Datasets:

vgoldberg

/

longform_article_summarization

like 9

SECTION 1. SHORT TITLE. This Act may be cited as the ``Health Emergencies Lack Provider Specialists Act of 2010''. SEC. 2. FINDINGS. Congress makes the following findings: (1) In communities facing environmental health hazards that have been declared a public health emergency (pursuant to section 104(a) of the Comprehensive Environmental Response, Compensation, and Liability Act of 1980), it is increasingly difficult for the health care facilities in those areas to recruit the specialists necessary to treat the particular health needs of the residents. As a result, these communities and their populations are medically underserved. (2) Since 1970, the National Health Service Corps has helped communities recruit health care professionals who are committed to serving the needs of underserved populations. SEC. 3. NATIONAL HEALTH SERVICE CORPS; PARTICIPATION OF SPECIALISTS IN LOAN REPAYMENT AND SCHOLARSHIP PROGRAMS. (a) Mission of Corps; Definition of Primary Health Services.-- Section 331(a)(3)(D) of the Public Health Service Act (42 U.S.C. 254d(a)(3)(D)) is amended by striking ``or mental health,'' and inserting ``mental health, or specialists needed to serve in medically underserved areas or populations that have needs for particular specialists related to a public health emergency declaration (pursuant to section 104(a) of the Comprehensive Environmental Response, Compensation, and Liability Act of 1980) based upon environmental health hazard-related health concerns,''. (b) Loan Repayment Program.--Section 338B of the Public Health Service Act (42 U.S.C. 254l-1) is amended-- (1) in subsection (a)(1), by striking ``and physician assistants;'' and inserting ``physician assistants, and specialists related to the health needs of environmental exposure affected individuals stemming from its declaration as a public health emergency (pursuant to section 104(a) of the Comprehensive Environmental Response, Compensation, and Liability Act of 1980);''; (2) in subsection (b)(1)-- (A) in subparagraph (A), by inserting before the semicolon the following: ``, or have been det ermined by the Secretary to be a specialist necessary to treat the particular health needs of environmental exposure affected individuals in an area that has been declared a public health emergency (pursuant to section 104(a) of the Comprehensive Environmental Response, Compensation, and Liability Act of 1980)''; (B) in subparagraph (B), by inserting ``specialists related to the health needs of environmental exposure affected individuals stemming from its declaration as a public health emergency (pursuant to section 104(a) of the Comprehensive Environmental Response, Compensation, and Liability Act of 1980),'' after ``mental health,''; and (C) in subparagraph (C)(ii), by inserting ``specialists related to the health needs of environmental exposure affected individuals stemming from its declaration as a public health emergency (pursuant to section 104(a) of the Comprehensive Environmental Response, Compensation, and Liability Act of 1980),'' after ``dentistry,''; and (3) by adding at the end the following: ``(i) Definition.--In this section, the term `environmental exposure affected individual' means any individual who-- ``(1) is diagnosed with a medical condition caused by the exposure of the individual to a public health hazard to which an emergency declaration applies, based on such medical conditions, diagnostic standards, and other criteria as the Secretary specifies; ``(2) as demonstrated in such manner as the Secretary determines appropriate, has been present for an aggregate total of 6 months in the geographic area subject to the emergency declaration involved, during a period determined appropriate by the Secretary; and ``(3) is determined under this section to meet the criteria described in this subsection.''. (c) Scholarship Program.--Section 338A of the Public Health Service Act (42 U.S.C. 254l) is amended-- (1) in subsection (a)(1), by striking ``and physician assistants;'' and inserting ``physician assistants, and specialists related to the health needs of environmental exposure affected individuals stemming from its declaration as a public health emergency (pursuant to section 104(a) of the Comprehensive Environmental Response, Compensation, and Liability Act of 1980);''; (2) in subsection (b)(1), by inserting before the semicolon the following: ``, or have been determined by the Secretary to be a specialist necessary to treat the particular health needs of environmental exposure affected individuals in an area that has been declared a public health emergency (pursuant to section 104(a) of the Comprehensive Environmental Response, Compensation, and Liability Act of 1980)''; and (3) by adding at the end the following: ``(i) In this section, the term `environmental exposure affected individual' means any individual who-- ``(1) is diagnosed with a medical condition caused by the exposure of the individual to a public health hazard to which an emergency declaration applies, based on such medical conditions, diagnostic standards, and other criteria as the Secretary specifies; ``(2) as demonstrated in such manner as the Secretary determines appropriate, has been present for an aggregate total of 6 months in the geographic area subject to the emergency declaration involved, during a period determined appropriate by the Secretary; and ``(3) is determined under this section to meet the criteria described in this subsection.''.

Health Emergencies Lack Provider Specialists Act of 2010 - Amends the Public Health Service Act to make eligible for the National Health Service Corps loan repayment and scholarship programs specialists needed to serve medically underserved areas or populations that have needs for particular specialists related to a public health emergency declaration based upon environmental health hazard-related health concerns.

the development of laser diode devices about thirty years ago is nowadays regarded as an indisputable breakthrough either for the growth of a broad range of technological applications or for its huge impact on atom physics research , from high resolution spectroscopy to laser cooling techniques . although the spectral properties and the tunability of these lasers may prove unsuited for some applications , an efficient device can be built by stabilizing the diode using an optical feedback from an external grating operating in littrow configuration @xcite . one can thus easily obtain a low - cost narrow band laser with several tens of milliwatts of optical power and a mode - hop free frequency tuning which can be larger than @xmath3 ghz . + such tunable laser diodes are useful tools for teaching atom physics in advanced undergraduate laboratory courses . indeed , many experiments have been developed for undergraduates using these devices in the past years , ranging from atomic hyperfine structure studies of rubidium and cesium @xcite , to interferometric measurements of the resonant absorption and refractive index in rubidium gas @xcite , temperature dependance of doppler - broadening @xcite , or observation of faraday effect @xcite and two - photon spectroscopy in rubidium @xcite . + in this paper , we use a simple grating - feedback laser diode to investigate the hyperfine structure of the @xmath4 and @xmath2 excited states in rubidium . this is achieved following two different methods of doppler - free high resolution spectroscopy . first , saturated absorption spectroscopy is performed on the @xmath0 transition in rubidium to measure the hyperfine structure of the @xmath4 excited - state . using the same laser diode and a slightly modified experimental setup , doppler - free two photon absorption spectroscopy is then performed on the transition @xmath1 , leading to accurate measurements of the hyperfine structure of the @xmath2 energy level . these two techniques , both based on non - linear interaction of light with atoms , are complementary since they enable to probe atomic transitions following different electric dipole selection rules . indeed , for single - photon transitions involved in saturated absorption spectroscopy , the orbital angular momentum @xmath5 must satisfy the selection rule @xmath6 . consequently , transitions have to involve ground and excited states with opposite parity . contrarily , selection rules for two - photon transitions become @xmath7 , allowing to investigate transitions between levels of identical parity . + in the following , we begin by providing a general description of the experimental apparatus used to perform the experiments . we then briefly discuss doppler broadening and describe doppler - free saturation absorption spectroscopy of the @xmath0 transition in rubidium , which is the simplest undergraduate experiment using tunable laser diode @xcite . afterwards , the hyperfine structure of the excited state @xmath2 is probed using doppler - free two - photon absorption spectroscopy . in addition , electric dipole selection rules of the two - photon transition are investigated , first by modifying the polarization of the excitation laser , and then by measuring two - photon absorption spectra when the rubidium vapor cell si placed in a magnetic field . such experiments provide an opportunity to compare different high resolution spectroscopy methods using a single experimental setup and may acquaint students with quantum mechanics selection rules , atomic spectra and zeeman effect . all experiments are performed with a commercial grating - feedback laser diode ( toptica photonics , dl100 ) operating in littrow configuration @xcite . such laser diode , stabilized in temperature , has a typical free - running wavelength of @xmath8 nm with @xmath9 mhz linewidth and an output power of @xmath10 mw . besides , a @xmath10 db optical isolator ( electro - optics technologies ) is used to prevent from laser instability caused by optical feedback in the laser diode cavity . + preliminary tuning of the laser diode emission wavelength close to a resonant transition of rubidium is achieved by manually changing the length of the external cavity and by monitoring the output wavelength using a commercial wavelength - meter @xcite . scanning the frequency of the laser diode is then realized by applying a voltage ramp to a piezoelectric transducer which changes the external cavity length and thus the emission wavelength . with toptica dl100 commercial diode , a mode - hop free frequency tuning around @xmath11 ghz is easily achieved . + part of laser emission is constantly sent into a homemade fabry - perot interferometer ( fpi ) , with a @xmath12 mhz free - spectral - range and a finesse @xmath13 , which transmission peaks provide a frequency reference for the measurements of rubidium spectral features . a rubidium vapor cell containing @xmath14 ( @xmath15 natural abundance ) and @xmath16 ( @xmath17 natural abundance ) from thorlabs the energy level diagram of the relevant transitions in rubidium is shown in figure [ rb ] . [ t ] and @xmath16.,width=377 ] in conventional laser spectroscopy , atomic hyperfine structure is often hidden by inhomogeneous doppler broadening . indeed , when atoms in a vapor cell are irradiated by a laser beam at frequency @xmath18 in the laboratory frame of reference , they experiment in their own frame a doppler shifted laser frequency @xmath19 , related to the atom velocity @xmath20 along the incident light direction @xmath21 as @xmath22 \ , \ ] ] where @xmath23 is the speed of light . this formula is valid in the approximation of non - relativistic atoms @xmath24 . + as a result , by scanning the laser frequency @xmath18 around an atomic transition at frequency @xmath25 , the class of atoms with velocity @xmath20 absorbs light when the condition @xmath26 is fulfilled . for atoms in a vapor cell , the probability distribution of velocities @xmath27 follows a maxwell - boltzmann distribution @xmath28 where @xmath29 the boltzmann constant , @xmath30 the absolute temperature and @xmath31 the mass of the atoms . by substituting equation ( [ dop2 ] ) into equation ( [ maxbol ] ) , the relative number of atoms @xmath32 which are resonant with the laser at frequency @xmath18 , is given by the gaussian function @xmath33 \ .\ ] ] this distribution is directly translated in a gaussian shape of the atomic medium absorption profile , centered at the resonant frequency @xmath25 and with a full - width at half - maximum ( fwhm ) @xmath34 given by @xmath35 for rubidium atoms , @xmath36 mhz at room temperature , which is smaller than the energy splitting between ground state @xmath37 hyperfine levels but much bigger than the one of the excited state @xmath38 ( see fig . + [ t ] in rubidium at room temperature . the ground - state hyperfine splitting is measured to be @xmath39 ghz for @xmath14 and @xmath40 ghz for @xmath16 . excited - state hyperfine structure is hidden by doppler broadening.,width=377 ] in order to experimentally observe doppler broadened absorption spectra , the extended - cavity diode laser is tuned close to the rubidium transition @xmath0 at the wavelength @xmath41 nm ( vacuum wavelength ) and directed through the rubidium vapor cell . a typical absorption profile for the @xmath0 transition in rubidium is depicted in figure [ doppler ] . ground state hyperfine levels are resolved whereas the hyperfine structure of the @xmath38 excited - state remains hidden by doppler broadening . gaussian fit of each absorption line gives a fwhm of @xmath42 mhz as expected for doppler broadening at room temperature @xcite . in the early seventies , theodor w. h@xmath43nsch and christian bord independently introduced a method using non - linear interaction of laser light with atoms to achieve doppler - free spectra of atomic gases @xcite . this technique , commonly called saturated - absorption spectroscopy , has revolutionized spectroscopy studies @xcite and is now widely used in atom physics research as a versatile method to lock laser frequencies on atomic transitions . + in such a technique , two counterpropagating laser beams at identical frequencies @xmath18 are interacting with atoms in a vapor cell . one beam is noted @xmath44 as pump beam , and the other one , weaker , is noted @xmath45 and usually called probe beam . when the laser frequency @xmath18 is different from the frequency @xmath25 of the atomic transition ( _ e.g. _ @xmath46 ) , the pump beam @xmath44 interacts with a group of atoms with velocity @xmath20 , whereas the counterpropagating probe beam @xmath45 excites the symetric group of velocity @xmath47 . as a result , the two laser beams interact with different classes of atom and the absorption spectra are identical to the one obtained using a single laser excitation scheme . however , under the particular circumstance where @xmath48 , both beams interact with the same class of atoms of velocity @xmath49 . in that case , the pump beam @xmath44 saturates the atomic transition , depleting the number of atom with velocity @xmath49 in the ground state . as a result , the absorption of the counterpropagating probe beam is decreased , as most part of the atoms are already excited by the pump beam . the absorption of the probe beam finally presents a doppler broadened profile , on which is superimposed a dip corresponding to the resonant frequency @xmath25 , for which both beams are interacting with the same class of atoms @xmath49 . + using bloch equations theory in the approximation of a two level atom , the dip is shown to be lorentzian with a linewidth @xmath50 ( fwhm ) given by the relation @xcite @xmath51 where @xmath52 is the natural linewidth of the transition , @xmath53 the spontaneous emission rate and @xmath54 the rabi frequency associated with the pump beam @xmath44 which saturates the atomic transition . in principle , such method should then allow to reach an asymptotic value of the natural linewidth of the transition by decreasing the saturating pump beam intensity . we now consider two atomic transitions at frequencies @xmath55 and @xmath56 ( @xmath57 ) involving a common ground state , with a frequency difference smaller than the doppler broadening @xmath58 . + when the laser frequency is set exactly midway between the two resonances , @xmath59 , the pump beam interacts with two classes of atoms of opposite velocities @xmath20 and @xmath47 . positive velocity atoms @xmath20 experiment the pump beam redshifted to the lower transition frequency @xmath60 whereas atoms with negative velocity @xmath47 see the pump beam blueshifted to the higher resonance frequency @xmath61 . this results in a depletion of the number of atom with velocities @xmath62 in the ground state . at the same frequency , the probe beam interacts with exactly the same group of atoms , but in opposite way as atoms with velocity @xmath47 ( resp . @xmath20 ) are resonant with the transition @xmath55 ( resp . @xmath56 ) . then , the probe beam absorption profile once again shows a dip , more intense than the one observed for standard resonance as it involves two groups of atom velocities . this dip , usually called a crossover resonance , is peculiar to saturated absorption spectroscopy . [ t ] : half - wave plate , @xmath63 : quarter - wave plate , pbs : polarization beamsplitter , fpi : fabry - perot interferometer , d : optical density ( @xmath64 ) , m : mirror , d1 and d2 : photodiodes . p and s denote the pump and probe beam respectively . * ( b)-*saturated absorption spectrum for the transition @xmath65 of @xmath16 . six doppler - free dips are resolved corresponding from left to right to @xmath66 , crossover @xmath67 , @xmath68 , crossover @xmath69 , crossover @xmath70 , and @xmath71 . * ( c)- * saturated absorption spectrum for the transition @xmath72 of @xmath14 . from left to right the peaks correspond to @xmath68 , crossover @xmath70 , @xmath71 , crossover @xmath73 , crossover @xmath74 , and @xmath75 . solid lines are data fitting using the product of six lorentzian functions with a gaussian profile . for the hyperfine structure of the @xmath4 excited state , we finally obtain @xmath76_{^{87}rb}= 156\pm 2 { \rm mhz}$ ] , @xmath77_{^{87}rb}= 264\pm 3 { \rm mhz}$ ] , @xmath77_{^{85}rb}= 64\pm 1 { \rm mhz}$ ] , and @xmath78_{^{85}rb}= 119\pm 2 { \rm mhz}$ ] , where @xmath79 $ ] is the energy splitting between hyperfine sublevels @xmath80 and @xmath81 . , width=377 ] the experimental setup used to implement doppler - free saturated absorption spectroscopy of rubidium is described in figure [ sat](a ) . + the laser beam , tuned close to the rubidium transition @xmath0 , is first sent through a half - wave plate and a polarizing beamsplitter ( pbs ) , used to control the light power entering into the rubidium cell . the pump beam @xmath44 then travels through the rubidium cell and is retroreflected as a counterpropagating probe beam @xmath45 using a mirror and a @xmath64 optical density . a quarter wave plate is inserted in order to rotate by @xmath82 the probe beam polarization which is finally reflected by the pbs and detected using a photodiode . + typical saturated absorption spectra are depicted in figures [ sat](b ) and ( c ) . within a gaussian envelope resulting from doppler broadening , six dips appear , three of them being related to the hyperfine structure of the excited state @xmath4 and the three others corresponding to crossover resonances . + the linewidths of the saturated absorption dips are found equal to @xmath83 mhz for @xmath16 and @xmath84 mhz for @xmath14 . the lifetime @xmath85 of the @xmath4 excited state in rubidium is about @xmath86 ns . the natural linewidth predicted by the heisenberg uncertainty principle is then @xmath87 mhz , much smaller than the one measured . + as illustrated by equation ( [ bloch ] ) , the spectral linewidth @xmath50 of the absorption dips strongly depends on the pump beam intensity which saturates the atomic transition . as such saturation is at the heart of the method , it is hard to reach the natural linewidth using doppler - free saturated absorption spectroscopy . a possible method would consist in measuring the linewidth of the dips for different pump beam intensities and to take the asymptotic value of the linewidth at null intensity . however , the obtained value would still be bigger than the natural linewidth because of collisions and inhomogeneous transit time broadening resulting from the finite time of interaction between the atoms and the laser light @xcite . + in the early seventies , saturated absorption spectroscopy led to huge improvements in metrology experiments @xcite . however , this method is sensible to recoil effect when an atom absorbs or emits a photon , which induces a splitting of the lines @xcite . for metrology applications , saturated absorption spectroscopy has thus quickly been superseded by other methods , like doppler - free two - photon absorption spectroscopy . the possibility to use two photon absorption as doppler - free spectroscopy method has been first proposed by l. s. vasilenko , v. p. chebotaev and a. v. shishaev @xcite whereas the first experimental demonstration has been simultaneously obtained in 1974 by f. biraben , b. cagnac and g. grynberg @xcite in paris and by m. d. levenson and n. bloembergen @xcite in harvard . + nowadays , doppler - free two - photon absorption spectroscopy is still the most powerful method for high precision measurements of fundamental constants like the lamb shift or the rydberg constant @xcite . we consider atoms in a vapor interacting with two counterpropagating beams at same frequency @xmath18 in the laboratory frame of reference ( figure [ princ2p ] ) . in its rest frame , each atom with velocity @xmath20 interacts with two doppler shifted travelling waves at frequency @xmath55 and @xmath56 which , in the approximation of non - relativistic atoms @xmath24 , are equal to : @xmath88 \\ \label{deuxp1 } \nu_{2}= & \nu_{l}\left[1+\frac{{\rm v}_{z}}{c}\right ] \label{deuxp2}\end{aligned}\ ] ] we now suppose that the atoms can reach an excited state @xmath89 ( energy @xmath90 ) by absorbing two photons in the ground state @xmath91 ( energy @xmath92 ) . using equations ( 7 ) and ( 8) , the resonant condition for absorbing two photons travelling in opposite directions is given by : @xmath93+h\nu_{l}\left[1+\frac{{\rm v}_{z}}{c}\right ] = 2h\nu_{l } \label{reso}\ ] ] the terms depending on atom velocity disappear as the two doppler shift terms cancel . consequently , when the resonance condition ( [ reso ] ) is fulfilled , all the atoms , irrespective of their velocities , can absorb two photons . the line shape of this doppler - free two - photon absorption resonance is theoretically predicted to be lorentzian , the width being the natural linewidth @xmath94 of the transition @xcite . contrary to saturated absorption spectroscopy , there is no recoil shift using such method as the total momentum transfer from light to atom is null . + [ t ] in the laboratory frame of reference . ( b)-in the atom rest frame , the two frequencies are doppler - shifted to @xmath55 and @xmath56 . by absorbing two photons travelling in opposite directions , the doppler shifts cancel.,width=377 ] when the resonant condition is not realized , or when the two counterpropagating beams are not well superimposed , the atoms can not absorb two photons propagating in opposite directions anymore . however , some atoms can still absorb two photons propagating in the same direction , if their velocity @xmath20 fulfill the relation @xmath95 $ ] . such a process leads to an additional doppler - broadened profile . however , for a given frequency @xmath18 of the laser , only one class of atom velocities contributes to this doppler broadened signal , whereas all the atoms contribute to the resonance signal when the condition ( [ reso ] ) is fulfilled . as a result , doppler - free two - photon absorption spectra appear as the superposition of a lorentzian curve of large intensity and narrow width , and a gaussian profile of small intensity and broad width ( doppler width ) @xcite . + single - photon transitions satisfy the selection rules @xmath6 , where @xmath5 is the orbital angular momentum . such transitions then require ground and excited states of opposite parity , like the transition @xmath96 investigated using saturated absorption spectroscopy in section [ satres ] . for two - photon transitions , the selection rules become @xmath7 , allowing to investigate transitions between levels of identical parity . in that sense , two - photon spectroscopy is complementary to saturated absorption spectroscopy . + in the following , we investigate the transition @xmath97 of rubidium . two - photon absorption is achieved by exciting rubidium at the wavelength @xmath98 nm ( vacuum wavelength ) , and detected by monitoring the fluorescence at @xmath99 nm from the @xmath100 radiative cascade decay ( fig . [ setup_2p](a ) ) . + usually , non - linear processes like two - photon transitions require high - power lasers . however , for the case under study , the two - photon transition probability is greatly enhanced because the first excited @xmath4 state is close ( @xmath101 nm detuning ) to the virtual intermediate state involved in the two - photon process ( fig . [ setup_2p](a ) ) . furthermore , the need of high power is also compensated by the fact that all the atoms contribute to the doppler - free signal whereas saturation spectroscopy only involves a single class of atom with velocity @xmath49 . therefore , the experiment can be performed with a simple tunable laser - diode @xcite . the experimental setup used to implement doppler - free two - photon absorption spectroscopy is depicted on figure [ setup_2p](b ) . + [ b ] of rubidium . ( b)- doppler - free two - photon spectroscopy setup . oi : optical isolator , @xmath102 : half - wave plate , pbs : polarization beamsplitter , @xmath63 : quarter - wave plate , fpi : fabry - perot interferometer , d1 : photodiode , l1 : @xmath103 mm focal lenses , m : mirror , l2 : @xmath104 mm focal lens , f : @xmath105 nm width interference filter centered at @xmath99 nm . pm : photomultiplier . the rubidium cell is inserted in a copper ring , on which a couple of high power resistors ( r ) are glued in order to heat the cell . an optical window ( ow ) is cut inside the copper to detect the fluorescence.,width=377 ] after preliminary tuning of the laser diode at the wavelength @xmath98 nm , the laser beam is sent through a half - wave plate and a polarizing beamsplitter ( pbs ) . the reflected light on pbs is directed into the fabry - perot interferometer for frequency reference while the transmitted part is focused inside the rubidium cell using a pair of collimating lens . the beam is then retroreflected using a mirror to obtain the required counterpropagating beams configuration . for the present experiment , the laser power entering the rubidium cell is measured equal to @xmath106 mw . a quarter - wave plate is also introduced before the rubidium cell in order to excite the atoms with two counterpropagating beams with identical circular polarizations @xmath107 . this corresponds to the most efficient procedure to fulfill the selection rule @xmath108 of the investigated two - photon transition . such configuration also strongly reduces the amount of light reflected into the laser diode , as the reflected light is mostly cut by the pbs . even by using an optical isolator , we noticed that optical feedback was causing instability in the laser output when the quarter - wave plate was removed . + the efficiency of two photon absorption strongly depends on the atomic vapor temperature @xcite , which is directly related to the average number of atoms in interaction with the laser in the focal volume . for the studied two - photon transition , it has been shown that the fluorescence signal at @xmath99 nm used to monitor two - photon absorption begins to be efficient for temperature higher than @xmath109c @xcite . this signal then increases with temperature until saturation around @xmath110c . at higher temperatures , even if the two - photon absorption probability is still increasing , the fluorescence signal did not increase anymore because of self - absorption of the @xmath111 transition @xcite . + usually the atomic vapor is heated by introducing the cell inside an oven . here the rubidium cell is simply inserted in a copper ring on which two high power resistors ( @xmath112 , @xmath105 mw maximal power ) are glued and used to heat the sample ( see fig . [ setup_2p](b ) ) . all contacts are realized with heat pasting grease and the ensemble is finally isolated using aluminium paper . an optical window is cut inside the copper ring in order to collect the blue fluorescence , using an imaging lens , an interferometric filter centered at the wavelength @xmath113 nm , used to isolate the fluorescence from scattered light , and a photomultiplier . two - photon absorption spectra are recorded by scanning the frequency of the laser diode and detecting the fluorescence from the @xmath100 radiative cascade decay . when the retroreflected beam is misaligned , doppler - broadened absorption spectra , which arise from absorption of two photons from the same laser beam , are measured . as depicted on figure [ general_2p](a ) , four lines corresponding to the hyperfine ground states of @xmath14 and @xmath16 are observed . however it is not possible to resolve excited state hyperfine structure , which remains hidden by doppler broadening . by fitting each line with a gaussian profile and using relation ( [ gaussien ] ) , the temperature of the atomic vapor in the interaction volume can be estimated . a temperature of about @xmath114c is achieved , which corresponds to optimal detection of the two - photon absorption process , as discussed in the previous section . + when the retroreflected beam is properly aligned , doppler - free two - photon absorption spectrum is evidenced as depicted on figure [ general_2p](b ) . strong fluorescence peaks at atomic resonant frequencies are superimposed to the remaining weak doppler broadened profile . as a two - photon transition is considered , energy difference in terms of laser frequency is related to energy splitting of the atom by a factor one half . the ground state hyperfine splitting is then measured to be @xmath115 ghz for @xmath14 and @xmath116 ghz for @xmath16 , in excellent agreement with other published values @xcite . + the hyperfine structure of the excited state @xmath2 , is then studied by reducing the frequency scanning range of the laser diode and zooming on the resonances of the two - photon absorption profile . as depicted on figures [ general_2p](c)-(f ) , all the hyperfine levels of the @xmath2 excited state are properly resolved , except @xmath117 for @xmath14 . even if the precision of the measurements is poor , due to laser diode instabilities , the measured spectral features are again in agreement with precise measurements given in reference @xcite . note that such an experiment also illustrates the selection rule on the total angular momentum @xmath118 for the two - photon absorption process [ t ] two - photon transition in rubidium , when the retroreflected beam is misaligned . blue solid line correspond to a fit of the data with four gaussian functions , which correspond to the ground state hyperfine levels of @xmath14 and @xmath16 . energy differences in term of laser frequency are related to hyperfine energy splittings by a factor one half . ( b)-doppler - free spectrum of the @xmath97 two - photon transition in rubidium . ( c)-(f)-hyperfine structure of the excited state @xmath2 for @xmath14 and @xmath16 . @xmath119 and @xmath120 are respectively related to the total angular momentum of the hyperfine levels on the ground state and on the excited state . data fitting with lorentzian functions leads to @xmath76_{^{87}rb}= 15 \pm 1 { \rm mhz}$ ] , @xmath77_{^{87}rb}= 22 \pm 1 { \rm mhz}$ ] , @xmath78_{^{87}rb}= 28 \pm 1 { \rm mhz}$ ] , @xmath76_{^{85}rb}= 5 \pm 1 { \rm mhz}$ ] , @xmath77_{^{85}rb}= 8 \pm 1 { \rm mhz}$ ] , @xmath78_{^{85}rb}= 10 \pm 1 { \rm mhz}$ ] , and @xmath121_{^{85}rb}= 9 \pm 1 { \rm mhz}$ ] , where @xmath79 $ ] is the energy splitting between hyperfine sublevels @xmath80 and @xmath81 . , width=415 ] for the data depicted on figure [ general_2p ] , the linewidths of the resonant peaks , measured in terms of laser frequency , are on the order of @xmath101 mhz , which is close to the spectral bandwith of the laser diode . the lifetime of the @xmath2 excited state is about @xmath122 ns , leading to a natural width of the transition around @xmath123 khz . as two - photon transitions are considered , the measured width in terms of laser frequency is related to the transition linewidth by a factor one - half . to evidence the natural width of the transition , a laser with less than @xmath124 khz spectral bandwidth would then be required . + the experiment can be used to illustrate two - photon absorption selection rules by changing the laser beam polarizations . as mentioned before , the introduction of a quarter wave - plate before the rubidium cell allows to excite the atoms with two counterpropagating beams with identical circular polarizations @xmath107 . in that condition , the selection rule @xmath108 is always fulfilled by absorbing two photons and a strong doppler - free signal is observed . besides , if a second half - wave plate is introduced in front of the reflecting mirror , the polarization of the retroreflected beam becomes @xmath125 . as a result , the absorption of two photons from opposite directions would lead to @xmath126 , and no doppler - free signal is observed , as depicted on figure [ selec ] . however , the doppler - broadened profile is still present because it corresponds to the absorption of two photons from the same beam ( @xmath108 ) . note that the experimental configuration using two quarter - wave plate would be the optimal situation for the investigation of @xmath127 transition ( @xmath126 ) , like the @xmath128 transition in rubidium . in that case , the profile of absorption spectra is just a lorentzian curve , as the absorption of two photons from the same beam lead to @xmath108 . the doppler - broadened profile can then be eliminated for that particular case @xcite . [ b ] , by changing the beams polarizations . ( a)-fluorescence spectrum with two counterpropagating beams with identical polarization @xmath107 and ( b ) with opposite circular polarization @xmath107 and @xmath125.,width=377 ] as a final experiment , a permanent magnet is put close to the cell in order to observe zeeman splitting . a typical result is depicted on figure [ zeeman ] for the transition @xmath129 of @xmath16 . the transition through @xmath130 is not split , the one through @xmath68 is split into two lines and the one through @xmath71 is split into three lines . such a result is an illustration of the transition selection rule @xmath131 ( see fig . [ zeeman ] ) . + in terms of energy , the splitting between consecutives zeeman levels in the ground state is equal to @xmath132 , where @xmath133 is the electron gyromagnetic factor in the ground state , @xmath134 the bohr magneton and @xmath135 the magnetic field magnitude ( see fig . [ zeeman ] ) . for the excited state , the zeeman level splitting follows the same relation replacing @xmath133 by the electron gyromagnetic factor in the excited state @xmath136 . as a result , it is straightforward to show that the frequency splitting of transitions associated with a given value of the excited state total angular momentum @xmath120 is given by @xmath137 . + a systematic study of zeeman splitting as a function the magnetic field magnitude has not been performed yet . as a next step , we plan to introduce the rubidium cell inside coils in order to have better control of the applied magnetic field . this configuration would allow to measure the parameter @xmath138 or to use the doppler - free two photon absorption spectrum as an atomic magnetometer . [ h ! ] and @xmath2 of @xmath16 , when a magnetic field @xmath135 is applied to the rubidium cell . a , b , c , d , e , f are related to the six transitions fulfilling the selection rule @xmath139=2.,width=377 ] while atomic physics may be considered by students as a theoretical subject , we present here experiments enabling advanced undergraduates to become acquainted with spectroscopy techniques widely used in laboratories . throughout this article , we have implemented two complementary methods of high resolution spectroscopy - saturated absorption and two - photon spectroscopy- to probe the hyperfine structure of rubidium . eventually , these experiments combined within a single setup , constitute a great opportunity for students to investigate atomic spectra and to illustrate quantum mechanics selection rule as well as zeeman effect . + ricci l , weidem@xmath140ller m , esslinger t , hemmerich a , zimmermann c , vuletic v , k@xmath141nig w , and h@xmath43nsch t w 1995 a compact grating - stabilized diode laser system for atomic physics , _ optics comm . _ * 117 * 541 - 549 . the grating - feedback laser diode system can be built by undergraduates as described in conroy r s , carleton a , carruthers a , sinclair b d , rae c f , and dholakia k 2000 a visible extended cavity diode laser for the undergraduate laboratory _ am . j. phys . _ * 68 * 925 . the description of a low cost michelson wavelength - meter is provided in fox p j , scholten r e , walkiewicz m r , and drullinger r e 1999 a reliable , compact , and low - cost michelson wavemeter for laser wavelength measurement _ am . _ * 67 * 624 - 630 . the lineshape of saturated absorption dips is actually much more complicated than a lorentzian profile because the method is sensible to velocity - changing collisions . for a precise calculation of the dip profile one can see cahuzac p , robaux o , and vetter r 1976 pressure - broadening studies of the @xmath142 m line of xenon by saturated - amplification techniques _ b : atom . molec . phys . _ * 9 * 3165 - 3172 . schwob c , jozefowski l , de beauvoir b , hilico l , nez f , julien l , biraben f , acef o , and clairon a 1999 optical frequency measurement of the @xmath145-@xmath146 transitions in hydrogen and deuterium : rydberg constant and lamb shift determinations _ phys . lett . _ * 82 * 4960 - 4963 .

in this paper , we describe two complementary non - linear spectroscopy methods which both allow to achieve doppler - free spectra of atomic gases . first , saturated absorption spectroscopy is used to investigate the structure of the @xmath0 transition in rubidium . using a slightly modified experimental setup , doppler - free two - photon absorption spectroscopy is then performed on the @xmath1 transition in rubidium , leading to accurate measurements of the hyperfine structure of the @xmath2 energy level . in addition , electric dipole selection rules of the two - photon transition are investigated , first by modifying the polarization of the excitation laser , and then by measuring two - photon absorption spectra when a magnetic field is applied close to the rubidium vapor . all experiments are performed with the same grating - feedback laser diode , providing an opportunity to compare different high resolution spectroscopy methods using a single experimental setup . such experiments may acquaint students with quantum mechanics selection rules , atomic spectra and zeeman effect .

SECTION 1. ON-CALL PAY FOR CERTAIN TECHNICAL MEDICAL EMPLOYEES. Title I of the Indian Health Care Improvement Act (25 U.S.C. 1611 et seq.) is amended by adding at the end the following new section: ``SEC. 125. ON-CALL PAY FOR CERTAIN TECHNICAL MEDICAL EMPLOYEES. ``(a) In General.--The Secretary shall pay a technical medical employee of the Service for such time as the technical medical employee is officially scheduled to be on call outside such technical medical employee's regular hours or on a holiday designated by Federal statute or Executive order for such time as the technical medical employee may be called back to work at a rate that is equal to 10 percent of the amount that is equal to one and \1/2\ times such technical medical employee's hourly rate of basic pay. ``(b) Technical Medical Employee.--For the purposes of this section, the term `technical medical employee' includes the following: ``(1) Medical technician.--An employee whose position is in the GS-0645 occupational series. Such a position may involve nonprofessional technical work in clinical (medical) laboratories such as performing tests and examinations in one or more areas of work (such as chemistry, blood banking, hematology, or microbiology) where the reports of findings of tests and examinations may be used by physicians in diagnosis, care and treatment of patients, or in support of medical research. The work may require a practical knowledge of the techniques of medical laboratory practice in one or more areas of clinical laboratory work (e.g., blood banking, chemistry, hematology, microbiology, and cytology) and of the chemistry, biology, and anatomy involved. ``(2) Medical technologist.--An employee whose position is in the GS-0644 occupational series. Such a position may involve one or more of the following: ``(A) Technical work subordinate to the work of pathologists or other physicians (or other professional employee) who make the final diagnostic examinations of specimens of human tissues or cell preparations). ``(B) Technician work in histopathology involving preparation of thin sections of tissue specimens including fixing, clear, infiltrating, embedding, sectioning, staining, and mounting. ``(C) Technician work in cytology involving preparation, staining, and examining microscopically specimens of body fluids, secretions, and exudiations from any part of the body to determine whether cellar structure is normal, atypical, or abnormal. ``(D) Work requiring a practical knowledge of the techniques of anatomical laboratory practice in one or both of the areas of laboratory work (i.e. histopathology and cytology) and of the chemistry, biology, and anatomy involved. ``(3) Diagnostic radiologic technologist or technician.--An employee whose position is in the GS-0647 occupational series. Such a position may involve one or more of the following: ``(A) Performing most routine diagnostic radiographic procedures under general supervision and gains experience in the performance of more difficult techniques and procedures by assisting higher grade technologists. ``(B) Operating radiographic equipment to produce x-ray films of chest, joints, feet, hands, long bones of arms and legs, and other routine views of other parts of the body. ``(C) Working with outpatients or ambulatory patients, positions patients, and sets technical factors in accordance with standardized procedures and techniques. ``(D) Performing a variety of difficult radiographic examinations. ``(E) Receiving patients, explaining method of procedure, positions patient, selecting and setting technical factors, setting up and adjusting accessory equipment required, and making exposures necessary for the requested procedure. ``(c) Modifications.--The Secretary shall carry out the intent of this section so that it applies to-- ``(1) subsequent or additional occupational series designations or redesignations; and ``(2) modified or additional employee descriptions as such modifications or additions are necessary to correspond with technological advancements. ``(d) Exception for Rate of On-Call Pay.--An employee who is eligible for on-call pay under subsection (a) and who was receiving standby premium pay pursuant to section 5545 of title 5 on May 20, 1988, shall, as long as such employee is employed in the same position and work unit and remains eligible for such standby pay, receive pay for any period of on-call duty at the rate equal to the greater of-- ``(1) the rate of pay which such employee would receive if being paid the rate of standby pay pursuant to such section that such individual would be entitled to receive if such individual were not scheduled to be on call instead, or ``(2) the rate of pay which such employee is entitled to receive including on-call premium pay described in subsection (a).''.

Amends the Indian Health Care Improvement Act to provide for certain technical medical employees of the Indian Health Service to be paid for such time as they are officially scheduled to be on call outside their regular hours or on a holiday for such time as they may be called back to work.

vascular injury during biopsy of renal allograft is not uncommon and poses a unique problem because of single functioning kidney that already is compromised . at times transcatheter embolization is preferred over surgical interventions as this is less invasive and preserves the remaining functional renal tissue . transcatheter embolization involves use of microcatheters , and coils or particulate agents as embolic agents . however , the embolization process entails use of iodinated contrast that further compromises the renal function . also , transcatheter embolization at times may be technically challenging due to unfavorable anatomy . an alternative to transcatheter embolization is direct percutaneous access with a thin needle and injection of liquid or particulate embolic agents to occlude the aneurysm . superficial location of graft kidney is of advantage for ultrasound ( usg ) and doppler evaluation and usg - guided needle placement into the pseudoaneurysm can easily be done . percutaneous embolization is quick and effective with minimal damage to the remaining functioning kidney and also without the added risk of contrast nephropathy . a 44-year - old renal allograft recipient from his wife presented with delayed graft dysfunction and underwent graft kidney biopsy . he had received no induction agent and was on tacrolimus , mycophenolate mofetil and steroids . the kidney biopsy was suggestive of acute cellular rejection-1b ( acr ) and was subsequently treated with pulse methylprednisolone . patient responded to above therapy and was discharged with serum creatinine of 1.2 mg / dl . at 7 months post - transplant , patient had recurrence of graft dysfunction ( serum creatinine 3.4 mg / dl and graft sonography examination was within normal limits ) . patient underwent another graft kidney biopsy , which was suggestive of acute humoral rejection ( ahr ) and subsequently , patient was treated with pulse glucocorticoids and serum creatinine came back to baseline ( 1.2 mg / dl ) . at 10 months post - transplant , patient again developed graft dysfunction ( serum creatinine 5.5 mg / dl ) and underwent third graft kidney biopsy and was diagnosed as acr+ahr . patient was offered second line therapy , but he refused the treatment due to financial constraints . two weeks post - graft kidney biopsy patient had severe pain at the graft site with acute onset anuria ( serum creatinine 4.5 mg / dl ) . an usg examination was performed at the admission that showed massive hydronephrosis ( hdn ) of graft kidney ( caliceal dilatation 2.5 cm ) . patient was planned for percutaneous nephrostomy ( pcn ) of graft kidney , but while shifting to the intervention suite the patient passed about 200 ml of fresh blood mixed with blood clots per - urethra and the pelvicaliceal system decompressed with relief of pain . the procedure was terminated in view of relief of obstruction , but 36 h later patient again developed severe pain and repeat usg showed massive hdn of graft kidney filled with blood clots . computerized tomography ( ct ) angiography study was performed , that confirmed the presence of hdn and a pseudoaneurysm arising from interlobar artery in the graft kidney [ figure 1 ] . patient hdn again subsided spontaneously with passing of about 150 ml of blood clots . in view of imaging findings , recurrent graft hdn and passage of blood clots per - urethra , a diagnosis of intermittent bleeding from the pseudoaneurysm causing ureteric obstruction due to blood clots was made . patient was taken up for obliteration of the pseudoaneurysm by percutaneous glue injection as the doppler examination clearly showed the pseudoaneurysm , which appeared to be easily accessible with the percutaneous route [ figure 2 ] . axial ( a ) and volume rendered ( b ) computerized tomography angiographic images show a lobulated pseudoaneurysm ( arrow ) arising from interlobar artery in graft kidney . note the dilated pelvicaliceal system of renal graft in figure 1a color - doppler image ( a ) clearly demonstrates the pseudoaneurysm ( arrow ) . ultrasound image ( b ) shows spinal needle tip ( arrow ) within the pseudoaneurysm a volume of 0.5 ml 1:1 mixture of n - butylcyanoacrylate ( nectaryl , dr.reddylaboratories , india ) and iodophendylate oil ( lipiodol , laboratories guerbet , france ) was injected into the aneurysm through a 22 g spinal needle ( vygonsa , ecouen , france ) . placement of needle into aneurismal sac was usg guided and subsequent doppler usg showed complete obliteration of blood flow in the pseudoaneurysm after the glue injection [ figures 2 and 3 ] . post - embolization was uneventful and the urine output ( blood tinged ) was 1 l/24 h through pcn and nil per - urethra . subsequently within a couple of days , the blood clots largely cleared from the ureter and the pelvicalyceal system and patient continued to pass 1l clear urine per - urethra . ureteric patency was confirmed with contrast injection through the pcn catheter and ct nephrostogram [ figure 4 ] . the patient did not experience any further bouts of hematuria and was discharged 10 days after the procedure . ultrasound image ( a ) shows glue cast as echogenic contents ( arrow ) within the aneurysm sac . color doppler image ( b ) shows no flow within the aneurysm after embolization axial ( a ) non - contrast computerized tomography ( ct ) shows radio - opaque glue cast ( shortarrow ) within the pseudoaneurysm . part of the percutaneous nephrostomy catheter ( longarrow ) is seen within the pelvicaliceal system . the incidence of complication after percutaneous renal biopsy has decreased after usg guidance and smaller gauge biopsy needles . renal allograft biopsies are known to have a higher incidence of gross hematuria , hematoma formation and arteriovenous fistulae . hematuria requiring hospitalization and some sort of active management is seen in about 2.8% cases of graft biopsies . renal pseudoaneurysm is a rare complication of renal biopsy , but is of great significance due to risk of rupture . surgery may be indicated when hemostasis and repair of the arterial wall defect are required . usg - guided percutaneous injection of gelfoam ( pharmacia and upjohn company , ny , usa ) , cyanoacrylate or other thrombogenic material into aneurismal sac is an option for cases with unfavorable vascular anatomy or patients who have contraindications for intravenous contrast agents . percutaneous thrombin injection was used for treatment of pseudoaneurysm ( including renal ) from 1986 . however , thrombin injection may be complicated with reperfusion within the pseudoaneurysm , thromboembolic episodes and allergic reactions . polymerization of cyanoacrylate monomers forms a glue cast and efficiently occludes the pseudoaneurysm without side effects that are experienced with thrombin . this has been successfully used for many years for endoluminal treatment of extra and intracranial vascular malformations . the largest series of percutaneous embolization into renal pseudoaneurysm included 14 patients who were treated with direct injection of gelfoam into aneurismal sac under usg guidance . the authors of the above study suggested that percutaneous embolization could potentially replace angioembolization as first - line treatment for renal pseudoaneurysms . we had earlier reported successful percutaneous cyanoacrylate glue injection into renal pseudoaneurysm after failed thrombin injection to control hematuria after percutaneous nephrolithotomy . our patient had severe pain abdomen secondary to bleed from renal pseudoaneurysm causing recurrent ureteric obstruction by blood clots . in this case the choice of percutaneous glue injection was influenced by the direct easy access of the pseudoanurysm , successful percutaneous embolization of previous cases and also cost - effectiveness as compared with transcatheter coil angioembolization . we report the first successful case of percutaneous acrylic glue embolization of pseudoaneurysm in a renal allograft . percutaneous therapy should be considered as a quick and effective alternative method to transcatheter coil embolization for management of pseudoaneurysm in a renal allograft .

we report a 44-year - old male , renal allograft recipient of 1-year duration who had two episodes of steroid responsive acute rejection . he presented with graft dysfunction for which a graft biopsy was performed and was suggestive of mixed rejection . at 2 weeks post - biopsy , patient developed severe pain over the graft site with anuria and graft hydronephrosis ( hdn ) . the hdn and anuria intermittently settled with the passage of blood clots per - urethra . contrast enhanced computerized tomography was suggestive of pseudoaneurysm in the graft kidney . the case was successfully managed with ultrasound guided percutaneous cyanoacrylate glue injection into the pseudoaneurysm .

1 of 4. U.S. Vice President Joe Biden (L) and China's Premier Wen Jiabao (R) smile during their meeting at the Zhongnanhai leadership compound in Beijing August 19, 2011. CHENGDU, China (Reuters) - U.S. Vice President Joe Biden on Sunday rejected views that American power is waning and said Washington would never default, wrapping up a China visit that has played down tensions between the world's two biggest economies. "We are still the single best bet in the world, in terms of where to invest," Biden told a university audience in Chengdu, the provincial capital of Sichuan, the southwest province that is the second and last stop of his visit to China. "Please understand that no one cares more about this than we do, since Americans own 87 percent of all our financial assets and 69 percent of all our treasury bonds," Biden said, answering a question about U.S. debt. "So our interest is not just to protect Chinese investment. We have an overarching interest in protecting the investment, while the United States has never defaulted and never will default." "You're safe," he added. Biden also used his speech to renew U.S. calls for Beijing to do more to rein in North Korea and Iran, whose nuclear ambitions have alarmed the West. "The fact is, China and the United States face many of the same threats and share many of the same objectives and responsibilities," he said. But his key theme was, as it has been throughout his five-day visit to China, economic: that the United States can reverse its high debt and low growth, and that China should play a part by buying more American-made goods and services. "I also know that some of you are skeptical about America's future prospects. With that in view, I would like to suggest that I respectfully disagree with that view and will allay your concerns," said Biden. He told the audience to remember that the United States was by far the largest economy in the world, about two and a half times as large as China's. Biden and President Barack Obama, both Democrats, face re-election next year. Biden said the debate with Republicans over how to tackle U.S. fiscal problems would be at the heart of the 2012 presidential election. Chinese Vice President Xi Jinping, who is virtually certain to succeed Hu Jintao as Chinese President in early 2013, has hosted Biden during this visit. Obama administration officials have said they want to build trust with Xi ahead of the transition that begins in late 2012, when Hu gives up his post as general secretary of the ruling Communist Party. Next year would need careful political footwork from both governments, said Biden. "Both our countries are going through a political transition in 2012. It is very important, in my view, that we both are aware of the political sensitivities in each of the countries as they go through that," he said. "NOTHING TO WORRY ABOUT" Sichuan province is a fast-growing example of the inland development that Beijing hopes will power the Chinese economy in coming decades -- and also a slice of the rising consumer power that Washington hopes will buy more U.S. goods and reduce a huge trade deficit with China. With 80 million people, Sichuan enjoyed economic growth of 15.1 percent last year, according to government statistics. Such economic concerns have dominated Biden's visit to China, which began on Wednesday, and has featured a succession of unusually vocal declarations of Beijing's confidence in the U.S. economy, despite Standard & Poor's recent downgrade of the sovereign credit rating of the United States. China has quarreled with the United States on trade, Internet censorship, human rights and U.S. arms sales to Taiwan. While those thorny disputes have not disappeared, they appear to have been overtaken by a shared desire to show confidence and cooperation to a jittery global economy. In Sichuan, Biden raised human rights in general terms. "Liberty unlocks a people's full potential, and in its absence, unrest festers," he told the university audience. Biden told Premier Wen Jiabao on Friday that China had "nothing to worry about" over the safety of its holdings of Treasury debt, and Wen voiced confidence in the resilience of the U.S. economy, troubled by debt worries and sluggish growth. Analysts estimate two thirds of China's $3.2 trillion in foreign exchange reserves, the world's largest, are in dollar holdings, making it the biggest U.S. foreign creditor. Biden will fly to Mongolia on Monday morning for a day before heading onto Japan. (Writing and additional reporting by Chris Buckley and Michael Martina in Beijing; Editing by Yoko Nishikawa) ||||| U.S. Vice President Joe Biden's head is framed by the teleprompter as he delivers a speech at Sichuan University in Chengdu in southwestern China's Sichuan province, Sunday, Aug. 21, 2011. Biden says... (Associated Press) U.S. Vice President Joe Biden's head is framed by the teleprompter as he delivers a speech at Sichuan University in Chengdu in southwestern China's Sichuan province, Sunday, Aug. 21, 2011. Biden says... (Associated Press) Vice President Joe Biden said Sunday that the United States and China need to recognize their mutual global concerns and responsibilities and ensure greater fairness in trade and investment conditions. Biden brought a strong message of mutual interdependence on his visit to the southwestern Chinese city of Chengdu on the final day of a five-day visit to the world's second-largest economy and a key U.S. trading partner. "The more we can work together, the more our people can benefit ... the more the world can benefit," Biden told students in a speech at Sichuan University. Biden emphasized the frequent exchanges between President Barack Obama and China's Hu Jintao along with government officials in the political and economic field. He said there needed to be more exchanges between their civilian and military leaders over security issues, especially on cybersecurity and maritime issues where the sides view matters from different perspectives. "The fact is, China and the United States face many of the same threats and share many of the same objectives and responsibilities," Biden said. "Our generals should be talking to each other as frequently as our diplomats." Biden said both countries need global stability, which includes preventing Iran and North Korea from obtaining nuclear weapons. He also reasserted that the U.S. will remain a Pacific nation in future, saying that the American presence had benefited regional stability and allowed China to focus on economic development. "Asia and the United States are not separated by this great ocean. We are bound by it," he said. Biden said he recognized frustrations among many Chinese businessmen and officials at the length of time needed to obtain visas to visit the U.S. and said Washington was working on improvements. But he said U.S. companies continue to face major investment barriers in China, a frequent complaint among the business community here. He said U.S. businesses were locked out of entire fields and face "restrictions that no other major economy imposes on us or so broadly." Biden also looked to reassure his audience over the security of China's $1.2 trillion in U.S. Treasury debt following the downgrading of America's credit rating. He said Chinese and U.S. prosperity was key to reviving the global economy. "We're the two biggest engines in the world to be able to do that," he said. Biden was to spend the rest of the day Sunday visiting sites with his Chinese counterpart, Xi Jinping, who is expected to become the country's next leader.

– Vice President Joe Biden wrapped up his five-day visit to China with a strong message of China-US interdependence and firm promises that the United States would never default on its debt, reports Reuters. Speaking in the southwest city of Chengdu earlier today, Biden emphasized the continued strength of the US economy, noting that America 's economy is two-and-a-half times larger than China's. He also pointed out that, as the United States owns 87% of its financial assets and 69% its treasury bonds, compared to the 1% of financial assets and 8% of treasury bills owned by China, it was in the US interest to pay its bills, adding "the United States has never defaulted and never will default." Biden called on China to be more forceful in reining in North Korea and Iran, and encouraged Beijing to allow a freer flow of information and greater political dialogue, reports the AP. "Liberty unlocks a people's full potential and in its absence, unrest festers," said Biden. In general, the visit emphasized common ties and building trust between the two countries. "Asia and the United States are not separated by this great ocean," said Biden. "We are bound by it."

the rotational evolution of stars is the result of the complex interaction of several fundamental processes . first , the molecular cloud contracts conserving initial angular momentum spinning up the central object . angular momentum can be stored in a disc , which may brake the rotation of the central object . after the disc is dissipated , the star can contract reaching the highest rotation rate after several ten million years of lifetime . solar - type stars , i.e. , stars with convective envelopes , start generating magnetic fields that couple to the stellar wind . the interaction between charged particles in the wind and the magnetic field generates a torque braking the star s rotation . in the case of the sun , braking has led to a rotation rate of about 1 revolution every month . according to the rotation - activity relation , rapidly rotating stars produce strong magnetic fields generating a strong magnetic torque that brakes the star . this leads to slower rotation , which in turn weakens the magnetic field production and braking is weakening , too . at young ages in open clusters , we observe rapidly rotating , very active stars , while the ( single ) field stars generally are slowly rotating and only weakly active . this means that in principle rotation and activity can tell about the age of a star ( e.g. , * ? ? ? * ; * ? ? ? the connection between rotation , stellar wind , magnetic fields , and magnetic activity is reviewed in this splinter session summary . first , we give an overview about the current picture on rotation in both clusters and the field , i.e. , in young and old stars . next , we discuss results from direct and indirect magnetic field measurements and their connection to stellar wind theory . in the last part , we give a summary on the theoretical work on magnetic field generation through stellar dynamos . low - mass stars and in particular the regime where stars become completely convective currently present a rather puzzling picture of the connection between magnetism , activity , and rotation . thus , low - mass stars are in the focus of our summary . the net effect of early stellar evolution and disc - coupling is that a star has approximately constant angular velocity for the first few myr while it is still coupled the disc . then it spins up rapidly once the disc dissipates , reaching maximum rotational velocity close to when it arrives on the zero age main sequence , followed by a gradual decay due to the stellar wind , lasting for the remainder of the main sequence lifetime . rotational evolution has traditionally been constrained by using measurements in open clusters to provide `` snapshots '' during the evolution . large samples of these are now available covering @xmath0 ( see fig . [ period - mass - comp ] ) . it is becoming increasingly clear that the evolution is strongly mass and rotation rate dependent , and this has important consequences for the nature of the mechanisms governing the angular momentum losses . in particular , unlike solar - type dwarfs , low - mass dwarfs spin up much more rapidly , appear to experience no significant angular momentum losses on the pre main sequence , and much weaker losses due to winds on the main sequence . rotation period and @xmath1 measurements for open clusters at ages @xmath2myr and masses @xmath3m@xmath4 . masses were derived assuming cluster ages given in each panel . distance and reddening are from the literature using @xmath5-band absolute magnitudes and nextgen stellar models of @xcite . for the ( numerous ) appropriate references , please see @xcite . ] early stars with no relevant convective envelopes can not generate surface magnetic fields , they rotate rapidly during their entire lifetime . solar - type stars with convective envelopes are strongly braked as seen above . this is consistent with observations of coronal emission , chromospheric emission , and latitudinal differential rotation , which set in exactly where stars are believed to form convective envelopes , i.e. , around spectral type a7f0 . wind braking becomes very efficient around late - f type stars , and the sun for example has slowed down to less than 2kms@xmath6 during its lifetime . field stars of spectral type k and early - m typically rotate very slowly as well , although in their youth braking was probably somewhat weaker ( see above ) . virtually all single field k and m dwarfs , including early - m classes m0m3 , are rotating at velocities slower than about 3kms@xmath6 . around spectral type m3.5 , however , a dramatic increase in rotation rate is observed . this threshold coincides with the mass range where stars become fully convective . it appears that for some reason rotational braking becomes weaker at this boundary . _ left : _ rotational velocities of m t type objects . circles are from @xcite ( blue : kinematically young , red : kinematically old ) ; triangles from @xcite . magenta stars indicate the three members of lhs 1070 @xcite , filled green squares the two subdwarfs 2mass 0532@xmath78246 and lsr 1610@xmath80040 @xcite . solid lines mark evolutionary tracks for objects of 0.1 , 0.09 , 0.08 , and 0.07m@xmath4 , dashed lines mark ages of 1 and 10gyrs ( from upper left to lower right ) . _ right : _ scaling of the magnetic wind - braking with temperature in eq.[eq : windbrake ] . ] fig.[fig : fieldvsini ] shows a compilation of ( projected ) rotational velocities @xmath1 in objects of spectral classes m t . the sudden increase of rotation rate is evident at spectral type @xmath9m3.5 . another important result is that braking does not completely vanish at least until spectral class l0 . in the figure , members of the ( statistically ) young population are shown in blue and old stars in red , and the two subdwarfs shown with green squares are probably _ very _ old . young objects are found predominantly in the upper part of the plot while the old sample shows slower rotation . this indicates that rotational braking still works in ultra - cool dwarfs . solid lines in fig.[fig : fieldvsini ] show evolutionary tracks according to a modified braking law of the form @xmath10 here , @xmath11 was scaled according to the right panel in fig.[fig : fieldvsini ] ; braking is weaker at lower temperature ( see * ? ? ? * ) . a viable explanation for this may be the weaker coupling of magnetic field lines ( which still exist ) to the atmosphere that is becoming more and more neutral . rotational braking in fully convective field stars and brown dwarfs appears to be so weak that after a few billion years the distribution of rotational velocities can tell a lot about their angular momentum evolution and the underlying processes , magnetic fields and ( sub)stellar winds . the discovery of x - ray emission from the brown dwarf lp944 - 20 @xcite provided the first direct demonstration of magnetic activity in the substellar regime . subsequent x - ray , h@xmath12 , and radio observations revealed that low - mass stars and even brown dwarfs ubiquitously generate magnetic activity . no break is observed at the boundary to full convection , but chromospheric activity weakens after spectral type about m7 @xcite , an effect that may be due to decreasing fractional ionization @xcite . quiescent activity and flaring are still observed in even cooler objects ( e.g. , * ? ? ? * ; * ? ? ? * ; * ? ? ? * ; * ? ? ? about 10% of ultracool dwarfs in the range m7l4 produce both quiescent and flaring radio emission , with inferred field strengths of 0.13 kg and covering fractions of order unity @xcite , and it likely correlates with rotation velocity @xcite . at the same time , the tight radio / x - ray correlation that exists in a wide range of stars ( including the sun ) is strongly violated beyond m7 , roughly the same regime where chromospheric and coronal emission become weaker . equally important , several ultracool dwarfs have been observed to produce periodic radio emission and h@xmath12 emission . this emission may carry information about the field topology . in general , radio observations suggest that a low multipole , large - scale field configuration is the best explanation for the observed variability @xcite . activity indicators like x - ray , h@xmath12 , and radio emission provide strong constraints on the magnetic flux depending on the mechanism that generates the observed emission . direct measurements of magnetic fields in m dwarfs through zeeman splitting of atomic lines were carried out by @xcite , results from a re - analysis with a multi - component fit are given in @xcite . in late - m dwarfs , however , atomic lines become rare and more and more blended so that molecular zeeman diagnostics would be useful , and @xcite suggested that feh could be a good indicator of magnetic flux . @xcite developed a method to measure magnetic flux through feh and did so in a sample of m3m9 dwarfs . they found that the relation between magnetic fields and ( chromospheric ) activity is intact through the entire m spectral range ; the most active m stars exhibit magnetic fields on the order of a few kg . thus , the lack of rotational braking in mid- to late - m dwarfs can not be a consequence of weaker magnetic fields . fully convective stars obviously find a way to efficiently generate magnetic fields . how does the magnetic field connect to rotation ? when a rotating star drives an outflow that is well - coupled to the stellar magnetic field , the wind and magnetic field conspire to extract angular momentum from the star . this happens because , as wind material leaves the stellar surface and tries to conserve its own angular momentum , it lags behind the star in a rotational sense . thus , the magnetic field connecting the stellar surface to the outflowing wind is bent backwards with respect to the stellar rotation . this imparts a torque , which acts to give `` extra '' specific angular momentum to the wind , removing it from the star . a method for calculating this stellar wind torque dates back to @xcite and @xcite , and magnetic stellar wind theory is still an active research topic . a generic result is that the torque can be written @xmath13 , where @xmath14 is the mass loss rate in the wind , @xmath15 is the angular spin rate of the star , and @xmath16 is sometimes called the `` magnetic lever arm '' in the flow . in a one - dimensional flow , @xmath16 is the alfvn radius , the radial location where the wind flow speed equals the magnetic alfvn wave speed . we can quantify the efficiency of angular momentum extraction by dividing the stellar angular momentum by @xmath17 , which gives a characteristic spin - down time @xmath18 where @xmath19 is the `` mean radius of gyration '' ( in main sequence stars , typically @xmath20 ) and @xmath21 and @xmath22 are the stellar radius and mass . note that the first two terms on the right - hand - side are dimensionless . the last term has the units of time and represents the mass loss time for the star . in the solar wind , for example , @xmath23 ( e.g. , * ? ? ? thus the angular momentum loss in magnetic stellar winds can be very efficient in a sense that the spin - down time can be much shorter than the mass loss time . this is an elegant result , but the difficulty lies in calculating the effective @xmath16 for an arbitrary star and a realistic ( 3-dimensional ) wind . our understanding of the observed evolution of stellar spins depends on this calculation of the torque . recent work by ( * ? ? ? * and see contribution in these proceedings ) emphasizes that , while there is still no adequate theory for predicting how the wind torque depends on stellar mass and age , significant progress can be made with the use of numerical simulations . the solar activity cycle is believed to be the result of a dynamo process either in the convection zone or the stably stratified layer beneath it . the original model was an @xmath24 dynamo in the convection zone generating a predominantly toroidal and axisymmetric magnetic field . problems with flux storage and the internal rotation pattern found by helioseismology led to a revised model where the dynamo is located at the bottom of the convection zone . that sort of dynamo , however , produces too many toroidal field belts and too short cycle periods . the advection - dominated dynamo is an extension of the @xmath24 dynamo where a large - scale meridional flow advects the magnetic field towards the poles at the surface and towards the equator at the bottom of the convection zone . the butterfly diagram is now the result of the meridional flow rather than a dynamo wave and the cycle time depends on the flow as much as on the dynamo number . for stars there is no clear picture yet . one would expect stars similar to the sun to show the same type of activity but doppler imaging frequently finds large spots at high latitudes and both solar - type and anti - solar cycles have been found in stellar butterfly diagrams from photometry . large polar spots can be explained as the consequence of flux tube instability in the tachocline while anti - solar butterfly diagrams could indicate a meridional flow pattern opposite to that of the sun . main sequence stars with masses below @xmath25m@xmath26 are fully convective , ruling out any dynamo mechanism involving the tachocline , but some sort of dynamo must still be at work . the @xmath27 dynamo , where the @xmath12 effect alone generates the field , is a possible mechanism . it generates completely non - axisymmetric fields that do not oscillate , so that monitoring of active low - mass stars will provide an important step towards understanding of the dynamo in these stars . at the moment , observations support neither the @xmath24 nor the @xmath27 dynamo : ab dor shows pronouced differential rotation but a strongly non - axisymmetric surface field while v374 peg has an axisymmetric dipole geometry despite nearly rigid surface rotation @xcite . particularly puzzling for dynamo theorists has been the finding that fully convective m dwarfs can host _ large - scale _ magnetic fields , even in the absence of any apparent differential rotation . @xcite discussed 3-d simulations of convection and dynamo action in fully convective stars , with an eye toward answering two main questions : first , how large - scale fields might be generated without a `` tachocline '' of shear , and second , whether differential rotation is always absent in such stars or might be maintained in certain circumstances . in this model @xcite , convection acted effectively as a dynamo , quickly building magnetic fields that ( in stars rotating at the solar angular velocity ) were approximately in equipartition with the turbulent velocity field . more rapidly rotating stars built somewhat stronger fields , whereas slower rotators hosted weaker fields . although differential rotation was established in hydrodynamic simulations , the strong magnetic fields realized in most mhd cases acted to strongly quench those angular velocity contrasts . despite the absence of any significant shear , the magnetic fields realized in the simulations had structure on a broad range of spatial scales , and included a substantial large - scale component . the large - scale field generation is attributed partly to the strong influence of rotation upon the slowly overturning flows realized in m - stars . our current picture of magnetic field generation , rotation , and stellar activity may be summarized as follows : 1 . rotation rates are available for a wide range of masses and ages . measurements of _ projected _ rotation velocities extend far into the brown dwarf regime , but direct measurements of rotational periods are lacking at very low masses . 2 . we observe a sharp break in rotation around the threshold where stars become fully convective . this probably indicates a breakdown of wind braking . magnetic field measurements as well as activity tracers like x - rays , h@xmath12 , and radio emission show now obvious break at the convection boundary . however , around spectral type m7 normalized activity strongly weakens and the relation between radio and x - ray emission breaks down . 4 . apparently , very low mass stars can have strong large - scale magnetic fields yet only little wind braking . this remains an unresolved problem . a key for understanding spindown is a theoretical understanding of wind braking . however , it is still a challenge for magnetic stellar wind theory to reliably calculate the wind torque for a range of stellar parameters . furthermore , the wind torque is affected by the mass loss rate , so it is very important that we get measurements of mass loss rates and continue to improve mass loss theory . efforts to theoretically understand magnetic field generation evolved from the solar dynamo to the larger class of stellar dynamos , in particular to fully convective ones in absence of a tachocline . first models successfully reproduce magnetic field generation , but it certainly is still a long way to understanding magnetic dynamos in very cool stars .

today , the generation of magnetic fields in solar - type stars and its relation to activity and rotation can coherently be explained , although it is certainly not understood in its entirety . rotation facilitates the generation of magnetic flux that couples to the stellar wind , slowing down the star . there are still many open questions , particularly at early phases ( young age ) , and at very low mass . it is vexing that rotational braking becomes inefficient at the threshold to fully convective interiors , although no threshold in magnetic activity is seen , and the generation of large scale magnetic fields is still possible for fully convective stars . this article briefly outlines our current understanding of the rotation - magnetic field relation . address = universitt gttingen address = university of st andrews address = thringer landessternwarte tautenburg address = national university of ireland galway address = harvard - smithsonian center for astrophysics address = university of california at berkeley , altaddress = the university of chicago address = harvard - smithsonian center for astrophysics address = astrophysikalisches institut potsdam address = the university of virginia ; currently at nasa ames research center

SECTION 1. DEFINITIONS. In this Act: (1) Board.--The term ``Board'' means the Stutsman County Park Board in Jamestown, North Dakota. (2) Game and fish headquarters.--The term ``game and fish headquarters'' means the land depicted as ``Game and Fish Headquarters'' on the Map. (3) Jamestown reservoir.--The term ``Jamestown Reservoir'' means the Jamestown Reservoir constructed as a unit of the Missouri-Souris Division, Pick-Sloan Missouri Basin Program, as authorized by section 9 of the Act of December 22, 1944 (commonly known as the ``Flood Control Act of 1944'') (58 Stat. 891, chapter 665). (4) Management agreement.--The term ``Management Agreement'' means the management agreement entitled ``Management Agreement between the United States of America and Stutsman County Park Board for the Management, Development, Operation and Maintenance of Recreation and Related Improvements and Facilities at Jamestown Reservoir Stutsman County, North Dakota'', numbered 15-LM-60-2255, and dated February 17, 2015. (5) Map.--The term ``Map'' means the map prepared by the Bureau of Reclamation, entitled ``Jamestown Reservoir'', and dated May 2018. (6) Permitted cabin land.--The term ``permitted cabin land'' means the land depicted as ``Permitted Cabin Lands'' on the Map. (7) Property.--The term ``property'' means any cabin site located on permitted cabin land for which a permit is in effect on the date of enactment of this Act. (8) Recreation land.--The term ``recreation land'' means the land depicted as ``Recreation and Public Purpose Lands'' on the Map. (9) Secretary.--The term ``Secretary'' means the Secretary of the Interior, acting through the Commissioner of Reclamation. (10) State.--The term ``State'' means the State of North Dakota, acting through the North Dakota Game and Fish Department. SEC. 2. CONVEYANCES TO STUTSMAN COUNTY PARK BOARD. (a) Conveyances to Stutsman County Park Board.-- (1) In general.--Subject to the management requirements of paragraph (3) and the easements and reservations under section 4, not later than 5 years after the date of enactment of this Act, the Secretary shall convey to the Board all right, title, and interest of the United States in and to-- (A) the recreation land; and (B) the permitted cabin land. (2) Costs.-- (A) In general.--Except as provided in subparagraph (B), the Secretary shall convey the land described in paragraph (1) at no cost. (B) Title transfer; land surveys.--As a condition of the conveyances under paragraph (1), the Board shall agree to pay all survey and other administrative costs necessary for the preparation and completion of any patents for, and transfers of title to, the land described in paragraph (1). (3) Management.-- (A) Recreation land.--The Board shall manage the recreation land conveyed under paragraph (1)-- (i) for recreation and public purposes consistent with the Act of June 14, 1926 (commonly known as the ``Recreation and Public Purposes Act'') (44 Stat. 741, chapter 578; 43 U.S.C. 869 et seq.); (ii) for public access; (iii) for fish and wildlife habitat; or (iv) to preserve the natural character of the recreation land. (B) Permitted cabin land.--The Board shall manage the permitted cabin land conveyed under paragraph (1)-- (i) for cabins or recreational residences in existence as of the date of enactment of this Act; or (ii) for any of the recreation land management purposes described in subparagraph (A). (4) Haying and grazing.--With respect to recreation land conveyed under paragraph (1) that is used for haying or grazing authorized by the Management Agreement as of the date of enactment of this Act, the Board may continue to permit haying and grazing in a manner that is permissible under the 1 or more haying or grazing contracts in effect as of the date of enactment of this Act. (b) Reversion.--If a parcel of land conveyed under subparagraph (A) or (B) of subsection (a)(1) is used in a manner that is inconsistent with the requirements described in subparagraph (A) or (B), respectively, of subsection (a)(3), the parcel of land shall, at the discretion of the Secretary, revert to the United States. (c) Sale of Permitted Cabin Land by Board.-- (1) In general.--If the Board sells any parcel of permitted cabin land conveyed under subsection (a)(1)(B), the parcel shall be sold at fair market value, as determined by a third-party appraiser in accordance with the Uniform Standards of Professional Appraisal Practice, subject to paragraph (2). (2) Improvements.--For purposes of an appraisal conducted under paragraph (1), any improvements on the permitted cabin land made by a permit holder shall not be included in the appraised value of the land. (3) Proceeds from the sale of land by the board.--If the Board sells a parcel of permitted cabin land conveyed under subsection (a)(1)(B), the Board shall pay to the Secretary the amount of any proceeds of the sale that exceed the costs of preparing the sale by the Board. (d) Availability of Funds to the Secretary.--Any amounts paid to the Secretary for land conveyed by the Secretary under this Act shall be made available to the Secretary, subject to the availability of appropriations made in advance, for activities relating to the operation of the Jamestown Dam and Reservoir. SEC. 3. CONVEYANCE OF GAME AND FISH HEADQUARTERS TO THE STATE. (a) Conveyance of Game and Fish Headquarters.--Not later than 5 years after the date of enactment of this Act, the Secretary shall convey to the State all right, title, and interest of the United States in and to the game and fish headquarters, on the condition that the game and fish headquarters continue to be used as a game and fish headquarters or substantially similar purposes. (b) Reversion.--If land conveyed under subsection (a) is used in a manner that is inconsistent with the requirements described in that subsection, the land shall, at the discretion of the Secretary, revert to the United States. SEC. 4. RESERVATIONS, EASEMENTS, AND OTHER OUTSTANDING RIGHTS. (a) In General.--Each conveyance to the Board or the State pursuant to this Act shall be made subject to-- (1) valid existing rights; (2) operational requirements of the Pick-Sloan Missouri River Basin Program, as authorized by section 9 of the Act of December 22, 1944 (commonly known as the ``Flood Control Act of 1944'') (58 Stat. 891, chapter 665), including the Jamestown Reservoir; (3) any flowage easement reserved by the United States to allow full operation of the Jamestown Reservoir for authorized purposes; (4) reservations described in the Management Agreement; (5) oil, gas, and other mineral rights reserved of record, as of the date of enactment of this Act, by, or in favor of, the United States or a third party; (6) any permit, license, lease, right-of-use, flowage easement, or right-of-way of record in, on, over, or across the applicable property or Federal land, whether owned by the United States or a third party, as of the date of enactment of this Act; (7) a deed restriction that prohibits building any new permanent structure on property below an elevation of 1,454 feet; and (8) the granting of applicable easements for-- (A) vehicular access to the property; and (B) access to, and use of, all docks, boathouses, ramps, retaining walls, and other improvements for which access is provided in the permit for use of the property as of the date of enactment of this Act. (b) Liability; Taking.-- (1) Liability.--The United States shall not be liable for flood damage to a property subject to a permit, the Board, or the State, or for damages arising out of any act, omission, or occurrence relating to a permit holder, the Board, or the State, other than for damages caused by an act or omission of the United States or an employee, agent, or contractor of the United States before the date of enactment of this Act. (2) Taking.--Any temporary flooding or flood damage to the property of a permit holder, the Board, or the State, shall not be considered to be a taking by the United States. SEC. 5. INTERIM REQUIREMENTS. During the period beginning on the date of enactment of this Act and ending on the date of conveyance of a property or parcel of land under this Act, the provisions of the Management Agreement that are applicable to the property or land, or to leases between the State and the Secretary, and any applicable permits, shall remain in force and effect. Speaker of the House of Representatives. Vice President of the United States and President of the Senate.

This bill directs the Bureau of Reclamation to provide to the holder of a permit for any cabin site located on specified federal land associated with the Jamestown Reservoir, North Dakota, the first option to purchase that property for fair market value, provided that the permittee pays to the Stutsman County Park Board any outstanding permit fees. Reclamation shall convey such property and sole use perpetual easements for access to such property to a permittee who elects such option. The conveyance shall end five years after this bill's enactment. If a permittee fails to exercise the option to purchase within five years, the commissioner shall transfer the property to the board without cost. If the board sells such a property within three years after such a transfer, it shall pay all proceeds in excess of its costs to Reclamation. Five years after the date of enactment of this bill, Reclamation shall transfer, without cost: (1) to the board federal land associated with the reservoir and managed by the board on which no cabin is located; and (2) to the North Dakota Game and Fish Department land leased by such department as of that date. Each conveyance to a permittee, and each transfer to the board or department, shall be made subject to specified oil, gas, and other mineral rights, and specified permits, reversions, and easements. Any revenues from a sale of federal land shall be made available to the commissioner, without further appropriation, for: (1) the costs to the commissioner of carrying out this bill, and (2) deferred maintenance activities relating to the operation of the dam in the reservoir.

SECTION 1. SHORT TITLE. This Act may be cited as the ``Federal Executive Accountability Act of 2017''. SEC. 2. OFFICE OF INSPECTOR GENERAL IN THE EXECUTIVE OFFICE OF THE PRESIDENT. (a) Establishment.-- (1) In general.--Section 12 of the Inspector General Act of 1978 (5 U.S.C. App.) is amended-- (A) in paragraph (1), by striking ``or the Director of the National Reconnaissance Office'' and inserting ``the Director of the National Reconnaissance Office; or the President (with respect to the Executive Office of the President)''; and (B) in paragraph (2), by striking ``or the National Reconnaissance Office'' and inserting ``the National Reconnaissance Office, or the Executive Office of the President''. (2) Appointment of inspector general.--Not later than 120 days after the date of the enactment of this Act, the President shall appoint an individual as the Inspector General of the Executive Office of the President in accordance with the requirements of section 3(a) of the Inspector General Act of 1978 (5 U.S.C. App.). (b) Special Provisions.--The Inspector General Act of 1978 (5 U.S.C. App.) is amended by inserting after section 8M the following: ``SEC. 8N. SPECIAL PROVISIONS CONCERNING THE EXECUTIVE OFFICE OF THE PRESIDENT. ``(a) Audits, Investigations, and Issuance of Subpoenas.-- ``(1) Authority, direction, and control.--Notwithstanding the last two sentences of section 3(a), the Inspector General of the Executive Office of the President shall be under the authority, direction, and control of the President with respect to audits or investigations, or the issuance of subpoenas, that require access to information concerning any of the following: ``(A) The identity of a confidential source, including a protected witness. ``(B) An intelligence or counterintelligence matter. ``(C) An undercover operation. ``(2) Prohibition in certain situations.--With respect to the information described in paragraph (1), the President may prohibit the Inspector General of the Executive Office of the President from initiating, carrying out, or completing any audit or investigation, or from issuing any subpoena, after the Inspector General has decided to initiate, carry out, or complete such audit or investigation, or to issue such subpoena, if the President determines that such prohibition is necessary to prevent the disclosure of any information described in paragraph (1). ``(3) Notice after prohibition.-- ``(A) To inspector general.--If the President exercises any power under paragraph (2), not later than 30 days after exercising any such power, the President shall notify the Inspector General of the Executive Office of the President in writing, stating the reasons for exercising that power. ``(B) To congress.--Not later than 30 days after receiving a notice under subparagraph (A), the Inspector General of the Executive Office of the President shall transmit a copy of the notice to the chair and ranking member of each of the following: ``(i) The Committee on Oversight and Government Reform of the House of Representatives. ``(ii) The Committee on the Judiciary of the House of Representatives. ``(iii) The Committee on Homeland Security and Governmental Affairs of the Senate. ``(iv) The Committee on the Judiciary of the Senate. ``(v) Any other appropriate committee or subcommittee of Congress. ``(b) Semiannual Reports.-- ``(1) Additional information to be included.--Any semiannual report prepared by the Inspector General of the Executive Office of the President under section 5(a) shall also include the following: ``(A) With respect to each significant recommendation on which corrective action has been completed, a description of the corrective action. ``(B) A certification of whether the Inspector General of the Executive Office of the President has had full and direct access to all information relevant to the performance of the functions of the Inspector General. ``(C) A description of any audit, inspection, or evaluation occurring during the reporting period in which the Inspector General of the Executive Office of the President could not obtain relevant information due to an exercise of power by the President under subsection (a)(2). ``(D) Such recommendations as the Inspector General of the Executive Office of the President considers appropriate with respect to efficiency in the administration of programs and operations undertaken by the President, and the detection and elimination of fraud, waste, and abuse in such programs and operations. ``(2) Submission to president.--Notwithstanding section 5(b), the Inspector General of the Executive Office of the President shall submit to the President the semiannual reports prepared under section 5(a), including the additional information required under paragraph (1), not later than April 30 and October 31 of each year. ``(3) Transmission to congress.--Not later than 30 days after receiving a semiannual report under paragraph (2), the President shall transmit the semiannual report, including any comments the President considers appropriate, to the chair and ranking member of each of the following: ``(A) The Committee on Oversight and Government Reform of the House of Representatives. ``(B) The Committee on the Judiciary of the House of Representatives. ``(C) The Committee on Homeland Security and Governmental Affairs of the Senate. ``(D) The Committee on the Judiciary of the Senate.''. (c) Technical and Conforming Amendments.--The Inspector General Act of 1978 (5 U.S.C. App.) is amended-- (1) by striking ``subpena'' each place the term appears and inserting ``subpoena''; (2) by striking ``subpenas'' each place the term appears and inserting ``subpoenas''; (3) in section 8G(a)(1)-- (A) by striking subparagraph (C); and (B) by redesignating subparagraphs (D) through (F) as subparagraphs (C) through (E), respectively; and (4) in section 8J, by striking ``8E'' and all that follows through ``this Act'' and inserting ``8E, 8F, 8H, or 8N of this Act''. (d) Over-Classification Audit.-- (1) Evaluations required.--The Inspector General of the Executive Office of the President, in consultation with the Information Security Oversight Office of the National Archives and Records Administration, shall carry out two evaluations of the Executive Office of the President-- (A) to assess whether applicable classification policies, procedures, rules, and regulations have been adopted, followed, and effectively administered within the Executive Office of the President; and (B) to identify policies, procedures, rules, regulations, or management practices that may be contributing to persistent misclassification of material within the Executive Office of the President. (2) Deadlines for evaluations.-- (A) Initial evaluation.--The first evaluation required under paragraph (1) shall be completed not later than one year after the date of the enactment of this Act. (B) Second evaluation.--The second evaluation required under paragraph (1) shall review progress made pursuant to the results of the first evaluation and shall be completed not later than one year after the date on which the first evaluation is completed. (3) Coordination.--The Inspector General of the Executive Office of the President shall coordinate with other Inspector Generals and the Information Security Oversight Office to ensure that evaluations follow a consistent methodology, as appropriate, that allows for cross-agency comparisons. (4) Reports required.-- (A) In general.--Not later than 45 days after the completion of an evaluation, the Inspector General of the Executive Office of the President shall submit to the appropriate entities a report on that evaluation. (B) Content.--Each report submitted under subparagraph (A) shall include a description of-- (i) the policies, procedures, rules, regulations, or management practices, if any, identified by the Inspector General under paragraph (1)(b); and (ii) the recommendations, if any, of the Inspector General to address any such identified policies, procedures, rules, regulations, or management practices. (5) Appropriate entities defined.--In this subsection, the term ``appropriate entities'' means each of the following: (A) The Committee on Oversight and Government Reform of the House of Representatives. (B) The Committee on the Judiciary of the House of Representatives. (C) The Committee on Homeland Security and Governmental Affairs of the Senate. (D) The Committee on the Judiciary of the Senate. (E) Any other appropriate committee or subcommittee of Congress. (F) The President. (G) The Director of the Information Security Oversight Office.

Federal Executive Accountability Act of 2017 This bill requires the President to appoint an Inspector General of the Executive Office of the President. Such Inspector General shall be under the authority, direction, and control of the President with respect to audits, investigations, or the issuance of subpoenas that require access to information concerning the identity of a confidential source, an intelligence or counterintelligence matter, and an undercover operation. The President may prohibit such Inspector General from carrying out any audit or investigation or issuing any subpoena upon determining that such prohibition is necessary to prevent the disclosure of any such information. The bill amends the Inspector General Act of 1978 to require the Inspector General established by this bill to include the following additional information in its required semiannual report to the head of its establishment: a description of corrective action completed on each significant recommendation; a certification of whether such Inspector General has had full and direct access to all information relevant to the performance of its functions; a description of any audit, inspection, or evaluation occurring during the reporting period in which such Inspector General could not obtain relevant information due to an exercise of presidential power; and any recommendations regarding efficiency in the administration of programs and operations undertaken by the President and the detection and elimination of fraud, waste, and abuse. Such Inspector General shall carry out two evaluations of the Executive Office of the President to: (1) assess whether applicable classification procedures have been followed within such office; and (2) identify policies and procedures that may be contributing to persistent misclassification of material within such office.

vision engages the largest portion of the human cerebral cortex and in multiple cortical areas is characterized by miniature functional units . for example , the two functional domains of the primary visual cortex , namely orientation and ocular preference , are represented by columns that span 0.77 mm to 1 mm 1 , 2 . clusters approximating 1 mm in size have been reported in highlevel visual areas important for motion perception 3 , 4 and similarly small sized modules are believed to represent complex object information in highlevel areas important for object recognition 5 , 6 . noninvasive functional imaging of these small modules requires imaging at resolutions finer than 1 mm , a capability that is lacking at the large majority of research sites . using functional mri ( fmri ) and ultrahigh field strengths , a number of studies have demonstrated feasibility of mapping one of the subunits of the human visual cortex , namely ocular dominance columns 7 , 8 . for example , yacoub and colleagues have demonstrated mapping ocular dominance columns in humans at 7 t using a segmented spin echo acquisition scheme , but only in subjects with a flat calcarine sulcus 9 . goodyear and menon successfully used a segmented gradient echo acquisition scheme at 4 t to map out the ocular dominance columns 10 . the methods used in these pioneering studies have seen very little extension , largely because of lack of access to ultrahighfield scanners and the challenges associated with highresolution image acquisition at such field strengths . therefore , submillimeter imaging of the visual cortex has remained largely elusive for the bulk of this large field of neuroscientists . increasing field strength is a sure way to improve fmri contrast , albeit an expensive one . at ultrahigh fields ( 7 t ) , enough gain in sensitivity is achieved to allow for submillimeter fmri assuming suitable gradients and radiofrequency ( rf ) hardware . however , such tools are generally unavailable to the majority of vision researchers , and their effective implementation is not straightforward ( eg , segmented echo planar imaging [ epi ] or threedimensional [ 3d ] segmented acquisitions ) . imaging smaller voxels places high demands on signaltonoise ratio ( snr ) that , aside from increasing field strength , can only be achieved through improvements in rf reception . optimizing coil design for the posterior head has been attempted on at least three previous occasions . 12 both have developed 16channel rf coils for highresolution functional imaging at 7 t , with petridou et al . demonstrating submillimeter resolution functional imaging but in a small constrained region of the posterior head . barth and norris 13 demonstrated very highresolution 3d functional imaging of the occipital cortex with a customized eightchannel phasedarray receiver coil at 3 t . the bulk of the visual cortex is close to the skull and is constrained to the posterior of the head . local increase of the receiver array density here could result in large gains in snr and acceleration performance for this restricted region of the brain . in previous studies , we found an approximately 40% snr gain when increasing the channel count from 32 to 64 with 65mmdiameter loops 14 and gains of approximately 60% with when increasing the channel count to 96 with 50mm loops in the cortex near skull 15 . further reducing loop sizes , while still using roomtemperature conductors , forces new design choices in order to maintain samplenoise dominance , namely that the coil housing has to closely follow the subject 's head shape . because of the layout of the visual cortex and the restricted portion of the posterior skull that covers it , we sought to study the snr gains of a densely packed openfaced array consisting of 42mm elements for targeted imaging of this area . the design choice to pack the available channels to only cover the visual cortex restricts our imaging plane to those that are approximately tangential to the posterior skull , in contrast to previous wholehead optimization approaches 14 , 15 , 16 , 17 . this integrated optimization led to a twofold increase in snr for imaging the visual cortex compared with a commercial 32channel wholehead coil and allowed for submillimeter functional imaging using singleshot gradient echo epi ( geepi ) . because our goal was to focus and optimize the coil for visual cortex imaging , we were able to restrict the element placement to the head posterior . the resulting openfaced topology is ideal for vision research as it allows for placement of optics ( mirrors , lenses , patches , etc . ) . . a critical component of our development was the identification and implementation of the optimal coil former shape . the coil former was modeled based on a nonlinear atlas of the international consortium for brain mapping . the atlas used included a model of the neck as well , which allowed for optimal placement of the coils around the temporal lobe . a second consequence of this design was the subject comfort afforded by a contoured surface for resting the neck and head . the comfort afforded by the head and neck contours of our coil former allowed us to eliminate the need for padding . this further reduced the space between our elements and the head , contributing to greater sensitivity of the coil . the layout of the overlapped circular coil elements was arranged by a hexagonal tiling pattern , which was printed onto the coil former together with standoffs to mount the preamplifiers and other coil electronic parts . targeting the visual cortex as a region of interest , the tile size was adjusted appropriately to meet the desired number of 32 channels ( fig . the loop diameter of 42 mm was derived from the size of the hexagon tiles , where the loop diameter is slightly larger than the diameter of the circle that inscribes the vertexes of the hexagon . all helmet parts , including its covers , were printed in polycarbonate plastic using a rapid prototyping 3d printer ( fortus 360 ; stratasys ltd . , eden prairie , minnesota , usa ) . dedicated 3 t visual cortex coil for highresolution fmri data acquisition . the coil former follows the contour of the occipital pole and cerebellum to provide tight fitting coil elements at the region ofinterest . special effort was made to create a comfortable head support to run fmri with little or no foam cushioning . the 42mm loops were constructed from tinplated , 16gauge , oxygenfree high thermal conductivity copper . each loop contained bridges bent into the wire to allow the coil conductors to cross over . each loop was symmetrically divided with two gaps , where the discrete rf components were placed [ see schematic circuit in keil et al . the discrete components were mounted on small fr4 circuit boards , manufactured with a rapid prototyping circuit router ( ttech7000 ; ttech , inc , norcross , georgia , usa ) and then soldered to the loop conductor . these small circuit boards minimized mechanical stress between the loop wires and the ceramic capacitors ( series 11 ; voltronics , danville , new jersey , usa ) . the tuning capacitor circuit board contained a variable capacitor ( gfx2700 nm ; sprague goodman , westbury , new york , usa ) to finetune the loop resonance to 123.25 mhz . the output circuitboard incorporated a capacitive voltage divider to impedancematch the element 's output to an optimized noisematched impedance , z nm , required by the preamplifier ( siemens ag , healthcare sector , erlangen , germany ) . additionally , the output circuit board used an active detuning circuit across the match capacitor consisting of a handwound inductor l and a pin diode ( ma4p4002b402 ; macom , lowell , massachusetts , usa ) to provide a parallel resonant circuit at the larmor frequency when the diode is forwardbiased . thus , when the pin diode was forwardbiased ( transmit mode ) , the resonant parallel lc circuit inserted a high impedance in series with the coil loop , blocking current flow at the larmor frequency during transmit . preamplifier decoupling was achieved by first transforming the preamplifier 's input impedance to a low impedance ( shortcircuit ) across detuning trap , which turned this parallel lc circuit into a highserial impedance in the coil loop . preamplifier outputs were connected to a cable trap to suppress common mode currents and to avoid interaction with the rf transmit system . bench measurements verified the element tuning , active detuning , nearestneighbor coupling , and preamplifier decoupling for each coil element . additionally , the ratio of unloadedtoloaded quality factor ( q u / q l ) was obtained with a coil element under test placed both external to the array assembly and within the populated but detuned array . active detuning was measured with an s 21 measure between two decoupled ( 80 db ) inductive probes slightly coupled to the array element under test . nearest neighbor coupling was measured using a direct s 21 measurement between pairs of elements using coaxial cables connected directly to the preamplifier sockets of the two elements under test . the overlap between nearest neighbors was empirically optimized , while watching the s 21 measure between the two loops under test . when measuring the s 21 between an adjacent pair , all other elements of the array were detuned . preamplifier decoupling was measured as the change in the doubleprobe s 21 when the preamplifier socket was first terminated with the powered low impedance preamplifier and second with a powermatched terminator 18 . data were acquired on a 3 t clinical mri siemens scanner ( magnetom , trio a tim system , siemens ag healthcare sector , erlangen , germany ) with 40 mt / m maximum amplitude gradient strength and a maximum slew rate of 200 mt / m / ms . these measurements were compared with a commercially available 32channel wholehead coil using the same subject with identical slice prescription ( atlasbased autoalign ) . ge images were used to acquire an snr map using the following parameters : repetition time ( tr ) = 300 ms ; echo time ( te ) = 15 ms ; flip angle ( fa ) = 20 ; slice thickness = 3 mm ; number of slices = 35 ; matrix = 64 64 ; field of view ( fov ) = 192 192 mm ; and bandwidth ( bw ) = 200 hz / pixel . noise covariance information was acquired using the same pulse sequence but with no rf excitation . the snr maps were calculated using the noisecovariance weighted root sumofsquares of the individual channel images , where the weights utilize coil sensitivity maps and noise covariance information 19 , 20 . the snr data were coregistered to a t1weighted multiecho mprage 21 acquired using a wholehead coil ( tr = 2.51 s ; ti = 1.2 s ; fa = 7 ; four echoes with te = 1.64 ms , 3.5 ms , 5.36 ms , and 7.22 ms ; matrix = 192 192 176 with 1 mm isotropic voxel size ; bw = 651 hz / pixel ; r = 3 ) . a 3d surface representation was reconstructed from the memprage image using freesurfer 22 , 23 and was used to visualize the snr data on the cortical surface . the sense gfactor maps were calculated from the complex coil sensitivities and noise covariance matrix to assess noise amplification in parallel image reconstruction 24 . for gfactor calculations , an obliquecoronal slice prescription was used , similar to that applied in visual cortex fmri acquisition schemes . coil stability was evaluated on a spherical phantom using singleshot geepi time series ( fov = 200 200 mm ; tr = 1000 ms ; te = 30 ms ; fa = 90 ; bw = 2298 hz / pixel ; matrix = 64 64 ; slice thickness = 5 mm ; number of slices = 16 ; 500 measurements ) . peaktopeak variation in the signal intensity was averaged over a 15pixel square region of interest positioned in the center of the phantom after the removal of linear and quadratic trends from the time series 25 . temporal snr ( tsnr ) was measured at two resolutions1 mm and 2 mm isotropic using singleshot geepi acquisitions with grappa acceleration . for the 1mm images , acquisition parameters were tr = 250 ms ; te = 33 ms ; fa = 33 ; 3 1mm slices acquired interleaved with 0.1 mm slice gap ; fov = 128 128 mm ; matrix = 128 128 ; bw = 1086 hz / pixel ; echo spacing = 1.05 ms ; and r = 3 acceleration with fat saturation . for the 2mm images , the same parameters were used with the following exceptions : matrix = 64 64 ; 3 2mm slices acquired with a 0.2mm slice gap . during each measurement , 320 volumes were acquired from the posterior occipital cortex while subjects viewed two blocks of 10 s visual stimulation , followed by 30 s of rest . the 240 volumes corresponding to the rest period of the hemodynamic response function were used for the tsnr measurements 26 . the tsnr measurements were performed on the visual cortexoptimized coil as well as the vendorsupplied wholehead 32channel coil ; therefore , a total of four tsnr measurements were performed . to calculate tsnr , measurement volumes were first assessed for motion using afni 's 27 3dvolreg motion correction tool , but motion was negligible in all runs , therefore motion correction was not applied . the mean of all images was then divided by the standard deviation of the images voxelwise . the coil underwent a battery of tests that assessed safety for the subjects . to check whether active detuning during transmit phase was sufficient , the power needed to achieve the adjustment flip angle ( 180 ) was measured in a phantom with and without the receive coil present . the coil was also tested for heating . after switching off the sar monitor and the gradient stimulation monitor , measurements were made of the temperature increase in the coil caused by rf transmit power being absorbed by the receive circuitry or heating by induced currents from the gradient switching . the detuned coil and phantom were scanned for 15 min with a body coil b1field of 30 t applied at a 10% duty cycle and repetition time of 60 ms , an rf power level well above the sar limit . for these fmri acquisitions , a standard singleshot geepi protocol was used to acquire images at 0.75 mm isotropic resolution with the following parameters : tr = 3000 ms ; te = 31 ms ; fa = 90 ; fat saturation ; fov = 160 mm 160 m ; matrix = 214 214 ; partial fourier = 6/8 ; r = 4 ; and bw = 834 hz / pixel . the images were reconstructed with standard online siemens epi and grappa reconstruction . during the acquisition , the subject viewed a stimulus that was backprojected on a translucent screen at the back of the scanner bore and reflected onto the eyes with a mirror placed just above the head coil . the stimulus consisted of an alternating pattern of 30 s of the movie despicable me with a 30s blank screen , with the alternation occurring five times . statistical parametric maps were generated using afni 's 3ddeconvolve program , which fits a model time series consisting of the canonical hemodynamic response function convolved with the movie onsets . the exact same procedure was followed for acquiring and analyzing comparison data from the 32channel wholehead vendorsupplied coil . in order to directly compare the two datasets , the results of the analysis from the visual cortex coil were rigidly coregistered to the wholehead data . because our goal was to focus and optimize the coil for visual cortex imaging , we were able to restrict the element placement to the head posterior . the resulting openfaced topology is ideal for vision research as it allows for placement of optics ( mirrors , lenses , patches , etc . ) . . a critical component of our development was the identification and implementation of the optimal coil former shape . the coil former was modeled based on a nonlinear atlas of the international consortium for brain mapping . the atlas used included a model of the neck as well , which allowed for optimal placement of the coils around the temporal lobe . a second consequence of this design was the subject comfort afforded by a contoured surface for resting the neck and head . the comfort afforded by the head and neck contours of our coil former allowed us to eliminate the need for padding . this further reduced the space between our elements and the head , contributing to greater sensitivity of the coil . the layout of the overlapped circular coil elements was arranged by a hexagonal tiling pattern , which was printed onto the coil former together with standoffs to mount the preamplifiers and other coil electronic parts . targeting the visual cortex as a region of interest , the tile size was adjusted appropriately to meet the desired number of 32 channels ( fig . the loop diameter of 42 mm was derived from the size of the hexagon tiles , where the loop diameter is slightly larger than the diameter of the circle that inscribes the vertexes of the hexagon . all helmet parts , including its covers , were printed in polycarbonate plastic using a rapid prototyping 3d printer ( fortus 360 ; stratasys ltd . , eden prairie , minnesota , usa ) . dedicated 3 t visual cortex coil for highresolution fmri data acquisition . the coil former follows the contour of the occipital pole and cerebellum to provide tight fitting coil elements at the region ofinterest . special effort was made to create a comfortable head support to run fmri with little or no foam cushioning . the 42mm loops were constructed from tinplated , 16gauge , oxygenfree high thermal conductivity copper . each loop contained bridges bent into the wire to allow the coil conductors to cross over . each loop was symmetrically divided with two gaps , where the discrete rf components were placed [ see schematic circuit in keil et al . the discrete components were mounted on small fr4 circuit boards , manufactured with a rapid prototyping circuit router ( ttech7000 ; ttech , inc , norcross , georgia , usa ) and then soldered to the loop conductor . these small circuit boards minimized mechanical stress between the loop wires and the ceramic capacitors ( series 11 ; voltronics , danville , new jersey , usa ) . the tuning capacitor circuit board contained a variable capacitor ( gfx2700 nm ; sprague goodman , westbury , new york , usa ) to finetune the loop resonance to 123.25 mhz . the output circuitboard incorporated a capacitive voltage divider to impedancematch the element 's output to an optimized noisematched impedance , z nm , required by the preamplifier ( siemens ag , healthcare sector , erlangen , germany ) . additionally , the output circuit board used an active detuning circuit across the match capacitor consisting of a handwound inductor l and a pin diode ( ma4p4002b402 ; macom , lowell , massachusetts , usa ) to provide a parallel resonant circuit at the larmor frequency when the diode is forwardbiased . thus , when the pin diode was forwardbiased ( transmit mode ) , the resonant parallel lc circuit inserted a high impedance in series with the coil loop , blocking current flow at the larmor frequency during transmit . preamplifier decoupling was achieved by first transforming the preamplifier 's input impedance to a low impedance ( shortcircuit ) across detuning trap , which turned this parallel lc circuit into a highserial impedance in the coil loop . preamplifier outputs were connected to a cable trap to suppress common mode currents and to avoid interaction with the rf transmit system . because our goal was to focus and optimize the coil for visual cortex imaging , we were able to restrict the element placement to the head posterior . the resulting openfaced topology is ideal for vision research as it allows for placement of optics ( mirrors , lenses , patches , etc . ) . . a critical component of our development was the identification and implementation of the optimal coil former shape . the coil former was modeled based on a nonlinear atlas of the international consortium for brain mapping . the atlas used included a model of the neck as well , which allowed for optimal placement of the coils around the temporal lobe . a second consequence of this design was the subject comfort afforded by a contoured surface for resting the neck and head . the comfort afforded by the head and neck contours of our coil former allowed us to eliminate the need for padding . this further reduced the space between our elements and the head , contributing to greater sensitivity of the coil . the layout of the overlapped circular coil elements was arranged by a hexagonal tiling pattern , which was printed onto the coil former together with standoffs to mount the preamplifiers and other coil electronic parts . targeting the visual cortex as a region of interest , the tile size was adjusted appropriately to meet the desired number of 32 channels ( fig . the loop diameter of 42 mm was derived from the size of the hexagon tiles , where the loop diameter is slightly larger than the diameter of the circle that inscribes the vertexes of the hexagon . all helmet parts , including its covers , were printed in polycarbonate plastic using a rapid prototyping 3d printer ( fortus 360 ; stratasys ltd . , eden prairie , minnesota , usa ) . dedicated 3 t visual cortex coil for highresolution fmri data acquisition . the coil former follows the contour of the occipital pole and cerebellum to provide tight fitting coil elements at the region ofinterest . special effort was made to create a comfortable head support to run fmri with little or no foam cushioning . the 42mm loops were constructed from tinplated , 16gauge , oxygenfree high thermal conductivity copper . each loop contained bridges bent into the wire to allow the coil conductors to cross over . each loop was symmetrically divided with two gaps , where the discrete rf components were placed [ see schematic circuit in keil et al . the discrete components were mounted on small fr4 circuit boards , manufactured with a rapid prototyping circuit router ( ttech7000 ; ttech , inc , norcross , georgia , usa ) and then soldered to the loop conductor . these small circuit boards minimized mechanical stress between the loop wires and the ceramic capacitors ( series 11 ; voltronics , danville , new jersey , usa ) . the tuning capacitor circuit board contained a variable capacitor ( gfx2700 nm ; sprague goodman , westbury , new york , usa ) to finetune the loop resonance to 123.25 mhz . the output circuitboard incorporated a capacitive voltage divider to impedancematch the element 's output to an optimized noisematched impedance , z nm , required by the preamplifier ( siemens ag , healthcare sector , erlangen , germany ) . additionally , the output circuit board used an active detuning circuit across the match capacitor consisting of a handwound inductor l and a pin diode ( ma4p4002b402 ; macom , lowell , massachusetts , usa ) to provide a parallel resonant circuit at the larmor frequency when the diode is forwardbiased . thus , when the pin diode was forwardbiased ( transmit mode ) , the resonant parallel lc circuit inserted a high impedance in series with the coil loop , blocking current flow at the larmor frequency during transmit . preamplifier decoupling was achieved by first transforming the preamplifier 's input impedance to a low impedance ( shortcircuit ) across detuning trap , which turned this parallel lc circuit into a highserial impedance in the coil loop . preamplifier outputs were connected to a cable trap to suppress common mode currents and to avoid interaction with the rf transmit system . bench measurements verified the element tuning , active detuning , nearestneighbor coupling , and preamplifier decoupling for each coil element . additionally , the ratio of unloadedtoloaded quality factor ( q u / q l ) was obtained with a coil element under test placed both external to the array assembly and within the populated but detuned array . active detuning was measured with an s 21 measure between two decoupled ( 80 db ) inductive probes slightly coupled to the array element under test . nearest neighbor coupling was measured using a direct s 21 measurement between pairs of elements using coaxial cables connected directly to the preamplifier sockets of the two elements under test . the overlap between nearest neighbors was empirically optimized , while watching the s 21 measure between the two loops under test . when measuring the s 21 between an adjacent pair , all other elements of the array were detuned . preamplifier decoupling was measured as the change in the doubleprobe s 21 when the preamplifier socket was first terminated with the powered low impedance preamplifier and second with a powermatched terminator 18 . data were acquired on a 3 t clinical mri siemens scanner ( magnetom , trio a tim system , siemens ag healthcare sector , erlangen , germany ) with 40 mt / m maximum amplitude gradient strength and a maximum slew rate of 200 mt / m / ms . these measurements were compared with a commercially available 32channel wholehead coil using the same subject with identical slice prescription ( atlasbased autoalign ) . ge images were used to acquire an snr map using the following parameters : repetition time ( tr ) = 300 ms ; echo time ( te ) = 15 ms ; flip angle ( fa ) = 20 ; slice thickness = 3 mm ; number of slices = 35 ; matrix = 64 64 ; field of view ( fov ) = 192 192 mm ; and bandwidth ( bw ) = 200 hz / pixel . noise covariance information was acquired using the same pulse sequence but with no rf excitation . the snr maps were calculated using the noisecovariance weighted root sumofsquares of the individual channel images , where the weights utilize coil sensitivity maps and noise covariance information 19 , 20 . acquired using a wholehead coil ( tr = 2.51 s ; ti = 1.2 s ; fa = 7 ; four echoes with te = 1.64 ms , 3.5 ms , 5.36 ms , and 7.22 ms ; matrix = 192 192 176 with 1 mm isotropic voxel size ; bw = 651 hz / pixel ; r = 3 ) . a 3d surface representation was reconstructed from the memprage image using freesurfer 22 , 23 and was used to visualize the snr data on the cortical surface . the sense gfactor maps were calculated from the complex coil sensitivities and noise covariance matrix to assess noise amplification in parallel image reconstruction 24 . for gfactor calculations , an obliquecoronal slice prescription was used , similar to that applied in visual cortex fmri acquisition schemes . coil stability was evaluated on a spherical phantom using singleshot geepi time series ( fov = 200 200 mm ; tr = 1000 ms ; te = 30 ms ; fa = 90 ; bw = 2298 hz / pixel ; matrix = 64 64 ; slice thickness = 5 mm ; number of slices = 16 ; 500 measurements ) . peaktopeak variation in the signal intensity was averaged over a 15pixel square region of interest positioned in the center of the phantom after the removal of linear and quadratic trends from the time series 25 . temporal snr ( tsnr ) was measured at two resolutions1 mm and 2 mm isotropic using singleshot geepi acquisitions with grappa acceleration . for the 1mm images , acquisition parameters were tr = 250 ms ; te = 33 ms ; fa = 33 ; 3 1mm slices acquired interleaved with 0.1 mm slice gap ; fov = 128 128 mm ; matrix = 128 128 ; bw = 1086 hz / pixel ; echo spacing = 1.05 ms ; and r = 3 acceleration with fat saturation . for the 2mm images , the same parameters were used with the following exceptions : matrix = 64 64 ; 3 2mm slices acquired with a 0.2mm slice gap . during each measurement , 320 volumes were acquired from the posterior occipital cortex while subjects viewed two blocks of 10 s visual stimulation , followed by 30 s of rest . the 240 volumes corresponding to the rest period of the hemodynamic response function were used for the tsnr measurements 26 . the tsnr measurements were performed on the visual cortexoptimized coil as well as the vendorsupplied wholehead 32channel coil ; therefore , a total of four tsnr measurements were performed . to calculate tsnr , measurement volumes were first assessed for motion using afni 's 27 3dvolreg motion correction tool , but motion was negligible in all runs , therefore motion correction was not applied . the mean of all images was then divided by the standard deviation of the images voxelwise . the coil underwent a battery of tests that assessed safety for the subjects . to check whether active detuning during transmit phase was sufficient , the power needed to achieve the adjustment flip angle ( 180 ) was measured in a phantom with and without the receive coil present . the coil was also tested for heating . after switching off the sar monitor and the gradient stimulation monitor , measurements were made of the temperature increase in the coil caused by rf transmit power being absorbed by the receive circuitry or heating by induced currents from the gradient switching . the detuned coil and phantom were scanned for 15 min with a body coil b1field of 30 t applied at a 10% duty cycle and repetition time of 60 ms , an rf power level well above the sar limit . submillimeter functional mri at 3 t was performed successfully using the visual cortex coil . for these fmri acquisitions , a standard singleshot geepi protocol was used to acquire images at 0.75 mm isotropic resolution with the following parameters : tr = 3000 ms ; te = 31 ms ; fa = 90 ; fat saturation ; fov = 160 mm 160 m ; matrix = 214 214 ; partial fourier = 6/8 ; r = 4 ; and bw = 834 hz / pixel . the images were reconstructed with standard online siemens epi and grappa reconstruction . during the acquisition , the subject viewed a stimulus that was backprojected on a translucent screen at the back of the scanner bore and reflected onto the eyes with a mirror placed just above the head coil . the stimulus consisted of an alternating pattern of 30 s of the movie despicable me with a 30s blank screen , with the alternation occurring five times . statistical parametric maps were generated using afni 's 3ddeconvolve program , which fits a model time series consisting of the canonical hemodynamic response function convolved with the movie onsets . the exact same procedure was followed for acquiring and analyzing comparison data from the 32channel wholehead vendorsupplied coil . in order to directly compare the two datasets , the results of the analysis from the visual cortex coil were rigidly coregistered to the wholehead data . the 42mmdiameter coil elements showed a q u / q lratio of 273/114 = 2.3 and 258/123 = 2.1 , for a single isolated coil loop and a loop surrounded by its six nonresonant neighboring elements , respectively . the q u / q l ratio showed that the sample and component losses contributed almost equally to the image noise for these small diameter loops with limited tissue volume under each element . in addition , upon sample loading , a frequency drop of 0.3 mhz was measured with an isolated coil element . the temperature increase in the coil caused by rf transmit power being absorbed by the receive circuitry or heating by induced currents from the gradient switching was < 2c . stability test indicated a peaktopeak variation of 0.2% over a 15 15 pixel roi for 500 time points for 3 3 5 mm resolution epi ( after detrending ) . bench tests showed a range of decoupling between nearest neighbor elements from 12 db to 21 db with an average of 14 db , which is improved by additional reduction of 19 db via preamplifier decoupling . furthermore , active pin diode detuning resulted in 40 db isolation between tuned ( pin diode forwardbiased ) and detuned states ( pin diode reversebiased ) of the array elements . figure 3 shows volume and surfacebased maps of the obtained visual cortex snr of the constructed coil and a commercial 32channel whole brain array coil . the representative sagittal slice snr map comparison was measured with the same subject . in the target region , the dedicated visual cortex coil shows a twofold snr improvement compared with the wholehead 32channel coil . the surfacebased snr map depicts the snr gain of the visual cortex coil over the wholehead coil . volume and surfacebased visualization of in vivo snr comparison of the visual cortex coil compared with a vendorsupplied 32channel wholehead coil . ( c ) snr gain of the visual cortex coil as a ratio of the whole head coil snr . the optimizations employed in the visual cortex coil resulted in a twofold snr improvement near the coils , and approximately 50% improvement elsewhere in the visual cortex . figure 4 shows the comparison of inverse local gfactor maps in an obliquecoronal plane ( as typically used for visual cortex fmri ) for onedimensional accelerations derived from coil sensitivity profiles and noise correlations from the in vivo measurements . the dedicated 32channel visual cortex coil produces overall lower gfactors , roughly providing a 1.5 additional unit of acceleration for a given noise amplification factor , when compared with a 32channel head coil . for example , for r = 3 the constructed coil showed an average of 28% less noise amplification . the combination of reduced gfactor and improved occipital cortical snr translates to improved image quality in visual fmri studies . coronallike maps of 1/gfactors obtained from the dedicated 32channel visual cortex coil and the 32channel head coil . the visual cortex coil performs considerably better than the wholehead coil in its target region , allowing for between 12 higher units of acceleration than the wholehead coil . figure 5 shows the mean and maximum tsnr estimates for 1 mm and 2 mm isotropic resolution geepi acquisitions made with the vendorsupplied 32channel coil and the visual cortex coil , as well as representative tsnr maps for each of those measurements . temporal snr in the posterior occipital cortex was approximately twofold higher on average with the visual cortex coil than the vendorsupplied wholehead coil . approximately 2.5fold greater in this cortical area with the optimized coil than with the standard 32channel wholehead coil . the tsnr gain from the wholehead to the visual cortex coil was higher for the 1mm acquisitions , likely due to decreased partial volume effects at the higher resolution . tsnr comparison at 2 mm and 1 mm between the visual cortex coil and the commercial 32channel wholehead coil . the visual cortex coil generally exhibited greater than a twofold increase in tsnr when comparing it with the mean or the maximum tsnr of the same region imaged with the wholehead coil . bottom row : temporal snr maps for one slice at 1 mm and 2 mm in the posterior visual cortex imaged with the wholehead coil versus the visual cortex coil along with relevant color scales . submillimeter fmri at 0.75 mm isotropic resolution yielded excellent image quality ( fig . 6 , top row ) and was usable for fmri measurements . without spatial smoothing , activityrelated signal changes were observed in the posterior occipital cortex in response to the 30 s on , 30 s off movie stimulus , suggesting that even with such small voxels , fmri responses can be robustly measured with appropriate hardware at 3 t ( figure 6 , bottom row ) . in contrast to the robust fmri signal change that was measureable with the visual cortex coil , the same paradigm resulted in negligible pattern of activity when measured using the wholehead coil ( fig . 6 , bottom row ) . images from the commercial 32channel wholehead coil and the visual cortex coil measured at 0.75 mm and 1 mm , as well as bold fmri at 0.75 mm isotropic resolution on both coils . although fmri activity measured with the visual cortex coil at 0.75 mm was robust , a similar pattern was not observed for the wholehead coil . in this study , we constructed and characterized a shapeoptimized , visual cortex targeted 32channel receiver array coil . through weighted design choices that sacrifice flexible imaging planes for higher snr and better acceleration , dense packing of small loops covering the snr gains were sufficient for submillimeter fmri at 3 t , opening the way for new studies on the microstructure of cortical visual function . given that previous 64 and 96channel studies with dense arrays yielded only between 40% and 60% cortical snr gain , respectively , over a 32channel wholehead , we had not anticipated a doubling of snr with the visual cortex coil . the previous coils 14 , 15 utilized loops that were of similar material and electronics , although our 42mmdiameter loops are slightly smaller compared with the 96channel wholehead coil 15 . however , our previous wholehead coils did not specifically optimize the shape of the housing to the extent carried out here . therefore , we suggest that shape optimization can be at least as important as electronic considerations in boosting snr in phasedarray coil design , particularly when one region of the brain is targeted at the cost of the flexibility of wholehead imaging . the 32channel visual cortex coil was designed for stability in both highly accelerated and highresolution functional imaging on a clinical 3 t scanner for robust daily use . the array coil performance was evaluated via 1 ) benchlevel measurements such as q u / q lratios , tuneddetuned isolation , and neighbor coupling ; 2 ) systemlevel validations , which included component heating , transmit field interactions , and stability measurements ; and 3 ) in vivo brain performance tests , which were performed by pixelwise snr maps , gfactor maps , noise correlation , tsnr , and submillimeter functional imaging . a number of technical issues arise in the implementation of large channelcount arrays employing relatively small element sizes ( such as the 42mmdiameter elements used here ) . in particular , the interelement decoupling becomes more difficult and timeconsuming as the element density increases . in addition , maintaining a sufficient q u / q l ratio becomes problematic . for example , while a wholehead 32channel adult coil with a loop diameter of 90 mm can be constructed out of flexible circuit material , array coils with smaller sized elements show significant eddy current losses in the flat circuit board conductors of the neighboring elements , leading to a lower q u / q l ratio and diminished snr 15 , 28 . spatially sparse wire conductors and carefully chosen location of the preamplifiers and their motherboards with at least 30 mm from the loop elements reduces the losses in these copper components . also , the ability to mechanically optimize the overlap between two neighboring loops by bending the wire facilitated the element decoupling procedure . despite these optimizations , the unloaded q of a given loop was measurably diminished when the loop under test was placed in an array configuration , suggesting that losses within the conductors of neighboring elements were still present . nonetheless , the q u / q l = 2.1 for our coil suggests that electronic noise and the sample noise is equally distributed . a frequency drop of 0.3 mhz upon sample loading , measured with an isolated coil element ( no neighbors present ) of the 32channel coil , indicates some imbalances in how the sample and coil interact through electric and magnetic fields . this source of loss could be compensated with more equally distributed series tuning capacitors to further balance the electrical field around the loop . when loop sizes are small , additional series capacitors increase the effective series loop resistance 28 , which in turn reduces snr . the practical implementation of higher capacitor counts in highdensity array coils is also seriously challenging . to image the function of small brain structures accurately , both highresolution scans and high snr values the boldfmri contrasttonoise ratio can be expressed as the product of the tsnr and the fractional change in relaxivity , r2 * , during activation ( r2*/r2 * ) 29 . because the latter is determined mainly by biology the latter is both expensive and introduces its own challenges , while hardware optimization can be economical and effective , albeit restricted to a region of interest , in this case , the visual cortex . for highresolution accelerated scans , this means optimizing the intrinsic detection sensitivity ( the effective b 1 of the array coil ) , the gfactor of the accelerated image while maintaining temporal stability . for example , grappa kernels are trained on multishot data to match the echo spacing of the accelerated data , and multishot sequences are intrinsically more sensitive to temporal instabilities than singleshot sequences . this means that temporal instabilities inadvertently reduce tsnr both directly by modulating the singleshot data and indirectly by increasing the gfactor . therefore , highresolution fmri acquisitions using grappa demand both maximal stability and sufficient image encoding capabilities to allow for detection of small r2*/r2*. the developed coil provides both a high time course stability of 0.2% peaktopeak and overall low noise amplification when using fmrirelevant acceleration factors ( r = 3 , r = 4 ) . furthermore , the high snr of the multiple small elements can be invested into submillimeter resolution , which brings the tsnr into a thermal noise dominated regimen by reducing the physiological noise , the amplitude of which scales with the mr signal strength in a given voxel 30 . therefore , acquisitions at higher resolutions have the additive advantage of reducing the associated time series artifacts caused by unwanted physiological noise contributions ( cardiac and respiratory fluctuations ) resulting in increased sensitivity . in addition to increased localized activations and the ability to resolve the visual cortex in its smallest modules , higherresolution fmri acquisitions allow for less throughplane signal dephasing , limited partial volume effects , and improved biological point spread function of the bold effect . this isolation process and the achieved high spatial specificity ultimately allow us a better understanding of intrinsic properties of functional networks in both stimulusrelated and spontaneous neural activities . by optimizing the shape of the mri coil to optimally fit the head , and by guiding the placement of smalldiameter elements with a surfacebased 3d model of the brain in the skull , we were able to realize substantial gains in snr and performance for imaging of the human visual cortex . the coil performance was adequate for functional imaging in the submillimeter range using a conventional grappaaccelerated geepi sequence .

purposefunctional neuroimaging of small cortical patches such as columns is essential for testing computational models of vision , but imaging from cortical columns at conventional 3 t fields is exceedingly difficult . by targeting the visual cortex exclusively , we tested whether combined optimization of shape , coil placement , and electronics would yield the necessary gains in signaltonoise ratio ( snr ) for submillimeter visual cortex functional mri ( fmri).methodwe optimized the shape of the housing to a populationaveraged atlas . the shape was comfortable without cushions and resulted in the maximally proximal placement of the coil elements . by using small wire loops with the least number of solder joints , we were able to maximize the q factor of the individual elements . finally , by planning the placement of the coils using the brain atlas , we were able to target the arrangement of the coil elements to the extent of the visual cortex.resultsthe combined optimizations led to as much as twofold snr gain compared with a wholehead 32channel coil . this gain was reflected in temporal snr as well and enabled fmri mapping at 0.75 mm resolutions using a conventional grappaaccelerated gradient echo echo planar imaging.conclusionintegrated optimization of shape , electronics , and element placement can lead to large gains in snr and empower submillimeter fmri at 3 t . magn reson med 76:321328 , 2016 . 2015 wiley periodicals , inc .

in recent years , noncommutative geometry has received a considerable interest to get insight into many conceptual issues in the quantum domain of high energy physics . it is argued that at sufficiently high energy scales the target - space structure coordinates may become noncommuting operators on a d - brane@xcite . consequently , the noncommutativity of the space - time can be encoded in a commutator @xmath1 = i \theta^{\mu \nu}$ ] , where , @xmath2 is an anti - symmetric matrix of dimension @xmath3^{2}$ ] which determines the fundamental cell discretization of the space - time . it is similar to the way the plank s constant @xmath4 discretizes phase - space@xcite . the noncommutative approach provides the construction of a black hole with a minimum scale @xmath5 , known as noncommutative black hole@xcite , whose commutative limit is the schwarzschild metric . it is note worthy that noncommutative geometry is an intrinsic property of the space - time and it does not depend on the curvature of space - time . a large number of studies inspired by noncommutative geometry are available in the literature . et al_@xcite have discussed thermodynamic behaviour and evaporation processes involved in a noncommutative black hole . in their investigations , they have considered a noncommutative @xmath0-dimensional black hole whose commutative limit is the non - rotating ba@xmath6ados , teitelboim and zanelli@xcite ( henceforth btz ) black hole . nozari and mehdipour@xcite have investigated the hawking radiation from a noncommutative black hole . et al_@xcite , in the context of galactic rotation curves , have shown that a noncommutative geometrical background is sufficient for the existence of a stable circular orbit and one need not consider dark matter in this formalism . in a separate paper , rahaman _ et al_@xcite have shown that wormhole solutions exist up to @xmath7-dimensional space - times ; however , they do not exist in dimensions @xmath8 . et al_@xcite have investigated the thermodynamic properties ( hawking temperature , entropy and area law , in particular ) of a schwarzschild black hole in noncommutative space - times . by invoking a graphical analysis , the authors have shown the non - trivial behavior of the noncommutative schwarzschild metric at different length scales . it has been shown that in the limit of large @xmath9 ( @xmath10 ) outside the horizon , the metric behaves like the standard schwarzschild solution , whereas in the limit of small @xmath9 ( @xmath11 ) inside the horizon , the space - time is de - sitter type with a constant positive curvature . it is to be stressed here that gravitational analyses in ( @xmath17)-dimensions have become extremely fascinating with the discovery of the black hole solution by ba@xmath6ados , teitelboim and zanelli@xcite . the btz metric describes the exterior gravitational field of a circularly symmetric einstein - maxwell system in the presence of a negative cosmological constant and is characterized by its mass , angular momentum and charge . in standard ( @xmath18)-dimensions , einstein - maxwell systems for static spherically symmetric charged distributions of matter have investigated by many ( see for example , tikekar and singh@xcite , sharma _ et al_@xcite , thirukkanesh and maharaj@xcite and also references therein ) . analytic models of static charged fluid spheres has been reviewed by ivanov@xcite . in ( @xmath17)-dimensions , rahaman _ et al_@xcite have developed a model for a charged gravastar in an anti - de sitter background space - time . corresponding to the static btz exterior , cataldo _ et al_@xcite have investigated the properties of a circularly symmetric static charged fluid distribution . larra@xmath6aga and tejeiro@xcite have obtained a charged black hole solution in @xmath0-d anti - de sitter space inspired by noncommutative geometry where a gaussian distribution of charge has been considered . in an earlier work , _ et al_@xcite have studied btz black holes inspired by noncommutative geometry . the current investigation is an extension of ref . @xcite where we have incorporated a distribution of charge into the system . the resultant charged black hole appears to have two horizons which , however , get reduced to a single horizon in the extreme case . thermodynamic properties such as hawking temperature , entropy and heat capacity of the charged black hole have been analyzed . effective potential and behaviour of test particles around the black hole have also been outlined . we write the line element for the interior space - time of a static circularly symmetric charged distribution of matter in ( @xmath17)-dimensions in the form @xmath19 the energy - momentum tensor corresponding to the charged fluid distribution is assumed to be @xmath20 where , @xmath16 is the energy - density , @xmath21 is the radial pressure and @xmath22 is the tangential pressure . in ( [ eq2 ] ) , @xmath23 is the velocity of the fluid and @xmath24 is a radial unit vector satisfying the relation @xmath25 . the electromagnetic field tensor is governed by the maxwell s equations @xmath26 where , @xmath27 is the current @xmath0-vector defined as @xmath28 in ( [ eq4 ] ) , @xmath29 is the proper charged density of the distribution . the electromagnetic field tensor may be expressed as @xmath30 where , @xmath31 is the electric field intensity . in the presence of a negative cosmological constant ( @xmath32 ) , the einstein - maxwell equations @xmath33 for the metric ( [ eq1 ] ) yield the following set of four independent equations ( in geometrized units @xmath34 ) @xmath35 @xmath36 @xmath37 where a ` prime ' denotes differentiation with respect to the radial parameter @xmath9 . ( [ eq10 ] ) can equivalently be expressed as @xmath38 where @xmath39 is the total charge contained within a sphere of radius @xmath9 . we assume that the volume charge density has the form @xmath40 where @xmath41 is an arbitrary constant and @xmath42 is the central charged density . * though it is true that one is free to choose an infinite number of possible ansatz , the main motivation for a particular choice in our model was to generate solutions which could be considered as physically meaningful . secondly , solutions obtained earlier for the neutral case can be easily regained from our solution for the specified ansatz . this enables one to investigate the effects of electromagnetic field on the system explicitly . the choice ( 12 ) of the charge density is only dictated by the mathematical convenience and has no physical justification since it gives the energy divergent at infinity . however , this particular choice is different from the gaussian distribution of charge assumed in ref . @xcite . * we will solutions obtained earlier for the neutral case can be easily regained from our solution for the specified ansatz . consequently , from eq . ( [ eq11 ] ) we get @xmath43 further , we consider the maximally localized source of energy of the static spherically symmetric charge distribution as a gaussian distribution with minimal width @xmath5 expressed as@xcite , @xmath44 where @xmath45 is the total mass of the source diffused throughout a region of linear dimension @xmath5 . substituting ( [ eq13 ] ) and ( [ eq15 ] ) in ( [ eq7 ] ) , we obtain @xmath46 which , on integration , yields @xmath47 where , @xmath48 is a constant of integration . in ref . @xcite it has been shown that the constant of integration @xmath48 plays the role of the mass of the black hole , i.e. , @xmath49 . in our construction , if we set @xmath50 and consider the limit @xmath51 , then it follows that @xmath49 . accordingly , we rewrite eq . ( [ eq17 ] ) as @xmath52 note that the vacuum einstein field equations in ( @xmath17)-dimensional space - time in the presence of a negative cosmological constant @xmath53 admit a black hole solution known as btz@xcite solution for which we have @xmath54 . to retain the structure of btz black hole , we must have @xmath55 . from eqs . ( [ eq7])-([eq8 ] ) , it then follows that @xmath56 which is the ` @xmath16 vacuum ' eos in reference to ` zero - point energy of quantum fluctuations'@xcite . combining eqs . ( [ eq7])-([eq9 ] ) and ( [ eq19 ] ) , we obtain @xmath57 from eq . ( [ eq16 ] ) , we get @xmath58 combining eqs . ( [ eq20 ] ) and ( [ eq21 ] ) , we obtain @xmath59 we , thus , have a noncommutative geometry inspired analytic model of a @xmath0-d charged black hole . in this construction , the spacetime near the origin behaves as @xmath60 \nonumber\\ -\frac{1}{n+2}\left(\frac{4\pi \sigma_0}{n+2}\right)^{2}r^{2n+4}-\lambda r^{2}.\label{eq23}\end{aligned}\ ] ] note that for @xmath61 , by adjusting the parameters suitably , one can regain the space - time for the ( @xmath17)-dimensional static charged distribution @xmath62 r^{2 } \nonumber\\ + \left [ \frac{2m}{32 \theta^2 } - 2\pi^2 \sigma_0 ^ 2\right ] r^{4},\label{eq24}\end{aligned}\ ] ] obtained earlier by liang and liu@xcite . in the following sections , we shall analyze some features of our charged btz black hole . the condition for the formation of event horizon is given by @xmath63 , which implies @xmath64 where @xmath65 is the horizon distance . though a closed - form solution for @xmath65 can not be obtained from the above equation , one can express the mass parameter in terms of @xmath65 as @xmath66 in fig . [ fig1 ] , we have shown the existence of horizons and their corresponding radii by identifying the intersections of @xmath67 with @xmath68 . we note that , for a given value of @xmath69 , there exists a minimal mass @xmath70 below which no black hole exists though two distinct horizons exist for @xmath71 . if mass of the black hole increases , the distance between the two horizons increases . the two horizons coincide at a minimal mass @xmath72 . in our illustrative example , @xmath73 is the distance where the two horizons coincide , i.e. , @xmath74 is the radius of the extremal black hole . the results may be summarized as follows : * existence of two horizons for @xmath75 ; * one horizon corresponding to the extremal black hole with @xmath76 ; * no horizon for @xmath77 . from eq . ( [ eq26 ] ) , it is interesting to note that the lower limit mass @xmath78 increases when charge is incorporated into the system . moreover , the distance of the outer event horizon increases in the presence of electromagnetic field as shown in fig . [ fig2 ] . plotted against @xmath68 . we have assumed @xmath79 ( dotted curve ) , @xmath80 ( solid curve ) , @xmath81 ( dashed curve ) and @xmath82(dot - dashed curve ) . ] plotted against @xmath68 for two different cases : ( 1 ) @xmath83 ( dotted curve ) and ( 2 ) @xmath84 ( solid curve ) . ] in fig . [ fig3]-[fig4 ] , we have shown behaviour of the density parameter ( @xmath16)/radial pressure ( @xmath85 ) and tangential pressure ( @xmath86 ) , respectively , between the inner and outer horizons and outside the outer horizon for different choices of the mass parameter . variation of mass @xmath87 with respect to the horizon radius @xmath88 has been shown in fig . we note a decrease in mass @xmath87 within the horizon distance @xmath88 when charge is incorporated into system . this has been shown in fig . [ fig6 ] . plotted against @xmath68 . we have assumed @xmath89 ( solid curve ) , @xmath81 ( dashed curve ) and @xmath82(dot - dashed curve ) . ] plotted against @xmath68 . we have assumed @xmath89 ( solid curve ) , @xmath81 ( dashed curve ) and @xmath82(dot - dashed curve ) . ] with respect to the horizon radius @xmath88 . ] with respect to the horizon radius @xmath88 for ( 1 ) @xmath90 ( dotted curve ) and ( 2 ) @xmath84 ( solid curve ) . ] the hawking temperature @xmath91 in our model turns out to be @xmath92.\label{eq28}\ ] ] the surface gravity @xmath93 takes the form @xmath94,\label{eq30}\ ] ] and the bakenstein - hawking entropy can be obtained from the equation @xmath95 in fig . [ fig7 ] , we have shown variation of the hawking temperature @xmath96 with respect to the radial distance @xmath68 . interestingly , the hawking temperature @xmath96 decreases with the inclusion of the charge as shown in fig . [ fig8 ] . plotted against @xmath68 . we have assumed @xmath89 ( solid curve ) , @xmath81 ( dashed curve ) and @xmath82(dot - dashed curve ) . ] for ( 1 ) @xmath90 ( dotted curve ) and ( 2 ) @xmath84 ( solid curve ) . ] the heat capacity of the charged btz black hole can be obtained from the relation @xmath97 for stability of the black hole , @xmath98 has to be positive@xcite . in fig . [ fig9 ] , the nature of the heat capacity in our model has been shown . we note that @xmath98 vanishes at the extremal event horizon @xmath74 . since @xmath98 is negative in the region @xmath99 , it is of no physical interest . however , for @xmath100 , @xmath98 is positive which indicates that the noncommutative geometry inspired charged btz black hole is stable in this region . we notice an appreciable change in the heat capacity due to the inclusion of charge as shown in fig . [ fig10 ] . plotted against @xmath88 . ] for ( 1 ) @xmath90 ( dotted curve ) and ( 2 ) @xmath84 ( solid curve ) . ] the geodesics equation @xmath101 in our construction yields the following results : @xmath102 where , @xmath103 the constants @xmath104 and @xmath105 represent the energy per unit mass and angular momentum , respectively . in eqs . ( [ eq33])-([eq35 ] ) , @xmath106 is the affine parameter and @xmath107 is the lagrangian having values @xmath108 and @xmath109 for massless and massive particles , respectively . from eq . ( [ eq33 ] ) , we have @xmath110.\label{eq36}\ ] ] combining eqs . ( [ eq35 ] ) and ( [ eq36 ] ) , we get @xmath111.\label{eq37}\ ] ] comparing eq . ( [ eq36 ] ) with @xmath112 we obtain the effective potential in the form @xmath113.\label{eq38}\ ] ] for a massless particle , i.e. , photon with @xmath114 and @xmath115 , we have @xmath116^{2},\label{eq39}\ ] ] which in integral form can be expressed as @xmath117 eq . ( [ eq40 ] ) is not integrable , however , one can obtain the values of @xmath118 for different choices of @xmath119 by numerical procedures . this has been shown in table@xmath120 and a graphical representation of it is given in fig . [ fig11 ] . @|c|c|@ @xmath121 & @xmath122 + 10 & 0 + 10.5 & 2.3753 + 11 & 3.5934 + 11.5 & 4.4077 + 12 & 5.01449 + 12.5 & 5.4950 + 13 & 5.8907 + is plotted against @xmath68 . ] the effective potential of the system is obtained as @xmath123,\label{eq41}\end{aligned}\ ] ] which for @xmath115 reduces to @xmath124 the nature of @xmath125 for massless particles has been shown in fig . [ fig12 ] . for massless particles . here , @xmath80 ( solid curve ) , @xmath81 ( dashed curve ) and @xmath82 ( dot - dashed curve ) . ] for massive particles with @xmath126 and @xmath115 , we have @xmath127 which in integral form can be written as @xmath128 for a time - like particle with @xmath129 , the effective potential @xmath125 gets the form @xmath130 the nature of effective potential for massive particles has been shown in fig . [ fig13 ] . the shape of the effective potential indicates the possibility of stable circular orbits for massive particles around the black hole . for massive particles . here , @xmath80 ( solid curve ) , @xmath81 ( dashed curve ) and @xmath82 ( dot - dashed curve ) . ] let us now analyze the motion of a test particle around noncommutative charged black hole using hamilton - jacobi(h - j ) approach . let @xmath131 and @xmath132 denote the respective mass and charge of the test particle . the hamilton - jacobi equation for the test particle has the standard form @xmath133 where , @xmath134 is the background space and @xmath135 is the hamilton s characteristic function . the gauge potential @xmath136 is given by @xmath137 where @xmath138 is the total charge of the black hole . for the background space - time ( [ eq1 ] ) , the h - j equation gets the form @xmath139 to solve the above partial differential equation , we use the method of separation of variables and choose the h - j function @xmath140 as @xmath141 where , @xmath142 is the energy and @xmath105 is the angular momentum of the particle . the radial velocity of the particle is then obtained as @xmath143 now , the turning points of the trajectory are determined from the requirement @xmath144 , which yields @xmath145 consequently , the potential curve can be obtained from the relation @xmath146 for a stationary system , @xmath147 must have an extremal value , i.e. , @xmath148 which implies @xmath149 in static equilibrium ( @xmath150 ) , from eq . ( [ eq50 ] ) , the value of @xmath9 at which potential curve will be an extremal can be obtained from the requirement @xmath151^{\frac{1}{2}}+\frac{mr}{2\theta}e^{-\frac{r^{2}}{4\theta } } + r^{2n+3}\left(\frac{4\pi \sigma_0}{n+2 } \right)^{2}+r\lambda = 0.\label{eq51}\ ] ] a graphical representation of @xmath152 , as shown in fig . [ fig14 ] , indicates that there does not exist any @xmath9 for which @xmath153 . this implies that the test particle can not be trapped by the black hole . in other words , the black exerts no gravitation force on the test particle in static equilibrium situation . is plotted against @xmath68 . ] for a text particle in non - static equilibrium ( @xmath129 ) , we consider two possibilities : in this case , the value of @xmath9 at which potential curve will be an extremal can be obtained from the requirement @xmath155-\frac{p^{2}}{m^{2}r^{3 } } \left [ -m+2 m e^{-\frac{r^{2}}{4\theta}}-\frac{1}{n+2}\left(\frac{4\pi \sigma_0}{n+2}\right)^{2}r^{2n+4}-\lambda r^{2 } \right ] = 0.\label{eq52}\ ] ] in fig . [ fig15 ] , we note that @xmath156 at some finite value of @xmath9 . therefore , the particle can be trapped by the black hole . in other words , the black hole exerts gravitation force on the uncharged test particle in non - static equilibrium . is plotted against @xmath68 . ] for a charged particle , the value of @xmath9 at which potential curve will be an extremal can be obtained from the requirement @xmath158^{\frac{1}{2}}\nonumber\\ + \left(1+\frac{p^{2}}{r^{2}m^{2}}\right)\left[\frac{mr}{2\theta}e^{-\frac{r^{2}}{4\theta}}+r^{2n+3}\left(\frac{4\pi \sigma_0}{n+2 } \right)^{2}+r\lambda\right ] -\frac{p^{2}}{m^{2}r^{3}}\left[-m+2 m e^{-\frac{r^{2}}{4\theta}}-\frac{1}{n+2}\left(\frac{4\pi \sigma_0}{n+2}\right)^{2}r^{2n+4}-\lambda r^{2 } \right ] = 0.\label{eq53}\end{aligned}\ ] ] fig . [ fig16 ] shows that @xmath159 for any finite value of @xmath9 . this implies that the black exerts no gravitation force on the charged test particle in non - static equilibrium . the results clearly show that a non - static charged test particle behaves differently from its neutral counterpart in the gravitational field of a charged black hole . the motion of a neutral particle is solely governed by the gravitational field of the black hole whereas the motion of a charged particle in the gravitational field of a charged black hole also experiences electromagnetic force . therefore , while a neutral particle moves along the geodesic and gets trapped , a charged test particle in motion may not be trapped by the black hole . is plotted against @xmath68 . ] in this work , we have constructed a charged btz - like black hole solution by adopting the formalism of noncommutative geometry . the uncharged limit of this solution reported in ref . @xcite can be regained simply by putting @xmath160 . the noncommutative effects on the physical quantities are found to be similar to the properties discussed in ref . @xcite . to investigate the impact of electromagnetic field we have considered two cases ( @xmath161 and @xmath162 ) and compared the results graphically . our results show that the limiting mass @xmath78 below which no black hole can exist depends on its associated charge . in fact , the value of the limiting mass increases as charge is incorporated into the system . the location of the event horizon , hawking temperature and heat capacity also do get modified in the presence of the electromagnetic field . particle trajectories around the black hole are also affected by the inclusion charge . in particular , we note that the motion of a charged particle around a charged black hole is quite different from the motion of a neutral test particle . we hope that our results will contribute towards getting a better understanding of the effects of noncommutative geometry on the structure and properties of black holes . in addition , the results may be useful to understand how the presence of electromagnetic field can change a number of astrophysical phenomena such as properties of accretion disks around charged black holes and hawking radiation . rs and fr gratefully acknowledge support from the inter - university centre for astronomy and astrophysics ( iucaa ) , pune , india , where a part of this work was carried out under its visiting research associateship programme . we are very grateful to an anonymous referee for his / her insightful comments that have led to significant improvements , particularly on the interpretational aspects . e. witten , _ nucl.phys.b _ * 460 * , 335 ( 1996 ) . n. seiberg and e. witten , _ jhep _ * 032 * , 9909 ( 1999 ) . a. smailagic and e. spallucci , _ a : math gen . _ * 36 * , l517 ( 2003 ) . t. g. rizzo , _ jhep _ * 09 * , 021 ( 2006 ) . p. nicolini , a.smailagic and p. nicolini , _ phys . b _ * 670 * , 449 ( 2009 ) . y. s. myung , y. w. kim and y. j. park , _ j. high energy phys . _ * 0702 * , 012 ( 2007 ) . m. ba@xmath163ados , c. teitelboim and j. zanelli , _ phys . lett . _ * 69 * , 1849 ( 1992 ) . k. nozari and s. h. mehdipour , _ class . quantum grav . _ * 25 * , 175015 ( 2008 ) . f. rahaman , p. k. f. kuhfittig , k. chakraborty , a. a. usmani and s. ray , _ gen . gravit _ * 44 * , 905 ( 2012 ) . f. rahaman , p. k. f. kuhfittig , s. ray and s. islam , _ phys . d _ * 86 * , 106010 ( 2012 ) . r. banerjee , b. r. majhi and s. k. modak , _ class . quantum grav . _ * 26 * , 085010 ( 2009 ) . r. titekar and g. p. singh _ gravitation and cosmology _ * 4 * , 294 ( 1998 ) . r. sharma , s. mukherjee and s. d. maharaj , _ gen . gravit . _ * f33 * , 999 ( 2001 ) . s. thirukkanesh and s. d. maharaj _ class . quantum grav . _ * 25 * , 235001 ( 2008 ) . f. rahaman , a. a. usmani , s. ray and s. islam , _ phys . b _ * 717 * , 1 ( 2012 ) . b. v. ivanov , _ phys . rev . d _ , * 65 * 104001 ( 2002 ) . m. cataldo , n. cruz , s. del campo and a. garcia , _ phys . b _ * 484 * , 154 ( 2000 ) . a. larra@xmath6aga and j. m. tejeiro , _ the abraham zelmanov j. _ * 4 * , 28 ( 2011 ) . f. rahaman , p. k. f. kuhfittig , b. c. bhui , m. rahaman , s. ray and u. f. mondal , _ phys . d _ * 87 * , 084014 ( 2013 ) . j. liang and b. liu , _ europhys . * 100 * , 30001 ( 2012 ) .

we report a @xmath0-d charged black hole solution in an anti - de sitter space inspired by noncommutative geometry . in this construction , the black hole exhibits two horizons which turn into a single horizon in the extreme case . we investigate the impacts of electromagnetic field on the location of the event horizon , mass and thermodynamic properties such as hawking temperature , entropy and heat capacity of the black hole . the geodesics of the charged black hole are also analyzed .

the genetic architecture of biological organisms shows remarkable robustness against both structural and environmental perturbations @xcite . for example , quantitative models indicate that the functionality of the _ drosophila _ segment polarity gene network is extremely insensitive to variations in initial conditions @xcite and robust against architectural modifications @xcite . ( also see @xcite . ) gene knock - out studies on yeast have shown that almost 40% of the genes on chromosome v have either negligible or no effects on the growth rate @xcite . certain cellular networks , such as the _ e. coli _ chemotaxis network , are also known to be very robust to variations in biochemical parameters @xcite . the genetic regulatory networks that control the developmental dynamics buffer perturbations and maintain a stable phenotype . that is why phenotypic variation within most species is quite small , despite the organisms being exposed to a wide range of environmental and genetic perturbations @xcite . it has been proposed that genetic robustness evolved through stabilizing selection for a phenotypic optimum @xcite . @xcite showed that this in fact can be true by modeling a developmental process within an evolutionary scenario , in which the genetic interaction sequence represents the development , and the stationary configuration of the gene network represents the phenotype . his results indicate that the genetic robustness of a population of model genetic regulatory networks can gradually increase through stabilizing selection , in which deviations from the `` optimal '' stationary state ( phenotype ) are considered deleterious @xcite . in this paper , we focus on the effects of evolution of genetic robustness on the dynamics of gene regulatory networks in general . first , we examine the relationship between genetic robustness and the dynamical character of the networks . by dynamical character , we mean the stability of the expression states of the network against small perturbations , or noise . models that are employed to study dynamics of gene networks , such as random boolean networks ( rbn ) @xcite or some variants of random threshold networks ( rtn ) @xcite have been known to undergo a phase transition at low connectivities @xcite , giving rise to change in dynamical behavior : on average , small perturbations will percolate through the network above the threshold connectivity ( chaotic phase ) , whereas they stay confined to a part of the network below the threshold ( ordered phase ) . intuitively , one might expect to find that robustness to mutations ( which are permanent structural changes , not dynamic perturbations ) is related to the dynamical behavior of the system , therefore , ordered gene regulatory networks should be genetically more robust than the chaotic ones . however , this is not necessarily true . here , we show that the relation between the dynamical character of a genetic regulatory network and its mutational robustness can be quite the opposite . in fact , even earlier studies provide a clue on this issue : for gene networks that have undergone selection ( i.e. , evolved ) , mutational robustness is known to increase with increasing connectivity @xcite . on the other hand , chaoticity has been shown to increase with increasing connectivity in random gene regulatory networks @xcite . these facts seem to contradict the intuitive interpretation of robustness since they suggest that chaotic networks can be mutationally robust . although this inference is proven true in this paper , such an assessment can not be based on the previous studies of the dynamics of random networks @xcite , as the evolved networks ( with high mutational robustness and connectivity ) mentioned above @xcite have undergone selection . the selection process could potentially tune a network to exhibit a different dynamical character than its random ancestors . therefore , the dynamical character of the evolved networks should be studied independently and then compared with their random counterparts . here , we study the dynamics of the evolved networks numerically and show that selection for an optimal phenotype indeed has only a minor effect on their global dynamical behavior . this result indicates that the evolution of mutational robustness can not be understood in terms of simple dynamical measures . we also provide statistics on robustness to _ noise _ , which is the ability of a network to reach its `` optimal '' steady state after a perturbation to the gene - expression _ trajectory_. computer simulations indicate that mutational robustness is correlated to robustness of the gene - expression trajectory to small perturbations ( noise ) , at least for short trajectories . this result is supported by recent studies @xcite . for perturbations of arbitrary magnitude , the basin size of the steady - state attractor provides a better measure . our analysis shows that basin sizes of densely connected networks ( which are highly chaotic ) have a broad distribution , and therefore such networks can have very large attractor basins @xcite . the yeast cell - cycle network has been reported to have similar properties @xcite . although chaoticity is just a side - effect of high connectivity , and not directly selected for during evolution , it appears that this intrinsic property of chaotic networks can be useful in terms of robustness to noise . when all of these measures are taken into account , chaotic dynamics does not seem be an obstacle for the networks with high connectivity since they are more robust to both mutations and noise than the ones that are sparsely connected . the organization of the rest of this paper is as follows . we describe the model in sec . [ sec : model ] and explain its implementation in simulations in sec . [ sec : methods ] . we give the results in sec . [ sec : results ] and discuss their implications in sec [ sec : discussion ] . we use the model introduced by @xcite , which has also been used with some modifications by other researchers @xcite . each individual is represented by a regulatory gene network consisting of @xmath0 genes . the expression level of each gene , @xmath1 can be either @xmath2 or @xmath3 , meaning that the gene is expressed or not , respectively . the expression states change in time according to regulatory interactions between the genes . the time development of the expression states ( i.e. , the dynamical trajectory taken by the network ) represents a developmental pathway . this deterministic , discrete - time dynamics of the development is given by a set of nonlinear difference equations , @xmath4 where sgn is the sign function and @xmath5 is the strength of the influence of gene @xmath6 on gene @xmath7 . nonzero elements @xmath5 of the @xmath8 matrix @xmath9 are independent random numbers drawn from a gaussian distribution with zero mean and unit variance . the diagonal elements of * @xmath9 * are allowed to be nonzero , corresponding to self - regulation . the mean number of nonzero elements in @xmath9 is controlled by the connectivity density , @xmath10 , which is the probability that any given @xmath5 is nonzero . thus , the mean degree of the network is @xmath11 to clarify , @xmath12 represents the _ developmental _ time , through which genetic interactions occur . it is different from the _ evolutionary _ time , @xmath13 , which will be explained in the next section . the dynamics given by eq . can display a wide variety of features . for a specified initial state @xmath14 , the network reaches an attractor ( either a fixed point or a limit cycle ) after a transient period . transient time , number of attractors , attractor periods , etc . can differ depending on the connectivity of the network , and from one realization of @xmath9 to another . the fitness of an individual is defined by whether it can reach a developmental equilibrium , i.e. , a fixed point , which is a fixed gene - expression pattern , @xmath15 , in a `` reasonable '' transient time . ( it has been shown that selection for developmental stability is sufficient for evolution of mutational robustness @xcite , i.e. , deviations from @xmath15 do not have to be deleterious , as long as the gene - expression configuration reaches a fixed point . however , we shall adopt the criterion used by @xcite for compatibility . ) further details of the model are explained in the next section . we studied populations of random networks with @xmath16 . we use these relatively small networks to be able to enumarate all network states exhaustively for a large set of realizations . in the simulations , each network was first assigned a random interaction matrix @xmath9 and an initial state @xmath14 . @xmath9 was generated as follows . for each @xmath5 , a random number uniformly distributed on @xmath17 was generated , and @xmath5 was set to zero if the random number was greater than the connectivity density , @xmath10 . otherwise , @xmath5 was assigned a random number drawn from a gaussian distribution with zero mean and unit variance . then , each `` gene '' of the initial configuration , @xmath18 , was assigned either @xmath3 or @xmath2 at random , each with probability 1/2 . after @xmath9 and @xmath14 were created , the developmental dynamics were started , and the network s stability was evaluated . if the system reached a fixed point , @xmath19 in @xmath20 time steps , then it was considered _ viable _ and kept . otherwise it was considered unstable , both @xmath9 and @xmath14 were discarded , and the process was repeated until a viable network was generated . ( a viable network can have several fixed points and/or limit cycles in addition to @xmath21 . ) for each viable network , its fixed point , @xmath15 , was regarded as the `` optimal '' gene - expression state of the system . this is the only modification we made to the model used by @xcite : we accept any @xmath21 as long as it can be reached within @xmath20 time steps from @xmath14 , whereas @xcite generated networks with preassigned random @xmath14 and @xmath15 . , between @xmath14 and @xmath21 to assess mutational robustness of these networks @xcite . we ignore this fact since producing networks with a predetermined @xmath22 is computationally not very feasible . the probability distribution of @xmath22 for the networks we generate follows approximately a gaussian with a mean between 2.8 and 4.5 , increasing with @xmath23 . see supplementary fig . s2 . ] in order to generate a collection of more robust networks , a mutation - selection process was simulated for each viable network as follows . first , a clan of @xmath24 identical copies of each network was generated . for each member of the clan , a four - step process was performed for @xmath25 generations : 1 . recombination : each pair of the @xmath0 rows of consecutive matrices in the clan were swapped with probability 1/2 . since the networks were already shuffled in step 4 ( see below ) , there was no need to pick random pairs . 2 . mutation : each nonzero @xmath5 was replaced with probability @xmath26 by a new random number drawn from the same standard gaussian distribution . thus , on average , one matrix element was changed per matrix per generation . fitness evaluation : each network was run starting from the original initial condition @xmath14 . if the network reached a fixed point , @xmath27 within @xmath28 developmental time steps , then its fitness was calculated using @xmath29 where @xmath30 denotes the normalized hamming distance between @xmath31 and @xmath32 , @xmath33 denotes the inverse of the strength of selection , @xmath21 is the optimal gene - expression state , which is the final gene - expression state of the original network that `` founded '' the clan . we used @xmath34 . if the network could not reach a fixed point , it was assigned the minimum nonzero fitness value , @xmath35 4 . selection / asexual reproduction : the fitness of each network was normalized to the fitness value of the most fit network in the clan . then a network was chosen at random and duplicated into the descendant clan with probability equal to its normalized fitness . this process was repeated until the size of the descendant clan reached @xmath36 . then the old clan was discarded , and the descendant clan was kept as the next generation . this process allows multiple copies ( offspring ) of the same network to appear in the descendant clan , while some networks may not be propagated to the next generation due to genetic drift . at the end of the @xmath25 generation ( evolutionary time ) selection , any unstable networks were removed from the evolved clan . some steps of the process above may be unnecessary , and in fact , the results do not depend strongly on model details @xcite . nevertheless , the entire procedure of @xcite was retained for compatibility . the mutational robustness , @xmath37 of a network was assessed as follows . first , a nonzero @xmath5 was picked at random and replaced by a new random number with the same standard gaussian distribution . then , the developmental dynamics were started , and it was checked whether the system reached the same stationary state , @xmath21 , within @xmath28 time steps . this process was repeated @xmath38 times , starting from the original matrix . the robustness of the original network before evolution was defined as the fraction of singly - mutated networks that reached @xmath21 . for the evolved networks , we picked one sample network at random from the clan and used the same procedure to assess its mutational robustness . ) of 10000 sample networks before ( filled bars ) and after ( empty bars ) evolution with @xmath16 and @xmath39 . before : @xmath40 @xmath41 . after : @xmath42 @xmath43 . the evolved distribution was calculated by sampling one network from each of 10000 evolved clans . the mean indegree , @xmath44 , rather than the connectivity density , @xmath10 , is the parameter that controls the behavior of the system @xcite . [ sec : methods ] for other model parameters.,scaledwidth=50.0% ] the stabilizing selection described above increases the robustness of a model population of gene networks against mutations @xcite . figure [ fig : symmetry - and - robustness ] shows that a population with a very large initial variation in robustness evolved an increased ability to absorb mutations after @xmath25 generations of stabilizing selection . however , it is not very clear what kind of a reorganization in the state spaces of these networks occur during the evolution . we measured the changes in several system parameters to answer this question . it has been analytically shown that the rtns undergo a phase transition from order to chaos with increasing @xmath23 @xcite . obviously , the state space of an rtn is finite . therefore , the expression states have to display periodicity in development after at most @xmath45 steps . thus , chaos here is not a long - term aperiodic behavior ; rather it corresponds to a dynamical regime in which small perturbations percolate through the gene network @xcite . we quantify the dynamical character of a network by comparing the time development of two configurations , @xmath46 and @xmath47 , that differ by one gene : we measure the mean number of different genes in time step @xmath48 , @xmath49 , averaged over all possible @xmath46 and @xmath47 pairs with @xmath50 . this is known as damage spreading or damage propagation . this incompatibility vanishes for larger @xmath23 as this detail in the update rule does not have any significance when almost all nodes have inputs . nevertheless , we use the term `` damage spreading '' instead of `` damage - spreading rate '' when referring to @xmath51 to avoid a confusion . ] . the dynamical behavior of random networks can be quantified analytically using damage - spreading analysis @xcite . however , this analytical approach may not be applied to the _ evolved _ networks as the selection process can tune a network to behave dynamically very differently than its ancestor . therefore , we calculated @xmath49 numerically for both viable and evolved networks , averaging ensembles of 10000 networks exhaustively over all possible configuration pairs , @xmath46 and @xmath47 , for each @xmath23 . as seen in fig . [ fig : matrixdistr - and - damage ] , the @xmath49 increases monotonically with increasing connectivity , indicating that highly connected networks are more chaotic on average . the evolved networks are slightly more ordered ( on average ) than their viable ancestors . these results indicate that the dynamical behavior of the evolved networks is not much different than that of the viable networks from which they are descended . , after a one - bit perturbation before ( viable ) and after evolution ( evolved ) for networks with @xmath16 , measured exhaustively for all possible state pairs , averaged over 10000 samples each . the error bars represent one standard deviation ( not standard error ) . evolved networks ( triangles ) are slightly more ordered compared to their viable ancestors . ( the differences are statistically significant . ) @xmath49 is always larger than unity due to our specific update rule . see the discussion in the text for details . the lines connecting the symbols are guides to the eye . ( probability distributions for @xmath49 for certain values of @xmath23 are given in supplementary figs . s3 and s4 . ) [ fig : matrixdistr - and - damage ] ] to @xmath48 . arrows indicate the direction of flow . each state drains into an attractor ( pentagons ) through transient states . ( a ) state space of a sample network with @xmath52 and @xmath53 . there are eight basins , each having a fixed - point attractor . the principal basin ( at the top ) contains the initial ( diamond shaped node ) and final states . note that the basins are quite symmetric , and transients are very short as the system behaves less chaotically when the connectivity of the network is low . ( b ) basin of a sample network with @xmath52 and @xmath54 . the principal basin occupies a large portion of the state space . the basin on the left crosses the symmetry plane with a 2-cycle ( note the symmetry of the branches ) . the other basins have mirror images on the other side of the state space ( not shown ) . the principal basin is significantly larger than the others . the high connectivity makes the network behave more chaotic , creating basins with broadly distributed sizes and branch lengths , and significantly longer transients . see text for details . generated using graphviz @xcite . [ fig : state - space - layout],title="fig : " ] to @xmath48 . arrows indicate the direction of flow . each state drains into an attractor ( pentagons ) through transient states . ( a ) state space of a sample network with @xmath52 and @xmath53 . there are eight basins , each having a fixed - point attractor . the principal basin ( at the top ) contains the initial ( diamond shaped node ) and final states . note that the basins are quite symmetric , and transients are very short as the system behaves less chaotically when the connectivity of the network is low . ( b ) basin of a sample network with @xmath52 and @xmath54 . the principal basin occupies a large portion of the state space . the basin on the left crosses the symmetry plane with a 2-cycle ( note the symmetry of the branches ) . the other basins have mirror images on the other side of the state space ( not shown ) . the principal basin is significantly larger than the others . the high connectivity makes the network behave more chaotic , creating basins with broadly distributed sizes and branch lengths , and significantly longer transients . see text for details . generated using graphviz @xcite . [ fig : state - space - layout],title="fig : " ] we also analyzed the state spaces of random , viable , and evolved networks @xcite . figures [ fig : stats1 ] and [ fig : stats2 ] show these statistics for networks with @xmath16 and connectivities @xmath551 , 5 , and 10 . due to the up - down symmetry of the system , the state space is divided into two parts , where the dynamics on one side is the mirror image of the other . therefore , the basin size of a fixed - point attractor can not exceed half the size of the state space , @xmath56 . limit cycles , however , can cross the symmetry plane that divides the state space ( fig . [ fig : state - space - layout](b ) ) . therefore , their basins can contain up to @xmath57 states . typically , sparsely connected gene networks have many attractors ( fixed points and limit cycles ) and , consequently , smaller basin sizes on average , as depicted in fig . [ fig : state - space - layout](a ) . increasing connectivity brings state spaces with fewer attractors ( figs . [ fig : stats1](a ) , ( b ) , and ( c ) ) , longer attractor ( limit cycle ) periods ( figs . [ fig : stats1](d ) , ( e ) , and ( f ) ) , and broadly distributed basin sizes ( figs , [ fig : stats1](g ) , ( h ) , and ( i ) ) . densely connected networks can contain basins that occupy a large portion , occasionally even all , of the state space . the basins of such networks tend to have broadly distributed branch lengths as seen in fig . [ fig : state - space - layout](b ) , and their states also tend to have fewer precursors ( figures [ fig : stats2](a ) , ( b ) , and ( c ) ) . ( all states , @xmath58 , that go to state @xmath31 at time step @xmath12 + 1 are precursors of @xmath31 . ) therefore , mean transient time ( total number of steps from a state to the attractor ) on such networks are typically larger than on networks with lower connectivity ( figs . [ fig : stats2](d ) , ( e ) , and ( f ) ) . these changes in the state - space characteristics are consistent with the damage - spreading measurements . the distributions for the evolved networks are shifted toward the distributions of more ordered networks of lower connectivity . this means evolved networks are slightly more ordered , as the damage - spreading measurements shown in fig . [ fig : matrixdistr - and - damage](b ) suggest . for example , the distribution of the number of attractors ( figs . [ fig : stats1](a ) , ( b ) and ( c ) ) for the networks with low connectivity ( @xmath59 has a longer tail compared to the networks with @xmath60 and 10 . similarly , the distributions for the evolved networks have slightly longer tails compared to those of viables of the same connectivity . the same effect can be seen in the attractor - period ( figs . [ fig : stats1](d ) , ( e ) , and ( f ) ) , precursor ( figs . [ fig : stats2](a ) , ( b ) , and ( c ) ) , and transient - time distributions ( figs . [ fig : stats2](d ) , ( e ) , and ( f ) ) , as well . the most significant changes are seen in the transient - time distributions , indicating that basins with relatively shorter branches are preferred by selection . the basin - size distributions of viable and evolved networks , however , do not display much difference as they virtually overlap . and @xmath61 5 , and 10 ( columns 1 , 2 , and 3 , respectively ) . each curve represents an average over 20,000 realizations for the `` random '' networks , and 10,000 realizations for the `` viable '' and `` evolved '' ones . for the evolved networks , we did not use clan averages to avoid a bias instead , we picked one sample network from each evolved clan . error bars were calculated by grouping the data : each data set was divided into groups of 1000 samples and the average distribution for each group was calculated . then , the error calculations were performed on the new set of averaged distributions . the data plotted on log - log scale were histogrammed using exponential bins ( 0 , 1 , 2 - 3 , 4 - 7 , ... ) to reduce the noise . ( see supplementary fig . s1 for histograms with linear bins . ) the basin size does not include the size ( period ) of the attractor . the evolved attractor - count and attractor - period distributions are shifted toward those of viable networks with lower @xmath23 , indicating that evolved networks display a slightly more ordered character . the basin - size distributions for the evolved networks seem to overlap with the ones for the viable networks except for the largest basins , which become less probable after selection . the lines connecting the symbols are guides to the eye.[fig : stats1],title="fig : " ] and @xmath61 5 , and 10 ( columns 1 , 2 , and 3 , respectively ) . each curve represents an average over 20,000 realizations for the `` random '' networks , and 10,000 realizations for the `` viable '' and `` evolved '' ones . for the evolved networks , we did not use clan averages to avoid a bias . instead , we picked one sample network from each evolved clan . error bars were calculated by grouping the data : each data set was divided into groups of 1000 samples and the average distribution for each group was calculated . then , the error calculations were performed on the new set of averaged distributions . the data plotted on log - log scale were histogrammed using exponential bins ( 0 , 1 , 2 - 3 , 4 - 7 , ... ) to reduce the noise . ( see supplementary fig . s1 for histograms with linear bins . ) the basin size does not include the size ( period ) of the attractor . the evolved attractor - count and attractor - period distributions are shifted toward those of viable networks with lower @xmath23 , indicating that evolved networks display a slightly more ordered character . the basin - size distributions for the evolved networks seem to overlap with the ones for the viable networks except for the largest basins , which become less probable after selection . the lines connecting the symbols are guides to the eye.[fig : stats1],title="fig : " ] and @xmath61 5 , and 10 ( columns 1 , 2 , and 3 , respectively ) . each curve represents an average over 20,000 realizations for the `` random '' networks , and 10,000 realizations for the `` viable '' and `` evolved '' ones . for the evolved networks , we did not use clan averages to avoid a bias instead , we picked one sample network from each evolved clan . error bars were calculated by grouping the data : each data set was divided into groups of 1000 samples and the average distribution for each group was calculated . then , the error calculations were performed on the new set of averaged distributions . the data plotted on log - log scale were histogrammed using exponential bins ( 0 , 1 , 2 - 3 , 4 - 7 , ... ) to reduce the noise . ( see supplementary fig . s1 for histograms with linear bins . ) the basin size does not include the size ( period ) of the attractor . the evolved attractor - count and attractor - period distributions are shifted toward those of viable networks with lower @xmath23 , indicating that evolved networks display a slightly more ordered character . the basin - size distributions for the evolved networks seem to overlap with the ones for the viable networks except for the largest basins , which become less probable after selection . the lines connecting the symbols are guides to the eye.[fig : stats1],title="fig : " ] and @xmath61 5 , and 10 ( columns 1 , 2 , and 3 , respectively ) . each curve represents an average over 20,000 realizations for the `` random '' networks , and 10,000 realizations for the `` viable '' and `` evolved '' ones . for the evolved networks , we did not use clan averages to avoid a bias instead , we picked one sample network from each evolved clan . error bars were calculated by grouping the data : each data set was divided into groups of 1000 samples and the average distribution for each group was calculated . then , the error calculations were performed on the new set of averaged distributions . the data plotted on log - log scale were histogrammed using exponential bins ( 0 , 1 , 2 - 3 , 4 - 7 , ... ) to reduce the noise . ( see supplementary fig . s1 for histograms with linear bins . ) the basin size does not include the size ( period ) of the attractor . the evolved attractor - count and attractor - period distributions are shifted toward those of viable networks with lower @xmath23 , indicating that evolved networks display a slightly more ordered character . the basin - size distributions for the evolved networks seem to overlap with the ones for the viable networks except for the largest basins , which become less probable after selection . the lines connecting the symbols are guides to the eye.[fig : stats1],title="fig : " ] and @xmath61 5 , and 10 ( columns 1 , 2 , and 3 , respectively ) . each curve represents an average over 20,000 realizations for the `` random '' networks , and 10,000 realizations for the `` viable '' and `` evolved '' ones . for the evolved networks , we did not use clan averages to avoid a bias . instead , we picked one sample network from each evolved clan . error bars were calculated by grouping the data : each data set was divided into groups of 1000 samples and the average distribution for each group was calculated . then , the error calculations were performed on the new set of averaged distributions . the data plotted on log - log scale were histogrammed using exponential bins ( 0 , 1 , 2 - 3 , 4 - 7 , ... ) to reduce the noise . ( see supplementary fig . s1 for histograms with linear bins . ) the basin size does not include the size ( period ) of the attractor . the evolved attractor - count and attractor - period distributions are shifted toward those of viable networks with lower @xmath23 , indicating that evolved networks display a slightly more ordered character . the basin - size distributions for the evolved networks seem to overlap with the ones for the viable networks except for the largest basins , which become less probable after selection . the lines connecting the symbols are guides to the eye.[fig : stats1],title="fig : " ] and @xmath61 5 , and 10 ( columns 1 , 2 , and 3 , respectively ) . each curve represents an average over 20,000 realizations for the `` random '' networks , and 10,000 realizations for the `` viable '' and `` evolved '' ones . for the evolved networks , we did not use clan averages to avoid a bias instead , we picked one sample network from each evolved clan . error bars were calculated by grouping the data : each data set was divided into groups of 1000 samples and the average distribution for each group was calculated . then , the error calculations were performed on the new set of averaged distributions . the data plotted on log - log scale were histogrammed using exponential bins ( 0 , 1 , 2 - 3 , 4 - 7 , ... ) to reduce the noise . ( see supplementary fig . s1 for histograms with linear bins . ) the basin size does not include the size ( period ) of the attractor . the evolved attractor - count and attractor - period distributions are shifted toward those of viable networks with lower @xmath23 , indicating that evolved networks display a slightly more ordered character . the basin - size distributions for the evolved networks seem to overlap with the ones for the viable networks except for the largest basins , which become less probable after selection . the lines connecting the symbols are guides to the eye.[fig : stats1],title="fig : " ] and @xmath61 5 , and 10 ( columns 1 , 2 , and 3 , respectively ) . each curve represents an average over 20,000 realizations for the `` random '' networks , and 10,000 realizations for the `` viable '' and `` evolved '' ones . for the evolved networks , we did not use clan averages to avoid a bias instead , we picked one sample network from each evolved clan . error bars were calculated by grouping the data : each data set was divided into groups of 1000 samples and the average distribution for each group was calculated . then , the error calculations were performed on the new set of averaged distributions . the data plotted on log - log scale were histogrammed using exponential bins ( 0 , 1 , 2 - 3 , 4 - 7 , ... ) to reduce the noise . ( see supplementary fig . s1 for histograms with linear bins . ) the basin size does not include the size ( period ) of the attractor . the evolved attractor - count and attractor - period distributions are shifted toward those of viable networks with lower @xmath23 , indicating that evolved networks display a slightly more ordered character . the basin - size distributions for the evolved networks seem to overlap with the ones for the viable networks except for the largest basins , which become less probable after selection . the lines connecting the symbols are guides to the eye.[fig : stats1],title="fig : " ] and @xmath61 5 , and 10 ( columns 1 , 2 , and 3 , respectively ) . each curve represents an average over 20,000 realizations for the `` random '' networks , and 10,000 realizations for the `` viable '' and `` evolved '' ones . for the evolved networks , we did not use clan averages to avoid a bias . instead , we picked one sample network from each evolved clan . error bars were calculated by grouping the data : each data set was divided into groups of 1000 samples and the average distribution for each group was calculated . then , the error calculations were performed on the new set of averaged distributions . the data plotted on log - log scale were histogrammed using exponential bins ( 0 , 1 , 2 - 3 , 4 - 7 , ... ) to reduce the noise . ( see supplementary fig . s1 for histograms with linear bins . ) the basin size does not include the size ( period ) of the attractor . the evolved attractor - count and attractor - period distributions are shifted toward those of viable networks with lower @xmath23 , indicating that evolved networks display a slightly more ordered character . the basin - size distributions for the evolved networks seem to overlap with the ones for the viable networks except for the largest basins , which become less probable after selection . the lines connecting the symbols are guides to the eye.[fig : stats1],title="fig : " ] and @xmath61 5 , and 10 ( columns 1 , 2 , and 3 , respectively ) . each curve represents an average over 20,000 realizations for the `` random '' networks , and 10,000 realizations for the `` viable '' and `` evolved '' ones . for the evolved networks , we did not use clan averages to avoid a bias instead , we picked one sample network from each evolved clan . error bars were calculated by grouping the data : each data set was divided into groups of 1000 samples and the average distribution for each group was calculated . then , the error calculations were performed on the new set of averaged distributions . the data plotted on log - log scale were histogrammed using exponential bins ( 0 , 1 , 2 - 3 , 4 - 7 , ... ) to reduce the noise . ( see supplementary fig . s1 for histograms with linear bins . ) the basin size does not include the size ( period ) of the attractor . the evolved attractor - count and attractor - period distributions are shifted toward those of viable networks with lower @xmath23 , indicating that evolved networks display a slightly more ordered character . the basin - size distributions for the evolved networks seem to overlap with the ones for the viable networks except for the largest basins , which become less probable after selection . the lines connecting the symbols are guides to the eye.[fig : stats1],title="fig : " ] @xmath61 5 , and 10 ( columns 1 , 2 , and 3 , respectively ) . the second row shows the distributions for the lengths of the transients starting from all possible states . the third row , however , shows the distribution for @xmath62 , the length of the transient starting from @xmath14 , the original initial state . again , changes in the distributions indicate that evolved networks display a slightly more ordered character . the data plotted on log - log scale were histogrammed using exponential bins ( 0 , 1 , 2 - 3 , 4 - 7 , ... ) and the other plots were histogrammed using linear ( 0,1,2 ... ) bins . see the caption of fig . [ fig : stats1 ] for the details of the data analysis . the lines connecting the symbols are guides to the eye.[fig : stats2],title="fig : " ] @xmath61 5 , and 10 ( columns 1 , 2 , and 3 , respectively ) . the second row shows the distributions for the lengths of the transients starting from all possible states . the third row , however , shows the distribution for @xmath62 , the length of the transient starting from @xmath14 , the original initial state . again , changes in the distributions indicate that evolved networks display a slightly more ordered character . the data plotted on log - log scale were histogrammed using exponential bins ( 0 , 1 , 2 - 3 , 4 - 7 , ... ) and the other plots were histogrammed using linear ( 0,1,2 ... ) bins . see the caption of fig . [ fig : stats1 ] for the details of the data analysis . the lines connecting the symbols are guides to the eye.[fig : stats2],title="fig : " ] @xmath61 5 , and 10 ( columns 1 , 2 , and 3 , respectively ) . the second row shows the distributions for the lengths of the transients starting from all possible states . the third row , however , shows the distribution for @xmath62 , the length of the transient starting from @xmath14 , the original initial state . again , changes in the distributions indicate that evolved networks display a slightly more ordered character . the data plotted on log - log scale were histogrammed using exponential bins ( 0 , 1 , 2 - 3 , 4 - 7 , ... ) and the other plots were histogrammed using linear ( 0,1,2 ... ) bins . see the caption of fig . [ fig : stats1 ] for the details of the data analysis . the lines connecting the symbols are guides to the eye.[fig : stats2],title="fig : " ] @xmath61 5 , and 10 ( columns 1 , 2 , and 3 , respectively ) . the second row shows the distributions for the lengths of the transients starting from all possible states . the third row , however , shows the distribution for @xmath62 , the length of the transient starting from @xmath14 , the original initial state . again , changes in the distributions indicate that evolved networks display a slightly more ordered character . the data plotted on log - log scale were histogrammed using exponential bins ( 0 , 1 , 2 - 3 , 4 - 7 , ... ) and the other plots were histogrammed using linear ( 0,1,2 ... ) bins . see the caption of fig . [ fig : stats1 ] for the details of the data analysis . the lines connecting the symbols are guides to the eye.[fig : stats2],title="fig : " ] @xmath61 5 , and 10 ( columns 1 , 2 , and 3 , respectively ) . the second row shows the distributions for the lengths of the transients starting from all possible states . the third row , however , shows the distribution for @xmath62 , the length of the transient starting from @xmath14 , the original initial state . again , changes in the distributions indicate that evolved networks display a slightly more ordered character . the data plotted on log - log scale were histogrammed using exponential bins ( 0 , 1 , 2 - 3 , 4 - 7 , ... ) and the other plots were histogrammed using linear ( 0,1,2 ... ) bins . see the caption of fig . [ fig : stats1 ] for the details of the data analysis . the lines connecting the symbols are guides to the eye.[fig : stats2],title="fig : " ] @xmath61 5 , and 10 ( columns 1 , 2 , and 3 , respectively ) . the second row shows the distributions for the lengths of the transients starting from all possible states . the third row , however , shows the distribution for @xmath62 , the length of the transient starting from @xmath14 , the original initial state . again , changes in the distributions indicate that evolved networks display a slightly more ordered character . the data plotted on log - log scale were histogrammed using exponential bins ( 0 , 1 , 2 - 3 , 4 - 7 , ... ) and the other plots were histogrammed using linear ( 0,1,2 ... ) bins . see the caption of fig . [ fig : stats1 ] for the details of the data analysis . the lines connecting the symbols are guides to the eye.[fig : stats2],title="fig : " ] @xmath61 5 , and 10 ( columns 1 , 2 , and 3 , respectively ) . the second row shows the distributions for the lengths of the transients starting from all possible states . the third row , however , shows the distribution for @xmath62 , the length of the transient starting from @xmath14 , the original initial state . again , changes in the distributions indicate that evolved networks display a slightly more ordered character . the data plotted on log - log scale were histogrammed using exponential bins ( 0 , 1 , 2 - 3 , 4 - 7 , ... ) and the other plots were histogrammed using linear ( 0,1,2 ... ) bins . see the caption of fig . [ fig : stats1 ] for the details of the data analysis . the lines connecting the symbols are guides to the eye.[fig : stats2],title="fig : " ] @xmath61 5 , and 10 ( columns 1 , 2 , and 3 , respectively ) . the second row shows the distributions for the lengths of the transients starting from all possible states . the third row , however , shows the distribution for @xmath62 , the length of the transient starting from @xmath14 , the original initial state . again , changes in the distributions indicate that evolved networks display a slightly more ordered character . the data plotted on log - log scale were histogrammed using exponential bins ( 0 , 1 , 2 - 3 , 4 - 7 , ... ) and the other plots were histogrammed using linear ( 0,1,2 ... ) bins . see the caption of fig . [ fig : stats1 ] for the details of the data analysis . the lines connecting the symbols are guides to the eye.[fig : stats2],title="fig : " ] @xmath61 5 , and 10 ( columns 1 , 2 , and 3 , respectively ) . the second row shows the distributions for the lengths of the transients starting from all possible states . the third row , however , shows the distribution for @xmath62 , the length of the transient starting from @xmath14 , the original initial state . again , changes in the distributions indicate that evolved networks display a slightly more ordered character . the data plotted on log - log scale were histogrammed using exponential bins ( 0 , 1 , 2 - 3 , 4 - 7 , ... ) and the other plots were histogrammed using linear ( 0,1,2 ... ) bins . see the caption of fig . [ fig : stats1 ] for the details of the data analysis . the lines connecting the symbols are guides to the eye.[fig : stats2],title="fig : " ] as seen in fig . [ fig : before - and - after - plots](a ) , networks of all connectivities have similar values of mutational robustness , @xmath63 , before selection . after selection , however , the networks with higher connectivity reach a much greater mean mutational robustness @xcite . sparsely connected networks do not show much improvement because the low connectivity leaves little room for optimization . another significant change is seen in the transient time , @xmath62 ( figs . [ fig : stats2](g ) , ( h ) , and ( i ) and [ fig : before - and - after - plots](b ) ) @xcite . for viable networks , the transient time increases with the connectivity . this is not surprising since state spaces of densely connected networks typically have basins with longer branches ( fig . [ fig : state - space - layout](b ) ) . however , selection brings the mean transient time down to around 2 , independent of the connectivity of the network . low transient time is one of the properties of highly robust networks @xcite . mutations are not the only kind of perturbations that genetic regulatory networks experience . all genetic systems are also exposed to noise created by both internal an external sources . we measure robustness to noise dynamical robustness using two parameters . the first one is the dynamical robustness , @xmath64 , of a gene expression state , @xmath65 , to small perturbations ( random one - bit flips ) , which is simply the fraction of nearest neighbors in hamming distance of @xmath65 that lie in the same basin as @xmath65 @xcite . in other words , @xmath64 is the probability that a random flip of a gene on @xmath65 yields a state that drains into the same attractor as @xmath65 . we also employ the mean robustness of a set of states , for instance , robustness of the gene expression trajectory , @xmath66 , which is the average of @xmath64 over all states in the trajectory ( including @xmath14 and @xmath21 ) . similarly , the robustness of the principal basin , @xmath67 , is the average of @xmath64 over all states in the basin , and the robustness of the entire state space , @xmath68 , is the average of @xmath64 over all possible states of the network . ( we usually omit the term `` dynamical '' when we talk about robustness of a state or a set of states since the mutational robustness of a _ state _ is not defined . ) the second parameter we use to estimate dynamical robustness is the normalized size of the principal basin , @xmath69 , which is the basin containing both @xmath14 and @xmath21 . the size of a basin is the total number of states it contains . therefore , @xmath69 is the fraction of all possible perturbations to the trajectory that leave @xmath21 unchanged , i.e. , the probability that flipping an arbitrary number of genes at random in a state on the trajectory does not change the attractor that the network settles into . clearly , the parameters we employ to measure robustness to noise are quite different than conventional measures of stability , such as the damage - spreading rate . this is because we are interested in the endpoints of the gene expression trajectory , but not in the exact path taken . therefore , the relationship between the damage spreading and robustness to noise is not trivial . in fact , it is quite counterintuitive as explained below . as shown in figs . [ fig : stats1](g ) , ( h ) and ( i ) , densely connected networks have a greater number of larger basins as their basin - size distributions essentially follow a power law for about two decades . the effect of the connectivity on @xmath69 is similar , as shown in fig . [ fig : before - and - after - plots](c ) . networks with low connectivity have small principal basins both before and after selection . more densely connected networks have larger @xmath69 before selection . we see a small increase in networks with @xmath60 , while fully connected networks ( @xmath70 increase their @xmath71 significantly after evolution . however , compared to the change in mutational robustness , the effect of selection on the size of the principal basin is modest for highly connected networks . although greater connectivity increases the damage spreading ( sensitivity to small perturbations ) , the dynamical robustness of the trajectory , @xmath72 , as well , increases with the connectivity ( fig . [ fig : before - and - after - plots](d ) ) . networks with @xmath73 have a small @xmath74 both before and after selection . the @xmath72 curve for the viables has a maximum around @xmath75 , which also shows no improvement after selection . this indicates that the networks with @xmath76 are intrinsically robust to noise , but not evolvable . viable networks with higher connectivity have monotonically decreasing values of @xmath74 , but the selection improves their average robustness significantly , above or up to the same level as the networks with @xmath75 . the robustnesses of the initial state , @xmath77 , and the final state , @xmath78 ( figs . [ fig : before - and - after - plots](e ) and ( f ) ) follow the same trend . the robustnesses of the principal basin , @xmath79 , and state space , @xmath80 , ( figs . [ fig : before - and - after - plots](g ) and ( h ) ) do not show as much improvement with selection . this implies that the effect of selection is more local ( on the specific gene - expression trajectory ) than global in terms of the change in dynamics . our results above agree with the findings by @xcite , who used very similar parameters to measure robustness to noise . we note that most of the robustness measures discussed above do not increase monotonically with @xmath81 for the viable networks ( i.e. , before selection ) . for example , @xmath82 for viable networks has a maximum around @xmath83 ( fig . [ fig : before - and - after - plots](a ) ) . this probably indicates that these quantities depend on more than one parameter ( like the principal basin size and the magnitude of the damage spreading ) , some increasing and some decreasing with increasing @xmath81 . for the evolved networks , however , @xmath82 , @xmath71 , and @xmath74 increase monotonically with @xmath84 at least for the range tested in this paper . this indicates that networks of higher connectivity are more evolvable when mutational robustness is considered . however , these networks are more chaotic on average compared to the ones of low connectivity , regardless of selection . mean mutational robustness ( @xmath85 transient time @xmath86 , normalized size of the principal basin @xmath87 , robustnesses of the trajectory @xmath88 , initial state @xmath89 , final state @xmath90 , principal basin @xmath91 , and state space @xmath92 before ( viable ) and after evolution ( evolved ) for @xmath16 and @xmath73 , 2.5 , 5 , 7.5 and 10 averaged over 10,000 networks . the error bars are equal to one standard deviation ( not standard error ) . @xmath69 is normalized by @xmath56 . the lines connecting the symbols are guides to the eye.,title="fig : " ] mean mutational robustness ( @xmath85 transient time @xmath86 , normalized size of the principal basin @xmath87 , robustnesses of the trajectory @xmath88 , initial state @xmath89 , final state @xmath90 , principal basin @xmath91 , and state space @xmath92 before ( viable ) and after evolution ( evolved ) for @xmath16 and @xmath73 , 2.5 , 5 , 7.5 and 10 averaged over 10,000 networks . the error bars are equal to one standard deviation ( not standard error ) . @xmath69 is normalized by @xmath56 . the lines connecting the symbols are guides to the eye.,title="fig : " ] mean mutational robustness ( @xmath85 transient time @xmath86 , normalized size of the principal basin @xmath87 , robustnesses of the trajectory @xmath88 , initial state @xmath89 , final state @xmath90 , principal basin @xmath91 , and state space @xmath92 before ( viable ) and after evolution ( evolved ) for @xmath16 and @xmath73 , 2.5 , 5 , 7.5 and 10 averaged over 10,000 networks . the error bars are equal to one standard deviation ( not standard error ) . @xmath69 is normalized by @xmath56 . the lines connecting the symbols are guides to the eye.,title="fig : " ] mean mutational robustness ( @xmath85 transient time @xmath86 , normalized size of the principal basin @xmath87 , robustnesses of the trajectory @xmath88 , initial state @xmath89 , final state @xmath90 , principal basin @xmath91 , and state space @xmath92 before ( viable ) and after evolution ( evolved ) for @xmath16 and @xmath73 , 2.5 , 5 , 7.5 and 10 averaged over 10,000 networks . the error bars are equal to one standard deviation ( not standard error ) . @xmath69 is normalized by @xmath56 . the lines connecting the symbols are guides to the eye.,title="fig : " ] mean mutational robustness ( @xmath85 transient time @xmath86 , normalized size of the principal basin @xmath87 , robustnesses of the trajectory @xmath88 , initial state @xmath89 , final state @xmath90 , principal basin @xmath91 , and state space @xmath92 before ( viable ) and after evolution ( evolved ) for @xmath16 and @xmath73 , 2.5 , 5 , 7.5 and 10 averaged over 10,000 networks . the error bars are equal to one standard deviation ( not standard error ) . @xmath69 is normalized by @xmath56 . the lines connecting the symbols are guides to the eye.,title="fig : " ] mean mutational robustness ( @xmath85 transient time @xmath86 , normalized size of the principal basin @xmath87 , robustnesses of the trajectory @xmath88 , initial state @xmath89 , final state @xmath90 , principal basin @xmath91 , and state space @xmath92 before ( viable ) and after evolution ( evolved ) for @xmath16 and @xmath73 , 2.5 , 5 , 7.5 and 10 averaged over 10,000 networks . the error bars are equal to one standard deviation ( not standard error ) . @xmath69 is normalized by @xmath56 . the lines connecting the symbols are guides to the eye.,title="fig : " ] mean mutational robustness ( @xmath85 transient time @xmath86 , normalized size of the principal basin @xmath87 , robustnesses of the trajectory @xmath88 , initial state @xmath89 , final state @xmath90 , principal basin @xmath91 , and state space @xmath92 before ( viable ) and after evolution ( evolved ) for @xmath16 and @xmath73 , 2.5 , 5 , 7.5 and 10 averaged over 10,000 networks . the error bars are equal to one standard deviation ( not standard error ) . @xmath69 is normalized by @xmath56 . the lines connecting the symbols are guides to the eye.,title="fig : " ] mean mutational robustness ( @xmath85 transient time @xmath86 , normalized size of the principal basin @xmath87 , robustnesses of the trajectory @xmath88 , initial state @xmath89 , final state @xmath90 , principal basin @xmath91 , and state space @xmath92 before ( viable ) and after evolution ( evolved ) for @xmath16 and @xmath73 , 2.5 , 5 , 7.5 and 10 averaged over 10,000 networks . the error bars are equal to one standard deviation ( not standard error ) . @xmath69 is normalized by @xmath56 . the lines connecting the symbols are guides to the eye.,title="fig : " ] and @xmath73 , 2.5 , 5 , 7.5 , and 10 . the @xmath93-value is much smaller than 0.01 for all correlation coefficients with an absolute value above 0.03 . @xmath94 , @xmath95 , @xmath96 , @xmath97 , @xmath98 , @xmath99 , @xmath100 and @xmath101 denote changes in normalized size of the transient time , size of the principal basin , robustnesses of the trajectory , initial state , final state , principal basin , and state space , and damage spreading , respectively . the dynamical robustness of the trajectory includes the contribution from the final state . the lines connecting the symbols are guides to the eye . see text for details.[fig : correlations],title="fig : " ] and @xmath73 , 2.5 , 5 , 7.5 , and 10 . the @xmath93-value is much smaller than 0.01 for all correlation coefficients with an absolute value above 0.03 . @xmath94 , @xmath95 , @xmath96 , @xmath97 , @xmath98 , @xmath99 , @xmath100 and @xmath101 denote changes in normalized size of the transient time , size of the principal basin , robustnesses of the trajectory , initial state , final state , principal basin , and state space , and damage spreading , respectively . the dynamical robustness of the trajectory includes the contribution from the final state . the lines connecting the symbols are guides to the eye . see text for details.[fig : correlations],title="fig : " ] and @xmath73 , 2.5 , 5 , 7.5 , and 10 . the @xmath93-value is much smaller than 0.01 for all correlation coefficients with an absolute value above 0.03 . @xmath94 , @xmath95 , @xmath96 , @xmath97 , @xmath98 , @xmath99 , @xmath100 and @xmath101 denote changes in normalized size of the transient time , size of the principal basin , robustnesses of the trajectory , initial state , final state , principal basin , and state space , and damage spreading , respectively . the dynamical robustness of the trajectory includes the contribution from the final state . the lines connecting the symbols are guides to the eye . see text for details.[fig : correlations],title="fig : " ] and @xmath73 , 2.5 , 5 , 7.5 , and 10 . the @xmath93-value is much smaller than 0.01 for all correlation coefficients with an absolute value above 0.03 . @xmath94 , @xmath95 , @xmath96 , @xmath97 , @xmath98 , @xmath99 , @xmath100 and @xmath101 denote changes in normalized size of the transient time , size of the principal basin , robustnesses of the trajectory , initial state , final state , principal basin , and state space , and damage spreading , respectively . the dynamical robustness of the trajectory includes the contribution from the final state . the lines connecting the symbols are guides to the eye . see text for details.[fig : correlations],title="fig : " ] and @xmath73 , 2.5 , 5 , 7.5 , and 10 . the @xmath93-value is much smaller than 0.01 for all correlation coefficients with an absolute value above 0.03 . @xmath94 , @xmath95 , @xmath96 , @xmath97 , @xmath98 , @xmath99 , @xmath100 and @xmath101 denote changes in normalized size of the transient time , size of the principal basin , robustnesses of the trajectory , initial state , final state , principal basin , and state space , and damage spreading , respectively . the dynamical robustness of the trajectory includes the contribution from the final state . the lines connecting the symbols are guides to the eye . see text for details.[fig : correlations],title="fig : " ] and @xmath73 , 2.5 , 5 , 7.5 , and 10 . the @xmath93-value is much smaller than 0.01 for all correlation coefficients with an absolute value above 0.03 . @xmath94 , @xmath95 , @xmath96 , @xmath97 , @xmath98 , @xmath99 , @xmath100 and @xmath101 denote changes in normalized size of the transient time , size of the principal basin , robustnesses of the trajectory , initial state , final state , principal basin , and state space , and damage spreading , respectively . the dynamical robustness of the trajectory includes the contribution from the final state . the lines connecting the symbols are guides to the eye . see text for details.[fig : correlations],title="fig : " ] and @xmath73 , 2.5 , 5 , 7.5 , and 10 . the @xmath93-value is much smaller than 0.01 for all correlation coefficients with an absolute value above 0.03 . @xmath94 , @xmath95 , @xmath96 , @xmath97 , @xmath98 , @xmath99 , @xmath100 and @xmath101 denote changes in normalized size of the transient time , size of the principal basin , robustnesses of the trajectory , initial state , final state , principal basin , and state space , and damage spreading , respectively . the dynamical robustness of the trajectory includes the contribution from the final state . the lines connecting the symbols are guides to the eye . see text for details.[fig : correlations],title="fig : " ] and @xmath73 , 2.5 , 5 , 7.5 , and 10 . the @xmath93-value is much smaller than 0.01 for all correlation coefficients with an absolute value above 0.03 . @xmath94 , @xmath95 , @xmath96 , @xmath97 , @xmath98 , @xmath99 , @xmath100 and @xmath101 denote changes in normalized size of the transient time , size of the principal basin , robustnesses of the trajectory , initial state , final state , principal basin , and state space , and damage spreading , respectively . the dynamical robustness of the trajectory includes the contribution from the final state . the lines connecting the symbols are guides to the eye . see text for details.[fig : correlations],title="fig : " ] the recent theoretical and computational work on gene regulatory networks @xcite indicates that there is a strong link between mutational robustness and robustness to noise . in order to see the relation between these two quantities , we calculated the correlation coefficients between the change in mutational robustness ( @xmath102 ) and changes in different measures of robustness to noise , as well as transient time and the damage spreading as functions of linkage density . changes in the transient time and mutational robustness are highly correlated in agreement with the earlier studies @xcite . the principal basin size does not seem to have much effect on @xmath103 , as the correlation between their changes is quite weak ( fig . [ fig : correlations](b ) ) . although a larger principal basin size means greater robustness to noise , this result suggests that it is not strongly selected for . changes in robustnesses of the initial state , final state , principal basin , and state space are also correlated with @xmath102 ( figs . [ fig : correlations](c ) , ( d ) , ( e ) , and ( f ) ) . the weak correlation between the changes in the damage spreading and mutational robustness ( fig . [ fig : correlations](h ) ) imply that it is not the change in dynamical behavior that brings mutational robustness . in this paper , we have analyzed changes in state - space properties of model genetic regulatory networks under selection for an optimal phenotype . both numerical stability analysis and the state - space statistics indicate that the difference between the global dynamical properties of mutationally robust networks that have undergone selection and their random ancestors are quite small . furthermore , the correlation between the changes in the damage spreading and the mutational robustness is weak . therefore , changes in the global dynamical properties do not seem to be responsible for the increase in mutational robustness after selection . dynamics of many random threshold networks , as well as random boolean networks , depend largely on their connectivity distributions . variants of the random threshold networks used in this paper have been shown to have a chaotic phase above @xmath104 , depending on the model details @xcite . essentially , rtns have a chaotic phase for sufficiently large @xmath23 @xcite just as rbns @xcite . the connectivity of a network affects the evolvability of its mutational robustness , as well as its dynamical character . for viable ( essentially random ) networks , the mutational robustness is very similar for all connectivities @xcite . for the evolved networks , however , it increases monotonically with increasing connectivity , creating drastic differences for large @xmath23 . the dynamical robustness of the gene - expression trajectory , the initial state , and the final state follow similar trends . these results clearly indicate that the stability of the system as measured by the damage spreading does not capture its dynamical characteristics in this context . as pointed out in a recent paper by @xcite , selection decreases the transient time by picking the `` proper '' interaction constants to construct a shorter ( or direct ) path from @xmath14 to @xmath21 . both @xcite and @xcite stated that mutationally robust networks are the ones that have found a path for the gene expression trajectory at a safe distance from the basin boundary , so that small perturbations can not kick them into a different basin . thus , even if the selection operates only on the stability of the stationary gene - expression pattern , robustness to mutations intrinsically requires stability of the gene - expression trajectory against small perturbations . there is also some experimental evidence supporting the association between genetic and non - genetic change @xcite . although it might seem like robustness to noise evolves as a by - product of robustness to mutations , the converse case is also true @xcite . thus , robustness to noise and robustness to mutations seem to evolve mutually when certain conditions are met @xcite . the analysis of the cell - cycle regulatory network of budding yeast provides further evidence for the chaotic behavior of gene networks @xcite . the simplified form of this network has 11 nodes ( genes or proteins ) , one checkpoint ( an external input , in this case , the cell size ) , and 34 links including self - degrading interactions . using a dynamical model similar to the one used in this paper , @xcite _ _ _ _ showed that the stationary state of the network has a basin occupying 86% of the state space . @xcite studied an ensemble of networks that can perform the same function , i.e. , the 12-step sequence of transitions in the expression trajectory , and found that these functional networks have larger basins for the stationary state ( consequently , broadly distributed basin sizes ) , fewer attractors , longer transient times , and a larger damage - spreading rate compared to their randomized counterparts . they concluded that those dynamical features emerge due to the functional constraints on the network . here , we showed that those features , which are signs of chaotic dynamics , can arise under the presence of structural perturbations ( mutations ) if the connectivity of the network is large enough , even when the constraints on the function are minimal , i.e. , when the only selection is on the phenotype . although the length of the gene - expression trajectory of the yeast cell - cycle network needs further explanation in terms of mutational robustness , it appears like chaotic dynamics may be a design principle underlying seemingly `` boring '' and ordered behavior generally seen in models of gene regulatory networks , where a simple cascade of expression terminates at a stationary state @xcite . the effect of network topology on evolvability of robustness is another aspect of the problem , which we do not discuss in this paper @xcite . however , we would like to point out that recent studies indicate that certain topological features , such as connectivity , are not very crucial in determining the response of cellular networks to genetic or non - genetic change @xcite , and there may be other factors shaping their topological structure @xcite . our results also imply that the `` life at the edge of chaos '' hypothesis @xcite , which suggests adaptability ( evolvability ) is maximized in the critical regime does not seem to be necessary , at least not to explain evolvability of robustness to mutations and noise . indeed , recent studies concerning dynamics of genetic regulatory networks do not indicate any special feature brought by criticality @xcite . the `` edge of chaos '' concept was primarily developed to describe the phase in which cellular automata can perform universal computation @xcite , and it may not be related to dynamics and evolution of biochemical pathways as was once thought . to summarize , our study indicates that conventional measures of stability may not be very informative about robustness to mutations or noise in gene regulatory networks when one considers the steady gene - expression pattern as the robust feature of the network . also , the dynamics underlying the simple gene - expression trajectories can be very rich , reflecting a complex state - space structure . the online version of this article contains supplementary material : linearly binned histograms of the data represented in figs . [ fig : stats1 ] and [ fig : stats2 ] , probability densities for the hamming distance between the initial and final states , the magnitude of the damage spreading before and after evolution , and probability densities for the latter . we thank t. f. hansen , s. bornholdt , g. brown , d. balcan , b. uzunolu , p. oikonomou , and a. pagnani for helpful discussions . this research was supported by u.s . national science foundation grant nos . dmr-0240078 and dmr-0444051 , and by florida state university through the school of computational science , the center for materials research and technology , and the national high magnetic field laboratory . albert , r. , othmer , h. g. , 2003 . the topology of the regulatory interactions predicts the expression pattern of the segment polarity genes in _ drosophila melanogaster_. j. theor . 223 ( 1 ) , 1 18 . aldana , m. , coppersmith , s. , kadanoff , l. p. , 2003 . boolean dynamics with random couplings . in : kaplan , e. , marsden , j. e. , sreenivasan , k. r. ( eds . ) , perspectives and problems in nonlinear science . a celebratory volume in honor of lawrence sirovich . springer , berlin heidelberg new york , pp . 2389 . azevedo , r. b. r. , lohaus , r. , srinivasan , s. , dang , k. k. , burch , c. l. , 2006 . sexual reproduction selects for robustness and negative epistasis in artificial gene networks . nature ( london ) 440 ( 7080 ) , 87 90 . balcan , d. , kabakiolu , a. , mungan , m. , erzan , a. , 2007 . the information coded in the yeast response elements accounts for most of the topological properties of its transcriptional regulation network . plos one 2 ( 6 ) , e501 . de visser , j. a. g. m. , hermisson , j. , wagner , g. p. , meyers , l. a. , bagheri - chaichian , h. , blanchard , j. l. , chao , l. , cheverud , j. m. , elena , s. f. , fontana , w. , gibson , g. , hansen , t. f. , krakauer , d. , lewontin , r. c. , ofria , c. , rice , s. h. , von dassow , g. , wagner , a. , whitlock , m. c. , 2003 . perspective : evolution and detection of genetic robustness . evolution 57 ( 9 ) , 1959 1972 . ellson , j. , gansner , e. r. , koutsofios , e. , north , s. c. , woodhull , g. , 2003 . graphviz and dynagraph static and dynamic graph drawing tools . in : junger , m. , mutzel , p. ( eds . ) , graph drawing software . springer - verlag , berlin heidelberg new york , pp . 127148 . von dassow , g. , odell , g. m. , 2002 . design and constraints of the _ drosophila _ segment polarity module : robust spatial patterning emerges from intertwined cell state switches . j. exp . 294 ( 3 ) , 179 215 .

robustness to mutations and noise has been shown to evolve through stabilizing selection for optimal phenotypes in model gene regulatory networks . the ability to evolve robust mutants is known to depend on the network architecture . how do the dynamical properties and state - space structures of networks with high and low robustness differ ? does selection operate on the global dynamical behavior of the networks ? what kind of state - space structures are favored by selection ? we provide damage propagation analysis and an extensive statistical analysis of state spaces of these model networks to show that the change in their dynamical properties due to stabilizing selection for optimal phenotypes is minor . most notably , the networks that are most robust to both mutations and noise are highly chaotic . certain properties of chaotic networks , such as being able to produce large attractor basins , can be useful for maintaining a stable gene - expression pattern . our findings indicate that conventional measures of stability , such as the damage - propagation rate , do not provide much information about robustness to mutations or noise in model gene regulatory networks .

apoptosis , or programmed cell death , is an essential physiological process ; dysfunction of this process has been linked to pathogenesis of cancer and other diseases ( thompson 1995 ) . the study of apoptotic processes has helped to focus the development of new therapies for the treatment of cancer ( hughes and mehmet 2003 ) . a rapid method to detect the onset of apoptosis is a useful adjunct to the monitoring of surrogate tissue in order to evaluate the effects of new cancer therapies in clinical trial settings . in the study of apoptosis , focus has largely been placed on methods that address the different stages of apoptosis following treatment of cells with apoptosis - inducing agents . for example , the annexin v assay is associated with the monitoring of changes in the proteins of the plasma membrane . this method , as with many other assays associated with the detection of apoptosis , is flow cytometry - based ; early - phase apoptotic cells have exposed phosphatidyl serine ( ps ) residues to which fitc - conjugate annexin v binds . another technique uses the membrane potential sensitive probe tmre ( tetra - methyl rhodamine ) to detect changes in the mitochondrial membrane potential . there is a tremendous variability in the kinetics of apoptosis induction , some cells being fully apoptotic after only 24 hours of treatment with staurosporine , such as jurkat t - lymphocytes , while some epithelial cells require nearly 24 hours of treatment with this inducer . hence , the delay before any biochemical change can be detected after adding an inducer to the cells is significant for the assessment of the drug treatment . however , relatively little is known about the events that occur within the cell prior to detection of apoptosis using standard biochemical techniques . one event known to occur early in the apoptotic process is that changes occur in the ion concentration inside the cell ( bortner et al 1997 ) . if such changes affect the cell electrical conductivity , apoptosis can be studied using methods capable of determining the dielectric properties of cells , which would offer a particularly and important assessment method . dielectrophoresis ( dep ) , described by pohl ( 1978 ) , is one of the techniques collectively termed ac - electrokinetics , and involves the movement of particles in non - uniform time - variant fields . dep has numerous potential applications in the context of cell biology , as observing the cellular response to various stimuli , measured as a function of frequency of the applied electric field , allows the non - invasive determination of the dielectric properties of both the membrane and the cytoplasm of cells . dep can provide quantitative analysis of electrophysiological properties of cells , and in our earlier studies it has been used to investigate chemotherapy resistance in cancer cells ( labeed et al 2003 ) . moreover , dep has been employed in a number of other experimental settings using cancer cell line models ( hu et al 1990 ; gascoyne et al 1992 , 1993 ; becker et al 1994 ; gascoyne et al 1997 ; wang et al 1997 , 1999 ; cristofanilli et al 2002 ; labeed et al 2006 ) . recently , it has also been employed to accurately study the dielectric changes of human leukemic cells at different stages of apoptosis , as well as necrosis ( wang et al 2002 ) in this study , we used a human chronic myelogenous leukemic cell line k562 , staurosporine for apoptosis induction , and the two techniques ( annexin v - fitc assay and dep ) in order to assess whether apoptotic induction could be detected 30 minutes and 1 hour following treatment . the dep data revealed that there is a significant change in the ionic content of the cytoplasm in k562 cells 30 minutes after treatment with staurosporine . additionally , a second population of necrotic cells was observed that increased in number over the hour , from 25% to 33% . the latter effect was not detectable using the annexin v technique , since no pi expression was measured during the same period . this indicates that dep can be used as a powerful and informative tool to detect very early - stage apoptosis . furthermore , the technique is low - cost , and has potential applications for parallelization in high - throughput systems ( hbner et al 2005 ) . staurosporine ( alexis corporation , nottingham , uk ) was dissolved in dimethyl sulfoxide ( dmso ) , and stored frozen as a 1 mm stock solution and thawed prior to use . human chronic myelogenous leukemia ( k562 ) was grown in modified rpmi-1640 medium supplemented with 10% heat inactivated fetal calf serum ( fcs ; invitrogen , paisley , uk ) , 2 m m l - glutamine , and 100 units / ml penicillin the cells were grown under standard cell culture conditions , with 5% co2/95% air at 37c . a density of 610 cells / ml were treated with an apoptosis - inducing agent ( staurosporine ) at 1 m final concentration , and incubated for 30 minutes , and 1 hour time points . the pellets were washed and resuspended in isotonic medium consisting of 8.5% ( w / v ) sucrose plus 0.3% ( w / v ) dextrose buffer ( gascoyne et al 1997 ) . the medium conductivity was adjusted to 2.5 m s / m using pbs and the final conductivity , before use , was verified with a conductivity meter ( rs components ltd , london , uk ) . the final cell population was counted using a hemocytometer and adjusted to approximately 310 cells / ml ( 15% ) for dep measurements . the dep system used in this study was similar to that reported by labeed et al ( 2003 ) . the biophysical properties of the cells , after each staurosporine incubation period , were determined by fitting the measurement spectra to the single shell model ( irimajiri et al 1979 ) . the best fit model was found by matching the curve to the measured data , and then altering the dielectric parameters of the membrane and the cytoplasm until a best match was found . for each staurosporine incubation period , the experiment was repeated at least 5 times , using different cell population at a time in order to reduce the effect of variation in cell number . the results , for each time point , were summed prior to modeling . in order to determine cell size for dep calculations , cell diameters were measured using photolite software to analyze microscope images of cells . in normal viable cells , the phosphatidylserine ( ps ) molecules are located on the cytoplasmic surface of the cell membrane . when apoptosis occurs , rapid alterations in the organization of the phospholipids take place leading to exposure of ps on the cell surface ( fadok et al 1992 ; martin et al 1995 ) . for these experiments , the rapid annexin v - fitc detection kit ( cn biosciences , beeston , uk ) was used . the assay principle uses fitc - conjugate annexin v to detect ps exposure by flow cytometry . simultaneously , propidium iodide ( pi ) was used to distinguish viable , necrotic or apoptotic cells in the late terminal stages , as pi is internalized only in cells whose membranes have become permeable . a population of around 0.510 cells in culture media was used for each datum and the method was carried out according to manufacturer s instructions . the analysis was performed using a flow cytometer ( coulter epics xl ) emitting an excitation laser light at 488 nm . the detection was made using an fitc detector at 518 nm and a pi detector at 620 nm . staurosporine ( alexis corporation , nottingham , uk ) was dissolved in dimethyl sulfoxide ( dmso ) , and stored frozen as a 1 mm stock solution and thawed prior to use . human chronic myelogenous leukemia ( k562 ) was grown in modified rpmi-1640 medium supplemented with 10% heat inactivated fetal calf serum ( fcs ; invitrogen , paisley , uk ) , 2 m m l - glutamine , and 100 units / ml penicillin the cells were grown under standard cell culture conditions , with 5% co2/95% air at 37c . a density of 610 cells / ml were treated with an apoptosis - inducing agent ( staurosporine ) at 1 m final concentration , and incubated for 30 minutes , and 1 hour time points . the pellets were washed and resuspended in isotonic medium consisting of 8.5% ( w / v ) sucrose plus 0.3% ( w / v ) dextrose buffer ( gascoyne et al 1997 ) . the medium conductivity was adjusted to 2.5 m s / m using pbs and the final conductivity , before use , was verified with a conductivity meter ( rs components ltd , london , uk ) . the final cell population was counted using a hemocytometer and adjusted to approximately 310 cells / ml ( 15% ) for dep measurements . the dep system used in this study was similar to that reported by labeed et al ( 2003 ) . the biophysical properties of the cells , after each staurosporine incubation period , were determined by fitting the measurement spectra to the single shell model ( irimajiri et al 1979 ) . the best fit model was found by matching the curve to the measured data , and then altering the dielectric parameters of the membrane and the cytoplasm until a best match was found . for each staurosporine incubation period , the experiment was repeated at least 5 times , using different cell population at a time in order to reduce the effect of variation in cell number . the results , for each time point , were summed prior to modeling . in order to determine cell size for dep calculations , cell diameters in normal viable cells , the phosphatidylserine ( ps ) molecules are located on the cytoplasmic surface of the cell membrane . when apoptosis occurs , rapid alterations in the organization of the phospholipids take place leading to exposure of ps on the cell surface ( fadok et al 1992 ; martin et al 1995 ) . for these experiments , the rapid annexin v - fitc detection kit ( cn biosciences , beeston , uk ) was used . the assay principle uses fitc - conjugate annexin v to detect ps exposure by flow cytometry . simultaneously , propidium iodide ( pi ) was used to distinguish viable , necrotic or apoptotic cells in the late terminal stages , as pi is internalized only in cells whose membranes have become permeable . a population of around 0.510 cells in culture media was used for each datum and the method was carried out according to manufacturer s instructions . the analysis was performed using a flow cytometer ( coulter epics xl ) emitting an excitation laser light at 488 nm . the detection was made using an fitc detector at 518 nm and a pi detector at 620 nm . we have used dep and annexin v assay to investigate whether it is possible to detect cellular changes as early as 30 minutes and 1 hour post apoptosis induction by staurosporine . the annexin v assay uses fitc - conjugate annexin v to detect ps exposure by flow cytometry , while simultaneously , pi dye is used to distinguish viable , necrotic or apoptotic cells in the late terminal stages , as pi is internalized only in cells whose membranes have become permeable . the results of the annexin / pi study are shown in figure 1 . at both incubation points , early apoptotic cells were not detected , and staursporine - treated cells did not differ significantly from untreated controls . the percentage of viable , early apoptotic , and necrotic populations after different incubation periods with staurosporine , as measured using flow cytometry and annexin v / pi . the cell collection versus frequency for the dep of untreated k562 control cells , and after 30 and 60 minutes of treatment with staurosporine , are shown in figure 2a , b , and c , respectively . in all three cases , cell collection was observed at frequencies of more than 10 khz , and declined at more than 23 mhz . after 30 and 60 minutes of exposure , the decline in the rate of collection at the high frequency range ( above 2 or 3 mhz ) indicated two distinct plateaus . it has been reported that multiple plateaus indicate the presence of more than one sub - population with different properties ( broche et al 2005 ) . in this study , the best fits for the post - treatment data were obtained after superimposing two single shell models , as suggested by broche et al ( 2005 ) . the superimposed fit can be seen in figures 2b and c ( for 30 and 60 minutes post exposure to staurosporine , respectively ) . the estimated dielectric parameters derived from the data obtained for each incubation period are summarized in table 1 . as can be seen , the control untreated cells exhibited a cytoplasmic conductivity ( cyto , reflecting the ionic concentration ) of 0.23 s / m , and a specific membrane capacitance ( cspec , reflecting membrane morphology ) of 9.7 mf / m . after 30 minutes of staurosporine treatment , two plateaus could be observed from the dep data suggesting the presence of more than one population in the sample . the majority of the sample ( approximately 75% ) , referred to here as population 1 , exhibited a significantly higher cyto ( 0.4 s / m ) , and a slightly higher cspec ( 10.4 mf / m ) relative control cells . the remaining proportion of the sample ( approximately 25% , referred to as population 2 ) displayed a significantly lower cyto ( 0.05 s / m ) . after 60 minutes of staurosporine treatment , the occurrence of two plateaus was persistent , where the majority of cells ( approximately 67% ) showed a persistent rise in cyto ( 0.40 s / m ) , and a gradual increase in cspec ( 12.4 mf / m2 ) . the second population , constituting approximately 33% , exhibited a low cyto ( 0.02 s / m ) . the surface conductance parameter ks ( reflecting cell surface charge ) did not change significantly throughout these incubation periods . these results show a persistent increase in the ionic concentration of the cytoplasm in the majority of cells following staurosporine treatment relative to control untreated cells . summed dielectrophoretic collection spectra showing the number of cells collected for different energizing frequencies , for 5 experiments per condition . ( a ) control population ; ( b ) cells 30 minutes after exposure to staurosporine ; ( c ) cells 1 hour after exposure to staurosporine . electrophysiological data of k562 cells before and after apoptosis treatment with staurosporine , derived from dielectrophoresis data one possible mechanism is that throughout the apoptotic process the cells become smaller , causing the cytoplasm to become more concentrated with remaining ions . cell radii were measured before and after treatment ; before treatment , the cells had a mean radius of 9.2 m , which dropped to 8.2 m after exposure . although this change in radius is small , the attendant 30% reduction in volume is proportional to the observed change in conductivity , indicating that the volume may have a significant influence on the conductivity of the cytoplasm . this may be due to the remaining charged molecules ( including macromolecules such as dna and proteins ) becoming more concentrated as the water is effluxed to restore the osmotic balance , increasing the conductivity of the interior . at both time points , population 2 typically , a very low value of cyto ( approaching that of the suspending medium ) is indicative of necrosis , as the membrane permeabilizes and the cell interior equilibrates with the medium . the fact that cyto in population 2 , although much lower than that of population 1 , is still an order of magnitude higher than the suspending medium may indicate that we are observing the onset of cell necrosis , where membrane permeabilization is relatively small . this would also explain why the pi assay fails to show a significant necrotic population , as the assay relies on significant membrane permeability in order to incorporate sufficient dye in the cytoplasm of necrotic cells . in this paper we have shown using dep , that the majority of k562 cells show a persistent elevation in the cytoplasmic conductivity ( ionic content ) , occurring as early as 30 minutes following exposure to staurosporine . a possible explanation for this rise in cytoplasmic conductivity may involve many ionic or ion channel hypotheses that have been described in the literature , some of which are contradictory ; however , the mechanism we suggest here is that this change is shrinkage dependent , and involves an increased ion influx . the dep results indicate that there is an increasing proportion of necrotic cells at the two time points after staurosporine exposure , indicating that the cell population responds to apoptosis - inducing drugs either by joining a slow apoptotic cascade , or by near - immediate necrosis . furthermore , when the dep results were compared with that of the annexin v assay , dep was found to be a powerful and a more informative tool , as it was capable of detecting cellular changes associated with very early - stage apoptosis , and as early as 30 minutes post staurosporine exposure . the technique is also low - cost , and has potential applications for parallelization in high - throughput systems ( hbner et al 2005 ) .

apoptosis , or programmed cell death , is a vital cellular process responsible for causing cells to self - terminate at the end of their useful life . abrogation of this process is commonly linked to cancer , and rapid detection of apoptosis in vitro is vital to the discovery of new anti - cancer drugs . in this paper , we describe the application of the electrical phenomenon dielectrophoresis for detecting apoptosis at very early stages after drug induction , on the basis of changes in electrophysiological properties . our studies have revealed that k562 ( human myelogenous leukemia ) cells show a persistent elevation in the cytoplasmic conductivity occurring as early as 30 minutes following exposure to staurosporine . this method therefore allows a far more rapid detection method than existing biochemical marker methods .

