 6. Robier, C. Platelet morphology. J. Lab. Med. 44, 231–239 (2020). 7. Reshes, G., Vanounou, S., Fishov, I. & Feingold, M. Cell shape dynamics in Escherichia coli. Biophys. J. 94, 251–264 (2008). 8. Song, Y., Li, D. & Xuan, X. Recent advances in multimode microfluidic separation of particles and cells. Electrophoresis 44, 910–937 (2023). 9. Zhou, J. & Papautsky, I. Viscoelastic microfluidics: progress and challenges. Microsyst. Nanoeng. 6, 113 (2020). 10. Zhang, J. et al. Fundamentals and applications of inertial microfluidics: a review. Lab Chip 16, 10–34 (2016). 11. Bhagat, A. A. S., Kuntaegowdanahalli, S. S. & Papautsky, I. Enhanced particle filtration in straight microchannels using shear-modulated inertial migration. Phys. Fluids 20, 101702 (2008). 12. Wang, X., Zandi, M., Ho, C.-C., Kaval, N. & Papautsky, I. Single stream inertial focusing in a straight microchannel. Lab Chip 15, 1812–1821 (2015). 13. Lu, X. & Xuan, X. Inertia-enhanced pinched flow fractionation. Anal. Chem. 87, 4560–4565 (2015). 14. Bhagat, A. A. S., Kuntaegowdanahalli, S. S. & Papautsky, I. Continuous particle separation in spiral microchannels using dean flows and differential migration. Lab Chip 8, 1906–1914 (2008). 15. Zhou, Y., Ma, Z. & Ai, Y. Sheathless inertial cell focusing and sorting with serial reverse wavy channel structures. Microsyst. Nanoeng. 4, 5 (2018). 16. Huang, L. R., Cox, E. C., Austin, R. H. & Sturm, J. C. Continuous particle separation through deterministic lateral displacement. Science 304, 987–990 (2004). 17. Ren, Y. et al. Plasmonic optical tweezers for particle manipulation: principles, methods, and applications. ACS Nano 15, 6105–6128 (2021). 18. Chen, Q. & Yuan, Y. J. A review of polystyrene bead manipulation by dielec- trophoresis. RSC Adv. 9, 4963–4981 (2019). 19. Alnaimat, F., Dagher, S., Mathew, B., Hilal-Alnqbi, A. & Khashan, S. Microfluidics based magnetophoresis: a review. Chem. Rec. 18, 1596–1612 (2018). 20. Destgeer, G. et al. Microchannel anechoic corner for size-selective separation and medium exchange via traveling surface acoustic waves. Anal. Chem. 87, 4627–4632 (2015). 21. Ho, B. P. & Leal, L. G. Migration of rigid spheres in a two-dimensional uni- directional shear flow of a second-order fluid. J. Fluid Mech. 76, 783–799 (1976). 22. D’Avino, G., Maffettone, P. L., Greco, F. & Hulsen, M. A. Viscoelasticity-induced migration of a rigid sphere in confined shear flow. J. Non-Newton. Fluid Mech. 165, 466–474 (2010). 23. Leshansky, A. M., Bransky, A., Korin, N. & Dinnar, U. Tunable nonlinear viscoe- lastic “focusing” in a microfluidic device. Phys. Rev. Lett. 98, 234501 (2007). 24. Nam, J. et al. Microfluidic device for sheathless particle focusing and separa- tion using a viscoelastic fluid. J. Chromatogr. A 1406, 244–250 (2015). 25. Li, D., Lu, X. & Xuan, X. Viscoelastic separation of particles by size in straight rectangular microchannels: a parametric study for a refined understanding. Anal. Chem. 88, 12303–12309 (2016). 26. Yang, S. H., Lee, D. J., Youn, J. R. & Song, Y. S. Multiple-line particle focusing under viscoelastic flow in a microfluidic device. Anal. Chem. 89, 3639–3647 (2017). 27. Seo, K. W., Byeon, H. J., Huh, H. K. & Lee, S. J. Particle migration and single-line particle focusing in microscale pipe flow of viscoelastic fluids. RSC Adv. 4, 3512–3520 (2014). 28. Di Carlo, D. Inertial microfluidics. Lab Chip 9, 3038–3046 (2009). 29. Nam, J., Lim, H., Kim, D., Jung, H. & Shin, S. Continuous separation of micro- particles in a microfluidic channel via the elasto-inertial effect of non- Newtonian fluid. Lab Chip 12, 1347–1354 (2012). 30. Ha, B., Park, J., Destgeer, G., Jung, J. H. & Sung, H. J. Transfer of microparticles across laminar streams from non-Newtonian to Newtonian Fluid. Anal. Chem. 88, 4205–4210 (2016). 31. Tian, F. et al. Label-free isolation of rare tumor cells from untreated whole blood by interfacial viscoelastic microfluidics. Lab Chip 18, 3436–3445 (2018). 32. Liu, P. et al. Separation and enrichment of yeast saccharomyces cerevisiae by shape using viscoelastic microfluidics. Anal. Chem. 93, 1586–1595 (2021). 