*UPDATE: The statistic above, which has been cited repeatedly including by PBS, may be wrong. Or at least it does not appear to be in the academic study that PBS referred to. Our readers and others have said that the correct percentage is ~2%-3%, not 9%. ORIGINAL: It has often been said that lotteries are a tax on the poor. And that's a fair description. Joe Weisenthal pointed out yesterday that poor people regularly buy lottery tickets, while rich people only buy them when the jackpots have gotten huge. What's less commonly realized is just how much money poor people spend on lottery tickets. According to a 2008 study, reported by PBS, households that earn less than $13,000 a year spend a staggering 9% of their income on lottery tickets. (via Scott Heiferman). That's 9% of an income that is presumably extraordinarily hard to live on to begin with. Rich, educated people tend to ridicule lottery players because the odds against winning are so astronomical. As PBS points out, you are 17-times more likely to get hit by falling airplane parts than you are to win the lottery. And you're 50-times more likely to get hit by lightning. But poor people keep on buying lottery tickets. Why? Because they're stupid? That's the popular explanation, at least among rich non-lottery players. But the more accurate explanation is probably that having any chance at radically improving their circumstances is probably better than having no chance. In any event, the fact that households that earn $13,000 or less spend 9% of their incomes on lottery tickets raises a few questions. First, are those households receiving money from the government in the form of food stamps, tax breaks, or welfare? If so, is it really fair to spend taxpayer money on lottery tickets? Is that what the folks who support assistance to poor households expect the money to be spent on? Second, given that lotteries are primarily used to generate revenue for states, might it not be fairer to just collect the revenue directly, as taxes? Or have lotteries discovered a magical way to tax people--one in which even anti-tax crusaders voluntarily choose to pay huge taxes in exchange for a minuscule chance of making a killing? Should the United States government raise ALL its tax revenue that way? Anyway, the finding that households earning $13,000 spend 9% of their precious dollars on lottery tickets is startling. And depressing. And it's worth thinking more about whether the government should really be sponsoring lotteries. SEE ALSO: 14 Lottery Winners Who Blew It All ||||| JEFFREY BROWN: Finally tonight, a dollar and a dream for millions of Americans. Lotto fever, it seems, is sweeping the country. MAN: That's it. Guys, you are all invited to my island after I win this. Thanks. MAN: Which one is it with the most money? WOMAN: The Mega Millions. MAN: Give me one of those. WOMAN: One sucker's going to win. Somebody's going to be a rich one, okay? (LAUGHTER) JEFFREY BROWN: The biggest jackpot in history, $640 million, is at stake in tonight's Mega Millions multistate lottery -- 42 states, Washington, D.C., and the Virgin Islands participate, 85 percent of the country. Lines swelled today with hopefuls ready to plunk down a dollar for a chance at millions. WOMAN: One, two, three, and good luck. WOMAN: Thank you. JEFFREY BROWN: Lottery officials said one million tickets an hour sold in the 48 hours after Tuesday's drawing failed to produce a winner. GARY GRIEF, executive director, Texas State Lottery Commission: We have people coming out that have never bought a ticket before because they see this number and they think, gee, for just a dollar, I have a chance at a half-a-billion. It's hard not to take a chance on that. MAN: Thirty-five, 40, 45, 50. JEFFREY BROWN: The chance at big money, about $350 million after taxes if the prize is taken in one lump sum, had many who wouldn't otherwise play shelling out. ANDREA SLONE, Store Manager: Your typical customers that would normally buy like $2 worth of tickets are now spending $20 to $50 and up to -- even they're coming in with $100 sleeves. So, I mean, even the people that don't play are tempted. JEFFREY BROWN: Can the president be counted among the tempted? JAY CARNEY, White House press secretary: No, but I'm going to run out and buy one. JEFFREY BROWN: As did many others elsewhere in the nation's capital who dared to dream. JASON DAVIS, lottery player: I'm buying 30 tickets, because if I'm going to play against astronomical odds, I figure why go in just halfway? If I were to win, I would probably pay off my debts, quit my job, and give all of my staff a million dollars. WANDA BROWN, lottery player: I'm going to help some people and buy myself a nice house and a nice oceanfront property. Hopefully, I'm just the one that will win the money. JEFFREY BROWN: But what are the real chances of winning? A lousy one in 176 million. Some more reasonable odds, by comparison, getting hit by falling airplane parts, 17 times more likely. Or being hit by lightning, that's 50 times more likely to happen than winning tonight's big money. But there are longer odds out there, for instance, the chance of being eaten by a shark is 280 million to one. MAN: It's slim. It's slim, but I'm going to take that chance, like anybody else. JEFFREY BROWN: So, with such long odds, why do so many play? MIT Professor Andrew Lo studies the psychology of risk. ANDREW LO, professor, Massachusetts Institute of Technology: We have an imagination, an extraordinarily refined imagination. And, as a result, we can conjure up all sorts of really interesting scenarios of what we might do with the money if we won, and how happy we would be, and so on and so forth. And the very act of conjuring up these scenarios actually provides pleasure right now. So, in a way, what they're doing is buying the dream. JEFFREY BROWN: Retailers have a stake, too. The store that sells the winning ticket could get up to $100,000, although foot traffic is the real boon. RICK HARTMAN: Anybody that comes up so far since I have been here this morning, they come in for their coffee or whatever, they get their lottery tickets, too. JEFFREY BROWN: The states that participate in the drawing also stand to benefit. If there's a winner in tonight's drawing, just over a third of that $640 million will go to the winning state in taxes. In Georgia, for example, proceeds of the sale of tickets go to the HOPE Scholarship, which funds in-state college education for high-achieving students. Still, it's definitely not all fun and games. In economically stressed areas, many people who have less money to play still do. Households earning under $13,000 per year spend about 9 percent of their income on lottery tickets, on average, according to a 2008 study from "The Journal of Risk and Uncertainty." Of course, someone will win, but even that doesn't guarantee happiness. ANDREW LO: When you win that kind of money, everybody knows that you have won that kind of money. So, all of a sudden, distant relatives, friends, people you never heard of are coming into your lives, asking for just a little bit of that money. And that creates an enormous amount of tension and ultimately unhappiness. So I think it's a mixed blessing. JEFFREY BROWN: In the end, some will settle for small victories. . . MAN: I won $9 today. QUESTION: Back into the lottery or. . . MAN: I'll take my cash. JEFFREY BROWN: . . . while someone else will take about 71 million times more than that after a drawing tonight in Atlanta at 11:00 p.m.

– The Mega Millions jackpot has inspired much media babble about lottery winners, losers, and what to do if you actually win. But how about the effect of lotteries on the poor? Apparently, it's a killer "hidden tax"—because households banking less than $13,000 a year spend 9% of their annual income on lottery tickets. Business Insider found the shocking statistic in a PBS interview, and says it raises serious questions—like, are the poor too dumb to avoid odds 17 times worse than the chance of being hit by falling airplane parts? The likely answer: No, they're just grabbing at any chance to improve their circumstances. Looking behind the numbers, Business Insider poses more questions: With the poor receiving tax breaks, welfare, etc, is that money going straight into lottery tickets? Wouldn't it be better just to tax them? Or, in this tax-averse nation, is it better to raise all tax revenue through lotteries? While chewing on that, consider that some experts disagree with the 9% estimate, and say the poor throw away only 2% to 3% of their income on lottery tickets.

Last year's oil disaster in the Gulf of Mexico crippled most of the region's offshore-drilling industry, battered the coast's economy and hobbled one of the world's most powerful oil companies, BP PLC. Yet a year later, one central player in the Deepwater Horizon disaster remains largely unscathed: Halliburton Co. Aside from BP, the primary owner of the blown-out Macondo well, no company has faced more criticism for the deadly explosion and resulting oil spill than Halliburton. One of several service providers on the Deepwater Horizon drilling rig, it designed the failed cement seal that experts believe allowed explosive gas to ... ||||| Halliburton's net income more than doubled during the first three months of the year the company said Monday, as drilling activity in North America picked up. The price for a barrel of oil has jumped 17 percent this year, boosting demand sharply for companies like Halliburton, which provide a variety of services for oil and natural gas drillers. The Houston company reported first-quarter earnings of $511 million, or 56 cents per share, compared with $206 million, or 23 cents per share, in the same period last year. Revenue rose 40 percent to $5.28 billion. After adjusting for a $46 million charge related to international sanctions on oil operations in Libya, Halliburton said it earned 61 cents per share. Analysts had expected earnings of 58 cents per share on revenue of $4.87 billion, according to FactSet. Halliburton Co. posted a big revenue gains despite a slowdown in offshore drilling in the Gulf of Mexico and political turmoil in North Africa that halted oil production in Libya. The company said an "unabated shift" by the industry to developing oil on land, particularly in underground shale deposits in the U.S., more than offset that decline in activity. Revenue in North America surged 75 percent in the quarter while revenue from international operations increased 11 percent, according to the company. Completion and production revenue jumped 62 percent to $3.2 billion due to increased drilling activity in the U.S. Drilling and evaluation revenue increased 17 percent to $2.1 billion as activity picked up in the western hemisphere and Iraq. The rebellion in Libya will continue to hinder oil operations in the country, but overall, Halliburton President and CEO Dave Lesar said those projects will eventually return to normal. "We remain very optimistic about this market and expect to be profitable in 2011," Lesar said. Shares increased 31 cents to $47.13 in premarket trading.

– Despite challenges arising from political unrest in the Arab world, Halliburton's net income has more than doubled during the first quarter of 2011. The oil-field services company credits the soaring earnings to an increase in unconventional North American oil and natural-gas drilling; the AP reports that North American revenue jumped 75%, while revenue from international operations was up 11%. The Wall Street Journal notes that high oil prices also helped. Halliburton's first-quarter profit was $511 million, up from $206 million a year prior.

SECTION 1. SHORT TITLE. This Act may be cited as the ``Abstinence Education Reallocation Act of 2011''. SEC. 2. SEXUAL RISK AVOIDANCE EDUCATION. (a) Grants.--The Secretary of Health and Human Services, acting through the Administrator of the Health Resources and Services Administration, may award grants on a competitive basis to public and private entities to provide qualified sexual risk avoidance education to youth and their parents. (b) Qualified Sexual Risk Avoidance Education.--To qualify for funding under subsection (a), sexual risk avoidance education shall meet each of the following: (1) The education shall be age appropriate. (2) The education shall be medically accurate. (3) The education shall be an evidence-based approach. (4) The education shall have as its sole purpose teaching of the skills and benefits of sexual abstinence as the optimal sexual health behavior for youth. (5) The education shall include, consistent with paragraphs (1) through (4), teaching of each of the following: (A) The holistic health, economic, and societal benefits that can be gained by refraining from nonmarital sexual activity, through teaching practical skills that promote self-regulation, goal setting, and a focus on the future. (B) The clear advantage of reserving human sexual activity for marriage, as a key contributing factor in the prevention of poverty and the preservation of physical and emotional health, based on social science research. (C) The foundational components of a healthy relationship and related research regarding the individual, economic, and societal advantages of bearing children within the context of a committed marital relationship in order to form healthy marriages and safe and stable families. (D) The skills needed to resist the negative influences of the pervasive sex-saturated culture that presents teenage sexual activity as an expected norm, with few risks or negative consequences. (E) The understanding of how drugs, alcohol, and the irresponsible use of social media can negatively influence healthy sexual decision making and can contribute to aggressive sexual behavior. (F) A focused priority on the superior health benefits of sexual abstinence, ensuring that any information provided on contraception does not exaggerate its effectiveness in preventing sexually transmitted diseases and pregnancies. (c) Priority.--In awarding grants under subsection (a), the Secretary shall give priority to applicants proposing programs to provide qualified sexual risk avoidance education that-- (1) will serve youth spanning ages 12 to 19; and (2) will promote protective benefits of parent-child communication regarding healthy sexual decision making. (d) Definitions.--In this Act: (1) The term ``age appropriate'' means appropriate for the general developmental and social maturity of the age group (as opposed to the cognitive ability to understand a topic or the atypical development of a small segment of the targeted population). (2) The term ``evidence-based approach'' means an approach that-- (A) has a clear theoretical base that integrates research findings with practical implementation expertise that is relevant to the field; (B) matches the needs and desired outcomes for the intended audience; and (C) if implemented well, will demonstrate improved outcomes for the targeted population. (3) The term ``medically accurate'' means referenced to peer-reviewed research by medical, educational, scientific, governmental, or public health publications, organizations, or agencies. (4) The term ``sexual abstinence'' means voluntarily refraining from sexual activity. (5) The term ``sexual activity'' means genital contact or sexual stimulation including, but not limited to, sexual intercourse. (e) Authorization of Appropriations.-- (1) In general.--There is authorized to be appropriated $110,000,000 for each of fiscal years 2012 through 2016 to carry out this Act. Amounts authorized to be appropriated by the preceding sentence shall be derived exclusively from amounts in the Prevention and Public Health Fund established by section 4002 of the Patient Protection and Affordable Care Act (42 U.S.C. 300u-11). (2) Federal administrative costs.--Of the amount authorized to be appropriated by paragraph (1) for a fiscal year-- (A) not more than $1,000,000 are authorized to be used for Federal administrative costs; and (B) of the amount used by the Secretary for such costs, at least 40 percent shall be used for training and technical assistance by qualified experts who-- (i) have singular experience in providing programmatic support in abstinence education; (ii) have expertise in theory-based abstinence education curriculum development and implementation; (iii) have experience in developing sexual risk avoidance evaluation instruments; and (iv) can offer technical assistance and training on a wide range of topics relevant to the sexual risk avoidance (or abstinence education) field.

Abstinence Education Reallocation Act of 2011 - Authorizes the Administrator of the Health Resources and Services Administration (HRSA) to award grants for qualified sexual risk avoidance education to youth and their parents. Requires such education to meet certain criteria, including: (1) being age-appropriate, medically accurate, and evidence-based; (2) having as its sole purpose the teaching of the skills and benefits of sexual abstinence as the optimal sexual health behavior for youth; and (3) teaching the benefits of refraining from nonmarital sexual activity, the advantage of reserving sexual activity for marriage, and the foundational components of a healthy relationship. Gives priority to programs that serve youth ages 12 to 19 and that will promote the protective benefits of parent-child communication regarding healthy sexual decisionmaking.

absorption of the background radio continuum by neutral hydrogen ( ) traces the cool component of the neutral gas in galaxies , the reservoir for star formation . high redshift observations of the 21-cm transition can address several pressing problems in cosmology and fundamental physics , such as the evolution of large - scale structure ( e.g. @xcite ) , detecting the epoch of re - ionisation ( e.g. @xcite ) and measuring the contribution of the neutral gas content to the mass density of the universe ( @xcite ) . furthermore , spectral lines at high redshift can provide a measure of the values of the fundamental constants of nature at large look - back times ( see @xcite ) . of these , the hydroxyl radical ( oh ) is of particular interest since several different combinations of the constants can be measured from this single species @xcite . that is , oh can potentially yield several measurements from a single sight - line , thus eliminating any relative velocity offsets which would cause a change in the redshifts , thus imitating a variation in the constants . however , the detection of high redshift absorption is currently very elusive , with only three detections at @xmath0 ( look - back times of @xmath1 gyr ) , two of which occur in galaxies intervening the sight - lines to more distant quasars @xcite and one within the host galaxy of the quasar itself @xcite . the former `` intervening '' systems arise in damped lyman-@xmath2 absorption systems ( dlas ) ) , detected through the lyman- transition ( usually redshifted into the optical band at @xmath3 . ] , with the low detection rate at high redshift being due to the geometry of an expanding universe , where the high redshift cases can not occult the background emission as effectively as those at lower redshift @xcite . in the case of molecular absorption , the optical selection of targets means that the background quasi - stellar object ( qso ) is not sufficiently obscured by the dla @xcite to indicate a suitable environment for detecting molecular gas in absorption , either by oh @xcite or by molecules with transitions in the millimetre band ( e.g. co , hco@xmath4 , hcn , @xcite ) . thus , given that an optical redshift biases against a dusty , obscured object , in the millimetre and decimetre bands , the number of redshifted molecular absorption systems remains a paltry five , all of which are at a redshifts of @xmath5 ( @xcite ) . for the `` associated '' systems , the use of an optical redshift to which to tune the receiver also introduces a bias against the detection of neutral atomic and molecular gas , particularly at high redshift . from a survey for 21-cm and millimetre - band ( co , hco@xmath4 & hcn ) absorption at @xmath0 , @xcite obtained zero detections in the ten objects searched . upon a detailed analysis of the photometry , they found all of the radio sources to be above a @xmath6 luminosity of @xmath7 , where 21-cm has _ never _ been detected , no matter the selection criteria or redshift @xcite . this critical value applies at all redshifts @xcite and , while 21-cm absorption is readily detected at @xmath8 ( e.g. @xcite ) , above these redshifts the optical selection of targets biases towards objects which are most uv luminous in the quasar rest - frame . in these , the ionising ( @xmath9 ) photon rate of @xmath10 sec@xmath11 is sufficient to ionise _ all _ of the neutral atomic gas in a large spiral galaxy @xcite . this suggests that even the square kilometre array will not detect atomic or molecular absorption in the @xmath0 radio galaxies and quasars currently known ( see figure 4 of @xcite ) . thus , in order to find such absorption at high redshift , it is necessary to dispense with the traditional reliance upon optical redshifts and perform spectral scans towards optically faint radio sources . currently , however , sufficiently wide spectral scans are subject to severe radio frequency interference ( rfi ) . therefore , in order to avoid the optical selection of targets , while retaining relatively narrow bandwidths , we can tune the receiver to the redshift of co emission , which has been detected over 150 times at @xmath12 . here we present the results of the first survey for and oh absorption in a sample of @xmath0 co emitters . from the known @xmath12 co emitterscompiled from @xcite . ] we selected those for which the 21-cm transition is redshifted into the 90-cm bands of the green bank telescope ( gbt ) and giant metrewave radio telescope ( gmrt ) . as described in @xcite , we compiled the photometry and selected those with an appreciable radio flux ( estimated to exceed @xmath13 jy at the redshifted 21-cm frequency ) , prioritised by lowest @xmath14 luminosity ( fig . [ seds_full ] ) . this yielded a shortlist of seven sources , of which six could be observed with the gbt and five with the gmrt . in order to offer some redundancy against rfi , we targeted the four sources which could be observed by both telescopes . although we attempted to select the most optically faint sources , the high redshift ( @xmath0 ) selection did nevertheless lead to the seven shortlisted sources having @xmath14 luminosities above ( but close to ) the critical value of @xmath15 ( see table [ obs ] ) . each of the sources was searched for 21-cm absorption on 3031 august 2013 with the gmrt full 30 antenna array , using the 325 mhz receiver backed with the fx correlator over a bandwidth of 4 mhz . this was spread over 512 channels in orthogonal circular polarisations ( ll & rr ) , giving a channel spacing of @xmath16 . for bandpass calibration 3c48 , 3c147 and 3c298 were used , with the phases being self calibrated apart from nvssj012142 + 132058 , which used 3c49 and b22327 + 39 . the data were flagged and reduced using the miriad interferometry reduction package , with removal of the non - functioning antenna 18 , leaving 406 baseline pairs . after averaging the two polarisations , a spectrum was extracted from the cube . regarding each source : + * 0119 + 130 ( nvssj012142 + 132058 ) * was observed for a total of 1.38 hours at a central frequency of 314.25 mhz . flagging of the worst rfi left 342 baseline pairs . the source was unresolved by the @xmath17 synthesised beam . + * b20748 + 27 * was observed for a total of 0.66 hours at a central frequency of 337.55 mhz . only one baseline pair required flagging due to excessive rfi , although some ripple on the bandpass was still evident ( fig . [ spectra ] ) . the source was unresolved by the @xmath18 synthesised beam . + * 1359 + 154 ( 87gb135911.5 + 152747 ) * was observed for a total of 2.25 hours at a central frequency of 335.01 mhz . rfi was relatively severe , and flagging all baseline pairs above an r.m.s . noise level of 1 jy , left just 127 pairs . the source was unresolved by the @xmath19 synthesised beam . + * 1909 + 722 ( 4c+72.26 ) * was observed for a total of 0.83 hours at a central frequency of 313.42 mhz , with only the flagging of one bad channel being required . the source was unresolved by the @xmath20 synthesised beam . + * b22327 + 39 * was observed for a total of 1.47 hours at a central frequency of 346.95 mhz . the presence of a strong bandpass ripple required flagging of the worst affected baseline pairs , leaving 357 . the source was unresolved by the @xmath21 synthesised beam . + each of the sources targeted with the gbt were observed for a total of two hours with the observations being completed over several sessions in 2013 ( ending in october ) . for all observations , the prime focus 1 ( pf1 ) receiver was used , backed by the gbt spectrometer , with a 12.5mhz band over 4098 or 8196 lags . this gave a channel spacing of 3.052 or 1.526 khz , corresponding to a spectral resolution of @xmath22 , which was redressed to 10 after averaging the good scans . associated 21-cm detections range from 18 to 475 , with a mean of 167 @xcite . ] four separate ifs were employed in two orthogonal linear polarisations ( xx & yy ) , allowing us to observe both the 21-cm and oh 18-cm ( main 1665 & 1667 mhz , satellite 1612 & 1720 mhz ) lines simultaneously in cases where these were redshifted into the band ( 290395 mhz ) . many of the observational scans were marred by rfi and those completely dominated by interference were removed . nevertheless , there remained rfi spikes peppered throughout the band . given that the gbt is a single dish telescope , thus not giving the option of removing badly affected baseline pairs , there was little we could do to improve the data , although we did apply the following steps : 1 . we fitted and removed a low order polynomial to the bandpass , although some ripple was still apparent in some spectra ( e.g. 0748 + 274 , fig . [ spectra ] ) . we did not use high order polynomials in order to avoid over - fitting the data and thus possibly removing any putative broad , weak absorption features . 2 . given that the detection of 21-cm emission at @xmath23 is beyond the capabilities of current radio telescopes ( e.g. @xcite ) , any positive flux spikes were deemed to be caused by rfi . the noise levels and redshift ranges are quoted between these spikes ( table [ obs ] ) , where they bracket the expected absorption frequency ( shown by the downwards arrows in fig . [ spectra ] ) . since we are searching for absorption , negative flux spikes can not automatically be attributed to rfi , although most were similar in appearance to the positive flux spikes . we distinguished the rfi from any putative absorption features by : 1 . checking whether the features were dominant in some individual scans while being absent or frequency shifted in others . often , as for the positive flux spikes , the spikes would be intermittent or dominated by a single scan ( e.g. the 299 mhz feature in the bands of 0508 + 604 and 0647 + 415 ) . 2 . checking if the feature resembles what we would expect . for example , for the `` absorption '' at 347.5 mhz towards 0647 + 415 , we would expect a second feature separated by @xmath24 mhz , due to the oh main - line doublet . also , absorption is not apparent at the expected 296.0 mhz . 3 . checking if the feature is of the expected strength . for example , if the 381 mhz feature towards 1359 + 154 were real , we would expect the stronger main - line doublet to be apparent at @xmath25 mhz , as well as absorption at 335.7 mhz , none of which are seen at these relatively clean frequencies . regarding the observation and data reduction for each individual target : + * 0508 + 604 ( 4c+60.07 ) * was observed in four ifs for ( centered on 296.66 mhz ) , the oh 1612 mhz line ( 336.72 mhz ) , the 1665 and 1667 mhz main lines in a single if ( redshifted to 347.83 and 348.24 mhz , respectively ) and 1720 mhz ( centred on 359.34 mhz ) . the band was very clean with 1.95 hours of integration on source remaining after flagging . in the final averaged spectrum there is a prominent absorption feature apparent at 298.73 mhz ( blueshifted from the co emission by 2060 ) . however , the fact that this feature was not prominent in all scans , as well as being apparent as emission in two ( out of 53 scans , as well as in the 0647 + 415 spectrum ) , leads us to conclude that this is instrumental in nature . the data were also relatively rfi - free in the other bands , leaving 1.91 hours on source for 1612 mhz , 1.83 hours for the oh main line band and 1.99 hours for the 1720 mhz band . + * 0647 + 415 ( 4c+41.17 ) * was observed in four ifs for ( centered on 296.16 mhz ) , the oh 1612 mhz line ( 336.16 mhz ) , the 1665 and 1667 mhz main lines in a single if ( redshifted to 347.25 and 347.66 mhz , respectively ) and 1720 mhz ( centred on 358.74 mhz ) . flagging in the band left a total of 0.40 hours of integration on source , 0.52 hours for the oh 1612 mhz band , 0.55 hours for the oh main line band and 0.24 hours in the 1720 mhz band , in which all of the xx polarisation was lost . note that the measured fluxes varied considerably between the two polarisations , particularly for the 1612 mhz band , where for xx this was @xmath26 jy , cf . @xmath27 jy in the yy , with the latter being the more consistent with the other bands and a flux density of @xmath28 jy being expected from a fit to the ned radio photometry . + * b20748 + 27 * was observed in two ifs for ( centered on 337.55 mhz ) and oh 1612 mhz ( 383.13 mhz ) . some rfi was present , particularly in the lower frequency if , and some flagging of the data was required . this left a total on source time of 0.68 hours for and 1.23 hours for oh , although some spikes still remained in the spectra ( fig . [ spectra ] ) . + * 87gb135911.5 + 152747 * was observed in three ifs for ( centered on 335.01 mhz ) , the oh 1612 mhz line ( 380.24 mhz ) and the 1665 and 1667 mhz main lines in a single if ( redshifted to 392.78 and 393.25 mhz , respectively ) . after flagging of the worst rfi affected scans , the total on source integration times were 1.82 hours ( ) , 0.92 hours ( oh 1612 mhz ) and 1.55 hours ( oh main lines ) . for each scan a negative flux was noted in both polarisations . these are believed to be caused by confusion within the beam / sidelobes / off - position , due to the large beam ( @xmath29 at 335 mhz , @xcite ) . + * 1909 + 722 ( 4c+72.26 ) * was observed in four ifs for ( centered on 313.42 mhz ) , the oh 1612 mhz line ( 355.74 mhz ) , the 1665 and 1667 mhz main lines in a single if ( redshifted to 367.48 and 367.91 mhz , respectively ) and 1720 mhz ( centred on 379.64 mhz ) . flagging left a total integration time of 1.51 hours in the band , 1.47 hours in the oh 1612 mhz band and 1.3 hours in the 1720 mhz oh band . rfi affected the middle of the main line oh band in the latter of two separate observing runs and flagging of this left 0.48 hours of integration time . + * b22327 + 39 * was observed in two ifs for ( centered on 346.95 mhz ) and oh 1612 mhz ( 393.80 mhz ) . after flagging of the worst rfi affected scans , leaving 1.19 hours of total integration time at the lower frequency , spikes were still present throughout the bandpass , which was clean between these ( with an r.m.s . noise level of @xmath30 mjy ) . unfortunately , one of these lies at the frequency where the absorption is expected and so we do not quote an optical depth limit ( table [ obs ] ) . spikes were all present at the higher frequency and , although close to the expected oh 1612 mhz absorption , 393.80 mhz is relatively clean , allowing us to quote a limit . note that , the flux density at both frequencies varied between the two polarisations and two separate observing sessions and so the mean values quoted should not be deemed as reliable as that obtained from the interferometric ( gmrt ) observations . in fig . [ spectra ] we show the final spectra and summarise these in table [ obs ] , from which we see neither nor oh were detected in any of the targets . ( 0,0 ) ( -4,1 ) [ obs ] since the oh absorption in the five known redshifted systems ( sect . [ intro ] ) was detected on the basis of a previous absorption detection @xcite , and that the absorption strength is only expected to be @xmath31 times that of the 21-cm absorption @xcite , we will treat as a prerequisite for oh absorption and thus focus our discussion around the 21-cm results . from fig . [ n - z ] , we see that our survey is as sensitive as many of the previous surveys for redshifted associated 21-cm absorption and deep enough to re - detect the majority of the known 21-cm absorbers.compiled from @xcite with the non - detections compiled in @xcite . ] therefore , we may expect @xmath32 detections from our sample , or @xmath16 from all the previous searches at @xmath0 , based upon the 27% detection rate at @xmath33 . however , there is just one detection at @xmath0 ( @xcite ) , which is the only source below the critical uv luminosity ( with @xmath34 ) . due to all of our targets being at @xmath0 , despite our best efforts , the uv luminosity of each of these was estimated to be close to the critical value of @xmath15 . this is seen in fig . [ l - ion ] , which shows the distribution for the 21-cm searches and the co detections . ) . ] from the figure it is clear that , while 21-cm is never detected above @xmath15 ( @xmath35 sec@xmath11 ) , co emission is detected in several cases , up to luminosities as high as @xmath36 ( @xmath37 sec@xmath11 ) , which is over two orders of magnitude more luminous than the critical value . we now discuss possible reasons why co emission is readily detected at ionising photon rates which are inhospitable to the neutral atomic gas . interstellar molecules form on dust grains and so shielding by dust may be a reason why co is detected at ultra - violet luminosities which ionise the . however , the fact that the uv / visible fluxes are high may suggest that the sight - lines towards the sources have relatively low dust obscuration . in order to address this , in fig . [ v - k ] we show the optical near infrared colours of the co emitters as a proxy for dust obscuration . from these , we see that the colours span a very similar range to optically selected qsos ( @xcite , which have a mean and a standard deviation of @xmath38 and @xmath39 , respectively ) in comparison to @xmath40 for the five known redshifted molecular absorption systems ( see figure 1 of @xcite ) and @xmath41 for associated 21-cm absorption @xcite . the molecular absorption is due to low - excitation gas ( @xmath42 k , @xcite ) , where the density is insufficient to populate the higher levels of the molecules , according to the higher kinetic temperatures ( i.e. @xmath43 ) . for gas in emission , however , both the volumic density excitation temperature must be higher , although lower than the kinetic temperature ( @xmath44 k , cf . @xmath45 k , @xcite ) , indicating that the gas is , on average , at intermediate densities and perhaps less obscured by dust , as is indicated by the less reddened colours . however , the colours may not be a reliable indicator of the actual column densities , if the dense regions are embedded in a diffuse medium . very dense self - shielded clumps of high column density gas could give rise to substantial co emission with un - reddened colours , if the surface filling factor of the dense gas is low . these low filling factors ( @xmath46% in absorption , @xcite ) offer an alternate explanation to the lack of 21-cm absorption . however , as seen from fig . [ n - z ] , 21-cm absorption is readily detected at @xmath8 and is also detected in all five of the decimetre / millimetre band molecular absorbers @xcite and so low filling factors are unlikely to be the cause of the 21-cm non - detections . another viable reason for the detection of co at uv luminosities unfavourable to 21-cm absorption is the possibility that the molecular gas is self - shielded , due to its higher density . @xcite showed that an ionising photon rate of @xmath35 sec@xmath11 was sufficient to ionise all of the neutral gas in a galaxy with the distribution of the milky way @xcite . this critical value is therefore valid for a central gas density of @xmath47 @xmath48 , which decays with galactocentric radius with a scale - length of @xmath49 kpc . however , co traces gas of significantly higher density , and applying the canonical @xmath50 @xmath48 to the maximum luminosity at which co is detected , @xmath36 , gives a scale - length of @xmath51 pc and a total gas mass of @xmath52 , both values being typical of a spiral galaxy ( e.g. @xcite ) . however , while an exponential disk may reasonably model the large - scale neutral atomic gas distribution in a galaxy , the denser molecular gas is expected to be embedded in discrete clouds within this . this could mean that the molecular gas is shielded by the enveloping atomic gas ( e.g. @xcite ) , since the dissociation of requires higher energy photons than the ionisation of ( 14.7 cf . 13.6 ev , @xcite ) . because of its large dipole moment , it is co , not directly , which is detected in these millimetre band surveys and so it is possible that co emission at high redshift could arise in very different environments than in the galaxy , and use of the galactic conversion ratio @xcite would not be warranted . therefore , since we have no direct measure of the emission properties of these objects , it is more prudent to consider the co directly . this is dissociated at 11.09 ev ( e.g. @xcite ) , which would suggest that the co actually shields the , and being readily detected , while is not , this would indicate that the co may be more remote from the agn activity , a possibility which we now discuss . co emission in high redshift galaxies has been observed to extend to large scales ; @xmath53 kpc in the @xmath54 transition @xcite and @xmath55 kpc in the @xmath56 transition . this extended emission appears to arise from external components such as merging gas - rich galaxies @xcite and ly halos around the host galaxy @xcite . furthermore , the co emission is often aligned with the radio jet axis @xcite , which is a further indication that the co is not confined to the host radio galaxy . since the absorption is believed to arise in the disk , if not the obscuring nuclear material @xcite , the molecular gas detected in emission may therefore be spatially offset from the atomic detected in absorption . if this were the case , we may expect differences in the offsets of each species from the systemic redshift . calculating these via @xmath57 gives mean offsets of @xmath58 for the co emission and @xmath59 for the absorption ( fig . [ dv - hist ] ) . that is , on average , the absorption may be more offset from the systemic velocity , where we would expect this to be less , if the were intrinsic . a kolmogorov - smirnov test of the @xmath60 values gives a probability of @xmath61 that the two samples are drawn from the same population , which is significant at @xmath62 assuming gaussian statistics ( fig . [ co - uv ] ) . this overall blueshift of the cool neutral gas was also noted by @xcite , whose sample comprises 19 of the 43 absorbers for which we can estimate @xmath60 . the blueshift was attributed to outflowing gas ( e.g. @xcite and references therein ) and fast outflows could account for the offsets of @xmath63 , which exceed the escape velocity of a large spiral galaxy . fast outflowing gas is predominant in compact radio sources ( e.g. @xcite ) , which may have higher detection rates than in the extended sources ( e.g. @xcite ) . since such kinetic feedback can deplete the hydrogen in galaxies ( e.g. @xcite ) , the depletion of gas in more mature ( extended ) objects could explain the paucity of 21-cm absorption detections , although high resolution radio imaging of the co emitters would be required in order to verify this . note , however , that once the @xmath15 sources are removed from the radio source samples , the detection rates in compact objects does not differ significantly from those in non - compact objects , which is consistent with the compact objects being less mature and luminous than the non - compact sources @xcite . thus , we believe that photo - ionisation of the neutral gas remains a key factor in the non - detection of . furthermore , in drawing any conclusions from the velocity offsets , it should be noted that many of the optical redshifts are only accurate to the second decimal place giving uncertainties of @xmath64 and so the absolute value of @xmath60 may be unreliable , with many of the @xmath65 values arising by default ( see fig . [ q_dis ] ) . the narrower spread in offsets - value of @xmath66 ) . ] may suggest that the atomic gas is more likely to be associated with the radio source , although one can not draw any firm conclusions from the distribution of the offsets until more accurate optical redshifts become available . returning to the dissociation of co by the uv flux , in fig . [ q_dis ] we show the co photo - dissociation rate versus @xmath60 , from which we only see a weak correlation . assuming that this is diluted by inaccurate optical redshifts and projection effects , and provided that @xmath60 is a reliable proxy for the distance between the agn host , this may be evidence of the molecular clouds being able to survive larger rates ( @xmath67 sec@xmath11 ) due to their larger distances from the agn . another possibility for the detection of co emission in the brightest uv sources , is that both luminosities are correlated with star forming activity : due to the low efficiency of star - formation , the consumption of molecular gas is far from complete , with a depletion times of @xmath68 gyr at @xmath69 @xcite compared to 0.7 gyr at @xmath70 @xcite . that is , there is an apparent increase in star formation efficiency with redshift . investigating the origin of the uv luminosity , in fig . [ co - uv ] we show the co line luminosity versus the uv continuum luminosity , from which a non - parametric generalised kendall - tau test gives a @xmath71 probability of the observed correlation occuring by chance , which is significant at @xmath72 . such a relationship may be expected , since far - infrared emission is a tracer of the star formation rate ( sfr ) in ultra luminous infrared galaxies ( ulirgs , where @xmath73 , e.g. @xcite ) and six of our sample are estimated to have @xmath74 ( fig . [ seds_full ] ) . the fact that they have both high co and fir luminosities , suggests that they are host to high star formation rates ( e.g. @xcite ) . however , it is generally assumed that all of the fir emission arises from star formation and such a large dynamic range may be subject to selection effects , such as an increasing luminosity with redshift probing differing host morphologies and amplification of the flux by gravitational lensing . in fig . [ radio - uv ] , we also find a strong correlation between the radio and uv continuum luminosities ( @xmath75 for the 27 sources for which the radio luminosity can be obtained ) . since the radio fir correlation is often attributed to star - formation , this could strengthen the argument that the high uv luminosities arise from star formation , although the radio fir relationship is generally limited to @xmath76 ( e.g. @xcite ) . furthermore , at @xmath77 , the population rapidly becomes dominated by agn ( e.g. @xcite ) , although this is only measured to @xmath78 and it is not known how this extrapolates to high redshift . in fig . [ mpd ] we show the estimated star formation rates , based upon the uv ( @xmath79 ) luminosities @xcite . the maximum @xmath80 at which 21-cm is detected corresponds to a sfr of @xmath81 , with the maximum @xmath82 at which co is detected corresponding to 17000 . by assuming that all of the fir emission is due to star formation , rates of @xmath83 have been found in high redshift ( @xmath84 ) co emitters ( e.g. @xcite ) , although these rates are believed to occur in short bursts ( @xmath85 myr ) . thus , we obtain extremely high star formation rates based upon the uv luminosities of the co emitters and hence believe that , at least partially , the high luminosities , and subsequent dust heating , are caused by increased agn activity ( e.g. @xcite ) . one way to address the origin of the uv radiation would be through spectral classification , although , of the six of the seven target spectra which could be found , all are uv ( rest ) emission line spectra , with little continuum , and so are difficult to classify . however , ned classifies three as qsos ( 0748 + 27 , 1359 + 154 & 2327 + 39 ) and four as galaxies ( 0119 + 130 , 0508 + 604 , 0647 + 415 & 1909 + 722 ) , although the 50% detection rate in both type-1 and type-2 objects @xcite suggests that the host morphology makes little difference to the detection of 21-cm absorption in objects below the critical uv luminosity . we have undertaken a survey for atomic ( 21-cm ) and molecular ( oh 18-cm ) absorption in seven strong co emitters at @xmath0 . our motivation was to circumvent the need for an optical redshift , to which to tune the receiver , which selects against the detection of decimetre absorption at high redshift . tuning to the co redshift also has the advantage that large amounts ( @xmath86 ) of molecular gas ( e.g. @xcite ) are known to exist and absorption and co emission are often coincident in low - z active galactic nuclei ( e.g. @xcite , cf . @xcite and @xcite , cf . @xcite ) . despite this , no absorption of either species was detected . we attribute this as being due to the targets , despite careful selection , having rest - frame ultra - violet luminosities close to the value above which all of the neutral gas is ionised @xcite . while the non - detection of 21-cm absorption within the host galaxies of sources with ionising photon rates exceeding @xmath87 sec@xmath11 ( @xmath88 ) appears to be a universal phenomenon , holding true for various heterogeneous and unbiased samples , with varying selection criteria and over all redshifts , we find that co emission is readily detected at @xmath89 . in order to explain the detection of molecular gas in emission , while atomic gas in absorption remains undetected , we suggest the following , non - mutually exclusive , possibilities : 1 . that , due to the ionisation of occuring at a lower energy than the dissociation of , as per galactic clouds , the molecular gas is shielded by the atomic gas . however , by the same argument the co should shield the , although this is likely to be embedded in dense molecular cores which are enveloped by the more diffuse atomic gas . 2 . co traces higher density gas ( @xmath90 , cf . @xmath91 @xmath48 for ) , which could provide the co with better self - shielding against the uv flux . from our model galaxy @xcite , we find that the maximum luminosity at which co is detected ( @xmath36 ) gives a gas density distribution and mass which is consistent with the molecular gas in a typical spiral galaxy . this , however , relies on the assumption that the distribution of co is spatially coincident with the , when the molecular gas is likely to be embedded in discrete clumps . the co gas is located in a dustier environment which provides better shielding against photo - ionisation . this appears to be the case for both molecular and 21-cm _ absorption _ which are correlated with the optical near infrared colours of the sight - line . for the co _ emission , however , no correlation is seen and this is readily detected at colours which are similar to those of optically selected qsos , ( @xmath92 ) , whereas co _ absorption _ has thus far only been detected towards much redder sight - lines ( @xmath93 ) . this suggests either that dust does not play as an important role in co emission as in absorption or that the co is physically offset from the sight - line ( to the radio / uv source ) along which the colours are measured . 4 . at high redshift , there is evidence that the co emission is physically remote from the source of the continuum emission , meaning that the co is subject to much lower uv fluxes than the cool , neutral gas located within the host galaxy . we also investigate the possibility that the uv emission arises primarily from star formation , as may be evident through a strong correlation between the uv and co luminosities . however , it is not clear how much of the ultra - violet emission is due to nuclear activity in these objects , although three of our seven targets appear to be qsos and all seven have radio luminosities typical of agn . thus , it is possible that a large fraction of uv emission does not arise from star formation and that the presence of co is these uv luminous sources could be explained by self - shielding of the molecular gas or their distance from the continuum source . whatever the cause , the detection of and oh absorption at high redshift remains elusive , with wide - band decimetre - wave spectral scans of optically obscured objects being required to detect these tracers of cool gas at high redshift and perhaps shed light upon the paucity of the star forming reservoir in the locale of warm molecular gas . we wish to thank bjorn emonts for his valuable input as well as the staff of the gbt and gmrt that made these observations possible . the gmrt is run by the national centre for radio astrophysics of the tata institute of fundamental research . the national radio astronomy observatory is a facility of the national science foundation operated under cooperative agreement by associated universities , inc . this research has made use of the nasa / ipac extragalactic database ( ned ) which is operated by the jet propulsion laboratory , california institute of technology , under contract with the national aeronautics and space administration and nasa s astrophysics data system bibliographic service . this research was conducted by the australian research council centre of excellence for all - sky astrophysics ( caastro ) , through project number ce110001020 . s. , abdalla f. b. , bridle s. l. , blake c. a. , baugh c. m. , greenhill l. j. , van der hulst j. m. , 2004 , science with the square kilometer array , new astronomy reviews 48 , carilli c. l. , rawlings s. , eds . , elsevier , amsterdam , pp . 10131027

we present the results of a survey for 21-cm and oh 18-cm absorption in seven strong co emitters at @xmath0 . despite reaching limits comparable to those required to detect 21-cm absorption at lower redshifts , we do not detect either transition in any of the objects searched . we believe that this is due to the high redshift selection causing all of our targets to have ultra - violet luminosities above the critical value , where all of the atomic gas in the host galaxy disk is suspected to be ionised . however , not only are all of our targets bright in co emission , but detection of co above the critical uv luminosity is generally not uncommon . this suggests that the molecular gas is shielded from the radiation or is physically remote from the source of the continuum emission , as it appears to be from co observations of high redshift radio galaxies . [ firstpage ] galaxies : active quasars : absorption lines galaxies : starburst galaxies : evolution galaxies : ism ultraviolet : galaxies

there are many relativistic frameworks in which hadronic systems can be described . each of them has its advantages and its drawbacks . field theory is the most ambitious one but it implies an undetermined , possibly , infinite number of degrees of freedom . lattice calculations can account in principle for the complexity of the qcd interaction but they are limited by their necessary finite size . finally , relativistic quantum mechanics ( rqm ) offers the advantage to rely on a finite number of degrees of freedom . it is therefore very close to the simplest view of the surrounding world , with hadrons considered as a bound state of quarks but these ones can only be effective objects . in this paper , we will be concerned with the application of the last framework to the calculation of form factors of pseudoscalar mesons ( pion and kaon ) . many approaches were proposed , depending on the symmetry properties of the surface on which physics is described @xcite . this entails that some of the generators of the poincar algebra have a dynamical character while the other ones have a kinematic one . the construction of the algebra was first done by bakamjian and thomas @xcite and extended later on to the front and point forms @xcite . it relies on the introduction of a mass operator that is poincar invariant and can be used in any form . the different forms were employed for the calculation of form factors of various hadrons , mesons as well as baryons . in principle , results should not depend on the chosen form @xcite but one of them may be more efficient than another one . looking at the results of calculations , generally based on a single - particle current , it was found that they could strongly depend on the form for the same solution of the mass operator @xcite or suppose quite different solutions of this operator if they were fitted to some measurements @xcite . this is especially true for the pion charge form factor . in such a case , one learns nothing about the underlying dynamics of the system under consideration . the dependence on the form points to the role of interaction terms that are here or there depending on the choice of the underlying hypersurface . recently , it was found that constraints stemming from the poincar covariance of currents under space - time translations @xcite could play an important role in discriminating between different approaches for the calculation of form factors @xcite . these constraints , go beyond the usual energy - momentum conservation which is assumed in all calculations and involve a relation between the squared momentum transferred to the system and the one transferred to the constituents . they imply that the current should necessarily contain many - particle terms . the only exception is the case of the front form with @xmath0 . moreover , an indirect way for accounting for these many - particle currents was found with the important result that all forms can now produce identical predictions for form factors from the same solution of a mass operator . however , these results were concerning a pion - like scalar system composed of scalar particles , which is not of much interest for physical systems made of quarks that have spin 1/2 . it is noticed that form factors corresponding to the simplest triangle feynman diagram @xcite could be reproduced exactly @xcite . those for the wick - cutkosky model @xcite could also be reproduced to a very good accuracy , @xcite , pointing in this case to a rather good determination of the mass operator @xcite . in both cases , the mass operator has a quadratic form . in the present work , we want to extend the above work for scalar constituents to the case of pseudoscalar mesons that are considered as quark - antiquark systems with the goal of getting , ultimately , some information on the underlying mass operator . many works have been done for the pion and kaon mesons . though the distinction is not always clear as soon as approximations are made , they roughly fall in two groups based on field theory @xcite and on relativistic quantum mechanics @xcite . a somewhat different group contains lattice calculations @xcite . within the rqm approach , which we are interested in here , most works have relied on the front - form approach with @xmath0 but there are also a few works relying on the instant- or point - form approaches as well as a front - form one with @xmath1 . most often , simple wave functions , with a gaussian or a power - law expression , were used . for a given wave function , calculated form factors were found to be strongly dependent on the form that was used @xcite and , _ vice versa _ , when a fit to measurements was done , quite different wave functions were obtained @xcite . there are only few works using a more founded wave function , obtained from a mass operator containing both confinement and an instantaneous one - gluon exchange interactions . in absence of quark form factors , the first ones @xcite , based on the front form with @xmath0 , tend to overestimate the measurements , forcing the authors to introduce some quark form factor and , thus , providing some information about this quantity . the other one @xcite was motivated by reproducing the asymptotic pion charge form factor in both the front form with @xmath0 and the breit - frame instant form . the parameters were not especially optimized on some data but this work tends also to overestimate data though not as much as the first works . had an other form been used ( point form , or front form with a parallel momentum configuration , or instant form with a large average momentum and also a parallel momentum configuration ) , the corresponding form factors would underestimate the measurements instead . thus , between the determination of the best form , the role of the wave function ( or the mass operator ) , the contribution of two - particle currents ensuring the right asymptotic behavior , the role of possible quark form factors , we believe that there is a sufficiently large number of reasons to look at the charge form factor of pseudoscalar mesons in rqm frameworks and possible information about the mass operator . independently , for a somewhat academic system made of scalar constituents , it was found that accounting for the constraints from covariant space - time translations was allowing one to recover expressions of form factors obtained in a dispersion - relation approach @xcite . the question arises of whether such a result holds for systems consisting of quarks . the plan of the paper is as follows . in the second section , we discuss a number of ingredients relative to the determination of the mass operator , which we would like to check ultimately from the comparison of form factors calculated using its solutions to those actually measured . they concern in particular the linear or quadratic form of the mass operator , the normalization of the solutions and the consequences for form factors in the asymptotic domain . the third section is devoted to constraints stemming from the poincar covariance of currents under space - time translations while their implementation for form factors of pseudoscalar mesons is discussed in the fourth section . the role of these constraints is illustrated in the fifth section by using a gaussian wave function that is approximately a solution of an interaction containing only confinement . some observations are made in relation with solving some paradoxes and restoring fundamental symmetries . in the sixth section , we account for one - gluon exchange contributions to both the mass operator and the current . we provide values for ingredients ( string tension , quark mass and qcd coupling ) that allow one to approximately reproduce measurements in the pion case while paying attention to the charge radius and the pion decay constant . the seventh section contains a discussion of the results and the conclusion . the construction of the poincar algebra in rqm approaches supposes that the mass operator fulfills some conditions such as independence of the total momentum , of the underlying hyperplane orientation , or of the angular momentum but , apart from these general properties , not much is known about it . in a two - body system , it depends on a 3-dimensional internal variable , denoted @xmath2 here . the mass operator therefore looks very much like a non - relativistic interaction to which it can be identified in some cases . we nevertheless stress that the rqm approach is not a center of mass non - relativistic one with some relativistic corrections . it is characterized by a deep internal consistency , often ignored , which stems from the bakamjian - thomas transformation in the instant form @xcite and its generalizations in the other cases @xcite . the bakamjian - thomas construction @xcite was originally involving a linear mass operator , @xmath3 , but a quadratic one , @xmath4 , could be used as well @xcite . this choice supposes that the corresponding interaction , @xmath5 , be related to the linear - case one , @xmath6 , by the relation @xmath7 . a reason to prefer the quadratic expression is that @xmath8 can be identified to @xmath9 , which is more likely the quantity to be considered rather than the quantity @xmath10 , but a stronger reason is provided by the examination of results for the simplest triangle feynman diagram with scalar constituents @xcite . this one represents a theoretical model that is free of dynamical uncertainty and , moreover , can be easily studied . it provides a minimal set of results that any rqm implementation of relativity should reproduce . looking at the expression of the charge , which can also be considered as a definition of the normalization in the present case , it is found that , in the case of unequal - mass constituents , it can be written as : @xmath11 where the wave function @xmath12 is given by : @xmath13 with @xmath14 , @xmath15 . the occurrence of the normalization front factor , @xmath16 , may look strange here but it provides some simplification of the normalization condition when the integral is performed over the mandelstam variable @xmath17 rather than the internal momentum variable @xmath18 ( see sect . [ sec : constraints ] ) . while the wave function , @xmath19 , is more appropriate for expressing form factors , due to factorizing out typical relativistic quantities @xmath20 , a related expression could be more useful to make the relation with the solution of a hermitian mass operator . the relation is given by : @xmath21 which corresponds to the normalization condition : @xmath22 the expression of the wave function @xmath23 obtained from eq . ( [ eq : wfk2 ] ) together with eq . ( [ eq : wfk3 ] ) obviously suggests that it can be the solution of an equation with a quadratic mass operator having the form : @xmath24 which , due to its separable form , can be easily solved . to make sense , the coupling @xmath25 at the r.h.s . should tend to 0 so that its product with the diverging integral @xmath26 be finite . this does not prevent one , however , to use the wave function , without any problem , for the calculation of form factors for the model under consideration . it is interesting to contrast the above result with what would be obtained from a semi - relativistic schrdinger equation in the center of mass : @xmath27 the equation has also a separable form and , up to a numerical factor , its solution is given by : @xmath28 comparing this solution with the one for the quadratic mass operator , it is seen that they behave differently at large @xmath18 . this feature has consequences for the convergence of the norm but , more importantly , for estimating the charge form factor at large momentum transfers , as far as the charge form factor extrapolates the expression of the norm at @xmath29 . in the present case , the charge form factor so obtained would tend to overshoot the theoretical one , evidencing a wrong asymptotic power - law behavior . the reasons of the above discrepancy have been analyzed in detail , what is made possible by the simplicity of the theoretical model @xcite . actually , considering the center of mass time component of the charge current , one should add to the contribution due to positive - energy constituents : @xmath30 the one due to negative - energy constituents ( double z - type diagram ) : @xmath31 considering the sum : @xmath32 it is seen that it factorizes into a term that is identical to the norm one obtained in relation with the quadratic mass operator , eqs . ( [ eq : norm ] , [ eq : wfk2 ] ) , and a factor @xmath33 , which is nothing but the value of the quantity appearing in the time component of the charge current , @xmath34 , calculated in the center of mass . thus , instead of a quadratic mass operator , one could as well use a linear one but this last choice would require adding further terms in the current so that to make results consistent with the predictions of the simplest triangle feynman diagram . we do not think this is the most efficient way to proceed and we therefore discard this choice . the choice of a quadratic mass operator has further advantages . the invariance of the charge under boosts is more naturally satisfied with the corresponding solution , eq . ( [ eq : wfk2 ] ) . in the instant form , for instance , the expression of the charge for a system with momentum @xmath35 may read : @xmath36 where @xmath37 , @xmath38 , @xmath39 . in this case , one can easily verify that the quantities @xmath40 and @xmath41 are lorentz invariant , which is not so for the quantities generalizing to an arbitrary total momentum those given separately by eqs . ( [ eq : f1p ] ) and ( [ eq : f1 m ] ) . one could add that the suppression of the center of mass time component of the charge current with respect to the scalar one by a factor of the order @xmath42 is more easily accounted for within a framework based on the quadratic mass operator . actually , some of the above properties can be ascribed to a fully relativistic calculation which involves both forward and backward time - ordered processes , as given by eqs . ( [ eq : f1p ] ) and ( [ eq : f1 m ] ) for instance , often offering convergence properties better than the one with retaining the first of these processes . after making the choice of using a quadratic mass operator , the following question concerns the interaction itself . in the non - relativistic case , an instantaneous approximation is most often used ( partly motivated by the success of the coulomb interaction ) . again , the consideration of a simple model , the wick - cutkosky one @xcite , is instructive . to reproduce the ground - state energy using the instantaneous approximation , it was found that the coupling constant should be renormalized significantly . this renormalization takes into account contributions that , in a time - ordered diagram approach , would correspond to retardation effects in a first approximation . the charge and scalar form factors calculated in this way were found to roughly agree with those calculated from the original wick - cutkosky model , including the large @xmath43 domain @xcite . a better agreement , at the level of a few % , was obtained by improving the interaction . the corrections , of the order of @xmath44 , were chosen so that the power - law behavior of the interaction in the high - momentum limit be not changed . interestingly , the interaction in this high - momentum limit becomes closer to the bare one . the above results are important because they indicate how the interaction entering the mass operator should be chosen so that to reproduce results expected for form factors in the asymptotic domain . the earlier results that we reminded for the scalar - constituent case may be useful for the pseudoscalar mesons we are considering here . there is however a significant gap between the two systems . the mesons involve spin-1/2 constituents instead of scalar ones and the exchanged boson has spin 1 instead of 0 . while , for the wick - cutkosky model , we had to only consider the ladder diagram , for a realistic description of mesons , we have to consider both the ladder and crossed diagrams . moreover , gluons that are exchanged between quarks carry some color . this prevents that the contributions due to crossed diagrams and to retardation effects cancel , as they do in the coulomb case . one can not therefore rely on the successful instantaneous character of the coulomb interaction to justify _ a priori _ the use of a similar approximation for the gluon - exchange case . as a further source of uncertainty , we should add the confinement interaction and its interference with the gluon - exchange one . thus , while the determination of the mass operator in the scalar - particle case seems to be on a good track , the determination in the qcd case is largely _ terra incognita_. the first one can be at most a guide for the second one . as a starting point , one could consider that the solution of the mass operator , @xmath45 , is described by a gaussian wave function for the confining part and by a term behaving asymptotically like @xmath46 ( in our conventions @xcite ) for the perturbative part produced by a one - gluon exchange . we expect that the comparison of theoretical predictions and measurements will be very instructive to reduce the uncertainty on the determination of the pseudoscalar - meson mass operator . this supposes that predictions do not depend on the chosen implementation of relativity however , what we consider in next section . it is well known that predictions of form factors in the single - particle current approximation , when fitted to measurements , lead to solutions of the mass operator that are strongly dependent on the form that has been used @xcite . as a complementary information , and always in the same approximation of a single - particle current , predictions made from the same solution of a mass operator exhibit a strong dependence on the form employed to implement relativity @xcite . this situation is quite unsatisfactory as a correct implementation of relativity should ensure that properties of the system under consideration should behave covariantly under transformations of the poincar group . these transformation properties are somewhat kinematic ones and should not depend on the underlying dynamics . as the dependence on a form implies a dependence on the underlying hypersurface on which physics is described and that changing one hypersurface for another one implies interaction effects , it can be inferred that the above calculations of form factors miss some interaction effects . in this respect , we notice that accounting for constraints related to the covariant transformations of currents under space - time translations could remove discrepancies for the scalar system composed of scalar constituents . the above constraints go beyond the usual overall energy - momentum conservation that is , evidently , assumed in all calculations . there is no special difficulty in generalizing to spin-1/2 constituents considered in this work results previously obtained for spin-0 ones . we therefore summarize below the main points , providing for some of them a presentation that complements the one given elsewhere @xcite . under poincar space - time translations , a vector or a scalar current ( denoted @xmath47 and @xmath48 respectively ) transforms as : @xmath49 where @xmath50 represents the 4-momentum operator . making the choice @xmath51 , one also obtains the relations : @xmath52 considering the matrix element of the above relations between eigenstates of @xmath50 , one obtains the following relation : @xmath53 which allows one to factorize the @xmath54 dependence . combined with the function @xmath55 describing the interaction with an external probe carrying momentum @xmath56 , and integrating over the @xmath54 variable or assuming space - time translation invariance , one gets the usual energy - momentum conservation relation : @xmath57 this relation tells nothing about the relation of the momentum transferred to the system , @xmath56 , and to the constituents , @xmath58 ( see fig . [ fig:1 ] for kinematic definitions ) . it tells nothing either on the single - particle character of the current , most often assumed , or its many - particle one . this is the place where further relations involving implicitly the covariant transformation properties of the current under translations given by eq . ( [ eq : translat1 ] ) can be useful . these ones , mentioned by lev @xcite , involve the commutator of the current with the momentum operator @xmath50 on the one hand , the derivatives of the current with respect to @xmath54 on the other hand . the simplest one is given by : @xmath59= -i\partial^{\mu}\,j^{\nu}(x ) , \;\;\ ; \nonumber \\ & & \big [ p^{\mu}\;,\ ; s(x)\big]= -i\partial^{\mu}\,s(x ) \ , . \label{eq : translat5}\end{aligned}\ ] ] at the next order in @xmath50 , a particularly interesting relation is given by : @xmath60\big]= -\partial_{\mu}\,\partial^{\mu}\,j^{\nu}(x ) , \;\;\ ; \nonumber \\ & & \big[p_{\mu}\;,\big [ p^{\mu}\;,\ ; s(x)\big]\big]= -\partial_{\mu}\,\partial^{\mu}\,s(x ) \ , . \label{eq : translat6}\end{aligned}\ ] ] when the matrix element of this relation is taken between eigenstates of @xmath50 and assuming a single - particle current , one gets , after factorizing the @xmath54 dependence as done in eq . ( [ eq : translat3 ] ) : @xmath61 where @xmath62 represents the squared momentum transferred to the system and @xmath63 the one transferred to the constituents . we observe that the relation could be satisfied in a field - theory approach , where @xmath64 , but , until recently , it was not checked within rqm approaches where it turns out to be generally violated . in this case , the violation shows that the assumption of a single - particle current is not supported by the above constraints . the current should then involve many - particle terms and it can be hoped that these ones contribute to restore the equivalence of different forms for the calculation of form factors @xcite . interestingly , it is found that eq . ( [ eq : translat7 ] ) is fulfilled in the front - form approach with @xmath0 ( see below ) , providing in this case support for the assumption of a single - particle current . in all the other cases , the current should involve many - particle terms to satisfy the covariant character of translations evidenced by eq . ( [ eq : translat1 ] ) . calculating the contribution of many - particle terms is quite tedious and this has been done for a limited number of cases with the aim of accounting for current conservation @xcite or getting the expected asymptotic behavior of the charge form factors for the pion @xcite or for a system of scalar constituents in the point form - approach @xcite . moreover , if these extra terms restore the equivalence of predictions of different approaches , we expect that they should occur at all orders in the interaction . however , the fact that the form factor in the front form with @xmath0 satisfies eq . ( [ eq : translat7 ] ) with a single - particle current suggests that the task is not hopeless and that some simplification could occur . in this section , we provide information about various quantities that will be calculated in the next sections . they often represent a generalization of expressions given elsewhere for equal - mass constituents . this is also done with the aim to facilitate the comparison with other works , as far as notations or conventions are concerned . we first remind the definitions that we are using for the charge and scalar form factors , @xmath65 and @xmath66 respectively , in the case of an interaction of constituent number 1 with the external probe : @xmath67 the single - particle part of the quark operators @xmath68 and @xmath69 , we give here for fixing some relative overall factors , are given by @xmath70 and @xmath71 respectively . they determine the strength of possible many - particle contributions that should be considered , such as z - type - diagram ones for instance . these contributions , which depend on the approach under consideration , have an interaction character . to account for the constraints mentioned in the previous section , we proceed as follows . + _ i _ ) we assume that the current keeps the structure of a single - particle current otherwise it would be difficult to recover the front - form results with @xmath0 . + _ ii _ ) the discrepancy between different approaches involves interaction effects that are here or there depending on its choice . looking at the expression of wave functions entering calculations , it is found that they differ by interaction effects that are located in the coefficient of the momentum transfer , @xmath72 , or some related quantity . our proposal is to multiply this quantity by a factor @xmath73 so that to fulfill eq . ( [ eq : translat7 ] ) and incorporate in this way interaction effects that have been missed . we thus obtain the equation : @xmath74 " \nonumber \\ & & \hspace*{-6mm}=\alpha^2q^2 - 2\,\alpha `` ( \delta_i \!-\!\delta_f ) " \;q \cdot \xi + `` ( \delta_i \!-\!\delta_f)^2"\;\xi^2 \ , , \label{eq : q2}\end{aligned}\ ] ] where the quantity @xmath75 holds for an interaction effect , of which expression given in ref . @xcite is reminded here : @xmath76 the 4-vector @xmath77 represents the orientation of the hyperplane on which physics is described . it appears in the equation that relates the momenta of the constituents , the total momentum of the system , and the quantity @xmath75 @xcite : @xmath78 expressions of @xmath77 for different approaches may be found in ref . @xcite and @xmath79 describing the velocity of the initial and final states must be introduced . in this approach , which is denoted here p.f . " and is different from the point form proposed by dirac @xcite , the above equation becomes slightly more complicated but is still manageable . ] . the notation @xmath80 in eq . ( [ eq : q2 ] ) reminds that the corresponding quantity should include the effect of the constraints . it is immediately seen that , in the front - form case where @xmath77 is often denoted @xmath81 with @xmath82 , this equation is satisfied for the momentum configuration @xmath83 with @xmath84 . in this case , the equality of the squared momentum transferred to the system and to the constituents , eq . ( [ eq : translat7 ] ) , is trivially fulfilled . in the other cases , one has to take into account the modification of the calculation given by the coefficient @xmath73 , which is solution of eq . ( [ eq : q2 ] ) . consistently with our intent , the coefficient @xmath73 departs from the value 1 by interaction effects . while the coefficient @xmath73 was given an approximate numerical value in earlier works , we stress that it is given here its exact algebraic expression as obtained from solving the above equation , similarly to what has already been done in ref . @xcite for scalar constituents . the practical implementation of the constraints discussed above for the form factors of pseudoscalar mesons does not differ much from the one for a scalar system composed of scalar constituents @xcite . as for this system , there are two form factors corresponding to lorentz 4-vector and scalar currents , @xmath65 and @xmath66 respectively , which sum up the contributions of constituents 1 and 2 with the corresponding charges . the main change concerns the introduction of the quark - spinor description . in short , this change amounts to multiply the integrand for scalar constituents , mostly given in ref . @xcite , by the ratio of the matrix elements of the free - particle currents for spin-1/2 and spin-0 constituents . the most general expressions of form factors for pseudoscalar mesons considered here are somewhat cumbersome . they involve results for different forms , without and with the effect of the implementation of the constraints and for different quark masses . due to their technical character , we refer to a separate note @xcite for details . in this note , it is also shown how charge form factors in different approaches , after implementing the effect of constraints , can be identified to a unique expression , which turns out to be the one obtained from a dispersion - relation approach . first examples of a relationship between this last approach and a rqm one were mentioned for the front - form case with @xmath0 @xcite . quite generally , such identities are non - trivial . on the one hand , the dispersion approach implies a two - dimensional integration over mandelstam variables of the covariant interaction - free scattering amplitude of the constituents with the external field . as a result , the squared momentum transferred to the constituents , @xmath63 , and to the system , @xmath62 , are equal and eq . ( [ eq : translat7 ] ) is automatically fulfilled . on the other hand , the rqm approaches imply generally a three - dimensional integration over the momentum of one of the constituents . different choices are possible for the matrix element of the current which is integrated over in this case ( see ref . @xcite for an example ) . matrix elements used in the present work are consistent with what is expected in the interaction - free case . they nevertheless contain extra terms that have an interaction character and complete those accounted for by the factor @xmath73 discussed above . these terms ensure that the form factor at @xmath85 , which is not affected by the above constraints , should be lorentz invariant . this is illustrated in a particular case by the consideration of eqs . ( [ eq : f1p ] ) , ( [ eq : f1 m ] ) and ( [ eq : f1 t ] ) of sect . [ mass_op ] . as the dispersion - relation approach is the one which the other rqm approaches are expected to converge to after implementing the effect of constraints , we give here the corresponding results . though we are mainly interested here in the charge form factor @xmath65 , we also include the scalar form factor @xmath66 as the comparison of the two form factors shows features significantly different from the scalar constituent case , especially with respect to their asymptotic behavior . the expressions for the contributions of the constituent 1 read : @xmath86 \;\theta(\cdots ) } { d\sqrt{d}\sqrt{s_i-(m_1\!-\!m_2)^2}\;\sqrt{s_f-(m_1\!-\!m_2)^2 } } \ , , \nonumber \\ & & f^{(1)}_0(q^2 ) = \frac{1}{n } \int d\bar{s } \ ; d(\frac{s_i\!-\!s_f}{q})\ ; \phi(s_i ) \ ; \phi(s_f ) \nonumber \\ & & \hspace*{2 cm } \times \frac{\big[2m_1 \big(\bar{s}\!-\!(m_1\!-\!m_2)^2\big)+m_2\,q^2\big ] \;\theta(\cdots ) } { 2\sqrt{d}\,(2m_1)\,\sqrt{s_i-(m_1\!-\!m_2)^2}\;\sqrt{s_f-(m_1\!-\!m_2)^2 } } \ , , \label{eq : dp15}\end{aligned}\ ] ] where @xmath87 refers to the interacting constituent , @xmath88 refers to the spectator one and @xmath89 . the quantities @xmath90 , @xmath91 and @xmath92 are defined as : @xmath93 in the equal - mass constituent case , where there is no difference between contributions of constituents 1 and 2 , the above expressions simplify to read : @xmath94 it is noticed that the above form factors differ from the ones for scalar constituents by making the exchange of factors @xmath95 and @xmath96 at the numerator . this immediately shows that the charge form factor will decrease asymptotically faster than the scalar one in the pion case compared to the scalar - constituent case . in this case , the ratio is given by a factor 2 which represents the large @xmath43 limit of the ratio @xmath97 . we notice that the above expression for the charge form factor agrees with the one given by melikhov @xcite but disagrees with an other one given in ref . @xcite for equal - mass constituents . the discrepancy factor in the integrand , @xmath98 , is the same as the factor found for scalar constituents @xcite . in this case , expressions of form factors were checked by considering the simplest feynman triangle diagram , including unequal constituent masses or different masses for the initial and final states . in the pion case , the comparison supposes to disentangle the effect of the wigner rotation used in one of the approach @xcite ( see appendix [ app : a ] ) . as expressions of form factors in the front - form case with @xmath0 are not affected by constraints related to space - time translations , we also give their expressions . they read : @xmath99 where the arguments , @xmath100 and @xmath101 , entering the wave functions may be written as : @xmath102 the ratios , @xmath103 and @xmath104 have been inserted in the expressions of form factors for the case of scalar constituents . they take into account that we are dealing here with spin-1/2 constituents instead of scalar ones . they read : @xmath105 the above expressions can be cast into the dispersion - relation ones by an appropriate change of variables , which allows one to reduce the 3-dimensional integration to a 2-dimensional one @xcite . a different demonstration is given in ref . @xcite the normalization is most often associated to a conserved current and , in absence of other candidate , it is taken as the charge , @xmath106 . starting from eq . ( [ eq : dp15 ] ) , one gets after some algebra of which detail is given elsewhere @xcite : @xmath107 it is noticed that the above expression is symmetrical in the exchange of the constituent masses , @xmath87 and @xmath88 , as expected . the symmetry property reflects a similar one for the contribution of each constituent , allowing one to sum up their charges to get the total charge . it is useful to make the relation of this expression with the expression of the norm in terms of the internal variable @xmath2 . this can be obtained as follows . using the bakamjian - thomas transformation for unequal constituent masses @xcite , possibly generalized to any form @xcite in eq . ( 2 ) of this reference should be replaced by @xmath108 depending on the particle and the factor @xmath109 in the next equations ( 3 , 4 , 5 ) should be replaced by @xmath110 . ] , one can express the @xmath17 variable entering the wave function @xmath111 as : @xmath112 where @xmath113 , @xmath114 . noticing that the above expression for @xmath17 implies relations such as : @xmath115 as well as the relation for the wave function @xmath116 that is useful for our purpose : @xmath117 the expression of the norm given by eq . ( [ eq : dp17 ] ) can be cast into the following ones in terms of the internal @xmath18 variable : @xmath118 this last expression is a rather straightforward generalization of the norm for equal - mass constituents . using the expression @xmath119 ( see eq . ( [ eq : dp19 ] ) ) , the expression @xmath120 ( see eq . ( [ eq : lf2 ] ) ) , and the resulting expressions @xmath121 , @xmath122 , one can also cast the above expression for the norm into the following one : @xmath123 the expression of the pion decay constant obtained in the case of an hyperplane with arbitrary orientation @xmath77 @xcite can be generalized as follows to a pseudoscalar meson composed of quarks with different mass : @xmath124 for the instant form , it reads : @xmath125 this expression can be expressed in terms of the internal variable @xmath2 and the total momentum @xmath35 , using eqs . ( 2 , 3 ) of ref . @xcite ( see also footnote 2 ) . taking into account in particular that the integration of the quantity @xmath126 over the orientation of @xmath2 gives @xmath127 , the expression is found to be equal to : @xmath128 the expression is independent of the momentum of the pseudoscalar meson , @xmath35 , and therefore is lorentz invariant . the expression in the point form " can be obtained from eq . ( [ fpi7 ] ) by using the relevant definition of @xmath77 , @xmath129 : @xmath130 this expression is explicitly lorentz invariant , in contrast to the instant - form one where this property is implicit . similarly to this approach however , the p.f . " expression of the pion decay constant can be expressed in terms of the internal variable @xmath2 . the result so obtained is given by : @xmath131 the expression in the front - form case can be found in the literature @xcite but can also be obtained from eq . ( [ fpi7 ] ) with a standard change of variable . it reads : @xmath132 where the argument of the wave function , @xmath133 , has been given previously ( see eqs . ( [ eq : dp19 ] , [ eq : dp20 ] ) and text after eq . ( [ eq : normif ] ) ) . not surprisingly , the above expression can be recovered from the instant - form one , eq . ( [ fpi2 ] ) , in the limit @xmath134 . one has therefore : @xmath135 an expression of @xmath136 different from the above one , but nevertheless equivalent , has been given in the literature @xcite in the denominator of his expression for @xmath137 ( eq . ( 2.65 ) of the arxiv reference ) is a misprint , without consequence for numerical results presented in his paper . ] . with our notations , it reads : @xmath138 the equivalence of the two expressions can be checked by making the change of variable already mentioned above , @xmath139 . apart from its interest in itself , the decay constant of pseudoscalar - mesons is relevant for the description of their form factors . in the pion case , a relation to the squared charge radius has been proposed in the chiral symmetry limit @xcite : @xmath140 the relation , which does not explicitly refer to the pion description , holds in the point - like limit . a second relation concerns the asymptotic behavior of the pion form factor @xcite : @xmath141 corrections are expected from a non - perturbative calculation @xcite , which could also be found in a rqm approach @xcite . we consider in this section the quantitative effect of constraints related to covariant space - time translations for the charge form factor of pseudoscalar mesons . this is done for both the pion and the kaon mesons . for our purpose , it is sufficient to consider the simplest description of the mesons . it is not totally arbitrary however and we assume that it is given by a gaussian wave function with a parameter as obtained from a standard confining potential @xcite : @xmath142 where @xmath143 represents the string tension ( @xmath144 gev@xmath145@xmath1461 gev / fm ) , while @xmath147 and @xmath148 respectively represent the smallest and largest constituent - quark masses . the quark masses are determined by requiring that they allow one to reproduce approximately the pion or kaon decay constants ( respectively 0.0924 gev and 0.113 gev in our conventions for the definition of these constants ) . as mentioned at the end of the previous section , there is in the pion case some approximate relation of this constant to the charge radius ( see eq . ( [ eq : rch2 ] ) ) . the above relationship may be therefore relevant for describing the pion charge form factor at small @xmath43 . the values we use for the quark masses are @xmath149 gev and @xmath150 gev , corresponding to pion and kaon decay constants of 0.092 gev and 0.113 gev . to the extent where the string tension we are using is determined by fitting regge trajectories , results presented in this section are essentially parameter free . a gaussian wave function has been used in many works @xcite but , in most cases , the parameter on which it depends and the quark masses were fitted to the measured pion ( or kaon ) form factor . though we show calculated form factors and measurements in the same figure , our intent in this section is not to compare them in detail . we stress that our main intent here is to examine the role of constraints related to space - time translations and determine which approach is , ultimately , the most appropriate for a comparison to measurements . nevertheless , a comparison at this point may be useful to tell us how good are estimates based on a wave function whose parameters are obtained from considerations different from the measured form factors . it can determine whether there is a large space for improvement from considering a better wave function to be considered in the next section . charge form factors of the charged pions and kaons are calculated for both a small range of @xmath43 ( @xmath151 gev@xmath145 ) , which is mainly sensitive to the charge radius , and an intermediate range which could be of relevance for present and future measurements , ( @xmath152 gev@xmath145 ) . in this case , the form factors are multiplied by a factor @xmath43 , as it is expected that this product should tend asymptotically to a constant ( up to log terms ) . the contribution that could account for this asymptotic behavior within a rqm framework @xcite is however ignored in the present section but will be considered in the next one . different rqm approaches are considered but , in all cases , calculations are performed in the breit frame . they involve the standard front - form one with @xmath0 ( denoted f.f . ( perp . ) , the instant - form one ( denoted i.f . ) , a front - form one with the momentum transfer oriented along the front direction , @xmath153 ( denoted f.f . ( parallel ) ) and a point - form one ( denoted p.f . " ) . we notice that this point form differs from the dirac one based on a hyperboloid surface @xcite . as mentioned by bakamjian @xcite , it is rather some kind of instant - form approach with the symmetry properties of dirac s point - form . contrary to some previous papers @xcite , we do not present results for an approach inspired from dirac s point - form @xcite . these ones , which involve front - form ones with a summation over all directions ( making their calculation rather lengthy ) , drop between the two cases shown here for a perpendicular and a parallel configuration of the momentum transfer , @xmath154 , and the front direction , @xmath153 . we could also add that the two front - form calculations presented here respectively coincide with the instant - form ones in an infinite momentum frame with a momentum transfer perpendicular and parallel to this infinite momentum . expressions of form factors that are used here have been given in a paper summarizing the technical aspects @xcite . it is reminded that these expressions ensure that form factors are boost and rotation independent and lead to the same results after accounting for constraints related to the covariant transformations of currents under space - time translations . as these results were given for quite general cases , we give in the appendix [ app : b ] the explicit expressions for the breit - frame case considered in the present work . in this respect , we note that expressions of form factors used here differ from the ones used in ref . @xcite , except for the front - form case with @xmath0 . this work , mainly devoted to the asymptotic behavior of the pion charge form factor , was not concerned with accounting for the constraints related to covariant space - time translations . though the numerical effect is a relatively minor one , the choice of the current adopted there differs from the one used here at @xmath29 . this could allow one to get results close to each other for different approaches after taking into account the constraints discussed in this work but would prevent one to get identical results for the different approaches as here . let s add that the form of matrix elements of the single - particle currents used here was suggested by an analysis of expressions obtained with the simplest feynman triangle diagram @xcite ( and taking into account that we are dealing in this work with fermions instead of bosons ) . results for the pion and kaon charge form factors in absence of the constraints related to space - time translations are shown in figs . [ pi1 ] and [ ka1 ] respectively , together with the corresponding measurements ( refs . @xcite for the pion and refs . @xcite for the kaon ) . examination of the figures shows that front - form form factors in the perpendicular configuration ( @xmath0 ) and the instant - form ones are close to each other . they strongly differ from the other ones ( front - form ones in the parallel configuration and point - form ones ) , especially for the pion where discrepancies can reach many orders of magnitude in the high-@xmath43 range . this result can be related to the departure of the momentum transferred to the constituents , @xmath63 , from the one transferred to the system under consideration , @xmath62 , preventing one to satisfy eq . ( [ eq : translat7 ] ) that is expected for poincar covariant space - time translations . looking at eq . ( [ eq : q2 ] ) , it is found that the discrepancy in the first case , due to the vanishing of the factor @xmath155 , involves terms that are of the second order in interaction effects . in the second case , this factor does not vanish and first order effects are therefore involved . the steep slope of the pion form factor at low @xmath43 can be then related to the appearance of a factor of the order @xmath156 in front of the @xmath43 term in the argument of wave functions entering the corresponding expressions for form factors . as the pion mass is small in comparison of the sum of the constituent masses , the effect due to this factor is necessarily large . in comparison , the kaon mass is closer to the sum of the constituent masses and , as a result , discrepancies are significantly smaller . not surprisingly , present results show a strong qualitative similarity with those for scalar constituents @xcite . the effects mentioned here essentially involve the wave functions and are relatively insensitive to the current operator . there is however one effect that the restriction of the present study to charge form factors does not allow us to evidence . in comparison with the scalar constituent case , the charge form factor is systematically suppressed with respect to the scalar form factor at high @xmath43 . this effect , which involves the current operator , is roughly given by a factor @xmath157 . when constraints related to covariant space - time translations are accounted for , form factors as those shown in figs . [ pi1 ] and [ ka1 ] tend to get closer to each other @xcite . in the present case , the choice of the currents in different forms also ensures lorentz invariance @xcite . thus , accounting for the above constraints makes form factors shown in figs . [ pi1 ] and [ ka1 ] identical to the front - form ones in the perpendicular configuration ( @xmath0 , denoted f.f . ( perp . ) ) . there is therefore no need to present new figures . it is worth noticing that accounting for the constraints has removed tremendous discrepancies at both low and large @xmath43 . in particular , the steep slope of the pion charge form factor at low @xmath43 , which could be infinite when the pion mass vanishes , has disappeared . in this case , the constraints allow one to get rid of the paradox where the charge radius becomes infinite while the mass of the system goes to zero , what is generally obtained by increasing the attraction . more generally , the constraints can reduce or even remove ambiguities like the one which leads to get very different form factors from employing a unique wave function , depending on the mass of the system , while one would expect a unique result from a non - relativistic calculation . to some extent , the constraints restore fundamental symmetry properties that are missed from using some particular ( truncated ) approaches , somewhat similarly to what occurs in other fields of physics . it has been shown that accounting for the constraints related to covariant space - time translations could allow one to cast the form factors calculated in different forms into a unique expression that is suggested by using a dispersion - relation approach . while expressions for form factors then involve the same integrand , we would like to stress that this result is far from being trivial . it is obtained by using a change of variables that differs from one form to the other . this is evidenced by looking at the contribution to form factors corresponding to given values of the momentum of the spectator constituent , which in the present work , is chosen as the integration variable . for illustrating this result , we considered the integrand , @xmath158 , obtained in different forms after integrating on the components of the spectator momentum corresponding to a total momentum , @xmath159 . the ratios of these integrands to the form factors , which are defined as : @xmath160 are shown in fig . [ pi2 ] as a function of the @xmath161 variable for two momentum transfers , @xmath162 and @xmath163 gev@xmath145 . as the examination of the two panels shows , results depend significantly on the approach , as well as the momentum transfer . it is noticed that results at low @xmath43 fall in two sets that are indicative of what occurs at the value @xmath85 ( not shown in the figure ) where the two front - form results and the instant- and point - form separately coincide with each other . the contribution to the form factor extends to large momenta in the first case while it is rather concentrated at relatively small momenta in the second case . at larger @xmath43 , the contribution to the form factor tends to concentrate to the lower @xmath161 range in all cases . it sounds that the results for the instant - form and front - form one with the parallel momentum configuration are getting closer to each other and could coincide in the infinite @xmath43 limit . as the first approach in an infinite - momentum frame coincides with the second one , such a result may not be so surprising . in this section , we concentrated on the role of constraints related to covariant space - time translations . having shown that accounting for them amounts to obtain form factors equal to the front - form ones with @xmath0 ( f.f . ( perp . ) ) , we can consider these last form factors for a first comparison with measurements . while , there is essentially no free parameter , it is found that there is a rough agreement in the pion case . it is noticeable that the calculated pion charge form factor evidences some kind of plateau in the range 15 gev@xmath145 . as mentioned previously , this plateau has nothing to do with the theoretically expected one as the corresponding physics has been ignored . it simply results from the fact that the product of the form factor by @xmath43 has a maximum in the above range . with this respect , the departure for the point around 10 gev@xmath145 probably provides hint for missing physics . in the kaon case , there could be some trend to slightly overestimate the experimental data . in view of this first comparison with measurements , improving the description of pseudoscalar meson form factors could reveal to be difficult . in this section , we intend to make some comparison with measurements , taking into account that form factors can be identified to those obtained in the standard front - form case with @xmath0 after the effect of constraints related to covariant space - time translations has been incorporated . the comparison mainly concerns the pion charge form factor , which has been measured in a momentum - transfer range larger than for the kaon case . we consider successively : further physical ingredients that should be accounted for , the perturbative calculation of the solution of the mass operator , and results so obtained once the qcd coupling @xmath164 is given some standard value . the discussion essentially involves the value of the string tension , @xmath143 , and the quark mass , @xmath165 . in most cases , we impose that the pion - decay constant be reproduced , which determines the value of the last quantity in terms of @xmath143 and the physical ingredients under consideration . the pion decay constant indeed enters in a chiral - symmetry calculation that provides a large part of the squared pion charge radius . to make a relevant comparison with measurements , further physical ingredients should be considered besides the contribution to the mass operator of the only confining force we accounted for in the previous section for simplicity . we thus expect some contribution due to the one - gluon exchange force . some was considered in the past @xcite but as mentioned in the introduction , it tends to overestimate the pion charge form factor at high @xmath43 with the currently used value of the qcd coupling @xmath166 . this suggests that the underlying non - perturbative calculation needs corrections . in the present work , we perform a perturbative calculation with respect to this one - gluon exchange , which can be therefore considered as providing a minimal effect . it is expected that this contribution enhances the high - momentum tail of the solution of the mass operator and , consequently , produce an increase of the form factor at very high @xmath43 in comparison to the gaussian solution . the former has a power - law behavior ( @xmath167 ) @xcite while the latter vanishes exponentially . there is a second contribution involving one - gluon exchange . as is known , a standard estimate of the pion charge form factor from a single - particle like current misses the expected asymptotic behavior of this form factor @xcite . to reproduce this behavior ( @xmath157 ) , a two - particle one - gluon exchange current , which implies the off - mass shell behavior of the one - gluon exchange interaction , has to be considered . its expression has been recently determined for a rqm calculation of the pion charge form factor @xcite . interestingly , its contribution , which involves the low - momentum component of the meson wave function , is not depending too much on its description . it provides an increase of the charge form factor corresponding to a small decrease of the squared charge radius ( @xmath168 fm@xmath145 ) and an increase of the product @xmath170 ( of the order of 0.2 gev@xmath145 at @xmath163 gev@xmath145 ) . the first contribution looks small in comparison to the total squared charge radius but is not so small if it is compared to the part of this quantity that could be attributed to the matter squared radius ( as roughly obtained from the difference between the measured one , 0.43 fm@xmath145 , and the part given by a chiral - symmetry calculation in the point - like limit , @xmath171 fm@xmath145 . the second contribution is definitively relevant at the highest values of @xmath43 where the pion charge form factor has been measured . to obtain a perturbative solution of the mass operator , we start from eq . ( 1 ) of ref . @xcite , which was given for a non - perturbative case . due to the non - local character of the interaction , the solution is more easily calculated in momentum space than in configuration space . the correction to the unperturbed gaussian solution , @xmath23 , is given for the free green s function case by : @xmath172 where @xmath173 is related to the strong coupling @xmath164 by the relation @xmath174 . the model implicitly used for describing the confinement interaction in the previous section ( harmonic - oscillator - type interaction ) allows one to do better however by incorporating its effect in the green s function . the solution then reads : @xmath175 where @xmath176 describes the radial excitations given by a harmonic oscillator model consistently with the gaussian solution employed for the ground state ( normalization @xmath177 ) . the modification of the green s function mainly affects the low-@xmath18 behavior of the correction to the solution of the mass operator , which it tends to reduce . in practice , we add to the correction given in the free green s function case the correction implied by the more complete green s function with @xmath178 . we first present results by adding to those for the pion charge form factor given in the previous section the contribution involving the one - gluon exchange contribution from a perturbative calculation as described above and the contribution due to two - particle currents as described in ref . @xcite for the standard front - form case . the intent is to provide us with a qualitative illustration of the effect of these contributions . this is done in fig . [ compar20 ] where we show the form factors obtained with a gaussian solution of the mass operator ( previous section , continuous line ) , and with adding successively the effect of a one - gluon exchange in the quark - quark interaction ( short - dash line ) and of a two - particle current ( short - dash dotted line , denoted ogec ) . as these last two calculations correspond to a different value for the pion decay constant , @xmath179 , we also show the results with the right pion decay constant ( long - dash and long - dash dotted lines ) , which supposes to modify the quark mass from @xmath180 gev to @xmath181 gev . the results without the two - particle current could be compared to the results involving the confinement interaction only . as in the previous section , results for the form factor extending up to @xmath163 gev@xmath145 are multiplied by the factor @xmath43 , in relation with the expectation of a plateau in the asymptotic limit , but , as the logarithmic scale does not justify any more here , we adopt a linear scale . corrections due to the one - gluon exchange in the interaction provide _ a priori _ a sizeable effect . however , at low @xmath43 , the correction is almost proportional to the form factor without the one - gluon exchange and , as examination of the corresponding panel shows , not much effect is seen after renormalizing the form factor at @xmath85 to its conventional value 1 ( more than a factor 2 ) . the slight discrepancy that can be observed between the continuous and short - dash lines can be traced back to the fact that including the one - gluon exchange in the interaction modifies the value of @xmath179 from 0.092 to 0.1015 gev . as there is some indication that part of the squared charge radius is proportional to the inverse of the square of the pion decay constant , see the relation given by eq . ( [ eq : rch2 ] ) and ref . @xcite for some probing of this relation , we examined the consequences due to a change of this value . as the comparison of the continuous and long - dash lines indicates , it is found that the discrepancy can be largely removed by using in the calculation that includes corrections due to the one - gluon exchange in the interaction a quark mass consistent with the value @xmath182 0.092 gev , ( @xmath183 0.21 gev instead of 0.25 gev ) . the correction due to the one - gluon exchange current , being proportional to @xmath43 , does not represent much in the low-@xmath43 range . its size nevertheless compares to the discrepancies between different calculations of the contributions to form factor due to the single - particle current . significant effects begin to show up at higher @xmath43 as examination of the corresponding panel in fig . [ compar20 ] indicates . the correction due to the one - gluon exchange in the interaction ( discrepancy between the continuous and short- or long - dash lines ) tends to show a plateau in the range ( 510 ) gev@xmath145 while the form factor without this contribution begins to decrease actually , this plateau is misleading and it rather represents a maximum as calculations at much higher @xmath43 shows . the appearance of a plateau in the product of the form factor by @xmath43 , as expected from qcd , is produced by the one - gluon exchange current contribution ( ogec ) , which , due to its proportionality to @xmath43 at small values of this quantity , is still increasing in the range considered in the figure ( the value at @xmath163 gev@xmath145 is off the asymptotic value by about 20% ) . considering the total form factor , it is found to significantly overshoot measurements as in the low-@xmath43 domain but , contrary to this case , the discrepancy can not be alleviated by modifying the quark mass so that to reproduce the pion decay constant , as shown in the figure . with this respect , it is noticed that the slight discrepancy between the two calculations of the contribution of the two - particle current around @xmath163 gev@xmath145 has some relationship with the discrepancy between the corresponding pion decay constants , as expected from the expression of the asymptotic form factor given by eq . ( [ eq : asym ] ) . thus , the consideration of the various contributions due to one - gluon exchange on top of the confinement interaction improves to some extent the description of the pion form factor at high @xmath43 but probably provides a too large effect . the second set of results is intended to remedy the above high-@xmath43 discrepancy and implies a change of the string tension @xmath143 so that to approximately reproduce measurements . in this case , the quark mass is always fitted to reproduce the pion decay constant , @xmath179 , and corresponding results are presented in fig . [ compar14 ] . we considered many values of the string tension and decrease it down to 0.14 gev@xmath145 , so that to approximately reproduce the most accurate measurements in the range @xmath18412 gev@xmath145 . as the corresponding panel shows , the one - gluon exchange contributions in both the interaction and in the current begin to be relevant in this range before becoming essential at higher values of @xmath43 . due to large error bars , it is difficult to say whether the present calculation disagrees with the measurement at the point close to @xmath163 gev@xmath145 . at low @xmath43 ( left panel of fig . [ compar14 ] ) , it is found that the three calculations are close to measurements at first sight . a closer examination nevertheless shows that the calculation with a gaussian wave function or the one incorporating contributions from one - gluon exchange in both the interaction and in the current are doing better as far as the squared charge radius is concerned . in units of fm@xmath145 , the numbers are 0.41 and 0.42 respectively instead of 0.49 in the third case while the usually value quoted from measurements is 0.43 . the comparison with the theoretical numbers for the string tension 0.20 gev@xmath145 , 0.45 , 0.39 and 0.46 respectively , shows a significant effect from one - gluon exchange contributions but , also , a significant dependence on the strength of the confinement . this one implies a different balance of contributions due to the one - gluon exchange in the interaction and in the current . to complement the above results , we also give in fig . [ comparwf ] the different solutions of the mass operator used here : gaussians with @xmath1850.2 gev@xmath145 and 0.14 gev@xmath145 , and the corresponding perturbative calculations . in all cases , the quark mass is fixed to reproduce the pion decay constant , @xmath182 0.092 gev , with the result @xmath1860.25 , 0.35 , 0.21 and 0.245 gev respectively . the left panel shows the bulk contribution , which is roughly the same for all cases . part of the differences can be ascribed to the choice of the string tension and to the one - gluon exchange contribution that slightly shifts the wave function to higher values of the internal variable @xmath18 . the role of the one - gluon exchange contribution is better seen on the right panel . in its absence , as can be seen on the figure , wave functions drop exponentially . when it is considered , the tail of the wave function shows a slow decrease given by the power - law behavior @xmath46 ( @xmath187 for the quantity shown in the figure ) . this tail is responsible for a slower decrease of form factors in comparison to the pure gaussian case . due to a limited experimental information , we did not consider the kaon charge form factor . let s first mention that a lower value of the string tension , as suggested by the pion results , would provide a better account of measurements in comparison to what was shown in sect . the main question is whether the one - gluon exchange contribution to the current would cancel most of the effect as it does for the pion . in absence of a detailed study of this contribution for the kaon , it is difficult to answer . we only note that a calculation with an average quark mass , @xmath188 leads to an effect slightly less than a half of the pion one . we provided in the text of the present paper a discussion of ingredients allowing us to make a comparison with other rqm calculations , especially with respect to the choice of the mass operator , possible quark form factors and non - perturbative effects ( introduction and sect . [ mass_op ] ) , and two - particle currents motivated by the asymptotic behavior of the pion charge form factor ( this section ) . one could also compare present results with those of field - theory or lattice calculations . in making such a comparison , one should however take into account that calculations to some order in a given framework are not necessarily identical to the ones in other frameworks . considering first the contribution that allows one to reproduce the asymptotic behavior of the pion charge form factor , the present one is found to be in good agreement with the field - theory one calculated over a large @xmath43 range in ref . @xcite for instance and with the one calculated differently at high @xmath43 in ref . @xcite ( the comparison is not possible at small and moderate @xmath43 in this case ) . it qualitatively agrees with the one obtained in lattice calculations by comparing unquenched and quenched calculations @xcite . in either case , this contribution is not essential to explain the bulk contribution at small and moderate @xmath43 ( below @xmath189 gev@xmath145 ) . in this range , it looks as if our results agree with the field - theory or lattice ones but we should stress that our results are calculated up to the first order in the qcd coupling , @xmath190 , while the other ones are likely to include many orders . we mentioned possible problems with accounting for the one - gluon exchange non - perturbatively in a rqm calculation together with the standard value @xmath190 . the comparison of rqm calculations with field - theory or lattice ones probably suggests that the former ones should use an effective coupling with a value smaller than the standard one . this could account for retardation effects or , perhaps also , the running character of the qcd coupling . a further suggestion would consist in introducing quark form factors . in this paper we considered the consequences of covariant poincar space - time translations for the description of the form factor of pseudoscalar mesons in a rqm framework . this property is generally used to factorize out the dependence on the space - time position in the current matrix element , allowing one to obtain the energy - momentum conservation . for the calculation of form factors , one can thus use the current at @xmath191 , which , most often , is taken as a single - particle current , independently of the form of relativity that is employed . we showed that the energy - momentum conservation does not exhaust all properties stemming from the covariant character of poincar space - time translations . looking at relations derived in the vicinity of the point @xmath191 @xcite , and implying the squared momentum transferred to the constituents and to the one transferred to the system , we found that they are generally inconsistent with the single - particle assumption for the current . only the standard front - form approach with the condition @xmath0 could fulfill the expected relations . for other forms or other kinematic conditions , we worked out a way to account for the further relations . it amounts to introduce interaction effects in the relation of the constituents momenta to the momentum transfer while keeping the single - particle structure of the current . these effects , that are here or there depending on the approach , correspond to take into account many - particle currents at all orders in the interaction as an expansion would show . in field - theory based approaches , they would correspond to z - type diagram ones . when these effects are introduced , the equivalence of different approaches can be restored provided that the matrix element of the single - particle current in each form is appropriately chosen . interestingly , present theoretical results for the pseudoscalar - meson charge form factor reproduce those expected in a dispersion - relation approach @xcite ( with some correction for the last reference ) . except for the standard front - form case ( with @xmath0 ) , such a result could not be anticipated . wondering about this result , we feel that two ingredients play an essential role . to a large extent , the effects of constraints considered here tend to restore the equality of the squared momenta transferred to the constituents and the one transferred to the system . this relation is always fulfilled in a field - theory approach and , _ a fortiori _ , in a dispersion - relation approach which is based on this framework , but it is generally not satisfied in the simplest rqm approach . the second ingredient concerns the matrix element of the single - particle current to start with . in absence of interaction between constituents , the scattering amplitude of the system with the electromagnetic field which underlies implicitly present rqm results , is the same as in the dispersion - relation approach . besides this contribution , the matrix element may also contain extra contributions . these ones have an interaction character and ensure that its value at @xmath85 , which is associated to the charge and is not concerned by the above constraints , be lorentz invariant . the effective matrix elements so obtained could differ from the ones naively expected . it thus appears that getting reliable form factors , which should be independent of the form chosen to implement relativity , implies all aspects of the poincar group : boosts , rotations but also space - time translations . the above effects have been illustrated in the case of the pion and kaon mesons , using a description of these mesons accounting essentially for the confinement interaction . the effects can be especially large for some calculations in the pion case , in relation with the fact that the pion mass is significantly smaller than the sum of the relativistic kinetic energies of the constituents in comparison with the kaon case . noting that in absence of these effects , these calculations would produce a charge radius that would go to infinity while the mass of the system vanishes as well as other paradoxes @xcite , it is probably not overstated to say that the above effects remove violations of space - time translations covariance properties that these calculations imply . to a very large extent , present results agree qualitatively with those obtained for scalar constituents @xcite but they offer the advantage to concern a physical system . in comparison with experiment , this first set of results provides a good account of measurements with a string tension equal to 0.2 gev@xmath145 . it represents a reasonable starting point for improvements . necessary improvements involve the contributions of the one - gluon exchange in both the interaction and in the current . the first one has been estimated from a perturbative - type calculation , taking into account that a complete non - perturbative calculation could lead to some difficulties with the qcd coupling @xmath190 . the second one ensures that the expected qcd asymptotic behavior for the charge form factor is recovered . it is found in the pion case that the two contributions tend to increase the form factor , especially at high @xmath43 . a quite reasonable account of measurements is obtained by lowering the string tension from 0.2 gev@xmath145 to 0.14 gev@xmath145 , a value that is probably at the lower limit of what is acceptable . interestingly , however , the change in the string tension has provided a better description of measurements in both the low-@xmath43 and the intermediate-@xmath43 domains . we could probably improve the description by playing with the different ingredients , by requiring for instance that the mass operator reproduces the mass difference between pseudoscalar and vector mesons or between the non - strange and strange mesons . we nevertheless refrain to do it as we believe that many questions could be raised at this point concerning the theoretical inputs . from this study , we can take for granted a number of features . the contributions of one - gluon exchange in both the interaction and in the current become important ingredients of a realistic description of the pion charge form factor around and beyond @xmath192gev@xmath145 , due to their increasing role with @xmath43 . the role of the contribution in the current could extend to the low-@xmath43 domain where it compares to other effects . remarkably , this contribution was found to be rather stable and not depending much on which calculation we were performing . in comparing different results , we found it was important that they correspond to the same value of the pion decay constant , what was achieved by fitting the quark mass . this prevented us to make biased conclusions in many circumstances . while the above contributions seem to go in the right direction , questions however may arise from the limitation of their study . as remembered in the introduction , an unrestricted calculation of the one - gluon exchange contribution to the interaction would produce a too large form factor . this could be remedied by using a smaller value for the string tension but this one is already at the lower limit of what is acceptable . we should add that describing the confining force as a sum of a kinetic energy and a linear @xmath193-dependent term could have similar effects to some extent and would not _ a priori _ alleviate the problem . this , in turn , raises the question of the precise form of the confinement interaction and its interplay with the one - gluon exchange contribution to the interaction . let s mention that retardation effects , which have been considered in the scalar constituent case , could decrease this last contribution but it is not clear whether they would be sufficient to remove the above problem . they could also affect the calculation of the meson mass spectrum but there is no indication that this one will be necessarily improved . as for the one - gluon exchange contribution to the current , the question that may be raised concerns higher - order corrections in the qcd coupling @xmath164 , which have been discarded for simplicity in the expression we used . the question also concerns possible corrections related to the confinement interaction , which have no reason to be negligible in comparison to the contribution retained here but are completely unknown . ultimately , one could invoke quark form factors @xcite though these ones are not quite consistent at first sight with the expression of the asymptotic behavior of the pion charge form factor . an improved model would consist in considering the coupling to the photon of quark - antiquark pairs generated by one - gluon exchange . it can incorporate the vector - meson phenomenology @xcite and in particular the @xmath194-vector meson dominance one @xcite that could be important for the range @xmath195 1 gev@xmath145 . part of this last effect is accounted for in the present work @xcite but there is another part corresponding to quark - antiquark correlations which is certainly not . how much space is left for such an effect in the present work is not clear but some could allow one to correct or to alleviate part of the drawbacks mentioned above . we started this work with the idea that an implementation of relativity free of uncertainties relative to the choice of a particular form should be used for studying the form factor of pseudoscalar mesons and , thus , for getting information on the mass operator describing these particles . from a phenomenological viewpoint , it sounds that this task should not be too difficult , partly due to the fact that the simplest description is already doing well . the main question is whether this information is consistent with what is theoretically expected . this part of the task could be more difficult . it would probably require more elaborate descriptions of both the mass operator and the current within the rqm framework but , also , more accurate measurements of the pion charge form factor for @xmath196 gev@xmath145 to discriminate between different schemes . clarifying the role of the measurement at around @xmath197 gev@xmath145 by making it more accurate would be specially useful . it seems difficult to accommodate its present central value within descriptions of the form factor which do relatively well at smaller momentum transfers . a complementary study would involve the consideration of the pseudoscalar meson spectrum . though it is likely very approximate , the mass operator obtained here could be used for predictions of this spectrum . in turn , the comparison with experiment could lead to improve the mass operator and help to discriminate effects that are due to its description from the ones that are due to the description of the electromagnetic interaction . * acknowledgements * + this work is partly supported by the national sciences foundations of china under grants no . 10775148 , 10975146 , 11035006 ( y.b . ) . the author is also grateful to the cas for grant no kjcx3-syw - n2 . is very grateful to ihep and to lpsc for offering hospitality allowing him to achieve this work . in this section , we provide details that allow one to make a comparison with results for the pion form factor given in ref . we first give expressions for form factors that include both the dirac current and an anomalous magnetic moment so that a more complete comparison can be made with the above work that contains the two terms ( with a different parametrization ) . as this work is based on the use of wigner rotation angles while ours does not consider them explicitly , we also provide expressions for quantities involving the sum of these wigner rotation angles @xmath198 and @xmath199 , that are relevant for a comparison . they allow one to get closer expressions for form factors while considerably simplifying the comparison which shows a discrepancy factor in the integrand . we finally show how our results , which agree with those obtained by melikhov @xcite , can be checked from the consideration of the simplest feynman diagram . for definiteness , we write the quark current as : @xmath200 where @xmath201 . for our main purpose here , it is sufficient to consider one kind of quark . it would be straightforward to generalize to different quarks expressions given below if necessary . for on mass - shell quarks , the above current can be cast into the gordon form : @xmath202 where : @xmath203 the corresponding dispersion - relation expression for the pion charge form factor is given by : @xmath204 though our approach does not explicitly refer to the wigner rotation angles , it is convenient to express some of the factors appearing in the above expression in terms of these quantities so that to facilitate the comparison with the expression given in ref . @xcite . in this aim , the following relations are useful : @xmath205 one thus gets : @xmath206 the contribution to the pion charge form factor for the term @xmath207 alone , considered in the main text , is easily recovered by using the relation : @xmath208 the comparison of the above expression for the form factor , eq . ( [ eq : app5 ] ) , with the one given in ref . @xcite shows that this last one contains an extra @xmath43 dependent factor , @xmath209 ( first line of their eq . ( 88 ) ) , that is not supported neither by our approach , nor by melikhov s one @xcite ( see eqs . ( 2.50 , 2.53 ) of the web version of the paper ) . the appearance of a discrepancy factor similar to the above one was already observed for the scalar - constituent case @xcite . actually the full factor is given by @xmath210 so that the charge form factor at @xmath85 is unchanged . it could be checked by considering the simplest feynman triangle diagram @xcite . due to divergences , the consideration of this diagram is not so useful in the spin-1/2 constituent case . it nevertheless provides some information for converging contributions like the one proportional to the factor @xmath211 in eq . ( [ eq : app1 ] ) . it is thus found that the contribution to the pion charge form factor can be cast into the form of the term proportional to @xmath211 in eq . ( [ eq : app4 ] ) by using the function @xmath212 . this result is inconsistent with the appearance of the extra @xmath43 dependent factor , @xmath209 , as found in ref . a similar conclusion could be obtained for some contributions proportional to @xmath207 in eq . ( [ eq : app1 ] ) but caution is required in this case in separating various diverging terms . the appearance of the extra @xmath43 dependent factor , @xmath209 , in ref . @xcite originates from a factor @xmath213 ( their eqs . ( 8) and ( 28 ) ) , which has been calculated by the authors in the lab frame where @xmath214 . of course , this result is not lorentz invariant despite its form . the formalism developed by the authors implies in principle other factors , @xmath215 , that depend on @xmath216 ( @xmath217 , their eq . ( 7 ) ; @xmath218 , their eq . ( 10 ) ) . for a reason unknown to us , these factors have been ignored in their final expression for the form factors . we only notice that the combined effect of these factors , @xmath219 , in their eqs . ( 34 , 38 , 39 ) provides an extra factor @xmath220 that could cancel the above undesirable factor . expressions of form factors used in this work are obtained from general ones given in ref . these last ones are somewhat involved and getting explicit expressions to be used for calculating form factors , including the effect of constraints related to covariant space - time translations , may not be straightforward . giving them here may be therefore useful . in principle , results do not depend on the frame used for calculations after the effect related to the above constraints is accounted for but , in practice , it is necessary to choose some . results presented in this work have been obtained in the breit - frame where some simplification occurs . this is done successively for the front form with a momentum transfer perpendicular to the front orientation ( f.f . ( perp . ) , the front form with a momentum transfer parallel to the front orientation ( f.f . ( parallel ) ) , the instant form ( i.f . ) and the point form ( p.f . " ) . expressions are given as integrals over the momentum of the spectator constituent . in the front - form case , we consider components , @xmath221 and @xmath222 , that are parallel and perpendicular to the front orientation , @xmath153 , ( defined in terms of the 4-vector @xcite @xmath223 as @xmath224 ) . in the other cases , we consider components that are parallel and perpendicular to the momentum transfer , @xmath154 . the integrand is given as the product of the one for scalar constituents multiplied by a factor that represents the ratio of currents for spin 1/2 and spin 0 constituents . it involves the variables relative to the spectator constituent , @xmath221 and @xmath222 , as well as other quantities that depend on them , such as the argument entering wave functions , @xmath225 ( or @xmath226 ) , the energy of the system , @xmath227 , and the energies of the interacting constituents , @xmath228 . in all cases , the relation of @xmath225 to @xmath226 , ( [ eq : lf1 ] ) , may be written as : @xmath229 the energy of the system in the breit frame is given by : @xmath230 the other quantities , which generally depend on the approach , are given below for each of them . @xmath231 front form with a momentum transfer perpendicular to the front orientation @xmath232 where @xmath233 using the quantity @xmath234 , it is noticed that the above expression for the form factor can be cast into the one given by eq . ( [ eq : lf1 ] ) while @xmath226 takes the form given by eq . ( [ eq : lf2 ] ) . @xmath231 front form with a momentum transfer parallel to the front orientation @xmath235 where @xmath236 @xmath231 instant form @xmath237 where @xmath238 @xmath231 point form " + the expression for form factors in the point - form " approach is perhaps more naturally written in terms of the velocity of the initial or final system in the breit frame , @xmath239 with our conventions : @xmath240 where @xmath241 the very last equation can be cast into a form implying the factor multiplying the quantity @xmath242 as in the other cases . the relevant equation is the following one : @xmath243 the quantity @xmath244 appearing in the above equation is a small correction that vanishes for equal mass constituents . it is defined as follows : @xmath245 it however depends on @xmath246 , which complicates the practical derivation of this last quantity . the full equation to be solved reads : @xmath247 it supposes to solve an equation of the 4rth degree in the variable @xmath248 . the correction has been accounted for in the present work . actually , we found simpler to solve the equation by using an iterative process ( a few iterations were sufficient ) . moreover , as the quantity @xmath244 involves terms depending on @xmath249 , one could wonder about the appearance of @xmath250 instead of @xmath251 or any combination of the masses in eq . ( [ eq : beta1 ] ) . the choice made here sounds to provide a faster convergence of the iterative process . despite differences in expressions , all form factors obtained in different approaches at @xmath85 can be reduced to a common expression given in terms of the internal variable @xmath2 : @xmath252 it was mentioned in the main text that strong effects , before accounting for constraints related to covariant space - time translations , were due to the smallness of the pion mass in comparison with the sum of the quark masses . looking at the expressions for form factors , it is seen that only the instant - form result ( breit frame ) does not depend on the mass of the system . for the front form with a momentum transfer perpendicular to the front orientation ( @xmath0 ) , the dependence on @xmath253 , through the dependence on @xmath227 , can be shown to have no effect by using the alternative variable @xmath234 instead of @xmath221 . for the front form with a momentum transfer parallel to the front orientation , a similar trick can be used but only after accounting for the above mentioned constraints . for the point form " , the dependence on @xmath253 appears through the quantity @xmath246 . by inserting in the first of eqs . ( [ eq : pfalpha ] ) , the value of @xmath73 obtained from the second one , it is easily seen that the dependence of @xmath246 on @xmath253 cancels . the way the dependence on @xmath253 disappears in this last case differs from the one for the front - form case .

the role of poincar covariant space - time translations is investigated in the case of the pseudoscalar - meson charge form factors . it is shown that this role extends beyond the standard energy - momentum conservation , which is accounted for in all relativistic quantum mechanics calculations . it implies constraints that have been largely ignored until now but should be fulfilled to ensure the full poincar covariance . the violation of these constraints , which is more or less important depending on the form of relativistic quantum mechanics that is employed , points to the validity of using a single - particle current , which is generally assumed in calculations of form factors . in short , these constraints concern the relation of the momentum transferred to the constituents to the one transferred to the system . how to account for the related constraints , as well as restoring the equivalence of different relativistic quantum mechanics approaches in estimating form factors , is discussed . some conclusions relative to the underlying dynamics are given in the pion case . pacs numbers : 12.39.ki , 13.40.fn , 14.40.aq + keywords : relativistic quark model ; form factors ; pseudoscalar mesons +

in the seminal paper @xcite , berry demonstrated that a quantum system in a pure state that undergoes an adiabatic cyclic evolution can pick up a phase which is independent of the dynamics of the system . berry s publication began a , still ongoing , era of intensive research on holonomy effects in quantum theory , and some of the more important earlier papers on the topic have been reprinted in @xcite . there , for example , one can find @xcite , in which simon identifies berry s phase as a parallel transport holonomy in a hermitian line bundle over the parameter manifold of the system s hamiltonian , and @xcite , in which aharonov and anandan extend berry s result to the non - adiabatic cyclic case , and make explicit that berry s phase is due to the curvature of projective hilbert space . more recent applications of quantum mechanics in which holonomy effects play a crucial role include quantum information processing and quantum computing @xcite . indeed , it is believed that quantum computation implemented by holonomic quantum gates is intrinsically fault - tolerant and robust against noise @xcite . states of experimentally prepared quantum systems generally exhibit classical uncertainty . hence they are most appropriately described as mixtures of pure states . uhlmann @xcite was among the first to develop a theory for geometric phase for parallel transported mixed states . the theory is based on the concept of purification . another approach to geometric phase for mixed states , based on quantum interferometry , was proposed by sjqvist _ _ @xcite . they derived , and carefully analyzed , an expression for the intensity of the output signal in a classical mach - zehnder interferometer , and from this they extracted a definition of geometric phase for mixed states . several experiments @xcite have been carried out that verify sjqvist _ s results . a shortcoming of the definition of geometric phase given in @xcite is that it only applies to parallel transported nondegenerate mixed states . in the current paper we provide a geometrical framework , inspired by arguments of montgomery @xcite , in which geometric phase for unitarily evolving general mixed states has a natural definition . we show that this definition agrees with the definition in @xcite in those cases where their definition applies , and we derive an explicit formula for the geometric phase which can be easily implemented . our approach is thus particularly well suited for computations . the geometric phase for an evolving quantum system prepared in a pure state is undefined if the initial and final states are orthogonal . for quantum systems in mixed states a similar situation may occur . in a concluding section we introduce higher order geometric phases , and prove that under a generically satisfied condition there will always be a well - defined geometric phase of some order . we also relate the higher order geometric phases to the off - diagonal geometric phases studied by manini and pistolesi @xcite , and mukunda _ et al . mixed quantum states can be represented by density operators . a density operator is a self - adjoint , nonnegative , trace - class operator with unit trace . we write @xmath0 for the space of density operators on a hilbert space @xmath1 , and @xmath2 for the subspace of density operators with finite rank at most @xmath3 . a state is called pure if its density operator has rank @xmath4 . in quantum mechanics , especially quantum information theory , _ purification _ refers to the fact that every density operator can be thought of as representing the reduced state of some pure state . indeed , one can show that if @xmath5 is a density operator acting on @xmath1 , there exists a hilbert space @xmath6 and a density operator @xmath7 representing a pure state in @xmath8 such that @xmath5 is the partial trace of @xmath7 with respect to @xmath6 . in this paper we only consider quantum systems whose states are represented by density operators with finite rank , and by the _ standard purification _ of the density operators in @xmath2 we mean the surjective map @xmath9 here @xmath10 is the space of linear functionals on @xmath11 , and @xmath12 is the unit sphere in @xmath13 . evolving mixed states will be represented by piecewise smooth curves of density operators that , for convenience , are assumed to be defined on an unspecified interval @xmath14 . operators on @xmath11 will be represented by matrices with respect to the canonical basis , whose @xmath15 member we denote by @xmath16 . we write @xmath17 and @xmath18 for the @xmath19 identity matrix and zero matrix , respectively . when you purify a state you artificially add extraneous , perhaps inaccessible , information to your state . one way to get rid of this extra information is to use symplectic reduction . montgomery @xcite showed that if one does symplectic reduction on @xmath20 by the action of the unitary group of @xmath10 , then the reduced phase spaces can be identified with the ( co)adjoint orbits of isospectral density operators in @xmath2 , and the canonical reduced space submersions are given by certain spectral weighted eigenframe bundles . ( a precise reformulation of montgomery s result will be given below . ) we show that in this context , there is a natural definition of geometric phase for unitarily evolving mixed states which generalizes the definition of sjqvist _ but before we do that we need to translate montgomery s result into a language appropriate for our purposes . we begin by identifying @xmath13 with the space of linear maps from @xmath11 to @xmath1 , equipped with the hilbert - schmidt hermitian inner product . then the standard purification is given by @xmath21 . a density operator whose evolution is governed by a von neumann equation stays in a single orbit of the left conjugation action of the unitary group @xmath22 on @xmath0 . these orbits are in one - to - one correspondence with the set of possible spectra for density operators on @xmath1 , where by the spectrum of a rank @xmath3 density operator we mean the _ nonincreasing _ sequence @xmath23 of its , not necessarily distinct , _ positive _ eigenvalues . throughout we assume @xmath24 to be fixed , and we write @xmath25 for the corresponding orbit of density operators . also , we refer to the integer @xmath3 as the length of @xmath24 . let @xmath26 be the diagonal @xmath19 matrix with diagonal @xmath24 , and define @xmath27 as the restriction of to @xmath28 . then @xmath29 is a principal fiber bundle with gauge group @xmath30 . we equip @xmath31 with the metric given by @xmath32 times the real part of the hilbert - schmidt hermitian inner product : @xmath33 . the vertical and horizontal bundles of @xmath29 are the subbundles @xmath34 and @xmath35 , respectively , of the tangent bundle @xmath36 . the former consists of the kernels of the differential of @xmath29 , and the latter of the kernels orthogonal complements with respect to @xmath37 . vectors in @xmath34 and @xmath35 are called vertical and horizontal , respectively , and a curve in @xmath31 is called horizontal if all of its velocity vectors are horizontal . recall that for every curve @xmath5 in @xmath25 and every @xmath38 in the fiber over @xmath39 there is a unique horizontal curve @xmath40 in @xmath31 that starts at @xmath38 and projects onto @xmath5 . this curve is the _ horizontal lift _ of @xmath5 extending from @xmath38 . furthermore , if @xmath5 happens to be a closed curve , then the _ holonomy of @xmath5 with base point @xmath38 _ is the unique matrix @xmath41 in @xmath42 satisfying @xmath43 . we define the geometric phase of @xmath5 to be the argument of the spectral weighted trace of @xmath41 : @xmath44 observe that does not depend on @xmath38 because the holonomy of @xmath5 associated with a different base point is conjugate equivalent to @xmath41 in @xmath42 , and the matrices in @xmath42 commute with @xmath26 . inspired by the classical work of pancharatnam @xcite , samuel and bhandari @xcite generalized berry s phase to a relative geometric phase for non - cyclic unitary evolutions of pure quantum states . here we extend to a relative geometric phase for non - cyclic unitary evolutions of mixed quantum states . let @xmath5 be a curve in @xmath25 . the horizontal lifts of @xmath5 define a parallel transport operator @xmath45 $ ] from the fiber over @xmath39 onto the fiber over @xmath46 according to @xmath45\psi_0=\psi_{||}(\tau)$ ] , where @xmath47 is the horizontal lift of @xmath5 extending from @xmath38 . we define the _ geometric phase factor _ and _ geometric phase _ of @xmath5 to be @xmath48\psi_{0}\right),\label{geophasefactor}\\ & { \gamma_{\text{geo}}}(\rho)=\arg{\zeta_{\text{geo}}}(\rho),\label{geophase}\end{aligned}\ ] ] respectively . observe that the geometric phase factor does not depend on @xmath38 since the right hand side of is invariant under the transitive action of the gauge group on the fiber over @xmath39 . definition reduces to if the curve is closed . however , for this definition to be useful in practice , we need a way to derive a horizontal lift from an arbitrary lift of a curve in @xmath25 . for this we need a connection form . the lie algebra of the gauge group is @xmath49 , and the infinitesimal generators of the gauge group yield canonical isomorphisms between @xmath50 and the fibers in @xmath34 : @xmath51 . furthermore , the horizontal bundle is the kernel bundle of the _ mechanical connection form _ @xmath52 defined by @xmath53 , where @xmath54 and @xmath55 are the _ locked inertia tensor _ and _ moment map _ , respectively : @xmath56 if @xmath5 is a curve in @xmath25 , and @xmath40 is any lift of @xmath5 to @xmath31 , then the horizontal lift of @xmath5 that extends from @xmath57 is @xmath58 where @xmath59 is the positive time - ordered exponential . the exponential factor in has a nice geometric interpretation ; it describes a curve in the gauge group @xmath42 whose continuous action on @xmath31 pushes @xmath40 onto a horizontal curve , see figure [ figure ] . equations and give a truly general definition of geometric phase for unitary evolutions of mixed states . we will now derive an explicit formula for the geometric phase , suitable for computations . thus , let @xmath60 be the multiplicities of the _ distinct _ eigenvalues in @xmath24 , where @xmath61 is the multiplicity of the greatest eigenvalue , @xmath62 of the second greatest eigenvalue and so forth , and define @xmath63 diagonal matrices by @xmath64 a straightforward computation shows that @xmath65 for every vector @xmath66 tangent to @xmath31 at @xmath40 and @xmath67 in @xmath50 . hence , @xmath68 moreover , if @xmath69 is a time - evolution operator that generates @xmath5 , i.e. , @xmath70 , we can take @xmath71 , where @xmath38 is any element in the fiber over @xmath39 . according to , , and , @xmath72 generically , a density operator of a mixed state is nondegenerate . in @xcite , the authors gave a definition of geometric phase for _ parallel transported _ nondegenerate mixed states . we will quickly review it here , and then show that it is a special case of our definition . let the curve @xmath73 represent a unitary evolution of a nondegenerate density operator . following sjqvist _ _ we say that the initial density operator @xmath39 is parallel transported provided all of its eigenkets are parallel transported : @xmath74 . the geometric phase of @xmath5 in the sense of @xcite is then the argument of the expected value of the relative phase factors for the eigenket curves : @xmath75 to show that generalizes , let @xmath5 be any curve in @xmath25 , @xmath47 be any horizontal lift of @xmath5 , and set @xmath76 . define curves of normalized , and at each instant pairwise orthogonal , kets @xmath77 . then @xmath78 , and it follows from the horizontality of @xmath47 , and the observation @xmath79 , that each curve of eigenkets is parallel . ( in fact , using , one can show that the horizontality condition @xmath80 is equivalent to the statement that , at each instant @xmath81 , the velocity vector @xmath82 is orthogonal to the eigenspace of @xmath83 corresponding to the eigenvalue @xmath84 . ) now @xmath85\psi_0\right ) = \sum_k e_k^\dagger \psi_{||}^\dagger(0)\psi_{||}(\tau ) e_k = \sum_k p_k{\langle k(0)|k(\tau)\rangle}.\ ] ] this shows that our definition of geometric phase generalizes the definition of geometric phase in @xcite . consider an ensemble of neutrons subjected to an external magnetic field , and assume that the ensemble is prepared so that the proportion of neutrons with spin up polarization is @xmath86 and the proportion with spin down polarization is @xmath87 , where @xmath88 . the initial state of the spin part of the ensemble s wave function can be represented by the density operator @xmath89 ( here we have modeled the system on @xmath90 in such a way that @xmath91 and @xmath92 represent the spin up and spin down states , respectively . ) if we further assume that the magnetic field is static and uniform with direction @xmath93 , then the hamiltonian is given by @xmath94 , where @xmath95 depends on the magnitudes of the magnetic field and of the neutrons magnetic moments , and @xmath96 is the vector of pauli matrices . the time - evolution operator associated with @xmath97 is the one - parameter family of unitaries @xmath98 observe that this family is non - parallel transporting if @xmath99 . now , a lift of the ensemble s evolution curve @xmath100 is given by @xmath71 , where @xmath101 if the final time equals @xmath102 , the curve @xmath5 returns to its initial state , and the geometric phase of @xmath5 is @xmath103 if the initial and final purifications @xmath38 and @xmath45\psi_0 $ ] are orthogonal , the geometric phase factor vanishes , and , consequently , the geometric phase is not defined . in this section we show how submatrices of @xmath104\psi_0 $ ] can be combined into higher order geometric phase factors that might be nonzero even if the geometric phase factor is zero . for a cyclically evolving state these phase factors will be formal homogeneous polynomials in the matrix entries of the holonomy of the evolution curve ( hence the name higher order geometric phase factors ) . we also formulate a fairly general condition that guarantees the existence of a well - defined geometric phase of some order not greater than the length of @xmath24 , and we observe that this condition is satisfied by cyclic evolutions . suppose @xmath5 is a curve in @xmath25 , and @xmath38 is an element in the fiber over @xmath39 . for each sequence @xmath106 of elements from @xmath107 we define the _ geometric phase factor and geometric phase for @xmath5 corresponding to @xmath108 _ by @xmath109\psi_0e_{j_{k+1}}\quad ( j_{d+1}=j_1),\qquad\gamma_j(\rho)=\arg\zeta_j(\rho),\end{aligned}\ ] ] respectively . the geometric phase factor can be recovered from the geometric phase factors corresponding to single element sequences : @xmath110 . more generally , if @xmath105 is any positive integer , then @xmath111\psi_0)^d ) = \sum_j\zeta_j(\rho)$ ] , where the sum is over all possible sequences @xmath106 that can be formed from the elements in @xmath107 . we define the _ @xmath112 order geometric phase factor and geometric phase of @xmath5 _ as @xmath113 below we show that there is always a nonzero geometric phase factor of an order not greater than the length of @xmath24 if @xmath104\psi_0 $ ] has a nonzero eigenvalue . for cyclic evolutions the geometric phase factor @xmath114 vanishes if the sequence @xmath108 is not constant . indeed , @xmath115\psi_0e_{j_{k+1 } } = \begin{cases } p(\sigma)^d{\operatorname{hol}}(\rho,\psi_0)^d e_{j_1}\text{if $ j_1=j_2=\dots = j_d$},\\ { { \mathbf 0}}_n\text { otherwise , } \end{cases}\ ] ] due to the block diagonal structure of the matrices in @xmath42 . it is apparent from this equation that @xmath116 is a formal homogeneous polynomial of degree @xmath105 in the entries of @xmath41 . moreover , the matrix @xmath104\psi_0=p(\sigma){\operatorname{hol}}(\rho,\psi_0)$ ] has a nonzero eigenvalue because it represents an isomorphism of @xmath11 . thus , a cyclic @xmath5 has a well - defined geometric phase of some order . ( on the other hand , if @xmath5 is open and the initial and final states @xmath39 and @xmath46 are _ distinguishable _ @xcite , then @xmath117\psi_{0}={{\mathbf 0}}_{n}$ ] why @xmath118 for every sequence @xmath108 , c.f . @xcite . ) consider the ensemble of neutrons in section [ neutron ] , but now assume that @xmath97 is such that @xmath119 if the final time is @xmath120 , then @xmath121 and @xmath122 . consequently , the geometric phase of @xmath5 is _ not _ defined , but its second order geometric phase _ is _ defined . if @xmath104\psi_0 $ ] has at least one nonzero eigenvalue , then @xmath5 has a well - defined geometric phase of some order less than or equal to the length of @xmath24 . to see this observe that the characteristic polynomial of @xmath104\psi_0 $ ] can be written @xmath123\psi_0\big)=\sum_{k=0}^{n}(-1)^ks_k\lambda^{n - k},\ ] ] where @xmath124 therefore @xmath125 for some @xmath126 if @xmath127\psi_0\big)=0 $ ] for some nonzero @xmath128 . it is customary to represent an evolving density operator as an incoherent sum of 1-dimensional time - dependent projectors defined by the normalized kets in a comoving eigenframe : @xmath129 . this representation is unique for nondegenerate mixed states , and if the eigenkets are parallel transported , the geometric phase factor is the expected value of the relative phase factors @xmath130 , see section [ sjoqvist ] . if all the relative phase factors vanish , the geometric phase is not defined . manini and pistolesi @xcite then proposed to study the gauge invariant _ off - diagonal phase factors _ @xmath131 mukunda _ et al . _ @xcite extended the work of manini and pistolesi . they expressed the off - diagonal phase factors in terms of bargmann invariants , and used the fact that the bargmann invariants satisfy certain relations , to give a full description of how the off - diagonal phase factors are interrelated . for degenerate mixed states the off - diagonal phase factors need not be gauge invariant . however , appropriate combinations of them are . for example , @xmath132 where each index @xmath133 run through all integers satisfying @xmath134 . hence , using and the results of mukunda _ et al . _ , one can , in principle , describe all relations between the higher order geometric phases . we have presented a fiber bundle framework in which geometric phase for mixed quantum states has a natural definition . this definition extends the standard definition of geometric phase of sjqvist _ @xcite , which is based on interferometry , and is particularly well suited for computations in quantum physics . furthermore , we have shown that the geometric phase is the first in a sequence of higher order geometric phases , and we have formulated a criterion that guarantees the existence of a geometric phase of some order . this criterion is met by cyclic evolutions of mixed states . another approach to geometric phase for mixed states is given in uhlmann @xcite . uhlmann s approach only applies to mixed states represented by invertible density operators , and according to slater @xcite it generally yields different outcomes than that of sjqvist _ et al . _ , and hence ours . the discrepancy is probably due to a difference in the notions of parallel transport @xcite . also singh _ et al . _ @xcite give a definition of geometric phase for parallel transported mixed states , and the paper by chaturvedi _ @xcite contains a differential geometrical approach to geometric phase for mixed states . comparative studies of our definition and those in @xcite and @xcite will be published in forthcoming papers . furthermore , in a forthcoming paper , off - diagonal geometric phases for mixed states will be defined and investigated . such phases have been studied by filipp and sjqvist @xcite . in @xcite , the authors defined `` off - diagonal quantum holonomy invariants '' for the bundle of purifications by uhlmann , and compared these with the off - diagonal geometric phase factors defined in @xcite . the conclusion was that there is `` a general discrepancy for these two approaches related to a fundamental difference in the treatment of parallel transport of quantum states '' . the off - diagonal quantum holonomy invariants can be similarly defined for the bundle of purifications in the current paper , and we will investigate how these are related to the off - diagonal geometric phases by filipp and sjqvist . the second author acknowledges the financial support by the swedish research council ( vr ) , grant number 2008 - 5227 . r. montgomery . heisenberg and isoholonomic inequalities . in _ symplectic geometry and mathematical physics ( aix - en - provence , 1990 ) _ , volume 99 of _ progr . _ , pages 303325 . birkhuser boston , boston , ma , 1991 .

geometric phase has found a broad spectrum of applications in both classical and quantum physics , such as condensed matter and quantum computation . in this paper we introduce an operational geometric phase for mixed quantum states , based on spectral weighted traces of holonomies , and we prove that it generalizes the standard definition of geometric phase for mixed states , which is based on quantum interferometry . we also introduce higher order geometric phases , and prove that under a fairly weak , generically satisfied , requirement , there is always a well - defined geometric phase of some order . our approach applies to general unitary evolutions of both nondegenerate and degenerate mixed states . moreover , since we provide an explicit formula for the geometric phase that can be easily implemented , it is particularly well suited for computations in quantum physics .

diabetes mellitus ( dm ) with a prevalence of 5.1% of all world population is characterized by high blood glucose levels ( 1 - 3 ) . dm has several long - term complications including cerebrovascular , coronary , and peripheral vascular diseases , nephropathy , retinopathy and neuropathy ( 4 , 5 ) . diabetic neuropathy is one of the most frequent and severe complications of diabetes which could affect sensory , motor , and autonomic nerves ( 6 ) . despite numerous efforts to uncover the precise mechanism(s ) of diabetic neuropathy hyperglycemia plays a key role in the development of diabetic complications ( 7 ) ; on the other hand a significant improvement in neuropathy following reduction of glucose level has been reported ( 8) . however , it is suggested that insufficiency of arterial blood flow due to a high glucose - induced atherosclerosis ( vascular aspect ) may be involved ( 8 , 9 ) . in addition , intracellular alteration of biochemical reactions induced by direct effect of high glucose on neuronal cells ( non - vascular aspect ) may also contribute ( 6 , 8 - 10 ) . some of this biochemical alterations including increased formation of advanced glycation end products , activation of protein kinase c ( pkc ) through increased diacylglycerol production , enhanced polyol pathway flux and increased hexosamine pathway flux have been reported as underlying mechanisms ( 9 ) . increased glucose concentrations activate the reactive oxygen species ( ros ) production through two main sources , the first is nicotinamide adenine dinucleotide phosphate ( nadph ) oxidase located on plasma membrane , and the second are mitochondria through a dysfunction of electron transport chain ( 2 , 11 - 13 ) . a large growing body of evidence reports an increased oxidative injuries induced by hyperglycemia in many diabetic tissues such as neural tissue ( 14 - 16 ) . in fact , oxidative stress is an upstream crucial trigger which promotes numerous detrimental pathways ending to apoptosis and cell death ( 9 , 13 ) . several studies have reported that apoptosis is the other mechanism involved in diabetic neural injury ( 2 , 17 , 18 ) . aside from classical renin - angiotensin system ( ras ) , a hormonal one maintaining blood pressure , electrolytes and water balance in the body , there are local or even intracellular renin - angiotensin systems in different tissues ( 5 , 19 - 21 ) . researchers refer many physiological and pathophysiological functions to local ras including inflammation , fibrosis , proliferation , differentiation or even apoptosis ( 22 ) . the local ras physiologically has been found in almost all body parts including : adrenal gland ( 5 , 21 ) , pancreas ( 23 ) , heart ( 24 ) , blood vessels ( 25 ) , kidney ( 26 ) , nervous system ( 19 , 22 ) , reproductive system ( 27 ) , and many tissues such as adipose tissue ( 28 ) . several evidences have been reported an over - activation of ras in diabetic complications , as it has been well - documented that the renin - angiotensin system ( ras ) plays a major role in the pathophysiology of diabetic nephropathy ( 26 ) . angiotensin ii has two main receptors named angiotensin receptor type 1 ( at1 ) and type 2 ( at2 ) ( 9 , 29 ) . actually the most known actions of angiotensin such as vasoconstriction , renal sodium reabsorption and also aldosterone and vasopressin secretion are mediated by at1 but the roles of at2 receptor remain mysterious and controversial ( 29 ) . at2 receptor has been abundantly found in fetus organs , uterus and neural tissues ( 29 ) . surprisingly , functions such as cellular proliferation , differentiation , and apoptosis that have been attributed to at2 receptors are corresponded well to the local ras ( 9 , 29 ) . there is several evidence of activation of local ras in most of diabetic tissues as well as neural tissue ( 8 , 9 , 26 ) . recently angiotensin converting enzyme ( ace ) inhibitors associated with angiotensin ii receptor antagonist are recognized as first line treatment for nephropathy(9 , 30 ) . in addition , it seems that ras contributes to almost all biochemical events which are promoted by hyperglycemia and finally result in neural cell death ( 9 ) . not only hyperglycemia , but also angiotensin ii , the main effector of ras , is among strong inducers of oxidative stress ( 9 , 31 , 32 ) . ( ang ii ) could add to high glucose - induced ros production and cause even more damages . interestingly , in a study on proximal tubule cells in rat , it was found that the effect of hyperglycemia on stimulation of angiotensinogen gene expression was through increasing ros production ( 33 ) . it was suggested that besides locally ang ii elevation following hyperglycemia , increased ros formation may in turn act as a second messenger for local ang ii production ( 13 ) . as previously mentioned , one possible mechanism to develop diabetic neuropathy is reduction of blood supply due to vasoconstriction of microvasculature ; thus , ace inhibitors such as captopril or at1 antagonists such as telmisartan and losartan as vasodilator agents can be curative in this situation ( 11 , 30 ) . although , some studies have shown a vascular effect of these drugs , but nonvascular actions of these agents in high glucose - induced neuropathy is still unclear ( 9 ) . the required components of an intrinsic ras have been found in rat 's adrenal medulla as well as pc12 cells ( 21 , 34 ) . the pc12 cells , pheochromocytoma cells are derived from rat s adrenal medulla , have a neural crest origin and abundantly express at2 angiotensin receptor ( 34 - 37 ) . in the present study , the role of local ras on high glucose - induced cell toxicity , apoptosis and ros production was investigated in pc12 cells . 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium ( mtt ) , 2,7-dichlorofluorescein diacetate ( dcf - da ) , captopril , telmisartan , losartan , pd-123319 , dimethyl sulfoxide , and d - glucose were purchased from sigma - aldrich company ( st . dmem , fetal bovine serum , trypsin , penicillin , and streptomycin were obtained from gibco brl life technologies ( grand island , ny , usa ) and annexin v - fitc & pi kit was purchased from biovision ( mountain view , ca , usa ) . pc12 cells were routinely cultured in dulbecco s modified eagle s medium , containing 4.5 mm - d-(+ ) -glucose , 10% heat - inactivated fetal bovine serum , 100u / ml penicillin , and , 100 u / ml streptomycin , incubated at a temperature of 37c in a humidified atmosphere of 95% air and 5% co2 , and were passaged when reached to 70% confluency . pc12 cells were pretreated for 3 hr prior to and after high glucose - induced toxicity with a glucose concentration of 27 mg / ml by following drugs : captopril ( 10 m ) , telmisartan ( 10 m ) , losartan ( 10 m ) , pd-123319 ( 10 m ) , and two combination groups include telmisartan plus pd-123319 ( each 10 m ) , and , losartan plus pd-123319 ( each 10 m ) . to evaluate cell viability , pc12 cells were seeded ( at 1x10 cells per well ) in a 96-well culture plate and cell viability was measured by mtt colorimetric assay . thus , after treatment , 11 l mtt solution ( 5mg / ml ) was added into each well and cells were incubated at 37c for 4h in a humidified atmosphere containing of 5% co2 and 95% air . after removing the medium , formazan crystals the absorption was measured at 570 nm ( 620 nm as a reference wavelength ) by means of an elisa reader . apoptosis was evaluated by annexin v - fitc and propidium iodide ( pi ) staining followed by flow cytometry . cells were detached and annexin v&pi double staining was performed according to manufacturer 's instructions and then measured by flow cytometry . after treatment , the pc12 cells once washed with prewarmed pbs , then they were incubated with 10 m dcfh - da at 37c in the dark . 30 min later , the cells were rewashed and resuspended in pbs for analysis by facscalibur flow cytometer ( bd , usa ) with excitation and emission wave lengths of 475 and 525 nm , respectively . for each analysis all results derived from at least three independent experiments are expressed as mean sem . the significance of difference was analyzed by a one - way anova followed by tukey as post - test using graphpad prism 5 and p<0.05 was considered to be statistically significant . 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium ( mtt ) , 2,7-dichlorofluorescein diacetate ( dcf - da ) , captopril , telmisartan , losartan , pd-123319 , dimethyl sulfoxide , and d - glucose were purchased from sigma - aldrich company ( st . dmem , fetal bovine serum , trypsin , penicillin , and streptomycin were obtained from gibco brl life technologies ( grand island , ny , usa ) and annexin v - fitc & pi kit was purchased from biovision ( mountain view , ca , usa ) . pc12 cells were routinely cultured in dulbecco s modified eagle s medium , containing 4.5 mm - d-(+ ) -glucose , 10% heat - inactivated fetal bovine serum , 100u / ml penicillin , and , 100 u / ml streptomycin , incubated at a temperature of 37c in a humidified atmosphere of 95% air and 5% co2 , and were passaged when reached to 70% confluency . pc12 cells were pretreated for 3 hr prior to and after high glucose - induced toxicity with a glucose concentration of 27 mg / ml by following drugs : captopril ( 10 m ) , telmisartan ( 10 m ) , losartan ( 10 m ) , pd-123319 ( 10 m ) , and two combination groups include telmisartan plus pd-123319 ( each 10 m ) , and , losartan plus pd-123319 ( each 10 m ) . to evaluate cell viability , pc12 cells were seeded ( at 1x10 cells per well ) in a 96-well culture plate and cell viability was measured by mtt colorimetric assay . thus , after treatment , 11 l mtt solution ( 5mg / ml ) was added into each well and cells were incubated at 37c for 4h in a humidified atmosphere containing of 5% co2 and 95% air . after removing the medium the absorption was measured at 570 nm ( 620 nm as a reference wavelength ) by means of an elisa reader . apoptosis was evaluated by annexin v - fitc and propidium iodide ( pi ) staining followed by flow cytometry . cells were detached and annexin v&pi double staining was performed according to manufacturer 's instructions and then measured by flow cytometry . after treatment , the pc12 cells once washed with prewarmed pbs , then they were incubated with 10 m dcfh - da at 37c in the dark . 30 min later , the cells were rewashed and resuspended in pbs for analysis by facscalibur flow cytometer ( bd , usa ) with excitation and emission wave lengths of 475 and 525 nm , respectively . for each analysis all results derived from at least three independent experiments are expressed as mean sem . the significance of difference was analyzed by a one - way anova followed by tukey as post - test using graphpad prism 5 and p<0.05 was considered to be statistically significant . mtt assay showed that treatment with high glucose concentrations decreased cell viability in a time- and concentration - dependent manner . concentrations of 13.5 , 18 , 22.5 and 27 mg / ml showed significant difference ( p<0.05-p<0.001 ) . figure 2 shows that 27 mg / ml of glucose had cytotoxic effects in a time dependent manner and it decreased cell viability at 96 , 120 and 144 hrs ( p<0.05-p<0.001 ) . the cell viability at 27 mg / ml of glucose ( high glucose ; hg ) was significantly lower than normal glucose ( ng ) concentration after 144 hrs ( p<0.001 ) . viability was increased in experimental groups : captopril ( p<0.05 ) , telmisartan ( p<0.001 ) , pd123319 ( p<0.05 ) , telmisartan / pd123319 ( p<0.001 ) , and losartan+pd123319 ( p<0.01 ) , respectively ( figure 3 ) . the flow cytometric results of annexin v - fitc and propidium iodide staining assay showed that apoptotic and necrotic cells were increased in high glucose condition ( 27 mg / ml ) by ( p<0.001 ) and ( p<0.01 ) respectively . pretreatment followed by treatment with captopril ( p0.05 ) , telmisartan ( p<0.01 ) , pd123319 ( p0.01 ) , telmisartan / pd123319 ( p<0.001 ) and losartan / pd123319 ( p<0.01 ) signify - cantly decreased apoptotic cells in high glucose conditions . as shown in figure 4 , telmisartan and telmisartan / pd groups had significant reduction ( p<0.05 ) in necrotic cells . dcf - da used as a probe to evaluate the intracellular ros alterations by flow cytometery . it was revealed that high glucose concentration increased the ros production after 1 h ( p<0.001 ) . as the figure 5 shows it was increased to the most high level after 2 hrs ( p<0.001 ) and then it was returned to the base up to 5 hrs . the figure 6 shows the effects of the drugs on decreasing ros production at 27 mg / ml of glucose after 2 hrs . the ros production in high glucose ( hg ) condition was increased compared to ng condition ( p<0.001 ) . treatment by quercetin ( rutin ) as an antioxidant decreased the ros production ( p<0.001 ) . after 3hs pretreatment and then 2hs treatment with the drugs in high glucose medium ( 27 mg / ml ) , tel / pd ( p<0.001 ) , telmisartan ( p<0.001 ) , los / pd ( p<0.01 ) , captopril ( p<0.01 ) and losartan ( p<0.05 ) , all treatments reduced ros production as amount of 69 , 66 , 40 , 34 and 32% , respectively . telmisartan in comparison with losartan had a better effect in lowering ros which statistically significant ( figures 6 , 7 , p<0.01 ) . mtt assay showed that treatment with high glucose concentrations decreased cell viability in a time- and concentration - dependent manner . concentrations of 13.5 , 18 , 22.5 and 27 mg / ml showed significant difference ( p<0.05-p<0.001 ) . figure 2 shows that 27 mg / ml of glucose had cytotoxic effects in a time dependent manner and it decreased cell viability at 96 , 120 and 144 hrs ( p<0.05-p<0.001 ) . the cell viability at 27 mg / ml of glucose ( high glucose ; hg ) was significantly lower than normal glucose ( ng ) concentration after 144 hrs ( p<0.001 ) . viability was increased in experimental groups : captopril ( p<0.05 ) , telmisartan ( p<0.001 ) , pd123319 ( p<0.05 ) , telmisartan / pd123319 ( p<0.001 ) , and losartan+pd123319 ( p<0.01 ) , respectively ( figure 3 ) . the flow cytometric results of annexin v - fitc and propidium iodide staining assay showed that apoptotic and necrotic cells were increased in high glucose condition ( 27 mg / ml ) by ( p<0.001 ) and ( p<0.01 ) respectively . pretreatment followed by treatment with captopril ( p0.05 ) , telmisartan ( p<0.01 ) , pd123319 ( p0.01 ) , telmisartan / pd123319 ( p<0.001 ) and losartan / pd123319 ( p<0.01 ) signify - cantly decreased apoptotic cells in high glucose conditions . as shown in figure 4 , telmisartan and telmisartan / pd groups had significant reduction ( p<0.05 ) in necrotic cells . dcf - da used as a probe to evaluate the intracellular ros alterations by flow cytometery . it was revealed that high glucose concentration increased the ros production after 1 h ( p<0.001 ) . as the figure 5 shows it was increased to the most high level after 2 hrs ( p<0.001 ) and then it was returned to the base up to 5 hrs . the figure 6 shows the effects of the drugs on decreasing ros production at 27 mg / ml of glucose after 2 hrs . the ros production in high glucose ( hg ) condition was increased compared to ng condition ( p<0.001 ) . treatment by quercetin ( rutin ) as an antioxidant decreased the ros production ( p<0.001 ) . after 3hs pretreatment and then 2hs treatment with the drugs in high glucose medium ( 27 mg / ml ) , tel / pd ( p<0.001 ) , telmisartan ( p<0.001 ) , los / pd ( p<0.01 ) , captopril ( p<0.01 ) and losartan ( p<0.05 ) , all treatments reduced ros production as amount of 69 , 66 , 40 , 34 and 32% , respectively . telmisartan in comparison with losartan had a better effect in lowering ros which statistically significant ( figures 6 , 7 , p<0.01 ) . the results of present study showed that high levels of glucose had both time and concentration dependent toxicity effects in pc12 cells . the results also showed that the cytotoxic effects of glucose were accompanied with increasing of ros production , the later was also attenuated by ras inhibitor drugs . hyperglycemia clearly plays an important role in the development and progression of diabetic neuropathy which characterized by an increasing loss of nerve fiber functions ( 1 , 2 ) . pc 12 cells or pheochromocytoma cells have neural crest origin and thus frequently have been used as a cell model for studying of high glucose toxicity ; the condition which mimics the effects of hyperglycemia to induce neuropathy ( 2 , 3 , 6 , 12 , 18 ) . despite a long time needed for diabetic neuropathy to occur in human , diabetic neuropathy symptoms appear in stz - induced diabetic rats just after 8 - 10 weeks ( 38 , 39 ) ; also , direct exposure of high glucose concentrations to susceptible cells such as pc12 cells can accelerate this deleterious process . it has been well - documented in pc12 cells that 4 - 7 days exposure to high glucose concentrations could decrease cell viability significantly ; thereby , this high glucose cytotoxicity is considered as an acceptable model to simulate diabetic neuropathy in many publications ( 2 , 3 , 6 , 12 , 18 ) . it has been well documented that hyperglycemia in diabetes mellitus as well as high glucose toxicity lead to neuronal damage , apoptosis and cell death ( 1 , 2 ) . the results of the present study also showed that the cell viability in high glucose concentrations was time and concentration dependently lower than normal concentration of glucose . the flow cytometry results of annexin v - fitc and propidium iodide staining also showed that apoptotic pc12 cells were increased in high glucose concentrations . several mechanisms including mitochondrial - dependent and -independent mechanisms are involved in diabetic neuropathy ( 40 ) . it was shown that mitogen - activated protein kinases ( mapk ) and p53-mediated pathways have important roles in apoptosis and cell death due to hyperglycemia ( 40 ) . an increased formation of advanced glycation end products and activation of protein kinase c ( pkc ) through increased diacylglycerol production have been reported to contribute in high glucose toxicity ( 41 , 42 ) . enhanced polyol pathway flux , and increased hexosamine pathway flux have also been suggested to be involved in neuronal damage due to high glucose levels ( 40 - 42 ) . it has also been well documented that oxidative stress , directly , or , as a second messenger , is one of the main mechanism involved in development of diabetic neuropathy(2,13 , 43 ) . the results of the present study added another evidence to confirm that free radicals have an important role in neural damage and cell death as well as apoptosis in hyperglycemia . it has been previously reported that hyperglycemia promotes oxidative stress through cell - membrane enzyme , nicotinamide adenine dinucleotide phosphate ( nadph ) oxidase , and mitochondrial pathways in diabetic neurons resulting in neuronal damage and dysfunction ( 8 , 17 ) . it has also been reported that hyperglycemia can induce apoptosis in neural cell such as pc12 cells by increasing production of reactive oxygen species such as hydrogen peroxide ( 3,6 , 12 ) . in addition to classic renin angiotensin system that is well known for its hemodynamic and cardiovascular functions , the presence of local renin angiotensin systems and their physiological roles within different tissues and organs including nervous system have been reported ( 5 , 19 , 22 - 28 ) . it has been well documented that local rass are involved in several cell processes such as growth , differentiation , and even apoptosis at cellular levels ( 9 , 22 ) . it was suggested that the local ras contributes to virtually all biochemical events including ros production and apoptosis which are triggered by hyperglycemia ( 9,24 , 26 ) . in the present study , our finding showed that all ras inhibitors including captopril , telmisartan and pd123319 increased the cell viability in high glucose toxicity . the neuroprotective effects of ace inhibitor as well as the angiotensin receptor antagonists ( 11,30 , 44 ) confirm the results observed in the present study . these drugs have been shown to treat diabetic neuropathy mostly with vascular aspect ( 30 ) . coppy and his colleagues showed that administration of enalapril , as an ace inhibitor , or l-158809 , as an angiotensin ii receptor blocker , reduced neurovascular deficits such as blood flow and motor nerve conduction velocity in diabetic conditions ( 11 ) . malik et al assessed the effect of trandolapril , an ace blocker , on human diabetic neuropathy and found a significant increase in peroneal motor nerve conduction velocity , m - wave amplitude and sural nerve action potential amplitude ; also a significant decrease in f - wave latency ( 44 ) . several mechanisms have been suggested for the protective effects of ras inhibitors against hyperglycemic conditions ( 30,45 , 46 ) . it has been suggested that , not only hyperglycemia , but also ang ii is an inducer of oxidative stress ( 9 , 31 ) . it has also been reported that oxidative stress can in turn induce expression of ang ii and its receptors , in a positive feedback manner ( 9 , 47 ) . in fact , ros as a second messenger may serve as a link between ras , hyperglycemia and apoptosis in pathophysiological events of diabetic neuropathy . reduction of ros production by ras inhibitors which were seen in the present study confirmed this idea . on the other hand , the insignificant effects of losartan on improving cell viability and reducing apoptosis which was observed here might be attributed to the presence of a limited number of at1 receptors on pc12 cells ( 36 ) . the results of ros production showed a decrease in high glucose - induced ros formation after treating by all drugs except pd123319 . several experiments have suggested a receptor - independent intracellular radical scavenging activity for ace inhibitors and at1 receptor blockers ( 48 ) . according to some studies , thus , such at1 independent antioxidant activity was observed in this study at least in case of losartan is in agreement with above reports ; although , it needs further investigation in future . in addition to its at1 blocker activity , telmisartan also serve as partial agonist of peroxisome proliferator - activated receptor gamma ( ppar- ) ( 50 , 51 ) . furthermore , the effectiveness of telmisartan seems to be through activation of different receptors , such as ppar- , which has been suggested as a possible mechanism for its neuroprotective effects ( 52 , 53 ) . it has been previously reported that the anti - inflammatory and antioxidant activities of telmisartan is mainly mediated activating of the ppar- receptor ( 50,52,53 ) . thiazolidinediones as ppar- agonists for many years have been used in diabetic treatments ( 54 , 55 ) . these drugs were even proposed as neuroprotective factors in several conditions such as ischemia and glucose cytotoxicity ( 56 , 57 ) . the presence of ppar- receptor on pc12 cells ( 58 ) and the stronger free radical scavenging effects of telmisartan in comparison with losartan which is seen in the present study might be another evidence for the effects of telmisartan by activating of ppar- receptors . overall , the results of the present study showed that telmisartan , pd123319 and captopril antagonized high glucose - induced cell death and apoptosis but only telmisartan and captopril performed these effects through reducing ros - induced cell damage . the results of the present study showed that telmisartan , pd123319 and captopril antagonized high glucose - induced cell death and apoptosis . so , it seems that at2 receptor is important in neuroprotection against high glucose toxicity by a mechanism other than protection against oxidative stress . as previously has been reported , nadph oxidase has a pivotal role in ang ii - induced ros production ( 13 ) ; this mechanism and/or other mechanism(s ) may contribute in ros generation . it is also suggested that both losartan and telmisartan have a non at1 receptor mediated antioxidant effects . the better antioxidant and cell protective effects of telmisartan observed in the present study are suggested to be through other pathways such as ppar- receptors .

objective(s):hyperglycemia , oxidative stress and apoptosis have key roles in pathogenesis of diabetic neuropathy . there are local renin - angiotensin systems ( rass ) in different tissues such as neural tissue . local rass are involved in physiological and pathophysiological processes such as inflammation , proliferation and apoptosis . this study aimed to investigate the role of local renin - angiotensin system on high glucose - induced cell toxicity , apoptosis and reactive oxygen species ( ros ) production in pc12 cells , as a cell model of diabetic neuropathy.materials and methods : pc12 cells were exposed to a high glucose concentration ( 27 mg / ml ) , captopril ( ace inhibitor ) , telmisartan and losartan ( at1 antagonists ) , and also pd123319 ( at2 antagonist ) were administered before and after induction of high glucose toxicity . then cell viability was assessed by mtt assay and apoptotic cells and intracellular ros production were detected by annexin v - propidium iodide and dcfda , respectively , using flow cytometry.results:high glucose concentration decreased cell viability , and increased apoptotic cells . intracellular ros production was also increased . in pc12 cells pretreatment and treatment by the drugs showed a significant improvement in cell viability and reduced apoptosis in captopril , telmisartan and pd123319 but only captopril and telmisartan were able to reduce ros production . losrtan significantly lowered ros but did n't show any improvements in cell viability and apoptotic cells.conclusion:the results of the present study showed that ras inhibitors reduced cell toxicity and apoptosis and ros production was induced by high glucose . it may be suggested that local ras has a role in high glucose toxicity .

primordial non - gaussianity has been attracting attention as a new probe of the physics of the early universe , e.g. , inflation models . there are a lot of theoretical models of predicting the primordial curvature fluctuations with the large non - gaussian features and several types of the primordial non - gaussianity have been predicted ( for recent reviews , see e.g. ref . @xcite ) . on the observational side , precise measurements of the cosmic microwave background ( cmb ) anisotropies are ones of the most powerful tools to hunt for the primordial non - gaussianity ( see e.g. refs . current cmb data indicates that the primordial adiabatic fluctuations follow nearly perfect gaussianity . however , there still remains the possibility of detecting the non - gaussianity in the future experiments such as planck @xcite . in the cmb experiments , the non - gaussianity could be detected by non - zero higher order correlation functions such as the three - point function ( bispectrum ) and the four - point one ( trispectrum ) . recently , the observations of the large - scale structure ( lss ) of the universe have been also focused on as other powerful tools to detect the primordial non - gaussianity just as the cmb observations ( see e.g. refs . in particular , it is known that the primordial non - gaussianity induces the modification of the halo mass function for more massive objects at higher redshift ( see e.g. refs . @xcite ) and also a scale - dependence of the halo bias ( see e.g. refs . since future surveys of the lss will provide a large amount of samples of galaxies over a huge volume , it is expected that the lss observations would give a tighter constraint on the primordial non - gaussianity comparable to that obtained from the future cmb observations @xcite . in accordance with the recent progress of observations , we are invited to consider the effect of the higher order non - gaussianities , e.g. , the non - zero four point correlation function of the primordial fluctuations @xcite , or that of the primordial non - gaussianity in a multi - field inflationary model where the primordial fluctuations are sourced from multi - field fluctuations @xcite . following these works , in this paper , we investigate the halo bias in the case where the primordial adiabatic curvature fluctuations are given by @xcite @xmath2 where @xmath3 . in ref . @xcite , such a model has been dubbed `` ungaussiton '' model . this type of the non - gaussianity can be realized in the case where the primordial fluctuations are sourced from both the inflaton and the curvaton fluctuations and the curvaton stays at the origin during inflation . in this case , due to the absence of the linear term of @xmath4 the non - zero bispectrum and trispectrum of the curvature perturbations respectively come from the six- and eight - orders in @xmath4 . hence , this model predicts a specific consistency relation between the bispectrum and the trispectrum which would be confirmed in the cmb experiments and it should be interesting to examine the effect of such a primordial non - gaussianity on the lss surveys , in particular , the scale - dependence of the halo bias . in order to obtain an analytic expression for the halo bias , we employ the peak - background split formula @xcite which is a useful tool to calculate the halo bias with the local - type non - gaussianity . this paper is organized as follows . in the next section , we briefly review the so - called `` ungaussiton '' model and show the expression for the bispectrum and the trispectrum of the primordial curvature fluctuations in this model and also the consistency relation between the bispectrum and the trispectrum . in section [ sec : bias ] , we give an expression for the halo bias in this model by making use of the peak - background formula . section [ sec : sum ] is devoted to the summary and discussion . here , we briefly review the so - called `` ungaussiton '' model @xcite and show some interesting consequence of this model by considering the bispectrum and the trispectrum of the primordial curvature perturbations . this model can be realized in the case where the primordial fluctuations are sourced from both the inflaton and the curvaton fluctuations and the curvaton stays at the origin during inflation . in this model where the primordial curvature fluctuations are given by eq . ( [ eq : form ] ) , the power spectrum , the bispectrum and the trispectrum of the primordial curvature fluctuations are respectively given by @xcite @xmath5 ~ , \label{eq : power } \end{aligned}\ ] ] @xmath6~,\label{eq : bis}\end{aligned}\ ] ] and @xmath7~,\label{eq : tri}\end{aligned}\ ] ] where @xmath8 is the size of the box in which the fluctuations are observed , @xmath9 , @xmath10 , @xmath11 , @xmath12 , @xmath13 and a subscript , @xmath14 , denotes the connected part . since the current observations indicate that the primordial curvature fluctuations are almost gaussian , the power spectrum of @xmath0 should not be dominated by the second term in the bracket of the right hand side in eq . ( [ eq : power ] ) as @xmath15 by making use of the non - linearity parameters defined as @xcite @xmath16 \cr t_\phi(k_1,k_2,k_3,k_4 ) & = & { 25 \over 9 } \tau_{\rm nl } \bigl [ p_\phi(k_1)p_\phi(k_2)p_\phi(k_{13 } ) + 11~{\rm perms . } \bigr]~,\end{aligned}\ ] ] we have @xmath17 from these expressions , we find that the large non - linearity parameters can be realized even under the condition given by eq . ( [ eq : condition ] ) and we can obtain a relation between the non - linearity parameters in this model , which is given by @xmath18 where @xmath19 is a coefficient of order unity and we have used @xmath20 . by using this relations , we can distinguish this model from the others which predict the large non - gaussianity and the other relations between the non - linearity parameters @xmath21 and @xmath22 , in particular , the models which give the standard consistency relation given by @xmath23 for local - type non - gaussianity . here , following refs . @xcite , we calculate the halo bias for the `` ungaussiton '' model where the primordial curvature perturbations are given by eq . ( [ eq : form ] ) in the context of the peak - background split formalism . in the non - gaussian case , the large and small scale density fluctuations are not independent . let us decompose the primordial curvature perturbations into the long- and short - wavelength parts as @xmath24 \nonumber\\ & = & \phi_l({\bf x } ) + \psi_l({\bf x})^2 - \langle \psi_l({\bf x})^2 \rangle \nonumber\\ & & + \phi_s ( { \bf x } ) + 2 \psi_l({\bf x})\psi_s({\bf x})+ \psi_s({\bf x})^2 - \langle \psi_s({\bf x})^2 \rangle ~ , \label{eq : split}\end{aligned}\ ] ] where we have assumed @xmath25 and the long- and short - wavelength parts are uncorrelated . from this equation , we can obtain expressions for the long- and short - wavelength modes of the density fields in fourier space as @xmath26 ~,\end{aligned}\ ] ] and @xmath27~,\end{aligned}\ ] ] with @xmath28 where we have neglected the contribution from the @xmath29 term because it is known that such a quadratic term does not affect the halo bias @xcite . here , @xmath30 is the matter transfer function , @xmath31 is the present matter density parameter and @xmath32 is the present hubble parameter . from this equation , we can find that the non - gaussianity affects the rescaling of the amplitude of the density fluctuations on small scales as @xmath33 \cr\cr & = & { \cal m}(k)^2 \left [ 1 + 4r \psi_l({\bf x})^2 \right]p_{\phi_s}~,\end{aligned}\ ] ] and hence a standard cosmological parameter , @xmath34 , which denotes the rms of the linear density field with @xmath35 smoothing , depends on the position @xmath36 as @xmath37 \sigma_8~.\end{aligned}\ ] ] where we have introduced the @xmath38 term in order to achieve @xmath39 . due to the long - wavelength modes of the density fluctuations and also the above effect of the primordial non - gaussianity , the density of halos @xmath40 in a large box at position @xmath36 deviates from the mean density @xmath41 . following refs . @xcite , @xmath42 is given by @xmath43 where the @xmath44 comes from transforming lagrangian to eulerian space . from this equation , we can obtain the density fluctuations of halos , @xmath45 , as @xmath46 where we have drop the second order terms of @xmath47 . in the fourier space , we have @xmath48~ , \label{eq : halodens}\end{aligned}\ ] ] where @xcite @xmath49 and we have used @xmath50 with @xmath51 being a critical density . the equation ( [ eq : halodens ] ) is one of the main result of this paper . however , defining the halo bias from this equation is somewhat ambiguous . hence , let us consider the cross power spectrum of the density fluctuations of halos and matter fluctuations and also the power spectrum of the density fluctuations of halos . the cross power spectrum is given by @xmath52 p_\delta(k ) \cr\cr & = & \left [ b_0 + { 2 \beta f_{\rm nl } \delta_c ( b_0 - 1 ) \over { \cal m}(k ) } \right ] p_\delta(k ) ~,\end{aligned}\ ] ] where we have used eq . ( [ eq : ft ] ) and @xmath53 . once the halo bias is defined as @xmath54 , we can obtain the halo bias in the `` ungaussiton '' model as @xmath55 where we have introduced the linear growth function , @xmath56 . since a parameter @xmath57 is order of unity , this expression is just corresponding to the one in the standard local - type primordial non - gaussianity case @xcite . let us consider the power spectrum of the density fluctuations of halos and it is given by @xmath58 p_\delta(k)~ , \end{aligned}\ ] ] where we have used eq . ( [ eq : ft ] ) and @xmath59 . if the consistency relation between @xmath21 and @xmath22 is given by @xmath60 with the assumption that @xmath61 , then @xmath62 is realized . it is well known that this result should be realized in the standard local - type primordial non - gaussianity case . however , since in the `` ungaussiton '' model the relation between @xmath21 and @xmath22 is given by eq . ( [ eq : consistency ] ) , @xmath63 can not be realized any more . instead , we find that in the `` ungaussiton '' model we have @xmath64~,\end{aligned}\ ] ] where we have used the relation given by eq . ( [ eq : consistency ] ) . hence , it could be also possible to distinguish the `` ungaussiton '' model from the other models by making use of lss surveys . as a function of @xmath65 with @xmath66 and @xmath67 at @xmath68 . the solid line is for the `` ungaussiton '' model and the dashed line for the case where @xmath23 . ] in fig . [ fig : fig1.eps ] , we plot @xmath69 as a function of @xmath65 with fixing @xmath66 , @xmath67 and @xmath68 . the solid line is for the `` ungaussiton '' model and the dashed line for the case where the consistency relation between @xmath21 and @xmath22 is given by @xmath70 . from this figure , we can find the enhancement of @xmath69 on large scales ( @xmath71 ) in the `` ungaussiton '' model compared with the case with @xmath72 . the scale - dependence of the bias of halos has been recently focused on as a powerful tool to give a constraint on the primordial non - gaussianity from the lss surveys . in this paper , we investigate the halo bias in the ungaussiton model , which predicts the large primordial non - gaussianity induced from a gaussian - squared field , by employing the peak - background split formalism . this model can be realized in the case where the primordial fluctuations are sourced from both the inflaton and the curvaton fluctuations and the curvaton stays at the origin during inflation , and predicts the large non - gaussianity and the specific relation between the non - linearity parameters @xmath21 and @xmath22 . we calculate not only the power spectrum of the density fluctuations of halos but also the cross power spectrum of the matter density fluctuations and halo density fluctuations . then , we find that in the ungaussiton model the effect of the non - gaussianity on the halo bias , which appears in the power spectrum of the halo density fluctuations , differs from that in the standard local - type non - gaussianity case due to the different consistency relation between @xmath21 and @xmath22 . as it is for the cmb observations , it is expected that the future lss surveys will make us distinguish the model from the other models where the large primordial non - gaussianity can be predicted . it is also interesting work to check our formula by performing the n - body numerical simulation . * acknowledgments : * the author would like to thank olivier dor for useful comments . this work is partially supported by the grant - in - aid for scientific research from the ministry of education , science , sports , and culture , japan , no . the author also acknowledges support from the grant - in - aid for the global coe program `` quest for fundamental principles in the universe : from particles to the solar system and the cosmos '' from mext , japan . m. sasaki and d. wands , class . * 27 * , 12 , 120301 ( 2010 ) e. komatsu , class . quant . * 27 * , 124010 ( 2010 ) [ arxiv:1003.6097 [ astro-ph.co ] ] . e. komatsu _ et al . _ [ wmap collaboration ] , astrophys . j. suppl . * 192 * , 18 ( 2011 ) [ arxiv:1001.4538 [ astro-ph.co ] ] . [ planck collaboration ] , arxiv : astro - ph/0604069 . l. verde , arxiv:1001.5217 [ astro-ph.co ] . v. desjacques and u. seljak , arxiv:1006.4763 [ astro-ph.co ] . s. matarrese , l. verde and r. jimenez , astrophys . j. * 541 * , 10 ( 2000 ) [ arxiv : astro - ph/0001366 ] . m. loverde , a. miller , s. shandera and l. verde , jcap * 0804 * , 014 ( 2008 ) [ arxiv:0711.4126 [ astro - ph ] ] . a. de simone , m. maggiore and a. riotto , mon . not . 412 * , 2587 ( 2011 ) [ arxiv:1007.1903 [ astro-ph.co ] ] . n. dalal , o. dore , d. huterer and a. shirokov , phys . d * 77 * , 123514 ( 2008 ) [ arxiv:0710.4560 [ astro - ph ] ] . s. chongchitnan and j. silk , astrophys . j. * 724 * , 285 ( 2010 ) [ arxiv:1007.1230 [ astro-ph.co ] ] . s. chongchitnan and j. silk , phys . d * 83 * , 083504 ( 2011 ) [ arxiv:1012.1859 [ astro-ph.co ] ] . k. enqvist , s. hotchkiss and o. taanila , jcap * 1104 * , 017 ( 2011 ) [ arxiv:1012.2732 [ astro-ph.co ] ] . m. loverde and k. m. smith , jcap * 1108 * , 003 ( 2011 ) [ arxiv:1102.1439 [ astro-ph.co ] ] . s. yokoyama , n. sugiyama , s. zaroubi and j. silk , arxiv:1103.2586 [ astro-ph.co ] . v. desjacques , d. jeong and f. schmidt , arxiv:1105.3476 [ astro-ph.co ] . v. desjacques , d. jeong and f. schmidt , arxiv:1105.3628 [ astro-ph.co ] . k. m. smith , s. ferraro and m. loverde , arxiv:1106.0503 [ astro-ph.co ] . j. o. gong and s. yokoyama , arxiv:1106.4404 [ astro-ph.co ] . l. boubekeur and d. h. lyth , phys . d * 73 * , 021301 ( 2006 ) [ arxiv : astro - ph/0504046 ] . t. suyama and f. takahashi , jcap * 0809 * , 007 ( 2008 ) [ arxiv:0804.0425 [ astro - ph ] ] . e. komatsu and d. n. spergel , phys . d * 63 * , 063002 ( 2001 ) [ arxiv : astro - ph/0005036 ] .

we investigate the halo bias in the case where the primordial curvature fluctuations , @xmath0 , are sourced from both a gaussian random field and a gaussian - squared field , as @xmath1 , so - called `` ungaussiton model '' . we employ the peak - background split formula and find a new scale - dependence in the halo bias induced from the gaussian - squared field . .5 in * scale - dependent bias from the primordial non - gaussianity with a gaussian - squared field * .45 in shuichiro yokoyama .1 in [email protected] .40 in _ department of physics and astrophysics , nagoya university , aichi 464 - 8602 , japan _ .4 in

we have discussed that as long as suitable initial conditions for time evolution of the scale factor were not satisfied at very early universe the 4-d metric could have been oscillating quantum mechanically between euclidean and lorentzian phases as degenerate vacuums of a higgs potential . however , once these conditions were satisfied in one of the tunnelings into a lorentzian vacuum ( early universe ) , the immediate inflation and the subsequent big bang could have stabilized this chosen metric . in this regard , inflation , big bang and even the present observed acceleration of the universe can be considered as different behaviors of the universe to escape the death through re - tunneling to the euclidean metric . we have also shown that lorentz invariance at small scales can be violated but at large space - time scales it can be restored exactly . this work has been supported financially by the research department of azarbaijan university of tarbiat moallem , tabriz , iran . + 99 j. b. hartle , s. w. hawking , phys . rev . d.*28 * ( 1983 ) , 2960 . t. dereli , r. w. tucker , class . quantum grav.*10 * ( 1993 ) , 365 ; g. f. r. ellis , a. sumruk , d. coule and c. hellaby , class . quantum grav.*9 * ( 1992 ) , 1535 ; s. a. hayward , class . quantum grav.*9 * ( 1992 ) , 1851 ; m. kossowski , m. kriele proc . lond . a.*446 * ( 1995 ) , 115 ; c. hellaby , t. dray , phys . d. * 49 * ( 1994 ) , 5096 ; f. darabi , h. r. sepangi , class . quantum grav.*16 * ( 1999 ) , 1565 ; f. darabi , phys . lett . a*259 * ( 1999 ) , 97 ; m. mohseni , phys . lett . a*267 * ( 2000 ) , 240 . m. mars , j. m. m. senovilla , r. vera , phys . lett.*86 * ( 2001 ) , 4219 ; g. w. gibbons , a. ishibashi , _ topology and signature changes in braneworlds _ , hep - th/0402024 . r. precacci , nucl . phys . b*353 * ( 1991 ) , 271 . j. greensite , phys . lett . b*300 * ( 1993 ) , 34 ; a. carlini , j. greensite , phy . rev . d*49 * ( 1994 ) , 866 . s. d. odintsov , a. romeo and r. tucker , class . quantum grav.*11 * ( 1994 ) , 2951 ; e. elizalde , s. d. odintsov and a. romeo , class . quantum grav.*11 * ( 1994 ) , l61 . p. wesson , phys . b*538 * ( 2002 ) , 159 . m. le bellac , _ quantum and statistical field theory _ , ( clarendon press , oxford ) ( 1991 ) . d. i. blokhintsev , physics letters * 12 * ( 1964 ) , 272 .

the problem of dynamical generation of 4-d space - time signature at small scales and its stabilization towards lorentzian signature at large scales is studied in the context of higgs mechanism in a two - time scenario . it is also shown that lorentz invariance at small scales can be violated but at large space - time scales is restored . -0.75 in the initial idea of signature change was due to hartle , hawking and sakharov @xcite . this idea would make it possible to have both euclidean and lorentzian metrics in the path integral approach to quantum gravity . however , it was later shown that signature change may happen , as well , in classical general relativity @xcite . this issue has recently been raised in the brane - world scenario , as well @xcite . there are two different approaches to this problem : continuous and discontinuous . in the continuous approach , in passing from euclidean to lorentzian region , the signature of the metric changes continuously , hence the metric becomes degenerate at the border . in the discontinuous approach , however , the metric is non - degenerate everywhere and discontinuous at the border . most of the works regarding the signature change dealt with situations where the signature changing metric is defined _ apriori _ on the manifold and one looks for the effects of the assumed signature change on the einstein equations or propagation of particles in such a manifold . however , there are some other viewpoints in which the signature generation of the large scale space - time is studied and considered to be a dynamical phenomenon @xcite , @xcite , @xcite . on the other hand , it is believed that while the signature of the large scale 4-d space - time is definitely lorentzian , the phenomena of dynamical topology and signature changes at ultrashort distances can happen as the microscopic fluctuations of the space - time . this is because a more general formulation of gravitation should accommodate geometries with degenerate metrics and nontrivial topologies . it is then interesting to introduce one mechanism which accommodates both small and large scales and addresses the problem of metric signature at these hierarchial scales . in the present letter , we propose such a mechanism for signature fluctuations at ultrashort distances and stabilization of lorentzian signature at large scale 4-d space - time , in the context of higgs mechanism in a two - time scenario . we introduce a higgs potential whose minima will define the signature of the 4-d metric . the parameter of the symmetry breaking is so chosen that it leads to a quantum oscillating signature at ultrashort distance and a definite signature at large scale . it is then discussed that the lorentzian signature of the present large scale universe might have been generated due to a quantum tunneling effect at very early universe and that the immediate inflation could have stabilized this chosen lorentzian metric and prevented this new baby universe from re - tunneling to an euclidean phase . the subsequent big bang and the observed acceleration of the universe are then considered as different ways by which the universe could have fixed the lorentzian metric as the preferred one . beside this scenario , it is also shown that at the present large scale lorentzian universe there can be fluctuating signature at small scales which may be accompanied by a constant time - like vector that accounts for a principle violation of the lorentz invariance at small scales . at large scales , although a same vector can in principle exist but its norm is vanishing and so is non - observable . this leaves the lorentz invariance as an almost exact symmetry at large space - time scales . consider the 5-d two - time metric @xmath0 where @xmath1 accounts for 3-space metric , @xmath2 is the extra time dimension , and @xmath3 is assumed to be the vacuum expectation value of a dimensionless higgs field with the following potential @xcite @xmath4 where @xmath5 and @xmath6 together with @xmath7 are the parameters of the potential . it is assumed that the 4-dimensional metric is independent of the extra time , but the higgs field depends merely on @xmath2 . the choice of @xmath7 is of particular importance in incorporating the notions of large and small scales in the study of signature dynamics . in fact , no absolute line of demarcation can exist between small and large scales without having a positive definite measure of distance . therefore , we assume a characteristic size in the ultrashort distance regime , described by an absolute scale of length @xmath8 , which acts as a sort of universal length that determines a lower bound on any scale of length probed in a measurement process . the existence of universal length @xmath8 is not compatible with the universal requirement of lorentz invariance . such a violation of lorentz invariance may be a consequence of unification of quantum physics and gravity and is expected to manifest itself at ultrashort distances . we therefore take @xmath9 where @xmath10 is the characteristic size of the region over which one measures the signature of metric . by starting from a very large parameter @xmath11 , namely @xmath12 , one finds that the potential has one minimum at @xmath13 as is shown in fig.1 . however , at some ( critical ) smaller parameter @xmath14 ( @xmath15 is presumably the planck length @xmath16 ) , the potential will have three minima at points where @xmath17 ( see fig.2 ) . one of these minima is at @xmath13 and two others are at @xmath18 . in other words , at @xmath19 there are two phases in equilibrium with each other , one with @xmath13 and the other with @xmath20 ( or @xmath21 ) . the phase with @xmath13 is stable when @xmath22 , and _ meta - stable _ when @xmath10 is a bit larger than @xmath15 . the order parameter , namely @xmath3 , is discontinuous at the transition @xmath19 . therefore , we are dealing with a _ first order phase transition _ where two phases can coexist , one with @xmath13 and the other with nonzero @xmath3 . one may then find meta - stability so that the system can persist in the phase with @xmath13 , for the parameter @xmath10 very close to @xmath15 . when @xmath23 , the potential @xmath24 is unstable at @xmath13 , but has two negative minima which are stable , as fig.3 . in such case , there can never be coexistent phases at @xmath13 and @xmath25 . therefore , the unstable phase at @xmath13 is removed and a stable phase should be chosen out of two minima at @xmath26 . this means , when @xmath27 we have the degenerate 4-d metric @xmath28 everywhere on the manifold , before symmetry breaking . then , at some smaller parameter @xmath7 namely @xmath14 the 4-d metric is capable of taking on the following forms @xmath29 corresponding to three equal minima of the potential where @xmath17 , so that they can be in equilibrium with each other . the manifold at the scale @xmath15 is then capable of being degenerate , euclidean , and lorentzian . in other words , the signature of metric oscillates ( in @xmath2 ) between the above three forms due to quantum tunneling between the minima of the potential . if the parameter @xmath10 begins to increase above @xmath15 the system will provisionally be meta - stable so that the metric can persist , for the parameter @xmath10 close to @xmath15 , in coexistent phases . finally , at @xmath23 the system is unstable at @xmath13 and has two negative minima . this means , the manifold can no longer have a degenerate metric and the signature can just oscillate between euclidean and lorentzian , due to quantum tunneling between the two minima . as @xmath10 increases above @xmath8 the system becomes more stable so that for @xmath30 the tunneling probability approaches zero and the preferred signature is permanently fixed . a few words on the length scales @xmath8 and @xmath10 are in order . in one hand , the existence of a universal length @xmath8 in the small scale regime is in sharp contrast with the universal requirement of lorentz invariance . on the other hand , one can not distinguish between large and small scales without having a positive definite metric . according to blokhintsev @xcite , accompanying the notion of a universal length ( lorentz non - invariance ) with a constant time - like vector @xmath31 , it is possible to distinguish between small and large scales in minkowski space - time by taking the positive definite interval @xmath32 therefore , the existence of a universal length @xmath8 at ultrashort distance regime is inevitably related to the existence of an _ internal _ time - like vector @xmath33 over the manifold . given the euclidean metric @xmath34 one may determine the absolute size of a distance by comparing @xmath35 with the universal length @xmath8 . in the same way , one may determine the absolute size of the distance @xmath10 and determine the meaningful value of the parameter @xmath7 . with no loss of generality one may take the distance @xmath10 to be the radius of universe , namely the scale factor @xmath36 . therefore , one may expect different phases in the potential according to the evolution of @xmath36 . at very early universe @xmath37 ( or @xmath38 ) we have not a meaningful notion of the metric because it is degenerate . at @xmath39 , the metric can fluctuate between euclidean , degenerate and lorentzian forms . this is plausible in the quantum gravity regime @xmath40 and is consistent with quantum tunneling in cosmology in which the universe tunnels from nothing ( @xmath41 ) , through a euclidean region , to the planck length @xmath16 at which the universe may fluctuate between euclidean ( @xmath42 ) , degenerate ( @xmath43 ) and lorentzian ( @xmath44 ) forms . as long as the scale factor is close to the planck length these quantum oscillations ( in @xmath2 ) persist with no preference for euclidean or lorentzian metric to be the permanent one . this means the true vacuum of the potential is not yet selected . however , once some suitable initial conditions are provided for one of the quantum tunnelings to the lorentzian region , the universe can start time ( @xmath45 ) evolution in the scale factor towards @xmath8 and this stabilizes the lorentzian metric because @xmath7 decreases . therefore , at the scale @xmath46 the metric is definitely lorentzian which means @xmath47 is selected as the preferred minimum of the potential . however , the probability for quantum tunneling to the euclidean region is not yet excluded , because the barrier between the two minima is not so high and wide . the new born lorentzian universe can get rid of death ( thorough quantum re - tunneling to the euclidean region ) by undergoing an inflation in the scale factor . this inflation launches the small scale factor @xmath48 ( presumably the grand unification scale ) to a distance tens of order greater than @xmath8 in a very short period of time , namely @xmath49 seconds . hence @xmath7 becomes very small and leads to a very high barrier so that the probability for quantum tunneling becomes very small , as well . in this regard , the inflation helps the lorentzian metric to be stabilized in a tiny fraction of a second . after inflation , the big bang also causes the universe to be expanded rapidly which leads to more stabilization of the lorentzian metric . this stabilization is continued as long as the universe expands . one may then interpret the expansion of the universe as a way to avoid re - tunneling to the euclidaen metric . the recent observed acceleration of the universe may also be addressed and justified according to this scenario . now suppose there is a constant internal vector on the 4-d manifold as @xmath50 associated with the properties of vacuum through @xmath3 . then , for @xmath51 we have @xmath52 corresponding to the absolute minimum at @xmath13 , before symmetry breaking . when @xmath53 , the parameter @xmath7 decreases and the vector @xmath33 is found in a non - vanishing form , namely @xmath54 . this means that before symmetry breaking , when @xmath55 , there is no @xmath33 at all , and one is appeared at the symmetry breaking at @xmath53 . at @xmath56 where only euclidean and lorentzian metrics are available through the quantum tunneling , one may use this non - vanishing @xmath33 to relate the euclidean metric @xmath57 and lorentzian one @xmath58 @xmath59 with no restriction on the norm of @xmath33 . this is because the permanent metric is not fixed . however , far from the critical point , @xmath60 where the true vacuum of the system is singled out as the lorentzian metric @xmath58 , we find , by contracting eq.([4 ] ) with @xmath61 , that the internal vector has negative norm @xmath62 which accounts for the time - like nature of @xmath33 , as is required according to blokhintsev point of view . notice that the norm of @xmath33 is almost vanishing for @xmath63 , namely @xmath64 , and becomes important at small scales @xmath65 . therefore , the internal vector @xmath33 is non - observable at large scales which means the lorentz invariance is an almost exact symmetry at large distances compared with @xmath8 .

Kelsey Grammer, Kayte Walsh to Wed on Broadway Email This is set to tie the knot with fiancee Kayte Walsh this afternoon in quite a creative setting: a Broadway playhouse. According to Sources say the ceremony will begin at 3:30PM this afternoon and security will be extremely tight, with guards checking invitations and IDs. A reception at the historic Plaza Hotel will follow the theatrical ceremony, where guests will dine on lobster, goat cheese truffles and braised beef shortribs -- just to name a few items on the lavish menu. And that's only for the dinner portion of the evening. A separate menu has been prepared for the after-party. Kelsey Grammer is set to tie the knot with fiancee Kayte Walsh this afternoon in quite a creative setting: a Broadway playhouse.According to TMZ , the actor -- who recently divorced 'Real Housewife' Camille Grammer -- will be married at New York's Longacre Theater where he just wrapped a yearlong performance in 'La Cage Aux Folles.'Sources say the ceremony will begin at 3:30PM this afternoon and security will be extremely tight, with guards checking invitations and IDs.A reception at the historic Plaza Hotel will follow the theatrical ceremony, where guests will dine on lobster, goat cheese truffles and braised beef shortribs -- just to name a few items on the lavish menu. And that's only for the dinner portion of the evening. A separate menu has been prepared for the after-party. http://xml.channel.aol.com/xmlpublisher/fetch.v2.xml?option=expand_relative_urls&dataUrlNodes=uiConfig,feedConfig,entry&id=691977&pid=691976&uts=1294158078 http://www.popeater.com/mm_track/popeater/music/?s_channel=us.musicpop&s_account=aolpopeater,aolsvc&omni=1&ke=1 http://cdn.channel.aol.com/cs_feed_v1_6/csfeedwrapper.swf PopScene: Week's Hottest Pics Reese Witherspoon keeps her hands in her pockets as she tries to stay warm while out in New York City on January 3rd. X17online X17online In addition, the couple will have a cake that's over 55 inches tall by cake designer Silvia Weinstock, according to RadarOnline.com . And the flavor? Well, it may not be traditional, but Walsh, who is a vegetarian, made the request."It's carrot cake!" Weinstock told Radar. "It's unusual. But obviously she's very comfortable in her skin, and that's what she wants so that's what she's going to have."The "showstopper" cake will feature cascading flowers and ivory cream.But such extravagance comes with a price tag. Sources told TMZ that the couple is dishing out $400 per person for everyone to celebrate with them in style.One person who won't be joining the couple this weekend is Grammer's ex-wife, Camille. The pair were married for 13 years before Grammer left her for Walsh last year -- a drama that was publicly played out on 'The Real Housewives of Beverly Hills.' Their divorce was finalized earlier this month."I have a great many mixed feelings about today -- I'm sad for what was, yet excited for the road ahead," she said the day divorce was finalized, wishing Kelsey and Kayte "love and happiness in their new marriage."Camille will be busy this weekend prepping for Sunday night's Academy Awards, where she'll be reporting from the red carpet for CNN. ||||| Fourth time's a charm?Actor Kelsey Grammer got married for the fourth time today, just two weeks after his divorce to Camille Grammer was finalized. His bride, 29-year-old Kayte Walsh, has been thrust into the limelight since Grammer began publicly declaring his love for the English woman in July.Surge Desk has the following information on the woman 26 years Grammer's junior.According to reports, Grammer and Walsh met on a New York -bound flight.In an interview with PopEater , Camille Grammer said she learned about Walsh while filming the "Real Housewives of Beverly Hills" and before filing for divorce. "I found out during filming that he wanted out and that he had moved another woman into our apartment in New York and she had gotten pregnant," Grammer said. "And I ended up the bad guy!"Back in August, Alan Walsh, Ms. Walsh's father, told the Daily Mail his daughter was pregnant with Grammer's child. Unfortunately, not long afterward, Walsh suffered a miscarriage.A former professional soccer player in England , Walsh's father not only broke the news of his daughter's pregnancy to the media , but was the one who first identified her as Grammer's girlfriend. According to RadarOnline , the couple's wedding reception at New York's Plaza Hotel featured a towering 4-foot-tall carrot cake. ||||| Kelsey Grammer Granted Divorce; Camille Wishes Him 'Love and Happiness' Email This You are free to marry your fiancee now, Los Angeles Superior Court Judge Maren Nelson signed off on the split, but the pair decided to handle the financial aspects of the divorce later. In a humble gesture, Camille released a statement wishing her husband of 13 years all the best. "I have a great many mixed feelings about today -- I'm sad for what was, yet excited for the road ahead," she said, wishing Kelsey and Kayte "love and happiness in their new marriage." You are free to marry your fiancee now, Kelsey Grammer . A Los Angeles judge granted the 'Frasier' star a divorce from Camille Grammer on Thursday, meaning he can tie the knot with Kayte Walsh, who is pregnant with his child.Los Angeles Superior Court Judge Maren Nelson signed off on the split, but the pair decided to handle the financial aspects of the divorce later. In a humble gesture, Camille released a statement wishing her husband of 13 years all the best."I have a great many mixed feelings about today -- I'm sad for what was, yet excited for the road ahead," she said, wishing Kelsey and Kayte "love and happiness in their new marriage." http://xml.channel.aol.com/xmlpublisher/fetch.v2.xml?option=expand_relative_urls&dataUrlNodes=uiConfig,feedConfig,entry&id=762708&pid=762707&uts=1273853626 http://www.popeater.com/mm_track/popeater/movies/?s_channel=us.moviespop&s_account=aolpopeater,aolsvc&omni=1&ke=1 http://cdn.channel.aol.com/cs_feed_v1_6/csfeedwrapper.swf Celebrity Splitsville Halle Berry and Gabriel Aubry Split Halle Berry called it quits with her boyfriend, Gabriel Aubry, ending their five-year relationship. The couple has a 2-year-old daughter, Nahla Ariel Aubry. Evan Agostini, AP Evan Agostini, AP Celebrity Splits In her statement, Camille said she was hopeful that she and Kelsey could "improve our communications" for the sake of raising their two daughters, Mason, 8, and Jude, 6.Kelsey, 55, has adamantly been pushing for a speedy divorce, so he can hurry up and say "I do" once again to the 29-year-old Walsh. He told David Letterman on his show last month that he plans to marry Walsh sometime in February.Sources said Kelsey and Camille agreed on all the prerequisites for an immediate divorce. The couple did not have a prenuptial agreement, which means all earnings during the marriage will be split down the middle. During their 13 years of marriage, the couple amassed a fortune in excess of $100 million, most of which is in real estate.The divorce has gotten slightly messy in recent months. Camille insinuated, jokingly, that her husband was a cross-dresser , and Kelsey attempted to freeze assets from his ex. But it looks like peace prevailed, and Kelsey reportedly plans to invite Camille to his upcoming wedding.

– Less than three weeks after his divorce from wife no. 3 was finalized, Kelsey Grammer tied the knot with wife no. 4, the New York Post reports. Grammer, 56, and Kayte Walsh, 29, married yesterday on the set of La Cage Aux Folles on Broadway, where Grammer just finished a run in the musical. Another star of the musical performed the ceremony, and the small guest list included chorus boys, Walsh’s flight attendant friends, and Grammer’s 5-year-old son (but not his 9-year-old daughter). Click for more on the ceremony and reception, or check out five facts about Kayte Walsh.

a first estimate of the total number of variable stars observable by gaia was done by eyer ( 1999 ) . the star population used came from the star - count model of figueras et al . ( 1999 ) and the variability detection threshold was derived from the hipparcos survey results . with the new qualifications of the gaia mission , about 1 billion stars ( up to mag g@xmath020 ) are expected to be observed , with about 18 million variable stars , including about 5 million `` classic '' periodic variables . + very different star counts are obtained according to the extinction laws used ( figueras , private communication ) . since the quality of the gaia photometry in the crowded fields is still uncertain , we can not discuss here the number of variables in dense clusters and galaxies . + about 2 to 3 millions eclipsing binaries will be observed , but their detection probability will be studied in detail in the future . about 300000 stars with rotation induced variability can be expected as well . for a specific interval of v - i , we computed the proportion of variables in the hipparcos survey and we applied that rate to the number of stars obtained from the figueras model ( method a ) . surface densities were calculated , either from the hipparcos parallaxes or from the specific properties of the stars . we integrated and removed the stars behind the bulge ( method b ) . we extrapolated the gcvs data ( kholopov et al . , 1998 ) assuming detection completeness up to a certain magnitude and a magnitude limit for the population beyond which no more stars are present ( method c ) . we also analysed the detection rates of the microlensing surveys ( when available ) and scanned the literature . method a and c estimate the number of @xmath1 cephei stars to be about 3000 . 15000 spb variables will be detected according to method a. applying method a and c gave about the same estimate for @xmath2 scuti stars : 60000 . however , it will be very difficult to analyse the very reddened low amplitude variables . with method b even higher numbers as 240000 @xmath2 scuti stars show up . + with a total number of rr lyrae as given by suntzeff et al . ( 1991 ) we arrive at 70000 observable rr lyrae ( method b ) . using the ogle and macho detection rates , we expect 15000 to 40000 rr lyrae in the bulge . + all galactic cepheids are within the observational range of gaia , if not too obscured by interstellar extinction . results of recent deep surveys confirm the early estimates of a total of 2000 to 8000 cepheids . with the help of the fernie database ( 1995 ) , we obtained ( method b ) a density of 15 - 20 cepheids/@xmath3 , leading to an estimate of 52006900 observable stars . + early estimates gave in total 200000 mira and related long period variables in the galaxy . with 500 miras/@xmath3 , 140000 to 170000 miras will be observable . method b gave us a density of 250 - 350 semi - regular variables/@xmath3 or a total of 100000 observable sr stars . + we plan to calculate and analyse all categories of variables stars in more detail to arrive at reliable estimates of all observable variable stars in the galaxy . an example : the international liquid mirrortelescope ( ilmt ) . + ( see ` http://vela.astro.ulg.ac.be/themes/telins/lmt/index_e.html ` ) + an international group of institutions are actively interested in developing a 4-m class liquid mirror telescope . if the view of the ilmt includes fields near the galactic center and all stars from r magnitude 17 up to 20 can be measured with high precision ( @xmath4 0.01 mag ) , the project will yield a unique time series of about 2 million stars with a total of 500 measurements of each star during 5 years . about 10000 new variable stars can be expected , including 6000 faint eclipsing binaries , 200 rr lyrae and 300 long periodic variables . eyer , l. 1999 , balt . 8 , 321 fernie , j.d . , beattie , b. , evans , n.r . , & seager , s. 1995 , ibvs 4148 figueras , f. et al . , 1999 , balt . 8 , 291 gaia : ` http://astro.estec.esa.nl/sa-general/projects/gaia/ ` hipparcos : hipparcos and tycho catalogues , esa sp-1200 kholopov , p.n . , et al . 1998 , gcvs , 4th edition suntzeff , n.b . , kinman , t.d . , & kraft , r.p . 1991 , , 367 , 528

future space and ground - based survey programmes will produce an impressive amount of photometric data . the gaia space mission will map the complete sky down to mag v=20 and produce time series for about 1 billion stars . survey instruments as the international liquid mirror telescope will observe slices of the sky down to magnitude v=23 . in both experiments , the opportunity exists to discover a huge amount of variable stars . a prediction of the expected total number of variable stars and the number of variables in specific subgroups is given .

graphene@xcite , composed carbon atoms arranged in a two - dimensional honeycomb lattice , is the building block for all graphitic materials from the 0d fullerenes to 1d nanotubes and also the common 3d graphite . however , following peierls and landau s arguments , the two - dimensional lattice is unstable and can not exist at any finite temperature . therefore , graphene is often used as a toy model and viewed as an academic material until its recent discovery in laboratory@xcite . since graphene has promising application potentials in nanoscale electronic devices , it is important to study how the band structure changes with respect to the finite transverse width and also the edge topology . in addition , we also expect the electron - electron interaction will play a crucial role for physics properties in low - energy limit . therefore , we are motivated to investigate the ground state properties in graphene nanoribbon ( gnr ) here . with lithography techniques , gnr with width smaller than 20 nm has been fabricated successfully@xcite . however , the edge roughness seems to post a tough challenge on both theoretical and experimental sides . a breakthrough comes from chemical approach@xcite recently , that can produce gnr down to 10 nm in the controlled way . moreover , these gnrs have remarkably smooth edges and make the fast electronics at molecular scale possible@xcite . in this work , we concentrate on the gnr with armchair edges since the open boundaries give rise to peculiar flat bands . note that the edges are hydrogenated so that the dangling @xmath0 bonds are saturated and only the @xmath1 bands remain active in low energy@xcite . by combining analytic weak - coupling analysis , numerical density matrix renormalization - group ( dmrg ) method , and the first - principles calculations , it was shown@xcite that armchair gnr exhibits novel carrier - mediated ferromagnetism upon appropriate doping . even though only @xmath1 bands are active in low - energy , in appropriate doping regimes , the armchair edges give rise to both itinerant bloch and localized wannier orbitals . these localized orbitals are direct consequences of quantum interferences in armchair gnr and form flat bands with zero velocity . the carrier - mediated ferromagnetism can thus be understood in two steps : electronic correlations in the flat band generate intrinsic magnetic moments first , then the itinerant bloch electrons mediate ferromagnetic exchange coupling among them . here we use a variational wave function approach and try to understand how the flat - band ferromagnetism evolves with the interaction strength . we start with the hubbard model to describe the armchair gnr , @xmath2 + u\sum_{{\bf r } } n_{\uparrow}({\bf r})n_{\downarrow}({\bf r}).\end{aligned}\ ] ] where @xmath3 is the hopping amplitude , @xmath4 is the repulsive on - site interaction , @xmath5 is the spin index , @xmath6 , and @xmath7 is taken only for nearest neighbor bonds . rough estimates from experiments give @xmath8 ev and @xmath9-@xmath10 ev , putting the ratio @xmath11 to be of order one . before diving into the numerical details , it is insightful to highlight the peculiar flat - band orbitals first . for the armchair gnr , its transverse width can be labeled by an integer @xmath12 , i.e. the size of the unit cell for each sublattice . writing down the wave function on different sublattices as the two - componenet spinor , it is easy to check that , for symmetric armchair gnr ( odd @xmath12 ) , one can construct a localized wave function at @xmath13 , @xmath14,\end{aligned}\ ] ] and show it is indeed an eigenstate of the hopping hamiltonian . applying translational invariance to shift the wannier orbital , the flat band emerges at the end . this is the one - dimensional analog of the landau level degeneracy for two - dimensional electrons in magnetic field . it is interesting that the edge topology in 1d quenches the kinetic energy without the necessity to couple to external magnetic field . furthermore , we would like to point out that the flat - band ferromagnetism in armchair gnr is not the same by mielke - tasaki@xcite mechanism since there is no direct overlap between these flat - band orbitals . the ferromagnetism is actually mediated by other dispersive bands that couple the magnetic moments in the flat band . on the purpose of seeing the polarization for the ground state , we introduce the following trial wave function , @xmath15 \left[\prod_{k_{s m \downarrow } } a_{s m \downarrow}^{\dag}(k_{s m \downarrow } ) \right ] valence bands ( @xmath16 ) and the conducting bands ( @xmath17 ) separately and @xmath18 is the band index . thus , there are @xmath19 number of bands totally . the lower bounds for @xmath20 are decided by their band structures ( which are either @xmath21 or @xmath22 ) , while the upper bounds are the fitting parameters to minimize the variational energy , reducing the problem to look for minimum in the @xmath23-dimensional ( one constraint from the total particle conservation ) parameter space . for convenience , we introduce the filling factor , @xmath24 for each band as the variational parameters . since the filling factor denotes the fraction of the filled states in the band , summing @xmath25 over all bands gives the number of particles in one unit cell , i.e. @xmath26 , where @xmath27 is the average particle number per site . meanwhile , the total spin of the ground state , @xmath28 , can also be expressed in terms of the filling factors easily . the kinetic energy per unit cell is obtained by integrating the energy spectra to the desired fillings . the integration is fundamental and can be expressed in terms of the elliptic integrals , @xmath29 + \sum_{s\alpha}st\nu_{s_{f\alpha}},\end{aligned}\ ] ] where @xmath30 for @xmath31 is the elliptic integral of the second kind . the magnitude of the transverse momentum is @xmath32 and @xmath33 . for clarity , we separate the kinetic energy from the dispersive bands and the flat bands in above . thus , the summation of the band index @xmath34 does not include the flat bands . it shall be clear that the kinetic energy of the flat band ( denoted by @xmath35 ) is rather trivial since it is directly proportional to filling factor multiplied by the energy @xmath36 . for dispersive bands , the initial momentum @xmath37 starts from either @xmath21 or @xmath1 , depending where the spectrum minimum sits in the 1d brillouin zone . the corresponding filled momentum @xmath38 is either @xmath39 or @xmath40 . similarly , we can also compute the interaction energy per unit cell , @xmath41 \nu_{sm\uparrow } \nu_{s'm'\downarrow},\end{aligned}\ ] ] where the effective repulsive interaction @xmath42 between the bands @xmath43 and @xmath44 is the summation inside the bracket in above . the reason why the effective repulsion does not carry the explicit dependence on @xmath45 is due to the particle - hole symmetry in the armchair gnr . the analytic expressions for the kinetic and interaction energies are nice but the search for minima in the global parameter space can only be done by numerical approach due to the number of all filling factors are large . the numerical search is carried out extensively at interaction strength from @xmath46 to @xmath47 . as an illustrating example , we present our numerical results at @xmath48 and @xmath49 in fig . [ fig : s ] for @xmath50 armchair gnr . for wider gnr , the numerical results are qualitatively the same . meanwhile , to avoid being trapped in local minima , we randomly choose the initial searching points and select the final configurations with lowest energy . spin polarization in each bands at different electron number per site @xmath51 for the ( a ) @xmath48 and ( b ) @xmath49 cases . the flat - band regime ( @xmath52 ) is between the yellow dashed lines and the gray open circle denotes twice of the total spin per unit cell @xmath53 . spin polarization from the valence bands are shown in red , green , blue open circles , corresponding to the flat band , the lower ( @xmath54 ) and the upper ( @xmath55 ) dispersive bands . the spin polarization for the conduction bands are mirror images of these around the symmetric axis @xmath56 . for clarity of the figure , they are not shown here.,title="fig : " ] spin polarization in each bands at different electron number per site @xmath51 for the ( a ) @xmath48 and ( b ) @xmath49 cases . the flat - band regime ( @xmath52 ) is between the yellow dashed lines and the gray open circle denotes twice of the total spin per unit cell @xmath53 . spin polarization from the valence bands are shown in red , green , blue open circles , corresponding to the flat band , the lower ( @xmath54 ) and the upper ( @xmath55 ) dispersive bands . the spin polarization for the conduction bands are mirror images of these around the symmetric axis @xmath56 . for clarity of the figure , they are not shown here.,title="fig : " ] for the relatively weak interaction strength @xmath48 , the influence of the band structure is still manifest . first of all , the particle - hole symmetry is manifest in the total spin @xmath57 . note that the finite spin polarization near @xmath58 and @xmath59 is due to the van hove singularity and is not our main focus here . it is rather interesting that the ferromagnetic phase coincide with the flat - band regime rather nicely . in fact , the total spin per unit cell @xmath57 mainly comes from the flat - band orbitals . furthermore , since the upper dispersive band ( @xmath55 in light blue color ) intersects with the flat band , it is also polarized in the flat - band regime . on the other hand , the lower dispersive band ( @xmath54 in green color ) is separated by a finite gap and does not participate in the ferromagnetism . these numerical findings agree with field - theory approach , which shows that the exchange coupling between the flat - band moments are mediated by the itinerant carriers in the intersecting dispersive bands . as the interaction strength increases to @xmath49 , the competition between the kinetic and the interaction energies become highly non - trivial even at the mean - field level . the ferromagnetic regime due to van hove singularity expands a little bit as expected from stoner criterion . it is rather remarkable that the ferromagnetic phase is still confined to the flat - band regime rather well . but , since the interaction strength is large enough , both dispersive bands contribute despite the minor gap in one of them . the intersecting band greatly enhances the ferromagnetic correlations and accounts for roughly one - third of the total spin density . this implies that the itinerant carriers no longer play the secondary role as messengers to line up the localized moments in the flat band . instead , they also develop ferromagnetic correlations and contribute to the total spin density . the role of the dispersive band with a minor gap is peculiar . it participates the ferromagnetic phase in the first - half of the flat - band regime and drops out in the second - half . it is not yet clear whether this asymmetrical behavior is an artifact of the simple wave function we chose , or it hints for something real in realistic armchair gnr . we show that the armchair edges of gnr quenches the kinetic energy of the itinerant carriers and leads to the flat - band orbitals at finite doping . this is a beautiful one - dimensional analogy of the 2d landau levels except the magnetic field is not needed here . following the hints from the field - theory analysis , we study magnetic properties of the ground state via variational wave function approach and found the flat - band ferromagnetism in armchair gnr . we acknowledge support from the national science council of taiwan through grants nsc-95 - 2112-m-007 - 009 and nsc-96 - 2112-m-007 - 004 and also from the national center for theoretical sciences in taiwan .

we study the electronic correlation effects in armchair graphene nanoribbons that have been recently proposed to be the building blocks of spin qubits . the armchair edges give rise to peculiar quantum interferences and lead to quenched kinetic energy of the itinerant carriers at appropriate doping level . this is a beautiful one - dimensional analogy of the landau - level formation in two dimensions except the magnetic field is not needed here . combining the techniques of effective field theory and variational wave function approach , we found that the ground state exhibits a new type of flat - band ferromagnetism that hasnt been found before . at the end , we address practical issues about realization of this novel magnetic state in experiments .

SECTION 1. SHORT TITLE. This Act may be cited as the ``Presidential Library Donation Reform Act of 2009''. SEC. 2. PRESIDENTIAL LIBRARIES. (a) In General.--Section 2112 of title 44, United States Code, is amended by adding at the end the following new subsection: ``(h)(1) Any Presidential library fundraising organization shall submit on a quarterly basis, in accordance with paragraph (2), information with respect to every contributor who gave the organization a contribution or contributions (whether monetary or in-kind) totaling $200 or more for the quarterly period. ``(2) For purposes of paragraph (1)-- ``(A) the entities to which information shall be submitted under that paragraph are the Administration, the Committee on Oversight and Government Reform of the House of Representatives, and the Committee on Homeland Security and Governmental Affairs of the Senate; ``(B) the dates by which information shall be submitted under that paragraph are April 15, July 15, October 15, and January 15 of each year and of the following year (for the fourth quarterly filing); ``(C) the requirement to submit information under that paragraph shall continue until the later of the following occurs: ``(i) The Archivist has accepted, taken title to, or entered into an agreement to use any land or facility for the archival depository. ``(ii) The President whose archives are contained in the depository no longer holds the Office of President and a period of four years has expired (beginning on the date the President left the Office). ``(3) In this subsection: ``(A) The term `Presidential library fundraising organization' means an organization that is established for the purpose of raising funds for creating, maintaining, expanding, or conducting activities at-- ``(i) a Presidential archival depository; or ``(ii) any facilities relating to a Presidential archival depository. ``(B) The term `information' means the following: ``(i) The amount or value of each contribution made by a contributor referred to in paragraph (1) in the quarter covered by the submission. ``(ii) The source of each such contribution, and the address of the entity or individual that is the source of the contribution. ``(iii) If the source of such a contribution is an individual, the occupation of the individual. ``(iv) The date of each such contribution. ``(4) The Archivist shall make available to the public through the Internet (or a successor technology readily available to the public) as soon as is practicable after each quarterly filing any information that is submitted under paragraph (1). The information shall be made available without a fee or other access charge, in a searchable, sortable, and downloadable database. ``(5)(A) It shall be unlawful for any person who makes a contribution described in paragraph (1) to knowingly and willfully submit false material information or omit material information with respect to the contribution to an organization described in such paragraph. ``(B) The penalties described in section 1001 of title 18, United States Code, shall apply with respect to a violation of subparagraph (A) in the same manner as a violation described in such section. ``(6)(A) It shall be unlawful for any Presidential library fundraising organization to knowingly and willfully submit false material information or omit material information under paragraph (1). ``(B) The penalties described in section 1001 of title 18, United States Code, shall apply with respect to a violation of subparagraph (A) in the same manner as a violation described in such section. ``(7)(A) It shall be unlawful for a person to knowingly and willfully-- ``(i) make a contribution described in paragraph (1) in the name of another person; ``(ii) permit his or her name to be used to effect a contribution described in paragraph (1); or ``(iii) accept a contribution described in paragraph (1) that is made by one person in the name of another person. ``(B) The penalties set forth in section 309(d) of the Federal Election Campaign Act of 1971 (2 U.S.C. 437g(d)) shall apply to a violation of subparagraph (A) in the same manner as if such violation were a violation of section 316(b)(3) of such Act (2 U.S.C. 441b(b)(3)). ``(8) The Archivist shall promulgate regulations for the purpose of carrying out this subsection.''. (b) Applicability.--Section 2112(h) of title 44, United States Code (as added by subsection (a))-- (1) shall apply to an organization established for the purpose of raising funds for creating, maintaining, expanding, or conducting activities at a Presidential archival depository or any facilities relating to a Presidential archival depository before, on or after the date of the enactment of this Act; and (2) shall only apply with respect to contributions (whether monetary or in-kind) made after the date of the enactment of this Act. Passed the House of Representatives January 7, 2009. Attest: LORRAINE C. MILLER, Clerk.

Presidential Library Donation Reform Act of 2009 - Amends federal law regarding presidential archival depositories to require any presidential library fundraising organization to submit quarterly reports to the National Archives and Records Administration and specified congressional committees on every contributor who gave the organization a contribution or contributions (whether monetary or in-kind) totaling $200 or more for the quarterly period. Requires the Archivist of the United States to make such information available to the public through the Internet as soon as is practicable after each quarterly filing. Makes it unlawful for contributors or fundraising organizations to knowingly and willfully submit false information or omit material information. Prescribes criminal penalties for violation of such prohibitions.

SECTION 1. EXCHANGE OF CERTAIN MINERAL INTERESTS IN BILLINGS COUNTY, NORTH DAKOTA. (a) Purpose.--The purpose of this Act is to direct the consolidation of certain mineral interests in the Little Missouri National Grasslands in Billings County, North Dakota, through the exchange of Federal and private mineral interests in order to enhance land management capability and environmental and wildlife protection. (b) Exchange.--Notwithstanding any other provision of law-- (1) if, not later than 45 days after the date of enactment of this Act, Burlington Resources Oil & Gas Company (referred to in this Act as ``Burlington'' and formerly known as Meridian Oil Inc.), conveys title acceptable to the Secretary of Agriculture (referred to in this Act as the ``Secretary'') to all oil and gas rights and interests on lands identified on the map entitled ``Billings County, North Dakota, Consolidated Mineral Exchange--November 1995'', by quitclaim deed acceptable to the Secretary, the Secretary shall convey to Burlington, subject to valid existing rights, by quitclaim deed, all Federal oil and gas rights and interests identified on that map; and (2) if Burlington makes the conveyance under paragraph (1) and, not later than 180 days after the date of enactment of this Act, the owners of the remaining non-oil and gas mineral interests on lands identified on that map convey title acceptable to the Secretary to all rights, title, and interests in the interests held by them, by quitclaim deed acceptable to the Secretary, the Secretary shall convey to those owners, subject to valid existing rights, by exchange deed, all remaining Federal non-oil and gas mineral rights, title, and interests in National Forest System lands and National Grasslands identified on that map in the State of North Dakota as are agreed to by the Secretary and the owners of those interests. (c) Leasehold Interests.--As a condition precedent to the conveyance of interests by the Secretary to Burlington under this Act, all leasehold and contractual interests in the oil and gas interests to be conveyed by Burlington to the United States under this Act shall be released, to the satisfaction of the Secretary. (d) Equal Valuation of Oil and Gas Rights Exchange.--The values of the interests to be exchanged under subsection (b)(1) shall be deemed to be equal. (e) Approximate Equal Value of Exchanges With Other Interest Owners.--The values of the interests to be exchanged under subsection (b)(2) shall be approximately equal, as determined by the Secretary. (f) Land Use.-- (1) Exploration and development.--The Secretary shall grant to Burlington, and its successors and assigns, the use of Federally-owned surface lands to explore for and develop interests conveyed to Burlington under this Act, subject to applicable Federal and State laws. (2) Surface occupancy and use.--Rights to surface occupancy and use that Burlington would have absent the exchange under this Act on its interests conveyed under this Act shall apply to the same extent on the federally owned surface estate overlying oil and gas rights conveyed to Burlington under this Act. (g) Environmental Protection for Environmentally Sensitive Lands.-- All activities of Burlington, and its successors and assigns, relating to exploration and development on environmentally sensitive National Forest System lands, as described in the ``Memorandum of Understanding Concerning Certain Severed Mineral Estates, Billings County, North Dakota'', executed by the Forest Service and Burlington and dated November 2, 1995, shall be subject to the terms of the memorandum. (h) Map.--The map referred to in subsection (b) shall be provided to the Committee on Energy and Natural Resources of the Senate and the Committee on Resources of the House of Representatives, kept on file in the office of the Chief of the Forest Service, and made available for public inspection in the office of the Forest Supervisor of the Custer National Forest within 45 days after the date of enactment of this Act. (i) Continuation of Multiple Use.--Nothing in this Act shall limit, restrict, or otherwise effect the application of the principle of multiple use (including outdoor recreation, range, timber, watershed, and fish and wildlife purposes) in any area of the Little Missouri National Grasslands. Federal grazing permits or privileges in areas designated on the map entitled ``Billings County, North Dakota, Consolidated Mineral Exchange--November 1995'' or those lands described in the ``Memorandum of Understanding Concerning Certain Severed Mineral Estates, Billings County, North Dakota'', shall not be curtailed or otherwise limited as a result of the exchange authorized by this Act.

Directs the Secretary of Agriculture to convey to the Burlington Resources Oil and Gas Company (formerly Meridian Oil Inc.) all Federal oil and gas rights and interests identified on a map entitled the "Billings County, North Dakota, Consolidated Mineral Exchange--November 1995," contingent on Burlington's conveyance to the Secretary of title to its own oil and gas rights and interests identified on the same map. States that the values of such exchanged oil and gas rights shall be deemed to be equal. Directs the Secretary, after Burlington makes such conveyance, to convey all remaining Federal non-oil and gas mineral rights, title, and interests in the National Forest System lands and National Grasslands in the State of North Dakota, to owners of the remaining non-oil and gas mineral interests identified on such map, contingent on the owners' conveyance to the Secretary of all their rights, title, and interests. States that the values of such exchanged interests shall be approximately equal, as determined by the Secretary. Directs the Secretary to grant to Burlington the use of federally-owned surface lands to explore and develop interests conveyed to Burlington under this Act.

strains were grown and maintained under standard conditions unless indicated otherwise . transgenic lines with pha-1 selection marker all optical stimulation experiments were done in lite-1 mutants to minimize the animal 's sensitivity to blue light . a complete strain list andinformation on transgenes the animals ' chemotaxis to a bacterial lawn were assayed on an open - lid , 10 cm nematode growth medium ( ngm ) plate incubated in room temperature overnight with 10 l escherichia coli op50 at the center . n2 young adults were placed on the plate , 1.5 cm away from the center of the bacterial lawn . the animals ' behaviors were recorded under 6 magnification by an emccd camera at 20hz and analyzed by customized labview scripts . an n2 young adult was placed on an open - lid , food - free , 10 cm ngm plate for at least 1 minute . 1b ) was used to determine whether the air ( 100 sccm ) was bubbled through water or 10 m isoamyl alcohol based on the posture of the freely moving animal . the images were recorded under 6 magnification by an emccd camera at 20 hz and analyzed by customized labview scripts . l4 animals were transferred to a new ngm plate with a thin layer of e. coli op50 , containing 100 m atr ( all - trans retinal , the co - factor required for functional light - gated ion channels ) if required , 24 hours before experiments in room temperature . an animal then was placed on an open - lid , food - free , 6 cm ngm plate for at least 1 minute . dark - field 660 nm illumination was used to visualize the posture of the animal under 1 magnification by a video camera at 20 hz ( fig . low - power 540 nm ( 0.1 mw / mm ) epifluorescent illumination was used to visualize the neurons co - expressing light - gated ion channels and monomeric kusabira - orange ( mko ) at 15 by an emccd camera at 40 hz ( computer 1 ) . image thresholding and particle detection were used as the image processing algorithms to identify the mko - tagged neurons . as the animal swung its head , the neurons in the field rotated and changed their positions . to offset the rotation effect , positions of the neurons were measured using the principle axis and the distance from the center of mass of the processed image . the processed images were then used to track the animal and to position the dlp mirrors to deliver light ( 4 mw / mm , 480 or 540 nm ) on the neurons of interest with any desired temporal patterns to excite or inhibit the activity of the neurons . feedback between motorized stage , dlp mirrors and image processing software was operated at 40 frames / sec to achieve a 5 m spatial resolution of excitation on a freely moving animal . l4 animals were transferred to a new ngm plate with a thin layer of e. coli op50 , containing 100 m atr if required , 24 hours before experiments in room temperature . a 6 cm copper ring was placed in an open - lid , food - free , 10 cm ngm plate immediately before experiments to keep the animals in the field of view . young adults then were transferred to the assay plate for 1 minute before the experiment started . the desired wavelength of light ( 1 mw / mm , 480 nm or 540 nm ) was delivered in alternate 3-minute intervals for 1 hour using customized labview scripts . reversal frequency was calculated from pirouettes determined by an automated worm tracker ( http://wormsense.stanford.edu/tracker ) . an aiy::chr2 animal was placed on an open - lid , food - free , 10 cm ngm plate for at least 1 minute before starting the experiment . a virtual - gradient of light , i(r ) = exp ( r / r0 ) , from 0 to 1 mw / mm over 1.3 mm , where r0 = 0.8 mm , was defined in an x y coordinate system tied to the center of mass of the animal which was always at the center of the gradient profile ( 0.65 mm , 0.65 mm ) ( supplementary fig . the virtual light gradient moved with the center of mass of the animal but at a fixed orientation . at each time t , the coordinates of the nose tip were identified to calculate the corresponding intensity of light i(nx , ny ) ( fig . the animal was then illuminated with blue ( 480 nm ) light at intensity i(nx , ny ) , and thus , aiy instantaneously experienced the intensity of light at the nose tip . arch::egfp was cloned into fire lab vector kit plasmid ppd96.52 ( ligation number l2534 , addgene plasmid 1608 ) . chop-2(h134r)::tagrfp was obtained by swapping tagrfp with yfp in the previously cloned chop-2(h134r)::yfp . arch::tagrfp and tagrfp and gcamp-3 were codon - optimized for c. elegans ( de novo synthesized by genscript ) whereas others were optimized for mammalian cells . we amplified 2 kb str-2p , 1 kb ttx-3p , 3 kb npr-9p , 4.5 kb ser-2prom2 , and 2.4 kb odr-2(18)p by pcr from c. elegans genomic dna . all the promoters were then fused with desired light - gated ion channels by pcr fusion . the animals ' chemotaxis to a bacterial lawn were assayed on an open - lid , 10 cm nematode growth medium ( ngm ) plate incubated in room temperature overnight with 10 l escherichia coli op50 at the center . n2 young adults were placed on the plate , 1.5 cm away from the center of the bacterial lawn . the animals ' behaviors were recorded under 6 magnification by an emccd camera at 20hz and analyzed by customized labview scripts . an n2 young adult was placed on an open - lid , food - free , 10 cm ngm plate for at least 1 minute . an electric valve ( supplementary fig . 1b ) was used to determine whether the air ( 100 sccm ) was bubbled through water or 10 m isoamyl alcohol based on the posture of the freely moving animal . the images were recorded under 6 magnification by an emccd camera at 20 hz and analyzed by customized labview scripts . l4 animals were transferred to a new ngm plate with a thin layer of e. coli op50 , containing 100 m atr ( all - trans retinal , the co - factor required for functional light - gated ion channels ) if required , 24 hours before experiments in room temperature . an animal then was placed on an open - lid , food - free , 6 cm ngm plate for at least 1 minute . dark - field 660 nm illumination was used to visualize the posture of the animal under 1 magnification by a video camera at 20 hz ( fig . low - power 540 nm ( 0.1 mw / mm ) epifluorescent illumination was used to visualize the neurons co - expressing light - gated ion channels and monomeric kusabira - orange ( mko ) at 15 by an emccd camera at 40 hz ( computer 1 ) . image thresholding and particle detection were used as the image processing algorithms to identify the mko - tagged neurons . as the animal swung its head , the neurons in the field rotated and changed their positions . to offset the rotation effect , positions of the neurons were measured using the principle axis and the distance from the center of mass of the processed image . the processed images were then used to track the animal and to position the dlp mirrors to deliver light ( 4 mw / mm , 480 or 540 nm ) on the neurons of interest with any desired temporal patterns to excite or inhibit the activity of the neurons . feedback between motorized stage , dlp mirrors and image processing software was operated at 40 frames / sec to achieve a 5 m spatial resolution of excitation on a freely moving animal . l4 animals were transferred to a new ngm plate with a thin layer of e. coli op50 , containing 100 m atr if required , 24 hours before experiments in room temperature . a 6 cm copper ring was placed in an open - lid , food - free , 10 cm ngm plate immediately before experiments to keep the animals in the field of view . young adults then were transferred to the assay plate for 1 minute before the experiment started . the desired wavelength of light ( 1 mw / mm , 480 nm or 540 nm ) was delivered in alternate 3-minute intervals for 1 hour using customized labview scripts . reversal frequency was calculated from pirouettes determined by an automated worm tracker ( http://wormsense.stanford.edu/tracker ) . an aiy::chr2 animal was placed on an open - lid , food - free , 10 cm ngm plate for at least 1 minute before starting the experiment . a virtual - gradient of light , i(r ) = exp ( r / r0 ) , from 0 to 1 mw / mm over 1.3 mm , where r0 = 0.8 mm , was defined in an x y coordinate system tied to the center of mass of the animal which was always at the center of the gradient profile ( 0.65 mm , 0.65 mm ) ( supplementary fig . the virtual light gradient moved with the center of mass of the animal but at a fixed orientation . at each time t , the coordinates of the nose tip were identified to calculate the corresponding intensity of light i(nx , ny ) ( fig . the animal was then illuminated with blue ( 480 nm ) light at intensity i(nx , ny ) , and thus , aiy instantaneously experienced the intensity of light at the nose tip . arch::egfp was cloned into fire lab vector kit plasmid ppd96.52 ( ligation number l2534 , addgene plasmid 1608 ) . chop-2(h134r)::tagrfp was obtained by swapping tagrfp with yfp in the previously cloned chop-2(h134r)::yfp . arch::tagrfp and tagrfp and gcamp-3 were codon - optimized for c. elegans ( de novo synthesized by genscript ) whereas others were optimized for mammalian cells . we amplified 2 kb str-2p , 1 kb ttx-3p , 3 kb npr-9p , 4.5 kb ser-2prom2 , and 2.4 kb odr-2(18)p by pcr from c. elegans genomic dna . all the promoters were then fused with desired light - gated ion channels by pcr fusion .

animals locate and track chemoattractive gradients in the environment to find food . with its small nervous system , caenorhabditis elegans is a good model system1,2 in which to understand how the dynamics of neural activity control this search behavior . extensive work on the nematode has identified the neurons that are necessary for the different locomotory behaviors underlying chemotaxis through laser ablation37 , activity recording in immobilized animals and the study of mutants4,5 . however , we do not know the neural activity patterns in c. elegans that are sufficient to control its complex chemotactic behavior . to understand how the activity in its interneurons coordinate different motor programs to lead the animal to food , we used optogenetics and new optical tools to directly manipulate neural activity in freely moving animals to evoke chemotactic behavior . by deducing the classes of activity patterns triggered during chemotaxis and exciting individual neurons with these patterns , we identified interneurons that control the essential locomotory programs for this behavior . surprisingly , we discovered that controlling the dynamics of activity in just one interneuron pair ( aiy ) was sufficient to force the animal to locate , turn towards and track virtual light gradients . two distinct activity patterns triggered in aiy as the animal moved through the gradient , controlled reversals and gradual turns to drive chemotactic behavior . since aiy are post - synaptic to most chemosensory and thermosensory neurons8 , these activity patterns in aiy are likely to play an important role in controlling and coordinating different taxis behaviors of the animal .

the evolution of galaxies and galaxy systems may be understoood in terms of a competition between two processes . one is the dominant gravitational drive of the dark matter ( dm ) that leads to hierarchical clustering ; this builds up `` haloes '' that grow larger and deeper by the merging of smaller clumps ( see peebles 1993 ) , and yet remain closely _ self - similar _ , i.e. , with central densities and profiles which are nearly scaled versions of each other ( see navarro et al . 1995 ) . the other process is the active _ response _ of the baryons contained in such potential wells ; this strives to drive the radiative structures _ away _ from self - similarity . groups and clusters of galaxies provide an ideal testing ground for such a picture . on the one hand , their deep gravitational wells are dominated by dm masses ranging from @xmath6 to @xmath7 . their sizes may be defined by the virial radius @xmath8 where the dm density @xmath9 at formation exceeds by a factor of about @xmath10 the background value @xmath11 ; they scale as @xmath12 , and match or exceed @xmath13 mpc for the rich clusters . the well depths may be measured in terms of the circular velocities @xmath14 , which attain or exceed 1400 km s@xmath15 in rich clusters today . on the other hand , such wells also contain large masses of diffuse baryons , of order @xmath16 ( white et al . 1993 ; white & fabian 1995 ; fukugita , hogan & peebles 1998 ) ; these are in the state of a hot plasma , the intra - cluster medium or icm . its temperatures may be estimated on assuming also the icm to be in virial equilibrium ; this provides the scaling @xmath17 , and values in the range @xmath18 kev in going from poor groups to rich clusters . by and large , these results are confirmed by the observations of many high - excitation lines at kev energies and of the x - ray continuum . in fact , the icm is well observable at x - ray energies through its thermal bremsstrahlung emission @xmath19 , which from groups to rich clusters ranges from @xmath20 to several @xmath21 erg s@xmath15 for typical densities @xmath22 @xmath23 . but the same hot electrons also inverse - compton upscatter the photons of the cmb , and thus they tilt slightly the black - body spectrum toward higher energies ; at microwave wavelengths the result toward individual clusters is an apparent intensity decrement @xmath24 in terms of the compton parameter @xmath25 . numerical values @xmath26 had been predicted by sunyaev & zeldovich ( 1972 ) ( hence the acronym sz effect ) , and are being measured in a growing number of rich clusters ; for reviews and recent data , see rephaeli ( 1995 ) , birkinshaw ( 1999 ) , carlstrom et al . ( 2000 ) , saunders & jones ( 2000 ) . the computation of @xmath0 and of related observables from a comprehensive model for the thermal state of the icm constitutes the main scope of the present paper ; its plan is as follows . in 2 we discuss how the sz probe fits into the current debate concerning the role of non - gravitational processes in setting the thermal state of the icm . in 3 we describe how we compute such state , and how our model fits into the current efforts toward including star formation and other baryonic processes in the hierarchical clustering picture ; at the end of the section we show how the sz observables are computed on the basis of our specific model . in 4 we present our results and predictions concerning the @xmath1 relation and the integrated sz observables , namely , the source counts and the average compton parameter @xmath27 . in 5 we discuss the building blocks of our model , and make contact with other related works ; we also stress the generic aspects of the link between the @xmath1 and the @xmath5 relations . in the final 6 we summarize our predictions and conclusions . before we embark into technical issues , we discuss the framework of observations and theories in which the present work is to fit . the simplest picture of the icm would have its thermal energy to be of purely gravitational origin ; that is to say , originated only by gravitational energy released on large scales comparable with @xmath8 as the external gas falls into the self - similar potential wells provided by the dm ( kaiser 1986 ) , and thermalized by some effective coupling . by itself , the process would establish temperatures @xmath28 and produce self - similar icm distributions in the wells , with central densities @xmath29 just proportional to the dm density @xmath9 , hence to the external @xmath30 . if so , the dm scaling recast into the form @xmath31 easily yields that the resulting x - ray luminosity should scale as @xmath32 however , this simple picture is challenged especially at the scales from poor clusters to groups of galaxies by several recent x - ray observations . first , the observed shape of the @xmath5 correlation departs from @xmath33 and bends down progressively in moving from very rich clusters down to poor groups ( see ponman et al . 1996 ; helsdon & ponman 2000 ) , as if lower @xmath34 should imply considerably lower values of @xmath29 and thus much lower luminosities @xmath35 . second , the profiles of the x - ray surface brightness do not appear to be self - similar , rather they flatten out at low @xmath34 ( ponman , cannon & navarro 1999 ) . third , the x - ray luminosity function @xmath36 shows little or no evidence of cosmological evolution ( rosati et al . 1998 ) ; if anything , weak negative evolution may affect the bright end of the lfs , but surely the data rule out the strong , positive `` density evolution '' that would prevail if the relation @xmath37 held and kept @xmath38 roughly constant . all that points toward an icm history more complex than pure , gravitational heating from infall into the forming dm potential wells , as already realized by kaiser ( 1991 ) . it rather suggests additional heating by injection of some non - gravitational energy , which ought to be more important for the shallower wells of the groups to the point of breaking there the simple assumption @xmath37 . to single out the baryonic processes responsible for this , it is clearly useful ( see cavaliere 1980 , and bower 1997 ) to consider the icm specific entropy ( in boltzmann units ) @xmath39 , the one combination of @xmath34 and @xmath29 that is invariant under pure adiabatic compressions of the gas falling into the wells . data and n - body simulations ( lloyd - davies , ponman & cannon 1999 ) concur to show that in moving from clusters to groups this quantity is far from behaving in the way suggested by the self - similar scaling @xmath40 in fact , when the values averaged out to @xmath41 are plotted as a function of @xmath34 , they level off to a `` floor '' corresponding to @xmath42 kev @xmath43 . on the other hand , in clusters @xmath44 as a function of @xmath45 increases outwards ( see lloyd - davies , ponman & cannon 1999 ) . these behaviours indicate that the entropy is enhanced in two ways relative to the self - similar scaling , both in the present groups and during the history of the clusters . one promising explanation of all these observational features goes back to heating / ejection of the icm by thermal / mechanical feedback effects from star formation during the process of galaxy build up and clustering into groups ( cavaliere , menci & tozzi 1997 , 1999 ; wu , fabian & nulsen 1998 ; valageas & silk 2000 ; fujita & takahara 2000 ) . we shall adopt as a baseline the injections of momentum and of thermal energy contributed both by stellar winds ( bressan , chiosi & fagotto 1994 ) and by type ii supernovae ( sn ) that follow the formation of massive stars in shallow wells . the latter include not only the current groups , but also the progenitors of current clusters ; in fact , the hierarchical clustering paradigm envisages such events to take place also during the early phase of a cluster s history when the progenitors were just groups , which subsequently grew by the progressive inclusion of additional mass lumps of comparable or smaller sizes . such combined feadback effects naturally imply the icm to be not only pre - heated to about @xmath46 kev , but also to be dynamically ejected outwards to the perifery of the dm haloes , at low densities @xmath47 @xmath23 . this is how a relatively high entropy level corresponding to @xmath48 kev @xmath43 may be attained in groups as well as in the central regions of the forming clusters . in the latter , the subsequent evolution will include adiabatic compression of the gas accreted along with the dm into the deepening wells ( tozzi & norman 2000 ) , a process that conserves entropy . but the gas falling supersonically into such deep potential wells will also pass through strong accretion shocks at about the virial radius @xmath8 , the process whereby the icm is actually heated to the current high temperatures of order @xmath49 . by the same token , much additional entropy is deposited in the outer regions , corresponding to shock conversion of the bulk inflows @xmath50 into thermal energy . this scenario leads one to expect in the groups not only lower densities , and much lower bremsstrahlung emission compared with the scaling @xmath51 , as observed ; but it also leads to expect little cosmological evolution for the population of bremsstrahlung emitters constituted by groups and clusters . this is because in the x - ray luminosity function @xmath36 the `` density evolution '' driven at medium - low @xmath35 by the hierarchical clustering is balanced by the lower luminosities corresponding to a steeper @xmath5 correlation . in fact , we have investigated and computed elsewhere in detail ( menci & cavaliere 2000 , hereafter mc2000 ; cavaliere , giacconi & menci 2000 , hereafter cgm2000 ) how the stellar feedbacks ( heating combined with ejection ) affect the icm and its x - ray emission @xmath52 , which is particularly sensitive to changes of the central icm density . in the present paper we stress the _ complementary _ probe provided by the sz effect . the cmb modulation @xmath53 introduced in 1 provides another observable combination of @xmath34 and @xmath29 which depends on the thermal and on the mechanical feedback in a more balanced way . in parallel with the scaling for @xmath35 provided by eq . ( 1 ) , the self - similar scaling for @xmath0 reads @xmath54 we shall investigate how the actual @xmath0 also _ departs _ away from @xmath55 due to @xmath56 and @xmath57 holding at groups scales , and shall discuss how the relative relative strength @xmath58 of the sz signal is related to entropy . our investigation will start with computations based upon specific semi - analytic modelling for the baryons in groups and clusters , in particular for those diffuse and hot constituting the icm . in the scenario outlined in 2.3 the processes responsible for the non - gravitational entropy floor in groups in clusters are just the same as those governing the formation history of stars and galaxies . at galactic scales , they tend to suppress the star formation in the earlier and shallower potential wells . the observable consequences include flattening of the local , optical lf function at faint - intermediate luminosities , and a decline of the integrated star formation rate for @xmath59 ; but the degree of such a decline sensitively depends on the feedback strength in the relevant wells . the picture has been quantitatively implemented in the so - called semi - analytic models for star and galaxy formation ( sams , see kauffmann et al . 1993 ; cole et al . 1994 ; somerville & primack 1999 ) . these are built upon the notion of galaxies as baryonic cores located inside dm haloes ( white & rees 1978 ) ; they specify though often in a phenomenological form how the baryons are cycled among the condensed stellar phase , the cool gas phase and the hot gas phase , under the drive of the merging events that make up the hierarchical evolution of the dm haloes . since the very same dm and baryonic processes also play a key role in determining the state of the icm on scales larger than galactic , we take up the sam approach in its latest versions , and use it to evaluate the amount of non - gravitational heating of the icm and to predict the corresponding sz effect . our model is necessarly complex as it comprises several processes and many computational steps , so we outline its frame and workings in the form of a flow chart in fig . 1 . we base on an updated version of the sam originally presented in poli et al . ( 1998 ) . in this approach the average over the many possible merging histories of a given structure is performed by convolution over the merging probability functions given by lacey & cole ( 1993 ) and tested , e.g. , by cohn , bagla & white ( 2000 ) ; the average also includes the convolution with the probabilities for galaxy aggregations driven by dynamical friction inside common haloes . toward computing the stellar observables , the model treats the following processes . \1 ) the dm haloes merge following the hierarchical clustering . the detailed merging histories are important for the problem at hands , since the gas carrying the non - gravitational entropy is pre - heated / expelled from condensations smaller than present - day systems , and is subsequently accreted by larger haloes . the time delays between heating / expulsion and accretion propagate up the structure hierarchy the aftermaths of the feedback . \2 ) part of the hot gas mass @xmath60 diffused throughout the haloes cools down in all differently - sized potential wells , then condenses into stars on the timescale @xmath61 , see table 1 . the amount of cool gas is also controlled by the stellar feedback . this is because the condensation in stars of a mass @xmath62 eventually causes stellar winds and sn explosions to release a total non - gravitational energy @xmath63 ergs , where @xmath64 erg is the energy of a type ii sn explosion , @xmath65 is the efficiency in sne for the scalo imf . part of such energy is coupled to the gas and reheats an amount of cool gas @xmath66 ; in the sams this is often related to @xmath62 by the phenomenological assumption @xmath67 , with typical values for the fraction of reheated gas given by @xmath68 . the importance of the thermal effects of the feedback is expressed in terms of the above parametrization by the `` stellar '' temperature @xmath69 where @xmath70 is the fractional energy going directly into bulk motion of the material ; @xmath71 is to be compared with the virial temperature @xmath72 . in the way of a preliminary estimate , note that @xmath73 kev holds for a stellar baryonic fraction exceeding @xmath74 , the low value actually appropriate only for rich clusters . but @xmath75 kev is also the virial temperature corresponding to @xmath76 ; so in galaxies and in poor groups the stellar heating is expected to cause the gas to flow out of the wells . in the numerical model the process is evaluated in detail for all haloes . in fact , the scale dependence of the feedback is marked by the key parameter @xmath77 . to identify its relevant range consider the ratio between the work done in moving the gas out of the well and the actual bulk kinetic energy , given by @xmath78 . the proportionality constant turns out to be around @xmath79 for our fiducial values @xmath80 erg , @xmath81 ( with the contribution from stellar winds included after bressan et al . 1994 ) and for @xmath82 ; so the reheated gas does escape from the relevant haloes with circular velocities @xmath83 when one takes @xmath84 , but it constitutes a fraction @xmath85 that decreases with increasing @xmath86 . in the model development presented by mc2000 and cgm2000 we allowed this parameter to range from the extreme value @xmath87 adopted by other workers to our fiducial value @xmath88 . the former value ( hereafter case @xmath89 ) yields @xmath90 , which in the shallow early wells constitutes quite a _ strong _ feedback , well over and above the escape energy barrier ; this leads to considerable depletion of the cool baryons and causes the star formation rate to decline sharply for @xmath91 . the latter value ( hereafter referred to as case @xmath92 ) instead yields a _ moderate _ and `` neutral '' feedback corresponding to @xmath93 const ; thus even the shallow , galactic haloes are allowed to retain considerable amounts of gas , and the resulting star formation rate is high and rather flat for @xmath94 . the values of this and of other relevant parameters are collected in table 1 . these lead to the b - band luminosity functions of the galaxies and to the cosmic star formation rate presented in mc2000 , when the critical universe dominated by standard cold dark matter is adopted . in the canonical @xmath95-dominated flat universe the same set of parameters leads to the results presented by poli et al . ( 1999 ) together with the related galaxy sizes and tully - fisher relation , and discussed by cgm2000 . the sam used in the present paper includes also the processes relevant to the icm that have been developed and implemented in mc2000 and cgm2000 . in those papers the baryonic component condensed into stars has been used to normalize the model parameters to the optical observations , and the cool gas component has been presented for a final check with relevant data ; but our main focus was onto the _ hot _ gas identified with the icm , and onto its x - ray emission @xmath35 . the hot icm gives also rise to the sz effect of interest here , so the enumeration begun in 3.1 is continued next , to cover also the following processes relevant to the present scope . \3 ) the accretion of external gas into the potential wells of groups and clusters sets the boundary condition for the internal gas disposition . to this aim , we compute the density and temperature of groups and clusters at their virial radius @xmath8 . this is done in terms of the external temperature @xmath96 of the gas to be accreted during the merging histories of groups and clusters ; @xmath96 is set not only by the virial equilibrium inside the merging lumps but also by the feedback , and the more strongly so the closer to @xmath97 are the virial values . our computation comprises the following steps . first , we assume that the dm density @xmath98 inside the cluster has the form given by navarro , frenk & white ( 1997 ) , and that the density @xmath99 external to the virial radius @xmath8 is related to the baryon density @xmath100 by @xmath101 . next , for a group or cluster of mass @xmath102 we compute the temperature @xmath96 of the external infalling gas . in particular , for each lump of mass @xmath103 accreted onto @xmath102 we consider two contributions : the fraction @xmath104 remains inside the potential well of @xmath103 at the virial temperature @xmath105 , while the fraction @xmath106 is ejected by the winds and the sne gone off within @xmath103 , and is heated to the temperature @xmath97 given by eq . last , we assume that the external gas is incorporated into the mass @xmath102 passing through a shock front at a position close to the virial radius @xmath8 . this is expected because the latter separates the region which is in hydrostatic equilibrium from the outer regions where the motion is dominated by infall ( see also bower et al . 2000 ) , and so defines the transition from infall kinetic to thermal energy of the gas . shock positions close to @xmath8 are confirmed by many 1-d and 3-d n - body simulations ( e.g. , knight & ponman 1997 ; takizawa & mineshige 1998 ; pantano , gheller & moscardini 1998 ; governato et al . 2001 , in preparation ) . then we compute the density @xmath107 and the temperature @xmath108 of the icm at the boundary @xmath8 of a group or cluster from the jump conditions at the shock ; these are derived from mass and momentum conservation across the shock ( the classic rankine - hugoniot conditions ) , and are expressed here in terms of the cluster potential @xmath109 at the boundary , and of the temperature of the incoming gas . the thermal energy @xmath110 associated with an accreted lump @xmath103 is contributed by the virialized component at @xmath111 and by the ejected component at @xmath112 , with their weigths @xmath113 and @xmath114 introduced above . thus , the weighted density jump @xmath115 at the shock in the icm of the considered group / cluster of mass @xmath102 is given by @xmath116 the density jump for either component has the form ( cavaliere , menci & tozzi 1999 ) @xmath117^{1/2}$ ] in terms of variable @xmath118 or @xmath119 , respectively . the full expression for @xmath108 is given by the same authors ( see their eq . 8) , but for strong shocks it reads simply @xmath120 in the approximation of small bulk kinetic energies downstream . note that for given @xmath103 the weighted jump @xmath121 increases with @xmath102 , but saturates to the value 4 when @xmath122 , that is , for strong shocks . for a cluster or group of mass @xmath102 we obtain the _ average _ values of the weighted density jump and of the boundary temperature @xmath108 by integrating over the merging histories ; that is , we sum over all accreted lumps @xmath103 with their relative merging probabilities by inserting the above expressions eqs . ( 4 ) ( 6 ) in the semi - analytic context . this will introduce dispersion in the boundary conditions due to the intrinsic spread of the merging histories ; we recall ( cavaliere , menci & tozzi 1997 , 1999 ) that the scatter we predicted for the @xmath123 correlation agrees with the findings by markevitch ( 1998 ) and by allen & fabian ( 1998 ) . we have numerically checked that for weaker and weaker feedback the average of @xmath124 over the merging histories goes to a constant , so that the self - similar scaling @xmath125 is recovered as expected . \4 ) the final process relevant to the icm is the hydrostatic equilibrium , from which we compute the internal gas density profile , given the above boundary conditions . the gas density run @xmath126 is related to the dm density profile @xmath98 in terms of the parameter @xmath127 , the ratio of the dm to the gas specific energy ( @xmath128 is the 1-d velocity dispersion of the dm at the boundary , related to @xmath109 ) . while in the case of isothermal icm and of constant @xmath129 the run is simply given by @xmath130 ( cavaliere & fusco femiano 1976 , jones & forman 1984 ) , here we use the expressions given by cavaliere , menci & tozzi ( 1999 ) for the potential of navarro et al . ( 1997 ) and for a polytropic , but nearly isothermal icm . is observed to be close to constant , we distinguish @xmath131 and @xmath34 ( the latter may be taken to be the emission - weighted temperature ) only when relevant . ] thus , for a mass @xmath102 at the redshift @xmath132 we compute the inner icm profiles @xmath133 and @xmath134 in terms of the normalized radius @xmath135 . this is achieved basically with no free parameters ( see 5 for a discussion ) since the profiles are defined in terms of the boundary conditions and of the depth of the dm potential wells . in particular , for rich clusters @xmath136 holds and the shocks are strong , so the expression of @xmath137 obtains simply on using the expression ( 6 ) for @xmath108 to obtain @xmath138 . on the other hand , for decreasing @xmath102 the value of @xmath137 decreases to attain values @xmath139 for small groups , which yield gas density profiles significantly shallower than in clusters in agreement with ponman , cannon & navarro ( 1999 ) . 1 provides a representation and a summary of the processes and of the computational steps we use to set the boundary conditions and the internal structure of the icm . our assumptions and fiducial choices are discussed in 5 . we refer to our previous papers mc2000 and cgm2000 for added details and for the results concerning the x - ray observables . in short , these include : @xmath137 decreases and the relation @xmath5 bends down in moving toward systems of lower @xmath34 , while @xmath140 shows little or no cosmological evolution , all in good agreement with the observations . in addition , the counts of x - ray sources from the icm are predicted to be enhanced corresponding to high values of the star formation rate at @xmath141 . here we epitomize the effectiveness of our model by showing in fig . 2 the central icm entropy as a function of the x - ray temperature @xmath34 . such entropy is given by the ratio @xmath142 and is computed on using the profiles discussed above . ultimately , these are determined by the global gravitational and by the feedback - induced energies associated with the gas in the infalling clumps . the result is compared with the data presented by ponman , cannon & navarro ( 1999 ) and by lloyd - davies , ponman & cannon ( 2000 ) . we recall that entropy is of special value as a state variable for the icm ; in fact , in conditions of long cooling times it keeps the archive - as it were - of the thermal events ( different from adiabatic compressions ) which are associated with the icm gravitational heating / compression and with the non - gravitational heating / ejection . here we focus on how we use the above model to compute the sz effect from the icm in groups and clusters . the basic relations will be just recalled , having been covered in many excellent reviews beginning with sunyaev & zeldovich ( 1980 ) and including rephaeli ( 1995 ) and birkinshaw ( 1999 ) . the compton parameter induced by the icm column displaced from the center by the distance @xmath143 on the plane of the sky may be written as @xmath144 where @xmath145 is the thompson cross - section , and @xmath146 is the path element through the structure along the line of sight . our sam provides @xmath108 , @xmath107 at the boundary and the profiles @xmath134 , @xmath133 all depending on the structure mass @xmath102 , as described in 3.2 . we extend the integrations to infinity , but take into account the temperature and density jumps at @xmath147 across the shock . the sz distortion of the cmb spectrum at a frequency @xmath148 is given by @xmath149 the function @xmath150 depending on @xmath151 is given by sunyaev & zeldovich ( 1980 ) in terms of the temperature @xmath152 of the cmb black - body spectrum ; @xmath153 holds in the rayleigh - jeans limit @xmath154 , appropriate for @xmath4wave observations . on the other hand , @xmath155 becomes positive beyond @xmath156 ghz ; so the sz effect offers a second chance to measure or check @xmath0 in the sub - mm band , which is clean of radiosources and is now coming of age with the recent or planned sub - mm instrumentation . a related observable is provided by the cosmic average of the compton parameter , that is , the integrated distortion of the cmb spectrum produced by all groups and clusters distributed in a given beam along the line of sight out to the redshift @xmath132 . this is given by @xmath166 where @xmath167 is the cosmological volume , and we take the mass function @xmath168 to have the press & schechter form that lies at the base of the all sam descriptions of dm merging process . finally , the source counts corresponding to fluxes larger than @xmath169 ( korolv , sunyaev & yakubtsev 1986 ) are given by @xmath170 where @xmath171 is the mass of a cluster ( or group ) that at the redshift @xmath132 produces the flux @xmath169 , computed after eqs . ( 8) and ( 9 ) . we plot in figs . 3 and 4 the relation @xmath1 that relates the compton parameter @xmath0 for individual groups or clusters to their icm temperature . the values provided by the self - similar scaling are shown by dotted lines , while dashed and solid lines represent what we predict for moderate ( case @xmath92 ) and strong ( case @xmath89 ) feedback , respectively . 3 refers to the critical universe with @xmath172 and with dm perturbation amplitude @xmath173 ( scdm cosmology / cosmogony hereafter ) . 4 refers to a flat universe with @xmath174 and @xmath175 ( in the following , @xmath95cdm cosmology / cosmogony ) . in both figures the bottom panel shows the @xmath1 relation with @xmath0 normalized to the self - similar scaling @xmath176 . the latter would yield a horizontal line in this plot , so that departures from this behaviour mark the effects of non - gravitational processes ; it is seen that the stronger is the feedback at group scales , the larger is the departure . as to observability , note from figs . 3 , 4 and from eqs . ( 9 ) , ( 10 ) that the difference @xmath177 expected at the scale of galaxy groups ( @xmath178 kev ) is of order @xmath179 or smaller , corresponding to @xmath180k . observing such values constitutes a challenging proposition , but one becoming feasible for groups and poor clusters with size @xmath181 mpc at @xmath182 ( and containing only weak radiosources ) , in the following instrumental conditions : last generation radiotelescopes ( see komatsu et al . 2000 ) , with low internal noise and beams of a few arcminutes , using long integrations ( the subtraction of atmospheric noise is favoured by the narrow throws required for these objects ) ; in the near future , arrays like amiba ( see lo , chiueh , & martin 2000 ) ; in perspective , many superposed orbits of the planned _ planck _ surveyor mission within its apertures of @xmath183 ( see de zotti et al . 2000 ) , and alma with its @xmath4 k sensitivity over angular scales from a few to tens of arcseconds ( see www.alma.nrao.edu ) . the detection of @xmath0 in groups may be disturbed by surrounding large scale structures aligned along the line of sight . however , the probability for this to occur is low , since such structures compared with virialized condensations have lower temperatures and densities lower by factors @xmath184 at least ; only when their extension along the line of sight exceeds the size of a galaxy group by factors larger than @xmath185 a comparable sz signal will be produced . we add that the scatter we find in the @xmath1 relation is smaller than @xmath186 for all temperatures ; so even in our moderate feedback case @xmath92 the predicted _ trend _ of @xmath1 departs neatly from @xmath55 below a few kevs , and even upper bounds to @xmath0 may be of value . in fig . 5 we plot ( for both the scdm and the @xmath95cdm cosmology / cosmogony ) the predicted sz source counts , and in fig . 6 we show also the contribution to the cosmic compton parameter from all virialized structures distributed along the line of sight . note that the difference bewteen the two feedback cases @xmath89 and @xmath92 ( solid lines and dashed lines , respectively ) is small for such integrated observables ( the curves corresponding to the self - similar case would closely overlap those relative to the moderate feedback case @xmath92 ) . this is because small and/or distant structures not filling a telescope beam contribute to these two observables with weights given by the system radius squared ( see eq . 10 - 11 ) ; this circumstance underplays the contribution of the groups , the structures most sensitive to feedback effects . on the other hand ( see cavaliere , menci & setti 1991 ; bartlett & silk 1994 ) , this very feature makes @xmath187 suitable as a cosmogonical probe , since the contributions of the cosmogonical parameters like the amplitude @xmath188 of the spectrum of the initial dm perturbations override those from the state and evolution of the icm . similar results concerning @xmath2 from the virialized structures have been found by valageas & silk ( 1999 ) ( see also valageas & schaeffer 2000 ) . these authors add the contributions produced by the gas inside lower density structures and by truly intergalactic gas , which they find to depend sensitively on the heating model ; this is not unexpected from non - virialized gas that fills bigger volumes and can absorb larger energies . here we focus the basic features shared by a number of current models of the icm ( mc2000 , cgm2000 ; wu , fabian & nulsen 1998 ; valageas & silk 1999 ; bower et al . 2000 ) , in order to discuss to what extent our predictions concerning the sz effect are robust . we first stress the basic blocks shared by such models . next we discuss our specific treatement of the boundary conditions in terms of shock jumps . then we discuss why the shocks are effective in amplifying the impact of non - gravitational energy injections . finally , we show how the departure of the @xmath1 relation from its gravitational counterpart is related to the corresponding departure of the @xmath5 relation ; the model - independent link is constituted by the entropy discharged by the injection of non - gravitational energy , but the actual size of such departures depends on the feedback strength . \a ) part of the baryons are subtracted out of the hot phase by cooling and are locked in the stars formed , to be only in part recycled by stellar winds . this actually constitutes a minor negative contribution to the mass of the hot phase . \b ) the energy fed back by the condensing baryons , either to fuel black holes at the galactic centers or to form massive stars followed by winds and sne , heats up a fraction of the intergalactic medium . in our model the energy injection is @xmath189 erg per solar mass of stars formed , the fraction is @xmath190 and the stellar heating temperatures are @xmath191 kev ; the net outcome is to produce in groups a central density @xmath47 @xmath23 , lower than in clusters . since such gas is recovered by larger haloes during later merging events ( with the delays described in 3.1 ) , the effects propagate a number of steps up the mass hierarchy , so that the @xmath5 relation departs away from @xmath192 at temperature considerably higher than @xmath79 kev . a corresponding feature is also present , e.g. , in the elaborate model used by bower et al . ( 2000 ) ; in their model , as well as in ours , the gas fraction inside the virial radius is lower in groups than in clusters . \c ) equilibrium is re - established soon after minor and intermediate merging events , that is , over sound crossing times which are somewhat shorter than the structures dynamical times . in such conditions , the pressure gradient balances gravity and a @xmath137-model holds . \d ) once equilibrium is assumed , a key role is played by the boundary conditions that set normalization and shape ( specifically , the values of @xmath137 ) of the icm density profiles . in particular , the pressure balance at the boundary @xmath193 clearly constitutes the key condition ; we add that such a balance is to include the ram pressure due to the bulk motion @xmath194 of the infalling gas out of equilibrium , to read @xmath195 in conditions with low bulk kinetic energy downstream . \e ) since the icm state is observed to be close to isothermal ( @xmath34 may decrease out to @xmath8 hardly by a factor 2 , see nevalainen , markevitch , & forman 2000 ) a sharp boundary that is , some sharp drop or discontinuity of @xmath34 and/or @xmath29 is to take place at @xmath193 , lest the thermal exceeds the integrated gravitational energy . model - dependent features , which however affect to a lesser extent the profiles of the icm in virialized structure , include : the exact value of the polytropic index ( close to 1 anyway ) and the detailed form of the underlying dm potential ( see the discussion by cavaliere , menci & tozzi 1999 ) ; the parameters other than the feedback exponent @xmath77 that are introduced in the various sams only to tune the optical luminosity function and the tully - fisher relation for the galaxies ( cf . cole et al . 1994 with cole et al . 2000 ) . it is also widely agreed that shocks provide an effective coupling of the gravitational to the thermal energy in the icm . in our picture , we take up from the results of the simulations referred to in 3.2 the notion that _ external _ accretion shocks do establish a discontinuity at about @xmath193 , with low bulk velocities left downstream ; observational evidence of large scale shocks related to violent merging events is reported by roettiger , stone & mushotzky ( 1998 ) ; roettiger , burns & stone ( 1999 ) ; markevitch , sarazin & vikhlinin ( 1999 ) . across such shocks the above stress conservation combined with with mass conservation yields the classic rankine - hugoniot jump conditions for @xmath34 and @xmath29 . without further ado these produce a non - linear increase of @xmath196 from @xmath197 to @xmath198 as the infall flows become increasingly supersonic , that is , as @xmath199 increases . note that the merging events that yield the largest contributions to @xmath200 are the numerous ones ( more than 90% ) with minor partners having mass ratios smaller than @xmath201 , which may be appropriately described as constituting an `` accretion '' inflow of the dm component as well as of the baryonic component ( see raig , gonzalez - casado & salvador - sole 1998 ) . such minor events contribute the majority of the mass increase ( more than 50% ) , and imply lower temperatures @xmath202 kev ( whether of gravitational or of stellar origin ) for the external gas they involve , leading to more supersonic gas inflows . the summed action of these events is as close to isotropic as permitted by the surrounding large scale structure ( see tormen 1997 ; colberg et al . 1999 ) ; re - establishing the equilibrium then is more like a continuous re - adjustement to the accretion inflow . on the other hand , given the external conditions the gas inflow is bound to be more supersonic on average when it takes place into the deeper wells provided by the richer clusters where @xmath203 km s@xmath15 is attained ; this leads to expect larger entropy depositions in the outer regions of rich clusters , as in fact observed ( lloyd - davies , ponman & cannon 1999 ) . in poor groups , instead , where the stellar heating temperatures match the virial ones to give @xmath204 kev , the shocks degenerate into sonic , adiabatic transitions ; here all internal densities scale down proportionally to @xmath205 , so @xmath206 is bound to plunge down toward @xmath207 . to see how the departures from the self - similar scalings begin and end , one can make use of two opposite approximations , rather crude but simple : when the pre - shock temperature @xmath96 is low , the strong shock approximation yields @xmath208 , see eq . ( 6 ) ; on the other hand , the lower bound to all temperatures is constituted by @xmath97 . for decreasing depths of the wells these approximations show that the decline of @xmath209 begins slowly , then becomes faster like @xmath210 in shallow wells ; this implies correspondingly flatter density profiles . similarly but more strongly , @xmath211 departs from @xmath212 slowly at first in deep wells , but eventually plunges toward @xmath213 in shallow wells . a final remark concerns the normalization of the compton parameter @xmath0 related to the shock condition . in our model , the boundary values for the density and the temperature are fixed by the shock jumps in terms of the external density @xmath99 and of the gravitational potential @xmath109 at @xmath214 ( see eq . 7 ) . now , @xmath215 holds , while @xmath109 depends both on the shape of the gravitational potential and on the location of the boundary at @xmath216 . for our fiducial choice of @xmath217 and of the navarro et al . ( 1995 ) potential , our shock or boundary location ( supported by the n - body simulations referred to in 3.2 ) leads to a normalization of the @xmath0 parameter in agreement with the observed values ; for example , for a coma - like cluster with @xmath218 kev , we obtain @xmath219 , closely independent of the feedback , see fig . 4 ; this is in good agreement with the measured value , see herbig et al . the same normalization can be obtained on changing the value of @xmath100 in the range @xmath220 allowed by the canonical primordial nucleosynthesis , and on retaining the same dm potential but readjusting the shock position within the range @xmath221 compatible with the n - body simulations . it is intrinsic to the present model that the departures from the gravitational scaling are non - linearly _ amplified _ , due to the varying shock strengths set by the depth @xmath222 of the potential wells compared with @xmath223 . for a given departure , such an amplification _ lowers _ the requirements for the non - gravitational energy injection . indeed , the excess central entropy @xmath224 observed in groups over the self - similar expectations ( see fig . 2 ) can be obtained with a moderate energy injection @xmath225 leading to @xmath226 with @xmath227 kev , provided the central density at the group scale is decreased relative to clusters by a factor around @xmath228 . in our model such a decrement results in part from the boundary density jump ( lower than in clusters by a factor 4 ) , and in part from the shallow gas density profile due to the lower values of @xmath137 ( about half than in clusters ) . thus , the presence of shock amplification allows us to consider _ conservative _ quantities for the feedback , namely , energy contributed by stellar winds plus by sn explosions adding up to @xmath229 erg per @xmath230 of stars formed . note also that the two contributions are largely separated and undergo different amounts of cooling , lesser ( if anything ) for the winds . stellar winds and amplification go a couple of steps toward meeting the concerns about prompt radiative cooling of the sn outputs which may limit the fraction available for action at galactic or group scales . as is well known , the issue is a thorny and debated one . on the one hand stands the intrinsic sensitivity of the cooling to density clumpiness ( see , e.g. , thornton et al . 1998 ) . on the other hand , momentum and thermal energy are carried outward of the sites of star formation in the form of blast waves and shocks , in fact as sn remnants . it is widely agreed ( see ostriker & mckee 1988 ) that these may easily overlap before they enter a strong radiative phase , especially when they are driven by type ii sne produced by correlated massive star formation , and when they are helped by the tunnel network in the ism . so they merge their hot and thin interiors , break out of the galaxies in the form of superbubbles , and discharge their high entropy content into the galaxian outskirts ; this is then mixed throughout the icm . additional sources of non - gravitational heating may be provided by active galactic nuclei shining at the center of developing galaxies ( see wu , fabian & nulsen 1999 ; valageas & silk 1999 ; aghanim , balland & silk 2000 ) . the agns are fed at sub - pc scales by accreting black holes ; their outputs are huge , but the effective coupling within galaxies or groups of such energy to the icm within galaxies or groups is even more uncertain than for the sne . such coupling would require quite some tuning to yield just the observed @xmath5 correlation ( p. madau , private communication ) ; the intrinsic instability of the cooling may easily drown any correlation into a large intrinsic scatter . treating such processes in full is beyond the scope of the present paper and will be undertaken elsewhere . as can be noted from figs . 3 and 4 , the departure from self - similarity we find from our model in the @xmath1 relation for groups and clusters features an _ @xmath0-dependence on the strength of the feedback , which sets in below @xmath231 kev . this behaviour is similar to that of the @xmath5 relation for groups and clusters of galaxies . the correspondence is explained by the model - independent relation which follows from combining the definitions of @xmath232 and of the compton parameter @xmath0 with its self - similar scaling given by by eq . ( 3 ) , to read @xmath233 we recall from 5 that @xmath34 exceeds @xmath49 due to the non - gravitational heating , and the excess becomes more and more relevant in moving from rich clusters to poor groups . the above eq . shows than that an internal heating source rising the entropy content will result in lower values of @xmath0 compared to the self - similar expectations at the scale of groups . the counterpart of eq . ( 12 ) for the x - ray emission reads @xmath234 again model - independently . assuming the two observables are associated ( albeit with different shape factors ) with icm confined within comparable sizes , the two equations combine to yield @xmath235 the above equations highlight in a _ model - independent _ way the inverse nature of both the @xmath236 and the @xmath237 relations . so the entropy excess observed in groups of galaxies implies a related deficit of _ both _ the x - ray luminosity as indeed is found in the observed @xmath5 correlation , and of the sz effect as here predicted . in both cases the dependence on the temperature is instead direct , and actually stronger in the @xmath236 relation . the point to emphasize is that these two probes are _ independent _ observationally ; in fact , they are measured in such distant bands as x - rays and microwaves , with very different instrumentations subject to different systematics . in addition , the sz effect can be measured also at sub - mm wavelengths , which provide a positive @xmath238 with systematics different yet . finally , the selections are intrisically different in the @xmath4w / sub - mm and in the x - ray bands , with the sz signal being much _ less _ sensitive than the x - ray emission to internal density clumpiness or enhancements . thus , while either observable may be subject to its own observational biases , background subtraction or scatter ( see mahdavi et al . 1997 ; roussel , sadat & blanchard 2000 ) , the _ combined _ evidence will be highly significant and strongly constraining for the non - gravitational heating mechanisms . in this paper we have computed and presented three observables related to the sz effect from the icm in groups and clusters of galaxies , namely , the @xmath1 correlation , the source counts and the contribution to the cosmic sz effect . we based our computations on the specific semi - analytic model ( sam ) described in 3 ; this is built upon the hierachical merging histories of the dm component of such structures , and provides stellar and x - ray observables in agreement with the data . the picture underlying our sam is widely shared , and its main blocks are common ( as discussed in 5 ) to other sams also aimed at explaining the optical and x - ray observations . one key feature is the energy and momentum fed back into the icm by the condensing baryons . this has the effect of pre - heating the baryons that fall into groups and clusters during their merging history . the shock front forming between the infalling and the internal gas amplifies the effect of the non - gravitational heating on the density distribution of the gas in a way which depends on the cluster or group temperature @xmath34 . the net effect is to break the ( approximate ) scale - invariance of the dm quantities in _ virialized _ structures , particulary in galaxy groups with @xmath239 kev compared to rich clusters . the effect of such processes on the x - ray properties of groups and clusters has been investigated in our previous papers ; here we have shown that the sz effect constitutes a _ complementary _ probe of the non - gravitational heating of icm . in particular we emphasize the following results . @xmath240 the measure of the compton parameter @xmath0 from deep , targeted observations of groups and clusters and the resulting @xmath1 correlation provide a direct probe of the energy discharged into the icm and archived there in conditions of long cooling times . specifically , for energy injections dumped into the icm within galaxies or groups we predict the @xmath1 correlation to bend down systematically relative to the self - similar expectations ( see 4 , figs . 3 - 4 ) . in 5 we discuss the generic aspects of the _ trend _ : larger injection - smaller @xmath0 at group scales , that we expect from any reasonably complete model . the level of such departures will be similar to ours for feedback models able to reproduce the bent shape of the @xmath5 relation in x - rays . this conclusion is substantiated by eqs . ( 12)-(14 ) which show _ model - independently _ that heating sources rising the internal entropy in groups to the observed `` floor '' will result in observably low values of @xmath0 compared to the self - similar expectations . @xmath240 the integrated sz effects from structures ( i.e. , the counts @xmath241 of sz sources associated with virialized structures and their contribution @xmath2 to cosmic sz effect ( see figs . 5 - 6 ) are dominated by clusters less affected by the feedback , even less by its details . to conclude , the emerging picture is one where the close scale - invariance of the _ gravitational _ energy released over large scales under the drive of the dm dynamics is broken by the _ nuclear _ energy that at small scales drives the stellar life and death ; the break - even point should occur at the transitional mass scale @xmath242 where @xmath243 kev holds . the specific way in which baryons break the dm scale - invariance can be probed with several _ complementary _ but observationally _ independent _ observables which include : the bent x - ray luminosity - temperature correlation ; the weak or absent evolution of the x - ray luminosity functions ; excess counts of the icm x - ray sources correlated with high rates of cosmic star formation at @xmath244 ; the shape and evolution of the optical luminosity function of the galaxies ; finally , the sz effect as proposed here , and in particular the bent @xmath1 relation from clusters to groups . * acknowledgements*. this work benefited at all stages from helpful exchanges with g. de zotti . we are grateful to f. melchiorri for discussions of his observational strategies with mito , to a. lapi for critical reading , and to our referee for constructive and helpful comments . partial grants from asi and murst are acknowledged . aghanim , n. , balland , c. , silk , j. 2000 , a&a , 357 , 1 allen , s.m , & fabian , a.c . 1998 , mnras , 297 , l56 bartlett , j.g . , & silk , j. 1994 , apj , 423 , 12 baugh , c.m . , cole , s. , frenk , c.s . lacey 1998 , apj , 498 , 504 birkinshaw , m. 1999 , in _ 3k cosmology _ , l. maiani , f. melchiorri & n. vittorio eds . ( woodbury : american institute of physics ) 476 , p. 298 bower , r.g . 1997 , mnras , 288 , 355 bower , r.g . , benson , a.j . , baugh , c.m . , cole , s. , frenk , c.s . , & lacey c.g . 2000 , preprint [ astro - ph/0006109 ] bressan , a , chiosi , c , & fagotto , f. 1994 , apj ss , 94 , 63 carlstrom , j.e . 2000 , phys . scripta , t 85 , 148 - 155 cavaliere , a. , menci , n. , & setti , g. 1991 , a&a , 245 , 21 cavaliere , a. , menci , n. , & tozzi , p. 1997 , apj , 484 , l21 1999 , mnras , 308 , 599 cavaliere , a. , giacconi , r. , & menci , n. 2000 , apj , 528 , l77 ( cgm2000 ) cohn , j.d . , bagla , j.s . , & white , m. 2000 , preprint [ astro - ph/0009381 ] colberg , j.m . , white , s.d.m . , jenkins , a. , & pearce , f.r . , 1999 , mnras , 308 , 593 cole , s. , aragon - salamanca , a. , frenk , c.s . , navarro , j.f . , & zepf , s.e . 1994 , mnras , 271 , 781 cole , s. , lacey , c. , baugh , c. , frenk , c.s . , & 2000 , mnras , in press [ astro - ph/0007281 ] de zotti , g. et al . 2000 , in 3k cosmology _ , l. maiani , f. melchiorri & n. vittorio eds . ( woodbury : american institute of physics ) 476 , p. 204 fujita , y. , & takahara , f. 2000 , apj , 536 , 523 fukugita , m. , hogan , c.j . , & peebles , p.j.e . 1997 , preprint [ astro - ph/9712020 ] gheller , m. , pantano , o. & moscardini , l. 1998 , mnras , 296 , 85 helsdon , s.f . , & ponman , t.j 2000 , mnras , in press [ astro - ph/0002051 ] jones , c. , & forman , w. 1984 , apj , 276 , 38 kaiser , n. 1986 , , 222 , 323 kaiser , n. 1991 , apj , 383 , 104 kauffmann , g. , white , s.d.m . , & guiderdoni , b. 1993 , mnras , 264 , 201 knight , p.a . , ponman , t.j 1997 , mnras , 289 , 955 komatsu , e. et al . 2000 , pasj , 53 , 57 korolv , v.a . , sunyaev , r.a . , & yakubtsev , l.a . 1986 , pazh , 12 , 141 herbig , t. , lawrence , c.r . , redhead , a.c.s . , gulkis , s. , 1995 , apj , 110 , l5 lacey , c. , & cole , s. 1993 , , 262 , 627 lloyd - davies , e.j . , ponman , t.j . , & cannon , d.b 2000 , mnras , 315 , 689 lo , k.y . , chieu , t. , martin , r.n . , 2000 , aas , 197 , 560 mahdavi , a. , boehringer , h. , geller , m.j . , ramella , m. , 1997 , apj , 483 , 68 markevitch , m. 1998 , apj , 504 , 27 markevitch , m. , sarazin , c.l . , & vikhlinin , a. 1999 , apj , 521 , 526 menci , n. , & cavaliere , a. 2000 , mnras , 311 , 50 ( mc2000 ) navarro , j.f . , frenk , c.s . , & white , s.d.m . 1997 , , 490 , 493 nevalainen , j. , markevitch , m. , & forman , w. 2000 , in _ large scale structure in the x - ray universe _ , plionis , m. & georgantopoulos , i. eds . ( atlantisciences : paris , france ) , p.393 ostriker , j.p . , & mckee , c.f . 1988 , rev . 60 , n. 1 peebles , p.j.e . 1993 , _ principles of physical cosmology _ ( princeton : princeton univ . press ) ponman , t.j . , cannon , d.b . , & navarro , j.f . 1999 , nature , 397 , 135 poli , f. , giallongo , e. , menci , n. , dodorico , s. , & fontana , a. 1999 , apj , 527 , 662 raig , a. , gonzalez - casado , g. , & salvador - sole , e. 1998 , apj , 508 , l129 rephaeli , y. 1995 , araa , 33 , 541 roettiger , k. , burns , j.o . stone , j.m . 1999 , apj , 518 , 603 roettiger , k. , stone , j.m , & mushotzky , r.f 1998 , apj , 493 , 62 rosati , p. , della ceca , r. , norman , c. , & giacconi , r. 1998 , apj , 492 , 21 roussel , h. , sadat , r. , & blanchard , a. , 2000 , a&a , 361 , 429 saunders , r.d.e . , & jones , m.e . 2000 , to appear in proc . iau symposium 201 somerville , r.s . , & primack , j.r . 1999 , mnras , 310 , 1087 sunyaev , r.a . , & zeldovich , ya.b . 1972 , comm . sc . , 4 , 173 sunyaev , r.a . , & zeldovich , ya.b . 1980 , ara&a 18 , 537 takizawa , m. , & mineshige , s. 1998 , apj , 499 , 82 tormen , g. , 1997 , mnras , 290 , 411 tozzi , p. & norman , c. 2000 , preprint [ astro - ph0003289 ] thornton , k. , gaudlitz , m. , janka , h.th . , & steinmetz , m. 1998 , apj , 500 , 95 valageas , p. , & silk , s. 1999 , a&a , 1999 , 350 , 725 valageas , p. , & schaeffer , r. , 2000 , a&a , 359 , 821 white , s.d.m . , & fabian , a.c . 1995 , mnras , 273 , 72 white , s.d.m . , navarro , j.f . , frenk , c.s . , & evrard , a.e . 1993 , nature , 366 , 429 white , s.d.m . , & rees , m.j . 1978 , mnras , 183 , 341 wu , k.k.s . , fabian , a.c . , nulsen , p.e.j . 1998 , mnras , 301 , l20 wu , k.k.s . , fabian , a.c . , nulsen , p.e.j . 1999 , preprint [ astro - ph/9907112 ] 1 . we show in the form of a flow chart diagram the processes we consider and the computational steps we use to compute in the dm haloes the icm profile and its boundary conditions . 2 . as a preliminary test of our sam model , we show the predicted central entropy of the icm as a function of the temperature for the strong feedback case @xmath89 ( solid line ) and the moderate feedback case @xmath92 ( dashed line ) , compared with the data from ponman , cannon & navarro ( 1999 ) . we also show as a dotted line the result from the self - similar scaling , eq . all lines refer to the scdm cosmogony / cosmology with @xmath245 , @xmath246 , @xmath247 , @xmath248 , and @xmath249 . the @xmath95cdm case yields similar results . 3 . the top panel shows the relation we predict between the ( area averaged ) compton parameter @xmath0 for individual groups and clusters and the temperature ; the solid line refers to the strong feedback case @xmath89 , the dashed line to the moderate feedback case @xmath92 , while the self - similar scaling is plotted as a dotted line . scdm cosmology / cosmogony . the bottom panel shows the same correlation but with the compton parameter normalized to its self - similar scaling given by eq . ( 3 ) fig . 5 . the predicted source counts as a function of the sz flux at 100 ghz , ( 10 ) and ( 11 ) . solid and dashed lines refer to the feedback cases @xmath89 and @xmath92 , respectively . the curve relative to the self - similar case would overlap that referring to case @xmath92 . the bottom line is computed for the scdm cosmogony / cosmology , while the one on top refers to the @xmath95cdm case . the contribution to the cosmic compton parameter ( see eq . 11 ) from the icm inside _ virialized _ structures , groups and clusters of galaxies , distributed out to the redshift z ; scdm ( bottom lines ) , and @xmath95cdm universe ( top lines ) are considered . the solid and dashed lines refer to the feedback strengths @xmath89 and @xmath92 , respectively .

we investigate how strongly and at what scales the sunyaev - zeldovich effect reflects the shifting balance between two processes that compete for governing the density and the thermodynamic state of the hot intra - cluster medium pervading clusters and groups of galaxies . one such process is the hierarchical clustering of the dm ; this induces gravitational heating of the diffuse baryons , and strives to push not only the galaxy systems but also the icm they contain toward self - similarity . away from it drives the other process , constituted by non - gravitational energy fed back into the icm by the condensing baryons . we base on a semi - analytic model of galaxy formation and clustering to describe how the baryons are partitioned among the hot , the cool and the stellar phase ; the partition shifts as the galaxies cluster hierarchically , and as feedback processes ( here we focus on stellar winds and supernova explosions ) follow the star formation . such processes provide a moderate feedback , whose impact is amplified by the same large scale accretion shocks that thermalize the gravitational energy of gas falling into the growing potential wells . we use the model to compute the compton parameter @xmath0 that governs the amplitude of the sz effect , and to predict how this is affected by the feedback ; for individual clusters and groups we find a relation of @xmath0 with the icm temperature , the @xmath1 relation , which departs from the form suggested by the self - similar scaling , and bends down at temperatures typical of galaxy groups . we also compute the average @xmath2 and the source counts as a function of @xmath0 under different assumptions concerning feedback strength and cosmology / cosmogony . we then discuss to what extent our results are generic of the hierarchical models of galaxy formation and clustering ; we show how the @xmath3 relation , to be measured at @xmath4wave or sub - mm wavelengths , is model - independently related to the shape of the @xmath5 correlation measured in x - rays . we conclude that these observables together because of their complementarity and their observational independence can firmly bound the processes responsible for non - gravitational entropy injections into the icm .

the extraordinary advancements made in the physical sciences at the beginning of twentieth century originated from the effort to understand the simplest , that is , the most fundamental , elements of physical phenomena . the separation of matter and light into its basic constituents : electrons , protons , atoms , and molecules in the first case and photons in the second , enabled scientists to explain the puzzling properties of solid materials , such as their sound transmission and electrical properties , as well as , light emission and reflection characteristics . the discipline of statistical mechanics demonstrated that the behavior of systems composed of millions of individual particles can be captured with simple laws , involving only their average properties @xcite . at that time it seemed as if the aristotelian approach of reductionism , where complex phenomena consisted of nothing more than the sum of essential elements , was the prescription underlying the correct method of scientific discovery . the french mathematician poincar was probably the first to rigorously demonstrate the failure of this attractive but overly optimistic method by extending newton s law of universal gravitation to a system consisting of three celestial bodies @xcite . his mathematical treatment of the three - body problem demonstrated that unlike the two - body problem of the earth and sun , a planet s orbit in the three - body system need not be periodic . poincar proved that the long held belief that planetary motion could be built up from the superposition of simple cycles was false . this unanticipated behavior emerges from nonlinear dynamics and has come to be known as chaos theory . another perplexing phenomena that violates the principle of superposition is critical phase transitions in magnetic materials . if criticality were truly nothing more than collective behavior resulting from the superposition of some basic building blocks , why then does the change in an external parameter , for example temperature , induce such a dramatic shift in its macroscopic behavior ? more recently the identification of emergent phenomena across multiple disciplines , from the swarming of insects @xcite , the schooling of fish @xcite and the flocking of birds @xcite observed in animal groups by naturalists ; to the spatiotemporal activity of the brain @xcite observed by neurophysiologists ; to the collective and cooperative behavior observed in social groups studied by psychologists and sociologists ; all demonstrate collective behavior reminiscent of particle dynamics near the critical phase transitions studied by physicists @xcite . each of these disciplines has demonstrated the need to investigate the dynamics of complex networks across scales in order to develop a deeper understanding of how large - scale behavior emerges from microscale dynamics and the sensitivity of the observed behavior to those dynamics . of particular interest to us here are the biological fields in which we observe a need for a system wide approach @xcite . the recent discoveries in biology were propelled by the successes of molecular biology and genetics that have made available genomic blueprints of numerous organisms , which are complemented by extensive experimental data describing cell functions . at the same time however the realization came that biological function emerges out of the interaction of numerous molecular components , such as depicted in figure [ fig_markram ] for the human brain , making the detailed knowledge of specific components at any level of organization insufficient to capture macroscopic functionality . there is probably no better example of this limitation then the study of the neurological systems , whose goal is to understand , predict and ultimately modify ( in order to heal ) brain function . ongoing initiatives of the human connectome project @xcite , the human brain project @xcite or the allen brain atlas @xcite illustrate the fact that the system wide approach and integration of data from across different spatial and temporal scales has become the norm in modern scientific disciplines . despite experimental developments , the ability of science to make theoretical predictions of the behavior of complex networks is still in its infancy . the adoption of methods from non - equilibrium statistical physics have demonstrated limitations , resulting from the fact that living systems , in contrast to inert physical materials , are extremely heterogeneous , non - generic , highly specialized and operate far from an equilibrium state @xcite . herein we demonstrate that what was for a very long time a niche branch of mathematics , the fractional calculus , might very well be able to span the gap between the inert materials of physics and the living networks of biology . although developed along side the classical calculus , fractional differential equations have only recently been shown to be a convenient way to describe the dynamics of complex phenomena characterized by long - term memory and spatial heterogeneity @xcite . fractional differential equations were demonstrated to capture the time evolution of fractal processes , such as in anomalous diffusion , viscoelasticity and turbulent fluid flow , as reviewed by west and grigolini @xcite . in spite of the success of the mathematical descriptions of such processes there has been a lack of identification and interpretation of mechanisms that entail fractional dynamic equations in the context of complex networks . herein we provide an explanation for one source of a fractional differential equation that describes the dynamics of a complex network using a fractional master equation . here the utility of the fractional calculus is demonstrated by capturing the dynamics of the individual elements of a complex network from the information quantifying that network s global behavior . the phase transitions observed in complex social and physiologic networks suggest the wisdom of using a generic model from the ising universality class to characterize network dynamics . using such a model it is then possible to demonstrate that the individual trajectory response to the collective motion of the network is described by a linear fractional differential equation . the solution to this fractional equation is obtained through a subordination procedure without the necessity of linearizing the underlying dynamics , that is , the solution retains the influence of the nonlinear network dynamics on the individual . moreover the solutions to the fractional equations of motion suggest a new direction for designing control mechanisms for complex networks . in section [ dmm ] we consider the dynamics of a complex network described by a two - state master equation . the decision making model ( dmm ) , defined by the two - state master equation , undergoes phase transitions at a critical value of the control parameter @xcite . it is understood that at criticality the short - range local interactions between the two - state elements generate long - range global correlations , thereby producing effective long - range interactions . consequently at criticality there is global cooperation among the network elements . an individual disconnected from the network is assumed to choose randomly between two states with an exponential distribution of decision times and a given average decision time . when coupled to the other individuals of the network , the global distribution for the time intervals between decisions is determined to be inverse power - law @xcite . in this latter case the power - law index of the survival probability is a measure of the complexity of the underlying dynamics determining whether that process is non - stationary and non - ergodic @xcite . in section [ subordination ] the dmm network dynamics is incorporated into that of an individual element through a process known as subordination . in order to formalize the subordination process we introduce the concept of subjective time to distinguish between clock time that determines the activities of the network and operational or subjective time that determines the activities of the individual . the subordination process results in the two - state master equation of the dmm being replaced by a fractional master equation for the individual whose solution is shown to be a mittag - leffler function in section [ subordination ] . this predicted behavior of the single element dynamics is compared with the numerical results from the dmm implemented on a two - dimensional lattice and found to be in excellent agreement . in section [ conclusion ] we draw some conclusions . the dmm realized on a complex networks represents the dynamics of the probability for an individual to be in either of the two states : yes or no , up or down , on or off . the model is based on the cooperative interaction of @xmath0 elements , each of which is described by the two - state master equation @xcite @xmath1 @xmath2 the quantity @xmath3 is the probability of the element _ i=1, ... ,n _ in the network being in the state @xmath4 at time @xmath5 and the probability is normalized at all times such that @xmath6 the network dynamics are determined by the choice of the functional form of the transition rates in the two - state master equation ( eqs . ( [ firstconsensus ] ) and ( [ secondconsensus ] ) ) . each probability @xmath3 is influenced by the states occupied by all the elements of the network linked to element _ i _ as determined by the transition rates @xmath7 \label{transition12}\ ] ] @xmath8 \label{transition21}\ ] ] the symbol @xmath9 denotes the total number of elements linked to the _ i_-th element and @xmath10 is the number of those elements in the state @xmath11 at time @xmath5 . of course @xmath12 at all times . the parameter @xmath13 is the control parameter that determines the strength of the interaction between elements of the network . in the case where each element in the network is coupled to all the other elements we have all - to - all ( ata ) coupling , such that @xmath14 and the time dependence of the total number of elements in states @xmath11 @xmath15 implies that the transition rates become erratic functions of time . in the ata coupling case when the total number of elements within the network becomes infinite ( @xmath16 ) the fluctuation frequencies collapse into probabilities according to the law of large numbers . in physics this replacement goes by the name of _ the mean field approximation _ , in which case the transition rates in the master equation ( [ firstconsensus ] ) and ( [ secondconsensus ] ) are written as @xmath17\ ] ] @xmath18\ ] ] the formal manipulation of the master equation even in this simplified case in made a little easier if we introduce a new variable defined as the difference in the probabilities @xmath19 subtracting eq.([secondconsensus ] ) from eq.([firstconsensus ] ) after some algebra yields the highly nonlinear rate equation for the difference variable @xmath20 where the nonlinearity enters through the transition rate dependence on the difference variable @xmath21 \label{model}\ ] ] @xmath22 \label{model2}\ ] ] in the mean field approximation . by inserting eqs.([model ] ) and ( [ model2 ] ) into eq.([notdefined ] ) we obtain @xmath23 and the network dynamics are determined by the potential function @xmath24(@xmath25 , which is a symmetric double well potential with the explicit form @xmath26 . \label{potential}\ ] ] note that the network is not described by a hamiltonian and yet the global dynamics in indeed described by an effective hamiltonian , that being the double well potential given by eq.([potential ] ) and depicted in figure [ fig_well ] . . a bifurcation occurs at the critical point @xmath27 right panel : potential function determined by eq.([potential ] ) with barriers for k subcritical ( dashed line , @xmath28 ) , critical ( solid line , @xmath29 ) and supercritical ( dotted line , @xmath30 ) . ] the cooperative behavior of the infinitely large ata coupled network described by eq.([ideal ] ) is that of an overdamped particle hopping from one potential minimum to the other , whose position is @xmath31 within the potential eq.([potential ] ) . for @xmath32 , half of the nodes are in one state and half are in the other because there is only a single broad minimum in the potential . at the critical value of the control parameter @xmath33 a bifurcation occurs and the potential develops two wells separated by a barrier as discussed by turalska _ et al_. @xcite . the height of the barrier increases with the value of the control parameter . it is now convenient to define the stochastic global variable @xmath34 where @xmath35 is the state of element @xmath36 at time @xmath5 . the variability of the global variable characteristic of the entire network , capturing the cooperation between units at any moment of time . it is interesting that at the critical value of the control parameter the ata version of the dmm undergoes a phase transition . note that the amplitude of @xmath37 depends on the value of the control parameter @xmath13 . when @xmath38 , all elements in the network are independent poisson processes ; thereby an average taken at any moment of time over all of them yields zero . once the value of the coupling becomes nonzero , @xmath39 , single elements are less and less independent , resulting in nonzero averages . the quantity @xmath40 is the critical value of the control parameter @xmath13 , at which point a phase transition to a global majority state occurs . in numerical calculations we use the time average @xmath41 @xmath42 @xmath43 as a measure of this global majority . more precisely , after an initial @xmath44 time steps , the average is taken over the same number of the consecutive time steps of the model . in figure [ fig_phase ] the thin line indicates the ata phase transition as measured by @xmath45 the other phase transitions indicated are for the ising model ( dashed line ) and the dmm model on a two - dimensional lattice as discussed in section [ two_dim ] and elsewhere @xcite . the thin solid line and the dashed line are the theoretical predictions for the fully connected and the two - dimensional regular network , respectively . in both cases @xmath46 and the latter case is the onsager theoretical prediction @xcite for a two - dimensional regular lattice . the dots corresponds to the global states observed for the dmm on a two - dimensional regular lattice @xmath47 nodes and @xmath48 . periodic boundary conditions were applied in the dmm calculations . ] real network are not ata coupled since interactions typically have finite range and elements are spatially separated . thus , the ata approximation may be valid for small networks but certainly breaks down for large systems . moreover , real - world networks have finite numbers of elements . it is therefore useful to examine how strongly the mean field solutions are violated when we relax these constraints . the stability condition can be violated in at least two different ways . the first way is by reducing the number of elements @xmath0 to a finite value . the second way is by restricting the number of links so the network no longer has ata coupling . in real - world networks both sources of equilibrium disruption are expected to occur . for the time being we retain the ata coupling within the networks and consider the number of elements @xmath0 to be finite . in this latter case we can no longer make the mean field approximation and the dynamic picture stemming from the above master equation is radically changed . if the number of elements is still very large , but finite , we consider the mean - field approximation to be nearly valid and replace the average eq.([fluctuationxi ] ) with the stochastic quantity @xmath49 where @xmath50 is a small amplitude random fluctuation . after inserting eq.([generalization ] ) into ( [ ideal ] ) and some straight forward algebra we obtain the stochastic differential equation @xcite to lowest - order in the strength of the fluctuations : @xmath51 the additive fluctuations @xmath52 have amplitudes that are computationally determined to be on the order of @xmath53 note that the double - well potential in the mean field approximation persists in the present description even though we have relaxed the mean field approximation to a finite number of network elements . the random fluctuations resulting from the finite size of the network induces transitions between the two states of the potential well . consequently , for a network with a finite but large number of elements the phase synchronization of eq.([ideal ] ) is not stable and the stochastic langevin equation eq.([stochastic ideal ] ) determines the dynamics of the network . furthermore , the fluctuations can drive the particle from one well of the potential to the other when its amplitude is sufficient to traverse the barrier separating the wells . however , here the fluctuations arise from the finite number of elements in the network rather than from non - existent thermal excitations and are consequently suppressed as the network size increases . elements ( top ) , @xmath54 elements ( middle ) , and @xmath55 elements ( bottom ) . the coupling constant is @xmath56 and @xmath48 in all three cases . ] although eq . ( [ stochastic ideal ] ) is written in the continuous time representation , in practice the numerical calculations of dmm correspond to the adoption of a finite integration time step @xmath57 . note that the stochastic rate equation eq.([stochastic ideal ] ) replaces eq . ( [ ideal ] ) in the case of a finite @xmath0 , and that eq . ( [ ideal ] ) is recovered in the ideal case @xmath46 . we incorporate the ata coupling condition with a finite number of elements by numerically integrating the the master equation for each element in the network and then calculating the number of elements in each of the two states . in figure [ fig_fluctuating ] the fluctuating global variable @xmath37 is depicted as a function of time , under differing conditions . notice that with increasing @xmath0 the fluctuation @xmath37 become more distinctly dichotomous - like , with an increasingly sharp transition from the up to the down state . this pattern corresponds to the entire network keeping a decision for a longer and longer time as the size of the network increases . the condition of a decision lasting forever is reached in the ideal case @xmath46 . the global variable fluctuates between the two minima of the double - well potential as described by eq.([stochastic ideal ] ) for @xmath58 . the single element follows the fluctuations of the global variable , switching back and forth from the condition where the upper state is preferred statistically to that where the lower sate is preferred statistically . the complete properties of the dmm on an ata network are explored by turalska _ _ @xcite . in this section we consider the topology of a simple two - dimensional lattice and confine the coupling between elements to its four nearest neighbors thereby setting @xmath59 in the transition rates of the two - state master equation . similarly to the ata case , the fluctuations of the global variable @xmath37 show pronounced transition as a function of the coupling parameter @xmath13 . as seen in figure [ fig_lattice]b , the global variable shifts from a configuration dominated by randomness to an organized state once the control parameter is increased above the critical value @xmath60 . for values of the control parameter @xmath13 corresponding to the disorganized phase @xmath61 , single elements of the lattice are only weakly influenced by the decisions of the neighbours . thus , the fluctuations of the global order parameter @xmath62 are characterized by small amplitude and very fast oscillations about the zero - axis . for @xmath63 , the interaction between individuals give rise to a majority or a consensus state , during which a significant number of agents adopts the same opinion at the same time . for the transitions between two states for the single unit @xmath64 of the system is compared with the behavior and statistical properties of the global order parameter @xmath65 . simulations were performed on a lattice of size @xmath66 nodes , with periodic boundary conditions , for @xmath48 and increasing values of the control parameter @xmath13 . blue , red and green lines correspond to @xmath67 , @xmath68 and @xmath69 , respectively . the critical value of the control parameter is @xmath70 black dashed line on the plots of @xmath71 denotes an exponential distribution , with the decay rate @xmath72 . the gray dashed line denotes an inverse power law function with exponent @xmath73 ] at the same time the global behavior is undergoing a phase transition , the presence of the lattice apparently exerts only very subtle influence over the behavior of single individuals . the latter influence can be observed as a change in the interval timing for a single element as the control parameter is increased ( fig . [ fig_lattice]a ) . note that if attention is concentrated on a single network element when the network is in a consensus state that individual would still appear to make transitions according to an exponential distribution as exhibited in figure [ fig_lattice]c . the strict exponential is indicated by the black dotted curve . the single particle survival probabilities do not look too much different , the light gray dashed curve with the subcritical value @xmath74 is very close to the exponential . the remaining single particle curves , whether critical @xmath75 or supercritical @xmath76 appear to be exponential on this graph . to characterize the changes in temporal properties of the microscopic and macroscopic variables we evaluate the survival probability function @xmath77 of time intervals @xmath78 between consecutive events defined as changes of the state or crossing of the zero - axis , for the single element and the global variable , respectively . these calculations unveil modest deviation of the survival probability for a single individual from the exponential form @xmath79 $ ] . the strict exponential is indicated in figure [ fig_lattice]c by the black dashed curve . the single particle survival probabilities do not look too much different , the blue curve with the subcritical value @xmath80 is very close to the exponential . the remaining single particle curves , whether critical @xmath81 or supercritical @xmath63 appear to be very nearly exponential on this graph . the difference in the behavior of the individual from that in the non - interacting state would be that she tends to be more reluctant to change her mind . the deviation of the individual survival probability from the exponential form in figure [ fig_lattice]c appears to be modest when compared with the dramatically greater deviation of the survival probability of the global variable from the exponential as depicted in figure [ fig_lattice]d . the average network behavior differs markedly as the control parameter is increased from the subcritical through the supercritical regions . however the influence of the global variable on the behavior of the individual does not appear to induce a significant change . for the individual the change is however a subtle yet profound difference and is a direct result of the imitation mechanism , that is the erh . so if the individual survival probability is not exponential , what is it ? to answer this question we turn our attention to describing an alternate construction of the dynamics of the individual elements . in this section we demonstrate the equivalence between a fractional trajectory that is the solution of a caputo fractional differential equation , and the ensemble average trajectory that results from a subordination process . we here consider only fractional derivatives of the caputo type , in part because it requires the least amount of explanation . however for the aficionado we note that an approach using riemann - liouville fractional derivatives would be equivalent as long as the initial conditions are properly specified . we begin the discussion with a derivation of the fractional derivative from a subordination argument . the master equation for a single isolated individual is , with the index suppressed , according to the numerical simulation given by @xmath82 \delta \tau \right ) = -g_{0}\phi \left ( \left [ n-1\right ] \delta \tau \right ) \delta \tau , \label{singleme}\ ] ] whose discrete solution is @xmath83 here @xmath84 is the difference variable for a single individual chosen from the network at random and as @xmath85 and @xmath86 such that clock time is @xmath87 we have the apparently trivial result @xmath88 subordination implies the existence of two different notions of time @xcite . one is the operational time @xmath78 , which is the internal time of a single individual , with an element generating the ordinary dynamics of a non - fractional system . the other notion is experimental time @xmath5 ; the time as measured by the clock of an external observer . typically in the operational time frame the temporal behavior of an element is regular and evolves exactly according to the ticks of a clock leading to the exponential . therefore it is assumed that the trajectory of a network s element in operational time is well defined and given by @xmath89 , which is the solution given by eq.([phi_solution ] ) . it is perhaps worthwhile to point out that this notion of two different times was introduced into psychology in the middle nineteenth century and lead to the general weber - fechner law . it has been further developed in a contemporary setting to explain the observation of @xmath90 noise in cognition by discriminating between subjective and objective times , that being operational and chronological time , respectively . in operational time an element s behavior appears ordinary , but to an experimenter observing the elements from outside the network their temporal behavior appears erratic , evolving in time then abruptly freezing in different states for extended time periods . because of the random nature of the experimental or chronological time evolution of the elements the subordination process involves an ensemble average over many realizations of the element s dynamics each evolving according to its own internal clock , independent of one another . making an ensemble average over a large number of realizations results in a smooth average trajectory , which is equivalent to the fractional trajectory . to find the average behavior we move from the operational time solution to the experimental time solution adopting the subordination interpretation . we assume that the chronological time lies in the interval @xmath91 and obtain @xmath92 it is evident that the trajectory resulting from the subordination process inherently involves an ensemble average . here we see that eq . [ gme ] replaces the solution to the single element two - state master equation of the dmm . note that @xmath93 is the probability that @xmath94 events have occurred , the last one in the time interval @xmath95 . the function @xmath96 denotes the probability that no event occurs up to time @xmath5 and is given empirically by numerical calculation in figure [ fig_lattice]d and mathematically by eq.([survival2 ] ) . the occurrence of an event corresponds to activating a decision with @xmath97 , so that activating @xmath94 such events transforms the initial condition @xmath98 into the product @xmath99 . this form of the equation is kept from time @xmath100 , at which time the last event occurs , up to time @xmath5 , the time interval @xmath101 being characterized by no event occurring . of course , the expression eq.([gme ] ) takes into account that the number of possible events may range from the no - event case to that of infinitely many events . the conditions necessary for this result to occur are discussed by svenkenson _ _ et al__@xcite . to interpret the physical meaning of eq . ( [ gme ] ) , consider each tick of the internal clock @xmath94 of an element measured in experimental time as an event . since the observation is made in experimental time , the time intervals between events are random . we assume that the waiting times between consecutive events are identically distributed independent random variables . the integral in eq . ( [ gme ] ) is then built up according to renewal theory . after the @xmath94-th event the individual changes from state @xmath102 to @xmath103 , where it remains until the action of the next event . the sum over @xmath94 takes into account the possibility that any number of events could have occurred prior to an observation at experimental time @xmath5 . the events occur randomly with a waiting - time probability density function ( _ pdf _ ) @xmath104 and survival probability @xmath96 . the waiting - time _ pdf _ is related to the survival probability through @xmath105 taking advantage of the renewal nature of the events , the waiting - time _ pdf _ for the @xmath94-th event in a sequence is connected to the previous event by @xmath106 at this point it is useful to introduce laplace variables in our discussion . the laplace transform of a function @xmath50 is denoted @xmath107 to find an analytical expression for the behavior in experimental time it is convenient to study the laplace transform of eq . ( [ gme ] ) @xmath108 ^{n}\phi ( 0 ) . \label{psi_hat}\ ] ] where we assume the intervals between successive transitions are independent of one another , it is a renewal process . consequently , the waiting time _ pdf _ for @xmath94 transitions is the product of @xmath94 single transition _ pdf _ s : @xmath109 ^{n}\ ] ] which was used to collapse the convolution of eq.([psin ] ) to the power - law form in eq.([psi_hat ] ) . consequently the time @xmath5 is derived from a waiting - time @xmath110 given by that of the network as a whole : @xmath111 and the survival probability is empirically determined from figure [ fig_lattice]d to be @xmath112 the laplace transform of the survival probability in terms of that for the waiting - time _ pdf _ is @xmath113 . \label{phi_last}\ ] ] inserting these last two expressions into eq.([psi_hat ] ) and evaluating the sum yields @xmath114 whose inverse laplace transform yields : @xmath115 a generalized master equation . the function @xmath116 in the eq.([gme2 ] ) is a memory kernel containing the information on how the other elements in the network influence the dynamics of the individual element under study . the laplace transform of the memory kernel is @xmath117 and a complete discussion of its properties is now given in textbooks @xcite . equation ( [ memory ] ) is the laplace transform of the montroll - weiss memory kernel obtained using their continuous time random walk theory . previous analysis , including the dmm calculations , have shown that the global waiting - time @xmath110 is an inverse power - law distribution , see for example figure [ fig_lattice]d . the asymptotic behavior of an individual in time is determined by considering the waiting - time @xmath110 given by eq.([survival ] ) as @xmath118 @xmath119 so that eq.([last ] ) reduces to @xmath120 and the rate parameter has the value @xmath121 we now assume that the exact equation for the individual dynamics has both an average and a fluctuating part just as in the mean field treatment of the double well potential . consequently in terms of the laplace variables we have the stochastic equation @xmath122 which has the inverse laplace transform @xcite @xmath123 = -\lambda ^{\mu -1}\phi(t)+\varepsilon ( t ) . \label{fractitonal le}\ ] ] equation ( [ fractitonal le ] ) is a stochastic fractional master equation or fractional langevin equation in which the stochastic properties of @xmath124 are determined by the fluctuations resulting from the dynamics if the finite - size dmm network . the fractional derivative in this equation is of the caputo form and has the laplace transform @xmath125;s\right\ } = s^{\alpha } \widehat{\phi } ( s)-s^{\alpha -1}\phi ( 0)\ ] ] and is completely equivalent to that determined using the riemann - liouville form of the fractional derivative . the solution to the fractional langevin equation is given by @xmath126\right ) ^{\mu -1}\right ) \varepsilon \left ( t^{\prime}\right ) dt^{\prime } . \label{solution2}\end{aligned}\ ] ] where the homogeneous solution to the fractional equation is the mittag - leffler function @xmath127 and the kernel of the integral is in terms of the mittag - leffler function of the second kind @xmath128 the dynamics of the individual is determined by the exact laplace transform equation eq.([phi_last ] ) . however it is notoriously difficult to obtain analytic expressions by direct inversion of the resulting equations due to the complexity of the exact form of the laplace transform memory kernel . consequently , the strategy is to consider the asymptotic forms of the solution , which was done by examining the solutions to the fractional langevin equation given by eq.([solution2 ] ) . we find that the properties of the fluctuations change as the control parameter is varied from the subcritical , critical and supercritical regions . in all three regions of dmm dynamics , subcritical , critical and supercritical , the single elements used in the evaluation of the probability difference @xmath129 were selected at random among all nodes of the lattice . the calculations were done on a @xmath130 node two - dimensional lattice , with nearest neighbor interactions . the time - dependent average solution calculated over an ensemble of randomly chosen individuals is depicted in figure [ fig_difference ] , where the average is taken over @xmath131 independent realizations of the dynamics . the analytic solution is obtained by averaging eq.([solution2 ] ) over an ensemble of realizations of the single particle trajectory to obtain the mittag - leffler function : @xmath132 ^{\mu -1}\right ) \label{mlfsolution}\ ] ] from the series form of the mittag - leffler function it is evident that for @xmath133 the average probability difference would be an exponential . consequently the influence of the network on the behavior of the individual in this case would be essentially that of uncorrelated random noise and therefore would not qualitatively change from the poisson nature of an isolated individual . however this is not the case for other values of the inverse power - law index ; in the subcritical region the fitted value of the scaling index is @xmath134 . thus , the dynamic behavior of the network results in a stretched exponential autocorrelation for the dynamics of the individual @xmath135 ^{\mu -1}}{\gamma \left ( \mu \right ) } \right ) . \label{stretched}\ ] ] note that the early time behavior of the mittag - leffler function is the indicated stretched exponential . on the figure [ fig_difference]a , the region where the black dashes of the mittag - leffler function fit diverge from the data is the onset of the inverse power - law tail of the mittag - leffler function . an exponential truncation of the mittag - leffler function would fit the data throughout its domain . the rational for a truncated mittag - leffler function will be taken up elsewhere . the fitting of the analytic solution at early times to the dmm numerically generated curves is certainly very good in the subcritical domain with @xmath136 . as the critical point is approached from the subcritical region the random influence of fluctuations are diminished as would be expected due to the formation of clusters as the network undergoes a phase transition and encounters critical slowing down . the plunging stretched exponential that was observed in the subcritical region as seen in figure [ difference]a is replaced with a more gently decreasing function . the time - dependent average solution of a randomly chosen individual in the critical regime is depicted in figure [ difference]b . it is evident by comparing these data with the curve in figure [ difference]a that the average solution does not decrease as quickly in time and there is less variability asymptotically in time . this behavior is reflected in the value of the power - law index which is determined to be @xmath137 with a quality of fit given by @xmath138 . note how well separated the solution is from the exponential function given by the light grey dashed curve . but here again an exponential truncation of the mittag - leffler function might provide a better overall fit to the data . in the supercritical region of the control parameter it is evident from the fit of the analytic solution to the data depicted in figure [ difference]c that the solution extends far beyond that found in either the subcritical or critical domains with the mittag - leffler function solution extending far into the inverse power - law region . here the power - law index is fitted with the value @xmath139 with @xmath140 . the measured inverse power - law index is very close to that obtained for the global survival probability obtained from the numerical calculation of the dmm lattice network . in summary the last few years have witnessed substantial attention focused on the role of criticality @xcite to explain the function of complex networks , from flocks of birds @xcite , to neural networks @xcite to the brain @xcite . at criticality , the short - range links of ising - like cooperative models are converted into long - range interactions turning a set of @xmath0 distinct elements into an organized network behaving as a single individual with extended cognition @xcite . a complex network at criticality generates 1/f noise @xcite , which is thought to be of relevance for cognition @xcite , with the interesting property of maximizing information transport @xcite . moreover the network dynamics has a subtle but profound influence on the behavior of each individual within the network . the numerical solution of the dmm on a @xmath130 lattice with elements at each of the nodes and with nearest neighbor interactions gives rise to an inverse power - law survival probability for the global variable introduced in section [ dmm ] . using the theory of subordination , that being the time experienced by an individual , with the influence of the network entering into the individual s dynamics through the distribution of critical events , the dynamics of an individual is determined by a fractional langevin equation . the explicit form of the fractional langevin equation depends on whether the network dynamics is in the subcritical , critical or supercritical domains . in all three domains the mittag - leffler function solution to the fractional langevin equation is sufficient to describe the dynamic response of an individual to the other @xmath141 dynamic elements of the network . in the subcritical and critical domains the solutions could be modified to include truncations effects evident in the numerical data . the lesson to be learned from the combination of computation and analysis presented herein is that complex networks of finite size whose dynamics are members of the ising universality class , such as described by the dmm , have an analytic not just a numerical description . instead of confining the dynamic description to that of the macroscopic variable , that being the global or average state of the network , one can also investigate how individual members of the network respond to the influence of the network as a whole . if we consider the fluctuations in the global dynamics to be microscopic , and the potential of the global variable to be macroscopic , then the real - time dynamic description of the individuals is mesoscopic . in general the mesoscopic dynamics can be described by a fractional stochastic differential equation . coupling two or more such fractional stochastic equations to model the across - scale coupling within the brain depicted in figure [ fig_markram ] suggests itself . this is presently an active area of investigation . the authors would like to thank the u.s . army research office for supporting this research . warmly thanks the aro and the welch foundation for their support through grants no . w911nf-11 - 1 - 0478 and no.b-1577 , respectively . 10 p. bonifazi , m. goldin , m.a . picardo , i. jorquera , a. cattani , g. bianconi , a. represa , y. ben - ari , and r. cossart , `` gabaergic hub neurons orchestrate synchrony in developing hippocampal networks '' , _ science _ * 4 * , 5958 , 1419 - 1424 ( 2009 ) . n. friedman , s. ito , b. a. w. brinkman , m. shimono , r. e. lee deville , k. a. dahmen , j. m. beggs , and t. c. butler , `` universal critical dynamics in high resolution neuronal avalanche data '' , _ phys . rev . lett_. * 108 * , 208102 ( 2012 ) . p. gong , a.r . nikolaev , and c. van leeuwen , `` intermittent dynamics underlying the intrinsic fluctuations of the collective synchronization patterns in electrocortical activity '' , _ phys . * 76 * , 011904 ( 2007 ) . larremore , w.l.shew , e. ott adn j.g . restrepo , `` effects of network topology , transmission delays , and refractoriness on the response of coupled excitable systems to a stohsastic stimulus '' , _ chaos _ * 21 * , ( 2011 ) . s. micheloyannis , e. pachou , c.j . vourkas , s. erimaki , and v. tsirka , `` using graph theoretical analysis of multi channel eeg to evaluate the neural efficiency hypothesis '' , _ neurosci . lett_. * 402 * , 273 - 277 ( 2006 ) e .- j . wagenmakers , h. l. j. van der massa , and s. farrlee , `` abstract concepts require concrete models : why cognitive scientists have not yet embraced nonlinearly coupled , dynamical , self - organized critical , synergistic , scale - free , exquisitely context - sensitive , interaction - dominant , multifractal , interdependent brain - body - niche systems '' , _ topics in cognitive science _ * 4 * , 87 - 93 ( 2012 ) .

a two - state master equation based decision making model has been shown to generate phase transitions , to be topologically complex and to manifest temporal complexity through an inverse power - law probability distribution function in the switching times between the two critical states of consensus . these properties are entailed by the fundamental assumption that the network elements in the decision making model imperfectly imitate one another . the process of subordination establishes that a single network element can be described by a fractional master equation whose analytic solution yields the observed inverse power - law probability distribution obtained by numerical integration of the two - state master equation to a high degree of accuracy .

sar data analysis for a range of applications from compact and fully polarimetric sar like radarsat-2 are becoming popular everyday on the fact that they offer features like higher resolution imaging , wide swath , reduced prfs . data from these family of sar are very useful in several applications involving terrain to oceans which are clearly depicted in@xcite . the polarimetric data analysis from convair-580 and radarsat-2 have resulted many successful studies in fields ranging from ship - detection@xcite , land - use pattern , crop classification . with the launch of radarsat-2 on december 14 , 2007 , it became possible to have a sar system having modes of multiple polarization including full polarimetry and resolution upto 1 metre in spotlight mode . the satellite carries a c - band sar . in this paper , confusion matrix analysis of radarsat-2 data has been examined for various feature classification . many studies have been undertaken for classification using radarsat-2 till date . they include classification of terrain classes using random forest@xcite , ship detection@xcite@xcite , oil slick characterization@xcite , crop monitoring of rice in china@xcite and identification of potato and rice fields using radarsat-1 in [email protected] work like ice - monitoring@xcite and mapping of seasonal floods in wetland forests of brazil has yielded promising results@xcite . research on classification using multi - temporal data sets of radarsat-2 is also being carried out using different classification algorithms coupled with various functions . here for the study , we utilize the data set consisting the greater vancouver area , canada . the test site is very diverse in nature consisting a wide variety of features to classify . the area consists of urban settlements including richmond area , rotated urban areas west to new westminster . rugged mountains in northern vancouver , rivers merging to the strait of georgia and crop - lands in the fraser river delta . radarsat-2 data has been acquired on may 2008 over vancouver area in full polarimetric mode . ground - truth parameters was also collected synchronous with the satellite pass . near range incidence angle is @xmath0 and far range incidence angle is @xmath1.the dataset of radarsat-2 was acquired in fine quad mode with q15 beam . it has been captured in descending pass direction inferring the snap is recorded on the sunlit side as the orbit of the sar system is sun - synchronous the coherency matrix * t * of @xmath2 is generated . beside @xmath3 matrix , additional polarimetric information like @xmath4 coefficients for target decomposition are computed for performing classification based on wishart distribution @xcite . speckle is a kind of noise that appears in data obtained through sar systems . speckle reduces with multi - looking images . therefore , we have applied a @xmath2 look using lee filter to remove noise keeping loss of information minimum . the coherency matrix t is computed through a scattering vector in the base of pauli that demonstrate geometrical properties.the equation is given by and is in accordance to @xcite @xmath5 @xmath6=k_{p}.k_{p}^{*t}\ ] ] after decomposition from @xcite the @xmath7 entropy shows the wave polarization , where as @xmath8 or anisotropy is a difference between the second and third eigenvalue especially significant for the range @xmath9 . the @xmath10 parameter is an important component because it gives the wave reflection mechanisms over the considered pixels . it characterizes the single bound , double bound and volume scattering . the t matrix elements especially dedicated to sar data involves the wishart classification as because the presence of speckle noise in the data set account for the wishart distribution . the polarimetric information for mono - static case is define by the target vector @xmath11 @xmath12 in the multi - look data that is @xmath2 case we represent the data by a polarimetric covariance matrix @xmath13 @xmath14 where @xmath15 is nothing but @xmath16th sample of @xmath11 , the superscript * in the equation denote the complex conjugate where as the number of looks ( samples ) is given by @xmath17 . as per wishart distribution the covariance matrix could be expressed as : @xmath18 with @xmath19 where @xmath20 represents the gamma function and @xmath21 is the trace of the given matrix . the @xmath22 denotes the number of elements of the obtained target vector @xmath11 ( it is generally 3 for mono - static and 4 for the bi - static ) . lastly , the @xmath17 represent the number of looks . it is to be noted that the wishart classification consist in a maximum likelihood classification based on a wishart distribution . the support vector machine ( svm ) are models of supervised learning that basically analyse data used for classification and regression analysis . the work here coincide with @xcite and @xcite . _ linear case : _ with @xmath23 training samples , the case of two classes problem is considered . every sample is described by a support vector @xmath24 consisting of different `` band '' having @xmath17 dimensions . a sample is labelled as @xmath25 . here , we shall consider the first class label as -1 and other as + 1 . the svm classifier consist in defining the function @xmath26 that found the optimum separating hyperplane as presented in the label from sample gives the sign of @xmath27 . the target of the svm is to maximize the margin between the support vector and the optimal hyperplane . thus , we look for the @xmath28 . for executing this , we tend to use the lagrange multiplier @xmath29 where lagrange multiplier is @xmath30 . _ nonlinear case : _ in non - linear as the fig . the solution involves first to develop soft margin that is adapted to data containing noise . the next solution of svm is to utilize a kernel . the kernel in this context is a function where the projection of the initial data is simulated in a space feature with greater dimension @xmath31 . in this new space the information are considered as separable linearly . thus , the dot product @xmath32 is replaced by @xmath33 the classification turns to be @xmath34 in general three types of kernels are used + 1 . polynomial kernel @xmath35 2 . sigmoid kernel @xmath36 3 . rbf kernel @xmath37 in accordance to the nature of this work , the rbf kernel is used as because it yields the best result . for classification using supervised wishart and svm classifiers , @xmath3 matrix elements of sar data is processed . for svm , lib - svm @xcite is applied . the radial basis function ( rbf ) kernel @xmath38 is 0.444 and the cost is 100 . in both the processes , we select training areas in accordance with the ground truth . nine test areas representing the type of terrain cover present in the area were selected . the classes included urban , water and non - urban . significant pixel density were selected for every class and the standard and mean deviation of the back - scattering were also calculated . same training set is used for both the classifiers . training cluster maps are generated for different classes for each classifier . confusion matrix is calculated and generated for every class from svm and wishart polarimetric segmentation . .svm confusion matrix with overall classification accuracy ( in % ) [ cols="<,^,^,>",options="header " , ] the rows represent the user defined clusters columns represent the segmented clusters . a number located at a position @xmath39 represents the amount of pixels in percent belonging to the user defined area @xmath40 that were assigned to cluster @xmath41 during the supervised classification . the results through the confusion matrices shows that the performance by the wishart is little better than the svm . but generally svm is the best from the other as we see from @xcite.this may be because of the training areas computed for classification . fully polarimetric data has significant contribution for urban and tropical vegetation cartography . for full polarimetric mode ( swath 2x bigger ) , dual polarimetry and particularly @xmath42 turns out to be a good compromise .wishart can be a good potential for polsar data classification for very few cases . the author would like to thank mr . shaunak de for helping to understand on sar and mda corporation for providing rs2 sample data of vancouver site . charbonneau , b. brisco , r.k . raney , h. mcnairn , c. liu , p.w . vachon , j. shang , r. deabreu , c. champagne , a. merzouki , t. geldsetzer `` compact polarimetry overview and applications assessment '' _ canadian journal of remote sensing _ , 36 , sup2 , s298s315 , 2010 p. du , a. samat , b. waske , s. liu , z. li . `` random forest and rotation forest for fully polarized sar image classification using polarimetric and spatial features . '' _ isprs journal of photogrammetry and remote sensing_. 2015 jul 31;105:38 - 53 . r. touzi , j. hurley and p. w. vachon , `` optimization of the degree of polarization for enhanced ship detection using polarimetric radarsat-2 , '' in _ ieee transactions on geoscience and remote sensing _ , vol . 5403 - 5424 , oct . g. staples and r. touzi . `` the application of radarsat-2 quad - polarized data for oil slick characterization . '' in _ international oil spill conference proceedings _ , vol . 2014 , no . 2242 - 2252 . american petroleum institute , 2014 . f. wu , c. wang , h. zhang , b. zhang and y. tang , `` rice crop monitoring in south china with radarsat-2 quad - polarization sar data , '' in _ ieee geoscience and remote sensing letters _ , vol . 196 - 200 , march 2011 . s. panigrahy , k.r . manjunath , m. chakraborty , n. kundu , j.s . `` evaluation of radarsat standard beam data for identification of potato and rice crops in india '' . _ isprs journal of photogrammetry and remote sensing_. 1999 sep 30;54(4):254 - 62 . t. l. evans , m. costa , k. telmer and t. s. f. silva , `` using alos / palsar and radarsat-2 to map land cover and seasonal inundation in the brazilian pantanal , '' in _ ieee journal of selected topics in applied earth observations and remote sensing _ , vol . 560 - 575 , dec . 2010 . lardeux , c. , frison , p. , tison , c. , deleflie , d. , souyris , j. , rudant , j. and stoll , b. `` comparison of compact polarimetric with full polarimetric radar data for land use discrimination based on svm classification '' . _ in proc . of the 3rd international workshop on science applications of sar polarimetry and polarimetric interferometry_. polinsar ( vol .

the pixel percentage belonging to the user defined area that are assigned to cluster in a confusion matrix for radarsat-2 over vancouver area has been analysed for classification . in this study , supervised wishart and support vector machine ( svm ) classifiers over radarsat-2 ( rs2 ) fine quad - pol mode single look complex ( slc ) product data is computed and compared . in comparison with conventional single channel or dual channel polarization , radarsat-2 is fully polarimetric , making it to offer better land feature contrast for classification operation . + wishart , support vector machine ( svm ) , confusion matrix

(CNN) White House press secretary Sarah Sanders is expected to receive Secret Service protection as soon as Wednesday, two sources familiar with the decision tell CNN, but they did not specify how long it will last. The Secret Service declined to comment, telling CNN: "For operational security purposes the Secret Service does not comment on its protective operations." The news comes days after Sanders was asked to leave a small Lexington, Virginia, restaurant because of her role with the Trump administration, a move that has since sparked a national conversation on civility and public service in the age of Trump. Sanders did not immediately respond to a CNN request for comment. Read More ||||| White House press secretary Sarah Sanders will begin receiving Secret Service protection as soon as tomorrow, according to NBC News and CNN, marking an unusual level of protection for what has traditionally been a low-threat job. No reason was given as to the extension of protection to Sanders. The Secret Service told CNN, “For operational security purposes the Secret Service does not comment on its protective operations.” Sanders didn’t provide comment to news organizations. The Secret Service typically protects the president, vice president, their immediate families, former presidents (along with spouses and children under 16), foreign heads of states, and major presidential and vice-presidential candidates and spouses. Press secretaries are not generally on the list. The Trump Administration has been criticized over Secret Service costs due to the large size of Trump’s immediate family and his frequent travel to his Florida resort, Mar-a-Lago, to play golf and meet with guests. Over the weekend, the owner of Red Hen, a restaurant in Lexington, Va., asked Sanders to leave because of differences with her politics. President Donald Trump later castigated the restaurant on Twitter, saying that the restaurant’s exterior was dirty. The restaurant has also received thousands of negative Yelp reviews. Unaffiliated restaurants with the same name have received calls threatening murder. ||||| White House press secretary Sarah Sanders will receive U.S. Secret Service protection at her home on a temporary basis, sources familiar with the matter tell CBS News. The anticipated protection comes after Sanders, one of the most visible members of Mr. Trump's White House, was refused service at the Red Hen restaurant in Lexington, Virginia, Friday night. Sanders said she was told to leave the restaurant in a tweet Saturday, and the incident snowballed to dominate social media and much of the news cycle. The Secret Service is not commenting on the matter of Sanders' home protection, which was first reported by NBC News. Sources said it is possible other White House staff members will receive similar protection. President Trump can personally sign off on additional protections for members of the White House staff. Last week, protesters confronted Homeland Secretary Secretary Kirstjen Nielsen outside a Mexican restaurant in Washington. Senate Majority Leader Mitch McConnell and his wife, Transportation Secretary Elaine Chao, were confronted by a small group of protesters Tuesday evening. The Sanders incident in particular has renewed debates about political civility. Jeff Pegues contributed reporting. ||||| Add this Tweet to your website by copying the code below. Saber máis Add this video to your website by copying the code below. Saber máis Vaites, produciuse un problema na conexión co servidor. Queres tentalo de novo? Incluír o chío pai Incluír multimedia Ao inserires contido de Twitter no teu sitio web ou na túa aplicación, aceptas o Acordo de programadores e a Normativa de programadores. Previsualizar

– In what may be a first in US history, the White House press secretary is reportedly going to receive protection from the Secret Service. A source tells NBC News that the service will protect the home of Sarah Sanders on a temporary basis starting Wednesday. President Trump has the power to sign off on Secret Service protection for any staff member, and sources tell CBS News that it is possible that he will grant extra protection to other high-profile employees soon. The move comes as controversy rages after the Red Hen restaurant in Virginia refused to serve Sanders last Friday. Democratic Rep. Maxine Waters later called for the public to confront members of the Trump administration whenever they could. The Secret Service won't say whether it is protecting Sanders. "For operational security purposes the Secret Service does not comment on its protective operations," a spokesperson tells CNN. The Secret Service usually protects current and former presidents and their families, along with foreign heads of state and major presidential candidates, reports Fortune, which calls it an "unusual level of protection" for a press secretary. Congressional leaders and Cabinet members also sometimes receive Secret Service protection. (Elaine Chao and husband Mitch McConnell were confronted by protesters Monday night.)

The brand-new Twitter account belonging to the office of the First Lady posted a photo earlier today of Michelle Obama talking to some guy. You’re like, “Enough about that random guy already!” We know, we know! Michelle Obama—there’s just no other way to put this—got bangs. So, like, O.K., first things first: they obviously look great. Michelle Obama is a tremendously pretty person whose hair is one of her top-10 best physical attributes. It’s shiny and healthy and thick, so upping its prominence on her face is an excellent idea. The bangs are also short enough that they don’t obscure her face—the way mothers are always saying their daughters’ bangs do—which is a relief, since her lovely face also ranks amongst her top-10 best physical attributes. As for the bangs themselves: they’re less blunt and more feathery, which helps combat any appearance of hair heaviness. They’re also longer at the sides than in the direct center of the forehead—a flattering cut for most face shapes. In the taxonomy of bangs, their genealogical ancestry is like this: ||||| Unveiled, the First Fringe: Michelle Obama debuts 1970s-style haircut as she turns 49 What did Michelle Obama, who turned 49 on Thursday, get for her birthday? Apparently, a whole new hairdo' and Twitter account. The First Lady unveiled the White House fashion first last night - a 1970s-style fringe which shows she is clearly in touch with trends. The President's wife appears to be following the example of famous figures such as the Duchess of Cambridge, singer Beyonce and reality star Kim Kardashian with her new look. Using her new Twitter identity, @FLOTUS, the second tweet revealed her new blunt bob, with heavy bangs. Scroll down for video New year, new look: The First Lady unveiled her bangs on her 49th birthday last month via Twitter Dressed in a burnt-red, elbow-sleeved patterned jersey dress, she showed off her new hairstyle, also reminiscent of Katie Holmes' chop in 2008, when she met with Inaugural citizen co-chair David Hall earlier yesterday. Mrs Obama has always had shoulder length hair, but since her entry into the White House in 2008, she has so far preferred to keep her look loose and flowing - or tied back. Her new cut, sharper, more sophisticated, comes in the wake of supermodel Karlie Kloss' new bob, after she cut off seven inches of hair late last year. The New York Times coined this return to shorter hair, 'The Karlie,' last night. So far the response to Mrs Obama's new do' has been positive, with thousands of Twitter users agreeing in unison that they 'love' her new bangs. Loose and lovely: Mrs Obama has always had shoulder length hair, but since her entry into the White House in 2008, has so far preferred to keep her look loose and flowing Low-key glamour: Mrs Obama often paired pearls and day dresses with pulled back, wavy short hair In an age of the overused term 'style icon,' Mrs Obama proves again she is one of the few modern women to deserve it. In the past four years she has adeptly walked - usually in kitten heels or ballet flats - the line between directional fashionista and everywoman. 'Just like any woman, she wants to look pretty, and I think she's having fun with it. It must be fun to be a girl with a big White House closet,' said Kevan Hall, a Los Angeles-based designer that Mrs Obama has worn before. Traveling in style: The moment she's probably the most relaxed in her style is coming on and off Air Force One, where she would tie her hair back or put it in a headband Winning look: Michelle Obama in Narciso Rodriguez at the election night rally in Chicago on November 4 2008, her hair shoulder-length and loose She also makes 'conscious choices' about what she's going to wear, knowing that people will take note - and read into it, he says. 'Of course she thinks about it,' agrees InStyle's Foxman, 'but she isn't preoccupied by it. She thinks about it in the way that everyone else does.' ||||| Lawrence Jackson/White House First Lady Michelle Obama shows off her new ’do and sassy bangs Thursday at an Inauguration reception at White House. In the last few years alone, Obama has sported plenty of different hairstyles. What will it look like on Monday? First Lady Michelle Obama celebrated her 49th with birthday bangs Thursday. Mrs. O unveiled a chic, youthful new ’do and launched a new Twitter account, @FLOTUS, to mark the day — a birthdate she shares with Muhammad Ali, Betty White, Ben Franklin and Al Capone. Her bangtastic new coif, a sleek shoulder-length cut with thick, heavy bangs, previews her hotly anticipated Inauguration Day ensemble. PHOTOS: MICHELLE OBAMA -- FIRST LADY OF STYLE “Michelle looks beautiful with her new cut,” said celebrity hairstylist Oscar Blandi. “The bangs and bob style are feminine and flatter her. This is a classic look with a modern sensibility, and I think she looks gorgeous.” “Her bangs are right on trend, bangs are back with a softer edge. The bangs give her bob and update with a fresh crisp finish!” Jewel Samad/Getty Images Michael Buckner/Getty Images The First Lady’s office tweeted a photo of the Zac Posen-clad Mrs. O and her trendy new look on Thursday. Johnny Lavoy, a consulting hair expert with L'Oreal Paris consulting hair expert wanted to set the record straight: The First Lady is no stranger to forehead fringe. “She been wearing versions of a soft side swept bang for some time," he said. " Her new bold bang is both chic and modern, just like our First Lady.” Previously, the First Lady had sported loose curls, elegant up ’dos and sensible Mom-in-Chief blowouts. Twitter via @FLOTUS Beauty buffs and style experts are saying out with old look and in with the new. "She looks amazing! I love the way it frames her face and accentuates her eyes and her cheekbones," said Louise O'Connor, owner of Upper East Side salon OC61 Salon & Spa. "It gives her a softer, sexier look, and it's more youthful than her old hairdo. With the new term and the inauguration this weekend, it makes sense that she went with a fresh, fashion-forward to reinvigorate her fans." Want to get her look? Blow dry your hair straight toward your face using a big, round brush. Smooth frizz and flyaways by finishing off with a straightening iron, then use a product with slight hold. O'Connor likes Black 15 in1 Miracle Hair Treatment, which will also "enhance shine." Brendan Smialowski/Getty Images Chris Jackson/Getty Images Click for video

– Michelle Obama kicked off her new Twitter account (@FLOTUS) and her 49th birthday with a new hairdo yesterday, sending the Internet into a tizzy over her bangs. It's a departure for the first lady, who usually sports a loose semi-bob or pulls her hair back tightly. But what do fashionistas think? "Bangtastic," writes the New York Daily News, calling her new look "a chic, youthful new 'do." "We're loving Michelle's new look!" writes E! Online. "Super cute, Michelle O.!" is Vanity Fair's verdict, noting her bangs descend from a lineage that includes Brigitte Bardot and Taylor Swift. "In an age of the overused term 'style icon,' Mrs. Obama proves again she is one of the few modern women to deserve it," writes the Daily Mail.

Photo: Paul Morigi/Getty Images for Capitol Concert Former secretary of State Colin Powell is supporting former secretary of State Hillary Clinton for president, the retired four-star Army general announced today at the fall luncheon for the Long Island Association. “She is balanced, she has temperament, and no matter what anyone says she has stamina,” Powell told a crowd of 1,000 business and political types in Woodbury. “I think she is fully qualified to serve as the president of the United States and will serve it with distinction.” But Powell didn’t just praise Clinton. He also ripped into Donald Trump, whom Powell says is “not qualified” and is selling Americans a “bill of goods.” Also, he has insulted a lot of people. “He has insulted Latino-Americans. He has insulted African-Americans. He has insulted women. He has insulted his own party. He has insulted our allies around the world one by one. He has insulted veterans,” Powell said. And later tonight, after Trump sees this news and gets on Twitter, Powell will be able to add himself to that distinguished list. ||||| Former Secretary of State Colin Powell, who served in three Republican White Houses, said Tuesday that he will vote for Democratic nominee Hillary Clinton. “She is smart, she is capable, she was a good secretary of State,” Powell said, according to Newsday. “She is balanced, she has temperament and no matter what anyone says, she has stamina ... I think she is fully qualified to serve as the president of the United States and will serve it with distinction.” Powell said GOP nominee Donald Trump was unqualified, and cited his insults of Latinos, African Americans, women, fellow Republicans, America’s allies and veterans. “He has insulted America in one way almost every day,” Powell said, speaking at the annual fall luncheon of the Long Island Assn. Powell is a Republican but this is not the first time he has broken with his party. He caused an uproar when he endorsed then-Sen. Barack Obama in 2008 over Sen. John McCain. The retired four-star general also created headlines earlier this year when his email was hacked and his unvarnished thoughts on Trump and Clinton were revealed. Powell called Trump a “national disgrace” and an “international pariah,” and noted his role in the birther movement, which Powell called “racist.” In the emails, Powell described Clinton as a respected friend, but also someone he would rather not vote for. “Everything [Clinton] touches, she kind of screws up with hubris," he wrote.

– Hillary Clinton secured the support of a fellow former secretary of state on Tuesday when Colin Powell announced he would be voting for her, New York magazine reports. "She is balanced, she has temperament, and no matter what anyone says she has stamina," the retired four-star general said. "I think she is fully qualified to serve as the president of the United States and will serve it with distinction." As for Donald Trump, Powell said he isn't qualified: "He has insulted Latino-Americans. He has insulted African-Americans. He has insulted women. He has insulted his own party. He has insulted our allies around the world one by one. He has insulted veterans." The Los Angeles Times notes that Powell was critical of both sides in emails leaked earlier this year. He called Trump a "national disgrace" involved in the "racist" birther movement. He also said, "Everything [Clinton] touches, she kind of screws up with hubris." Powell served in three Republican administrations but endorsed Barack Obama in 2008.

autism spectrum disorder ( asd ) is characterized by behavioral , cognitive and language impairment . over the past decade , studies on monogenetic syndromes with high prevalence of asd , such as fragile x ( fx ) and tuberous sclerosis ( ts ) , have provided insights into the pathophysiology of diseases that can cause autism . for example , it has been shown that altered signaling downstream of metabotropic glutamate receptor 5 ( mglur5 ) plays a pivotal role in the pathogenesis of fx , and that genetic and pharmacological modulation of mglur5 can ameliorate numerous impairments in fx animal models . chromosomal copy number variations ( cnvs ) have been associated with 510% of patients with asd . variation at human chromosome 16p11.2 is the most common of these and accounts for approximately 0.51% of all asd cases . the affected region harbors ~27 annotated protein - coding genes , many of which are expressed in the brain . the common clinical presentations in individuals carrying chr16p11.2 microdeletion are language impairment , intellectual disability ( i d ) , asd , anxiety , attention deficit hyperactive disorder ( adhd ) , and epilepsy . recent studies on animal models of human chr16p11.2 microdeletion have demonstrated morphological , behavioral and electrophysiological deficits , however the synaptic pathophysiology remains largely unexplored . using electrophysiology , biochemistry and behavioral tests we characterized hippocampal function of a mouse model for human chr16p11.2 microdeletion . we uncovered alterations in mglur5-mediated synaptic plasticity , arc expression , basal protein synthesis , and hippocampus - dependent learning that are reminiscent of previous observations in mouse models of syndromic autism and i d . importantly , we were able to ameliorate the behavioral abnormalities using an mglur5 negative allosteric modulator ( nam ) , 2-chloro-4-((2,5-dimethyl-1-(4-(trifluoromethoxy)phenyl)-1h - imidazol-4-yl)ethynyl)pyridine ( ctep ) , suggesting a pathophysiology shared with fx . mutant mice ( termed 16p11.2 df/+ ) , engineered to be heterozygous null at the region of chromosome 7qf3 that is syntenic to human chromosome 16p11.2 , were back - crossed for 510 generations to c57bl/6n mice ( charles river ) to allow a comparison of synaptic physiology with previous studies . as noted previously , loss of the genes in this region can compromise survival , and we found that this effect was amplified in successive generations on the c57bl/6n background ( supplementary fig . we first characterized basal synaptic transmission at the schaffer collateral - ca1 synapse using hippocampal slices from 45 week old mice and found no difference from wild type ( wt ) in input - output or paired - pulse facilitation ( ppf ) ( supplementary fig . 2 ) . to investigate nmda receptor - dependent synaptic plasticity , we induced long - term potentiation ( ltp ) with theta - burst stimulation ( tbs ) , and long - term depression ( ltd ) with low - frequency ( 1 hz ) stimulation ( lfs ) . b ) , suggesting basic excitatory synaptic transmission and plasticity mechanisms are intact in the mutant mice . mglur - ltd was induced either by brief application of the mglur1/5 agonist s-3,5-dihydroxyphenylglycine ( dhpg ) or by applying a series of paired pulses at 50 ms interval ( pp - lfs ) . we again found no difference between wt and the 16p11.2 df/+ mutant with either induction protocol ( fig . f ) . a distinctive property of mglur - ltd in wt animals is a requirement for mrna translation at the time of induction . in slices from fmr1 mice , however , mglur - ltd is unaffected by translation inhibitors because basal synaptic synthesis of ltd - regulatory proteins such as arc is elevated downstream of constitutive mglur5 activity due to loss of the translational repressor fmrp . we were therefore compelled to investigate the protein synthesis - dependence of mglur ltd in the 16p11.2 df/+ mice , and discovered a striking difference from wt . like fx model mice , mglur - ltd in the 16p11.2 df/+ mice was unaffected by cycloheximide ( chx ) ( fig . as reported previously in wt animals , dhpg induces ltd via two mechanisms : a postsynaptic reduction in ampa receptors and a presynaptic reduction in glutamate release probability . only the postsynaptic mechanism is chx sensitive . to test whether the different sensitivity of ltd to chx in the mutant was due to a qualitatively different expression mechanism , we analyzed ppf at the beginning and end of each dhpg - ltd experiment . these findings point to a deficiency in postsynaptic regulation of protein synthesis in the 16p11.2 df/+ mice . we next tested the mutant mice in two hippocampus - dependent behavioral assays , contextual fear conditioning ( cfc ) and inhibitory avoidance ( ia ) , which have been shown in previous studies to reveal cognitive impairments in fmr1 mice . cfc requires intact mglur5 signaling and new protein synthesis at the time of conditioning . in this assay , mice are exposed to a distinctive environmental context in which a foot - shock is delivered , and 24 h later the mice are returned to either the same ( familiar ) or a different ( novel ) context ( fig . wt mice expressed fear memory by freezing in the familiar context , and demonstrated an ability to discriminate different contexts by freezing less in the novel context . in contrast , the mutant mice showed significantly less freezing in the familiar context , and were unable to distinguish between the familiar and novel context ( fig . 2c ) , suggesting the difference in freezing at 24 h was due to an impairment in memory formation in the mutant mice . in the ia assay , mice received a foot shock upon entry into the dark side of a two - chamber box ( fig . memory strength and extinction were measured as the latency to enter the dark side when given the opportunity at 6 , 24 , and 48 h intervals . similar ia deficits in fmr1 mice have been ameliorated by chronic post - adolescent treatment with the mglur5 nam ctep . therefore we repeated the ia assay on wt and mutant mice that were treated every second day with ctep ( 2 mg / kg p.o . ) or vehicle for 4 weeks . although treatment had no effect in the wt mice , it corrected the deficits in the mutants both in terms of acquisition and extinction ( fig . we were motivated to investigate the possibility that fx and 16p11.2 microdeletion have shared pathophysiology for several reasons , including the fact that four deleted genes are targets of fmrp ( maz , sez62l , taok2 , aldoa ) and disruption of several genes in this region are predicted to affect mglur5 signaling ( mvp , cdipt , mapk3 ) or protein turnover ( kctd13 ) . the most straightforward prediction from our results is that synaptic protein synthesis downstream of mglur5 is exaggerated by the 16p11.2 microdeletion , and this gives rise to cognitive impairment . in the fmr1 mouse , however , we found that basal protein synthesis in hippocampal slices in the 16p11.2 df/+ mice was reduced , possibly explained by the decrease in erk pathway activity ( fig . therefore , constitutive elevation of arc could render mglur - ltd insensitive to acute inhibition of protein synthesis and contribute to cognitive impairment . first , the data suggest that some cognitive and neuropsychiatric symptoms of 16p11.2 microdeletion disorder arise from altered synaptic signaling that is amenable to targeted drug therapy . second , the data strengthen the hypothesis that multiple causes of asd and i d converge on common pathophysiological processes , and one of these is the synaptic regulation of protein synthesis .

human chromosome 16p11.2 microdeletion is the most common gene copy number variation in autism , but the synaptic pathophysiology caused by this mutation is largely unknown . here we show using a mouse with the same genetic deficiency that metabotropic glutamate receptor 5-(mglur5- ) dependent synaptic plasticity and protein synthesis is altered in the hippocampus , and that hippocampus - dependent memory is impaired . remarkably , chronic treatment with a negative allosteric modulator of mglur5 reverses the cognitive deficit .

let @xmath0 be a prime power , @xmath1 be the finite field with @xmath0 elements and @xmath2 be the degree @xmath3 extension of @xmath1 . the multiplication of two elements of @xmath2 is a application from @xmath4 onto @xmath2 . then it can be considered as an application from the tensor product @xmath5 onto @xmath2 . consequently it can be also considered as an element @xmath6 of @xmath7 , namely an element of @xmath8 . more precisely , when @xmath6 is written @xmath9 where the @xmath10 elements @xmath11 and the @xmath10 elements @xmath12 are in the dual @xmath13 of @xmath2 and the @xmath10 elements @xmath14 are in @xmath2 , the following holds for any @xmath15 : @xmath16 the decomposition ( [ tensor ] ) is not unique and neither is the length of these decompositions , thus we set : the minimal number of summands in a decomposition of the tensor @xmath6 of the multiplication is called the bilinear complexity of the multiplication in @xmath2 over @xmath1 and is denoted by @xmath17 : @xmath18 hence the bilinear complexity of the multiplication in @xmath2 over @xmath1 is nothing else than the rank of the tensor @xmath6 . among others , a special case of decompositions for @xmath6 is of particular interest , namely the symmetric decompositions : @xmath19 the minimal number of summands in a symmetric decomposition of the tensor @xmath6 of the multiplication is called the symmetric bilinear complexity of the multiplication in @xmath2 over @xmath1 and is denoted by @xmath20 : @xmath21 one easily gets that @xmath22 . some cases where @xmath23 are known but to the best of our knowledge , no example where @xmath24 has already been exhibited . however , better upper bounds have been established in the asymmetric case @xcite and this may suggest that in general the asymmetric bilinear complexity of the multiplication and the symmetric one are distinct . in any case , at the moment , we must consider separately these two quantities . remark that from an algorithmic point on view as well as for some specific applications , a symmetric bilinear algorithm can be more interesting than anasymmetric one , unless if _ a priori _ , the constant factor in the bilinearcomplexity estimation is a little worse . moreover , many other research domains are closely related to the determination of symmetric bilinear multiplicationalgorithms such as , amoung others , arithmetic secret sharing and multipartycomputation ( see @xcite ) the bilinear complexity @xmath25 of the multiplication in the @xmath3-degree extension of a finite field @xmath1 is known for certain values of @xmath3 . in particular , s. winograd @xcite and h. de groote @xcite have shown that this complexity is @xmath26 , with equality holding if and only if @xmath27 . using the principle of the d.v . and chudnovsky algorithm @xcite applied to elliptic curves , m.a . shokrollahi has shown in @xcite that the symmetric bilinear complexity of multiplication is equal to @xmath28 for @xmath29 where @xmath30 is the function defined by : @xmath31 later in @xcite , the study made by m.a . shokrollahi has been generalized to algebraic function fields of genus @xmath32 . + let us recall that the original algorithm of d.v . and g.v . chudnovsky introduced in @xcite is symmetric by definition and leads to the following theorem obtained in @xcite : let @xmath0 be a power of a prime @xmath33 . the symmetric tensor rank @xmath34 of multiplication in any finite field @xmath2 is linear with respect to the extension degree ; more precisely , there exists a constant @xmath35 such that : @xmath36 general forms for @xmath35 have been established such as the following best current known estimates : @xmath37 now we introduce the generalized chudnovsky - chudnovsky type algorithm described in @xcite ; the original algorithm given in @xcite by d.v . and g.v . chudnovsky being the case where @xmath38 and @xmath39 for @xmath40 . here a wider notion of complexity is involved : the quantity @xmath41 , which corresponds to the symmetric bilinear complexity of the multiplication over @xmath42 in @xmath43/(x^\ell)$ ] , the @xmath1-algebra of polynomials in one indeterminate with coefficients in @xmath44 truncated at order @xmath45 . [ theo_evalder ] let * @xmath0 be a prime power , * @xmath46 be an algebraic function field , * @xmath47 be a degree @xmath3 place of @xmath48 , * @xmath49 be a divisor of @xmath48 , * @xmath50 be a set of @xmath51 places of arbitrary degree , * @xmath52 be positive integers . we suppose that @xmath47 and all the places in @xmath53 are not in the support of @xmath49 and that : a. the map @xmath54 is onto , b. the map @xmath55 is injective , where the application @xmath56 is defined by @xmath57 with @xmath58 , the local expansion at @xmath59 of @xmath60 in @xmath61 , with respect to the local parameter @xmath62 . note that we set @xmath63 . then @xmath64 the following special case of this result has been introduced independently by n. arnaud in @xcite , and can be seen as a corollary of theorem [ theo_evalder ] by gathering the places used with the same multiplicity ; namely one has to set for @xmath65 and @xmath66 , @xmath67 . [ theo_deg12evalder ] let * @xmath0 be a prime power , * @xmath48 be an algebraic function field , * @xmath47 be a degree @xmath3 place of @xmath48 , * @xmath68 be a divisor of @xmath48 , * @xmath69 be a set of @xmath70 places of degree + one and @xmath71 places of degree two , * @xmath72 and @xmath73 be two integers . we suppose that @xmath47 and all the places in @xmath53 are not in the support of @xmath68 and that : a. the map @xmath74 is onto , b. the map @xmath75 is injective . then @xmath76 from the results of ( * ? ? ? * corollary 2.1 ) and ( * ? ? ? * theorems 2.3 and 2.3 ) and the algorithm of corollary [ theo_deg12evalder ] with @xmath77 , we obtain : [ theoprinc ] let @xmath0 be a prime power and let @xmath3 be an integer @xmath78 . let @xmath48 be an algebraic function field of genus @xmath32 and @xmath79 the number of places of degree @xmath80 in @xmath48 . if @xmath81 is such that @xmath82 then : 1 . if @xmath83 , then @xmath84 2 . if there exists a non - special divisor of degree @xmath85 and @xmath86 , then @xmath87 3 . if @xmath88 , then @xmath89 to conclude , we recall some particular exact values for @xmath90 wich will be useful for computational use : @xmath91 for any prime power @xmath0 , @xmath92,@xmath93 and @xmath94 @xcite . in this paper , we prove new uniform bounds for the symmetric bilinear complexity , namely the following ones : [ theo_arnaud1 ] let @xmath95 be a power of the prime @xmath33 . then : a. if @xmath96 , then @xmath97 . + + b. if @xmath96 , then @xmath98 . + + c. if @xmath99 , then @xmath100 . + + d. if @xmath99 , then @xmath101 . * remark . * even if bound ( i ) was established by arnaud in @xcite it has never been published in any journal , and the proof that is given in this paper is more complete than the one that can be found in @xcite . moreover , bound ( ii ) is an amelioration of since it holds for @xmath102 whereas arnaud s bound in ( * ? ? ? * theorem 5.9 ) holds for @xmath103 . furthermore , arnaud also gave bounds which are similar to bounds ( iii ) and ( iv ) in ( * ? ? ? * theorems 5.13 and 5.12 ) with respectively @xmath104 and @xmath105 as denominators . unfortunatly , these denominators are slightly overestimated under arnaud s hypotheses and no calculation is given to prove these bounds . thus we will give a corrected version of these bounds with detailed proofs . + in the last part of this paper , we discuss the validity of certain published bounds and explain why some of them should not be considered as proven . in this section , we introduce some towers of algebraic function fields.theorem [ theoprinc ] applied on the algebraic function fields of these towers gives us bounds for the bilinear complexity . a given curve can not permit to multiply in every extension @xmath2 of @xmath1 , but only for @xmath3 lower than some value . with a tower of function fields , we can adapt the curve to the degree of the extension . the important point to note here is that in order to obtain a well adapted curve it will be desirable to have a tower for which the quotients of two consecutive genus are as small as possible , namely a dense tower . for any algebraic function field @xmath48 defined over the finite field @xmath1 , we denote by @xmath106 the genus of @xmath48 and by @xmath107 the number of places of degree @xmath80 in @xmath48 . we present now a modified garcia - stichtenoth tower ( cf . @xcite ) having good properties . let us consider a finite field @xmath108 with @xmath109 and let @xmath110 be the garcia - stichtenoth elementary abelian tower over @xmath108 constructed in @xcite and defined by the sequence @xmath111 where @xmath112 and @xmath113 satisfies the equation : @xmath114 with @xmath115 moreover @xmath116 is the rational function field over @xmath108 and @xmath117 the hermitian function field over @xmath108 . let us denote by @xmath118 the genus of @xmath119 , we recall the following _ formulae _ : @xmath120 let us consider the completed garcia - stichtenoth tower @xmath121 considered in @xcite such that @xmath122 for any integer @xmath123 , where @xmath124 and @xmath125 . recall that each extension @xmath126 is galois of degree @xmath127 with full constant field @xmath108 . now , we consider the tower studied in @xcite : @xmath128 defined over the constant field @xmath1 and related to the tower @xmath129 by : @xmath130 namely @xmath131 is the constant field extension of @xmath132 . note that the tower @xmath133 is well defined by @xcite and @xcite . moreover , we have the following result : [ subfield ] let @xmath134 be a prime power . for all integers @xmath135 and @xmath136 , there exists a step @xmath137 ( respectively @xmath132 ) with genus @xmath138 and @xmath139 rational places in @xmath137 ( respectively @xmath140 ) such that : 1 . @xmath122 , where we set @xmath124 and @xmath125 , + ( respectively @xmath141 , where we set @xmath142 and @xmath143 ) , 2 . @xmath144 , 3 . @xmath145 . in this section , we present a garcia - stichtenoth tower ( cf . @xcite ) having good properties . let @xmath1 be a finite field of characteristic @xmath146 . let us consider the tower @xmath6 over @xmath1 which is defined recursively by the following equation , studied in @xcite : @xmath147 the tower @xmath148 is represented by the sequence of function fields @xmath149 where @xmath150 and @xmath151 holds for each @xmath152 . note that @xmath153 is the rational function field . for any prime number @xmath154 , the tower @xmath155 is asymptotically optimal over the field @xmath156 , i.e. @xmath155 reaches the drinfeld - vladut bound . moreover , for any integer @xmath80 , @xmath157 is the constant field extension of @xmath158 . from @xcite , we know that the genus @xmath159 of the step @xmath160 is given by : @xmath161 and that the following bounds hold for the number of rational places in @xmath160 over @xmath156 and for the number of places of degree 1 and 2 over @xmath162 : @xmath163 and @xmath164 from the existence of this tower , we can obtain the following proposition @xcite : [ propoexistcf2 ] let @xmath99 be a prime number . then for any integer @xmath165 where @xmath166 is defined as in theorem [ thm_shokr ] : 1 . there exists an algebraic function field @xmath157 of genus @xmath167 such that @xmath168 and @xmath169 2 . there exists an algebraic function field @xmath170 of genus @xmath171 containing a non - special divisor of degree @xmath172 and such that @xmath173 and @xmath174 here we establish some technical results about the genus and number of places of each step of the towers @xmath175 , @xmath176 , @xmath155 and @xmath177 defined in section [ sectdeftowers ] . these results will allow us to determine a suitable step of the tower to apply the algorithm on . in this section , @xmath178 is a power of the prime @xmath33 . [ lemme_genre ] let @xmath179 . we have the following bounds for the genus of each step of the towers @xmath175 and @xmath176 : a. @xmath180 for all @xmath181 , b. @xmath182 , c. @xmath183 for all @xmath184 and @xmath185 , d. @xmath186 for all @xmath187 and @xmath185 . _ i ) _ according to formula ( [ genregs ] ) , we know that if @xmath188 , then @xmath189 since @xmath179 and @xmath190 , we have @xmath191 , thus @xmath192 . + else if @xmath193 , then @xmath194 since @xmath179 and @xmath181 , we have @xmath195 , thus @xmath192 . _ ii ) _ it follows from formula ( [ genregs ] ) since for all @xmath196 we have @xmath197 which works out for odd @xmath80 cases and @xmath198 which works out for even @xmath80 cases , since @xmath199 . _ iii ) _ if @xmath200 , then according to formula ( [ genregs ] ) , we have @xmath201 else , @xmath202 and proposition [ subfield ] says that @xmath203 . moreover , since @xmath204 and @xmath205 , we obtain @xmath206 from formula ( [ genregs ] ) . we get @xmath207 _ iv ) _ it follows from ii ) since proposition [ subfield ] gives @xmath203 , so @xmath208 which gives the result since @xmath209 for all @xmath210 . + [ lemme_delta ] let @xmath211 and @xmath212 . we set @xmath213,@xmath214 and @xmath215 . one has : a. @xmath216 , b. @xmath217 . \(i ) from hurwitz genus formula , one has @xmath218 , so @xmath219 . applying @xmath220 more times hurwitz genus formula , we get @xmath221 . thus @xmath222 , from lemma [ lemme_genre ] i ) since @xmath211 and @xmath223 . + ( ii ) according to proposition [ subfield ] , one has @xmath224 [ lemme_bornesup ] let @xmath215 . for all @xmath225 and @xmath226 , we have @xmath227 from proposition [ subfield ] and lemma [ lemme_genre ] iii ) , we get @xmath228 thus we have @xmath229 . in this section , @xmath33 is an odd prime . we denote by @xmath118 the genus of the step @xmath160 and we fix @xmath230 . the following lemma is straightforward according to formulae ( [ genregsr ] ) and ( [ nbpldeg12gsr ] ) : [ lemme_genregsr ] these two bounds hold for the genus of each step of the towers @xmath155 and @xmath177 : a. @xmath231 , b. @xmath232 . [ lemme_deltagsr ] for all @xmath233 , we set @xmath234 . then one has @xmath235 . if @xmath80 is even then @xmath236 , else @xmath237 so the second equality holds trivially . moreover , since @xmath238 , the first one follows from bounds ( [ nbratplgsr ] ) and ( [ nbpldeg12gsr ] ) which gives @xmath239 . [ lemme_bornesupgsr ] let @xmath160 be a step of one of the towers @xmath155 or @xmath177 . one has : @xmath240 from bounds ( [ nbratplgsr ] ) and ( [ nbpldeg12gsr ] ) for @xmath79 and lemma [ lemme_genregsr ] i ) , we get @xmath241 in @xcite , ballet and le brigand proved the following useful result : [ existdivnonspe ] let @xmath48 be an algebraic function field of genus @xmath242 . if @xmath243 , then there exists a non - special divisor of degree @xmath85 . the four following lemmas prove the existence of a `` good '' step of the towers defined in section [ sectdeftowers ] , that is to say a step that will be optimal for the bilinear complexity of multiplication : [ lemme_placedegn ] let @xmath244 be an integer . if @xmath245 , then there exists a step @xmath137 of the tower @xmath175 such that all the three following conditions are verified : 1 . there exists a non - special divisor of degree @xmath246 in @xmath137 , 2 . there exists a place of @xmath137 of degree @xmath3 , 3 . @xmath247 . moreover , the first step for which both conditions ( 2 ) and ( 3 ) are verified is the first step for which ( 3 ) is verified . note that @xmath248 since @xmath243 and @xmath249 . fix @xmath250 and @xmath251 . first , we prove that condition ( 2 ) is verified . lemma [ lemme_genre ] iv ) gives : @xmath252 on the other hand , one has @xmath253 so @xmath254 . this gives @xmath255 , hence @xmath256 . therefore , one has @xmath257 which ensure us that condition ( 2 ) is satisfied according to corollary 5.2.10 in @xcite . + now suppose also that @xmath258 . note that for all @xmath259 there exists such an integer @xmath80 since the size of the interval @xmath260 $ ] is bigger than@xmath261 . moreover such an integer @xmath80 verifies @xmath262 , so @xmath263 since @xmath243 . then one has @xmath264 which gives @xmath265 according to proposition [ subfield ] ( 3 ) . hence , for any integer @xmath266 $ ] , conditions ( 2 ) and ( 3 ) are satisfied and the smallest integer @xmath80 for which they are both satisfied is the smallest integer @xmath80 for which condition ( 3 ) is satisfied . + to conclude , remark that for such an integer @xmath80 , condition ( 1 ) is easily verified from theorem [ existdivnonspe ] since @xmath267 and @xmath268 according to formula ( [ genregs ] ) . + this is a similar result for the tower @xmath176 : [ lemme_placedegn2 ] let @xmath269 be an integer . if @xmath270 , then there exists a step @xmath132 of the tower @xmath176 such that all the three following conditions are verified : 1 . there exists a non - special divisor of degree @xmath246 in @xmath132 , 2 . there exists a place of @xmath132 of degree @xmath3 , 3 . @xmath271 . moreover , the first step for which both conditions ( 2 ) and ( 3 ) are verified is the first step for which ( 3 ) is verified . note that @xmath272 since @xmath243 , @xmath273 and @xmath274 . first , we focus on the case @xmath275 . fix @xmath276 and @xmath251 . one has @xmath277 since @xmath278 hence @xmath279 since @xmath280 for @xmath243 . according to ( [ eqgenre1 ] ) in the previous proof , this proves that condition ( 2 ) is satisfied . + the same reasoning as in the previous proof shows that condition ( 3 ) is also satisfied as soon as @xmath258 . moreover , for @xmath275 , the interval@xmath281}$ ] contains at least one integer and the smallest integer @xmath80 in this interval is the smallest integer @xmath80 for which condition ( 3 ) is verified . furthermore , for such an integer @xmath80 , condition ( 1 ) is easily verified from theorem [ existdivnonspe ] since @xmath267 and @xmath268 according to formula ( [ genregs ] ) . to complete the proof , we want to focus on the case @xmath282 . for this case , we have to look at the values of @xmath283 and @xmath3 for which we have both @xmath284 and @xmath285 . for each value of @xmath3 such that these two inequalities are satisfied , we have to check that conditions ( 1 ) , ( 2 ) and ( 3 ) are verified . in this aim , we use the kash packages @xcite to compute the genus and number of places of degree 1 and 2 of the first steps of the tower @xmath176 . thus we determine the first step @xmath132 that satisfied all the three conditions ( 1 ) , ( 2 ) and ( 3 ) . we resume our results in the following table : @xmath286 @xmath287 in this table , one can check that for each value of @xmath0 and @xmath3 to be considered and every corresponding step @xmath132 one has simultaneously : * @xmath288 so condition ( 1 ) is verified according to theorem [ existdivnonspe ] , * @xmath289 so condition ( 2 ) is verified . * @xmath290 so condition ( 3 ) is verified . this is a similar result for the tower @xmath155 : [ lemme_placedegngsr ] let @xmath99 and @xmath291 . there exists a step @xmath157 of the tower @xmath155 such that the three following conditions are verified : 1 . there exists a non - special divisor of degree @xmath292 in @xmath157 , 2 . there exists a place of @xmath157 of degree @xmath3 , 3 . . moreover the first step for which all the three conditions are verified is the first step for which ( 3 ) is verified . note that @xmath294 . we first prove that for all integers @xmath80 such that @xmath295 , we have @xmath296 , so condition ( 2 ) is verified according to corollary 5.2.10 in @xcite . indeed , for such an integer @xmath80 , since @xmath297 one has @xmath298 , thus it holds that @xmath299 and then @xmath300 . hence@xmath301 since @xmath297 , which gives the result according tolemma [ lemme_genregsr ] ii ) . + we prove now that for @xmath302 , condition ( 3 ) is verified . indeed , for such an integer @xmath80 , we have @xmath303 , so @xmath304 . hence we get @xmath305 and so @xmath306 since @xmath297 . thus we have @xmath307 according to bound ( [ nbratplgsr ] ) andlemma [ lemme_genregsr ] ii ) . + hence , we have proved that for any integers @xmath308 and @xmath309 such that@xmath310 , both conditions ( 2 ) and ( 3 ) are verified . moreover , note that for any @xmath308 , there exists an integer @xmath311 in the interval@xmath312}$ ] . indeed , @xmath313 and the size of this interval increases with @xmath3 and is greater than 1 for @xmath314 . to conclude , remark that for such an integer @xmath80 , condition ( 1 ) is easily verified from theorem [ existdivnonspe ] since @xmath315 and @xmath316 according to formula ( [ genregsr ] ) . + this is a similar result for the tower @xmath177 : [ lemme_placedegngsr2 ] let @xmath99 and @xmath317 . there exists a step @xmath158 of the tower @xmath177 such that the three following conditions are verified : 1 . there exists a non - special divisor of degree @xmath292 in @xmath158 , 2 . there exists a place of @xmath158 of degree @xmath3 , 3 . . moreover the first step for which all the three conditions are verified is the first step for which ( 3 ) is verified . note that @xmath319 . we first prove that for all integers @xmath80 such that @xmath320 , we have @xmath321 , so condition ( 2 ) is verified according to corollary 5.2.10 in @xcite . indeed , for such an integer @xmath80 , since @xmath297 and @xmath322 one has @xmath323 . thus@xmath324 and it follows from lemma [ lemme_genregsr ] ii ) that @xmath325 , which gives the result . + the same reasoning as in the previous proof shows that condition ( 3 ) is also satisfied as soon as @xmath302 . hence , we have proved that for any integers @xmath326 and @xmath309 such that @xmath327 , both conditions ( 2)and ( 3 ) are verified . moreover , note that the size of the interval@xmath328}$ ] increases with @xmath3 and that for any @xmath326 , this interval contains at least one integer @xmath311 . to conclude , remark that for such an integer @xmath80 , condition ( 1 ) is easily verified from theorem [ existdivnonspe ] since @xmath329 and @xmath316 according to formula ( [ genregsr ] ) . + now we establish general bounds for the bilinear complexity of multiplication by using derivative evaluations on places of degree one ( respectively places of degree one and two ) . [ thm_arnaud1 ] let @xmath0 be a prime power and @xmath330 be an integer . if there exists an algebraic function field @xmath331 of genus @xmath32 with @xmath51 places of degree 1 and an integer @xmath332 such that a. there exists @xmath333 , a non - special divisor of degree @xmath85 , b. there exists @xmath47 , a place of degree @xmath3 , c. @xmath334 , then @xmath335 let @xmath336 be a set of @xmath51 places of degree 1 and @xmath337 be a subset of @xmath338 with cardinality @xmath339 . according to lemma 2.7 in @xcite , we can choose an effectif divisor @xmath340 equivalent to @xmath341 such that @xmath342 . we define the maps @xmath343 and @xmath344 as in theorem [ theo_evalder ] with @xmath345 if @xmath346 and @xmath39 if @xmath347 . then @xmath343 is bijective , since @xmath348 with @xmath349 and @xmath350 according to riemann - roch theorem . thus @xmath351 . moreover , @xmath344 is injective . indeed,@xmath352 with @xmath353 . furthermore , one has @xmath354 , and @xmath355 since @xmath356 with @xmath357 . so @xmath358 , and we can extract a subset @xmath359 from @xmath338 and a subset @xmath360 from @xmath337 with cardinality @xmath361 and @xmath362 , such that : * @xmath363 , * the map @xmath364 defined as @xmath344 with @xmath345 if @xmath365 and @xmath39 if @xmath366 , is injective . according to theorem [ theo_evalder ] , this leads to @xmath367 which gives the result . [ thm_arnaud2 ] let @xmath0 be a prime power and @xmath330 be an integer . if there exists an algebraic function field @xmath331 of genus @xmath32 with @xmath70 places of degree 1 , @xmath71 places of degree 2 and two integers @xmath368 , @xmath369 such that a. there exists @xmath333 , a non - special divisor of degree @xmath85 , b. there exists @xmath47 , a place of degree @xmath3 , c. @xmath370 , then @xmath371 and @xmath372 let @xmath373 be a set of @xmath70 places of degree 1 and @xmath360 be a subset of @xmath359 with cardinality @xmath374 . let @xmath375 be a set of @xmath71 places of degree 2 and @xmath376 be a subset of @xmath377 with cardinality @xmath378 . according to lemma 2.7 in @xcite , we can choose an effectif divisor @xmath340 equivalent to @xmath341 such that @xmath379 . we define the maps @xmath343 and @xmath344 as in theorem [ theo_evalder ] with @xmath345 if @xmath380 and @xmath39 if @xmath381 . then the same raisoning as in the previous proof shows that @xmath343 is bijective . moreover , @xmath344 is injective . indeed , @xmath352 with @xmath382 . furthermore , one has @xmath354 , and @xmath355 since @xmath356 with @xmath357 . so @xmath358 , and we can extract a subset @xmath383 from @xmath359 , a subset @xmath384 from @xmath360 , a subset @xmath385 from @xmath377 and a subset @xmath386 from @xmath376 with respective cardinality @xmath387 , @xmath388 , @xmath389 and @xmath390 , such that : * @xmath391 , * the map @xmath392 defined as @xmath344 with @xmath345 if @xmath393 and @xmath39 if @xmath394 , is injective . according to theorem [ theo_evalder ] , this leads to @xmath395 since @xmath396 for all prime power @xmath80 . hence , one has the first result since @xmath397 and the second one since @xmath398 . here , we give a detailed proof of bound ( i ) of theorem [ theo_arnaud1 ] and of an improvement of ( * ? ? ? * theorem 5.9 ) . moreover , we established the new bounds for @xmath399 and @xmath400 announced in section [ sect_newresults ] . + a. let @xmath401 . otherwise , we already know from the pionner works recalled in section [ sect_known ] that @xmath402 . according to lemma [ lemme_placedegn ] , there exists a step of the tower @xmath175 on which we can apply theorem [ thm_arnaud1 ] with @xmath403 . we denote by @xmath404 the first step of the tower that suits the hypothesis of theorem [ thm_arnaud1 ] with @xmath403 , i.e. @xmath80 and @xmath220 are integers such that @xmath405 and @xmath406 , where @xmath407 and @xmath408 . we denote by @xmath409 the biggest integer such that@xmath410 , i.e. @xmath411 . to perform multiplication in @xmath412 , we have the following alternative : a. use the algorithm on the step @xmath413 . in this case , a bound for the bilinear complexity is given by theorem [ thm_arnaud1 ] applied with @xmath403 : @xmath414 ( recall that @xmath415 ) b. use the algorithm on the step @xmath416 with an appropriate number of derivative evaluations . let @xmath417 and suppose that @xmath418 . then @xmath419 implies that @xmath420 so condition ( iii ) of theorem [ thm_arnaud1 ] is satisfied . thus , we can perform @xmath339 derivative evaluations in the algorithm using the step @xmath416 and we have : @xmath421 + thus , if @xmath418 case ( b ) gives a better bound as soon as @xmath422 . since we have from lemma [ lemme_delta ] both @xmath423 and @xmath424 , if @xmath425 then we can perform @xmath339 derivative evaluations on places of degree 1 in the step @xmath416 and case ( b ) gives a better bound then case ( a ) . + for @xmath426 such that @xmath427 + 2g_{k , s+1}-1}$ ] and @xmath428 + 2g_{k , s}-1}$ ] , we define the function @xmath429 as follow : @xmath430 we define the function @xmath431 for all @xmath432 as the minimum of the functions @xmath433 for which @xmath434 is in the domain of @xmath433 . this function is piecewise linear with two kinds of piece : those which have slope @xmath66 and those which have slope @xmath435 . moreover , since the y - intercept of each piece grows with @xmath80 and @xmath220 , the graph of the function @xmath431 lies below any straight line that lies above all the points @xmath436 , since these are the _ vertices _ of the graph . + let @xmath437 , then @xmath438 we want to give a bound for @xmath439 which is independent of @xmath80 and @xmath220 . + recall that @xmath440 , and @xmath441 and @xmath442 so we have @xmath443 thus , the graph of the function @xmath431 lies below the line @xmath444 . in particular , we get @xmath445 b. let @xmath446 otherwise , we already know from section [ sect_known ] that @xmath447 . according to lemma [ lemme_placedegn2 ] , there exists a step of the tower @xmath448 on which we can apply theorem [ thm_arnaud2 ] with @xmath449 . we denote by @xmath450 the first step of the tower that suits the hypothesis of theorem [ thm_arnaud2 ] with @xmath449 , i.e. @xmath80 and @xmath220 are integers such that @xmath405 and @xmath406 , where @xmath451 and@xmath452 . we denote by @xmath409 the biggest integer such that@xmath410 , i.e. @xmath411 . to perform multiplication in @xmath2 , we have the following alternative : a. use the algorithm on the step @xmath453 . in this case , a bound for the bilinear complexity is given by theorem [ thm_arnaud2 ] applied with @xmath449 : @xmath454 b. use the algorithm on the step @xmath455 with an appropriate number of derivative evaluations . let @xmath456 and suppose that@xmath457 . then @xmath410 implies that@xmath458 . thus we can perform @xmath459 derivative evaluations in the algorithm using the step @xmath455 and we have : @xmath460 + thus , if @xmath461 case ( b ) gives a better bound as soon as@xmath462 . since we have from lemma [ lemme_delta ] both @xmath463 and @xmath464 , if @xmath465 , i.e. @xmath466 , then we can perform @xmath374 derivative evaluations on places of degree 1 and @xmath378 derivative evaluations on places of degree 2 in the step @xmath455 and case ( b ) gives a better bound then case ( a ) . + for @xmath426 such that @xmath427 + 2g_{k , s+1}-1}$ ] and @xmath428 + 2g_{k , s}-1}$ ] , we define the function @xmath429 as follow : @xmath467 we define the function @xmath431 for all @xmath432 as the minimum of the functions @xmath433 for which @xmath434 is in the domain of @xmath433 . this function is piecewise linear with two kinds of piece : those which have slope @xmath468 and those which have slope @xmath469 . moreover , since the y - intercept of each piece grows with @xmath80 and @xmath220 , the graph of the function @xmath431 lies below any straight line that lies above all the points @xmath436 , since these are the _ vertices _ of the graph . + let @xmath437 , then @xmath470 we want to give a bound for @xmath439 which is independent of @xmath80 and @xmath220 . + recall that @xmath440 , and @xmath471 and @xmath442 so we have @xmath472 thus , the graph of the function @xmath431 lies below the line @xmath473 . in particular , we get @xmath474 c. let @xmath475 . otherwise , we already know from section [ sect_known ] that @xmath476 . according to lemma [ lemme_placedegngsr ] , there exists a step of the tower @xmath155 on which we can apply theorem [ thm_arnaud1 ] with @xmath403 . we denote by @xmath477 the first step of the tower that suits the hypothesis of theorem [ thm_arnaud1 ] with @xmath403 , i.e. @xmath80 is an integer such that @xmath478 and @xmath479 , where @xmath480 and @xmath481 . wedenote by @xmath482 the biggest integer such that @xmath483 , i.e. @xmath484 . to perform multiplication in @xmath485 , we have the following alternative : a. use the algorithm on the step @xmath486 . in this case , a bound for the bilinear complexity is given by theorem [ thm_arnaud1 ] applied with @xmath403 : @xmath487 ( recall that @xmath488 ) b. use the algorithm on the step @xmath160 with an appropriate number of derivative evaluations . let @xmath489 and suppose that @xmath490 . then @xmath491 implies that @xmath492 so condition ( 3 ) of theorem [ thm_arnaud1 ] is satisfied . thus , we can perform @xmath339 derivative evaluations in the algorithm using the step @xmath160 and we have : @xmath493 + thus , if @xmath490 case ( b ) gives a better bound as soon as @xmath494 . for @xmath426 such that @xmath495 + 2g_{k+1}-1}$ ] and @xmath496 + 2g_k-1}$ ] , we define the function @xmath497 as follow : @xmath498 note that when case ( b ) gives a better bound , that is to say when@xmath499 , then according to lemma [ lemme_deltagsr ] we have also @xmath500 so we can proceed as in case ( b ) since there are enough rational places to use @xmath501 derivative evaluations on . + we define the function @xmath431 for all @xmath432 as the minimum of the functions @xmath502 for which @xmath434 is in the domain of @xmath502 . this function is piecewise linear with two kinds of piece : those which have slope @xmath66 and those which have slope @xmath435 . moreover , since the y - intercept of each piece grows with @xmath80 , the graph of the function @xmath431 lies below any straight line that lies above all the points @xmath503 , since these are the _ vertices _ of the graph . + let @xmath504 , then @xmath505 we want to give a bound for @xmath439 which is independent of @xmath80 . + lemmas [ lemme_genregsr ] ii ) , [ lemme_deltagsr ] and [ lemme_bornesupgsr ] give @xmath506 since @xmath507 is the minimum of the function @xmath508 . + thus , the graph of the function @xmath431 lies below the line @xmath509 . in particular , we get @xmath510 d. let @xmath511 . otherwise , we already know from section [ sect_known ] that @xmath512 . according to lemma [ lemme_placedegngsr2 ] , there exists a step of the tower @xmath177 on which we can apply theorem [ thm_arnaud2 ] with @xmath449 . we denote by @xmath513 the first step of the tower that suits the hypothesis of theorem [ thm_arnaud2 ] with @xmath449 , i.e. @xmath80 is an integer such that @xmath478 and @xmath479 , where @xmath514 and @xmath481 . we denote by @xmath482 the biggest integer such that @xmath483 , i.e.@xmath484 . to perform multiplication in @xmath515 , we have the following alternative : a. use the algorithm on the step @xmath486 . in this case , a bound for the bilinear complexity is given by theorem [ thm_arnaud2 ] applied with @xmath449 : @xmath516 b. use the algorithm on the step @xmath160 with an appropriate number of derivative evaluations . let @xmath517 and suppose that @xmath518 . then @xmath483 implies that @xmath519 . thus we can perform @xmath459 derivative evaluations in the algorithm using the step @xmath160 and we have : @xmath520 + thus , if @xmath461 case ( b ) gives a better bound as soon as @xmath462 . for @xmath426 such that @xmath495 + 2g_{k+1}-1}$ ] and @xmath496 + 2g_k-1}$ ] , we define the function @xmath497 as follow : @xmath521 note that when case ( b ) gives a better bound , that is to say when@xmath499 , then according to lemma [ lemme_deltagsr ] we have also @xmath500 so we can proceed as in case ( b ) since there are enough places of degree 1 and 2 to use @xmath522 derivative evaluations on . + we define the function @xmath431 for all @xmath432 as the minimum of the functions @xmath502 for which @xmath434 is in the domain of @xmath502 . this function is piecewise linear with two kinds of piece : those which have slope @xmath468 and those which have slope @xmath469 . moreover , since the y - intercept of each piece grows with @xmath80 , the graph of the function @xmath431 lies below any straight line that lies above all the points @xmath503 , since these are the _ vertices _ of the graph . + let @xmath504 , then @xmath523 we want to give a bound for @xmath439 which is independent of @xmath80 . + the same reasoning as in ( iii ) gives @xmath524 thus , the graph of the function @xmath431 lies below the line @xmath525 . in particular , we get @xmath526 the two papers @xcite predict new upper bounds for the limsup of the complexity of the multiplication in extensions of small prime finite fields . unfortunatly these predictions are based on an asumption which is unproven ( and might be false in general ) . this asumption is stated as lemma iv.4 in the paper @xcite . the claim is the following : * defined over @xmath162 ; * whose genuses tend to infinity , and grow slowly , i.e. @xmath529 ; * whose number of @xmath530-points is asymptotically optimal ( i.e. the ratio of this number with respect to the genus tends to @xmath531 ) . and thus , by ( * ? ? ? * lemma iv.3 ) , the family @xmath528 would attain the generalized drinfeld - vldu bound for the number of points of degree @xmath527 . + the new result claimed in @xcite is that the curves are defined over @xmath162 . if one removes this property , the computations made in this paper would lead to results already known since @xcite . but to justify the fact that their curves are defined over @xmath162 , @xmath33 being a prime , the authors need that these curves come from the reduction modulo @xmath33 of shimura curves that would be defined over @xmath532 . this latter claim is not proved , so this invalidates the result . we can further notice that it appears that , up to some details ( e.g. add the sufficient hypothesis that @xmath533 has narrow class number 1 ) , some of these curves should indeed admit @xmath532 as field of moduli ( by the first corollary of @xcite the levels @xmath45 being assumed galois invariant ) . but this potentially restrains the list of possible choices for @xmath33 and @xmath527 and even in those cases , it does not suffice to prove the assumption , since the field of moduli need not be the field of definition . + we give here a list of the bounds that , to the best of our knowledge , rely on this unproven assumption : * the symmetric bounds in theorem iv.6 , theorem iv.7 and the list of specific bounds in corollary iv.8 of @xcite ; namely the followings : @xmath534 for any @xmath535 as long as @xmath536 for @xmath0 a prime power ; @xmath537 for any @xmath535 as long as @xmath538 for @xmath0 a prime power which is a square ; @xmath539 and @xmath540 * the asymmetric bounds in theorem 5.3 , corollary 5.4 , corollary 5.5 of @xcite , namely the followings : + @xmath541 for @xmath0 be a prime power and @xmath542 an integer such that @xmath543 is a square ; + and @xmath544 stphane ballet , dominique le brigand , and robert rolland . on an application of the definition field descent of a tower of function fields . in _ proceedings of the conference arithmetic , geometry and coding theory ( agct 2005 ) _ , volume 21 , pages 187203 . socit mathmatique de france , sr . sminaires et congrs , 2009 . hao chen and ronald cramer . algebraic geometric secret sharing schemes and secure multi - party computations over small fields . in cynthia dwork , editor , _ advances in cryptology - crypto 2006 _ , volume 4117 of _ lecture notes in computer science _ , pages 521536 . springer berlin heidelberg , 2006 . igor shparlinski , michael tsfasman , and serguei vladut . curves with many points and multiplication in finite fields . in h. stichtenoth and m.a . tsfasman , editors , _ coding theory and algebraic geometry _ , number 1518 in lectures notes in mathematics , pages 145169 , berlin , 1992 . springer - verlag . proceedings of agct-3 conference , june 17 - 21 , 1991 , luminy .

we establish new upper bounds about symmetric bilinear complexity in any extension of finite fields . note that these bounds are not asymptotical but uniform . moreover , we discuss the validity of certain published bounds . finite field , tensor rank of the multiplication , algebraic function field .

protein protein interactions are essential for many biological processes in the cell . in recent years , there has been a major progress in high - throughput identifications of interacting proteins ( 1 ) . despite recent advances in the structural genomics project ( 2 ) , the number of experimentally solved structures of protein protein complexes remains very low ( 3 ) . therefore , computational methods are essential for 3d characterization of protein protein interactions . protein protein docking aims to predict the 3d structure of a protein complex given the structures of the individual proteins that assemble it . protein flexibility ( 4 ) and the absence of robust scoring functions present a major challenge in the docking field . the flexibility of proteins includes both backbone and side - chain movements , and dealing with it significantly extends the search space for the optimal complex structure ( 5,6 ) . in addition , state of the art scoring functions are not tolerant enough to the inaccuracies in the predicted structures ( 7 ) . first , soft rigid docking is performed ( 811 ) , allowing a certain amount of steric clashes . then , thousands of solution candidates are refined and re - scored in a refinement stage ( 5,6 ) . in this stage , each solution candidate is improved by modeling the protein flexibility and optimizing the rigid - body orientation . most of the refinement methods use an optimization of the side - chain conformations and/or rigid - body orientation in order to minimize a certain scoring function . one of the main differences between the refinement methods is in the approach used for side - chain optimization : monte - carlo ( mc ) ( 12,13 ) , graph theory - based methods ( 14,15 ) , linear programming ( lp ) ( 16 ) , etc . the optimization of the rigid - body orientation usually involves a randomized perturbation followed by energy minimization . the minimization is performed using methods such as steepest descent ( 17 ) , newton raphson ( 18,19 ) , quasi - newton ( 12,16 ) and more . there are several web servers that deal with different aspects of the docking challenge : zdock ( 20 ) and patchdock ( 21 ) perform rigid - body docking . smoothdock ( 24 ) is a newer version of cluspro that also refines the representatives of the largest clusters . rosettadock ( 12,25 ) web server allows local search in the vicinity of a single given input solution candidate . the gramm - x ( 26 ) and hex ( 27 ) web servers perform rigid - body docking followed by an optimization of the rigid - body orientation . we present the firedock web server that provides a user - friendly interface for running this protocol online . the method simultaneously targets the problem of flexibility and scoring of solutions produced by fast rigid - body docking algorithms . the output provides a list of refined complexes , sorted by a binding energy function , and a 3d visualization for observing and comparing between the refined complexes . additionally , we suggest a platform for performing full docking protocol : rigid - body docking by the patchdock web server ( 21 ) and a redirection of the results for refinement and scoring by firedock web server . this protocol was thoroughly tested ( 16 ) on protein protein docking benchmarks ( 28,29 ) . the method refines each candidate and ranks all the candidates according to the binding energy . the firedock ( 16 ) method includes three main steps : side - chain optimization : the side - chain flexibility of the receptor and the ligand is modeled by a rotamer library . the optimal combination of rotamers for the interface residues is found by solving an integer lp problem ( 3032 ) . this lp minimizes a partial energy function consisting repulsive van der waals and rotamer probabilities terms.rigid-body minimization : this minimization stage is performed by a mc technique that attempts to optimize an approximate binding energy by refining the orientation of the ligand structure . the binding energy consists of softened repulsive and attractive van der waals terms . in each cycle of the mc method , a local minimization is performed by the quasi - newton algorithm ( 33,34 ) . by default , 50 mc cycles are performed.scoring and ranking : this final ranking stage attempts to identify the near - native refined solutions . the ranking is performed according to a binding energy function that includes a variety of energy terms : desolvation energy ( atomic contact energy , ace ) , van der waals interactions , partial electrostatics , hydrogen and disulfide bonds , -stacking and aliphatic interactions , rotamer 's ; probabilities and more . side - chain optimization : the side - chain flexibility of the receptor and the ligand is modeled by a rotamer library . the optimal combination of rotamers for the interface residues is found by solving an integer lp problem ( 3032 ) . this lp minimizes a partial energy function consisting repulsive van der waals and rotamer probabilities terms . rigid - body minimization : this minimization stage is performed by a mc technique that attempts to optimize an approximate binding energy by refining the orientation of the ligand structure . the binding energy consists of softened repulsive and attractive van der waals terms . in each cycle of the mc method , a local minimization is performed by the quasi - newton algorithm ( 33,34 ) . by default , scoring and ranking : this final ranking stage attempts to identify the near - native refined solutions . the ranking is performed according to a binding energy function that includes a variety of energy terms : desolvation energy ( atomic contact energy , ace ) , van der waals interactions , partial electrostatics , hydrogen and disulfide bonds , -stacking and aliphatic interactions , rotamer 's ; probabilities and more . the firedock method was extensively tested ( 16 ) on docking candidates generated by the patchdock method ( 10,21 ) for cases from benchmark 1.0 and 2.0 ( 28,29 ) . firedock succeeded in ranking a near - native solution in the top 15 predictions for 83% of the 30 enzyme inhibitor test cases and for 78% of the 18 semi - unbound antibody antigen test cases . the firedock web server is available at http://bioinfo3d.cs.tau.ac.il / firedock/. there are two input options for the firedock web server . in the first option , the user uploads or specifies codes of two protein data bank ( pdb ) ( 35 ) files ( receptor and ligand ) and provides a list of up to 1000 transformations ( the required format is detailed in the help page of the web server ) . each transformation , when applied on the ligand , produces a candidate docking solution . in the second option , the user can upload an input pdb file , with each docking solution represented by a model . the candidate solutions for firedock can be generated by rigid - body docking methods , such as patchdock ( 10,21 ) , methods that use fast fourier transform ( fft ) such as zdock ( 20,36 ) , gramm - x ( 26 ) , hex ( 27 ) , etc . the patchdock server ( http://bioinfo3d.cs.tau.ac.il/patchdock/ ) includes an option for automatic redirection of the solution candidates to firedock . this parameter determines the number of best scoring candidates for which a pdb file with the refined structure will be generated . the server allows generating up to 100 pdb files . a link to the output web - page is sent to the email of the user as soon as the refinement process is finished . the server includes optional advanced parameters for adjusting the refinement and scoring for a specific biological system . the user can specify the type of the complex ( default , antibody antigen or enzyme inhibitor ) , which is used for adjusting the weights of the scoring function . furthermore , the user can specify if the proteins are in their bound or unbound conformation and if certain side - chains are known to be flexible or fixed . full refinement mode allows all the interface residues to be flexible and uses an extended rotamer library . we recommend using the restricted mode at first , for coarse refinement , and to use the full mode on the final best candidates . this parameter influences the range of rigid - body movements around each original solution candidate . we recommend using 0.8 for coarse refinement ( restricted mode ) and 0.85 for a final refinement ( full mode ) of the best candidates . the output of the server is a table of all the input solutions , where each row corresponds to a single input complex ( figure 1 ) . different complexes can be viewed simultaneously for comparison and the 3d structures can be downloaded as pdb files . the table can be sorted by different energy terms , such as the attractive and repulsive van der walls forces , the ace and the contribution of the hydrogen bonds ( hb ) to the global binding energy . an extended table with full specifications of the values of each energy term can be downloaded . there are two input options for the firedock web server . in the first option , the user uploads or specifies codes of two protein data bank ( pdb ) ( 35 ) files ( receptor and ligand ) and provides a list of up to 1000 transformations ( the required format is detailed in the help page of the web server ) . each transformation , when applied on the ligand , produces a candidate docking solution . in the second option , the user can upload an input pdb file , with each docking solution represented by a model . the candidate solutions for firedock can be generated by rigid - body docking methods , such as patchdock ( 10,21 ) , methods that use fast fourier transform ( fft ) such as zdock ( 20,36 ) , gramm - x ( 26 ) , hex ( 27 ) , etc . the patchdock server ( http://bioinfo3d.cs.tau.ac.il/patchdock/ ) includes an option for automatic redirection of the solution candidates to firedock . this parameter determines the number of best scoring candidates for which a pdb file with the refined structure will be generated . the server allows generating up to 100 pdb files . a link to the output web - page is sent to the email of the user as soon as the refinement process is finished . the server includes optional advanced parameters for adjusting the refinement and scoring for a specific biological system . the user can specify the type of the complex ( default , antibody antigen or enzyme inhibitor ) , which is used for adjusting the weights of the scoring function . furthermore , the user can specify if the proteins are in their bound or unbound conformation and if certain side - chains are known to be flexible or fixed . the full refinement mode allows all the interface residues to be flexible and uses an extended rotamer library . we recommend using the restricted mode at first , for coarse refinement , and to use the full mode on the final best candidates . this parameter influences the range of rigid - body movements around each original solution candidate . we recommend using 0.8 for coarse refinement ( restricted mode ) and 0.85 for a final refinement ( full mode ) of the best candidates . the output of the server is a table of all the input solutions , where each row corresponds to a single input complex ( figure 1 ) . different complexes can be viewed simultaneously for comparison and the 3d structures can be downloaded as pdb files . the table can be sorted by different energy terms , such as the attractive and repulsive van der walls forces , the ace and the contribution of the hydrogen bonds ( hb ) to the global binding energy . an extended table with full specifications of the values of each energy term can be downloaded . the firedock web server presented here is the first web server for addressing the problem of protein flexibility in docking and allows a high - throughput refinement of docking candidates . due to the high efficiency of the algorithm , we are able to present a web server that allows online refinement of large number of candidates within reasonable running times . the web server interface is easy to understand and simple , requiring no previous knowledge in docking algorithms . in addition , we provide an option for redirection of the solution candidates from the patchdock web server to the refinement process of firedock . this allows the users to perform a full docking protocol of global search ( patchdock ) and local refinement ( firedock ) in a fully automated manner . the algorithm of firedock was proven to be successful in the task of refinement and selection of near - native solution out of thousand candidates ( 16 ) . we believe that the server will enable biologists to use this state - of - the - art docking algorithm in order to predict the structure of new protein protein complexes .

structural details of protein protein interactions are invaluable for understanding and deciphering biological mechanisms . computational docking methods aim to predict the structure of a protein protein complex given the structures of its single components . protein flexibility and the absence of robust scoring functions pose a great challenge in the docking field . due to these difficulties most of the docking methods involve a two - tier approach : coarse global search for feasible orientations that treats proteins as rigid bodies , followed by an accurate refinement stage that aims to introduce flexibility into the process . the firedock web server , presented here , is the first web server for flexible refinement and scoring of protein protein docking solutions . it includes optimization of side - chain conformations and rigid - body orientation and allows a high - throughput refinement . the server provides a user - friendly interface and a 3d visualization of the results . a docking protocol consisting of a global search by patchdock and a refinement by firedock was extensively tested . the protocol was successful in refining and scoring docking solution candidates for cases taken from docking benchmarks . we provide an option for using this protocol by automatic redirection of patchdock candidate solutions to the firedock web server for refinement . the firedock web server is available at http://bioinfo3d.cs.tau.ac.il / firedock/.