33. Tian, F. et al. Microfluidic co-flow of Newtonian and viscoelastic fluids for high- resolution separation of microparticles. Lab Chip 17, 3078–3085 (2017). 34. Zhang, T. et al. Microfluidic separation and enrichment of Escherichia coli by size using viscoelastic flows. Anal. Chem. 95, 2561–2569 (2023). 35. D’Avino, G. & Maffettone, P. L. Particle dynamics in viscoelastic liquids. J. Non- Newton. Fluid Mech. 215, 80–104 (2015). 36. Denn, M. M. Fifty years of non-Newtonian fluid dynamics. AICHE J. 50, 2335–2345 (2004). 37. Amini, H., Lee, W. & Di Carlo, D. Inertial microfluidic physics. Lab Chip 14, 2739–2761 (2014). 38. James, D. F. Boger fluids. Annu. Rev. Fluid Mech. 41, 129–142 (2009). 39. Di Carlo, D., Edd, J. F., Humphry, K. J., Stone, H. A. & Toner, M. Particle segre- gation and dynamics in confined flows. Phys. Rev. Lett. 102, 094503 (2009). 40. Zhou, J. & Papautsky, I. Fundamentals of inertial focusing in microchannels. Lab Chip 13, 1121–1132 (2013). 41. Pitt, W. G. et al. Rapid separation of bacteria from blood—review and outlook. Biotechnol. Prog. 32, 823–839 (2016). 42. Kim, J., Campbell, A. S., de Ávila, B. E.-F. & Wang, J. Wearable biosensors for healthcare monitoring. Nat. Biotechnol. 37, 389–406 (2019). 43. Tirtaatmadja, V., McKinley, G. H. & Cooper-White, J. J. Drop formation and breakup of low viscosity elastic fluids: effects of molecular weight and con- centration. Phys. Fluids 18, 043101 (2006). 44. Graessley, W. W. Polymer chain dimensions and the dependence of viscoe- lastic properties on concentration, molecular weight and solvent power. Polymer 21, 258–262 (1980). 45. Zimm, B. H. Dynamics of polymer molecules in dilute solution: viscoelasticity, flow birefringence and dielectric loss. J. Chem. Phys. 24, 269–278 (1956). 46. Rodd, L. E., Scott, T. P., Boger, D. V., Cooper-White, J. J. & McKinley, G. H. The inertio-elastic planar entry flow of low-viscosity elastic fluids in micro- fabricated geometries. J. Non-Newton. Fluid Mech. 129, 1–22 (2005). 47. Lee, S. H., Cha, B., Ko, J., Afzal, M. & Park, J. Acoustofluidic separation of proteins from platelets in human blood plasma using aptamer-functionalized micro- particles. Biomicrofluidics 17, 024105 (2023). 48. Gökaltun, A., Kang, Y. B., Yarmush, M. L., Usta, O. B. & Asatekin, A. Simple surface modification of poly(dimethylsiloxane) via surface segregating smart polymers for biomicrofluidics. Sci. Rep. 9, 7377 (2019). Jeon et al. Microsystems & Nanoengineering (2024) 10:15 Page 14 of 14

Title: Elasto-inertial microfluidic separation of microspheres with submicron resolution at high-throughput ​ Authors: Hyunwoo Jeon, SongHa Lee, Jongho Shin, Kicheol Song, Nari Ahn, Jinsoo Park ​ Publisher: Microsystems & Nanoengineering, Nature Publishing Group ​ Date: 22 January 2024​ Abstract: Elasto-inertial microfluidic separation offers many advantages including high throughput and separation resolution. ​ Even though the separation efficiency highly depends on precise control of the flow conditions, no concrete guidelines have been reported yet in elasto-inertial microfluidics. ​ Here, we propose a dimensionless analysis for precise estimation of the microsphere behaviors across the interface of Newtonian and viscoelastic fluids. ​ Reynolds number, modified Weissenberg number, and modified elastic number are used to investigate the balance between inertial and elastic lift forces. ​ Based on the findings, we introduce a new dimensionless number defined as the width of the Newtonian fluid stream divided by microsphere diameter. ​ The proposed dimensionless analysis allows us to predict whether the microspheres migrate across the co-flow interface. ​ The theoretical estimation is found to be in good agreement with the experimental results using 2.1-and 3.2-μm-diameter polystyrene microspheres in a co-flow of water and polyethylene oxide solution. ​ Based on the theoretical estimation, we also realize submicron separation of the microspheres with 2.1 and 2.5 μm in diameter at high throughput, high purity (>95%), and high recovery rate (>97%). ​ The applicability of the proposed method was validated by separation of platelets from similar-sized Escherichia coli (E. coli).