An Albemarle County grand jury has charged Jesse Matthew with the October 17, 2009 disappearance and death of Morgan Harrington. Matthew is charged with first-degree murder and abduction with intent to defile. He was served with the indictments on Tuesday. He will make his first appearance in the Albemarle County Circuit Court on Wednesday at 12:45 p.m. The maximum penalty for each offense is life in prison. Here’s the news release from Albemarle County: On September 11, 2015, an Albemarle County Grand Jury returned two Indictments against Jesse Leroy Matthew, Jr. in connection with the October 17, 2009 disappearance and death of Morgan Dana Harrington. Matthew was charged with First Degree Murder of Morgan Harrington and Abduction with the Intent to Defile. The maximum penalty for each offense is life in prison. These Indictments were received by the Court on September 15, 2015. An indictment is a charge and not evidence of guilt. A defendant is presumed innocent and entitled to a fair trial with the burden on the Commonwealth to prove guilt beyond a reasonable doubt. Matthew was served with the Indictments on September 15, 2015. His first appearance before the Albemarle County Circuit Court will take place at 12:45 p.m. on September 16, 2015. The indictments result from the dedicated investigative efforts over the past six years by the Virginia State Police, Albemarle County Police, Charlottesville Police, University of Virginia Police, and the FBI. ||||| (CNN) Morgan Harrington's parents were struck by the similarities as soon as they heard University of Virginia student Hannah Graham went missing. Their daughter, a Virginia Tech student, had disappeared five years earlier at the same time of year, around the same time of night and in the same place -- Charlottesville, Virginia. But even as speculation surged that the two cases could be connected , the Harringtons were still waiting for answers. Until now. Prosecutors revealed Tuesday that a grand jury has indicted Jesse Matthew Jr. -- the same suspect who's charged with capital murder in the Graham case -- in Harrington's death, too. The grand jury charged Matthew with first-degree murder and abduction with the intent to defile in the case of Harrington, a 20-year-old Virginia Tech student who went missing in October 2009. A grand jury has indicted Jesse Matthew Jr. in the Morgan Harrington case, charging him with kidnapping and murder. After investigators said they believed he was the last person to see Graham before she went missing, Matthew, a former cab driver, was taken into custody nearly a year ago on a beach in Galveston County, Texas, about 1,300 miles away from Charlottesville. The Albermarle County Commonwealth Attorney's Office announced the new charges against him in a statement Tuesday. He is set to appear in court to face the charges in the Harrington case on Wednesday, prosecutors said. Prosecutors didn't detail what evidence led them to pursue charges in the Harrington case, and said in a statement that to ensure a fair trial they would not be holding a press conference or comment on the evidence, the penalty they're seeking or their trial strategy. Matthew's public defender did not immediately respond to a call requesting comment. Gil Harrington, the slain student's mother, said she's long believed Matthew was behind her daughter's death, and was relieved to hear he'd been charged. "That the person responsible will be brought to justice, there's a lot of satisfaction in that," she told CNN affiliate WDBJ . "Something as heinous as taking someone's life should have consequences. Today, finally, the domino cascade of consequences for Jesse Matthew for killing Morgan Harrington has started." The disappearance Harrington disappeared on October 17, 2009, after attending a Metallica concert at the University of Virginia's John Paul Jones Arena. She had been so excited about the concert, according to her mother, that she posted the tickets on the refrigerator about six months ahead of time. She tried on three outfits before settling on what to wear: a crystal necklace and a black T-shirt with the word "Pantera" spelled out in tan letters. Police say she left her friends to use the restroom during the concert. They called her cell phone when she didn't return. Harrington told them she was outside the arena and could not get back in because of its reentry policy. But she also said they shouldn't worry and that she would find a ride home. Witnesses later saw someone matching Harrington's description walking along a nearby bridge. Harrington's purse, identification and cell phone were found the following day in an overflow parking lot near the arena. Her remains were discovered on a nearby farm in January 2010. Searching for closure Last year, Harrington's mother told CNN affiliate WSLS that she was happy investigators had found a possible link between Graham's case and her daughter's killing. "But it doesn't change a lot for us, in some ways," she said. "You know, our bedroom is still empty upstairs. We're still not going to have the grandchildren, the wedding, those things." JUST WATCHED Morgan Harrington's family speaks out Replay More Videos ... MUST WATCH Morgan Harrington's family speaks out 06:16 On Tuesday, she told WDBJ that long before Matthew's indictment in her daughter's killing, she's been going to court every time he's appeared, ever since his arrest in the Graham case. "I have always known that he was the one who did it, and that's one reason why ... I want my face there," she said. "Because I want him to see me. Because I want him to know that I know." And Gil Harrington said she's prepared to keep showing up. "I'm on the new marathon now. I don't know what shoes I'm going to need," she told WDBJ. "But I know it's going to be rigorous. And I have what it takes to finish the course."

– A man already facing a capital murder charge has been charged with the murder of a Virginia Tech student who vanished after a Metallica concert in 2009. Jesse Matthew was indicted yesterday on charges of first-degree murder and abduction with the intent to defile in the case of 20-year-old Morgan Harrington, reports the Richmond Times-Dispatch. The 33-year-old former taxi driver was arrested last year after the disappearance of 18-year-old University of Virginia student Hannah Graham. Her disappearance bore strong similarities to the Harrington case and forensic evidence linked him to that crime as well as a rape case, CNN reports. Harrington's mother says she has been going to every one of Matthew's court appearances "because I want him to know that I know" and that she's relieved that he has finally been charged. "That the person responsible will be brought to justice, there's a lot of satisfaction in that," she tells WDBJ7. "Something as heinous as taking someone's life should have consequences. Today, finally, the domino cascade of consequences for Jesse Matthew for killing Morgan Harrington has started."

MOSCOW — President Trump’s announcement that the United States would withdraw from a nuclear disarmament treaty with Russia drew sharp criticism Sunday from one of the men who signed it, Mikhail S. Gorbachev, who called the decision reckless and not the work of “a great mind.” In making his announcement Saturday, Mr. Trump cited Russian violations of the pact, the Intermediate-Range Nuclear Forces Treaty, which was signed in Washington in 1987 by President Ronald Reagan and Mr. Gorbachev. Mr. Gorbachev, who is now 87 years old, cast Mr. Trump’s decision as a threat to peace. In an interview with the Interfax news agency, Mr. Gorbachev called Mr. Trump’s rollback of the disarmament agreement “very strange.” He added: “Do they really not understand in Washington what this can lead to?” The last Soviet leader, who is perceived more warmly in the West than inside Russia, has already watched his domestic reform agendas supporting democracy and greater freedom of the press unravel in recent years. Nuclear disarmament also defined his legacy. ||||| President Donald Trump dismbarks from Air Force One, Saturday, Oct. 20, 2018, in Andrews Air Force Base, Md., en route to Washington returning from a campaign rally in Elko, Nev. (AP Photo/Carolyn Kaster) (Associated Press) President Donald Trump dismbarks from Air Force One, Saturday, Oct. 20, 2018, in Andrews Air Force Base, Md., en route to Washington returning from a campaign rally in Elko, Nev. (AP Photo/Carolyn Kaster) (Associated Press) President Donald Trump dismbarks from Air Force One, Saturday, Oct. 20, 2018, in Andrews Air Force Base, Md., en route to Washington returning from a campaign rally in Elko, Nev. (AP Photo/Carolyn Kaster) (Associated Press) President Donald Trump dismbarks from Air Force One, Saturday, Oct. 20, 2018, in Andrews Air Force Base, Md., en route to Washington returning from a campaign rally in Elko, Nev. (AP Photo/Carolyn Kaster) (Associated Press) WASHINGTON (AP) — The Latest on President Donald Trump's decision to pull the U.S. from an arms control agreement with Russia (all times local): 10:45 a.m. There doesn't seem to be a consensus in Congress about whether President Donald Trump is making the right move when he says he will withdraw the United States from an arms control agreement with Russia. Sen. Rand Paul says he thinks it's "a big, big mistake to flippantly get out of this historic agreement." He tells "Fox News Sunday" that both sides accuse the other of violations, and he wants to have "a rational discussion" with experts to see if Washington and Moscow can settle their differences. The chairman off the Senate Foreign Relations Committee hopes Trump's step is just a negotiating maneuver. Sen. Bob Corker tells CNN's "State of the Union" that "this could be something that's just a precursor to trying to get Russia to come into compliance." Corker says he hopes "we're going to be able to figure out a way to stay within the treaty." But backing Trump is Sen. Lindsey Graham, who tells Fox News: "Absolutely the right move." Graham says "the Russians have been cheating." ___ 9:05 a.m. Germany's foreign minister says President Donald Trump's intention to pull out of an arms control agreement with Russia is "regrettable." Heiko Maas says in a statement that the Intermediate-Range Nuclear Forces Treaty is "an important pillar of our European security architecture." He says Trump's announcement "raises difficult questions for us and Europe." The 1987 treaty prohibits the United States and Russia from possessing, producing or test-flying a ground-launched cruise missile with a range of 300 miles to 3,400 miles. Maas says Germany has repeatedly urged Moscow to "clear up the serious allegations of breaching the INF treaty, which Russia has so far not done." He says Germany is urging Washington to "consider the possible consequences" of its decision, including for a U.S.-Russian nuclear disarmament treaty beyond 2021. ___ 8:10 a.m. Britain's defense secretary says his country stands "absolutely resolute" with the United States as President Donald Trump says he'll pull out from a landmark arms control agreement with Russia. Gavin Williamson blames Russia for endangering the treaty. He's calling on the Kremlin to "get its house in order." Trump says he'll exit the agreement because Russia has violated it "for many years" and it's preventing the U.S. from developing new weapons. Backing Trump, Williamson tells the Financial Times that Moscow has made a "mockery" of the Intermediate-Range Nuclear Forces Treaty. The 1987 pact prohibits the United States and Russia from possessing, producing or test-flying a ground-launched cruise missile with a range of 300 miles to 3,400 miles ___ 5 a.m. A top Russian diplomat says President Donald Trump's intention to withdraw from a landmark treaty on nuclear weapons is a perilous move. And a Russian senator says the U.S. move to leave the Intermediate Range Nuclear Forces treaty would undermine nuclear nonproliferation efforts. Deputy Foreign Minister Sergei Ryabkov was quoted as telling state news agency Tass that "this would be a very dangerous step." He says the move "will cause the most serious condemnation from all members of the international community who are committed to security and stability." Konstatin Kosachev is head of the foreign affairs committee in Russia's upper house of parliament. He says on Facebook that a U.S. withdrawal from the treaty would mean "mankind is facing full chaos in the nuclear weapons sphere." ___ 12:30 a.m. President Donald Trump says he will exit a landmark arms control agreement the United States signed with the former Soviet Union. He says Russia is violating the pact and it's preventing the U.S. from developing new weapons. The 1987 pact helps protect the security of the U.S. and its allies in Europe and the Far East. It prohibits the United States and Russia from possessing, producing or test-flying a ground-launched cruise missile with a range of 300 miles to 3,400 miles. Trump is saying that "Russia has violated the agreement. They have been violating it for many years." The agreement has constrained the U.S. from developing new weapons, but Trump said America will begin developing them unless Russia and China agree not to possess or develop the weapons.

– Mikhail Gorbachev is puzzled and alarmed by President Trump's plan to pull the US out of a treaty that is part of his—and Ronald Reagan's—legacy. The 87-year-old former Soviet leader told Russia's Interfax news agency Sunday that Trump's move to scrap the Intermediate-Range Nuclear Forces Treaty was "very strange" and "not the work of a great mind," the New York Times reports. "Do they really not understand in Washington what this can lead to?" wondered Gorbachev, who signed the nuclear pact with Reagan in 1987. "All agreements aimed at nuclear disarmament and limiting nuclear weapons must be preserved, for the sake of preserving life on earth," he said. Congressional Republicans were split on the decision to withdraw from the pact, which bans the US and Russia from possessing or testing ground-launched cruise missiles with a range of 300 miles to 3,400 miles, the AP reports. Sen. Rand Paul said it would be "a big, big mistake to flippantly get out of this historic agreement," while Sen. Bob Corker, chair of the Senate Foreign Relations Committee, told CNN that the move could be "something that's just a precursor to trying to get Russia to come into compliance" and he hopes "we're going to be able to figure out a way to stay within the treaty." Sen. Lindsey Graham told Fox that the "Russians have been cheating," so he believes pullout is "absolutely the right move." (The Kremlin says the move is a "very dangerous step.")

the problem of spin glass , with quenched disorder and frustration as main ingredients , is known to be a challenge in statistical mechanics.@xcite in order to reduce its complexity , it makes sense to discuss these ingredients separately . the aim of this work is to report numerical results on magnetic properties of a structure where frustration is present for purely antiferromagnetic interaction , with only one value of the exchange interaction . the interaction is limited to nearest neighbors . the structure studied is presented in fig . [ lattice ] . lattice , with the triangular lattice as a background . ] our motivation to discuss this structure is as follows . first , the frustration is to be present , and the simplest way to achieve it is to put triangles into the lattice . second , the number of nearest neighbors is to be odd , what ensures that for any magnetic state , the energy barrier to flip a spin is finite . then we may expect that the magnetic transition temperature is greater than zero . third , we are interested in the ground state degeneracy . we look for a lattice where , if external field is zero , a simultaneous flip of some spins does not change the total energy . in fact , if the magnetization of the flipped group of spins is zero , the flipping does not change the energy even in the presence of the applied field . fourth , all distances between the nearest neighbors should be equal . additionally , two - dimensional structures are preferred for their simplicity . the structure presented in fig . [ lattice ] fulfills all these conditions . the last condition is guaranteed by spanning our structure on the triangular lattice . actually , this structure is topologically equivalent to the archimedean lattice @xmath0 . patterns of all eleven archimedean lattices can be found in ref . . topological equivalence means that one lattice can be stretched into the other . magnetism of archimedean lattices has been investigated for some years.@xcite however , these works deal with the isotropic heisenberg interaction . we are not aware about temperature - dependent simulations on the @xmath0 lattice with ising antiferromagnetism . the energy of the classical ising state@xcite in the presence of external magnetic field @xmath2 is @xmath3 where @xmath4 , @xmath5 is the antiferromagnetic exchange constant and the first summation goes over all nearest neighbor pairs @xmath6 . the degeneracy of the ground state energy ( gse ) of the structure presented in fig . [ lattice ] , termed as stretched archimedean for brevity from now on , can be demonstrated easily when we look at the unit cell in fig . there are nine bonds in the unit cell . the ground state energy can not be smaller than it is allowed by the frustration , which is unavoidable within the two triangles . the contribution from the triangles to gse is then @xmath7 per unit cell . provided that the spins connected with other bonds are oriented in antiparallel , we get @xmath8 per unit cell for field equal to zero . this is well possible , and some the ground states are periodic . one of such states is @xmath9 . another periodic ground state can be obtained by a simultaneous flip of spins @xmath10 in each unit cell . more general , we have six periodic ground states @xmath11 ; additional condition is that @xmath12 . these states are collected in tab . [ tab1 ] . .list of homogeneous ground states , with spins labeled as in fig . [ cell ] . in last column , paths are indicated which lead to other states by flipping pairs of spins in all unit cells . [ cols="^,^,^ " , ] obviously , many other non - periodic ground states of the whole lattice can be obtained , for example from @xmath13 if the flip of two spins is performed only in a selected number of unit cells . this means that the ground state degeneracy increases with the lattice size at least as @xmath14 , where @xmath15 is the number of sites . we apply the heat bath monte carlo approach@xcite to find the magnetic contribution to the specific heat at zero field , i.e. @xmath16 where @xmath17 is an average over thermodynamic ensemble , and @xmath18 . in the numerical calculations , the thermal average @xmath17 is substituted by the time average . a lattice of @xmath19 spins is used , with periodic boundary conditions . the initial state is of full saturation , i.e. all spins equal to @xmath20 . alternatively spins are randomly + 1 or @xmath21 , with equal weights . after about @xmath22 time steps , the total magnetization is close to zero , and the system is reasonably close to thermal equilibrium , at least for high temperatures . we define a time step as one update of the whole network . then , the time average of @xmath23 and @xmath24 is found . the results are averaged over @xmath25 trials . for @xmath26 less than @xmath27 $ ] the statistics is better : @xmath28 . the obtained plot is shown in fig . [ cv ] . the same algorithm is used to calculate the static susceptibility for zero field , i.e. @xmath29 where @xmath30 . here again , two sets of data @xmath31 are obtained for two different kinds of the initial conditions , one saturated and one random . the results are shown in fig . as we see , two curves @xmath31 become different below certain temperature . the curve for the random initial state is higher . this is so since , for low temperature , the algorithm of heat bath leads the saturated system to one of its ground states , whereas the randomness of initial state is to some extent preserved . to get more insight into this memory effect , we also calculate the thermal dependence of the edward anderson order parameter @xmath32.@xcite in its definition below , the appropriate time average is written explicitly : @xmath33 in fig . [ qea ] we show @xmath34 obtained from a random and saturated states by the heat bath algorithm at zero temperature . as we see , @xmath32 starts to differ from zero at temperature close to @xmath35 $ ] , where the plots on @xmath36 and @xmath31 obtained for different initial conditions separate . for the case of @xmath37 , we calculate also the spectrum of the metastable states . these states are obtained from a random initial state by means of the heat bath algorithm in zero temperature limit . the result is shown in fig . [ hist_e](a ) . it is seen that there is some randomness preserved in the metastable states . the mean energy of a metastable state is less than three percent above the ground state energy . in fig . [ hist_e](b ) , an attempt is presented to find a correlation between energy and magnetization of the same metastable states . as we see , there is no correlation at all . we note only that metastable states with non - zero magnetic moments do exist and can produce some contribution to the hysteresis loop . however , this contribution is very small , as seen in the next figure . \(a ) from random initial states . the mean energy is about 2.5 % higher that gse=@xmath8 per unit cell . ( b ) energy against the reduced magnetization @xmath38 of the same metastable states . no visible correlation is found . @xmath39 , @xmath40 , @xmath37 , @xmath41 , @xmath42 . , title="fig : " ] + ( b ) from random initial states . the mean energy is about 2.5 % higher that gse=@xmath8 per unit cell . ( b ) energy against the reduced magnetization @xmath38 of the same metastable states . no visible correlation is found . @xmath39 , @xmath40 , @xmath37 , @xmath41 , @xmath42 . , title="fig : " ] the same kind of randomness is present in the results on the magnetization curve . the curve is shown in fig . [ loops ] . for a comparison , we present also the data obtained for the square lattice and the triangular lattice . the distribution of sizes of spin flips avalanches is shown in fig . [ peaks ] . by an avalanche size we mean the number of flipped spins at a given field . in fig . [ peaks ] , we see three maxima , obtained at fields @xmath40 , @xmath43 $ ] and @xmath44 $ ] . the avalanches at @xmath40 are just numbers of spins which flip when the system passes from random initial state to a metastable state , with final energy distribution shown in fig . [ hist_e](a ) . these avalanches are the largest , as they contain about 23000 flippings . the avalanches occurring at field @xmath43 $ ] and @xmath44 $ ] contain 10450 and 19800 flippings in the average ( see fig . [ peaks](a ) ) . above @xmath44 $ ] , all spins are saturated . provided that , in the average , the magnetization of a metastable state is approximately zero , a half of spins ( @xmath45 ) are to be flipped to saturate the sample . in fig . [ peaks](b - d ) we show the same peaks in smaller scales , what enables to observe their detailed character . the positions of the peaks of the spectrum indicate , that the summarized size of avalanches at @xmath43 $ ] and @xmath44 $ ] is 30250 in the average . the small amount of difference , here 250 spins in the average , mean that some spins flip back and forth . , the square lattice and the triangular lattice ( solid , dashed and dotted lines , respectively ) for @xmath37 . ] \(a ) ( b ) + ( c ) ( d ) the magnetic properties of the investigated lattice shows similarities to the spin glass state . these are : maxima of the spin susceptibility @xmath46 and the specific heat @xmath47 as dependent on temperature , and the memory effect , i.e. the dependence of these observables on an initial state below @xmath48 $ ] . in this range of @xmath26 , the edwards anderson order parameter @xmath32 is different from zero . we deduce that there , the ensemble average can not be substituted by the time average , and our numerical results on @xmath47 and @xmath46 are not reliable . however , the main peaks of @xmath47 and @xmath46 between @xmath49 $ ] and @xmath50 $ ] do not depend on the initial state . on the other hand , the ground state energy is multiply degenerated . as a consequence , the overlap@xcite of two ground states @xmath51 and @xmath52 , defined as @xmath53 is different from unity . for example , the overlap between states a and b from tab . [ tab1 ] is @xmath54 . when the non - periodic ground states are taken into account , the overlap distribution @xmath55 is practically a continuous function of @xmath56 . to explain it , let us consider only two periodic ground states , a and b. if only those two are possible , an overlap between two non periodic ground states @xmath51 and @xmath52 within a unit cell is either @xmath57 or @xmath58 , for the cells in the same or different states , respectively . for any state @xmath51 , we can select @xmath59 out of @xmath60 unit cells and form state @xmath52 putting them in the same states , as in @xmath51 . in this case we have the overlap probability @xmath61 in fact , there are six periodic ground states , and not only two . information , cells in which ground states can be neighbors without raising energy , is given in the last column of tab . [ tab1 ] . if the condition of periodicity is removed , the number of ground states of a unit cell increases . in any case , a typical ground state of the whole lattice is expected to be not periodic , but disordered . in this way , the most simple definition of spin glass@xcite is true for our lattice . in the case of @xmath37 , the system dynamics leads to ( meta)stable states , which depend on initial states . the spectrum of gse and the magnetization curve reveal a random character , which is a consequence of the random initial state . numerical results reported above suggest , that the temperature of the transition between the paramagnetic state and the low - temperature state , which seems to be the spin - glass state , is positive . it is an open question , how much disorder is needed to reproduce the vanishing of the transition temperature , which is the standard result for two - dimensional ising spin glasses.@xcite with small amount of disorder , we expect that the interaction field at some sites is zero and these spins flip freely . once a cluster of these spins spans throughout the lattice , the transition at finite temperatures is likely to disappear . concluding , the @xmath0 archimedean lattice can be useful as a reference example when the question , which features of a realistic spin glass are a consequence of frustration only , is under debate . this structure can be also a good starting point for numerical calculations . last but not least , it is much easier to simulate an ising spin glass where the magnetic interaction is homogeneous . part of calculations was carried out in ack cyfronet agh . the machine time on hp integrity superdome is financed by the polish ministry of science and information technology under grant no . mnii / hp_i_sd / agh/002/2004 . 88 c. m. newman and d. l. stein , j. phys . : condens . matt . * 15 * ( 2003 ) r1319 . p. n. suding and r. m. ziff , phys . e * 60 * ( 1999 ) 275 . p. tomczak and j. richter , phys . b * 59 * ( 1999 ) 107 . j. richter , j. schulenburg and a. honecker , _ quantum magnetism in two dimensions : from semi - classical nel order to magnetic disorder _ notes phys . * 645 * ( 2004 ) 85 . w. lenz , z. phys . * 21 * ( 1920 ) 613 ; e. ising , z. phys . * 31 * ( 1925 ) 253 . d. w. heermann , _ computer simulation methods in theoretical physics _ , ( springer - verlag , berlin , 1990 ) . s. f. edwards and p. w. anderson , j. phys . f : metal phys . * 5 * ( 1975 ) 965 . k. h. fischer and j. a. hertz , _ spin glasses _ , ( cambridge up , cambridge , 1991 ) .

we investigate magnetic properties of a two - dimensional periodic structure with ising spins and antiferromagnetic nearest neighbor interaction . the structure is topologically equivalent to the archimedean @xmath0 lattice . the ground state energy is degenerate . in some ground states , the spin structure is translationally invariant , with the same configuration in each unit cell . numerical results are reported on specific heat and static magnetic susceptibility against temperature . both quantities show maxima at temperature @xmath1 . they reveal some sensitivity on the initial state in temperatures where the edwards anderson order parameter is positive . for zero temperature and low frequency of the applied field , the magnetic losses are negligible . however , the magnetization curve displays some erratic behavior due to the metastable states .

SHARE THIS ARTICLE Share Tweet Post Email WikiLeaks founder Julian Assange was challenged by a U.K. judge to come out of his hiding place in the Ecuadorian embassy and face the arrest that he’s been avoiding for more than five years. Judge Emma Arbuthnot on Tuesday refused to overturn a warrant that Assange blames for keeping him in the London apartment. The Australian appears to think he’s above the law and lacks courage, she said. It’s the second time this month Arbuthnot refused to overturn the warrant issued after the 46-year-old failed to appear at a London court in 2012 for a Swedish sexual assault probe. “He’s a man who wants to impose his terms on the course of justice,” Judge Emma Arbuthnot said. “Defendants on bail up and down the country, and requested persons facing extradition, come to court to face the consequences of their own choices. He should have the courage to do so too.” Arbuthnot said she wasn’t convinced by the public interest arguments from Assange’s lawyer, which included that his time in the embassy had been punishment enough. Assange is free to use his computer, his cellphone and has access to a balcony, she said. She also judged he is in “relatively good physical health,” after 5 1/2 years in the office. Arbuthnot dismissed another set of arguments a week ago by his team, which said the Swedish arrest warrant lost its purpose when the sexual-assault case was dropped. One of Assange’s attorneys, Gareth Peirce, declined to give a view on the verdict, which could be reviewed by judges in the next three months. ‘Surprised’ “We are surprised,” Assange’s Twitter feed said. “The judge went outside what the parties presented in court. This seems to have led to the significant factual errors in the judgment.” Assange walked into the Ecuadorian embassy in June 2012, after exhausting options in U.K. courts to avoid extradition over the allegations stemming from a 2010 trip to Sweden. He refused to return to the Scandinavian country for questioning, citing risks he would be extradited to the U.S. He and WikiLeaks have become famous over the past decade for disclosing confidential documents about the U.S. government and politics. The website injected itself into the middle of the last U.S. presidential race by publishing hacked emails from Hillary Clinton’s campaign. ||||| FILE - In this May 19, 2017 file photo, WikiLeaks founder Julian Assange gestures to supporters outside the Ecuadorian embassy in London, where he has been in self imposed exile since 2012. A British... (Associated Press) FILE - In this May 19, 2017 file photo, WikiLeaks founder Julian Assange gestures to supporters outside the Ecuadorian embassy in London, where he has been in self imposed exile since 2012. A British judge on Tuesday Feb. 13, 20-18 is scheduled to quash or uphold an arrest warrant for WikiLeaks founder... (Associated Press) FILE - In this May 19, 2017 file photo, WikiLeaks founder Julian Assange gestures to supporters outside the Ecuadorian embassy in London, where he has been in self imposed exile since 2012. A British judge on Tuesday Feb. 13, 20-18 is scheduled to quash or uphold an arrest warrant for WikiLeaks founder... (Associated Press) FILE - In this May 19, 2017 file photo, WikiLeaks founder Julian Assange gestures to supporters outside the Ecuadorian embassy in London, where he has been in self imposed exile since 2012. A British... (Associated Press) LONDON (AP) — A British judge on Tuesday upheld an arrest warrant for WikiLeaks founder Julian Assange, who has spent more than five years evading the law inside Ecuador's London embassy. Judge Emma Arbuthnot rejected arguments by Assange's lawyers that it is no longer in the public interest to arrest him for jumping bail in 2012 and seeking shelter in the embassy to avoid extradition to Sweden, where prosecutors were investigating allegations of sexual assault and rape made by two women. He has denied the allegations. Arbuthnot said Assange should come to court and make his case like any other defendant and did not mince words in leveling her decision at Westminster Magistrates' Court. She said that by jumping bail Assange had made "a determined attempt to avoid the order of the court," before rejecting each argument made by his attorneys. "The impression I have ... is that he is a man who wants to impose his terms on the course of justice," she said. "He appears to consider himself above the normal rules of law and wants justice only if it goes in his favor." Assange is able to appeal, but his lawyers don't yet know whether he will. Swedish prosecutors dropped their investigation last year, saying there was no prospect of bringing Assange to Sweden in the foreseeable future. But the British warrant for violating bail conditions still stands, and Assange faces arrest if he leaves the embassy. Assange's lawyers had asked for the warrant to be withdrawn since Sweden no longer wants him extradited, but the judge rejected their request last week. Assange's attorney had gone on to argue that arresting him is no longer proportionate or in the public interest. Lawyer Mark Summers said that the 5½ years Assange has spent inside the embassy were "adequate, if not severe" punishment for his actions, and cited a report by a U.N. committee which said the 46-year-old was being arbitrarily detained. He also claimed the Australian was justified in seeking refuge in the embassy because he has a legitimate fear that U.S. authorities are seeking to arrest him for WikiLeaks' publication of secret documents. Summers also argued that Assange's actions had not stalled Sweden's legal case, because Assange had offered to be interviewed by Swedish prosecutors at the embassy. He said emails recently released after a freedom of information request showed that a British state prosecutor had advised Sweden "that it would not be prudent for Sweden to try to interview Mr. Assange in the U.K." Some lawyers who have followed the case suggest the impasse will continue in the case. Edward Grange, a partner at law firm Corker Binning, said the fact remained that Assange had chosen to enter the embassy to avoid arrest. "It would be a dangerous precedent to set if the warrant could just be withdrawn on public interest grounds, because that would be seen as a reward for individuals who decide to avoid administrative justice," he said. Assange suspects there is a secret U.S. grand jury indictment against him for WikiLeaks' publication of classified documents, and that American authorities will seek his extradition. Arbuthnot rejected that contention as well. "I do not find that Mr. Assange's fears were reasonable," Arbuthnot said. Another Assange lawyer, Jennifer Robinson, said the WikiLeaks chief was willing to face legal proceedings in Britain — if he receives a guarantee that he will not be sent to the U.S. to face prosecution. "Mr. Assange remains ready to face British justice and to resolve any outstanding matters related to his seeking protection in the Ecuadorean embassy — but not at the risk of being forced to face American injustice for exercising the freedom to publish," Robinson said.

– A British judge on Tuesday upheld an arrest warrant for WikiLeaks founder Julian Assange, who has spent more than five years evading the law inside Ecuador's London embassy. Judge Emma Arbuthnot—who Bloomberg reports last week rejected arguments made by his team—rejected new arguments by Assange's lawyers that it's no longer in the public interest to arrest him for jumping bail in 2012 and seeking shelter in the embassy to avoid extradition to Sweden, where prosecutors were investigating allegations of sexual assault and rape made by two women. He has denied the allegations. Arbuthnot said Assange should come to court and make his case like any other defendant and didn't mince words in leveling her decision at Westminster Magistrates' Court, reports the AP. "He appears to consider himself above the normal rules of law and wants justice only if it goes in his favor," she said. "Defendants on bail up and down the country ... come to court to face the consequences of their own choices. He should have the courage to do so, too." Swedish prosecutors dropped their investigation last year, saying there was no prospect of bringing Assange to Sweden in the foreseeable future. But the British warrant for violating bail conditions still stands, and Assange faces arrest if he leaves the embassy. Assange's attorney argued that arresting him is no longer proportionate or in the public interest, saying the 5½ years Assange has spent inside the embassy were "adequate, if not severe" punishment for his actions.

malignant syphilis is a rare form of destructive syphilide , with rupia - like ulcerative lesions and severe toxemia , which may end in death . ulcers , commonly seen over the face and extremities , are covered with thick crusts , which heal slowly . mucus membranes of the mouth and nose may be involved and prodromes of fever , myalgia and headache are common . these lesions were commonly reported in the pre - antibiotic era , and have now re - emerged with the advent of hiv . a 30-year - old housewife presented with multiple , large , ulcerative lesions all over the body of 1-month duration . she did not give any history of genital lesions before the onset of skin lesions . she also gave a history of two spontaneous miscarriages for which she had not taken treatment and has not had contact with her husband since 6 months . he was diagnosed as having hiv 2 years ago and was initiated on antiretroviral therapy . he was currently being treated for chancroid as well , due to many genital ulcers that he presented to us with . on examination , cutaneous examination revealed multiple , ulcerative , crusted lesions on the face and extremities [ figures 1 and 2 ] . the axillary , epitrochlear and inguinal lymph nodes were enlarged , tender and rubbery in consistency . multiple crusted lesions with erosion of lips crusted lesions of extremities annular lesion with central pigmentation of the palms initial laboratory investigations revealed leucocytosis , with predominance of polymorphs and an elevated esr . pus culture from the ulcerated lesions grew staphylococcus aureus which was highly sensitive to newer quinolones . we initiated treatment with benzathine penicillin g 24 lakh units intramuscularly as a single dose following which the partner was lost to follow - up . skin biopsy of the rupioid lesions showed pseudoepitheliomatous hyperplasia with ulceration , dense lymphocytic infiltrate at mid - dermal level on 20 magnification [ figure 4 ] and plasma cell infiltrate with obliterative vasculitis on 40 magnification [ figure 5 ] . section on 20 magnification showing dense lymphocytic infiltrate section on 40 magnification showing plasma cell infiltrate with endarteritis obliterans since the patient gave history of intense headache and fever we considered an impending cns involvement and hence treatment was initiated with procaine penicillin 1.2 million units daily for 3 weeks intramuscularly , and we also took the advantage of admitting the patient in our hospital . patient started responding to treatment and all her cutaneous lesions healed completely in 3 weeks [ figures 6 and 7 ] . monthly vdrl titers were done , and there was a four - fold decrease in the titers . follow - up after 6 months showed no evidence of relapse , with a nonreactive vdrl and positive tpha . it is not surprising that hiv and treponema pallidum causing syphilis can co - infect the same person . both organisms are sexually transmitted and the risk factors for their acquisition are also the same . in immunodeficient states , hence the diagnosis of malignant syphilis can occasionally prove to be challenging . in chandigarh , india , malignant syphilis was reported in two out of 55 patients with syphilis , from the year 1990 - 99 ; and among the study population one of three hiv - infected patient had malignant syphilis . a review of publications in the english literature identified 14 cases of malignant syphilis reported between the early 1900s and 1988 . from 1989 to 1994 , of those 12 cases , 11 occurred in patients who either were infected with hiv or were at high risk for hiv infection . it is still not clear why only some patients infected with t. pallidum have malignant syphilis . this could probably be attributed to the altered immune status of the host or to a virulent strain of t. pallidum . this atypical form of syphilis with concomitant hiv can lead to accelerated neurosyphilis with which it commonly presents . similar cases have been reported which stressed the atypical presentation of syphilis in a background of hiv infection and cautioned the clinician on maintaining a high index of suspicion to identify and treat this deadly association . its malignant presentation penicillin still continues to play a promising role in treating this fatal disease . some of the features suggestive of syphilis and hiv co - infection are unusually high or low titers , a late fall in titer after successful treatment and a higher incidence of asymptomatic cns involvement . physicians also need to maintain a serological follow - up to document a four - fold fall in titer besides a stringent clinical documentation of resolution of symptoms . this case is highlighted for the presence of malignant syphilis with hiv , an association which seems to be on a rise parallel with the rise of hiv infection .

malignant syphilis or lues maligna , commonly reported in the pre - antibiotic era , has now seen a resurgence with the advent of human immunodeficiency virus ( hiv ) . immunosuppression and sexual promiscuity set the stage for this deadly association of hiv and treponema pallidum that can manifest atypically and can prove to cause diagnostic problems . we report one such case in a 30-year - old female who responded favorably to treatment with penicillin .

we consider ranking and selection of systems based on the average performance of the alternatives . the particular set - up used here is motivated by problems from optimization under uncertainty . often in operations research as well as in technical applications the performance of solutions depends on some random influence like market conditions , material quality , or simply measurement errors . we shall call such random influences a random _ scenario_. usually , the aim is then to find a solution with minimal expected costs taken over all scenarios . we assume here that we can describe the random scenario mathematically by a random variable @xmath0 with a distribution @xmath1 . let @xmath2 denote the cost of solution @xmath3 if it has been applied to random scenario @xmath4 then the average costs are given by the expectation @xmath5 . except for particularly simple cases , we will not be able to calculate this expression analytically . instead , we have to estimate @xmath5 based on a sample @xmath6 where @xmath7 are observations of the random variable @xmath8 , usually produced by a stochastic simulation model on a computer . with estimated costs , optimization can be performed by heuristic search methods like genetic algorithms or ant algorithms . typically , these methods take a relatively small set @xmath9 of solutions ( a ` population ' ) and try to improve the quality of @xmath10 iteratively . the improvement step usually includes a _ selection _ of the best or at least the most promising solutions from @xmath10 with respect to their expected costs @xmath11 . as @xmath12 can only be estimated , this selection will return sub - optimal solutions with a certain error probability . often , this probability can be made arbitrarily small by increasing the sample size @xmath13 , i.e. the number of simulations . the aim of this paper is to find selection mechanisms for good solutions suitable for heuristic optimization that have error probabilities below a given bound and use few simulations only . most heuristic optimization procedures do not need the exact values of @xmath14 in order to perform a reasonable selection , instead it is sufficient to find the correct _ ranking _ @xmath15 or even only part of it . as it has been noted before ( see e.g. @xcite ) it is much easier ( needs less simulations ) to estimate the correct ranking than to estimate the correct values . methods of ranking and selection are therefore widely used in heuristic optimization under uncertainty , see e.g. @xcite for an overview . in this paper we have a fixed set @xmath16 of solutions , the observed cost values are assumed to be normally distributed with unknown mean and unknown covariance matrix . we use a bayesian approach and estimate the ranks of the solutions in each iteration based on the present posterior means . roughly , the steps of our procedure to rank and select the solutions can be summarized as follows : 1 . initialization : observe all solutions for a fixed number @xmath17 of scenarios ( = simulations ) . 2 . determine the ranking and selection based on the posterior means given these observations . calculate a lower bound lb(pcs ) for the _ probability of correct selection _ pcs 4 . while lb(pcs ) @xmath18 do 1 . allocate a fixed _ budget _ of additional simulations to the solutions , 2 . recalculate the posterior means , the ranking and selection and lb(pcs ) based on the extended set of observations . 5 . return the last ranking and selection . input parameters are the allowed error probability @xmath19 , the simulation budget @xmath20 and the initial sample size @xmath17 . this is the standard framework of a ( bayesian ) computing budget allocation ( cba ) algorithm , see e.g. in @xcite . our contributions concern the following points which we label for further reference : depend : : we allow for _ dependent observations _ , i.e. we apply the solutions to common random scenarios ( common random numbers , crn ) observing @xmath21 , a vector of possibly dependent , normally distributed values . target : : we use a very _ general concept of a target _ for ranking and selection that includes targets as median or span of means and still allows to bound the probability of a correct selection in a simple bonferroni fashion . alloc : : most importantly , we introduce a new _ heuristic allocation scheme _ for additional simulations based on the posterior distribution of the means and the covariance matrix . this scheme reuses terms that have been evaluated to calculate the lb(pcs ) in the iteration before and therefore requires little additional effort . in the experiments described below , our algorithm needed less simulations to guarantee lb(pcs)@xmath22 than competitors from literature . let us discuss these issues in more detail . * depend * : classical ranking and selection ( r&s ) procedures evaluate the alternatives based on random scenarios drawn _ independently _ for each alternative , see e.g. @xcite . only a few authors ( see e.g. @xcite ) use _ dependent _ samples based on common random numbers ( crn ) for simulation . it is well known , that if the observations are _ positively correlated _ , it is more efficient to use common random numbers ( crn ) , i.e. to compare the solutions on the same scenario ( see e.g. @xcite ) . positive correlation in our case roughly means that if a solution @xmath23 has , for a scenario @xmath24 costs @xmath2 that are above average , then costs @xmath25 will tend to be over average for all the other solutions @xmath26 also . in other words , if some scenario @xmath27 is relatively difficult ( costly ) for solution @xmath28 then @xmath29 will tend to be difficult for all solutions . similarly , a scenario that has small costs ( below average ) for one solution will tend to be an easy scenario for all solutions creating smaller costs for all of them . as this is the behaviour we would expect from a set of solutions at least after some iterations of improvement , it seems to be justified to expect positive correlation and to use crn specific r&s procedures for heuristic optimization . the numerical results below show that if the cost are positively correlated huge savings in simulation effort are indeed possible and if there is no positive correlation our approach is not worse than other procedures . * target * : we fix a set @xmath30 of ranks and try to select ( only ) those solutions that have these ranks with respect to the posterior means ( and sort them if necessary ) . e.g. if we have @xmath31 then we want to select the @xmath32 best solutions ( with minimal means ) . we describe the sets of possible correct selections in a way that uses a minimal set of pairwise comparisons of solutions , see @xcite for a similar approach . this allows to give a bonferroni type of lower bound to the posterior probability of correct selection that involve only one - dimensional @xmath33-distributions . the important and difficult part of this calculation is the determination of the posterior distributions in the presence of incomplete observations due to the possibly unequal allocation of the budget . * alloc * : the expressions forming the bonferroni lower bound for the pcs may be used to identify pairs of solutions for which the comparison has a large error probability and which need more data for a clear r&s decision . this results in a simple allocation rule that is simpler to calculate and turned out to be more efficient in our experiments than greedy ocba allocation rules as they are often used in literature ( see e.g. @xcite ) . this paper is based on the doctoral thesis of one of the authors ( @xcite ) . it is organized along the three issues outlined above as follows . * depend * : in the first section we give the exact mathematical description of the sampling process and describe our bayesian model . details of the rather involved calculation of the posterior distribution with missing data are summarized in an appendix . * target * : the second section generalizes the concept of ranking and selection of solutions to the case of partial selections . * alloc * : in section 3 we introduce several schemes for allocating the simulation budget to solutions based on the posterior distributions . a precise definition of our complete ranking and selection algorithm is given in section 4 . we report on extensive empirical tests with this algorithm in section 5 where we compare it to a greedy type of ocba algorithm and to the standard @xmath34 procedure of @xcite . some conclusions are given in the final section . let @xmath35 denote the fixed set of solutions . @xmath36 is the @xmath32-th observation of solution @xmath37 , i.e. the cost when @xmath38 is applied to the @xmath32-th random scenario . we do not consider cost functions and scenarios explicitely in the sequel . we collect the @xmath36 into a matrix - like object @xmath39 : a column in our data @xmath40 represents the observations of all solutions with a single scenario , whereas the rows represent all observations from a particular solution . @xmath40 need not be a complete matrix : due to possibly unequal allocation of simulations we may have a ragged right border , see below . as we use crn , missing values at the end of a row are not really ` missing ' but are rather ` not yet observed ' . simulating _ all _ of the solutions from @xmath41 with the @xmath32-th scenario therefore leads to a ( column ) vector of observations @xmath42 as it is often done in ranking and selection , we assume that @xmath43 are independent and identically @xmath44-distributed observations . here , @xmath45 denotes the @xmath46-dimensional normal distribution with mean @xmath47 and the positive definite @xmath48 covariance matrix @xmath49 . this model includes the case , where the @xmath50 solutions are simulated independently ( i.e. with different scenarios ) , then @xmath51 is a diagonal matrix . @xmath52 and @xmath51 are assumed to be unknown . our overall goal is to extract information about @xmath53 from the observations @xmath39 . typically , we want to identify solutions @xmath37 that have small mean values @xmath12 . we take a bayesian point of view , that is we assume that the unknown parameters @xmath53 and @xmath51 are themselves observations of random variables @xmath54 and @xmath55 having a prior distribution with density @xmath56 . we do not assume any specific prior knowledge about the parameters , therefore we shall use the so - called uninformed prior distribution ( see @xcite , @xcite ) with @xmath57 where @xmath58 means that the right hand side gives the density @xmath59 up to some multiplicative constant that does not depend on @xmath53 or @xmath51 . @xmath60 is a so - called hyperparameter that allows to control the degree of uncertainty about @xmath51 . instead of simulating all solutions equally often , we iteratively allocate a given amount @xmath20 of simulations to the solutions , depending on the observations seen so far , see the detailed algorithm in section [ sec : thealgorithm ] below . the result are samples that may contain different numbers of observations for different solutions . we use @xmath61 to denote the random ( row ) vector of the @xmath62 observations produced for the @xmath38-th solution , @xmath63 , and similarly @xmath64 for a specific sample . let @xmath65 be the vector of the @xmath46 present sample sizes , then the overall samples can be collected into a matrix - like scheme with possibly different row lengths @xmath62 : @xmath66 columns @xmath67 may be incomplete , as the @xmath32-th simulation ( scenario ) may not have been allocated to all solutions , see figure [ fig : samplingscheme ] for an illustration . let @xmath68 denote the set of possible samples of that shape for a particular size vector @xmath69 . we shall now define the possible samples and allocation rules recursively . at first ( in iteration @xmath70 ) , all solutions are simulated @xmath17 times where @xmath17 is a given fixed number . with @xmath71 we are therefore observing a ( @xmath72-matrix ) sample @xmath73 from @xmath74 next we apply an _ allocation rule _ @xmath75 @xmath76 that determines the numbers @xmath77 of additional simulations for solution @xmath63 in the first iteration . then the overall number of simulations seen so far is @xmath78 after these additional simulations have been performed we have a sample @xmath79 let @xmath80 be the set of all possible samples after the first iteration , i.e. @xmath81 where the operation @xmath82 concatenates elements row - wise , i.e. @xmath83 generally , after the @xmath84-th iteration we have a sample @xmath85 where @xmath86 gives the total number of simulations performed with each solution so far . then , an allocation rule @xmath87 is applied to determine the numbers of additional simulations in the @xmath88-st iteration . the set of possible samples after that iteration is @xmath89 note , that under crn the simulation of different iterations will in general not be independent as we may have to _ reuse _ scenarios ( random numbers ) for some solutions that have already been used in earlier iterations for other solutions . a new independent scenario is drawn for the simulation of some solution @xmath38 only if @xmath90 has been applied to all scenarios drawn before . see figure [ fig : samplingscheme ] for a simple example . and budget @xmath91 . the allocations of the second iteration are marked in gray , those of the third in black . the results in the ( complete ) columns @xmath92 are @xmath93-distributed . , width=188 ] the allocation schemes we use below depend on the posterior distribution of the mean @xmath54 given data @xmath94 which is determined in the next subsection . the likelihood function of incomplete samples as described in the last section are examined in great detail and generality in @xcite . our case is comparatively simple , as we have consecutive observations for each solution ( row in the sample ) and there are no ` holes ' , data may only be missing at the end of the sample . this is due to the crn scheme we are using : assume a solution @xmath95 has been simulated with the first @xmath32 scenarios resulting in @xmath96 . if no simulations are allocated to @xmath38 in the next iterations , but additional simulations are performed in later iterations , these have to use scenarios @xmath97 resulting in observations @xmath98 . also , the pattern of the missing data is a function only of sample values observed before , this is called a monotone and ignorable pattern ( @xcite ) . there is no closed expression for the posterior density of @xmath54 given data @xmath99 if the covariance matrix @xmath51 of the underlying normal distribution is unknown . we therefore use a semi - bayesian approach and first assume that the covariance matrix is known . we determine the conditional distribution of @xmath54 given @xmath100 and @xmath101 exactly and then replace @xmath102 by its ( non - bayesian ) estimate @xmath103 . to simplify notation , let the set of solutions @xmath104 be ordered such that for the present data @xmath105 with @xmath106 we have @xmath107 this means that solution @xmath108 has been simulated with @xmath109 different independent scenarios . as we use crn , the other solutions @xmath110 have been observed with subsets of these scenarios , see fig . [ fig : monotonesample ] for a simple example . and @xmath111 . , width=226 ] we need projections of vectors and matrices to components corresponding to subsets of the solutions @xmath104 . for @xmath112 and @xmath113 let @xmath114}:= ( y_1 , \ldots , y_{i-1})^t\in { \mathbb{r}}^{i-1},\quad \text { and } \quad { \bm{y}}_{[\le i]}:= ( y_1 , \ldots , y_{i})^t\in { \mathbb{r}}^{i}.\ ] ] similarly , for the @xmath115 matrix @xmath116 we define @xmath117}&:=&(\sigma_{kl})_{k , l = 1 , \ldots , i-1 } , \qquad { \bm{\sigma}}_{[i,<i]}:= ( \sigma_{i1 } , \ldots , \sigma_{i , i-1})\quad \text { and } \label{eq : sigmaproj}\\ \beta_i & : = & \sigma_{[i,<i]}\big(\sigma_{[<i]}\big)^{-1 } \label{eq : defbeta}. \end{aligned}\ ] ] here , @xmath118 is a @xmath119-dimensional row vector . let @xmath120 be the sample mean of all @xmath62 observations @xmath121 available for solution @xmath122 . for @xmath123 we have @xmath124 therefore we may define the sample mean of solution @xmath38 restricted to its first @xmath125 observations @xmath126 [ fig : samplemeans ] } $ ] contains all @xmath127 sample means from the boxed values.,title="fig:",width=226 ] then @xmath128}:=({\overline{\bm{x}}}^{(n_i)}_{1 } , \ldots,{\overline{\bm{x}}}^{(n_i)}_{i-1})^t $ ] is the @xmath119-dimensional column vector of sample means restricted to the first @xmath62 observations for solutions @xmath129 , that all have at least @xmath62 observations , see fig . [ fig : samplemeans ] . the posterior distribution of @xmath54 given an incomplete observation @xmath130 with known prior covariance is given in the following theorem , its rather technical proof is sketched in the appendix . [ the : posterior ] let ( the columns ) @xmath131 be @xmath132 distributed with _ known _ covariance matrix @xmath51 and unknown mean @xmath133 . assume that the variable @xmath54 for the mean has the uninformative prior @xmath134 . let the ( possibly incomplete ) data @xmath135 with @xmath136 for some @xmath137 , be given as described in section [ subsec : iterativeallocation ] . then the posterior distribution of @xmath54 given @xmath100 is an @xmath46-dimensional normal distribution @xmath138 with mean @xmath139 where @xmath140 } - \bar{{\bm{x}}}_{[<i]}^{(n_i)})\quad \text { for } i=2 , \ldots , l,\ ] ] and covariance matrix @xmath141}$ ] where @xmath142}=\frac{\sigma_{11}}{n_1},\qquad { \bm{\lambda}}_{[\le i]}= \left(\begin{array}{c|l } { \bm{\lambda}}_{[<i ] } & { \bm{\lambda}}_{[<i]}\ \beta_i^t \\[0.9ex]\hline \rule[0.5ex]{0pt}{2ex}\beta_i\ { \bm{\lambda}}_{[<i ] } & \frac{1}{n_i}(\sigma_{ii}-\beta_i{\bm{\sigma}}_{[<i]}\beta_i^t ) + \beta_i\ { \bm{\lambda}}_{[<i]}\ \beta_i^t \end{array}\right)\ ] ] for @xmath143 . for the case of an _ unknown _ covariance matrix @xmath51 we have to replace @xmath144}$ ] and @xmath118 by their estimators @xmath145}({\bm{x}})$ ] and @xmath146 . for the estimation of @xmath147}=\big(\sigma_{kl}\big)_{1\le k , l < i}$ ] we only consider solutions @xmath148 . these all have sample sizes @xmath149 we may therefore define for @xmath150 and @xmath151 the estimator @xmath152 and put @xmath153}= \hat{{\bm{\sigma } } } _ { [ < i]}({\bm{x}})&:=&\big ( \hat{\sigma}^{(n_{i-1})}_{kl } \big)_{k , l=1 , \ldots , i-1 } \label{eq : defsigest}\\ \hat{{\bm{\sigma}}}_{[i,<i]}=\hat{{\bm{\sigma}}}_{[i,<i]}({\bm{x}})&:= & ( \hat{\sigma}^{(n_{i-1})}_{i1 } , \ldots , \hat{\sigma}^{(n_{i-1})}_{i , i-1}).\notag\end{aligned}\ ] ] note that we use the maximum - likelihood estimator for the covariances and that @xmath154}$ ] is not necessarily contained in @xmath155}$ ] as both estimators may use different sample sizes @xmath156 and @xmath62 . we also have to estimate the @xmath118 and put @xmath157}(\hat{{\bm{\sigma } } } _ { [ < i]})^{-1},\ ] ] where we have to make sure that @xmath158 } $ ] is non singular . from @xcite it is known , that if the sample size @xmath156 of @xmath158}$ ] fulfills @xmath159 then @xmath158}$ ] is positive definite with probability one . this could be guaranteed if we require that the initial sample size @xmath160 is larger than the number of solutions @xmath161 as then @xmath162 . we may now plug these estimators into the definition of the posterior means and obtain @xmath163 } - \bar{{\bm{x}}}_{[<i]}^{(n_i)}),\quad \hat{{\bm{\nu}}}({\bm{x}}):=(\hat{\nu}_1 , \ldots , \hat{\nu}_l).\ ] ] to obtain an adequate estimator @xmath164 we first look at the case of _ complete _ observations , i.e. with @xmath165 . then it is well - known ( see e.g. @xcite , 10.3 ) that with @xmath51 _ known _ and an uninformative prior distribution for the mean @xmath54 , the posterior distribution of @xmath54 would be normal with covariance matrix @xmath166 . if @xmath51 is _ unknown _ with the improper prior distribution as in the marginal posterior distribution of the mean @xmath54 in the complete observation case is an @xmath46-dimensional @xmath33-distribution with @xmath167 degrees of freedom , location parameter @xmath168 and scale matrix @xmath169 . here , the correction term @xmath170 involves the hyperparameter @xmath171 , the sample size and the dimension of the problem . for the present situation of incomplete observations and _ known _ covariance matrix , the posterior covariance @xmath172 has to be replaced by @xmath173 as in , reflecting the different sample sizes for each solution instead of the fixed size @xmath174 . then , in the case of _ unknown _ @xmath102 , it seems reasonable to approximate the posterior distribution of the mean @xmath54 by an @xmath46-dimensional @xmath175-distribution with @xmath167 degrees of freedom and location parameter @xmath176 . the scale matrix should be obtained from @xmath173 with the @xmath177 replaced by their adequate estimators . in particular , the correction terms @xmath170 from the complete observation case should be replaced on the @xmath38-th step of the recursion in by @xmath178 using the number @xmath38 of solutions considered in that step . we thus obtain @xmath179}=\hat{{\bm{\lambda}}}_{[\le 1]}({\bm{x}})&:=\frac{\hat{\sigma}^{(n_1)}_{11}}{n_1 - 1+\nu_0},\label{eq : lambdahat } \\ \hat{{\bm{\lambda}}}_{[\le i]}= \hat{{\bm{\lambda}}}_{[\le i]}({\bm{x } } ) & : = \left(\begin{array}{c|l } \hat{{\bm{\lambda}}}_{[<i ] } & \hat{{\bm{\lambda}}}_{[<i]}\ \hat{\beta}_i^t \\[0.9ex]\hline \rule[0.5ex]{0pt}{2ex}\hat{\beta}_i\ \hat{{\bm{\lambda}}}_{[<i ] } & \frac{1}{n_i - i+\nu_0}(\hat{\sigma}^{(n_i)}_{ii}-\hat{\beta}_i\hat{{\bm{\sigma}}}_{[<i]}\hat{\beta}_i^t ) + \hat{\beta}_i\ \hat{{\bm{\lambda}}}_{[<i]}\ \hat{\beta}_i^t \end{array}\right ) \notag\end{aligned}\ ] ] for @xmath143 , and @xmath180}({\bm{x}})$ ] . in this paper , the posterior distribution of the mean @xmath54 is used mainly to express the probability of a wrong selection , see below . in particular , we need the posterior probability of the event @xmath181 for @xmath182 and @xmath183 . from the properties of the multivariate @xmath33-distribution we may conclude that @xmath184\ = \ { \text{\textbf{p}}}[w_i - w_j\le \delta\mid { \bm{x}}={\bm{x}}]\\ & \approx \ g(\delta;\ \min\{n_i , n_j\}-1,\ ; \hat{\nu}_i-\hat{\nu}_j,\ ; \hat{\lambda}_{ii}+\hat{\lambda}_{jj}-2\hat{\lambda}_{ij})\notag\\ & : = p_{ij}^\delta\notag\end{aligned}\ ] ] where @xmath185 is the distribution function of the one - dimensional @xmath186-distribution with @xmath32 degrees of freedom , location parameter @xmath187 and scale parameter @xmath20 . this approximation will be used below . we start with a general definition of the ranking and selection schemes we are examining in this paper . it is a generalization of the approach in @xcite . we want to select solutions from the set @xmath188 according to their ranks under some performance measure , in our case the mean value . e.g. we want to select the solution with the lowest mean value ( the best solution ) or the @xmath189 best solutions as it is often used e.g. in ant algorithms . we restrict ourselves to such selections that can be determined using pairwise comparisons of solutions only . the idea is to formulate _ minimal _ requirements for the correctness of a selection in terms of pairwise comparisons and then use to determine the error probability . this may allow a tighter error bound compared to a complete ranking of all solutions . we first introduce an abstract concept which is illustrated by an example below . for a general ranking and selection scheme ( r&s - scheme ) we first define a set of _ target ranks _ @xmath190 . this means that we want to select those solutions that have ranks from @xmath191 with respect to their mean values . as the mean values are assumed to be unknown , we use their available estimates @xmath192 instead . these are ordered in increasing order @xmath193 and the solutions with estimated ranks in @xmath191 are selected , i.e. the solutions @xmath194 the aim is then to determine the error probability of the selection @xmath195 i.e.the posterior probability that a solution @xmath196 does not have a rank from @xmath197 . as we have continuous posterior distributions for which @xmath198 = 0\ ] ] we may restrict ourselves to the @xmath46-dimensional euclidean space without equal values : @xmath199 let @xmath200 be the set of all @xmath46-dimensional vectors , in which the selected positions from @xmath201 have ranks @xmath191 . thus , @xmath202 is the set of all potential means for which the selection @xmath201 would be correct for target @xmath191 . recall that @xmath203 is the random variable indicating the unknown mean . with the help of @xmath202 we can therefore express the probability that @xmath201 is a correct selection for target @xmath191 simply as @xmath204 = { \text{\textbf{p } } } [ \{\text{rank}(w_l)\mid l \in b\}=a \mid { \bm{x}}={\bm{x}}].\ ] ] for an easier access to this probability we assume that there is a binary _ relation _ @xmath205\ \cup\ [ ( { \mathcal{l}}-b)\times b]\ ] ] on pairs @xmath206 that relates selected positions @xmath196 to unselected positions @xmath207 such that @xmath202 has the following representation @xmath208 where as usual @xmath209 is true if @xmath210 . thus @xmath211 provides a definition of a correct selection by pairwise comparison of certain pairs @xmath212 . note that @xmath201 and hence @xmath202 and @xmath211 all depend on the observation @xmath130 . the following examples explain these definitions . assume that holds . 1 . let @xmath213 this means we want to select the best solution . then with , the selection is @xmath214 as @xmath215 is the smallest posterior mean . with @xmath216 we have from @xmath217 @xmath202 is the set of all potential mean value vectors where selection @xmath218 leads to the best ( minimal ) solution . 2 . if @xmath219 for some @xmath220 we want to select the @xmath189 best ( minimal ) solutions . then from we see that we must choose @xmath221 . as characterizing relation we obtain @xmath222 and @xmath223 3 . if , in addition , the @xmath189 best solutions have to be ranked among themselves then we would choose @xmath224 and @xmath225 this example includes complete ranking of the solution with @xmath226 and @xmath227 4 . if we want to select the median with @xmath228 we take as selection @xmath229 the median solution with respect to posterior means and as auxiliary sets @xmath230 and @xmath231 . then we use as characterizing relation @xmath232 and obtain @xmath233 as the set of vectors from @xmath234 where about half of the components is less than @xmath235 and the rest is larger , therefore @xmath235 is the median . 5 . as a final example let @xmath236 denote a target that could be used to describe the span of the mean values of the solution . then the selection should be @xmath237 from and @xmath238 and @xmath239 in the iterative procedure below , the posterior means @xmath240 have to be determined after each iteration based on the new observations . therefore , @xmath241 and @xmath202 have to be adapted in each iteration also . we now define the probability of correct selection ( pcs ) for a selection as in simply by @xmath242.\ ] ] to determine pcs directly , one has to solve high dimensional integrals in order to arrive at the marginal distribution of the posterior distribution on the components of the selection @xmath201 . instead , we use the relation @xmath243 that defines the set @xmath202 to derive a simple lower bound of bonferroni type for the pcs as follows @xmath244\notag\\ & = & { \text{\textbf{p}}}\big [ w_i \le w_j \text { for all } 1\le i , j\le l \text { with } \rho_{ab}(i , j)\mid { \bm{x}}={\bm{x}}\big]\notag\\ & = & 1- { \text{\textbf{p}}}\big [ w_i > w_j \text { for some } 1\le i , j\le l \text { with } \rho_{ab}(i , j)\mid { \bm{x}}={\bm{x}}\big]\notag\\ & \ge & 1- \sum_{(i , j)\in \rho_{ab } } { \text{\textbf{p } } } [ w_i > w_j \mid { \bm{x}}={\bm{x } } ] \label{eq : bonferroni}\\ & = & 1- \sum_{(i , j)\in \rho_{ab } } \big(1-{\text{\textbf{p}}}[w_i - w_j\le 0 \mid { \bm{x}}={\bm{x}}]\big ) . \notag \end{aligned}\ ] ] using we may approximate this lower bound by the following expression @xmath245 it is quite usual in ranking and selection to relax the definition of correctness of a selection . instead of strict comparisons of means @xmath246 for relevant pairs @xmath210 we are content if @xmath247 for some fixed _ indifference zone _ value @xmath248 . this allows to take the limited precision of our observations into account . formally , we then define @xmath249 and have , using @xmath250\notag\\ & \ge & 1- \sum_{(i , j)\in \rho_{ab } } { \text{\textbf{p } } } [ w_i > w_j+\delta { } \mid { \bm{x}}={\bm{x } } ] \notag \\ & \approx & 1- \negthickspace\negthickspace \sum_{(i , j)\in \rho_{ab } } \negthickspace\big(1-g ( \delta { } ; \min\{n_i , n_j\}-1,\ ; \hat{\nu}_i-\hat{\nu}_j,\ ; \hat{\lambda}_{ii}+\hat{\lambda}_{jj}-2\hat{\lambda}_{ij})\big)\label{eq : deflbdelta}\\ & = & 1- \negthickspace\negthickspace \sum_{(i , j)\in \rho_{ab}}(1-p_{ij}^\delta)\ = : lb^\delta({\bm{x } } ) \notag \end{aligned}\ ] ] in each of the iterations described in section [ subsec : iterativeallocation ] it has to be decided how many simulations @xmath251 should be performed for each solution @xmath37 . we first look at a modified version of the so - called optimal computing budget allocation ( ocba ) strategy introduced by chen ( see for example @xcite ) . ocba allocation strategies try to allocate a fixed simulation budget @xmath252 in such a way that the expected value of the @xmath253 is maximized . let @xmath254 with @xmath255 denote an allocation of the @xmath20 simulations to solutions @xmath256 . calculating the expected effect of additional simulations and to find @xmath257 that are strictly optimal with respect to that expectation is a difficult non - linear optimization problem , see e.g.@xcite . therefore , most versions of the ocba in the literature solve a substitute problem and try to maximize an approximation @xmath258 to the lower bound as in for given data @xmath130 and additional simulations @xmath259 . in this sense , a myopically optimal allocation is the solution to the following optimization problem : @xmath260 in general , even this simplified problem can be solved exactly only for very small instances of @xmath261 and small simulation budgets @xmath262 . for larger instances , heuristic solution approaches must be used , see e.g. @xcite . we adapt this approach to our environment with dependent observations . the difficulty lies in estimating the future covariances _ after _ the additional simulations @xmath259 have been performed . we use the lower bound @xmath263 where the scale parameter @xmath264 is a weighted mean of the posterior covariances : @xmath265\hat{\lambda}_{ij}.\end{aligned}\ ] ] here it is assumed that the posterior variance of @xmath266 after @xmath259 additional simulations can be estimated from the present posterior values @xmath267 and @xmath268 by entering the variances @xmath269 inversely proportional to the relative increases of the sample sizes and by scaling the covariance @xmath270 such that the influence of the sample sizes @xmath271 is proportional to the posterior variances @xmath272 and @xmath273 . a greedy heuristic ( greedyocba ) to find good solutions to the problem may then be defined similar as in @xcite and @xcite . greedyocba first measures the benefit of assigning all @xmath20 additional simulations to a single solution @xmath274 : @xmath275+\sum_{i\in{\mathcal{l}}:(i , l)\in\rho_{ab}}\left[p^\delta_{il}(0,b)-p^\delta_{il}(0,0)\right],\end{aligned}\ ] ] where the @xmath276 are defined in and @xmath277 is the @xmath278-th unit vector which has a @xmath108 at the @xmath279-th position and zeros elsewhere . then , greedyocba distributes the simulation budget proportional to the weights @xmath280 , i.e. @xmath281 a remaining budget @xmath282 is allocated according to the largest remainder method . this allocation strategy requires @xmath283 evaluations of the distribution function @xmath284 in total . hence its computational effort is about twice as high as the calculation of the bonferroni bound @xmath285 in . this complexity can be reduced if we do not try to estimate the future pcs but simply look at its present value , more precisely its components @xmath286 $ ] , defined in . @xmath287 describes the posterior probability of @xmath288-dominance of @xmath289 over @xmath290 . recall that for @xmath210 we have to make sure the @xmath291-dominance @xmath181 in order for the present selection @xmath201 to be correct with indifference parameter @xmath291 . hence a small value of @xmath292 for @xmath293 indicates that at least one of the solutions @xmath294 has insufficient data . we therefore define the weights @xmath295 then the budget is allocated proportionally to these weights as above . here , those solutions @xmath279 get a larger weight that are part of a pair @xmath296 that has a small dominance probability and where the partner of @xmath279 has a relatively small variance . this implies that @xmath279 has a relatively large variance and hence needs more simulations to increase the certainty of the dominance relation @xmath297 . we call this strategy dominance probability weighting ( @xmath298 ) . in empirical tests @xmath298 proved slightly better than greedyocba with respect to the number of simulations needed , at the same time it needs less computational effort as only the @xmath299 from the bonferroni bound are used . it turned out in the experiments that the performance could be improved further by stopping simulations for those solutions with high enough dominance probabilities . therefore we restricted the definition of @xmath300 in to those @xmath287 which are below @xmath301 where @xmath302 is the number of summands in the bonferroni bound . the allocation strategy @xmath303 therefore uses the weights @xmath304 and then allocates simulations as in . empirical results on greedyocba and @xmath303 are given in section [ sec : computational - study ] below . we are now in the position to define our algorithm in detail . let the following items be given : @xmath104 is the set of solutions , @xmath190 is the target set of ranks to be selected and possibly ranked , @xmath305 is the bound for the error probability , @xmath306 is the simulation budget for each iteration , @xmath307 is an initial sample size and @xmath291 is the indifference zone parameter . 0.5 cm * initialization * : : : observe @xmath308 for @xmath309 i.e. choose @xmath17 random scenarios and apply all solutions to each of them . let @xmath130 denote the result . + determine the posterior means @xmath310 as in , the selection @xmath311 as in , relation @xmath312 as in and and the dominance probabilities @xmath313 , as in . finally calculate the lower bound @xmath314 for the pcs as in . * while * : : @xmath315**do * * + * apply an allocation rule @xmath316 to determine the number of additional simulation runs @xmath317 , * perform @xmath251 simulations with solution @xmath37 , taking into account the common random numbers scheme as described in section [ subsec : iterativeallocation ] , let @xmath130 be the extended data including the new simulation results , * update the posterior means @xmath176 , the selection @xmath311 , the relation @xmath243 , the dominance probabilities @xmath313 , and the lower bound @xmath314 . : : * return * the present selection @xmath311 . in @xcite it is shown that this algorithm terminates if at least one simulation is allocated to each solution in each iteration . we implemented the algorithm bayesrs and compared its efficiency to other r&s procedures . the main objectives of the study were : * to compare different allocation strategies within the framework of bayesrs , here we use greedyocba , @xmath303 and equalallocation , the naive equal allocation of the budget to solutions , * to show the increasing efficiency of @xmath303 with increasingly positive correlation of the observations , * to compare bayesrs with allocation rule @xmath303 to another standard from literature , namely @xmath34 , a procedure designed to find the best solution , see @xcite , and * to investigate the behaviour of our approach in cases where there is no positive correlation . it seems that the ( approximately ) correct determination of the posterior distribution for missing values makes the allocation more precise , even if , in the case of negative correlation , common random numbers may increase the variance of the estimators used . we measured the performance by the average number of simulations each strategy needs with a common error bound @xmath19 . also we checked the empirical error probabilities or rather pcs . the tests were implemented using the free statistics software ` r ` . in @xcite further studies show the efficiency of these allocation strategies in the context of heuristic optimization methods like ant algorithms . as our methods require normally distributed observations , we generated them by a @xmath318-random generator for different values of @xmath53 and @xmath51 . some values were fixed : the number of solutions @xmath319 ( other values showed similar behaviour ) , the error probability @xmath320 and the indifference zone parameter @xmath321 . the initial sample size was @xmath322 , the budget to be allocated in each iteration was @xmath323 , and at least one simulation was allocated to each solution in each iteration . the parameter @xmath171 for the prior probability of the covariance matrix as in showed best results in our setup for @xmath324 and was therefore fixed to this value throughout our tests . .different values for @xmath325 were used in the @xmath53 -case `` ufc '' . [ cols="<,<",options="header " , ] a _ basic scenario _ consists of the following four variables that are varied in the tests : 1 . we have examined three different * r&s - cases * : in `` best@xmath326 '' we want to select the best solution , i.e. we use a target set @xmath327 ( see subsection [ subsec : targetandselection ] ) , in `` best@xmath328 '' we want to select the better half of the solutions ( @xmath329 ) and in `` rank@xmath328 '' we also want to rank these ten best solutions . also three different * @xmath53-cases * have been used for the @xmath318-generator . in the case `` inc '' , @xmath53 is the increasing sequence @xmath330 . in the unfavourable case `` ufc '' , @xmath53 is adapted to the r&s - case chosen as described in table [ tab : mucase ] . in the case `` unif '' , @xmath46 values are drawn randomly from the interval @xmath331 $ ] with a minimal distance of at least @xmath332 and then sorted into increasing order . this is repeated @xmath333 times , so that 15 simulations with different random @xmath53 are performed . as we use a bayesian approach , the `` unif''-case seems to be the most natural to simulate the uninformative prior but the cases may differ remarkably depending on how well the random values are separated . 3 . as our method claims to work well when observations are positively correlated , we created covariance matrices @xmath334 for the @xmath318-generator with a given joint correlation @xmath335 @xmath336 . to do so , variances @xmath337 were chosen uniformly distributed in the interval @xmath338 $ ] , then we put @xmath339 for @xmath340 . to examine the robustness of our procedure when there are negative correlations , we complemented the above construction for @xmath341 with @xmath342 resulting in a covariance matrix with alternating positive and negative entries . finally we used a random covariance matrix following a wishart distribution with @xmath46 degrees of freedom and a random scale matrix . these make nine different @xmath51**-cases**. 4 . finally , we distinguish two * crn - case * : we apply the complex calculation for the posterior means and covariances based on the joint distribution as described above ( case `` iscrn '' ) or we simply use the marginal posterior distributions as if no crn had been used . in this case ( `` nocrn '' ) the posterior means and variances are estimated by standard non - bayesian estimators . this would be correct in the uncorrelated case with @xmath343 , but it is a simplification in the other cases . this results in 162 different scenarios . for each scenario , @xmath344 random covariance matrices @xmath51 were generated according to the @xmath51-case chosen and , if the @xmath345-case `` unif '' was used , also @xmath346 random vectors @xmath53 were generated . for each pair of @xmath347 , @xmath348 repetitions of the different allocation strategies were performed . we kept track of the random seeds so that all strategies used the same random observations . -case : comparison of the allocation strategies equalallocation , greedyocba and @xmath349 using the full posterior distribution of the unknown means.,width=340 ] we first show the results for @xmath53-case `` ufc '' with crn - case `` iscrn '' . in figure [ fig : ufc_compfulldistrabs ] the mean number of simulations necessary to obtain a pcs @xmath351 with bayesrs is shown for the three allocation strategies equalallocation , greedyocba and @xmath349 . the @xmath352-axis shows the nine different @xmath353-cases repeated for each of the three r&s - cases `` best@xmath326 '' , `` best@xmath328 '' and `` rank@xmath328 '' . here , the @xmath102-case with the random covariance matrix is indicated by rnd. the number of simulations on the @xmath354-axis is the mean over the @xmath355 different covariance matrices , each with the given correlation , and the @xmath348 repetitions for each scenario . figure [ fig : ufc_compfulldistrabs ] clearly shows that the intelligent allocation rules are much more efficient than the simple equal allocation . also in all scenarios , our new allocation rule @xmath349 performed better than the classical greedyocba . this holds for all @xmath356-cases , including the ones involving negative correlations as well as the random covariance matrix . increasing the correlation from @xmath357 to @xmath358 reduced the necessary effort , for all strategies . figure [ fig : ufc_compmargdistrabs ] shows @xmath53-case `` ufc '' with crn - case `` nocrn '' . we use the same multi - normal observations as before , but this time the posterior distribution is based on the marginal distribution of the observation only , neglecting the possible dependence . in particular , the complicated definition of the posterior covariance matrix @xmath359 in is replaced by a diagonal matrix @xmath360 with diagonal @xmath361 as defined in . note that this is justified only in the @xmath356-case @xmath362 , the only case where the observation for different solutions are independent . -case : comparison of the allocation strategies equalallocation , greedyocba and @xmath363 . here , the posterior distribution is calculated using marginal distributions only.,width=340 ] nevertheless , figure [ fig : ufc_compmargdistrabs ] shows a similar picture as figure [ fig : ufc_compfulldistrabs ] , @xmath349 is superior in all scenarios , but the absolute values of the number of simulations needed is larger . in figure [ fig : ufc_compmargfullabs ] we therefore compare the crn - cases `` iscrn '' and `` nocrn '' for the best allocation strategy @xmath349 and @xmath53-case `` ufc '' . figure [ fig : ufc_compmargfullabs ] shows that it is indeed worth calculating the full posterior distribution in order to save simulations . -case : comparison of the two crn - cases for strategy @xmath363.,width=340 ] finally , figure [ fig : ufc_emppcs ] shows the relative frequency of correct selections and rankings in the above experiments . as it can be seen , it is always well above @xmath364 , indicating that our setup is quite conservative . -case : the empirical frequency of correct selections in the above experiments.,width=340 ] next we look at the results for @xmath53-case inc , the results are quite similar . figure [ fig : inc_compfulldistrabs ] shows the crn - case `` iscrn '' and again , @xmath349 performs best , though for the two first r&s - cases best@xmath326 and best@xmath328 , greedyocba has about the same performance . -case `` inc '' : comparison of the allocation strategies equalallocation , greedyocba and @xmath349 using the full posterior distribution of the unknown means.,width=340 ] figure [ fig : inc_compfullmarginabs ] again compares the result for @xmath365 for the estimators based on full posterior distributions and the ones using only marginal information . the advantage of the full distribution is obvious . the empirical pcs was well above 95% in all cases . -case `` inc '' : comparison of the crn - cases for the strategy @xmath349.,width=340 ] in the `` unif''-case , results are means over @xmath346 different @xmath53 drawn randomly from @xmath331^l$ ] , over @xmath355 random covariance matrices and @xmath366 repetitions . results vary considerably depending on the difficulty of the random @xmath53 , so that the mean number of simulations gives only a rough picture of the performance . figure [ fig : unif_compfulldistrabs ] shows that our new strategy @xmath349 is superior to the other strategies for positively correlated observations and with random covariance matrix , but it uses more simulations than greedyocba for @xmath367 . in figure [ fig : unif_emppcs ] , it can be seen , that @xmath368 and greedyocba have high empirical pcs except for one of the cases with @xmath367 . -case `` unif '' : comparison of the allocation strategies equalallocation , greedyocba and @xmath349 using the full posterior distribution of the unknown means.,width=340 ] -case `` unif '' : the empirical pcs.,width=340 ] in @xcite ( see also @xcite ) the sequential procedure @xmath34 is introduced . it is suitable to identify the best solution by iteratively excluding solutions that seem inferior to at least one of the other solutions . in our tests , @xmath34 needed much more simulation runs than our procedure bayesrs with allocation @xmath368 , in particular in the @xmath53-case ufc , where @xmath34 was not able to find the best solution within our limit of 150000 simulations . to make results better comparable , we biased the setup in favor of @xmath34 . for @xmath34 , we used a larger indifference zone parameter @xmath369 in the @xmath53-cases ufc and inc , and @xmath370 the actual minimal distance in @xmath53 for unif-case , thus adapting the parameter to the step between best and second best solution . for @xmath371 , we used @xmath332 for all @xmath53-cases as before . figure [ fig : compdpwkn ] shows the mean number of simulations needed for the r&s - case best@xmath326 and the three @xmath53-cases . to make the figure better readable , we scaled down the results for @xmath34 in the unif-case by a factor @xmath372 . in the @xmath53-case unif , we performed only @xmath373 repetitions for @xmath374 covariance matrices and @xmath375 different @xmath53-values to save runtime . with the relaxed indifference zone parameter @xmath369 , @xmath34 was considerably faster than @xmath368 in the ufc-case , but missed the empirical pcs of @xmath376 in most of these cases , as can be seen in figure [ fig : compdpwkn_pcs ] . hence , one may conclude that in most cases our new approach is superior to @xmath34 with respect to the number of simulations needed and empirical error probabilities observed . and @xmath377 for the r&s - case best@xmath326 . here , @xmath34 has a larger indifference zone parameter @xmath291 for the first two cases and its unif-values are shown multiplied by @xmath378 . , width=340 ] and @xmath377 for the r&s - case best@xmath326 . here , @xmath34 was below @xmath376 for most covariances in the @xmath53-cases ufc and unif . , width=340 ] in this paper we presented a new sequential bayesian r&s procedure with support for common random numbers . based on an approximation of the posterior distribution of the unknown mean and covariance , the simulation effort could be allocated to solutions in such a way that , empirically , a given pcs can be obtained with less simulations than are needed by other strategies . in our future work we will extend this concept to multivariate selection problems . essential parts of this problem were solved in @xcite . we need the following well - known facts about multivariate normal distributions , see e.g. @xcite or @xcite , sec . let @xmath379 be a random vector with distribution @xmath380 . let @xmath381 and @xmath382 be a partition of @xmath383 for some @xmath384 and define @xmath385 so that @xmath386 note that with the notation from , we may write @xmath387}$ ] and @xmath388}$ ] . then the marginal distributions of @xmath389 and @xmath390 are normal : @xmath391 moreover , the conditional distribution of @xmath390 given @xmath392 is a @xmath393-dimensional normal distribution @xmath394 with @xmath395 the converse does also hold : if @xmath396 are random variables such that @xmath397 has a @xmath398-distribution and the conditional distribution of @xmath399 given @xmath400 is as in , then the joint distribution of @xmath401 is @xmath402 . in particular , if @xmath403 so that @xmath404 then we have @xmath405 @xmath406 and @xmath407 } & ( \sigma_{1d } , \ldots , \sigma_{d-1,d})^t\\ ( \sigma_{d1 } , \ldots , \sigma_{d , d-1 } ) & \sigma_{dd } \end{pmatrix } = \begin{pmatrix } { \bm{\sigma}}_{[<d ] } & { \bm{\sigma}}_{[d,<d]}^t\\ { \bm{\sigma}}_{[d,<d ] } & \sigma_{d , d } \end{pmatrix } , \ ] ] where we have used the symmetry of the covariance matrix @xmath51 and the notation from . then from , the conditional distribution of @xmath408 given @xmath409 is a one - dimensional normal distribution with mean @xmath410}^{-1}\big((y_1 , \ldots , y_{d-1})^t-(\mu_1 , \ldots , \mu_{d-1})^t\big ) \notag\\ & = \mu_d + \beta_d({\bm{y}}_{[<d]}-{\bm{\mu}}_{[<d]})\label{eq : defmutilde}\end{aligned}\ ] ] and variance ( independent of @xmath411 ) @xmath412}^{-1 } ( \sigma_{d1 } , \ldots , \sigma_{d , d-1})^t \label{eq : defsigmatilde}\\ & = & \sigma_{dd } - \beta_d { \bm{\sigma}}_{[<d ] } \beta_d^t.\notag \end{aligned}\ ] ] then the likelihood function of the unknown mean @xmath53 given data @xmath130 is @xmath417}-\bar{{\bm{x}}}_{[<i]}^{(n_i ) } ) , \frac{\tilde{\sigma}_{(i-1)}}{n_i } ) \ ] ] where @xmath418 is the one - dimensional normal density with mean @xmath187 and variance @xmath20 . as we assume that the covariance matrix @xmath51 is known , the likelihood function for @xmath419 given the sample @xmath420 as in can be written as a product of independent blocks of normal densities of different dimensionality . let @xmath421 be the number of solutions with at least @xmath62 observations . @xmath422 is the height of the data blocks with at least @xmath62 observations , see fig . [ fig : datablocks ] . then with @xmath424 we have for the likelihood function @xmath425 } , { \bm{\sigma}}_{[\le l_i]}\big),\ ] ] where @xmath426 is the density function of the @xmath279-dimensional normal distribution . here , the inner product describes the likelihood for the sample values within one of the blocks as marked in fig . [ fig : datablocks ] . note that may contain empty products ( defined to be @xmath108 ) if @xmath427 . now each of the @xmath422-dimensional densities in can be factorized into @xmath422 factors of one - dimensional conditional densities . we write @xmath428 for the density of the conditional distribution of @xmath383 given @xmath429 . for @xmath430 let @xmath431 then using and we obtain @xmath432 } , { \bm{\sigma}}_{[\le l_i]}\big)\notag \\ & = f_{x_{1k}}(x_{1k})\cdot f_{x_{2k}|x_{1k}}(x_{2k}|x_{1k})\cdot \ldots\label{eq : nfactorization } \\ & \hspace*{3cm}\cdot f_{x_{l_ik}|x_{1,k } , \ldots , x_{l_i-1k}}(x_{l_ik}|x_{1k } , \ldots , x_{l_i-1k})\notag\\ & = \phi_1(x_{1k};\ \mu_1,\sigma_{11})\cdot \phi_1(x_{2k};\ \tilde{\mu}_{(1)}(x_{1k}),\tilde{\sigma}_{(1 ) } ) \cdot \ldots \notag\\ & \hspace*{3 cm } \cdot \phi_1\big(x_{l_ik};\ \tilde{\mu}_{(l_i-1)}(x_{1k } , \ldots , x_{l_i-1,k}),\tilde{\sigma}_{(l_i-1)}\big)\notag\\ & = \phi_1(x_{1k};\ \mu_1,\sigma_{11})\cdot \phi_1(x_{2k};\ \tilde{\mu}_{(1)}({\bm{x}}_{[<2,k]}),\tilde{\sigma}_{(1 ) } ) \cdot \ldots \notag\\ & \hspace * { 3 cm } \cdot\phi_1\big(x_{l_ik};\ \tilde{\mu}_{(l_i-1)}({\bm{x}}_{[<l_i , k]}),\tilde{\sigma}_{(l_i-1)}\big)\notag \end{aligned}\ ] ] where @xmath433}:=(x_{1k } , \ldots , x_{i-1,k})^t . $ ] plugging into and reordering terms we get @xmath434}),\tilde{\sigma}_{(i-1)}).\ ] ] dropping terms that do not depend on @xmath53 ( remember that @xmath51 was assumed to be known ) we obtain from straightforward calculations @xmath435}),\tilde{\sigma}_{(i-1)})&\propto\notag\\ \phi_1(\bar{{\bm{x}}}_i;&\ \mu_i+\beta_i(\bar{{\bm{x}}}_{[<i]}^{(n_i ) } - { \bm{\mu}}_{[<i ] } ) , \tilde{\sigma}_{(i-1)}/n_i)\label{eq : prop2}\end{aligned}\ ] ] for @xmath436 . from , and we therefore obtain @xmath437}^{(n_i ) } - { \bm{\mu}}_{[<i ] } ) , \tilde{\sigma}_{(i-1)}/n_i ) \notag\\ & = \phi_1(\mu_1;\ \bar{{\bm{x}}}_{1 } , \sigma_{11}/n_1 ) \cdot \prod_{i=2}^l \phi_1(\mu_i;\ \bar{{\bm{x}}}_i + \beta_i ( { \bm{\mu}}_{[<i]}-\bar{{\bm{x}}}_{[<i]}^{(n_i ) } ) , \tilde{\sigma}_{(i-1)}/n_i).\label{eq : posteriorfactorized}\end{aligned}\ ] ] moreover , from we see , that is the factorized representation of a @xmath46-dimensional normal density @xmath440 where the mean @xmath441 and covariance matrix @xmath173 are such that the operations in lead to the representation in . to find @xmath442 and @xmath173 we have to undo the operations from this is possible since we see from that @xmath443}-\bar{{\bm{x}}}_{[<i]}^{(n_i ) } ) , \tilde{\sigma}_{(i-1)}/n_i).\label{eq : dichtewix } \end{aligned}\ ] ] from this it is also obvious , that @xmath444},w_{[<i ] } } ( { \bm{\mu}}_{[<i]}\mid { \bm{x}}_{[<i,{\,\bm{\cdot}\,}]})\end{aligned}\ ] ] where @xmath445 and @xmath446}$ ] denotes all observations for solutions @xmath447 . this means that the conditional expressions do not depend on observations for solutions @xmath448 resp . therefore we can conclude for the means @xmath450 @xmath451\ = \ { \text{\textbf{e}}}[w_1 \mid { \bm{x}}_{1{\,\bm{\cdot}\,}}={\bm{x}}_{1{\,\bm{\cdot}\ , } } ] = \bar{{\bm{x}}}_{1 } \label{eq : nu1}\\ \nu_i&= { \text{\textbf{e}}}[w_i \mid { \bm{x}}={\bm{x}}]\ = \ { \text{\textbf{e}}}[w_i \mid { \bm{x}}_{[\le i,{\,\bm{\cdot}\,}]}={\bm{x}}_{[\le i,{\,\bm{\cdot}\ , } ] } ] \label{eq : nu2}\\ & = { \text{\textbf{e}}}\big[{\text{\textbf{e } } } [ w_i\mid { \bm{x}}_{[\le i,{\,\bm{\cdot}\,}]},w_{[<i ] } ] \ \big|\ { \bm{x}}_{[\le i,{\,\bm{\cdot}\,}]}={\bm{x}}_{[\le i,{\,\bm{\cdot}\,}]}\big]\notag\\ & = { \text{\textbf{e}}}\big [ \bar{{\bm{x}}}_i + \beta_i ( w_{[<i]}-\bar{{\bm{x}}}_{[<i]}^{(n_i ) } ) \ \big|\ { \bm{x}}_{[\le i,{\,\bm{\cdot}\,}]}={\bm{x}}_{[\le i,{\,\bm{\cdot}\,}]}\big]\notag\\ & = \bar{{\bm{x}}}_i + \beta_i\big({\text{\textbf{e}}}\big[w_{[<i]}\ \big|\ { \bm{x}}_{[\le i,{\,\bm{\cdot}\,}]}={\bm{x}}_{[\le i,{\,\bm{\cdot}\,}]}\big ] -\bar{{\bm{x}}}_{[<i]}^{(n_i)}\big)\notag\\ & = \bar{{\bm{x}}}_i + \beta_i ( { \bm{\nu}}_{[<i ] } - \bar{{\bm{x}}}_{[<i]}^{(n_i)})\qquad \text { for } i=2 , \ldots , l. \notag \end{aligned}\ ] ] for the @xmath452 posterior covariance matrix @xmath453=\big({\text{cov}}[w_k , w_l\mid { \bm{x}}={\bm{x}}]\big)_{k , l=1 , \ldots , l}\ ] ] we again put @xmath454 } : = \big({\text{cov}}[w_k , w_l\mid { \bm{x}}={\bm{x}}]\big)_{k , l=1 , \ldots , i}.\ ] ] then we have for @xmath455 that @xmath456 } $ ] equals @xmath457 \\ { \bm{\lambda}}_{[<i ] } & \qquad\vdots\\ & { \text{cov}}[w_{i-1},w_i| { \bm{x}}={\bm{x}}]\\[0.9ex]\hline \rule[0.6ex]{0pt}{2ex}{\text{cov}}[w_i , w_1| { \bm{x}}={\bm{x}}]\ \ldots\ { \text{cov}}[w_i , w_{i-1}| { \bm{x}}={\bm{x } } ] & { \text{cov}}[w_i , w_i| { \bm{x}}={\bm{x } } ] \end{array}\right)\ ] ] to determine the entries of this matrix , we use the following facts about the conditional covariance which are straightforward to prove . let @xmath458 and @xmath459 be random variables such that all integrals exist and let @xmath460 be a suitable function : @xmath461&= { \text{\textbf{e}}}[u\cdot v\mid z]-{\text{\textbf{e}}}[u\mid z]\cdot { \text{\textbf{e}}}[v\mid z],\notag\\{\text{cov}}\big[u , \big(v+g(z)\big)\ \big|\ z\big]&={\text{cov}}[u , v\mid z],\notag \\ { \text{cov}}[u , v\mid z]&= { \text{cov}}\big[u,\ { \text{\textbf{e}}}[v\mid y , z]\;\big |\ , z\big ] \ \text { if $ u = g(y ) , $ } \label{eq : covprop1}\\ { \text{cov}}[u , u\mid z]&= { \bm{v}}[u\mid z]\label{eq : covprop2}\\ & = { \text{\textbf{e}}}\big[{\bm{v}}[u\mid z , y]\;\big |\ , z\big ] + { \bm{v}}\big[{\text{\textbf{e}}}[u\mid z , y]\,\big |\ ; z\big].\notag \ ] ] we now have from @xmath462}&={\text{cov}}[w_1,w_1\mid { \bm{x}}={\bm{x}}]\notag\\ & = { \bm{v}}[w_1\mid { \bm{x}}={\bm{x}}]= \frac{\sigma_{11}}{n_1}={\text{cov}}[w_1,w_1\mid { \bm{x}}_{1{\,\bm{\cdot}\,}}={\bm{x}}_{1{\,\bm{\cdot}\ , } } ] \label{eq : lambda1}\end{aligned}\ ] ] and similarly from and @xmath463 = { \bm{v}}[w_i\mid { \bm{x}}={\bm{x}}]\notag\\ & = { \text{\textbf{e}}}\big [ { \bm{v } } [ w_i|{\bm{x } } , w_{[<i ] } ] \;\big|\ , { \bm{x}}={\bm{x}}\big]+{\bm{v}}\big[{\text{\textbf{e}}}[w_i\mid { \bm{x } } , w_{[<i]}]\;\big|\ , { \bm{x}}={\bm{x}}\big]\label{eq : covecke}\\ & = { \text{\textbf{e}}}\big [ \frac{\tilde{\sigma}_{(i-1)}}{n_i } \;\big|\ , { \bm{x}}={\bm{x}}\big]\notag\\ & \hspace * { 2cm}+{\bm{v}}\big[\bar{x}_i+\beta_i(w_{[<i]}-\bar{x}_i^{(n_i ) } ) \;\big|\ , { \bm{x}}_{[<i,{\,\bm{\cdot}\,}]}={\bm{x}}_{[<i,{\,\bm{\cdot}\,}]}\big]\notag\\ & = \frac{\tilde{\sigma}_{(i-1)}}{n_i } + { \bm{v}}\big[\beta_i w_{[<i ] } \;\big|\ , { \bm{x}}_{[<i,{\,\bm{\cdot}\,}]}={\bm{x}}_{[<i,{\,\bm{\cdot}\,}]}\big]\notag\\ & = \frac{1}{n_i}(\sigma_{ii}-\beta_i{\bm{\sigma}}_{[<i]}\beta_i^t ) + \beta_i\;{\text{cov}}\big[w_{[<i]}\mid { \bm{x}}_{[<i,{\,\bm{\cdot}\,}]}={\bm{x}}_{[<i,{\,\bm{\cdot}\,}]}\big]\ ; \beta_i^t\notag\\ & = \frac{1}{n_i}(\sigma_{ii}-\beta_i{\bm{\sigma}}_{[<i]}\beta_i^t ) + \beta_i \ { \bm{\lambda}}_{[<i]}\ \beta_i^t\notag.\end{aligned}\ ] ] finally , for @xmath464 we have using and @xmath465 = { \text{cov}}\big[w_k , w_i\ \big|\ { \bm{x}}_{[<i,{\,\bm{\cdot}\,}]}={\bm{x}}_{[<i,{\,\bm{\cdot}\,}]}\big]}\label{eq : covspalte}\\ & = & { \text{cov}}\big[w_k,\ { \text{\textbf{e}}}[w_i\mid w_{[<i]},{\bm{x}}_{[\le i ] } ] \ \big|\ { \bm{x}}_{[<i,{\,\bm{\cdot}\,}]}={\bm{x}}_{[<i,{\,\bm{\cdot}\,}]}\big]\notag\\ & = & { \text{cov}}\big[w_k,\ \bar{x}_i+\beta_i(w_{[<i]}-\bar{{\bm{x}}}_{[<i]}^{(n_i)})\ \big|\ { \bm{x}}_{[<i,{\,\bm{\cdot}\,}]}={\bm{x}}_{[<i,{\,\bm{\cdot}\,}]}\big]\notag\\ & = & { \text{cov}}\big[w_k,\ \beta_i w_{[<i]}\ \big|\ { \bm{x}}_{[<i,{\,\bm{\cdot}\,}]}={\bm{x}}_{[<i,{\,\bm{\cdot}\,}]}\big]\notag\\ & = & \beta_i \big({\text{cov}}[w_k , w_l\ \big|\ { \bm{x}}_{[<i,{\,\bm{\cdot}\,}]}={\bm{x}}_{[<i,{\,\bm{\cdot}\,}]}]\big)^t_{l=1 , \ldots , i-1}\notag\\ & = & \beta_i\ { \bm{\lambda}}_{[<i]}.\notag\end{aligned}\ ] ] from - and we now obtain the recursion @xmath466}=\frac{\sigma_{11}}{n_1},\qquad { \bm{\lambda}}_{[\le i]}= \left(\begin{array}{c|l } { \bm{\lambda}}_{[<i ] } & { \bm{\lambda}}_{[<i]}\ \beta_i^t \\[0.9ex]\hline \rule[0.5ex]{0pt}{2ex}\beta_i\ { \bm{\lambda}}_{[<i ] } & \frac{1}{n_i}(\sigma_{ii}-\beta_i{\bm{\sigma}}_{[<i]}\beta_i^t ) + \beta_i\ { \bm{\lambda}}_{[<i]}\ \beta_i^t \end{array}\right)\ ] ] for @xmath467 which concludes the proof of theorem [ the : posterior ] . jrgen branke , stephen e. chick , and christian schmidt . . _ management science _ , 530 ( 12):0 19161932 , dec 2007 . doi : 10.1287/mnsc.1070.0721 . url http://mansci.journal.informs.org/cgi/doi/10.1287/mnsc.1070.0721 . chun - hung chen , hsiao - chang chen , and liyi dai . . in john m. charnes , douglas j. morrice , daniel t. brunner , and james j. swain , editors , _ proceedings of the 1996 winter simulation conference _ , pages 398405 . ieee , 1996 . isbn 0 - 7803 - 3383 - 7 . doi : 10.1109/wsc.1996.873307 . chun - hung chen , jianwu lin , enver ycesan , and stephen e. chick . . _ discrete event dynamic systems _ , 100 ( 3):0 251270 , 2000 . doi : 10.1023/a:1008349927281 . url http://www.springerlink.com/index/p132u04nm122g459.pdf . chun - hung chen , donghai he , michael fu , and loo hay lee . . _ informs journal on computing _ , 200 ( 4):0 579595 , sep 2008 . doi : 10.1287/ijoc.1080.0268 . url http://joc.journal.informs.org/cgi/doi/10.1287/ijoc.1080.0268 . hsiao - chang chen , liyi dai , chun - hung chen , and enver ycesan . . in sigrun andradottir , kevin j. healy , david h. withers , and barry l. nelson , editors , _ proceedings of the 1997 winter simulation conference _ , pages 334341 . ieee , 1997 . isbn 0 - 7803 - 4278-x . doi : 10.1109/wsc.1997.640417 . stephen e. chick and koichiro inoue . . _ management science _ , 470 ( 8):0 11331149 , aug 2001 . doi : 10.1287/mnsc.47.8.1133.10229 . url http://mansci.journal.informs.org/cgi/doi/10.1287/mnsc.47.8.1133.10229 . christian schmidt , jrgen branke , and stephen e. chick . . in franz rothlauf and others , editors , _ applications of evolutionary computing _ , pages 752763 . 2006 . doi : 10.1007/11732242_73 . url http://www.springerlink.com/index/jk184206618h1248.pdf .

we want to select the best systems out of a given set of systems ( or rank them ) with respect to their expected performance . the systems allow random observations only and we assume that the joint observation of the systems has a multivariate normal distribution with unknown mean and covariance . we allow dependent marginal observations as they occur when common random numbers are used for the simulation of the systems . in particular , we focus on positively dependent observations as they might be expected in heuristic optimization where ` systems ' are different solutions to an optimization problem with common random inputs . in each iteration , we allocate a fixed budget of simulation runs to the solutions . we use a bayesian setup and allocate the simulation effort according to the posterior covariances of the solutions until the ranking and selection decision is correct with a given high probability . here , the complex posterior distributions are approximated only but we give extensive empirical evidence that the observed error probabilities are well below the given bounds in most cases . we also use a generalized scheme for the target of the ranking and selection that allows to bound the error probabilities with a bonferroni approach . our test results show that our procedure uses less simulations than comparable procedures from literature even in most of the cases where the observations are not positively correlated . * keywords : * sequential ranking and selection , common random numbers , bayesian statistics , multiple testing , missing data

there are many corneal transplantation techniques such as deep anterior lamellar keratoplasty and descemet 's stripping endothelial keratoplasty with many advantages over penetrating keratoplasty ( pk ) , but pk is still the most common type of corneal transplant performed . the leading indications for pk are keratoconus , bullous keratopathy ( bk ) , corneal scars due to previous intraocular surgeries , infections , or trauma , corneal dystrophies , and graft failure . in developing countries , corneal scars due to herpes simplex virus , presumed bacterial infections , or traumatic insults are more frequent indications for pk than the noninflammatory conditions such as keratoconus and corneal dystrophies . the success of pk depends on many preoperative , intraoperative , and postoperative factors , including the health of the donor cornea , the indication for pk , suture techniques preferred , the quality of postoperative management , and the presence of high intraocular pressure ( iop ) . postkeratoplasty glaucoma ( pkg ) is one of the challenging issues important for the survival of the graft . the incidence of pkg has been reported to range between 9% and 35% [ 49 ] . it has been reported to be one of the most serious complications following pk and the second leading cause of graft failure after graft rejection [ 10 , 11 ] . its diagnosis and management are much more difficult than the glaucoma cases with their own corneas . the aims of our study were to report the incidence and risk factors for pkg and its management . this was a retrospective study conducted at the department of ophthalmology , eskisehir osmangazi university medical faculty , eskisehir , turkey . the charts of 155 eyes that underwent pk between january 2007 and july 2010 were reviewed independently from the indication for pk . the inclusion criteria were follow - up period of at least 12 months after pk and well - documented iop measurements at each visit . group 1 included 29 eyes of 24 patients ( 16 women and 8 men ) with keratoconus or corneal dystrophies . group 2 included 53 eyes of 51 patients ( 28 women and 23 men ) with pseudophakic or aphakik bk . group 3 included 40 eyes of 40 patients ( 20 women and 20 men ) with indications other than those in groups 1 and 2 . pkg was defined as the persistence of raised iop ( > 21 mmhg ) or the requirement for increased treatment in patients with previous high intraocular pressure ( phiop ) , one month after pk , in the presence of glaucomatous optic disc changes . all the procedures , namely , pk , glaucoma surgeries , and diode laser cyclophotocoagulation ( dcpc ) , were performed by an experienced ophthalmologist ( ny ) . the mean diameter of the donor corneal button was 8.0 mm ( range , 7.58.5 mm ) , and the mean diameter of the recipient bed was 0.5 mm to 0.25 mm smaller than the donor corneal bed . single continuous suture was preferred in most of the cases . in highly vascularized corneas , pk and cataract surgery combined with intraocular lens ( iol ) implantation were performed in eleven eyes , and in two of these , pkg developed . phacoemulsification ( phaco ) and in - the - bag posterior chamber iol ( pciol ) implantation were performed in four of these through the diseased cornea and open - sky extracapsular cataract extraction ( ecce ) in the other seven . in the four cases that underwent ecce surgery , pciol was implanted in the ciliary sulcus , and no iol was implanted in the other three . phaco and in - the - bag pciol implantation were performed in six eyes during the follow - up . hydrophobic acrylic foldable iol was inserted in the bag and poly(methyl methacrylate ) ( pmma ) iol was preferred in the ciliary sulcus . topical antibiotic eye drops four times / day for one month and topical prednisolone phosphate ( 0.5% ) eye drops four times / day for up to one year , with gradually tapering doses , were routinely applied in all cases . topical and/or systemic steroids in higher doses were applied if anterior segment inflammation and/or graft rejection occurred . topical beta - blockers , carbonic anhydrase inhibitors , and alpha-2 agonist were initiated in pkg cases . in pkg cases refractory to medical treatment , trabeculectomy , the ex - press shunt ( with 50 micron lumen ) implantation , the ahmed glaucoma valve ( agv ) implantation , or dcpc were performed under retrobulbar anesthesia . the subconjunctival and sub - tenons 's portion of the tube was covered with a patch graft of donor dura matter . the tenets of the declaration of helsinki were followed , and the local medical ethics committee approved the study . all patients were followed up postoperatively with routine ophthalmic examinations at the first day , first week , first month , the third month , the sixth month , and every six months thereafter . the best - corrected visual acuities ( bcvas ) in logmar units and iop pressure were assessed preoperatively and postoperatively at each visit . the bcvas at the final visit were used for statistical and clinical analyses . for data analysis in the study , 2.2 logmar , 2.3 logmar , and 2.4 logmar were used instead of hand movement ( hm ) , perception of light ( pl ) , and no perception of light ( npl ) , respectively . the indications for pk , the presence of phiop , and the lens status were noted . the management modalities for pkg , the iop before the initiation of glaucoma treatment , the iop at the final visits , and the number of antiglaucomatous drugs applied were documented . the iop before treatment was compared with iop after treatment in medically and surgically treated cases separately using paired samples t - test . odds ratios and 95% confidence intervals were calculated to determine the probability of developing pkg , using logistic regression analysis with pkg as the dependent variable , and the indications for pk , the lens status , and the phiop as independent variables . the incidence of graft rejection , graft failure , and post - keratoplasty infections in cases with pkg was compared with that without pkg using yates ' chi - square test . statistical analyses were performed using spss version 15.0 ( spss inc . , chicago , ill , usa ) . pkg developed in 42 ( 34% ) of these eyes within 38.9 14.3 ( 1272 ) months of follow - up . the mean preoperative and postoperative bcva in eyes with pkg were 2.12 0.25 and 1.6 0.71 logmar units , respectively ( p = 0.001 ) . the mean pre - operative and post - operative bcva in eyes without pkg were 2.13 0.16 and 1.17 0.85 logmar units , respectively ( p = 0.001 ) . the visual acuity was improved in 33/42 ( 79% ) of the eyes with pkg and 64/80 ( 80% ) of the eyes without pkg ( p > 0.05 ) . the number of eyes with phiop , post - keratoplasty glaucoma ( pkg ) and the pkg cases requiring medical or surgical treatment according to the indications of pk are represented in table 3 . seventeen eyes ( one in group 1 , thirteen in group 2 , and three in group 3 ) had a phiop . iop was 21 mmhg with medication prior to pk in these seventeen eyes , but in thirteen of these pkg developed . in seven out of these thirteen , the indications for pk other than keratoconus and corneal dystrophies , previous pseudophacia and aphakia , cataract surgery after pk , and phiop were highly associated with pkg ( p < 0.05 ) ( table 4 ) . pseudophakia ( including 36 posterior and ten anterior chamber iol ) prior to pk was present in 46 eyes and aphakia prior to pk in 26 eyes . pre- and posttreatment iop values in medically and surgically treated eyes are represented in tables 5 and 6 . iop was > 21 mmhg despite medical and surgical treatments in one case , in which trabeculectomy and dcpc were performed . the mean time interval between the diagnosis of pkg and pk was 12.8 8.9 ( 236 ) months . sixteen pkg cases were refractory to antiglaucomatous drugs . the agv implantation was performed in three of these , the ex - press mini glaucoma shunt implantation in ten of these , and dcpc in two of these . dcpc was performed three months following trabeculectomy in one case ( table 6 ) . corneal graft rejection occurred in seven out of 42 pkg eyes and thirteen out of 80 eyes without pkg . corneal graft failure developed in six out of these twenty cases in which rejection occurred . the risk for developing corneal graft rejections , corneal graft failures , or infections following pk was similar in patients with and without pkg ( table 7 ) . in the present study , the incidence of pkg was found to be 34% with 39 months of follow - up . the ten - year cumulative risk of pkg following pk was found to be 21% by ing et al . . the incidence of pkg was reported to be lower in the early post - operative period , but if long - term follow - up had be a possible , the rate probably would have increased [ 4 , 5 , 9 ] . the diagnosis of pkg is a challenging process due to difficulties in the measurement of iop in the corneal graft and the possible occurrence of steroid - induced iop elevations in the post - operative period [ 13 , 14 ] . the tono - pen is the most accurate commercially available instrument for measurement of iop in the early post - operative period , so the tono - pen was preferred in the present study . the diagnosis of pkg was made if iop rise persisted after one month following pk in the presence of glaucomatous optic disc changes . temporary iop elevations due to inflammatory processes can occur in the early post - operative period , and this can interfere with the diagnosis of pkg . in addition to this , the corneal edema , which is frequently observed in the early post - operative period , resolves after the first month , so that the iop measurements are more accurate after one month from pk . it has been reported that the incidence pkg is associated with the indications for pk . patients with pseudophakic bk , corneal perforation , and graft rejection were shown to be at high risk for pkg . our findings were consistent with the previous studies [ 9 , 16 , 17 ] . in the present study , there was only one pk case refractory to medical treatment in the keratoconus and corneal dystrophy group . the ratio was higher with other corneal pathologies such as pseudophakik bk , corneal perforations , and herpes keratitis . however , nine out of nineteen ( 47% ) pk cases that developed in bk cases and six out of seventeen pk cases that developed in group 3 did not respond to antiglaucomatous drugs . in the present study pseudophakia and aphakia prior to pk and combined surgery ( phaco and iol implantation ) during the follow - up after pk were found to be the risk factors for pkg . the majority of the pseudophakic and aphakic cases were having bk , so it is not possible to consider pseudophakia and aphakia as independent risk factors . inflammatory processes associated with the surgery , the iol material , the peripheral anterior synechia formation , and the effects of aphakia and pseudophakia on the angle structures are the most probable explanations for the increased pk incidence in these cases [ 8 , 9 , 18 ] . in thirteen ( 76% ) of the cases with phiop , pkg developed . in seven of these cases , glaucoma surgery was performed to lower the iop , whereas antiglaucomatous drugs were effective in the other six . the finding was consistent with the previous studies in which phiop was shown to be a major risk factor for pkg . sixteen pkg cases ( 38% ) were refractory to medical treatment , and trabeculectomy agv implantation , ex - press mini glaucoma shunt implantation , and dcpc were performed in these . in all of the cases , except one , iop was controlled with the surgical interventions . the agv implantation was shown to be associated with graft failure due to tube - corneal endothelium touch and the instability of the tube in several studies . the ex - press mini glaucoma shunt implantation was the most preferred surgical procedure ( 62% ) in our study . it was successfully implanted in ten cases lowering mean iop from 29 to 13 mmhg . the efficacy of the device has been reported to be similar with trabeculectomy in healthy corneas . the ex - press shunt may be an alternative treatment in pkg cases resistant to medical treatment . finally the risk of endothelial cell loss associated with agv implant is negligible with the ex - press shunt . inadequate control of iop after pk is an important cause of graft failure . in the present study , the iop of 21 mmhg was obtained by medical treatment , surgical treatment , or dcpc in the majority of the pkg cases . the rates of post - operative complications including graft rejection episodes , graft failures , and post - keratoplasty infections were similar in patients with and without pkg . the success rate of visual acuity improvement was the same in patients with and without pkg . the number of eyes that underwent pk due to non - inflammatory conditions ( keratoconus and corneal dystrophies ) was much less than the eyes that underwent pk due to other pathologies . pseudophakik and aphakik bk comprised 43% of the study group , whereas the noninflammatory conditions comprised 24% of the study group . there are several explanations for the lower percentage of the non - inflammatory conditions in the present study . first , this retrospective study was conducted at our ophthalmology department , which is considered to be one of the national referral centers for corneal diseases , so many complicated cases including bk and corneal perforations have been referred to our clinic . second , the patient satisfaction after pk in the eyes with the non - inflammatory conditions is usually higher than that after pk in eyes with inflammatory conditions , such as bk , keratitis , and corneal perforations . therefore , there are many patients who fail to attend their appointment after a successful pk , and this affected the distribution of the pre - operative diagnoses in the present study . the distribution of the pre - operative diagnosis caused overestimation of the incidence of pkg , since bk was one of the high risk factors for the development of pkg . the graft failure was also overestimated . in a study including 3640 eyes that underwent pk for the first time , the survival of grafts was reported to be 90% at five years . the highest survival rate was documented in grafts for eyes with non - inflammatory conditions and the lowest in grafts for eyes with bk , being 70% at five years . the small number of eyes with non - inflammatory conditions in the current study was the possible explanation for the high incidence of graft failure after a mean follow - up of 39 months . it was reported to range from 2% to 12% of eyes undergoing pk [ 2527 ] . the large percentage of eyes undergoing pk due to inflammatory conditions ( 76% ) may explain the high incidence of post - keratoplasty infections . in conclusion , pkg developed in one out of three patients who underwent pk . phiop , pseudophakik bk , pseudophakia , aphakia , corneal perforations , and corneal scars were highly associated with pkg , whereas pkg was less likely to develop in cases with keratoconus and corneal dystrophies . in pkg cases refractory to medical treatment , variable glaucoma surgeries and dcpc the ex - press shunt implantation may be the first - choice surgical procedure for refractory pkg . if iop is adequately controlled in pkg , it may be possible to obtain similar rates of graft survival and post - operative complications in eyes with and without pkg .

purpose . to report the incidence and risk factors for postkeratoplasty glaucoma ( pkg ) , as well as its management . subjects and methods . 122 eyes , ( 43% with pseudophakic and aphakic bullous keratopathy ( pabk ) ) which underwent penetrating keratoplasty ( pk ) , were analyzed . results . the rate of pkg development was 34% within 39 months of follow - up . pabk , corneal perforations , keratitis , and previous high intraocular pressure ( phiop ) were high risk factors for pkg . glaucoma was controlled medically in 62% of pkg cases . surgery ( ex - press shunt in 63% ) and diode laser cyclophotocoagulation were applied in others ( 38% ) . the rate of postoperative complications and graft survival was similar in eyes with and without pkg . conclusion . phiop , preoperative diagnoses other than keratoconus , and corneal dystrophies were highly associated with pkg . ex - press shunts were effective in refractory pkg . if glaucoma is controlled , it is possible to obtain similar rates of graft survival and postoperative complications in eyes with and without pkg .

Met Gala: Elon Musk, Grimes make red carpet debut wearing... is that Tesla accessories? CLOSE Elon Musk and singer Grimes make their red carpet debut at the Met Gala. USA TODAY It's now red-carpet official: entrepreneur Elon Musk, 45, and musician Grimes, 30, are an item. The South Africa-born billionaire (who moved to Canada when he was 17) and Canadian artist arrived at the Met Gala together on Monday, confirming reports that two have been quietly seeing each other. Elon Musk and Grimes arrive at the Met Gala together, making their relationship red-carpet official. (Photo: Neilson Barnard, Getty Images) Did they dress for the carpet theme, "Heavenly Bodies: Fashion and the Catholic Imagination"? Yes, if you consider Musk's electric cars heavenly bodies: He appeared to wear a Tesla pin and she a Tesla choker as part of their coordinated ensembles. The unlikely couple got connected after they made the same artificial intelligence joke, reports Page Six. As the story goes, Musk, a longtime A.I. warner, thought of a pun that's way over our heads and combines A.I. thought experiment Roko's Basilisk with baroque European style Rococo, to make "Rococo basilisk." But Musk realized Grimes had made the same highbrow A.I. joke, years before he thought of it. So, according to the report, he reached out to her (before finally tweeting out his pun today) and they got together. USA TODAY has reached out for confirmation on this story. Rococo basilisk — Elon Musk (@elonmusk) May 7, 2018 Musk and Grimes are a new couple on the carpet this year. Last year, Musk dated another lady who's at this Met Gala, Amber Heard. Read or Share this story: https://usat.ly/2HVfG6l ||||| New relationship alert! Elon Musk stepped out with his new girlfriend, Grimes, at the 2018 Met Gala in New York City on Monday, May 7. The duo also attended Rihanna’s Met Gala afterparty on Monday. An eyewitness told Us Weekly that Musk and Grimes “made out the whole night” at the event, which was sponsored by Beats by Dre. “They have been dating for about a month,” another source tells Us of the new couple. The source added that pair designed the musician’s dress together over dinner and commissioned a team to make it. Musk, 46, tweeted about Grimes’ music in April. “Likewise …was just listening to Go Flex & Psycho on @Grimezsz playlist,” he wrote on April 25. “glad ur finally listening to cyberpunk speedwae hahaha,” the 30-year-old replied. After the duo exchanged tweets, a fan tweeted at Musk on April 27 to “just ask her out already.” He responded with a wink face. Us Weekly confirmed on February 1 that Musk had called it quits with on-again, off-again girlfriend Amber Heard. “Amber wants her independence and prefers being friends rather than romantically linked,” one source told Us at time. Another source aded that “Elon decided it was time to end things, and Amber agreed … They both care for one another, but the timing just isn’t right.” The Tesla CEO and the Justice League actress, 31, split for the firs time in August 2017 after dating for a year. Five months later, they were spotted kissing in Los Angeles and spent New Year’s Eve together in Chile. Heard also attended the 2018 Met Gala. Sign up now for the Us Weekly newsletter to get breaking celebrity news, hot pics and more delivered straight to your inbox! ||||| The SpaceX founder and musician arrived arm in arm at the glitzy event. Perhaps the most unexpected couple made their debut at the 2018 Met Gala when Elon Musk and Grimes appeared together on the red carpet. The Space Exploration Technologies Corp. (SpaceX) CEO/Tesla co-founder and the musician (real name Claire Elise Boucher) have been flirt-tweeting back and forth for a while, and reportedly met when Musk discovered Grimes beat him to a “Rococo Basilisk” joke on Twitter. The two were dressed in black and white for the “Heavenly Bodies: Fashion & the Catholic Imagination” theme, a topic that heavily contrasts with their interest in artificial intelligence and technology. A version of this story originally appeared on Billboard.com. ||||| Elon Musk has been keeping everyone guessing about his love life, but sources exclusively revealed to Page Six that he has been quietly dating hip musician Grimes — who will walk the red carpet with him at Monday’s Met Gala. A source tells us the pair met around a month ago online, of course, through a joke Musk had planned to tweet but discovered Grimes had already made, dealing with the complications of artificial intelligence. Thought experiment Roko’s Basilisk considers the hypothesis of a future where AI lords over the world and could punish those who did not help it into existence. His joke was to merge this thought experiment with a pun using “Rococo,” referring to the ornate French 18th century baroque style, perhaps pointing out that both concepts are complex, too extreme and ridiculous. And while this takes some explaining, arty performer Grimes was already in on the same joke — three years ahead of Musk. In 2015, she created a character named “Rococo Basilisk” for a video of her song “Flesh Without Blood.” “I don’t know if you’ve heard of Roko’s Basilisk,” she told Fuse. “[This character] is doomed to be eternally tortured by an artificial intelligence, but she’s also kind of like Marie Antoinette.” “Elon was researching the idea of joking about Rococo Basilisk, and when he saw Grimes had already joked about it, he reached out to her,” says the insider. “Grimes said this was the first time in three years that anyone understood the joke. They were both poking fun at AI.” Musk is well known for warning of an AI apocalypse, calling it “more dangerous than nukes.” SpaceX and Tesla founder Musk has been very public in his past fandom for Grimes, whose real name is Claire Boucher. He tweeted out her artsy video with Janelle Monae for the song “Venus Fly” this past March, adding “Best music video art I’ve seen in a while.” Grimes shot to fame in 2012 with her third studio album, “Visions,” and also put out the critically acclaimed “Art Angels” in 2015. She recently revealed she has clashed with her label 4AD, saying “There’s some srsly f–ked up and crazy s–t going behind the scenes in my career,” but that she will be releasing another album with 4AD, followed by independent music. “I just took a month off, a lot of insane s–t went down and I’m reorienting my life,” she wrote on Instagram. “I have a deep well of s–t this time, like sooo many songs so after my album I’ll be able to consistently release new music.” She was a double major in psychology and philosophy, with minors in Russian and electro-acoustics before she dropped out of school to follow her music career. The tech billionaire also tweeted his approval of her Spotify playlist “Go Flex & Psycho.” “Glad ur finally listening to cyberpunk speedwae hahaha,” she responded. “Sounds great riding my cyborg,” he hit back. Just last week they had another online in-joke. After Musk tweeted a video created from long-exposure photos of a comet, Grimes said “that’s a lot of cocaine,” to which he responded, “Yeah, most people don’t know this, but comets [are] mostly made of cocaine.” Aside from flaunting their banter online, Musk hinted at his talented Met Gala date on Monday, tweeting “Rococo basilisk,” and a link to the Rococo Wikipedia page.

– The Hollywood Reporter calls them "perhaps the most unexpected couple" to show up at the Met Gala on Monday evening, and Elon Musk and Grimes certainly caused some buzz on the red carpet. Now people are wondering if the SpaceX/Tesla founder, 46, and 30-year-old Canadian musician are an actual romantic item, and sources tell Page Six they are indeed "quietly dating." They reportedly first connected over a joke about artificial intelligence Musk had wanted to post on Twitter—until he discovered Grimes (real name Claire Elise Boucher) had tweeted out the same joke in 2015. "Grimes said this was the first time in three years that anyone understood the joke," one source says. USA Today reports they both apparently wore Tesla accessories to the Met event: she a Tesla choker, he a Tesla pin. Meanwhile, a source tells Us Weekly that the couple, who've been canoodling for a month or so, worked up the design for Grimes' Met dress together, then pulled together a team to create it. Musk previously dated actress Amber Heard.

SECTION 1. SHORT TITLE. This Act may be cited as the ``Professional Standards for Government Attorneys Act of 2001''. SEC. 2. PROFESSIONAL STANDARDS FOR GOVERNMENT ATTORNEYS. (a) Section 530B of title 28, United States Code, is amended to read as follows: ``SEC. 530B. PROFESSIONAL STANDARDS FOR GOVERNMENT ATTORNEYS. ``(a) Definitions.--In this section: ``(1) Government attorney.--The term `Government attorney'-- ``(A) means the Attorney General; the Deputy Attorney General; the Solicitor General; the Associate Attorney General; the head of, and any attorney employed in, any division, office, board, bureau, component, or agency of the Department of Justice; any United States Attorney; any Assistant United States Attorney; any Special Assistant to the Attorney General or Special Attorney appointed under section 515; any Special Assistant United States Attorney appointed under section 543 who is authorized to conduct criminal or civil law enforcement investigations or proceedings on behalf of the United States; any other attorney employed by the Department of Justice who is authorized to conduct criminal or civil law enforcement proceedings on behalf of the United States; any independent counsel, or employee of such counsel, appointed under chapter 40; and any outside special counsel, or employee of such counsel, as may be duly appointed by the Attorney General; and ``(B) does not include any attorney employed as an investigator or other law enforcement agent by the Department of Justice who is not authorized to represent the United States in criminal or civil law enforcement litigation or to supervise such proceedings. ``(2) State.--The term `State' includes a Territory and the District of Columbia. ``(b) Choice of Law.--Subject to any uniform national rule prescribed by the Supreme Court under chapter 131, the standards of professional responsibility that apply to a Government attorney with respect to the attorney's work for the Government shall be-- ``(1) for conduct in connection with a proceeding in or before a court, the standards of professional responsibility established by the rules and decisions of that court; ``(2) for conduct reasonably intended to lead to a proceeding in or before a court, the standards of professional responsibility established by the rules and decisions of the court in or before which the proceeding is intended to be brought; and ``(3) for all other conduct, the standards of professional responsibility established by the rules and decisions of the Federal district court for the judicial district in which the attorney principally performs his or her official duties. ``(c) Licensure.--A Government attorney (except foreign counsel employed in special cases)-- ``(1) shall be duly licensed and authorized to practice as an attorney under the laws of a State; and ``(2) shall not be required to be a member of the bar of any particular State. ``(d) Covert Activities.--Notwithstanding any provision of State law, including disciplinary rules, statutes, regulations, constitutional provisions, or case law, a Government attorney may, for the purpose of enforcing Federal law, provide legal advice, authorization, concurrence, direction, or supervision on conducting covert activities, and participate in such activities, even though such activities may require the use of deceit or misrepresentation. ``(e) Admissibility of Evidence.--No violation of any disciplinary, ethical, or professional conduct rule shall be construed to permit the exclusion of otherwise admissible evidence in any Federal criminal proceeding. ``(f) Rulemaking Authority.--The Attorney General shall make and amend rules of the Department of Justice to ensure compliance with this section.''. (b) Technical and Conforming Amendment.--The analysis for chapter 31 of title 28, United States Code, is amended, in the item relating to section 530B, by striking ``Ethical standards for attorneys for the Government'' and inserting ``Professional standards for Government attorneys''. (c) Reports.-- (1) Uniform rule.--In order to encourage the Supreme Court to prescribe, under chapter 131 of title 28, United States Code, a uniform national rule for Government attorneys with respect to communications with represented persons and parties, not later than 1 year after the date of enactment of this Act, the Judicial Conference of the United States shall submit to the Chief Justice of the United States a report, which shall include recommendations with respect to amending the Federal Rules of Practice and Procedure to provide for such a uniform national rule. (2) Actual or potential conflicts.--Not later than 2 years after the date of enactment of this Act, the Judicial Conference of the United States shall submit to the Chairmen and Ranking Members of the Committees on the Judiciary of the House of Representatives and the Senate a report, which shall include-- (A) a review of any areas of actual or potential conflict between specific Federal duties related to the investigation and prosecution of violations of Federal law and the regulation of Government attorneys (as that term is defined in section 530B of title 28, United States Code, as amended by this Act) by existing standards of professional responsibility; and (B) recommendations with respect to amending the Federal Rules of Practice and Procedure to provide for additional rules governing attorney conduct to address any areas of actual or potential conflict identified pursuant to the review under subparagraph (A). (3) Report considerations.--In carrying out paragraphs (1) and (2), the Judicial Conference of the United States shall take into consideration-- (A) the needs and circumstances of multiforum and multijurisdictional litigation; (B) the special needs and interests of the United States in investigating and prosecuting violations of Federal criminal and civil law; and (C) practices that are approved under Federal statutory or case law or that are otherwise consistent with traditional Federal law enforcement techniques.

Professional Standards for Government Attorneys Act of 2001 - Amends the Federal judicial code to specify which standards of professional responsibility apply to a Government attorney in various choice of law scenarios. Provides that a Government attorney (except foreign counsel employed in special cases) shall: (1) be duly licensed and authorized to practice as an attorney under the laws of a State; and (2) not be required to be a member of the bar of any particular State. Authorizes a Government attorney, for the purpose of enforcing Federal law, to provide legal advice, authorization, concurrence, direction, or supervision on conducting covert activities and to participate in such activities, even though such activities may require the use of deceit or misrepresentation.Provides that no violation of any disciplinary, ethical, or professional conduct rule shall be construed to permit the exclusion of otherwise admissible evidence in any Federal criminal proceeding.Requires the Judicial Conference of the United States to report to: (1) the Chief Justice of the United States on recommendations with respect to amending the Federal Rules of Criminal Procedure (FRCrP) to provide for a uniform national rule for Government attorneys with respect to communications with represented persons and parties; and (2) the House and Senate Judiciary Committees on a review of any areas of conflict between specific Federal duties related to the investigation and prosecution of violations of Federal law and the regulation of Government attorneys by existing standards of professional responsibility and on recommendations with respect to amending the FRCrP to provide for additional rules governing attorney conduct to address such conflicts.

CLOSE A potentially record-breaking giant rabbit died on a United flight from London to Chicago. USA TODAY Steve Bruere, president of Peoples Co., and his friends bought Simon, a big bunny that was found dead in Chicago following a flight from London. (Photo: contributed) The owners of a 3-foot giant rabbit that died last month following a United Airlines flight from London are demanding an independent investigation into the death and calling on the airline to change its procedures for transporting animals. Simon, a Continental Giant rabbit, was purchased by an Iowa-based ownership group with hopes that he could win the Iowa State Fair's biggest rabbit contest in August and be used to help raise money for the fair and its Blue Ribbon Foundation. But the giant rabbit was found dead following a United flight from London to Chicago. Des Moines trial attorney Guy Cook announced at a press conference on Monday that the owners are demanding an independent investigation into Simon's death. Cook cited news reports based on anonymous sourcing that said Simon may have been inadvertently locked in a freezer before he was scheduled to board a connecting flight to Kansas City. That claim that was reported in the Daily Mail tabloid and other media outlets. A United spokesperson called the claim "completely false" in an email. United also had the rabbit was cremated following its death without the permission of the owners, making an autopsy to determine what exactly happened impossible, Cook said. That action by the airline was tantamount to "destroying evidence" in the case, he said. "It's circumstantial proof that there was something wrong here that they cremated the remains of Simon without the consent of the ownership group or the breeder who provided the rabbit to the owners," Cook said. "United Airlines has essentially done nothing to demonstrate objectively what actually happened here. They've had scant interaction with the ownership group." Cook said that the attorneys are asking United to provide video from a closed-circuit camera inside the facility where Simon was held that could provide more clues as to what happened. Simon was expected to surpass his father in length and take "world's largest rabbit" title himself within "a few short months," Cook said. In an email, United spokesman Charles Hobart said that Simon arrived in Chicago at 10:25 a.m. and was seen moving in his crate about a half-hour later. A short time later, an employee found the rabbit motionless and determined he had died. At the time, Simon was being kept in a PetSafe kennel facility kept at 70 degrees Fahrenheit. "The assertion that Simon died in a freezer is completely false," he said. Hobart also directed a reporter to the website of British rabbit breeder Annette Edwards, who owns Simon's four-foot long father, Darius, the current world's biggest rabbit. Edwards wrote in a recent statement, "United Airlines has been in regular contact with me regarding the sad death of Simon the Rabbit and that the matter has been resolved to my satisfaction." At the press conference, Cook said a retired pilot has brought forward multiple other possible situations that could have caused the death, including that pilots may not have been told an animal was loaded on the plane and therefore not activated a higher temperature selection for the bulk cargo compartment. The ownership group is demanding the airline to pay for the purchase price of the rabbit, shipping costs and the "economic loss" caused by the rabbit's death. The owners anticipated that Simon's status as world's largest rabbit could be used as a fundraising tool to help the state fair, Cook said. The demand letter gives United seven days to respond before a lawsuit is filed. The ownership group is also asking the airline to re-evaluate its procedure of flying animals in the cargo holds of its airplanes. After Simon's death Edwards initially told the Sun newspaper that Simon had a check-up with a vet three hours before the April 19 flight and was “fit as a fiddle.” “Something very strange has happened and I want to know what,” Edwards told the newspaper. “I’ve sent rabbits all around the world and nothing like this has happened before.” The rabbit’s death added to the airlines’ headaches last month: United was widely criticized after video was made public of a 69-year-old passenger being dragged off a flight at Chicago O’Hare International to make room for a crew member. PETA has criticized United, saying the rabbit's death "is not unique." It said "more than 300 animals have died in cargo holds since 2005, and many more have been been injured or lost." "We think that the importance of this case and his death goes beyond the life of one single giant rabbit, but reflects a practice by United that needs to be changed," Cook said. The rabbit's three main owners were retired Wells Fargo executive Mark Oman, People's Co. president Steve Breure and Benning Financial partner Duke Reichardt. Read or Share this story: http://dmreg.co/2pd6i4R ||||| DES MOINES, Iowa (AP) — The Latest on questions being raised by the owners of a giant rabbit that died after it was flown from the United Kingdom to Chicago (all times local): 12:45 p.m. A United Airlines spokesman says it has reached a satisfactory resolution with the breeder in Britain of a giant rabbit that died after flying from the United Kingdom to Chicago. The airline declined to comment Monday on a threat of legal action from the new owners of Simon the rabbit, who live in Iowa. An attorney for the owners says the new owners are troubled that he was cremated without a necropsy, or post-mortem examination, soon after his death April 20. Attorney Guy Cook says he sent a letter to United Airlines last week but hasn't heard back. United spokesman Charles Hobart says United reached a resolution with breeder Annette Edwards, who was United's customer and is based in Worcestershire, England. He says she declined United's offer of a necropsy. Hobart declined to comment on the letter sent by Cook. ___ 10:50 a.m. The owners of a giant rabbit that died after flying from the United Kingdom to Chicago want to know more about the animal's death and an explanation of why he was so quickly cremated. Attorney Guy Cook said Monday that the owners of the rabbit, named Simon, are troubled that he was cremated without an autopsy, soon after his death April 20. Cook says he sent a letter to United Airlines last week but hasn't heard back. Simon had been expected to grow to become the world's largest rabbit. Cook says the buyers had planned to enter Simon at the Iowa State Fair and display him at later events to raise money for the fair. The owners are seeking the costs of buying and transporting the rabbit and future earnings.

– When it comes to the case of Simon, the dead giant rabbit, United Airlines is down one headache but faces a second. A rep for the airline says it has reached a satisfactory resolution with the British breeder of the giant rabbit, which died after flying from the United Kingdom to Chicago last month. The rep adds that Annette Edwards declined United's offer of a necropsy, or postmortem examination, reports the AP. That lack of necropsy isn't sitting so well with the three Iowa businessmen who had purchased the rabbit. The Des Moines Register reports their Iowa-based "ownership group" had bought Simon with the intention of entering him in the Iowa State Fair's biggest rabbit competition and later raising funds for the fair and its associated foundation by displaying him. Attorney Guy Cook said Monday that the owners are troubled that Simon was cremated without a necropsy soon after his death April 20. "It's circumstantial proof that there was something wrong here that they cremated the remains of Simon without the consent of the ownership group," he said. Cook added he sent a letter to United Airlines last week but hasn't heard back. The owners—retired Wells Fargo exec Mark Oman, People's Co. president Steve Breure, and Duke Reichardt of Benning Financial—are seeking the costs of buying and transporting the rabbit and future earnings.

A possible hidden chamber within the ancient tomb of Tutankhamun is “full of treasures,” Egypt’s tourism minister has promised. The possibility of a hidden chamber was revealed late last year, when Egypt’s Antiques Ministry said scans of the boy king’s tomb showed evidence of another room behind two secluded doorways, and suggested the possibility of it being the resting place of Queen Nefertiti. Egypt’s tourism minister Hisham Zaazou told Spanish newspaper ABC on a trip to Spain that there will be a press conference regarding what has been found in Tutankhamun’s tomb, adding that the discovery will be a “Big Bang”. “We do not know if the burial chamber is Nefertiti or another woman, but it is full of treasures,” he told the newspaper. “It will be a ‘Big Bang’, the discovery of the 21st century”. Various theories surround the possibility of the hidden chamber. British Egyptologist Nicholas Reeves first raised the belief that Queen Nefertiti, understood to be Tutankhamun’s step-mother, could be buried in a secret compartment after high resolution photos showed straight lines on the walls of the tomb. In November, Egyptian officials said they were “90% sure” of the hidden chamber after conducting radar tests on the tomb. Discovery of Tutankhamun’s tomb - in colour 21 show all Discovery of Tutankhamun’s tomb - in colour 1/21 Carter and a worker examine the solid gold innermost sarcophagus, October 1925. Image courtesy of Griffith Institute, University of Oxford, colourised by Dynamichrome 2/21 Carter examines Tutankhamun's sarcophagus, October 1925. Image courtesy of Griffith Institute, University of Oxford, colourised by Dynamichrome 3/21 Carter, Callender and two Egyptian workers carefully dismantle one of the golden shrines within the burial chamber, December 1923. Image courtesy of Griffith Institute, University of Oxford, colourised by Dynamichrome 4/21 Carter, Mace and an Egyptian worker carefully roll up the linen pall covering the second shrine, 30th October 1923. Image courtesy of Griffith Institute, University of Oxford, colourised by Dynamichrome 5/21 Inside the outermost shrine in the burial chamber, a huge linen pall with gold rosettes, reminiscent of the night sky, covers the smaller shrines within, December 1923. Image courtesy of Griffith Institute, University of Oxford, colourised by Dynamichrome 6/21 Carter, Callende, and two workers remove the partition wall between the antechamber and the burial chamber, 2nd December 1923. Image courtesy of Griffith Institute, University of Oxford, colourised by Dynamichrome 7/21 A statue of Anubis on a shrine with pallbearers' poles in the treasury of the tomb, ca.1923. Image courtesy of Griffith Institute, University of Oxford, colourised by Dynamichrome 8/21 Arthur Mace and Alfred Lucas work on a golden chariot from Tutankhamun's tomb outside the "laboratory" in the tomb of Sethos II, December 1923. Image courtesy of Griffith Institute, University of Oxford, colourised by Dynamichrome 9/21 Howard Carter, Arthur Callender and an Egyptian worker wrap one of the sentinel statues for transport, 29th November 1923. Image courtesy of Griffith Institute, University of Oxford, colourised by Dynamichrome 10/21 In a "laboratory" set up in the tomb of Sethos II, conservators Arthur Mace and Alfred Lucas clean one of the sentinel statues from the antechamber, January 1924. Image courtesy of Griffith Institute, University of Oxford, colourised by Dynamichrome 11/21 Ornately carved alabaster vases in the antechamber, December 1922. Image courtesy of Griffith Institute, University of Oxford, colourised by Dynamichrome 12/21 Chests inside the treasury, ca.1923. Image courtesy of Griffith Institute, University of Oxford, colourised by Dynamichrome 13/21 A gilded bust of the Celestial Cow Mehet-Weret and chests sit in the treasury of the tomb, ca.1923. Image courtesy of Griffith Institute, University of Oxford, colourised by Dynamichrome 14/21 Under the lion bed in the antechamber are several boxes and chests, and an ebony and ivory chair which Tutankhamun used as a child, December 1922. Image courtesy of Griffith Institute, University of Oxford, colourised by Dynamichrome 15/21 A gilded lion bed and inlaid clothes chest among other objects in the antechamber, December 1922. Image courtesy of Griffith Institute, University of Oxford, colourised by Dynamichrome 16/21 An assortment of model boats in the treasury of the tomb, ca. 1923. Image courtesy of Griffith Institute, University of Oxford, colourised by Dynamichrome 17/21 A gilded lion bed, clothes chest and other objects in the antechamber. The wall of the burial chamber is guarded by statues, december 1922. Image courtesy of Griffith Institute, University of Oxford, colourised by Dynamichrome 18/21 A ceremonial bed in the shape of the Celestial Cow, surrounded by provisions and other objects in the antechamber of the tomb, December 1922. Image courtesy of Griffith Institute, University of Oxford, colourised by Dynamichrome 19/21 Howard Carter, Arthur Callender and an Egyptian worker open the doors of the innermost shrine and get their first look at Tutankhamun's sarcophagus, 4th January 1924. Image courtesy of Griffith Institute, University of Oxford, colourised by Dynamichrome 20/21 Tutankhamun's burial mask, November 1925. Image courtesy of Griffith Institute, University of Oxford, colourised by Dynamichrome 21/21 Lord Carnarvon, financier of the excavation, reads on the veranda of Carter's house near the Valley of the Kings, ca.1923. Image courtesy of Griffith Institute, University of Oxford, colourised by Dynamichrome But former antiquities minister and archaeologist Zahi Hawasshas refuted Mr Reeves’ claims, believing Queen Nefertiti to be one of the female mummies discovered in the Valley of the Queens, which are currently undergoing DNA tests at the Egyptian museum. It is thought that Tutenkhamun’s tomb may have originally been Queen Nefertiti’s tomb, but was converted when he died at the age of 19, before his own burial chamber had been completed. ||||| An Egyptologist has suggested hidden chambers lie behind a wall in King Tut's tomb. Forthcoming scans may reveal whether such chambers exist. On April 2, a new series of radar scans will be performed on King Tutankhamun's tomb to search for hidden chambers that may contain an undiscovered royal burial, Egypt's antiquities ministry has announced. The announcement comes after stories were published in numerous media outlets last week claiming that Egypt's tourism minister, Hisham Zazou, had told the Spanish news outlet ABC that the chambers had been proven to exist and contain numerous treasures. "The Ministry of Antiquities has not issued any statement concerning the results that have been reached so far," the ministry said in a statement released to Live Science. "Further radar examinations will be performed on April 2, and a press conference will be held afterwards to announce the results of the scan." [See Photos of King Tut's Mummy & His Burial] Last year, University of Arizona Egyptologist Nicholas Reeves published findings suggesting that there are hidden chambers behind a wall in Tutankhamun's tomb. These chambers, he believes, hold the burial of Queen Nefertiti, the wife of Akhenaten, a pharaoh who was Tutankhamun's father. "We could be faced, for the first time in recent history, with the intact burial of an Egyptian pharaoh in the Valley of the Kings," Reeves told Live Science last year. King Tutankhamun lived between roughly 1343 and 1323 B.C. Credit: Horemweb Wikimedia. Scans performed by Factum Arte, a company commissioned to scan Tutankhamun's tomb, show unusual lines and abnormalities in the plaster of the tomb, Reeves said, adding that these features indicate that a wall was built over a doorway in ancient times. Some of the artifacts in Tutankhamun's tomb were originally made for Nefertiti but were buried with Tutankhamun after the boy king's death, Reeves found. Radar scans performed on the tomb last year suggest that a void could exist behind the wall. Egypt's former antiquities minister, Zahi Hawass, urged that the claims be viewed cautiously. He noted that the geology of the Valley of the Kings can lead radar to produce false positives showing a tomb when, in fact, there is only a natural feature. Reeves did not immediately respond to Live Science's requests for comment on the latest developments. Tourism disaster Tourism has long been a major industry in Egypt. Since the revolution that toppled former Egyptian President Hosni Mubarak in 2011, Egypt's tourism industry has struggled, archaeologists have told Live Science. The political instability over the past five years has meant that the number of visitors to Egypt has yet to return to its prerevolution levels. Additionally, recent terrorist attacks — including the bombing of a Russian plane in the Sinai Desert, an attack carried out by the Islamic State group, or ISIS — have made it difficult for the Egyptian government to convince tourists that the country is safe to visit, according to these archaeologists. Egyptian officials hope that, if a hidden tomb is discovered, it will spur tourists to return to Egypt, bringing badly needed revenue and jobs to the country. Follow Live Science @livescience, Facebook & Google+. Original article on Live Science.

– First came the theory, then a dribble of updates: In August 2015, University of Arizona archaeologist Nicholas Reeves made the case that Tutankhamun's tomb also holds the remains of Nefertiti. Egyptian authorities had no comment at the time, but three months later, a duo of stories seemed to lend credence to the idea, at least of a hidden chamber. A "preliminary analysis indicates the presence of an area different in its temperature than the other parts of the northern wall," announced Egypt's antiquities minister; further scans that month led Egyptian officials to say they were "approximately 90%" certain a previously unknown chamber is present. Now, the next step in the process has been established. Additional radar exams will take place April 2, and the Ministry of Antiquities will hold a subsequent press conference to share the findings. That update was provided in an emailed statement to Live Science in an apparent attempt to discredit a story picked up by the media last week (see the Independent's version here) in which the country's tourism minister supposedly told Spanish media that the hidden chamber was packed with "treasures." Counters the statement, "The Ministry of Antiquities has not issued any statement concerning the results that have been reached so far."

the model hamiltonian we use is a combination of the usual optomechanical hamiltonian and the hamiltonian description of the shg process , and describes the system shown schematically in fig . [ fig : model ] . we shall label the annihilation operators of the two optical fields @xmath10 ( fundamental ` f ' , of frequency @xmath11 ) and @xmath12 ( second harmonic ` s ' , frequency @xmath13 ) . these two modes are coupled to a continuum of modes , represented by the operators @xmath14 , through decay rates @xmath15 ( in practice , @xmath16 @xcite ) , as well as to each other through a second - harmonic interaction frequency @xmath17 . the mechanical oscillator ` m ' is represented through its dimensionless quadratures @xmath18 and @xmath19 , and is characterized by the mechanical frequency @xmath5 and decay rate @xmath1 . we allow @xmath18 to couple to the two optical modes through the coupling constants @xmath20 ; we shall make the simplifying assumption that , since @xmath20 is proportional to the respective optical frequency , @xmath21 . thus , we can write the hamiltonian @xmath22 as a sum of four terms @xmath23 with the free hamiltonian ( we take units such that @xmath24 throughout the paper ) @xmath25 where @xmath26 and @xmath27 , the dissipation hamiltonian @xmath28 where we leave the mechanical dissipation hamiltonian undefined , the optomechanical hamiltonian @xmath29 and , finally , the shg hamiltonian @xcite @xmath30\,.\ ] ] in the expression for @xmath31 we defined two frequency ranges @xmath32 , which define the bath modes through which the two modes are damped . given the very large separation in frequency between the two optical modes , we can justify considering @xmath33 and @xmath34 as non - overlapping without violating the requirement that these two frequency ranges must be very large compared to @xmath15 that is necessary to ensure markovian dynamics . if the two frequency ranges were to have a significant overlap , , in the case of two optical modes spaced by a mechanical frequency that exist in different resonators but are coupled to the same bath , then one must be careful to use correctly modified input output relations and equations of motion . in our case , the standard input output relations will be held valid . in the following we will obtain the linearized equations of motion for the system described by this hamiltonian . as a first step we derive the heisenberg equations of motion for @xmath35 , which read : @xmath36 where @xmath37 is the input field coupled to the fundamental mode ( the second harmonic ) having zero mean and two - time correlation function @xmath38 and @xmath39 is the detuning of the driving field from cavity resonance . ( [ eq : eom ] ) are written in a frame rotating with the optical modes , , in an interaction picture with respect to the hamiltonian @xmath40 . similarly , for the mechanical mode we have @xmath41 and @xmath42 where we used a brownian - motion type damping model @xcite . the self - adjoint langevin force @xmath43 is zero - mean and ( assuming the high - temperature limit ) delta - correlated as @xmath44 . we now linearize the equations of motion by considering a pumping field of large intensity . under these conditions , both the field modes of the toroid would be macroscopically populated . we are then allowed to take @xmath45 , where @xmath46 is the ( large ) mean amplitude of each operator and @xmath47 is its fluctuation around such average . for simplicity of notation , we shall drop the ` @xmath48 ' in the operator fluctuations . we thus write ( @xmath49 ) @xmath50\hat{a}_\mathrm{f}+ig_\mathrm{j}\overline{a}_\mathrm{j}\hat{x}+\hat{o}_j-\sqrt{2\kappa_\mathrm{j}}\hat{a}_\mathrm{j}^\mathrm{in}\,\ ] ] with @xmath51 and @xmath52 . despite the relation linking @xmath53 and @xmath54 , in what follows we shall continue to use both symbols for clarity . for the mechanical modes , the equation of motion for @xmath18 remains unchanged , while that for momentum becomes @xmath55 assuming , for now , the existence of a steady state we find the following equation relating the amplitude of the fundamental mode and that of the input noise @xmath56 where we have taken @xmath57 is the phase of @xmath58 . the input field is assumed to be in a monochromatic coherent state characterized by the ( real ) amplitude @xmath59 . for the parameters used throughout this paper , the first term on the left - hand side in the above equation can be safely neglected , whereupon the equation can easily be solved to obtain @xmath58 . for the second harmonic , we get @xmath60 while @xmath61 . the linearization of the equations of motion makes the dynamics gaussian so that any initial gaussian will remain such at any instant of time @xcite . we now introduce the quadrature vector @xmath62 where we have defined the optical quadrature operators @xmath63 and @xmath64 of mode @xmath49 . similar definitions hold for the input - field operators . it is worth bearing in mind that all our operators are functions of time @xmath65 , and we have simply dropped the label @xmath65 for conciseness of notation . with these definitions , the first moment of @xmath66 is zero and any gaussian state of the system is thus fully characterized by the covariance matrix @xmath67 . the equations of motion derived above can be concisely written as @xmath68 , with the input noise vector @xmath69 the drift matrix @xmath70 can be explicitly determined and depends on the set of parameters characterizing the dynamics of the three - mode system addressed here . its expression is too lengthy to be reported here and is thus deferred to the appendix . a close inspection of the form of @xmath70 reveals that , by assuming @xmath71 and introducing the rescaled parameters @xmath72 and @xmath73 , the drift matrix is a universal expression of @xmath74 . thus , for a fixed value of @xmath75 the nature of the dynamics is determined solely by the ratio of the coupling constants . for small @xmath76 , the interaction is dominated by the shg process . conversely , for @xmath77 , the dynamics resembles closely that of a standard optomechanics model with two fields @xcite . the dynamical equations should be stable in order for a steady state to exist . this is assured if the real part of the spectrum of @xmath70 is negative , in which case the system will tend to a stationary state characterized by the covariance matrix that solves the lyapunov equation @xmath78 with the input - noise matrix @xmath79\,.\ ] ] the stability condition for @xmath70 can be rephrased more formally in terms of the routh - hurwitz criterion @xcite , which we have used in our quantitative characterization of the dynamics . we note in passing that the lyapunov equation above has a concise analytic solution for @xmath80 , as reported in ref . the covariance matrix encompasses the full information on the system at hand . here , we shall be interested in the entanglement - sharing properties of the three modes . in order to demonstrate the occurrence of genuine multipartite entanglement , we rely on the criterion based on negativity of partial transpose ( npt ) @xcite and we will make use of the logarithmic negativity as an entanglement quantifier @xcite . for a bipartition consisting of subsystems @xmath81 and @xmath82 ( @xmath83 ) , this is defined as @xmath84 $ ] , where @xmath85 is the set of symplectic eigenvalues of the covariance matrix associated with the partially transposed states of the system such that @xmath86 @xcite . if either @xmath81 or @xmath82 are single - mode subsystems , @xmath87 regardless of the number of modes comprised in @xmath82 or @xmath81 . moreover , although this is not the case in general , in this situation the npt criterion is a necessary and sufficient condition for inseparability of pure and mixed gaussian states alike . in what follows , we characterize the entanglement structure in both reduced two - mode states and bipartite one - versus - two - mode ones . in order to do that , we use numerical values for the various constants entering the model that reflect the state - of - the - art of recent experiments . the fundamental wavelength is chosen to be @xmath88 nm @xcite , at which an input power @xmath89@xmath90w corresponds to @xmath91s@xmath92 . moreover , we set @xmath93 @xcite , and @xmath94hz , which is within a factor of @xmath95 of what has been observed in ref . @xcite . d.|-1|c & ' '' '' @xmath96 + .&0.10 + .&0.42 + .&0.01 + d.|-1|c & ' '' '' @xmath97 + .&0.44 + .&0.15 + .&0.45 + for these choices , fig . [ fig : entangledregions ] summarizes both the entanglement in one - versus - one - mode reduced states and one - versus - two - mode situations . entanglement is analyzed in the @xmath98@xmath99 parameter space , @xmath99 being the input power . while all - optical entanglement ( , the entanglement within the reduction involving only the s and f subsystems ) exists in a narrow strip around @xmath100 and is maximum on resonance , the mechanical mode is entangled more strongly with s near @xmath101 , and with f close to @xmath102 . at low ( yet still quite sizeable ) values of the mechanical quality factor , the region corresponding to @xmath103 is largely associated with separability of any two - mode reduction , except the narrow strip at @xmath100 mentioned above , which witnesses the fact that , in these conditions , the direct nonlinear coupling between the optical modes overcomes any entangling power of the optomechanical mechanism . larger values of @xmath104 , on the other hand , give rise to non - negligible areas of ( even strong ) optomechanical entanglement involving both the m s pair and the m this is clearly shown in fig . [ fig : entangledregions](c ) where , remarkably , we find that even the all - optical entanglement is affected , spreading quite considerably in regions where , at lower @xmath104 , we had @xmath105 . this result might be interpreted as arising from the indirect coupling between the two optical modes , whose interaction is ruled not only by their direct nonlinear coupling but also by a detuning - dependent effective one mediated ( quasi - coherently ) by the mechanical mode . also quite interesting is the behavior of the one - vs - two - mode entanglement . an investigation on these configurations is relevant in order to characterize the multipartite entanglement being possibly shared by the three subsystems . indeed , based on the classification provided by giedke _ et al . _ @xcite , the simultaneous inseparability of the three possible one - versus - two - mode bipartitions in a three - mode system implies the existence of genuine tripartite entanglement . likewise , the state is @xmath106-mode biseparable if there are @xmath106 one - versus - two - mode bipartitions with respect to which the state of the system is separable . [ fig : entangledregions](b ) and fig . [ fig : entangledregions](d ) show the rich structure of entanglement sharing that is exhibited by our model . one - versus - two - mode entanglement turns out to be , in general , much more robust ( and larger ) with respect to noise affecting the system than the entanglement in any two - mode reduction , a feature that has already been shown in other optomechanics - related investigations @xcite . in fig . [ fig : entangledregions](b ) , regions of full three - mode inseparability are shown even for a relatively low - quality mechanical oscillator . however , in this case , noise affecting the system through the mechanics is too strong to allow for much overlap between regions of three - mode inseparability . indeed , by increasing the mechanical quality factor by a factor of @xmath107 , giving the results in fig . [ fig : entangledregions](c ) , the overlap between regions of one - versus - two - mode entanglement increases significantly , covering virtually the whole stability area shown in the figure . in passing , we mention that we have applied a multipartite entanglement witness for continuous - variable states , multiwit , that was developed in ref . @xcite using semi - definite optimization methods . the use of this instrument has confirmed the genuinely tripartite nature of the entanglement at hand in the regions of overlap among the three regions of one - versus - two - mode inseparability , which excludes the possibility of having generalized three - mode biseparable states . as a quantitative illustration for the high-@xmath104 case , in table [ tab : en ] we give the entanglement in any reduction and bipartition that can be singled - out in our problem , taking the values of the parameters listed above and choosing @xmath108 with @xmath109w . in order to complete our assessment , we have determined the degree of genuine tripartite entanglement across interesting regions in the full - inseparability areas . as a quantitative estimator , we have used the tripartite logarithmic negativity @xmath110 , which is a proper entanglement monotone @xcite . the results of this study are shown in fig . [ fig : tripartite ] for both the low- and high-@xmath104 cases and increasing optical input powers . the qualitative differences in the behavior of the tripartite entanglement is very marked at large input power : whilst at low mechanical quality factors the high - power tripartite entanglement is null , it extends for most of the region @xmath111 $ ] at high mechanical quality factor , therefore leaving us with much room for maneuvering in the space of entangled three - mode states . + let us finally explore the competition between the shg process and the optomechanics in our model . as @xmath17 grows in fig . [ fig : entangledregionschi](a ) and fig . [ fig : entangledregionschi](c ) , the entanglement for the f@xmath112 m and s@xmath112 m reductions decreases , whereas that for f@xmath112s covers an ever - larger area of the parameter space . the behavior of the entanglement in the bipartitions , fig . [ fig : entangledregionschi](b ) and fig . [ fig : entangledregionschi](d ) , is similar and also easily understood on an intuitive basis : a bigger @xmath17 leads to larger regions of entanglement for the two bipartitions that involve one of the optical mode on its own ( , f@xmath112ms and s@xmath112mf ) , but a contraction in the parameter space where entanglement in the m@xmath112fs bipartition is observed . the inference of the full state of an optomechanical system is a major practical challenge @xcite , mainly due to the fact that the mechanical quadratures are not directly accessible to an experiment . here we propose a technique , which requires the use of the system drawn schematically in fig . [ fig : detection ] , that allows us to infer the mechanical quadratures indirectly . initially , we assume that the homodyne detectors needed in the scheme have infinite bandwidth ; we shall account for the finite bandwidth of any realistic apparatus later on . given such a system , one has access to the four input ( two each for the fundamental and the second harmonic ) and four output quadratures . one can then infer the intra - cavity optical modes using the input - output relation @xmath113 and similarly for the rest of the quadratures . it is clear that very good characterization of the system , including knowledge of all the coupling constants and the effect of vacuum input noise @xcite is required to infer the intra - cavity quadratures accurately . once the four optical intra - cavity quadratures are known , it is natural to ask how the mechanical quadratures can be inferred . indeed , the key to our proposal is noticing that the inferred quadratures are obtained as a time trace . one can therefore make direct use of the equations of motion to obtain a time trace for the mechanical quadrature @xmath18 and @xmath19 . the covariances of these inferred quadratures can finally be used to build an inferred covariance matrix , @xmath114 . in the limit of infinite detector bandwidth , @xmath115 . we use a simple model for including the effects of a finite detector bandwidth . let the bandwidth of the detector be @xmath116 . then the point - spread function of the detector is taken to be @xmath117 where @xmath118 is the heaviside step function . the label @xmath65 is understood as the time at which the measurement was performed . normalization requires that @xmath119 . for each operator @xmath120 we assign an inferred operator @xmath121 as the convolution of @xmath122 with @xmath120 . it can easily be shown that @xmath123 . this means that we can infer the value of any @xmath124 by calculating the time derivative of the _ inferred _ @xmath125 . with this at hand , we can finally show that the inferred covariance matrix , at the steady - state , is given by @xmath126{\mathbf{d}}\bigl[e^{{\mathbf{a}}(\tau - s)}-1\bigr]^{\mathrm{t}}\,\rmd s\right\}\bigl({\mathbf{a}}\tau\bigr)^{-{\mathrm{t}}}. \end{aligned}\ ] ] modern homodyne detectors can operate with a bandwidth of the order of @xmath127ghz , which is much larger than typical values of @xmath5 in the micro - mechanical domain . therefore , it is understood that @xmath116 is by far the shortest timescale of the system . it then suffices to expand @xmath114 to first order in @xmath116 , which gives @xmath128 these expressions hint at the tantalizing possibility that by increasing @xmath116 electronically one could deduce the value of @xmath114 for _ vanishing _ @xmath116 , and therefore infer @xmath80 itself . in our numerical exploration , the fidelity @xcite for the inference of the mechanical mode using this method was above @xmath129% when @xmath116 corresponded to a bandwidth of @xmath130mhz . we have presented a system that combines a nonlinear optical process with optomechanics in a very natural manner . its monolithic design makes it very attractive for experimental , or even technological , applications . indeed , the system we presented is based on technology that is inherently compatible with integration on optoelectronic chips . our investigation concentrated on the dynamics of the system , but we also addressed the problem of the actual detection of the intra - cavity state by outlining a method involving homodyning all the input and output quadratures to infer the covariance matrix for the three intra - cavity modes . lastly , a numerical example using constants from recent experiments was used to illustrate the feasibility of observing these effects in a realistic system . + looking further ahead , one can envisage several of these structures sharing a common photonic `` bus '' whose function is to populate the optical mode of each toroid at the fundamental frequency . the shg process and optomechanics could then be used to create an entangled state of the mechanics with the second - harmonic field , thereby generating for each structure an optical field , which can be routed out of the photonic bus without losses , due to the large separation in frequencies , that is entangled to the mechanical mode of the toroid . we remark that this system lends itself naturally to the distribution and certification of optomechanical entanglement as per the protocol recently proposed in ref . @xcite . ax acknowledges financial support from the royal commission for the exhibition of 1851 . mb is supported by a fastquast itn marie curie fellowship . mp is supported by the uk epsrc through a career acceleration fellowship and the `` new directions for epsrc research leaders '' initiative ( ep / g004759/1 ) . here we provide the explicit form of the drift matrix @xmath70 for our problem , which reads with @xmath132 . as done in the main body of the paper , we assume that @xmath133 is real and @xmath21 . this can always be done by dropping the corresponding assumption on @xmath134 and choosing its phase appropriately . we then define the parameters @xmath72 and @xmath135 and rewrite the drift matrix as @xmath136,\ ] ] showing that the steady - state of the system is a universal function of @xmath76 and @xmath75 . in particular , at a fixed value for @xmath75 the dynamics is determined solely by the value of the ratio of the coupling constants @xmath76 . 26ifxundefined [ 1 ] ifx#1 ifnum [ 1 ] # 1firstoftwo secondoftwo ifx [ 1 ] # 1firstoftwo secondoftwo `` `` # 1''''@noop [ 0]secondoftwosanitize@url [ 0 ] + 12$12 & 12#1212_12%12@startlink[1]@endlink[0]@bib@innerbibempty link:\doibase 10.1126/science.1156032 [ * * , ( ) ] link:\doibase 10.1364/josab.27.00a189 [ * * , ( ) ] link:\doibase 10.1038/nature08967 [ * * , ( ) ] link:\doibase 10.1038/nature10261 [ * * , ( ) ] link:\doibase 10.1038/nature10461 [ * * , ( ) ] link:\doibase 10.1103/physrevlett.108.033602 [ * * , ( ) ] link:\doibase 10.1038/nphys1304 [ * * , ( ) ] link:\doibase 10.1364/oe.19.011415 [ * * , ( ) ] link:\doibase 10.1103/physrevlett.104.153901 [ * * , ( ) ] @noop _ _ ( , , ) link:\doibase 10.1103/physreva.63.023812 [ * * , ( ) ] @noop ( ) , link:\doibase 10.1103/physrevlett.99.250401 [ * * , ( ) ] @noop _ _ ( , ) link:\doibase 10.1103/physrevlett.77.1413 [ * * , ( ) ] link:\doibase 10.1016/s0375 - 9601(96)00706 - 2 [ * * , ( ) ] link:\doibase 10.1103/physrevlett.84.2726 [ * * , ( ) ] link:\doibase 10.1103/physreva.65.032314 [ * * , ( ) ] link:\doibase 10.1103/physreva.70.022318 [ * * , ( ) ] link:\doibase 10.1103/physreva.83.063835 [ * * , ( ) ] link:\doibase 10.1103/physreva.64.052303 [ * * , ( ) ] link:\doibase 10.1103/physreva.83.052324 [ * * , ( ) ] @noop * * , ( ) link:\doibase 10.1140/epjd / e2008 - 00112 - 5 [ * * , ( ) ] link:\doibase 10.1103/physreva.73.062330 [ * * , ( ) ] @noop ( ) ,

we investigate the nature of the three - mode interaction inside an optomechanically - active microtoroid with a sizeable @xmath0 coefficient . experimental techniques are quickly advancing to the point where structures with the necessary properties can be made , and we argue that these provide a natural setting in which to observe rich dynamics leading , for instance , to genuine tripartite steady - state entanglement . we also show that this approach lends itself to a full characterisation of the three - mode state of the system . over the last several years , the field of optomechanics has witnessed remarkable progress in experimental achievements @xcite , the chief driving factor behind which was the quest to achieve ground - state cooling of a mechanical oscillator . this was achieved , first in by means of cryogenics @xcite , then by electromagnetic means in an electromechanical system @xcite , and finally in an optomechanical setting @xcite . reaching the ground state is a means to an end , for it is only when a mechanical oscillator is close to , or at , the ground state that its true quantum nature shows up unambiguously . this was demonstrated clearly in a recent experiment @xcite that showed the imbalance between the red- and blue - mechanical sidebands in the spectrum , a clear signature that the mechanical oscillator is behaving in a nonclassical way . turning away from fundamental physics , one would like to use quantized mechanical resonators as a _ resource _ ; typical oscillators have decay rates @xmath1 in the sub - khz domain , meaning that the decoherence time @xmath2 can be made large compared to the other timescales of the system by using cryogenic methods to decrease @xmath3 , the average number of phonons at an environmental temperature @xmath4 and at mechanical frequency @xmath5 ( @xmath6 is boltzmann s constant ) , as much as possible . clearly , mechanical oscillators with a large mechanical frequency , say @xmath7mhz , and large mechanical quality factor @xmath8 are at an advantage in this respect . at the same time , one would like the mechanical oscillator to interact strongly with an optical resonator that has a similarly large optical @xmath9 . it is in this context that optomechanical toroidal structures @xcite appear as ideal optomechanical systems . from a technological point of view , toroidal structures are also ideal in that they minimize the number of moving parts there are no moving mirrors to align and can be manufactured monolithically on cmos - compatible substrates @xcite , pointing the way towards a possible integration with conventional ( opto)electronics in the future . + the highest - quality optical modes in toroidal structures are of the ` whispering gallery mode ' type , with the mechanics of total internal reflection ensuring that losses are minimized . a recent group of experiments @xcite has recognized this feature as enabling another technology : second - harmonic generation ( shg ) . indeed , it turns out that toroidal and ring - resonator structures facilitate shg because the phase matching conditions that are necessary in any nonlinear optics experiment can be met automatically by choosing the right doublet of optical modes @xcite . + it is the purpose of this paper to combine these two ideas . we shall look at the emergence of nonclassical steady - states , , genuinely tripartite entangled states , in the three - mode system formed by the two optical modes the fundamental and the second harmonic and the mechanical oscillator . every pair of these three modes interacts directly , and we shall see that this results in a competition between the two purely optomechanical interactions and the second - harmonic generation process . this paper is structured as follows . over the next section we shall introduce the full model hamiltonian , and then proceed to obtain the equations of motion . the usual procedure is used to linearize the dynamics , whereupon we can concentrate exclusively on gaussian states and present some numerical results . the next section discusses state detection using homodyning techniques , after which we conclude our investigation .

men who have sex with men ( msm ) is the term used to denote all men who have sex with other men as a matter of preference or practice , regardless of their sexual identity or sexual orientation and irrespective of whether they also have sex with women or not . msm is a very important subgroup of targeted intervention ( ti ) for national aids control program ( nacp ) phase iii . however , lesbian , gay , bisexual , and transgender people face unique risks to their mental health . many face discrimination from coworkers , family members and peers , as well as society at large . recent studies indicate that experiencing social discrimination is a strong predictor of mental health issues . sexual orientation represents an important , but relatively understudied , individual characteristic shaping risk for psychiatric morbidity . no wonder , the inner conflicts in a msm grows day - by - day and it takes a toll on their social life and hurts their mind . as a result , psychiatric morbidities such as depression , anxiety , psychotic disorders , and even suicidal tendencies are common in this group . very few studies have been conducted to evaluate mental health status in msm and their risk factors for psychiatric morbidity . the present study was conducted in the drop in centers ( dics ) in ahmedabad city with the help of non - governmental organization ( ngo ) , which is working for msm . the present study attempts to find determinants of mental health , but also to fill a crucial gap in available mental health information of msm . in the ahmedabad municipal corporation ( amc ) area , nacp is implemented by aids control society ( acs ) in which ngo has taken responsibility for ti for msm . present study was conducted on registered msm of ahmedabad city after taking permission from amcacs , chuwal gram vikash trust unit 1 , 2 and swavlambi chuwal mandal unit , ahmedabad . through purposive sampling , 10% msm ( 410 msm ) from each unit were selected out of total 4100 msm who were coming in dic of their respective unit to attend meetings . after taking informed consent interview of msm was conducted personally through pretested , prestructured questionnaire during the study period with the help of counselor , out - reach workers and peer educators to get correct and reliable answer as they have good rapport with msm . in the study , sexually transmitted infections ( stis ) were considered on the basis of any of the sti symptoms present as examined by the medical officer appointed by naco in msm at the time of interview . mental health status of msm was evaluated through general health questionnaire 28 ( ghq 28 ) . it is the most common assessment tool of mental well - being is the ghq 28 . ghq 28 developed as a screening tool to detect those likely to have or be at risk of developing psychiatric disorders , it is a measure of the common mental health problems / domains of depression , anxiety , somatic symptoms , and social withdrawal . tool ghq 28 has self - reporting screening questionnaire , which identifies high probability of suffering from psychiatric illness . the four subscales , each containing seven items , are as follows : somatic symptoms ( items 1 - 7)anxiety / insomnia ( items 8 - 14)social dysfunction ( items 15 - 21)severe depression ( items 22 - 28 ) . somatic symptoms ( items 1 - 7 ) anxiety / insomnia ( items 8 - 14 ) social dysfunction ( items 15 - 21 ) severe depression ( items 22 - 28 ) . each was given a 4-point likert scoring system ( 0 - 1 - 2 - 3 ) that ranges from a better / healthier than normal option ( allotted score 0 ) , through a same as usual ( allotted score 1 ) and a worse / more than usual ( allotted score 2 ) to a much worse / more than usual ( allotted score 3 ) option . according to that , higher the score worse is the condition . 24 score is the point where probability of case suffering from psychiatric morbidity was 50% . therefore , msm scored more than 24 considered as psychiatric morbid and counted as the numerator in prevalence rate . the questionnaire was translated to local language ( gujarati ) and retranslated back to english . the analysis was done using trial version of statistical package for social science ( spss ) and mean , standard deviation , unpaired t - test , and mann whitney u - test were applied . to evaluate mental health status of msm , ghq 28 scale was used , which includes the somatic symptoms , anxiety and insomnia symptoms , social dysfunction symptoms and severe depression symptoms . prevalence of psychiatric morbidity ( > 24 ) was 52.9% . in another similar study in central kolkata , more than half ( 63.9% ) of the msm crossed the threshold score of 24 signaling a high risk of psychiatric illness in the msm group . gay - bisexual men evidenced higher prevalence of depression , panic attacks , and psychological distress than heterosexual men . the mean score obtained in anxiety / insomnia subscale ( 5.4 4.2 ) and severe depression ( 5.4 4.6 ) was higher than other two subscale somatic symptoms ( 4.0 3.2 ) and social dysfunction symptoms ( 4.6 3.8 ) . table 1 shows how the study population fared with regards to ghq scores , which was a reflection of the status of their physical , mental , and social health . the likert scale of scoring ( 0 - 1 - 2 - 3 ) was used in ghq 28 . in each of the four subscales , that is , somatic symptoms , anxiety and insomnia , social dysfunction and severe depression - the maximum attainable score is 21 while the minimum possible score is 0 . msm had obtained more than 14 score while regarding anxiety and insomnia symptoms 0.3% msm obtained more than 14 score while regarding social dysfunction symptoms 1.2% msm obtained more than 14 score while regarding severe depression 0.7% msm obtained more than 14 score . using the recommended threshold score of > 24 ( threshold being defined as just significant clinical disturbance or that point where probability of being a case suffering from psychiatric morbidity is 50% ) , more than half ( 52.9% ) of the msm crossed the threshold score of 24 signaling a high risk of psychiatric illness in the study population . distribution of the study population according to ghq scoring pattern figure 1 shows the highest mean ghq score was obtained in the age group 55 - 65 years of age followed by 15 - 25 years of age . in a similar study of meyer et al . , young lesbians , gay men , and bisexual individuals ( aged 18 - 29 and 30 - 44 ) had lower mood disorder prevalence than did older individuals ( aged 45 - 59 ) . gay men and bisexual and homosexually experienced heterosexual individuals had higher levels of psychological distress compared with exclusively heterosexual individuals . age - group - wise mean general health questionnaire score obtained by men who have sex with men table 2 shows 6 questions of ghq , msm had obtained higher score than other questions . higher score obtained in some of individual ghq questions figure 2 shows the prevalence of psychiatric morbidity was more seen in msm living with the family as compared with living alone or with friends . prevalence of psychiatric morbidity was more in never married msm and also in less educated msm . msm with sti symptoms suffered from psychiatric illness more than msm who did nt have sti symptoms . furthermore , prevalence of psychiatric morbidity was higher in msm having more than 2 partners ( 54.9% ) as compared to msm having 2 or less partner ( 49.3% ) . prevalence of psychiatric morbidity was higher in msm having regular partners ( 60.3% ) than in msm having casual partner ( 51.7% ) . determinants of psychiatric morbidity table 3 shows the various determinants for assessment of mental health of msm were like partner characteristic ( casual vs. regular ) , presence of sti symptoms , marital status , and living arrangement . in the present study , msm with sti symptoms obtained significantly higher mean score than msm without sti symptoms in all 4 ghq subgroup scales somatic symptoms , anxiety symptoms , social dysfunction and severe depression ( p < 0.005 , unpaired t - test ) . msm with regular sexual partner had a higher score in all 4 subscale as compared to msm with a casual partner which indicate higher score was found , but no significant association obtained between the characteristic of partner ( either have a regular partner or casual partner ) and mental health status of the msm ( p > 0.05 , mann furthermore , msm living with family obtained higher mean score than living alone , which shows that msm living with the family they may likely to suffer from psychiatric morbidity ( p < 0.005 , highly significant mann out of the total score 84 , median score of ghq 28 was 25 in msm . hence , threshold median score of 24 or higher signaling a high risk of psychiatric illness in the population . prevalence of psychiatric morbidity was higher in msm having more than 2 partners ( 54.9% ) , msm having sti symptoms ( 59% ) and also in msm having regular partner ( 60.3% ) . psychiatric morbidity was more in msm may be because of shame , stigma , discrimination , and presence of stis . present study could not reveal whether psychiatric illness lead to high risk sexual behavior of msm or high risk sexual behavior of msm lead to psychiatric illness .

background : men who have sex with men ( msm ) , a unique group of people , feel , and believe they will face hardships in society once their identity is disclosed , but this does not deter them from dressing and behaving like the opposite sex in public life or fighting for their rights.objectives:to study the mental health status of msm and their determinants.materials and methods : descriptive cross - sectional study was conducted among 410 msm in the drop in centers of non - governmental organization working for msm in ahmedabad city through purposive sampling.results:prevalence of psychiatric morbidity was 52.9% . the mean score obtained in anxiety / insomnia subscale ( 5.4 4.2 ) and severe depression ( 5.4 4.6 ) was higher than other two subscale somatic symptoms ( 4.0 3.2 ) and social dysfunction symptoms ( 4.6 3.8 ) . among general health questionnaire 28 questions , more msm had a more than usual feeling that they are getting difficulty in staying asleep once you are off , lost much sleep over worry , been getting edgy and bad tempered , felt constantly under strain , been feeling nervous and strung - up all time . prevalence of psychiatric morbidity is more in never married msm and also in less educated msm . msm with sexually transmitted infection ( sti ) symptoms suffer from psychiatric illness more than msm who did nt have sti symptoms.conclusion:various determinants like partner characteristic , presence of sti symptoms , marital status , and living arrangement affect the mental health of msm .

hepatocellular carcinoma ( hcc ) represents the fifth most common cancer worldwide and is known to cause significant public health problems , particularly in association with chronic hepatitis b ( chb ) or chronic hepatitis c . based on available data , more than half of hcc cases and deaths are estimated to occur in north eastern asian areas including korea , china , taiwan , and japan where viral hepatitis b or c is highly prevalent . unlike other solid tumors , hcc presents several unique characteristics , including multifocal tumorigenesis , frequent vascular invasion , recurrence , and most importantly associated cirrhotic background , altogether making a hcc hard to cure malignancy . in addition , hcc is characterized by heterogeneity in terms of genetic diversity , tumor behavior , and patient population . in spite of an effort to detect early stage of hcc in patients at risk through a surveillance program , a substantial proportion of patients with hcc are still diagnosed at an advanced stage of the disease when the survival rate is poor . potentially curative treatments including resection , ablation , and liver transplantation can be applied only to hcc detected at an early stage ( single nodule 5 cm or 2 - 3 nodules 3 cm ) . transarterial chemoembolization ( tace ) is regarded as standard - of - care for multinodular hcc without vascular invasion and extrahepatic metastasis . sorafenib is the first developed molecular targeted agent in hcc which blocks the raf / mek / erk pathway by inhibiting raf serine / threonine kinase and also inhibiting the upstream receptor tyrosine kinases that are important in angiogenesis , such as vascular endothelial growth factor receptor ( vegfr)-2 , vegfr-3 , platelet derived growth factor receptor and kit . in a global phase iii , randomized trial of 602 patients with advanced hcc , the median overall survival ( os ) was 10.7 months in the sorafenib group compared with 7.9 months in the placebo group ( hazard ratio , 0.69 ; 95% confidence interval , 0.55 to 0.87 ; p < 0.001 ) . the survival benefit was preceded by a delay in time to progression ( ttp ) : 5.5 months for sorafenib versus 2.8 months for control ( p < 0.001 ) . another phase iii trial conducted in the asia - pacific ( ap ) area confirmed the survival benefit of sorafenib in unresectable hcc . based on these results , sorafenib was approved as the first systemic drug for patients with advanced hcc not amenable to resection , transplantation , or locoregional treatments . data obtained from well - controlled clinical trials might not be translated into a real - clinical setting , particularly in hcc treatment . the efficacy and safety of sorafenib in hcc patients with liver dysfunction remain largely unknown , as only patients of child - pugh a were included in the trials . gideon ( global investigation of therapeutic decisions in hcc and of its treatment with sorafenib ) is a prospective , non - interventional study conducted to fulfil post - approval commitments to licensing agencies . gideon is one of the largest studies conducted in patients with unresectable hcc , and the data facilitate broad evaluation of patient subgroups . many subanalyses were therefore planned and performed , with a focus on potentially predictive or prognostic factors , including child - pugh score , barcelona clinic liver cancer ( bclc ) stage , and etiology . herein , we report on real - life experience of sorafenib therapy for hcc in korea , using a subset of the gideon data . gideon recruited patients who were candidates for systemic therapy , for whom the decision to treat with sorafenib was made in real - life practice conditions including patients with child - pugh b liver function . the primary objective of gideon is to evaluate the safety of sorafenib in patients with unresectable hcc in real - life . the secondary objectives are to explore drug efficacy in terms of os , progression - free survival , ttp , response rate ( rr ) , and disease control rate ( dcr ) ; to determine the duration of therapy according to various patient characteristics ; to assess methods of patient evaluation , diagnosis , and follow - up ; to assess comorbidities and their influence on treatment and outcome in real - life practice rather than a controlled clinical trial setting ; and to evaluate the practice pattern of the physicians involved in the care of these patients . eligible patients were those diagnosed histologically or radiographically with hcc , who have a life expectancy of > 8 weeks and in whom the decision to treat with sorafenib was made by their physician . exclusion criteria were those dictated by the manufacturer of the drug . written informed consents were given by all patients and the study was approved by the individual institutional review board . more than 3,000 patients were recruited from 39 countries of five geographic regions between january 2009 and april 2012 . a total of 497 patients were enrolled from 11 sites in korea during the same period . of these , 482 patients were evaluable for safety analyses after exclusion of 15 patients who did not receive at least one dose of sorafenib during the study period ( n=5 ) or did not undergo at least one assessment for follow - up after initiating study medication , regardless of previous systemic treatment ( n=10 ) . paper or electronic case report forms were used to record data from all enrolled patients at study entry and start of sorafenib , then at intervals chosen by the prescribing physician until death , withdrawal from the study , or loss to follow - up . all adverse events ( aes ) were graded according to the national cancer institute common terminology criteria ver . 3.0 ( national cancer institute , bethesda , md ) , and their likely relationship to sorafenib therapy was documented . hcc assessment was made by computed tomography or other equivalent radiographical method and was evaluated using the response evaluation criteria in solid tumors ( recist ) . gideon recruited patients who were candidates for systemic therapy , for whom the decision to treat with sorafenib was made in real - life practice conditions including patients with child - pugh b liver function . the primary objective of gideon is to evaluate the safety of sorafenib in patients with unresectable hcc in real - life . the secondary objectives are to explore drug efficacy in terms of os , progression - free survival , ttp , response rate ( rr ) , and disease control rate ( dcr ) ; to determine the duration of therapy according to various patient characteristics ; to assess methods of patient evaluation , diagnosis , and follow - up ; to assess comorbidities and their influence on treatment and outcome in real - life practice rather than a controlled clinical trial setting ; and to evaluate the practice pattern of the physicians involved in the care of these patients . eligible patients were those diagnosed histologically or radiographically with hcc , who have a life expectancy of > 8 weeks and in whom the decision to treat with sorafenib was made by their physician . exclusion criteria were those dictated by the manufacturer of the drug . written informed consents were given by all patients and the study was approved by the individual institutional review board . more than 3,000 patients were recruited from 39 countries of five geographic regions between january 2009 and april 2012 . a total of 497 patients were enrolled from 11 sites in korea during the same period . of these , 482 patients were evaluable for safety analyses after exclusion of 15 patients who did not receive at least one dose of sorafenib during the study period ( n=5 ) or did not undergo at least one assessment for follow - up after initiating study medication , regardless of previous systemic treatment ( n=10 ) . paper or electronic case report forms were used to record data from all enrolled patients at study entry and start of sorafenib , then at intervals chosen by the prescribing physician until death , withdrawal from the study , or loss to follow - up . all adverse events ( aes ) were graded according to the national cancer institute common terminology criteria ver . 3.0 ( national cancer institute , bethesda , md ) , and their likely relationship to sorafenib therapy was documented . hcc assessment was made by computed tomography or other equivalent radiographical method and was evaluated using the response evaluation criteria in solid tumors ( recist ) . the baseline demographic and tumor characteristics of 482 patients evaluable in terms of safety analysis are shown in table 1 . male patients predominated ( 85.5% ) , and 76.8% of patients were under 65 years of age ( median age , 55.0 years ) . the most common underlying etiology was hepatitis b virus ( hbv ) infection ( 81.1% ) , followed by alcohol use ( 26.3% ) . most patients were child - pugh a class ( 56.8% ) , with fewer child - pugh b patients ( 21.8% ) . eastern cooperative oncology group ( ecog ) performance status was 1 ( 44.8% ) and 0 ( 33.8% ) in most patients . all bclc stages were represented but most patients ( 60.8% ) were bclc stage c , while 4.8% of patients were bclc stage b , 4.6% stage d , and 0.8% stage a. in terms of tnm staging , stage iii and iv patients accounted for 25.9% and 52.5% of all patients , respectively , and only a few were tnm stage i ( 0.2% ) or ii ( 1.9% ) . prior locoregional treatment ( lrt ) was administered in 68.3% of all patients , with tace being the most common . thus , 60.6% of all patients had undergone prior tace compared with 14.5% , 8.3% , and 2.1% of patients treated with prior radiofrequency ablation , hepatic arterial infusional chemotherapy , or percutaneous ethanol injection , respectively . approximately 67% of patients received the approved initial daily dose of 800 mg , while 31.5% received a half dose ( 400 mg ) . only a few patients received 200 mg or 600 mg as an initial daily dose ( 0.6% and 0.8% , respectively ) . patients were most frequently treated for 4 - 8 weeks ( 22.0% ) , followed by 4 weeks ( 21.4% ) and > 28 weeks ( 12.7% ) . analysis of sorafenib dosing was based on child - pugh class ( a or b ) ( table 2 ) . the duration of sorafenib administration was generally longer in child - pugh a than b patients . more child - pugh a patients received sorafenib for > 8 weeks compared with child - pugh b patients ( 55.5% vs. 34.3% ) . however , some child - pugh b patients were treated for longer periods , and 3.8% of child - pugh b patients received > 28 weeks of sorafenib therapy . child - pugh score did not appear to influence the starting dose of sorafenib ; approximately 70% of patients in both child - pugh a and b class received the recommended initial daily dose of 800 mg ( 69.0% and 69.5% , respectively ) and the median daily dose was slightly lower in child - pugh a patients than b patients ( 661.5 mg vs. 715.0 mg ) . the frequency of permanent discontinuation of sorafenib due to aes was similar between child - pugh a and b patients ( 29.6% and 32.4% , respectively ) . response to sorafenib was assessed using intent - to - treat analysis ( itt ) of all patients who received at least one dose of sorafenib . a total of 490 patients were valid for the itt set . according to recist criteria , three patients ( 0.61% ) achieved complete response ( cr ) , while partial response ( pr ) and stable disease ( sd ) were observed in 10 ( 2.04% ) and 131 ( 26.73% ) patients . there were 247 ( 50.41% ) patients who showed progressive disease ( table 3 ) . the objective rr ( cr+pr ) was 2.65% and the dcr , defined as proportion of patients with the best response rating of documented cr , pr , or sd maintained for at least 28 days from the first demonstration of that rating , was 79 ( 16.12% ) . of 13 patients who achieved an objective response , the median time to response was 65 days and the median duration of response was 556 days . the median os and ttp were 8.5 months and 2.5 months , respectively ( fig . 1 ) . in particular , the median os and ttp in child - pugh a patients was 10.2 months and 2.5 months . of note , the os and ttp appeared to be longer in patients whose starting dose was 800 mg rather than 400 mg . the os and ttp were 9.3 and 2.8 months in patients with a starting dose of 800 mg , compared to 7.8 and 2.4 months in those with 400 mg , respectively ( table 4 ) . at least one treatment - emergent adverse event ( teae ) was reported for 82.2% of patients ( table 5 ) , and 293 patients ( 60.8% ) experienced drug - related teaes . of these , 16.2% patients had grade 3 events and 0.8% of patients had grade 4 events . overall , 36.9% of patients ( n=178 ) experienced treatment - emergent serious adverse events ( saes ) and 4.4% experienced treatment - emergent drug - related saes . the incidence of teaes was similar between child - pugh a ( 85.4% ) and child - pugh b ( 84.8% ) patients ( table 5 ) . however , the incidence of drug - related teaes and that of grade 3 teaes was higher in child - pugh a than b patients ( treatment - emergent drug - related aes , 66.4% vs. 56.2% ; grade 3 teaes , 28.5% vs. 18.1% ) . treatment - emergent saes occurred more often in child - pugh b than a patients ( 52.4% vs. 34.3% ) . treatment - emergent drug - related saes occurred in 4.4% of child - pugh a and 7.6% of child - pugh b patients . the rates of sorafenib discontinuation due to aes , regardless of any causal relationship with sorafenib , was similar in child - pugh a ( 29.6% ) and b patients ( 32.4% ) . treatment emergent deaths were higher in child - pugh b than a patients ( 28.6% vs. 10.9% ) . the most commonly reported teaes in the overall population included hand - foot skin reaction ( 32.2% ) , diarrhea ( 22.8% ) , and abdominal pain ( 20.1% ) ( table 6 ) . hand - foot skin reaction ( 6.0% ) , bilirubin elevation ( 5.2% ) , and thrombocytopenia ( 4.5% ) were the most commonly reported grade 3 or 4 aes in korea , while the most common grade 4 aes were liver dysfunction ( 1.2% ) and bilirubin elevation ( 0.8% ) . the most frequent treatment - emergent drug - related ae was hand - foot skin reaction ( 31.7% ) , followed by diarrhea ( 18.0% ) , rash / desquamation ( 9.3% ) , and anorexia ( 8.1% ) . the safety profile of child - pugh b patients was generally consistent with the overall safety profile . the baseline demographic and tumor characteristics of 482 patients evaluable in terms of safety analysis are shown in table 1 . male patients predominated ( 85.5% ) , and 76.8% of patients were under 65 years of age ( median age , 55.0 years ) . the most common underlying etiology was hepatitis b virus ( hbv ) infection ( 81.1% ) , followed by alcohol use ( 26.3% ) . most patients were child - pugh a class ( 56.8% ) , with fewer child - pugh b patients ( 21.8% ) . eastern cooperative oncology group ( ecog ) performance status was 1 ( 44.8% ) and 0 ( 33.8% ) in most patients . all bclc stages were represented but most patients ( 60.8% ) were bclc stage c , while 4.8% of patients were bclc stage b , 4.6% stage d , and 0.8% stage a. in terms of tnm staging , stage iii and iv patients accounted for 25.9% and 52.5% of all patients , respectively , and only a few were tnm stage i ( 0.2% ) or ii ( 1.9% ) . prior locoregional treatment ( lrt ) was administered in 68.3% of all patients , with tace being the most common . thus , 60.6% of all patients had undergone prior tace compared with 14.5% , 8.3% , and 2.1% of patients treated with prior radiofrequency ablation , hepatic arterial infusional chemotherapy , or percutaneous ethanol injection , respectively . approximately 67% of patients received the approved initial daily dose of 800 mg , while 31.5% received a half dose ( 400 mg ) . only a few patients received 200 mg or 600 mg as an initial daily dose ( 0.6% and 0.8% , respectively ) . patients were most frequently treated for 4 - 8 weeks ( 22.0% ) , followed by 4 weeks ( 21.4% ) and > 28 weeks ( 12.7% ) . analysis of sorafenib dosing was based on child - pugh class ( a or b ) ( table 2 ) . the duration of sorafenib administration was generally longer in child - pugh a than b patients . more child - pugh a patients received sorafenib for > 8 weeks compared with child - pugh b patients ( 55.5% vs. 34.3% ) . however , some child - pugh b patients were treated for longer periods , and 3.8% of child - pugh b patients received > 28 weeks of sorafenib therapy . child - pugh score did not appear to influence the starting dose of sorafenib ; approximately 70% of patients in both child - pugh a and b class received the recommended initial daily dose of 800 mg ( 69.0% and 69.5% , respectively ) and the median daily dose was slightly lower in child - pugh a patients than b patients ( 661.5 mg vs. 715.0 mg ) . the frequency of permanent discontinuation of sorafenib due to aes was similar between child - pugh a and b patients ( 29.6% and 32.4% , respectively ) . response to sorafenib was assessed using intent - to - treat analysis ( itt ) of all patients who received at least one dose of sorafenib . a total of 490 patients were valid for the itt set . according to recist criteria , three patients ( 0.61% ) achieved complete response ( cr ) , while partial response ( pr ) and stable disease ( sd ) there were 247 ( 50.41% ) patients who showed progressive disease ( table 3 ) . the objective rr ( cr+pr ) was 2.65% and the dcr , defined as proportion of patients with the best response rating of documented cr , pr , or sd maintained for at least 28 days from the first demonstration of that rating , was 79 ( 16.12% ) . of 13 patients who achieved an objective response , the median time to response was 65 days and the median duration of response was 556 days . the median os and ttp were 8.5 months and 2.5 months , respectively ( fig . 1 ) . in particular , the median os and ttp in child - pugh a patients was 10.2 months and 2.5 months . of note , the os and ttp appeared to be longer in patients whose starting dose was 800 mg rather than 400 mg . the os and ttp were 9.3 and 2.8 months in patients with a starting dose of 800 mg , compared to 7.8 and 2.4 months in those with 400 mg , respectively ( table 4 ) . at least one treatment - emergent adverse event ( teae ) was reported for 82.2% of patients ( table 5 ) , and 293 patients ( 60.8% ) experienced drug - related teaes . of these , 16.2% patients had grade 3 events and 0.8% of patients had grade 4 events . overall , 36.9% of patients ( n=178 ) experienced treatment - emergent serious adverse events ( saes ) and 4.4% experienced treatment - emergent drug - related saes . the incidence of teaes was similar between child - pugh a ( 85.4% ) and child - pugh b ( 84.8% ) patients ( table 5 ) . however , the incidence of drug - related teaes and that of grade 3 teaes was higher in child - pugh a than b patients ( treatment - emergent drug - related aes , 66.4% vs. 56.2% ; grade 3 teaes , 28.5% vs. 18.1% ) . treatment - emergent saes occurred more often in child - pugh b than a patients ( 52.4% vs. 34.3% ) . treatment - emergent drug - related saes occurred in 4.4% of child - pugh a and 7.6% of child - pugh b patients . the rates of sorafenib discontinuation due to aes , regardless of any causal relationship with sorafenib , was similar in child - pugh a ( 29.6% ) and b patients ( 32.4% ) . treatment emergent deaths were higher in child - pugh b than a patients ( 28.6% vs. 10.9% ) . the most commonly reported teaes in the overall population included hand - foot skin reaction ( 32.2% ) , diarrhea ( 22.8% ) , and abdominal pain ( 20.1% ) ( table 6 ) . hand - foot skin reaction ( 6.0% ) , bilirubin elevation ( 5.2% ) , and thrombocytopenia ( 4.5% ) were the most commonly reported grade 3 or 4 aes in korea , while the most common grade 4 aes were liver dysfunction ( 1.2% ) and bilirubin elevation ( 0.8% ) . the most frequent treatment - emergent drug - related ae was hand - foot skin reaction ( 31.7% ) , followed by diarrhea ( 18.0% ) , rash / desquamation ( 9.3% ) , and anorexia ( 8.1% ) . the safety profile of child - pugh b patients was generally consistent with the overall safety profile . gideon is the largest , prospective , non - interventional global study to investigate the treatment of patients with unresectable hcc in the real world , and reflects the current practice of participating physicians . looking at the final global data , a total of 3,371 patients were enrolled from 39 countries across five different regions and data on 3,202 patients were available for safety analysis . in terms of etiology , the frequency of hbv infection was similar to that of hepatitis c virus infection globally ( 36.5% vs. 32.9% ) . of all patients , 52% were bclc stage c , while 20% of patients had bclc - b . regarding child - pugh class , sorafenib was prescribed in 20.8% of child - pugh b patients , indicating the real - life pattern of sorafenib use in treatment of hcc . in korean data ( total , 482 patients ) , the most common cause of hcc was hbv infection ( 81.1% ) . the frequency of advanced stage ( bclc - c ) ( 60.8% ) tended to be higher than the global figure , but the proportion of patients with decreased liver function ( child - pugh b ) ( 21.8% ) was similar to the global proportion , although unknown was 20.1% . portal vein thrombosis was more common in korea ( 50.4% ) , and more patients had been previously treated with locoregional therapy ( 68.3% ) , and 66% of patients had extrahepatic spread . overall , korean patients treated with sorafenib had more advanced diseases and more unfavorable prognosis than patients from other countries . the drug safety profile was consistent with both those of previously published phase iii trials and the final gideon data ( table 5 ) ; the most common drug - related aes were hand foot skin reaction ( 31.7% ) and diarrhea ( 18% ) . collectively , the incidence of aes including saes and treatment - emergent aes was similar in child - pugh a and b patients , and in particular , child - pugh b did not appear to increase drug - related aes or the rate of permanent sorafenib discontinuation , compared to child - pugh a ( table 4 ) . a possible explanation for this is the consistent pharmacokinetics ( pk ) of sorafenib in child - pugh a and b patients . the pk data indicate that the maximal concentration and the geometric means of area under curve at steady state were not significantly different between child - pugh a and b patients . this characteristic of pk might make child - pugh score less influential on the safety of sorafenib treatment . although a non - interventional study can not thoroughly evaluate drug efficacy , and data interpretation must be done with caution , we sought to determine the efficacy of sorafenib in korean hcc patients in a real life practice setting . the median os was 8.5 months , and thus seems superior to that observed in the ap phase iii study , even though more bclc - b patients were included in gideon ( 11.2% vs. 4.7% ) . however , we also have to consider that the majority of patients in the ap study were of child - pugh a. if only child - pugh a patients are considered , the median os is 13.6 and 10.2 months in global and korean data , respectively , and these are superior to the ap study and seem comparable even to sharp ( 10.7 months ) . in addition , the median ttp was 2.5 months in korean patients with child - pugh a , also comparable to that of the ap trial ( table 7 ) . consequently , our result has confirmed the benefit of sorafenib in korean patients with hcc , showing longer os compared to the ap sorafenib study . another finding from this study was the comparison of efficacy between different starting dose of sorafenib ( reduced vs. full ) . due to various reasons including concern of ae and old patient s age , starting dose of sorafenib is occasionally reduced to half ( 400 mg ) or to three - fourths ( 600 mg ) . despite several selection biases regarding comparison of efficacy between different starting doses and no analytical statistics were performed , os in patients who received 800 mg appeared to be longer ( median survival , 9.3 months ) than that of patients on 400 mg ( 7.8 months ) . however , further studies are necessary to clarify whether a full dose of sorafenib can result in longer survival or better baseline patient characteristics , leading physicians to start and maintain full dose of sorafenib . overall , the survival benefit in the korean gideon study was less than that observed globally ( median os , 10.8 months globally vs. 8.5 months in korea ) , probably because korean patients presented with more advanced disease represented by high frequency of bclc - c , child - pugh b , and involvement of portal vein as well as predominant etiology of chb . several international guidelines suggest the use of sorafenib in treatment of child - pugh b patients with advanced hcc , although most enrolled patients in randomized trials were child - pugh a ; such patients have no other treatment option because of poor liver function . sorafenib has been used in treatment of child - pugh b patients in korea , and was prescribed for 21.8% of all patients . the initial dose and average daily dose in child - pugh b patients were similar to those administered to child - pugh a patients , and the extent of permanent treatment discontinuation triggered by development of aes was similar in both groups . although treatment duration tended to be shorter in child - pugh b patients , the most common reason for treatment discontinuation except disease progression was patient s own decision including financial reason . ae was the second most common reason ; however , the incidence is not different between child - pugh a and b. in addition , neither the safety profile nor the incidence of aes differed between child - pugh a and b patients . accordingly , child - pugh score did not influence sorafenib dosing strategy and we found no evidence that aes associated with sorafenib were more prevalent in patients with decreased liver function . nevertheless , more prospective evidence is needed in terms of effectiveness and safety of sorafenib treatment in advanced hcc with child - pugh b. the interpretation of finding that the safety profile of sorafenib by the starting dose ( 800 mg vs. 400 mg ) was not significantly different between the two groups in our study also requires caution because baseline patients characteristics might not be similar ( data not shown ) . the gideon study is an observational study and this result is limited in data analysis due to several reasons including no control arm , selection bias , and limited data input from investigators . in particular , the economic issue of sorafenib due to non - reimbursement may affect the results regarding the cause of its discontinuation , but also the duration of therapy within this study . however , a non - interventional study can provide an opportunity to observe real clinical practice enabling the assessment of a wider patient population and this result also clearly showed the treatment pattern as well as the safety and efficacy of sorafenib in korean hcc patients . in conclusion , our study subanalyzed the korean data from the gideon study and is the first , largest and prospective report on real clinical practice of sorafenib for hcc treatment in korea . sorafenib was well tolerated by korean hcc patients in real - life settings , and the drug safety profile did not appear to vary by child - pugh status , which also did not appear to influence the approach to sorafenib dosing , although the treatment duration was shorter in child - pugh b than a patients . the survival benefit of sorafenib in korean hcc patients seems less than global data as korean patients were in more advanced diseases . nevertheless , the observed efficacy of sorafenib in korean hcc patients was consistent with that observed in earlier randomized trials ( sharp or ap ) despite inclusion of more patients with child - pugh b.

purposethe purpose of this study is to report real life experiences of sorafenib therapy for hepatocellular carcinoma ( hcc ) in korea , using a subset of data from gideon ( global investigation of therapeutic decisions in hcc and of its treatment with sorafenib ; a large , prospective , observational study).materials and methodsbetween january 2009 and april 2012 , a total of 497 patients were enrolled from 11 sites in korea . of these , 482 patients were evaluable for safety analyses . case report forms of paper or electronic version were used to record safety and efficacy data from all patients.resultsmore patients of child - pugh a received sorafenib for > 8 weeks than did patients of child - pugh b ( 55.5% vs. 34.3% ) . child - pugh score did not appear to influence the starting dose of sorafenib , and approximately 70% of patients both in child - pugh a and b groups received the recommended initial daily dose of 800 mg ( 69.0% and 69.5% , respectively ) . the median overall survival ( os ) and time to progression ( ttp ) were 8.5 months and 2.5 months . in child - pugh a patients , the median os and ttp were 10.2 months and 2.5 months . the most frequent treatment - emergent drug - related adverse event was hand - foot skin reaction ( 31.7% ) , followed by diarrhea ( 18.0% ) . the incidence of treatment - emergent adverse events was similar in both child - pugh a ( 85.4% ) and child - pugh b ( 84.8% ) patients.conclusionsorafenib was well tolerated by korean hcc patients in clinical settings , and the safety profile did not appear to differ by child - pugh status . survival benefit in korean patients was in line with that of a previous pivotal phase iii trial ( sharp ) .

VOLUSIA COUNTY, Fla. -- Investigators remain unsure how a married couple whose bodies were found near an SUV with their young children inside on New Year’s Eve died. Daniel Kelsey, 32, and Heather Kelsey, 30, of Ormond Beach, Florida were found near the vehicle after a state trooper saw it parked on the side of a road around 2 a.m. Saturday, according to deputies. The car had no obvious signs of damage, and the couple’s three children, all between 8 months and 4 years old, were unharmed inside, Gary Davidson a spokesman for the Volusia County Sheriff’s Office told CBS News. “There was no obvious signs of trauma that would immediately explain the cause of death or what happened,” Davidson said. Investigators have not determined why the couple exited the vehicle, which was found with its hazard lights blinking, but Davidson said no signs of foul play have been detected. He said an autopsy on the deceased couple has yet to be completed. ||||| Updated: Jan 3, 2017 - 6:41 PM DELAND, Fla. - Volusia County authorities are trying to figure out the circumstances surrounding the deaths of a husband and wife who were found outside their SUV on I-4 in DeLand while their three children were unharmed inside the vehicle. Volusia County Sheriff Mike Chitwood said authorities are relying on autopsy results. Heather Kelsey, 30, and her husband, Daniel Kelsey, 32, of Ormond Beach were found dead Saturday when a Florida Highway Patrol trooper spotted hazard lights on the couple’s SUV, authorities said. Daniel and Heather Kelsey “Right now, it's in the hands of the medical examiner. We have everything we have, but to determine the cause of death is what we are waiting for, and we are expecting to get that in the next day or two," Chitwood said. The couple’s three children, ranging in age from 8 months to 4 years old, were found in the SUV. Investigators said there were no obvious signs of foul play. Chitwood said the couple had a history of drug use, but Channel 9 did not find any arrest information in Volusia County. “At first glance, the investigators feel it was an overdose based on what they see,” Chitwood said. Family and friends described them as a loving and happy couple. "It boggles me. I'm blown away by it. I don't want to believe it. We were real close," said friend Leigh Meekins. The sheriff said the children are staying with family. Chitwood said. © 2017 Cox Media Group. ||||| Starting in 1996, Alexa Internet has been donating their crawl data to the Internet Archive. Flowing in every day, these data are added to the Wayback Machine after an embargo period.

– A Florida Highway Patrol trooper spotted a car parked along the interstate with its hazard lights on around 1:30am Saturday and stopped to investigate. He found a couple dead on the side of the road nearby and their three children still strapped into their car seats, the Daytona Beach News-Journal reports. Authorities say the couple had a history of drug abuse, and it appears 32-year-old Daniel Kelsey may have died from an overdose. Questions remain about the cause of death for 30-year-old Heather Kelsey, and authorities are waiting on the results of an autopsy. The couple's three children—ages 2, 1, and an infant—were unharmed. Authorities don't believe the car had been on the side of road for longer than 30 minutes. The children are staying with relatives. There were no signs of foul play or trauma, though it remains unclear why Daniel and Heather Kelsey got out of the car before dying, CBS News reports. They had been married for nearly six years. "It boggles me," a family friend tells WFTV. "I'm blown away by it. I don't want to believe it."

neuropsychiatric disorders are the greatest contributor to global burden of disease in adolescents and young adults worldwide . there has been growing interest in prevention and early intervention in psychiatry in recent years , as it has become increasingly evident that effective management of child and adolescent psychiatric disorders can help prevent the development of persistent mental health concerns in adulthood and that early intervention strategies can positively impact long - term outcome of severe mental disorders , especially in young people . as neurodevelopmental disorders , schizophrenia and other psychoses usually show their first manifestations during childhood and adolescence , and 1118% of patients present with their first episode of psychosis before age 18 ( early - onset psychosis ; eop ) . outcome in eop is negatively affected by the impact of illness onset on individuals whose neurobiological and psychosocial development is not yet complete , leading to 5060% of eop patients with poor outcome . although almost 40% of patients with schizophrenia will achieve social or functional recovery , and some will have a positive outcome even if medication is discontinued , there is still a large group of patients at risk of poor outcome . this group may constitute an even larger proportion in the population with an early - onset form of the illness , which makes identification of the risk factors associated with a poor outcome in this population especially valuable . this would facilitate more intensive and tailored interventions in those patients deemed to be at higher risk of having poor outcome , facilitating a rationalization of resources use and expectations . despite the interest of identifying predictors of outcome in this population , studies are still scarce and have shown contradictory results . one previous systematic review of predictors of outcome in adolescent first episode psychosis in papers published in 19891999 did not find any variable significantly predictive of diagnostic or overall outcome , except for ( i ) presence of abnormal premorbid personality traits , which was suggestive of a diagnostic outcome of schizophrenia , and ( ii ) lower functioning before and after the first episode of psychosis , which was associated both with a diagnostic outcome of schizophrenia and poorer overall outcome . similarly , a more recent non - systematic review reported the following predictors of chronic long - term course in early - onset schizophrenia : younger age at illness onset , insidious onset , positive family history of non - affective psychosis , developmental delays , poor premorbid adjustment , longer duration of the first episode of psychosis , greater symptom severity and poorer psychosocial functioning at discharge , and higher number of relapses through follow - up . given the potential clinical relevance of identifying predictors of outcome in children and adolescents with psychosis , we aimed to perform a comprehensive systematic review of the literature to date on predictors and correlates of clinical , functional , cognitive , and biological outcomes in eop . we hypothesized that there would be a set of main predictors that overlap with those reported for adult - onset psychoses , and that those related to premorbid difficulties and developmental delays would play an especially important role in this population . a systematic two - step literature search was performed following the guidelines of the prisma statement . a pubmed , embase , and psycinfo search ( 1980 through august 2014 ) was performed using the following search terms : ( early - onset , childhood - onset , adolescent - onset , child * , adolescent * ) combined with ( psychosis , psychotic , schizophrenia , first - episode psychosis , first - episode psychotic , bipolar psychotic ) . in a second step , we manually reviewed the reference lists of the selected studies and previous reviews to identify any potentially relevant studies not identified by the computerized search . the initial literature search yielded 3,750 studies and the manual search identified 47 additional studies . after removing duplicates , 2,293 potential studies were identified . the abstracts of the 2,293 resulting studies were assessed for eligibility using the following hierarchical criteria : studies were peer - reviewed original articles published in english.studies had a longitudinal and observational design . as the main objective of this review was to assess predictors and correlates of the course of eop and not specific therapeutic interventions , studies assessing predictive and outcome variables in the context of a clinical trial were not included.participants had a diagnosis of schizophrenia or other psychotic disorders according to the diagnostic and statistical manual of mental disorders ( dsm ) criteria - dsm - iii , dsm - iii - r , dsm - iv , dsm - iv - tr , or to the international classification of diseases ( icd ) criteria - icd-9 or icd-10 . this limitation was applied since , before the dsm - iii , the definition of categories such as childhood - onset schizophrenia included clinical pictures that would currently be classified under the diagnostic category of autism spectrum disorders . onset of psychotic illness in childhood or adolescence ( that is , either the upper limit of the range of age at onset was < 18 years or the onset was defined by the authors as a childhood onset , adolescence onset , and/or early - onset ) . in four studies , the upper limit of the range of the age at onset was > 18 , but mean age at onset or at baseline was < 18 and the authors referred to these as participants with eop . in two studies , the range of the age at onset or at baseline was not provided , but mean age at baseline was < 18 and the authors referred to the sample as adolescent onset . studies assessed clinical , functional , cognitive , and/or biological ( that is , neuroimaging , biochemical ) outcome measures or suicide risk . this broad definition of outcome was used to provide a more comprehensive perspective on the issue and to increase the clinical applicability of the results.studies assessed the association between demographic , clinical , functional , cognitive , and/or biological baseline variables and follow - up outcome measures using bivariate ( for example , student s t - tests , analysis of variance , -tests , correlations ) or multivariate ( for example , linear / logistic regression models or novel multivariate machine - learning methods ) techniques . as the main objective of this review was to assess predictors and correlates of the course of eop and not specific therapeutic interventions , studies assessing predictive and outcome variables in the context of a clinical trial were not included . participants had a diagnosis of schizophrenia or other psychotic disorders according to the diagnostic and statistical manual of mental disorders ( dsm ) criteria - dsm - iii , dsm - iii - r , dsm - iv , dsm - iv - tr , or to the international classification of diseases ( icd ) criteria - icd-9 or icd-10 . this limitation was applied since , before the dsm - iii , the definition of categories such as childhood - onset schizophrenia included clinical pictures that would currently be classified under the diagnostic category of autism spectrum disorders . onset of psychotic illness in childhood or adolescence ( that is , either the upper limit of the range of age at onset was < 18 years or the onset was defined by the authors as a childhood onset , adolescence onset , and/or early - onset ) . in four studies , the upper limit of the range of the age at onset was > 18 , but mean age at onset or at baseline was < 18 and the authors referred to these as participants with eop . in two studies , the range of the age at onset or at baseline was not provided , but mean age at baseline was < 18 and the authors referred to the sample as adolescent onset . studies assessed clinical , functional , cognitive , and/or biological ( that is , neuroimaging , biochemical ) outcome measures or suicide risk . this broad definition of outcome was used to provide a more comprehensive perspective on the issue and to increase the clinical applicability of the results . studies assessed the association between demographic , clinical , functional , cognitive , and/or biological baseline variables and follow - up outcome measures using bivariate ( for example , student s t - tests , analysis of variance , -tests , correlations ) or multivariate ( for example , linear / logistic regression models or novel multivariate machine - learning methods ) techniques . when the abstract did not provide sufficient information to assess study eligibility , the full text was consulted . in instances where the full text was not available , 214 full - text articles were selected and further assessed for eligibility . of those , data were extracted by two reviewers ( cmd - c , ar - q ) and supervised by an external reviewer ( lp - c ) . for each study , the following data were retrieved : author names , year of publication , name or acronym of the cohort , design ( retrospective , prospective , or mixed ) , number of subjects , demographic variables ( age at baseline , proportion of male subjects ) , clinical variables ( age at onset , diagnosis distribution ) , length of follow - up , outcome measures , and predictors / correlates of outcome . papers reporting on the same cohort were included as long as they provided additional information on any of the relevant outcome measures . studies were classified according to the type of outcome measures assessed ( clinical , functional , cognitive , biological , or suicide risk ) , length of follow - up , and study cohort . for reporting purposes , findings are displayed ( i ) separately for studies using multivariate / regression models and those using bivariate analyses and ( ii ) only if associations / predictions reach a significance threshold of p<0.05 . a systematic two - step literature search was performed following the guidelines of the prisma statement . a pubmed , embase , and psycinfo search ( 1980 through august 2014 ) was performed using the following search terms : ( early - onset , childhood - onset , adolescent - onset , child * , adolescent * ) combined with ( psychosis , psychotic , schizophrenia , first - episode psychosis , first - episode psychotic , bipolar psychotic ) . in a second step , we manually reviewed the reference lists of the selected studies and previous reviews to identify any potentially relevant studies not identified by the computerized search . the initial literature search yielded 3,750 studies and the manual search identified 47 additional studies . after removing duplicates , 2,293 potential studies were identified . the abstracts of the 2,293 resulting studies were assessed for eligibility using the following hierarchical criteria : studies were peer - reviewed original articles published in english.studies had a longitudinal and observational design . as the main objective of this review was to assess predictors and correlates of the course of eop and not specific therapeutic interventions , studies assessing predictive and outcome variables in the context of a clinical trial were not included.participants had a diagnosis of schizophrenia or other psychotic disorders according to the diagnostic and statistical manual of mental disorders ( dsm ) criteria - dsm - iii , dsm - iii - r , dsm - iv , dsm - iv - tr , or to the international classification of diseases ( icd ) criteria - icd-9 or icd-10 . this limitation was applied since , before the dsm - iii , the definition of categories such as childhood - onset schizophrenia included clinical pictures that would currently be classified under the diagnostic category of autism spectrum disorders . onset of psychotic illness in childhood or adolescence ( that is , either the upper limit of the range of age at onset was < 18 years or the onset was defined by the authors as a childhood onset , adolescence onset , and/or early - onset ) . in four studies , the upper limit of the range of the age at onset was > 18 , but mean age at onset or at baseline was < 18 and the authors referred to these as participants with eop . in two studies , the range of the age at onset or at baseline was not provided , but mean age at baseline was < 18 and the authors referred to the sample as adolescent onset . studies assessed clinical , functional , cognitive , and/or biological ( that is , neuroimaging , biochemical ) outcome measures or suicide risk . this broad definition of outcome was used to provide a more comprehensive perspective on the issue and to increase the clinical applicability of the results.studies assessed the association between demographic , clinical , functional , cognitive , and/or biological baseline variables and follow - up outcome measures using bivariate ( for example , student s t - tests , analysis of variance , -tests , correlations ) or multivariate ( for example , linear / logistic regression models or novel multivariate machine - learning methods ) techniques . studies had a longitudinal and observational design . as the main objective of this review was to assess predictors and correlates of the course of eop and not specific therapeutic interventions , studies assessing predictive and outcome variables in the context of a clinical trial were not included . participants had a diagnosis of schizophrenia or other psychotic disorders according to the diagnostic and statistical manual of mental disorders ( dsm ) criteria - dsm - iii , dsm - iii - r , dsm - iv , dsm - iv - tr , or to the international classification of diseases ( icd ) criteria - icd-9 or icd-10 . this limitation was applied since , before the dsm - iii , the definition of categories such as childhood - onset schizophrenia included clinical pictures that would currently be classified under the diagnostic category of autism spectrum disorders . onset of psychotic illness in childhood or adolescence ( that is , either the upper limit of the range of age at onset was < 18 years or the onset was defined by the authors as a childhood onset , adolescence onset , and/or early - onset ) . in four studies , the upper limit of the range of the age at onset was > 18 , but mean age at onset or at baseline was < 18 and the authors referred to these as participants with eop . in two studies , the range of the age at onset or at baseline was not provided , but mean age at baseline was < 18 and the authors referred to the sample as adolescent onset . studies assessed clinical , functional , cognitive , and/or biological ( that is , neuroimaging , biochemical ) outcome measures or suicide risk . this broad definition of outcome was used to provide a more comprehensive perspective on the issue and to increase the clinical applicability of the results . studies assessed the association between demographic , clinical , functional , cognitive , and/or biological baseline variables and follow - up outcome measures using bivariate ( for example , student s t - tests , analysis of variance , -tests , correlations ) or multivariate ( for example , linear / logistic regression models or novel multivariate machine - learning methods ) techniques . when the abstract did not provide sufficient information to assess study eligibility , the full text was consulted . in instances where the full text was not available , 214 full - text articles were selected and further assessed for eligibility . of those , data were extracted by two reviewers ( cmd - c , ar - q ) and supervised by an external reviewer ( lp - c ) . for each study , the following data were retrieved : author names , year of publication , name or acronym of the cohort , design ( retrospective , prospective , or mixed ) , number of subjects , demographic variables ( age at baseline , proportion of male subjects ) , clinical variables ( age at onset , diagnosis distribution ) , length of follow - up , outcome measures , and predictors / correlates of outcome . papers reporting on the same cohort were included as long as they provided additional information on any of the relevant outcome measures . studies were classified according to the type of outcome measures assessed ( clinical , functional , cognitive , biological , or suicide risk ) , length of follow - up , and study cohort . for reporting purposes , findings are displayed ( i ) separately for studies using multivariate / regression models and those using bivariate analyses and ( ii ) only if associations / predictions reach a significance threshold of p<0.05 . table 1 provides a summary of the reported significant predictors ( in studies using multivariate / regression models ) or correlates ( in studies using bivariate approaches ) for each outcome category . for further description of the characteristics and main findings of the reviewed articles ( for example , sample size , design , statistical methods , outcomes assessed ) , see supplementary table 1 . using multivariate models , premorbid difficulties ( that is , poorer premorbid adjustment , history of developmental disorder ) and greater symptom severity ( especially negative symptoms ) at baseline were consistently found to be significant predictors of worse outcome across all areas ( clinical , functional , cognitive , and neuroimaging ) . a diagnosis of schizophrenia was a significant predictor of greater disability , lower global functioning , and poorer quality of life at follow - up . longer duration of untreated psychosis ( dup ) was a significant predictor of worse clinical , functional , and cognitive outcomes in multivariate models ( table 1 ) . however , the association between dup and clinical or functional outcomes was not replicated in an eop sample with longer dup using a bivariate approach . although sex has not been found to be a relevant predictor in most studies using regression models , being female has been found to predict better insight and higher number of readmissions ( see table 1 ) . in studies using bivariate approaches , being female has also been found to be associated with better global functioning , less likelihood of a chronic course and receiving clozapine , more likelihood of being in remission at follow - up , and less regional gray matter ( gm ) loss through follow - up ( see table 1 ) . lower age at onset has been found to predict worse quality of psychiatric care and poorer social , educational , and occupational functioning in multivariate models , but is not a consistently reported predictor of these and other outcomes in studies using regression models ( table 1 ) . in bivariate studies , lower age at onset has been found to be associated with less likelihood of remission , worse global functioning , and greater disability , although there are also studies that do not find this association . cognitive variables such as lower intelligence quotient ( iq ) at baseline have been found to predict worse functional outcome , a diagnostic outcome of schizophrenia , or poorer insight at follow - up in multivariate models ( table 1 ) . using multivariate models , biological predictors such as lower antioxidant levels at baseline have been found to predict greater brain volume changes and worse cognitive functioning at follow - up . among neuroimaging markers , cortical thickness and gm volume at baseline in different brain regions have been found to predict remission and insight at follow - up , respectively ( table 1 ) . however , other studies using multivariate techniques have not found significant associations / predictions between biological variables and outcomes such as diagnosis at follow - up in first - episode patients . in this systematic review , we found that the most replicated predictors of worse clinical , functional , cognitive , and/or biological outcomes in eop are a positive history of premorbid difficulties ( developmental delays and poor premorbid adjustment ) , greater symptom severity ( especially of negative symptoms ) at baseline and longer dup . greater initial symptom severity is also a good predictor of attempting suicide during follow - up , together with greater severity of depressive symptoms at baseline or at discharge after the first episode . cognitive variables such as lower iq at baseline predict poorer insight at follow - up , worse functional outcomes , and a diagnostic outcome of schizophrenia . biochemical variables such as lower blood antioxidant levels at baseline predict greater brain volume changes and worse cognitive functioning at follow - up , whereas regional brain thickness and volume measures of different brain regions at baseline predict remission status and insight at follow - up , respectively . age at psychosis onset and sex do not seem to be consistent predictors of any outcome in eop samples . it has been proposed that developmental continuity may exist from premorbid difficulties to primary negative symptoms in eop . the coexistence of severe premorbid impairments and negative symptoms delineate a large subgroup of eop individuals with higher neurodevelopmental load who are eventually at risk of a deleterious course . this would be consistent with our finding that poorer premorbid adjustment and more prominent negative symptoms at illness onset are core predictors of functional and clinical outcomes in eop and would further support the neurodevelopmental nature of psychotic disorders , with early - onset forms at one extreme of the continuum of disease severity and genetic liability . indeed , both negative symptoms and premorbid adjustment have also been found to be good predictors of outcome in adult - onset psychosis , which would support the continuity between eop and adult - onset psychosis . however , as children and adolescents seem to present more frequently with poor premorbid adjustment and greater initial negative symptom severity than adults , patients with eop would be at increased risk of poor outcome and should be subject to close monitoring and to early and intensive interventions when required . the fact that patients with early - onset schizophrenia spectrum disorders usually present with more severe premorbid impairments and initial negative symptoms than other types of eop could underlie our finding that a diagnosis of schizophrenia predicts greater disability , worse global functioning , and poorer quality of life at follow - up . that being said , it should also be considered that numerous studies have failed to find a significant association between psychosis diagnostic subgroup and functional or cognitive outcomes . in addition to potential methodological issues that could underlie these inconsistent findings , it has been proposed that presenting with psychotic symptoms at a young age may be a common phenotypic manifestation of similar deviant neurodevelopmental trajectories in early - onset schizophrenia spectrum disorders and early - onset psychotic bipolar disorder and that differences between the two disorders may be quantitative rather than qualitative in nature . on the basis of shared genetic vulnerability , having additional neurodevelopmental impairments would shift the phenotypic expression toward more severe presentations that would be associated with worse outcome . in keeping with this , poorer outcome would more likely be associated with presence of premorbid impairments or negative symptoms transdiagnostically rather than with a categorical diagnosis of early - onset psychotic bipolar disorder or early - onset schizophrenia spectrum disorders . in fact , when diagnosis , premorbid adjustment and negative symptoms are introduced as independent variables in regression models , premorbid adjustment and baseline negative symptoms are the strongest predictors of functional outcome , accounting together for 55% of the explained variance at 1-year follow - up and for 44% at 2-year follow - up . along those lines , negative symptoms were found to be stronger predictors of functional outcome and of improvement in executive functioning than diagnosis in a prospective cohort of first - episode eop , whereas premorbid adjustment was found to be a stronger predictor of functional outcome than diagnosis in a retrospective cohort of eop . these data would further support the relevance of poorer premorbid adjustment and more prominent negative symptoms as markers of more severe outcome in eop . moreover , the association of a diagnosis of schizophrenia with worse outcome should also be appraised in light of the fact that most eop studies use a follow - up diagnosis to categorize patients into diagnostic subgroups . this strategy can help more accurately define patient diagnosis as it minimizes the impact of diagnostic instability inherent in first episodes of eop . however , if a follow - up diagnosis of schizophrenia is used as a predictor of outcome , there is a risk that those patients showing poorer outcome are also those more likely to receive this diagnosis during follow - up . insidious onset and longer dup are well - replicated predictive factors of worse outcome in eop in keeping with what has been found in adult - onset psychosis samples . indeed , insidious onset is a good predictor of greater illness severity and poorer global functioning at follow - up , whereas longer dup predicts worse clinical , functional , and cognitive outcomes . the association between insidious onset and worse outcome may be confounded by the fact that this presentation is also more common in more developmentally impaired patients who present poorer outcomes as mentioned above . this may also be the case for dup , as longer dup has also been associated with poorer premorbid adjustment . however , premorbid adjustment and dup have both been found to be independent predictors of 2-year improvement in functioning in patients with a dup shorter than 6 months . given that dup is reported to be longer in eop than in adult - onset psychosis cases and that it is a potentially modifiable factor , worldwide mental health policies should give priority to early intervention services for children and adolescents , which have proven to be cost effective in this population . such interventions should be considered for numerous psychiatric disorders starting in childhood and adolescence , since reducing the duration of episodes at these developmental stages can positively impact mental health in adulthood . sex and age at onset have yielded inconsistent associations with outcome in eop , which contrasts with the classical assumption , based on adult - onset studies , that male sex and earlier age at onset are associated with poorer outcomes . the finding of a worse outcome in adult male patients is frequently contaminated by the fact that males usually have an earlier age at onset and insidious onset . in this review , being female was found to be a good predictor of better insight at follow - up and a higher number of readmissions , as well as a significant correlate ( by bivariate analyses ) of less regional gm loss through follow - up . the lack of a consistent association between sex and outcome in eop could be due to the fact that females who develop a psychotic disorder during childhood or adolescence probably have a higher load of genetic , neurodevelopmental , or environmental factors leading to significantly earlier onset of the disease in spite of potential protective factors ( for example , estrogens ) . in these individuals , outcome may already be impoverished by the presence of a more severe form of the disorder from the outset . furthermore , it has also been proposed that prepubertal onset may preclude the protective effect of estrogens on development of the disorder , leading to a more severe course . in this review , lower age at onset was found to predict worse quality of psychiatric care and poorer social , educational , and occupational functioning in some multivariate models . however , it was not consistently reported as a significant predictor of functional and other outcomes in other studies using regression models , nor was it a good correlate in studies using bivariate approaches . a narrow age range in studies exclusively including adolescent - onset cases decreases the capability of detecting a significant effect of age at onset . the effect of age at onset ( at least in studies using bivariate comparison ) seems to be more marked in schizophrenia samples . this may be due to the fact that these are more homogeneous samples in which the contribution of age at onset would be more easily detected than in mixed samples with stronger differences in other relevant predictors ( negative symptoms , premorbid functioning ) , which may obscure the predictive value of age at onset . among cognitive predictors of clinical outcomes , lower iq at baseline was found to predict worse functional outcomes , a diagnostic outcome of schizophrenia , and poorer insight at follow - up in multivariate models , whereas its association with other outcomes such as disability was more inconsistent . interestingly , higher baseline iq was found to be a good predictor of functional outcome only for early - onset psychotic bipolar disorder patients in one cohort . this could be due to a specific effect of iq in this diagnostic subgroup or to the fact that a higher developmental load in early - onset schizophrenia spectrum disorders may obscure the predictive value of this variable . other cognitive variables ( for example , baseline speed of processing ) have been described as good predictors of functional outcomes , but more inconsistently , which highlights the complexity of the interaction between global cognition measures and outcome in eop and the need to specifically assess the relationship between specific neurocognitive domains and specific dimensions of outcome or to develop complex predictive models by combining multiple clinical and neuropsychological variables . furthermore , the finding of a strong association between cognition and functional outcome in this review is consistent with results in first episodes of adult - onset schizophrenia , in which cognitive variables and negative symptoms have been found to be the main predictors of long - term functional outcome , and points to the potential usefulness of cognitive remediation strategies for improving functional outcome in eop . although biomarker discovery efforts in psychiatry have gained priority in recent years , this review found few studies that focused on the predictive value of biological variables for outcomes in eop . lower baseline antioxidant status was found to predict greater loss of gm volume and worse cognitive functioning at follow - up in one cohort . these findings provide some support for the role of oxidative stress in eop warranting further replication . these findings may also point to the potential applicability of antioxidant strategies to the treatment of eop patients , as suggested by the promising results of a developmental animal model of schizophrenia indicating that the use of n - acetylcysteine can prevent the later expression of schizophrenia - like traits in adulthood . among neuroimaging markers , cortical thickness and gm volume at baseline in different brain regions were reported to significantly predict remission and insight at follow - up , respectively , in studies using multivariate models . even if implementation of biological predictors in psychiatric settings is still a way off , assessment of their predictive value is warranted by complex predictive models in combination with other relevant clinical , functional , and cognitive variables on a subject - by - subject basis using novel multivariate machine - learning methods . this could help design personalized medicine models by stratifying patients according to their risk of poor outcome or treatment response . these models would help determine whether more intensive interventions ( for example , earlier initiation of clozapine treatment or more intensive psychosocial support ) would be justified for a defined subset of eop patients , an issue of great clinical and economic importance as this could improve quality of life in patients with eop and reduce the burden of disease and cost to national health systems . first , differing outcome measures , length of follow - up , outcome measures , and designs make it difficult to compare studies . many studies used a retrospective design , with retrospective identification of cases and use of clinical records for assessment of baseline variables . the lack of standardized data - recording methods may have led to inaccuracy or inconsistent reporting of different predictors . furthermore , attrition rates were high in most of the studies , which may have affected the results to some extent , since it is usually difficult to establish whether discontinuation is due to factors such as lack of compliance or more severe course . although many studies used appropriate statistical methods to identify predictors , most of the older studies provided only descriptive data and bivariate comparisons between potentially relevant variables , which precluded assessing the impact of potential covariates in the results . this is illustrated by studies finding significant results in bivariate comparisons that do not survive regression analyses . that being said , given the scarcity of studies on eop and relevant outcomes , studies using traditional bivariate comparisons were ultimately included in this review so as to acquire a broader view of the issue . it should also be considered that our findings from multivariate models may have been influenced by the covariates introduced into the models , which differed among studies and were rarely selected systematically . furthermore , the inclusion of studies using different diagnostic criteria ( see methods ) may have also affected our findings to some extent . however , all patients included in this review were diagnosed or re - diagnosed with at least the dsm - iii - r , whose diagnostic criteria for psychotic disorders are similar to those of current classification systems . second , since findings on neurobiological predictors are mostly based on single studies , further replication would be needed to support their predictive value . third , the exclusion of results based on clinical trials from this review may have prevented us from detecting some significant predictors of treatment response or short - term adherence . for example , data from a 6-month clinical trial found that a better attitude toward antipsychotic medication at a first lifetime psychiatric admission for a first early - onset psychotic episode was significantly related to lower all - cause antipsychotic treatment discontinuation . however , we decided not to include results from clinical trials to ascertain predictors of outcome over the course of eop not related to specific therapeutic interventions . these limitations notwithstanding , this is to the best of our knowledge the first systematic review to provide a comprehensive overview of recent studies on predictors of clinical , functional , cognitive , and neurobiological outcomes in eop . accurate research with potential for replication based on long - term longitudinal studies targeting the search for such predictors is needed . this could help identify subjects with eop at higher risk of poor outcome in whom more intensive and earlier interventions would be warranted . early intervention services in eop should aim at shortening dup and at carefully monitoring patients with poorer adjustment and more severe negative symptoms at first presentation . novel therapeutic approaches targeting negative and cognitive symptoms are needed to improve the outcome of eop .

given the global burden of psychotic disorders , the identification of patients with early - onset psychosis ( eop ; that is , onset before the age of 18 ) at higher risk of adverse outcome should be a priority . a systematic search of pubmed , embase , and psycinfo ( 1980 through august 2014 ) was performed to identify longitudinal observational studies assessing correlates and/or predictors of clinical , functional , cognitive , and biological outcomes in eop . seventy - five studies were included in the review . using multivariate models , the most replicated predictors of worse clinical , functional , cognitive , and biological outcomes in eop were premorbid difficulties and symptom severity ( especially of negative symptoms ) at baseline . longer duration of untreated psychosis ( dup ) predicted worse clinical , functional , and cognitive outcomes . higher risk of attempting suicide was predicted by greater severity of psychotic illness and of depressive symptoms at the first episode of psychosis . age at onset and sex were not found to be relevant predictors of outcome in most multivariate models , whereas studies using bivariate analyses yielded inconsistent results . lower intelligence quotient at baseline predicted lower insight at follow - up , worse functional outcomes , and a diagnostic outcome of schizophrenia . biological predictors of outcome in eop have been little studied and have not been replicated . lower levels of antioxidants at baseline predicted greater brain volume changes and worse cognitive functioning at follow - up , whereas neuroimaging markers such as regional cortical thickness and gray matter volume at baseline predicted remission and better insight at follow - up , respectively . eop patients with poorer premorbid adjustment and prominent negative symptoms at initial presentation are at risk of poor outcome . they should therefore be the target of careful monitoring and more intensive interventions to address whether the disease course can be modified in this especially severely affected group . early intervention strategies to reduce dup may also improve outcome in eop .

the association between diabetes and cancer was described long before the 21st century , as far back as 1885 . dm2 continues to increase in prevalence affecting 17.9 million americans with 5.7 million undiagnosed , costing an estimated 174 billion healthcare dollars . cancer , second only to heart disease in mortality , is also on the rise with estimated costs in the us of $ 263.8 billion . these two high - impact diseases share factors which influence their development and progression , important in modifying each other 's outcome . common nonmodifiable ( age , sex , and race / ethnicity ) and modifiable ( weight , diet , physical activity , tobacco use , and alcohol use ) risk factors underlie the development of cancer and dm2 . it is known that both dm2 and cancer increase with age ; those 55 years comprise almost 80% of newly diagnosed cancers and 23.1% of patients 60 years develop dm2 compared to 10.7% of younger adults [ 4 , 5 ] . men have slightly more cancer and diabetes compared to women after adjusting for other risks [ 46 ] . african - americans as a subgroup appear hardest hit with regards to cancer - related deaths , dm2 , and obesity compared to non - hispanic white counterparts [ 4 , 5 ] . central obesity , a marker of insulin resistance and a key player in both dm2 and the metabolic syndrome , has also been linked to breast , colorectal , liver , and endometrial , malignancies . dietary choices high in glycemic load and saturated fat and low in fiber accompanied by reduced physical activity also increase the risk for dm2 and malignancy , particularly for the colon , endometrium and breast [ 5 , 7 ] . moreover , studies show that tobacco and excess alcohol usage linked to cancer can also worsen diabetes complications . diabetes has been recognized as a key factor contributing to the development of solid organ malignancies including liver , pancreas , colorectal , breast , endometrial , uterine , and bladder [ 3 , 5 , 818 ] . the two cancers showing the strongest association to dm2 are those of the liver [ 1 , 5 , 9 , 1820 ] and pancreas [ 1 , 5 , 1820 ] . not only does there appear to be an association between dm2 and cancer , but having both diagnoses may increase mortality , regardless of the type of cancer [ 9 , 21 ] . studies performed in japan , korea , and hong kong demonstrated increased cancer risk [ 19 , 20 , 22 ] and mortality [ 19 , 22 ] among participants with dm2 , especially those with poorly controlled dm2 based on hba1c and fasting serum glucose levels . a recent meta - analysis of 23 articles indicated a 41% increase in cancer mortality related to endometrial , breast , and colorectal cancer in patients with preexisting diabetes as compared to normoglycemic individuals . in the american cancer society cancer prevention study ii that enrolled over 1 million patients , adults with diabetes and cancer had greater mortality . in contrast , increased mortality was not found in subjects with diabetes in the national health and nutrition examination survey mortality followup . considering the associations between diabetes and various malignancies , can mechanisms related to diabetes development predispose to oncogenic expression ? there appears to be a critical interplay between hyperglycemia , hyperinsulinemia , and adiposity , particularly central adiposity , creating a low - grade chronic inflammatory state . these elements are proposed to connect cancer development and progression to dm2 which may also influence the response to anticancer therapy . since insulin , glycemia , adiposity , and inflammation can be modified by antidiabetes pharmacotherapy , a better understanding of their pathophysiologic links to cancer may allow us to more effectively target dm2 treatment . insulin , because of its known mitogenic effects , has been implicated as a key mediator in the complex mechanisms involved in carcinogenesis . both insulin and insulin - like growth factor-1 ( igf-1 ) have affinity to both the insulin receptor ( ir ) and igf-1 receptor ( igf-1r ) because of similar structural homology . but it is important to recognize that insulin 's affinity for the ir is upwards of 1000-fold greater than for igf-1r . both igf-1 and igf-1r tend to have stronger mitogenic and antiapoptotic effects , and the hyperinsulinemia that occurs in insulin - resistant individuals may enhance this effect [ 1 , 5 , 18 , 24 ] . insulin decreases igf - binding protein-1 , and possibly igf - binding protein 2 , which may increase the bioactive form of the growth factor , igf-1 [ 18 , 24 ] in addition , malignant cells predominantly express the a isoform of the ir ( ir - a ) or hybrid ir - a / igf-1r forms , which have more mitogenic effects than the b isoform ir [ 5 , 18 , 25 ] . thus , in the hyperinsulinemic individual , insulin 's mitogenic properties may further oncogenic proliferation . furthermore , hyperinsulinemia may ultimately upregulate the insulin mitogenic pathway compared to the insulin metabolic pathway . insulin resistant states such as obesity , metabolic syndrome , and dm2 cause impairment of downstream glut4 translocation by disruption of insulin receptor substrate-1 ( irs-1 ) associated pi3k signaling in the metabolic pathway of insulin . insulin , to a lesser extent than igf-1 , stimulates cellular growth and protein synthesis through the protein kinase b ( pkb ) system and activation of mtor . abnormal irs-1 phosphorylation from overactivation of mtor creates a negative feedback loop that attenuates the metabolic pathway in hyperinsulinemia [ 18 , 27 ] . irs-2 expression by insulin phosphorylation leads to increased erk activation , a mitogen - activated protein kinase pathway ( mapk ) , because the mitogen pathways mediated by mtor and ras remain intact [ 18 , 26 , 27 ] . this drive towards the mitogen pathway with hyperinsulinemia leads to enhanced cell growth and survival . figure 1(b ) illustrates the potential molecular pathways , mediated by insulin , which lead to cancer . moreover , hyperglycemia may not only promote tumorigenesis indirectly by stimulating insulin production , but also may have a direct effect , since cancer cells depend on glycolysis for energy [ 6 , 17 ] . central adiposity highly correlates with insulin resistance and is a key player in metabolic derangements associated with diabetes . adipose tissue - derived cytokines , free fatty acids , and other vascular factors released from the visceral compartment have been shown to induce insulin resistance , lipid abnormalities , glucose intolerance , and low grade inflammation that collectively creates an environment ripe for cancer development and progression . in contrast , adiponectin is of particular interest for cancer prevention because of its unique metabolic properties which include the ability to decrease hepatic gluconeogenesis , to increase insulin sensitivity , and to reduce adipogenic inflammation [ 2831 ] . working in opposition to adiponectin these factors may increase cancer risk by perpetuating insulin resistance , hyperglycemia and inflammation [ 25 , 2834 ] . the 30% mortality reduction related primarily to cancer and cardiovascular events following massive weight loss after bariatric surgery in morbidly obese subjects enrolled in the swedish obesity study cohort further supports the contribution of adipocytokines in carcinogenesis . however , the precise mechanisms related to lower cancer risk following surgical weight loss remains unclear . breast cancer is one of the more widely studied malignancies with respect to its connection to diabetes . some studies showed an increased risk of breast malignancy in individuals with diabetes [ 811 , 1416 , 18 ] , whereas others did not [ 3639 ] . although most studies were retrospective case - control or cohort studies [ 810 , 1418 , 3638 ] , one of two large - scale prospective studies of more than 97,000 japanese women showed no increase in breast cancer risk , whereas another with more than 116,000 women enrolled in the nurses ' health study , showed a mild , but significantly increased , cancer risk with a hazard ratio of 1.17 ( 95% ci of 1.011.35 ) in those with diabetes . additionally , many studies demonstrate greater cancer risk in postmenopausal women with dm2 than their younger , premenopausal counterparts [ 10 , 14 , 21 ] . elevations in plasma estrogen levels have been associated with postmenopausal breast cancer risk in the nondiabetes population [ 1 , 34 ] . in insulin - resistant postmenopausal women , elevated serum insulin levels reduce sex - hormone - binding globulin ( shbg ) , resulting in increased estrogen bioavailability possibly explaining this increased risk [ 1 , 5 , 34 , 40 ] . the elevation of free estrogens is also seen in postmenopausal dm2 even after adjusting for the degree of obesity [ 5 , 34 ] . furthermore , insulin has been shown to be mitogenic in human mammary epithelial cells , but was less mitogenic compared to igf-1 . in obesity , igf-1 is an important link to breast cancer . hyperinsulinemia could stimulate igf-1r and hybrid receptors although the clinical significance of this in breast cancer development is still unclear . it is important to remember that igf-1 is much more mitogenic than insulin , and an insulin concentration 100 times that of igf-1 was needed to elicit equivalent breast cancer cell growth . in vitro animal models showed igf-1 to be a significant risk factor in mammary tumor onset and development . a significant risk for colorectal cancer in dm2 patients as compared to those without diabetes has been reported in a number of retrospective and prospective studies examining this relationship . some studies show an increased risk only in men , whereas others document a risk in both genders [ 18 , 4247 ] . as with breast cancer , for example , in vitro systems point to enhanced colonic tumor cell growth with elevations of both insulin and igf-1 levels [ 4851 ] . decreased igf binding proteins may also play a role in colorectal cancer development as suggested by one but not other studies [ 50 , 52 , 53 ] . because the liver and pancreas are two main target organs for insulin metabolism , it is not surprising that dm2 and hepatocellular carcinoma share a link . the incidence of hepatocellular carcinoma has been reported to be higher in those with dm2 in both sexes , with a greater risk in men and in those with concomitant hepatitis c infection [ 18 , 5461 ] . some studies show that dm2 increases hepatocellular cancer only in the presence of hepatitis or cirrhosis [ 56 , 57 , 59 , 60 ] , whereas others observe that the association exists in the absence of those characteristics [ 18 , 54 , 58 , 61 ] . other cancers linked to diabetes and its metabolic features include endometrial , pancreatic , kidney , and possibly gastric malignancies [ 5 , 42 , 54 , 62 ] . older studies published in the early 1990s have indicated that individuals with diabetes 5 years appear to have an increased risk of pancreatic cancer [ 63 , 64 ] . more recent studies show that pancreatic cancer risk occurs within the first decade of the diagnosis of dm2 , and some argue that the highest risk is within 2 - 3 years of dm2 onset [ 65 , 66 ] . controversy regarding pancreatic cancer has evolved from the chicken or egg issue : does pancreatic cancer cause diabetes or does this malignancy result from diabetes ? some investigators would argue that diabetes is a result of pre - existing pancreatic cancer causing destruction of - cells via tumor infiltration . the tumor burden would have to be extensive for a physical loss of islet cells to cause dm2 . newer hypotheses suggests that dm2 results more from peripheral insulin resistance and disruption of amylin secretion in -cells [ 67 , 68 ] from a paraneoplastic effect of the tumor cells , rather than a physical destruction of -cells . one epidemiologic case - control study by chari et al . suggest that pancreatic cancer may cause dm2 through alteration of glucose metabolism in the liver and skeletal muscle , thereby inducing glucose intolerance . moreover , elevated glucose levels are associated with increased pancreatic cancer mortality . regardless of the exact nature of the association , it is clear that a relationship exists between dm2 and pancreatic cancer . interestingly , the presence of helicobacter pylori may increase gastric cancer risk [ 6971 ] in diabetes , possibly mediated through an insulin resistance / hyperinsulinemia pathway . increase in gastrin levels , decrease in somatostatin levels , and increase in neutrophilic and monocytic infiltration of the gastric mucosa in patients with h. pylori infection may lead to insulin resistance . however , the prevalence findings of h. pylori in dm2 patients has been variable , and we do not yet clearly understand the clinical implications in this population . there are also studies arguing against an association between diabetes and cancer , specifically for ovarian , lung , and prostate malignancies [ 5 , 42 , 73 , 74 ] . in prostate cancer , dm2 appears to have a protective effect , and like pancreatic cancer , there is a temporal relationship , with the protective effect occurring later in dm2 [ 62 , 74 ] . circulating insulin levels thus , it has been proposed that the lower testosterone levels that occur in dm2 may be a mechanism of decreased prostate cancer risk . however , elevated circulating testosterone levels are not a consistent finding associated with prostate cancer [ 5 , 9 , 62 ] . another suggested mechanism that may explain the time - associated inverse relationship is the change in insulin levels as dm2 progresses . insulin downregulates igf binding protein 1 , and as insulin levels decrease over time through reduction in -cell mass with dm2 disease progression , there is less downregulation of igf - binding protein 1 . since igf binding protein 1 controls the amount of igf-1 free levels , less circulating insulin may indirectly mitigate prostate cancer risk [ 9 , 62 , 74 , 75 ] . the studies examining the relationship between dm2 and hematopoietic malignancies appear to show a positive relationship between diabetes and hematopoietic cancers [ 6 , 37 ] , but this finding is not consistent in all studies [ 42 , 76 ] . major limitations of these studies include self - reported data regarding the diagnosis of diabetes , which makes it difficult to clearly ascertain the exact links between diabetes and hematopoietic cancers . oxidative stress and cellular damage related to hyperglycemia may be involved in the association between the two [ 22 , 77 , 78 ] . one prospective cohort study found a positive association between postload plasma glucose levels in non - diabetes patients and non - hodgkin 's lymphoma in men and a 3-fold increased mortality risk from multiple myeloma in women at the highest level of post - load plasma glucose levels . insulin is a known mitogen that stimulates the mapk pathway leading to increases in growth factors . in addition , insulin down - regulates igf binding proteins which may contribute to sex - steroid dependent cancers in diabetes , particularly postmenopausal breast and endometrial malignancies . in vitro studies have shown that high insulin levels can affect angiogenesis and potentially propagate tumor progression by stimulating the mitogen pathway via both insulin and igf receptors [ 92 , 93 ] . a number of studies have examined the effect of exogenous insulin usage with cancer . an initial concern was raised by the provocative report of a retrospective german study suggesting an increased cancer risk with glargine use . since then , most large - scale studies have focused on glargine although other insulin analogues have been studied as well . the results from retrospective studies are conflicting , with some studies showing an increased risk of malignancy [ 22 , 82 , 8587 , 94 ] , whereas others [ 82 , 83 , 88 , 88 , 89 , 89 , 90 , 90 , 91 , 91 ] did not . in vitro studies may help explain the basis of the concern regarding insulin analogues , particularly glargine . weinstein et al . studied the comparative mitogenic effect at supraphysiologic doses of regular insulin and insulin analogues glargine , detemir , lispro , and aspart to igf-1 in cancer - derived cell lines from colon ( hct116 ) , prostate ( pc3 ) , and breast ( mcf-7 ) . the insulin analogues glargine , detemir and lispro stimulated proliferation with a dose - dependent effect of all three cell lines but less than igf-1 . regular and aspart insulin had the lowest mitogenic effect compared to the other insulin analogues and igf-1 . furthermore , studies [ 9597 ] indicate that glargine induced mcf-7 breast cancer cell proliferation to a significant level compared to the mcf-10 cells , but the stimulation was less compared to igf-1 . this discrepancy in responses between the two breast cancer cell lines is attributed to the differences in relative cellular igf-1r and ir expression . however , one study by liefvendahl et al . found that glargine had little to no increased mitogenic effect in malignant cell lines for breast cancer ( mcf-7 and skbr-3 ) or osteosarcoma ( saos-2 ) compared to human insulin , the caveat in this controversy may relate to a dose - time exposure to insulin treatment , particularly with glargine ; that is , cumulative insulin intake over time may potentially increase the cancer risk and mortality . because of all the controversy , the fda has concluded that glargine is safe , but it is awaiting longer - term prospective studies regarding malignancy potential . agents which treat or prevent dm2 might be expected to influence risk of cancer favorably . current oral agents that treated dm2 fall into two broad general categories : insulin providing ( secretagogues , metiglinides , and incretin analogs ) and insulin - sensitizing ( metformin and thiazolidinediones ) . the insulin sensitizers , metformin , and thiazolidinediones ( tzds ) are promising cancer therapies , because they not only lower glucose , insulin and fatty acid levels , but also may have unique anticarcinogenic properties that will be discussed below . metformin is generally used as a first - line agent for dm2 treatment ; it decreases hepatic glucose output and increases glucose disposal in muscle , thereby reducing levels of circulating serum glucose and insulin levels . epidemiological studies in diabetic patients have shown that metformin may be neutral or protective of cancer risk [ 64 , 80 , 81 , 90 , 100 , 101 ] . table 1(a ) displays data from several population studies examining oral anti - diabetes agents and cancer risk . a meta - analysis of diabetes studies with 4,042 cancer events and 529 cancer deaths demonstrated a 31% reduction in relative risk with metformin versus other antidiabetic drugs . in vitro cell culture studies as well as animal studies mice mammary tumor growth was reduced by metformin , indicating a potential chemotherapeutic role in human breast cancer therapy . the mechanisms for the anti - tumor effects of metformin include an inhibition of cell proliferation , decrease cancer proliferation , with partial cell - cycle arrest in oncogenic cell lines with the activation of 5 adenosine monophosphate - activated protein ( amp ) and amp - kinase ( ampk ) . , ampk could be used to suppress cancer cells containing loss - of - function lkb1 mutations , active b - raf mutations , or in cancers associated with metabolic syndrome . the activation of ampk reprograms cellular metabolism by acting on mtorc1 , p53 , fatty acid synthase , and other molecules involved with regulating cell growth and metabolism . thiazolidinediones , or tzds as they are more commonly known ( i.e. , rosiglitazone and pioglitazone ) , bind to peroxisome proliferator - activated receptor ( ppar ) gamma ( ) receptor molecules inside the cell nucleus which , when activated , result in transcription of a variety of genes . ppar is an adipocyte transcription factor , stimulating differentiation of adipocytes as well as inhibiting inflammatory cytokine production . ppar activation results in reduced free fatty acids and eicosanoids and inhibition of vegf - induced angiogenesis , amongst other actions . like metformin , tzds inhibit cancer cell growth , potentiation , and proliferation , inducing apoptosis , at the in vitro level [ 5 , 34 ] . epidemiologic studies have shown inconclusive results with a recent meta - analysis showing no effect on malignancy risk . overall , studies examining tzds are limited because of the short - term exposure and limited cases of cancer at specific sites . a phase 1 trial using thiazolidinediones in combination with chemotherapy for refractory cancers was negative , but large - scale controlled studies are warranted [ 5 , 112 ] . secretagogues stimulate insulin production by binding to specific cell receptors that result in depolarization of pancreatic beta cells . sulfonylurea ( sfu ) use , like insulin , has been implicated in cancer risk . however , the limitations of these studies relate to the lack of power given the small numbers of cancer events . in addition , most studies have not addressed differences between the various sfu agents with one small study suggesting variable effects . the effect of oral diabetic agents on incidence of malignancy was extracted from two randomized controlled trials , adopt ( a diabetes outcome progression trial ) and record ( rosiglitazone evaluated for cardiovascular outcomes and regulation of glycaemia in diabetes ) . despite a total study exposure of 39,000 person / years over a 4- to 6-year duration , neither trial demonstrated an advantage of metformin over rosiglitzone or sfus on cancer rates . the hazard ratio for metformin versus rosiglitazone was close to 1.0 in both studies however , the data regarding sfus is less clear with a nonstatistically significant reduction of 22% ( 95% ci 0.531.14 ) in adopt for metformin versus sfus and 25% ( 95% ci 0.851.18 ) in record for rosiglitazone versus sfus . acarbose , an -glucosidase inhibitor , curbs postprandial blood glucose excursions by inhibiting the enzymatic degradation of carbohydrates in the small intestines brush border . although cancer risk information regarding -glucosidase inhibitors is limited , one study suggests that acarbose may augment butyrate , a colonocyte energy source with anticolon cancer effects . this particular study showed promising results of acarbose use to enhance fecal butyrate concentrations , which may favorably affect colonic neoplasia . dipeptidyl peptidase - iv ( dpp - iv ) inhibitors , as well as glucagon - like peptide-1 ( glp-1 ) agonists , are relatively new medications in the arsenal of treatment of dm2 . sitagliptin , one of two available dpp - iv inhibitors in the us , initially made its debut in 2006 followed by the release of saxagliptin in 2009 . the noninsulin injectable glp-1 agonists , exenatide and liraglutide , were first introduced in the us in 2005 , with a once - weekly option on the horizon . these therapies are effective in preserving - cell mass by inhibiting apoptosis as well as improving islet cell function [ 114 , 115 ] . glp-1 is an incretin hormone that stimulates up to 70% of glucose - dependent insulin secretion after an oral stimulus , and in non - dm2 patients , there is a quick first - phase insulin surge followed by a longer second - phase response . dm2 patients have approximately 80% decreased - cell function as a result of increased cell death from the oxidative stress of persistent hyperglycemia . glp-1 receptor agonists and the dpp - iv inhibitors , which inhibit the enzymatic breakdown of endogenous glp-1 , can restore - cell sensitivity to glucose , increase - cell mass , and improve overall islet cell function [ 114 , 115 ] . their relatively short - term use clinically does not permit meaningful data on malignancy potential or risks . thus , only in vitro and animal studies may be used to address a potential risk . dpp - iv has a complex role in relationship to cancer and may influence all stages of cancer from apoptosis , migration , invasion , and metastasis to even chemotherapy sensitivity . increased ductal cell turnover and ductal metaplasia may predispose to pancreatic cancer risk although one short - term study involving human pancreatic cancer cell lines did not result in cell proliferation with activation of glp-1r signaling . this lack of cell proliferation even after activation of functional glp-1r may be a result of glp-1r expression in the transduction pathway activation in pancreatic cancer cells . of the two glp-1 agonists , liraglutide was associated with thyroid c - cell hyperplasia / tumor growth in rodents mediated by glp-1 receptor agonist stimulating calcitonin gene expression [ 5 , 118 ] . however , humans have shown low glp-1 receptor expression in thyroid c - cells , which may be an indication of species - specific differences in glp-1 receptor expression . with the current diabetes pandemic running in parallel to the one for obesity , there is a growing need to identify pathophysiologic links underlying cancer risk and mortality in this high risk population . the diabetes / metabolic syndrome certainly appears to increase the risk of certain malignancies , including breast , endometrial , colorectal , hepatocellular , and possibly others . since dm2 may be preventable and certainly treatable with lifestyle modification and pharmacotherapy , cancer risk may also be lowered by these strategies . certain anti - diabetes therapies ( e.g. , biguanides ) may become the adjuvant chemotherapy of the future . however , large - scale controlled trials are warranted . the role of exogenous insulin administration for cancer risk in diabetes remains controversial ; further clinical trials are needed .

type 2 diabetes mellitus ( dm2 ) is increasing in incidence , creating worldwide public health concerns and impacting morbidity and mortality rates . an increasing number of studies have demonstrated shared associations between dm2 and malignancy , including key clinical , biochemical , and metabolic commonalities . this paper will attempt to explore the relationship between the various types of cancer and diabetes , the common metabolic pathways underlying cancer development , and the potential impact of various antidiabetes therapies on cancer risk .

cerebrospinal fluid ( csf ) shunts are a definite treatment for hydrocephalus . as increasing numbers of women have csf shunts placed to treat hydrocephalus , more shunt - dependent women are becoming pregnant ( 1 , 2 ) . although the maternal and fetal outcome in patients with ventriculoperitoneal ( vp ) shunts is uniformly excellent , the changes in the abdominal cavity , such as the enlargement of the uterus and increased abdominal pressure , could cause shunt failure ( 1 , 3 - 5 ) . the distal shunt catheter is frequently obstructed in pregnancy , especially during the third trimester when the intra - abdominal pressure is thought to be highest ( 3 , 4 ) . postpartum shunt complications are rare ( 1 , 4 , 6 , 7 ) , and shunt obstruction immediately after a cesarean section had not been reported . we present a patient with a vp shunt who had reduced consciousness due to obstruction of the abdominal shunt catheter immediately after a cesarean section delivery . a 32-yr - old woman , g2p2a0l2 , came to the emergency department complaining that she felt drowsy . she had undergone a cesarean section delivery of a full - term healthy baby ( 3,200 gm ) the day before . at the age of 26 yr she underwent a shunt revision when she was 29 yr old . at that time , she was in the sixth month of her first pregnancy and complained of drowsiness and headache . her husband said that the reason for the shunt malfunction had not been determined and the malfunctioning vp shunt had been replaced with a new device . , she underwent a lower segment cesarean section because of fetal distress and gave birth to her first child , who weighed 3,580 g. the postpartum course was unremarkable after the birth of her first child . at 31 yr of age a repeated cesarean section was performed at the same private obstetrics clinic and a healthy baby was delivered . the peritoneal cavity was not irrigated and the shunt tube was not observed at surgery . she began to complain of a headache 12 hr after the cesarean section . , she did not open her eyes spontaneously and her verbal response was very slow and inappropriate . ventriculomegaly with a bifrontal index of 41% was seen on brain computed tomography ( ct , fig . 1 ) . when the flushing device was pumped , it was hard to pump . malfunction of the catheter distal to the flushing device was strongly suspected . after preparing the skin with alcohol and povidone / iodine solution , a skin incision was made at the previous operative scar in the abdomen . the catheter was patent externally , but no csf was observed dripping from the catheter hole . no csf flow was observed on pumping the flushing device . when 10 cm was cut from the end of the catheter , csf dripped steadily from the catheter . her consciousness recovered fully immediately after the operation and her ventricle size returned to normal ( fig . with the development of shunt devices and the increasing success in treating hydrocephalus , more women with csf shunts are surviving to child - bearing age . abdominal complications are common with vp shunts ( 8 , 9 ) and these may increase with the abdominal changes during pregnancy . as a result , a broad range of interdisciplinary health care professionals in neurosurgery and obstetrics will require information about the management of these patients , especially during pregnancy and delivery ( 1 ) . interdisciplinary management of pregnant woman with csf shunts should be performed during the preconception , antepartum , and postpartum periods . the early preconception management includes an evaluation of medication , especially anticonvulsants , which may be associated with increased risks to fetal development , and image studies to measure the baseline size of the ventricles . during pregnancy in patients with shunts , the patients should be watched for symptoms and signs of increased intracranial pressure ( icp ) . signs of increased icp were reported in 58% of pregnancies with shunts ( 5 ) . the most common symptoms are headache , nausea , vomiting , drowsiness , gaze paresis , ataxia , and seizures . however , the symptoms of increased icp are not always associated with shunt malfunction ( 5 , 10 - 12 ) . women with well functioning shunts frequently have symptoms of increased icp during pregnancy because of an increase in brain water and venous distension ( 10 ) . therefore , brain images before conception are important for determining whether the shunt is functioning during pregnancy in patients with shunts . if the csf shunt is functioning inappropriately during pregnancy , the imaging studies show greater enlargement of the ventricles compared to the preconception study . magnetic resonance imaging seems to be a safe , effective tool for monitoring ventricular dilatation and diagnosing shunt failure ( 5 , 7 ) . in addition , the pregnancy of a woman with a csf shunt differs from that of a normal pregnancy , primarily during the third trimester . the flow of csf in pregnant women decreases either because the shunt is being compressed between the gravid uterus and other internal organs or because the intraabdominal pressure has increased secondary to the large size of the uterus ( 2 ) . as a ventriculo - atrial ( va ) or ventriculopleural ( vpl ) shunt may be influenced less by the increased abdominal pressure , some studies have advocated that a va shunt be considered on revision of a vp shunt or during the initial surgery for hydrocephalus in pregnant woman ( 2 , 3 , 5 , 13 , 14 ) . va or vpl shunts might be preferable to avoid uterine trauma on the placement of a distal catheter . moreover , shunt revisions in the case of va shunts have also been reported ( 1 ) . endoscopic third ventriculostomy is one treatment modality for pregnant patients with newly diagnosed obstructive hydrocephalus and malfunction of a preexisting shunt ( 15 ) . although a chance of shunt malfunction related to pregnancy has always existed , few cases require shunt revision . ( 1 ) reported that the rates of shunt malfunction and revision before delivery were 13.7% and 5.0% , respectively , in 138 shunt - dependent pregnancies . in their review of the literature , okagaki et al . ( 13 ) found that only 2 ( 12.5% ) of 16 pregnancies with csf shunts required revision . many patients with shunt malfunctions can be managed with bed rest and manual pumping of the flushing device of the shunt . in addition , one should remember that the symptoms of increased icp may mimic those of preeclampsia and an appropriate workup should be obtained ( 5 ) . the outcomes of pregnancy in terms of live births are overwhelmingly favorable ( 1 , 3 , 16 ) . the mode of delivery should be managed carefully in pregnancies with csf shunts , and a vaginal delivery is preferred to a cesarean section ( 1 , 2 , 4 , 5 ) . vaginal deliveries should be attempted in pregnancies with vp shunts unless cesarean sections are inevitably required for obstetrical or neurosurgical reasons ( 17 ) . a shortened second stage is preferred to obviate straining and consequent elevation of the icp . general anesthesia is preferred for the surgical delivery of such patients , while epidural anesthesia is not recommended because an inadvertent dural puncture might result in contamination of the csf ( 3 , 5 ) . a cesarean section may cause adhesion formation around the shunt tip in vp shunts and may increase the possibility of shunt infections , as bacteremia occurs more often after cesarean sections ( 5 ) . meticulous hemostasis and profuse irrigation of the peritoneal cavity should be performed to minimize the risk of future obstruction due to fibrin deposition on the end of the shunt ( 3 ) . fourteen women ( 10.1% ) in 138 shunt - dependent pregnancies had postpartum revisions , of which eight were vaginal deliveries and six were cesarean sections ( 1 ) . however , no acute shunt failures occurred during the course of delivery in these reports . in our case , the shunt failure developed immediately after cesarean delivery . we believe that the shunt failure resulted from blood sludge spilling into the peritoneal cavity during the cesarean section . since peritoneal blood spilled during cesarean section may cause shunt obstruction , the obstetric surgeon should clean the peritoneal cavity when a vp shunt exists . acute obstruction of the distal catheter must be managed as an emergency because it can lead to a significant increase in the intracranial pressure . pregnant women with csf shunts should be managed in a routine fashion and an awareness of csf shunt failures manifested by the signs of increased intracranial pressure is necessary to create an index of suspicion for the obstetrician . in addition , a neurosurgeon should be consulted during the antepartum , intrapartum , and postpartum periods . we summarize the recommendations for management of shunt malfunction in shunt - dependent pregnancy ( table 1 ) .

shunt malfunctions that require surgical intervention during pregnancy and the postpartum period are rare . furthermore , no study has reported on an acute shunt malfunction immediately after cesarean section . here , we describe the case of a 32-yr - old woman who became drowsy 12 hr after cesarean section delivery of her second child . she had a ventriculoperitoneal shunt placed to treat hydrocephalus associated with meningitis at 26 yr of age . marked ventriculomegaly was seen on brain computed tomography and her consciousness recovered temporarily after aspirating cerebrospinal fluid from the flushing device . at surgery , the distal catheter tip was plugged by a blood clot . we believe that the blood spilled over during the cesarean section . the clogged catheter end was simply cut off and the remaining catheter was repositioned in the peritoneal cavity . her consciousness recovered fully .

SECTION 1. SHORT TITLE. This Act may be cited as the ``Training the Next Generation of Primary Care Doctors Act of 2017''. SEC. 2. FINDINGS. The Congress finds as follows: (1) The program of payments to teaching health centers for graduate medical education under section 340H of the Public Health Service Act (42 U.S.C. 256h) was enacted in 2010 to address the crisis-level shortage of primary care physicians, especially in rural and medically underserved communities. (2) Teaching health center residents and faculty will provide more than one million primary care medical visits in 2017 to underserved communities. (3) When compared with traditional Medicare GME residents, residents who train at teaching health centers are more likely to practice primary care and remain in underserved or rural communities. (4) The teaching health center program not only plays a vital role in training the Nation's next generation of primary care physicians (including dentists), but helps bridge the Nation's physician shortfall. (5) For these reasons, it is of vital importance to continue the program under section 340H of the Public Health Service Act (42 U.S.C. 256h) at a sustainable level of funding per full-time equivalent resident, as recommended in the fact sheet of the Health Resources and Services Administration entitled ``Cost Estimates for Training Residents in a Teaching Health Center''. SEC. 3. REAUTHORIZATION OF PROGRAM OF PAYMENTS TO TEACHING HEALTH CENTERS THAT OPERATE GRADUATE MEDICAL EDUCATION PROGRAMS. (a) Payments.--Subsection (a) of section 340H of the Public Health Service Act (42 U.S.C. 256h) is amended to read as follows: ``(a) Payments.-- ``(1) In general.--Subject to subsection (h)(2), the Secretary shall make payments under this section for direct expenses and indirect expenses to qualified teaching health centers that are listed as sponsoring institutions by the relevant accrediting body for-- ``(A) maintenance of existing approved graduate medical residency training programs; ``(B) expansion of existing approved graduate medical residency training programs; and ``(C) establishment of new approved graduate medical residency training programs. ``(2) New programs.-- ``(A) Payments.--The Secretary shall make payments under paragraph (1)(C)-- ``(i) for fiscal year 2019, for a total of up to 60 full-time equivalent residents at new approved graduate medical residency programs; and ``(ii) for fiscal year 2020, for a total of up to 120 full-time equivalent residents at new approved graduate medical residency programs. ``(B) Priority.--Subject to subparagraph (C), in making payments pursuant to paragraph (1)(C), the Secretary shall give priority to qualified teaching health centers that-- ``(i) serve a health professional shortage area with a designation in effect under section 332 or a medically underserved community (as defined in section 799B); or ``(ii) are located in a rural area (as defined in section 1886(d)(2)(D) of the Social Security Act). ``(C) Limitations.--The number of full-time equivalent residents for which a qualified teaching health center receives payments pursuant to paragraph (1)(C) for a fiscal year shall not exceed by more than 6 the number of full-time equivalent residents for which the center received such payments for the preceding fiscal year. The total number of full-time equivalent residents at all qualified teaching health centers for which payments are made by the Secretary under subparagraphs (A) and (B) of subsection (a)(1) shall not exceed the total number of full-time equivalent residents at all qualified teaching health centers for which payments were made by the Secretary as of January 1, 2017, pursuant to this section.''. (b) Funding.--Subsection (g) of the first section 340H of the Public Health Service Act (42 U.S.C. 256h) is amended to read as follows: ``(g) Funding.-- ``(1) Existing programs.--Out of any money in the Treasury not otherwise appropriated, there are appropriated for payments under subparagraphs (A) and (B) of subsection (a)(1) $116,500,000 for each of fiscal years 2018, 2019, and 2020, to remain available until expended. ``(2) Incentive for new programs.--Out of any money in the Treasury not otherwise appropriated, there are appropriated for payments under subsection (a)(1)(C), $10,000,000 for fiscal year 2019 and $19,000,000 for fiscal year 2020, to remain available until expended. ``(3) Administrative expenses.--Of the amount made available to carry out this section for any fiscal year, the Secretary may not use more than 5 percent of such amount for the expenses of administering this section.''. (c) Annual Reporting.--Paragraph (1) of subsection (h) of the first section 340H of the Public Health Service Act (42 U.S.C. 256h) is amended-- (1) by redesignating subparagraph (D) as subparagraph (H); and (2) by inserting after subparagraph (C) the following: ``(D) The number of patients treated by residents described in paragraph (4). ``(E) The number of visits by patients treated by residents described in paragraph (4). ``(F) Of the number of residents described in paragraph (4) who completed their residency training at the end of such residency academic year, the number and percentage of such residents entering primary care practice (meaning any of the areas of practice listed in the definition of a primary care residency program in section 749A). ``(G) Of the number of residents described in paragraph (4) who completed their residency training at the end of such residency academic year, the number and percentage of such residents who entered practice at a health care facility-- ``(i) primarily serving a health professional shortage area with a designation in effect under section 332 or a medically underserved community (as defined in section 799B); or ``(ii) located in a rural area (as defined in section 1886(d)(2)(D) of the Social Security Act).''. (d) Report on Training Costs.--Not later than March 31, 2020, the Secretary of Health and Human Services shall submit to the Congress a report on the direct graduate expenses of approved graduate medical residency training programs, and the indirect expenses associated with the additional costs of teaching residents, of qualified teaching health centers (as such terms are used or defined in section 340H of the Public Health Service Act (42 U.S.C. 256h)). (e) Definition.--Subsection (j) of the first section 340H of the Public Health Service Act (42 U.S.C. 256h) is amended-- (1) by redesignating paragraphs (2) and (3) as paragraphs (3) and (4), respectively; and (2) by inserting after paragraph (1) the following: ``(2) New approved graduate medical residency training program.--The term `new approved graduate medical residency training program' means an approved graduate medical residency training program for which the sponsoring qualified teaching health center has not received a payment under this section for a previous fiscal year (other than pursuant to subsection (a)(1)(C)).''. (f) Technical Corrections.--Part D of title III of the Public Health Service Act (42 U.S.C. 254b et seq.) is amended-- (1) in subsection (f) of the first section 340H (42 U.S.C. 256h), by striking ``hospital'' each place it appears and inserting ``teaching health center''; (2) by redesignating the second subpart XI (relating to a community-based collaborative care network program) as subpart XII; and (3) by redesignating the second section 340H (42 U.S.C. 256i) as section 340I. (g) Payments for Previous Fiscal Years.--The provisions of the first section 340H of the Public Health Service Act (42 U.S.C. 256h), as in effect on the day before the date of enactment of this Act, shall continue to apply with respect to payments under such section for fiscal years before fiscal year 2018.

Training the Next Generation of Primary Care Doctors Act of 2017 This bill amends the Public Health Service Act to extend and expand funding through FY2020 for graduate medical education programs at teaching centers (which train medical residents in primary care specialties). The bill allows funds to be used for maintaining, expanding, and establishing graduate medical residency programs.

To our knowledge, this is the first study that more systematically and thoroughly investigated the effects of the experimental induction of crying on subsequent mood across several time points. The most important finding was that the participants who cried reported an increase in NA immediately after their crying as well as subsequent decreases in NA at follow up (i.e., 20 and 90 min post film) in comparison to the measurement immediately after the film and also when compared to the pre-film baseline measurement (only in the case of 90 min post film). In contrast, non-criers did not experience any mood changes after the film presentation. Thus, the present results seem to reconcile the findings of previous quasi-experimental studies of crying (i.e., that crying predominantly results in an increase in NA immediately after the films) and of retrospective studies (i.e., that crying can facilitate mood improvement). This is the first study that has demonstrated a clear relation between experimentally induced crying and subsequent, more long-term mood improvement. Regarding the hypothesized dose–response relationship, frequency of crying did not have any predictive power when only the crying participants were taken into account. Irrespective of how often the participants cried, the immediate decreases as well as subsequent increases in their mood were rather similar. Perhaps it is in particular the strong mood improvement experienced by those participants who cried that fuels the popular notion that crying brings relief. It is obvious that decreases in NA from T2 to T4 and from T3 to T4 in participants who cried are mainly the consequences of previous (i.e., T1–T2) NA increases, that is, the return to baseline levels. This finding may explain why people report mood improvement after crying: those who cried indeed experience greater mood changes, be it after an initial deterioration. Such strong mood recovery, as well as the observed return of NA even to below baseline levels thus seems to support the hypothesis about the cathartic effects of crying. These findings are in accordance with both of our hypotheses about the negative effects of crying over the short run and about mood increases that follow crying over the longer run. On a more general level, these findings can be compared to the short-term negative and long-term positive effects of the expression of emotion on mood and well-being (Pennebaker 1997; Smyth 1998). However, the question remains whether these long-term mood-enhancing effects of crying and of other types of emotion expression are mediated by the same cognitive, physiological, or behavioral mechanisms. One could argue that the observed general decline in NA reported by criers at the final measurement is the consequence of increased tension and nervousness of the study participants at the beginning of the experiment, due to the fact that they are in a new and uncertain situation, rather than being the result of crying. However, if this mood improvement is considered as a kind of return to the (pre-experiment) baseline level, it remains unclear why non-criers did not end up with improved mood at the final relative to the first measurement. Also note that both groups did not differ in NA at T1. If the observed decline in NA below the baseline level reflects the real effects of crying, which physiological mechanisms could account for such finding? The most likely candidates are increases in parasympathetic activation and increases in levels of oxytocin, which may accompany specific cognitive and behavioral mechanisms (see Gračanin et al. 2014). For example, there is mounting evidence that crying is accompanied with and possibly followed by increases in parasympathetic activation (e.g., Hendriks et al. 2007; Rottenberg et al. 2003), which is also related to states of relaxation and absence of intensive negative emotion (Porges 2003). In addition, increases in oxytocin are thought to accompany crying, resulting not only from comforting behaviors that are elicited by crying, but also from behavioural and cognitive mechanisms that are not necessarily based on the reception of social support (Vingerhoets 2013; Gračanin et al. 2014). Since there is some evidence that low oxytocin is related to sadness (Turner et al. 1999), one could speculate that increases in the level of this hormone following crying could lead to associated decreases in NA. On the other hand, a much simpler explanation is that the decreased mood stimulates the participants to apply all kinds of cognitive and behavioral mood management strategies, which would result in the desired mood improvement, without any necessary influence of the here suggested, direct physiological and cognitive mechanisms, induced by the act of crying. However, after partializing out the effect of change in NA from T1 to T2, the observed decrease in NA remained significant. Thus, the amount of initial NA increase, that could have motivated participants to engage in mood enhancing behaviors, was not related to general mood improvement. The stability of this effect after excluding the effects of initial mood deterioration also contrasts the possibility that criers ended up with increased mood because they were generally more emotionally reactive, since the initial increase in NA did not seem to affect the mood improvement at the delayed measurement as compared to the measurement before crying. Two aspects of this study were innovative. First, mood was assessed at three fixed times after having been exposed to an emotional film. Although the time of the initial crying episodes varied across participants, this variation was relatively small, and, more importantly, the time of the last crying episode was fixed. Second, objectively established crying was operationalized both in terms of mere appearance as well as in terms of frequency. The relatively high number of participants and the optimal ratio of criers to non-criers represent strong features of the study as well. On the other hand, we have to keep in mind that the present study, being similar to previous laboratory studies, also necessarily had a quasi-experimental design, meaning that participants were assigned to the two groups on the basis of their responses to the films. It thus cannot be excluded that individuals who did and did not cry, differed in certain personality traits (Stougie et al. 2004) or other, more temporarily characteristics related to changes in crying and/or mood after the exposure to emotional stimuli (cf. Vingerhoets 2013). For example, previous research has shown that more neurotic individuals cry more often (De Fruyt 1997) and more easily (Peter et al. 2001), while, for example, introverted and depressive individuals report more often the absence of mood benefits following crying (De Fruyt 1997; Rottenberg et al. 2008b). Kraemer and Hastrup (1988) tried to solve this issue of confounding individual differences by instructing participants to cry or to suppress their tears, but, as noted above, the adequacy of that solution is arguable because such a manipulation makes the situation rather artificial. Bylsma et al. (2011) applied a diary methodology in order to separate inter-individual from intra-individual differences in mood that follows crying. They showed that crying is related to increased negative mood even the day after the crying episode. Although this method has a high ecological validity, it still does not exclude the non-systematic effects of different conditions that inflict both crying and negative mood during the periods of several days. It is possible that both crying and mood dynamics observed in our as well as the latter study are influenced by some temperamental characteristics, such as emotional reactivity (Larsen and Diener 1987), despite the above presented preliminary findings which seem to challenge such an explanation. Relatedly, distinct mood dynamics of criers and non-criers in our study could be interpreted in the context of previous research showing a positive relation between emotion suppression and vulnerability to mood disturbances (Ehring et al. 2010). A final critical and still unanswered question is whether the observed decreased NA really reflects a different mood state, induced by the crying, or that it reflects a kind of response shift, a phenomenon, which is well-known in the literature on quality of life in cancer patients. Repeatedly it has been found that cancer patients report a better quality of life than before their disease, when comparing their absolute scores on quality-of-life measures. However, when being asked to compare directly their current quality of life with before their disease (as is also done in retrospective studies on mood changes after crying), they indicate unanimously that their current state is worse than before their disease (Schwartz and Sprangers 1999). This response shift might be the result of changes in internal standards, conceptualization of the concepts, and/or one’s values. This methodological issue certainly needs adequate consideration in future studies, for example by including a measure asking participants to compare directly their current mood state to the pre-film measurement. For future studies, we also suggest to pay an additional attention to factors that influence the memory of emotional events and mood, to stable individual differences related to affect intensity and variability, as well as to mood regulation processes. In conclusion, the present findings suggest a simple, obvious, and parsimonious explanation for the paradoxical findings of different studies investigating the effects of crying on mood. After the initial deterioration of mood following crying that is usually observed in laboratory studies, it takes some time for the mood, not just to recover, but also to increase above the levels that it had before the emotional event, a pattern of findings which corresponds to the results of retrospective studies. ||||| Yes, a good cry indeed might go a long way to make you feel better, says Asmir Gračanin of the University of Tilburg in the Netherlands, lead author of a study in Springer's journal Motivation and Emotion. These findings were established after a research team videotaped a group of participants while watching the emotionally charged films La vita è bella and Hachi: A Dog's Tale. Afterwards, the participants were asked a few times to reflect on how they felt. Although humans are the only species able to shed emotional tears, little is known about the function of crying. While some researchers see it as a cry for support, comfort or help, others believe the main role of crying is to relieve emotions. Different types of studies focusing on the latter, however, provide conflicting results. Retrospective self-report studies support claims that crying provides emotional relief and ultimately influences someone's mood for the better. In contrast, laboratory studies using emotional films often show a consistent decrease in mood immediately after an emotional event. In an effort to understand these discrepant results, Gračanin's team extended methodology used in previous laboratory studies. They examined both the immediate and the delayed effect of crying on mood within a controlled laboratory setting. The two films shown to 60 participants are known to be tearjerkers. Immediately afterwards, the 28 participants who cried and the 32 who didn't shed a tear were asked how they felt. They also had to rate their moods 20 and 90 minutes later. As expected, the mood of the non-criers was unchanged and unaffected immediately after seeing the films. The mood of the criers, on the other hand, was distinctively low and even took a dip. Within 20 minutes, however, their mood had returned to the level reported before the screening. Finally, after 90 minutes, the criers reported even a better mood than was the case before the films started. Such a mood shift was not tied to the number of times that a person cried during the films. According to Gračanin, it's this dip and subsequent return of emotions to previous levels that might make criers feel as if they are in a much better mood after they have shed some tears. However, it seems that criers even experience a general mood increase, but only after a longer period of time. "After the initial deterioration of mood following crying, it takes some time for the mood not only to recover but also to be lifted above the levels at which it had been before the emotional event," he explains. This pattern is often found in retrospective studies where people are asked to rate their mood levels after having experienced a good cry. ### Reference: Gračanin, A. et al (2015). Why crying does and sometimes does not seem to alleviate mood: A quasiexperimental study, Motivation and Emotion. DOI 10.1007/s11031-015-9507-9 ||||| Since we’re the only species to cry tears of emotion, you’d think that we would have all the answers as to why we cry, right? Wrong. We don’t really know why we cry. Some people attribute it to an emotional response to life events; others say it was a way of communicating before the emergence of language. While there are some reasons for crying, like releasing toxins, killing bacteria, and relieving stress, one thing most people can agree on is that after a “good” cry, we feel better. Now, there is some research to backs up this train of thought. Researchers from the University of Tilburg in the Netherlands brought together a group of people to watch a couple of movies generally considered to be tearjerkers. The participants watched these emotionally charged films (La vita è bella (Life is Beautiful) and Hachi: A Dog's Tale) and were asked how they felt before, immediately afterward, and then 20 and 90 minutes afterward. Out of those 60 participants, 28 of them cried during the films, while the other 32 didn’t shed a tear. Those 32 said they felt the same way at the beginning of the film as well as immediately afterward, and also noted that their moods remained unchanged 20 and 90 minutes later. On the other hand, the people who cried during the films reported feeling lousy immediately after the credits rolled. Twenty minutes later, however, the criers reported that their moods had returned to the levels they reported before the films began. But then, after 90 minutes, the criers reported they were in even better moods than before the movie. It's easy to suggest that there was a yo-yo effect in which the criers simply felt sad while watching the movie, and then returned to their original mood afterward — that they only believed they felt better before. However, it seems that over a longer period of time, these criers did indeed feel an uptick in happiness. So why did the criers feel better after crying? Though the researchers couldn't explain, the criers might have felt better for a number of reasons. Previous studies have found crying reduces stress by releasing toxins through our tears. These tears are called emotional tears, and they are one of the three types of tears our body produces. It's possible these criers also felt better because crying has also been shown to cause the release of endorphins, our body's natural pain killer, thus making them feel better. So, although they had just watched two sad movies, the criers may have been releasing the toxins of a stressful day, and when combined with endorphins, it resulted in a much better mood. Source: Graanin A, Vingerhoets A, Kardum I, et al. Why crying does and sometimes does not seem to alleviate mood: a quasi-experimental study. Motivation and Emotion. 2015. ||||| It is said that laughter is the best medicine, but when it comes to feeling blue, crying might be the best cure. Researchers in the Netherlands videoed a group of 60 volunteers watching two emotional films, La vita e bella and Hachi: a dogs tale. After viewing the tearjerkers , participants were asked to reflect on how they felt. 28 had cried during the films but 32 didn’t shed a tear. As expected, the mood of the non-criers was unchanged after seeing the films but despite feeling down initially after the movie, those that had wept suddenly experienced an upsurge of happiness around 90 minutes later. “After the initial deterioration of mood following crying , it takes some time for the mood not only to recover but also to be lifted above the levels at which it had been before the emotional event,” said lead author Dr Asmir Gracanin of the University of Tilburg. Although humans are the only species able to shed emotional tears, little is known about the function of crying. While some researchers see it as a plea for support, comfort or help, others believe the main role of crying is to relieve emotions or even get rid of toxins in the body. Previous studies have given conflicting results. When people are questioned about crying most will say it provides emotional relief and boosts mood. In contrast, laboratory studies using emotional films often show a consistent decrease in mood immediately after an emotional event. Dr Gracanin’s team examined both the immediate and the delayed effect of crying on mood within a controlled laboratory setting. According to Dr Gracanin, it’s this dip and subsequent return of emotions to previous levels that might make criers feel as if they are in a much better mood after they have shed some tears. However, it seems that criers even experience a general mood increase, but only after a longer period of time. Photo: Alamy “The present findings suggest a simple explanation for the paradoxical findings of different studies investigating the effects of crying on mood,” added Dr Gracanin. “After the initial deterioration of mood following crying that is usually observed in laboratory studies, it takes some time for the mood, not just to recover, but also to increase above the levels that it had before the emotional event, a pattern of findings which corresponds to the results of retrospective studies. “Perhaps it is in particular the strong mood improvement experienced by those participants who cried that fuels the popular notion that crying brings relief,” added Dr Gračanin The research was published in the journal Motivation and Emotion.

– Feeling gloomy? Shed a few tears, then wait 90 minutes, and you'll probably be in a better mood. That's the word from researchers involved in a new study out of the Netherlands that suggests crying actually boosts a person's mood, but not immediately. Scientists asked 60 participants how they felt before watching two tearjerker films, Hachi: A Dog's Tale and Life Is Beautiful (La Vita è Bella), then asked the same question immediately after the credits rolled, as well as 20 and 90 minutes later. The moods of the 32 participants who didn't cry during the films remained constant. But an interesting thing happened among the 28 who did shed tears: Their mood took a dip after the film, returned to the level reported before the screening after 20 minutes, then climbed higher after 90 minutes, according to a press release. The act of emotional crying is actually somewhat of a mystery. Some scientists say it's a call for support, comfort, or help, while others say it relieves emotions. Studies focusing on the latter theory have turned up conflicting results that crying can better a person's mood or decrease it. This latest study may offer an explanation. "After the initial deterioration of mood following crying that is usually observed in laboratory studies, it takes some time for the mood, not just to recover, but also to increase above the levels that it had before the emotional event, a pattern of findings which corresponds to the results of retrospective studies," the lead author says, per the Telegraph. Criers may feel better because crying releases toxins, which may reduce stress, and endorphins, a natural pain killer, reports Medical Daily. (Some people feel the urge to cry in this strange locale.)

type ia supernovae ( sne ia ) have found use in cosmology after it has been established that the maximum luminosity can be calibrated via an empirical relation between it and the shape of the light curve ( lc , phillips 1993 ; riess , press & kirshner 1996 ) . the origin of this empirical relation is however not fully understood ( e.g. , mazzali et al . 2001 ) , mainly because of uncertainties regarding the properties of the explosion mechanism . a one - parameter ordering scheme similar to the one found for the lc was also proposed for the spectra ( nugent et al . 1995 ) . in this scheme temperature is the driving parameter characterizing the spectra . while this relation may apply near maximum , detailed observations of sne ia with extended early time spectral coverage indicate that sne ia with similar lcs may have different absorption line velocities . in particular , the absorptions of si ii @xmath1 6355 , s ii @xmath1 5640 , ca ii h & k and ca ii ir triplet have been investigated by several authors ( e.g. , patat et al . 1996 ; hatano et al . 2000 ; kotak et al . 2005 ; benetti et al . 2005 ) . simultaneously , the number of polarization observations has increased ( sn 1996x , wang et al . 1997 ; sn 1999by , howell et al . 2001 ; sn 2001el , wang et al . 2003 ; sn 2004dt , wang et al . 2004 ) and it has become possible to infer asphericity by means of spectropolarimetry . these results suggest that some sne ia have a somewhat aspherical geometry of the photosphere ( @xmath2% for sn 2001el or @xmath3% for sn 1999by , assuming a ellipsoidal geometry ) . even larger degree of asphericity is inferred for the distribution of intermediate mass elements ( at the level of @xmath4 % ; see wang et al . multi - dimensional numerical simulations have also suggested that the explosion is aspherical , mainly owing to the nature of the deflagration flame in 3d numerical simulations ( reinecke , hillebrandt & niemeyer 2002 ; gamezo et al . 2003 ; rpke & hillebrandt 2005 ) . recently , high velocity features ( hvfs ) in the ca ii ir triplet have been the subject of interest : sn 1994d ( hatano et al . 1999 ) , sn 1999ee ( mazzali et al . 2005a ) , sn 2000cx ( thomas et al . 2004 ) , sn 2001el ( wang et al . 2003 ) , sn 2003du ( gerardy et al . 2004 ) , sn2005cg ( quimby et al . 2006 ) . here , hvfs are defined as absorptions with velocities much higher than the photospheric component , which has a typical velocity @xmath5 15,000 km s@xmath6 at @xmath7 week before maximum . hvfs are often seen detached from the photospheric component , at velocities of 17,00029,000 km s@xmath6 . the above papers discuss the possible origin of hvfs including primordial metallicity ( lentz et al . 2000 ) , a property of the explosion and interaction of the sn ejecta with circumstellar matter ( csm ) . whatever their origin , understanding hvfs can cast light on the explosion mechanism . mazzali et al . ( 2005a ) tried to fit the hvfs of sn 1999ee using abundance or density enhancements . their results suggest that it is impossible to reproduce hvfs by abundance enhancement only and @xmath8 of additional material is required if only the density enhancement is assumed . gerardy et al . ( 2004 ) and quimby et al . ( 2006 ) discussed how hvfs may result from interaction with a csm . they obtained good agreement for several features including mg ii , and found @xmath9 and @xmath10 of the csm are needed for sn 2003du and sn 2005cg , respectively . it should be noted that the explosion model ( i.e. , abundance distribution and the density structure ) and the way to introduce additional material are not identical with each other . recently , mazzali et al . ( 2005b ) have shown that almost all sne ia have ca ii ir triplet hvfs at the earliest epochs . these hvfs have velocities ranging from 17,000 km s@xmath6 to 29,000 km s@xmath6 in different supernovae . the ubiquity of hvfs may indicate that they do not come from an extreme environment . probably , the combination of different phenomena results in the observed hvfs . the geometry of the ejecta has been studied in multi - dimensional space . kasen et al . ( 2003 ) analyzed both spectroscopy and spectropolarimetry of sn 2001el and showed that both an aspherical photosphere and a single high velocity blob can reproduce the observations . thomas et al . ( 2004 ) derived a similar geometry for the ca ii hvfs of sn 2000cx . although all previous studies performed modeling for each sn , no systematic study has been made of the 3d properties of the geometry . we present here synthetic spectra computed in 3d space for various geometries and show how hvfs are affected by different geometrical configurations and line - of - sight effects . the increasing number of early spectra available enables us to investigate the statistical properties of hvfs , and to constrain the geometry of the ejecta and possibly the nature of the explosion . in [ sec : hvf1d ] we discuss how hvfs are formed and suggest a possible parametrized description . in [ sec : method ] we present the method of calculation for the spectra and our models . in [ sec : results ] the results and some properties of 3d computations are presented . in [ sec : dis ] the probable geometries that can reproduce the observed trend are discussed . finally , conclusions including considerations on the origin of the high velocity material and on the asphericity of the explosion are made in [ sec : con ] . hvfs come in different forms . figure [ fig : hvf ] shows the caii ir triplet in the earliest spectra of sn 1999ee ( @xmath11 days before b maximum ) , sn 2002dj ( @xmath12 days ) , sn 2003cg ( @xmath13 days ) , and sn 2003du ( @xmath12 days ) . at that epoch , the photospheric velocity is @xmath14 km s@xmath6 . the photospheric component of the caii ir triplet has @xmath15 km s@xmath6 in all sne ia , as suggested by the data of mazzali et al . ( 2005b ) . this is slightly higher than the photospheric velocity , since the caii ir triplet is stronger than siii or sii , and forms above the photosphere . however , the velocities of the absorption minima in sn 1999ee ( @xmath16 km s@xmath6 ) , sn 2002dj ( @xmath17 km s@xmath6 ) and sn 2003du ( @xmath16 km s@xmath6 ) are much higher , suggesting that these lines form well above the photosphere . therefore the hvfs are expected to have a different origin that the photospheric absorption . comparing sn 2002dj and sn 2003du , which were observed at the same epoch , it can be noticed that their hvfs have different strength and velocity range . the same is true for sn 1999ee and sn 2003du , although their spectra were not taken at exactly the same epoch . at very early epochs , even a small difference in epoch can strongly affect the strength of the photospheric component . however , judging from a number of early spectra we can safely conclude that there are real variations in the strength of the hvfs . therefore we examine a parameterization of the properties of the hvfs based on their velocity range ( @xmath18 ) , their strength ( @xmath19 ) and on the strength of the photospheric component ( @xmath20 ) . we performed numerical tests to verify what governs the properties of the hvfs . the monte carlo sn spectrum synthesis code described in mazzali & lucy ( 1993 ) , lucy ( 1999 ) and mazzali ( 2000 ) was used . the code computes a synthetic spectrum based on the luminosity , the position of the photosphere , the time since the explosion , the density structure and the abundance distribution . the density structure of the standard deflagration model w7 ( nomoto , thieleman & yokoi 1984 ) was used in all the calculations presented in this section . photospheric velocity ( @xmath21 km s@xmath6 ) , epoch ( 8 days since the explosion assuming a risetime of 19 days ) and luminosity ( @xmath22erg s@xmath6 ) were fixed for simplicity . first we consider the case where @xmath20 and @xmath18 are fixed and parameterize @xmath19 through the line optical depth of the caii ir triplet . we assume that the high velocity region lies at @xmath23 km s@xmath6 . in this region , the line optical depth is imposed irrespective of the value computed consistently with the w7 structure in order to simplify the investigation of the behavior of hvfs . for example , if line optical depth is taken as @xmath24 , about half the photons that come into resonance with the caii ir triplet are scattered . figure [ fig : shv1d ] shows hvfs with various line optical depths @xmath25 . with this approximation the depth of the hvfs depends almost linearly on @xmath26 . the origin of the observed diversity in strength is investigated in 3-dimensional space in [ sec : method ] and [ sec : results ] . next we show how the strength of the photospheric component affects the absorption feature . here @xmath20 is parameterized through the abundance of ca . in the calculation , a homogeneous abundance distribution is used , which is a reasonable assumption because the region used in the computation is only @xmath27 km s@xmath6 . figure [ fig : sph1d ] shows the caii ir triplet with various strengths of the photospheric component . the mass fraction of ca is @xmath28 , and 0.04 , respectively . the photospheric absorption depth does not change linear with the abundance , and the line becomes saturated if the abundance is more than @xmath7% . since in this calculation the line optical depth at high velocity is fixed as @xmath29 and the velocity separation is large , the hvfs are not affected by the photospheric component . using only the abundance of ca to change the strength of the photospheric component is not completely realistic because the line strength also depends strongly on temperature and ionization state . ca is mostly caiii at the typical temperature of sne ia before maximum ( @xmath30k ) and only a small fraction is caii and caiv . the strength of the caii ir triplet is proportional to temperature because of the behavior of the ionization . we tested models with different luminosities , which yield different temperature structures . we found that even with the highest ca abundance @xmath31 , when the luminosity is increased by a factor of @xmath32 , the strength of the caii ir triplet becomes weaker than in the original model with the lowest ca abundance , @xmath33 . an inverse correlation between the strength of the photospheric component and the luminosity at these early epochs might therefore be expected . to verify this , more observations are needed and it is necessary to fit these individually to determine the exact photospheric velocity and temperature . this is beyond the scope of this work , and will be the subject of a separate investigation . ( m. tanaka et al . , in preparation ) . the results of the tests we performed by changing @xmath19 and @xmath20 ( figures [ fig : shv1d ] and [ fig : sph1d ] ) show clearly that changing these two parameters is not enough to reproduce all the observed hvfs . as seen between sn 2002dj and sn 2003du in figure [ fig : hvf ] ( and see figure 4 in quimby et al . 2006 ) , the width of the high velocity absorption is not identical among sne that have a similar depth of the hvfs . no combination of @xmath19 and @xmath20 , however , can account for such a difference . therefore we conclude that the additional parameter @xmath18 is also needed . one might think that this is because of our assumption of spherical symmetry . however , we obtain the same results in 3d geometry ( [ sec : results ] ) . figure [ fig : hvffit ] shows how the three parameters ( @xmath34 and @xmath20 ) work . their combination determines the depth and shape of the absorption and the position of the absorption minimum . although the luminosity and the photospheric velocity are not fine - tuned , the shape of the absorption feature is reproduced well . the numerical tests presented here may be somewhat unrealistic because we assumed a detached spherical shell that is optically thick to the the caii line and it is probably more realistic to consider 3d structures . the explosion may be aspherical and has fragmentations ( yielding a clumpy structure ) , or interaction between the sn ejecta and a circumstellar disk may occur ( yielding a torus - like structure ) . in the next section , we use 3d models to see what the three parameters used in this section ( i.e. , @xmath34 , and @xmath20 ) physically mean . to investigate 3d effects on the hvfs , synthetic spectra are calculated assuming various geometries ( [ sec : model ] ) . we have developed a 3-dimensional monte carlo radiative transfer code based on the 1d monte carlo code described in mazzali & lucy ( 1993 ) , lucy ( 1999 ) , and mazzali ( 2000 ) . the code assumes the sobolev approximation and a sharply defined photosphere above which there is no energy deposition . spherical coordinates are used in the code in order to treat the photosphere precisely . the number of meshes depends on the model and is typically @xmath35 for @xmath36 and @xmath37 , respectively . the path of the energy packets is traced in 3d space , and the effect of back scattering into the photosphere is included . line treatment is free from the approximation of resonance scattering , i.e. , photon branching is considered correctly as outlined by lucy ( 1999 ) . the free parameters are the luminosity @xmath38 , the photospheric velocity @xmath39 and the epoch since the explosion @xmath40 , all of which are defined as in the 1d code . though angle dependent @xmath41 and @xmath42 can be used in the code , here we assume them to be uniform for simplicity . we again assume @xmath43 km s@xmath6 , @xmath44 days since the explosion and @xmath22erg s@xmath6as typical values for the earliest spectra of sne ia . with these parameters , the temperature structure , excitation and ionization are computed in all zones using a modified nebular approximation ( mazzali & lucy 1993 ) . this assumes that there is no net exchange of energy between matter and radiation . photon flux is collected by recording energy packets at the outer boundaries of the ejecta and is binned into a @xmath45 solid angle mesh . since the path of each packet is affected by the density and temperature structure , the emergent spectrum depends on the orientation . our models are based on the spherical deflagration model w7 ( nomoto et al . 1984 ) . we introduced additional material in the outer layers of the ejecta to produce hvfs . we are not concerned here with the origin of this material , which may come from fluctuations of the explosion or from interaction with csm or an accretion disk . abundance enhancements are not considered because they have been shown not to be suitable for reproducing hvfs ( mazzali et al . 2005a ) . the velocity range and the degree of density enhancement are determined by fitting one of the strongest caii hvf , that of sn 2002dj , with the 1d code . as a result , @xmath46 of material at @xmath47 km s@xmath6 is added in a shell . we fixed this degree of density enhancement in our 3d computations . we used a density enhancement rather than an artificial line strength , which was used in the previous section , because we want to explore the cause of hvfs . in fact , a spherical density enhancement has the same effect on the caii ir triplet profile as the artificial line strength . however , other lines , such as siii @xmath16355 , are also affected when using a density enhancement . if the observed behavior of both the caii ir triplet and siii @xmath16355 is reproduced consistently with a density enhancement , we may conclude that hvfs are due to density enhancements . additionally , the mass invoked in hvfs should be reduced in 3d space . in mazzali et al . ( 2005a ) , a large amount of material ( @xmath48 in the case of density enhancement only ) was required to produce hvfs , and this was a serious concern in the hypothesis that hvfs come from either the explosion or csm interaction . although gerardy et al . ( 2004 ) and quimby et al . ( 2006 ) found only @xmath49 and @xmath50 are enough for the hvf of sn 2003du and sn 2005cg , respectively , the hvf that has a higher velocity and a deeper absorption has been observed like sn 2002dj ( see fig . [ fig : hvf ] ) . we will give an estimate of the amount of material needed in a 3d calculation . we mapped the density enhancement into 3d space conserving the radial velocity range and the degree of enhancement derived in the 1d calculations . we tested various morphologies that may be realistic , including one or two large blobs , a small number of discrete blobs , a crowded clumpy structure , and tori of various opening angles . first we describe the general behavior of hvfs in 3d models taking a model with a large blob ( model b1 ) as an example . figure [ fig : blob1 ] shows the geometry ( left ) and the synthetic line profile ( right ) . in the left panel , the red sphere shows the photosphere and the blue region shows the density enhancement . the depth of hvfs in the synthetic spectra is different for different lines - of - sight . seen on the z - axis , which is defined as the direction of the blob , the absorption at high velocity is deepest . if we move toward the equatorial plane , the high velocity absorption becomes shallower and shallower and it disappears when the line - of - sight reaches the edge of the blob . note that having the blob on one side has only a small effect on the emission profile , because the volume occupied by the blob is small . the range of profiles in the right panel of figure [ fig : blob1 ] is qualitatively very similar to figure [ fig : shv1d ] , which shows that our 1d parametrization captures the role of the blobs.if the blob is optically thick , the depth of the hvfs is determined by the fraction of the projected photosphere that is concealed by the dense blob for each line - of - sight . we define as the `` covering factor '' and denote it as @xmath51 . figure [ fig : blobshv ] shows that the hvfs obtained using different covering factors in 3d models resemble those obtained with 1d synthetic spectra for different values of @xmath52 . the values are not exactly the same because our 3d blobs are not infinitely optically thick . in fact , given a typical optical depth @xmath53 in the blobs , one expects a relation @xmath54 , where @xmath55 is the line optical depth introduced in the 1d computation . thus @xmath56 if @xmath57 . since @xmath53 has a finite value , @xmath58 , which is smaller than the value in an infinitely thick case . figure [ fig : blobshv ] clearly indicates this . comparing the value of @xmath59 and @xmath51 that yield similar spectra shows that the effective @xmath53 of the 3d blob decreases with increasing angle . this is probably because the average length of a segment crossing the blob is smaller for larger angles , as there are more grazing trajectories . if such a blob exists , the variation of the strength of the hvfs ( @xmath19 ) can be reproduced along various lines - of - sight without introducing unknown parameters such as line optical depth @xmath60 in [ sec : hvf1d ] . we roughly classify the hvfs by their strength into three groups , strong hvfs ( @xmath61 ) , medium hvfs ( @xmath62 ) and weak hvfs ( @xmath63 ) . for example , sn 2002dj and sn 2003du have `` strong '' hvfs , sn 1999ee has a `` medium '' hvf , and sn 2003cg is `` weak '' ( see fig [ fig : hvf ] ) . however , we have to consider the statistical properties of hvfs . recent observations suggest that a considerable fraction of the earliest spectra have high velocity absorption . on the contrary , model b1 suggests that strong hvf will be observed only @xmath64% in all sne . figure [ fig : histblob1 ] is a histogram of the covering factor @xmath51 . it clearly indicates that only very few orientations can produce strong hvfs and about 90% of the observations ( @xmath65 ) should show only the photospheric absorption . figure [ fig : histobs ] shows the observed frequency of the hvf s strength made from mazzali et al . ( 2005a and 2005b ) by distributing 8 sne into 4 bins . the observed depth of the hvf is converted to the covering factor thorough the numerical fit as in figure 4 . it should be noted that the number of the sample is not enough in figure 8 but the ubiquity of the hvfs is not overthrown even if we consider other sne ( mazzali et al . 2005b ) . the clear differences between the histogram of model b1 ( fig . [ fig : histblob1 ] ) and the observation ( fig . [ fig : histobs ] ) are seen at @xmath66 ( too much in model b1 ) and @xmath67 ( too small in model b1 ) . although it is of course not necessarily required that all observations are reproduced with a single geometry , a general geometry may be inferred if a certain model can reproduce the observed trend . we investigate several geometrical models in the following subsections and compare the distribution of synthetic properties to the observed trend . we showed that a model with one blob is unlikely as a general geometry of sne ia . we therefore vary both the size of the blobs and their number . we show the expected statistical properties of each model by means of the distribution of covering factors , since we have shown that there is a direct correspondence between @xmath51 and hvf strength . figure [ fig : blob2 ] shows the distribution of covering factors in a model with two blobs ( model b2 ) . as expected , the fraction of lines of sight with large covering factor doubles and the fraction of small factors decreases . this is however still not consistent with the fact that most spectra have high velocity absorption . although we tested various blob sizes , most lines - of - sight have @xmath68 because of the large space between the two blobs . we then increase the number of blobs adjusting their size so that the photosphere is not completely covered . next we consider a case with several blobs . figure [ fig : multi ] shows the distribution of covering factors for a model with 6 blobs with opening angle @xmath69 degrees ( top panel ; model b6 ) , a model with 5 blobs of @xmath70 degrees ( middle panel ; model b5 ) and a model with several blobs of @xmath71 degrees ( bottom panel ; model b30 ) . from top to bottom , the space between the blobs becomes smaller . synthetic spectra show that the correlation between @xmath51 and the depth of the hvf remains even when the blobs are crowded as in model b30 . model b6 still has a large space between the blobs , making the fraction of small @xmath51 large . in addition , this model is very unlikely to produce the deep absorption required to reproduce the objects like sn 2002dj and sn 2003du ( see , fig [ fig : hvf ] and fig [ fig : hvffit ] ) , which needs @xmath72 . model b5 ( fig [ fig : multi ] , middle ) has smaller intervals between the blobs and a large dispersion in the covering factor . this model has a 15% probability of showing a deep absorption ( @xmath73 ) while the fraction of lower @xmath51 is smaller than in any of the models discussed before . the fact that hvfs exist in almost all early spectra may suggest that a clumpy structure like model b5 is a possible average geometry . if we cram more blobs ( model b30 ; fig [ fig : multi ] , bottom ) , the effect of different lines - of - sight is averaged and the variation disappears . this result is similar to that of the 1d test with @xmath74 . therefore we can conclude that this geometry is not typical of the majority of sne ia , although it may exist . we distinguish a model that has a torus - like density enhancement from blob models because the origin of the enhancement is expected to be interaction with csm or an accretion disk in this case . the main problem with the hypothesis that hvfs come from csm interaction is the fact that extremely high mass loss rates are required to place the material just outside the explosion . one expects that this may be solved if the progenitor wd is surrounded by an accretion disk and the ejecta collide with the disk , leading to density enhancements on the plane of the disk . figure [ fig : torus ] shows the distribution of covering factors of models with torus - like enhancements ( model t2 , t4 and t6 ) . these models have a disk - like enhanced region with opening angles of @xmath75 and @xmath76 , respectively . as shown in the left panels of figure [ fig : torus ] , the @xmath76 disk has a thickness comparable to the diameter of the photosphere . in model t2 the disk is too thin for the covering factor ever to become large ( top panels in fig . [ fig : torus ] ) . if the thickness increases to @xmath77 ( model t4 ; middle panels in fig . [ fig : torus ] ) , the fraction of `` weak '' hvfs decreases while those of `` strong '' and `` middle '' hvfs increase . if the the disk is thick enough for the photosphere to be totally concealed , the fraction of `` strong '' hvfs increases ( model t6 ; bottom panels in fig . [ fig : torus ] ) and the distribution of covering factors becomes broad . only model t6 may produce the observed distribution of hvf strength . this implies that a very thick disk is required , with thickness comparable to the diameter of the wd . the material in the disk should be swept by the sn ejecta in a radial direction leaving an imprint of the disk s angular size after the explosion . while this may be a realistic model , the absence of hydrogen lines in the early spectra remains the strongest argument against the disk origin of the hvfs . this problem can be overcome by assuming low temperature ( @xmath78 ) at the shocked ejecta ( gerardy et al . 2004 ) , where the hydrogen lines are less active than metal lines . and see the consideration made in mazzali et al . ( 2005a ) on the role of hydrogen in making the caii ir triplet broad . they estimate m(h)@xmath79 in spherical symmetry . the strength of the hvfs ( @xmath19 ) was parameterized via the line optical depth of the caii ir triplet in [ sec : hvf1d ] . the observed range of hvfs can be reproduced using only geometrical effects if we assume that the optically thick region distributes discretely . the covering factor that represents how the photosphere is concealed by the optically thick region acts exactly as @xmath26 in [ sec : hvf1d ] . among the various geometries discussed in the previous section , models b1 and b2 have a very large fraction of lines - of - sight with @xmath68 , which makes almost no hvfs . since observations suggest that a considerable fraction of the earliest spectra show hvfs , these models can be ruled out as a standard configuration . as the interval between the blobs becomes smaller , the fraction of lines - of - sight with @xmath68 decreases ( e.g. , from model b6 to model b30 ) . however , too crowded structures like model b30 do not give rise to a variation in the covering factor and so the strength of hvf is constant . model b5 has a wide range of covering factors from @xmath80 to @xmath72 . if such a structure is formed from the explosion , it can explain the observed variety naturally . it should be noted that models with a hole can be tuned to give the observed distribution of hvf more easily than models with `` blobs '' by changing the covering factor , i.e. , the size of the hole . how such geometries might be produced is however unclear , as they still require a dense high velocity region and a line of sight that is never far from the hole , because otherwise most sne would show strong hvfs . a torus model may reproduce the observed distribution of hvf if the disk is geometrically thick ( @xmath81 ) . such a thick disk - like enhancement could be produced if the accretion disk is thick enough to surround the wd before the explosion . the opening angle of the accretion disk is likely to be reflected on the angular size of a density enhancement . a torus in model t2 or t4 is so thin that it provides a large fraction of `` weak '' features , which are not frequently observed . however , it may be possible to reduce the fraction of @xmath65 if the interaction with csm resulting from spherical or bipolar wd wind occurs . although many additional parameters should be introduced to investigate the possibility of this scenario , this scenario seems to work qualitatively . when the optically thick region at high velocity is introduced as a density enhancement , other features are also affected . the siii @xmath16355 line is the most notable line , and its behavior has been thoroughly examined ( e.g. , benetti et al . 2005 ) . figure [ fig : hvfsi ] shows spectra around siii @xmath16355 . if the photosphere is totally covered by dense blobs , the absorption minimum becomes @xmath82 km s@xmath6 . such high velocity features have not been observed . also , the velocity of siii @xmath16355 is not always correlated with that of the caii ir triplet in the observed spectra . for example , sn 2002bo has a higher siii @xmath16355 velocity @xmath83 km s@xmath6(at -8 days after the maximum ) than that of sn sn 2003kf @xmath84 km s@xmath6(at -9 days ) but the caii hvf of sn 2002bo ( @xmath85 km s@xmath6 ) is slower than that of sn 2003kf ( @xmath86 km s@xmath6 ) . therefore the assumption that hvfs in the caii ir triplet are due only to density enhancements may not be correct . however there are some sne that have an extended blue wing in siii @xmath16355 . this may indicate some degree of density enhancement also occurs . the combination of density enhancement and abundance enhancement may provide a proper correlation . such a study , however , is beyond the scope of this work . it is worth noting that the mass of additional material is reduced from @xmath46 in the spherical case to @xmath87 in models b5 , b6 and b30 . the velocity range of hvfs ( @xmath18 ) is found to be the same in all the models and all the lines - of - sight as long as the position of the enhancements is fixed . if the covering factor is identical , one might expect that the position of the absorption minimum depends on the line - of - sight . however , we found that this effect is very slight . the strength of the photospheric absorption @xmath20 is not correlated with the covering factor and it is not affected even if the line - of - sight is varied . we tested the properties of hvfs of caii ir triplet through 1d and 3d modeling . parameterized 1d simulations were used to extract the main features that determine the hvf . we defined three parameters that govern the hvfs . these are the strength of the hvf @xmath19 , its velocity range @xmath18 , and the strength of the photospheric component @xmath20 . as for @xmath19 , it was shown that geometrical effects on models based on high velocity blobs or a thick torus can provide enough variety to cover all the observations . on the contrary , @xmath18 is not affected by line - of - sight effects . therefore we speculate there may be a number of blobs that have different velocities . this might be possible if the wd rotates and the clumpy structure formed by the deflagration flame has different properties depending on direction . such a variety is not produced in a torus model . however , it may be possible that different disks lead to different enhancements from sn to sn since the degree of density enhancement and its velocity range depend strongly on the density , the total mass and radial extent of the disk . the strength of the photospheric absorption ( @xmath20 ) may be influenced by the temperature and the abundance . although we changed this value by changing the abundance in this paper , it should be studied whether there is any correlation between the temperature and @xmath20 . this requires knowing the exact temperature and photospheric velocity by fitting observed spectra , which will be the subject of future work ( m. tanaka et al . in preparation ) . the models that best explain the statistics of the observed strength of the hvfs are a blob model ( b5 ) with @xmath88 blobs of @xmath89 and a thick torus of opening angle @xmath81 . while a torus model sounds appealing , the main argument against it is the absence of hydrogen lines ( but see gerardy et al . 2004 , and mazzali et al . 2005a ) and the variation of the hvf velocity . a blob model may result from the explosion if the mushroom structure of the deflagration is not completely washed away in a delayed detonation ( gamezo et al . although this does not mean that all the sne have a single geometry , the average structure may have a distribution of high velocity material similar to that of model b5 . to verify this conclusion , more early phase observations before maximum are needed . a statistical study can constrain the structure more accurately . model b5 is different from the 3d structure that was obtained for sn 2001el by kasen et al . their model has one large blob and an aspherical photosphere , and is able to reproduce the observed polarization flux . our results suggest that such a geometry can not be standard ( see model b1 in [ sec : results ] ) . it is completely unknown whether only polarized sne ia have such a geometry , consisting of one or two blobs in the outermost region . rotation of the wd may lead to such a configuration . although a statistical study of polarization is not available yet , it is potentially useful to verify the geometry , including the abundance distribution . in addition , the statistical study of polarization may be able to distinguish the torus models and the blob models because the torus - like enhancement tend to produce a large polarization ( kasen et al . 2003 ) . detailed hydrodynamic calculations of 3d deflagration flames suffer from shortage of high velocity material . it is unknown whether such a result indicates our ignorance about the deflagration flame or the existence of a transition from a deflagration to a detonation . it is therefore quite important to define a suitable explosion mechanism from the observational data . this will be achieved via a statistical study presented in this paper when larger number of early spectra are available . the importance of early observations of sne ia can not be understated . this work has been supported in part by the grant - in - aid for scientific research ( 16540229 , 17030005 , 17033002 ) and the 21st century coe program ( quest ) from the jsps and mext of japan . k.m is supported through the jsps ( japan society for the promotion of science ) research fellowship for young scientists . benetti , s. , cappellaro , e. , mazzali , p.a . , turatto , m. , altavilla , g. , bufano , f. , elias - rosa , n. , kotak , r. , pignata , g. , salvo , m. , & stanishev , v. 2005 , apj , 623 , 1011 gamezo , v.n . , khokhlov , a. , oran , e.s . , chtchelkanova , a.y . , & rosenberg , r.o . 2003 , science , 299 , 77 gamezo , v.n . , khokhlov , a. m. , & oran , e. s. 2005 , apj , 623 , 337 gerardy , c. l. , hflich , p. , fesen , r. a. , marion , g. h. , nomoto , k. , quimby , r. , schaefer , b. e. , wang , l. , & wheeler , j. c. 2004 , apj , 607 , 391 hatano , k. , branch , d. , fisher , a. , baron , e. , & filippenko , a.v . 1999 , apj , 525 , 881 hatano , k. , branch , d. , lentz , e.j . , baron , e. , filippenko , a.v . , & garnavich , p.m. 2000 , apj , 543 , l49 howell , d.a . , hflich , p. , wang , l. , & wheeler , j.c . 2001 , apj , 556 , 302 kasen , d. , nugent , p. , wang , l. , howell , d. a. , wheeler , j. c. , hflich , p. , baade , d. , baron , e. , & hauschildt , p. h. 2003 , apj , 593 , 788 kotak , r. , meikle , w.p.s . , pignata , g. , stehle , m. , smartt , s.j . , benetti , s. , hillebrandt , w. , lennon , d.j . , mazzali , p.a . , patat , f. , & turatto , m. 2005 , a & a , 436 , 1021 lentz , e. j. , baron , e. , branch , d. , hauschildt , p. h. , & nugent , p. e. 2000 , apj , 530 , 966 lucy , l.b . 1999 , a&a , 345 , 211 mazzali , p.a . , & lucy , l.b . 1993 , a&a , 279 , 447 mazzali , p.a . 2000 , a&a , 363 , 705 mazzali , p.a . , nomoto , k. , cappellaro , e. , nakamura , t. , umeda , h , & iwamoto , k. , 2001 , apj 547 , 988 mazzali , p.a . , benetti , s. , stehle , m. , branch , d. , deng , j. , maeda , k. , nomoto , k. , & hamuy , m. 2005a , mnras , 357 , 200 mazzali , p.a . , benetti , s. , altavilla , g. , blanc , g. , cappellaro , e. , elias - rosa , n. , garavini , g. , goobar , a. , harutyunyan , a. , kotak , r. , leibundgut , b. , lundqvist , p. , mattila , s. , mendez , j. , nobili , s. , pain , r. , pastorello , a. , patat , f. , pignata , g. , podsiadlowski , ph . , ruiz - lapuente , p. , salvo , m. , schmidt , b.p . , sollerman , j. , stanishev , v. , stehle , m. , tout , c. , turatto , m. , & hillebrandt , w. 2005b , apj , 623 , l37 nomoto , k. , thielemann , f .- k . , & yokoi , k. 1984 , apj , 286 , 644 nugent , p. , phillips , m. , baron , e. , branch , d. , & hauschildt , p. 1995 , apj , 455 , l147 patat , f. , benetti , s. , cappellaro , e. , dazinger , i. j. , della valle , m. , mazzali , p.a . , & turatto , m. 1996 , mnras , 278 , 111 phillips , m.m . 1993 , apj , 413 , l105 quimby , r. , hoeflich , p. , kannappan s.j . , rykoff e. , rujopakarn w. , akerlof c.w . , gerardy c.l . , & wheeler j.c . 2006 , apj , 636 , 400 reinecke , m. , hillebrandt , w. , & niemeyer , j. c. , 2002 , a & a , 391 , 1167 riess , a. g. , press , w. h. , & kirshner , r. p. 1996 , apj , 473 , 88 rpke , f. , k. , & hillebrandt , w. 2005 , a & a , 431 , 635 thomas , r. c. , branch , d. , baron , e. , nomoto , k. , li , w. , & filippenko , a. v. 2004 , apj , 601 , 1019 wang , l. , wheeler , j.g . , & hflich , p. 1997 , apj , 476 , l27 wang , l. , baade , d. , hflich , p. , khokhlov , a. , wheeler , j.c . , kasen , d. , nugent , p.e . , perlmutter , s. , fransson , c. , & lundqvist , p. 2003 , apj , 591 , 1110 wang , l. , baade , d. , hflich , p. , kawabata , k. , khokhlov , a. , nomoto , k. , & patat , f. 2004 , submitted ( astro - ph/0409593 )

spectral synthesis in 3-dimensional ( 3d ) space for the earliest spectra of type ia supernovae ( sne ia ) is presented . in particular , the high velocity absorption features that are commonly seen at the earliest epochs ( @xmath0 days before maximum light ) are investigated by means of a 3d monte carlo spectral synthesis code . the increasing number of early spectra available allows statistical study of the geometry of the ejecta . the observed diversity in strength of the high velocity features ( hvfs ) can be explained in terms of a `` covering factor '' , which represents the fraction of the projected photosphere that is concealed by high velocity material . various geometrical models involving high velocity material with a clumpy structure or a thick torus can naturally account for the observed statistics of hvfs . hvfs may be formed by a combination of density and abundance enhancements . such enhancements may be produced in the explosion itself or may be the result of interaction with circumstellar material or an accretion disk . models with 1 or 2 blobs , as well as a thin torus or disk - like enhancement are unlikely as a standard situation .

SECTION 1. SHORT TITLE. This Act may be cited as the ``Investment in After-School Programs Act of 2009''. SEC. 2. FINDING. Congress finds that-- (1) 21 percent of the children in the United States attend public schools in rural areas; (2) more than 14,000,000 school-age children (25 percent of all school-age children) are left alone after school, including more than 40,000 kindergartners; (3) only 6,500,000 (11 percent) of children in kindergarten through twelfth grade participate in after-school programs, although an additional 15,000,000 would participate if a quality program were available in the communities of the children; (4) in rural areas of the United States, 2,500,000 children live in deep and persistent poverty; (5) among children living in rural areas, 19 percent live in poverty, compared to 15 percent among non-rural children; (6) rural schools have fewer financial resources that non- rural schools, largely as a result of diminished local property tax bases and inequitable distributions of State funds; (7) low literacy rates among parents in poor rural communities affect the early language development and educational aspirations of children; (8) children living in poverty experience less cognitive stimulation and enrichment than children living in middle- income households; (9) the poorer and more diverse the rural population, the lower the scores of the students of the population are on the National Assessment of Educational Progress; (10) academic outcomes that are linked to after-school programs include-- (A) better performance in school as measured by achievement test scores and grades; (B) better attitudes toward school and higher educational aspirations; (C) higher school attendance; and (D) less disciplinary action; (11) investing in after-school programs helps children in rural communities break out of the cycle of poverty and creates opportunities for at-risk youth; (12) in areas in which resources are limited, after-school programs are often the only source of supplemental enrichment in literacy, nutrition education, technology, and preparation for college entrance exams; (13) children attending rural schools have the lowest median per-student funding for after-school programs under the 21st century community learning center program under part B of title IV of the Elementary and Secondary Education Act of 1965 (20 U.S.C. 7171 et seq.), as compared to children attending urban and suburban schools; (14) after-school program providers in rural communities face unique barriers that include-- (A) higher transportation costs; (B) fewer economies of scale, because of the smaller population base, which results in less funding per child; and (C) fewer trained staff and community-based organizations with whom to partner; (15) in the 30 years before the date of enactment of this Act-- (A) the percentage of children in the United States who are overweight has more than doubled; and (B) the number of teenagers who are overweight has nearly tripled; (16) rural, low-income children represent the highest obesity group among all children in the United States; and (17) after-school programs provide-- (A) much-needed opportunities to promote and support healthy lifestyles in youth in addition to constructive learning environments; and (B) effective venues for improving nutrition, nutrition education, and physical activity. SEC. 3. AFTER-SCHOOL PROGRAMS. Subtitle D of the Consolidated Farm and Rural Development Act is amended by inserting after section 365 (7 U.S.C. 2008) the following: ``SEC. 366. AFTER-SCHOOL PROGRAMS. ``(a) Purpose.--The purpose of this section is to enhance after- school programs in rural areas by helping communities-- ``(1) to establish after-school programs; and ``(2) to improve existing programs by overcoming barriers to service. ``(b) Definitions.--In this section: ``(1) After-school program.--The term `after-school program' means a program that carries out a broad array of activities during periods when school is not in session (such as before school, after school, or during summer recess and other vacation periods) that advance student academic achievement and promote positive youth development. ``(2) Eligible entity.--The term `eligible entity' means a local educational agency (as such term is defined in section 9101 of the Elementary and Secondary Education Act of 1965 (20 U.S.C. 7801)), educational service agency, community-based organization, another public or private entity, or a consortium of 2 or more such agencies, organizations, or entities. ``(3) Rural area.--The term `rural area' means an area that is served by an elementary or secondary school that is designated with a school locale code of Distant Town, Remote Town, Fringe Rural, Distant Rural, or Remote Rural, as determined by the Secretary of Education. ``(c) Grants.-- ``(1) In general.--The Secretary shall make grants to eligible entities to improve, expand, or establish after-school programs in rural areas. ``(2) Requirement.--Each grant under this section shall be in an amount of not less than $25,000. ``(d) Duration.-- ``(1) Term of grant.--The term of a grant under this section may not be for less than 3 years. ``(2) Renewal.--The Secretary may renew a grant under this section for a period of not less than 3 years, based on the performance of the eligible entity during the previous grant term. ``(e) Uses.--As a condition of the receipt of a grant under this section, an eligible entity shall use the grant to fund projects and activities described in subsection (c), including transportation, professional development, training, recruitment and retention of staff, increasing access to technology, and planning. ``(f) Evaluation.--The Secretary may use not more than 1 percent of the funds under this section-- ``(1) to conduct evaluations of the effectiveness of programs and activities assisted under subsection (c); and ``(2) to disseminate the results of those evaluations for the purpose of refining, improving, and strengthening programs. ``(g) Outreach, Training, and Technical Assistance.--The Secretary may use not more than 3 percent of the funds made available to carry out this section-- ``(1) to conduct outreach, including bidders' conferences, to ensure widespread knowledge of the availability of resources described in subsection (c); ``(2) to disseminate information on best practices and successful program models for serving children and youth in rural areas; and ``(3) to provide capacity building, training, and technical assistance to after-school programs and providers in rural areas. ``(h) Application.-- ``(1) In general.--To be considered for a grant under this section, each eligible entity shall submit to the Secretary an application at such time, in such manner, and accompanied by such information as the Secretary may require. ``(2) Contents.--An application submitted pursuant to paragraph (1) shall include-- ``(A) a description of the after-school program to be funded, including-- ``(i) an assurance that the program will take place in a safe and easily accessible facility; ``(ii) a description of how children and youth participating in the program will travel safely between the program site and home; ``(iii) a description of how the eligible entity will disseminate information about the program, including the location of the program, to the community in a manner that is understandable and accessible; ``(iv)(I) a description of the services to be provided to children and youth, which may include a broad array of activities, such as-- ``(aa) academic enrichment and youth development activities; ``(bb) drug and violence prevention programs; ``(cc) counseling programs; ``(dd) art, music, physical fitness, and recreational programs; ``(ee) technology education programs; ``(ff) character education programs; and ``(gg) service-learning programs; ``(II) the roles and responsibilities of the partners in providing the services; and ``(III) how the services enhance an existing after-school program; and ``(v) an assurance that the program will provide a nutritious snack or meal that meets nutrition standards established by the Secretary; ``(B) an assurance that the proposed program was developed, and will be carried out, in active collaboration with the schools the students attend; ``(C) an assurance that funds provided under this section will be used to increase the level of State, local, and other non-Federal funds that would, in the absence of funds under this section, be made available for programs and activities authorized under this section, and in no case supplant Federal, State, local, or non-Federal funds; ``(D) a description of the partnership between a local educational agency, a community-based organization, or another public entity or private entity, if applicable; and ``(E) such additional assurances as the Secretary determines to be necessary to ensure compliance with this section. ``(i) Priority.--The Secretary shall give priority to applications that-- ``(1) propose partnerships between 2 or more eligible entities; or ``(2) propose that a majority of the students participating in the after-school program are eligible for free or reduced price school meals under the Richard B. Russell National School Lunch Act (42 U.S.C. 1751 et seq.) and section 4 of the Child Nutrition Act of 1966 (42 U.S.C. 1773). ``(j) Authorization of Appropriations.--There are authorized to be appropriated to carry out this section-- ``(1) $25,000,000 for fiscal year 2010; ``(2) $50,000,000 for fiscal year 2011; and ``(3) such sums as are necessary for each of fiscal years 2012 through 2014.''.

Investment in After-School Programs Act of 2009 - Amends the Consolidated Farm and Rural Development Act to direct the Secretary of Agriculture to award grants to local educational agencies, educational service agencies, community-based organizations, or other entities to improve, expand, or establish rural after-school programs that provide students with a broad array of activities when school is not in session that improve their academic performance and promote their positive development. Requires eligible programs to be implemented in active collaboration with the schools the students attend and take place in safe and easily accessible facilities. Gives priority to applicants that are partnerships between eligible entities or propose to serve students a majority of whom are eligible for free or reduced price meals under the school lunch and breakfast programs.

soft tissue defects of the extremity that expose underlying critical structures like bone / tendon / joint require a flap cover . many of these defects , especially if they are moderate to large in size , require free tissue transfer for a successful reconstruction . a soft tissue defect requiring a free flap which is longer than that provided by the conventional large free flaps like latissimus dorsi ( ld ) and anterolateral thigh ( alt ) is a challenging problem . we have used the boomerang - shaped extended rectus abdominis myocutaneous ( beram ) flap to reconstruct nine such defects . this flap has a robust blood supply , consistent anatomy and has caused acceptable donor morbidity . the purpose of this study was to retrospectively analyse the outcome of nine such reconstructions ( in terms of flap outcome , complications , donor site morbidity and functional outcome ) performed in our unit during the last 3 years . we also conducted a clinical study on 30 volunteers ( 10 males , 10 females and 10 children ) , where we used standard markings for alt flap and ld flap and did a comparison of the available flap lengths with our design of beram flap . we present nine patients who underwent coverage of long soft tissue defects with the beram flap in our unit in last 3 years [ table 1 ] . in five cases , the flap was used in upper extremity , and in four cases , it was used in lower extremity soft tissue reconstruction . the age of patients ranged between 8 years to 39 years and all were male patients . the defect sizes ranged between 25 and 39 cm in length and between 8 and 12 cm in width . a pattern of the defect was created , with the position of recipient vessels clearly marked . we believe that the most important measurement in this kind of situation is the distance from the location of the ideal recipient vessels to the distal - most point of the defect . a line was drawn from the pubic symphysis to the umbilicus , and extended upwards and laterally towards the inferior angle of scapula [ figures 1 and 2 ] . the proximal ( inferior ) vertical segment of flap extended from pubic symphysis to umbilicus and overlay the rectus abdominis muscle at paramedian position , and the width of the flap was kept limited to allow primary closure of this part of the defect in all cases . the distal ( superior ) oblique cutaneous segment was designed symmetrically on a line from umbilicus to inferior angle of scapula the distal limit of the flap was kept at the mid - axillary line in seven cases , and extended up to the posterior axillary line in the other two cases ( case nos 4 and 6 ) the other usual flap sites ( ld , alt flap , groin flap , parascapular flap ) were also marked according to standard measurements mentioned by mathes and nahai and maximum possible flap dimensions were noted . in all cases , we found that beram flap provided the longest flap . diagrammatic representation of design and axis of the flap and local vascular anatomy picture depicting the flap design on patient adrenaline in saline ( 1 in 200 ) was injected along flap margins . distal cutaneous part of flap was raised from the chest wall starting from the distal tip of the flap and proceeding towards the umbilicus [ figure 3a ] . dissection proceeded in the subcutaneous plane until the lateral border of the anterior rectus sheath was crossed and the first major paraumbilical perforator(s ) encountered [ figure 3b ] . ( c ) transverse incision at rectus sheath just superior to first paraumbilical perforator a transverse incision was made in the rectus sheath just superior to the perforator(s ) [ figure 3c ] and another vertical incision made in the sheath just lateral to the major perforator(s ) . the rectus muscle was cut transversely a little above the umbilicus ( preserving the main paraumbilical perforators in the flap . the medial skin margin of the flap was incised just lateral to the umbilicus , bringing the incision to the midline below the umbilicus . the flap included the oblique supra - umbilical skin paddle , the lower half of the rectus muscle along with its overlying rectus sheath , fat and skin [ figure 3d ] . as the rectus muscle was lifted off from its bed , the deep inferior epigastric vessels were identified and followed to their origin from the external iliac vessels [ figure 3e and f ] . the pedicle was divided and the flap transferred [ figure 3 g and h ] . in all our cases , skin was closed in layers with a negative suction drain [ figure 3i ] . in one patient , in whom the oblique cutaneous portion of the flap was broader , that part of the donor area was skin grafted . ( e ) identifying the deep inferior epigastric artery on the deeper surface of the rectus muscle . ( f ) completion of flap dissection showing comparison with 15 cm ruler and diea pedicle at its origin ( g ) final defect after thorough debridement and harvested beram flap kept aside . the patient was positioned supine under general anaesthesia . the recipient defect was prepared and healthy recipient vessels were identified . a pattern of the defect was created , with the position of recipient vessels clearly marked . we believe that the most important measurement in this kind of situation is the distance from the location of the ideal recipient vessels to the distal - most point of the defect . a line was drawn from the pubic symphysis to the umbilicus , and extended upwards and laterally towards the inferior angle of scapula [ figures 1 and 2 ] . the proximal ( inferior ) vertical segment of flap extended from pubic symphysis to umbilicus and overlay the rectus abdominis muscle at paramedian position , and the width of the flap was kept limited to allow primary closure of this part of the defect in all cases . the distal ( superior ) oblique cutaneous segment was designed symmetrically on a line from umbilicus to inferior angle of scapula the distal limit of the flap was kept at the mid - axillary line in seven cases , and extended up to the posterior axillary line in the other two cases ( case nos 4 and 6 ) the other usual flap sites ( ld , alt flap , groin flap , parascapular flap ) were also marked according to standard measurements mentioned by mathes and nahai and maximum possible flap dimensions were noted . in all cases , we found that beram flap provided the longest flap . diagrammatic representation of design and axis of the flap and local vascular anatomy picture depicting the flap design on patient distal cutaneous part of flap was raised from the chest wall starting from the distal tip of the flap and proceeding towards the umbilicus [ figure 3a ] . dissection proceeded in the subcutaneous plane until the lateral border of the anterior rectus sheath was crossed and the first major paraumbilical perforator(s ) encountered [ figure 3b ] . ( c ) transverse incision at rectus sheath just superior to first paraumbilical perforator a transverse incision was made in the rectus sheath just superior to the perforator(s ) [ figure 3c ] and another vertical incision made in the sheath just lateral to the major perforator(s ) . the rectus muscle was cut transversely a little above the umbilicus ( preserving the main paraumbilical perforators in the flap . the medial skin margin of the flap was incised just lateral to the umbilicus , bringing the incision to the midline below the umbilicus . the flap included the oblique supra - umbilical skin paddle , the lower half of the rectus muscle along with its overlying rectus sheath , fat and skin [ figure 3d ] . as the rectus muscle was lifted off from its bed , the deep inferior epigastric vessels were identified and followed to their origin from the external iliac vessels [ figure 3e and f ] . the pedicle was divided and the flap transferred [ figure 3 g and h ] . in all our cases , skin was closed in layers with a negative suction drain [ figure 3i ] . in one patient , in whom the oblique cutaneous portion of the flap was broader , that part of the donor area was skin grafted . ( e ) identifying the deep inferior epigastric artery on the deeper surface of the rectus muscle . ( f ) completion of flap dissection showing comparison with 15 cm ruler and diea pedicle at its origin ( g ) final defect after thorough debridement and harvested beram flap kept aside . a 40-year - old male presented with type iiib open fracture of radial head , loss of lateral condyle of humerus and composite tissue loss over the extensor aspect of the right forearm and distal arm [ figure 4a ] . he underwent wound debridement , external fixator application , lateral collateral ligament reconstruction [ figure 4b ] and coverage with a 35 12 cm beram flap [ figure 4c g ] . a ) side swipe injury with composite tissue loss over the extensor aspect of the right forearm and distal arm . ( h ) after flap debulking at 1 year a 35-year - old industrial worker sustained a major crush injury with type iiib fracture in both bones of right leg , with metatarsal fracture with composite tissue loss ( 47 8 cm ) over anterolateral aspect of right leg and foot . patient underwent medial gastrocnemius muscle flap cover for proximal one - third of the right leg and free beram flap ( 43 8 cm ) transfer for the critical raw area over the distal two - thirds of anteromedial aspect of the right leg and dorsum of foot . residual raw area and superolateral part of flap donor area was covered with split skin graft . he started non - weight - bearing walking in 3 weeks and walking without support in 12 weeks . this was a 30-year - old male with severe crush injury of the left forearm following a vehicular accident . after debridement , we were left with a soft tissue defect of 35 10 cm . considering the gross comminution along with bone loss , a decision was taken to create a single bone forearm by plate osteosynthesis between distal radius and proximal ulna . wound was covered by a free beram flap ( 35 10 cm ) with end - to - side arterial anastomosis to brachial artery and three end - to - end venous anastomoses . the bones united uneventfully . later on , the patient underwent secondary flap debulking procedure . in his recent follow - up , he was found to be able to perform all his daily activities and was able to drive a bike using his single bone forearm .. an 8-year - old male child had an avulsion injury of the anteromedial aspect of the left leg , extending from the knee to the distal third of leg , exposing subluxated knee joint and most of the tibia . defect measuring 12 30 cm was covered by free beram flap . in this case , the flap marking had been extended beyond the mid - axillary line . postoperatively , the distal 5 cm of the flap got necrosed [ figure 5a ] which was debrided and covered with an inferiorly based local transposition skin flap [ figure 5b ] . he was able to walk with support in 4 weeks time ( a ) 1 week postoperative picture of flap with partial distal necrosis . ( b ) post debridement of necrotic segment of flap and coverage with inferiorly based local transposition flap we also conducted a clinical study with randomly selected 30 volunteers ( 10 children aged 415 years , 10 adult males and 10 adult females ) [ figure 6 ] . the subject 's height , standard flap marking and measurements were taken for alt and ld flaps according to the standard measurements given by mathes and nahai , and beram flap was marked according to above - described markings . the comparison of possible flap length in relation to volunteer 's height and comparison of ld and alt flap length to beram flap length was done [ table 2 ] . representation of clinical study showing standard flap markings and comparison of different flap lengths in centimeters clinical study : children 's measurements adult female measurements adult male measurements a 40-year - old male presented with type iiib open fracture of radial head , loss of lateral condyle of humerus and composite tissue loss over the extensor aspect of the right forearm and distal arm [ figure 4a ] . he underwent wound debridement , external fixator application , lateral collateral ligament reconstruction [ figure 4b ] and coverage with a 35 12 cm beram flap [ figure 4c g ] . a ) side swipe injury with composite tissue loss over the extensor aspect of the right forearm and distal arm . a 35-year - old industrial worker sustained a major crush injury with type iiib fracture in both bones of right leg , with metatarsal fracture with composite tissue loss ( 47 8 cm ) over anterolateral aspect of right leg and foot . patient underwent medial gastrocnemius muscle flap cover for proximal one - third of the right leg and free beram flap ( 43 8 cm ) transfer for the critical raw area over the distal two - thirds of anteromedial aspect of the right leg and dorsum of foot . residual raw area and superolateral part of flap donor area was covered with split skin graft . he started non - weight - bearing walking in 3 weeks and walking without support in 12 weeks . this was a 30-year - old male with severe crush injury of the left forearm following a vehicular accident . after debridement , we were left with a soft tissue defect of 35 10 cm . considering the gross comminution along with bone loss , a decision was taken to create a single bone forearm by plate osteosynthesis between distal radius and proximal ulna . wound was covered by a free beram flap ( 35 10 cm ) with end - to - side arterial anastomosis to brachial artery and three end - to - end venous anastomoses . the bones united uneventfully . later on , the patient underwent secondary flap debulking procedure . in his recent follow - up , he was found to be able to perform all his daily activities and was able to drive a bike using his single bone forearm .. an 8-year - old male child had an avulsion injury of the anteromedial aspect of the left leg , extending from the knee to the distal third of leg , exposing subluxated knee joint and most of the tibia . defect measuring 12 30 cm was covered by free beram flap . in this case , the flap marking had been extended beyond the mid - axillary line . postoperatively , the distal 5 cm of the flap got necrosed [ figure 5a ] which was debrided and covered with an inferiorly based local transposition skin flap [ figure 5b ] . he was able to walk with support in 4 weeks time ( a ) 1 week postoperative picture of flap with partial distal necrosis . ( b ) post debridement of necrotic segment of flap and coverage with inferiorly based local transposition flap we also conducted a clinical study with randomly selected 30 volunteers ( 10 children aged 415 years , 10 adult males and 10 adult females ) [ figure 6 ] . the subject 's height , standard flap marking and measurements were taken for alt and ld flaps according to the standard measurements given by mathes and nahai , and beram flap was marked according to above - described markings . the comparison of possible flap length in relation to volunteer 's height and comparison of ld and alt flap length to beram flap length was done [ table 2 ] . representation of clinical study showing standard flap markings and comparison of different flap lengths in centimeters clinical study : children 's measurements adult female measurements adult male measurements our clinical experience of nine cases combined with results of our clinical study has confirmed that our design of free beram flap consistently provides a flap length which is an average 32.6% longer than the standard ld myocutaneous / skin flap and an average 42.2% longer than the standard alt flap in adults . in children , beram is 71% longer than alt flap and 46.7% longer than ld flap.the free beram flap was consistently reliable in all the seven cases in which the distal end did not extend beyond the mid - axillary line . in the two patients in whom the flap had been extended beyond the mid - axillary line , the portion beyond the mid - axillary line was lost.in our follow - up so far ( minimum 1 year ) , no patient has reported a hernia or a weakness of the abdominal wall.in our clinical study , we found that for adult men and women , the available flap length to ( patient ) height ratio for alt , ld and beram flaps was on average 19.79% , 21.31% and 28.09% , respectively . our clinical experience of nine cases combined with results of our clinical study has confirmed that our design of free beram flap consistently provides a flap length which is an average 32.6% longer than the standard ld myocutaneous / skin flap and an average 42.2% longer than the standard alt flap in adults . in children , beram is 71% longer than alt flap and 46.7% longer than ld flap . the free beram flap was consistently reliable in all the seven cases in which the distal end did not extend beyond the mid - axillary line . in the two patients in whom the flap had been extended beyond the mid - axillary line , the portion beyond the mid - axillary line was lost . in our follow - up so far ( minimum 1 year ) , no patient has reported a hernia or a weakness of the abdominal wall . in our clinical study , we found that for adult men and women , the available flap length to ( patient ) height ratio for alt , ld and beram flaps was on average 19.79% , 21.31% and 28.09% , respectively . pennington and pelly in 1980 reported two successful rectus abdominis myocutaneous free flaps based on deep inferior epigastric artery ( diea ) . they mentioned a long pedicle with wide vascular lumen , easy harvest and aesthetic and functional acceptability as advantages . the disadvantages included the need to reconstruct anterior rectus sheath to prevent hernia formation and the bulk of the flap . the vascular anatomy of the diea and its paraumbilical perforators has been well studied.[46 ] variants of diea - based flaps like vertical rectus abdominis muscle / myocutaneous ( vram ) and transverse rectus abdominis muscle / myocutaneous ( tram ) flaps have been described earlier . while technically our flap qualifies to be an extended deep inferior epigastric free flap , the same name would be applied to most of the above - mentioned variants and modifications . free boomerang - shaped extended rectus abdominis myocutaneous ( beram ) flap because the phrase boomerang - shaped closely describes the shape of the flap and makes it easy to understand and remember . he observed that by including the paraumbilical cutaneous perforator(s ) , the flap can be designed with a diagonally placed upper skin island extending beyond the rectus muscle from umbilicus to costal margin , giving a long flap with an equally long vascular pedicle in a free flap and wide arc of rotation in case of a pedicled flap . this is because these perforators communicate by means of choke vessels to the anterior branches of the lateral intercostal vessels at a 45 angle to the anterior axillary line . boyd et al . performed cadaveric studies by dye injections , dissections , and barium radiographic studies to delineate the vascular territories of superior epigastric and deep inferior epigastric vessels and they observed that majority of the abdominal wall was stained through injection of the deep inferior epigastric system . the beram flap has several attributes that make it unique and many interesting comparisons can be made to its cousins , the vram and tram flaps . first , the distal skin paddle is easy to mark and elevate . on an average , a 1012 cm wide flap can easily be harvested with direct closure and the length - to - width ratio is around 3:1 in all these flaps . the beram flap is simpler because of a more limited inclusion of rectus muscle ( only the inferior half ) , while in vram flap the extra muscle dissection adds time to the procedure and probably increases postoperative pain . in obese patients , owing to the characteristic distribution pattern of fat in the abdominal wall , the distal skin paddle in vram flap is likely to be bulkier than that of beram flap . the beram flap distal skin paddle ( beyond the periumbilical area ) is quite thin in most people , and in 67% cases , it has been less than 1 cm in thickness . the beram flap skin paddle donor site can be closed immediately without compromising the visualisation of the pedicle , unlike the tram flap , where closure of the donor site must be performed after harvest of the flap . the distal skin paddle which lies beyond the repaired rectus sheath can be made as broad as is required , and if necessary the donor area is grafted . the skin paddle donor site is closed without additional elevation of skin flaps as seen in the tram flap closure , which requires elevating and mobilising the upper abdominal skin . the rectus muscle and anterior fascial dissection is the same as a free tram flap , as opposed to the greater muscle dissection of the vram flap . boyd , taylor and other investigators have shown the pedicled extended rectus abdominis myocutaneous flap to be versatile in its arc of rotation and very reliable , with no reported cases of distal flap necrosis . no significant long - term donor - site complications were noted in our study or in other studies . a similar flap was described by edmond and franklyn as periumbilical axial flap which was designed on an axis between the umbilicus and the inferior angle of the scapula running upwards laterally as far as the mid - axillary line or even the posterior axillary line . in our series , the flap had been extended beyond the mid - axillary line in two cases . in both these cases , we lost this portion of the flap . all the above designs of flaps involve a proximal muscle with diea pedicle and a distal skin paddle of variable length . our design of beram flap provides the longest continuous skin paddle of any flap in the body . we feel in certain situations having a skin paddle for the major part of the defect has definite advantages . the myocutaneous flap is , however , bulkier than a muscle flap asko et al . did a comparative study of 51 patients operated by ld and rectus abdominis free flap and they found that average rectus flap skin island was larger than that used for the ld flap ( maximal length 47 vs. 34 cm ) , which shows ram flap to be 38% longer than ld flap , but in our clinical study we found that beram flap was 32.6% longer than ld flap in adults , using standard landmarks . in our surgical experience of over 200 ld muscle flaps , we have frequently noticed that if we transfer a complete ld muscle , the distal 34 cm of the flap does not survive , so the final length difference would be even more . gnter germann and markus hlbauer mentioned ld muscle dimensions : length 35 cm ( range 2142 cm ) and width 20 cm ( range 1426 cm ) . did a study of anterolateral femoral flap applied anatomy based on a doppler analysis of 50 volunteer adults and cadaver dissections of 42 legs ; vascular injection technique were used in 35 cadavers . , we also found that alt flap length varies between 12 and 38 cm ( average 28.4 cm . ) depending on the patient 's height . in our experience beram flap is the free flap which provides the longest skin paddle in the body . it is easy to harvest , has a long reliable pedicle , and causes minimal donor site morbidity . based on the findings of this study , it could be argued that beram flap would be the free flap of choice for coverage of long soft tissue defect over extremities in males , and females beyond child - bearing age . owing to the significant scarring of abdominal wall , we would not recommend this flap for use in females of , or below child - bearing age . more studies , including dye injection studies , are warranted to more precisely define the safe distal limit of beram flap . larger prospective clinical studies along with long - term functional and quality of life evaluations are warranted to conclude that one flap is superior to other for reconstruction of extremity .

background : a soft tissue defect requiring flap cover which is longer than that provided by the conventional long free flaps like latissimus dorsi ( ld ) and anterolateral thigh ( alt ) flap is a challenging problem . often , in such a situation , a combination of flaps is required . over the last 3 years , we have managed nine such defects successfully with a free boomerang - shaped extended rectus abdominis myocutaneous ( beram ) flap . this flap is the slightly modified and free version of a similar flap described by ian taylor in 1983.materials and methods : this is a retrospective study of patients who underwent free beram flap reconstruction of soft tissue defects of extremity over the last 3 years . we also did a clinical study on 30 volunteers to compare the length of flap available using our design of beram flap with the maximum available flap length of ld and alt flaps , using standard markings.results:our clinical experience of nine cases combined with the results of our clinical study has confirmed that our design of beram flap consistently provides a flap length which is 32.6% longer than the standard ld flap and 42.2% longer than the standard alt flap in adults . the difference is even more marked in children . the beram flap is consistently reliable as long as the distal end is not extended beyond the mid - axillary line.conclusion:beram flap is simple in design , easy to harvest , reliable and provides the longest possible free skin / myocutaneous flap in the body . it is a useful new alternative for covering long soft tissue defects in the limbs .

SECTION 1. SHORT TITLE. This Act may be cited as the ``At-Risk Youth Protection Act of 2006''. SEC. 2. GRANTS TO REDUCE YOUTH AND GANG VIOLENCE. (a) Grants to SEAs.-- (1) In general.--The Secretary of Education may make grants to State educational agencies for the purpose of making subgrants to alternative schools or programs that agree to implement a community service requirement and thereby reduce youth and gang violence. (2) Application.--To seek a grant under this section, a State educational agency shall submit an application to the Secretary at such time, in such manner, and containing such information as the Secretary may require. (b) Subgrants to Alternative Schools or Programs.-- (1) In general.--A State educational agency receiving a grant under this section shall use the grant to make subgrants to alternative schools or programs that agree to require each secondary school student enrolled in the school or program-- (A) to perform not less than 100 hours of community service each school year; and (B) to receive training or counseling on conflict resolution as a prerequisite to performing such community service. (2) Application.--To seek a subgrant under this section, an alternative school or program shall submit an application to the State educational agency at such time, in such manner, and containing such information as the Secretary may require. (c) Definitions.--In this section: (1) The term ``alternative school or program'' means a public school or program designed to address student needs that typically cannot be met in regular schools because the student is at risk of education failure (as indicated by poor grades, truancy, disruptive behavior, pregnancy, or similar factors associated with temporary or permanent withdrawal from school). (2) The term ``community service'' means a method of service learning-- (A) under which the student involved learns and develops through active participation in thoughtfully organized and adult-supervised service that-- (i) is conducted in, and meets the needs of, a community; (ii) is coordinated with the student's alternative school or program, and with the community; and (iii) helps foster civic responsibility; and (B) that-- (i) is integrated into and enhances the academic curriculum of the student, or the educational components of the community service program in which the student is enrolled; and (ii) provides structured time for the student to reflect on the service experience. (3) The term ``institution of higher education'' has the meaning given to that term in section 101 of the Higher Education Act of 1965 (20 U.S.C. 1001). (4) The term ``secondary school'' has the meaning given to that term in section 9101 of the Elementary and Secondary Education Act of 1965 (20 U.S.C. 7801). (5) The term ``Secretary'' means the Secretary of Education. (6) The term ``State educational agency'' has the meaning given to that term in section 9101 of the Elementary and Secondary Education Act of 1965 (20 U.S.C. 7801). SEC. 3. COMMUNITY SERVICE DEDUCTION. (a) In General.--Part VI of subchapter B of chapter 1 of the Internal Revenue Code of 1986 (relating to itemized deductions for individuals and corporations) is amended by inserting after section 181 the following new section: ``SEC. 182. COMMUNITY SERVICE DEDUCTION. ``(a) Allowance of Deduction.--In the case of a business, there shall be allowed as a deduction an amount determined in accordance with subsection (b). ``(b) Amount of Deduction.--In the case of a business, the amount determined under this subsection, with respect to a taxable year, is the sum of-- ``(1) $750 per 100 hours of community service completed by a qualified student through such business during such taxable year, plus ``(2) $2,000 per qualified employee employed through such business. ``(c) Dollar Limitation.--In the case of a business, the amount determined under subsection (b)(1), with respect to each qualified student completing hours of community service through such business, shall not exceed $1,500. ``(d) Definitions.--For purposes of this section, with respect to a taxable year-- ``(1) Qualified student.--The term `qualified student' means a student enrolled in an alternative school or program (as defined in section 2(c) of the At-Risk Youth Protection Act of 2006) who performs community service through a place of business located not more than 20 miles from the location of the student's alternative school or program in order to comply with such school or program's community service requirement. ``(2) Qualified employee.--With respect to a business, the term `qualified employee' means a graduate of an alternative school or program (as defined in section 2(c) of the At-Risk Youth Protection Act of 2006) who completes 1 year of employment through such business during such taxable year. ``(3) Community service.--The term `community service' has the meaning given to such term in section 2(c) of the At-Risk Youth Protection Act of 2006. ``(e) Regulations.--The Secretary shall prescribe such regulations as may be necessary or appropriate to carry out the purposes of this section and to ensure that the community service completed by a qualified student through a business that is allowed a deduction under subsection (a) meets the requirements described in section 2(c) of the At-Risk Youth Protection Act of 2006.''. (b) Clerical Amendment.--The table of sections for part VI of subchapter B of chapter 1 of such Code is amended by inserting after the item relating to section 181 the following new item: ``Sec. 182. Community service deduction.''. (c) Effective Date.--The amendments made by this section shall apply to taxable years beginning after December 31, 2006.

At-Risk Youth Protection Act of 2006 - Authorizes the Secretary of Education to make grants to states for subgrants to alternative public schools or programs that serve the needs of students who are at risk of educational failure. Requires subgrantees to require their secondary school students to perform at least 100 hours of community service each school year and receive training or counseling on conflict resolution as a prerequisite to performing such service. Amends the Internal Revenue Code of 1986 to provide a tax deduction to a business of: (1) $750 per 100 hours of community service provided by such a student through such business during the taxable year; and (2) $2,000 for each graduate of such alternative school or program who completes one year of employment with such business.

this paper deals with the parametrically driven , repulsive nonlinear schrdinger ( nls ) equation : @xmath8 here @xmath0 is the strength of the parametric driving and @xmath9 is the damping coefficient . in the absence of damping , i.e. when @xmath10 , this equation has the same stationary bloch- and nel - wall solutions as the ( 2:1)-resonantly forced ginzburg - landau equation and the relativistic montonen - sarker - trullinger - bishop model @xcite . however , unlike the ginzburg - landau and the relativistic model , where only one of these solutions ( the bloch wall ) is linearly stable in their region of coexistence , the nls equation exhibits bloch - nel bistability . furthermore , both domain - wall solutions of the nls ( also known as dark solitons or kinks ) can move with constant velocity , and the moving walls also turn out to be linearly stable @xcite . this multistability is a rare phenomenon and leads one to wonder about the outcome of the soliton - soliton interaction . the problem that is of ultimate interest to a physicist , is formulated as follows : given an initial configuration of many different walls , will the asymptotic solution , as @xmath11 , consist of predominantly bloch walls , nel walls or possibly some other , more complicated , structures ? will the walls form widely spaced , equidistant lattices , or tightly bound clusters ? in this paper we make the first step towards answering these questions . when @xmath12 , equation ( [ nls ] ) still has a dark soliton solution ( in the form of the nel wall ) ; this solution was shown to be stable for all @xmath9 @xcite . our analysis of soliton interactions will naturally include the case of nonzero damping , especially in view of the wide range of applications of eq.([nls ] ) . equation ( [ nls ] ) was indeed derived in a broad variety of physical situations . in fluid dynamics , the repulsive ( `` defocusing '' ) parametrically driven nls describes the amplitude of the water surface in a vibrated channel with large width - to - depth ratio @xcite . ( the case of the small width - to - depth ratio gives rise to the attractive nls @xcite . ) the same equation arises as an amplitude equation for the upper cutoff mode in a chain of parametrically driven , damped nonlinear oscillators . in the optical context , it was derived for the doubly resonant @xmath13 optical parametric oscillator in the limit of large second - harmonic detuning @xcite . next , stationary solutions of eq.([nls ] ) with @xmath14 minimise the ginzburg - landau free energy of the anisotropic @xmath15-model . here @xmath16 , where @xmath17 and @xmath18 is the magnetisation vector whose nontrivial components serve as the real and imaginary parts of the complex field @xmath19 in ( [ nls ] ) : @xmath20 . this model appeared in studies of stationary domain walls in easy - axis ferromagnets near the curie point @xcite . _ nonstationary _ magnetisation configurations were considered in the overdamped limit : @xmath21 @xcite . the damped hamiltonian dynamics @xmath22 provides a sensible alternative ; this is precisely our equation ( [ nls ] ) . finally we note that eq.([nls ] ) also arises in a completely different magnetic context that of a weakly anisotropic easy - plane ferromagnet in a constant external magnetic field @xcite . here , the external field ( chosen parallel to the @xmath23-axis ) forces the magnetisation to be almost homogeneous , and eq.([nls ] ) describes small deviations @xmath24 from the uniform magnetisation @xmath25 . ( here @xmath26 is a small parameter . ) in the @xmath15-model , on the other hand , eq.([nls ] ) governs the magnetisation vector itself . the literature devoted to the interactions of dark solitons and kinks is quite extensive ( although perhaps not as vast as for bright solitons and pulses ) . kinks are known to attract antikinks in real - valued , single - component klein - gordon equations , such as the sine - gordon and @xmath27-theory @xcite , with and without damping terms @xcite . the same is true for kinks of the real ginzburg - landau equations @xmath28 these results admit simple interpretations ; the kink - antikink pair converges in order to minimise its total energy in the former case , and to minimise the value of its lyapunov functional in the latter . next , the dark solitons of the ( undriven ) nls equations are known to repel @xcite . this can also be understood as an attempt to minimise the energy of the pair , at the expense of the gradient of the phase . proceeding to the domain - wall solutions of the parametrically driven ginzburg - landau equation @xmath29 the bloch wall and antiwall of opposite chiralities were shown to attract , while those of like chiralities repel @xcite . ( here @xmath30 , the region of stability of bloch walls . ) the nel wall and antiwall always repel in their stability region ( @xmath31 ) @xcite . unlike the case without driving , the interpretation of these interactions is not straight - forward though . as for the driven nls equation , the behaviour of its bloch and nel walls is even less predictable at the intuitive level , while the variety of possible interacting partners is much wider due to the multistability . we will see that the interaction pattern is quite complicated indeed . the character of interaction ( repulsion vs attraction ) will depend both on the driving strength and the interwall separation . we will also show that it is influenced by stationary complexes of walls , stable and unstable . this paper constitutes the first part of our project ; here , we restrict ourselves to interactions of the walls of the same type , i.e. nel - nel and bloch - bloch interactions . the analysis of the nonsymmetric situations , i.e. nel - bloch interactions , requires a different mathematical formalism and will be presented separately . ( see the following publication @xcite . ) the dynamics of the _ repelling _ solitons is , in a sense , trivial : if the walls are initially at rest , they will simply diverge to the infinities . less obvious is what the collision of two _ attracting _ walls will result in . the study of the asymptotic ( as @xmath32 ) attractors arising in the parametrically driven nls constitutes the second objective of our work . we will show that if the dynamics are dissipative , then , depending on the strength of the driving , colliding walls either annihilate or form a stable stationary bound state . in contrast to this , undamped collisions will be found to always produce a breather , a spatially localised , temporally oscillating structure . depending on the initial conditions , the breather propagates or remains motionless , and in either case is found to persist indefinitely . the outline of this paper is as follows . the two fundamental solutions of eq.([nls ] ) , the bloch and nel wall , are introduced in the next section . for the analysis of the bloch - bloch and nel - nel interaction we use the variational method , under the assumption of well - separated walls . the method is detailed in section [ variational ] and the resulting finite - dimensional systems are analysed in sections [ neelvar ] , [ oppvar ] , and [ likevar ] . section [ neelvar ] deals with the nel walls ; section [ oppvar ] is devoted to the bloch walls of the opposite chirality , while the like - chirality walls are examined in section [ likevar ] . the conclusions of the variational analysis have been verified in direct numerical simulations of the full partial differential equation . the numerical simulations allow to advance beyond the limit of well - separated walls ; in particular , we use this approach to examine the outcome of soliton collisions . we have allocated a separate section ( section [ simulations ] ) to the nel - nel simulations while the bloch - bloch simulations are reported in sections [ oppvar ] and [ likevar ] , along with the corresponding variational results . the nontrivial attractors mentioned above the stationary bound state in the case of dissipative dynamics , and the breather in the undamped system are further investigated in sections [ dbs ] and [ breathers ] , respectively . finally , the main results of this work are summarised in section [ conclusions ] . dark solitons are localised patches of low intensity ( @xmath33 ) in a high intensity background ( @xmath34 ) . the admissible backgrounds are described by the stationary , spatially homogeneous nonzero solutions of eq.([nls ] ) , @xmath35 where @xmath36 as one can easily check , for @xmath37 the zero solution is the only stable background and so dark solitons can only exist for @xmath38 ; this is the condition we are implicitly assuming in this paper . it can be shown that @xmath39 is stable for all values of @xmath40 while @xmath41 is always unstable . we will only consider dark solitons existing over the stable background so that all solutions obey @xmath42 as @xmath43 . accordingly , @xmath44 stands for @xmath45 and @xmath46 for @xmath47 for the rest of the paper . it will be convenient to transform eq.([nls ] ) so that the asymptotic solution is independent of @xmath0 and @xmath9 . to this end , we set @xmath48 ( we have also rescaled the spatial dependence for later convenience . ) under this transformation , eq.([nls ] ) becomes @xmath49 this is the form of the parametrically driven , damped nls that we will be working with in this paper . the stable background solutions of eq.([nls2 ] ) are simply @xmath50 . solutions to eq.([nls2 ] ) with @xmath51 as @xmath52 can either be topological @xmath53 $ ] or nontopological @xmath54 $ ] . eq.([nls2 ] ) has two explicit topological solitons . the first is the nel , or ising , wall @xcite : @xmath55 named after the nel wall in magnetism , which is a domain wall with the magnitude of the magnetisation vector vanishing at its centre . the second topological solution , which exists only for @xmath14 , is usually referred to as the bloch wall @xcite : @xmath56 ( in magnetism , a bloch wall is a domain wall connecting the two domains smoothly , with the magnetisation vector remaining nonzero everywhere . ) in eq.([bloch ] ) , @xmath57 and @xmath58 the solutions obtained by multiplying @xmath59 and @xmath60 by @xmath61 will be called antiwalls , or antikinks . the bloch wall ( [ bloch ] ) exists in two chiralities . in the bloch wall with positive imaginary part , the phase of the complex field @xmath62 decreases ( that is , the point on the unit circle moves clockwise ) as @xmath63 varies from @xmath64 to @xmath65 . by analogy with the right - hand rule of circular motion , we refer to this wall as the right - handed bloch wall . the phase of the bloch wall with negative imaginary part increases as @xmath63 increases ( that is , the phase vector rotates counter - clockwise ) . this corresponds to a left - handed sense of rotation , so that this wall will be called the left - handed bloch wall . the antiwall obtained by multiplying @xmath60 by @xmath66 has obviously the same chirality as its parent wall , @xmath60 . regardless of their chirality , bloch walls only exist for @xmath67 . in ref.@xcite , it was proved that the nel wall is stable for all @xmath38 . the stability of the bloch wall in its entire domain of existence was demonstrated numerically @xcite . examples of _ nontopological _ dark solitons are given by stationary complexes , or bound states , of domain walls . these can be formed by two dissipative nel walls , or by a bloch and nel wall in the undamped situation . ( see @xcite . ) in condensed matter physics , these nontopological solitons describe bubbles of one thermodynamic phase in another one @xcite . accordingly , we will occassionally be referring to bound states of domain walls as solitonic bubbles . in this paper , we will be paying special attention to the simplest situation where the interacting walls are initially at rest . choosing the origin of the coordinate axis midway between two bloch or two nel walls , one can verify that the subsequent evolution will preserve this symmetric arrangement ( see below ) . a symmetric pair of well separated walls can be approximated by a product function [ ansatz ] @xmath68 where @xmath69 and @xmath70 represent the individual walls in the pair : @xmath71 } - i\kappa_1 \mbox{sech } [ { \cal b } ( x+z ) ] , \label{convenience1 } \\ \varphi_2(x , t)=\tanh{[{\cal b } ( x - z ) ] } + i\kappa_2 \mbox{sech } [ { \cal b } ( x - z ) ] . \label{convenience2 } \end{aligned}\ ] ] in eq.([ansatz ] ) , @xmath72 and @xmath73 are time - dependent parameters accounting for the deformation of the walls due to their interaction . the variable @xmath74 gives half the distance between the walls ; without loss of generality , we take @xmath23 to be positive . finally , the constant @xmath75 characterises the width of the walls ( @xmath76 for bloch walls and @xmath77 for nel walls ) . our analysis is based on the variational method . for this method , we substitute the ansatz ( [ ansatz ] ) into the action integral that gives rise to eq.([nls2 ] ) : @xmath78 where @xmath79 + \frac{i\gamma}{2 } \left[\psi^2 - ( \psi^*)^2\right ] - \frac{a^2}{2 } \right\ } dx . \label{lagrange}\ ] ] in what follows we introduce a small parameter @xmath80 . integrating off the explicit @xmath63-dependence in ( [ lagrange ] ) , produces a finite - dimensional lagrangian [ lll ] @xmath81 where @xmath82 \nonumber \\ - \frac{2\pi}{\cal b } ( \epsilon - 4\epsilon^2)\left[\dot{\kappa_1}(1-\kappa_2 ^ 2 ) + \dot{\kappa_2}(1-\kappa_1 ^ 2 ) \right ] , \label{tt } \end{aligned}\ ] ] and @xmath83\epsilon\kappa_1 \kappa_2 \\ + \frac{8}{3{\cal b } } \epsilon^2 \left [ 2a^2(4{\cal b } ^2 - 7 ) + ( 30a^2 - 5a^2 { \cal b}^2 -12)(\kappa_1 ^ 2 + \kappa_2 ^ 2 ) \right . \\ \left . + 2a^2 ( { \cal b}^2 - 11 ) \kappa_1 ^ 2\kappa_2 ^ 2 -4a^2(\kappa_1 ^ 4+\kappa_2 ^ 4 ) + 4a^2(\kappa_1 ^ 2+\kappa_2 ^ 2)\kappa_1 ^ 2\kappa_2 ^ 2 \right ] \\ + 16\epsilon^2 z \left [ 2a^2(1-{\cal b}^2 ) + ( a^2 { \cal b}^2 - 6a^2 + 4 ) ( \kappa_1 ^ 2 + \kappa_2 ^ 2 ) + 2a^2\kappa_1 ^ 2\kappa_2 ^ 2 \right ] + \frac{4\pi\gamma}{{\cal b } } \epsilon ( 1 - 4 \epsilon ) ( \kappa_1 + \kappa_2 ) ( 1+\kappa_1\kappa_2 ) . \label{vv } \end{gathered}\ ] ] [ in ( [ tt ] ) , the overdot indicates differentiation with respect to @xmath84 . ] the stationary action principle @xmath85 yields then the euler - lagrange equations for @xmath86 and @xmath23 . in deriving ( [ tt])-([vv ] ) we neglected all powers of @xmath26 higher than @xmath87 . one can readily check that such terms would produce only higher - order corrections in the resulting equations of motion . some comments must be made regarding the ansatz ( [ ansatz ] ) . after a variational ansatz has been substituted in the corresponding field lagrangian and the @xmath63-dependence integrated away , all dynamical variables ( or possibly their combinations ) can be grouped into canonically - conjugate pairs . ( see @xcite for review and references . ) in particular , if the waveform consists of _ two _ solitary waves and the separation between two constituents , @xmath88 , is chosen as one of the variables , the conjugate momentum is the phase gradient . this fact is well known in the case where the constituents are bell - shaped ( bright " ) solitons ( see e.g. @xcite ) . that it remains true in a more general situation can be seen from an analogy with quantum mechanics where the momentum of the system is given by an eigenvalue of the operator @xmath89 . ( since the eigenvalue has to be real , the operator acts just on the phase of the eigenfunction while the modulus is taken to be constant . ) another simple analogy arises if we write @xmath90 ; this polar decomposition casts eq.([nls ] ) with @xmath91 in the form of equations of gas dynamics , where @xmath92 is the density of the gas and @xmath93 is its velocity , proportional to the momentum . in the case of bright solitons , each constituent soliton in the ansatz is usually multiplied by @xmath94 ( see e.g. @xcite ) ; then , the momentum conjugate to @xmath23 is @xmath95 . however , in the case of kinks this simple recipe would violate the boundary conditions at infinity . for this reason we have introduced the phase gradient by allowing the imaginary parts @xmath96 $ ] of the kinks to be variable . the imaginary parts decay as @xmath97 and therefore making them variable is compatible with the boundary conditions . below , we will show that @xmath72 and @xmath73 are indeed momenta canonically conjugate to @xmath23 . another reason for introducing the phase gradient in this way is a simple interpretation of the finite - dimensional momenta @xmath72 and @xmath73 in terms of the original fields @xmath98 . indeed , these variables coincide , modulo a numerical coefficient , with the _ field momenta _ of the two walls . the field momentum integral has the form @xmath99 for the undamped nls [ equation ( [ nls2 ] ) with @xmath10 ] , the integral ( [ momentum ] ) is conserved . the field momentum of the nel wall ( [ neel ] ) equals zero , while that of the bloch wall ( [ bloch ] ) is given by @xmath101 . [ the same sign convention is used here as for eq.([bloch ] ) the top sign applies for the right - handed wall , while the bottom sign corresponds to the left - handed wall . ] it is not difficult to check that the field momenta of the perturbed walls @xmath69 and @xmath70 in the configuration ( [ ansatz ] ) are @xmath102=\pi \kappa_1 $ ] and @xmath103=-\pi \kappa_2 $ ] . in symmetric situations that we are concerned with , the variables @xmath72 and @xmath73 ( both of which are conjugate to the same coordinate variable @xmath23 ) will eventually turn out to be related due to the equations of motion . the calculations simplify , however , if this relationship is established yet at the level of the lagrangian ( [ lll ] ) , that is , before the equations of motion have been derived . the relationship between @xmath72 and @xmath73 depends on the type of walls being considered . if the initial configuration consists of two well - separated nel walls at rest , or two quiescent distant bloch walls of _ opposite _ chirality , we have a symmetry @xmath104 . since equation ( [ nls2 ] ) is parity - invariant , the subsequent evolution will preserve this symmetry . substituting the ansatz ( [ ansatz ] ) into @xmath105 , we get @xmath106 . the initial value of @xmath107 should be chosen close to zero for nel walls and close to @xmath108 for bloch walls [ with the sign of @xmath109 depending on whether the wall placed on the right is right- or left - handed . ] if the initial configuration consists of two quiescent bloch walls of _ like _ chirality , the relationship between @xmath72 and @xmath73 is not so trivial to establish . the reason is that equation ( [ nls2 ] ) _ does not _ preserve the symmetry @xmath110 of the initial condition . in this case we have to appeal to the field - momentum considerations rather than symmetries . substituting the ansatz ( [ ansatz ] ) into the integral ( [ momentum ] ) , we find that @xmath111 = \pi ( \kappa_1 - \kappa_2 ) [ 1 + \mathcal{o}(e^{-2 { \cal b } z})]$ ] . on the other hand , the total momentum of two like - chirality walls which are initially at rest and far away from each other , should be near @xmath112 . therefore , for moving walls the quantity @xmath113 must not be different from @xmath114 by more than @xmath115 . this is accomplished by letting @xmath116 and @xmath117 . when @xmath23 is large , the perturbation @xmath118 is small but not necessarily as small as @xmath26 . the euler - lagrange equations corresponding to eqs.([s_cal]),([lll ] ) are [ el_0 ] @xmath119 and @xmath120 in eq.([first el ] ) , we assumed the situation of @xmath121 ( that is , two nel or two oppositely - handed bloch walls ) . in the other case , i.e. when we have two bloch walls of like chirality , @xmath122 should be replaced by @xmath123 in eq.([first el ] ) . the integrals @xmath124 and @xmath125 can both be found explicitly and simplified assuming wide separation of the walls . finally , we note that the variational method is not well suited for the analysis of the bloch - nel interaction . the reason for this is that the bloch and nel walls have different widths , leading to terms in the lagrangian which are not periodic along the imaginary axis on the plane of complex @xmath63 ; as a result , the lagrangian can not be obtained in closed form . ( when the walls have the same width , the integrals can all be evaluated by integration along the rectangular contour with one side on the real axis and the other on the line @xmath126 . ) consequently , we had to resort to a different approach for the analysis of the nel - bloch interaction ( see paper ii of this project @xcite . ) the resulting phenomenology is also very different @xcite . in this case , we let @xmath127 and @xmath128 . in equations ( [ el_0 ] ) we discard products of powers of small quantities @xmath26 and @xmath122 for which there are larger counterparts . for instance , we drop a term proportional to @xmath129 from an equation which already has a term @xmath130 with a nonsmall coefficient . here we keep in mind that in some cases the damping @xmath9 and the difference @xmath131 can be small parameters , hence we can not drop @xmath129 in favour of the term @xmath132 or @xmath133 . with these simplifications , equations ( [ first el])-([second el ] ) take the form [ general ] @xmath134 the subsequent analysis depends on the relation between the damping and driving in the system . first we consider the case where @xmath9 is not small . assume , in addition , that @xmath136 is not close to @xmath137 . ( later in this subsection we will explore the situation where @xmath131 is small . ) in this case the terms in the second lines of ( [ 31 ] ) and ( [ 30 ] ) are smaller than those in the first lines and can be neglected . the equations simplify to [ ga_large ] @xmath138 since @xmath122 is small , the variable @xmath139 varies very slowly , @xmath140 . on the other hand , the variable @xmath141 will initially change on a much faster scale . within the time @xmath142 it will zap " onto the nullcline @xmath143 after which the point @xmath144 will be slowly moving along this parabola . according to eq.([ga_large_1 ] ) , it will move towards greater @xmath26 ( i.e. the separation @xmath145 will decrease ) if @xmath146 and to smaller @xmath26 if @xmath147 . that is , the walls will attract if @xmath146 and repel if @xmath147 . note that this criterion is consistent with results for the undamped , undriven case ( @xmath10 , @xmath148 ) where the dark solitons are known to repel @xcite . since the above criterion has been derived under the assumption that @xmath136 is not very close to @xmath149 , the value @xmath150 provides only a rough watershed between the two types of interaction . in order to establish a more accurate borderline , we zoom in on a narrow strip along the line @xmath150 on the @xmath151-plane . assuming that @xmath152 is small ( while @xmath9 is not ) , eq.([ga_large_1 ] ) should be replaced by @xmath153 substituting ( [ parabola ] ) into ( [ 310 ] ) and dropping an @xmath154 term , we obtain a one - dimensional dynamical system @xmath155 when @xmath156 , @xmath139 tends to zero for all @xmath157 . for @xmath158 , the system ( [ bsg ] ) has a stable fixed point at @xmath159 this fixed point corresponds to a stable bound state of two nel walls . when @xmath136 approaches @xmath149 , the distance @xmath160 between the walls in this bound state tends to infinity and so the bound state does not exist for @xmath136 smaller than @xmath149 . this means that @xmath161 is , in fact , an _ accurate _ borderline between the two types of behaviour . for @xmath156 , two walls repel whereas for @xmath146 , the walls attract except for @xmath136 close to @xmath149 , in which case they form a stable bound state . we should emphasise here that our present conclusions pertain only to distant walls . in order to extend our understanding of the nel wall dynamics beyond the limit of _ very _ small @xmath26 , one has to analyse the dynamical system ( [ general ] ) without neglecting any powers of @xmath26 and @xmath122 in it . this will be done numerically in section [ numerical_fp ] below . we will show , in particular , that in addition to the stable bound state of two walls , there is also an unstable complex at a shorter distance . when @xmath9 is small , the system ( [ general ] ) becomes [ small_gamma ] @xmath163 for either sign of @xmath164 , the origin is the only fixed point in the system . noting that the @xmath122-axis ( @xmath165 ) is an invariant manifold flowing into the fixed point and calculating the index of the vector field ( [ small_gamma ] ) along the semicircle @xmath166 , @xmath167 , with @xmath168 , we conclude that the fixed point is a stable node for @xmath156 and a saddle for @xmath146 . hence , for @xmath156 , all trajectories tend to the origin as @xmath32 [ fig.[ibfig1](a ) ] , i.e. , the walls repel . for @xmath146 , all trajectories fly away to infinity [ fig.[ibfig1](b ) ] implying the attraction of the walls . one may wonder whether some trajectories coming from the lower half of the phase plane , could flow into the origin ( tangent to the vertical axis . ) a simple analysis of trajectories in a small neighbourhood of the origin shows that such behaviour is , in fact , impossible . trajectories which seem to be approaching the point @xmath169 close to the @xmath122-axis , do turn away when they are a small distance away from the origin . this is illustrated by fig.[ibfig1](c ) which gives a blow - up of a small neighbourhood of the fixed point . in the next subsection , we will zoom in on a small neighbourhood of @xmath170 to draw a sharper boundary between domains of the opposite types of interaction similar to the way we have done it for large @xmath9 . we should also mention here that , as in the previous subsection , our current conclusions pertain to walls with large separations . the undamped case , @xmath171 , is exceptional ; in this case , the entire @xmath122-axis is a line of fixed points they represent pairs of infinitely separated walls moving at constant velocities . for @xmath156 , the points with @xmath172 are stable and those with @xmath173 unstable . trajectories have the form of arcs starting on the lower semiaxis and flowing into points on the upper semiaxis : @xmath174 , @xmath175 as @xmath11 [ fig.[ibfig11](a ) ] . the separation between the walls corresponding to the points on the upper semiaxis grows linearly : @xmath176 ; that is , the evolution produces two nel walls moving away from each other at a constant speed . in the undamped case with @xmath146 , the stable points are those with @xmath177 and unstable those with @xmath172 . since @xmath178 on the horizontal axis ( where @xmath179 ) , trajectories starting on the upper semiaxis can not cross to the negative-@xmath122 half - plane and have to escape to the positive-@xmath122 infinity : @xmath180 , @xmath181 as @xmath182 . the same is true for trajectories that have arrived from the negative-@xmath122 half - plane . invoking the reversibility of the system ( [ small_gamma ] ) with @xmath10 , i.e. making use of the invariance under @xmath183 , @xmath184 , completes the phase portrait [ fig.[ibfig11](b ) ] . to interpret the portrait , we note that @xmath122 is proportional to @xmath185 , the velocity of the wall [ see eq.([small_gamma_1 ] ) ] . according to fig.[ibfig11](b ) , two walls with zero initial velocities [ @xmath186 will attract [ @xmath187 as @xmath11 ] . the same applies , naturally , to the walls whose initial velocities are directed towards each other [ @xmath189 , and to walls with small outward initial velocities [ @xmath190 . however , walls with sufficiently large outward initial velocities will diverge [ @xmath191 , with the separation growing linearly : @xmath192 as @xmath11 . ( here @xmath193 . ) the dashed line in fig.[ibfig11](b ) is a separatrix between initial conditions giving rise to the above two scenarios . finally , it is worth mentioning that when @xmath10 , equations ( [ el_0 ] ) with @xmath194 and @xmath127 form a hamiltonian system ( with a nonstandard bracket ) : @xmath195 where @xmath196 and the hamiltonian @xmath197 \\ + \frac83 \epsilon^2 [ 3a^2 + ( 12 - 25a^2)\kappa^2 + 14 a^2 \kappa^4 -4a^2 \kappa^6 ] \\ + 16\epsilon^2 z \kappa^2 ( 5a^2 - 4-a^2 \kappa^2 ) . \nonumber \ ] ] this observation endows @xmath122 with a simple interpretation of the momentum canonically conjugate to @xmath23 in agreement with qualitative arguments in section [ variational ] . finally , let us assume that _ both _ @xmath198 and @xmath9 are small . here , equations ( [ general ] ) are to be replaced by [ revvy ] @xmath199 note that we have neglected the term proportional to @xmath200 in the second line of ( [ 30 ] ) . when @xmath201 , this is justifiable as this term is of the same sign as the last term in the right - hand side of ( [ 30 ] ) and so it can not alter the dynamics qulitatively . the validity of this approximation for @xmath202 will be established below . the dynamics is influenced by nontrivial fixed points which arise as intersections of the nullclines of the system ( [ revvy ] ) : [ cline ] @xmath203 here we have introduced @xmath204 the nullcline ( [ cline2 ] ) emanates out of the origin as a parabola : @xmath205 as @xmath206 ; turns back and escapes to infinity asymptotic to the positive @xmath122-axis : @xmath207 as @xmath206 . importantly , it has no points in the @xmath208 , @xmath209 quadrant . the nullcline ( [ cline1 ] ) consists ( apart from the vertical and horizontal axes ) of a parabola lying on a side : @xmath210 . intersections of these nullclines are easy to determine and visualise , and the stability of the fixed points can be classified by straightfoward index arguments . when @xmath211 , there is only one nullcline intersection in the positive-@xmath26 halfplane . it is not difficult to check that this fixed point is a saddle . the origin is also a fixed point a stable node . the portrait is in fig.[fig2](a ) . distant walls [ more precisely , walls with initial conditions lying below the stable manifold of the saddle in fig.[fig2](a ) ] repel : @xmath174 as @xmath212 . on the other hand , nearby walls ( more precisely , those above the stable manifold ) attract : @xmath213 . as @xmath214 grows through zero , another fixed point appears from the negative-@xmath26 half - plane . an exchange of stabilities occurs at @xmath215 : the nontrivial point appearing for @xmath216 is a stable node whereas the origin becomes a saddle . the nearby walls attract while distant walls form a stable bound state [ fig.[fig2](b ) ] . as @xmath214 is increased further , the two nontrivial fixed points merge in a saddle - node bifurcation . when @xmath217 , the origin persists as the only fixed point in the system ( an unstable one ) . all walls attract [ fig.[fig2](c ) ] . note that the logarithmic term in ( [ 30 ] ) that was omitted in ( [ reviso ] ) , becomes of the same order as the last term in the right - hand side of ( [ 30 ] ) only if @xmath218 , i.e. when @xmath26 is as small as @xmath219 . however , since the nullcline ( [ cline1 ] ) is bounded from the vertical axis by the inequality @xmath220 , there can be no fixed points with @xmath221 . therefore the logarithmic term can have no significant effect on the dynamics and its omission is totally legitimate . to find the threshold @xmath222 , we eliminate @xmath122 between ( [ cline1 ] ) and ( [ cline2 ] ) . the resulting equation can be written as @xmath223 if @xmath214 is positive , the function @xmath224 in the left - hand side of ( [ pi9 ] ) grows to infinity as @xmath225 and @xmath181 , and has a minimum at @xmath226 . the minimum value is @xmath227 , where @xmath228 is a numerical coefficient . consequently , eq.([pi9 ] ) has no roots if @xmath229 and two roots if @xmath230 . according to eq.([pi9 ] ) , when @xmath9 grows , the smaller " ( stable ) fixed point tends to @xmath231 ; this reproduces eq.([separa ] ) of subsection [ both_large ] . these considerations translate into the following criterion valid for small @xmath9 and small differences @xmath164 . [ we are also assuming that the imaginary parts of the perturbation of the walls are small initially , i.e. @xmath109 is small . ] the direction of forces between the walls depends on their position relative to two stationary bound states , a stable ( with the interwall separation denoted @xmath232 ) and an unstable one ( with the separation @xmath3 ) . the unstable complex exists for all @xmath233 while the stable one only for @xmath234 , where @xmath235 in their region of coexistence ( @xmath234 ) , the stable complex has a larger separation : @xmath236 . as @xmath237 , the distance @xmath232 grows to infinity . when @xmath156 , two nel walls repel if their separation distance is greater than @xmath238 . if the initial separation is smaller than @xmath238 , the walls attract . it is natural to expect that the attraction should result in the annihilation of the walls , but this diagnosis is beyond the scope of the variational approximation and can only be established in direct numerical simulations of the full partial differential equation ( [ nls2 ] ) ( see below ) . next , if @xmath234 , the walls with separations larger than @xmath238 will move towards the stable equilibrium [ from inside or outside depending on whether @xmath239 or @xmath240 . the walls at shorter distances , @xmath241 , are attracted to each other ; they converge and , apparently , annihilate . finally , for @xmath242 , the walls are attracted to each other . no complexes , stable or unstable , can be formed for these large @xmath44 . like in the large-@xmath243 situation , the undamped case ( @xmath10 ) is exceptional in the small-@xmath243 region . in this case , the whole @xmath122-axis is a line of fixed points . when @xmath216 , the phase portrait [ fig.[fig3](b ) ] is similar to fig.[ibfig11](b ) . the walls which are initially at rest [ @xmath186 , attract ( @xmath181 as @xmath32 ) . as for the _ moving _ walls with large separations , their initial velocities are determined by @xmath109 : @xmath244 . \label{z_dot}\ ] ] if the walls are initially diverging sufficiently fast , they will continue to do so , with @xmath245 the portrait for @xmath211 is in fig.[fig3](a ) . restricting our analysis to small @xmath246 , we observe that walls with large separations repel and small separations attract . this is true both for initially quiescent and slowly moving walls . as we have seen in section [ neelvar ] , distant walls with @xmath146 are attracted to each other . whether the attracting walls are going to form a stable bound state or collide and annihilate , depends on two factors : ( i ) whether a stable and unstable bound states exist for the corresponding @xmath9 and @xmath136 , and if yes , then ( ii ) how the initial interwall separation compares with @xmath238 , the interwall separation in the unstable complex . for small @xmath9 , the region where the two complexes exist was found to be @xmath247 , with @xmath248 as in eq.([ac_ga ] ) . in order to classify the outcomes of the wall attraction , we need to demarcate the corresponding region for nonsmall @xmath9 as well . the one - dimensional dynamical system ( [ bsg ] ) has only one , _ stable _ , fixed point . in order to describe the _ unstable _ complex ( which is bound tighter than the stable one , i.e. has a greater @xmath26 ) , it is sufficient to retain the next , @xmath154 , term in eq.([310 ] ) when we substitute ( [ parabola ] ) for @xmath122 . however , despite capturing both the stable and unstable bound states , the system ( [ parabola])-([310 ] ) will not produce any reasonably - accurate description of the saddle - node bifurcation where the two fixed points merge and disappear . one reason for this is that the term @xmath249 in eq.([31 ] ) which was dropped from eq.([310 ] ) , becomes _ larger _ than @xmath250 when we substitute ( [ parabola ] ) for @xmath122 . another problem is that eq.([parabola ] ) keeps only the leading term in the @xmath251 expansion ; retaining the next , @xmath252 , term in @xmath251 produces another term larger than @xmath250 in eq.([bsg ] ) . thus , in order to obtain an accurate variational description of the saddle - node bifurcation , we need to return to the original , nonreduced , vector field ( [ general ] ) . denoting @xmath253 and @xmath254 the right - hand sides of ( [ 31 ] ) and ( [ 30 ] ) , the two fixed points arise as intersections of the nullclines @xmath255 the nullclines have a common tangent when @xmath256 using a standard numerical routine to solve the system ( [ null_int])-([com_tan ] ) for the vector of unknowns @xmath257 , one can find the saddle - node value @xmath258 for each @xmath9 . the resulting curve @xmath259 is shown in fig.[edash2 ] below ( the dotted line ) , where it is compared to the data from the numerical continuation of the wall complexes as solutions to eq.([nls2 ] ) . the significance of the curve is that it provides a borderline between the two dynamical scenarios : for @xmath260 , two nel walls attract each other and annihilate ; for @xmath261 , the walls attract and annihilate if the initial separation @xmath241 and form a stable bound state if @xmath262 . note that the above numerical result is valid both for large _ and _ small @xmath9 . for small @xmath9 , our numerical curve @xmath263 is reproduced by the explicit formula ( [ ac_ga ] ) . we conclude this section by mentioning that the _ unstable _ fixed point exists for all @xmath264 for which there are nel walls , i.e. for @xmath265 . this is a result of the numerical study of the system ( [ null_int ] ) with @xmath9 varying from @xmath266 to @xmath267 in steps of 0.01 , and @xmath136 varying from @xmath267 to @xmath149 in steps of 0.001 . the reservation that we should make here , however , is that when @xmath9 tends to 0 and , simultaneously , @xmath136 tends to 1 , the coordinate @xmath122 of the saddle point approaches a value of order 1 . this contradicts the assumptions we made in the derivation of the system ( [ general ] ) and so the fixed point in this parameter region can not represent any bound states of the walls . ( the value of the @xmath122-coordinate is reasonably small only when @xmath9 is greater than 0.5 or when @xmath131 is smaller than 0.01 . ) consequently , the variational analysis can not provide a trustworthy description of the small - distance dynamics of the walls in the @xmath268 , @xmath269 region . the direct numerical simulations of the full nls equation ( [ nls2 ] ) seem to be the only reliable source of information here . in the previous section we showed that two bound states of nel walls , a stable and an unstable one , exist in certain parts of the @xmath270-plane . here , we will reobtain these solutions numerically , demarcate their regions of existence and compare these to the corresponding variational results . we will be using the term solitonic bubble " as a synonym for the wall complex . treating bound states as independent soliton - like entities is meant to emphasise the significance of these stationary solutions as possible attractors in the phase space ; also , it should reflect their different , nontopological , nature . in fact , when the complex is tightly bound , it looks more like a single entity than a wall doublet ; see fig.[bubble ] . our approach here is based on the numerical continuation ( path - following ) of the stationary bubbles as solutions to the ordinary differential equation @xmath271 the variational approximation ( [ ansatz ] ) with parameters found in subsection [ small_small ] was used as an initial guess for the numerical solution at small @xmath9 and @xmath272 ; this , in turn , served as a starting point for our continuation . we classified the stability of the resulting stationary complexes as solutions of the full partial differential equation ( [ nls2 ] ) , by linearising about the solution and examining the spectrum of the linearised operator numerically . to present results of the continuation graphically , we use the energy functional @xmath273 although the quantity defined in eq.([energy ] ) is not conserved for nonzero @xmath9 , the energy can be used as a bifurcation measure for stationary solutions . [ the field momentum ( [ momentum ] ) is not suitable for this purpose as it satisfies @xmath274 and so all stationary solutions with @xmath12 have the same , zero , momentum . ] a typical pair of bifurcation diagrams ( corresponding to the separate continuations in @xmath0 and @xmath9 ) is presented in fig.[edash1 ] . [ fig.[edash1 ] corresponds to @xmath275 ( main frame ) and @xmath276 ( inset ) ; the continuations for other fixed values of @xmath9 and @xmath0 produce curves of similar shape ] . each diagram consists of two branches ; the entire branch with higher energy is found to be linearly stable . the solutions on the lower branch are found to be unstable ; the instability is associated with a ( single ) positive real eigenvalue . numerical simulations of the full time - dependent pde ( [ nls2 ] ) show that when perturbed , the unstable bubbles decay to the flat solution . as we approach the termination point of the top branch , the separation of the walls becomes infinite . the termination point satisfies @xmath277 ( i.e. @xmath278 ) therefore , this solution reproduces the stable bound state detected by the variational method ( sections [ both_large ] , [ small_small ] ) . the solution on the lower branch corresponds to the unstable complex . we note that this lower branch can be continued all the way to @xmath279 , in agreement with variational results in section [ numerical_fp ] . the walls pull closer together as we move towards the turning point along the upper branch ( in the main frame of fig . [ edash1 ] ) . as we continue away from the turning point along the bottom branch , the distance between the walls continues to decrease , reaches a minimum , and then starts increasing . this nonmonotonicity can be explained in terms of the fixed points of the dynamical system ( [ revvy ] ) . the existence and stability of the bound states is summarised in fig.[edash2 ] . this figure charts the @xmath280-plane into regions of different type of interaction between the walls . in the shaded region and above it , distant walls attract each other . the attraction may result in the creation of a stable bound state at some finite separation ; this happens in the shaded domain . [ the formation of the bound state is illustrated in fig.[simulationpics2](c ) below . ] above the shaded corridor , two attracting nel walls are expected to collide and annihilate . finally , in the region between the shaded area and the bisector line @xmath281 , two nel walls at large separation repel . in fig.[edash2 ] , we also display the variational results for the saddle - node bifurcation curve @xmath282 . the dotted line in the main frame gives the result of solution of the system of three equations ( [ null_int])-([com_tan ] ) while the dotted line in the inset was plotted using eq.([ac_ga ] ) . the variational results are seen to be in good agreement with the outcome of the numerical continuation . conclusions of the variational analysis were verified in direct numerical simulations of the nls equation ( [ nls2 ] ) . we used a split - step pseudospectral method @xcite , with @xmath283 fourier modes on the interval @xmath284 . the numerical scheme is stable for the timesteps @xmath285 ; accordingly , we set @xmath286 . the method imposes periodic boundary conditions . the initial condition had the form ( [ ansatz ] ) where @xmath72 and @xmath73 were set equal to zero . the results are shown in figs.[simulationpics2 ] , where we have `` zoomed in '' on the solitons neglecting the flanks of the simulation interval . to verify the diagram of fig.[edash2 ] , we examined three sequences of points on the @xmath270-plane : one just above the shaded region , one just below it , and one inside . the sequence just above the saddle - node line consisted of ten points @xmath287 with @xmath288 . for each pair of parameter values , we examined the initial separations @xmath289 and @xmath290 . the results were in agreement with the diagram of fig.[edash2 ] : all simulations gave rise to the convergence of the walls . for @xmath12 , this resulted in the annihilation of the walls [ fig.[simulationpics2](a ) ] while in the dissipation - free case , the convergence of the walls ended in the formation of a nonpropagating breather [ fig.[simulationpics2](b ) ] . the sequence just below the line @xmath291 consisted of @xmath292 with @xmath293 . in the @xmath10 case , the walls separated by @xmath294 were observed to repel whereas those placed at a smaller distance @xmath295 , attracted and formed a nonpropagating breather . these results are in agreement with the variational analysis [ see fig.[fig3](a ) ] . when @xmath9 is nonzero , the initial separations @xmath296 and @xmath297 gave rise to the repulsion of the walls . in order to observe the attraction , we had to reduce the initial distance to @xmath298 for @xmath299 ; to @xmath300 for @xmath301 and to @xmath302 for @xmath303 . these observations are consistent with the fact that @xmath304 , the separation in the unstable complex , becomes smaller as @xmath9 grows . finally , the sequence of points through the dashed region in fig.[edash2 ] included @xmath305 with @xmath306 . for these values of @xmath0 , the variational method predicts a tightly bound stable complex of two walls and indeed , in all eight cases the walls with initial separations @xmath289 and @xmath290 moved towards each other and formed a stable bound state at a certain smaller distance [ fig.[simulationpics2](c ) ] . thus the simulations of the nel wall interactions are in agreement with our expectations for distant - wall dynamics summarised in fig.[edash2 ] . proceeding to the analysis of bloch walls , we remind the reader that the bloch walls exist only for @xmath14 and @xmath67 ; these will be our assumptions in this section . here , we consider the interaction of two bloch walls of opposite chiralities ( i.e. with total field momentum @xmath307 ) . the corresponding lagrangian arises by setting @xmath194 and @xmath308 in eq.([lll ] ) . the resulting equations of motion can be cast in the form of a hamiltonian system @xmath309 where @xmath310 is given by eq.([tau ] ) , and the hamiltonian @xmath311 \\+16 a^2 \epsilon^2 z ( 2 \kappa^2 -\kappa_0 ^ 2- \kappa^4 ) , \label{hamiltonian_bb}\end{gathered}\ ] ] with @xmath312 and @xmath313 as in ( [ kappa_0 ] ) . trajectories of the system ( [ h_eqs_b ] ) are simply level curves of the function @xmath314 . when the interwall separation is large , @xmath122 should be close to its unperturbed value : @xmath315 or @xmath316 , where @xmath313 is , in general , @xmath317 , but becomes small when @xmath0 is near @xmath318 . in the derivation of the variational equations , we assumed that the walls are well - separated and each wall is close to its unperturbed form . therefore , only regions around the fixed points ( @xmath319 ) and ( @xmath320 ) can be interpreted within the pde ( [ nls2 ] ) with full certainty . ( trajectories outside those regions may also have infinite - dimensional counterparts but this requires verification using direct numerical simulations of the full pde ) . note that @xmath321 is the value of the imaginary part of the right - handed bloch wall at its center [ see eq.([bloch ] ) ] , and @xmath322 is the imaginary part of the left - handed bloch wall at its center . therefore , the point ( @xmath319 ) represents a configuration of the right - handed wall at @xmath323 and the left - handed antiwall at @xmath324 . the point ( @xmath320 ) corresponds to the left - handed wall at @xmath325 and the right - handed antiwall at @xmath324 . assume , first , that @xmath0 is not close to @xmath266 or @xmath326 . when @xmath26 is small and @xmath122 is close to @xmath108 ( which are not small ) , terms in the third and second lines in ( [ hamiltonian_bb ] ) are much smaller than the second term in the first line , and can be safely disregarded . the resulting dynamical system @xmath327 does not have fixed points with nonzero @xmath26 and @xmath122 ; on the other hand , the entire @xmath122-axis is a line of nonisolated fixed points . all these points describe pairs of walls moving with constant velocities @xmath328 , where @xmath329 points on the positive-@xmath122 semiaxis with @xmath330 are stable and those with @xmath331 unstable . points on the negative-@xmath122 semiaxis with @xmath332 are stable and those with @xmath333 unstable . ( see fig.[schweik ] . ) consequently , walls with large initial separation [ @xmath157 near @xmath266 ] and @xmath335 diverge to infinities ( @xmath206 ) , whereas distant walls with @xmath336 converge . as for the pairs of walls whose separation is not very large , the situation is straightforward for the walls which are not moving initially [ @xmath337 ; the corresponding initial conditions lie on the straight lines @xmath338 ( dashed lines in fig.[schweik ] . ) these initial conditions give rise to the convergence of the walls ( i.e. @xmath26 grows as @xmath212 ) . otherwise , the type of interaction depends on whether the point @xmath339 lies to the left or to the right of the heteroclinic trajectory [ the trajectory which connects the point @xmath340 to @xmath341 this trajectory is tangent to the vertical axis in fig.[schweik ] . ] these variational conclusions are in agreement with direct numerical simulations of the full pde ( [ nls2 ] ) . ( we employed the same numerical method as described in section [ simulations ] . ) the initial condition was chosen in the form of two bloch walls of the opposite chirality which are initially at rest , i.e. eq.([ansatz ] ) with @xmath342 . the initially quiescent walls have always been observed to attract ; see fig.[simulationpics1 ] . when @xmath0 is close to @xmath326 , @xmath313 is small ; since @xmath122 is assumed to be in the vicinity of @xmath108 , we can not neglect terms in the third and second lines in ( [ hamiltonian_bb ] ) in favour of the first line . however , it is sufficient to keep just the leading term ( the term proportional to @xmath343 in the second line ) . a straightforward analysis reveals then that the situation here is similar to the one considered above : there are no fixed points with small nonzero @xmath26 , while the @xmath122-axis is a line of nonisolated fixed points , stable for @xmath344 and unstable otherwise . therefore the phase portrait for small @xmath26 and @xmath122 is similar to the one above . when @xmath0 is close to @xmath266 , the last term in the first line of ( [ hamiltonian_bb ] ) becomes small and hence no terms in the third and second lines can be discarded . in this case , the dynamics can be analysed by plotting level curves of @xmath345 using standard software . the same approach was adopted to study the vector field outside the small-@xmath26 region . the resulting phase portrait is shown in fig.[schweik ] for @xmath346 ; the portrait does not undergo any qualitative transformations as @xmath0 is increased up to @xmath326 or decreased down to @xmath266 . a striking feature of fig.[schweik ] is the existence of three families of closed orbits : one centred on a point with @xmath347 ; a mirror - reflected family centred on a point with @xmath348 ; and a family of closed trajectories centred on a point on the horizontal axis . the closed trajectories centered on the fixed point with @xmath347 represent a family of breather solutions of the nls ( [ nls ] ) ( and so do their mirror - reflected twins ) . these breathers have been observed in our numerical simulations of the full partial differential equation ( [ nls2 ] ) ; see fig.[simulationpics1 ] . they can also be constructed perturbatively ( see section [ breathers ] below ) . the nonlinear - center fixed point is sandwiched between two saddles , one below it ( clearly visible in fig.[schweik ] ) and one above . as @xmath0 is decreased , the two saddle points approach each other . as a result , the periodic orbits are compressed in the vertical direction , and , as @xmath0 reaches zero , the family of closed trajectories degenerates into a segment of the straight line @xmath349 . the closed loops about a nonlinear - centre fixed point with @xmath179 represent another family of temporally - periodic solutions . since the value of @xmath122 for a free - standing wall ( i.e. @xmath313 ) is close to zero only when @xmath0 is close to @xmath326 , the family centred on @xmath179 admits a reliable interpretation only in this limit . when @xmath350 , the center point has the coordinate @xmath351 ; as @xmath0 grows to @xmath326 , the centre moves towards the origin so that the family of closed orbits shrinks to a single point @xmath165 , @xmath179 . for @xmath0 close to @xmath326 , i.e. in the region where these solutions can be interpreted in terms of the two - wall ansatz ( [ ansatz ] ) , the closed trajectories describe a pair of bloch walls of opposite chiralities executing periodic oscillations of their separation ( but remaining far away from each other . ) these oscillatory doublets " have not yet been observed in direct numerical simulations and their existence remains an open problem . ( see the concluding section for a possible explanation of the nonvisibility " of these objects . ) finally , we examine the case of a pair of bloch walls ( more precisely , a wall and an antiwall ) of the same chirality . as in the previous section , we let @xmath14 and consider @xmath352 . assume , for definiteness , that we have a right - handed pair . when at rest , the well - separated wall and antiwall have equal ( nonzero ) momenta @xmath353 where @xmath313 is as in ( [ kappa_0 ] ) . when the walls start moving as a result of their interaction , the total momentum remains the same and hence the individual field momenta of the two walls will change by the same amount : one will become @xmath354 and the other one @xmath355 . this means that one of the walls will have the amplitude of its imaginary part increase by @xmath123 and the other one decrease by @xmath123 , and so we will not have a symmetric configuration of an equal - amplitude wall and antiwall any longer . therefore one may question the validity of our assumption that the two walls remain equal distance away from the origin for @xmath356 . to see that the equal - distance ansatz ( [ ansatz ] ) remains valid at least for not too late times we note that the velocity - momentum curve @xmath357 of a single bloch wall has a nonzero slope at the point @xmath358 , @xmath359 ( see @xcite ; the curve is also reproduced in part ii of the present series of papers @xcite ) . this means that the wall whose momentum has increased by @xmath360 , acquires the velocity @xmath361 , while the wall whose momentum has decreased by @xmath360 , starts moving with the velocity @xmath362 where @xmath363 . accordingly , if two walls are equal distance from the origin initially , they will remain equally far from the origin for all @xmath364 . this symmetric arrangement will break down only if @xmath365 is very large or if @xmath366 is very small , in which case one would have to take into account deviations of the shape of the @xmath357 curve from a straight line . the derivative @xmath366 tends to zero only if @xmath367 and indeed , numerical simulations do reveal nonsymmetric motion of like - chirality walls when @xmath0 is very close to @xmath326 ( see below ) , but outside this narrow region the symmetric ansatz ( [ ansatz ] ) remains valid . letting @xmath368 , @xmath369 and @xmath76 in the lagrangian ( [ lll ] ) , we get equations describing the dynamics of two like - chirality bloch walls . these can be written as a hamiltonian system [ hami_b ] @xmath370 where @xmath371>0 \ ] ] and the hamiltonian @xmath372 \\ + 16 \epsilon^2 z [ 4h\kappa_0 ^ 2 + 4(1-h ) q^2-a^2 q^4 ] . \label{h_like}\end{gathered}\ ] ] assume , first , that @xmath0 is not close to @xmath326 , so that @xmath313 is not a small quantity . in this case the hamiltonian ( [ h_like ] ) with small @xmath26 and @xmath123 is dominated just by two terms , @xmath373 as in the previous section , the @xmath123-axis in this case is a line of nonisolated fixed points . since @xmath374 , points with @xmath375 and @xmath376 represent pairs of converging and diverging walls , respectively . the trajectories are parabolas @xmath377 ; they start at points on the positive-@xmath123 semiaxis and flow into points on the negative-@xmath123 semiaxis . this implies that the initially diverging walls continue to diverge whereas the walls initially moving towards each other shall stop at some finite separation , and then repel to infinities . ( a simple but practically important situation concerns walls which are initially at rest ; these will obviously start repelling straight away . ) the above conclusion applies , of course , only to slowly moving walls which are sufficiently far from each other [ i.e. @xmath157 and @xmath378 are small ] . fig.[like](a ) displays a typical result of direct numerical simulation of the interaction of two like - chirality bloch walls within eq.([nls2 ] ) . we tested several values of @xmath0 and a variety of @xmath379 . the initial condition was taken in the form ( [ ansatz ] ) with @xmath380 and @xmath381 . in agreement with conclusions of the variational analysis , the initially quiescent walls were observed to repel for all @xmath0 not very close to @xmath326 . ( the case of @xmath0 close to @xmath326 is discussed below . ) as @xmath0 tends to zero , the phase portrait does not undergo any qualitative changes . however , the turning point of the parabola starting at a point @xmath382 on the @xmath123-axis , @xmath383 , is shifted out of the small-@xmath26 region , i.e. out of the range of applicability of variational approximation . consequently , we can no longer expect the initially converging walls to stop a large distance away from each other and repel to infinities after that . instead , for @xmath384 the colliding like - chirality bloch walls should penetrate into the core of each other , and the numerical simulations of the full pde could be the only way to study the outcome of this deep impact . next , let @xmath0 be near @xmath326 . in this case the hamiltonian ( [ h_like ] ) with small @xmath26 and @xmath123 reduces to @xmath385 the dynamics with very small @xmath26 and @xmath123 is similar to the one described by eq.([hzq ] ) : distant pairs of walls with @xmath386 diverge while those which are initially set to converge ( @xmath387 ) slow down , stop and then repel to infinities [ fig.[fig9](a ) ] . a new feature in the ( @xmath272)-case is a saddle point at @xmath388 and a region of attraction which is separated from the region of repulsion by the stable manifold of the saddle [ fig.[fig9](a ) ] . this fixed point was previously discovered in a variational analysis of the ( 2:1)-resonantly forced ginsburg - landau equation @xcite . although it would be tempting to think that it represents a stationary complex of two bloch walls of like chiralities , the actual interpretation of the stationary point turns out to be somewhat different . indeed , it was proved in @xcite that in the absence of damping , two bloch or two nel walls can not form stationary complexes . on the other hand , letting @xmath389 and @xmath390 with small @xmath313 , the trial function ( [ ansatz ] ) can be written , approximately , as @xmath391 this coincides with the expression for the bloch - nel bound state \{eq.(11 ) of ref.@xcite } with @xmath392and @xmath393 , where we only need to send @xmath394 and make the identification @xmath395 . therefore , the bound state " of two like - chirality bloch walls produced by the variational analysis is , in fact , the bloch - nel complex with @xmath396 . the reason why the bloch - nel complex could be mistaken for a complex of two bloch walls , was simply because the bloch and nel walls become indistinguishable as @xmath367 . the appearance of the region of attraction for @xmath0 close to @xmath326 deserves a special comment . the attraction becomes possible due to the smallness of @xmath313 in this limit . indeed , for sufficiently small @xmath313 , the momentum @xmath397 becomes close to @xmath398 which is characteristic for two bloch walls of _ opposite _ chirality . thus , in the limit @xmath367 , the walls may effectively change their chiralities . it is instructive to consider the full phase portrait of the system ( [ hami_b ] ) ; we produce it by plotting level curves of the hamiltonian ( [ h_like ] ) beyond the region of small @xmath26 and @xmath122 [ fig.[fig9](b ) ] . a remarkable feature here is a family of closed orbits surrounding a nonlinear - center point . the center is born , along with the saddle point , in a saddle - center bifurcation as @xmath0 is increased past @xmath399 . the presence of periodic orbits suggests that breathers may be formed in the collision of bloch walls of like chirality . as @xmath367 , the saddle point @xmath400 moves closer to the origin and so the periodic orbits pass near @xmath165 . accordingly , in this limit the breathers should be accessible from initial conditions in the form of well - separated pairs of walls . we note , however , that all closed orbits pass also through a region of large @xmath26 . [ in fact , as @xmath367 , the coordinate of the nonlinear center tends to infinity : @xmath401 . ] consequently , the formation of the breathers requires accurate testing within the full pde . in our numerical simulations with @xmath0 close to @xmath326 , we have indeed observed the attraction of walls with moderate separations ( e.g. with @xmath402 in the case of @xmath403 and @xmath404 in the case of @xmath405 ) followed by the formation of a breather [ fig.[like](b ) ] . it is interesting to note that the attraction of two like - chirality walls with @xmath406 proceeds via the chirality transmutation : first , one of the walls changes its chirality to the opposite ; after that , the two opposite - chirality walls attract . finally , we need to mention an anomaly in the interaction of two like - chirality walls which was observed in some of our simulations with @xmath0 near @xmath326 . the walls which are initially at rest and equal distance away from the origin , would start moving with different velocities or even in the same direction violating our ansatz ( [ ansatz ] ) based on the assumption of a symmetric arrangement for all @xmath84 . this asymmetric anomaly is observed in a wider range of @xmath0-values near @xmath407 than the chirality transmutation ( we detected the former for @xmath0 as far from @xmath326 as @xmath408 ) and has a straightfoward explanation in terms of the @xmath357 curve . as @xmath367 , the derivative @xmath409 tends to infinity at the points where the @xmath410-shaped @xmath357-curve intersects the @xmath411-axis and so the equation @xmath412 has to be amended by keeping the symmetry - breaking term in @xmath413 . it is this term that causes the asymmetric motion of the two walls . the anomalous interaction is typical for bloch - nel pairs and can be interpreted as the interaction of particles with the opposite mass sign @xcite . the fact that the motion of two walls has to be asymmetric becomes even more obvious if one notices that the left and right turning points of the @xmath410-curve approach @xmath358 as @xmath367 . as a result , the motion in the direction of the turning point becomes hampered . when @xmath0 is _ extremely _ close to @xmath326 , a new channel of interaction becomes available ; namely , the wall which is repelled by its partner in the hard " direction , may tunnel " through the @xmath357-barrier by means of the chirality transmutation , and the original symmetric arrangement remains undisturbed . in the nondissipative situation ( @xmath14 ) , colliding walls form a moving or quiescent breather : a temporally oscillating , spatially localised structure . the breather was formed , for at least a short time , in every undamped collision that we simulated . the formation of the breather is accompanied by the release of a large amount of radiation ; the numerical simulations reveal that the breather carries only about a quarter of the energy of the initial configuration , and so the remaining three quarters must escape into the radiation field . as a result , when the interval of simulation is too short , the interaction of the breather with the radiation re - entering the interval via the periodic boundaries is strong enough to destroy it after just a few oscillations . on a large interval , however , the amplitude of the re - entering radiation is small due to the dispersive broadening , and the breather persists indefinitely . the breather can be easily constructed perturbatively . first of all , a harmonic solution @xmath414 of the nls ( [ nls2 ] ) linearised about @xmath415 obeys the dispersion relation @xmath416 the @xmath417-harmonic oscillates with a nonzero frequency @xmath418 ; therefore , one may also expect to find a broad small - amplitude breather oscillating with that frequency . we write @xmath419 where @xmath420 , @xmath421 and @xmath26 is a small parameter , and substitute ( [ breath1 ] ) in equation ( [ nls2 ] ) . setting to zero coefficients of @xmath422 and @xmath87 , we find : @xmath423 where @xmath424 and @xmath425 here the amplitude @xmath426 depends only on long scales @xmath427 and slow times @xmath428 , while @xmath429 indicates the complex conjugate . the solvability condition at the order @xmath87 is @xmath430 , so that @xmath426 , in fact , is independent of @xmath431 : @xmath432 . at the order @xmath433 , the solvability condition forces @xmath426 to obey the attractive unperturbed nonlinear schrdinger equation @xmath434 the breather results if we choose @xmath426 in the form of the soliton : @xmath435 \quad \quad \quad \nonumber \\ \times \exp\left [ -i\frac{a(1 + 4h)}{\sqrt{h } } \phi_0 ^ 2 t_2 + v \frac{\sqrt{h}}{a(1 + 2h ) } ( 2 x_1 - v t_2)\right ] , \nonumber \\ \label{breath6}\end{aligned}\ ] ] where @xmath436 and @xmath125 are free parameters describing the amplitude and velocity of the soliton , respectively . substituting eq.([breath6 ] ) into ( [ breath1])-([breath3 ] ) and defining the amplitude of the breather @xmath437 and its velocity @xmath438 , we obtain , finally , [ 48 ] @xmath439 \cos \left [ \omega t - v \frac{\sqrt{h}}{a(1 + 2h)}(2x - v t ) \right ] + \mathcal{o}(\epsilon^2 ) , \\ \nonumber \\ \mbox{im } \ , \psi = -\frac{2 a a}{\sqrt{h}}\mbox{sech } \left[2\sqrt{\frac{1 + 4h}{1 + 2h}}a(x - v t)\right ] \sin \left [ \omega t - v \frac{\sqrt{h}}{a(1 + 2h)}(2x - v t ) \right ] + \mathcal{o}(\epsilon^2),\,\ , \label{breath7}\end{aligned}\ ] ] where @xmath440 we carried out numerical simulations of eq.([nls2 ] ) with eq.([48 ] ) as an initial condition , with a variety of ( small ) values of @xmath441 . ( we confined our simulations to the case @xmath442 . ) for all values of @xmath0 and @xmath441 we tried , the breather persisted for the full length of the simulation ( approximately @xmath443 periods of the breather s oscillation ) , with virtually no change . the measured frequency of oscillation coincided with the asymptotic value ( [ omega ] ) up to the third decimal place . simulations were also performed with a gaussian initial condition @xmath444 for a number of small complex values of @xmath445 ( @xmath446 ) and positive @xmath447 . all runs resulted in the formation of a breather , although in some cases [ for @xmath448 , the emerging breather would break into a pair of counterpropagating breathers . in those cases where the emerging breather was nonmoving , its shape and frequency were found to be in an excellent agreement with the asymptotic formula ( [ 48 ] ) . in this paper , we studied the interactions between the similar - type dark solitons of the nonlinear schrdinger equation , i.e. bloch - bloch and nel - nel interactions . our approach was based on the variational approximation ( also known as the collective - coordinate , or variation - of - action , method ) . the variational conclusions were verified using numerical continuation of solutions of the stationary damped - driven nls ( [ nls_stat ] ) and via direct numerical simulations of the full partial differential equation ( [ nls2 ] ) . in the dissipative situation ( @xmath12 ) , the only available solitons are the nel walls . when two nel walls are very far apart , their interaction is simple : the walls repel if @xmath449 and attract if @xmath450 . the repelling walls diverge to infinities ; as for the case of attraction , there are two possible scenarios . in order to distinguish between the two , one is led to consider the situation where the walls are closer to each other [ but still sufficiently far apart for the large - separation approximation ( [ ansatz ] ) to remain valid . ] at these shorter distances , the dynamics is influenced by two bound states , a stable and an unstable one . the stable bound state exists for @xmath0 between @xmath451 and a threshold driving strength @xmath5 , and the unstable one exists for all @xmath452 . here @xmath453 where @xmath454 is defined as a root of the system ( [ null_int])-([com_tan ] ) . for small @xmath9 , the curve @xmath282 can be described explicitly : @xmath455 [ this is eq.([ac_ga ] ) written in terms of @xmath0 and @xmath9 . ] in their region of coexistence , the stable complex has a larger separation : @xmath456 . when @xmath0 is smaller than @xmath457 , the walls repel if their separation distance @xmath2 is greater than @xmath3 , the interwall separation in the unstable complex . if @xmath241 , the walls converge and annihilate . ( this verdict does not extend to the region where _ both _ @xmath0 and @xmath9 are small . in this region the variational analysis of the small - separation dynamics is inconclusive . ) when @xmath458 , pairs of nel walls with separations @xmath459 larger than @xmath238 evolve towards the stable bound state while those with @xmath460 converge and annihilate . finally , the walls with @xmath461 converge and annihilate irrespectively of their initial separation . these results pertain to walls at shorter distances ( which are however sufficiently far apart for the variational approximation to remain valid ) . in particular , they answer the question as to what finally happens to the two walls attracted from very large distances . the nondissipative case requires a separate summary . here the walls can move at constant speeds and the interaction pattern becomes complicated by the presence of inertia . when @xmath0 is greater than @xmath326 ( by small or large value ) , the nel walls attract and converge unless the initial condition corresponds to walls having large and opposite velocities . in the latter case the attraction is unable to stop the diverging walls and they escape to infinities . on the other hand , when @xmath0 is smaller than @xmath326 , the walls repel . the exception here is the case where @xmath0 is close to @xmath326 ; in this case walls with very large separations repel whereas walls which are not so far from each other , attract . in the dissipation - free case , the available dark solitons also include bloch walls . the interaction between two bloch walls depends on their relative chiralities : two initially quiescent , oppositely - handed bloch walls attract while two quiescent walls with like chiralities placed at a large distance away from each other , repel . the exception is the case of @xmath0 close to @xmath326 ; in this limit , two walls of like chirality repel at large distances but exhibit anomalous interaction or transmute into an opposite - chirality pair and attract when placed closer to each other . these conclusions can be extended to the case of the _ moving _ bloch walls , where one just needs to take their inertia into account . for example , two initially diverging oppositely - handed walls at large separation will continue to diverge despite the attraction whereas two likely - handed walls which were initially moving against each other , will continue to converge ( until the repulsion stops them and sends away to infinities ) . in addition to the interactions between well - separated walls , we investigated products of their collision . when the system is not damped , the collision of two walls results in a stationary or travelling breather . we reconstructed the numerically found breather as an asymptotic series . when @xmath9 is nonzero , oscillations are damped and the only nontrivial product of collision of two nel walls is a stationary bubble the bound state of two nel walls . using the numerical continuation of solutions to the ode ( [ nls_stat ] ) , we demarcated the bubble s domain of existence in the parameter space . [ this domain is , naturally , a subset of the part of the @xmath280-plane in which remote walls attract ] . the numerical demarcation is in excellent agreement with the domain of existence obtained variationally . we complete the paper by listing several open problems to which we plan to return in future . one interesting problem that merits further investigation , concerns the ( unstable ) bubble solution with small @xmath0 and @xmath9 . ( this solution is exemplified by fig.[weird_bubble ] . ) our numerics and the variational analysis in section [ numerical_fp ] show that this solution _ can not _ be regarded as a complex of two nel walls , not even strongly overlapping ones . its asymptotic behaviour is closer to that of a bloch wall ; however , bloch walls do not exist in presence of damping . furthermore , the bubble can not be continued to @xmath10 and hence does not have a nondissipative analogue in the form of a bound state of two bloch , or a bloch and a nel , walls . ( this follows from the fact that the nel wall is the only solution in the @xmath10 domain which admits continuation to nonzero @xmath9 as it is the only solution with zero momentum @xcite . ) thus a question arises whether the bubble with small @xmath0 and @xmath9 could be interpreted as a complex of two hypothetical dissipative bloch walls " of opposite chiralities which do not exist individually but can exist as a bound state due to the cancellation of their opposite momenta . a similar momentum cancellation occurs in the attractive damped - driven nls where it allows complexes to travel with nonzero speeds despite the fact that their constituent solitons are immobile @xcite . a related question concerns the short - distance nel wall dynamics with small @xmath0 and @xmath9 . this problem is inaccessible to the variational method , and the direct numerical simulations of the full pde seems to be the only appropriate line of attack here . \2 . with regard to the bloch walls , an open problem concerns the family of closed orbits centred on @xmath179 in fig.[schweik ] . when @xmath0 is close to @xmath326 , these periodic orbits can be interpreted within the full partial differential equation ( [ nls ] ) , as pairs of opposite - chirality bloch walls executing periodic oscillations of their separation . it is not impossible that these periodic solutions exist also for @xmath0 not so close to @xmath326 [ where the validity of the well - separated ansatz ( [ ansatz ] ) becomes questionable . ] it remains to be understood why these orbits have not been observed in our numerical simulations of eq.([nls ] ) , with either @xmath0 . one possible explanation stems from the fact that the nonlinear - center fixed point enclosed by this family of closed orbits , corresponds to a _ maximum _ of the energy ( [ vv ] ) . consequently , the nonlinear modes not captured by our two - dimensional ansatz ( [ ansatz ] ) such as radiations should make the point @xmath462 slide downhill towards orbits with larger radii , until it crosses through the homoclinic trajectory and ends up at @xmath165 . [ it is pertinent to note here that the centre points enclosed by the other two families of closed orbits in fig.[schweik ] are _ minima _ of the energy ( [ vv ] ) ; this is consistent with the stability of the corresponding breather solutions observed in numerical simulations in section [ simulations ] . ] next , it would be interesting to simulate collisions of the like - chirality bloch walls with @xmath384 . this case is not amenable to the variational analysis due to the large extent ( width " ) of the walls . it would also be interesting to gain a deeper theoretical insight into the anomalous interaction of the like - chirality bloch walls arising for @xmath0 close to @xmath326 . the variational approach remains a proper tool here ; one should only generalise the ansatz ( [ ansatz ] ) by allowing nonsymmetric configurations of the walls : @xmath463 } - i\kappa_1 \mbox{sech } [ { \cal b } ( x+z_1 ) ] , \label{convenience1 } \\ \varphi_2(x , t)=\tanh{[{\cal b } ( x - z_2 ) ] } + i\kappa_2 \mbox{sech } [ { \cal b } ( x - z_2 ) ] . \end{aligned}\ ] ] here @xmath464 and @xmath465 are unrelated pairs of variables . it is a pleasure to thank boris malomed for useful references . one of the authors ( ib ) thanks dr reinhard richter and prof ingo rehberg for their hospitality at the university of bayreuth where this project was completed . ib is a harry oppenheimer fellow ; also supported by the nrf of south africa under grant 2053723 . sw was supported by the nrf of south africa . ez was supported by the russian foundation for basic research under grant 06 - 01 - 00228 . p. coullet , j. lega , b. houchmanzadeh and j. lajzerowicz , phys . lett . * 65 * , 1352 ( 1990 ) ; p. coullet , j. lega and y. pomeau , europhys . lett . * 15 * , 221 ( 1991 ) ; d.v . skryabin , a. yulin , d. michaelis , w.j . firth , g .- oppo , u. peschel , and f. lederer , phys . e * 64 * , 056618 ( 2001 )

we study interactions between the dark solitons of the parametrically driven nonlinear schrdinger equation , eq.([nls ] ) . when the driving strength , @xmath0 , is below @xmath1 , two well - separated nel walls may repel or attract . they repel if their initial separation @xmath2 is larger than the distance @xmath3 between the constituents in the unstable stationary complex of two walls . they attract and annihilate if @xmath2 is smaller than @xmath3 . two nel walls with @xmath0 lying between @xmath4 and a threshold driving strength @xmath5 attract for @xmath6 and evolve into a stable stationary bound state for @xmath7 . finally , the nel walls with @xmath0 greater than @xmath5 attract and annihilate irrespective of their initial separation . two bloch walls of opposite chiralities attract , while bloch walls of like chiralities repel except near the critical driving strength , where the difference between the like - handed and oppositely - handed walls becomes negligible . in this limit , similarly - handed walls at large separations repel while those placed at shorter distances may start moving in the same direction or transmute into an oppositely - handed pair and attract . the collision of two bloch walls or two nondissipative nel walls typically produces a quiescent or moving breather .

in the last few years it has become possible to observe details of absorption by singly ionized helium . the observations combine new information about the history of quasars , intergalactic gas , and structure formation . early observations of the heii ly@xmath1 absorption spectral region included the quasars q0302 - 003 ( z=3.285 , jackobsen et al . 1994 , hs 1700 + 64 ( z=2.72 , davidsen et al . 1996 ) and pks 1935 - 692 ( z=3.18 tytler & jackobsen 1996 ) . higher resolution ( ghrs ) observations of q0302 - 003 hogan , anderson & rugers 1997 and he 2347 - 4342 ( z=2.885 , reimers et al . 1997 ) revealed structure in the absorption which could be reliably correlated with hi absorption . heap et al . have followed up with stis on q0302 - 003 ( 1999a ) and he 2347 - 4342 ( 1999b ) . the second observation should be particularly illuminating since he 2347 - 4342 is relatively bright allowing a high resolution grating to be used . the anderson et al . ( 1998 ) observations of pks 1935 - 692 with stis yield good zero level estimates important for estimating the optical depth @xmath6 . preliminary reductions of longer stis integrations of pks 1935 - 692 with the 0.1 slit by anderson et al . ( 1999 ) confirm the 1998 results . taken together , these data now appear to be showing the cosmic ionization of helium by quasars around redshift 3 . although it is possible that the medium is already ionized to heiii by other sources at a lower level ( miralda - escud et al . 1999 ) . all of the objects show absorption with mean @xmath7 at redshifts lower than the quasar . for the higher redshift qso s q0302 - 033 and pks 1935 - 692 ( shown in fig . 1 ) there is a clear shelf of @xmath8 in a wavelength region of order 20 in observed wavelength blueward of the quasar emission line redshift , dropping to a level consistent with zero flux or @xmath9 beyond that . the sharp edge led anderson et al . to conclude that gas initially containing helium as mostly heii was being double - ionized in a region around the quasars . the lack of a strong emission line for heii ly@xmath1 suggests that ionizing flux is escaping so that the 228 flux may be similar to a simple power - law extension of the observed 304 rest frame flux . hogan et al . ( 1997 ) used the same reasoning to estimate the time required for quasars to create the double ionized helium region to be 20 myr for a 20 shelf ( dependent on the hubble parameter , spectral hardness , cosmology , baryon density and the shelf size ) . the features present in heii ly@xmath1 spectra are reflected in the hi ly@xmath1 forest for these quasars . attempts to model the heii absorption with line systems detected in hi suggest that very low column hi absorbers , difficult to differentiate from noise in hi spectra , provide a substantial contribution to the heii absorption . typically , in the shelf region , the ratio of heii to hi ions is of order 20 or more , rising to at least 100 farther away ( the cross - section for heii ly@xmath1 absorption is 1/4 that of hi ) . both pks 1935 - 692 and he 2347 - 4342 display conspicuous voids in the heii absorption near the apparent edge of the heiii bubble with corresponding voids in the hi spectra . reionization and the origin of the heii ly@xmath1 forest can addressed with detailed theoretical treatments ( eg . zheng & davidsen 1995 , zhang et al . 1998 , fardal et al . 1998 , abel & haehnelt 1999 , gnedin 1999 ) . wadsley , hogan & anderson ( 1999 ) presented numerical models of the onset of full helium reionization around a single quasar . the models integrated one - dimensional radiative transfer along lines of sight taken from cosmological hydrodynamical simulations and used flux levels comparable to pks 1935 - 692 . the results reinforced the basic intepretation of pks 1935 - 692 by hogan et al . ( 1997 ) as the growth of an he iii bubble over time in a medium that was mostly heii . in addition void recoveries in the large ionized bubbles similar to that observed for pks 1935 - 692 occurred often among a random set of simulated lines of sight . the gas temperature in such bubbles is strongly affected by the ionization of he ii to he iii , particularly because the first photons to reach much of the gas will be quite hard since the softer photons are absorbed close to the quasar until the gas is optically thin . in particular the underdense medium reaches temperatures of order 15000k . we make a simple analytical argument for this result in the next section . given our fairly good guess as to the physical conditions near pks 1935 - 692 we are in position to attempt to convert the observed optical depths into a density in baryons . comparing optical depths measured for the small sample of voids in the shelf region of pks 1935 - 692 to distributions of void widths and densities from simulations we can build an estimate of @xmath0 , the total cosmic density in baryons . the are still uncontrollable systematic uncertainties in this estimate but these differ from other techniques and can be addressed with better simulations and a larger sample of quasars . the main focus of this paper is the technique . in he ii ly@xmath1 absorption spectra only the voids are sufficiently low density to allow measurements of the optical depth . the highly ionized void gas is optically thin to the ionizing radiation and cool enough to ignore collisional effects , resulting in a fairly simple relation between optical depth and gas density , where @xmath10 is the optical depth for absorption of he ii ly@xmath1 , @xmath11 is the number density of he ii ions , @xmath12 converts from real space to wavelength ( velocity ) space and @xmath13 is the gas density . the recombination rate @xmath14 contains the only temperature dependence . the photo - ionizations per second @xmath15 is determined from the rest frame heii ionizing flux , @xmath16 can be extrapolated from the rest frame flux at @xmath17 which is estimated ( assuming a cosmological model ) from the observed continuum flux at @xmath18 , where @xmath19 is the redshift of the quasar . the fraction of heii depends on temperature roughly as @xmath20 through the recombination coefficient . the radiative transfer models of wadsley et al . ( 1999 ) gave temperatures around 15000k for the underdense gas near quasars . the optical depth to a he ii ionizing photon travelling @xmath21 ( the size of the pks 1935 - 692 shelf region ) at redshift @xmath2 ( scdm , @xmath22 , @xmath23 ) is approximately @xmath24 . the optical depth falls to 1 for photons with energies , @xmath25 . thus the heii in the outer half of the shelf region will be ionized preferentially by photons in the energy range 100 - 200 ev . injecting 100 - 54.4 ev per helium atom is equivalent to a temperature increase of 13000 k when the energy is distributed among all the particles . the cooling time for the underdense gas is very long , dominated by adiabatic expansion . gas elsewhere will gain @xmath26 4000 k due to heiii reionization . as voids evolve they approach an attractor solution resembling empty universes and their relative growth slows when they reach around @xmath27 times the mean density , making that value fairly representative . we used @xmath28-body simulations of 3 cosmologies ( standard cdm , open cdm and @xmath5cdm ) to get probability distributions for the quantity we label normalized opacity @xmath29 as a function of void width . @xmath30 may be directly related to the void optical depths via ( [ opacity ] ) . the set of voids allows a statistical maximum likelihood comparison of the simulated distribution of @xmath30 to the distribution of void widths and optical depths observed . figure [ taunorm ] shows the probability distribution of @xmath30 in voids ( equivalent to void optical depth ) and void widths for the @xmath5cdm cosmology . the optical depth from the simulation was normalized so that mean density gas expanding with the hubble flow gives an optical depth of 1.0 . the effect of gas pressure on the dynamics of gas in the voids should be negligible and was ignored in our simulations . thus the gas follows the dark matter exactly . the simulations were performed using hydra ( couchman 1991 ) with 64 mpc periodic simulation volumes ( @xmath31 @xmath32 at @xmath2 ) containing @xmath33 particles . a preliminary convergence study indicated that the statistics of @xmath30 are relatively insensitive to resolution however our resolution is still lower than that of the best current lyman-@xmath1 forest studies which also include gas . we were constrained by the need to include larger scales so that the large void portion of our sample was reasonable . higher resolution gives slightly larger estimates for @xmath0 . the ratio of @xmath10 to @xmath30 that has the maximum likelihood gives an estimate for the total baryon density as follows , @xmath34 in this equation all the quantities are given as ratios with typical values estimated from pks 1935 - 692 , with @xmath35 being the local density divided by the cosmological mean density , @xmath36 the local expansion rate along the line - of - sight compared to the mean , @xmath37 local hubble parameter value , @xmath1 the spectral slope of the quasar ( @xmath38 ) and @xmath39 the helium mass fraction . the value of @xmath40 is @xmath41 at @xmath2 for an @xmath42 scdm cosmology . the exact systemic redshift of pks 1935 - 692 is uncertain due to an absence of narrow ir emission lines . we use @xmath43 . we used the 5 large voids observed over the range @xmath44 for pks 1935 - 692 . this range should be far enough from the quasar to avoid `` associated '' absorbers caught in the quasar outflow . the fits are shown in figure [ taufit ] . he ii and h i absorption are both plotted with the models for each overplotted as dashed lines . the he ii spectrum was modeled with the known hi ly@xmath1 absorption lines and 5 parameter values for the optical depth in each void . the ratio of the hi to heii optical depths was a sixth free parameter . the models were convolved with the same spectral point spread function as the observations and include same level of photon shot noise . the best model was determined using maximum likelihood and the fitting errors determined with monte carlo realizations . the emptiest void has a reasonable probability according to the simulations , however since it has been suggested that it could be due to a local ionizing source we calculated the effect of removing it , which was a @xmath45 increase in the estimate for @xmath0 . the ionizing flux was inferred from the observed pks 1935 - 692 continuum level at 304 @xmath46 rest frame and extrapolated to @xmath47 and 228 @xmath46 . assuming the quasar redshift is @xmath43 this gives a flux of @xmath48 ( for standard cdm ) at @xmath49 which is in the middle of the voids . the sample of helium quasars is quite small and though pks 1935 - 692 does not have any known variability all quasars are thought to be intrinsically variable due to the nature of the fueling and emission processes . selection effects favour the idea that pks 1935 - 692 is currently brighter than its average value over the last few thousand years ( the ionization response timescale ) . if pks 1935 - 692 has recently brightened then ( [ ombh2eqn ] ) implies that our @xmath0 estimate is biased upward . if there is additional foreground continuum absorption then our estimates are biased low . the results are tabulated below with 1-@xmath4 fitting errors indicated ( monte carlo ) . aside from the uncertainties mentioned above , there is still uncertainty in the temperature through the @xmath50 dependence . if the gas was pre - ionized to heiii the underdense gas could be colder by a factor of order 2 which would lower the @xmath51 estimates by 20 % . a larger sample of quasars would make the greatest improvement in the robustness of this measurement .

a new method to extract @xmath0 from high redshift intergalactic absorption is described , based on the distribution of heii ly@xmath1 optical depths in the voids in the ionization zone of quasars . a preliminary estimate from recent hst - stis spectra of pks 1935 - 692 at @xmath2 gives @xmath3 ( 1-@xmath4 statistical errors , for a @xmath5cdm cosmology ) consistent with other estimates .

diffusion tensor tractography ( dtt ) , which is derived from diffusion tensor imaging ( dti ) , is one of the most remarkable recent advances in neuroimaging . water diffuses preferentially in a direction parallel to the axon 's longitudinal axis ; in contrast , diffusion is restricted in the perpendicular axis . this phenomenon can be represented mathematically by the diffusion tensor and the diffusion tensors of the cerebral white matter can be reconstructed to track 3-dimentional macroscopic fiber orientation in the brain . recent studies have reported on the state of the aras in various brain pathologies including traumatic brain injury , intracerebral hemorrhage , and hypoxic - ischemic brain injury ( hibi ) . many studies have reported on patients with severe injury of the whole cerebral cortex , such as hydranencephaly or hemihydranencepahly , who have some level of consciousness . however , no study on the aras finding of these patients has been reported so far . in this study , using dtt , we reported on the aras finding of a patient who showed severe injury of the cerebral cortex following a hibi . a 67-year - old female patient who suffered from hibi induced by cardiac arrest after surgery for lumbar disc herniation underwent cardiopulmonary resuscitation approximately 20 to 30 minutes after cardiac arrest . after 3 months from onset , she was admitted to the rehabilitation department of our university hospital for rehabilitation . the patient exhibited impaired alertness , with a glasgow coma scale ( gcs ) score of 4 ( eye opening : 2 , best verbal response : 1 , and best motor response : 1 ) . diffusion - weighted brain mr images at 4 days after onset showed increased intensities in the whole cerebral cortex ( figure 1a ) . in addition , t2-weighted brain mr images at 3 years after onset showed leukomalactic lesions in the whole cerebral cortex ( figure 1b ) . she underwent comprehensive rehabilitative therapy , which included neurotropic drugs , physical therapy , and occupational therapy . at approximately 8 months after onset approximately 2 years after onset , she was able to close her eyes in response to a question and began to move the toes on both feet ( flexion - extension 20~30 ) after voiding or defecating in a diaper until a caregiver changed the diaper . approximately 3 years after onset , she began to whimper sometimes and showed improved consciousness , with a gcs score of 10 ( eye opening : 4 , best verbal response : 2 , and best motor response : 4 ) and coma recovery scale - revised score of 9 ( auditory function : 1 , visual function : 1 , motor function : 2 , verbal function : 2 , communication : 1 , and arousal : 2 ) . the patient 's daughter provided signed , informed consent , and yeungnam university hospital institutional review board approved the study protocol . ( a ) diffusion - weighted brain mr images at 4 days after onset show increased intensities in the whole cerebral cortex . ( b ) t2-weighted brain mr images at 3 years after onset show leukomalactic lesions in the whole cerebral cortex . ( c ) results of diffusion tensor tractography for the upper connectivity of the ascending reticular activating system ( aras ) . results of diffusion tensor tractography for the upper connectivity of the aras showed decreased neural connectivity to each cerebral cortex in both hemispheres : the right hemisphere no neural fibers reached the cerebral cortex ( blue arrow ) , and the left hemisphere some neural fibers were connected to the parietal cortex ( red arrow ) . the right lower aras between the pontine reticular formation and the thalamic intralaminar nuclei was thinner compared with the left side of the patient and those of a normal subject ( 68-year - old female ) . dti data were acquired at approximately 3 years after onset using a 6-channel head coil on a 1.5-t philips gyroscan intera ( philips , best , netherlands ) with single - shot echo - planar imaging . for each of the 32 noncollinear diffusion sensitizing gradients , 67 contiguous slices were acquired parallel to the anterior commissure - posterior commissure line . imaging parameters were as follows : acquisition matrix = 96 96 ; reconstructed matrix = 192 192 ; field of view = 240 240 mm ; tr = 10,726 ms ; te = 76 ms ; b = 1000 s / mm ; nex = 1 ; and a slice thickness of 2.5 mm with no gap ( acquired isotropic voxel size 1.3 1.3 2.5 mm ) . analysis of dti data was achieved using the oxford centre for functional magnetic resonance imaging of the brain software library ( fsl ; streamline samples : 5000 , step length : 0.5 mm , and curvature thresholds : 0.2 ) . for analysis of the lower aras , the seed region of interest ( roi ) was placed at the reticular formation of the pons at the level of the trigeminal nerve entry zone and the target roi was placed at the intralaminar nuclei of the thalamus at the level of the commissural plane . in analysis of the connectivity of the intralaminar nucleus ( iln ) of the thalamus , the seed roi was placed at the iln of the thalamus at the level of the intercommissural plane between the anterior and posterior commissures . of 5000 samples generated from the seed voxel , results for contact were visualized at a threshold for the aras of a minimum of 5 and for connectivity of the intralaminar nucleus of 30 streamlined through each voxel for analysis . results of dtt for the upper connectivity of the aras showed decreased neural connectivity to each cerebral cortex in both hemispheres : the right hemisphere ( no neural fibers reached the cerebral cortex ) and the left hemisphere ( only some neural fibers were connected to the parietal cortex ) ( figure 1c ) . the right lower aras between the pontine reticular formation and the thalamic iln was thinner compared with the left side . dti data were acquired at approximately 3 years after onset using a 6-channel head coil on a 1.5-t philips gyroscan intera ( philips , best , netherlands ) with single - shot echo - planar imaging . for each of the 32 noncollinear diffusion sensitizing gradients , 67 contiguous slices were acquired parallel to the anterior commissure - posterior commissure line . imaging parameters were as follows : acquisition matrix = 96 96 ; reconstructed matrix = 192 192 ; field of view = 240 240 mm ; tr = 10,726 ms ; te = 76 ms ; b = 1000 s / mm ; nex = 1 ; and a slice thickness of 2.5 mm with no gap ( acquired isotropic voxel size 1.3 1.3 2.5 mm ) . analysis of dti data was achieved using the oxford centre for functional magnetic resonance imaging of the brain software library ( fsl ; streamline samples : 5000 , step length : 0.5 mm , and curvature thresholds : 0.2 ) . for analysis of the lower aras , the seed region of interest ( roi ) was placed at the reticular formation of the pons at the level of the trigeminal nerve entry zone and the target roi was placed at the intralaminar nuclei of the thalamus at the level of the commissural plane . in analysis of the connectivity of the intralaminar nucleus ( iln ) of the thalamus , the seed roi was placed at the iln of the thalamus at the level of the intercommissural plane between the anterior and posterior commissures . of 5000 samples generated from the seed voxel , results for contact were visualized at a threshold for the aras of a minimum of 5 and for connectivity of the intralaminar nucleus of 30 streamlined through each voxel for analysis . results of dtt for the upper connectivity of the aras showed decreased neural connectivity to each cerebral cortex in both hemispheres : the right hemisphere ( no neural fibers reached the cerebral cortex ) and the left hemisphere ( only some neural fibers were connected to the parietal cortex ) ( figure 1c ) . the right lower aras between the pontine reticular formation and the thalamic iln was thinner compared with the left side . in the current study , using dtt , the aras was evaluated in a patient with severe injury of the cerebral cortex following a hibi . the aras was divided into 2 portions : the lower aras between the pontine reticular formation and the thalamic iln : 3-dimensional reconstruction and the upper aras : the neural connectivity of the thalamic iln to the cerebral cortex . we found that only some neural fibers were connected to the left parietal cortex , no neural fibers were connected to the other fronto - parieto - occipital cortex , and the right lower aras was thinner . these findings appear to suggest severe injury of the upper aras between the thalamic iln and cerebral cortex , and mild injury of the right lower aras between the pontine reticular formation and the thalamic iln . previous studies have demonstrated that patients with near - total or total absence of the cerebral cortex due to hydranencephaly or hemihydranencepahly had some level of consciousness such as person recognition , social interaction , funtional vision , muscial preferences , smiling at someone , appropriate affective response , and goal - directed motor behavior . therefore , merker suggested that the thalamocortical system is not an essential system for consciousness , but the midbrain reticular system is responsible for consciousness . rearding our patient , the patient was able to perform goal - directed behavior ( close her eyes in response to a question and move the toes on both feet after voiding or defecating in a diaper until a caregiver changed the diaper ) and express her emotion ( whimpering ) . we believe that our patient also had some level of consciousness , even though injury of the whole cerebral cortex was observed on the brain mr images and dtt showed that only some neural connectivity to the left parietal lobe was spared . in conclusion , severe injury of the upper portion of the aras between the thalamic iln and cerebral cortex was demonstrated in a patient with some level of consciousness . we believe that evaluation of the aras using dtt would be useful in elucidating the state of the aras . this is the first dtt study to demonstrate the state of the aras in a patient with severe injury of the whole cerebral cortex . second , regions of fiber complexity and crossing can prevent full reflection of the underlying fiber architecture ; therefore , dtt may underestimate the fiber tracts

abstractwe reported on the ascending reticular activating system ( aras ) finding of a patient in whom severe injury of the cerebral cortex was detected following a hypoxic - ischemic brain injury ( hibi).a 67-year - old female patient who suffered from hibi induced by cardiac arrest after surgery for lumbar disc herniation underwent cardiopulmonary resuscitation approximately 20 to 30 minutes after cardiac arrest . the patient exhibited impaired alertness , with a glasgow coma scale ( gcs ) score of 4 ( eye opening : 2 , best verbal response : 1 , and best motor response : 1 ) . approximately 3 years after onset , she began to whimper sometimes and showed improved consciousness , with a gcs score of 10 ( eye opening : 4 , best verbal response : 2 , and best motor response : 4 ) and coma recovery scale - revised score of 9 ( auditory function : 1 , visual function : 1 , motor function : 2 , verbal function : 2 , communication : 1 , and arousal : 2).results of diffusion tensor tractography for the upper connectivity of the aras showed decreased neural connectivity to each cerebral cortex in both hemispheres . the right lower aras between the pontine reticular formation and the thalamic intralaminar nuclei ( iln ) was thinner compared with the left side.severe injury of the upper portion of the aras between the thalamic iln and cerebral cortex was demonstrated in a patient with some level of consciousness .

recent studies of high time resolution data from two magnetar hyperflares recorded by the proportional counter array ( pca ) onboard the rossi x - ray timing explorer ( rxte ) have resulted in the discovery of a new phenomenon associated with these events . both the december , 2004 event from sgr 1806 - 20 , and the august , 1998 hyperflare from sgr 1900 + 14 produced fast , rotation - phase - dependent x - ray oscillations in the 20 - 150 hz range . first , israel et al . ( 2005 ) reported the discovery of @xmath7 , 30 , and 90 hz quasi - periodic oscillations ( qpo ) in the december , 2004 event , and suggested that the 30 and 90 hz qpos could be linked with seismic vibrations of the neutron star crust . strohmayer & watts ( 2005 ) then reported the discovery of a sequence of qpos in the sgr 1900 + 14 hyperflare . they found a set of frequencies ; 28 , 53.5 , 84 , and 155 hz , which could plausibly be associated with a sequence of low @xmath8 toroidal modes ( denoted @xmath9 ) of the elastic neutron star crust ( see , for example , hansen & cioffi 1980 ; mcdermott , van horn & hansen 1988 ; duncan 1998 ; piro 2005 ) . in both hyperflares the oscillations are episodic , that is , their amplitudes vary considerably with time and rotational phase . most recently , watts & strohmayer ( 2006 ) examined ramaty high energy solar spectroscopic imager ( rhessi ) data for the sgr 1806 - 20 event , confirmed the presence of the 18 hz and 90 hz qpos , and found evidence for additional oscillations at 26 hz and 626 hz . the similar phenomenology of the oscillations in the two sources , as well as the closeness of some of the measured frequencies argues rather convincingly that we are seeing the same physical process in each case . the connection with torsional modes of the crust seems plausible for several reasons ; 1 ) the observed frequencies are consistent with theoretical expectations for such modes , and can be more or less self - consistently associated with a sequence of modes with varying spherical harmonic index , @xmath8 . 2 ) the magnetic instability which powers the hyperflares is likely associated with large scale fracturing of the neutron star crust @xcite , and will almost certainly generate seismic motions within the star . 3 ) the strong phase dependence argues for a mechanism associated with particular sites on the stellar surface , such as a fracture zone or magnetic field bundle . 4 ) mechanical motions provide a natural explanation for the relatively high coherence of the oscillations . 5 ) horizontal motions of the crust could modulate the beaming pattern associated with the strong magnetic field , providing a mechanism to modulate the x - ray flux . moreover , beaming can act as an `` amplifier , '' producing potentially large x - ray modulations from modest horizontal displacements . although the present evidence for torsional modes is very suggestive , it is not yet definitive . levin ( 2006 ) , for example , argues that toroidal modes may damp too quickly to account for the detection of oscillations some minutes after the onset of the flare . in addition some of the detected frequencies ( 18 hz , 26 hz ) do not fit easily into current torsional mode models , without invoking magnetic splitting or other complications . in our previous study of the rxte data from the sgr 1900 + 14 hyperflare we computed average power spectra for different rotational phases and time intervals during the event . this method should be more sensitive to oscillations which are localized in rotational phase , as borne out in the sgr 1900 + 14 study . in this paper we report the results of a similar , phase averaged timing study on the now public archival rxte data from the sgr 1806 - 20 hyperflare . using this method we find strong evidence for additional , higher frequency oscillations during the flare . an overview of the rxte data recorded from the december , 2004 hyperflare from sgr 1806 - 20 is given by israel et al . data were recorded in the `` goodxenon_2s '' mode that allows for time resolution up to @xmath10 @xmath11s . the hyperflare intensity profile , folded at the rotational frequency ( see figure [ fig1 ] ) , shows 3 peaks . in subsequent discussions we will refer to these as peaks 1 , 2 , and 3 , in order of decreasing peak intensity , respectively . we will also refer to the region of pulse phase between peaks 2 and 3 as the `` interpulse '' region . since previous studies have shown the @xmath12 90 hz qpo to be extremely robust , and its approximate location in rotational phase has been linked to the interpulse region , by both israel et al . ( 2005 ) and watts & strohmayer ( 2006 ) , we began our study by computing average power spectra around this phase range , but for a sequence of different time intervals during the flare . we used 3 s intervals to compute each individual power spectrum and we initially restricted our search to a nyquist frequency of 4096 hz , although these pca data can , in principle , be used to sample to much higher frequencies . we found a significant signal at 625 hz in power spectra computed from approximately the last third of the hyperflare . we now discuss the detection , significance and properties of this oscillation . figure [ fig2 ] shows an average power spectrum computed from 9 successive rotations starting approximately 190 s after the onset of the hyperflare . both the time interval during the flare ( top ) , and the phase region ( bottom , dashed lines ) used in computing this spectrum are shown in figure [ fig1 ] . this power spectrum has a prominent feature at 625 hz , and the qpo at 92 hz is also clearly detected . to estimate the significance of the 625 hz feature we extended the frequency range to 65 khz , and used all frequency bins above 800 hz to estimate the noise power distribution . figure [ fig2 ] shows the power spectrum to 65 khz ( main panel ) , as well as the distribution of noise powers ( inset panel ) . we fit the noise power histogram with a @xmath13 function , and found a reasonable fit for 87 degrees of freedom ( dof ) , and a small reduction in the poisson level of 0.01 . this function is also plotted in the inset panel of figure [ fig2 ] ( solid curve ) . using this noise distribution we find a single trial significance of @xmath14 for the 625 hz feature . the power spectrum has 1,536 bins up to 4096 hz ( 2.66 hz resolution ) , which was the top end of our search range . we emphasize that we extended the frequency range only _ after _ the search , simply to better characterize the noise power distribution . this gives a probability of @xmath15 to find a peak this high in the power spectrum . the spectrum shown in figure [ fig2 ] was one of a sequence from across the entire duration of the flare . we computed these by overlapping the time intervals , so each spectrum in the sequence is not fully independent . however , even using the total number of spectra computed ( 47 ) , we have a significance @xmath16 , so this is a robust detection . we fit the qpo with a lorentzian profile and find a center frequency and width of @xmath17 hz , and @xmath18 hz , respectively . the 625 hz qpo has an average amplitude during this interval of @xmath19 . we further note that the strength of the 625 hz feature is comparable to that of the 92 hz signal , which provides additional confidence that it is not simply a statistical fluctuation . we searched the rhessi data to see if there was any indication of a simultaneous 625 hz peak but did not detect anything significant at this time . this is however not surprising given the amplitude , and the fact that for such high frequencies we can only use the rhessi front segments , which have a much lower countrate than rxte ( see the discussion in @xcite ) . in addition the rxte signal is strongest at energies less than 45 kev ; at low energies the rhessi spectrum exhibits much higher background levels , which could swamp such a weak signal . we computed dynamic power spectra in the vicinity of 625 hz to search for time dependence of the signal . the results suggest that the 625 hz oscillation is most strongly associated with the falling edge of peak 2 of the pulse profile , and that it s amplitude can vary strongly with time . for example , figure [ fig3 ] shows a portion of the hyperflare that contributes strongly to the 625 hz signal detected in the average power spectrum described above . contours of constant fourier power in the vicinity of 625 hz are plotted over the hyperflare profile . we used 1/2 s intervals and started a new interval every 0.1 s. one pulsation cycle is plotted . the strong correlation of power contours with the falling edge of peak 2 is rather similar to the behavior seen in the 84 hz oscillation from sgr 1900 + 14 ( strohmayer & watts 2005 , see their figure 3 ) , and these similarities suggest it may be connected with the x - ray modulation mechanism . we also computed several average power spectra in the immediate temporal vicinity of the strong 625 hz signal seen in the dynamic power spectrum . an average from two consecutive rotation cycles beginning with the cycle prior to that shown in figure [ fig3 ] reveals evidence for an oscillation at an even higher frequency of 1,840 hz . the average power spectrum from these two cycles is shown in figure [ fig4 ] . the two spectra are the same except for being plotted at different resolutions . we reiterate that the phase range used here ( and for figure [ fig5 ] below ) is the same as for figure [ fig2 ] ( denoted by the vertical dashed lines in figure [ fig1 ] ) . the peak at 1,840 hz is most prominent in the top trace , at 5.33 hz resolution ( the bottom trace has 2.66 hz resolution ) . both the 92 hz and 625 hz peaks also stand out prominently in this spectrum . we estimated the significance in the manner discussed above , and found chance probabilities of @xmath20 , and @xmath21 for the 625 and 1,840 hz peaks , respectively . this is an estimate of the probability of finding a peak as high as those observed in this power spectrum up to 4096 hz . we computed eight such spectra , so this will reduce the significances somewhat , but again , the detections are further supported by the comparable amplitude of these peaks to that of the well established 92 hz oscillation , which is also detected in the same power spectrum . the average amplitudes for the 625 and 1,840 hz oscillations over these two cycles are 18.3 and 18.0 % ( rms ) respectively . we also see weaker indications for a few additional high frequency peaks during this time interval . figure [ fig5 ] compares two power spectra , one ( top ) from the two cycle interval in which the 1,840 hz signal is seen , and the other ( bottom ) an average of two cycles beginning six cycles earlier than the cycle shown in figure [ fig3 ] . the frequency resolution is 10.66 hz in both plots . the top spectrum is actually the same as in figure [ fig4 ] , but plotted with lower resolution . the 625 and 1,840 hz peaks still stand out prominently . we estimated the standard deviation in the noise distribution as before , and we placed two horizontal dotted lines 4@xmath22 ( single trial ) above the mean in each case . in the bottom spectrum , there are also two peaks which reach above the @xmath23 line . these have frequencies of 720 and 2,384 hz . we estimate significances ( single trial ) of @xmath24 and @xmath25 , respectively , for these peaks . a third peak , at 976 hz , does not reach the 4@xmath22 line , but is a @xmath26 deviation , with an estimated significance of @xmath27 . while we do not claim that all these peaks represent strong detections , it does seem unlikely by chance to have several such sizable deviations from the mean in a single spectrum , and thus we think this could be an indication of the presence of additional , weaker signals in the data . we also searched the rxte data for evidence of a 626 hz qpo earlier in the tail , when a qpo of that frequency was seen in the rhessi data @xcite . we were not able to find a corresponding signal in the pca data . however , this is not entirely surprising . the 626 hz signal was only observed in the rhessi data for photons with recorded energies in the range 100 - 200 kev . whilst rhessi is sensitive at these energies , the pca does not record photons with energies above @xmath12 100 kev . comparing spectra from the two spacecraft is difficult because of the scattering caused by the oblique incidence angles . however we can get some idea of the magnitude of the energy shift between the two datasets by comparing the positions of the spectral maxima . for the pca the maximum is at 20 kev , for rhessi it is at 40 kev . if incident photons are downshifted in energy by only 20 kev for the rxte pca compared to rhessi , then we would not expect to see the rhessi 626 hz signal , since the pca does not capture sufficient high energy photons . unfortunately the rxte high energy x - ray timing experiment ( hexte ) , which covers a higher energy range than the pca , recorded the main flare but not the decaying tail @xcite . we also computed average power spectra centered on the rotational phase of peak 1 . figure [ fig1 ] shows the range of phases used ( dashed - dot lines ) . average power spectra centered on this phase over the entire hyperflare show a significant qpo centered near 150 hz . figure [ fig6 ] shows the power spectrum in which we detected this qpo . we averaged 45 , 3 second power spectra , and the frequency resolution is 8 hz . the peak near 150 hz is evident . we modelled the power continuum in the range above 30 hz with a constant plus a power law , and then rescaled the spectrum by dividing by the best fitting continuum model . we then estimated the noise power distribution in the same way as described earlier , by fitting a @xmath13 distribution to a histogram of noise powers in the rescaled spectrum . based on this we estimate a significance for the highest bin in the qpo profile as @xmath28 , which includes the number of frequency bins searched ( up to 4096 hz ) . this is a very conservative estimate of the qpo significance , because it only uses the highest bin , and the qpo peak is resolved at this frequency resolution . we fit the qpo profile with a lorentzian and find a centroid frequency of @xmath29 hz , a width of @xmath30 hz , and an amplitude ( rms ) of @xmath31 . if we construct averages from the first and second halves of the hyperflare , we still detect the 150 qpo , so this oscillation seems to persist through most of the hyperflare . this feature is not detected in the rhessi data , but this is not unexpected given the low amplitude of the qpo and the lower countrates of the rhessi front segments . @xcite reported the marginal detection of 18 hz and 30 hz qpos over a period late on in the burst , without exploring for any phase dependence . @xcite then found evidence in the rhessi dataset for broad qpos at 18 and 26 hz , with a weaker feature at 30 hz . these qpos showed a strong rotational phase dependence , appearing at the same phase as the 92.5 hz qpo . for these lower frequency qpos we were able to include photons detected by the rhessi rear segments , so that the rhessi countrate exceeded that recorded by rxte . the broad qpos at 18 hz and 26 hz were seen in the rhessi dataset between 60 and 230s after the main flare . we were interested to see whether these qpos were detectable in the rxte data . folding up exactly the same time period and rotational phase used in the rhessi analysis we were unable to make a statistically significant detection , not unexpected given the discrepancy in countrates and the low fractional amplitude of the qpos . we therefore focused on two shorter periods in the rhessi data when the 18 hz and 26 hz oscillations were particularly strong , and searched for them at corresponding times in the rxte data . in both of these cases corresponding peaks are observed in the rxte data , confirming the detection of qpos at these frequencies ( figure [ fig7 ] ) . interestingly the 26 hz qpo was stronger in this period in the rxte dataset than it is in rhessi , suggesting that other factors may offset the higher countrate ( see below ) . what about the 30 hz qpo ? if we consider the same time interval indicated in figure [ fig1 ] , but shift the phase range over which we compute power spectra to later phases , that is , exclude the falling edge of peak 2 , the 625 hz signal drops to undetectable levels . figure [ fig8 ] shows the average power spectrum of this `` interpulse '' region during this time interval , and confirms the initial claims of israel et al . ( 2005 ) that signals at @xmath32 and 92 hz are present towards the end of the hyperflare . these qpos are extremely significant , for example , we conservatively estimate the significance of the 30 hz qpo at @xmath33 , and the 90 hz feature is even more significant . these qpos can be fitted with lorentzian profiles . based on such fits we find centroid frequencies of @xmath34 , and @xmath35 hz ; quality factors ( @xmath36 ) of @xmath37 , and @xmath38 ; and average amplitudes of @xmath39 @xmath40 , and @xmath41 @xmath40 , respectively . the 30 hz feature in the rxte spectrum is far more significant than the weaker feature at 30 hz found in the rhessi spectrum . this is at first glance surprising , since rhessi has a higher countrate once the rear segments are included . there are however several factors that probably contribute to this discrepancy . firstly , we are in the interpulse region , where rhessi s high background levels are more important . secondly , one cycle of this time period was excised from the rhessi data because of an artificial spike in countrate as a protective attenuator was removed . in addition , as discussed above , we find occasions where the 26 hz qpo appears far more prominently in the rxte data than in the rhessi data , suggesting that other factors such as scattering off the spacecraft and the earth may reduce rhessi s effectiveness and offset the higher countrate . in the periods when they are detected , the qpos are far from static . their amplitudes wax and wane , and there is evidence for frequency shifts and possible multiplet splitting . in figure [ fig9 ] we show a sequence of dynamical power spectra for the peak 2/interpulse region , for the time period when the 92.5 hz qpo is active . the presence of the strong qpo at this frequency from 180 - 230s after the main flare is clear ( panels 17 - 24 of figure [ fig9 ] ) . if we look at the cycles around this period however , there are hints of interesting behavior . back at only 80s after the flare , weak detections are made , with a frequency that starts at around 78 hz and rises up to a strong 92.5 hz qpo that persists for a couple of cycles from 120 - 130 s. the qpos then weaken , and the frequency seems to fall again by a few hz , until the strong 92.5 hz signal reappears at 180s . at later times , as already noted by @xcite , the frequency rises to 95 hz and possibly higher , as the amplitude falls and the signal becomes undetectable . the variation of amplitude over the rotational cycle , and the consequent interruption of the signals , means that we can not rigorously connect cycles , as one would wish to in order to verify that the frequency is evolving . however , our results are suggestive of this eventuality . there is also some suggestion of frequency movement in the lower and higher frequency qpos ( see for example figure [ fig3 ] ) , although this is even harder to track from cycle to cycle because the qpos are weaker and the amplitudes more variable . as such it is not possible to verify whether the other qpo frequencies move in concert with the 92.5 hz qpo . using phase averaging techniques we have found evidence for additional , higher frequency qpos during the december , 2004 hyperflare from sgr 1806 - 20 . the properties of the qpos , reported in this and previous papers , are summarized in table [ qposum ] and figure [ fig10 ] . the additional frequencies and the time and phase dependence of the detections suggest an extremely rich and complex phenomenology associated with the magnetar oscillations . the detection of a strong 625 hz qpo in the rxte data is particularly interesting . the frequency is remarkably similar to that of a qpo found by us in the rhessi data , but there are some intriguing differences in the properties of the two qpos . in addition to having a slightly lower centroid frequency ( there is frequency overlap of the qpo profiles however ) , the rxte qpo has substantially lower fractional amplitude and coherence value @xmath42 . the rxte qpo appears later in the tail of the flare , and the apparent photon energies of the two qpos also differ . the rhessi detection used events from the front segments , in the 100 - 200 kev energy band ( see @xcite for a discussion of rhessi data in this context ) . the phase interval was centered on the rising edge of peak 1 ( @xcite , figure 4 ) , and the average was obtained from about 50 to 200 s after the start of the hyperflare . an average power spectrum from rxte for the same time and phase ranges shows no corresponding signal in the pca . however , it is difficult to know exactly how to compare the energies of events detected in the two instruments . for rhessi , many of the events observed in the front segments were direct ( ie . meaning that they were not scattered before detection ) , wheareas this is likely not the case with rxte , as virtually no photons would have made it directly into the pca xenon volumes without having scattered off of some part of the spacecraft . it is quite possible that no photons with incident energies in the 100 - 200 kev range were detected by the pca , which would account for the non - detection . the later , lower amplitude rxte qpo is not detected in the rhessi data , most probably due to the lower countrates . the lack of simultaneous detections is therefore disappointing , but not surprising . perhaps more important is the fact that the two instruments detected signals independently at consistent frequencies . the qpo profile of the 625 hz feature detected with rxte overlaps the 1 hz bin ( centered on 626.5 hz ) in which the signal was detected with rhessi . although it is difficult to determine an _ a priori _ probability , it seems extremely unlikely that both instruments would detect signals at a consistent frequency unless that frequency were intrinsic to the source . we therefore think there is compelling evidence to associate this frequency with sgr 1806 - 20 . the finding of additional characteristic frequencies in the sgr 1806 - 20 hyperflare further strengthens the connections between the oscillations seen in both the sgr 1806 - 20 and sgr 1900 + 14 events . in each case , oscillations near @xmath32 , @xmath43 and @xmath44 hz have been seen . this strongly suppports the notion that the same physical processes are involved in these objects . several mechanisms have been suggested as the cause of the qpos . one suggestion is that the qpos are caused by an interaction with a remnant or ejected debris disk , the mechanism being similar to that which gives rise to the khz qpos in accreting neutron stars . although there is now evidence that some magnetars have disks @xcite , there is no evidence as yet for a disk around the sgrs , and it is also very difficult to understand the rotational phase dependence if a disk is responsible . an alternative is that we are seeing oscillations of the plasma - filled magnetosphere and the trapped fireball . simple estimates of the alfvn speed in the magnetosphere suggest that magnetospheric frequencies would be too high to explain the observations , but evolution of the magnetosphere and fireball over the course of the tail might be a natural explanation for the frequency drift suggested in section [ drift ] . the theoretical details of such modes remain to be worked out , however , and we will not discuss the magnetospheric model further in this paper . we will instead focus on the third and perhaps most promising mechanism , neutron star vibrations . the detection of similar frequencies in sgr 1806 - 20 and sgr 1900 + 14 makes sense in the context of global oscillation modes ; if the neutron stars have similar masses and magnetic fields , then they should ring with the same set of characteristic frequencies . the detection of similar frequencies at different rotational phases ( the @xmath12 625 hz qpos ) also argues in favor of an underlying global oscillation , with magnetospheric beaming / obscuration effects causing the phase dependence . frequency drift can also be incorporated within this model , as discussed later . attention has so far focused on the toroidal shear modes of the neutron star crust , thought to be both easy to excite and strongly coupled to the external magnetosphere ( providing a means to modulate the x - ray lightcurve ) . the most detailed computations of mode frequencies to date have included both the depth - dependence of the shear modulus within the crust , and the effective boost to the shear modulus due to the magnetic pressure @xcite . potentially important effects that have not been addressed in detail include coupling between crust and core due to the magnetic field , the equation of state in the boundary layer between crust and core , and non - uniformity of the magnetic field . in what follows we will refer to the models that assume no coupling between crust and core as `` pure crust '' models ; and those that do include coupling due to the field as `` coupled crust - core '' models . the question of whether or not `` pure crust '' models are adequate is an important one . @xcite used a toy model to show that if there is a strong perpendicular magnetic field threading the boundary , then large horizontal displacements at the base of the crust must excite vibrations in the core . the effects of coupling may however be mitigated in several ways . for example , coupling to the core will depend sensitively on the amplitude at the crust core boundary , and previous calculations show that this amplitude can be substantially smaller than that at the top of the crust ( see mcdermott , van horn & hansen 1988 , for example ) . thus , approximating the amplitude as a single constant for a given mode , as assumed by levin , may not be very accurate . the physics at the boundary layer at the base of the crust will also be crucial ( see for example @xcite ) . the elastic properties at the base of the crust @xcite have not yet been considered , and could substantially modify the eigenfunctions in this region . in addition , coupling will likely depend rather sensitively on both the magnetic field geometry and the particular displacement pattern of individual modes . the modes that persist , and that we observe , may be those for which the coupling is minimal . the presence of a strong toroidal field in the core of the star could also reduce coupling by making core more rigid and less prone to excitation . we will return to the issue of coupling later in this section . for the moment , however , we will start by assessing the observations in the light of the `` pure crust '' models . the 30 hz , 92 hz and 150 hz qpo can be interpreted within the global oscillation model as @xmath45 , @xmath8=2 , 7 and 12 torsional modes of the neutron star crust . @xcite suggested that the 626 hz oscillation seen in rhessi data could be associated with a toroidal mode having a single node in the radial displacement eigenfunction ( @xmath46 modes ) . recent estimates from piro ( 2005 , see his figure 3 ) suggest that this frequency is consistent with theoretical expectations . our confirmation of the same frequency in the rxte data , provides a firm indication that we are seeing not only modes with a sequence of different @xmath8-values , but also modes with different @xmath47-values . it is possible that the 625 hz qpo seen in the rxte dataset represents an evolution of the qpo seen earlier in the flare in the rhessi data . however , the mode model also offers a possible explanation for the detection of two @xmath12 625 hz qpos with differences in properties . calculations ( see @xcite ) , indicate that the @xmath48 mode frequencies are not very sensitive to @xmath8 . as such we could be seeing two @xmath48 modes of different @xmath8 , excited at different times by either aftershocks or mode coupling . the implications of detecting an @xmath48 mode are discussed in more detail in section [ thick ] . the 18 hz and 26 hz qpos are at first glance too low in frequency to fit simple torsional mode models , however , mode calculations with realistic magnetic fields will have @xmath49-dependent splitting , perhaps producing an observable multiplet structure . this might accommodate the observed spread from about 26 - 30 hz in a putative @xmath50 mode , but detailed calculations will be required to explore this quantitatively . the 18 hz qpo , however , remains difficult to understand . the stronger high frequency qpos at 625 and 1840 hz can be nicely accommodated within the torsional mode hypothesis as low @xmath8 , @xmath48 and @xmath51 modes , respectively ( see , for example , figure 3 in piro 2005 ) . the less significant features at 720 , 976 , and 2,384 hz , may also fit within this scenario . the 720 hz might represent a low @xmath47 mode with significantly different @xmath8 , as pointed out by hansen & cioffi ( 1980 ) , the @xmath8 dependence of such modes is not strong , but can produce a scatter in frequency on the order of 15% . the other frequencies might correspond to modes with @xmath52 , and @xmath53 , respectively . in addition , at these high frequencies , other modes , such as the crustal spheroidal modes ( see mcdermott et al . 1988 ) , may become relevant . again , more detailed mode calculations , including the effects of magnetic fields , will be needed to make more quantitative mode identifications . if the 625 hz qpos are indeed @xmath48 torsional modes , the implications for the study of neutron star structure are profound . the ratio of frequencies of the @xmath48 and @xmath45 torsional modes enables one to deduce the depth of the neutron star crust ( see hansen & cioffi 1980 ; piro 2005 ) . the basic physics behind this estimate is that the @xmath45 mode frequencies are set by the horizontal wavelength , which scales with the stellar radius , @xmath54 , whereas the @xmath55 mode frequencies are dominated by the vertical wavelength , which senses the depth of the crust , @xmath56 . in the limit of a thin crust and a constant shear wave speed , one finds the simple expression ( see hansen & cioffi 1980 ; mcdermott et al . 1988 ; piro 2005 ) , @xmath57 if we identify 30 hz with the @xmath58 mode frequency , and 625 hz with the @xmath48 mode ( and @xmath59 ) , the above expression predicts @xmath60 . in most modern neutron star models , however , the crust is not `` thin '' in the sense of @xmath61 , and the shear speed has some variation with depth , so this simple estimate should probably be considered a lower limit . a more accurate estimate can be obtained by comparisons with more detailed mode calculations . for example , using the calculations of mcdermott et al . ( 1988 ) we evaluated the expression , @xmath62 , that according to the approximate theory should be the proportionality constant between the mode frequency ratio and the fractional depth of the crust . for the four models tabulated by mcdermott et al . ( 1988 ) we find that this expression ranges from 2.15 to 2.65 . adopting this range as representative , and using the scale factors to convert our observed mode frequency ratios into depths , we obtain the range , @xmath63 . we note that the models from mcdermott et al . use softer equation of state models than are currently favored , so it is important to repeat this exercise with more up to date neutron star models , and also incorporate magnetic fields . in addition the effects of possible crust - core coupling must be considered ( see next subsection ) . measuring the thickness of a neutron star crust also conveys information on the equation of state ( eos ) . in other words , stellar models of a given mass computed with different eoss will in general have crusts of different depths . for example , lattimer ( 2006 ) has recently outlined how constraints on the fractional depth and stellar mass could be used to constrain the nuclear symmetry energy and the nuclear force model . the crust depth dependence on the eos also has implications for pulsar glitch models ( see , for exmaple , crawford & demianski 2003 ; link , espstein & lattimer 1999 ) . if the coupling between crust and core is strong , by virtue of boundary layer physics or magnetic field threading , one needs to consider the global magneto - elastic modes of the neutron star . as first suggested by @xcite , global modes can accommodate the lower frequency 18 and 26 hz qpos very easily . a recent paper by @xcite developed a simple slab model of global magneto - elastic oscillations that showed two interesting features . firstly , it confirmed the presence of modes at lower frequencies than the `` pure crust '' toroidal modes . secondly , the model exhibited modes for which the amplitudes in the crust were strong ; in these cases the frequency was very close to the well - established `` pure crust '' frequencies . in other words , even with coupling included , it is possible to obtain very similar frequencies to those that we know match the data . although the model was very simple ( slab geometry , for example , is not adequate to describe behavior deep in the core ) , this gives us some indication that global modes may have similar frequencies . low core amplitudes would also reduce damping , another issue of concern for @xcite . the bounds on crust thickness estimated in section 3.2.1 above were based on `` pure crust '' models . in principle , however , a similar calculation could be done for coupled crust - core modes , using the ratio of two frequencies to scale out gravitational redshift effects . figure [ fig10 ] shows the periods during the tail of the flare when the different qpos are detected in either the rxte or rhessi datasets . some of the oscillations are seen throughout the flare , others are detected only after the rise in emission half way through the tail , and the highest frequency modes are very short - lived . this complex temporal variation requires explanation , and to do this we must understand the excitation and damping mechanisms . the data suggest that some qpos are excited by the main flare , whereas others are excited later in the tail , perhaps by aftershock fracturing and reconnection , or energy release from the core . the association of several of the qpos with the rise in emission late in the tail lends support to the idea of continued excitation . however , there remains the possibility that all of the qpos are excited by the main flare , with their visibility depending on beaming effects that vary during the tail . beaming will be influenced by both the magnetic field and by the plasma surrounding the magnetar . selection by beaming might also account for the fact that only some of the myriad oscillations predicted by theory are observed - although mode excitation will also depend sensitively on the speed and extent of the fracture . some modes may also damp far too quickly to be detected , depending on local conditions in the crust and magnetic field geometry . we believe that these factors are more than capable of accounting for the fact that only a few frequencies reach detectable amplitudes , an issue of concern to levin ( 2006 ) . once a mode is excited , there is still significant variation in amplitude and perhaps in frequency ( as discussed in section [ drift ] ) . one possibility to explain amplitude variation is that the mechanism which modulates the x - ray flux is strongly `` tunable . '' that is , at times when certain frequencies are detected their instantaneous amplitudes can be quite high , almost certainly higher than the relative surface motions . so , it may be that the modulation mechanism can amplify relatively small surface motions . resonant interaction between the crust and the core could also lead to amplitude variations over the course of the tail . frequency drifts could arise in several ways . evolution of the magnetic field in the aftermath of the flare , relaxation of the deep crustal structure , and the evolution of the surrounding plasma , are all candidates for causing frequency shifts . alternatively we could be seeing different members of a magnetically - split multiplet excited , perhaps , by mode coupling . our study of the rxte data from the sgr 1806 - 20 hyperflare indicates that a complex pulsation phenomenology is associated with magnetar hyperflares . the discovery of new khz - range frequencies consistent with theoretical predictions for @xmath55 torsional modes provides strong evidence that we may be seeing vibration modes of the neutron star crust excited by these catastrophic events . if this is true , then it opens up the exciting prospect of probing the interiors of neutron stars in a manner analogous to helioseismology . additional excitement is warranted when we consider that all the current datasets used to explore these oscillations have been purely serendipitous . that is , they have not been optimized in any way for studying these signals . this suggests that a wealth of additional information would likely be found from instruments better optimized to capture with high time resolution the flood of x - rays produced by these events . based on the findings presented here we are also strongly convinced that more theoretical work is definitely needed to make more accurate mode identifications , to better understand the excitation and damping mechanisms of modes and how they can couple to the x - ray emission , and to make more precise inferences on neutron star structure . alw acknowledges support from the european union fp5 research training network `` gamma - ray bursts : an enigma and a tool '' . tes thanks nasa for its support of high energy astrophysics research . we are also grateful to the anonymous referee for a detailed report , including many useful thoughts on qpo interpretation . crawford , f. , & demiaski , m. 2003 , apj , 595 , 1052 . duncan , r.c . 1998 , apj , 498 , l45 flowers , e. , & ruderman , m.a . 1977 , apj , 215 , 302 glampedakis , k. , samuelsson , l. & andersson , n. 2006 , astro - ph/0605461 hansen , c. j. & cioffi , d. f. 1980 , apj , 238 , 740 . israel , g. , et al . , 2005 , apj , 628 , l53 kinney , j.b . , & mendell , g. 2003 , phys . d , 67 , 024032 lattimer , j. m. 2006 , to appear in the proceedings of the conference ` isolated neutron stars : from the interior to the surface ' , published in apss ( springer ) levin , y. 2006 , mnras , 368 , l35 . link , b. , epstein , r. i. , & lattimer , j. m. 1999 , physical review letters , 83 , 3362 . mcdermott , p.n . , van horn , h.m . , & hansen , c.j . 1988 , apj , 325 , 725 pethick , c.j . & potekhin , a.y . 1998 , phys . b , 427 , 7 piro , a.l . 2005 , apj , 634 , l153 schwartz , s.j . , 2005 , , 627 , l129 smith , e. , swank , j. , markwardt , c.b . , rephaeli , y. , gruber , d. , persic , m. , & rothschild , r. , 2005 , gcn grb observation report 2927 strohmayer , t.e . , & watts , a.l . 2005 , apj , 632 , l111 thompson , c. , & duncan , r.c . 2001 , apj , 561 , 980 thompson , c. , & duncan , r.c . 1995 , mnras , 275 , 255 wang , z. , chakrabarty , d. , & kaplan , d.l . 2006 , nature , 440 , 772 watts , a.l . , andersson , n. , beyer , h. & schutz , b.f . 2003 , mnras , 342 , 1156 watts , a.l . , andersson , n. & williams , r.l . 2004 , mnras , 350 , 927 watts , a.l . & strohmayer , t.e . 2006 , apj , 637 , l117 distribution ( solid ) . the distribution is plotted in units of @xmath22 s . the vertical dashed line marks the peak power of the 625 hz feature . see the text for further discussion.,width=576,height=576 ] ( one trial ) deviation . the 625 and 1,840 hz features are detected in the top spectrum , while several different frequencies are suggested in the bottom spectrum . see the text for more details.,width=576,height=576 ] 18 hz qpo starts 89s after the main flare ; that for the @xmath12 26 hz qpo starts 127s after the main flare . simultaneous peaks are seen in the rxte data despite the apparent countrate disadvantages of rxte.,width=576 ] 60 s after the main flare . the y - axis shows frequency in hz . dynamical power spectra , shown as contours , are computed from 1s segments , overlapping by 0.1s . the minimum contour level shown is a power of 15 , with increments of 5 . lightcurves are also shown , plotted to the same scale on each panel . the plots show amplitude variation , frequency evolution , and possible multiplet activity . the start time of each panel in seconds ( relative to the initial flare at time zero ) is : ( 1 ) 59.8 , ( 2 ) 67.4 , ( 3 ) 75.0 , ( 4 ) 82.5 , ( 5 ) 90.1 , ( 6 ) 97.7 , ( 7 ) 105.3 , ( 8) 112.8 , ( 9 ) 120.4 , ( 10 ) 128.0 , ( 11 ) 135.6 , ( 12 ) 143.1 , ( 13 ) 150.7 , ( 14 ) 158.3 , ( 15 ) 165.9 , ( 16 ) 173.4 , ( 17 ) 181.0 , ( 18 ) 188.6 , ( 19 ) 196.2 , ( 20 ) 203.7 , ( 21 ) 211.3 , ( 22 ) 218.9 , ( 23 ) 226.5 , ( 24 ) 234.0 , ( 25 ) 241.6 , ( 26 ) 249.2 , ( 27 ) 256.8 , ( 28 ) 264.3,width=624 ] 17.9 @xmath64 0.1 & 1.9 @xmath64 0.2 & 4.0 @xmath64 0.3 & 60 - 230 & p2/i & rhessi & [ 1 ] + 25.7 @xmath64 0.1 & 3.0 @xmath64 0.2 & 5.0 @xmath64 0.3 & 60 - 230 & p2/i & rhessi & [ 1 ] + 29.0 @xmath64 0.4 & 4.1 @xmath64 0.5 & 20.5@xmath64 3.0 & 190 - 260 & p2/i & rxte & [ 2 ] + 92.5 @xmath64 0.2 & @xmath65 & 10.7 @xmath64 1.2 & 150 - 260 & p2/i & rxte & [ 3 ] + 92.7 @xmath64 0.1 & 2.3 @xmath64 0.2 & 10.3 @xmath64 0.8 & 150 - 260 & p2/i & rhessi & [ 1,4 ] + 92.9 @xmath64 0.2 & 2.4 @xmath64 0.3 & 19.2 @xmath64 2.0 & 190 - 260 & p2/i & rxte & [ 2,5 ] + 150.3 @xmath64 1.6 & 17 @xmath64 5 & 6.8 @xmath64 1.3 & 10 - 350 & p1 & rxte & [ 2 ] + [ 6pt ]

we report an analysis of the archival rossi x - ray timing explorer ( rxte ) data from the december 2004 hyperflare from sgr 1806 - 20 . in addition to the @xmath0 hz qpo first discovered by israel et al . , we report the detection of higher frequency oscillations at @xmath1 , 625 , and 1,840 hz . in addition , we also find indications of oscillations at @xmath2 , and 2,384 hz , but with lower significances . the 150 hz qpo has a width ( fwhm ) of about 17 hz , an average amplitude ( rms ) of @xmath3 , and is detected in average power spectra centered on the rotational phase of the strongest peak in the pulse profile . this is approximately half a cycle from the phase at which the 90 hz qpo is detected . the 625 hz oscillation was detected in an average power spectrum from nine successive cycles beginning approximately 180 s after the initial hard spike . it has a width ( fwhm ) of @xmath4 hz and an average amplitude ( rms ) during this interval of @xmath5 . we find a strong detection of the 625 hz oscillation in a pair of successive rotation cycles begining about 230 s after the start of the flare . in these cycles we also detect the 1,840 hz qpo . when the 625 hz qpo is detected we also confirm the simultaneous presence of 30 and 92 hz qpos . the centroid frequency of the 625 hz qpo detected with rxte is within 1 hz of the @xmath6 hz oscillation recently found in rhessi data from this hyperflare by watts & strohmayer . we argue that these new findings provide further evidence for a connection of these oscillations with global oscillation modes of neutron stars , in particular , the high frequency signals may represent toroidal modes with at least one radial node in the crust . we discuss their implications in the context of this model , in particular for the depth of neutron star crusts .

SECTION 1. SHORT TITLE. This Act may be cited as the ``Retired Pay Restoration Act''. SEC. 2. ELIGIBILITY FOR PAYMENT OF BOTH RETIRED PAY AND VETERANS' DISABILITY COMPENSATION FOR CERTAIN MILITARY RETIREES WITH COMPENSABLE SERVICE-CONNECTED DISABILITIES. (a) Extension of Concurrent Receipt Authority to Retirees With Service-Connected Disabilities Rated Less Than 50 Percent.--Subsection (a) of section 1414 of title 10, United States Code, is amended-- (1) by striking ``Compensation'' in the subsection heading and all that follows through ``Subject'' and inserting ``Compensation.--Subject''; and (2) by striking paragraph (2). (b) Phase-In of Concurrent Receipt for Retirees With Service- Connected Disabilities Rated as 40 Percent or Less.--Subsection (c) of such section is amended-- (1) in the matter before paragraph (1), by striking ``subsection (a)(1)'' and inserting ``subsection (a)''; and (2) in paragraph (1), by adding at the end the following new subparagraph: ``(G) For a month for which the retiree receives veterans' disability compensation for a disability rated as 40 percent or less or has a service-connected disability rated as zero percent, $0.''. (c) Clerical Amendments.-- (1) Section heading.--The heading for such section is amended to read as follows: ``Sec. 1414. Members eligible for retired pay who are also eligible for veterans' disability compensation: concurrent payment of retired pay and disability compensation.''. (2) Table of sections.--The item relating to such section in the table of sections at the beginning of chapter 71 of such title is amended to read as follows: ``1414. Members eligible for retired pay who are also eligible for veterans' disability compensation: concurrent payment of retired pay and disability compensation.''. (d) Effective Date.--The amendments made by this section shall take effect on January 1, 2010, and shall apply to payments for months beginning on or after that date. SEC. 3. COORDINATION OF SERVICE ELIGIBILITY FOR COMBAT-RELATED SPECIAL COMPENSATION AND CONCURRENT RECEIPT. (a) Eligibility for TERA Retirees.--Subsection (c) of section 1413a of title 10, United States Code, is amended by striking ``entitled to retired pay who--'' and all that follows through the end of paragraph (1) and inserting ``who-- ``(1) is entitled to retired pay, other than a member retired under chapter 61 of this title with less than 20 years of service creditable under section 1405 of this title and less than 20 years of service computed under section 12732 of this title; and''. (b) Amendments To Standardize Similar Provisions.-- (1) Clerical amendment.--The heading for paragraph (3) of section 1413a(b) of such title is amended by striking ``rules'' and inserting ``rule''. (2) Specification of qualified retirees for concurrent receipt purposes.--Section 1414 of such title, as amended by section 2, is amended-- (A) in subsection (a)-- (i) by striking ``a member or'' and all that follows through ``retiree')'' and inserting ``an individual who is a qualified retiree for any month''; and (ii) by inserting ``retired pay and veterans' disability compensation'' after ``both''; and (B) in subsection (e), by adding at the end the following new paragraph: ``(5) Qualified retiree.--The term `qualified retiree' means a member or former member of the uniformed services who, with respect to any month-- ``(A) is entitled to retired pay, other than in the case of a member retired under chapter 61 of this title with less than 20 years of service creditable under section 1405 of this title and less than 20 years of service computed under section 12732 of this title; and ``(B) is entitled to veterans' disability compensation.''. (3) Disability retirees.--Subsection (b) of section 1414 of such title is amended-- (A) by striking ``Special Rules'' in the subsection heading and all that follows through ``is subject to'' and inserting ``Special Rule for Chapter 61 Disability Retirees.--In the case of a qualified retiree who is retired under chapter 61 of this title, the retired pay of the member is subject to''; and (B) by striking paragraph (2). (c) Effective Date.--The amendments made by this section shall take effect on January 1, 2010, and shall apply to payments for months beginning on or after that date.

Retired Pay Restoration Act - Allows the receipt of both military retired pay and veterans' disability compensation with respect to any service-connected disability (under current law, only a disability rated at 50% or more). Provides a phase-in for the concurrent receipt of retired pay with respect to retirees with service-connected disabilities rated at 40% or less. Makes eligible for the full concurrent receipt of both veterans' disability compensation and either military retired pay or combat-related special pay those individuals who were retired or separated from military service due to a service-connected disability.

current treatment of the ichthyoses remains symptomatic , and largely directed towards reducing the scaling component of these disorders . yet , such therapy of the ichthyoses is often irrational , because removal of excess scale can interfere with homeostatic responses that allow patients to survive in a harsh , terrestrial environment . moreover , the favored alternative , corrective gene therapy , though seductive in concept , remains a distant dream , impeded by : ( 1 ) difficulties in transcutaneous drug delivery ; ( 2 ) enormous costs of the required designer gene approach ; ( 3 ) discomfort of intracutaneous injections ; and ( 4 ) unknown , long - term risks of transfection with viral vectors . all ichthyoses , including inherited syndromic disorders of distal cholesterol metabolism , display a permeability barrier abnormality , with the severity of the clinical phenotype paralleling the prominence of the barrier abnormality ( reviewed in ref . , we have assumed that the cutaneous phenotype represents a best attempt by a metabolically - compromised epidermis to generate a competent permeability barrier in the desiccating , terrestrial environment ( op . epidermis mounts a vigorous , metabolic response in response to a compromised barrier that rapidly restores function,46 ichthyotic epidermis only partially succeeds in normalizing function.13 as a result , the clinical phenotype reflects the negative consequences of the genetic mutation for epidermal function , coupled with the epidermis ' impaired , homeostatic response . thus , unraveling the cellular and biochemical mechanisms that account for the barrier abnormality provides an explanation for the pathogenesis of the cutaneous phenotypes ( reviewed in ref . 2 , 3 and 7 ) , and it could point to potentially - novel , pathway - based therapies . in disorders due to impaired cholesterol synthesis , evidence to date suggests that the clinical phenotype in most cases reflects either accumulation of toxic metabolites and/or deficiency of pathway end - product.8 moreover , in all of the lipid - metabolic disorders , whether due to metabolite accumulation , pathway product deficiency , or both , lamellar / non - lamellar ( l / nl ) phase separation within the lamellar bilayers accounts , at least in part , for the barrier abnormality ( examples of pathogenic mechanisms for disorders of distal cholesterol metabolism are shown in table 1 ) . we typically assess four different , functional end - points ; i.e. , tewl , ph , hydration and stratum corneum ( sc ) integrity , which separately or together can impact permeability barrier function . for example , a less cohesive sc , which often is due to an elevated ph of sc , increases proteolytic degradation of corneodesmosomes , which results in a poor quality sc . finally , the ph - driven increase also activates pro - inflammatory cytokines , such as il-1 and il-1 , further aggravating barrier function while provoking inflammation . by measuring multiple functional , structural and biochemical parameters and their structural / biochemical basis , together , this approach has identified key pathophysiologic abnormalities ( e.g. , metabolite accumulation and/or product depletion ) in these disorders , which in turn could point to the most - promising , potential , pathogenic - based therapeutic interventions ( see below ) . nine enzymatic steps are required to generate cholesterol from lanosterol , with the further generation of cholesterol sulfate from cholesterol comprising a tenth step ( fig . while syndromic disorders , with a variety of developmental malformations , have been reported in seven of these diseases,913 an abnormal cutaneous phenotype has been described in only six , i.e. , lathosterolosis , desmosterolosis , congenital hemidysplasia with ichthyosiform erythroderma and limb defects ( child ) syndrome , conradi - hnermann - happle syndrome ( chh ) or x - linked chondrodysplasia punctata type 2 ( cdpx2 ) , sc4mol deficiency1416 and x - linked ichthyosis ( xli).17 the pathogenesis of the ichthyosiform dermatosis ( and likely the extracutaneous abnormalities ) in all of the inborn errors of distal cholesterol metabolism can be variously attributed to either : deficiency of cholesterol in cell membranes and/or toxic effects of accumulated sterol precursors with resulting functional alterations.18,19 sterol precursors can only partially substitute for cholesterol in the formation of sc lamellar membranes , and cholesterol is one of the three key sc lipids ( along with ceramides and free fatty acids ) required to form lamellar membranes ( reviewed in ref . additional , downstream pathogenic mechanisms whereby sterol metabolites could contribute to disease pathogenesis include : ( 1 ) formation of oxysterol metabolites that either downregulate cholesterol synthesis or activate the liver x receptor;21 ( 2 ) altered hedgehog pathway signaling ( hox normally is tethered onto cell membranes via a cholesterol moiety);22,23 and/or ( 3 ) deficient peroxisomal function , as we have described in both chh , child patients and in the bare patches mouse model,2428 which displays nsdhl mutations that mimic child syndrome29,30 ( further information about our work on the pathogenesis of child syndrome , chh and xli is provided below ) ; and ( 4 ) sterol metabolite - accelerated degradation of hmgcoa reductase.31 while ichthyosis is not clinically apparent in smith - lemli - opitz syndrome ( slos ) ( omim # 270400 ) [ 7-dehydrocholesterol reductase ( dhcr7 ) deficiency ] , both photosensitivity and a propensity to develop eczema are common32 ( drs . dhcr7 deficiency impairs both desmosterol and 7-dehydrocholesterol metabolism,20,21,33 resulting in elevated 7-dhc and 8-dhc blood levels , with proportionate , phenotype - dependent reductions in serum cholesterol,913,24,32,34,35 alterations that are mimicked in dhcr7 and mice,36 and in mice with a knock - in of the human t93 m mutation.37 slos is fairly common ( predicted incidence of 1:10,000),8 with over 120 different dhcr7 mutations identified to date.32 although the pi is unaware of lathosterolosis cases in the us , several patients have been described in europe , and all have prominent ichthyosis . moreover , a mouse model of lathosterolosis ( sc5d and ) is available,15 which should allow assessment of pathogenic mechanisms in this disorder ( see below ) . furthermore , a us kindred38 and several additional patients in europe14 have been described with desmosterolosis , a disorder that displays prominent congenital anomalies , but minimal evidence of skin abnormalities . finally , a prominent skin phenotype has been described in two patients with sc4mol deficiency , who present with a severe ichthyosiform dermatosis and psoriasiform features.16 conradi - hnermann - happle syndrome ( chh ) or x - linked dominant chondrodysplasia punctata type 2 ( cdpx2 ) ( omim # 302960 ) exhibits linear bands of scaling or follicular spikes in a morphogenic pattern ( i.e. , along the lines of blaschko ) , and generalized erythroderma , most prominently in neonates . involved skin sites conform to regions in which the mutant x - chromosome predominates.39,40 the cutaneous features of chh and child syndrome can improve after infancy,40 due to diminished viability of keratinocytes bearing the mutant x chromosome.29 the cutaneous phenotype in child syndrome ( omim # 308050 ) , however , differs in its distribution from chh ; i.e. , it is strictly unilateral , including both skeletal defects and internal organ involvement . skin lesions are circumscribed plaques , surmounted by prominent wax - like scales , which typically involve flectures.23 chh is caused by mutations in ebp ( emopamil - binding protein ) that encodes -hydroxysterol- , -isomerase , which catalyzes the conversion of 8(9)-cholestenol to lathostero1,34,41,42 resulting in diagnostic elevations in serum 8-dehydrocholesterol and 8(9 ) cholesterol.43 mutations in nsdhl , which encodes a member of the enzyme complex that removes the c-4 methyl group from lanosterol , underlie child syndrome . however , child syndrome can also be caused by mutations in ebp9,43 ( fig . 1 ) . given the close proximity of the sites of metabolic blockade , the presence of some phenotypic overlap between child and chh is not surprising ( reviewed in ref . 9 ) . availability of mouse models of chh and child syndrome8 should allow for an assessment of the mechanistic basis for the cutaneous phenotype in chh and child syndrome , and for preclinical evaluation of potential therapies for these patients . both the density of lamellar bodies ( lb ) and lb secretion appear normal in chh , but organelle contents are abnormal , displaying vesicular inclusions . moreover , newly - secreted material fails to disburse at the stratum granulosum - sc interface.7 furthermore , these electron - lucent vesicles persist as discrete spheres after secretion at the stratum granulosum - sc interface . importantly , maturation of lamellar bilayers is delayed , and bilayer membranes with normal morphology are displaced by extensive areas of lamellar / non - lamellar phase separation ( table 1).29 yet , the morphology of clinically - affected skin sites in child syndrome is even more dramatically abnormal than that in chh . although lb form normally , they display almost no internal lamellae , and they fuse into intracellular multivesicular bodies , which then are largely ( but incompletely ) secreted.7 nevertheless , the sc displays a huge expansion of the extracellular matrix , which is filled with interspersed lamellar and non - lamellar material.7 together , these features predict a severe barrier abnormality in both child and chh . the pathogenesis of xli is better known than for any of the other ichthyoses . as a result of steroid sulfatase ( ssase ) deficiency in xli , cholesterol sulfate ( cso4 ) accumulates in the outer epidermis,4446 in erythrocyte cell membranes,45,47 as well as in both the ldl ( -lipoprotein ) and pre - ldl fractions of plasma.45 but cso4 levels in epidermis are an order of magnitude higher than are levels in blood,45,47 likely explaining the prominence of epidermal vs. other organ involvement in xli.48 normally , cso4 levels decline to about 1% of lipid mass in the outer sc , through ongoing hydrolysis during sc transit.49,50 in contrast , the sc in xli typically contains 1012% cholesterol sulfate ( by dry weight).48 hydrolysis of cso4 generates some of the cholesterol required for the barrier , while conversely , cso4 itself is a potent inhibitor of hmgcoa reductase , further reducing cholesterol levels in xli.48 although ssase is secreted from lamellar bodies ( like other lipid hydrolases that process barrier lipid precursors into their own hydrophobic products ) , cso4 is delivered to the sc interstices by its extreme amphiphilicity , which allows it to diffuse readily across cell membranes;51 i.e. , in the absence of a lipid milieu within corneocytes , cholesterol sulfate likely partitions preferentially into the highly hydrophobic , extracellular domains of the stratum corneum . accumulation of cso4 , coupled with cholesterol depletion , provokes lamellar / non - lamellar phase separation,17 accounting for the barrier abnormality in xli.52 the pathogenesis of xli is better known than for any of the other ichthyoses . as a result of steroid sulfatase ( ssase ) deficiency in xli , cholesterol sulfate ( cso4 ) accumulates in the outer epidermis,4446 in erythrocyte cell membranes,45,47 as well as in both the ldl ( -lipoprotein ) and pre - ldl fractions of plasma.45 but cso4 levels in epidermis are an order of magnitude higher than are levels in blood,45,47 likely explaining the prominence of epidermal vs. other organ involvement in xli.48 normally , cso4 levels decline to about 1% of lipid mass in the outer sc , through ongoing hydrolysis during sc transit.49,50 in contrast , the sc in xli typically contains 1012% cholesterol sulfate ( by dry weight).48 hydrolysis of cso4 generates some of the cholesterol required for the barrier , while conversely , cso4 itself is a potent inhibitor of hmgcoa reductase , further reducing cholesterol levels in xli.48 although ssase is secreted from lamellar bodies ( like other lipid hydrolases that process barrier lipid precursors into their own hydrophobic products ) , cso4 is delivered to the sc interstices by its extreme amphiphilicity , which allows it to diffuse readily across cell membranes;51 i.e. , in the absence of a lipid milieu within corneocytes , cholesterol sulfate likely partitions preferentially into the highly hydrophobic , extracellular domains of the stratum corneum . accumulation of cso4 , coupled with cholesterol depletion , provokes lamellar / non - lamellar phase separation,17 accounting for the barrier abnormality in xli.52 the brown and goldstein group recently published relevant work on another animal model with aberrant cholesterol synthesis ; i.e. , epidermal - localized insig-1 mice with an additional germ - line deletion of insig-2 ( epi - insig ) dko mice.53 this model mimics the syndromic human disorder , ichthyosis follicularis , atrichia and photophobia ( ifap ) syndrome ( omim # 308205 ) . deletion of these intracellular proteins allows migration of srebp from the endoplasmic reticulum to the golgi apparatus followed by translocation to the nucleus , where these srebps excessively stimulate several genes involved in cholesterol synthesis . as a result , pertinently , these mice respond to treatment with topical simvastatin , which simultaneously normalizes both metabolite production and cholesterol levels in epidermis.53 this recent work , coupled with preliminary evidence of efficacy with topical lovastatin plus cholesterol in child syndrome,54 provides evidence that metabolite accumulation in the epidermis can be toxic ; and conversely , that blockade of metabolite production ( and normalization of cholesterol levels ) could be beneficial for these disorders . while slos patients display a minimal skin phenotype , dhcr7 mice display prominent ichthyosis , with neonatal lethality due to a putative permeability barrier abnormality.36 more pertinent to slos patients , who display residual enzyme function , our still - unpublished preliminary studies in dhcr7 mice ( with s. patel ) demonstrate epidermal structural abnormalities in both lamellar body contents and lamellar bilayer organization , predictive of a barrier abnormality in slos patients with comparable reductions in enzyme activity . these mice also display serum 7dhc and cholesterol levels that are comparable to patients with moderate slos due to partial loss - of - function mutations.36 one relatively - common mutation in slos ( t93 m ) has been recapitulated in a transgenic knockin mouse model.37,55 while their skin phenotype has not yet been assessed , this model should also be useful to assess both pathogenic mechanisms and preclinical therapeutic studies . we also have recently begun to assess a potential animal model of desmosterolosis . like dhcr7 mice , dhcr24 mice are neonatal lethal , apparently due to a failure of epidermal development in utero , but possibly also due to a barrier defect.56,57 in contrast , dhcr24 mice survive , and like dhcr7 mice , they show structural evidence of a skin barrier abnormality . while the bpa , stri and tattered strains closely mimic varying severities of chh and child syndromes , one of these animal models is not a pure analogue of human disease ; i.e. , the sc5d mouse , but partial loss - of - function in the sc5d could reflect comparable reductions in enzyme function in lathosterolosis . thus , this model could also be useful to assess pathogenic mechanisms and potential therapies for lathosterolosis . the brown and goldstein group recently published relevant work on another animal model with aberrant cholesterol synthesis ; i.e. , epidermal - localized insig-1 mice with an additional germ - line deletion of insig-2 ( epi - insig ) dko mice.53 this model mimics the syndromic human disorder , ichthyosis follicularis , atrichia and photophobia ( ifap ) syndrome ( omim # 308205 ) . deletion of these intracellular proteins allows migration of srebp from the endoplasmic reticulum to the golgi apparatus followed by translocation to the nucleus , where these srebps excessively stimulate several genes involved in cholesterol synthesis . as a result , pertinently , these mice respond to treatment with topical simvastatin , which simultaneously normalizes both metabolite production and cholesterol levels in epidermis.53 this recent work , coupled with preliminary evidence of efficacy with topical lovastatin plus cholesterol in child syndrome,54 provides evidence that metabolite accumulation in the epidermis can be toxic ; and conversely , that blockade of metabolite production ( and normalization of cholesterol levels ) could be beneficial for these disorders . while slos patients display a minimal skin phenotype , dhcr7 mice display prominent ichthyosis , with neonatal lethality due to a putative permeability barrier abnormality.36 more pertinent to slos patients , who display residual enzyme function , our still - unpublished preliminary studies in dhcr7 mice ( with s. patel ) demonstrate epidermal structural abnormalities in both lamellar body contents and lamellar bilayer organization , predictive of a barrier abnormality in slos patients with comparable reductions in enzyme activity . these mice also display serum 7dhc and cholesterol levels that are comparable to patients with moderate slos due to partial loss - of - function mutations.36 one relatively - common mutation in slos ( t93 m ) has been recapitulated in a transgenic while their skin phenotype has not yet been assessed , this model should also be useful to assess both pathogenic mechanisms and preclinical therapeutic studies . we also have recently begun to assess a potential animal model of desmosterolosis . like dhcr7 mice , dhcr24 mice are neonatal lethal , apparently due to a failure of epidermal development in utero , but possibly also due to a barrier defect.56,57 in contrast , dhcr24 mice survive , and like dhcr7 mice , they show structural evidence of a skin barrier abnormality . while the bpa , stri and tattered strains closely mimic varying severities of chh and child syndromes , one of these animal models is not a pure analogue of human disease ; i.e. , the sc5d mouse , but partial loss - of - function in the sc5d could reflect comparable reductions in enzyme function in lathosterolosis . thus , this model could also be useful to assess pathogenic mechanisms and potential therapies for lathosterolosis . current therapy of the ichthyoses is largely aimed at scale removal ; i.e. , it is purely symptomatic . not only is this form of therapy relatively ineffective excess stratum corneum ( sc ) , symptomatic therapy can do more harm than good ( = therapeutic paradox ) as seen with : ( 1 ) retinoids in the treatment of netherton syndrome ( ns),58 and sometimes in epidermolytic ichthyosis ( ei);59 ( 2 ) excessive absorption of salicylates , lactic acid or immunosuppressive molecules in ns;58 and ( 3 ) worsening of the permeability barrier after alpha - hydroxyacid applications , accentuating fluid and electrolyte abnormalities in hi , ns , ei and other disorders.58 while localized gene therapy has shown promise in focal conditions , such as pachyonychia congenital,60 generalized skin involvement in most of the ichthyoses makes topical gene therapy impractical . moreover , this approach can be limited by pain from injections,60 unknown risks for viral vector - induced neoplasia , and the high cost of designer gene replacement , which together render gene therapy largely impractical for this diverse group of disorders , and certainly unattainable for patients in the developing world . very recently , we proposed a novel , pathogenesis - based approach to the treatment of ichthyosis in disorders of distal cholesterol metabolism;54 i.e. , provision of pathway product plus blockade of metabolite production , exploiting this new understanding of disease pathogenesis ( fig . 2 ) . if metabolite accumulation appears to account for the cutaneous phenotype , it would seem reasonable to deploy a proximal enzyme inhibitor [ e.g. , of hmgcoa reductase ( lovastatin ) ] to reduce levels of potentially - toxic metabolites . in addition , provision of the pathway product ( cholesterol ) to avoid epidermal dysfunction due to cholesterol deficiency could also be beneficial by further downregulating ( negative feed - back ) of hmgcoa reductase activity . then , this new information about disease pathogenesis has the potential to be deployed rapidly into topical therapy for patients with rare inherited disorders of distal cholesterol metabolism ( table 2 ) . another not - so - rare , inherited disorder of distal cholesterol metabolism , x - linked ichthyosis ( xli ) , occurs in 1:2,0006,000 males . our studies over several years already have shown that disease pathogenesis in xli also reflects both metabolite ( cso4 ) accumulation and end - product ( cholesterol ) deficiency ( see also above).17,46,48 pertinently , topical cholesterol alone in our experience is not effective in xli , but the ichthyosis in xli could be treatable with either a topical statin or a sulfotransferase inhibitor ( plus cholesterol ) . it must be emphasized that blockade of metabolite production alone , though it could be temporarily useful , can not be utilized as monotherapy for the cutaneous phenotype in these disorders , because the end - product of this pathway ( i.e. , cholesterol ) is required to prevent development of a permeability barrier abnormality ( topical statins provoke a barrier abnormality with ichthyosiform changes in normal mouse skin).61,62 in very preliminary studies , we have treated two patients with one of the rare disorders of distal cholesterol metabolism ( child syndrome ) [ drs . amy paller ( northwestern university ) and marina rodriquez - martin ( canary islands univ hospital)point mutation in g83dp gly83 asp in nshdl , and nonsense mutation ( c.317c > a ; p.s106x ) in nshdl , respectively ] . notably , these patients failed to improve with topical cholesterol alone , but both responded to dual treatment with cholesterol plus lovastatin.54 both excessive scale and epidermal hyperplasia diminished greatly , and one patient displayed improved mobility of underlying extremities by 68 weeks of treatment . in principal , this approach bridges the two poles of symptomatic vs. curative ( i.e. , gene ) therapy . it also displays the following inherent advantages : ( 1 ) it is disease - targeted and mechanism - based specificity ; ( 2 ) it is inherent safe ; ( 3 ) it is relatively low - cost ; and ( 4 ) most - importantly , it exploits the accessibility of skin to assess efficacy , as well as providing the opportunity to assess the mechanisms responsible for positive outcomes . yet , topical pathogenesis - based therapy is not curative , and even if successful , it would need to be utilized for the duration of the patient 's lifetime . moreover , despite knowledge of disease pathogenesis , it is possible that such mechanism - targeted therapies may not always be effective , if multiple downstream pathways contribute to disease pathogenesis . however , since these patients ' skin displays higher than normal water permeability , both the inhibitors and lipid end - products should be readily bioavailable . if either the drug or the lipid end - product fails to be delivered ( suggested by a failure to respond to either pathway product or pathway product inhibitor ) , it is possible that co - applications of inhibitor and lipid product together could interfere with absorption of one or both . finally and importantly , it is possible that there will be benefits for the extracutaneous features of one or more of these disorders . in the case of disorders of distal cholesterol metabolism , the transdermal approach has the potential to deliver statins and cholesterol to extracutaneous tissues prior to hepatic first - pass metabolism , offering the tantalizing prospect that topical therapy could improve the extracutaneous manifestations in one or more of these disorders . it is highly likely that the cutaneous phenotype reflects pathogenic mechanisms that also are on - going in extracutaneous tissues , successful pathogenesis - based therapy for the ichthyoses could point to comparable approach(es ) to treat / prevent the extracutaneous manifestations of these disorders .

molecular geneticists tend to conceptualize disease pathogenesis from the mutated gene outward , an approach that does not take into account the impact of barrier requirements in determining disease phenotype . an outside - to - inside perspective has provided quite different explanations for the ichthyoses , including several of the disorders of distal cholesterol metabolism . elucidation of responsible pathogenic mechanisms also is pointing to appropriate , pathogenesis ( pathway)-based therapeutic strategies . in the case of the lipid metabolic disorders , it takes full advantage of new molecular , genetic and cellular pathogenesis information to correct or bypass the metabolic abnormality . this approach fully exploits the unique accessibility of the skin to a topical approach . moreover , since it will utilize topical lipids and lipid - soluble , and often generic , lipid - soluble drugs , these treatments should be readily transported across the stratum corneum . if successful , this approach could initiate an entirely new departure for the therapy of the ichthyoses . finally , because these agents are relatively safe and inexpensive , this form of treatment has the potential to be widely - deployed , even in the developing world .

extensive evidence shows that biological networks are remarkably robust against damage of their nodes as well as links among the nodes . for example , parkinson disease only becomes apparent after a large proportion of pigmented cells in the substantia nigra are eliminated @xcite , and in spinal cord injuries in rats , as little as 5% of the remaining cells allow functional recovery @xcite . many metabolic networks , as well , were found to be robust against the knockout of single genes . this feature is both due to the existence of duplicate genes as well as alternative pathways which ensure that a certain metabolite can still be produced using the undamaged parts of the network @xcite . approaches of network analysis have been used to investigate various types of real - world networks , in which persons , proteins , brain areas or cities are considered nodes ; and functional interactions or structural connections are represented as edges of the network @xcite . many such systems display properties of small - world networks @xcite , with clustered local neighborhoods and short characteristic paths ( or average shortest paths , asp ) . also , some networks possess more highly connected nodes , or hubs , than same - size random networks , leading to a power - law degree ( _ scale - free _ ) distribution of edges per node , where the probability for a node possessing @xmath0 edges follows @xmath1 @xcite . such scale - free networks are error - tolerant towards random elimination of nodes , but react critically to the targeted elimination of highly connected nodes @xcite . it has been shown that cerebral cortical networks in the cat and macaque monkey brain display a similar behavior @xcite . while networks may possess features of both small - world and scale - free organization , the two topologies are not necessarily identical . whereas previous studies explored the impact of lesioning network nodes @xcite , the effect of _ edge _ elimination in biological networks has not yet been investigated . how can edges that are integral for the stability and function of a network be identified ? in some systems , for instance , transportation or information networks , functional measures for the importance of edges , such as flow or capacity , are available . for many biological networks , however , such measures do not exist . in brain connection networks , for example , a projection between two regions may have been reported , but its structural and functional strength is frequently unknown or not reliably specified @xcite , and its functional capacity may vary depending on the task @xcite . similarly , in biochemical networks , reaction kinetics are often highly variable , or generally unknown @xcite . however , the analysis of a network s structural organization may already provide useful information on the importance of individual nodes and connections , by identifying local features and investigating their importance for global network structure and function . specifically , we are interested in these questions : which structural patterns can be identified in a network ? have biological networks specific features , compared to artificial networks ? as examples for biological networks we analyzed cortical fiber networks , metabolic networks as well as protein interaction networks and , for comparison , also an artificial network , the german highway system . in our analyses we tested the effect of eliminating single edges from networks . for some of the studied networks , such as cortical connectivity , structural damage might also result in multiple lesions of connections or regions . such lesions can lead to network fragmentation , and may be theoretically analyzed within the framework of edge or vertex cut sets @xcite . a computational algorithm to predict the effect of multiple network perturbations ( or lesions ) was presented as part of the msa ( multi - perturbation shapley value analysis ) approach @xcite . in the present article , however , we focus on the impact of eliminating single edges , to infer network patterns and their vulnerability . two established parameters for characterizing networks are the average shortest path ( asp ) and the clustering coefficient ( cc ) . the asp is the average number of edges that have to be crossed in order to reach one node from another . for a network with @xmath2 nodes , it is calculated as the average of all existing shortest paths : + @xmath3 where @xmath4 is the number of edges of the shortest path between nodes @xmath5 and @xmath6 . infinite distances between unconnected nodes , which occur after network fragmentation , are excluded from the average calculation . we used the deviation of the asp before and after edge elimination as a measure of network damage . the clustering coefficient of a node @xmath7 with @xmath8 adjacent nodes ( neighbors ) is defined as the number of edges existing among the neighbors , divided by the number @xmath9 of all possible edges among the neighbors @xcite . we use the term clustering coefficient as the average clustering coefficient for all nodes of a network . networks with an asp comparable to randomly connected networks , but with much higher clustering coefficient , are called _ small - world _ networks @xcite . these systems exhibit network clusters , that are regions , in which many interconnections exist within a cluster , but only few connections run between clusters . various kinds of networks , such as electric power grids and social networks , display small - world properties @xcite . in addition , neural networks of _ c. elegans _ and cortical networks of the cat and macaque were also shown to be small - world networks @xcite and to exhibit a clustered architecture @xcite . we investigated long - range fiber projections in the cat and macaque brain . nodes were brain regions or areas ( e.g. , v1 ) , and edges were fiber connections between them . we considered connectivity data for a non - human primate , the macaque monkey ( 73 nodes ; 835 edges ; density 16% ) , and the cat ( 55 nodes ; 891 edges ; density 30% ) @xcite . in both species , the data included connections between cortical regions , as well as a few subcortical structures ( e.g. , the amygdala ) and regions of entorhinal cortex . these networks possess properties of small - world networks @xcite , and also show similar response to attack as scale - free networks @xcite . the clustering coefficient of these networks ranged between 40 to 50% ( cf . table [ corrtable ] ) . as an example of biochemical networks , we examined the protein - protein interactions of the _ s. cerevisiae _ yeast proteome @xcite . the data consisted of 1,846 proteins and 2,203 distinct functional relationships among them , forming 4,406 unidirectional edges in the network graph ( data from http://www.nd.edu/@xmath10networks/database/ ) . with a value of 6.8% , the clustering coefficient was considerably smaller than for brain networks . as a further difference , the protein interactions network consisted of 149 disconnected components . the main component contained 79% of the proteins , and the remaining components mostly were composed of only one pair of proteins . as shown before @xcite , connections in this network are also distributed in a scale - free fashion . however , the yeast two - hybrid method yielding protein interaction data @xcite produces many artifacts @xcite which might have influenced prediction results . cellular metabolic networks of different species were analyzed . nodes here were metabolic substrates , and edges were considered as reactions @xcite ( data at http://www.nd.edu/@xmath10networks/database/ ) . for bacteria , we investigated the metabolism of _ e. coli _ with 765 metabolites and 3,904 reactions . for eukaryotes , the data for _ arabidopsis thaliana _ ( 299 metabolites and 1,276 reactions ) and the yeast _ s. cerevisiae _ ( 551 metabolites and 2,789 reactions ) were examined . data for the german highway ( autobahn ) system were explored as a comparative example of man - made transportation networks . the network consisted of 1,168 location nodes ( that is , highway exits ) and 2,486 road links between them ( autobahn - informations - system , ais , from http://www.bast.de ) . only highways were included in the analysis , discarding smaller and local roads ( bundesstrassen and landstrassen ) . parking and resting locations were also excluded from the set of nodes . furthermore , multiple highway exits for the same city were merged to one location representing the city as a single node of the network graph . twenty random networks with 73 nodes and comparable density as the macaque network were generated . moreover , twenty scale - free networks with 73 nodes and equivalent density were grown by preferential attachment @xcite , starting with an initial matrix of 10 nodes . in addition to the random and scale - free networks , which consisted of only one cluster , networks with multiple clusters[multibench ] were considered . twenty networks were generated with 72 nodes in order to yield three clusters of the same size with 24 nodes each . connections within the clusters were distributed randomly , and six inter - cluster connections were defined to mutually connect all clusters . average density of these networks was again similar to the macaque data . + llll|llll & density & cc & asp & @xmath11 & @xmath12 & @xmath13 & @xmath14 + macaque@xmath15 & 0.16 & 0.46 & 2.2 & 0.10@xmath16 & 0.57@xmath16 & -0.40@xmath16 & 0.84@xmath16 + cat@xmath17 & 0.30 & 0.55 & 1.8 & 0.08@xmath18 & 0.48@xmath16 & -0.34@xmath16 & 0.77@xmath16 + at@xmath19 ( metabolic ) & 0.014 & 0.16 & 3.5 & 0.04 & 0.09@xmath16 & -0.11@xmath16 & 0.74@xmath16 + ec@xmath20 ( metabolic ) & 0.0067 & 0.17 & 3.2 & 0.31@xmath16 & 0.38@xmath16 & -0.15@xmath16 & 0.75@xmath16 + sc@xmath21 ( metabolic ) & 0.0092 & 0.18 & 3.3 & 0.11@xmath16 & 0.22@xmath16 & -0.04 & 0.74@xmath16 + sc@xmath22 ( protein interactions ) & 0.0013 & 0.068 & 6.8 & 0.24@xmath16 & 0.02 & -0.14@xmath16 & 0.60@xmath16 + german highway@xmath23 & 0.0018 & 0.0012 & 19.4 & 0.19@xmath16 & 0.06@xmath16 & -0.04 & 0.63@xmath16 + random@xmath15 & 0.16 & 0.16 & 1.7 & 0.02 & 0.06 & 0.00 & 0.03 + scale - free@xmath15 & 0.16 & 0.29 & 2.0 & 0.03 & 0.08 & -0.01 & 0.03 + + @xmath18 significant pearson correlation , 2-tailed 0.05 level . + @xmath16 significant pearson correlation , 2-tailed 0.01 level . + ] we tested four candidate measures for predicting vulnerable edges in networks . all algorithms were programmed in matlab ( release 12 , mathworks inc . , natick ) as well as implemented in c for larger networks . links were analyzed as directed connections for all networks . first , the product of the degrees ( pd ) of adjacent nodes was calculated for each edge . a high pd indicates connections between two hubs which may represent potentially important network links . second , the absolute difference in the adjacent node degrees ( dd ) of all edges was inspected . a large degree difference signifies connections between hubs and more sparsely connected network regions which may be important for linking central with peripheral regions of a network . third , the matching index ( mi ) @xcite was calculated as the number of matching incoming and outgoing connections of the two nodes adjacent to an edge , divided by the total number of the nodes connections ( excluding direct connections between the nodes @xcite ) . a low mi identifies connections between very dissimilar network nodes which might represent important short cuts between remote components of the network . finally , edge frequency ( ef ) , a measure similar to edge betweenness @xcite , indicates how many times a particular edge appears in all pairs shortest paths of the network . this measure focuses on connections that may have an impact on the characteristic path length by their presence in many individual shortest paths . we used a modified version of floyd s algorithm @xcite to determine the set of all shortest paths and calculate the frequency of each edge in it . multiple shortest paths between nodes @xmath5 and @xmath6 were present in the analyzed data sets . however , the standard algorithm only takes into account the first shortest path found . in order to account for edges in alternative shortest paths , the ef was calculated as the average of 50 node permutations in floyd s algorithm . this led to an increased predictive value of this measure in all networks ; however , the correlations already converged after 10 permutations . another possible prediction measure , not used here , would be the range of an edge @xcite , that is , the length of the shortest path between two adjacent nodes after the edge between them is removed . for dense networks , such as cortical connectivity , only range values of 2 and 3 occurred . having only two classes of range values was not sufficient to distinguish vulnerable edges in detail . however , the range may be a useful predictor for sparse networks with higher asp . the elimination of an edge from a network can have two possible effects on the asp . first , the parts previously connected by this edge can still be reached by alternative pathways . if these are longer , the asp will increase . second , the eliminated edge may be a _ cut - edge _ , which means that its elimination will fragment the network into two disconnected components . the probability for fragmentation , naturally , is larger in sparse networks . network separation causes severe damage , as interactions between the previously connected parts of the network are no longer possible . therefore , this impact can be seen as more devastating than the first effect , which may only impair the efficiency of network interactions . our asp calculation disregarded paths between disconnected nodes , which would be assigned an infinite distance in graph theory . therefore , the asp in disconnected networks was actually shorter , because paths were measured within the smaller separate components . cut - edges , which lead to network fragmentation , frequently occurred in the highway network ( 30% of all edges ) and the yeast protein interaction network ( 23% of all edges ) . however , cut - edges did not occur for cortical networks of cat and macaque and only to a limited extent ( @xmath245% of all edges ) in the studied metabolic networks . in the present calculation both increase and decrease of asp indicate an impairment of the network structure , we took the deviation from the asp of the intact network as a measure for damage . we evaluated the correlation between the size of the prediction measures and the damage ( tab . [ corrtable ] for all networks ) . while most of the local measures exhibited good correlation with asp impact in real - world networks , the highest correlation was consistently reached by the ef measure . for the cortical networks , the measures of matching index and difference of degrees also show a high correlation . cortical connectivity differed from the other networks not only by the performance of different edge vulnerability predictors , but also in the density of connections and the amount of clustering . the cortical networks showed a higher density than the biochemical metabolic and protein - protein interaction networks . whereas the highway network showed similar density to the biochemical networks , its clustering coefficient was much lower because of the high proportion of linear paths in the highway network . the random and scale - free benchmark networks designed to resemble size and edge density of the macaque cortical network are presented at the end of the table . [ lincorr ] shows the asp after edge elimination plotted against edge frequency ( ef ) . for cortical networks ( [ lincorr ] a , b ) no network fragmentation occurred , and only an increase in asp became apparent . for metabolic networks , e.g. , the network of _ s. cerevisiae _ ( [ lincorr ] c ) , also a few cut - edges , lowering the asp , were targeted . for the highway network containing linear chains of nodes ( [ lincorr ] d ) , many cut - edges were observed . the elimination of these links , therefore , resulted in two disconnected compartments , each of which had shorter path lengths . + ) . for all networks , except the random and scale - free benchmark networks , edge frequency had the highest correlation with edge vulnerability . in random networks and scale - free networks with only one cluster , however , the tested measures were unable to indicate impact of edge elimination . [ corroverview ] ] we also calculated the four predictive indices for scale - free and random benchmark networks with 73 nodes and a similar number of edges as the macaque cortical network . our comparisons focused on this network , because it showed the highest correlation between prediction measures and actual damage for all four measures . for the benchmark networks , however , all measures were poor predictors of network damage ( fig . [ corroverview ] ) . this is surprising , because scale - free networks generated here by growth and preferential attachment appeared to differ in their structure from real scale - free networks . analyzing data for one of these real networks , the internet at the autonomous systems level , which was previously shown to be scale - free @xcite , we found that ef as a prediction measure was also performing well in this case ( @xmath25 , not shown ) . the difference between the real and simulated scale - free networks may result from the fact that scale - free networks generated by growth and preferential attachment did not possess multiple clusters . we therefore tested whether the lack of connections between clusters might be the reason for the low performance of ef in the scale - free benchmark networks . we generated further 20 test networks ; each consisting of three randomly wired clusters and six fixed inter - cluster connections ( fig . [ testmatrix]a ) . the inter - cluster connections ( light gray ) occurred in many shortest paths ( fig . [ testmatrix]b ) leading to an assignment of the highest ef value , as no alternative paths of the same length were available . furthermore , their elimination resulted in the greatest network damage as shown by increased asp . + ) . the gray - level of a connection in the adjacency matrix indicates relative frequency of an edge in 20 generated networks . white entries stand for edges absent in all networks . * a * connectivity of test networks with three clusters and six pre - defined inter - cluster connections . * b * edge frequencies in the all - pairs shortest paths against asp after elimination of edges . red data points represent the values for the inter - cluster connections in all 20 test networks . inter - cluster connections not only have the largest edge frequency , but also cause most damage after elimination . [ testmatrix ] ] after establishing the high impact on asp of edges with large ef , we investigated what made specific edges more vulnerable than others . we here discuss two patterns that occurred in many of the analyzed networks . first , linear chains of nodes that appeared in biological as well as the artificial ( highway ) networks . second , clusters of highly interconnected regions of the network that occurred for all small - world networks , such as the analyzed cortical and biochemical systems . naturally , other and more complex network patterns are possible . we already discussed elimination of edges between a hub and a node with fewer connections ( cf . [ predictiondiscussion ] ) . also , the functional role of these patterns ( e.g. feedback loops ) was not examined here and would merit further study . linear chains of nodes with a terminal end ( fig . [ patterns]a ) became apparent in various biological as well as artificial networks . these patterns were detected by testing for each node if it was part of a chain , that is , if it possessed two edges . in this case the chain was followed in both directions , and considered terminal , if at least one end of the chain had a terminal node . using this method for identification , each terminal chain consisted of at least two edges . nodes in the terminal chain were excluded from the further searching process . terminal chains occurred frequently in the highway system , but also arose in metabolic networks in the form of redox chain reactions . for the highway system , the average terminal chain length was 6.4 edges , with a maximum of 22 edges . for the yeast protein interaction network , 13% of the nodes were part of terminal chains , which were on average 2.25 edges long ( maximum 6 edges ) . eliminating edges at the terminal end of a chain would have a small impact , as only few nodes become disconnected to the rest of the network . on the other hand , severing the first edge that connects a chain to the rest of the network eliminates all paths leading to the chain nodes from the shortest paths matrix . the effect of eliminating edges in a chain can be seen clearly for the highway network ( fig . [ lincorr]d ) . edges that connect chains to the rest of the network have a large ef , and their elimination greatly decreases asp , in contrast to edges at the terminal end . indeed , for networks that show many cut - edges , also many terminal chains occurred . for the highway system , 42% of all nodes were part of terminal chains . similar properties of edge vulnerability arise when the terminal of a chain end is formed by a small sub - network that is still smaller than the main network component at the start of the chain . + ] a clustered or modular architecture is a characteristic feature of many naturally occurring networks , such as cortical connectivity networks in the primate @xcite or the cat brain @xcite as well as metabolic networks @xcite . these systems are known to consist of several distinct , linked clusters with a higher frequency of connection within than between the clusters . inter - cluster connections have also been considered important in the context of social contact networks , as weak ties between individuals @xcite and separators of communities @xcite . we , therefore , speculated that connections between clusters might be generally important for predicting vulnerability ( fig . [ patterns]b ) . whereas many alternative pathways exist for edges within clusters , the alternative pathways for edges between clusters may be considerably longer . interestingly , previously suggested growth mechanisms for scale - free networks , such as preferential attachment @xcite , or strategies for generating hierarchical networks @xcite did not produce distributed , interlinked clusters . consequently , the low predictive value of ef in the scale - free benchmark networks was attributable to the fact that scale - free networks grown by preferential attachment consisted of one central cluster , but did not possess a multi - cluster organization . this suggests that alternative developmental models may be required to reproduce the specific organization of biological networks , and we have recently presented an algorithm based on spatial growth that can generate such distributed cluster systems @xcite . we analyzed four measures for identifying vulnerable edges and predicting the impact of edge removal on global network integrity . among these measures , the index of ef appeared consistently as the best predictor for damage to edges . the high performance of this measure may be linked to characteristic features of biological networks , as detailed below ( [ cluster ] ) . for the macaque monkey , 7 out of the top 10 connections with highest edge frequency originated from , or projected to , the amygdala . in addition , these edges were most vulnerable as could be observed by the damage after edge elimination . therefore , the amygdala appears to serve as a central link between many clusters of the network . following ef in terms of performance , the index for the difference of degrees also showed a high correlation in both the cortical and metabolic networks ( fig . [ corroverview ] ) . this means that connections between highly and sparsely connected nodes are vulnerable , especially in cortical networks . when a node with few connections is connected to an already well - connected node ( hub ) , it can access a large part of the network , by using routes involving the hub . after eliminating the connecting edge , the node would have to use longer alternative pathways to reach the same parts of the network . this effect is particularly strong , if the node was the only one in its local neighborhood that was connected to the hub . the matching index showed a large ( negative ) correlation with edge vulnerability in cortical networks and to a lower degree the protein - protein interaction network . therefore , edges between dissimilar connections , that is , with low mi , were more vulnerable . this was due to the cluster structure of these networks ( cf . [ cluster ] ) . nodes with similar connectivity belong to the same cluster , and therefore multiple alternative pathways are available . dissimilar nodes are more likely to be part of different clusters with few alternative pathways . from theoretical studies it has been proposed for scale - free networks that edges between hubs are most vulnerable @xcite . however , in the networks analyzed here , both in the scale - free yeast protein interaction network as well as for cortical networks , edges which connected nodes possessing many connections ( large product of degrees ) were not particularly vulnerable . although a low increase can be seen for the correlation coefficient , edges with maximum vulnerability occurred for a small product of degrees . one of the general advantages of using prediction measures , instead of testing the damage for all edges of a network , is computational efficiency . for a network with @xmath26 edges and @xmath27 nodes , the order of time for the calculation of ef that can predict the effect of edge elimination for all edges is @xmath28 . this is lower than for testing the damage after edge elimination for all edges individually , calculating the asp @xmath26 times resulting in a time complexity of @xmath29 . the prediction measures presented here might therefore be particularly useful for large networks in which global testing is computationally impractical , or for networks with frequently changing connections demanding a regular update . examples of these include acquaintance networks , internet router tables , and traffic networks . identifying vulnerable edges by ef generally appears to work well for various biological networks . in the analyzed biological networks , inter - cluster projections may play an important role in linking functional units . for cortico - cortical networks , they connect and integrate different sensory modalities ( e.g. , visual , auditory ) or functional sub - components @xcite . a lesion affecting these connections may result in dissociation disorders @xcite . for metabolic networks , reactions proceed more frequently within a reaction compartment ( e.g. , mitochondria and endoplasmatic reticulum ) than between compartments . therefore , in these systems as well , localized clusters arise , with many reactions within a compartment and few connections between compartments . such an organization is also found in the investigation of protein - protein interactions and their spatial and functional clustering , in which fewer proteins from different groups interact @xcite . once again , interactions between proteins from different compartments correspond to inter - cluster connections , and might thus be among the most vulnerable edges of the network . to a lower extent , inter - cluster connections also appeared in the highway network , as the highway sub - systems of western and eastern germany formed ( spatially separate ) dense regions connected by only four highways . that is , the elimination of four edges would once again split the german highway system into eastern and western components . our analysis of artificial networks was restricted to networks without functional differentiation of edges or nodes . it remains to be seen if functional or social networks , for instance , interactions of people with different functions within a company , may show a higher similarity in cluster - architecture with biological networks . clustered network architecture appears to result in edge - robustness in a similar way as scale - free architecture results in node - robustness . random elimination of edges will most frequently select edges within a cluster . for paths routed through these edges , various alternative pathways exist , and the damage after edge elimination is small . targeted attacks on inter - cluster connections , on the other hand , result in large network damage . we note that the cortical networks investigated here exhibit properties of both small - world @xcite and scale - free @xcite networks and are therefore particularly robust to random failure of edges and nodes . we examined how local network features and patterns relate to global network properties , such as robustness towards edge elimination . the correlation between different predictors and the actual damage after the elimination of a connection signified differences in the global network architecture . specifically , various biological networks appear to be organized as distributed , linked network clusters . we have shown that inter - cluster connections represent the most vulnerable edges in these networks , and that their position can be predicted using the edge frequency measure . hilgetag cc , burns gapc , oneill ma , scannell jw , young mp ( 2000 ) anatomical connectivity defines the organization of clusters of cortical areas in the macaque monkey and the cat . phil trans r soc lond biol 355:91110

biological networks , such as cellular metabolic pathways or networks of corticocortical connections in the brain , are intricately organized , yet remarkably robust toward structural damage . whereas many studies have investigated specific aspects of robustness , such as molecular mechanisms of repair , this article focuses more generally on how local structural features in networks may give rise to their global stability . in many networks the failure of single connections may be more likely than the extinction of entire nodes , yet no analysis of edge importance ( edge vulnerability ) has been provided so far for biological networks . we tested several measures for identifying vulnerable edges and compared their prediction performance in biological and artificial networks . among the tested measures , edge frequency in all shortest paths of a network yielded a particularly high correlation with vulnerability , and identified inter - cluster connections in biological but not in random and scale - free benchmark networks . we discuss different local and global network patterns and the edge vulnerability resulting from them .

SECTION 1. SHORT TITLE. This Act may be cited as the ``Helping Fill the Medicare Rx Gap Act of 2006''. SEC. 2. INCLUDING COSTS INCURRED BY THE INDIAN HEALTH SERVICE, A FEDERALLY QUALIFIED HEALTH CENTER, AN AIDS DRUG ASSISTANCE PROGRAM, CERTAIN HOSPITALS, OR A PHARMACEUTICAL MANUFACTURER PATIENT ASSISTANCE PROGRAM IN PROVIDING PRESCRIPTION DRUGS TOWARD THE ANNUAL OUT OF POCKET THRESHOLD UNDER PART D. (a) In General.--Section 1860D-2(b)(4)(C) of the Social Security Act (42 U.S.C. 1395w-102(b)(4)(C)) is amended-- (1) in clause (i), by striking ``and'' at the end; (2) in clause (ii)-- (A) by striking ``such costs shall be treated as incurred only if'' and inserting ``subject to clause (iii), such costs shall be treated as incurred if''; (B) by striking ``, under section 1860D-14, or under a State Pharmaceutical Assistance Program''; and (C) by striking the period at the end and inserting ``; and''; and (3) by inserting after clause (ii) the following new clause: ``(iii) such costs shall be treated as incurred and shall not be considered to be reimbursed under clause (ii) if such costs are borne or paid-- ``(I) under section 1860D-14; ``(II) under a State Pharmaceutical Assistance Program; ``(III) by the Indian Health Service, an Indian tribe or tribal organization, or an urban Indian organization (as defined in section 4 of the Indian Health Care Improvement Act); ``(IV) by a federally qualified health center (as defined in section 1861(aa)(4)); ``(V) under an AIDS Drug Assistance Program under part B of title XXVI of the Public Health Service Act; ``(VI) by a subsection (d) hospital (as defined in section 1886(d)(1)(B)) that meets the requirements of clauses (i) and (ii) of section 340B(a)(4)(L) of the Public Health Service Act; or ``(VII) by a pharmaceutical manufacturer patient assistance program, either directly or through the distribution or donation of covered part D drugs, which shall be valued at the negotiated price of such covered part D drug under the enrollee's prescription drug plan or MA-PD plan as of the date that the drug was distributed or donated.''. (b) Effective Date.--The amendments made by subsection (a) shall apply to costs incurred on or after January 1, 2006. SEC. 3. PROVIDING A SAFE HARBOR FOR PHARMACEUTICAL MANUFACTURER PATIENT ASSISTANCE PROGRAMS. (a) Safe Harbor.--Section 1128B(b)(3) of the Social Security Act (42 U.S.C. 1320a-7b(b)(3)) is amended-- (1) in subparagraph (G), by striking ``and'' at the end; (2) in subparagraph (H), as added by section 237(d) of the Medicare Prescription Drug, Improvement, and Modernization Act of 2003 (Public Law 108-173; 117 Stat. 2213)-- (A) by moving such subparagraph 2 ems to the left; and (B) by striking the period at the end and inserting a semicolon; (3) by redesignating subparagraph (H), as added by section 431(a) of the Medicare Prescription Drug, Improvement, and Modernization Act of 2003 (Public Law 108-173; 117 Stat. 2287), as subparagraph (I); (4) in subparagraph (I), as so redesignated-- (A) by moving such subparagraph 2 ems to the left; and (B) by striking the period at the end and inserting ``; and''; and (5) by adding at the end the following new subparagraph: ``(J) any remuneration paid by a pharmaceutical manufacturer patient assistance program, either in cash or through the distribution or donation of covered Part D drugs (as defined in section 1860D-2(e)), to an individual enrolled in a prescription drug plan under part D of title XVIII or in an MA-PD plan under part C of such title.''. (b) Effective Date.--The amendments made by subsection (a) shall apply to remuneration paid on or after January 1, 2006.

Helping Fill the Medicare Rx Gap Act of 2006 - Amends part D (Voluntary Prescription Drug Benefit Program) of title XVIII (Medicare) of the Social Security Act (SSA), with respect to the annual out of pocket threshold, to count costs incurred in providing prescription drugs by the Indian Health Service, a federally-qualified health center, an AIDS drug assistance program, certain hospitals, or a pharmaceutical manufacturer patient assistance program. Amends SSA title XI, with respect to criminal penalties for certain illegal remunerations, to exclude from prohibited remunerations (provide safe harbor for) any remuneration paid by a pharmaceutical manufacturer patient assistance program, either in cash or through the distribution or donation of covered Part D drugs, to an individual enrolled in a Part D plan or a Medicare Advantage Prescription Drug (MA-PD) plan under SSA title XVIII part C.

TITLE I--CASTILLO DE SAN MARCOS NATIONAL MONUMENT PRESERVATION ACT SEC. 101. SHORT TITLE. This title may be cited as the ``Castillo de San Marcos National Monument Preservation and Education Act''. SEC. 102. VISITOR CENTER. (a) Authorization.--Subject to the availability of appropriations and the project being prioritized in the National Park Services 5-year, line-item construction program, the Secretary of the Interior (referred to in this section as the ``Secretary'') may design and construct a Visitor Center for the Castillo de San Marcos National Monument (referred to in this section as the ``Monument''). (b) Preferred Alternative.--The Visitor Center authorized in subsection (a) shall be located and constructed in accordance with the Preferred Alternative identified in the Record of Decision for the General Management Plan for the Monument, expected to be signed in 2005. SEC. 103. COOPERATIVE AGREEMENT. The Secretary may enter into cooperative agreements with the City of St. Augustine, Florida, the Colonial St. Augustine Preservation Foundation, other Federal, State, and local departments or agencies, academic institutions, and non-profit entities for the planning and design, construction, management, and operation of the Visitor Center. SEC. 104. BOUNDARY EXPANSION. (a) Property Acquisition.--If the Preferred Alternative for the Visitor Center authorized by section 102 is located outside the boundary of the Monument, the Secretary is authorized to acquire the site for the Visitor Center, from willing sellers, by donation, purchase with donated or appropriated funds, or by exchange. (b) Administration of Newly Acquired Land.--Land added to the Monument pursuant to subsection (a) shall be administered by the Secretary in accordance with applicable laws and regulations. (c) Boundary Modification.--The boundary of the Monument shall be modified to reflect the acquisition of land authorized in subsection (a) after completion of the acquisition. SEC. 105. PROJECT APPROVAL. Prior to initiating any planning, design, or construction on the Visitor Center authorized by section 102, the project must be reviewed and approved by the National Park Service consistent with partnership construction guidelines established by that agency. TITLE II--CASTILLO DE SAN MARCOS NATIONAL MONUMENT BOUNDARY MODIFICATION SEC. 201. SHORT TITLE. This title may be cited as the ``Castillo de San Marcos National Monument Boundary Adjustment Act of 2004''. SEC. 202. FINDINGS. Congress finds the following: (1) The early defense lines for Fort Marion, Florida, today known as the Castillo de San Marcos National Monument, included defenses extending in a line due west to the Sebastian River, a distance of about one half mile. (2) In the 1830's, during the Seminole Wars in Florida, these defensive lines were maintained, but as Florida became more settled they fell into disrepair and/or became obsolete. (3) In 1908 the War Department deeded much of the property running west to the Sebastian River to the St. Johns County Board of Public Instruction. The portion of this property remaining in federal ownership today is occupied by Orange Street, a City of St. Augustine, Florida street. (4) For nearly a century, the City of St. Augustine has maintained and managed Orange Street, a modern city street, and associated utilities in the Orange Street corridor. (5) Any archeological remains that are still present on the property overlaid by Orange Street are adequately protected by the City's archeological ordinances, and by the City having an archeologist on staff. (6) Although the city currently operates Orange Street under a right-of-way from the National Park Service, from a management perspective it is appropriate for the City of St. Augustine to own Orange Street. SEC. 203. BOUNDARY ADJUSTMENT. (a) Conveyance of Land.--The Secretary of the Interior shall convey, without consideration, to the City of St. Augustine, Florida, all right, title, and interest of the United States in and to the lands known as Orange Street, a portion of the Castillo de San Marcos National Monument (Monument), consisting of approximately 3.1 acres, as shown on the map entitled Castillo de San Marcos National Monument Boundary Adjustment and Correction, numbered 343/80060, and dated April 2003. Upon completion of the conveyance, the Secretary shall revise the boundary of the Monument to exclude the land conveyed. (b) Boundary Revision.--Effective on the date of the enactment of this Act, the boundary of the Monument is revised to include an area of approximately 0.45 acres, as shown on the map identified in subsection (a). The Secretary shall administer the lands included in the boundary as part of the national monument in accordance with applicable laws and regulations. Speaker of the House of Representatives. Vice President of the United States and President of the Senate.

Title I: Castillo De San Marcos National Monument Preservation Act - Castillo de San Marcos National Monument Preservation and Education Act - (Sec. 102) Authorizes the Secretary of the Interior to design and construct a Visitor Center for the Castillo de San Marcos National Monument, subject to such project being prioritized in the National Park Service's five-year, line-item construction program. Requires the Visitor Center to be located and constructed in accordance with the Preferred Alternative identified in the Record of Decision for the General Management Plan for the Monument, expected to be signed in 2005. (Sec. 103) Authorizes the Secretary to enter into cooperative agreements with the city of St. Augustine, Florida, the Colonial St. Augustine Preservation Foundation, other Federal, State, and local departments or agencies, academic institutions, and non-profit entities for the planning and design, construction, management, and operation of the Visitor Center. (Sec. 104) Provides that, if the Preferred Alternative for the Visitor Center is located outside the boundary of the Monument, the Secretary is authorized to acquire the site for the Visitor Center from willing sellers, by donation, purchase, or exchange. Requires, after completion of the acquisition, the boundary to be modified to reflect the acquisition of such land. (Sec. 105) Mandates that, prior to initiating any planning, design, or construction on the Visitor Center, such project must be reviewed and approved by the National Park Service consistent with partnership construction guidelines established by that agency. Title II: Castillo De San Marcos National Monument Boundary Modification - Castillo de San Marcos National Monument Boundary Adjustment Act of 2004 - Directs the Secretary to: (1) convey, without consideration, to the City all right, title, and interest of the United States in and to the lands known as Orange Street, a portion of the Monument; and (2) upon completion of the conveyance, revise the Monument's boundary to exclude the land conveyed. Revises such boundary to include specified land.

Milledgeville Man Fights Flesh Eating Bacteria Rick Devens "It's very surreal. I'm quite shocked we're having to deal with this in this area but there's been a lot of news recently of the flesh eating bacteria. Not just in Middle Georgia but when it's hitting this close to home it's a little shocking," says Barry Toon, vacationing with his family on Lake Sinclair. Paul Bales, a Milledgeville man, was scheduled to have his leg amputated Wednesday because it's infected with the same flesh eating bacteria that has already claimed three other Georgia victims including Aimee Copeland. According to a neighbor, Bales had created a makeshift platform in order to create an addition on his dock. The neighbor says the injury occurred when Bales tried to remove the makeshift platform. Bales cut leg was submerged in Lake Sinclair. "Very small cut. Matter of fact he just bandaged it up and then went and played golf for the next couple of days," says Mike Bales, the victims son. On May 5, Bales went to the Oconee Regional Medical Center. A week later he was sent to the Medical Center of Central Georgia. "Like, over the last three decades only about 200 cases nationwide. And then all of a sudden we've three or four in the last month," says Mike Bales. Those are shocking numbers and they have a lot of Milledgeville residents afraid to go in the water. "My children will be with me this weekend and it makes you think about it. Whether you're going to get into the water or not," says Barry Toon. "They're saying stay away from the lake. They're saying they ain't going in the lake," says Jonathon Koupke, a Lake Sinclair resident. "People are scared they'll lose limbs. Everybody in town's scared to go out on the water," says Austin Hunter, a Lake Sinclair resident. Paul Bales is currently in stable condition at the Medical Center of Central Georgia. Next Article River Levels, Flood Concerns Continue to Rise ||||| Milledgeville resident Paul Bales, whose leg was amputated below the knee Wednesday after being infected with flesh-eating bacteria, likely will lose more of the leg because doctors found more infection, his son said Thursday. His son, Mike Bales, of Dacula, said his father’s problems began when he fell and cut his leg on his boat ramp at Lake Sinclair. What initially seemed like a minor injury quickly turned into a potentially deadly situation, he said. “He didn’t think it was a big deal,” Mike Bales said. “Everybody cuts themselves working around the house.” Mike Bales said his father bandaged the cut and played golf the next couple of days. Paul Bales sought medical attention, his son said, when he was unable to finish a game because of pain in his leg, which his son said was “unusual for him.” After first receiving treatment at Oconee Regional Medical Center in Milledgeville, Paul Bales was transferred to The Medical Center of Central Georgia in downtown Macon. He was diagnosed with necrotizing fasciitis, the same infection that caused Amiee Copeland of north Georgia to lose a leg, both feet and both hands. The Centers for Disease Control and Prevention in Atlanta estimates there are about 800 cases of necrotizing fasciitis of varying severities reported in the United States annually, according to the CDC’s website. Dr. Mike Green, a family practice doctor in Macon, said it’s his understanding that Bales is infected with a different organism than the strain of bacteria that infected the 24-year-old Copeland. Just because the bacteria is different does not mean it is any less dangerous, though. Necrotizing fasciitis, Green said, occurs when tissue from a wound gets infected and triggers a response in the body. He said there is not a single so-called “flesh-eating bacteria.” Two-thirds of people who are diagnosed with necrotizing fasciitis have another contributing condition that weakens their immune systems, he said. Initial symptoms of an infection can be mild. Someone with a cut may notice redness or swelling around a wound or have a low-grade fever, Green said. Green cautioned against public panic because infections requiring amputations are rare. “We have thousands of people getting in Georgia rivers and lakes and aren’t getting this,” he said. Green said flesh-eating bacteria are not unique to water, but that natural water sources are often unsanitary. Dr. Ed Grimsley, an internal medicine specialist who is a professor at Mercer University School of Medicine, said necrotizing fasciitis is rare, even though there are four cases now in Georgia. Grimsley said it’s “a little surprising” to see four cases happen so close together in the same region, but he thinks that is a coincidence. Although the specific organism that affected Bales lives in water, Grimsley said, people should not fear going in the water. He said they should “use common sense,” like wearing shoes if walking in a rocky area of a lake. In the event someone is cut while in the water, Grimsley said, “odds are you’re going to be fine.” He advised cleaning the cut immediately and applying antibacterial ointment. If symptoms of infection occur, medical attention should be sought. Grimsley said the odds of being infected with necrotizing fasciitis are very slight. Mike Bales said his family is hoping for the best. He said he has been impressed with the care his father has received in Macon. Telegraph writer Liz Fabian contributed to this report.

– An astounding third victim in Georgia—the fourth in recent weeks in the Southeast—has been infected by a flesh-eating bacteria and has already lost his leg to the disease. Paul Bales cut his leg three weeks ago while removing a section of dock on Lake Sinclair in Milledgeville. "Very small cut. He just bandaged it up and played golf for the next couple of days. He didn't think it was a big deal," Bales' son told WGXA-TV. Bales' leg was amputated below the knee yesterday, and he's listed in stable condition, though doctors may have to amputate more of the limb. The infections, which all seem to be linked to cuts and exposure to lake or river water, are beginning to panic Georgia residents. Another victim affected by the flesh-eating bacteria in the last few weeks is from South Carolina. "People are scared they'll lose limbs. Everybody in town's scared to go out on the water," said a Lake Sinclair resident. But a Macon County family doctor cautioned against overreacting to the frightening outbreak of necrotizing fasciitis. “We have thousands of people getting in Georgia rivers and lakes and aren’t getting this,” he told the Macon Telegraph.

the electron cyclotron resonance ion source ( ecris ) is used to deliver beams of singly or multiply charged ions for a wide range of applications in many laboratories . in particular , such devices are well suited for the production of highly charged ions ( hcis ) a key consideration for the new acceleration facilities ( e.g. fair , ria , hribf , etc . ) , which will require milliampere levels of hcis . in order to get such high currents , the recent progress in the performance of the ecris has been mainly linked to improvement of the plasma magnetic confinement within the source chamber and to an increase of the frequency for the feeding microwaves which , under proper conditions , develop to higher plasma densities @xcite . the trend followed until now has been to increase the frequency and the magnetic field , leading to rising costs for the technology and safety problems for the magnet s cryostat because of the growth of hot electrons : the frequency and magnetic field scaling are close to saturation . apart from this main route , various techniques are also employed to enhance the production of hcis , such as the use of secondary emission materials , the wall coatings , the installation of a bias disc , or gas mixing , to mention the most important ones @xcite . moreover , in the past decade , some experiments involving new approaches to feeding have allowed an increase in the performance of the conventional ecr ion sources with a minimum-@xmath0 magnetic field structure by feeding them with electromagnetic waves that have a large spectral content , or that are obtained by the superimposition of a discrete set of microwaves at different frequencies @xcite . even if these experiments have provided interesting results , they have not given us an explanation or a methodology to convey a better understanding of the coupling mechanism between a feeding waveguide and a cavity filled with plasma , and the energy transfer between the electromagnetic field in the source plasma chamber and the plasma confined therein . an increase of knowledge in terms of microwave coupling to ecris plasma , and therefore optimization of the ecr power transfer processes , may allow us to design ion sources with higher performance . further improvements of ecris output currents and the average charge state require a deep understanding of electron and ion dynamics in the plasma , and of the impact of the electromagnetic structure on the electron density distribution : theoretical investigations , in order to find a reasonable and adequate model for these mechanisms and to predict their possible improvement , may lead to the design of a future innovative ecr ion source . over recent years , dedicated experiments at infn - lns have aimed to investigate these topics and , at the same time , some theoretical studies have been undertaken to describe them in detail @xcite . the microwave coupling between the electromagnetic wave and the plasma determines the efficient transfer of the energy from the microwaves to the plasma electrons inside the ecris . the plasma chamber , on the other hand , can be considered as a resonant cavity for the electromagnetic waves and , when the magnetized plasma is created , the electrical permittivity of the medium filling the chamber is no longer homogeneous and no longer electrically isotropous . a detailed investigation has been carried out to demonstrate that the performance of ecr ion sources depends on the electromagnetic field excited inside the plasma chamber and on the coupling mechanism used to provide the microwaves to the plasma . in the following , the various approaches used over the years are presented , together with the possible alternative heating schemes . up to now , the so - called ` ecris standard model ' has , for the greater part of a decade , been the road map followed by ecris designers . the main rules were confirmed by experiments performed at msu - nscl in 19934 and 1995 , and can be summarized as follows @xcite : * the radial magnetic field value at the plasma chamber wall must be @xmath1 @xmath2 @xmath3 ; * the axial magnetic field value at injection must be @xmath4 @xmath5 @xmath6 or more ; * the axial magnetic field value at extraction must be about @xmath7 @xmath5 @xmath1 ; * the minimum value of the axial magnetic field must be in the range @xmath8 ; and * the optimum power must increase with the volume of the plasma and with the square of the frequency . up to now , almost every operating ecris has complied with the standard model : the extracted current increases as the microwave frequency increases , but only an increase in the mirror ratio can exploit the optimal performance , making the increase of the electron density with frequency effective . also , according to the standard model , the development of the ecris is strictly linked to improvements in superconducting magnets and in the technology of microwave generation . various authors have studied the rf coupling to the plasma in terms of the maximum power rate per unit volume and its relationship with the beam intensity produced by different ecr ion sources @xcite , but this description is not satisfactory . the cavity design , and the microwave injection geometry , are of primary importance for high - rf - energy transmission to the plasma chamber . note that the problem of wave energy transmission into the plasma must be divided into two parts : the first is related to the microwave generator waveguide plasma chamber coupling , while the second concerns the wave plasma interaction . both of these two aspects play notable roles for the future improvement of ecris performance . many experiments have been undertaken outside the framework traced by the standard model , to verify the possibility of improving the plasma heating . principally , they follow three different road maps . a first series of experiments has been devoted to the study of the variation of ecris performance with slight variations of the microwave frequency . the second route regards the possibility of operating with more than one frequency for plasma heating ( usually two ) or of using broad microwave spectra . the third method is actually a mixture of the previous ones : two or more frequencies are used for plasma heating , but at least one is provided by a broadband microwave generator ( such as a travelling - wave tube , or twt ) , which allows the effects of frequency tuning and of multi - frequency heating to be combined . in order to characterize the electromagnetic field that is present inside the plasma chamber of an ecr ion source and where the particle motion occurs , it is fundamental to make the following assumption : the plasma chamber is a resonating cavity for the electromagnetic wave feeding the plasma . the coupling between the electromagnetic wave and the plasma - filled chamber and the electromagnetic field patterns that can be excited inside the resonating cavity are of primary importance for the characterization and for the properties of the plasma . furthermore , the characterization of the plasma chamber in terms of the excitable electromagnetic field allows us to make some assumptions about the charged particle motion and energy , as described in the following sections . a plasma chamber can be represented , in a first - order approximation , by a cylinder of radius _ a _ and length _ , filled by a medium with a certain electric permittivity @xmath9 and a certain magnetic permeability @xmath10 . then , a discrete number of electromagnetic field patterns can exist inside the plasma chamber : the so - called resonant modes . they can be defined by the following equations , defined using a system of cylindrical coordinates ( @xmath11,@xmath12,@xmath13 ) : @xmath14 these are the equations describing the transverse magnetic ( tm ) modes , with only the magnetic field components on the transverse plane . the transverse electric ( te ) modes , with only the electric field components on the transverse plane , can be calculated using the following equations : @xmath15 here , the time dependence @xmath16 is omitted ; @xmath17 and @xmath18 are , respectively , the bessel functions and the derivatives of the bessel functions of order @xmath19 ; and @xmath20 and @xmath21 are their related @xmath22 roots . a discrete set of frequencies @xmath23/2@xmath24 can exist inside the resonance cavity and they are defined as follows : @xmath25 where the value @xmath26 is as follows : @xmath27 then , the resonant modes te@xmath28 and tm@xmath28 that exist inside the plasma chamber are identified by the mode parameters and their strength is related to the amplitude associated with the field strength of the wave . by supposing that the chamber is filled with a homogeneous and unmagnetized medium , the corresponding electrical permittivity is given by the relation @xmath29 where @xmath23 is the pulsation generating the plasma and @xmath30 is the plasma pulsation : @xmath31 in which @xmath32 and @xmath33 are , respectively , the electron mass and the electron charge , @xmath34 is the electrical permittivity in vacuum , and @xmath35 is the electron density . therefore , under these hypotheses , the plasma build - up can be seen as a change in the electrical permittivity and therefore as a change in the resonant frequencies , because of the change of @xmath9 in eq . ( [ eqn : omega ] ) . this model is certainly oversimplified if we consider the plasma of an ecr ion source , but has been applied successfully , giving information on the plasma parameters generated in a small reactor at infn - lns . since 1994 , the so - called two - frequency heating ( tfh ) has been used @xcite to improve the hci production by feeding the plasma with two electromagnetic waves at different frequencies instead of one . in some cases , even three or more close frequencies have been used . the performance of the lbl aecr source has been improved by simultaneously heating the plasma with microwaves of 10 and 14 ghz . the plasma stability was improved and the ion charge - state distribution was shifted to a higher - charge state . the production of high - charge - state ions was increased by a factor of between 2 and 5 , or higher , for the very heavy ions such as bismuth and uranium , as compared to the case of single - frequency ( 14 ghz ) heating @xcite . in an ecr source , electron cyclotron resonance heating couples microwave power into the plasma electrons . this occurs when the microwave frequency @xmath36 matches the cyclotron frequency , @xmath37 , of the electrons . in high - charge - state ecr sources with one frequency , the geometry of the minimum-@xmath0 field results in a closed , approximately ellipsoidal ecr surface . the electrons are heated in a thin resonance zone at the surface , as they spiral back and forth between the magnetic mirrors . when two frequencies are used , it is possible to produce two concentric surfaces , the physical separation of which depends on the frequency difference and the strength and gradient of the magnetic field , leading to a higher density of the energetic electrons . with tfh , the ecr plasma is more quiescent than with single - frequency heating . both the short - term and the long - term plasma stability are improved , and more microwave power could be launched into the plasma . tfh has been demonstrated to be a powerful method : in the case in ref . @xcite for @xmath38u , it increased the production of higher - charge states ( from 35 + to 39 + ) by a factor ranging from 2 to 4 and shifted the peak charge state from 33 + to 36 + . two - frequency heating using 10 and 14 ghz in the aecr provided significantly better performance and indicated that still higher performance with multiple - frequency heating may be possible . while multiple - frequency heating would increase the complexity and cost of an ecr source , it could provide significant gains in performance . in @xcite , the performance of the argonne ecr ion source was improved through the use of tfh , with the primary frequency of 14 ghz from a klystron and the second frequency from a travelling - wave tube amplifier ( twta ) with a tunable range of 11.013.0 ghz . source output as well as stability were improved , with a shift to higher - charge states observed . the use of a second frequency increased the intensity of the medium charge states by 50100@xmath39 and the higher - charge states by a factor of between 2 and 5 . in a modern second - generation ecris , tfh is usually implemented by using frequencies between 14 and 18 ghz , while the best - performing ecris use a combination of 24 or 28 ghz with 18 ghz . microwaves of various frequencies can be simultaneously launched into and absorbed by a high - charge - state ecr plasma . the minimum-@xmath0 magnetic field configuration in an ecris can provide many closed and nested ecr heating surfaces , as graphically shown in fig . if two or more significantly different frequencies are used , two or more well - separated and nested ecr surfaces will exist in the ecr plasma . with the multiple ecr surfaces , electrons can be heated four times or more for one pass from one mirror end to the other , whereas they are only heated twice in the case of single - frequency heating . multiple - frequency heating can couple more microwave power with better efficiency into the plasma and it leads to a higher density of hot electrons , which is essential for the production of highly charged ions . to demonstrate that the frequency - domain technique can be used to enhance the performance of a traditional minimum-@xmath0 ecr ion source , comparative studies have been undertaken to assess the relative performance of the oak ridge national laboratory caprice ecr ion source @xcite , in terms of its multiply charged ion - beam generation capability , when excited with high - power , single - frequency , or multiple - discrete - frequency microwave radiation , derived from standard klystron and/or twt technologies . these studies demonstrate that the charge - state populations for ar@xmath40 and xe@xmath41move towards higher values when excited with two- and three - discrete - frequency microwave power compared to those observed when single - frequency microwave power is used . for example , the most probable charge state for xe is increased by one charge - state unit , while the beam intensities for charge states higher than the most probable one are increased by factors of @xmath42 compared to those observed for single - frequency plasma excitation . in ref . @xcite , particle - in - cell codes have been used to simulate the magnetic field distributions , to demonstrate the advantages of using multiple , discrete frequencies over single frequencies to power conventional ecr ion sources . , scaledwidth=50.0% ] one , two and three - frequency heating experiments have been conducted using xe feed gas . with the addition of the second and third frequencies , the most probable xe@xmath40 charge state moves towards higher values by one unit ; this clearly illustrates that the performance of conventional - geometry ecr ion sources can be significantly improved by the use of multiple - discrete - frequency plasma heating . the ionization process in electron cyclotron resonance ( ecr ) ion sources is based on the sequential removal of electrons in collisions between ions or neutral atoms with electrons that have been heated stochastically to high energies by the adsorption of microwave power under ecr conditions . the ecr zones in a conventional minimum-@xmath0 geometry ecris , powered by narrow - bandwidth microwave radiation , are thin volumes that are substantially smaller in relation to their total plasma volumes . consequently , the probability of an acceleration resulting in a substantial energy gain for the electrons that arrive in the ecr zone in phase with the electric field vector of the electromagnetic wave is lower than is possible in extended - volume ecr zones . therefore , it is reasonable to believe that the performance of conventional minimum-@xmath0 ecr ion sources can be improved by increasing their respective resonance volumes . the volume effect has been demonstrated by tailoring the central magnetic field so that it forms a large resonant volume and by increasing the number of discrete operational frequencies of the ion source . broadband sources of rf power provide a simple and potentially more effective alternative for increasing the physical sizes of the resonance zones in conventional @xmath43 ecr ion sources . some experiments have been performed with the jyfl 6.4 ghz conventional minimum-@xmath0 geometry ecr ion source at the university of jyvskyl , using ar as the feed gas . the performance of the source was compared when operated with either narrow or with broadband microwave radiation , under the same neutral gas pressure and input power conditions . for the narrow - bandwidth experiments , the carrier signal from the local oscillator ( lo , bandwidth 1.5 mhz ) was fed directly into the twta . for the broadband experiments , the signal from the lo was fed into a white - noise generator ( wng ) , producing an output signal with a bandwidth of 200 mhz , fwhm , equally distributed about the central frequency of the lo ( 6.4 ghz ) . the measurements were carried out at the same absorbed microwave power level ( 200 w ) , determined by subtracting the reflected power from the forward power of the twta . the input power was limited due to impedance mismatch of certain frequencies in the amplified broadband signal , resulting in 20@xmath39 reflected power of the injected power . this problem can not be avoided and it constitutes the main drawback of such a technique , since frequencies are differently coupled into the ion source depending on the intrinsic electromagnetic structure of the source itself . in the case of narrow- bandwidth operation , the reflected power was typically 6@xmath39 . for the wng mode of operation at optimum pressure , the ion plasma density , as evaluated from the measured drain current and the charge - state distribution , using bohm s criterion , was within 15@xmath39 of the neutral density . although the beam intensities were higher by factors > 2 with the wng at low pressures , there was no difference between the broadband and narrow - bandwidth modes of operation in the high neutral pressure regime due to increased rates of charge exchange @xcite . enlarged ecr zones improve the production of high - charge - state ions due to enhanced bombardment with higher populations of energetic electrons and , especially , due to the enhanced ionization rates of neutrals in the ecr zone , thereby lowering the probability of charge - exchange collisions . the tremendous potential of the broadband technique for enhancing high - charge - state beam intensities over conventional means at equivalent input power levels is illustrated in fig . [ broad ] , where the ratio of wn / lo - generated high - charge - state beams is seen to increase continually with the charge state . clearly , the potential of the broadband method can only be fully evaluated by comparing the high charge states produced with the two modes of operation at the same power density , if this is achievable in practice in terms of the operational limitations imposed by outgassing effects and the required rf power . , scaledwidth=48.0% ] the performance of ecr ion sources can also be significantly improved by tailoring the central region of the magnetic field so that it is resonant with single - frequency microwave radiation ( spatial domain ) @xcite . the spatial - domain technique employs a magnetic field configuration with an extended central flat region , tuned to be in resonance with single - frequency microwave radiation . because of the large resonant plasma volume , significantly more rf power can be coupled into the plasma , resulting in heating of electrons over a much larger volume than is possible in conventional ecr ion sources . the ability to ionize a larger fraction of the particles in the plasma volume effectively reduces the probability of resonant and non - resonant charge exchange , thereby increasing the residence time of an ion in a given charge state and for subsequent and further ionization . all other parameters being equal , the ` volume ' ecr source should result in higher - charge - state distributions , higher beam intensities , and improved operational stability . the axial magnetic field is shown in fig . [ bflat ] : its profile is flat ( constant mod-@xmath0 ) in the centre , and extends over the length of the central field region , along the axis of symmetry , and radially outwards to form a uniformly distributed ecr plasma ` volume ' . this magnetic field design strongly contrasts with those used in conventional ecr ion sources , where the central field regions are approximately parabolic and the consequent ecr zones are ` surfaces ' . configurations in ` surface ' ( dotted line ) ecr ion sources @xcite . [ bflat],scaledwidth=50.0% ] according to computational studies , the new configuration will result in dramatic increases in the absorption of rf power , thus enabling the heating of electrons over a much larger volume , thereby increasing the electron temperature and the ` hot ' electron population in the plasma . many experiments over recent years have shown that significant improvements of ecris performance ( both in terms of total extracted current and the production of highly charged ions ) can be obtained by slightly varying the microwave frequency in the case of single - frequency heating ( sfh ) , this being defined as a ` frequency tuning ' effect . it was already known that a large increase in the frequency increases ( @xmath44ghz ) the electron density and improves the ecris performance because of the increase of the cut - off density , but since 2001 several experiments have demonstrated that even slight variations of the pumping wave frequency ( @xmath44mhz ) may lead to strong variations in the extracted current . the first evidence was provided by the different performances observed for the serse and caesar ion sources when fed by a klystron - based or a twt - based generator @xcite at either 14 or 18 ghz . other interesting results came from experiments performed at gsi and at jyfl . in frequency tuning , the microwave frequency is varied in order to select the most efficient heating mode inside the plasma chamber of the ecris . in the experiments , the input frequency for the klystron was swept from 14.05 to 14.13 ghz in 100 s , using a rohde @xmath45 schwartz signal generator . this bandwidth was found adequate to maintain a constant output power over the whole frequency sweep , using the automatic level control feature of the klystron . the beam emittance and the beam structure were studied as a function of the frequency with the aid of an allison - type emittance scanner and a kbr beam viewer . figure [ emitt ] shows three beam viewer pictures : the beam structure varies strongly with the microwave frequency , as an indication of the change in the plasma wave coupling during the scan . however , no unequivocal explanation concerning the origin of the beam structure variations can be given : they could originate from the changes in the plasma , in the electron ion dynamics , due to electromagnetic field variations and/or in the beam line due to changes in ion - beam intensity and space charge . the explanation of the data presented above is based on the assumption that the frequency tuning changes the electromagnetic field distribution inside the resonator in terms of its distribution over the resonance surface ; that is , where the wave electron energy transfer takes place . this assumption requires that even in case of plasma filling the cavity , the resonant modes persist ; that is , the formation of standing waves is still possible . ion beam with different plasma heating frequencies is shown : ( a ) 14.050 ghz , ( b ) 14.090 ghz , and ( c ) 14.108 ghz.[emitt],scaledwidth=50.0% ] measurements have been performed with the caprice - type ecris installed at the ecr injector setup ( eis ) of gsi . the experimental set - up uses a microwave sweep generator that feeds a twta , covering a wide frequency range from 8 to 18 ghz . this arrangement provides a precise determination of the frequencies and of the reflection coefficient along with the beam properties . a sequence of viewing targets positioned inside the beam line monitors the evolution of the beam shape . in the present experiment , the frequency tuning effect has been analysed in the 12.516.5 ghz frequency range . the availability of a twta driven by a signal generator made it possible to change the source operating frequency in steps of a few hundred kilohertz . this experiment allows us to analyse the beam properties when the ecris operative frequency sweeps over a wide range of 4 ghz , and hence for increasing ecr surfaces . the influence on lower- and higher - charge states has been analysed for different source conditions concerning the magnetic field configuration , the gas pressure , and the power setting . the caprice - type @xcite ecr ion source used for this experiment is equipped with a 1.2 t maximum radial magnetic field . the plasma chamber was 179 mm long and 64 mm in diameter . the rf power was provided by a twta working in the 818 ghz frequency range and able to provide an output power higher than 650 w in the frequency range of 1218 ghz . the input of the amplifier was driven by a signal generator able to sweep from 1 to 20 ghz . according to the maximum manageable power reflected to the amplifier , it has been restricted to working at a power of 100 w and in the frequency range of 12.516.5 ghz . the use of a waveguide microwave isolator covering this frequency range and handling up to 650 w could allow us to work with higher powers . the frequency steps were set to 200 khz , with a dwell time of 20 ms for each step . the duration of one measurement was then around 400 s. two directional couplers with high directivity were inserted in the waveguide line in order to measure the forward power and the reflected power by means of two microwave power probes . the experiment was carried out with argon and helium as support gases , at gas pressures of ( 3.95.0)@xmath46 mbar . the ion currents of the ar@xmath47 , ar@xmath48 , and ar@xmath49 charge states were measured using a faraday cup ; the drain current of the high - voltage power supply of the extraction was also recorded . the extraction voltage was set to 15 kv ; a voltage of @xmath50 kv was applied to the screening electrode . viewing targets could be remotely inserted at three positions along the beam line in order to monitor the evolution of the beam shape right after the extraction , the focused beam , and the analysed beam @xcite . kbr was used as the target coating material for this experiment . different measurements were carried out by sweeping the frequency and setting different ion source parameters ; that is , the injection and extraction magnetic field values , the gas pressure , and the microwave power . the source parameters were set to operate using a charge - state distribution with a maximum on the ar@xmath48 current ( by feeding the plasma with 100 w microwave power at 14.5 ghz ) . an ar@xmath48 current of 85 @xmath10a and a drain current of 2.36 ma were obtained . from these source conditions , the frequency sweep was started by ramping the signal generator from 12.5 ghz up to 16.5 ghz , while the reflection coefficient , the ar@xmath47 , ar@xmath48 , and ar@xmath49 currents , and the drain current were recorded simultaneously . the evolution of the reflection coefficient with the frequency is shown in fig . [ coeff ] . as expected by comparison with previous experiments , the matching impedance between the cavity filled by the plasma and the electromagnetic wave is strongly dependent on the frequency @xcite . it is remarkable that the plasma properties also change considerably with varying frequency . the strong correlation between the peaks of the reflection coefficient and the current amplitude are clearly visible around the frequencies at which the reflection coefficient is higher than @xmath51 db ( matching condition ) . the relationship between the resonance frequencies and the heating efficiency has been analysed theoretically and particle - in - cell codes have been used to correlate the electromagnetic field patterns and the electron cyclotron resonance surface @xcite . however , it is not possible with our analysis to determine the electromagnetic field patterns ( modes ) related to these peaks . the comparison of the current evolution in the frequency range indicated above is presented in fig . [ coeff ] . , scaledwidth=100.0% ] it is clear how the current amplitude is affected by the choice of the operative frequency . looking at the ar@xmath48 current , it ranges from a few microamperes up to 200 @xmath10a . the experimental results were clearly reproducible in several runs , thus confirming the reliability of the measurements . the evolution of the ar@xmath47 and ar@xmath48 currents is similar , but their amplitudes differ . in fact , at the frequencies at which both currents present a peak , the ar@xmath48 current is quite a bit higher than the ar@xmath47 current ( e.g. at 14.119 ghz , the difference between the two currents is 80 @xmath10a ) . the opposite behaviour is visible for the minima of the current amplitudes , where the ar@xmath47 current is higher than the ar@xmath48 current . in the range 15.6416.5 ghz , the currents of the higher - charge states that is , ar@xmath49 tend to lower values even if the reflected power is less than 10@xmath39 . this seems to be due to the confining magnetic field , which restricts the source operation to lower frequencies . it has been also observed that the evolution of the drain current follows the trend of the three charge states presented in fig . [ coeff ] . in order to have a complete understanding of the sweep effects on the ionization process , the charge - state distribution has been analysed for different frequencies . it was decided to restrict the analysis to the frequency range of 1415 ghz . several frequencies have been considered at which peaks and minimum amplitudes occur . in fig . [ csd ] , the charge - state distributions are presented for four different frequencies . , scaledwidth=50.0% ] the 14.5 ghz value is the normal operational frequency of the caprice ion source ; 14.46 ghz and 14.119 ghz are the frequencies at which the minimum and the maximum ar@xmath48 currents , respectively , were measured in the 1415 ghz frequency range . the charge - state distribution related to 14.0 ghz operation is also reported in order to emphasize the importance of the electromagnetic field pattern and the choice of the frequency . in fact , the charge - state distributions at 14.0 ghz and at 14.46 ghz are quite similar , even though the amount of power feeding the plasma was more than doubled . in the first case , the reflection coefficient ( indicated in the legend of fig . [ broad ] ) was @xmath52 db and more than half of the power was reflected ; and in the second case it was @xmath53 db , the impedance matching condition was fulfilled , and hardly any power was reflected . it is also interesting that for the frequencies at which the higher - charge states are favoured , the current of the lower charge state is decreasing and vice versa . the analysed charge - state distributions confirm that frequency tuning affects the higher - charge states to a greater extent ( at 14.119 ghz , the current enhancement with respect to the 14.5 ghz operational frequency is 244@xmath39 for the ar@xmath48 current and 456@xmath39 for the ar@xmath49 current ) . the enhancement of the current is not the only effect of frequency sweeping ; in fact , the quality , the shape , and the emittance of the ion beam also vary . the use of beam viewing targets has proven to be a favourable technique for monitoring the beam shape and a promising beam diagnostic tool . the images recorded beyond the extracted beam - focusing solenoid ( position vt2 ) and in the diagnostic box after the mass / charge selection dipole ( position vt3 ) are shown in fig . [ em ] . beam viewed at the targets located after the focusing solenoid ( left - hand column ) and after the dipole ( right - hand column).[em],scaledwidth=50.0% ] here , the same frequencies are chosen as in fig . the ar@xmath48 beam is shown in the right column and the focused beam images also refer to the ar@xmath48 magnetic field setting . at 14.0 ghz and 14.46 ghz , which are the frequencies at which the ar@xmath48 current presents a minimum , the focused beam shape seems to remain unchanged in the orientation of the arms ( at 14.0 ghz it is a little bit brighter , also according to the higher intensity measured at the faraday cup ) . at 14.119 ghz , the focused beam is a little bit bigger and brighter than the one at 14.5 ghz , and in both cases the orientation of the arms is turned by more then 40@xmath54 clockwise with respect to the 1414.6 ghz beam shapes . the relationship between the two frequencies and the respective power was not univocally determined . in fact , any source features a different set of parameters and the optimization is done empirically , just by looking at the maximization of the beam current . several qualitative explanations have been offered for this phenomenon , all related to the increase of the average electron temperature , t@xmath55 , and to the ionization rate , by assuming that the crossing of two resonance surfaces helps the electrons to gain more energy . this simple picture does not explain the reason for the relevant changes in the charge - state distribution for different pairs of frequencies ( even for the case of minor changes such as a few megahertz over 14 or 18 ghz ) , which can be explained nowadays in terms of the frequency tuning effect . it is important to underline that , even in the case of tfh applied to many existing sources , a twt is often used , the other option being a klystron - based generator . the choice of a twt allows the experimentalists to vary the second frequency slightly . it has been observed for example , for the production of o@xmath47 that 60 w emitted by the twt at the optimum frequency gives the same effect as 300 w emitted from the fixed - frequency klystron . the maximum current is obtained by means of a klystron at 427 w and a twt at 62 w ( @xmath56 = 66 @xmath10a ) , operating simultaneously ; in order to obtain the same current , the experimenters needed @xmath57 = 800 w from the klystron in sfh . furthermore , in the case of tfh , the current increases almost 20@xmath39 ( from 57 to 66 @xmath10ea ) when the twt - emitted frequency shifts from 11.06 to 10.85 ghz , the klystron and twt emitted power both being held constant . then , the tfh is an effective method to increase the extracted current from an ecris , but it can only be fully exploited by means of frequency tuning . several measurements have been carried out with the serse ion source . the tfh has been used for operation at either 14 or 18 ghz , with a clear advantage with respect to sfh . in section [ mic ] , the evolution of the ion current intensities of ar@xmath47 , ar@xmath48 , and ar@xmath49 over the 12.516.5 ghz frequency range has been described . the argon charge - state distributions were analysed for different frequencies , and for some frequencies an enhanced intensity of the higher - charge states was observed . we decided to perform an experiment to investigate the double - frequency heating effect using a single fixed frequency ( 14.5 ghz in one case and 14.119 ghz in another ) and a second frequency swept over the 12.516.5 ghz range . first , the power feeding the plasma was kept at 100 w , in order to compare the results of double - frequency heating with single - frequency sweeping . then the power distribution between the fixed frequency and the sweeping frequency was unbalanced by doubling the power of the fixed frequency in one case and the power of the sweeping frequency in the other . the ion source parameters including the magnetic field , the gas pressure , the extraction voltage , and so on were set to and maintained at the same values as used for single - frequency sweep analysis , with the charge - state distribution optimized for the ar@xmath48 intensity . the ar@xmath47 , ar@xmath48 , and ar@xmath49 currents were recorded together with the extractor drain current . the forward power and the reflected power were measured simultaneously . however , in the case of double - frequency heating , the power probes can not distinguish the measured values of the forward and reflected power related to each of the two waves . the results of these measurements are shown in fig . [ dfh ] . , scaledwidth=50.0% ] a comparison between the two techniques concerning the behaviour of the ion source is possible . as expected , in the case of the two frequencies , the minima of the reflection coefficient are higher because of the higher level of reflected power due to the superposition of the two waves . it is interesting to note that these minima occur at almost the same frequencies for both techniques . since the positions of the reflection coefficient minima do not vary , it can be expected that the peaks of the ion current are located at the same frequencies for the two heating methods . this comparison is shown in fig . [ drain ] for the drain current of the high - voltage extractor power supply . in this case , 50 w is provided at one fixed frequency and the effect of sweeping a second frequency with a power of 50 w produces a different current behaviour from that with a single sweeping frequency ( at the same power ) . this can be seen in fig . [ drain ] and figs . [ artf][ar9f ] . in fact , during the single - frequency sweep , the drain current , scaledwidth=50.0% ] current as a function of frequency : a comparison between the frequency tuning effect and double - frequency heating.[artf],scaledwidth=50.0% ] current as a function of frequency : a comparison between the frequency tuning effect and double - frequency heating.[ar9f],scaledwidth=50.0% ] varies from around 1.4 ma to 2.8 ma , while with double - frequency heating the range of variation is 0.6 ma . the drain current appears more stable with frequency when the double frequency is applied instead of single - frequency tuning . this behaviour is also observed in the ar@xmath47 current variation shown in fig . [ artf ] . a possible explanation might be found in the microwave power provided by the two methods . in the case of single - frequency tuning , 100 w is provided to the source and during the frequency sweep , when the impedance is not matched , most of the forward power is not coupled to the source but is reflected ( see fig . [ dfh ] ) . but in the case of double - frequency heating , just 50 w of the total forward power of 100 w is associated with the sweeping frequency , and at the frequencies at which the power is not coupled to the plasma , one half of the total power is provided at a fixed frequency , which is well coupled to the source ( i.e. at 14.5 ghz or at an optimized frequency such as 14.119 ghz ) . the choice of the fixed frequency allows enhancement of the ion currents of the higher - charge states . with respect to single - frequency operation , with two frequencies the current peaks are broadened and reduced in amplitude , the frequencies at which they occur remain the same , and the average current level remains high ( see fig . [ artf ] for ar@xmath47 ) , while the higher - charge states tend to higher ion currents when the frequency is increased ( see figs . [ ar9f ] and [ ar8f ] ) . the experimental results indicate that there can be strong differences when the operating frequency is optimized by frequency tuning . in fact , when operating in double - frequency mode and optimizing one of the two frequencies ( 14.119 ghz for the present case , as described above ) , the current increases linearly with frequency ( with respect to the 14.5 ghz fixed frequency ) . current as a function of frequency : a comparison between the frequency tuning effect and double - frequency heating.[ar8f],scaledwidth=50.0% ] in comparing the two techniques while keeping the ion source settings and the microwave power constant , note that the behaviour of the ion currents and the reflection coefficient remain almost the same with frequency . this result is useful to optimize the performance of an ecris further when double - frequency heating is used . in fact , single - frequency tuning can be used to find the optimum frequencies to be used for operating in the multiple heating mode . note also that when operating with two generators set at the same frequency , the current level measured is different from the single - generator case . this is because when the two frequencies become equal , the current of each charge state and the power provided to the ion source are not stable . a possible explanation for this phenomenon might be overlapping of the two signals and the phase difference between the two waves . we plan to explore the use of two phase - locked generators in forthcoming experiments . the behaviour of argon ion beams has been explored for different power levels of the fixed frequency and the sweep frequency . in both cases , two fixed frequencies were chosen and in this case the possibility of setting the fixed frequency to an optimized value , obtained by fine - tuning the frequency , allowed us to increase the beam intensity ( fig . [ curr ] ) . current as a function of frequency : differing power distributions between the two waves.[curr],scaledwidth=50.0% ] figure 13 shows the evolution of the ar@xmath49 current when 150 w of total power is distributed between the two microwave feeds in different proportions , one of fixed frequency and the second swept from 12.5 ghz to 16.5 ghz . again , the single - frequency sweep carried out at 100 w is included in the figure for comparison . for the optimum frequency mentioned previously ( 14.119 ghz ) , the current intensity is still comparable between the two methods even though the total power is 50@xmath39 greater . when the power associated with the fixed frequency is higher , all the analysed charge states are less sensitive to variation of the second frequency . this follows from the reduced dynamic range of the current , indicating a more stable plasma ; in particular , when the fixed frequency is chosen to be at the optimum value ( 14.119 ghz ) . furthermore , when one of the two frequencies is optimized , the average extracted current remains high with respect to an unoptimized frequency ( such as 14.5 ghz ) , increasing with the second frequency ( quite evident above 15 ghz ) . all these observations are more evident for higher - charge states . with the ion source running at higher microwave power , it was possible to perform an experiment with an ar@xmath58 ion beam . the results are shown in fig . [ ar11 ] . current as a function of frequency , showing different power distributions between the two waves.[ar11],scaledwidth=50.0% ] the power distribution between the two waves is also important . obviously , it is more effective to increase the power at the fixed frequency . figure [ ar11 ] shows once more that the choice of the optimum frequency , as obtained in the previous experiment on frequency tuning , is very important for double - frequency heating at higher power . this result is interesting with respect to the operation of new - generation ecris machines working at 28 ghz , using gyrotron microwave generators in combination with a second microwave generator of lower frequency , working in double - frequency mode . ecr devices are density limited , because the electromagnetic waves can not propagate beyond a certain density , called the cut - off density . an alternative to the classical ecr interaction is electrostatic wave heating , driven by bernstein waves . bernstein waves ( bw ) are very interesting for nuclear fusion devices @xcite , because the plasma heating occurs in the absence of any density cut - off . electromagnetic ordinary ( o ) or extraordinary ( x ) modes can be externally launched into the plasma . o - mode waves may be coupled to an x mode in the o - mode cut - off layer , and then the x mode can be coupled to a bw mode at the upper hybrid resonance ( uhr ) . this process is called o - x - b mode conversion and was described in 1973 by preinhaelter and kopecky @xcite . , scaledwidth=50.0% ] it was shown that o - x - b mode conversion may be optimized by changing the o - mode insertion angle with respect to the external magnetic field direction : in this case , the o mode is completely converted into a slow x mode , which under certain conditions is in turn converted to bws in the upper hybrid resonance ( uhr ) layer @xcite . the generated bernstein waves travel inside the plasma until they are absorbed at the ecr or at the higher - order cyclotron harmonics . a possible design for a microwave injection system producing the o - x - b conversion is shown in fig . [ b ] : first , an o wave is launched from the outside , with an oblique angle of incidence obtained with a proper orientation of the parabolic mirrors . for an optimal launch angle , it is possible to obtain a correlated optimal parallel refractive index and then a coincidence of the o and x modes at the critical plasma density ( cut - off ) . this means that both modes have the same phase and group velocities and the power is transferred without reflections . once the x waves are generated , they propagate towards the uhr . here , the x mode coincides with the electron bernstein mode . in the linear description , the x waves are completely converted into ebws . this process is called x b conversion . it should be noted that the o - x - b process can only take place if the plasma density is above the o - wave cut - off density . o - x - b plasma heating and current driving with bw in an overdense plasma were demonstrated in the stellarator wega , operating at the max planck institute for plasma physics in greifswald , germany @xcite . the heating of a plasma by means of ebw at particular frequencies enabled us to reach densities much larger than the cut - off ones . evidence of ebw generation and absorption together with x - ray emissions due to high - energy electrons is shown in ray tracing simulations and ccd photographs in ref . @xcite . a plasma reactor operating at the laboratori nazionali del sud of infn , catania , has been used as a test - bench for the investigation of innovative mechanisms of plasma ignition based on electrostatic waves ( es - w ) , obtained via the inner plasma em - to - es wave conversion . evidence of bernstein wave ( bw ) generation is shown in ref . @xcite . in particular , during the experiment , a microwave discharge ion source has been used : a plasma reactor consisting of a stainless - steel cylinder that is 24 cm long and 14 cm in diameter . a ndfeb permanent magnet system generates an off - resonance magnetic field along the plasma chamber axis ( with a maximum of 0.1 t on axis ) . microwaves have been generated by using a twt , which is able to generate microwaves from 3.2 to 4.9 ghz . the typical working frequency when using the twt was 3.7478 ghz . the temperature and plasma density measurements have been carried out by using a movable langmuir probe ( lp ) . the lp can host a small wire used as a local electromagnetic antenna , which can be connected to a spectrum analyser for the plasma spectral emission analysis . an si - pin and a hpge x - ray detector have been used for the measurement of x - ray spectra in different plasma conditions . both detectors are able to detect x rays with energies greater than about 1 kev . a ccd camera has been used to visualize the plasma structure within the chamber at different working frequencies , and at different microwave powers and pressures . a series of lp measurements has been carried out with the plasma reactor at the frequency of 2.45 ghz , when both under - resonance and off - resonance regions are present . in fig . [ den ] , it is evident that the electron density is drastically enhanced in regions where the condition @xmath59 is satisfied . mbar , and frequency 2.45 ghz , at different microwave powers . microwave injection occurs at the right - hand side of the figure.[den],scaledwidth=50.0% ] this effect is observed for all of the different power values that we used ; in particular , at 200 w , an electron density of about @xmath60 @xmath61 has been measured , a value 20 times greater than the cut - off density . note that the electron density is everywhere comparable or larger than the cut - off density ( @xmath62 @xmath61 ) . in the same magnetic configuration , x - ray measurements have been carried out at 2.45 ghz and 3.7478 ghz . by increasing the pumping frequency , it is possible totally to remove the ecr , so that at 3.7478 ghz the entire plasma chamber is at under - resonance and ebw heating becomes the unique heating mechanism . spectral temperatures measured in the two cases are shown in fig . [ tem ] . , scaledwidth=50.0% ] at the frequency of 3.7478 ghz , the spectral temperature is significantly larger ( up to 4 kev ) than at 2.45 ghz . around 80 w , it is possible to identify a threshold for which the temperature slope increases suddenly and becomes steeper for both configurations . the end - point energy is about 10 times the value of the spectral temperature . the spectral temperature decreases slightly with the atomic mass of the gas used and when the pressure is increased . further results and discussion can be found in ref . the results are interpreted through the bernstein wave heating theory , and are very promising for future high - intensity multicharged ion sources that can , therefore , be based on the results described here , by employing a simplified magnetic configuration with respect to typical minimum-@xmath0 ecr ion sources . microwave coupling to ecr ion sources plays a fundamental role in enhancing their performance in terms of current extracted and average charge state produced . over the past decade , new heating methods have been studied to overcome the technological limitations due to the magnetic field and frequency scaling , to achieve the production of milliampere levels of hci , as requested for the new accelerating facilities all over the world . 99 s. gammino , _ high energy phys . * 31 * ( 2007 ) 137 . drentje , _ rev . instrum . _ * 74 * ( 2003 ) 2631 . y. kawai , g.d . alton , o. tarvainen , p. suominen , and h. koivisto , _ rev . instrum . _ * 77 * ( 2006 ) 03a331 . z.q . xie and c.m . lyneis , _ rev . instrum . _ * 66 * ( 1995 ) 4218 . vondrasek , r.h . scott , r.c . pardo , and h. koivisto , operational improvements of the argonne ecr sources , proc . workshop ecr ion sources , jyvaskyla , finland , 1214 june 2002 . _ , _ rev . instrum . _ * 69 * ( 1998 ) 2305 . l. celona , g. ciavola , f. consoli , s. gammino , f. maimone _ et al . _ , observations of the frequency tuning effect in the 14 ghz caprice ion source , _ rev . instrum . _ * 79 * ( 2008 ) 023305 . s. gammino and g. ciavola , ecr ion sources and scaling laws , proc . capetown , south africa , 1995 , p. 377 . d. hitz _ et al . _ , the comparison of 18 and 28 ghz behavior of serse : some conclusions , proc . workshop ecr ion sources . jyvaskyla , finland , 2002 , p. 100 . alton , f.w . meyer , y. liu , j.r . beene , and d. tucker . enhancing the performances of traditional electron cyclotron resonance ion sources with multiple - discrete - frequency microwave radiation , _ rev . _ * 69 * ( 1998 ) 2305 . alton , _ computational studies for a multiple - frequency electron cyclotron resonance ion source_._rev . sci . instrum . _ * 67 * ( 1996 ) 989 . xie , production of highly charged ion beams from electron cyclotron resonance ion sources ( invited ) , _ rev . instrum . _ * 69 * ( 1998 ) 625 . o. tarvainen , y. kawai , g.d . alton , p. suominen , and h. koivisto , electron heating with broadband microwave radiation : a new method for improving the performances of conventional @xmath0-minimum electron cyclotron resonance ion sources , _ nucl . methods phys . b _ * 261 * ( 2007 ) 1044 . y. kawai , g.d . alton , o. tarvainen , p. suominen , and h. koivisto , effect of broadband microwave radiation on the performance of a conventional @xmath0-minimum geometry electron cyclotron resonance ion source , _ rev . _ * 77 * ( 2006 ) 03a331 . alton and d.n . smithe , _ rev . instrum . _ * 65 * ( 1994 ) 775 . alton and d.n . smithe , _ physica scripta _ * t71 * ( 1996 ) 66 . alton , proc . conference on cyclotrons and their applications ( capetown , south africa , 813 october 1995 ) , ed . cornell , world scientific , singapore , p. 362 . alton and y. liu , enhancing the performances of ecr ion source , proc . 1999 particle accelerator conference , new york ( 1999 ) . l. celona _ et al . _ , analysis of the serse ion output by using klystron - based or twt - based microwave generators , proc . , vol . 749 ( 2005 ) , p. 99 . s. gammino , g. ciavola , and l. celona . _ nucl . methods phys . res . a _ , * 491 * ( 2002 ) 342 . r. vondrasek _ et al . _ , aip conf . , vol . 749 ( 2005 ) , p. 31 . d. hitz , a. girard , k. serebrennikov , g. melin , d. cormier , j.m . mathonnet , j. chartier , l. sun , j.p . briand , and m. benhachoum , _ rev . instrum . _ * 75 * ( 2004 ) 1403 . _ , _ rev . instrum . _ * 81 * ( 2010 ) 174 . d. mascali _ et al . _ , _ rev . instrum . _ * 81 * ( 2010 ) 02a334 . _ , _ plasma phys . control . fusion _ * 41 * ( 1999 ) a273 . n.a . krall and a.w . trivelpiece , _ principles of plasma physics _ ( san francisco press , san francisco , ca , 1986 ) . podoba , h.p . laqua , g.b . warr , m. schubert , m. otte , s. marsen , f. wagner , and e. holzhauer , _ phys . * 98 * ( 2007 ) 255003 . d. mascali , l. celona , s. gammino , r. miracoli , g. castro , n. gambino , and g. ciavola , electrostatic wave heating and possible formation of self - generated high electric fields in a magnetized plasma , _ nucl . methods phys . a. _ * 653 * ( 2011 ) 11 . g. castro , d. mascali , f. p. romano , l. celona , s. gammino _ et al . _ , comparison between off - resonance and electron bernstein waves heating regime in a microwave discharge ion source , _ rev . instrum . _ * 83 * ( 2012 ) 02b501 .

the electron cyclotron resonance ion source ( ecris ) is nowadays the most effective device that can feed particle accelerators in a continuous and reliable way , providing high - current beams of low- and medium - charge - state ions and relatively intense currents for highly charged ions . the ecris is an important tool for research with ion beams ( in surface , atomic , and nuclear science ) while , on the other hand , it implies plasma under extreme conditions and thus constitutes an object of scientific interest in itself . the fundamental aspect of the coupling between the electromagnetic wave and the plasma is hereinafter treated together with some variations to the classical ecr heating mechanism , with particular attention being paid to the frequency tuning effect and two - frequency heating . considerations of electron and ion dynamics will be presented together with some recent observations connecting the beam shape with the frequency of the electromagnetic wave feeding the cavity . the future challenges of higher - charge states , high - charge breeding efficiency , and high absolute ionization efficiency also call for the exploration of new heating schemes and synergy between experiments and modelling . some results concerning the investigation of innovative mechanisms of plasma ignition based on upper hybrid resonance will be described .

deep water gravity - capillary waves are relevant in a range of applications , including the understanding of the generation of waves by wind and the interpretation of satellite remote sensing data ( see , for example @xcite and @xcite ) . the study of solitary waves in this regime is of particular theoretical interest since it is _ only _ under the joint effects of surface tension and gravity that localised water waves in three - dimensions have been found in the water wave problem . such localised waves have recently been observed in the experiments of @xcite . in the deep water limit , these gravity - capillary ( gc ) wavepacket " solitary waves are of a fundamentally different nature from long " solitary waves which are described approximately by the korteweg de vries ( kdv ) , kadomtsev - petviashvilli ( kp ) and related equations in shallow water . the later bifurcate from linear waves at zero wavenumber whereas the former bifurcate at a finite wavenumber , and hence their oscillatory nature . these oscillatory solitary waves were seen by @xcite and @xcite to be approximately described by solitary wave solutions of the focussing nonlinear schrdinger ( nls ) equation which governs the slowly varying envelope of monochromatic waves . in this regime , @xcite observed that if the phase speed ( the speed of crests of the carrier wave ) and the group speed ( the speed of the envelope ) are equal , the solitary waves of nls will describe approximately solitary waves in the primitive fluid equations . it is simple to show that at a minimum of the phase - speed , group and phase speed coincide , and that this occurs at nonzero wavenumber in gc waves for sufficiently deep water . ( the condition is that the bond number be less than 1/3 which roughly corresponds to a depth greater than a centimetre in the air - water problem . ) in a two dimensional fluid domain ( corresponding to a one dimensional free - surface and henceforth denoted as the ` 1d problem ' ) , wavepacket solitary waves were first computed in the full fluid equations by @xcite and by @xcite . in three - dimensions ( with a two - dimensional free - surface , denoted the ` 2d problem ' ) , the first computations of steady solitary waves were by @xcite , with related work by @xcite and @xcite on reduced equations . due to the highly oscillatory and spatially extended nature of these waves , accurate computations are challenging . localised waves on a two - dimensional water surface are often called lumps " , a name carried over from their shallow water counterparts which can be approximated by the localised lump " solutions of the kp equation , but we refer to them as wavepacket solitary waves . in this paper we focus only on the infinite depth case since for a water - air interface , any gc dynamics in water deeper than a few centimetres is essentially in the infinite depth regime . in this regime for an air - water interface , the waves bifurcate with a carrier wavelength of approximately 1.7 cm . and a speed of 23 cm./sec . the stability and dynamics of gc solitary waves in deep water has only recently been studied . in the 1d problem , @xcite studied the question of linear stability and @xcite studied the time - dependent evolution of solitary waves ( stability and collisions ) in full potential flow . in 2d , there are far fewer studies . the transverse instability of line solitary waves ( solitary waves of the 1d problem trivially extended in the transverse variable ) has been considered by @xcite and others . line solitary waves are unstable to transverse perturbations of sufficiently long wavelength . fully 2d dynamics have been considered by @xcite in a one - way simplified model and in a quadratic isotropic model in @xcite . the main goal of this paper is to study 2d dynamics within a close approximation of the euler equations . a simplification that we make , suggested and used in @xcite for 1d time - dependent solutions , is to take a cubic truncation of the scaled dirichlet - to - neuman operator that appears in the free - surface boundary conditions . ( one important difference from the model of @xcite is that we use the full surface tension term which results in a considerably better approximation of the full equations at larger amplitudes . ) the approximation proposed is the simplest model that can _ quantitatively _ capture small and moderate amplitude euler nonlinear cg solitary wave dynamics - a claim we support with 1d comparisons . the focussing two - dimensional cubic nls equation is central to the understanding of the existence and stability of these solitary waves . we shall see that this equation can be used to correctly predict the existence and certain instabilities of line and wave packet solitary waves , but does not capture the larger amplitude stability characteristics , the asymptotic dynamics of unstable waves nor the interaction of solitary waves . ( the situation in 1d is worse , since the nls does not even capture the instabilities of arbitrarily small waves correctly - see for example , @xcite and @xcite . ) this paper is structured as follows : in section [ formulation ] we briefly present the derivation of the cubic truncation model we shall use and discuss what can be learned about the solitary waves from the associated nls equation . in section [ results ] we present the numerical results : 1d comparisons between the cubic model and the full problem , followed by 2d bifurcation diagrams , and stability and collision calculations . in section [ extensions ] we briefly introduce variations on the cubic model , principally the addition of forcing and dissipation and treating the finite depth problem . consider the three - dimensional free - surface water wave problem under the influence of both gravity and surface tension . let @xmath0 denote the horizontal plane , @xmath1 the vertical direction and @xmath2 time . the fluid is assumed to be inviscid and irrotational and therefore there exists a potential function @xmath3 , such that the fluid velocity @xmath4 . if the displacement of the water surface is designated by @xmath5 , then the governing equations for water waves read @xmath6+g\eta=\frac{\sigma}{\rho } \nabla\cdot\big[\frac{\nabla\eta}{\sqrt{1+|\nabla\eta|^2}}\big ] \quad\text{at $ z=\eta(x , y , t)$ } \label{dbc}\end{aligned}\ ] ] where @xmath7 is the horizontal gradient operator , and @xmath8 is the corresponding horizontal divergence operator . the constants @xmath9 are the acceleration due to gravity , density , and the coefficient of surface tension , respectively . following @xcite , who worked in the canonical variables introduced by @xcite , the kinematic and dynamic boundary conditions ( [ kbc]-[dbc ] ) can be recast in terms of the free surface potential @xmath10 and @xmath11 as @xmath12-\eta+\nabla\cdot\big[\frac{\nabla\eta}{\sqrt{1+|\nabla\eta|^2}}\big ] \label{zcsb}\end{aligned}\ ] ] @xmath13 is a scaled dirichlet to neumann ( dtn ) operator yielding the vertical velocity of the free surface . it is defined by @xmath14 , where @xmath15 is the derivative of the potential in the outward normal direction to the free surface and @xmath3 satisfies ( [ laplace]-[decay ] ) with @xmath16 . these equations have been also been nondimensionalized using a characteristic lengthscale @xmath17 , a timescale @xmath18 , and a resulting velocity scale @xmath19 . in cgs units , @xmath20 , and @xmath21 , the ratio of the surface tension coefficient and density , equals @xmath22 for water . @xcite prove that if the @xmath23-norm and lipschitz - norm of @xmath11 is smaller than a certain constant , then @xmath24 is an analytic function of @xmath11 . it follows that the dtn operator can be naturally written in the form of taylor expansion in @xmath11 , @xmath25 . for infinite depth , the first three terms of the taylor series are given by @xmath26\end{aligned}\ ] ] where @xmath27 and @xmath28 . using the cubic truncation of @xmath24 and substituted into the kinematic and dynamic boundary conditions closes the evolution problem @xmath29\nonumber\\ & & + \frac{1}{2}\big[(g_0\xi)\big(g_0\xi-2g_0\eta g_0\xi-2\eta\delta\xi\big)-|\nabla\xi|^2\big ] . \label{zcs3b}\end{aligned}\ ] ] this formulation and approximation has reduced the three dimensional nonlinear water wave problem to a two dimensional one involving only the variables on the surface that is computationally , reasonably simple . in a doubly periodic setting , each term can be efficiently computed using a pseudospectral method and the fast fourier transform ( fft ) . we shall henceforth call this model the cubic dirichelet - to - neumann euler equations ( cdtne ) . computational methods based on series truncations of the dtn operator have been used used in a variety of water wave problems and are summarised in detail by @xcite . for the 1d problem where the full equations can be numerically integrated using a conformal map method we find ( see the results section ) that the cubic truncation is extremely accurate . the next physically reasonable truncation for this problem , at fifth order , would involve substantially more computational resources . the cdtne model can also be obtained from the fourth - order truncation of the kinetic energy part of the hamiltonian expression of the surface water wave problem written in terms of the surface potential . the total energy of the fluid is the sum of kinetic and potential energies @xmath30 and an approximate hamiltonian can be derived by expanding the energy in powers of the @xmath31 . this takes the form @xmath32&\triangleq&\widetilde{h}[\eta,\xi]+o(\eta^3 \xi^2)\nonumber\\ \widetilde{h}[\eta,\xi]&=&\int\frac{1}{2}\xi ( g_0 + g_1 + g_2)\xi+\frac{1}{2}\eta^2 + \big(\sqrt{1+|\nabla\eta|^2}-1\big)dxdy \label{zcsh}\end{aligned}\ ] ] the equations ( [ zcs3a ] ) and ( [ zcs3b ] ) can be expressed in canonical form in the sense of @xcite : @xmath33 and @xmath34 . the system has further physical conserved quantities , of which mass and momentum @xmath35 are used to monitor the global accuracy of numerical computations with our truncated equations . traditionally , weakly nonlinear wavepackets are studied using the resulting cubic nonlinear schrdinger equation ( nls ) for the modulational regime of monochromatic waves . it can be derived by substituting the ansatz : @xmath36 into ( [ zcsa ] ) , ( [ zcsb ] ) and ensuring that the series is well - ordered for @xmath37 . here @xmath38 , @xmath39 and @xmath40 where @xmath41 is the group velocity in the wave propagating direction and c.c . " represents the complex conjugate of preceding terms . the wave envelope @xmath42 can then be found to satisfy the nls equation ( @xcite ) @xmath43 it is a trivial fact that substituting the same ansatz into the equations ( [ zcs3a ] ) , ( [ zcs3b ] ) instead yields an nls equation with identical coefficients - which is the motivation for choosing at least a cubic truncation of the dtn operator . we omit the details of the derivation , and just state the results . choosing @xmath44 as the carrier wave , the phase and group velocity are equal , with the phase velocity at its minimum @xmath45 . all of the waves we consider bifurcate from this point and exist only for @xmath46 . the coefficients of nls are given by @xmath47 the solution to the original system is then as follows @xmath48 where @xmath49 . since the nls equation ( [ nls ] ) is of the elliptic or focussing type with solitary wave solutions in both one and two dimensions , and since the phase and group speed are equal at the chosen carrier wave , one can expect small amplitude solitary waves bifurcating from a uniform flow . these solitary waves of ( [ zcs3a],[zcs3b ] ) can be approximated by the nls solitary waves found by solving the elliptic eigenvalue problem for @xmath50 and @xmath51 @xmath52 this is obtained by setting @xmath53 . denoting @xmath54 where c is the wave propagating speed , then , by the chosen scaling , @xmath55 . the total energy of the gravity - capillary solitary wave bifurcating below the minimum phase speed is then calculated by @xmath56 . for the one dimensional problem ( [ nonlinev ] ) has the well known unique focussing nls soliton , @xmath57 , @xmath58 , @xmath59 and thus @xmath60 for the two dimensional case , which are the ones of interest here , there are countably many solutions to the problem ( [ nonlinev ] ) ( see @xcite and references therein ) , and the first three radially symmetric solutions are shown in figure [ fignonlinev ] . for the ground state , called the townes soliton in nonlinear optics ( @xcite ) , @xmath61 , @xmath62 , and , in the present hydrodynamic context , @xmath63 the details of these computations can be found in @xcite . an interesting particularity is that the physical energy for two dimensional wavepacket solitary waves is predicted to tend to a _ finite _ value of 12.04 as the amplitude approaches zero , which we shall verify in the cdtne model . this is purely a consequence of scaling : the radially symmetric envelope s area is proportional to @xmath64 exactly countering the effect of decreasing amplitude of the wave whose energy density is @xmath65 . shallow water lump solutions of kp ( a valid approximation when the bond number is greater than 1/3 ) do not have this property . the higher energy states of the eigenvalue problem ( [ nonlinev ] ) can be associated with different families of travelling waves of the cdtne model resulting in a remarkable quantisation " of the energy of solitary gc waves in the 2d problem . the numerical solution of the cdtne system is implemented on a periodic domain with fourier pseudo - spectral methods , where all derivatives and hilbert transforms are computed in fourier space with spectral accuracy , while nonlinearities are computed pseudo - spectrally in real space . for traveling waves , the resulting algebraic system for the fourier coefficients is solved using newton s method using a monochromatic wave modulated by the solution to ( [ nonlinev ] ) as initial guesses . the branches are computed through straightforward continuation methods . for time integration of the system , a classic fourth order runge - kutta method is used with the integrating factor method ( see @xcite for details ) used to exactly integrate the linear part of the equation . the conserved quantities of the system are monitored and in all cases are preserved to a relative error of at most @xmath66 . all the computations are de - aliased with a doubling of fourier modes . for two dimensional computations at least @xmath67 modes are used along the propagating and transverse directions respectively . it is often the small amplitude solutions that are most difficult to compute accurately since the spatial decay of those solutions is much slower . thus , the computational the domain is gradually enlarged as the amplitude becomes smaller . the bifurcation diagrams of 1d gravity - capillary solitary waves for the full equations in deep water have been presented in @xcite and others . in figure [ fig1 ] we compare the speed - amplitude and speed - energy bifurcation diagrams of the cdtne model to these and to the theoretical prediction of nls . there , and elsewhere , we use either @xmath11 at the centre of the wave or the energy @xmath68 as the amplitude parameter . the cdtne model agrees well with the bifurcation picture for the euler equations far beyond the nls regime . typical profiles of the depression and elevation branches of waves are show in figure [ fig2 ] . the model is remarkably accurate : at relatively large amplitudes which are far from the nls regime the relative difference in profile between the full equations and the model are of order @xmath69 and not visually discernible . although a quantitative comparison of time - dependent dynamics is involved and beyond the scope of this paper ( in particular methods used to solve the full equations usually do not use a uniform grid in @xmath70 ) , we show an example of the inelastic overtaking collision of two solitary waves computed with the full equations ( reported in @xcite ) and cdtne truncation in figure [ figure1dtdcomp ] . the results are extremely close and we see this as further evidence that the cdtne model is an accurate representation of the euler equations in a broad amplitude range of the cg regime . comparisons that we have made with the cubic model of @xcite show that retaining the full nonlinearity of the surface tension term is far more important than the nonlinearity associated with higher order corrections of the dirichelet to neumann map . one may conjecture that the surface tension term has a strong regularising effect that implies fast convergence of the dtn power series approximation throughout the evolution . two - dimensional gc solitary waves of the full equations in infinite depth were first computed in @xcite using finite differences and boundary integral methods . a more resolved computation was performed by p@xmath71r@xmath71u and reported in @xcite . however , this later computation is , in our opinion , also under - resolved , particularly at small amplitudes where the waves are highly oscillatory and spatially extended , as it deviates considerably from both the cdtne and the nls results . figure [ figbif2d ] shows the bifurcation diagram of gc solitary waves , as obtained from numerical solutions of the cdtne , full potential flow ( as computed by p@xmath71r@xmath71u and reported in @xcite ) , and both the leading order and leading order plus first correction of the nls approximation . we conjecture that the cdtne would be in quantitative agreement with full potential flow in the 2d problem given the accuracy of results at moderate amplitude in the 1d case , and the agreement with nls approximations at small amplitude . the discrepancy between the full euler results and the expected amplitudes predicted by nls had been noted in @xcite . furthermore , we note that the cdtne wave packets have finite energy at their bifurcation point , as predicted by nls but which can not be verified in the full euler computations at current resolution ( p@xmath71r@xmath71u , private communication ) . typical profiles of the elevation and depression waves corresponding to the bifurcation curves presented in figure [ figbif2d ] are shown in figure [ figprofiles2d ] . all solutions presented so far are those whose profile envelope at bifurcation is described by the ground state eigenfunction of ( [ nonlinev ] ) . in the 2d problem , we have also computed cdtne solitary wave solutions whose envelope is approximated by radially symmetric higher modes . for example in figure [ figmode2 ] we show the unstable evolution of the complicated travelling wave resulting from the solitary wave assigned to the second radial mode of ( [ nonlinev ] ) ( the wave is shown in the top - left panel of figure [ figmode2 ] ) . this wave has an energy of 79.39 at bifurcation , much higher than the ground state . non - radially symmetric solutions to ( [ nonlinev ] ) are discussed in @xcite , but we did not attempt to compute solitary waves whose envelopes are not radially symmetric . there are a few known results that guide us in a numerical study of 2d stability problem . first , it is known that both depression and elevation plane solitary waves ( 1d waves extended in the second dimension ) are linearly unstable with respect to sufficiently long small perturbations in the transverse direction . this has been shown both within an nls approximation @xcite and using arguments based on linearization of the full equations @xcite . second , in 2d the underlying focussing nls equation ( [ nls ] ) is well known to exhibit a finite - time focussing blowup called wave collapse when , in an unbounded setting , the initial conserved energy @xmath72 , is negative ( see @xcite and @xcite ) . ( note that this energy is not the same one arising from the cdtne equations . ) the result is obtained by a virial argument , whence @xmath73 is conserved and @xmath74 satisfies @xmath75 . solitary waves which are solutions to the eigenvalue problem ( [ nonlinev ] ) are critical with @xmath76 . thus , a small negative energy perturbation leads to focussing and blowup and a positive energy perturbation leads to spreading of the underlying wave envelope . we thus expect , and will confirm numerically , the instability of localised solitary wave solutions for nonzero envelope energy perturbations in the near - nls limit of the cdtne model ( where solitary wave envelopes are well approximated by the nls ) . we note that the simple virial argument is not available in a periodic setting ( see @xcite ) but nevertheless seems to predict stability very well in our computations on periodic domains . third , both elevation and depression wave branches have critical point in their speed - energy relation ( see figure [ figbif2d ] ) , which can lead to an exchange of linear stability of the eigenfunction of the linearized problem associated to the translational invariance symmetry ( see , for example , @xcite ) . this is the instability commonly observed in small amplitude elevation waves of the 1d problem leading to the eventual development of a depression wave @xcite . all figures of solitary wave dynamics presented are shown is a frame moving with the speed of the wave that was used construct the initial data . in this frame the main features of the wave evolve slowly . for plane solitary waves , the linear analysis based on nls ( see @xcite ) shows that the transverse perturbation @xmath77 is unstable , when the wave number @xmath78 in the @xmath79 direction satisfies @xmath80 we confirm this in our numerical experiments where a plane solitary wave is perturbed with four transverse perturbations of different wavelengths and the subsequent nonlinear evolution is compared . the perturbation wavenumbers are @xmath81 , and @xmath82 respectively . as shown in figure [ figtransins ] the first two perturbations do not destabilise the plane wave whereas the next two do . the subsequent evolution of the instability shows a focussing behaviour reminiscent of the underlying collapse dynamics of nls as shown in figure [ figtransevol ] . this intermediate time focussing is arrested by the generation of a travelling _ breather _ : a propagating periodic - in - time localised structure . this structure is best described as a localised depression solitary wave with periodic amplitude modulation , and which appears to be stable ( see evolution for @xmath83 in figure [ figtransins ] ) in all our experiments . these breathers are very common and also occur in the nonlinear evolution of instabilities of small amplitude fully localised solitary waves below . throughout our computations in this section , instabilities and wave interactions will invariably lead to some high frequency dispersive radiation and thus , due to our use of a periodic domain , the remaining coherent structures are embedded in a sea " of linear ripples . this is visible in most computations and can also be seen as further evidence of the stability of the resulting structures . the stability of localised traveling waves is considered next . first , the virial argument sketched above implies that near the bifurcation point , both elevation and depression solitary waves are linearly unstable . the virial argument would predict eventual blowup for negative energy perturbations and this is not observed , in all cases the blowup is arrested by the generation of a larger amplitude breather . dispersive spreading consistent with the envelope spreading predicted by the virial argument is observed for positive energy perturbations . in the computations that we present we perturb the exact solitary wave solution by a small multiple of itself , by taking initial data @xmath84 where @xmath85 is the computed travelling wave . since , for the perturbed wave , @xmath86 where @xmath87 is the envelope of the solitary wave , negative energy perturbations correspond to @xmath88 and positive energy ones to @xmath89 . in the left panel of figure [ deplumpstab ] we show the typical evolution of the amplitude for a perturbed small amplitude depression solitary wave . for a negative energy perturbation we see focussing arrested by the formation of a breather whereas for positive energy the amplitude decreases monotonically as a result of dispersive spreading . the case shown is for a depression wave , however the elevation wave dynamics is broadly similar . in figure [ figbreather ] we show four snapshots of the breather evolution resulting from the unstable small amplitude depression wave at later times . for a large class of problems , linear stability may change at a critical point of @xmath90 , the speed - energy curve . this necessary condition for instability was observed by @xcite , for gravity waves and has since been extended to many other situations . @xcite present an application of this result to a wavepacket solitary wave in a model equation . in the present problem , both depression and elevation waves have critical points in @xmath90 . we denote solitary waves with speed lower than this critical speed large amplitude " and those with speed larger than it small amplitude " since in all our computations amplitude is a monotonic function of speed . small amplitude waves bifurcation diagram and linear stability are well described by the nls equation whereas large amplitude waves are not . our numerical simulations show that for depression waves , the exchange of stability does take place at the minimum point in @xmath90 . the evolution of large amplitude depression waves amplitudes when subject to perturbations is shown in the right panel of figure [ deplumpstab ] . the waves are stable regardless of the sign of @xmath91 . solitary waves ( or breathers which are small perturbations of the solitary waves ) propagate in the midst of small linear dispersive waves that have been shed by the perturbed initial data . all our computations show that elevation waves remain unstable at large amplitude . in figure [ figuneleprof ] an unstable large elevation solitary wave subject to a smallnegative energy perturbation and evolves into a depression breather . similarly , positive energy perturbations will also yield depression breathers ( whose energy is much smaller than the elevation waves ( see figure [ figbif2d ] ) . the instability is initially similar to that of a 1d depression wave ( see @xcite ) : a symmetry breaking whereby the leading trough grows at the expense of the trailing one ( this instability is associated to the translational invariance mentioned above ) . what follows is collapse focussing that is arrested by the formation of a depression breather . from our calculations , we believe there are families of periodic ( breather ) solutions of different periods and amplitude for each fixed energy above the minimum of the depression solitary waves . the orbits of these breathers in phase space are centred around the fixed point of stable depression solitary waves and the precise bifurcation diagram for them would require computing exact periodic localised structures which is beyond the scope of this paper . a summary of the stability results in this section is shown in table [ table ] . .summary of stability results [ cols="<,^,^ " , ] lastly we compute the evolution of a complex solitary wave of the cdtne equations corresponding to a higher mode of the nonlinear eigenvalue problem discussed previously , and this is shown in figure [ figmode2 ] . in this case all perturbations triggered rapid instabilities , but the nonlinear evolution shows a remarkable dynamics with eventual focussing into four depression breathers of different amplitudes . given the stability of large amplitude depression waves , we have numerically computed their collisions . we have only computed head - on and overtaking collisions of pairs of waves although in a 2d problem there is a wide range of possible collision scenarios . for head - on collisions , the interaction time between the two waves is insufficient for any strong nonlinear effect to take place and we have only observed very small oscillations that result from the small inelasticity of the collision . the waves essentially traverse each other . the more interesting case is the overtaking collision . here , the small difference in solitary wave speeds implies that the calculations must be carried out over long times . in the 1d problem collisions were of two types of inelastic collisions @xcite : collisions where both waves survived and collisions where only the larger wave survived when their amplitude difference was large . here , we have only observed quasi - elastic collisions where both waves survive and the primary effect of the overtaking collision is a rapid and large phase shift of the order of one envelope wavelength . figure [ colldd ] shows the before and after free surface profiles of the waves and figure [ collddc ] shows the resulting waves trajectories in @xmath92 space . the collisions are weakly inelastic and the wave amplitude is mildly attenuated with some dispersive radiation present during the collision . there are several extensions of the model which , while the detailed study is beyond the scope of this paper , may be useful in studying problems of this type . we have considered fluids of infinite depth only ( which in the case of gc flows in water is a good approximation for depths exceeding a few centimetres ) . if the effect of finite depth is required , the formulation can be modified simply by taking @xmath93 where @xmath94 is the mean depth of the fluid normalised by the capillary gravity length scale and is inversely related to the bond number . in particular the shallow water lump dynamics modelled by the kadomtsev - petviashvilli ( kp ) equation should be recovered when the bond number is greater than @xmath95 . given the small length scales of the waves , it may also be of practical interest to add the effects of viscosity and forcing . in the analysis of their experiments @xcite adjusted a simple one - way model proposed in @xcite by adding forcing and a viscous damping . the more accurate cdtne equations can be modified to include small viscous damping effects by using the approximation presented in @xcite whereby dissipation is modelled through the modification of both kinematic and dynamic boundary conditions : @xmath96\nonumber\\ & & + \frac{1}{2}\big[(g_0\xi)\big(g_0\xi-2g_0\eta g_0\xi-2\eta\delta\xi\big)-|\nabla\xi|^2\big].\end{aligned}\ ] ] here , @xmath97 is the pressure forcing and the reynolds number , which controls the dissipation rate , is given by @xmath98 where @xmath99 is the kinematic viscosity of the fluid . for the case of an air - water interface in the regime that we considered in this paper , we obtain a reynolds number of approximately 500 . for small amplitude waves , the variation in the transverse direction is not significant compared to that in the propagation direction . one can therefore propose to assume this a priori and simplify the system by deleting all the nonlinear terms which include y - derivatives obtaining a weakly transversal " model which still has the same nls equation describing wave packets as the full problem . the hamiltonian for this model reads @xmath100=\int\:\frac{1}{2}\xi\big(g_0+\overline{g}_1 + \overline{g}_2\big)\xi+\frac{1}{2}\eta^2 + \frac12\eta_y^2 + \big(\sqrt{1+\eta_x^2}\big)\:dxdy\end{aligned}\ ] ] where @xmath101 calculations performed with this approximation show excellent agreement with cdtne at small amplitudes and only qualitative agreement for larger amplitude solitary waves . the dynamics of gravity - capillary solitary waves on the surface of three - dimensional fluid was studied . the only approximation made was a cubic truncation of a scaled dirichelet to neumann map that provides the normal velocity of the free - surface given its tangential velocity . in two dimensions , where comparisons to the untruncated problem ( i.e. fully nonlinear free - surface potential flow ) can be accurately measured , this truncation is remarkably accurate in modelling small and moderate amplitude waves . we conjecture that the same is true in three - dimensions . there are undoubtedly in this problem infinitely many branches of solitary travelling wave solutions as this is the prediction of the associated envelope nls analysis about the bifurcation point . we compute examples of three of them : elevation and depression solitary waves arising from the simplest eigenfunction of the nls problem and a more complex wave arising from a higher eigenfunction of the same problem . the localised solitary waves have the surprising property that as their amplitude ( from peak to trough ) decreases to zero as the bifurcation point is approached , their physical energy tends to a finite positive value , quantised by the different eigenfunctions of the nls equation . the instability and subsequent evolution for one dimensional line solitary waves and the various two dimensional solitary waves have been explored numerically by perturbing the waves and computing the solution through accurate pseudo spectral based methods . all solitary waves are found to be unstable with the notable exception of larger amplitude depression waves . these waves together with travelling breathers , which are periodic travelling cycles oscillating about these travelling states , are stable and appear to be attractors in the long time evolution of the problem . the focussing nls equation adequately predicts the bifurcation and linear stability properties of small amplitude solitary cg waves . the collapse singularity of initial data , however , is not observed in our computations leading to the conjecture that an appropriate envelope model for this problem is a cubic - quintic nls equation where the quintic term is defocussing . we thank dr e. p@xmath71r@xmath71u for making available more resolved numerical results solitary waves . this work was supported by epsrc , under grant number gr / s47786/01 , by the division of mathematical sciences of the national science foundation , under grant number dms-0908077 , and by a royal society wolfson award .

the dynamics of solitary gravity - capillary water waves propagating on the surface of a three - dimensional fluid domain is studied numerically . in order to accurately compute complex time dependent solutions , we simplify the full potential flow problem by taking a cubic truncation of the scaled dirichlet - to - neumann operator for the normal velocity on the free surface . this approximation agrees remarkably well with the full equations for the bifurcation curves , wave profiles and the dynamics of solitary waves for a two - dimensional fluid domain . fully localised solitary waves are then computed in the three - dimensional problem and the stability and interaction of both line and localized solitary waves are investigated via numerical time integration of the equations . the solitary wave branches are indexed by their finite energy at small amplitude , and the dynamics of the solitary waves is complex involving nonlinear focussing of wave packets , quasi - elastic collisions , and the generation of propagating , spatially localised , time - periodic structures ( breathers ) .

most literature in the field of total hip arthroplasty ( tha ) for fused hips , until date has reported the results of using metal on polyethylene and ceramic on polyethylene bearings . results of tha using ceramic on ceramic ( coc ) bearings in fused hips have not been published in literature . this study reports the results of cementless tha using coc articulation perfomed in fused hips . twenty - three patients ( 25 hips ) with fused hips underwent conversion to tha using coc bearings and were followed up for a mean 5.4 years . the conventional posterolateral approach was used in 15 hips , a modified two incision technique in 7 hips and a direct lateral approach with greater trochanteric osteotomy in 3 hips . postoperatively , range of motion exercises were encouraged after 23 days of bed rest and subsequent gradual weight bearing using crutches was begun . mean harris hip score improved from 42.4 to 84.2 and mean leg lengthening of 36.6 mm was achieved . in the average 5.4 years ( range 2.8 - 9.1 years ) followup there were no cases with osteolysis around acetabular cup and femoral stem . in this study this study suggests that cementless tha performed for fused hips with coc bearings can provide good early clinical results . it can lead to degenerative changes and pain in other joints like ipsilateral knee , contralateral hip and lumbar spine . in the past , hip arthrodesis was a valuable and commonly performed procedure in a young , active , high demand patient with unilateral involvement and damage to the hip.12 a well performed and successful arthrodesis provides long term pain relief and allows the resumption of activities including heavy labor . this however is achieved at the cost of lack of motion at the hip and resultant compensatory movement at other uninvolved joints to produce a useful gait.2 therefore total hip arthroplasty ( tha ) is now considered a better option than hip fusion to achieve movement postoperatively and to spare effect on other joints.2 severe bony deformity with contracture and atrophy of surrounding soft tissues , makes conversion to tha , a technically difficult procedure.12 in addition , tha for fused hip has a higher complication rate with more neurovascular injuries , postoperative infections and inconsistent clinical improvement compared to tha for other indications , such as osteoarthritis and osteonecrosis of the femoral head.34 it has been reported that up to 10% of patients needed re - operation after the initial tha for fused hip.4 however , despite the reported difficulties , tha for fused hip is increasingly recognized as the standard surgical therapy and carries numerous benefits , such as reduction of other joint pain and correction of limb length discrepancy.456 historically , in tha , implant failure was frequently the result of aseptic loosening , causing failure of fixation and implant fracture.7 improvements in prosthetic materials , designs and implant fixation resulted in wear of the bearing surface being the primary mechanical limitation in otherwise correctly implanted metal - on - conventional polyethylene components.78 improvements in technology of articulating surfaces for the hip have focused on increasing implant survival by decreasing articulation wear and resultant osteolysis thereby reducing dislocation rates . the need for more wear - resistant bearings has led to the development and use of ceramic on ceramic ( coc ) bearing couples . these bearings have the potential advantages in terms of improved implant tribology ( lubrication , friction , wear ) , increased longevity and reduced dislocation rates . dantonio et al.9 reported that coc bearing surfaces have advantage of higher survivorship and reduced osteolysis compared with metal on metal or metal on polyethylene ( mop ) bearing couples . however , potential disadvantages of coc bearings , such as fractures and squeaking still remains a concern.10 most literature for tha in fused hip till date has reported the results of mop or ceramic on polyethylene bearings.411121314 there has been no report of results of tha performed in fused hips using coc bearings to the best of our knowledge . this study reports the results of cementless tha using coc articulation performed for fused hips . 23 patients ( 25 hips ) with fused hips were operated for tha with coc bearing implants between october 2003 to november 2009 . this included 11 males and 12 females , with a mean age of 42.1 years ( range 2170 years ) . 18 of these hips had fused spontaneously and 7 hips had had surgical fusion [ table 1 ] . it consisted of 12 pyogenic arthritis , 4 tuberculous arthritis , 4 ankylosing spondylitis , and 5 trauma cases [ table 1 ] . patients who had pyogenic and tuberculous arthritis were quiescent at the time of conversion to tha . the postero - lateral approach was used in 15 hips , modified two incision technique15 in 7 hips and direct lateral approach with greater trochanteric osteotomy in 3 hips . if the bony anatomy of the hip was found to be well preserved , we chose a modified two incision technique and if bony anatomy of the hip was severely deformed , we chose posterolateral approach [ table 2 ] . during the posterolateral approach , anterior capsulotomy and capsule release was done through interval between tensor fascia lata and gluteus medius . an iliopsoas tenotomy was optional . in patients with severe bony deformity and soft tissue adhesions , where muscle interval of tensor fascia lata and gluteus medius could not be found , we took a direct lateral approach with greater trochanteric osteotomy . during the surgery , after acetabular reaming , we confirmed placement of the acetabular cup in the true acetabulum by comparing both sides on c - arm images . in all patients , demographics of the patients surgical approach and types of implants the prosthesis used were secur - fittm ( stryker osteonics , new jersey , usa ) acetabular shell in 13 cases and delta pf ( lima - lto , udine , italy ) acetabular shell in 12 cases , with m / l taper stem ( zimmer , warsaw , in , usa ) in 12 cases , wagner cone prosthesis stem ( zimmer , winterthur , switzerland ) in 11 cases and accolade stem ( stryker orthopedics , mahwah , nj ) in 2 cases [ table 1 , figure 1a and 1b ] . all patients were fitted with an alumina biolox forte ( ceram tec , plochingen , germany ) neutral liner and an alumina biolox forte ( ceram tec , plochingen , germany ) modular head . the head diameter was 28 mm in 11 patients , 32 mm in 9 and 36 mm in 5 . the neck lengths used were short in 10 , medium in 8 and long in 7 patients . x - ray pelvis showing both hips anteroposterior view in a 57 year old male with a history of right hip surgery for fusion with angled blade plate 20 years ago due to sequelae of developmental dysplasia of hip ( a ) preoperative radiograph showing a solid fusion with 30 abduction malposition . ( b ) 7 years followup radiograph showing good bone ingrowth on femoral and acetabular implants without osteolysis or radiolucent line . secur - fittm ( stryker osteonics , new jersey , usa ) acetabular shell and wagner cone prosthesis stem ( zimmer , winterthur , switzerland ) were used with alumina biolox forte ( ceram tec , plochingen , germany ) liner and head . the surgery was performed without greater trochanter osteotomy ( a ) preoperative teleoroentgenogram showing pelvis right side tilting and right knee varus deformity with severe joint space narrowing . ( b ) teleoroentgenogram after 7 years right total hip arthroplasty showing improved pelvic tilt and it shows right total knee arthroplasty which was performed 3 years after right total hip arthroplasty at another hospital postoperatively , the hip joint was maintained in abduction brace . the drain was removed when blood collected was < 100 ml over 24 h. on day 1 , quadriceps strengthening exercises and ankle rom exercises were started on second postoperative day the hip joint was gradually placed in a more neutral position and partial weight bearing was allowed using 2 crutches . outcomes measured in this study were intraoperative blood loss , preoperative and postoperative harris hip scores ( hhs ) , patient 's subjective satisfaction , the ability to sit cross legged . subjective satisfaction was assessed preoperatively and postoperatively by asking them to classify their hip function as excellent , good , moderate or dissatisfied . radiological outcomes , in addition to the standard measures of anteversion of the acetabular cup , lateral opening angle and axis of the femoral stem were assessed for the following criteria . to measure lateral opening angles and acetabular cup anteversions , we used the method described by sah and estok16 and to measure amounts of leg lengthening , we measured vertical distance changes of greater trochanter tip or lesser trochanter from the horizontal line bisecting both inferior margins of tear drops on both hip anteroposterior radiographs . if the anatomical landmark of the greater trochanter or lesser trochanter is not visible on radiographs , we measure the difference of distance from hip joint center to the center of the knee joint on teleoroentgenogram . seoul , south korea ) allowed measurements of angles and lengths , accurate to two decimal points after compensating for magnification , which were then rounded off . the engh et al.17 classification of femoral stem fixation , the gruen et al.18 classification of femoral stem osteolysis and the callaghan et al.19 classification of stem subsidence were used to evaluate femoral stem stability . furthermore , to evaluate acetabular components , we used the delee and charnley20 classification of acetabular osteolysis . heterotopic ossification was evaluated according to the system of brooker et al.21 statistical analysis was performed using the mann mean duration of surgery was 178.6 min ( range 65250 min ) , with mean total blood loss of 1420.1 ml ( range 6301700 ml ) . the preoperative hhs was 42.4 ( range 21.079.0 ) , which improved to 84.2 ( range 75.098.0 ) at last followup ( p < 0.05 ) . this correlated with patient 's subjective satisfaction , with 14 patients ( 15 hips [ 58.6% ] ) answering excellent , 6 patients ( 7 hips [ 20.6% ] ) answering good , 2 patients ( 2 hips [ 13.8% ] ) answering moderate and 1 patient ( 1 hip ) dissatisfied . in terms of the ability to sit cross - legged , 12 patients ( 13 hips [ 48.4% ] ) said they were comfortable , 5 patients ( 5 hips [ 19.4% ] ) said possible with mild discomfort , 4 patients ( 5 hips [ 19.4% ] ) said possible with moderate discomfort and 2 patients ( 2 hips [ 12.9% ] ) responded that it was impossible . limb length discrepancy was optimized from 51 mm ( range 372 mm ) preoperatively to 9 mm ( range 029 mm ) postoperatively with a mean correction of 36.6 mm ( range 050 mm ) . radiological evaluation showed mean anteversion of the acetabular cup was 18.1 ( range 4.630.1 ) and the mean lateral opening angle was 32.8 ( range 16.547.1 ) . the femoral stem was placed in varus 0.4 ( range varus 3.2valgus 2.2 ) on average . there was no migration of the acetabular cup , change in slope or migration of the femoral stems in any case . focal osteolytic change was observed in 1 patient ( 3.2% ) adjacent to the acetabular cup , but not on the femoral stem . heterotopic ossification was observed in 3 hips with type i in 2 and type ii in 1 . two postoperative complications were seen in one patient : posterior dislocation of the hip joint and transient femoral nerve palsy . more specifically , there was no femoral stem loosening , ceramic breakage , infection , deep vein thrombosis or pulmonary thromboembolism . there was one patient who complained of squeaking , but the sound was not audible . total hip arthroplasty for fused hips was performed in 1970s and subsequently successful surgical reconstruction of arthrodesed hip with total joint arthroplasty has been reported.1222 tha helped these patients to improve activities of daily living and they felt overall satisfaction.4101123 fused hip secondary to diseases , such as pyogenic arthritis or childhood trauma , can cause adjacent soft tissue contracture and atrophy and makes surgical approach very difficult due to extensive scarring , fibrotic tissue and distortion of anatomical landmarks.1224 rutz et al.25 showed that tha after spontaneous ankylosis gave better functional outcomes as compared with conversion to tha after surgical fusion ( arthrodesis hip ) . strathy and fitzgerald26 reported in their study of 80 patients that failure rate for tha in spontaneous fused hip is 5% , while tha in surgical fused hips had a failure rate of 48.3% . in particular , increased failure rates were found in patients < 50 years of age or when tha was performed early after the onset of hip fusion.1327 this was attributed to the poor condition of hip abductors and the altered configuration of the bone , which led to poor positioning or poor fixation of the prosthesis , or both . it is known that patients with fused hip have weakened abductors compared with patients who undergo tha for other indications . the complications such as dislocation of tha and postoperative abnormal gait appear to be more common in this group.24 joshi et al.12 described almost 4 of 5 dislocations that occurred in patients who underwent the arthrodesis before the age of 15 years . the functional score , as judged by walking ability , was found to be slightly better in the group of patients who were older than 15 years at the time of arthrodesis . an associated underdevelopment of the greater trochanter and abductor muscle may lead to a poor functional outcome . a noteworthy result in this study is that only 3 patients underwent greater trochanteric osteotomy , to preserve the function of the abductors that were already atrophied . in previous studies of tha for fused hip , greater trochanteric osteotomy had been performed in most cases in order to gain adequate exposure.111228 furthermore , tha in fused hips is associated with an increased incidence of complications.413142930313233 dislocation has been reported as the most common complication in tha for hip fusion , occurring in 24.8% of cases.31 in this study , we have reported one case of dislocation and one case of transient femoral nerve palsy . the rate of dislocation in our series was 4% , which is slightly higher than that in the general population of patients managed with tha , but less than that reported in other studies on fused hips converted to tha.1314293031 despite difficult surgery , we attributed the relatively low rate of dislocation to the excellent exposure , which allows the osseous bed to be prepared and the components to be implanted in optimum orientation and at the correct anatomical level , restoration of proper soft tissue tension by a minimally invasive approach and careful rehabilitation of the abductor muscles in our study . the patient who suffered dislocation post tha for fused hip had a 90 flexion contracture preoperatively and the dislocation was treated by closed reduction under radiological guidance . we suspect that the dislocation occurred due to the severity of soft tissue deficiency , severe bone deformity and persistent 60 flexion state with inadequate physiotherapy after surgery . a hip abductor orthosis , limiting hip flexion and adduction , may have prevented dislocation in this patient . in the same patient , although there was no nerve injury during the operation , extensive soft tissue injury may have occurred during the operation causing edema or hematoma in the adjacent soft tissue , causing transient nerve palsy . it is reported that the complication rate is up to 7% for femoral nerve or sciatic nerve palsy.1231 the etiology of nerve palsy after tha is multifactorial.12 contributing factors include the distorted anatomy and scarring secondary to previous surgery , the inadvertent misplacement of retractors and the use of traction to gain exposure . even though , the use of somatosensory - evoked potential monitoring during surgery has been reported to reduce the prevalence of nerve injury by some operators,31 we performed sciatic nerve exploration during surgery instead of use of monitoring . postoperative identification and early management of femoral or sciatic nerve palsies is of utmost importance after tha for fused hip [ table 3 ] . comparison of the other author 's results of total hip arthroplasty in ankylosed hip related complications have been reported in mop soft bearings in long term followup.78 we have used a coc surface commonly used in tha for other indications and we anticipate avoiding complications associated with erosion of the articular bearing surface . this is especially the case given that the use of coc bearings is considered as an effective way to prolong the life of the artificial prosthesis in tha for other indications such as osteoarthritis and osteonecrosis of the femoral head . recently , there are reports about the long term good results of coc bearing10 and even in a young patients , coc produced good results without visible wear . however , longer term followup is required to determine the presence of prosthesis related complications and lifespan of the prostheses infused hip . overall , there are many factors that may influence the outcomes reported in this study , including the use of minimally invasive two - incision approach , intra operative sciatic nerve exploration , the use of hard bearings and postoperative rehabilitation . further research into above mentioned areas and longer followup of our patients is necessary in order to further validate the use of tha with coc bearings for fused hip . to conclude tha for fused hip presents a variety of technical difficulties when compared to traditional tha . however , we report that it can be an effective treatment in the hands of a well trained hip surgeon with low complication rates .

background : most literature in the field of total hip arthroplasty ( tha ) for fused hips , until date has reported the results of using metal on polyethylene and ceramic on polyethylene bearings . results of tha using ceramic on ceramic ( coc ) bearings in fused hips have not been published in literature . this study reports the results of cementless tha using coc articulation perfomed in fused hips.materials and methods : twenty - three patients ( 25 hips ) with fused hips underwent conversion to tha using coc bearings and were followed up for a mean 5.4 years . the conventional posterolateral approach was used in 15 hips , a modified two incision technique in 7 hips and a direct lateral approach with greater trochanteric osteotomy in 3 hips . postoperatively , range of motion exercises were encouraged after 23 days of bed rest and subsequent gradual weight bearing using crutches was begun.results:mean harris hip score improved from 42.4 to 84.2 and mean leg lengthening of 36.6 mm was achieved . in the average 5.4 years ( range 2.8 - 9.1 years ) followup there were no cases with osteolysis around acetabular cup and femoral stem . in this study , there was no case of ceramic fracture . there was one case of squeaking.conclusion:this study suggests that cementless tha performed for fused hips with coc bearings can provide good early clinical results .

parkinson 's disease ( pd ) is a progressive , complex disorder characterized by motor symptoms ( bradykinesia , rigidity , resting tremor , and postural instability ) as well as a wide range of nonmotor symptoms ( nms ) that contribute to significant morbidity and disability [ 1 , 2 ] . it is important to identify those nms that most influence the patient 's life , since they may not be evident during the clinical examination . nms like depression , anxiety , cognitive decline , pain , fatigue , insomnia , and autonomic dysfunction ( constipation , urinary symptoms ) are significant factors that diminish health - related quality of life ( hrqol ) of individuals with pd [ 46 ] . while common , they are still often underrecognized in clinical practice because patients fail to spontaneously mention them , and healthcare professionals also fail to systematically ask about them [ 5 , 7 ] . some symptoms , for example , olfactory deficit , constipation , rapid - eye movement sleep behavior disorder , and depression , can even precede the appearance of motor symptoms by many years . most of the pd - associated nms are believed to be caused by the nondopaminergic systems , in accordance with the hypothesis that other neurotransmitters including serotoninergic , noradrenergic , and cholinergic transmission are involved . however , in a recent study on advanced pd subjects , storch and coworkers showed that seven out of ten selected nms ( with the exception of dysphagia , excessive sweating , and bladder urgency ) fluctuated in conjunction with motor symptom fluctuations . moreover , they were also more frequent and more severe in off than in the on state . this evidence indicates that any optimization of dopaminergic therapies must also address the management of nms . in light of the above facts , our study aimed to determine the impact of nms on hrqol in a cohort of central european pd patients from the slovak republic who were already on dopaminergic medications . we hypothesized that the involvement of individual nms domains would differ depending on the disease stage . therefore , special emphasis was placed on a comparison of early - stage and advanced - staged pd patients . one hundred consecutive patients with idiopathic pd diagnosed according to the uk parkinson 's disease society brain bank criteria were recruited from two specialized movement disorder units of tertiary centers . all subjects gave their informed written consent in accordance with the declaration of helsinki , and the local ethics committee approved the study protocol . patients with mild cognitive impairment were included if their informed written consent could be obtained and they were able to complete clinimetric questionnaires alone or with the help of their caregiver . all patients had been on dopaminergic therapy with levodopa ( plus dopa decarboxylase inhibitor ) and/or dopamine agonists for at least 3 months . untreated subjects or those on advanced therapies like deep brain stimulation , subcutaneous apomorphine pump , or intrajejunal levodopa infusion pump were not included . for analysis the patients were divided into early - stage ( es ) and advanced - stage ( as ) groups on the basis of the modified hoehn and yahr score ( h&y ) , the cut - off of 2.5 , and a history of late complications of levodopa therapy . six patients were classified in h&y1 , 1 in h&y1.5 , 31 in h&y2 , and 9 in h&y2.5 ( es subjects ) . forty - five people were in h&y stage 3 , 7 in h&y4 , and 1 in h&y5 ( as patients ) . dopaminergic therapy load was expressed in terms of levodopa equivalent daily dose ( ledd ) . each person was in the state in which parkinson motor symptoms were best controlled during assessment . validated slovak translations of the following screening and diagnostic instruments were applied : the parkinson 's disease questionnaire with eight dimensions ( pdq-8 ) , health - related quality of life measure , a summary index ( pdq-8 si ) which was used for statistical analysis , the nonmotor symptoms screening questionnaire ( nmsquest ) , a 30-item tool , which records the presence or absence of nonmotor symptoms , the nonmotor symptom assessment scale for parkinson 's disease ( nmss ) , a 30-item scale for assessing nms , which covers nine dimensions : cardiovascular , sleep / fatigue , mood / apathy , perceptual problems , attention / memory , gastrointestinal , urinary , sexual function , and miscellaneous . the parkinson 's disease questionnaire with eight dimensions ( pdq-8 ) , health - related quality of life measure , a summary index ( pdq-8 si ) which was used for statistical analysis , the nonmotor symptoms screening questionnaire ( nmsquest ) , a 30-item tool , which records the presence or absence of nonmotor symptoms , the nonmotor symptom assessment scale for parkinson 's disease ( nmss ) , a 30-item scale for assessing nms , which covers nine dimensions : cardiovascular , sleep / fatigue , mood / apathy , perceptual problems , attention / memory , gastrointestinal , urinary , sexual function , and miscellaneous . questionnaires pdq-8 and nmsquest were completed by patients ( with the aid of caregivers if necessary ) while waiting to be seen by a neurologist . clinical and demographic variables of both groups of pd patients were compared by student 's t - test ( p < 0.05 ) . the kolmogorov - smirnov test showed that not all data were normally distributed , so spearman 's rank correlation coefficient ( rho ) was used to evaluate the association between pdq-8 and demographic and clinical variables , nmsquest score , nmss total score , and nine different nmss domains . the strength of the association for correlation coefficients was interpreted as follows : 0.19 , negligible ; 0.20 to 0.39 , weak ; 0.40 to 0.59 , moderate ; 0.60 to 0.79 , strong ; and 0.80 , very strong . compared to es patients , as subjects had significantly higher scores on the pdq-8 , nms - quest ( number of nms ) , and nmss ( table 1 ) . the average declared number of nms in all 100 patients was 11.3 ; the average number in es was 9.6 , and in as 12.8 . table 2 presents the correlations found between quality of life measure pdq-8 and selected variables of interest . the evaluation of all 100 patients showed a weak correlation with the duration of pd and nmss cardiovascular aspects , nmss sleep / fatigue , nmss / perceptual problems , nmss / gastrointestinal aspects , and nmss / miscellaneous . the h&y score , nmsquest , nmss total , nmss mood / apathy , and nmss attention / memory domain revealed correlations , which were moderate to strong . the as group had a pdq-8 score that correlated moderately with nmsquest , nmss total , and nmss sleep / fatigue scores . weak correlations were found for nmss cardiovascular , nmss mood / apathy , and nmss attention / memory domains . although nms greatly influence the hrqol of pd patients , more than 50% of existing nms are not identified in clinical practice . the prevalence of overall nms in our cohort of 100 pd subjects on dopaminergic drugs was 11/30 . [ 3 , 5 , 15 , 16 , 18 ] according to the nmsquest ( evaluation of prevalence ) and nmss ( frequency severity ) the nonmotor symptoms were significantly associated with poor hrqol across the entire clinical spectrum of pd . this finding agrees with the proposal to consider the frequency and severity of nonmotor symptoms as a whole to be the most important predictor of hrqol in pd . surprisingly , separate evaluation of nmss domain correlation profiles for early - stage and advanced - stage groups did not reveal any fundamental differences ; however , the degree of the association with hrqol differed . the neuropsychiatric domains attention / memory and mood / apathy correlated moderately to strongly with hrqol in the es group , while hrqol was moderately related to the sleep / fatigue domain in the as group . other weak but still significantly correlating domains were sleep / fatigue in es and cardiovascular aspects , attention / memory , and mood / apathy in as . our data are thus in line with previous studies reporting that fatigue , sleep disturbances , apathy , and mood are independent determinants of hrqol [ 35 , 1922 ] . as our subjects had been optimally tuned up with dopaminergic therapy ( according to the clinicians ' impressions ) and fluctuating patients were assessed in their optimal on state , we can assume that nondopaminergic lesions influenced their hrqol the most . an important limitation of our study is that the most advanced phases of disease were underrepresented . other drawbacks are the absence of severity measures for motor symptoms , like updrs motor score , to determine the impact of motor system involvement , and the fact that special attention was not given to nondopaminergic add - on therapies , for example , antidepressants , hypnotics , cognitives , and laxatives . in conclusion , our data confirm that nms are very common and significantly influence hrqol even in pd patients on dopaminergic therapy . these observations indicate that systematic , active screening for nms and above all therapeutic strategies for neuropsychiatric disorders ( mood , cognition , sleep , and fatigue ) are urgently required both at the initial diagnosis of pd and across the entire disease course . further studies are needed to investigate how to improve the hrqol of pd patients and relieve their nms .

to determine the impact of nonmotor symptoms ( nms ) on health - related quality of life ( hrqol ) we examined 100 parkinson 's disease ( pd ) patients on dopaminergic medications . an early - stage ( es ) and an advanced - stage ( as ) groups were formed . hrqol was established by the questionnaire pdq-8 , number of nms by nmsquest , and severity and frequency of nms by the assessment scale nmss . the total nms averaged 11.3 ( es = 9.6 , as = 12.8 ) . the nmss domain correlation profiles for es and as did not fundamentally differ ; however , the domains attention / memory and mood / apathy correlated moderately to strongly with hrqol in es , while the sleep / fatigue domain correlated moderately with hrqol in as . weakly correlating domains were sleep / fatigue in es and cardiovascular , attention / memory , and mood / apathy domains in as . in view of these findings we strongly recommend systematic , active screening and therapy for neuropsychiatric disorders ( mood , cognitive and sleep disorders , and fatigue ) at the initial diagnosis and throughout the entire course of pd .

quantum decoherence control has been studied intensively in recent years due to the fact that it represents one of the main obstacles in implementing quantum computation . however the problem of decoherence remains daunting . although there have been rapid advances in physical realization of quantum operations on few levels system in which a single qubit or few qubit can be embedded . the fidelity for those quantum operations , such as rabi rotation , is typically far below the threshold to make the system scalable . to increase the fidelity , many strategies are proposed to counteract the undesired effects resulting from decoherence . those strategies can be roughly divided into two categories , depended on if an encoding scheme is used . some prominent examples in which encoding is needed are the quantum error - correction codes ( qecc)@xcite and the decoherence - free subspace ( dfs).@xcite one of the main drawback of the encoding strategies is the large amount of ancillary space needed , especially when the qubit is still a rare resource . as a result , strategies which do not need ancillary systems is highly desirable . closed - loop decoherence control ( such as quantum feedback control @xcite ) and open - loop decoherence control ( such as bang - bang or dynamical decoupling @xcite ) fall into this category . the open - loop decoherence control typically requires only a limited , _ a priori _ , knowledge of the system - environment dynamics . empirical determination of control parameters via quantum tomography has also been proposed recently.@xcite in this work we will focus on the dynamical decoupling , but it is acknowledged that no single strategy can efficiently eliminated the problem of decoherence at all levels . combining or concatenating different strategies is usually necessary for any real physical system . in the original bang - bang decoupling framework , arbitrarily strong and instantaneous control pulses are utilized to induce frequent unitary interruptions during the evolution of the system . the control hamiltonian is independent of the system dynamics and are judicially designed to realize an effective decoupling between the system and the environment . the stringent requirement on the control hamiltonian represents a drawback of the bang - bang decoupling . experimentally it is impossible to implement arbitrarily strong and instantaneous pulses in real physical systems . an ultra strong and fast control pulse will also inevitably induce transitions to higher energy levels which are usually neglected in the analysis of the bang - bang decoupling . theoretically is difficulty to describe the evolution with and without control terms simultaneously . this also make it difficult to estimate the robustness of the control and to estimate the error induced by operational imperfections . the highly abstract group theory which is frequently used in the decoupling analysis also make it less intuitive and difficult to make transparent connection to the realization of bang - bang decoupling . to alleviate the need for strong and impulsive control actions , a dynamical decoupling using only bounded - strength hamiltonian is recently proposed.@xcite within this framework the same group symmetrization is achieved by exploiting the _ eulerian cycles on a cayley graph of @xmath1_,@xcite where @xmath1 is the decoupling group . on the other hand a complimentary , geometric perspective of bang - bang decoupling is recently proposed to provide a more intuitive picture and provide a method to estimate implementation errors.@xcite in this work we extend the geometric picture of bang - bang decoupling to the case of continuous decoupling with bounded controls . we show that the decoupling by symmetrization is equivalent to average out error vectors whose trajectories are determined by the control hamiltonians . the decoupling pulses can be intuitively designed by viewing the effect of control hamiltonian from a geometric perspective . to avoid confusing we will use the term _ bang - bang decoupling _ to refer to the typical decoupling scheme originally proposed.@xcite the term _ eulerian decoupling _ corresponds to the decoupling with bounded hamiltonian introduced by l. viola and e. knill@xcite , while the term _ continuous decoupling _ corresponds to the version of continuous decoupling from a geometric picture developed in this work . the structure of the paper is the following . in sec . [ sec : review ] we review the original bang - bang decoupling , the eulerian decoupling , and the geometric perspective of the bang - bang decoupling . in sec . [ sec : cdd ] we introduce the idea of continuous dynamical decoupling from a geometric perspective . in sec . [ sec : example ] several examples are given to illustrate how to construct the decoupling pulses . we summarize in sec . [ sec : summary ] . in general , dynamical decoupling seeks to eliminate the decoherence of an open quantum system by effectively averaging out the interaction between the system and the bath by introducing some strong periodic control hamiltonian on the system.@xcite following the standard treatment , the dynamics of an quantum open system is determined by the total hamiltonian @xmath2 where @xmath3 represents the system - bath interaction . now introduce a control hamiltonian @xmath4 acting on the system alone . denote @xmath5 the time - evolution operator associated with the control hamiltonian @xmath6 where @xmath7 is the time - ordering operator . in periodic dynamical decoupling one is restricted to the situation where the control field is _ cyclic _ , i.e. , @xmath8 for some period @xmath9 . for any state @xmath10 and any operator @xmath11 in schrdinger picture , the corresponding state @xmath12 and operator @xmath13 in the interaction representation associated with @xmath14 are : @xmath15 and @xmath16 where @xmath17 is the time - evolution operator associated with @xmath18 . it is easy to show that @xmath19 where @xmath20 . using the periodic condition @xmath21 one finds @xmath22 the _ stroboscopic _ dynamics at @xmath23 for integer @xmath24 is hence determined by the time evolution operator @xmath25 it is possible to define a k - th order average hamiltonian @xmath26 by applying the magnus expansion@xcite to @xmath27 , results in @xmath28t_c}.\ ] ] in particular we have @xmath29 and @xmath30.\ ] ] higher - order corrections can also be systematically evaluated . in the limit of @xmath31 , which is the ideal limit of bang - bang decoupling , @xmath32 becomes the dominant term . it can be viewed as an effective hamiltonian governing the stroboscopic dynamics under control hamiltonian . in the following we will focus on designing the effective hamiltonian @xmath32 . denote @xmath33 the finite - dimensional state space associated with the system . the idea of decoupling by symmetrization is to identify a discrete decoupling group @xmath34 , @xmath35 , acting on @xmath33 via a faithful , unitary , projective representation @xmath36 such that @xmath37 , the unitary matrices acting on @xmath33 . the bang - bang decoupling via @xmath1 is implemented by assigning @xmath38 with @xmath39 , and @xmath40 . with this assignment the effective hamiltonian @xmath32 becomes : @xmath41 where @xmath42 the nontrivial work is to identify the group @xmath1 such that for all @xmath43 the effective error operator @xmath44 where @xmath45 is a real number . once this is accomplished then the effective hamiltonian @xmath32 is reduced to @xmath46 as a result the system is effectively decoupled from the bath , or equivalently the decoherence is suppressed . note that in this formulation the underlying control hamiltonian is never explicitly mentioned . an instantaneous , arbitrary strong control hamiltonian is needed to implement the desired @xmath5 . however , physically it is impossible to implement such an instantaneous control pulse . an arbitrary strong control hamiltonian would also inevitably induce transition to higher energy states which are neglected when a two level approximation is used to describe the qubit space . those unphysical requirements represent some of the main drawbacks of the original bang - bang decoupling framework . in order to alleviate the unphysical requirements of the original bang - bang decoupling framework , l. viola and e. knill propose a general framework in which the same group symmetrization can be achieved while using only bounded control hamiltonians.@xcite physically it uses only bounded control hamiltonians to steer the time evolution operator . mathematically it exploits the eulerian cycles on a cayley graph@xcite of the decoupling group @xmath1 . given a decoupling group @xmath1 , the first step in implementing eulerian decoupling is to find a generating set @xmath47 , for the decoupling group @xmath1 . the physical implementation requirement is the ability to generate @xmath48 by some control hamiltonian @xmath49 over a period of time @xmath50 , @xmath51 if we image each group element @xmath52 as a vertex , then @xmath48 can be imaged as the directional , colored edge connecting the vertices . if @xmath53 , then we draw a line from point @xmath54 to pint @xmath55 with color @xmath56 . an eulerian cycle is defined as a cycle that uses each edge exactly once . in this case , one can show that it is always possible to find eulerian cycle , having length @xmath57 . @xcite a well - defined eulerian cycle beginning at the identity @xmath58 of @xmath1 can be uniquely specified by the sequence of the edge colors used , @xmath59 , where @xmath60 . an eulerian decoupling is then implemented by letting @xmath61 and by assigning @xmath5 as follows : @xmath62=u_l(s)u_c[(l-1)\delta t],\ ] ] where @xmath63 , and @xmath64 , @xmath65 . in this way the average hamiltonian @xmath32 becomes : @xmath41 where @xmath66 it can be shown that the same decoupling can be achieved through this average.@xcite assuming that @xmath50 remains the same as in the eulerian decoupling , the length of the eulerian decoupling is lengthened by a factor of @xmath67 compared to the bang - bang decoupling . eulerian decoupling provides a guideline to design the control hamiltonian if the decoupling group and it s representation is known . however the search for the decoupling group remains a nontrivial work . bang - bang decoupling and eulerian decoupling schemes make heavy use of the abstract group theory . in recent years a complementary geometric perspective is developed to provide a more intuitive picture.@xcite the geometric picture of the bang - bang decoupling utilities the homomorphic mapping between the lie group @xmath0 and @xmath68 , where @xmath69 . let @xmath70 , @xmath71 be the @xmath24 traceless , hermitian generators of @xmath0 . the generators @xmath72 satisfy trace - orthogonality , @xmath73 where @xmath74 is a normalization constant . for any group element @xmath75 , one can define a rotation @xmath76 via @xmath77_{ij } \lambda_j.\ ] ] this defines a homomorphism from @xmath0 to a subgroup of @xmath68 . without loss of generality , one can re - write @xmath78 as @xmath79 where @xmath80 is traceless . note that the first term @xmath81 only gives rise to an overall phase and can be discarded . for simplicity ( and without loss of generality ) we will write @xmath82 , where @xmath83 is traceless . any traceless system operator @xmath84 can be expanded in terms of @xmath85 , yielding : @xmath86 where @xmath87 in other word , a traceless system operator can be represented by a @xmath24-dimensional vector . using this result the system - bath hamiltonian @xmath88 can be written as follows : @xmath89 where @xmath90 is a vector of length @xmath24 . in the following we should refer @xmath90 as error vectors . by using error vectors to represent the system - bath hamiltonian @xmath88 , the decoupling by symmetrization over a group @xmath1 with projective representation @xmath91 can be viewed as an average over rotated error vectors . following this line the average hamiltonian @xmath32 becomes @xmath92_{ij } \lambda_j \otimes b_\gamma \\ & = & \nonumber \sum_\gamma \sum_j \left\ { \frac{1}{|\mathcal{g}| } \sum_{g\in \mathcal{g } } \sum_i r^\dagger[\mu(g)]_{ji } ( \vec{s}_\gamma)_i \right \ } \lambda_j \otimes b_\gamma \\ & = & \nonumber \sum_\gamma \left ( \vec{s^\prime}_\gamma \cdot \vec{\lambda } \right ) \otimes b_\gamma,\end{aligned}\ ] ] where the average error vector @xmath93 is equal to @xmath94_{ji } ( \vec{s}_\gamma)_i = \frac{1}{|\mathcal{g}| } \sum_{g\in \mathcal{g } } r^\dagger[\mu(g ) ] \vec{s}_\gamma .\ ] ] from the geometric perspective the decoupling condition ( in case of quantum memory ) is equal to require that the average error @xmath90 be zero for all @xmath43 . geometrically each term in group symmetrization procedure corresponds to an effective rotation @xmath95\in o(n)$ ] on all error vectors . however it is evident that the error vector can be averaged to zero by a set of rotations which do not correspond to the representation of some decoupling group . it is thus intriguing to discuss if a underlying group structure is necessary to achieve dynamical decoupling . the geometric picture of the bang - bang decoupling is intuitive but it shares the same drawback as the bang - bang decoupling , i.e. , the error vector is instantaneously rotated to another vector by some rotation . this drawback can be alleviated if a bounded control hamiltonian is used to continuously rotate the error vector . we thus seek to formulate a framework for continuous dynamical decoupling from a geometric perspective . recall that the average hamiltonian has the following expression @xmath96 now instead of piecewisely mapping @xmath5 into the representation of some decoupling group , one represents the effective system operator @xmath97 by its corresponding average error vector @xmath93 . the average error vector can be expressed as the time average over the trajectory of the error vector rotated by @xmath98 $ ] : @xmath99_{ij } \lambda_j \\ & = & \nonumber \sum_j \left\ { \frac{1}{t_c } \int_0^{t_c } du \sum_i r^\dagger[u_c(u)]_{ji}(s_\gamma)_i \right\ } \lambda_j \\ & = & \nonumber \vec{s^\prime}_\gamma \cdot \vec{\lambda},\end{aligned}\ ] ] where @xmath100_{ji}(s_\gamma)_i .\ ] ] or using vector notation : @xmath101 \vec{s}_\gamma.\ ] ] the decoupling condition ( in case of quantum memory ) is to require @xmath102 for all @xmath43 . note that we do nt explicitly require that @xmath103 be the representation of some group . in order to make the design of control hamiltonian easier it is desirable to make a more transparent connection between the decoupling and the control hamiltonian . first define a time - dependent error vector via @xmath104 the @xmath105-th component of @xmath106 can be expressed as @xmath107 it is instructive to study the trajectory of @xmath106 when the control hamiltonian is proportional to one of the generators of @xmath0 . assuming that @xmath108 , where @xmath109 represents the envelope function of the control pulse , one finds @xmath110 \right\ } \\ & = & \nonumber i a_l(t ) \sum_j s_j(t ) \mathrm{tr } \left\ { \lambda_i i\sum_k f_{ljk}\lambda_k \right\ } \\ & = & \nonumber i a_l(t ) \sum_j i f_{lji } s_j(t ) \equiv -i a_l(t ) \left[l_l\right]_{ij } s_j(t),\end{aligned}\ ] ] where we have defined @xmath111_{ij}=-if_{lji}=+if_{lij},\end{aligned}\ ] ] and @xmath112 is the structure function of @xmath0 . from the @xmath113 point of view , the effect of control hamiltonian @xmath114 is to induce a rotation with generator @xmath115 and with speed @xmath109 . it is thus useful to express @xmath116 in terms of the natural generators of @xmath68 . the natural generator of @xmath68 are antisymmetric hermitian matrices @xmath117 where @xmath118 , whose components have the form @xmath119_{ij}=-i(\delta_{\mu i}\delta_{\nu j}-\delta_{\mu j}\delta_{\nu i}).\ ] ] we will restrict ourself to @xmath120 as a convention and to avoid double counting . they satisfy the commutation relation @xmath121 \\ & = & \nonumber -i\left ( \delta_{\mu \nu^\prime } l_{\nu \mu^\prime } -\delta_{\mu \mu^\prime } l_{\nu \nu^\prime } + \delta_{\nu \nu^\prime } l_{\mu \mu^\prime } -\delta_{\nu \mu^\prime } l_{\mu \nu^\prime } \right),\end{aligned}\ ] ] and the trace orthogonality condition @xmath122 giving a control hamiltonian of the form @xmath123 , in the geometric picture it corresponds to a time independent rotation generator @xmath115 and an time - dependent envelope function @xmath109 representing the time dependent speed of the rotation . by expressing @xmath115 in terms of the natural generators of @xmath68 @xmath124 a compact notation of the form @xmath125= \left(\sum_{\mu \nu } x_{\mu \nu } l_{\mu \nu}\right)\vec{\lambda}\ ] ] can be used to represent the effect of control hamiltonian @xmath126 . for example , for @xmath127 one has @xmath128= \left(-l_{12}+l_{45}+l_{76}\right)\vec{\lambda}.\ ] ] it immediately leads us to the conclusion that @xmath129 can be used to average any vector in the 1 - 2 plan to zero with appropriate envelope function . in the appendix we explicitly calculate the @xmath130 $ ] for @xmath131 , and @xmath132 . using the continuous decoupling from a geometric perspective , the design of the decoupling pulse sequences can be outlined as follows : the first step is to find the corresponding error vectors from the system - bath hamiltonian . the second step is to identify the useful control hamiltonian @xmath126 . the third step is to design a proper envelope function @xmath133 to ensure the average error vector to be zero . continuous decoupling is robust against implementation imperfection because a small implementation error on the control hamiltonian will only result in a small deviation of the average error vectors from their ideal values . the implementation error can be evaluated via the distance between the ideal average error vector and the real average error vectors . let @xmath134 be ideal average error vectors resulted from a perfect control hamiltonian while @xmath135 be the real average error vectors resulted from a imperfect control hamiltonian . the euclidean distance between two vectors @xmath136 can be used to quantify the implementation error . in this section we study several examples which illustrate the basic idea of continuous decoupling from geometric perspective . consider a single qubit with a single error operator , @xmath137 . in geometric picture it corresponds to a single error vector @xmath138 . intuitively , performing any @xmath139 rotation in a plan containing the error vector @xmath140 should average the error vector to zero . using the results in the appendix it is easy to verify that one can choose the control hamiltonian to be proportional to @xmath141 or @xmath142 . from the geometric perspective , this corresponds to rotate the error vector in @xmath143-@xmath144 or @xmath145-@xmath144 plan using @xmath146 generator @xmath147 or @xmath148 . if we were to choose @xmath149 and assume that @xmath150 , the time - dependent error vector becomes @xmath151 where @xmath152 . the decoupling condition can be written as @xmath153 the decoupling condition can be satisfied very generally by requiring that @xmath154,\ ] ] and @xmath155 where @xmath156 $ ] represents a @xmath157 rotation around @xmath145-axis . geometrically this corresponds to rotate the error vector from @xmath140 to @xmath158 at some speed controlled by @xmath133 , and rotate it back to @xmath140 with the same speed profile . the first condition ensures that the error vector is steered to @xmath158 at half time @xmath159 . the second condition ensures that the contribution from the second half cancels exactly the contribution from the first half , resulting in zero average error vector . it is known that the minimal decoupling group of bang - bang decoupling in this case is the group @xmath160 where @xmath161 . it is also referred as parity kick in the literature . the corresponding representation can be chosen to be either @xmath162 or @xmath163 . from the geometric picture the effect of @xmath164 is to rotate error vector @xmath140 instantaneously to @xmath158 , ensuring the average error vector be zero . it is easy to show that a larger group @xmath165 , where @xmath166 , can achieve the same decoupling . the corresponding representation is @xmath167 where @xmath168 is the @xmath169 rotation along x - direction . from the geometric picture this corresponds to rotate the error vector by @xmath169 at each kick . from the typical bang - bang decoupling point of view larger decoupling group represents a less optimal decoupling scheme since more kicks are needed . on the other hand when viewed as the limiting case of the continuous decoupling , @xmath170 bang - bang decoupling corresponds to require a large amplitude @xmath133 for small @xmath171 and turn @xmath133 off once the error vector @xmath140 is steered to @xmath158 . a different @xmath133 can be similarly designed to reproduce the @xmath172 bang - bang decoupling . however in any real physical implementation there is a upper limit for the strength of @xmath133 . hence there is a minimal time needed to finish one continuous decoupling cycle and the ideal limit of bang - bang decoupling is never reached . it is this minimal @xmath9 , not the order of the decoupling group , when compared to the decoherence time , indicates the efficiency of the decoupling scheme . consider next a single qubit with all possible error operators , @xmath173 . in geometric picture they correspond to three error vectors @xmath174 , @xmath175 , and @xmath176 . intuitively a @xmath139 rotation in a plan containing both the vectors @xmath177 and @xmath178 can average both error vectors to zero , but @xmath179 will remain unchanged . however it is possible to design a sequence which average all three error vectors to zero . to see how such a pulse sequence can be constructed , first recall that in previous example the vector @xmath180 must reach @xmath181 during the decoupling operation . we thus seek to rotate @xmath182 to @xmath181 using alternating generators , in hope that the residual errors will cancel each other when a full decoupling cycle is finished . using this idea it is straightforward to construct and verify that a sequence of @xmath157 rotations using following generators @xmath183 can average all three error vectors to zero . in fig.[fig : single qubit ] we plot the trajectories of three error vectors during the decoupling sequence . it is evident from the figure that a judicial envelope function will ensure that all time integrals of error vectors are zero . the decoupling pulse sequence designed here is equivalent to the eulerian decoupling prescribed in ref . however as pointed out in previous example the efficiency consideration should be based on the continuous decoupling framework . in ref , an example is given to demonstrate that a decoupling group may not be necessary to achieve the decoupling condition . from the geometric picture of the bang - bang decoupling it suffices to rotate instantaneously the error vectors to the vortices of a tetrahedron . from continuous decoupling point of view it is evident that for this kind of decoupling sequences the residual errors will accumulate when the error vectors are rotated from one vertex to another . it is difficult to cancel these residuals systematically using a design similar to what has been done in this example . even if it is accomplished , it would represent a less optimal solution . we thus argue that a decoupling group is not necessary to achieve continuous dynamical decoupling but a decoupling group usually provides a guideline to design the optimal continuous decoupling sequence . ] next example consists of a two qubit system with independent dephasing error operators . the system - bath hamiltonian has the form : @xmath184 the hamiltonian corresponds to two error vectors @xmath185 and @xmath186 . any rotation in @xmath187 which can rotate both error vectors by @xmath139 should effectively decouple the system from the dephasing error . in many solid - state qubit , heisenberg exchange is utilized to implement quantum operations . it is thus advantageous to design a decoupling sequence which is compatible with heisenberg exchange interaction . in terms of pauli matrices the heisenberg interaction is written as @xmath188 in other words the heisenberg interaction corresponds to three vectors @xmath189 , @xmath190 , and @xmath191 from the geometric perspective . a decoupling sequence compatible with heisenberg interaction should average error vectors to zero while leave those three vectors in tact . using the results in the appendix it is apparent that one should avoid using the generators @xmath192 , @xmath193 , and @xmath194 which either ca nt average error vectors to zero or have undesirable side effects on heisenberg interaction . this leaves us to the only choice of @xmath195 , @xmath196 , and @xmath197 . it is then easy to verify that any one of those three generators can be used as the control hamiltonian to average out the dephasing error with an appropriately designed envelope function @xmath133 while leaves the heisenberg interaction in tact . our final example consists of a three level system in which the first two levels @xmath198 are used as the qubit space while the third level @xmath199 is used as an ancilla level used to implement quantum operation in qubit space . we assume that all three levels are coupled to the environment , with the following system - bath hamiltonian : @xmath200 this system - bath hamiltonian corresponds to three error vectors @xmath201 , @xmath202 , and @xmath203 . by consulting the @xmath204 mapping in the appendix it is easy to show that all three error vectors can be averaged to zero via the generator @xmath205 . this simple example illustrates that the continuous dynamical decoupling from geometric perspective can be straightforwardly applied not only to the logical qubit space but also the physical qubit space or the larger space in which the physical qubit space is embedded in . in summary we have developed a continuous dynamical decoupling framework from a geometric perspective . within this framework , the need to perform unphysical , arbitrarily strong and fast control is eliminated , and bang - bang control can be viewed as a unphysical limit of the continuous decoupling in which the control hamiltonian is unbounded . the decoupling condition is equal to require that all time - dependent error vectors @xmath90 average to zero at the end of the decoupling cycle . the trajectories of the error vectors are steered by the control hamiltonian . by expressing control hamiltonian in terms of the generators of @xmath0 , the geometric picture provides an intuitive way to design the decoupling pulse sequences , provided that the structure function of the corresponding @xmath0 is known . several examples are given to explicitly illustrate how to design the decoupling sequences starting from a given system - bath hamiltonian . we also show that , in stead of the order of the decoupling group , the minimal time needed to finish one continuous decoupling cycle . the framework is not restricted to physical qubit space or logical qubit space . the ancilla levels or other relevant nearby levels can be naturally included in the analysis . this is important especially when ancilla levels are needed to perform quantum operation or when the nearby levels can not be neglected . the paper has focused on designing the decoupling pulses which are ideal for quantum memory . less is addressed about how to perform quantum operation and decoupling at the same time . the continuous decoupling framework developed in this work can be extended to systematically treat this problem.@xcite . the detail of the analysis is beyond the scope of this work and will be presented elsewhere . it is also intriguing to discuss the issue of optimal control . in a typical bang - bang decoupling framework a decoupling group is identified , assuming that the corresponding time evolution operators can be implemented . however in real system the possible control hamiltonian at our disposal might be limited and the desired time evolution operators might not be achievable . it is thus nature to ask the complementary questions : giving a set of possible control hamiltonian , what is the optimal decoupling sequence ? the geometric continuous decoupling framework developed here is suitable to answer this question . as a simplest example consider the case where some of the generators of @xmath0 can not be used as the control hamiltonian . in this case one can use the remaining generators and their corresponding rotations to construct a ( sub)-optimal decoupling sequence . recently there has been efforts to unify the dynamical decoupling and the quantum zeno effect.@xcite roughly speaking bang - bang control and quantum zero effect both require a strong interaction with a quantum system . this idea shared by two scheme leads to the possible unification . it is thus very interesting to see if the continuous decoupling scheme in which the arbitrarily strong pulses are not necessary can still be connected to the quantum zeno effect . in this appendix we explicitly calculate the correspondence between the generators of @xmath0 and the natural generators of @xmath68 where @xmath69 using the procedure outlined in sec [ sec : cdd ] . we adapt the following convention for the natural generators of @xmath68 : @xmath119_{ij}=-i(\delta_{\mu i}\delta_{\nu j}-\delta_{\mu j}\delta_{\nu i}),\ ] ] where @xmath120 . note that the choise of the generators of @xmath0 is not unique . unitary transformation on a set of generators results in another set of generators . however this only amounts to an rotation on error vectors and the basis vectors of @xmath68 . let @xmath207 , @xmath208 , and @xmath209 be the 3 generators of @xmath206 . they satisfy the trace - orthogonality @xmath210 it is easy to verify that @xmath211=+4l_{23 } \vec{\lambda } , \\ & & [ \lambda_2 , \vec{\lambda}]=-4l_{13 } \vec{\lambda } , \\ & & [ \lambda_3 , \vec{\lambda}]=+4l_{12 } \vec{\lambda}.\end{aligned}\ ] ] they satisfy the trace - orthogonality @xmath210 using this set of generators one can verify the following relations @xmath217=(+4l_{23}+2l_{47}+2l_{65 } ) \vec{\lambda } , \\ \nonumber & & [ \lambda_2,\vec{\lambda}]=(-4l_{13}+2l_{46}+2l_{57 } ) \vec{\lambda } , \\ \nonumber & & [ \lambda_3,\vec{\lambda}]=(+4l_{21}+2l_{45}-2l_{76 } ) \vec{\lambda } , \\ \nonumber & & [ \lambda_4,\vec{\lambda}]=(-2l_{62}-2l_{71}-2l_{53}-2\sqrt{3}l_{58 } ) \vec{\lambda } , \\ \nonumber & & [ \lambda_5,\vec{\lambda}]=(+2l_{16}+2l_{34}-2l_{72}-2\sqrt{3}l_{84 } ) \vec{\lambda } , \\ \nonumber & & [ \lambda_6,\vec{\lambda}]=(-2l_{24}+2l_{37}+2l_{51}+2\sqrt{3}l_{78 } ) \vec{\lambda } , \\ \nonumber & & [ \lambda_7,\vec{\lambda}]=(+2l_{14}+2l_{25}-2l_{63}-2\sqrt{3}l_{86 } ) \vec{\lambda } , \\ \nonumber & & [ \lambda_8,\vec{\lambda}]=(+2\sqrt{3}l_{45}+2\sqrt{3}l_{67 } ) \vec{\lambda}.\end{aligned}\ ] ] for @xmath0 where @xmath218 is a power of 2 , it is convenient to use the product of pauli matrices to form the generator of @xmath0 . we hence use the following assignment for the generators of @xmath132 : by matrix manipulation one can verify that the following relations holds @xmath221= \left ( + 8l_{2,3}+8l_{10,13}+8l_{11,14}+8l_{12,15 } \right)\vec{\lambda } \\ & & [ \lambda_2,\vec{\lambda}]= \left ( -8l_{1,3}-8l_{7,13}-8l_{8,14}-8l_{9,15 } \right)\vec{\lambda } \\ & & [ \lambda_3,\vec{\lambda}]= \left ( + 8l_{1,2}+8l_{7,10}+8l_{8,11}+8l_{9,12 } \right)\vec{\lambda } \\ & & [ \lambda_4,\vec{\lambda}]= \left ( + 8l_{5,6}+8l_{8,9}+8l_{11,12}+8l_{14,15 } \right)\vec{\lambda } \\ & & [ \lambda_5,\vec{\lambda}]= \left ( -8l_{4,6}-8l_{7,9}-8l_{10,12}-8l_{13,15 } \right)\vec{\lambda } \\ & & [ \lambda_6,\vec{\lambda}]= \left ( + 8l_{4,5}+8l_{7,8}+8l_{10,11}+8l_{13,14 } \right)\vec{\lambda } \\ & & [ \lambda_7,\vec{\lambda}]= \left ( + 8l_{2,13}-8l_{3,10}+8l_{5,9}-8l_{6,8 } \right)\vec{\lambda } \\ & & [ \lambda_8,\vec{\lambda}]= \left ( -8l_{2,14}-8l_{3,11}-8l_{4,9}+8l_{6,7 } \right)\vec{\lambda } \\ & & [ \lambda_9,\vec{\lambda}]= \left ( + 8l_{2,15}-8l_{3,12}+8l_{4,8}-8l_{5,7 } \right)\vec{\lambda } \\ & & [ \lambda_{10},\vec{\lambda}]= \left ( -8l_{1,13}+8l_{3,7}+8l_{5,12}-8l_{6,11 } \right)\vec{\lambda } \\ & & [ \lambda_{11},\vec{\lambda}]= \left ( -8l_{1,14}+8l_{3,8}-8l_{4,12}+8l_{6,10 } \right)\vec{\lambda } \\ & & [ \lambda_{12},\vec{\lambda}]= \left ( -8l_{1,15}+8l_{3,9}+8l_{4,11}-8l_{5,10 } \right)\vec{\lambda } \\ & & [ \lambda_{13},\vec{\lambda}]= \left ( + 8l_{1,10}-8l_{2,7}+8l_{5,15}-8l_{6,14 } \right)\vec{\lambda } \\ & & [ \lambda_{14},\vec{\lambda}]= \left ( + 8l_{1,11}-8l_{2,8}-8l_{4,15}+8l_{6,13 } \right)\vec{\lambda } \\ & & [ \lambda_{15},\vec{\lambda}]= \left ( + 8l_{1,12}-8l_{2,9}+8l_{4,14}-8l_{5,13 } \right)\vec{\lambda } \\\end{aligned}\ ] ]

we develop a theory of continuous decoupling with bounded controls from a geometric perspective . continuous decoupling with bounded controls can accomplish the same decoupling effect as the bang - bang control while using realistic control resources and it is robust against systematic implementation errors . we show that the decoupling condition within this framework is equivalent to average out error vectors whose trajectories are determined by the control hamiltonian . the decoupling pulses can be intuitively designed once the structure function of the corresponding @xmath0 is known and is represented from the geometric perspective . several examples are given to illustrate the basic idea . from the physical implementation point of view we argue that the efficiency of the decoupling is determined not by the order of the decoupling group but by the minimal time required to finish a decoupling cycle .

SECTION 1. SHORT TITLE. This Act may be cited as the ``Oregon Surplus Federal Land Act of 2008''. SEC. 2. DEFINITIONS. In this Act: (1) Commandant.--The term ``Commandant'' means the Commandant of the Coast Guard. (2) Light station.--The term ``Light Station'' means the Cape Arago Light Station on Chief's Island in the State of Oregon. (3) Maps.--The term ``maps'' means the maps filed under section 3(d) (4) Secretary.--The term ``Secretary'' means the Secretary of the Interior. (5) Tribes.--The Term ``Tribes'' means the Confederated Tribes of the Coos, Lower Umpqua, and Siuslaw Indians in the State of Oregon. SEC. 3. TRANSFER OF ADMINISTRATIVE JURISDICTION. (a) In General.--As soon as practicable after the date of enactment of this Act and subject to subsection (c), the Commandant shall transfer to the Secretary, to hold in trust for the benefit of the Tribes, administrative jurisdiction over the Federal land described in subsection (b). (b) Description of Land.--The Federal land referred to in subsection (a) consists of the parcels of Coast Guard land (including any improvements to the land) comprising approximately 24 acres, located in Coos County, Oregon, in the areas commonly known as ``Gregory Point'' and ``Chief's Island'', as depicted on the maps. (c) Conditions.-- (1) Compliance with applicable law.--Before completing the transfer of administrative jurisdiction under subsection (a), the Commandant shall execute any actions required to comply with applicable environmental and cultural resources laws. (2) Trust status.--On transfer of administrative jurisdiction over the land under subsection (a), the land transferred to the Secretary shall be-- (A) held in trust by the United States for the Tribes; and (B) included in the reservation of the Tribes. (3) Maintenance of cape arago light station.-- (A) In general.--The transfer of administrative jurisdiction over the Light Station under subsection (a) shall be subject to the conditions that the Tribes-- (i) shall-- (I) use, and make reasonable efforts to maintain, the Light Station in accordance with-- (aa) the National Historic Preservation Act (16 U.S.C. 470 et seq.); (bb) the Secretary of the Interior's Standards for the Treatment of Historic Properties under part 68 of title 36, Code of Federal Regulations; and (cc) any other applicable laws; and (II) submit any proposed changes to the Light Station for review and approval by the Secretary, in consultation with the Oregon State Historic Preservation Officer, if the Secretary determines that the changes are consistent with-- (aa) section 800.5(a)(2)(vii) of title 36, Code of Federal Regulations; and (bb) the Secretary of the Interior's Standards for Rehabilitation under section 67.7 of title 36, Code of Federal Regulations; (ii) shall make the Light Station available to the general public for educational, park, recreational, cultural, or historic preservation purposes at times and under conditions determined to be reasonable by the Secretary; (iii) shall not-- (I) sell, convey, assign, exchange, or encumber the Cape Arago Light Station (or any part of the Light Station) or any associated historic artifact conveyed in conjunction with the transfer under subsection (a), unless the sale, conveyance, assignment, exchange, or encumbrance is approved by Secretary; or (II) conduct any commercial activities at the Cape Arago Light Station (or any part of the Light Station) or in connection with any historic artifact conveyed in conjunction with the transfer under subsection (a) in any manner, unless the commercial activities are approved by the Secretary; and (iv) shall allow the United States, at any time, to enter the Light Station without notice, for purposes of ensuring compliance with this section, to the extent that it is not practicable to provide advance notice. (B) Reversion.--If the Tribes fail to meet any condition described in subparagraph (A), the Light Station, or any associated historic artifact conveyed in conjunction with the transfer under subsection (a), shall, at the option of the Secretary-- (i) revert to the United States; and (ii) be placed under the administrative control of the Secretary. (d) Maps and Legal Descriptions.-- (1) In general.--As soon as practicable after the date of enactment of this Act, the Commandant shall file the maps entitled ``Confederated Tribes of the Coos, Lower Umpqua, and Siuslaw Land Transfer Maps'' and legal descriptions of the parcels to be transferred under subsection (a) with-- (A) the Committee on Commerce, Science, and Transportation of the Senate; (B) the Committee on Transportation and Infrastructure of the House of Representatives; and (C) the Secretary. (2) Force of law.--The maps and legal descriptions filed under paragraph (1) shall have the same force and effect as if included in this Act, except that the Commandant may correct any errors in the maps and legal descriptions. (3) Availability.--Each map and legal description filed under paragraph (1) shall be on file and available for public inspection in the appropriate office of the Department of the Interior. (e) Easements.--The Coast Guard may retain easements or other property interests as may be necessary across the property described in subsection (b) to operate, maintain, relocate, install, improve, replace, or remove any aid to navigation located on the land for such period as the aid to navigation may be required by the Coast Guard. (f) Tribal Fishing Rights.--No fishing rights of the Tribes that are in existence on the date of enactment of this Act shall be enlarged, impaired, or otherwise affected by the transfer of administrative jurisdiction under subsection (a).

Oregon Surplus Federal Land Act of 2008 - Requires transfer of administrative jurisdiction over Coast Guard lands in Coos County, Oregon (including Cape Arago Light Station on Chief's Island), in the areas commonly known as Gregory Point and Chief's Island, to the Secretary of the Interior to hold in trust for the benefit of the Confederated Tribes of the Coos, Lower Umpqua, and Siuslaw Indians and to be included in the reservation of those tribes. Allows the Coast Guard to retain easements for access to aids to navigation.

Several gruesome discoveries involving mutilated animals have prompted a southwestern Ontario humane society to warn pet owners about a possible serial animal killer on the loose. Last week, police in London, Ont., responded to a report of a headless dog found on top of a recycling bin near a beer store. The animal had been skinned and was missing organs. It was the latest in a series of similar disturbing incidents in which dead animals were found in public places around the city, according to the London Humane Society's executive director Judy Foster. Over the last year, Foster said, there have been at least eight incidents involving 17 dead animals, including a skinned and beheaded bunny found on the Western University campus, a mutilated cat found in a park, six dead coyotes — two of them headless and skinned — placed in a pose in three different locations, and seven dead snakes left in a strange pose. A stabbed and partially skinned goose was dropped off at the humane society's front door, she said. "It doesn't make me feel better knowing there is such great similarities between all of these and the disturbing part is you don't know when the animals died — at the start, halfway through or as a result of what was done to it," Foster said. "It's impossible to forget what we've seen. All animals mutilated All the animals were found with some form of mutilation, but there was no blood at the scenes, Foster said, suggesting they were killed elsewhere. A scalpel appears to have been used in each case, she said. "The animals are incredibly clean," Foster said. "We believe that it would take a fair amount of time to do that." It also looks like the pattern is escalating, she said. First it was wildlife — coyotes and geese — and then a bunny, a cat and now a dog. Foster said she doesn't know if it's the work of one person, a group or even copycats. But Michael Arntfield, a criminology professor at Western University, believes one person is behind all the incidents. "This will continue to escalate," he said in a phone interview. "This is not a prank, it's not mischief, it's sexual, it's predatory, it's high risk and it's criminal." Criminologist says killings likely done by one person Arntfield, a former police officer, is confident that one of the incidents — the mutilated goose that was dropped off at the humane society — suggests the person has been to the humane society before. Two years ago, Arntfield said he received a tip that someone was going to the London Humane Society claiming to be a rescuer and asking to adopt animals "with the sole purpose of torturing them and mutilating them." Criminologist Michael Arntfield believes the string of animal killings and mutilations are the result of one person. (Michael Arntfield) Arntfield told police and the humane society and urged them to examine the adoption files. Nothing happened, he said. "This is a serial animal killer," Arntfield said, calling it a clear case of zoosadism — being sadistic to an animal — with an underlying sexual component. Arntfield said he is concerned that whoever is behind the animal killings could potentially move on to more serious crimes targeting humans. The incidents have left the humane society reeling. "We're doing OK, but I'm not going to downplay it," Foster said with a heavy sigh. "I felt physically ill when I saw the dog, and the bunny, the cat, the goose, the coyotes...the skinned coyotes we thought were dogs initially." She said counsellors are coming in soon to help staff deal with the gruesome discoveries. "The longer we talk about this, the hair on my arms are standing straighter and straighter," Foster said. "It's chilling. And at a certain point, when these things keep happening, we also need to be concerned about public safety — public human safety." London police said they are taking the matter very seriously. Const. Sandasha Bough said the force has assigned an investigator to the case, but noted they were only made aware of two incidents — two dead coyotes found by a grocery store last February and the beheaded dog last week. ||||| Another disturbing discovery of a mutilated, beheaded dead animal — this time a small dog — has been made near a London Beer Store, marking at least the eighth disturbing carcass found in or near the city this year. That has rung alarm bells for both the local humane society and a Western University criminologist who point to animal mutilations as signs of escalating behaviours common to killers. “You don’t want to think the worst for your own community, but at what point do we say we really need to be wondering, we really need to be trying to figure out how this is happening,who is doing this, what’s the root of this?” said Judy Foster, the executive director of the London Humane Society. The dog was found beheaded, skinned and cleaned near a dumpster behind the Beer Store on Adelaide Street on Friday, sparking an investigation by animal-cruelty investigators. Two vets have looked at the remains and have determined that it is a dog. It had been beheaded, skinned, had puncture wounds and the blood removed before it was left in plain view. “What would drive somebody to commit that act, that level of violence against such a small body?” Foster said. Already in 2016, several animals have been reported to the humane society that were found killed and left for people to find including: • Two coyotes behind the Metro store on Clarke Road. • A mutilated cat in Springbank Park. • A beheaded bunny at Western University campus. • Two beheaded coyotes, also at the university campus. • Snakes found killed and posed. • A goose that was skinned, stabbed and left on the steps of the Human Society. • Two dead animals found on a walking trail near Ailsa Craig. “The commonality between all of them – the animals have suffered a degree of mutilation, they’ve all been left in a public place, in a high- traffic place,” Foster said. With the exception of the bunny and the cat, all the animals were found in cold temperatures. All of them appear to have been exposed to a scalpel, either for stabbing or skinning. All of them appear to have been cleaned, with the exception of the cat, whose body may have been interferred with by other wildlife. “I’m not seeing it happen in other communities. This is something that is uniquely happening in London.” Western University criminology professor Michael Arntfield said he’s been sent photos of a group of geese with their beaks broken and placed in a semi-circle in Old South. Another person has contacted him replicating a set of snakes that were killed using pieces of plastic. “It’s crossing the species boundary now and it’s no question that it’s the same people or group of people,” he said. Crossing the species notes a level of sadism, he said and that this is “a prepatory behaviour that will inevitably escalate to more sophisticated forms of offending, up to and including human victims.” Arntfield said the clinical and forensic literature “overwhelming points to spectrum of prepatory paraphilias” that lead to a number of high-risk behaviours. The person is aroused by “visual vignettes” of entrails, dismemberment and extreme gore. The animals are often left posed — for example, the coyotes in a circle, the geese in a semi-circle — and “speak to increasingly elaborate fantasies that are playing out with a wider variety of species.”

– "It's impossible to forget what we've seen," says the director of a Humane Society in London, Ontario, where officials say a serial animal killer is on the loose. Over the past year, 17 dead animals have been found around the Canadian city. It started with skinned and headless coyotes and a stabbed and partially skinned goose left outside the Humane Society's front door, reports the Canadian Press. But lately domestic animals—including a skinned and headless bunny and a mutilated cat—have been found in public places. The most recent discovery came last Friday, when a skinned dog missing its head and several organs was found outside a beer store, reports the London Free Press. Like the other animals, the dog appeared to have been mutilated with a scalpel and deliberately left in a public spot. All the animals were drained of blood and expertly cleaned, and most were left in poses (including snakes). Authorities say it's unclear if the animals were dead before the mutilation began. Police are now investigating, but criminology professor and former police officer Michael Arntfield believes the crime spree could stretch back more than two years, when he says he received a tip that an individual was adopting pets from the Humane Society simply to torture and kill them; he says he notified police. "This is not a prank," says Arntfield. This is "a prepatory behavior that will inevitably escalate to more sophisticated forms of offending, up to and including human victims." (Someone previously burned dogs in LA.)

the unified scheme for low luminosity radio loud active galactic nuclei associates low luminosity fr i radio galaxies with bl lacs objects , or at least with most of them . according to the most recent studies , there is growing evidence that the non thermal radiation produced at the base of the relativistic jet , on sub pc scales , which dominates the overall emission in bl lacs , is also visible in the nuclei of their misaligned counterparts . the nuclear sources observed through high resolution hst optical and uv images in the great majority of complete samples of fr i @xcite , tightly correlate with the radio core emission , strongly arguing for a common origin ( i.e non - thermal synchrotron emission from the base of the jet ) . the discovery of such non - thermal nuclei imply that fr i radio galaxies represent a fundamentally different manifestation of the agn phenomenon , as they lack at least two of the typical characteristics of other active galaxies : optically and geometrically thick tori , and thermal disk emission . on larger ( kpc ) scales , jets have been observed in the optical ( e.g. de koff et al . 1996 , martel et al . 1999 , capetti et al . 2000 ) and in the uv band @xcite , in a substantial number of fr i radio galaxies . the origin for the emission of these jets is most plausibly non - thermal synchrotron radiation . best support for this interpretation comes from detailed multiwavelength observations of the different components of the jets ( e.g perlman et al . 2001 , sparks et al . 1996 ) , which show smooth spectra from the radio to the uv . @xcite have shown that optical jets in a complete sample of 24 nearby 3cr fr i are associated with sources in which dark disks are seen presumably face - on . their analysis strongly supports the scenario in which , as a result of relativistic beaming , optical non - thermal synchrotron emission from a jet is detected only if the jet is pointing towards the observer , forming an angle to the line of sight @xmath0 . on the other hand , observations made with the _ chandra _ satellite have shown that x ray jets are common among low luminosity radio galaxies @xcite and are observed in quasars as well @xcite . for the x - ray emission of powerful quasars jets , the most plausible radiation mechanism is inverse compton scattering ( * ? ? ? * for a recent analysis of the emission processes in x - ray jets ) . the source for the seed photons which are upscattered to x ray energies might reside in the cosmic microwave radiation . this mechanism requires high velocity bulk motion of the jet on the kpc scales , which might be present in powerful quasars ( and fr ii galaxies ) but is not expected in lower luminosity objects . another possible source for the seed photons , which might well apply to low luminosity radio galaxies jets , is their `` blazar '' nucleus . @xcite have shown that , for large viewing angles to the jet , this can be the dominant mechanism , if the jet has a slow velocity component ( which might be still relativistic but with a lorentz factor of @xmath1 ) . in order to discriminate between the above scenarios , a detailed modeling of the sed of such large scale jets is required . clearly , this is possible only if multiwavelength and co spatial data , from radio to the x - ray band , are available . the low luminosity radio galaxy 3c 270 is an ideal object to further investigate all of the above issues . in vla radio maps , this nearby source shows an fr i morphology @xcite with symmetric jet and counter jet @xcite . vlba radio images show symmetric jets on the sub - pc scale , implying that the viewing angle to the jet is quite large , @xmath2 @xcite . in the hst images , the galaxy shows a large ( hundreds of pc scale ) obscure dusty disk @xcite . the jet axis projects onto the disk minor axis and it is plausibly almost perpendicular to the disk . an unresolved nucleus is present in the ir and optical @xcite , but it is not detected in the uv @xcite . in this paper we show that the hst / stis uv image of 3c 270 shows a further feature , which is possibly connected to the jet . as we will show in the following , such feature is unexpected in an object as 3c 270 , in which the jets almost lie on the plane of the sky . the presence of this component , together with both the absence of the nucleus in the uv and the information from the _ chandra _ x ray data , give us a unique global picture of the nuclear structure of this object . the x ray image also shows the presence of a jet and , more surprisingly , of a counterjet . all of these issues have important implications for the agn unified models . this paper is organized as follows : in section [ observations ] we describe the hst and _ chandra _ observations and we show the results ; in section [ discussion ] we discuss our results and we propose different scenarios which can account for the observations ; in section [ conclusions ] we present a summary of our findings and we draw conclusions . the uv hst - stis image was taken as part of the uv snapshot survey of 3cr radio galaxies ( * ? ? ? * snap 8275 ) , using the nuv - mama detector and the f25srf2 broad band filter , whose transmission function is centered at 2320 . the image has been processed through the hst pipeline calibration . iraf standard packages have been used for the analysis . in fig . [ im1 ] ( left panel ) we show the central @xmath3 of the stis image , which has been smoothed by convolving the original image with a 2 pixels ( corresponding to @xmath4 ) sigma gaussian in order to improve the rather low signal to noise ratio ( @xmath5 in the center of the galaxy ) . the most apparent feature in the uv image is the @xmath6 three hundred pc scale dark disk @xcite . emission from the host galaxy stellar component is also clearly visible . the circle represents the position of the center of the galaxy , which has been identified by fitting ellipses to the isophotes of the galaxy , in the region outside the dark disk , between 1.5 and 2.5 arcsec from the center . due to the relatively low signal to noise ratio of the uv image , the position of the center of the galaxy is known with an uncertainty of @xmath7 pixel . while an unresolved nucleus is present in the near infrared and optical hst images @xcite , in the uv image a faint , elongated , jet like structure appears to emerge from the center of the galaxy , and the nucleus is not detected @xcite . as pointed out by @xcite , the nucleus is probably not at the center of the galaxy isophotes . however , the error on the position of the center in the uv image is of the same order as the shift between the isophote center and the position of the unresolved nucleus in the optical images . therefore such small shift ( @xmath8 arcsec ) is not significant for our purposes . the apparent angular dimensions of the jet like feature ( to which we will refer in the following as the `` a '' component ) are @xmath9 arcsec , which correspond to @xmath10 pc . however , the width of the feature is consistent with being unresolved . the `` a '' component lies at the same position angle ( @xmath11 ) as the jets observed in the radio , both on the vlbi and vla scales ( jones et al . 2000 , birkinshaw & davies 1985 ) , and in the x ray band ( see below ) . clumps of emission , possibly superimposed on other components aligned with the jet , are present on larger scales , across the western edge of the obscure disk , up to a distance of @xmath12 arcsec from the location of the nucleus . we have measured the flux of the `` a '' component , by extracting the count rate from a box of @xmath13 pixels , and evaluating the background by averaging the counts in the pixels contiguous to such box . the background evaluation is clearly the largest source of error in the process of evaluating the flux of this component . adopting the photflam parameter in the image header . ] to convert from counts to flux density , we obtained @xmath14 erg @xmath15 s@xmath16 @xmath16 . at the distance to 3c 270 this corresponds to a luminosity @xmath17 erg s@xmath16 . we analyze a _ chandra _ archival 34 ksec observation of 3c 270 ( p.i . birkinshaw ) , obtained on 2000 may 6 with the back illuminated acis - s3 chip . since significant pileup effects were expected , a subarray configuration was used , which allowed to reduce the frametime to 1.8 sec and the estimated pileup fraction to @xmath18 . the data reduction was performed with ciao v2.2 applying the standard corrections for bad and flaring pixels , and filtering for standard asca grades . an updated gain map included in the caldb 2.8 release was used , which reduces the calibration uncertainties at low energies . we also eliminated about 12% of the exposure time where the background flux was @xmath19 above the average value . the x - ray image ( fig . [ chandra ] ) clearly shows the nucleus , diffuse emission from the hot corona , a kpc - scale jet ( pointing westwards ) and , surprisingly , a faint counterjet . the counterjet is clearly visible in the x ray image when only the soft ( 0.30.6 kev ) is displayed ( fig . [ softx ] ) . the jet counterjet flux ratio is @xmath20 , in substantial agreement with what is observed in the radio band @xcite . to avoid contamination from the kpc - scale jets and thermal gas , we extract the nuclear spectrum in a circle with aperture radius of 4 pixel ( @xmath1 arcsec ) , which is twice as large as the fwhm of the observed point spread function . the background spectrum is measured in an external region on the same chip . the background flux is less than 1% of the source flux , therefore our results are not altered by measuring the background spectrum in a different region . we carry out the spectral analysis using the xspec v11.1.0 package . we fitted the 0.39 kev spectrum of 3c 270 with an absorbed powerlaw ( the agn ) plus a thermal plasma ( mekal model in xspec ) . since it is likely that the observed spectrum has been significantly hardened by pileup , we convolve the model with the pileup model in xspec @xcite . in addition to the thermal component we obtain a hard power law is defined by @xmath21 ( @xmath22 ) which is similar to what has been found in asca and rosat data @xcite . most importantly , and differently from the rosat and asca observations , we find evidence for a moderate amount of nuclear absorption ( @xmath23 @xmath15 ) . the x ray spectrum of 3c 270 is shown in fig . [ specx ] . note that the presence of moderate x ray absorption is rather common among fr i. @xcite studied nine fr i galaxies with the asca satellite , finding a broad range of absorbing columns . the typical values for @xmath24 lie between @xmath25 and @xmath26 @xmath15 , and for three out of the nine fr i galaxies in their sample , they find no intrinsic absorption . very recent work with _ ( e.g. hardcastle et al . 2001 , 2002 ) basically confirms this picture . in order to check for consistency with the previous x ray observations of 3c 270 , we have reanalyzed the asca data . we find that a satisfactory fit can be obtained by setting the parameters for the power - law component and absorption to those we have obtained from the chandra observation . we also find that a @xmath27 kev iron line is not statistically required by our fit . however , its presence can not be ruled out by the _ chandra _ data , since we have no stringent upper limits on its equivalent width ( 380 ev at 90% c.l . ) . in table [ chandrafit ] we summarize the parameters for the best fit ( @xmath28 ) , and fluxes and luminosities of the different spectral components ( errors are at 90% c.l . ) . note that the 210 kev flux is comparable to the asca value , while the _ chandra _ 0.52 kev flux is a factor 4 lower , since , due to the the small extraction area we adopt , we are missing most of the diffuse soft thermal emission . instead , the total 210 kev flux is dominated by the ( nuclear ) power law component . by subtracting the thermal component from the total flux , we obtain that the observed flux of the power law component in the range 210 kev is @xmath29 erg s@xmath16 @xmath15 . l c c c c @xmath30 & 1.29 & 1.26 & & + @xmath31 & 0.26 & 0.25 & & + @xmath32 & 6.91 & & 6.88 & 9.58 + @xmath33 & 1.38 & & 1.37 & 1.91 + + p l spectral index @xmath34 & @xmath24 & kt & @xmath35 + @xmath36 & @xmath37 & @xmath38 kev & @xmath39 + [ chandrafit ] two are the most important questions arising from the analysis of the stis image of the nuclear regions of 3c 270 : @xmath40 what is the nature of the `` a '' jet like feature ? @xmath40 what is the role of nuclear absorption in this radio galaxy ? in the following sections , we test whether the available data are consistent with the synchrotron scenario for the jet - like feature , and we discuss the implications for the agn unified model . then , we consider a different scenario for the observed emission ( namely scattered radiation from the `` blazar '' nucleus ) which has again important implications for the unification schemes . finally , we discuss the role of nuclear absorption , and we suggest future observations that may offer a definitive discrimination between the two . a fundamental tool in order to constrain the emission process of the jet like structure in 3c 270 is the information about its spectral shape . unfortunately , the `` a '' component is not detected in any other hst image , and no co spatial observations are available either in the radio or in the x ray bands . the absence of a corresponding feature in the optical images is not surprising : we can predict the expected counts of such feature in the optical ( f547 m ) image , by considering the flux density of component `` a '' in the uv . assuming a spectral index @xmath41 , which is common among synchrotron emitting sources in the optical - uv regime , the expected flux is @xmath42 erg @xmath15 s@xmath16 @xmath16 . using the wfpc2 exposure time calculator , this translates in a count rate of @xmath43 counts / sec integrated on an area of @xmath44 pixels , corresponding to an average value of 0.4 counts / pixel in the f547 m image ( which has @xmath45s ) . this value is less than 0.3% of the background in the region of the dark disk , at the position angle of the jet . therefore if the `` a '' component is a synchrotron jet , it can not be detected in the available optical images . in fig . [ im1 ] ( right panel ) we show a `` color '' image uv v . we have chosen the v band image since in the other optical images the psf from the nuclear component dominates the central regions . the galaxy emission fills the field of view of both instruments , therefore the background is undetermined and the estimate of the color index of the jet is not straightforward @xcite . such an analysis is well out of the purposes of this paper . however , a qualitative analysis of this image tells us that i ) the region with similar spectral properties ( the jet ? ) extends further than the `` a '' component , and its color is almost constant on a scale of @xmath46 ii ) the `` jet '' is bluer than the underlying stellar emission of the host galaxy . it is also important to compare the uv to the radio emission . as already mentioned , unfortunately no co spatial radio observations are available in the literature . however , since the distance in frequency between radio and uv measurement is relatively high , we can roughly estimate the radio flux by subtracting the vlbi total flux ( observed on the scale of @xmath47 mas from the nucleus ) from the vla core flux . this results in a rough estimate of the emission coming from the region between the vla and the vlbi scales , i.e. some tenths of arcsec . adopting the fluxes given by @xcite , we obtain a value of the radio uv spectral index @xmath48 , which is compatible with other synchrotron emitting jets @xcite . note that due to the large difference in frequency between the radio and the uv , an error of a factor two on one of the two measurements would result in a variation of only @xmath49 . the detection of synchrotron emission from a jet oriented at such a large angle to the line of sight is not expected at either optical or uv wavelengths , since the observed flux from relativistic jets is certainly affected by relativistic beaming . the observed flux is @xmath50 , where @xmath51 , @xmath52 is the bulk lorentz factor , @xmath53 and @xmath54 is the flux observed in the comoving frame of the jet . 3c 270 has a quasisymmetric jet and counter jet ( on all scales and both in the radio and in the x ray band ) , therefore , in the standard picture , the viewing angle should be quite large . this results in a small value for @xmath55 , and most of the jet radiation should be beamed away from our line of sight , which would reduce the observed flux by a factor @xmath56 , while for @xmath57 the flux is still reduced by a factor @xmath58 . ] . although the extreme lorentz factors ( @xmath59 ) required in order to account for the bl lac phenomenon are probably limited to the very innermost region of the jet ( sub pc ) , it is not yet clear where the jet deceleration takes place and what are the characteristics of the velocity gradients along the jet . @xcite and @xcite have pointed out that the low number of objects with detected vlbi counterjets in randomly oriented samples implies that motions with @xmath60 must be present , at least on the pc scale . on larger scales , the study of jet asymmetries performed by @xcite suggest that fr i jets are still relativistic up to @xmath61 kpc from the core . furthermore , the analysis of @xcite of a statistically complete and randomly oriented sample of nearby fr i from the 3cr catalog , for which a set of homogeneous hst observations is available , shows that relativistic beaming plays indeed an important role in the detection of fr i optical jets on the kpc scale . the chance of detecting a uv synchrotron jet in a highly misaligned source such as 3c 270 is significantly increased if lower speed components are present in the jet . this scenario might find support from radio observations of this object . @xcite have calculated that the viewing angle of the 3c 270 jet is @xmath62 , on the basis of the jet - counterjet ratio and the apparent jet velocity from vlbi data . according to their observations , the intrinsic velocity is @xmath63 . although their estimate is only based on the motion of a single local maximum on the jet profile plots , this would corresponds to a mildly relativistic motion with a lorentz factor @xmath64 , which might be expected if the jet has a velocity structure on the pc ( and sub - pc ) scales , for example a fast spine and a slower layer @xcite for the jet velocity , which appears to be more typical of the broad class of low luminosity radio galaxies , the jet - to - counterjet ratio ( in the radio band and on the vlbi scale ) implies that the viewing angle can be as large as @xmath65 . ] . in this case , the detection of synchrotron emission in highly misaligned sources ( @xmath66 or more ) is possible , since with such low lorentz factors the de - beaming effect does not affect dramatically the jet radiation . note however , that if all fr i had significant emission from such a slow component , we would expect to observe optical jets in most of them , which is not the case . the probability of observing them might increase in the uv , due to the enhanced contrast between the jet emission and the underlying stellar galaxy component . however , hst / stis uv images are available for 14 of the 24 fr i of the @xcite sample . with the only possible exception of 3c 270 , no `` new '' jets have been discovered @xcite . this further supports the idea that detection of jets is more strongly determined by relativistic beaming than by the contrast to the host galaxy emission . we stress that whatever the viewing angle to 3c 270 ( which however has to be rather large ) , the detection of a synchrotron uv jet implies that _ we are observing a component of the jet which moves slower than what is expected for a typical bl lac nucleus _ , for which @xmath52 is constrained to be @xmath67 , at least at optical - uv frequencies ( e.g. tavecchio et al . 1998 , sikora et al . 1994 ) . a low velocity component must be present on larger scales , to account for the observation of x ray emission from the kpc scale jet ( and counter jet ) . we can further test this scenario through a reverse argument , in the frame of the agn unification schemes . we can calculate the luminosity of the `` a '' component as seen from an observer placed at a small angle to the axis of the jet ( @xmath68 ) , under the assumption of highly relativistic motion of such a component . if we assume @xmath69 for the bulk lorentz factor of the jet , for a large viewing angle ( @xmath70 ) we obtain @xmath71 . therefore , the luminosity @xmath72 , as observed on - axis would be @xmath73 erg s@xmath16 . we can compare this to the optical luminosity ( @xmath72 ) of a bl lac which has the same extended ( unbeamed ) radio power as 3c 270 ( @xmath74 erg s@xmath16 hz@xmath16 ) . although there is a large scatter in the data ( @xmath7 dex ) , an average value of @xmath75 erg s@xmath16 ( see e.g. chiaberge et al . 2000 ) represents a good estimate for its luminosity . therefore , @xmath76 is at least 2 orders of magnitude higher than expected . in order for the `` a '' component not to outshine the inner bl lac , we must set an upper limit for its bulk lorentz factor @xmath77 ( if the viewing angle to the jet in 3c 270 is @xmath78 , and even lower if @xmath79 is larger ) . this limit is therefore compatible with the scenario in which the uv emission observed on the scale of tens of pc is produced by a rather slow component of the jet . considering the potential difficulties about the synchrotron origin , we explore an alternative scenario , namely scattered radiation from the central regions . such a phenomenon might indeed be observed _ only _ in highly misoriented sources . the observation of scattered radiation ( both in the form of continuum and emission lines ) from absorbed nuclei in type 2 agns is the most striking confirmation of the unification schemes . the best examples of such a process can be found in spectropolarimetric data of seyfert 2 and radio galaxies @xcite and in hst polarimetric images of seyfert 2 galaxies @xcite . the observed phenomenology has been successfully interpreted as due to the presence of a hidden quasar nucleus , in which both the continuum emission from the accretion disk and the broad emission line region are seen through scattered light . the nature of the `` mirrors '' is still unknown , since the ambiguity between electron scattering and dust - grain scattering has not been clearly solved . since there are strong clues that the nuclear emission from any accretion disk is rather low in fr i @xcite , the dominant nuclear source for the scattered light might reside in the base of the relativistic jet . the material responsible for scattering might be either the ism or the jet itself . in the former case , the observed structure ( i.e. component `` a '' ) represents a _ direct evidence of the jet beam_. note that in such a scenario , the fact that the width of component a is unresolved at a distance of @xmath80 pc from the nucleus sets a limit to the half opening angle of the beam of the inner misoriented bl lac as being @xmath81 . this in turn translates to a bulk lorentz factor of the jet @xmath82 , which is consistent with the highly relativistic velocities @xmath83 required by modeling of the bl lac overall emission @xcite . let us now calculate the particle density of the scattering material . the radiation observed by any material located on the line of propagation of the jet can be estimated by considering the emission of a bl lac object of the same intrinsic total power as 3c 270 . we assume again @xmath84 erg s@xmath16 . since the luminosity of component `` a '' is @xmath85 erg s@xmath16 and it has a dimension of @xmath86 pc , the particle density inside the scattering cloud using @xmath87 , where r is the distance to the source of radiation ( @xmath88pc ) , @xmath89 is the particles cross section , @xmath90 is the particle density and @xmath91 is the volume of the scattering region . in case of scattering by electrons we obtain @xmath92 @xmath93 , while in case of scattering by dust we have ( assuming normal dust / gas ratio ) @xmath94 @xmath93 . more precisely , these values should be considered as lower limits , since the width of the `` a '' component might be unresolved , and therefore the volume of the jet might in turn be overestimated . although both of them appear to be reasonable values , we stress that from the normalization of the thermal component in the x ray spectrum , where v is the source volume in @xmath95 , d is the distance to the source @xmath96 and @xmath97 are the electron and hydrogen density in the gas in @xmath93 . for a gas temperature of 0.6 kev , it is reasonable to assume @xmath98 . we then estimate @xmath96 by assuming that the gas is distributed in a sphere with radius @xmath99 pc ( corresponding to 2 arcsec , i.e. the extraction radius for the x ray spectrum ) . ] we obtain @xmath100 @xmath93 , which is in agreement with the value for @xmath96 we obtain in the electron scattering scenario . we must point out that the presence of the jet might strongly affect the properties of the ism , and the material might well be swept away along the line of propagation of the jet . in this case , the material responsible for scattering may reside either in an region which surrounds the jet , or inside the jet itself . in the latter scenario , the electrons of the jet , which are relativistic in their comoving frame since they emit synchrotron radiation at least in the radio band , may upscatter the nuclear emission via the inverse compton process . electrons with a lorentz factor @xmath101 ( which , assuming , as a reference value , a magnetic field @xmath102 gauss emit synchrotron radiation in the radio band at @xmath103 ghz ) , can upscatter radio photons of frequency @xmath104 to frequencies as high as @xmath105 . for @xmath106 ghz and @xmath107 , we obtain @xmath108 hz , i.e. uv emission . clearly , more data at different frequencies are necessary for a detailed modeling of synchrotron and inverse compton radiation . although with the available data we can not firmly distinguish among the proposed different scenarios , either of them are consistent with the fr i bl lacs unification scheme . when interpreted in such a framework , these observations give us important information on the jet structure and the physical conditions in the central tens of parsecs . in particular , if the origin of the `` a '' component is synchrotron radiation from the jet , this implies that either a velocity structure in the jet must be present , or the whole jet has already slowed down on the scale of tens of parsecs . this provides an important `` link '' to the evidence for such stratification in jets which have already been found on larger @xcite and smaller scales @xcite . we argue that the emission analogous to component `` a '' , with its intrinsic low surface brightness , might be visible only in a few selected objects . 3c 270 has to be considered as a special case for three main reasons : i ) its low distance ; ii ) the presence of the dark disk ; iii ) the particular viewing angle , at which the `` a '' component is projected on the dark disk . we argue that all of these parameters combine in such way that 3c 270 represents a rather unique opportunity to observe resolved jet components in the uv regime on the scale of @xmath109pc with current instruments . the hard power law in the x rays obtained from the analysis of the _ chandra _ data basically confirms the results obtained with both asca and rosat . as already argued by @xcite , we interpret the presence of a hard x ray power law component in the nuclear sed as due to inverse compton scattering , since this is indeed expected in the framework of the the agn unification models . in particular , the presence of such spectral feature is a key characteristic of low energy peaked bl lac objects @xcite , to which 3c 270 should be unified . in fig . [ multi ] we show a `` picture gallery '' of 3c 270 , as seen at different wavelengths . from left to right , in the upper panel , we report the radio map at 5 ghz as taken from @xcite , images at 1.6 @xmath110 m with hst / nicmos @xcite . in the lower panel : images at 6700 and 5500 with hst / wfpc2 @xcite , 2300 with hst / stis @xcite , and the x ray _ chandra_/acis archival image . the hst images are reproduced on the same scale ( @xmath111 ) , which is reported for reference on the _ chandra_/acis image as a black empty square . the unresolved nucleus dominates the emission of the central region of the dark disk in the 1.6 @xmath110 m and 6700 images . for shorter wavelengths the nucleus is progressively fainter , and vanishes in the uv . the absence of the nucleus , together with the presence of a `` jet '' which has its base at the location of the nucleus , is a clue that obscuration is only confined to the very innermost region ( less than @xmath112pc ) . to investigate the properties of the obscuring structure , we combine the hst data and the x ray information obtained with the _ chandra _ satellite . we can evaluate the absorption of the dusty disk by comparing the counts in different regions of the disk ( along the semi major axis ) to the counts in a small box of @xmath113 pixels just outside the disk , @xmath114 arcsec east of the nucleus . we assume that the galaxy is optically thin to stellar light , therefore @xmath115 of the observed counts are produced between the disk and the observer , and @xmath115 are produced behind it . along the line of sight to the disk , only the contribution from @xmath115 of the produced light is diminished by the presence of dust . under this assumptions we obtain for both the f675w and the f547 m images an optical extinction @xmath116 magnitudes . this has to be understood as a lower limit to the disk absorption . a lower fraction of stellar light produced in the far half of the galaxy and the presence of emission on the disk ( star forming regions are commonly observed in dusty structures of nearby galaxies ; e.g. allen et al . 2002 , calzetti et al . 2001 ) would result in a higher value of @xmath117 . if the fraction of light from the back of the galaxy is only @xmath118 of the total , the value of @xmath117 increases to 2.5 ( see martel et al . 2000 for an extensive discussion on this issue ) . a value of several magnitudes for the nuclear extinction is also compatible with the analysis of the spectral energy distribution of the core of 3c 270 . in @xcite we have shown that in the framework of synchrotron emission and assuming an intrinsic spectral index @xmath41 , the nucleus vanishes in the uv image when absorbed by a column density corresponding to @xmath119 . on the other hand , through the analysis of the sed of 3c 270 in the framework of the unified models , @xcite have shown that 3c 270 might be well unified to the low energy peaked bl lacs ( lbl ) . therefore , the intrinsic value of @xmath34 for this source might be higher than 1 , and this would result in an even lower amount of nuclear absorption . if we assume galactic gas to dust ratio to convert @xmath24 to @xmath117 ( @xmath120 ) , our results seem to be in contrast to the value of @xmath24 as derived from the analysis of x ray data . our value for the x - ray absorption would result in @xmath121 mag . however , it is rather common to find that the determination of the absorbing column density from x ray information differs from the results obtained with other methods . among seyfert galaxies , the estimate of @xmath117 made both using absorption features in the infrared spectrum and evaluating the reddening of optical and infrared emission lines is typically @xmath122 times @xmath123 @xcite . a similar result has also been recently found by @xcite in the case of the closest fr i radio galaxy , centaurus a , in which absorption towards the nucleus can well be provided by the kpc scale dust lane . interestingly , @xcite have proposed that the excess of x - ray absorption compared to the lower extinction in the optical and infrared can be accounted for by the presence of large grain dust which have small extinction efficiency . another possible interpretation is that in 3c 270 the absorbing structure is `` free '' from dust . therefore , the observations of 3c 270 fit the scenario in which the nuclei of fr i radio galaxies are not obscured by the presence of optically and geometrically thick tori . the observed ( rather small ) amount of absorption in 3c 270 can be well provided by the extended dusty disk seen almost edge on . we have analyzed and discussed hst and _ chandra _ data of 3c 270 . the hst / stis uv image shows a jet like feature ( component `` a '' ) originating from the location of the nucleus , at the same position angle as the radio and x ray jet . the nucleus is clearly visible in the ir and optical images , and it is not detected in the uv . on the other hand , the emission of the jet - like feature is so low , that it can not be detected in the optical images , due to the higher amount of stellar emission in that band compared to the uv . the color image uv v shows that the jet is indeed bluer than the underlying stellar emission , while the radio to uv spectral index is consistent with other synchrotron jets . we propose two basic scenarios for the origin of component `` a '' : i ) non - thermal synchrotron emission from a slowly moving ( possibly mildly relativistically ) component of the relativistic jet ; ii ) scattered radiation . in case i ) , this would argue for the presence of mildly relativistic motions in the jet on the scale of tens of pc , in addition to the already achieved evidence for such motions on smaller ( vlbi ) and larger ( vla and x rays jets ) scales . in case ii ) the ultimate origin for the emission may well reside in radiation from the base of the jet , which is scattered into our line of sight , confirming that 3c 270 is indeed a misoriented bl lac . to test such pictures , co spatial radio data are needed in order to identify the possible radio counterpart of the uv jet like feature and thus constrain the broad band spectral index and the emission mechanism . another possible test for discriminating between the different scenarios can be provided by optical ( and radio ) polarimetric observations . in case of scattered radiation we expect the radiation to be polarized perpendicularly to the jet direction . in case of synchrotron emission , the polarization properties must be strictly connected to what is observed in the radio jet . the x ray spectrum of the nucleus shows a flat ( @xmath124 ) power law component , absorbed by a column density @xmath125 @xmath15 . the apparent discrepancy between this value and the low amount of absorption estimated in the optical , is however often found in other agns , such as seyfert galaxies . the nuclear structure of 3c 270 appears to be in agreement with that of other fr i radiogalaxies : a standard optically and geometrically thick obscuring torus is not required to account for the observed properties . the origin for the discrepancy between the amount of absorption as estimated through different methods is still to be fully understood . the power law component in the x rays is a further indication of the presence of a bl lac in its nucleus . we confirm that the flat slope observed for such a component can be interpreted as due to inverse compton emission , analogously to what is observed in low energy peaked bl lacs .

the hst / stis ultraviolet image of the fr i radio galaxy 3c 270 shows the presence of a jet like structure emerging from the position of the nucleus . this feature , which represents the first jet like component ever detected in the uv in a radio galaxy with jets lying almost on the plane of the sky , has the same position angle as the jet in the radio and x ray images . we propose two different scenarios for the origin of the emission : i ) non - thermal synchrotron from a mildly relativistic component of the jet ; ii ) scattered light from the nucleus , where a bl lac source may be hosted . either of these pictures would have important consequences for the agn unification schemes and for our knowledge of the jet structure . in the _ chandra _ image a faint counter jet is also present . from a comparative analysis of the hst images and _ chandra _ x ray spectrum , we find that the nucleus is only moderately obscured . the obscuring structure might well reside in the geometrically thin dark disk observed on large scales . this fits the scenario in which a standard geometrically and optically thick torus is not present in fr i radio galaxies .

These crawls are part of an effort to archive pages as they are created and archive the pages that they refer to. That way, as the pages that are referenced are changed or taken from the web, a link to the version that was live when the page was written will be preserved.Then the Internet Archive hopes that references to these archived pages will be put in place of a link that would be otherwise be broken, or a companion link to allow people to see what was originally intended by a page's authors.The goal is to fix all broken links on the web . Crawls of supported "No More 404" sites. ||||| According to the U.S. Geological Survey, as of Tuesday, the chances of a magnitude 7 or greater earthquake being triggered on the southern San Andreas fault over the next seven days were as high as 1 in 100 and as low as 1 in 3,000. Without the swarm, the average chance for such an earthquake striking on any given week is 1 in 6,000.

– The possibility of the Big One hitting along the "locked, loaded, and ready to go" San Andreas fault is an ever-present risk in southern California—and lately, it has been more present than usual. A cluster of more than 200 earthquakes hit a seismic zone under the Salton Sea at the southern end of the fault on Monday, the Los Angeles Times reports. The jolts, the strongest of which was magnitude 4.3, lasted for more than 24 hours and US Geological Survey experts say the activity has temporarily raised the risk of an earthquake 7.4 magnitude or stronger to as high as 1 in 100. The area has triggered other quakes in the past and experts say the increased risk will last until next Tuesday. The California Office of Emergency Services has issued an earthquake advisory for the region, CBS Los Angeles reports. "California is earthquake country. We must always be prepared and not let our guard down," says OES Director Mark Ghilarducci, who describes the warning as an opportunity to revisit emergency plans. The Smithsonian reports that the increased risk came the same week that Gov. Jerry Brown approved an expansion of California's early warning system. The system will be able to provide up to a minute's warning ahead of major quakes, long enough for train drivers to slow down or for workers to move away from dangerous machinery.

data were from the whitehall ii study ( 9 ) . in the 2003 and 2004 data collection phase , 4,228 men and women aged 5074 years completed a depression questionnaire and , if without known diabetes , underwent an oral glucose tolerance test ( ogtt ) . venous blood samples were taken after at least 8-h fasting , before ogtt , and at 2-h postadministration of a 75 g glucose solution . blood glucose was measured using the glucose oxidase method ( 10 ) on a ysi model 2300 stat plus analyzer ( ysi corporation , yellow springs , oh ; mean coefficient of variation [ cv ] 1.43.1% ) ( 11 ) . mmol / l , reported doctor - diagnosed diabetes , or use of diabetes medication ( 12 ) . in nondiabetic participants , we classified moderate hyperglycemia as ifg ( fasting glucose 5.66.9 mmol / l ) and impaired glucose tolerance ( igt ) ( 2-h postload glucose 7.811.0 a1c was measured in whole blood with a calibrated high - performance liquid chromatography system ( cv 0.8% ) . depressive symptoms were assessed with the center for epidemiologic studies depression scale ( ces - d ) summary score ( 13 ) , a measure that has been validated among diabetic patients ( 14 ) . ethnicity ( caucasian or non - caucasian ) , bmi ( weight in kilograms divided by height in meters squared [ kg / m ] ) , waist circumference ( cm ) , systolic and diastolic blood pressure ( mmhg ) , hdl and ldl cholesterol ( mmol / l ) , triglycerides ( mmol / l ) , current smoking ( yes / no ) , alcohol consumption ( none , 13 units per day , or > 3 units per day ) , and physical inactivity ( < 2.5 h moderate and > 1 h vigorous exercise per week ) were measured according to standardized protocols . statistical analyses are based on between 3,945 ( 93% of the 4,228 ) and 4,228 ( 100% ) of the eligible participants because there were missing data for some of the various glucose parameters . we used linear regression analysis to model the associations of ifg and igt with the ces - d score . the shape of the associations between fasting glucose , postload glucose , a1c , and ces - d were studied by treating all these measures as continuous variables . to test for curvilinear trends , a squared term of the glycemic measures the models were adjusted for age , sex , ethnicity , and clinical characteristics ( bmi , waist circumference , systolic and diastolic blood pressure , hdl and ldl cholesterol , triglycerides , smoking status , alcohol consumption , and physical activity ) . subsidiary analyses examined these associations in subgroups and in the whole cohort with glucose levels measured repeatedly ( in 19971999 and in 20032004 ) and with a dichotomized ces - d score ( < 16 vs. 16 ) . of the 4,228 participants , 2,038 ( 73.0% ) were men and 3,895 ( 92.1% ) caucasian . mean sd age was 60.7 6.0 years , and the levels of clinical characteristics were 128 17 and 74 10 mmhg for systolic and diastolic blood pressure , respectively , 1.6 0.4 mmol / l for ldl cholesterol , 26.7 4.4 kg / m for bmi , and 94.2 10.7 cm ( men ) and 84.3 13.0 cm ( women ) for waist circumference . for triglycerides , median ( interquartile range ) was 1.2 ( 0.81.6 ) 7.9% were current smokers , 16.0% were physically inactive , 17.8% consumed more than 3 units of alcohol per day , and 16.2% did not consume alcohol regularly . mean sd for fasting glucose was 5.55 1.51 mmol / l . compared with participants with normal fasting glucose ( n = 3,038 ; ces - d 9.9 6.7 ) , those with ifg ( n = 735 ) showed a marginally reduced ces - d score ( 9.0 6.1 ; p = 0.05 ) , whereas those with diabetes ( n = 455 ) showed an elevated ces - d score ( 11.2 7.0 ; p = 0.002 ) after taking into account age , sex , and ethnicity . 1a , there was a u - shaped association between fasting glucose and ces - d ( pcurve = 0.001 after adjustment for age , sex , and ethnicity ; n = 3,986 ) , with elevated ces - d values at glucose levels < 4.5 and > 9.0 mmol / l . the curvilinear trend was robust to additional adjustment for clinical characteristics ( p = 0.001 ) . age- , sex , and ethnicity - adjusted associations of fasting glucose ( a ) , 2-h postload glucose ( b ) , and a1c ( c ) with self - reported depressive symptoms assessed with ces - d . igt ( n = 423 ; ces - d 9.49 6.58 ) was not associated with ces - d ( p = 0.75 ) . however , there was a u - shaped association between postload glucose and ces - d ( fig . 1b ; n = 3,455 ; pcurve = 0.05 after adjustment for age , sex , and ethnicity ; pcurve = 0.11 after additional adjustment for clinical char- acteristics ) . again , a curvilinear association with ces - d was evident ( p = 0.04 ; n = 4,160 ; fig . the lowest ces - d scores were between a1c levels 4.0 and 5.5% ( nadir 4.4% in age- , sex- , and ethnicity - adjusted model ) . the curvilinear trend remained after additional adjustment for all clinical characteristics ( p = 0.007 ) . there were no differences in the u - shaped associations of the three glucose measures with ces - d between men and women or between caucasian and non - caucasian participants ( all pinteraction = 0.150.74 ) . using the average of repeated fasting and postload glucose measurements as exposure variables replicated the u - shaped associations ( pcurve = 0.01 ) . with the dichotomised ces - d score , the u - shaped trend reached statistical significance for repeatedly measured fasting glucose ( pcurve = 0.02 ) , but for the other glucose measures conventional statistical significance was not met ( pcurve = 0.090.26 ) . mean sd for fasting glucose was 5.55 1.51 mmol / l . compared with participants with normal fasting glucose ( n = 3,038 ; ces - d 9.9 6.7 ) , those with ifg ( n = 735 ) showed a marginally reduced ces - d score ( 9.0 6.1 ; p = 0.05 ) , whereas those with diabetes ( n = 455 ) showed an elevated ces - d score ( 11.2 7.0 ; p = 0.002 ) after taking into account age , sex , and ethnicity . 1a , there was a u - shaped association between fasting glucose and ces - d ( pcurve = 0.001 after adjustment for age , sex , and ethnicity ; n = 3,986 ) , with elevated ces - d values at glucose levels < 4.5 and > 9.0 mmol / l . the curvilinear trend was robust to additional adjustment for clinical characteristics ( p = 0.001 ) . age- , sex , and ethnicity - adjusted associations of fasting glucose ( a ) , 2-h postload glucose ( b ) , and a1c ( c ) with self - reported depressive symptoms assessed with ces - d . igt ( n = 423 ; ces - d 9.49 6.58 ) was not associated with ces - d ( p = 0.75 ) . however , there was a u - shaped association between postload glucose and ces - d ( fig . 1b ; n = 3,455 ; pcurve = 0.05 after adjustment for age , sex , and ethnicity ; pcurve = 0.11 after additional adjustment for clinical char- acteristics ) . mean sd for a1c was 5.36 0.73% . again , a curvilinear association with ces - d was evident ( p = 0.04 ; n = 4,160 ; fig . the lowest ces - d scores were between a1c levels 4.0 and 5.5% ( nadir 4.4% in age- , sex- , and ethnicity - adjusted model ) . the curvilinear trend remained after additional adjustment for all clinical characteristics ( p = 0.007 ) . there were no differences in the u - shaped associations of the three glucose measures with ces - d between men and women or between caucasian and non - caucasian participants ( all pinteraction = 0.150.74 ) . using the average of repeated fasting and postload glucose measurements as exposure variables replicated the u - shaped associations ( pcurve = 0.01 ) . with the dichotomised ces - d score , the u - shaped trend reached statistical significance for repeatedly measured fasting glucose ( pcurve = 0.02 ) , but for the other glucose measures conventional statistical significance was not met ( pcurve = 0.090.26 ) . however , this finding was generated by a u - shaped association between fasting glucose and ces - d with elevated depression scores seen at both ends of the glucose distribution , a finding that was replicated for 2-h postload glucose and a1c . although low depression scores were observed both at normal and pre - diabetic ranges of fasting and postload glucose , findings from long - term glucose levels ( a1c ) suggested that normoglycemic individuals had the lowest depression risk . future research should examine whether our findings are generalizable to other populations and whether they are applicable to clinical depression .

objectiveto examine the recent suggestion that impaired fasting glucose may protect against depression , whereas a diagnosis of diabetes might then result in depression.research design and methodscross - sectional analysis of 4,228 adults ( mean age 60.7 years , 73.0% men ) who underwent oral glucose tolerance testing and completed the center for epidemiologic studies depression scale ( ces - d).resultsafter adjustment for demographic factors , health behaviors , and clinical measurements ( bmi , waist circumference , lipid profile , and blood pressure ) , there was a u - shaped association between fasting glucose and depression ( pcurve = 0.001 ) , with elevated ces - d at low and very high glucose levels . this finding was replicable with 2-h postload glucose ( p = 0.11 ) and a1c ( p = 0.007).conclusionsthe u - shaped association between blood glucose and ces - d , with the lowest depression risk seen among those in the normoglycemic range of a1c , did not support the hypothesized protective effect of hyperglycemia .

machine learning algorithms based on stochastic neural network models such as and deep networks are currently the state - of - the - art in several practical tasks @xcite . the training of these models requires significant computational resources , and is often carried out using power - hungry hardware such as large clusters @xcite or graphics processing units @xcite . their implementation in dedicated hardware platforms can therefore be very appealing from the perspectives of power dissipation and of scalability . neuromorphic systems exploit the physics of the device to emulate very densely the performance of biological neurons in a real - time fashion , while dissipating very low power @xcite . the distributed structure of suggests that neuromorphic circuits and systems can become ideal candidates for such a platform . furthermore , the communication between neuromorphic components is often mediated using asynchronous address - events @xcite enabling them to be interfaced with event - based sensors @xcite for embedded applications , and to be implemented in a very scalable fashion @xcite . currently , and the algorithms used to train them are designed to operate efficiently on digital processors , using batch , discrete - time , iterative updates based on exact arithmetic calculations . however , unlike digital processors , neuromorphic systems compute through the continuous - time dynamics of their components , which are typically neurons @xcite , rendering the transfer of such algorithms on such platforms a non - trivial task . we propose here a method to construct using neuron models and to train them using an online , event - driven adaptation of the algorithm . we take inspiration from computational neuroscience to identify an efficient neural mechanism for sampling from the underlying probability distribution of the . neuroscientists argue that brains deal with uncertainty in their environments by encoding and combining probabilities optimally @xcite , and that such computations are at the core of cognitive function @xcite . while many mechanistic theories of how the brain might achieve this exist , a recent _ neural sampling _ theory postulates that the spiking activity of the neurons encodes samples of an underlying probability distribution @xcite . the advantage for a neural substrate in using such a strategy over the alternative one , in which neurons encode probabilities , is that it requires exponentially fewer neurons . furthermore , abstract model neurons consistent with the behavior of biological neurons can implement sampling @xcite , and sampled in this way can be efficiently trained using , with almost no loss in performance @xcite . we identify the conditions under which a dynamical system consisting of neurons performs neural sampling . these conditions are compatible with neuromorphic implementations of neurons , suggesting that they can achieve similar performance . the calibration procedure necessary for configuring the parameters of the spiking neural network is based on firing rate measurements , and so is easy to realize in software and in hardware platforms . in standard , weight updates are computed on the basis of alternating , feed - forward propagation of activities @xcite . in a neuromorphic implementation , this translates to reprogramming the network connections and resetting its state variables at every step of the training . as a consequence , it requires two distinct dynamical systems : one for normal operation ( _ i.e. _ testing ) , the other for training , which is highly impractical . to overcome this problem , we train the neural using an online adaptation of . we exploit the recurrent structure of the network to mimic the discrete `` construction '' and `` reconstruction '' steps of in a spike - driven fashion , and to carry out the weight updates . each sample ( spike ) of each random variable ( neuron ) causes synaptic weights to be updated . we show that , over longer periods of time , these microscopic updates behave like a macroscopic weight update . compared to standard , no additional programming overhead is required during the training steps , and both testing and training take place in the same dynamical system . because are generative models , they can act simultaneously as classifiers , content - addressable memories , and carry out probabilistic inference . we demonstrate these features in a mnist hand - written digit task @xcite , using an network consisting of @xmath0 visible neurons and @xmath1 `` hidden '' neurons . the spiking neural network was able to learn a generative model capable of recognition performances with accuracies up to @xmath2 , which is close to the performance obtained using standard and gibbs sampling , @xmath3 . we describe here the conditions under which a dynamical system composed of neurons can perform neural sampling . in has been proven that abstract neuron models consistent with the behavior of biological spiking neurons can perform sampling of a boltzmann distribution @xcite . two conditions are sufficient for this . first , the instantaneous firing rate of the neuron verifies : @xmath4 with @xmath5 proportional to @xmath6 , where @xmath7 is the membrane potential and @xmath8 is an absolute refractory period during which the neuron can not fire . @xmath9 describes the neuron s instantaneous firing rate as a function of @xmath7 at time @xmath10 , given that the last spike occurred at @xmath11 . the average firing rate of this neuron model for stationary @xmath7 is the sigmoid function : @xmath12 second , the membrane potential of neuron @xmath13 is equal to the linear sum of its inputs : @xmath14 where @xmath15 is a constant bias , and @xmath16 represents the pre - synaptic spike train produced by neuron @xmath17 and is set to 1 for a duration @xmath18 after the neuron has spiked . the terms @xmath19 are identified with the time course of the , _ i.e. _ the response of the membrane potential to a pre - synaptic spike . the two conditions above define a neuron model , to which we refer as the `` abstract neuron model '' . the network then samples from a boltzmann distribution : @xmath20 where @xmath21 is the partition function , and @xmath22 can be interpreted as an energy function @xcite . an important fact of the abstract neuron model is that , according to the dynamics of @xmath16 , the are `` rectangular '' and non - additive . the implementation of a large number of synapses producing such is very difficult to realize in hardware , when compared to first - order linear filters that result in `` alpha''-shaped @xcite . this is because , in the latter model , the synaptic dynamics are linear , such that a single hardware synapse can be used to generate the same current that would be generated by an arbitrary number of synapses ( see also next section ) . as a consequence , we will use alpha - shaped instead of rectangular in our models . the use of the alpha over the rectangular is the major source of degradation in sampling performance , as we will discuss in sec . [ sec : kldivergence ] . [ [ stochastic - neurons . ] ] stochastic neurons . + + + + + + + + + + + + + + + + + + + a neuron whose instantaneous firing rate is consistent with eq . ( [ eq : refr_exp_hazard ] ) can perform neural sampling . ( [ eq : refr_exp_hazard ] ) is a generalization of the poisson process to the case when the firing probability depends on the time of the last spike ( _ i.e. _ it is a renewal process ) , and so can be verified only if the neuron fires stochastically @xcite . stochasticity in neurons can be obtained through several mechanisms , such as a noisy reset potential , noisy firing threshold , or noise injection @xcite . the first two mechanisms necessitate stochasticity in the neuron s parameters , and therefore may require specialized circuitry . but noise injection in the form of background poisson spike trains requires only synapse circuits , which are present in many neuromorphic implementation of spiking neurons @xcite . furthermore , poisson spike trains can be generated self - consistently in balanced excitatory - inhibitory networks @xcite , or using finite - size effects and neural mismatch @xcite . we show that the abstract neuron model in eq . ( [ eq : refr_exp_hazard ] ) can be realized in a simple dynamical system consisting of leaky neurons with noisy currents . the neuron s membrane potential below firing threshold @xmath23 is governed by the following differential equation : @xmath24 where @xmath25 is a membrane capacitance , @xmath26 is the membrane potential of neuron @xmath13 , @xmath27 is a leak conductance , @xmath28 is a white noise term of amplitude @xmath29 ( which can for example be generated by background activity ) , @xmath30 its synaptic current and @xmath23 is the neuron s firing threshold . when the membrane potential reaches @xmath23 , an action potential is elicited . after a spike is generated , the membrane potential is clamped to the reset potential @xmath31 for a refractory period @xmath8 . in the case of the neural , the currents @xmath30 depend on the layer the neuron is situated in . for a neuron @xmath13 in layer @xmath32 @xmath33 where @xmath34 is a current representing the data ( _ i.e. _ the external input ) , @xmath35 is the feedback from the hidden layer activity and the bias , and the @xmath36 s are the respective synaptic weights . for a neuron @xmath17 in layer @xmath37 , @xmath38 where @xmath39 is the feedback from the visible layer , and @xmath40 and @xmath41 are poisson spike trains implementing the bias . the dynamics of @xmath39 and @xmath35 correspond to a first - order linear filter , so each incoming spike results in that rise and decay exponentially ( _ i.e. _ alpha- ) @xcite . can this neuron neuron verify the conditions required for neural sampling ? the membrane potential is already assumed to be equal to the sum of the as required by neural sampling . so to answer the above question we only need to verify whether eq . ( [ eq : refr_exp_hazard ] ) holds . eq . ( [ eq : clif ] ) is a langevin equation which can be analyzed using the fokker - planck equation @xcite . the solution to this equation provides the neuron s input / output response , _ i.e. _ its transfer curve ( for a review , see @xcite ) : @xmath42 where @xmath43 is the error function ( the integral of the normal distribution ) , @xmath44 is the stationary value of the membrane potential when injected by a constant current @xmath45 , @xmath31 is the reset voltage , and @xmath46 . according to eq . ( [ eq : refr_exp_hazard_tau ] ) , the condition for neural sampling requires that the average firing rate of the neuron to be the sigmoid function . although the transfer curve of the noisy neuron eq . ( [ eq : tf ] ) is not equal to the sigmoid function , it was previously shown that with an appropriate choice of parameters , the shape of this curve can be very similar to it @xcite . we observe that , for a given refractory period @xmath8 , the smaller ratio @xmath47 in eq . ( [ eq : clif ] ) , the better the transfer curve resembles a sigmoid function ( fig . [ fig : tf ] ) . transfer curve of a leaky neuron for three different parameter sets where @xmath48 , and @xmath49 $ ] ( dashed grey ) . in this plot , @xmath50 is varied to produce different ratios @xmath47 . the three plots above shows that the fit with the sigmoid function ( solid black ) improves as the ratio decreases.,title="fig : " ] transfer curve of a leaky neuron for three different parameter sets where @xmath48 , and @xmath49 $ ] ( dashed grey ) . in this plot , @xmath50 is varied to produce different ratios @xmath47 . the three plots above shows that the fit with the sigmoid function ( solid black ) improves as the ratio decreases.,title="fig : " ] + transfer curve of a leaky neuron for three different parameter sets where @xmath48 , and @xmath49 $ ] ( dashed grey ) . in this plot , @xmath50 is varied to produce different ratios @xmath47 . the three plots above shows that the fit with the sigmoid function ( solid black ) improves as the ratio decreases.,title="fig : " ] with a small @xmath47 , the transfer function of a neuron can be fitted to @xmath51 where @xmath52 and @xmath53 are the parameters to be fitted . the choice of the neuron model described in eq . ( [ eq : clif ] ) is not critical for neural sampling : a relationship that is qualitatively similar to eq . ( [ eq : tf ] ) holds for neurons with a rigid ( reflective ) lower boundary @xcite which is common in neurons , and for neurons with conductance - based synapses @xcite . this result also shows that synaptic weights @xmath54 , @xmath55 , which have the units of charge are related to the weights @xmath56 by a factor @xmath57 . to relate the neural activity to the boltzmann distribution , eq . ( [ eq : boltzmann_distr ] ) , each neuron is associated to a binary random variable which is assumed to take the value @xmath58 for a duration @xmath18 after the neuron has spiked , and zero otherwise , similarly to @xcite . the relation between the random vector and the neurons spiking activity is illustrated in fig . [ fig : example_rbm10 ] . [ [ calibration - protocol . ] ] calibration protocol . + + + + + + + + + + + + + + + + + + + + + in order to transfer the parameters from the probability distribution eq . ( [ eq : boltzmann_distr ] ) to those of the neurons , the parameters @xmath53 , @xmath52 in eq . ( [ eq : tf_fit ] ) need to be fitted . an estimate of a neuron s transfer function can be obtained by computing its spike rate when injected with different values of constant inputs @xmath45 . the refractory period @xmath18 is the inverse of the maximum firing rate of the neuron , so it can be easily measured by measuring the spike rate for very high input current @xmath45 . once @xmath18 is known , the parameter estimation can be cast into a simple linear regression problem by fitting @xmath59 with @xmath60 . [ fig : calibration ] shows the transfer curve when @xmath61{ms}$ ] , which is approximately exponential in agreement with eq . ( [ eq : refr_exp_hazard ] ) . the shape of the transfer curse is strongly dependent on the noise amplitude . in the absence of noise , the transfer curve is a sharp threshold function , which softens as the amplitude of the noise is increased ( fig . [ fig : tf ] ) . as a result , both parameters @xmath53 and @xmath52 are dependent on the variance of the input currents from other neurons @xmath62 . since @xmath63 , the effect of the fluctuations on the network is similar to scaling the synaptic weights and the biases which can be problematic . however , by selecting a large enough noise amplitude @xmath29 and a slow enough input synapse time constant , the fluctuations due to the background input are much larger than the fluctuations due to the inputs . in this case , @xmath52 and @xmath53 remain approximately constant during the sampling . neural mismatch can cause @xmath52 and @xmath53 to differ from neuron to neuron . from eq . ( [ eq : tf_fit ] ) and the linearity of the postsynaptic currents @xmath62 in the weights , it is clear that this type of mismatch can be compensated by scaling the synaptic weights and biases accordingly . the calibration of the parameters @xmath53 and @xmath52 quantitatively relate the spiking neural network s parameters to the . in practice , this calibration step is only necessary for mapping pre - trained parameters of the onto the spiking neural network . although we estimated the parameters of software simulated neurons , parameter estimation based on firing rate measurements were shown to be an accurate and reliable method for neurons as well @xcite . transfer function of neurons driven by background white noise ( eq . ( [ eq : clif ] ) ) . we measure the firing rate of the neuron as a function of a constant current injection to estimate @xmath64 , where for constant @xmath65 , @xmath66 . ( top ) the transfer function of noisy neurons in the absence of refractory period ( @xmath67 , circles ) . we observe that @xmath68 is approximately exponential over a wide range of inputs , and therefore compatible with neural sampling . crosses show the transfer curve of neurons implementing the abstract neuron eq . ( [ eq : refr_exp_hazard ] ) , exactly . ( bottom ) with an absolute refractory period the transfer function approximates the sigmoid function . the firing rate saturates at @xmath69{hz}$ ] due to the refractory period chosen for the neuron . . ] [ cols="<,<,^,^ " , ] we train the to learn a generative model of the mnist handwritten digits using event - driven ( see sec . [ sec : nnarch ] for details ) . for training , @xmath70 digits selected randomly from a training set consisting of 10000 digits were presented in sequence , with an equal number of samples for each digit . the raster plots in fig . [ fig : trained_rbm ] show the spiking activity of each layer before and after learning for epochs of duration @xmath71{ms}$ ] . the top panel shows the population - averaged weight . after training , the sum of the upwards and downward excursions of the average weight is much smaller than before training , because the learning is near convergence . the second panel shows the value of the modulatory signal @xmath72 . the third panel shows the input current ( @xmath73 ) and the current caused by the recurrent couplings ( @xmath74 ) . two methods to estimate the overall classification performance of the neural can be used . the first is by neural sampling : the visible layer is clamped to the digit only , and the network is run for @xmath75 . the known label is then compared with the positions of the group of class neurons that had the highest population rate . the second method is by minimizing free - energy : the neural parameters are extracted , and for each data sample , the class neurons with the lowest free - energy ( see materials and methods ) is compared to the known label . in both cases , recognition was tested for @xmath76 data samples that were not used during the training . the results are summarized in fig . [ tab : performance ] . as a reference we provide the best performance achieved using the standard and one unit per class label ( @xmath77 ) ( fig . [ tab : performance ] , table row 1 ) , @xmath3 . by mapping the learned parameters to the neural the recognition accuracy reached @xmath78 . when training a neural of neurons using event - driven , the recognition result was @xmath2 ( fig . [ tab : performance ] , table row 2 ) . the performance of this obtained by minimizing its free - energy was @xmath79 . the learned parameters performed well for classification using the free - energy calculation which suggests that the network learned a model that is consistent with the mathematical description of the . in an energy - based model like the the free - energy minimization should give the upper bound on the discrimination performance @xcite . for this reason , the fact that the recognition accuracy is higher when sampling as opposed to using the free - energy method may appear puzzling . however , this is possible because the neural does not exactly sample from the boltzmann distribution , as explained in sec . [ sec : kldivergence ] . this suggests that event - driven compensates for the discrepancy between the distribution sampled by the neural and the boltzmann distribution , by learning a model that is tailored to the spiking neural network . excessively long training durations can be impractical for real - time neuromorphic systems . fortunately , the learning using event - driven is fast : compared to the off - line training ( @xmath80 presentations , in mini - batches of @xmath81 samples ) the event - driven training succeeded with a smaller number of data presentations ( @xmath70 ) , which corresponded to @xmath82{s}$ ] of simulated time . this suggests that the training durations are achievable for real - time neuromorphic systems . [ [ the - choice - of - the - number - of - class - neurons - n_c . ] ] the choice of the number of class neurons @xmath83 . + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + event - driven underperformed in the case of @xmath58 neuron per class label ( @xmath77 ) , which is the common choice for standard and gibbs sampling . this is because a single neuron firing at its maximum rate of @xmath69{hz}$ ] can not efficiently drive the rest of the network without tending to induce spike - to - spike correlations ( _ e.g. _ synchrony ) , which is incompatible with the assumptions made for sampling with neurons and event - driven . as a consequence , the generative properties of the neural degrade . this problem is avoided by using several neurons per class label ( in our case four neurons per class label ) because the synaptic weight can be much lower to achieve the same effect , resulting in smaller spike - to - spike correlations . we test the neural as a generative model of the mnist dataset of handwritten digits , using parameters obtained by running the event - driven . in the context of the handwritten digit task , the s generative property enables it to classify digits , generate them , and infer a digit by combining partial evidence . these features are clearly illustrated in the following experiment ( fig . [ fig : classification_reconstruction_inference ] ) . first the digit @xmath84 is presented ( _ i.e. _ layer @xmath85 is driven by layer @xmath86 ) and the correct class label in @xmath87 activated . second , the neurons associated to class label @xmath88 are clamped , and the network generated its learned version of the digit . third , the right - half part of a digit @xmath89 is presented , and the class neurons are stimulated such that only @xmath84 or @xmath90 are able to activate ( the other class neurons are inhibited , indicated by the gray shading ) . because the stimulus is inconsistent with @xmath90 , the network settled to @xmath84 and reconstructed the left part of the digit . the latter part of the experiment illustrates the integration of information between several partially specified cues , which is of interest for solving sensorimotor transformation or multi - modal sensory cue integration problems @xcite . this feature has been used for auditory - visual sensory fusion in a spiking model @xcite . there , the authors trained a with visual and auditory data , which learned to associate the two sensory modalities , very similarly to how class labels and visual data are associated in our architecture . their network was able to resolve a similar ambiguity as in our experiment in fig . [ fig : classification_reconstruction_inference ] , but using auditory inputs instead of a class label . in the digit generation mode , the trained network had a tendency to be globally bistable , whereby the layer @xmath85 completely deactivated layer @xmath37 . since all the interactions between @xmath85 and @xmath87 take place through the hidden layer , @xmath87 could not reconstruct the digit . to avoid this , we added two populations of neurons that were wired to layers @xmath32 and @xmath37 , respectively . the parameters of these neurons and their couplings were tuned such that each layer was strongly excited when it s average firing rate fell below @xmath91{hz}$ ] . [ [ neural - parameters - with - finite - precision . ] ] neural parameters with finite precision . + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + in hardware systems , the parameters related to the weights and biases can not be set with floating - point precision , as can be done in a digital computer . in current neuromorphic implementations the synaptic weights can be configured at precisions of about @xmath89 bits @xcite . we characterize the impact of finite - precision synaptic weights on performance by discretizing the weight and bias parameters to @xmath89 bits and @xmath88 bits . the set of possible weights were spaced uniformly in the interval @xmath92 , where @xmath93 are the mean and the standard deviation of the parameters across the network , respectively . the classification performance of mnist digits degraded gracefully . in the @xmath89 bit case , it degrades only slightly to @xmath94 , but in the case of @xmath88 bits , it degrades more substantially to @xmath95 . in both cases , the still retains its discriminative power , which is encouraging for implementation in hardware neuromorphic systems . neuromorphic systems are promising alternatives for large - scale implementations of and deep networks , but the common procedure used to train such networks , , involves iterative , discrete - time updates that do not straightforwardly map on a neural substrate . we solve this problem in the context of the with a spiking neural network model that uses the recurrent network dynamics to compute these updates in a continuous - time fashion . we argue that the recurrent activity coupled with dynamics implements an event - driven variant of . using event - driven , the network connectivity remains unchanged during training and testing , enabling the system to learn in an on - line fashion , while being able to carry out functionally relevant tasks such as recognition , data generation and cue integration . the algorithm can be used to learn the parameters of probability distributions other than the boltzmann distribution ( even those without any symmetry assumptions ) . our choice for the , whose underlying probability distribution is a special case of the boltzmann distribution , is motivated by the following facts : they are universal approximators of discrete distributions @xcite ; the conditions under which a spiking neural circuit can naturally perform mcmc sampling of a boltzmann distribution were previously studied @xcite ; and form the building blocks of many deep learning models such as , which achieve state - of - the - art performance in many machine learning tasks @xcite . the ability to implement with spiking neurons and train then using event - based paves the way towards on - line training of of spiking neurons @xcite . we chose the mnist handwritten digit task as a benchmark for testing our model . when the was trained with standard , it could recognize up to 926 out of 1000 of out - of - training samples . the mnist handwritten digits recognition task was previously shown in a digital neuromorphic chip @xcite , which performed at @xmath96 accuracy , and in a software simulated visual cortex model @xcite . however , both implementations were configured using weights trained off - line . a recent article showed the mapping of off - line trained onto spiking neural network @xcite . their results demonstrated hand - written digit recognition using neuromorphic event - based sensors as a source of input spikes . their performance reached up to @xmath97 using leaky neurons . the use of off - line combined with an additional layer explains to a large extent their better performance compared to ours . our work extends @xcite by demonstrating an on - line training using synaptic plasticity , testing its robustness to finite weight precision , and providing an interpretation of spiking activity in terms of neural sampling . to achieve the computations necessary for sampling from the , we have used the neural sampling framework @xcite , where each spike is interpreted as a sample of an underlying probability distribution . @xcite proved that abstract neuron models consistent with the behavior of biological spiking neurons can perform , and have applied it to a basic learning task in a fully visible boltzmann machine . we extended the neural sampling framework in three ways : first , we identified the conditions under which a dynamical system consisting of neurons can perform neural sampling ; second , we verified that the sampling of was robust to finite - precision parameters ; third , we demonstrated learning in a boltzmann machine with hidden units using synapses . in the neural sampling framework , neurons behave stochastically . this behavior can be achieved in neurons using noisy input currents , created by a poisson spike train . spike trains with poisson - like statistics can be generated with no additional source of noise , for example by the following mechanisms : balanced excitatory and inhibitory connections @xcite , finite - size effects in a large network , and neural mismatch @xcite . the latter mechanism is particularly appealing , because it benefits from fabrication mismatch and operating noise inherent to neuromorphic implementations @xcite . other groups have also proposed to use neuron models for computing the boltzmann distribution . @xcite have shown that noisy neurons activation function is approximately sigmoidal as required by the boltzmann machine , and have devised a scheme whereby a global inhibitory rhythm drives the network to generate samples of the boltzmann distribution . @xcite have demonstrated a deep belief network of neurons that was trained off - line , using standard and tested it using the mnist database . independently and simultaneously to this work , @xcite demonstrated that conductance - based neurons in a noisy environment are compatible with neural sampling as described in @xcite . similarly , @xcite find that the choice of non - rectangular and the approximations made by the neurons are not critical to the performance of the neural sampler . our work extends all of those above by providing an online , -based learning rule to train sampled using neurons . [ [ applicability - to - neuromorphic - hardware . ] ] applicability to neuromorphic hardware . + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + neuromorphic systems are sensible to fabrication mismatch and operating noise . fortunately , the mismatch in the synaptic weights and the activation function parameters @xmath53 and @xmath52 are not an issue if the biases and the weights are learned , and the functionality of the is robust to small variations in the weights caused by discretization . these two findings are encouraging for neuromorphic implementations of . however , at least two conceptual problems of the presented architecture must be solved in order to implement such systems on a large - scale . first , the symmetry condition required by the does not necessarily hold . in a neuromorphic device , the symmetry condition is impossible to guarantee if the synapse weights are stored locally at each neuron . sharing one synapse circuit per pair of neurons can solve this problem . this may be impractical due to the very large number of synapse circuits in the network , but may be less problematic when using ( also called _ memristors _ ) crossbar arrays to emulate synapses @xcite . are a new class of nanoscale devices whose current - voltage relationship depends on the history of other electrical quantities @xcite , and so act like programmable resistors . because they can conduct currents in both directions , one circuit can be shared between a pair of neurons . a second problem is the number of recurrent connections . even our of modest dimensions involved almost 2 million synapses , which is impractical in terms of bandwidth and weight storage . even if a very high number of weights are zero , the connections between each pair of neurons must exist in order for a synapse to learn such weights . one possible solution is to impose sparse connectivity between the layers @xcite . this remains to be tested in our model . [ [ outlook - a - custom - learning - rule . ] ] outlook : a custom learning rule . + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + our method combines neurons that perform neural sampling and the rule . although we showed that this leads to a functional model , we do not know whether event - driven is optimal in any sense . this is partly due to the fact that @xmath98 is an approximate rule @xcite , and it is still not entirely understood why it performs so well , despite extensive work in studying its convergence properties @xcite . furthermore , the distribution sampled by the neuron does not exactly correspond to the boltzmann distribution , and the average weight updates in event - driven differ from those of standard , because in the latter they are carried out at the end of the reconstruction step . a very attractive alternative is to derive a custom synaptic plasticity rule that minimizes some functionally relevant quantity ( such as kullback - leibler divergence or contrastive divergence ) , _ given _ the encoding of the information in the neuron @xcite . a similar idea was recently pursued in @xcite , where the authors derived a triplet - based synaptic learning rule that minimizes an upper bound of the kullback - leibler divergence between the model and the data distributions . interestingly , their rule had a similar global signal that modulates the learning rule , as in event - driven , although the nature of this resemblance remains to be explored . such custom learning rules can be very beneficial in guiding the design of on - chip plasticity in neuromorphic and nanotechnologies , and will be the focus of future research . this work was partially funded by the national science foundation ( nsf efri-1137279 ) , the office of naval research ( onr muri 14 - 13 - 1 - 0205 ) , and the swiss national science foundation ( pa00p2_142058 ) . we thank all the anonymous reviewers of a previous version of this article for their constructive comments . j. arthur , p. merolla , f. akopyan , r. alvarez , a. cassidy , s. chandra , s. esser , n. imam , w. risk , dbd rubin , et al . building block of a programmable neuromorphic substrate : a digital neurosynaptic core . in _ neural networks ( ijcnn ) , the 2012 international joint conference on _ , pages 18 . ieee , 2012 . j. bergstra , o. breuleux , f. bastien , p. lamblin , r. pascanu , g. desjardins , j. turian , d. warde - farley , and y. bengio . theano : a cpu and gpu math expression compiler . in _ proceedings of the python for scientific computing conference ( scipy ) _ , volume 4 , 2010 . e. chicca and s. fusi . stochastic synaptic plasticity in deterministic avlsi networks of spiking neurons . in frank rattay , editor , _ proceedings of the world congress on neuroinformatics _ , argesim reports , pages 468477 , vienna , 2001 . argesim / asim verlag . d. corneil , d. sonnleithner , e. neftci , e. chicca , m. cook , g. indiveri , and r. douglas . function approximation with uncertainty propagation in a vlsi spiking neural network . in _ international joint conference on neural networks , ijcnn 2012 _ , pages 29902996 . ieee , 2012 . deiss , r.j . douglas , and a.m. whatley . a pulse - coded communications infrastructure for neuromorphic systems . in w. maass and c.m . bishop , editors , _ pulsed neural networks _ , chapter 6 , pages 15778 . mit press , 1998 . j. fiser , p. berkes , g. orbn , and m. lengyel . statistically optimal perception and learning : from behavior to neural representations : perceptual learning , motor learning , and automaticity . , 14(3):119 , 2010 . g. indiveri , b. linares - barranco , t.j . hamilton , a. van schaik , r. etienne - cummings , t. delbruck , s .- c . liu , p. dudek , p. hfliger , s. renaud , j. schemmel , g. cauwenberghs , j. arthur , k. hynna , f. folowosele , s. saighi , t. serrano - gotarredona , j. wijekoon , y. wang , and k. boahen . neuromorphic silicon neuron circuits . , 5:123 , 2011 . s. joshi , s. deiss , m. arnold , j. park , t. yu , and g. cauwenberghs . scalable event routing in hierarchical neural array architecture with global synaptic connectivity . in _ cellular nanoscale networks and their applications ( cnna ) , 2010 12th international workshop on _ , pages 16 . ieee , 2010 . b. pedroni , s. das , e. neftci , k. kreutz - delgado , and g. cauwenberghs . neuromorphic adaptations of restricted boltzmann machines and deep belief networks . in _ international joint conference on neural networks , ijcnn 2013 _ , 2013 . ( accepted ) . j. schemmel , d. brderle , a. grbl , m. hock , k. meier , and s. millner . a wafer - scale neuromorphic hardware system for large - scale neural modeling . in _ international symposium on circuits and systems , iscas 2010 _ , pages 19471950 . ieee , 2010 . teresa serrano - gotarredona , timothe masquelier , themistoklis prodromakis , giacomo indiveri , and bernabe linares - barranco . stdp and stdp variations with memristors for spiking neuromorphic learning systems . , 7 , 2013 . t. yu and g. cauwenberghs . log - domain time - multiplexed realization of dynamical conductance - based synapses . in _ international symposium on circuits and systems , ( iscas ) , 2010 _ , pages 2558 2561 . ieee , june 2010 .

and deep belief networks have been demonstrated to perform efficiently in a variety of applications , such as dimensionality reduction , feature learning , and classification . their implementation on neuromorphic hardware platforms emulating large - scale networks of spiking neurons can have significant advantages from the perspectives of scalability , power dissipation and real - time interfacing with the environment . however the traditional architecture and the commonly used training algorithm known as are based on discrete updates and exact arithmetics which do not directly map onto a dynamical neural substrate . here , we present an event - driven variation of to train a constructed with neurons , that is constrained by the limitations of existing and near future neuromorphic hardware platforms . our strategy is based on neural sampling , which allows us to synthesize a spiking neural network that samples from a target boltzmann distribution . the recurrent activity of the network replaces the discrete steps of the algorithm , while carries out the weight updates in an online , asynchronous fashion . + we demonstrate our approach by training an composed of leaky neurons with synapses to learn a generative model of the mnist hand - written digit dataset , and by testing it in recognition , generation and cue integration tasks . + our results contribute to a machine learning - driven approach for synthesizing networks of spiking neurons capable of carrying out practical , high - level functionality .

CHICAGO (CBS) — Sunny summer weather brought plenty of people to Lake Michigan this weekend, with sometimes deadly consequences. Lake Michigan saw its 20th drowning so far this year with two men in Gary and one man in Grand Haven dying in the water on Saturday, according to Dave Benjamin, co-founder of the Great Lakes Surf Rescue Project. “It is very unfortunate, but drowning can be pretty predictable when we’re going to have warmer weather, with some north winds, and it occurring on a weekend,” he said. A 23-year-old man drowned Saturday while kayaking on the lake near Grand Haven, Michigan. Two men, ages 26 and 37, also died Saturday near the air show in Gary, Indiana, while they were trying to rescue two children struggling in the water. “Would-be rescuers often become the drowning victim as well. They don’t have experience with water rescue, they normally don’t have the physical stamina or the training,” he said. WBBM 780’s Nancy Harty WBBM 780/105.9FM playpause Benjamin said the Gary drownings happened despite repeated warnings by the Surf Rescue Project and air show organizers not to swim, due to strong currents. He said, if you are going to try to rescue someone else struggling in the water, you should first grab something that floats. “Even if it’s a football or soccer ball, you could easily throw to the person,” Benjamin said. “An NFL football is enough flotation to keep an adult floating.” Benjamin estimated there could be another 12 drownings in Lake Michigan this year. ||||| David Halford (left) and Kyle Reibly (right), died Saturday while rescuing a child from dangerously strong currents at a beach in Gary, Indiana. Two people drowned and three others were rescued from the water at a northwest Indiana beach Saturday afternoon, according to the Gary Fire Department. Around 2:28 p.m., fire officials responded to a call at Wells Street Beach in Gary, Indiana. There they found 5 people stuck in powerful currents in Lake Michigan. The National Weather Service issued a Beach Hazards Statement warning beachgoers to stay out of the water Saturday, as high waves and strong currents proved treacherous. Emergency responders pulled the five people from the water, officials said. Two left on their own from the beach, and three were taken to area hospitals, according to Mark Jones, the Chief of Operations for the Gary Fire Department. Of the three that were taken to the hospital, two were pronounced dead while the third was listed in stable condition, authorities said. David Halford, 37, of the 3700 block of Colbourne St in Hobart, Indiana, and Kyle Reibly, 26, of the 1200 block of N Indiana St in Griffith, Indiana, were both pronounced dead before 4 p.m., according to the Lake County Coroner's office. Halford was initially incorrectly identified by the coroner as David Alden. Vernon Lesner was one of the people who survived the experience, and he told NBC 5 that he and three others, including his good friend David, jumped into the water to rescue a child struggling in the current. "We were having a good time, and all of a sudden someone said there's a kid in the water," Lesner said. "We had a mission," he added. "We were like, 'Hey this kid's coming back to shore, no matter what. No matter what happens, we all stick together, and that's what we did." Lesner said he was pulled from the water, and once he began breathing and regained consciousness, he asked where his friend Dave was. But Halford was already in an ambulance. Friends and family remembered Dave, a father of three, as someone who took care of everyone, even going out of his way to help strangers. "I think he's a hero," said friend Ron Smith. "He's a hero. He went out in a blaze of glory." ||||| Starting in 1996, Alexa Internet has been donating their crawl data to the Internet Archive. Flowing in every day, these data are added to the Wayback Machine after an embargo period. ||||| Two people drowned and three others were injured Saturday while swimming in Lake Michigan in Gary, where beaches were under a hazard warning, officials said. The two men who drowned were identified as David Halford, 37, of Hobart, and Kyle Reibly, 26, of Griffith, according to the Lake County coroner’s office. Both men were pronounced dead at Wells Street Beach after being pulled from the water, according to a release from the office. The coroner has preliminarily listed each man's cause of death as drowning. A woman who nearly drowned was stabilized at Methodist Hospital Northlake in Gary, said Mark Jones, chief operating officer for the Gary Fire Department. Two other people also were rescued from the water but declined to be taken to hospitals, Jones said. All five had been swimming at Wells Street Beach, he said. Coroner Merrilee Frey confirmed the two deaths, one of which was initially incorrectly said to have occurred at Chesterton Beach. The woman who was hospitalized became caught in the current as she was trying to help a child who was struggling in the water, Frey said. The child made it out of the water without injury, she said. People were being warned not to swim Saturday because of dangerous lake currents. An announcer at the Gary Air Show repeated the warning throughout the event, which lasted from 11 a.m. to 3 p.m. Kyle Telechan, Post-Tribune U.S. Army Golden Knights soar over Marquette Park on Saturday, July 9, during the first day of the 2016 Gary Air Show. U.S. Army Golden Knights soar over Marquette Park on Saturday, July 9, during the first day of the 2016 Gary Air Show. (Kyle Telechan, Post-Tribune) (Kyle Telechan, Post-Tribune) The National Weather Service had earlier issued a beach hazards statement until Saturday at 10 p.m., warning that "life-threatening waves and currents are expected at the beaches. People visiting the beaches should stay out of the water." The Great Lakes Surf Rescue Project issued a "dangerous currents alert," advising that the north to northwest winds could produce waves of 2 to 6 feet. "Winds equal waves and waves equal dangerous currents on the Great Lakes," project executive Dave Benjamin said in an online message about the conditions in Lake Michigan. "We can expect to see a combination of rip currents, longshore currents, and structural currents at all beaches tomorrow. "The surf conditions that are forecasted for Saturday are eerily similar to the 2012 Gary Air Show surf forecast when 15-year-old Cory McFry drowned," Benjamin said. Carrie Napoleon is a freelance reporter for the Post-Tribune.

– Two men drowned while trying to rescue a child struggling in powerful currents in Lake Michigan on Saturday. David Halford, 37, and Kyle Reibly, 26, were among a group of four that entered the water at Wells Street Beach in Gary, Ind., after the child around 2:30pm. "We were having a good time, and all of a sudden someone said there's a kid in the water," says Vernon Lesner, a friend of Halford. "We had a mission. We were like, 'Hey this kid's coming back to shore, no matter what." Lesner tells NBC Chicago that he lost consciousness. After being saved by rescuers and coming to on shore, he learned Halford, a father of three, was gone. Fire officials say they arrived and found five people in danger. Halford and Reibly were pronounced dead, while a woman was taken to a hospital in stable condition, reports the Times of Northwest Indiana. The child and Lesner walked away from the scene. "I think he's a hero," a friend says of Halford. "He went out in a blaze of glory." It isn't clear if the group was at the beach for the Gary Air Show happening at the same time. Announcers repeatedly told visitors to avoid Lake Michigan as the National Weather Service had warned of "life-threatening waves and currents," per the Post-Tribune. A 23-year-old man also drowned Saturday on Lake Michigan, raising the tally to 20 drownings this year, per CBS Chicago.

Kelly Ripa Ballistic Over Strahan Shocker Kelly Ripa's Ballistic Over Strahan Shocker EXCLUSIVE Kelly Ripa is livid over Michael Strahan's departure from her show, largely because she was shockingly disrespected by Disney honchos. TMZ broke the story ... Kelly was blindsided by Tuesday's announcement. She found out at 10:30 in the morning ... the same time Disney made the announcement. She never got a call from Disney CEO Bob Iger or anyone else at the Mouse House. Our ABC sources say Kelly -- and virtually everyone on her show -- feels Disney has screamed to the world they don't care about 'Live' ... their singular focus is breathing life into 'GMA,' which has lost a big chunk of its audience over the last year. We're told there's serious talk about giving 'Live' the boot at 9 AM and adding a third hour to 'GMA.' It's unclear if Disney is eyeing a time slot later in the morning for Kelly's show. It's pretty incredible, since 'Live' has been super successful on Kelly's watch. Adding a 3rd hour to 'GMA' is the logical next move, since Strahan has established himself in the 9 AM time slot. As for Kelly, it's unclear if Disney can ever win her back. It's not difficult to understand how pissed she is ... it's like the Ann Curry/NBC mess, but more outrageous. ||||| Starting in 1996, Alexa Internet has been donating their crawl data to the Internet Archive. Flowing in every day, these data are added to the Wayback Machine after an embargo period.

– Kelly Ripa didn't show up for Live! With Kelly and Michael Wednesday morning, and sources tell TMZ it's because she's outraged over the way Michael Strahan is handling his exit from the show. Ripa reportedly heard the news in a meeting with Strahan, a producer, and a network manager after Tuesday's show, but the meeting didn't take place until the same time Disney made the public announcement. Sources say Disney CEO Bob Iger told Strahan to keep the news secret from everyone, but Ripa believes she deserved to be told earlier than she was because she played such a big role in Strahan's rise to TV success. The rest of the Live! staff is also said to be none too happy they were kept in the dark. Sources also say there's no love lost between Ripa and Strahan; Ripa reportedly thinks Strahan is conceited and doesn't respect her. Strahan reportedly reached out to Ripa after the announcement of his exit—and he lauded her at the end of Wednesday's show—but she has yet to respond. No one from Disney is said to have reached out to her, and sources say she feels Disney has made it obvious they only care about boosting Good Morning America (which Strahan is leaving to host) and not Live. Sources expect Ripa to miss more upcoming shows. (Here are the two rumored frontrunners for Strahan's Live! spot.)

SECTION 1. SHORT TITLE. This Act may be cited as the ``Deceptive Practices and Voter Intimidation Prevention Act of 2005''. SEC. 2. DECEPTIVE PRACTICES IN ELECTIONS. (a) Civil Action.-- (1) In general.--Subsection (b) of section 2004 of the Revised Statutes (42 U.S.C. 1971(b)) is amended-- (A) by striking ``No person'' and inserting the following: ``(1) No person''; and (B) by inserting at the end the following new paragraph: ``(2) No person, whether acting under color of law or otherwise, shall knowingly deceive any other person regarding-- ``(A) the time, place, or manner of conducting a general, primary, run-off, or special election for the office of President, Vice President, presidential elector, Member of the Senate, Member of the House of Representatives, or Delegate or Commissioner from a territory or possession; or ``(B) the qualifications for or restrictions on voter eligibility for any election described in subparagraph (A).''. (2) Private right of action.-- (A) In general.--Subsection (c) of section 2004 of the Revised Statutes (42 U.S.C. 1971(c)) is amended-- (i) by striking ``Whenever any person'' and inserting the following: ``(1) Whenever any person''; and (ii) by adding at the end the following new paragraph: ``(2) Any person aggrieved by a violation of subsection (b)(2) may institute a civil action or other proper proceeding for preventive relief, including an application in a United States district court for a permanent or temporary injunction, restraining order, or other order.''. (B) Conforming amendments.-- (i) Subsection (e) of section 2004 of the Revised Statutes (42 U.S.C. 1971(e)) is amended by striking ``subsection (c)'' and inserting ``subsection (c)(1)''. (ii) Subsection (g) of section 2004 of the Revised Statutes (42 U.S.C. 1971(g)) is amended by striking ``subsection (c)'' and inserting ``subsection (c)(1)''. (b) Criminal Penalty.--Section 594 of title 18, United States Code, is amended-- (1) by striking ``Whoever'' and inserting the following: ``(a) Intimidation.--Whoever''; and (2) by adding at the end the following: ``(b) Deceptive Acts.-- ``(1) Prohibition.-- ``(A) In general.--It shall be unlawful for any person to knowingly deceive another person regarding the time, place, or manner of an election described in subparagraph (B), or the qualifications for or restrictions on voter eligibility for any such election, with the intent to prevent such person from exercising the right to vote in such election. ``(B) Election.--An election described in this subparagraph is any general, primary, run-off, or special election for the office of President, Vice President, presidential elector, Member of the Senate, Member of the House of Representatives, Delegate of the District of Columbia, or Resident Commissioner. ``(2) Penalty.--Any person who violates paragraph (1) shall be fined not more than $100,000, imprisoned not more than 1 year, or both.''. (c) Effective Date.--The amendments made by this section shall take effect on the date of the enactment of this Act. SEC. 3. REPORTING FALSE ELECTION INFORMATION. (a) In General.--Any person may report to the Assistant Attorney General of the Civil Rights Division of the Department of Justice, or the designee of such Assistant Attorney General, any act of deception regarding-- (1) the time, place, or manner of conducting a general, primary, run-off, or special election for Federal office; or (2) the qualifications for or restrictions on voter eligibility for any general, primary, run-off, or special election for Federal office. (b) Corrective Action.-- (1) In general.--Except as provided in paragraph (2), not later than 48 hours after receiving a report under subsection (a), the Assistant Attorney General shall investigate such report and, if the Assistant Attorney General determines that an act of deception described in subsection (a) occurred, shall-- (A) undertake all effective measures necessary to provide correct information to voters affected by the deception, and (B) refer the matter to the appropriate Federal and State authorities for criminal prosecution. (2) Reports within 72 hours of an election.--If a report under subsection (a) is received within 72 hours before the election described in such subsection, the Assistant Attorney General shall immediately investigate such report and, if the Assistant Attorney General determines that an act of deception described in subsection (a) occurred, shall immediately undertake all effective measures necessary to provide correct information to voters affected by the deception. (3) Regulations.-- (A) In general.--The Attorney General shall promulgate regulations regarding the methods and means of corrective actions to be taken under paragraphs (1) and (2). Such regulations shall be developed in consultation with the Election Assistance Commission, civil rights organizations, voting rights groups, State election officials, voter protection groups, and other interested community organizations. (B) Study.-- (i) In general.--The Attorney General, in consultation with the Federal Communications Commission and the Election Assistance Commission, shall conduct a study on the feasibility of providing the corrective information under paragraphs (1) and (2) through public service announcements, the emergency alert system, or other forms of public broadcast. (ii) Report.--Not later than 180 days after the date of the enactment of this Act, the Attorney General shall submit to Congress a report detailing the results of the study conducted under clause (i). (c) Reports to Congress.-- (1) In general.--Not later than 90 days after any primary, general, or run-off election for Federal office, the Attorney General shall submit to the appropriate committees of Congress a report compiling and detailing any allegations of deceptive practices submitted pursuant to subsection (a) and relating to such election. (2) Contents.-- (A) In general.--Each report submitted under paragraph (1) shall include-- (i) detailed information on specific allegations of deceptive tactics; (ii) any corrective actions taken in response to such allegations; (iii) the effectiveness of any such corrective actions; (iv) any suit instituted under section 2004(b)(2) of the Revised Statutes (42 U.S.C. 1971(b)(2)) in connection with such allegations; (v) statistical compilations of how many allegations were made and of what type; (vi) the geographic locations of and the populations affected by the alleged deceptive information; and (vii) the status of the investigations of such allegations. (B) Exception.--The Attorney General may withhold any information that the Attorney General determines would unduly interfere with an on-going investigation. (3) Report made public.--The Attorney General shall make the report required under paragraph (1) publicly available through the Internet and other appropriate means. (d) Federal Office.--For purposes of this section, the term ``Federal office'' means the office of President, Vice President, presidential elector, Member of the Senate, Member of the House of Representatives, or Delegate or Commissioner from a territory or possession of the United States. (e) Authorization of Appropriations.--There are authorized to be appropriated to the Attorney General such sums as may be necessary to carry out this section.

Deceptive Practices and Voter Intimidation Prevention Act of 2005 - Amends the Revised Statutes and federal criminal law to prohibit any person, whether acting under color of law or otherwise, from knowingly deceiving any other person regarding: (1) the time, place, or manner of conducting any federal election; or (2) the qualifications for or restrictions on voter eligibility for any such election. Creates a private right of action for any person aggrieved by a violation of such prohibition. Prescribes a criminal penalty for such deceptive acts. Authorizes any person to report a deceptive act to the Assistant Attorney General (AAG) of the Civil Rights Division of the Department of Justice (or a designee). Requires the AAG to investigate such a report within 48 hours after its receipt and provide correct information to the voters if it is determined that an act of deception occurred. Requires an immediate investigation if such a report is received within 72 hours before an election. Directs the AAG, in such an instance, to undertake immediately all effective measures necessary to provide correct information to voters affected by the deception. Directs the Attorney General to study the feasibility of providing such corrective information through public service announcements, the emergency alert system, or other forms of public broadcast.

inflatable penile prostheses ( ipp ) have been a successful method of treating men with erectile dysfunction since the early 1970s . ipp are comprised of two intracorporal cylinders , a scrotal pump and a fluid reservoir . these reservoirs may be placed in the space of retzius , in a pre - peritoneal or retroperitoneal location , or in layers of the abdominal wall . complications relating to ipp include patient dissatisfaction , mechanical failure , infection , herniation and occasionally migration . in the non - infective setting , the routine removal of the original reservoir is not standard practice during three - component ipp replacement . we present a case of a retained reservoir presenting as a cystic abdominal mass and bothersome luts , 15 years after the removal of the penile components of a three - piece penile prosthesis . a sixty eight year old gentlemen who had undergone removal of a three - piece penile prosthesis and placement of a malleable prosthesis 15 years previously presented with symptoms of urgency , urinary frequency , and a feeling of incomplete bladder emptying . his past medical history included erecticle dysfunction secondary to diabetes related vascular disease , end stage renal failure requiring haemodialysis thrice weekly and ischaemic heart disease . with respect to his penile prosthesis the patient reported a mechanical failure shortly after the initial ipp was inserted in 1998 . this prompted the replacement of the three piece device with a two piece malleable prosthesis . at the time of the initial ipp removal the initial ipp procedure was performed in a different institution and attempts made to track the make and model of the device were unsuccessful . whilst awaiting investigations for his lower urinary tract symptoms he developed an episode of acute urinary retention . cystoscopy demonstrated a normal bladder mucosa , with an indentation on the anterior surface of the bladder wall . this was followed up with a computed tomography ( ct ) which demonstrated a 10 cm 10 cm cyst , presumed to be of dermoid origin . the patient went on to have a transurethral resection of the prostate as it was thought his urinary retention was secondary to bladder outflow obstruction . a follow up scan seven months later demonstrated an increase in the size of the cyst to 13 cm 12 cm , which appeared to be abutting and exerting a mass effect upon the anterior aspect of the bladder wall . the scan also suggested that the cyst contained a foreign body likely to represent a retained penile prosthesis reservoir ( fig . a percutaneous aspiration of the cyst was offered to the patient however he was not keen for any intervention as his symptoms were manageable . the patients urinary tract symptoms continued to deteriorate over the course of nine months and on examination a large anterior abdominal mass was palpable . a further ct scan showed the cyst surrounding the retained reservoir had enlarged substantially , measuring 21 cm in maximum axial diameter ( fig . the patient agreed to surgical intervention , as the symptoms were unbearable . an initial attempt to remove the reservoir the cyst was punctured in the lower midline with an 18 g percutaneous access needle through which a guidewire ( sensor , boston scientific ) was advanced into the cyst . serial fascial dilators ( cook ) followed by balloon dilatation ( nephromax , boston scientific ) allowed the insertion of a 30f amplatz sheath to create a controlled access into the cyst . four litres of purulent fluid were evacuated and the cyst thoroughly washed out through a 24ch nephroscope ( wolff ) to obtain a clear view of the retained reservoir . the size of the reservoir did not allow removal through the amplatz sheath , therefore a limited midline laparotomy was performed using the sheath as guide to enter the cyst . after further washout a 24ch robinson drain was left in the cavity and the abdomen closed in layers . the microbiology analysis identified pus cells however there was no organism visualized on gram stain and no growth when cultured . inflammatory reaction to the foreign body and subsequent erosion of an ipp reservoir is an infrequent but severe complication of ipp insertion , replacement or infection . there have been three mechanisms proposed whereby an ipp reservoir may injure the bladder : gradual erosion into the bladder ; inadvertent surgical placement into the bladder ; and laceration of the bladder when an ipp reservoir is re - inflated during a revision procedure . we present the first case whereby a retained reservoir has led to the formation of a large reactive cyst causing pressure effect on the bladder . a number of previous publications have described de - functionalized ipp reservoir complications . in 1999 , munoz described a patient who had a three component ipp placed , but 2 years later had the cylinders and pump removed and replaced with a two - component ipp . two years thereafter , with no signs of urinary tract or peri - prosthetic infection , he developed intravesical erosion of the de - functionalized ipp reservoir , requiring laparotomy and reservoir removal . in 2002 , jones et al . reported four cases of intravesical erosion of retained , de - functionalized ipp reservoirs in patients who only had their cylinders and pump removed . these patients presented 315 years ( mean 7 years ) postoperatively , and required either endoscopic or open - reservoir removal . there have been reports of retained reservoirs migrating and eroding into sigmoid colon , ileal conduit , neobladders , seminal vesicles and ureters . levine and hoeh describe six cases of reservoir complications including reservoir herniation , direct inguinal herniation , bladder laceration , ectopic reservoir placement , iliac vein compression and a vascular laceration . infection remains the primary indication for penile prosthesis removal and in this setting removal of the reservoir is routine . however the need to remove the reservoir in the setting of prosthesis malfunction or patient dissatisfaction may be questioned , for it has been thought to be a relative innocuous entity . in 2004 , rajpurkar et al . it was their practice to insert new cylinders , pump and reservoir , but to leave the original reservoir in situ . with a mean of 50 months of follow up , they reported one infection , and no complications related to the originally retained reservoir . they concluded that routine removal of the original reservoir was not required during three - component ipp replacement . those in favour of this approach suggest that pursuing a retained reservoir may be difficult due to extensive scar and may require extra time as well as a secondary incision to extract . erosion of retained prosthetic materials can have disastrous consequences that can be avoided if complete explantation is carried out immediately . kava and burdick - will recently described their case series of retained foreign bodies complicated by infections necessitating removal . they devised an implant - specific checklist to ensure removal of all device - related foreign bodies when explanting an infected penile prosthesis . we advocate the use of such a checklist during removal of penile prosthesis in the non infected setting . in particular the use of pre - operative imaging is indispensible in confirming the presence and location of the retained foreign bodies . in patients with a history of ipp presenting with new luts , inflammatory reactions of the reservoir should be considered in the differential diagnosis and investigation with cystoscopy and computed tomography included early in the investigatory armament of the urologist . in conclusion based on our case report and the literature described it is our belief that a defunctionalized reservoir serves no purpose ; rather it can only cause trouble in the future . the authors of this manuscript have no conflicts of interest to disclose as described by international journal of surgical case reports . the results presented in this paper have not been published previously in whole or part . written informed consent was obtained from the patient for publication of this case report and accompanying images . a copy of the written consent is available for review by the editor - in - chief of this journal on request . hamid abboudi , marco bolgeri , andrew chetwood writing ; rajesh nair writing and data analysis ; andy symes , philip thomas review and writing.key learning pointspatients presenting with luts require a detailed history including previous urological surgery.always consider removing all three parts of an inflatable penile prosthesis where the device has failed or become infected . patients presenting with luts require a detailed history including previous urological surgery.always consider removing all three parts of an inflatable penile prosthesis where the device has failed or become infected . always consider removing all three parts of an inflatable penile prosthesis where the device has failed or become infected .

introductioninflatable penile prostheses ( ipp ) have been a successful method of treating men with erectile dysfunction since the early 1970s . ipp are comprised of two intracorporal cylinders , a scrotal pump and a fluid reservoir.presentation of casewe present a case of a retained reservoir in a sixty eight year old gentlemen presenting with a cystic abdominal mass and bothersome luts , 15 years after the removal of the penile components of a three - piece penile prosthesis . percutaneous drainage of the cyst was performed , with four litres of purulent fluid evacuated . a midline laparotomy was required to remove the reservoir and drain the collection completely.discussioninflammatory reaction and subsequent erosion of an ipp reservoir is an infrequent but severe complication of ipp insertion , replacement or infection . infection remains the primary indication for penile prosthesis removal and in this setting removal of the reservoir is routine . a thorough literature search has identified that in the non - infective setting , the routine removal of the original reservoir is not standard practice during three - component ipp replacement . in patients with a history of ipp presenting with new luts , reservoir erosion should be considered in the differential diagnosis and investigation with cystoscopy and computed tomography included early in the investigatory armament of the urologist.conclusionit is our belief that a defunctionalized reservoir serves no purpose ; rather it can only cause trouble in the future . consequently , at our institution we do not leave defunctionalized reservoirs in situ .

the basic pathological changes are diffuse pulmonary fibrosis and silicotic nodule [ 1 , 2 ] . inhaled silica particles are firstly recognized by the scavenger receptors on alveolar macrophages and consequently activate alveolar macrophages secreting cytokines and chemokines to induce the influx of inflammatory cells including macrophages , neutrophils , and lymphocytes [ 3 , 4 ] . upon the activation of innate immune , silicosis represents acute inflammatory reaction at the early stage , which is characterized by the infiltration of inflammatory cells and destruction of alveolar wall . accompanied by the emergence of tissue repair , silicosis progresses to diffuse interstitial fibrosis or eventually forms silicotic nodule along with the deposition of extracellular matrix . nave cd4 t cells initiate to differentiate into t helper cells under the activation of tcr signal and the concurrent interaction between costimulatory molecules and specific cytokines , such as th1 , th2 , th17 , and tregs [ 68 ] . whereas th2 cells induce fibrogenic response by secreting cytokines such as il-4 and il-13 , which are known to mediate , fibroblasts differentiate into myofibroblasts . tregs can modulate this balance to a th2 dominant response by suppressing th1 response in a direct or indirect manner . based on the regulatory role of tregs in silicosis , th17 cells are a recently discovered subset of cd4 t cells which produce il-17 and are primarily recognized as an important inducer of autoimmune disease [ 7 , 12 ] . subsequent studies also reveal the role of th17 cells in silica - induced lung inflammation and fibrosis [ 1317 ] . the differentiation of th17 cells depends on the joint action of tgf- and il-6 . nevertheless , il-23 is essential to promote the proliferation rather than the generation of th17 cells . tgf- alone can facilitate the differentiation of tregs by inducing foxp3 [ 19 , 20 ] . however , tgf- plus il-6 can inhibit tregs and induce the differentiation of th17 cells , so there may exist a reciprocal association between tregs and th17 cells , and il-6 may be the regulator of this balance [ 18 , 21 ] . canonical wnt/-catenin is an evolutionarily conserved signaling pathway that controls the embryonic development and cell - fate decision [ 22 , 23 ] . -catenin is degraded by a destruction complex consisting of axis inhibition protein , adenomatous polyposis coli , casein kinase 1 , and glycogen synthase kinase 3. in the presence of wnt ligands , transmembrane protein frizzled and its coreceptor lrp5/6 are activated to disrupt the destruction complex ; hence -catenin proteins accumulate and then translocate into the nucleus to generate target gene transcription . in the immune system , the role of wnt/-catenin pathway in thymic t cells development has been fully studied . however , the association between peripheral t lymphocytes differentiation and wnt/-catenin pathway still needs to be explored . it had been proved that -catenin combined with tcf-1 activated the gata3 transcription to initiate th2 differentiation [ 26 , 27 ] . cd4cd25tregs expressing stable -catenin inhibited inflammation more effectively due to the superior ability to survive . on the contrary , another study demonstrated that activation of wnt/-catenin pathway competed with the function of foxp3 and thus reduced the suppressive ability of tregs . there are studies that also delineated that inhibition of wnt/-catenin pathway promoted th17 differentiation [ 30 , 31 ] . these suggest that wnt/-catenin pathway may play an important role in cd4 t cells mediated inflammation or fibrosis . our previous study had demonstrated that activation of wnt/-catenin pathway was involved in the development of experimental silicosis . so we suggested that wnt/-catenin pathway may participate in regulating silica - induced inflammation and fibrosis . in the current study , we used a lentivirus expressing -catenin shrna to decrease target mrna , which continuously blocked the wnt/-catenin pathway in the lung . all mice were maintained in specific pathogen - free conditions and fed a standard mouse chow at an environmental temperature of 24 1c and a 12 h/12 h light / dark cycle with water available ad libitum . the animal study was approved by the animal care and use committee of china medical university ( cmu62043018 ) , which complies with the national institutes of health guide for the care and use of laboratory animals . natural crystalline silica particles ( min - u - sil 5 ground silica ; size distribution : 97% < 5 m diameter , 80% <3 m diameter ; median diameter 1.4 m ) were obtained from the u.s . all the mice were randomly divided into four groups , as follows : ( 1 ) direct oral - tracheal instillation of 0.1 ml sterile saline ( saline group ) ; ( 2 ) exposure to silica by direct oral - tracheal instillation of 1 mg silica crystals suspended in a total volume of 0.1 ml sterile saline ( silica group ) ; ( 3 ) direct oral - tracheal instillation of 1 mg silica crystals and 3 10 transducing units ( tu ) of -catenin shrna suspended in a total volume of 0.1 ml sterile saline ( silica + -catenin shrna group ) ; ( 4 ) direct oral - tracheal instillation of 1 mg silica crystals and 3 10 transducing units ( tu ) of nc shrna suspended in a total volume of 0.1 ml sterile saline ( silica + nc shrna group ) . the method of exposure of the mice to silica crystals ( min - u - sil 5 ) has been previously described . mice were sacrificed on days 7 , 28 , and 56 after oral - tracheal instillation . the lungs of the mice were removed and washed in cold phosphate - buffered saline ( pbs ) after sacrifice of the mice . bronchoalveolar lavage fluid ( balf ) was obtained by cannulating the trachea and then injecting and retrieving 1 ml aliquots of sterile physiological saline two times . after lysis of red blood cells ( rbcs ) , the balf cell pellet was washed and resuspended in pbs . macrophages , neutrophils , and lymphocytes were identified in 200 cells using standard morphologic criteria . hilar lymph nodes ( hlns ) were harvested , dissected with needles , and digested with 0.25% trypsin for 5 min at 37c . the digestion reaction was terminated by the addition of 3% fetal bovine serum in pbs , and samples were centrifuged at 1,500 rpm and 4c for 8 min . cells from the hlns were resuspended in pbs and stimulated with cell stimulation cocktail ( including phorbol-12-myristate-13-acetate ( pma ) , ionomycin , brefeldin a , and monensin ) ( 2 l / ml ) ( ebioscience inc . , san diego , ca , usa ) for 5 h in complete rpmi-1640 . cells were then incubated with anti - mouse cd4 percp - cy5.5 clone : rm4 - 5 for 20 min at 4c in the dark . after cellar surface staining , cells were fixed and permeabilized using standard reagents , according to the manufacturer 's protocols ( ebioscience inc . ) . cells were then stained with an anti - mouse il-17a pe clone : ebio17b7 ; an anti - mouse foxp3 efluor 660 clone : fjk-16s ; and an anti - mouse ifn- alexa fluor 488 clone : xmg1.2 ( ebioscience inc . ) . cells were subsequently analyzed using a facscanto ii flow cytometer ( bd biosciences , franklin lakes , nj ) . dead cells and silica particles were gated out according to forward scattering ( fsc ) and side scattering ( ssc ) . cytokines in balf were measured by using bd cba mouse th1/th2/th17 cytokine kit ( bd biosciences , san jose , ca , usa ) . samples were measured on the facscanto ii flow cytometer ( bd biosciences , franklin lakes , nj ) and analyzed by fcap array software ( bd biosciences , franklin lakes , nj ) . fluorescence intensity was proportional to the amount of a given cytokine in a vial , and the protein concentrations of the test samples were estimated according to the standard curves acquired after analysis of standard dilutions . total rna was extracted from lung homogenates using trizol reagent ( invitrogen , carlsbad , ca , usa ) , according to the manufacturer 's protocol . total lung rna ( 2 g ) samples were reverse - transcribed ( rt ) separately in 20-l volumes using a program of 37c for 15 min and 85c for 5 sec . primers and taqman probes sequences were as follows : il-1 , sense 5-tgacctgggctgtcctgatg-3 , antisense 5-ggtgctcatgtcctcatcctg-3 ; il-17a , sense 5-gcaaaagtgagctccagaagg-3 , antisense 5-tcttcattgcggtggagagtc-3 ; il-6 , sense 5-caattccagaaaccgctatgaag-3 , antisense 5-gtagggaaggccgtggttg-3 ; ifn- , sense 5-aagcgtcattgaatcacacctg-3 , antisense 5-tgacctcaaacttggcaatactc-3 ; il-10 , sense 5-ggggccagtacagccgggaa-3 , antisense 5-ctggctgaaggcagtccgca-3 ; foxp3 , sense 5-aagccccggagaggcagagg-3 , antisense 5-tgcaggctcaggttgtggcg-3 ; il-4 , sense 5-aaaatcacttgagagagatcatcgg-3 ; antisense 5-gttgctgtgaggacgtttgg-3 ; il-13 , sense 5-cccctgtgcaacggcagcat-3 ; antisense 5-gaaggggccgtggcgaaaca-3 ; and gapdh , sense 5-caatgtgtccgtcgtggatct-3 , antisense 5-gtcctcagtgtagcccaagatg-3. the probe sequences were as follows : il-1 , 5-(fam ) tcgcagcagcacatcaacaagagc ( bhq1)-3 ; il-17a , 5-(fam ) cctcagactacctcaaccgttccac ( bhq1)-3 ; il-6 , 5-(fam ) caccagcatcagtcccaagaaggca ( bhq1)-3 ; ifn- , 5-(fam ) cttcttcagcaacagcaaggcgaa ( bhq1)-3 ; il-10 , 5-(fam ) gcacccacttcccagtcggccagagcc ( bhq1)-3 ; foxp3 , 5-(fam ) accaccccgccacctggaagaatgcca ( bhq1)-3 ; il-4 , 5-(fam ) tggcgtcccttctcctgtgacctcg ( bhq1)-3 ; il-13 , 5-(fam ) tggacctggccgctggcgggt ( bhq1)-3 ; and gapdh , 5-(fam ) cgtgccgcctggagaaacctgcc ( bhq1)-3. for t - bet , il-23 , and gata-3 , reverse - transcribed cdna was detected by sybr green on an abi 7500 system ( applied biosystems , carlsbad , ca , usa ) , according to the manufacturer 's protocol . their primer sequences were as follows : t - bet , sense 5-tcaaccagcaccagacagaga-3 , antisense 5-tccaccaagaccacatccac-3 ; il-23 , sense 5-acatgcaccagcgggacata-3 , antisense 5-ctttgaagatgtcagagtcaagcag-3 ; gata-3 , sense 5-gaaaccggaagatgtctagcaaa-3 , antisense 5-tggagtggctgaagggaga-3. real - time rt - polymerase chain reaction ( pcr ) was performed with a premix ex taq rt - pcr kit ( drr039a ; takara , dalian , china ) or a sybr premix ex taq ii rt - pcr kit ( drr081a ; takara ) . a total of 2 l of cdna was used in each 25-l pcr volume . differences in amplification efficiencies between the target and housekeeping genes were identified by comparing standard curve slopes . real - time pcr was performed with abi 7500 ( applied biosystems ) according to the following program : ( i ) taqman : 95c for 30 sec . , 40 cycles of 95c for 5 sec . , and 62c for 34 sec . or ( ii ) sybr green : 95c for 30 sec . , 40 cycles of 95c for 5 sec . , tissues were embedded in paraffin , cut into 6-m thick sections , and stained with hematoxylin and eosin ( h&e ) and masson 's trichrome stain for pathological evaluation of inflammation and fibrosis , respectively . the differences between values were evaluated through one - way analysis of variance ( anova ) followed by pairwise comparison with the student - newman - keuls test . intratracheal instillation of silica particles could induce acute alveolitis which is characterized by infiltration of inflammatory cells and destruction of alveolar wall structures . to investigate the role of wnt/-catenin pathway in silica - induced inflammation , we observed the sections of lung tissue stained by h&e . the saline control group showed normal alveolar structure and no infiltration of inflammatory cells at all time points ( figures 1(a1 ) , 1(b1 ) , and 1(c1 ) ) . in contrast , silica group and silica + nc shrna group developed severe pulmonary alveolitis at day 7 due to the treatment of silica . acute inflammation destructed the intrinsic alveolar structure and accumulated massive inflammatory cells in alveolar septal ( figures 1(a2 ) and 1(a4 ) ) . at day 28 , the inflammation attenuated compared with day 7 ( figures 1(b2 ) and 1(b4 ) ) . at day 56 , the inflammation basically vanished and the alveolar walls were thickened by tissue repair process ( figures 1(c2 ) and 1(c4 ) ) . however , the silica + -catenin shrna group exhibited significantly aggravated inflammation compared to silica group and silica + nc shrna group at day 7 ( figure 1(a3 ) ) . at day 28 , the exudation and infiltration were alleviated compared with day 7 , while the inflammation was apparently severer than the other two groups ( figure 1(b3 ) ) . at day 56 , the pathological characteristics of silica + -catenin shrna group were still inflammation ( figure 1(c3 ) ) . thereby , the results of h&e staining showed that blockade of wnt/-catenin pathway aggravated the silica - induced inflammation at early stage . besides , the inflammation persisted for longer time compared with silica group and silica + nc shrna group . finally , the development of silicosis was delayed by blocking wnt/-catenin pathway . in response to silica , alveolar macrophages released abundant cytokines and chemokines . we analyzed the infiltration of inflammatory cells by counting total cells , lymphocytes , macrophages , and neutrophils in balf . at three time points , the number of total cells obviously augmented in silica - treated groups compared with saline group . at day 7 , more inflammatory cells were accumulated in silica + -catenin shrna group than other groups ( figure 2(a ) ) . differential cell counting showed that the number of neutrophils increased obviously at days 7 and 28 in silica + -catenin shrna group compared with silica group and silica + nc shrna group ( figure 2(c ) ) . more lymphocytes were also accumulated in silica + -catenin shrna group than other groups at day 7 ( figure 2(b ) ) , while the number of macrophages showed no difference between three silica - treated groups at all time points ( figure 2(d ) ) . at the early stage of silica - induced inflammation , il-1 , tnf- , and our results showed that the expression of il-1 mrna in lung and the concentration of tnf- and il-6 cytokines in balf increased obviously in silica + -catenin shrna group at day 7 compared with silica group and silica + nc shrna group . afterwards , these cytokines dramatically declined to a low level in silica - treated groups at days 28 and 56 ( figures 3(a)3(c ) ) . above all , our study revealed that blockade of wnt/-catenin pathway aggravated silica - induced inflammation by increasing the accumulation of inflammatory cells and the production of proinflammatory cytokines . it has been well established that cd4 t cells played an important role in silicosis . however , recent studies found that wnt/-catenin pathway was involved in the development of cd4 t cells [ 27 , 28 ] . to explore the potential mechanism that blockade of wnt/-catenin pathway aggravated silica - induced inflammation , we investigated th response by analyzing different subsets of th cells . instillation of silica particles apparently activated the differentiation of th17 cells and the secretion of il-17a at the early stage of silicosis . in this study , we evaluated the th17 response by flow cytometry and real - time rt - pcr . the percentage of cd4il-17a t cells in hln was higher in silica + -catenin shrna group at day 7 ( figure 4(a ) ) . compared with silica group and silica + nc shrna group , expressions of il-17a , il-21 , and rort mrna significantly increased in silica + -catenin shrna group at day 7 ( figure 4(b ) and figure s1 in supplementary material available online at http://dx.doi.org/10.1155/2016/6235614 ) . the level of il-6 mrna in lung tissue significantly increased in silica + -catenin shrna group at days 7 and 28 ( figure 4(c ) ) . but il-23 mrna showed no difference at three time points ( figure 4(d ) ) . we assayed the mrna of ifn- by real - time rt - pcr . at day 7 , the expression of ifn- mrna was higher in silica + -catenin shrna group compared with silica group and silica + nc shrna group . followed by the progress of silicosis , ifn- mrna decreased to an equivalent level in silica - treated groups at days 28 and 56 ( figure 5(a ) ) . activation of t - bet initiates the differentiation of th1 subset and promotes the secretion of ifn- . the level of t - bet mrna showed a similar tendency in comparison to ifn- ( figure 5(b ) ) . the percentage of cd4ifn- t cells in silica + -catenin shrna group increased at day 7 compared with silica group and silica + nc shrna group ( figure 5(c ) ) . overall , th1 response was elevated due to the blockade of wnt/-catenin pathway during the silica - induced lung inflammatory stage . tregs are a distinct subset of cd4 t cells which maintain the immune homeostasis and exert self - tolerance [ 36 , 37 ] . we used flow cytometry to determine the percentage of cd4foxp3 t cells in hln . at day 7 , tregs decreased compared with silica group and silica + nc shrna group . there was no difference between all groups at days 28 and 56 ( figure 6(a ) ) . the reduction of foxp3 became indistinctive among silica - treated groups at days 28 and 56 ( figure 6(b ) ) . in vivo , tregs negatively regulate other cell types by producing cytokines such as tgf- and il-10 . we then examined the expression of tgf- and il-10 mrna in lung tissue to assess the suppressive capacity of tregs . tgf- reduced at day 7 and day 56 compared with silica group and silica + nc shrna group . similar to tgf- , il-10 decreased at day 7 ( no significance ) and day 56 in silica + -catenin shrna group ( figures 6(c)-6(d ) ) . these data suggested that blockade of wnt/-catenin pathway inhibited tregs and impaired the treg - mediated suppression . followed by the degradation of inflammation , collagen deposited in the alveolar septum and gradually formed interstitial fibrosis . in order to investigate the level of fibrosis , masson 's trichrome blue staining was applied to colorize the collagen in paraffin sections of lung tissue . at the late stage of experimental silicosis the accumulation of collagen was obvious in silica group and silica + nc shrna group . silica + -catenin shrna group showed significantly less collagen deposition ( figure 7(a ) ) . th1/th2 polarization drives the progress of experimental silicosis that develops from an inflammatory stage to fibrosis stage . in this course , th2 response supersedes th1 response and generates cytokines to promote the production of collagen . a study has proved that deletion of tcf-1 , which was a downstream transcription factor of wnt/-catenin pathway , impaired the th2 response by affecting the activation of gata3 . our results showed a similar phenomenon that gata3 mrna was decreased in silica + -catenin shrna group at day 56 ( figure 7(b ) ) . moreover , profibrogenic cytokines secreted by th2 cells were further examined in this study ; the level of il-4 and il-13 mrna at day 56 was lower compared with silica group and silica + nc shrna group ( figures 7(c ) and 7(d ) ) . these data demonstrated that using -catenin shrna to block wnt/-catenin pathway could attenuate silica - induced fibrosis by suppressing th2 response . followed by the inflammation , adaptive immunity drives the pathological progress of silicosis entering a fibrotic phase . the outcome of silicosis is diffuse pulmonary interstitial fibrosis or even silicotic nodule , which is gravely destructive for the patient 's respiratory function . so exploring the mechanism of silicosis is of profound significance to provide effective therapeutic methods for patients . many studies have proved that cd4 t lymphocytes participated in the pathogenesis of silicosis [ 3942 ] . our previous studies also delineated that different subsets of cd4 t cells regulated the pathology of silicosis arranging from inflammation stage to fibrosis stage [ 11 , 1417 ] . extensive evidences have demonstrated the close connection between t lymphocytes and wnt/-catenin pathway . however , researches mainly focused on the role of wnt/-catenin pathway in the t cell development in thymus . the functions of wnt/-catenin pathway on peripheral t cell differentiation are still not well understood . in this study , we explored the change of th immune response by blocking wnt/-catenin pathway in an experimental silicosis model . combined with the pathological examination , we revealed the regulatory role of wnt/-catenin pathway in silicosis . our study demonstrated that the severity of silica - induced lung inflammation was significantly enhanced by blocking wnt/-catenin pathway . furthermore , the mechanism was elucidated by investigating the regulatory role of wnt/-catenin pathway on cd4 t cells ( figure 8) . we suggested that wnt/-catenin pathway might act on cd4 t cells to regulate the silica - induced inflammation and fibrosis . as a crucial protein in the canonical wnt pathway , the amount of -catenin in cytoplasm determines whether -catenin could translocate into the nucleus , bind to tcf / lef , and activate target genes . our previous study has verified the efficiency of the lentivirus in both in vitro and in vivo experiments . in this study , lentivirus was administered through intratracheal injection to block the wnt/-catenin pathway in the lung . by observing h&e staining sections of lung tissues , we found that treatment of silica + -catenin shrna induced remarkable severer inflammation than other groups at all time points . this indicated that blockade of wnt/-catenin pathway in the lung exacerbated the silica - induced inflammation . in addition , the progress of experimental silicosis was also delayed due to the continuous inflammatory response . paralleled with the results of h&e staining , blockade of wnt/-catenin pathway showed extensive accumulation of inflammatory cells in the lung . among them , proinflammatory cytokines tnf- , il-6 , and il-1 were also abundantly secreted at the early stage in silica + -catenin shrna group . these suggested that blocking the wnt/-catenin pathway in lung promoted the accumulation of inflammatory cells and secretion of proinflammatory cytokines , which ultimately led to an amplified silica - induced lung inflammation . although innate immune processes are proved to be sufficient for driving silicosis , th responses are still thought to play an important regulatory role in the pathogenesis of silicosis . the level of th17 cells and il-17a in lung tissue obviously elevated after treating mice with silica particles . accordingly , il-17r mice or mice injected with anti - il-17a neutralizing abs showed significantly limited inflammatory response . this indicated that th17 cells possessed an obvious proinflammatory role in silica - induced inflammation [ 1315 , 44 ] . as il-17ra is distributed in multiple tissues , il-17a is effective in promoting inflammation by acting on various cell types to induce the production of cytokines and chemokines such as il-6 , tnf- , il-1 , cxcl1 , and cxcl8 . blockade of wnt/-catenin pathway significantly enhanced th17 response at the early stage of silicosis . as a result , the increased il-17a promoted the infiltration of inflammatory cells , augmented the production of proinflammatory cytokines , and induced severe lung inflammation . to investigate the mechanism of th17 enhancement , we analyzed the expression of il-6 and il-23 , which were critical for the commitment of th17 lineage . il-6 is a pleiotropic cytokine mainly derived from innate immune system such as macrophages and dcs . il-6 combined with tgf- can persistently activate stat3 signaling to initiate the differentiation of th17 cells by inducing the transcription of rort [ 47 , 48 ] . il-23 was not essential for the differentiation of th17 cells , but it acted to sustain the proliferation of th17 cells . our study showed that blockade of wnt/-catenin pathway significantly increased il-6 rather than il-23 at the early stage . this resulted from the enhanced th17 response , and il-6 in turn promoted the differentiation of th17 cells . the mutual stimulation of il-6 and th17 cells amplified the silica - induced inflammation by blocking wnt/-catenin pathway . considering the fact that th1 cells produce ifn- to active macrophages and sustain the infiltration of macrophages , these suggested that the aggravating inflammation was regulated by the enhanced th17/th1 response . tregs are an important t cell lineage which function to maintain the immune homeostasis and self - tolerance . in experimental silicosis one study that constructed tregs expressing stable form of -catenin proved that activation of wnt/-catenin pathway enhanced the survival of tregs in vitro . however , another research found that the suppression mediated by tregs was diminished by the activation of wnt/-catenin pathway . thus , the role of this signaling pathway on tregs is still controversial . in our study , tregs were reduced in hln at the early stage by blocking wnt/-catenin pathway . paralleled with the change of tregs , expression of foxp3 mrna in lung also decreased . although wnt/-catenin signaling pathway was demonstrated to negatively modulate the function of tregs , blockade of wnt/-catenin should enhance the suppressive ability of tregs . however , exposure to silica induced the apoptosis of cd4 t cells ; gene silencing of -catenin during silicosis may extinguish the antiapoptotic property contributed by wnt pathway . as a result , the survival of tregs was weakened and the amount of tregs was reduced , which might outcompete the enhanced function of tregs . inhibition of tregs by blocking wnt/-catenin pathway might promote the th17 response and induce an aggravating silica - induced inflammation . the pathogenesis of experimental silicosis contained a shift from th1 response to th2 response and this polarization was regulated by tregs . delaying the th1/th2 polarization might slow down the resolution of lung inflammation , and th2 response mediated lung fibrosis would be postponed . on one hand , our study showed that th1 response was enhanced by the treatment of -catenin shrna at the early stage and was still relatively higher at the late stage . on the other hand , we found that blockade of wnt/-catenin pathway inhibited gata-3 , which was the specific nuclear transcription factor of th2 cells , as well as reducing the profibrogenic cytokines il-4 and il-13 . these results were consistent with the evidence that -catenin binding to tcf-1 promoted th2 response and inhibited th1 response by initiating gata-3 expression . so blocking the wnt/-catenin pathway delayed the th1/th2 polarization by impairing tregs and by directly inhibiting the differentiation of th2 cells , based on the notion that th2 response was distinctly profibrotic . the morphological results were consistent with the tendency of th1/th2 polarization , which was exhibited as the attenuated fibrosis at the late stage and the seriously persistent inflammation . except for th2 cells , it is not surprising that tregs may possess profibrotic properties for the highly secreted tgf- , which is identified as a critical fibrogenic mediator and is also a potent anti - inflammatory cytokine [ 52 , 53 ] . however , the concept of whether tregs can protect or worsen tissues from fibrosis is still controversial . the observation that knockout of mdig ameliorates silica - induced lung fibrosis by altering the th17/tregs balance supported tregs to be antifibrogenic . however , some other studies demonstrated that tregs exacerbated the silica - induced fibrosis via direct ( producing pdgf - b and tgf- ) or indirect ( modulating th1/th2 polarization ) mechanisms [ 11 , 41 ] . in this study , inhibition of tregs and th2 response by blocking wnt/-catenin pathway could attenuate silica - induced fibrosis . our study demonstrated that blockade of wnt/-catenin pathway could inhibit tregs and enhance th17 response reciprocally . this effect promoted the production of massive proinflammatory cytokines and led to an aggravating silica - induced inflammation . on the other hand , blocking wnt/-catenin pathway delayed the th1/th2 polarization by inhibiting tregs and th2 response . as a result , the inflammation was sustained whereas the fibrosis attenuated at the late stage of experimental silicosis .

cd4 + t cells play an important role in regulating silica - induced inflammation and fibrosis . recent studies showed that wnt/-catenin pathway could modulate the function and the differentiation of cd4 + t cells . therefore , wnt/-catenin pathway may participate in the development and progress of silicosis . to investigate the role of wnt/-catenin pathway , we used lentivirus expressing -catenin shrna to block the wnt/-catenin pathway by intratracheal instillation to the mice model of silicosis . treatment of lentivirus could significantly aggravate the silica - induced lung inflammation and attenuated the fibrosis at the late stage . by analyzing cd4 + t cells , we found that blockade of wnt/-catenin pathway suppressed regulatory t cells ( tregs ) . reciprocally , enhanced th17 response was responsible for the further accumulation of neutrophils and production of proinflammatory cytokines . in addition , blockade of wnt/-catenin pathway delayed the th1/th2 polarization by inhibiting tregs and th2 response . these results indicated that wnt/-catenin pathway could regulate tregs to modulate th immune response , which finally altered the pathological character of silicosis . our study suggested that wnt/-catenin pathway might be a potential target to treat the silica - induced inflammation and fibrosis .

intracytoplasmic sperm injection ( icsi ) has emerged as an ideal tool for the treatment of severe male infertility . previous studies have confirmed that a viable spermatozoon is the prerequisite for initiating fertilization in cases of icsi . it was reported that icsi using completely immotile spermatozoa usually resulted in a relatively low fertilization rate and at times , even complete fertilization failure . therefore , motile sperm are preferentially selected for icsi in practice . thus far , sperm cryopreservation is the most effective method of preserving male fertility , although the freezing - thawing process can cause irreversible damage to the sperm . considering the cryodamage to the sperm , only motile sperm should be cryopreserved . however , we do not know whether completely immotile spermatozoa are suitable for cryopreservation for icsi . on the basis of our previous reports , we present a case in which successful pregnancy was achieved by using a noncontact diode laser ( wavelength , 1.48 m ) to identify viable sperm before freezing and after thawing in a patient with completely immotile spermatozoa ; this may help embryologists recognize the value of cryopreserving completely immotile spermatozoa . in this study , we considered a 40-year - old man with infertility due to nonobstructive azoospermia . his 38-year - old wife presented to center for reproductive medicine , the maternal and child health hospital of guangxi zhuang autonomous region with a 10-year - long history primary infertility . his serum follicle - stimulating hormone level was 14.7 miu / ml , and his karyotype was 46,xy without y - chromosome microdeletion . a semen analysis according to the world health organization manual repeatedly showed azoospermia . three to five completely immotile spermatozoa per view were observed in the retrieval of the extracted testicular sperm under an inverted microscope ( magnification 200 ; olympus , tokyo , japan ) after culture for 4 hours . sperm viability was then assessed by applying a laser beam directly to the tip of the sperm flagellum . the viable spermatozoa rate was 55.8% , which suggested that this spermatozoa sample was worth freezing for subsequent icsi . anesthesia was performed by 2% lidocaine to the spermatic cord block . a 50-ml syringe containing 0.5 ml of quinn 's 1020 ( sage , trumbull , ct , usa ) and these samples were then independently minced using two sterile needles in a dish containing 2 ml of the fertilization medium , quinn 's 1020 . the sperm sample containing a 200 l suspension was concentrated to 5 l by centrifugation ( 2,000 rpm ) and then diluted with a sperm cryoprotectant medium in a 1:1 ratio . after being maintained at the liquid nitrogen surface for 4 minutes , the cryotip was rapidly immersed in liquid nitrogen at 196 for long - term cryopreservation . the thawing test was performed on the day of oocyte pick - up as follows : the cryotip was taken out of the liquid nitrogen , placed immediately into the 37 water bath , and kept for 15 minutes before adding to the quinn 's 1020 dish . after incubation for 4 hours , no motile sperm were observed , and viability was assessed by laser . controlled ovarian stimulation was carried out after downregulation with diphereline ( ipsen , tianjin , china ) . follicle - stimulating hormone was administered at a dose of 200 iu per day as described previously by feng et al . . when dominant follicles reached a diameter of 18 mm , ovulation was induced by an intramuscular injection of 10,000 iu of human chorionic gonadotrophin ( hcg ) . oocytes were recovered by the transvaginal aspiration of follicles under ultrasound guidance 36 hours after the hcg injection . sperm viability was assessed by a diode laser ( wavelength , 1.48 m ) as described by aktan et al . . before the freezing process , testicular sperm viability was assessed by laser , and cryopreservation was performed immediately . thawed spermatozoa were washed , and the pellet was suspended in quinn 's 1020 medium . laser assessment of sperm viability was performed by a direct laser shot to the tip of the sperm flagellum using laser energy of approximately 200 j at an irradiation time of approximately 2 ms . if a spermatozoon responded to the laser shot by the curling of its tail , it was regarded as presumably viable and selected for icsi ( figure 1 ) . fertilization was checked by the detection of two pronuclei and two polar bodies at 16 to 18 hours after icsi . only zygotes displaying two pronuclei were transferred to quinn 's 1026 medium ( sage ) supplemented with 10% serum protein substitute ( sage ) from days 0 to 3 , and then were moved into quinn 's 1029 medium ( sage ) supplemented with 10% serum protein substitute for another 2 days . a biochemical pregnancy test was carried out 14 days after embryo transfer by measuring the serum -hcg level . clinical pregnancy was confirmed if a gestational sac was observed in a vaginal ultrasound 6 to 8 weeks after transfer . on the day of oocyte pick - up , the spermatozoa sample was thawed and no motile spermatozoa were detected , while 39.8% of the spermatozoa were observed to be viable in the laser assessment . after culturing for 4 hours , the viable spermatozoa from the frozen - thawed immotile spermatozoa were selected by laser for icsi . a total of five mature oocytes were injected , resulting in four cases of normal fertilization ( 80% ) on day 1 , four cases of normal cleavage on day 2 , and two high - quality embryos on day 3 . fourteen days after the intrauterine transfer , the blood concentration of -hcg was 492.6 iu / l , and one gestational sac with heart activity was observed by transvaginal ultrasonography 3 weeks after the transfer . in this study , we considered a 40-year - old man with infertility due to nonobstructive azoospermia . his 38-year - old wife presented to center for reproductive medicine , the maternal and child health hospital of guangxi zhuang autonomous region with a 10-year - long history primary infertility . his serum follicle - stimulating hormone level was 14.7 miu / ml , and his karyotype was 46,xy without y - chromosome microdeletion . a semen analysis according to the world health organization manual repeatedly showed azoospermia . three to five completely immotile spermatozoa per view were observed in the retrieval of the extracted testicular sperm under an inverted microscope ( magnification 200 ; olympus , tokyo , japan ) after culture for 4 hours . sperm viability was then assessed by applying a laser beam directly to the tip of the sperm flagellum . the viable spermatozoa rate was 55.8% , which suggested that this spermatozoa sample was worth freezing for subsequent icsi . anesthesia was performed by 2% lidocaine to the spermatic cord block . a 50-ml syringe containing 0.5 ml of quinn 's 1020 ( sage , trumbull , ct , usa ) and these samples were then independently minced using two sterile needles in a dish containing 2 ml of the fertilization medium , quinn 's 1020 . the sperm sample containing a 200 l suspension was concentrated to 5 l by centrifugation ( 2,000 rpm ) and then diluted with a sperm cryoprotectant medium in a 1:1 ratio . after being maintained at the liquid nitrogen surface for 4 minutes , the cryotip was rapidly immersed in liquid nitrogen at 196 for long - term cryopreservation . the thawing test was performed on the day of oocyte pick - up as follows : the cryotip was taken out of the liquid nitrogen , placed immediately into the 37 water bath , and kept for 15 minutes before adding to the quinn 's 1020 dish . after incubation for 4 hours , no motile sperm were observed , and viability was assessed by laser . controlled ovarian stimulation was carried out after downregulation with diphereline ( ipsen , tianjin , china ) . follicle - stimulating hormone was administered at a dose of 200 iu per day as described previously by feng et al . . when dominant follicles reached a diameter of 18 mm , ovulation was induced by an intramuscular injection of 10,000 iu of human chorionic gonadotrophin ( hcg ) . oocytes were recovered by the transvaginal aspiration of follicles under ultrasound guidance 36 hours after the hcg injection . sperm viability was assessed by a diode laser ( wavelength , 1.48 m ) as described by aktan et al . . before the freezing process , testicular sperm viability was assessed by laser , and cryopreservation was performed immediately . thawed spermatozoa were washed , and the pellet was suspended in quinn 's 1020 medium . laser assessment of sperm viability was performed by a direct laser shot to the tip of the sperm flagellum using laser energy of approximately 200 j at an irradiation time of approximately 2 ms . if a spermatozoon responded to the laser shot by the curling of its tail , it was regarded as presumably viable and selected for icsi ( figure 1 ) . fertilization was checked by the detection of two pronuclei and two polar bodies at 16 to 18 hours after icsi . only zygotes displaying two pronuclei were transferred to quinn 's 1026 medium ( sage ) supplemented with 10% serum protein substitute ( sage ) from days 0 to 3 , and then were moved into quinn 's 1029 medium ( sage ) supplemented with 10% serum protein substitute for another 2 days . a biochemical pregnancy test was carried out 14 days after embryo transfer by measuring the serum -hcg level . clinical pregnancy was confirmed if a gestational sac was observed in a vaginal ultrasound 6 to 8 weeks after transfer . on the day of oocyte pick - up , the spermatozoa sample was thawed and no motile spermatozoa were detected , while 39.8% of the spermatozoa were observed to be viable in the laser assessment . after culturing for 4 hours , the viable spermatozoa from the frozen - thawed immotile spermatozoa were selected by laser for icsi . a total of five mature oocytes were injected , resulting in four cases of normal fertilization ( 80% ) on day 1 , four cases of normal cleavage on day 2 , and two high - quality embryos on day 3 . fourteen days after the intrauterine transfer , the blood concentration of -hcg was 492.6 iu / l , and one gestational sac with heart activity was observed by transvaginal ultrasonography 3 weeks after the transfer . to the best of our knowledge , this is the first report of a successful pregnancy achieved using completely immotile frozen - thawed spermatozoa selected by laser . our report demonstrates for the first time that completely immotile sperm can be successfully frozen and that normal in vitro fertilization ( ivf ) ability can be achieved , which may provide a new insight into male fertility preservation in patients with completely immotile sperm . regarding the cryodamage to the sperm , only motile sperm are generally cryopreserved in routine clinical operations , while the immotile spermatozoa are often discarded , resulting in the loss of the opportunity of assisted reproductive treatment for some patients . therefore , effective preservation of the fertility of viable but immotile spermatozoa is a major challenge facing ivf . as is known , completely immotile spermatozoa are often found in ivf treatment cycles involving ejaculate samples in patients with conditions such as primary cilia dyskinesia , which is a rare autosomal recessive multisystem disorder characterized by ultrastructural and functional defects of the ciliated cells of the body . completely immotile spermatozoa also occasionally occur in surgically extracted testicular spermatozoa , which can be attributed to very heterogeneous events and are a consequence of oxidative stress , infection , or numerous other factors . according to the traditional freezing procedure , immotile testicular spermatozoa are likely to be abandoned and a subsequent biopsy is scheduled , which increases both the chances of long - term complications and the economic burden on the patients . many studies have demonstrated that using fresh immotile sperm for icsi can lead to successful fertilization . the selection of immotile but viable spermatozoa on the day of icsi is a major challenge for embryologists . the latest world health organization manual ( 2010 ) for the examination and processing of human semen recommends the eosin test , which may be used in combination with negrosin , and the hypo - osmotic swelling ( hos ) test for the diagnostic evaluation of vitality . the eosin test is the standard technique for determining sperm viability and is based on the exclusion of the dye . nonviable spermatozoa exhibit deficient cell membrane structures , permitting eosin to enter the cells and stain them , whereas viable spermatozoa remain unstained . however , once exposed to toxic dyes , spermatozoa are no longer suitable for icsi , which limits its application in assisted reproductive techniques . the hos test has been reported to be successful in the fertility treatment of patients with fresh completely immotile spermatozoa . however , it must be noted that spontaneously developed tail swelling may influence the accuracy of the hos test in the determination of the membrane integrity and viability of human spermatozoa . therefore , this method is not suitable for spermatozoa that have been processed , specifically for cryopreservation , and then thawed . a healthy birth was reported after the laser - assisted immobilization of spermatozoa before icsi . application of a noncontact diode laser to immobilize sperm is considered safe , because its energy is much lower than that used in assisted hatching . in 2004 , for the first time presented data showing that presumably viable spermatozoa can be easily selected by using a laser system . their results showed that the percentage of immotile spermatozoa classified as viable by the laser test ( 22.0% ) was similar to that detected by the hos test ( 21.50% ) . the fertilization rate increased significantly from 20.4% in the randomly selected testicular sperm extraction spermatozoa to 45.4% in the laser - selected group ; accordingly , the take - home baby rate increased from 5.9% to 19.0% . laser - assisted selection of viable spermatozoa in a patient with completely immotile sperm , which were subsequently used for icsi , was found to lead to a successful pregnancy . compared with the hos test , laser - assisted selection of viable sperm is more objective , simple , and rapid , and does not require the use of other chemical agents . here , we described the successful cryopreservation of immotile but viable spermatozoa detected by single laser shots , and the achievement of ideal embryo development and clinical outcomes using the viable frozen - thawed spermatozoa for icsi . in conclusion , we believe that viable but immotile spermatozoa can be preserved for further icsi , which provides a new insight into male fertility preservation with completely immotile spermatozoa .

the aim of this study was to report a successful pregnancy using completely immotile frozen - thawed spermatozoa selected by laser . a single laser shot was used to detect the presence of viable immotile spermatozoa in fresh and frozen - thawed testicular spermatozoa . the viability rate was 55.8% after the laser detection , and cryopreservation was carried out immediately . the thawing test was performed on the day of oocyte pick - up , and no motile sperm were observed after extending the culture for another 4 hours , while a survival rate of 39.8% was detected using the laser . in all , five mature oocytes were injected , resulting in four cases of normal fertilization ( 80% ) on day 1 . further , two high - quality day 3 embryos were transferred , which resulted in a singleton pregnancy . our study demonstrates that completely immotile spermatozoa are worth cryopreserving for further intracytoplasmic sperm injection , which provides a new insight into male fertility preservation in cases of completely immotile spermatozoa .

In June 2009 my husband, Bill, and I were five and a half years into an arduous fertility journey that had involved five rounds of IVF, the late-term loss of twin boys (stillborn), and a subsequent miscarriage. Tired and depleted, we took a break from the fertility treatments and discussions that had consumed much of the past half decade and tried to listen for some way we would still be able to have children. Seven hundred miles away, my 59-year-old mother, who had watched and supported us in our angst, experienced a flash of an idea. My mother, who, to her own or my knowledge, had never done anything that would be considered the least unconventional, offered to be the surrogate for my and Bill’s biological child. She wrote her offer in a letter: three small pieces of creamy white paper containing an invitation that would change our lives. I read the letter on the floor of my bedroom, feeling none of the things my mother had feared I might feel (rejection, alienation, overstepping of bounds). I clutched the paper to my chest. I felt only awe, incredulity, gratitude and- for the first time in many months, hope. We knew the idea was wild and far-fetched. We called our fertility clinic to set up an appointment anyway. To ease our insecurity we cracked jokes about the idea’s sensationalist nature, laughing over the mock holiday card we could send if the idea worked: “WOMAN GIVES BIRTH TO OWN GRANDSON”. I laughed but was aware of a deeper sensation humming within me. Despite the protesting of my logical mind, I felt this surrogacy idea like a song—a song that called to me like wind in the trees. I also knew something that possibly no one else aside from my father knew at that time—that this act of colossal generosity on the part of my mother was also the answer to another prayer: my mother’s desire to discover a calling. Two years earlier, newly retired from a career that had been successful but never a passion, my mother began calling me for advice. I happily offered the techniques I used in my life coaching practice: meditation, journaling, and exploratory questions. “I keep coming up with the same thing,” she’d lament after journaling. “The time I was the happiest in my life was when I was pregnant with you three girls. What am I supposed to do with that?” Out of sheer persistence, she attended a coaching workshop and created a vision board for her ideal life. In the center was a young ostrich; its beak stretched wide open in a great yawping grin. “This is the way I want to feel about what I am doing in my life,” my mother said. She’d also pasted onto the board a page from a magazine that read: Women after menopause have a choice. “I meant the page to say retirement,” she said. “I’ll change it when I get home”. Instead, she hung the vision board up in her room at home as it was and promptly forgot about it—until three months later when a friend mentioned that she’d heard about a post-menopausal woman who’d become pregnant. My mother went home and stared at the board. The skin on her body pricked and she felt as if a current moved through her. The idea took shape in her mind. In that moment our two visions, mine to have a family and hers to find a calling, became one. On Feb. 9, 2011, my son, Finnean Lee, came into the world and at 61 my mother became the oldest woman in Illinois to give birth. One of my mother’s favorite quotes is from a rabbi who said if we are open along the way of realizing our own visions and dreams, we will also become the puzzle pieces for the visions and dreams of others. Years before, my mother displayed the quote in her kitchen and sent a copy to me. She called recently to say she couldn’t find the paper and would I send her the passage again? That evening I took out a thick piece of cardstock and sat down to handwrite the words. As I reached for an envelope in which to enclose it, I wondered if she needed it anymore. In carrying Finn my mother had embodied the essence of that quote, lodging it deep within the heart of our family. ||||| Unprecedented: A British woman is staging a legal bid to become pregnant with her own grandchild – using her dead daughter’s eggs (file image) A British woman is staging a desperate legal bid to become pregnant with her own grandchild – using her dead daughter’s eggs. In the first case of its kind in the world, the woman, 59, and her husband will claim it was their daughter’s dying wish that her eggs be fertilised by donor sperm and implanted into her own mother’s womb. It would be the couple’s only chance to become grandparents after their daughter, an only child, died of bowel cancer four years ago while still in her 20s. She chose to freeze her eggs in the hope that she could have children in the future, but tragically lost her battle with the disease. No UK-based clinic has agreed to treat the mother, who is now hoping to export the eggs to New York, where a clinic is lined up to provide fertility treatment at an estimated cost of up to £60,000. At her age, the woman’s chances of becoming pregnant using the eggs are small. There are potentially large risks to her health, and the health of the unborn child, if fertility treatment succeeds. However, the woman and her 58-year-old husband say they are determined to honour their daughter’s wishes and the case is now set to be decided by a judge. If successful, the woman would be the first in the world to give birth to a baby using eggs from her dead daughter, experts believe. Dr Mohammed Taranissi, who runs the ARGC fertility clinic in London, said: ‘I have never heard of a surrogacy case involving a mother and her dead daughter’s eggs. It’s fair to say that this may be a world first.’ The Human Fertility and Embryology Authority (HFEA) has already refused the couple’s application to export their daughter’s frozen eggs to America, on the grounds that she did not give clear written consent. But her parents are now preparing to challenge the ruling in the High Court. They claim their daughter told them shortly before her death that this was what she wanted. However, politicians and campaigners criticised plans to bring a baby into the world long after their biological mother has died. David Davies, Conservative MP for Monmouth, said: ‘I can’t understand why anyone would want to do that. I would have grave concerns about any permission being granted by the HFEA or the courts. It’s potentially rather disturbing.’ Josephine Quintavalle, from campaign group Comment on Reproductive Ethics, acknowledged there would be sympathy for the mother’s loss, but said it would be ‘impossible not to feel very uncomfortable’ if the procedure was allowed to go ahead. She said of the potential grandmother: ‘Her daughter is irreplaceable and should be mourned as such.’ But Annie Casserley, 62, who acted as a surrogate for her own daughter, said: ‘If that was her daughter’s wish and she wants to honour that wish then it’s absolutely her choice.’ Treatment: The woman and her husband will claim it was their daughter’s dying wish that her eggs be fertilised by donor sperm and implanted into her mother’s womb. Above, file image of artificial insemination Women who have gone through the menopause are still able to bear children using donor eggs and sperm. However, obstetricians say the risks associated with pregnancy, such as miscarriage, are greater. The full details of the controversial case are revealed in minutes of the HFEA’s Statutory Approvals Committee, which has so far rejected three attempts by the couple to secure permission to use the eggs. The Mail on Sunday is aware of the family’s identity, but will respect their wish to remain anonymous. Last night lawyers for the family declined to comment, saying they considered the case to be private. The documents reveal the couple’s daughter was diagnosed with bowel cancer at 23 and chose to freeze and store three of her eggs at IVF Hammersmith in West London in 2008. SURROGACY: THE FACTS, THE LAWS AND THE ETHICS Cases of surrogacy, where a woman carries a child on behalf of its genetic parents, have more than trebled in just six years. But in only a handful of cases worldwide has a woman become a surrogate for her own daughter’s child. The first surrogate grandmother, 56-year-old Pat Anthony, from South Africa, gave birth to triplets for her daughter in 1987. Since then the UK has seen at least four cases. Any woman can legally become a surrogate in the UK as long as they are not paid more than ‘reasonable expenses’. To become a surrogate, women have standard IVF treatment using embryos created from the genetic mother’s eggs. In 2013, 167 babies were officially born to a surrogate parent in the UK, up from 47 in 2007. However, there may be hundreds more. The woman who gives birth is always the legal mother; genetic parents must apply for a court order to get full legal rights over the child. Surrogacy is not the same as ‘three-parent babies’ because the child’s genes come only from the biological parents. No DNA is passed from the surrogate. She completed a form which gave consent for the eggs to be stored for use after her death, but crucially, failed to fill in a separate form which indicated how she wished the eggs to be used. This technically meant her consent became invalid. She died in 2011 without leaving further instructions. She was single. The minutes reveal the ‘strongest and only evidence’ of her wishes was a reported conversation with her mother while she was in hospital in 2010. The young woman is said to have asked an unnamed doctor whether someone with a stoma such as herself could carry a child. The doctor confirmed it was possible. But, the mother says, it was then agreed that if her daughter could not carry a child ‘I would do it for her’. The minutes say the young woman wanted her mother to ‘carry her babies… in the context of her not expecting to leave hospital alive.’ The couple approached fertility clinics after their daughter died. They hoped to create embryos using standard IVF treatment from their daughter’s eggs and sperm from an anonymous donor. However, no UK clinics were prepared to carry it out. Generally, fertility clinics will not treat women over 50 because of the limited chances of success and the extra risks involved. Despite this, the HFEA committee was not required to consider the mother’s age in this case because the issues solely surrounded whether her daughter consented to her eggs being used in such a way. The couple have now been approved for treatment by a US clinic, New York Fertility Services. The minutes say: ‘Although it is stated that the chances of [the woman’s mother] becoming pregnant are “very small” and that “any complications could be life threatening”, the couple say that they are determined to “honour their daughter’s wishes”.’ The application for permission to export the sperm was made to the HFEA by IVF Hammersmith, which is storing the eggs. It treats both NHS and private patients and is based within Hammersmith Hospital in West London. Applications in November 2013, March 2014 and August 2014 were rejected. Minutes from the HFEA committee say they are ‘sympathetic’ to the parents’ views, but that they did not provide enough evidence for the export to be agreed. The HFEA confirmed the case will now proceed to judicial review. It will be heard in the Administrative Court, a division of the High Court, at a date to be set. Risks: At her age, the woman’s chances of becoming pregnant using the eggs are small. There are potentially large risks to her health, and the health of the unborn child, if fertility treatment succeeds (file image) If this final legal bid fails, the eggs will be destroyed in February 2018, ten years after they were stored. Professor Simon Fishel, managing director of Care Fertility clinics, said the only similar case involved a British mother who attempted to use her dead daughter’s already fertilised embryo – but that bid failed. However he believed the latest case was ‘little different’ in ethical terms to that of Diane Blood, who in 1997 won a legal fight to use her dead husband’s sperm to try to conceive a child. He said: ‘One argument is this: if the family feels it’s right for them, whose right is it to interfere?’ But he said other factors should be taken into consideration. The HFEA said it did not know of any other cases where a woman had given birth to a child using her deceased daughter’s eggs. However, it added that it would not automatically be informed if adequate consent had been provided and if an export licence was not needed. A spokesman declined to comment further on ‘an on-going case’. Imperial NHS Trust, which runs IVF Hammersmith, also had no comment. I GAVE BIRTH TO MY OWN GRANDCHILD... SHE SHOULD, TOO Legacy Annie Casserly acted as a surrogate for daughter Emma ten years ago. Her granddaughter Annie (pictured as a newborn) is now nine A British woman who was one of the first surrogate mothers to give birth to her own grandchild has backed the couple’s bid to continue their daughter’s legacy. Annie Casserley acted as a surrogate for her daughter Emma ten years ago after she was diagnosed with a rare lung condition which meant pregnancy could be fatal. Emma is still alive – although on the transplant list. Mrs Casserley’s granddaughter, also named Annie, is now nine. Mrs Casserley, from the West Midlands, said of the new case: ‘It’s a way of keeping their daughter alive, isn’t it? That’s what they must be thinking. It’s like creating an extension of their child. They’ve lost their daughter. It’s heartbreaking. ‘It depends on the woman’s health but if that was her daughter’s wish and she wants to honour that wish then it’s absolutely her choice. ‘If you can keep a part of your child alive, anyone would do it, wouldn’t they? My heart goes out to them.’ Mrs Casserley, now 62, said she had ‘no regrets – not one’ about carrying her daughter’s child, and that she treated her ‘no differently’ to her other three grandchildren. ‘Even if I’d died in the process I wouldn’t have regretted it. It was an absolute privilege. The only stipulation was I didn’t want to give birth so I had a caesarean under general anaesthetic. ‘When I came round, my daughter was sitting beside me, smiling, with Annie in her arms. I was at home, straight back to normal, two days later. ‘I just grew her. I’d do anything for my daughter, and this was just one of those things you do for your children.’ Unmasked: Sperm donor cowboy who's 'fathered 40 children... with 15 on the way' as doctors warn of health timebomb of 'siblings' born in 50-mile radius By Ben Ellery and Jacinta Taylor for the Mail on Sunday Criminal past: Spemr donor Declan Rooney as he emerged smirking from court in 1993 The Mail on Sunday can today unmask an anonymous sperm donor who boasts that an astonishing 32 women are expecting his babies and another 15 are about to take pregnancy tests after asking him for donations. Declan Rooney, 42, claims he is ‘Britain’s most successful sperm donor’ and says he has donated sperm to two more women who have already given birth. He also has six children born naturally with three different mothers – meaning he has the potential to be the father of 55 children. The former web designer runs his website under the alias Upton North and advertises himself on Facebook to single women, lesbians and couples desperate for a baby. Last night experts called for an investigation into the unregulated and potentially dangerous service he provides to women he meets online, with one sociologist saying that Mr Rooney was ‘determinedly engineering a one-man eugenics movement’. Medical experts fear he could create a ‘ticking timebomb’ by flouting official guidelines for sperm donation, which limit the number of families that legitimate sperm donors can help create to a maximum of ten. As well as growing up without knowing their father, his children will potentially live close to each other, meaning that half-brothers and sisters may meet and unwittingly have children of their own. The murky world of unregulated sperm donation has come under increasing scrutiny from watchdogs as the internet offers men and women easy opportunities to meet up anonymously and create families – without needing to qualify or pay for expensive private fertility treatment, overseen by doctors. A cycle of artificial insemination costs £850 privately and is only offered to selected patients on the NHS. Rooney set up his anonymous site last March, offering to visit women in their homes or hotel within a 50-mile radius of his Middlesbrough home and give them a sample of his sperm in a specimen pot for them to inseminate themselves. His website, which was taken down last night after he was contacted by The Mail on Sunday, stated: ‘I am willing to help either through artificial insemination or naturally with no strings attached.’ Despite that wording, he told this newspaper that he does not have sex with the women. Sperm donations are not illegal unless a man charges for the service, but the risks of private donations include reports of women being abused, pressured into sex or forced to hand over money when they meet a donor. His cynical advert: Declan Rooney boasted of 'natural' insemination, but insisted he did not offer sex Rooney, who insists he acts within the law, says he only charges ‘expenses’ and that his motives are purely ‘altruistic’. He said: ‘I like helping people’. And he added: ‘Have you changed anyone’s lives for the better?’ Since becoming a sperm donor, Rooney says two lesbian women in the North East have given birth to his children. He said: ‘When I was told, I was really happy for the mothers. I like meeting new people, I like hearing their stories, I like problem-solving. I’m quite an altruistic person. I haven’t done anything illegal. ‘I set myself up as a private donor and have been inundated – I have 5,000 emails. If they are too far out of the area I say no to them. If you say you’re a sperm donor, people say it’s really smutty, but if someone said they were an egg donor it’s like “Wow that’s amazing”. There were a few days when I had a success each day. It’s a good feeling.’ Donor: Rooney pictured with his partner, who he says understands his reasoning for donating On Rooney’s webpage he backed up his claims by posting photos of ultrasounds scans, positive reviews from female recipients and an image of a specimen pot. A HUMAN Fertilisation and Embryology Authority (HFEA) spokesman said: ‘Unfortunately, women finding a sperm donor online, rather than through a licensed clinic, run a number of risks. Apart from the personal safety risks to the woman, the donor won’t have been screened for infectious diseases like HIV, or for inherited illnesses, and he will probably also be the legal parent of any child that is born. ’ Dr Suvir Venkataraman of London’s Harley Street Fertility Clinic, added: ‘A registered clinic will inform a child of a donor who else has been born using their sperm so they don’t have a sexual relationship with someone sharing the same genes. This man cannot expect to keep tabs on everyone and that is a big risk.’ Mr Rooney, who says his partner ‘understands my reasons for donating’, claims that his family have had no medical issues in five generations. ‘I wouldn’t donate if I had something genetically wrong. And there is no risk that my offspring will unknowingly have sex with each other because evolution makes sure that we are not attracted to people with the same genes,’ he claimed. He also boasted that he is ‘immune’ from the Child Support Agency. ‘The CSA has to find your taxable income and assets. They would have difficulty. I’m not scared of them,’ he said. Mr Rooney was photographed on the front page of the Daily Mail in 1993 leaving court smirking after he was found guilty of causing £60,000 of graffiti damage. He was given a suspended sentence and served seven months in a young offenders’ institution while waiting to stand trial. As he stepped out of the dock he said: ‘My barrister’s a genius. I’m laughing. It’s a soft touch.’ Questioned on his criminal past last night, he said: ‘I don’t mention it to recipients, but if the subject comes up then I will talk about it.’ ||||| A mother's love takes many forms. For Kristine Casey, 61, it meant giving the gift of motherhood to her infertile daughter by carrying and giving birth to her own grandson. With the help of hormone supplementation, Casey, who had gone through menopause 10 years earlier, became pregnant during her second round of in vitro fertilization, the Chicago Tribune reported. She carried full term and gave birth via Cesarean section to Finnean, her first grandchild, last week at Prentice Women's Hospital in Chicago. Although Casey's daughter, Sara Connell, 35, had been unable to carry a pregnancy to term, her egg and her husband Bill's sperm were used in the procedure, making the couple Finnean's biological parents. "The idea of having a family member being open to doing this for us was so extraordinary for us," Sara Connell told the Tribune. Casey, who is retired, told the Tribune that giving birth to her own three daughters were three of the happiest days in her life and she believed that serving as a surrogate to her daughter was a spiritual calling. She had kidney complications after the birth that were quickly resolved. Casey's husband, William, who spoke on behalf of the family, said there'd be no further comment to the media after their interview with the Tribune. Mothering in the 60s In the world of surrogate parenting, the Connell's scenario is not as uncommon as you might think. The first case of such an arrangement dates back to 1987 when a South African woman gave birth to her triplet grandchildren. More recently, ABC News' "Good Morning America" spoke with 56-year-old Jaci Dalenberg of Wooster, Ohio, who gave birth to triplet girls that she carried for daughter Kim Coseno in 2008. The Uterus Goes on Forever While age is a limiting factor for the safety of such late-in-life surrogacy, hormonal supplementation and the use of donor eggs make pregnancy possible even in women who have gone through menopause. "It works despite the woman being post-menopausal because the uterus continues to respond to hormones forever," says Dr. David Cohen, an obstetrician and ethicist at the University of Chicago. "After menopause, you have to supply the hormones in the form of pills, shots or vaginal creams." The age of the eggs and the ovaries, which would normally provide those hormones, is more of a concern for getting pregnant later in life, he adds, but in the case of surrogacy, the egg is provided by the biological mother. Those synthetic hormones, given before in vitro fertilization would most likely be continued into the first trimester, Cohen says, when the placental hormones would take over. What does become more of a concern in the case of Casey and late-in-life pregnancies such as hers is the health of the gestational mother. "The data suggests that the risk to the mom has been much higher in people who are older," Cohen says. Although each case must be evaluated individually, the risk of high blood pressure, gestational diabetes and risk of miscarrying tend to be higher. "The biggest issue is that the vascular volume -- the amount of fluid floating around the blood vessels -- increases dramatically in pregnancy and the demand on the heart to push that volume around is greater" he says. "An older heart doesn't have the same strength to accommodate that volume as a young heart does. The older blood vessels also don't have the same elasticity so the risk of getting high blood pressure is clearly higher." But age isn't always the best indicator of maternal suitability, Cohen notes, and "someone at 61 might seem healthier than another person at 49. Thankfully, in this case, everything worked out fine." Ethical, Emotional Concerns of Grandma Surrogacy At first mention, the idea of a grandmother giving birth to her own grandson sounds like a genetic nightmare, but because the Connells contributed the egg and sperm, the risk of genetic abnormality was actually quite low. From an emotional or even ethical standpoint, however, this arrangement might still raise concerns. Is it ethical to put an elderly mother at increased risk of complications by allowing her to be a surrogate? Would carrying a grandchild that is then handed over to the biological parents create psychological turmoil in the grandmother? Surrogacy in any case can be ripe with emotional complications as gestational mothers become attached to the child during pregnancy and may be less willing than expected to part with the child, even though it is not biologically theirs. Even if the surrogate is no stranger but a family member, such as a sister, there might be similar attachment issues. In this case however, grandmother surrogacy might actually be one of the least complicated scenarios for surrogacy, notes Dorothy Greenfeld, a clinical psychologist who counsels patients at the Yale Fertility Center. "I don't see it as particularly emotionally complicated," she says. "She's probably so overjoyed to be able to do this for her daughter." Given that Casey was already going to play a somewhat maternal role in the child's life as his grandmother and that she is no longer at mothering age (and less likely to want to raise the child as her own), the situation is less complicated than others, she adds. Indeed, Casey told the Tribune, "From the very beginning, the moment I've wanted is the moment the baby is in their arms. I've been clear since after my third child that I didn't need to have any more children, and as much as I will be delighted to be a grandmother, I don't want to take a baby home."

– It's not unheard of for a woman to act as a surrogate mother for her own grandchild, but a 59-year-old British woman is reportedly hoping for what may be a world first: becoming a surrogate for her dead daughter, who succumbed to bowel cancer four years ago while still in her 20s, reports the Daily Mail. She's not having any luck in the UK, though, where apparently no clinic is willing to fertilize the woman with her daughter's eggs (she froze three in 2008). The anonymous woman reportedly says it was her daughter's dying wish to have her become a surrogate, but it's not in writing. The mother is now trying to export the eggs to a clinic in New York that has apparently agreed to attempt in vitro fertilization for roughly $90,000, but her request to actually export the eggs out of the country has been denied three times, so the case is going to be heard in the UK's High Court. While it's technically possible for a post-menopausal woman to become pregnant thanks to hormonal supplementation, reports ABC News, the chances of becoming pregnant are lower and the risks to the older woman's health are greater. The main complications are gestational diabetes, high blood pressure, and miscarriage. But it can be done: A woman recounted in the New York Times the story of her 61-year-old mother giving birth to her son in 2011. Still, the unidentified woman in this most recent story says she wants to honor her daughter's wish; if this final legal bid to export the eggs fails, they will be destroyed in 2018, a decade after being frozen. (A 49-year-old woman who gave birth to her own grandson in 2012 said it was like "babysitting for a few months.")

SECTION 1. SHORT TITLE. This Act may be cited as the ``Family Planning Amendments Act of 1995''. SEC. 2. PROJECT GRANTS AND CONTRACTS FOR FAMILY PLANNING SERVICES. (a) Requiring Certain Nondirective Counseling and Referral Services.--Section 1001 of the Public Health Service Act (42 U.S.C. 300) is amended-- (1) by redesignating subsections (b) through (d) as subsections (c) through (e), respectively; and (2) by inserting after subsection (a) the following subsection: ``(b)(1) The Secretary may not make an award of a grant or contract under this section unless the applicant for the award agrees that the family planning project involved will provide to individuals information regarding pregnancy management options upon request of the individuals, and that such information will be provided only through individuals holding professional degrees in medicine or osteopathic medicine, nursing, clinical psychology, the allied health professions, or social work, through individuals meeting such other criteria as the Secretary determines to be appropriate for providing such information, or through individuals allowed under State law to provide such information. ``(2) With respect to compliance with the agreement made under paragraph (1), the family planning project involved, and any provider of services in the project, may not be required to provide information regarding a pregnancy management option if-- ``(A) the project or provider (as the case may be) objects to doing so on grounds of religious beliefs or moral convictions; and ``(B) the project refers the individual seeking services to another provider in the project, or to another project in the geographic area involved, as the case may be, that will provide such information. ``(3) For purposes of this subsection, the term `information regarding pregnancy management options' means nondirective counseling and referrals regarding-- ``(A) prenatal care and delivery; ``(B) infant care, foster care, and adoption; and ``(C) termination of pregnancy.''. (b) Compliance With State Laws on Parental Notification and Consent.--Section 1008 of the Public Health Service Act (42 U.S.C. 300a-6) is amended by inserting ``(a)'' before ``None'' and by adding at the end the following: ``(b)(1) No public or nonprofit private entity that performs abortions may receive an award of a grant or contract under section 1001 unless the entity has certified to the Secretary that the entity is in compliance with State law regarding parental notification of or consent for the performance of an abortion on a minor which is enforced in the State in which the entity is located. ``(2) Paragraph (1) shall not be construed to require or prohibit a State's adoption of parental notification or parental consent laws regarding the performance of an abortion on a minor, or to require or prohibit the enforcement by a State of such laws.''. (c) Information on Condoms.--Section 1001 of the Public Health Service Act, as amended by subsection (a) of this section, is amended by inserting after subsection (b) the following subsection: ``(c) The Secretary may not make an award of a grant or contract under this section unless the applicant for the award agrees that the family planning project involved will-- ``(1) distribute only those condoms meeting current requirements for quality control and labeling; and any subsequently developed standards, established by the Food and Drug Administration for the prevention of pregnancy and the prevention of the transmission of sexually transmitted diseases; and ``(2) advise individuals of the benefits of the proper use of condoms, of the extent of risk that still exists with condom usage, and of the fact that condoms currently available do not completely eliminate the risk of pregnancy or the transmission of sexually transmitted diseases.''. (d) Authorization of Appropriations.--Section 1001(f) of the Public Health Service Act, as redesignated by subsection (a) of this section, is amended to read as follows: ``(f) For the purpose of grants and contracts under this section, there are authorized to be appropriated $220,000,000 for fiscal year 1996, and $250,000,000 for fiscal year 1997.''. SEC. 3. AUTHORIZATION OF APPROPRIATIONS FOR TRAINING GRANTS AND CONTRACTS. Section 1003(b) of the Public Health Service Act (42 U.S.C. 300a- 1(b)) is amended to read as follows: ``(b) For the purpose of grants and contracts under subsection (a), there are authorized to be appropriated $6,250,000 for fiscal year 1996, and $7,000,000 for fiscal year 1997.''. SEC. 4. AUTHORIZATION OF APPROPRIATIONS FOR INFORMATIONAL AND EDUCATIONAL MATERIALS. Section 1005(b) of the Public Health Service Act (42 U.S.C. 300a- 3(b)) is amended to read as follows: ``(b) For the purpose of grants and contracts under subsection (a), there are authorized to be appropriated $12,000,000 for fiscal year 1996, and $13,500,000 for fiscal year 1997.''. SEC. 5. EFFECTIVE DATE. This Act and the amendments made by this Act take effect upon the date of the enactment of this Act.

Family Planning Amendments Act of 1995- Amends the Public Health Service Act to require family planning grant and contract recipients to provide nondirective counseling and referrals regarding: (1) prenatal care and delivery; (2) infant care, foster care, and adoption; and (3) termination of pregnancy. Allows a provider who objects, on religious or moral grounds, to providing such counseling and referrals to refer the woman to another provider. Requires recipients to: (1) comply with State parental notification or consent laws; and (2) distribute only those condoms meeting current quality and labeling requirements and provide information regarding condom use benefits and risks. Authorizes appropriations. Authorizes appropriations for grants and contracts concerning: (1) training to provide family planning services; and (2) informational and educational materials regarding family planning and population growth.

in equilibrium statistical mechanics , the notion of an ordered state is well understood and the degree of order is characterized with the aid of two - point and one - point functions . thus , the long - range order ( lro ) @xmath10 is defined through the asymptotic behaviour of a two - point correlation function , while the order parameter @xmath11 , the spontaneous value in a vanishing field , is a one - point function . in the thermodynamic limit , fluctuations become insignificant and @xmath11 and @xmath12 have well defined values @xcite . further , for systems with short - ranged interactions , conditions under which ordering is possible are known . ordering occurs only if the spatial dimension exceeds one for a scalar order parameter , or exceeds two if ordering breaks a continuous symmetry @xcite . in nonequilibrium steady states , other types of behaviour are possible and characterization of order needs to be addressed afresh . of particular interest is a class of systems in which fluctuations are anomalously strong , but which nevertheless have a propensity to order , leading to fluctuation - dominated phase ordering ( fdpo)@xcite . fdpo arises in several types of systems . these include passive scalar systems , in which a passive species is driven by an autonomously evolving field , e.g. , particles driven by a fluctuating surface or a noisy burgers fluid in one and two dimensions @xcite , or , in the context of active systems , by a 2d nematic field @xcite . fdpo also arises in a model 1d granular gas in which the coefficient of restitution depends on the velocity of approach @xcite . the signature of fdpo is a cusp singularity at small argument in the scaled two - point correlation function , signifying a breakdown of the porod law . the relation of this singularity to giant number fluctuations has been discussed in ref . @xcite in the context of active systems . stronger singularities of the scaling function arise if the passive particles do not have hard core interactions @xcite . finally , there seems to be an intriguing connection between fdpo and systems with quenched disorder , and cusp singularities have been observed in a number of systems with rough surfaces and interfaces @xcite . this paper deals with the characterization of order in a passive scalar system which exhibits fdpo . the system consists of hard - core particles sliding locally downwards , along the local slopes of a one - dimensional fluctuating surface with overall slope zero @xcite . the surface evolves through its own dynamics whereas the particle movement is guided by local surface gradients . as time passes , particles are driven towards each other and the spatial extent of particle - rich regions increases as a function of time , until it is of the order of system size in steady state . in earlier work , this tendency was quantified by studying coarsening properties , as the system evolves in time starting from a completely disordered state . as usual for coarsening systems , the equal time correlation function @xmath13 obeys scaling , with a growing length scale @xmath14 . the unusual point here is that the scaling function shows a cusp singularity as the argument @xmath15 approaches zero . in momentum space , this translates into the scaled structure factor varying as @xmath16 where @xmath17 is the wave vector . the exponent @xmath18 is less than 1 signifying a cusp singularity , which represents a marked deviation from the linear behaviour characteristic of the porod law ( @xmath19 ) which holds normally for scalar field coarsening @xcite . further , cusp singularities were also observed in the correlation function in steady state @xcite , and also in the decay of the temporal auto - correlation function @xcite . in this paper , our focus is on the study of both static and dynamic aspects of the order parameter or one point function @xmath20 . we argue that a single scalar order parameter does not suffice to properly characterize the order and we need to monitor a larger set . this set is built from the long - wavelength fourier components of the density profile . we present evidence that these fourier components have probability distributions which remain broad in the thermodynamic limit ; that they are anticorrelated with each other ; and that the probability distributions of the components for different sizes are described by simple scaling laws . we supplement our studies of the sliding particle system by studying a related coarse - grained depth model , and show that this model exhibits broadly similar behaviour . further , the temporal behaviours ( of autocorrelation and cross - correlation of the fourier modes ) are studied and scaling properties are investigated . this includes a study of dynamical structure function and the flatness , which is found to exhibit a divergence at small argument , indicating that the behaviour in time is intermittent @xcite . the paper is organized as follows : in sec . [ sec : model ] , we introduce the sliding particle ( sp ) and coarse - grained depth ( cd ) models of fluctuating surfaces and review the behaviour of the two - point correlation function . in sec . [ sec : statics ] , we discuss the static properties of one point function , arguing that long - wavelength fourier transforms of the density profile constitute an appropriate set of order parameters . we discuss their probability distributions , the correlations between them , and scaling properties . in sec . [ sec : dynamics ] , we discuss the corresponding dynamical properties including cross correlations between modes . we conclude with a discussion of our results in sec . [ sec : conclude ] . in this section , we discuss some simple models that show fdpo . the sliding particle ( sp ) model involves a system of hard core particles sliding under gravity on a stochastically evolving surface @xcite through either edwards - wilkinson ( ew ) or kardar - parisi - zhang ( kpz ) dynamics @xcite . we also define the coarse grained depth ( cd ) model which only involves the height field of the fluctuating surface , and which provides considerable insight . we then summarize the results of @xcite on the scaling behaviour of two - point correlation functions in these models . this is a lattice model of particles moving on a 1d fluctuating surface @xcite . the particles and links are represented respectively by @xmath21 and @xmath22 . both @xmath23 s and @xmath24 s are ising like variables that can take values @xmath25 on a one dimensional lattice with periodic boundary conditions . the occupation of any site @xmath26 can be given in terms of @xmath27 s , as @xmath28 ( @xmath29 ) , and the local slope of the surface connecting site @xmath26 is given by the variable @xmath30 or @xmath31 and is denoted by / or @xmath32 respectively . the evolution of the surface can be modelled by either the ew or the kpz dynamics . this is incorporated in our model by the stochastic corner flips involving exchange of adjacent @xmath24 s : thus @xmath33 occurs with rate @xmath34 , while @xmath35 changes with rate @xmath36 . the symmetric surface fluctuations , i.e. @xmath37 , belong to the ew class whereas @xmath38 belongs to the kpz class . the dynamics of the particles can be modelled by exchanging the position of a particle and a vacancy ( hole ) pair at adjacent sites @xmath39 with rates that depend on the intermediate local slope : thus the moves @xmath40 and @xmath41 occur at a rate @xmath42 , while the reverse moves occur at a rate @xmath43 . this asymmetry reflects the fact that it is easier to move downwards under the influence of a gravitational field . in our study we consider the strong field limit i.e. , @xmath44 for the particle system and set @xmath45 . the dynamics conserves both @xmath46 and @xmath47 , and we study that sector where @xmath48 and @xmath49 vanish corresponding to the half - filled system of particles on a surface with zero average tilt . in order to describe the dynamics of the hills and valleys of the surface , let us consider the height profile @xmath50 with @xmath51 . we wish to define a model involving only @xmath52 , to mimic the sp model . since sp particles slide down and occupy the lower portion of the height profile , we define an analogous variable @xmath27 in the cd model as taking on the values @xmath53 , @xmath31 , or @xmath54 depending on whether the surface profile at site @xmath26 is below , above , or exactly coincident with a reference level : @xmath55 , where @xmath56 is the instantaneous average height which fluctuates with time . the nomenclature coarse - grained depth model derives from the fact that the mapping @xmath57 may be viewed as a coarse graining which eliminates all fluctuations of the height other than the sign . the cd model is concerned with the static and dynamic properties of @xmath21 , which mimics the particle configuration in the sp model . the two - point correlation function characterizes the steady state approached by the system of particles driven by a fluctuating surface that exhibits lro . we monitor the evolution of the local density using monte carlo simulations . for both the ew and kpz surfaces , no equilibration is needed because every configuration of hills and valleys with periodic boundary condition carries equal weight and can be chosen at random as a valid surface configuration in the steady state . the particles are distributed randomly on sites . in every monte carlo step , we performed @xmath58 updates ( @xmath6 each for sites and bond variables ) at random . the density distribution is guided by the evolution of the surface profile . to quantify the tendency towards clustering , one can define the equal time two point correlation function as @xmath59 for the sp model , and @xmath60 for the cd model . the correlation functions have the scaling form @xmath61 where @xmath62 is a time - dependent length scale which describes the typical linear size of a cluster at time @xmath63 , typically growing as a power law in time i.e. @xmath64 . here , @xmath7 is the dynamical exponent characteristic of the surface fluctuations . this length scale @xmath62 for density fluctuations is set by the base lengths of typical coarse - grained hills which have overturned in time @xmath63 . in 1d , we have @xmath8 for ew and @xmath9 for kpz surface evolution . the existence of such a single growing length scale is a signature of coarsening towards a phase - ordered state . the coarsening is driven by surface fluctuations , rather than temperature quenching . as previously studied in refs . @xcite the scaling curves have cusps at small values of @xmath65 with a nonzero intercept . that is , @xmath66 . the intercept @xmath67 is equal to the lro measure @xmath68 . this is because an arbitrary large but fixed distance @xmath69 corresponds to @xmath70 in a coarsening system , since @xmath71 diverges as @xmath72 . the cusp exponent @xmath18 is found numerically to be @xmath73 for ew evolution and @xmath74 with kpz dynamics of the interface @xcite . in fact , the cusp exponent @xmath75 can be found analytically for the cd model . the cusp implies a tail of scaled structure factor @xmath76 for large @xmath77 . this shows a deviation from the porod law @xmath78 , characteristic of customary coarsening . if instead of considering coarsening in an infinite system , we consider steady state in a finite system of size @xmath6 , we may replace @xmath79 by @xmath6 to conclude that the scaled two - point correlation function in the steady state can be written as @xmath80 with @xmath81 . here , as with coarsening , the cusp exponent @xmath82 for ew and @xmath83 for kpz surface evolution . the long - wavelength fourier transforms of the density profile ( in the sp model ) or the coarse - grained depth ( in the cd model ) constitute a set of order parameters appropriate to characterize the type of large - scale clustering that sets in . in this section , we study the probability distributions of these parameters and their scaling properties as the system size is changed . let us define fourier components of the density @xmath84 where , @xmath85 and @xmath86 . as we will see below , the lowest nonzero fourier components @xmath87 can be used as a measure of the phase separation in our system with conserved dynamics . figure [ fig : qkkcd ] shows the mean values @xmath88 as a function of @xmath17 for various values of @xmath6 for sp and cd models . two points should be noted . ( a ) first , for any fixed non zero value of wave - vector @xmath17 , one observes that @xmath89 as @xmath90 . ( b ) in order to study the @xmath91 limit , it is instructive to observe the behaviour of the low-@xmath92 modes @xmath93 with @xmath94 and monitor @xmath95 . it is seen from fig . [ fig : qkkcd ] that @xmath96 , @xmath97 , etc . , each approach a finite limit as @xmath98 . the values of first four fourier modes for various models are tabulated in table [ tab:1 ] for both the ew and kpz surface evolutions . from the table , we observe that @xmath99 is the largest , and it thus provides a first characterization of order . . @xmath100 values for sp and cd models . [ cols="^,^,<,<,<,<",options="header " , ] the values of @xmath101 characterize the gross form of the macroscopic cluster that occurs in the system . for example , @xmath96 is largest in configurations with a single dense cluster of particles , @xmath97 is largest in configurations with two well separated dense clusters and so on . the mean values of the fourier components @xmath102 decrease with increasing @xmath92 , providing strong evidence that macroscopic clustering occurs in the system . figure [ fig : qtime ] shows the time series for the long - wavelength fourier modes @xmath0 . the strong excursions about their average values lead to broad probability distributions . in fact these distributions remain broad in the thermodynamic limit . this is contrary to the situation in normal equilibrium phase transitions where the order parameter has a well defined value in the thermodynamic limit and its distribution consists of delta functions at values that characterize the phase . in fig . [ fig : probability ] , we have shown the probability distribution functions of the first eight modes @xmath103 for both the sp and cd models with ew and kpz surface evolutions . these distributions are obtained numerically for system sizes @xmath104 , 128 , and 192 for ew , and @xmath105 , 256 , and 512 for kpz surface evolutions . it is evident from the figure that the distributions for various modes are spread over a wide range of values . furthermore , these distributions approach a limiting form on increasing the system size ; they remain broad even in the thermodynamic limit . the probability distributions of the fourier modes for the sp and cd models are broadly similar except for the first mode @xmath106 . for the cd model , the distribution @xmath107 increases monotonically with @xmath106 , while , for the sp model , it first increases and then decreases . this difference reflects the fact that @xmath106 reaches the maximum value of @xmath108 more often in the cd model than the sp model ( see fig . [ fig : qtime ] ) . correspondingly the value of @xmath109 is higher for cd model ( see table . [ tab:1 ] ) . the modes @xmath110 are anticorrelated at short times . this is already evident from fig . [ fig : qtime ] , which shows that local maxima @xmath111 usually occur when @xmath106 is small . a quantification of the degree of anticorrelation and its behaviour in time will be discussed in section [ sec : dynamics ] below . let us turn to a discussion of the scaling behaviour of @xmath112 as a function of mode number @xmath92 and system size @xmath6 . as noted earlier , fig . [ fig : qkkcd ] shows that : ( a ) for fixed value of @xmath113 away from zero , @xmath114 as @xmath98 . ( b ) for a fixed ( typically small ) value of @xmath92 , the mean value @xmath102 approaches a finite @xmath92 dependent value as @xmath115 . thus , in fig . [ fig : qkkcd ] the limit @xmath116 exposes the set of order parameters we have been discussing . the limiting values ( as @xmath98 ) of @xmath117 fall with increasing @xmath92 . in order to connect ( a ) and ( b ) , we postulate the scaling form : @xmath118 the fact that @xmath113 is a good variable in the large @xmath6 limit is already incorporated in writing the argument @xmath119 as @xmath120 . evidently the scaling function @xmath121 , a constant value , as @xmath122 in order to be consistent with ( a ) above ; @xmath123 falls to zero as @xmath124 . turning to ( b ) , the small-@xmath92 end of fig . [ fig : qkkcd ] corresponds to @xmath125 where we expect @xmath126 , which would imply an @xmath6 dependence of the form @xmath127 for @xmath128 . since the data in fig . [ fig : qkkcd ] suggests finite limiting values as @xmath98 as noted in ( b ) , we conclude that @xmath129 and the limiting values @xmath102 fall as @xmath130 . this is verified in fig . [ fig : scaling ] which shows the data for the sp model for both ew and kpz surface dynamics , and for the cd model . as noted earlier , the static properties of the cd model are identical for both the ew and kpz cases . the observed scaling properties of the average value @xmath131 suggest that the full probability distributions @xmath132 in fig . [ fig : probability ] may exhibit a scaling collapse as well . this is indeed the case ( except for first few modes ) , as seen in fig . [ fig : probscaling ] where we have plotted the scaled distribution @xmath133 versus @xmath134 . we conclude by commenting on the values of the exponent @xmath135 . the values used in the plots in fig . [ fig : scaling ] and fig . [ fig : probscaling ] are @xmath136 and @xmath137 ( for the sp model with ew and kpz surface dynamics , respectively ) and @xmath138 ( for the cd model ) . an analytic understanding of these values would be very desirable . we now turn to a discussion of the scaling properties of time dependent correlation functions in the models under study . an earlier study @xcite has shown that the single site occupancy autocorrelation function @xmath139 exhibits the scaling form @xmath140 for both sp and cd models , with @xmath8 and @xmath141 for surface evolutions obeying ew and kpz dynamics respectively . the scaling function @xmath142 was found to show a cusp singularity as @xmath143 @xmath144 \quad \text{for } \quad y<<1,\ ] ] where @xmath145 is a measure of lro . for the sp model , the exponent @xmath146 was found to be approximately @xmath147 for ew , and @xmath148 for kpz dynamics . for the cd model , the value @xmath149 was derived analytically for ew dynamics , while the value @xmath150 was found numerically for kpz case @xcite . and cross - correlation @xmath151 for ( a ) sp model with ew , ( b ) sp model with kpz , ( c ) cd model with ew , ( d ) cd model with kpz surface evolutions show that steady state auto - correlations decay with time and scale with @xmath5 where @xmath6 is the system size and @xmath7 is the dynamic exponent . however , cross - correlations of order parameter increase with time from their initial negative values implying anticorrelations decay in times . , scaledwidth=48.0% ] let us define time - dependent correlation functions involving the order parameter set @xmath152 in fig . [ fig : corrscale ] , we have plotted @xmath153 against the scaled argument @xmath154 . the collapse , evident in the figure , provides clear evidence of scaling . moreover , the cross - correlation function @xmath155 is negative , implying that the fourier modes for @xmath156 and @xmath157 are anticorrelated . this feature is evident in fig . [ fig : qtime ] as well , and has its origins in the fact that the configurations that contribute most to the two modes involve respectively one large particle cluster or two large clusters , and are thus mutually exclusive . , of the first fourier mode is plotted as a function of @xmath158 for various lengths . the weak divergence of the flatness seen for the cd model indicates intermittency . , scaledwidth=48.0% ] we now turn to the characterization of the dynamical structure function of the first fourier mode @xmath106 , whose variation in time is shown in fig . [ fig : qtime ] . the question arises whether the time series @xmath159 is self - similar , or whether it displays intermittency . in this subsection , we study the dynamical structure factors , and an associated measure , namely the flatness , to answer this question . for the cd models , we find a weak but definite divergence of the flatness in the limit of small argument , implying that the series is weakly intermittent . the structure functions are defined as moments of the distributions of temporal variations of @xmath106 @xmath160^n \rangle}_l.\ ] ] in general , @xmath161 grows as a power of @xmath63 , but saturates at a value which depends on system size @xmath6 . figure [ fig : s2s4 ] shows that @xmath162 is a scaling function of the variable @xmath5 for both @xmath163 and @xmath164 , where @xmath7 is the dynamical exponent . for large @xmath63 , @xmath165 and @xmath166 are independent , and thus the saturation values of @xmath167 and @xmath168 are given by the static quantities @xmath169 and @xmath170 respectively . these values can be determined accurately from steady state data and are shown as dashed lines in fig . [ fig : s2s4 ] . the property of intermittency has to do with the behaviour of @xmath171 at small values of @xmath172 , i.e. , @xmath173 . for self - similar series , the exponents @xmath174 themselves grow linearly with @xmath175 , i.e. , @xmath176 is a constant . by contrast , for an intermittent time series , this property is no longer true . a good diagnostic is the flatness @xmath177 . for a self - similar system , @xmath178 approaches a constant value as @xmath179 , while for an intermittent system , @xmath178 diverges as @xmath143 , due to the preponderance of sharp rises and falls of @xmath106 over relatively short times . the flatness as a function of scaled variable @xmath5 for both sp and cd models with ew and kpz dynamics is plotted in fig . [ fig : flat ] . let us first consider the cd models , for both the ew and the kpz dynamics . the data in fig . [ fig : s2s4 ] indicate @xmath180 and @xmath181 with @xmath182 ( ew ) and @xmath183 ( kpz ) , and @xmath184 ( ew ) and @xmath185 ( kpz ) . this would imply @xmath178 diverging as @xmath186 with @xmath187 , leading to @xmath188 ( ew ) and @xmath189 ( kpz ) . the exponent @xmath190 can also be be extracted directly from the plot for the flatness ( fig . [ fig : flat ] ) . for the cd models we obtain @xmath191 ( ew ) and @xmath192 ( kpz ) . there is a weak but definite divergence . hence we conclude that the time series @xmath159 displays weak intermittency for the cd models , in both the ew and kpz cases . for the sp models in the intermediate @xmath119 regime , we estimate @xmath193 ( ew ) and @xmath194 ( kpz ) , and @xmath195 ( ew ) and @xmath196 ( kpz ) . correspondingly we find @xmath197 for both ew and kpz dynamics . at smaller values of @xmath119 , the curves seems to show a flattening , but we are not able to reach a firm conclusion owing to problems with the precision of the data in this case . in this paper , we have examined the characterization of order in fluctuation - dominated phase ordering ( fdpo ) , by studying the static and dynamic properties of the order parameter set for a system of sliding hard - core particles driven by a 1d fluctuating surface . in addition to the sliding particle ( sp ) model , we studied the cd model of surface dynamics which mimics the properties of the sp model . the necessity for having a set of order parameters here the long - wavelength fourier modes of the particle density arises from the fact that the macroscopic cluster of particles has a finite probability of breaking into a small number @xmath92 of clusters ( @xmath198 ) ; the occurrence of these clusters is tracked by the @xmath92th fourier mode , @xmath0 . the characteristic of fdpo is that fluctuations remain large , and do not damp down in the thermodynamic limit . correspondingly , the probability distribution @xmath4 approaches a broad limiting form as @xmath90 . the mean value @xmath199 is found to be a scaling function of mode number @xmath92 and system size @xmath6 , as is the full probability distribution . the temporal properties of fdpo are influenced by the existence of an @xmath6 dependent time scale @xmath200 where @xmath7 is the dynamical exponent of the driving interface ( @xmath201 for ew , and @xmath141 for kpz case ) . the dynamical properties are a function of @xmath5 . the most interesting property is that the time series for the primary order parameter , @xmath202 , displays intermittency in the case of the cd models for both ew and kpz evolutions for the driving interface . the signature of this is a weak but definite divergence of the flatness , which involves the ratio of the fourth and second moments of the variations of the order parameter . it would be interesting to be able to spell out the conditions for intermittency to arise in systems displaying fdpo , and phase ordering in general .

in systems exhibiting fluctuation - dominated phase ordering , a single order parameter does not suffice to characterize the order , and it is necessary to monitor a larger set . for hard - core sliding particles ( sp ) on a fluctuating surface and the related coarse - grained depth ( cd ) models , this set comprises the long - wavelength fourier components of the density profile . we study both static and dynamic scaling laws obeyed by the fourier modes @xmath0 and find that the mean value obeys the static scaling law @xmath1 with @xmath2 and @xmath3 with edwards - wilkinson ( ew ) and kardar - parisi - zhang ( kpz ) surface evolution respectively . the full probability distribution @xmath4 exhibits scaling as well . further , time - dependent correlation functions such as the steady state auto - correlation and cross - correlations of order parameter components are scaling functions of @xmath5 , where @xmath6 is the system size and @xmath7 is the dynamic exponent with @xmath8 for ew and @xmath9 for kpz surface evolution . in addition we find that the cd model shows temporal intermittency , manifested in the dynamical structure functions of the density and a weak divergence of the flatness as the scaled time approaches zero .

NEW YORK, Nov. 25, 2011 /PRNewswire/ -- Euro RSCG Worldwide launches its largest-ever trend tome, discussing what to expect in 2012. "The Big Little Book of Nexts: Trendspotting for 2012" features trend sightings for the new year in areas ranging from advertising and parenting to home furnishings, men, lifestage marketing, and politics. Marian Salzman, CEO of Euro RSCG Worldwide PR, North America, and one of the world's leading trendspotters, curates this annual exercise that's intended to flag shifts in attitudes, beliefs, values, and media preferences, as well as the broader geopolitical shifts that together are rewriting the landscape for brands, business, and newsmaking. "We're in the business of generating awareness for our clients—to promote good will, consumption, and, ultimately, loyalty—and the best way to serve them most effectively is by anticipating the density and velocity of the changes on the near horizon," Salzman explains. "When a multinational brand gets ahead of a trend and can own it, and ride its wave, the benefits are long-lasting—recognizing, of course, that one of the trends in recent years is the speed of change, as well as the fickleness of leading-edge consumers who embrace what's new one day and move on to another new the next." Here's a sneak peek at 12 trends for 2012 from Euro RSCG Worldwide's new report on what's next, now: The U.S. State of Mind. We will see big business leaders speak out against the way things are going and pave the way for the future, as our confidence in politicians and their ilk falters amid the constant partisan fight-club atmosphere. Politics will reach a boiling point with more protests, most likely organized and cross-promoted on social media. The Prime Crisis/Education Correlation. Studies have tied home equity gains to dramatic increases in college attendance, meaning today's reduced housing prices and sinking home equity will finally affect the college roster. As a result, panicked universities will go to greater lengths to attract students, offering outside-the-classroom options in the form of online classes. Out-of-work boomers will join the new student body, as they supplement their skill sets by going back to school, albeit digitally. Re-feathering the Empty Nest. More empty nests are full once again as recent college grads, the biggest casualty of the dire job market, look for Mom and Dad to come to the rescue. Likewise, senior citizens reluctant to retreat to a rocking chair at the senior center will choose instead to move in with their grown children. The Always-Ticking Millennial. Generation Y (which we call millennials) will upend the traditional workday, as the digital generation works anywhere, anytime. Look for 2012 to be the beginning of an era in which notions of time are divided differently, especially when we all know work nowadays is a 24/7/365 proposition. All hands on deck, but at different times. Transportation in Tip-Top Shape. During the Great Depression, Americans broke their backs building roads and train tracks. With all this talk about our collapsing infrastructure, look for champions of improvement to step forward and propose a way to get America working again, among fears of the rapid deterioration of our highways, bridges and tunnels. Hyperlocal vs. Universal. Although there's certainly something to the hyperlocal movement, clever brands will transcend geography and home in on universal truths when looking to market to the (global) masses; especially as we try to swallow the collective lump in our throats, it makes sense to speak to all of us, as one world. Be Private, Be Present. Experiencing full-blown information overload, many will rediscover their need for privacy. We will still expect our leaders and businesses to be transparent, but in our personal lives look for a retreat en masse from TMI. Also speaking to our overtaxed lives is the "in the moment" movement, which for many people will be the only way to stomach the harsh realities of life in 2012. iWars. With Steve Jobs gone, Apple will be looking over its iShoulder. From new music-sharing superstar Spotify, which has partnered with Facebook, to Amazon, whose new tablet, the Kindle Fire, has set the tablet wars raging, competitors are gunning for one of the most valuable brands on the planet. Double-Dip Frugality. Look for 2012 to be the year of essentials only. As numerous institutions heralded the end of the recession, wallets opened, but some people now regret buying unnecessary items. Pop-up stores will continue to soothe by offering one-off items without the sticker shock, and with the success of Missoni at Target and a new zigzag zeitgeist, other brands will look to partner up and co-produce products and lines that give a one-two punch in what is shaping up to be a tepid holiday season. The Focused Foodie. Organic and artisanal foods will dominate the dinner plate as GMO madness seizes conversations at tables from Tallahassee to Topeka. This relates to the economy, too, as we continue to shop local to support our communities. Likewise, our obsession with farmers markets and farm-to-table will endure. Semi-Scientific Voodoo Medicine. Instead of the communicable diseases of yesteryear, people will grapple with excess weight and its related ailments, as well as cancers and cardiovascular, autoimmune and degenerative diseases. As the Internet provides access to medical information, the effect across markets is a fragmented mix of semi-scientific voodoo, full of contradictory and complementary elements—folk remedies (e.g., gargling with salt water) and alternative beliefs (e.g., homeopathy) alongside pharmaceuticals and supplements. Look for wellness to be the buzzword du jour. Retreat from Reality. With reality TV falling out of favor and viewers looking for new ways to escape, you'll find TV fans embracing the next generation of scripted shows. Standouts include "Modern Family," "The Middle," "Up All Night," and Zooey Deschanel 's "New Girl." Next year welcomes a full-on push for TV on the Internet. YouTube will launch scheduled programming in 2012, with shows on everything from fashion to sports, while Google TV will debut as well, surely redefining the realm of the couch potato. To review and download the full report, please go to www.eurorscg.com. For more information and some of Salzman's past annual forecasts, please go to the Brainfood tab at www.eurorscgpr.com. About Euro RSCG Worldwide Euro RSCG Worldwide is a leading integrated marketing communications agency and was the first agency to be named Global Agency of the Year by both Advertising Age and Campaign in the same year. Euro RSCG is made up of 233 offices in 75 countries and provides advertising, marketing, corporate communications, and digital and social media solutions to clients including Air France, Charles Schwab, Citigroup, Danone Group, IBM, Kraft Foods, Lacoste, L'Oreal, Merck, PSA Peugeot Citroen, Reckitt Benckiser, Sanofi and Volvo. Euro RSCG Worldwide is the largest unit of Havas, a world leader in communications (Euronext: HAV.PA) (Paris: HAV.PA). About Euro RSCG Worldwide PR We call ourselves @erwwpr; we're the North American earned-media and buzz boutique (#bethenews) within French holding company Havas. Headquartered in New York City, with Pittsburgh and Chicago offices, we've seen 25 percent growth in the last two years and become one of the most-awarded PR agencies of our size for work including #wyclefforpresident (global scope), @theywinulose (Campaign Money Watch; against big money in elections), the first-ever teenage girl SoMe lab (The Sisterhood; industry innovation) and Ford's Warriors in Pink (#welovecause). We're grounded in media, strategy, client service and community to ensure we message in straight talk and real time. For more information: www.eurorscgpr.com. Contact: Lisa Gruber Global Communications Manager Euro RSCG Worldwide 212-886-2018 [email protected] SOURCE Euro RSCG Worldwide ||||| The traditional eight-hour workday may soon be the exception rather than the rule. New evidence shows that we’re reaching a tipping point in terms of workplace flexibility, with businesses seeing the wisdom of allowing employees — young ones especially — to work odd hours, telecommute and otherwise tweak the usual 9-to-5 grind. One of the top 12 trends for 2012 as named by the communications firm Euro RSCG Worldwide is that employees in the Gen Y, or millennial, demographic — those born between roughly 1982 and 1993 — are overturning the traditional workday. The Business and Professional Women’s Foundation estimates that by 2025, 75% of the global workforce will be Gen Y. As early as next year, this group of younger Americans will comprise 60% of the employees at companies like Ernst & Young. And increasingly, companies are creating workplace-flexibility programs because it makes good business sense, not in the least because that’s what their employees are demanding. (GALLERY: 9 Jobs of of the (Near) Future) Gen Y-ers are spearheading this change because they don’t want the same work environment their parents had. Between new technology and global workplace dynamics, companies are implementing flexible work arrangements for everyone, inclusive of Gen Y. A recent Vodafone U.K. survey illustrates that 90% of employers enable work flexibility instead of sticking to traditional hours. Leading the charge in the shift toward allowing employees to work anywhere around the world, at any time they want, are companies such as Ernst & Young, Aflac and MITRE, which all realize that they need to accommodate employees’ personal lives if they want to retain them. “This notion of an eight-hour day is rapidly disappearing, simply because we work so virtually and globally,” says Maryella Gockel, Ernst & Young’s flexibility-strategy leader. By understanding Gen Y-ers’ need for workplace flexibility, companies are better able to recruit and grow young talent for the future. Aside from the early adopters of workplace-flexibility programs, many other companies are hesitant because of the traditional “command and control” approach laid out for older generations. The challenge these companies face is letting go and trusting their young employees — even when they are telecommuting or using Facebook regularly at work. (LIST: 10 Money Moves to Make Before 2012) Many companies fear that, without structure, employees will be distracted, not as engaged and less productive. In fact, the opposite is often true. A trusting work environment breeds more-loyal employees and increases efficiency. Here are three reasons for companies to embrace workplace-flexibility programs: 1. Gen Y workers won’t accept jobs where they can’t access Facebook. Cisco’s “Connected World Technology” report shows that more than half of Gen Y employees prioritize social-media freedom over a higher salary when evaluating a job offer. Furthermore, more than half say the Internet is an integral part of their lives. Gen Y-ers wants to be connected to their friends and families, not just their co-workers, throughout the day. Although some companies ban social media at work, other companies have embraced it as long as employees use it professionally. “We do want people to use social networks in order to keep in touch with their colleagues and contacts,” explains Gockel, whose company has no formal social-media guidelines or policies. (MORE: The Blackberry Moral, Or: The Trouble With Too Many Options) 2. Gen Y-ers value workplace flexibility over more money. More than one-third (37%) of Gen Y workers would take a pay cut if it meant more flexibility on the job, reports a study by Mom Corps. Flexibility motivates these workers to be more productive and loyal to their companies because they feel like they are respected. An employer that allows flexibility in the workplace also demonstrates that it understands the evolving modern-day work environment, which bodes well for the future. 3. Gen Y workers are always connected to jobs through technology. Technology has made the traditional 9-to-5 model blurry — for all workers, of all generations, really. No one is ever out of touch or off the clock. When workers go home, they’re still working because who they are personally and professionally have become one and the same. Workers are always representing the company, and more and more, it seems, work e-mail doesn’t stop for anything or anyone. By no means does time away from the office equal less work getting done. Schawbel is the managing partner of Millennial Branding LLC, a full-service personal-branding agency. He is the author of Me 2.0: 4 Steps to Building Your Future, founder of the blog Personal Branding and publisher of Personal Branding magazine.

– Show of hands, how many people are still clocking in at 9 and out at 5 every day? Well, you might be in the minority soon. In its annual list of top trends, communications firm Euro RSCG Worldwide is predicting that “Generation Y will upend the traditional workday, as the digital generation works anywhere, anytime.” Time agrees, predicting that telecommuting and flexible schedules with strange hours could soon be the norm. For backup, Time cites this study, which shows that young professionals demand Internet access, and another showing that some 37% of them would take a pay cut in exchange for workplace flexibility. It also points out that technology is blurring the line between home and work—thanks to email, “no one is ever out of touch or off the clock.”

the @xmath1-systems @xcite satisfied by the transfer matrices of the generalized heisenberg model or the @xmath4-characters of quantum affine algebras @xcite can be considered as discrete dynamical systems with special initial conditions . more generally , the equations of these systems can be shown @xcite to be mutations in an infinite - rank cluster algebra @xcite . as such , their solutions under general boundary conditions @xcite are expected to satisfy special properties such as the laurent property and positivity . among discrete dynamical systems , the cluster algebras of fomin and zelevinsky @xcite hold a special place . these describe the evolution of data vectors ( clusters ) attached to the nodes of an infinite regular tree via mutations along the edges . mutations are defined in such a way that the following laurent property is guaranteed : any cluster data may be expressed as a laurent polynomial of the cluster variables at any node of the tree . it was conjectured in @xcite and proved in several particular cases ( in particular in the so - called acyclic cases @xcite , or that of clusters arising from surfaces @xcite ) that these polynomials always have non - negative integer coefficients ( laurent positivity ) , a property that still awaits a good general combinatorial interpretation . cluster algebras turn out to be quite universal , and have found applications in various fields , such as the study of non - linear recursions , the geometry of teichmller space , quiver representations , wall crossing formulas etc . the relation between the recursion satisfied by the ( @xmath4- ) characters of kr - modules of quantum affine algebras on the one hand , and cluster algebras on the other , was found in @xcite . such systems are known as @xmath2-sytems or @xmath1-systems when they are supplemented by special boundary conditions . it is known that such equations can be interpreted as discrete integrable systems : in the case of an @xmath5 type algebra , the @xmath1-system was identified as the discrete hirota equation @xcite . it is also known as the tetrahedron equation in combinatorics , and arises in the context of the littlewood - richardson coefficients for tensor products of irreducible representations of @xmath5 @xcite and domino tilings of the aztec diamond @xcite . solutions to the @xmath2 and @xmath1-systems have been constructed by various authors @xcite . recently , a transfer matrix solution was given for the @xmath0 @xmath1-system in the case of arbitrary boundary conditions . the latter is also known in the combinatorics literature as frieze equation @xcite . this solution was generalized to the case of @xmath5 in @xcite . it amounts to representing general solutions of the system as partition functions for paths on a positively weighted graph or network . the graph is determined solely by the initial conditions . the connection to cluster algebras is as follows @xcite : one shows that the admissible initial data for the @xmath1-systems form a subset of the clusters a cluster algebra , and that the mutations in this algebra are local transformations which are the @xmath1-system equations . thus the expression of the solutions as partition functions for positively weighted paths implies the laurent positivity for these particular clusters . an important question is how to quantize such evolution equations @xcite . the quantization in the case of cluster algebras generally was given by berenstein and zelevinsky @xcite . quantum cluster algebras are non - commutative algebras where the cluster variables obey special commutation relations depending on a deformation parameter @xmath4 . mutations are defined in such a way that the laurent property is preserved , and a positivity conjecture is also expected to hold : that is , any cluster variable may be expressed as a laurent polynomial of the variables in any other cluster seed , with coefficients in @xmath6 $ ] . quantum cluster algebras were used in @xcite to define quantum @xmath2-systems for @xmath5 . in the present paper , we focus on the @xmath1 system for @xmath0 , and construct its quantum version via the cluster algebra connection . we gather a few definitions in section [ definitions ] and construct the quantum @xmath0 @xmath1-system in section [ section3 ] . we then express the general solution in section [ section5 ] by use of a non - commutative transfer matrix , quantizing the solution of @xcite . the main result of the paper is theorem [ solq ] , which implies an interpretation of the solution as a partition function for quantum paths " with step weights which are non - commutative laurent monomials in the initial data , thereby proving laurent positivity for the relevant clusters . the @xmath7-periodic solutions of the @xmath1-systems satisfy @xmath2-system equations , and this generalizes to the quantum case . the @xmath0 @xmath2-system has a fully non - commutative generalization introduced by kontsevich in the framework of wall - crossing phenomena in non - commutative donaldson - thomas invariant theory . the solution was given in @xcite for this system using the method of @xcite . we revisit this system in section [ section6 ] and formulate a fully non - commutative ( as opposed to @xmath4-commutative ) version of the network transfer matrices used in section 4 to solve the @xmath1-system . this gives an alternative solution for the non - commutative @xmath0 @xmath2-system . finally in section [ conclusion ] we give the relation between the quantum @xmath0 @xmath1-system and the discrete quantum liouville equation of faddeev et al @xcite . this equation can also be viewed as a non - commutative @xmath3-system . * acknowledgments . * we thank l. faddev for illuminating remarks , and the organizers of the msri semester program on random matrix theory , interacting particle systems and integrable systems " where this work was completed . pdf received partial support from the anr grant granma . the work of rk is supported by nsf grant dms-0802511 . we use a simplified version of the definition of fomin and zelevinsky @xcite of cluster algebras of geometric type with trivial coefficients . a cluster algebra is the commutative ring generated by the union of commutative variables called cluster variables . the generators are related by rational transformations called _ mutations _ determined by an _ exchange matrix _ , which governs the discrete dynamics of the system . for the purposes of his paper , it is sufficient to consider a cluster algebra of rank @xmath8 , with a seed cluster consisting of @xmath8 cluster variables @xmath9 and an @xmath10 skew - symmetric exchange matrix @xmath11 . ( we will also have occasion to consider cluster algebras of infinite rank ( @xmath12 ) . it will be clear from our solution that when such algebras occur they are well - defined as a completion of the finite rank case . ) clusters are pairs @xmath13 where @xmath14 is a label of a node of a complete @xmath8-tree . each node is associated with a cluster . the edges of the tree are labeled in such a way that each node is connected to exactly one edge with label @xmath15 where @xmath16 $ ] . the clusters at nodes @xmath14 and @xmath17 connected by an edge labeled @xmath15 are related to each other by a _ mutation _ , which acts as a rational transformation on the component @xmath18 : @xmath19 where @xmath20 a mutation also acts on the exchange matrix @xmath21 , such that @xmath22 if @xmath14 and @xmath17 are connected by an edge labeled @xmath15 , and @xmath23_+ & \hbox{otherwise}. \end{array}\right.\ ] ] with the notation @xmath24_+={\rm max}(x,0)$ ] . to define a cluster algebra , it is sufficient to give the seed @xmath25 at one single node . this then determines the cluster variables at all other nodes via iterated mutations . it is interesting to consider whether there exist non - commutative generalizations of cluster algebras , which maintain some of the properties of cluster algebras . in particular , the laurent property @xcite and the ( conjectured in general ) positivity of a cluster variable at any node as an expression in terms of the cluster variables at any other node . we considered some possible candidates in @xcite motivated by our consideration of the integrable subcluster algebras described by @xmath2-systems and @xmath1-systems , as well as the kontsevich wall - crossing formula . we also considered the specialization of these non - commutative systems to the simplest type of non - commutativity , the @xmath4-deformation . such systems were first considered by berenstein and zelevinsky in ref.@xcite , where they defined `` quantum cluster algebras '' . we give here a simplified version of their definition which is sufficient for this paper . a quantum cluster algebra is the skew field of rational functions generated by the non - commutative cluster variables @xmath26 where @xmath14 are the labels of the complete @xmath8-tree as above . at a node @xmath14 we have the cluster @xmath27 where the exchange matrix is the same as for the usual cluster algebra . the cluster variables at this node @xmath4-commute : @xmath28 here @xmath29 are the entries of an @xmath10 skew - symmetric matrix @xmath30 . up to a scalar multiple , we can take @xmath30 to be the inverse of the exchange matrix @xmath11 . according to the definitions of @xcite such a matrix @xmath30 is `` compatible '' with the exchange matrix @xmath11 . equivalently , we can define @xmath31 , where @xmath32 are also non - commuting variables and the exponential is taken formally . then the commutation relations above correspond to @xmath33=h \lambda_{i , j}$ ] where @xmath34 . clusters at tree nodes @xmath14 and @xmath17 connected by an edge labeled @xmath15 are related by a mutation . let @xmath35 . then we define @xmath36 to be @xmath37_+ e_i } + { { \mathbf x}}^{-e_k + \sum_i [ -b_{ik}]_+e_i } & j = k.\end{array}\right.\ ] ] the exchange matrix @xmath22 is the same as in the commutative case . the @xmath1-systems appear in the solution of exactly solvable models in statistical mechanics , in the bethe ansatz of generalized heisenberg quantum spin chains based on representations of yangians of each simple lie algebra @xcite . the transfer matrices of the model satisfy a recursion relation in the highest @xmath38-weight of the @xmath39-modules corresponding to the auxiliary space . these relations are called @xmath1-systems . in the context of representation theory , these relations are the equations satisfied by the @xmath4-characters @xcite of kirillov - reshetikhin modules of the yangians , or the associated quantum affine algebra . these systems provide examples of discrete integrable systems which are part of a suitable cluster algebra structure @xcite . however , in the representation - theoretical context , a special initial condition is placed on the variables ( corresponding to the fact that the @xmath4-character of the trivial representation is 1 ) . here , we dispense with this special value . moreover , we renormalize the variables so that the solutions are positive laurent polynomials of the initial data for any initial data . this corresponds to normalizing the cluster variables of the cluster algebras so that all coefficients are trivial . thus , with slight abuse of notation , we call the following system the @xmath0 @xmath1-system : @xmath40 here , we consider the set @xmath41 as commutative variables . solutions of the equation are given as functions of a choice of initial variables . upon a simple change of coordinates , this system is also known as frieze " equation in combinatorics @xcite . equations split into two independent sets of recursion relations , since the parity of @xmath42 is preserved by the equations . without loss of generality , let us restrict to the relations for @xmath43 . an admissible initial data set for the @xmath1-system is a set @xmath44 the solutions of equation are determined by iterations of the evolution equations starting from any admissible initial data set . the fundamental initial data ( the `` staircase '' ) is the set @xmath45 the boundary corresponding to the initial condition @xmath46 is the set of points in the lattice @xmath47 . a solution of the @xmath1-system is an expression for @xmath48 in terms of @xmath46 for each @xmath49 . a general solution of the @xmath0 @xmath1-system for arbitrary boundary was given in @xcite and generalized to the case of the @xmath5 algebra , @xmath50 , in @xcite . the solution is given in terms of a matrix representation and is interpreted as partition functions of networks . in the present paper , we will introduce a quantum version of the @xmath0 @xmath1-system and derive its solutions in terms of quantum networks . the formulation of the @xmath1-systems as sub - cluster algebras was given in @xcite . in the case of @xmath0 the cluster algebra is given as follows . let @xmath51 be the cluster algebra of infinite rank generated by the fundamental seed @xmath52 , where @xmath53 is given by , and the exchange matrix @xmath54 has entries @xmath55 where the indices refer to the first index of the @xmath48 s . each equation in the @xmath1-system corresponds to a mutation in the cluster algebra @xmath51 ( but not vice versa ) . all solutions of the @xmath1-system are contained in a subset of the clusters corresponding to @xmath56 defined in . they are obtained from @xmath52 via iterated cluster mutations of the form @xmath57 : @xmath58 with @xmath59 , where @xmath60 leaves all cluster variables unchanged apart from : @xmath61 in the case where all three terms on the right hand side are cluster variables in @xmath62 . in this note , we consider the non - commuting quantum " version of the @xmath0 @xmath1-system . recall that for any cluster algebra of finite rank @xmath8 , a quantum cluster algebra is obtained by producing a compatible pair " @xmath63 of skew - symmetric @xmath10 integer matrices , with @xmath64 , where @xmath65 is a diagonal matrix with positive integer entries . in turn , @xmath30 encodes the @xmath4-commutation relations between the cluster variables of the initial cluster @xmath66}$ ] via @xmath67 . and the other variables of the fundamental cluster @xmath53 . vertices @xmath68 and @xmath69 are connected by an arrow @xmath70 iff @xmath71 and @xmath72 iff @xmath73 , while @xmath74 otherwise . ] however , the @xmath0 @xmath1-system comes from an infinite rank cluster algebra with @xmath75 . we adapt the above condition , based on the quantization of the @xmath0 @xmath2-system @xcite , which is a specialization of the @xmath1-system . let @xmath30 be an infinite , skew - symmetric matrix such that @xmath76 and such that @xmath77 . then @xmath78 the second condition on @xmath30 is a choice , a reflection symmetry imposed on the matrix @xmath30 which determines the matrix entries completely . the matrix @xmath30 encodes the commutation relations among the elements of the fundamental cluster variable @xmath53 @xmath79 these commutation relations are depicted graphically in figure [ fig : qcomz ] . and @xmath80 or @xmath81 for @xmath82 are illustrated as follows : vertices @xmath68 and @xmath83 are connected by an arrow @xmath70 iff @xmath71 . note that only vertices @xmath84 with heights @xmath85 of opposite parity give rise to non - trivial commutations . the interior of the shaded cone below @xmath49 corresponds to the values @xmath86 such that @xmath87 can not belong to the same cluster as @xmath48 . ] we define the quantum @xmath0 @xmath1-system for the variables @xmath48 subject to the commutation relations to be : @xmath88 as in the commuting system , this is a `` three - term '' recursion relation in the variable @xmath85 : all the variables @xmath89 are determined via these equations in terms of the initial data @xmath90 with @xmath91 . mutations @xmath92 are now implemented by using the relations in the forward direction @xmath93 or backward direction @xmath94 . using equations and , the commutation relations between cluster variables within the same seed @xmath62 are determined for any @xmath95 . within each admissible initial data set of the quantum @xmath0 @xmath1-system , we have the commutation relations ( see fig.[fig : qcom ] ) : @xmath96 for all @xmath97 and @xmath98 , with @xmath99 mod 2 . by induction under mutation . the relations reduce to for @xmath53 under the specialization @xmath100 . suppose the variables in the admissible data set @xmath101 satisfy and that @xmath102 for some fixed value of @xmath103 . let us apply to perform a mutation @xmath104 with @xmath105 . we must check that all the commutation relations between any @xmath106 for @xmath107 and @xmath108 hold . writing @xmath109 , @xmath110 , the new cluster variable is @xmath111 , given by @xmath112 . let @xmath113 , @xmath114 for some @xmath107 . without loss of generality , let s assume that @xmath115 and @xmath116 , @xmath117 . then by the commutation relations , we have @xmath118 henceforth , @xmath80 must commute with @xmath119 , and we obtain @xmath120 in agreement with . the lemma follows . note that @xmath48 and @xmath121 in the same cluster @xmath122 commute if @xmath123 . from the definition of admissible data sets , we see that @xmath48and @xmath121 do not belong to the same cluster if @xmath124 . [ barinv ] equation satisfies a bar invariance " property in the following sense . let @xmath125 denote an algebra antiautomorphism of @xmath126 , where @xmath127 and @xmath128 for @xmath129 . then @xmath130 for all @xmath131 , @xmath99 mod 2 . this result is obtained by conjugating the quantum @xmath1-system by @xmath132 and using the commutation relations . using these commutation relations , we see that the @xmath1-system relation is exactly of the form of the quantum cluster mutation , upon the renormalization of variables @xmath133 . we note that the subset of mutations which we consider in the infinite rank cluster algebra makes sense , because the product on the right hand side of a mutation has only a finite number of factors ( at most three ) . a finite - rank quantum cluster algebra has a laurent property @xcite , that is , cluster variables are laurent polynomials as functions of any cluster seed , as in the case of a commutative cluster algebra . in the quantum case , the coefficients are in @xmath134 $ ] . it is not completely obvious that this carries over to the current case , which has infinite rank . however we will show that the solutions of the quantum @xmath0 @xmath1-system have the laurent property , by constructing explicit formulas for the solutions @xmath48 of the @xmath0 quantum @xmath1-system in terms of any initial data @xmath135 . the coefficients are in @xmath6 $ ] , which is the analog of the positivity property of cluster algebras @xcite . here , we generalize the results of @xcite for the network solution of the @xmath1-system in terms of arbitrary admissible initial data to the non - commutative case . the solution of in terms of any given admissible data @xmath136 is expressed as a quantum network partition function . let @xmath84 be elements of @xmath139 . define the matrices @xmath140 these are interpreted as an elementary transfer matrix or chip " , along a lattice with two rows , going from left to right : @xmath141 or @xmath142 is the weight of the edge connecting the dot ( entry connector ) in row @xmath143 on the left to the dot ( exit connector ) in row @xmath85 on the right in those elementary chips : @xmath144 note that we have represented the variables @xmath84 as attached to the _ faces _ of the chips , separated by their edges . a _ quantum network _ is obtained by the concatenation of such chips , forming a chain where the exit connectors @xmath145 of each chip in the chain are identified with the entry connectors of the next chip in the chain , while face labels are well - defined . the latter condition imposes that @xmath137 and @xmath138 arguments themselves form a chain @xmath146 , for instance : @xmath147 corresponds to the network : @xmath148 the partition function of a quantum network with matrix of weights @xmath149 with entry connector @xmath143 and exit connector @xmath85 is @xmath150 . it the sum over paths from entry @xmath143 to exit @xmath85 of the product on the edges , taken in the order they are traversed . [ prealem ] let @xmath151 be invertible elements with relations @xmath152 , @xmath153 and @xmath154 in @xmath139 , then @xmath155 where @xmath156 is defined by the relation @xmath157 . this definition implies that @xmath158 and @xmath159 . direct calculation : @xmath160 and @xmath161 setting the two expressions equal , we find @xmath162 from the @xmath163 element , @xmath164 from the @xmath165 one . since @xmath68 commutes with @xmath166 , it commutes with @xmath167 , and the first identity implies that @xmath168 , i.e. @xmath169 , and @xmath170 . the lemma follows . let @xmath62 be admissible data . then @xmath171 . we associate @xmath172 if @xmath173 and @xmath174 if @xmath175 . thus for the boundary path @xmath176 on the lattice , @xmath138 is associated with a down step and @xmath137 is associated with an up step . therefore lemma [ prealem ] has a graphical representation in terms of a local mutation of admissible data , @xmath177 in other words , lemma [ prealem ] is an implementation of a mutation of an admissible boundary , using the @xmath0 @xmath1-system . that is , we have the relation @xmath178 where @xmath179 . let @xmath180 ( @xmath181 ) above a fixed admissible boundary @xmath95 , that is , with @xmath182 . onto a given boundary @xmath183 . ] the projection of the point @xmath49 onto the boundary @xmath95 is the set of points @xmath184 , the portion of boundary between the lines @xmath185 and @xmath186 , with endpoints @xmath187 and @xmath188 such that @xmath189 with @xmath190 maximal and @xmath191 with @xmath192 minimal . figure [ fig : proj ] is an example of such a projection . it is a path along the boundary points @xmath193 from the vertex @xmath194 to the vertex @xmath195 formed by a succession of down ( se ) steps @xmath196 and up ( ne ) steps @xmath197 . by definition such a path , if non - empty , starts with a down step and ends up with an up step . to any path @xmath198 made of steps @xmath199 , @xmath200 , we associate a matrix product as follows . we define @xmath201 and @xmath202 , with the matrices @xmath138 and @xmath137 as in and where for any point of the form @xmath203 we denote by @xmath204 . define @xmath205 this product is the weight matrix of the network made up of a concatenation of the basic network chips of the form determined by @xmath206 . let @xmath207 be the corresponding quantum network . the quantum network @xmath207 in equation with weight matrix @xmath208 corresponds to the path @xmath209 made of a succession of steps @xmath210 , and with a set of vertices of the form @xmath211 with @xmath212 mod 2 , @xmath213 , with @xmath214 . the main theorem of this section is the following : [ solq ] let @xmath206 be the projection of @xmath49 onto the boundary @xmath95 , with endpoints @xmath215 and @xmath216 . as a function of the admissible data set @xmath62 , @xmath217 this is proved by induction under mutations of initial data . let @xmath122 be some initial data whose boundary contains the point @xmath49 . for such a case , we have @xmath218 , @xmath219 , and is trivially satisfied . assume holds for some boundary @xmath122 , let us show it also holds for the boundary @xmath220 with @xmath221 , that is , @xmath222 is changed for one value of @xmath103 , and all other values of @xmath223 remain unchanged . if @xmath224 or @xmath225 , then the mutation does not affect the formula , as the boundary @xmath226 is modified outside of the projection of @xmath49 onto it , whereas @xmath227 and hence @xmath48 only depends on the boundary values within the projection . : ( a ) @xmath228 ( b ) @xmath229 ( c ) @xmath230 ( d ) @xmath231 ( e ) @xmath232 . for each case , we indicate the mutation by an arrow . the projection of @xmath49 onto the boundary is modified by the mutation only in the first four cases . ] if @xmath233 , five situations may occur , as sketched in fig.[fig : fivecases ] ( a - e ) . let @xmath206 the projection of @xmath49 onto @xmath95 , and @xmath234 the projection of @xmath49 onto @xmath226 , and @xmath235 , @xmath236 . ( a ) : : if @xmath228 and @xmath237 , then @xmath238 . the first step of @xmath206 is must be @xmath65 for this mutation to be one of the @xmath1-system equations . separating out the contribution of this first step of @xmath206 , we write @xmath239 . using the fact that @xmath240 : @xmath241 where in the last line , we applied eq . . equation follows , as @xmath242 . ( b ) : : if @xmath229 and the first two steps of @xmath206 are @xmath65 , @xmath243 , then @xmath244 , @xmath245 . therefore , @xmath246 by application of eq . . equation follows , as @xmath247 is unchanged by the mutation . ( c ) : : if @xmath230 and @xmath237 , then @xmath248 . the last step of @xmath206 is @xmath243 , so @xmath249 . since @xmath250 , @xmath251 ( d ) : : if @xmath231 and @xmath244 , then @xmath252 and the last two steps of @xmath206 are @xmath65 , @xmath243 . therefore , @xmath253 again using @xmath250 . ( e ) : : if @xmath232 , the endpoints of the projection onto the boundary do not change and the mutation @xmath92 amounts to a change of ordering of one pair of factors within the product @xmath227 of the form , which corresponds to writing it as @xmath254 , @xmath255 and follows . theorem [ solq ] may be rephrased in the language of a quantum network partition function : the quantity @xmath256 is the partition function of the quantum network @xmath207 , with weight matrix @xmath227 , with entry and exit connector @xmath257 , where @xmath206 is the projection of @xmath49 onto the boundary . as all weights involved in the network @xmath207 are laurent monomials of the initial data @xmath62 with coefficients in @xmath6 $ ] , we deduce the following positivity result , the quantum version of the fomin - zelevinsky positivity conjecture : the expression for @xmath48 in terms of any initial data @xmath135 is a laurent polynomial with coefficients in @xmath6 $ ] . consider the case where @xmath258 , with a boundary projection of the form : @xmath259 . then @xmath260 , @xmath261 . it consists of the steps @xmath262 , hence @xmath263 which yields @xmath264 the five monomials forming @xmath265 are the weights of the five paths @xmath266 in the network @xmath207 with weight matrix @xmath227 : @xmath267 onto a boundary @xmath95 , and the corresponding point @xmath268 . ( b ) the action of the reflection @xmath269 . ] finally , we can use the symmetry of the @xmath1-system under the bar involution to compute @xmath87 with @xmath270 . given a boundary @xmath95 and a point @xmath49 above it with @xmath182 , let @xmath206 denote the projection of @xmath49 onto the boundary with endpoints @xmath271 and @xmath272 . then @xmath273 let @xmath268 be the point under the boundary such that @xmath274 ( see fig.[fig : bigrect ] ( a ) for an illustration . ) . let @xmath275 denote a reflection . under @xmath276 , the boundary @xmath95 is sent to @xmath277 ( see fig.[fig : bigrect ] ( b ) ) . the projection of @xmath278 onto the reflected boundary @xmath277 is @xmath279 , a sub - path of @xmath280 , with endpoints @xmath281 and @xmath282 , with @xmath283 and @xmath284 . note that @xmath285 . we have the following : [ identwo ] let @xmath95 , @xmath49 , @xmath206 and @xmath227 be as in theorem [ solq ] , and @xmath268 the point under the boundary @xmath95 defined by . in terms of the initial data @xmath122 , we have : @xmath286 note first that @xmath287 is a solution of the @xmath0 quantum @xmath1-system with @xmath288 . indeed , from , @xmath289 , and upon applying the bar involution of remark [ barinv ] , @xmath290 . therefore with the initial data @xmath291 , we have @xmath292 here , we have made explicit the arguments of @xmath293 , where @xmath294 is the boundary data in the @xmath295 matrices , and the quantum parameter is @xmath14 . similarly , let @xmath296 and @xmath297 where @xmath14 is the quantum parameter . then @xmath298 is obtained from @xmath299 upon substitution of the matrices @xmath300 we note that @xmath301 where @xmath302 is the permutation matrix . therefore , @xmath303 where @xmath280 is the reflected path with @xmath65 and @xmath243 steps interchanged . this last identity corresponds to the reflecting of the entire initial picture . upon renaming @xmath304 , @xmath305 , @xmath306 , @xmath307 , and @xmath308 , we deduce that @xmath309 recalling finally that @xmath310 and that , due to the particular triangular form of the @xmath311 matrices : @xmath312 the theorem follows . in this section we investigate the content of the full network matrix @xmath227 of theorems [ solq ] and [ identwo ] , in the special case of the fundamental boundary @xmath314 , with heights @xmath315 . onto the fundamental boundary @xmath314 . ] let @xmath206 be the projection of @xmath316 with @xmath317 onto the boundary @xmath314 , consisting of vertices @xmath318 with @xmath319 odd ( see fig.[fig : bigsquare ] ) . we have @xmath320 let @xmath321 , then the length of @xmath206 is @xmath322 . we focus on the non - diagonal terms of @xmath323 . these involve what we call ( in analogy with the commutative case ) the conserved quantities of the quantum @xmath0 @xmath1-system : let @xmath316 , and @xmath1 a solution of the quantum @xmath0 @xmath1-system . then @xmath324 is independent of @xmath325 and @xmath326 is independent of @xmath42 . that is , @xmath327 we write the @xmath1-system equations : @xmath328 where in the first line we have used the @xmath4-commutation of @xmath329 and @xmath330 and that of @xmath331 and @xmath332 in the second . subtracting these last two equations leads to @xmath333 . the conservation of @xmath65 is proved in a similar manner . we also define by induction the following polynomials of the conserved quantities : @xmath334 note that , while it is true that @xmath335=0=[\varphi^{(i)}_m,\theta^{(j)}_p]$ ] , for all @xmath336 , neither the @xmath166 s nor the @xmath65 s commute among themselves . we have : let @xmath49 be a point above the boundary @xmath337 and @xmath206 be the projection of @xmath49 onto the boundary , @xmath206 a zig - zag path with endpoints @xmath338 and @xmath339 and length @xmath340 , as in fig.[fig : bigsquare ] . then @xmath341 by induction on @xmath8 . for @xmath342 , @xmath343 , and the theorem holds , as @xmath344 . assume the theorem holds for paths @xmath234 of length @xmath345 . let @xmath206 be a path of length @xmath346 , with @xmath347 , @xmath348 , @xmath349 . denote by @xmath234 the truncated projection between the lines @xmath350 and @xmath351 . for simplicity , we introduce the following notation : @xmath352 and @xmath353 , with @xmath354 for all @xmath143 . we have @xmath355 by applying theorem [ solq ] . repeating this calculation for @xmath356 by the recursion hypothesis , we get analogously : @xmath357 we may consider this identity with indices @xmath358 shifted by @xmath359 , while @xmath8 remains fixed , namely @xmath360 from which we deduce : @xmath361 by use of the @xmath4 commutation of @xmath362 and @xmath363 . comparing with , we finally get @xmath364 by the defining recursion relation for @xmath365 . the second statement of the theorem follows analogously . closely related to the @xmath0 @xmath1-system is the @xmath0 @xmath2-system : @xmath366 which is satisfied by the 2-periodic solutions of the @xmath0 @xmath1-system in @xmath143 , namely with @xmath367 . the admissible initial data are of the form @xmath368 and are the restrictions of the @xmath7-periodic initial data of the @xmath1-system with @xmath95 such that @xmath369 if @xmath370 mod 2 , and @xmath371 otherwise . the @xmath0 @xmath2-system has an associated cluster algebra @xcite with fundamental seed made of the cluster @xmath372 and of the exchange matrix @xmath373 . a forward mutation @xmath374 takes @xmath375 , while a backward one @xmath376 takes @xmath377 . the quantum cluster algebra associated to the cluster algebra of the @xmath0 @xmath2-system , is obtained by taking the admissible pair @xmath63 with @xmath378 ( see ref.@xcite ) , which amounts to the commutation relation @xmath379 for the fundamental initial data @xmath372 . the quantum @xmath0 @xmath2-system @xcite expresses the mutations of the quantum cluster algebra , and reads : @xmath380 together with the above fundamental initial data , compatibility implies the following commutation relation holds within each cluster @xmath368 : @xmath381 note that , like in the commuting case , the solutions of the quantum @xmath0 @xmath2-system are the solutions of the quantum @xmath0 @xmath1-system that are @xmath7-periodic in the index @xmath143 , namely with @xmath382 . the quantum @xmath0 @xmath2-system was solved in @xcite in terms of quantum " paths as follows . let us define weights @xmath383 these weights satisfy the relations : @xmath384 we consider quantum " paths on the integer segment @xmath385 $ ] from and to the origin @xmath386 , with steps @xmath387 with weight @xmath257 for @xmath388 , @xmath389 and @xmath390 for @xmath391 , @xmath392 . the weight of a path @xmath206 , @xmath393 is the product of the step weights in the order in which they are taken . the partition function for quantum paths of length @xmath394 is the sum over the paths @xmath206 from and to the origin , with @xmath394 steps , of the weights @xmath393 . we have the following ( @xcite ) for @xmath395 , the solution @xmath396 to the quantum @xmath0 @xmath2-system is equal to the partition function for quantum paths of length @xmath394 , times @xmath397 . a reformulation of this result uses the two - step " transfer matrix @xmath398 whose entries are the weights of the paths of length @xmath7 that start ( and end ) at the even points @xmath386 and @xmath7 : @xmath399 the theorem may be rephrased as the following identity : @xmath400 we may now apply the theorem [ solq ] above to obtain an alternative quantum network formulation of the @xmath0 @xmath2-system solutions . we start with the fundamental initial data @xmath401 , with @xmath402 . we have by theorem [ solq ] , for all @xmath403 : @xmath404 where , due to the periodicity property , we have @xmath405 comparing with eq . , and noting that @xmath406 , and that @xmath407 , we arrive at the relation : @xmath408 from which we deduce that eqns . and are equivalent , as the conjugation does not affect the @xmath163 matrix element . the fully non - commutative version of the @xmath0 @xmath2-system was studied and solved in @xcite . it reads : @xmath409 for @xmath410 some formal non - commutative variables subject to the quasi - commutation relations @xmath411 where @xmath412 is another fixed non - commuting variable . the quantum case is recovered when @xmath413 is central . using the relations , the non - commutative @xmath0 @xmath2-system may be rewritten as @xmath414 let us keep the definition for @xmath415 , now in terms of the non - commutative initial data @xmath397 and @xmath416 . the solution of @xcite involves non - commutative paths " from and to the origin on @xmath385 $ ] , with weights @xmath257 for the steps @xmath388 , @xmath389 and @xmath390 for the steps @xmath391 , @xmath392 . we have : ( @xcite ) for @xmath417 , the solution @xmath410 of the non - commutative @xmath0 @xmath2-system is the partition function for non - commutative paths from the origin to itself with @xmath322 steps , times @xmath397 . as before , this is best expressed by use of the two - step " transfer matrix @xmath398 , still given by the expression in terms of @xmath397 and @xmath416 , and the identity still holds . the network solution of the quantum @xmath0 @xmath2-system may be adapted for the fully non - commutative one as follows . for non - commuting variables @xmath84 , we introduce the matrices : @xmath418 we have the following generalization of lemma [ prealem ] . [ usefulem ] assume @xmath419 have the quasi - commutations @xmath420 , @xmath421 , and @xmath154 , then we have the equation : @xmath422 for @xmath156 defined via @xmath423 . moreover , with this definition , @xmath424 and @xmath425 . we compute directly @xmath426 and @xmath427 identifying the two results , we obtain @xmath428 from the ( 1,1 ) element identification , and @xmath429 from the @xmath165 one . but from the first identity we deduce that @xmath430 ( as well as @xmath424 ) , and the lemma follows . [ ncmain ] for @xmath417 , @xmath431 , the solution @xmath432 of the non - commutative @xmath0 @xmath2-system is expressed in terms of the initial data @xmath433 as : @xmath434 where @xmath435 and @xmath436 in terms of the matrices of eq .. by induction on @xmath8 . the result is clear for @xmath437 . assume that the theorem holds for @xmath438 . applying the lemma [ usefulem ] for @xmath439 and @xmath440 , we get @xmath441 and @xmath442 . we deduce that : @xmath443 and the theorem holds for @xmath444 . finally , the translational invariance of implies that @xmath432 is the same _ function _ of @xmath445 as @xmath410 of @xmath446 , independently of @xmath431 . the theorem follows . the direct connection between the non - commutative network formulation and the non - commutative path formulation is the same relation between @xmath447 and @xmath398 as in the quantum case . it is now a consequence of : @xmath448 and @xmath449 , by use of the quasi - commutations . in this paper , we have introduced and solved the quantum @xmath0 @xmath1-system in terms of an arbitrary admissible data , by means of a quantum path model . this system turns out to be closely related to the quantum lattice liouville equation of @xcite . the @xmath1-systems in general are related to the so - called @xmath3-systems via a birational transformation @xcite . the following is a quantum version of this transformation . define @xmath450 then @xmath451 note that all the factors in the last line commute . this system may be called quantum @xmath3-system for @xmath0 : if we set @xmath452 and denote @xmath453 it coincides with the @xmath0 @xmath3-system @xcite . in the non - commuting case , it coincides ( upon a reordering of the left hand side and a renormalization of the variables , @xmath454 ) with the quantum lattice liouville equations of @xcite . note that here we do not impose the periodicity condition of @xcite , that @xmath461 . here it would be implemented by a periodicity condition of the form @xmath462 . the solution of this paper holds for any choice of boundary conditions , and may therefore be _ restricted _ to these special periodicity conditions on @xmath48 . p. di francesco and r. kedem , _ q - systems , heaps , paths and cluster positivity _ , comm . math . phys . * 293 * no . 3 ( 2009 ) 727802 , doi 10.1007/s00220 - 009 - 0947 - 5 . arxiv:0811.3027 [ math.co ] . p. di francesco and r. kedem , _ positivity of the @xmath1-system cluster algebra _ , jour . of comb . * 16(1 ) * ( 2009 ) r140 , oberwolfach preprint owp 2009 - 21 , arxiv:0908.3122 [ math.co ] . p. di francesco and r. kedem , _ discrete non - commutative integrability : proof of a conjecture by m. kontsevich _ , int . res . notices ( 2010 ) , doi:10.1093/imrn / rnq024 . arxiv:0909.0615 [ math - ph ] . e. frenkel and n. reshetikhin , _ the @xmath4-characters of representations of quantum affine algebras and deformations of @xmath149-algebras_. in recent developments in quantum affine algebras and related topics ( raleigh , nc 1998 ) , contemp . * 248 * ( 1999 ) , 163205 . a. n. kirillov and n. yu . reshetikhin , _ representations of yangians and multiplicity of occurrence of the irreducible components of the tensor product of representations of simple lie algebras _ , j. sov . math . * 52 * ( 1990 ) 3156 - 3164 . i. krichever , o. lipan , p. wiegmann and a. zabrodin , _ quantum integrable systems and elliptic solutions of classical discrete nonlinear equations _ , phys . * 188 * ( 1997 ) , 267304 . arxiv : hep - th/9604080 . a. kuniba , a. nakanishi and j. suzuki , _ functional relations in solvable lattice models . i. functional relations and representation theory . _ international j. modern phys . a * 9 * no . 30 , pp 52155266 ( 1994 ) . arxiv : hep - th/9310060 .

we solve the quantum version of the @xmath0 @xmath1-system by use of quantum networks . the system is interpreted as a particular set of mutations of a suitable ( infinite - rank ) quantum cluster algebra , and laurent positivity follows from our solution . as an application we re - derive the corresponding quantum network solution to the quantum @xmath0 @xmath2-system and generalize it to the fully non - commutative case . we give the relation between the quantum @xmath1-system and the quantum lattice liouville equation , which is the quantized @xmath3-system .

early hst observations of ngc 1275 , the central galaxy in the perseus cluster , revealed a population of about 60 blue ( v - r @xmath1 0.3 ) star clusters surrounding the nucleus ( holtzman _ et al . _ the color of these clusters suggests an age of roughly 300 million years based on the models of charlot and bruzual ( 1991 ) . spectra of the brightest object ( zepf _ et al . _ 1995 ) also suggest an age of 0.1 to 0.9 gyr , based on a comparison of the observed line widths to those predicted by the models of bruzual and charlot ( 1993 ) . none of the clusters seem to have h@xmath2 emission , with the exception of one object found by shields & filippenko ( 1990 ) , which appears to be a much younger object . the blue clusters in the original wfpc1 images appear unresolved , suggesting sizes of less than 15 parsecs . the brightest object has v = 18.9 , which corresponds to m@xmath3 = -15.8 for @xmath4 = 75 km / s / mpc and cz=5264 km / s ( strauss _ et al . _ 1992 ) . the brightnesses of the blue clusters suggest masses of between 2 @xmath5 10@xmath6 and 1 @xmath5 10@xmath7 m@xmath8 , depending on the assumed age and distance , if one assumes that the objects are star clusters with a salpeter imf . the observed sizes , luminosities , and the estimated masses suggest that these objects may be young analogues of globular clusters . in the past several years , massive young clusters have been observed in a variety of other galaxies . lutz ( 1991 ) detected young globular cluster candidates in a ground - based study of the merger remnant ngc 3597 , and these have been confirmed to be compact by hst observations ( holtzman _ et al . _ candidate young globular clusters have also been found in other interacting systems , including ngc 7252 ( whitmore _ et al . _ 1993 ) , ngc 4038/9 ( whitmore & schweizer 1995 ) , ngc 3921 ( schweizer _ et al . _ 1996 ) , among others . a few massive clusters are seen in the starburst galaxy ngc 253 ( watson _ et al . _ 1996 ) , while others have been detected in the ring galaxies ngc 1097 and ngc 6951 ( barth _ et al . _ 1995 ) and the dwarf galaxies ngc 1569 , ngc 1705 ( oconnell _ et al . _ 1994 ) , and he 2 - 10 ( conti & vacca 1994 ) . while no generally accepted picture has emerged as to what conditions lead to the formation of young clusters , galaxy interactions appear to be an important component . it is particularly difficult to determine the precise mechanism responsible for the presence of these objects in ngc 1275 because of the myriad peculiarities of this galaxy , including the presence of a significant amount of dust , streamers of h@xmath2 emission , an active nucleus , and the location of the galaxy at the center of a cooling flow in the perseus cluster . two hypotheses have been offered for the origin of these clusters , namely , that they were formed from the substantial mass deposition of the perseus cluster cooling flow ( 200 m@xmath8/yr ) or that the cluster formation was triggered by a galaxy - galaxy interaction . et al . _ ( 1992 ) preferred the latter hypothesis based on the observed lack of spread in the wfpc1 colors , which implies a common age for the objects , and the appearance of a ripple in the galaxy light which suggests that a previous interaction may have occurred . richer _ et al . _ ( 1993 ) found larger color spreads in high resolution cfht images and preferred the cooling flow hypothesis . however , holtzman _ _ ( 1996 ) did not detect young clusters in three of a sample of four other cooling flow galaxies ; the central cluster galaxy in abell 1795 may have a few clusters , but it also has a peculiar morphology which suggests a previous interaction . the merger hypothesis is particularly interesting in light of the theory that elliptical galaxies form through mergers and the observation that ellipticals have higher specific frequencies of globular clusters than spirals , where the specific frequency is a measure of the number of globular clusters per unit luminosity of the host galaxy . ashman & zepf ( 1992 ) investigate the proposition that clusters might form during mergers and suggest that , in such an event , cluster formation would occur in a brief burst , resulting in a set of newly formed clusters with a common age and color . this would lead to a cluster system with a bimodal distribution of cluster colors reflecting the difference in metallicity or age ( or both ) between the original and the newly formed clusters . they predict that the spatial distribution of the younger clusters would be more sharply peaked toward the center of the galaxy than that of the old cluster system , because the old globular cluster populations of the two progenitor galaxies would remain spatially extended and probably be dynamically heated during the merger , while the new clusters would be formed out of gas which becomes more centrally concentrated during a merger . however , as harris _ et al . _ ( 1995 ) note , an increase in specific frequency as a result of a merger requires not only that globular clusters form during such an event , but that they form _ preferentially _ over non - cluster stars as compared to the ratio of clusters to background stars in the progenitor galaxies . few estimates of the specific frequency of these young cluster systems exist . et al . _ ( 1996 ) suggest that the 4 young clusters in ngc 253 most likely have formed with a large specific frequency . in the merger remnant ngc 3921 schweizer _ et al . _ ( 1996 ) find that the blue clusters will increase the overall number of clusters enough that the galaxy will come to have the specific frequency of an elliptical within 7 gyr . et al . _ ( 1997 ) find that the specific frequency of globular clusters in the merger remnant ngc 7252 will rise over the next 15 gyr as the background population fades to resemble that of an elliptical . these results all suggest that interactions can increase the specific frequency in a galaxy . luminosity functions of old globular cluster systems have been well studied and used as a part of the extragalactic distance scale because of their uniformity from galaxy to galaxy ; they are roughly gaussian in shape with a peak near m@xmath3 = -7.3 ( harris 1996 ) . the luminosity functions of most of the recently discovered young cluster systems are poorly determined because of either small number statistics ( few young clusters in the galaxy ) or incompleteness . a notable exception is the young cluster system in ngc 4038/9 , which shows no turnover to two magnitudes fainter than the turnover predicted for a typical old cluster system , even after allowing for the expected fading of the clusters based on stellar population models . based on this , van den bergh ( 1995 ) argues that this cluster system may be intrinsically different from old globular cluster systems . however , mateo ( 1993 ) notes that , at least in the lmc , the observed increasing cluster luminosity function is well modelled by a combination of globular and open clusters . also , several authors have recently suggested that substantial numbers of clusters may be destroyed over a hubble time ( gnedin & ostriker 1997 ; elmegreen & efremov 1997 ) ; mechanisms include evaporation and tidal disruption by galactic bulges and disks . we have obtained wfpc2 images of ngc 1275 which go about 4 magnitudes deeper ( in the red ) than the wfpc1 observations of holtzman et al . ( 1992 ) . these observations provide more accurate colors than previous observations and probe the cluster population to approximately 2.5 magnitudes fainter than the turnover expected if this population is identical to the galactic globular cluster system seen at an younger age . section 2 briefly summarizes the observations and the reductions . section 3 discusses our analysis and potential sources of error . in section 4 we present our results including the photometry , luminosity function of the clusters , surface density distribution , an estimate of the specific frequency , and analysis of the sizes of the objects . observations of ngc 1275 were made with the wfpc2 on 1995 november 16 in the f450w and f702w filters . exposure times in f450w were 200 , 1000 , and 3 @xmath5 1300 seconds . in f702w the exposures were 200 , 900 , 1000 , and 2 @xmath5 1300 seconds . the f450w and f702w filters are roughly similar to broad band b and r filters . the data were reduced using the procedures discussed by holtzman _ et al . _ ( 1995a ) . the individual exposures were all taken with a common pointing , and the frames in each color were combined . cosmic rays were rejected in the averaging based on the expected variance from photon statistics and readout noise ; an extra term was included in the expected variance which was proportional to the signal in the pixel to allow for small pointing differences between frames . combined color images of ngc 1275 in the pc and in the wfpc2 fields are shown in figures 1a and 1b , respectively . the nucleus is in the center of the pc , and the other bright point source in the pc is a foreground f star ( hughes & robson 1991 ) . almost all of the remaining point sources are candidate star clusters in ngc 1275 . to detect the compact clusters , we summed the two colors and subtracted a 5 @xmath5 5 boxcar - smoothed version of this image . we divided this by the square root of the smoothed image to provide an image whose units were proportional to the local noise ( assuming the noise is dominated by the background , as is the case here ) . we then used iraf s daofind to detect objects on the resulting image , in order to provide a uniform detection threshold in signal - to - noise ratio across the image . the choice of detection threshold was determined by minimizing the number of spurious detections and maximizing the number of faint objects detected , judging from a visual inspection . objects were filtered by shape based on roundness and sharpness criteria computed by daofind ; we required -1 @xmath9 _ roundness @xmath9 1 and 0.2 @xmath9 _ sharpness @xmath9 1 . several areas of the frame were masked out , including the galaxy nucleus , the bright saturated star in the pc , and a few bright stars and galaxies in the wfs . _ _ aperture photometry was performed using a 1-pixel radius aperture in both the pc and the wfs . the small aperture was used to reduce background related errors , which are large in the central region of the galaxy . sky values were determined by taking an estimate of the mode in a background annulus ; in the pc , the annulus was 2 pixels wide with an inner radius of 12 pixels , while in each wf the corresponding annulus was 3 pixels wide with an inner radius of 6 pixels . we chose to use small sky annuli because the galaxy background is variable on small scales . corrections from 1-pixel aperture flux to flux within 0.5@xmath10 were determined from the nine brightest sources . the average aperture corrections were 1.03 and 1.15 magnitudes in the pc frame for f450w and f702w , respectively , and 0.63 and 0.71 magnitudes in the wfs . these are slightly larger than the corrections for bright point sources measured by holtzman _ et al . _ ( 1995a ) , but this is expected if these objects are slightly resolved . in the pc , measured aperture corrections varied on the order of 0.05 mag between different objects . measured variations in the aperture corrections for the individual wfs were @xmath1 0.02 mag , so an average aperture correction was assumed for all three . if there is an intrinsic spread in cluster sizes , using a single aperture correction for all objects would lead to systematic errors in the derived magnitudes . to first order , however , colors are unaffected by such a spread . the transformations from hst magnitudes ( f450w , f702w ) to cousins magnitudes ( b , r ) were made using the transformations given by holtzman _ et al . _ ( 1995b ) . foreground galactic extinction in the direction of ngc 1275 was taken to be @xmath11 = 0.70 ( burstein & heiles 1984 ) . we determined the extinction in the wfpc2 passbands by numerically integrating the product of an a star spectrum , the filter transmission , the system response , and an extinction curve from cardelli _ et al . _ ( 1989 ) derived assuming @xmath12 . an a star was used because of its similarity to the observed spectrum of the bright clusters . this gave @xmath13 and @xmath14 . these estimates do not include internal extinction , however , which may be important in ngc 1275 since patchy dust is evident ; this is discussed further below . potential photometry errors include intrinsic poisson error in the signal , error in the aperture correction , and error in the background level determination . typical errors were estimated from the simulated clusters from our completeness tests and are shown in figure 2 . the dashed lines in color and magnitude indicate input magnitudes for the artificial clusters . completeness was estimated by generating simulated objects at each of 9 different input magnitudes ( 23.75 to 27.75 in b ) . the simulated objects were given the same noise characteristics as real objects . in the pc , 1000 objects were placed randomly in each of 3 separate annuli to better model the variation of completeness with distance from the center of the galaxy . each set of artificial clusters was given a spatial distribution which mimicked the distribution of the brightest ( b @xmath9 25 ) blue and red clusters . in the wfs , the 1000 artificial objects were placed randomly in a uniform distribution . on each chip , a psf of one of the isolated bright clusters was used to create the simulated objects ( the use of other objects gave comparable results ) . two sets of artificial objects were placed to estimate the difference in detection efficiency for objects of two different colors ; the two sets of simulated clusters were given b - r=0.7 and b - r=1.6 , comparable to the colors of the observed cluster populations ( next section ) . the derived average completeness ( weighted by the spatial distribution of the observed clusters ) as a function of b magnitude is shown in figure 3 for the whole image as well as for the section which fell in the pc . we estimated the number of foreground stars based on the models of bahcall and soneira ( 1980 ) and expect @xmath9 4 objects with b @xmath9 27 in the pc . since we expect such small numbers of foreground stars , we have neglected them . we present the photometry of all detected objects in ngc 1275 by plotting color against apparent magnitude in figure 4a . extinction - corrected absolute magnitudes and colors are shown as well , using a distance of 70.2 mpc determined by assuming pure hubble flow with @xmath4 = 75 km / s / mpc . we find 1181 blue objects ( b - r @xmath9 1.1 ) and 1855 red objects . distinct red and blue populations are seen , although there is significant color scatter . roughly 50% of the blue objects are seen in the pc , as compared to about 15% of the red objects . these objects can not be single stars because they are marginally resolved and because they are too bright . with the exception of the shields - filippenko object , the objects lack h@xmath2 emission ( holtzman _ et al . _ 1992 ) , which precludes their being emission line objects . consequently , they are probably star clusters , as supported by spectroscopy of the brightest object ( zepf _ et al . _ 1995 ) . they are brighter and more compact than open clusters in the galaxy ; the brightest object is 250 times brighter than the brightest galactic open cluster . their closest analog seems to be globular clusters , although the inferred ages are much smaller ( see below ) . to test whether the observed color scatter is likely to be related to internal extinction within ngc 1275 and photometric errors from errors in background subtraction , we show in figure 4b only clusters in the southwestern half of the pc frame which have estimated photometric errors of less than 0.15 mag in both b and r. this region was chosen because it contains fewer obvious signatures of dust than the northeastern region . in fact , we find that the spread in color among the blue objects in figure 4b is consistent with that associated with photometric errors ( cf . figure 2 ) , supporting the conclusion that the observed color spread within the two populations is likely to be caused by the variation of internal extinction in the environment of the galaxy , rather than differences in age . we conclude that the blue clusters are a single color , single age population , with the spread in colors coming from poisson errors and background subtraction errors . figure 4b shows a distinct bimodality in the cluster population , consistent with the presence of two discrete populations . the blue clusters have a typical dereddened ( b - r)@xmath15 0.4 . this is much bluer than typical old globular clusters , which have ( b - r)@xmath16 @xmath1 1.2 ( harris 1996 ) . the uniformity of the colors suggests that the clusters were formed in a relatively short duration single burst rather than an ongoing or continuous process . figure 5 shows the magnitude and color evolution of a single burst population for a variety of metallicities , assuming a salpeter initial mass function from 0.1 to 125 m@xmath17 and a total mass of 1 m@xmath17 ( bruzual & charlot 1993 ) . if we compare the measured colors of the blue clusters in the pc to the models , we infer ages of 10@xmath18 to 10@xmath19 years , allowing for small possible systematic errors in the models and the data as well as the unknown metallicity of the objects . we note that the clusters are far too blue to be explained by a metallicity effect alone . ages younger than 10@xmath18 years are ruled out by the absence of h@xmath2 emission from the clusters . spectra of the clusters ( zepf _ et al . _ 1995 ) argue for a several hundred myr old population dominated in the blue by a type stars . it is also simply less probable that we that we should happen to observe these clusters at a younger age . the lmc has a number of compact clusters with comparable colors ( van den bergh 1981 ) . these objects are substantially fainter than the brightest objects in ngc 1275 , implying that they are less massive . still , observations of blue clusters in the lmc , where we can directly measure ages using the main sequence turnoff in color - magnitude diagrams , give us a less model dependent idea of the spread in colors that could be expected from a spread in ages . figure 6 shows the distribution of b - v versus age for lmc clusters ; ages are from elson & fall ( 1988 ) and hodge ( 1981 , 1983 ) , and colors from van den bergh ( 1981 ) . between 10@xmath7 and 10@xmath19 years , we see that the integrated colors of the clusters cover a range of 0.3 in b - v . this argues against a large spread in the ages for the ngc 1275 clusters , which show no such spread in colors . while our observations were in b and r , not b and v , the color spread in b - r for the same age range would be 0.8 magnitudes , assuming a v - r vs b - r relation from the population synthesis models . given ages , we can estimate masses for the clusters based on their luminosities . age estimates of 10@xmath7 and 10@xmath19 years give mass estimates for the brightest object of 2 @xmath5 10@xmath18 and 10@xmath7 m@xmath17 , respectively . blue clusters at our completeness limit of b @xmath20 27 have masses of 2 @xmath5 10@xmath6 to 10@xmath21 m@xmath17 . these masses are very comparable with those of milky way globulars , which typically have masses between 10@xmath6 and 3@xmath5 10@xmath22 m@xmath17 , with a handful of clusters with m @xmath9 10@xmath23m@xmath8 ( mandushev , spassova , & staneva 1991 , pryor and meylan 1993 ) . our mass estimates depend on the assumption of a salpeter imf . two of the three brightest objects in the southwest half of the pc ( figure 4b ) have much redder colors than the rest of the blue clusters ( b - r of 0.95 and 1.23 ) . while these objects are close to the nucleus , they are bright enough that errors in determining the galaxy background are not a large source of error . possible explanations are reddening by dust , a younger age ( slightly less than 10@xmath18 years old ) when the integrated light is dominated by red supergiants ( leitherer & heckman , 1995 ) , or the identification of these objects with late type foreground stars . for the redder object , the last interpretation is supported by our measurement of sizes ( @xmath24 ) , since it appears to be unresolved while almost all other objects appear marginally resolved . we suggest that the objects with b - r @xmath1 1.6 ( @xmath1 1.3 dereddened ) are the old population of globular clusters around ngc 1275 . these are slightly redder than galactic globular clusters which have an average ( b - r)@xmath16 @xmath1 1.2 . the brightest ( m@xmath25 = -10.7 ) has a magnitude similar to the brightest globulars seen in other central cluster galaxies . figure 7a shows the b luminosity function for the blue clusters ( b - r @xmath9 1.1 ) , and figure 7b shows the b luminosity function for the red clusters ( b - r @xmath26 1.1 ) . the dotted lines in each plot show the results after correction for incompleteness . the luminosity function of the blue clusters looks distinctly different from that expected for a typical old globular cluster population at a younger age . while the galactic globular cluster luminosity function is gaussian in shape with peak at m@xmath25 @xmath1 -6.6 and @xmath27 1.0 mag ( harris 1996 ) , the luminosity function for the clusters in ngc 1275 is more closely fit by a exponential . if we were to observe the current galactic globular cluster system at an age of 500 million years and at the distance of ngc 1275 ( and the same galactic extinction ) , we would observe a turnover in the luminosity function at b @xmath1 24 ( @xmath28 75 km / s / mpc ) . this prediction assumes 4 magnitudes ( 13 gyr ) of fading as suggested by the models of bruzual & charlot ( 1993 ) . our photometry is complete at the 50% level to 3 magnitudes fainter than this , yet there is no evidence of a turnover in the luminosity function of the clusters in ngc 1275 . the luminosity function of the blue clusters has the same trend as that of galactic open clusters , namely , an increasing number of clusters at fainter magnitudes with no turnover ( van den bergh and lafontaine 1984 ) . however , the most luminous clusters in ngc 1275 are brighter than any observed galactic open clusters , despite being older than the brightest of them . the compactness as inferred from the hst images is also different from that of open clusters ( @xmath24 ) . mateo ( 1993 ) finds that an increasing luminosity function for clusters in the lmc can be produced by a mixed population of true globulars and open clusters . in ngc 1275 , a similar explanation would require a large number of open clusters which are far more massive than any galactic open clusters . consequently , as a system , these clusters are different from any cluster system seen in local group galaxies . as individual objects , however , the physical properties appear most similar to globular clusters . in figure 8 , we compare the luminosity function of clusters in ngc 1275 with the luminosity functions in several of the other galaxies where reasonable numbers of blue clusters are found , as well as with the luminosity functions of milky way clusters . dashed lines show rough completeness limits for the different observations , and dotted lines give the location of the expected turnover given the various age estimates of the clusters . there is no strong evidence in any of the young cluster systems for an intrinsic turnover in the luminosity function . if these objects will evolve to look like the galactic globular cluster system , some mechanism must preferentially destroy low luminosity , low mass clusters on timescales of 13 gyr . two possibilities are tidal disruption and evaporation ( gnedin & ostriker 1997 ; elmegreen & efremov 1997 ) . for tidal disruption to preferentially destroy low mass clusters , such clusters must have a lower mean density than more massive clusters . evaporation through two - body relaxation can preferentially destroy lower mass clusters as their stars escape the cluster potential well and are captured by the gravitational potential well of the galaxy . gnedin and ostriker ( 1997 ) predict that from half to three quarters of the initial globular cluster population in a galaxy may be destroyed by a combination of these processes in a hubble time . figure 9 shows the surface density distribution of red and blue clusters ( open triangles and filled triangles , respectively ) . corrections have been made for incomplete annuli at large radii , for masked areas , and for differing completeness levels with distance from the bright galaxy center . error bars are simple poisson errors in counts of clusters . the central area , within 18 pixels ( 0.8 arcsec ) from the core of the galaxy , has been omitted from the surface density profile due to the bright nucleus . it is clear that the blue clusters are more centrally concentrated than the red ones . we fit the surface density distribution of the blue and red cluster systems from 4@xmath10 to 120@xmath10 with power laws . for the blue clusters , we find that a power law slope of -1.3 provides a reasonable fit over the entire range . for the red clusters , we note a flattening in the inner portion of the distribution and fit the surface density with two power laws . inside [email protected] , we measure a slope of -0.6 , while outside [email protected] we find a slope of -1.0 . flattening in the central part of the surface density distribution of a globular cluster system is also seen in other similar galaxies , such as m87 ( mclaughlin 1995 ) and ngc 5128 ( harris _ et al . _ 1984 ) . our measurements for the distribution of old clusters are in good agreement with those of kaisler _ et al . _ ( 1996 ) . however , they adopt a power law slope of -1.3 , based on the observational relation between galaxy magnitude and power law slope of the surface density distribution of the globular cluster system ( harris _ et al . _ 1986 , 1993 ) . we note that our measured outer slope is sensitive to the choice of break point between the inner and outer regions ; the data show a sign of steepening even more in the outermost parts . the spatial distribution of the clusters agrees with the galaxy merger model of ashman and zepf ( 1992 ) , which predicts that the younger clusters will be peaked towards the center of the galaxy , while the older clusters will be more flattened in their distribution . the specific frequency of globular clusters in a galaxy is given by @xmath30 ( harris and van den bergh 1981 ) where @xmath31 is the total number of clusters and @xmath32 is the absolute v magnitude of the galaxy . this is of interest in light of the hypothesis that elliptical galaxies form via mergers of spirals and the observation that ellipticals have a higher specific frequency of globular clusters than spirals . consequently , the merger hypothesis requires that globular clusters form during mergers with a higher specific frequency than that of the progenitor population . also , it requires that clusters form in numbers comparable to those of the old cluster population ( zepf & ashman 1993 ) . to address these questions , we calculate the specific frequency of the old population , the current specific frequency of the merger related population , and the predicted specific frequency of the merger related population in 13 gyr . to calculate specific frequencies , we need to estimate the total number of clusters associated with each population . these estimates come from integrating the surface density profiles of the red and blue clusters from the galaxy core to 100 kpc . this integration suggests that the total number of blue clusters is five times the number of clusters that we observe . for the red clusters , we correct this number for the clusters fainter than our completeness cutoff based on a gaussian fit to the part of the magnitude distribution which we have observed . for the blue clusters , we make no correction for missing faint clusters and consider the resultant specific frequency to be a lower limit . to make a rough prediction of the number of clusters from the merger related population which survive to be 13 gyr old , we assume that the cluster luminosity function will come to resemble the globular cluster luminosity function of the galaxy after 4 magnitudes of fading and substantial cluster destruction . we assume that no clusters brighter than the predicted turnover of m@xmath25 = -10.6 are destroyed , and that the remaining clusters fainter than the turnover are equal in number to those brighter than the turnover , forming a gaussian luminosity function . we note that this would require the destruction of @xmath1 90% of the young clusters in ngc 1275 seen within our field . if the young cluster population is older than 10@xmath7 yrs , less cluster destruction would be required , and we would derive a higher specific frequency . of course , if some fraction of the massive clusters are destroyed as well , we would derive a lower specific frequency . our corrections yield estimates of 12,700 clusters for the old population , 5700 clusters for the young population , and 550 clusters remaining from the young cluster population after 13 gyr . we also need to estimate what fraction of the underlying stellar component is associated with each of the populations . ngc 1275 clearly has an excess blue population over what is normally observed in central cluster galaxies ( romanishin 1987 ) . it is unknown whether this blue population is related to star formation in a recent merger or whether it is related to the presence of the cooling flow centered on ngc 1275 . assuming the entire excess blue light comes from a merger - related population , we derive a lower limit for the specific frequency of globular clusters in such a population . romanishin ( 1987 ) estimates that 15% of the total b light comes from an excess blue population , and we adopt this contribution as an upper limit for the v band as well . with a total brightness of v=11.88 ( devaucouleurs _ et al . _ 1991 ) , our adopted @xmath33 , and @xmath34 km / s / mpc , we derive @xmath35 . using a 15% contribution for the merger - related population gives @xmath36 and @xmath37 . in order to estimate the specific frequency of the merger - related population _ as it would appear in @xmath1 13 gyr _ , we need to allow for a fading of the background population , and we adopt 4 magnitudes of fading based on the population synthesis models . we combine the information on the total number of clusters with the total v magnitudes for the populations to calculate specific frequencies . these estimates yield a @xmath38 for the old population , a @xmath39 for the current young population ( without corrections for background fading or for cluster destruction ) , and a @xmath40 as an estimate of the specific frequency of the young population after 13 gyr of cluster destruction and 4 magnitudes of background fading . even without correction for clusters outside the wfpc2 field of view , we would predict 150 clusters surviving for 13 gyr and a specific frequency of 28 . all of these numbers , however , have significant uncertainties , as the corrections for completeness , cluster destruction , and fading are very substantial while at the same time being highly uncertain . from shallower ground - based observations over a larger field , kaisler _ et al . _ ( 1996 ) determine the s@xmath41 for the old cluster population to be 4.3 . the main sources of disagreement are that they have adopted a steeper surface density profile and a different total v magnitude . the increase in the _ overall specific frequency of the galaxy from this event , however , is small , as the number of these clusters predicted to survive 13 gyr is small ; only about 550 new clusters would be added to a population of 12,700 . whether the specific frequency increases significantly in a merger depends on the mass and gas content of the merging bodies . however , the numbers are intriguing because they suggest that , even allowing for substantial cluster destruction , the specific frequency of a merger - related population in 13 gyr will be much higher than that typically observed in spiral galaxies . while this particular merger event will not have a large impact on the overall specific frequency in ngc 1275 , it does show that a merger population can have a large specific frequency , which is the first requirement for increasing the overall specific frequency in a merger . consequently , the observation that ellipticals have a higher specific frequency of globular clusters is not inconsistent with the hypothesis that these galaxies have formed via the merging of spiral systems . _ our calculation indicates that an estimate of the future specific frequency is difficult to make , as several large corrections must be applied . the most uncertain of these is probably the estimate of the number of clusters which will be destroyed . future work will need to carefully consider the probability of cluster destruction as a function of cluster mass and density if one wants to put serious constraints on the merger hypothesis for ellipticals from observations of their globular cluster systems . holtzman _ et al . _ ( 1996 ) estimated the sizes of marginally resolved clusters in wfpc2 images using the difference between a 1 and a 2 pixel aperture magnitude . these measurements are compared with measurements of simulated objects made by convolving a model psf with a modified hubble profile . the comparison yields an estimate of the cluster core radius _ if _ the cluster shape is well modelled by a modified hubble profile . figure 10 shows measurements of @xmath42 in f702w for the ngc 1275 objects ; note that values are near zero because @xmath42 is defined differentially with respect to a model point source placed at the same location on the frame as each cluster ( see holtzman _ et al . _ 1996 for details ) . positive values of @xmath42 indicate that the objects are resolved , and core radii are estimated using figure 4 of holtzman _ et al . _ ( 1996 ) . for the brighter objects , we find that the objects are most likely resolved , with estimated core radii of @xmath43 pixels , corresponding to @xmath1 0.15 - 0.75 pc using our adopted distance to ngc 1275 . despite the uncertainties in these measurements , it seems clear that these objects are compact , and much more comparable to globular clusters than to open clusters . from new deep observations of ngc 1275 with hst , we identify roughly 3000 objects which appear to be compact star clusters . the color distribution of the cluster system is bimodal , with a blue population which has ( b - r)@xmath16 @xmath1 0.4 and a red population which has ( b - r)@xmath16 @xmath1 1.3 . we suggest that the red objects are members of the old globular cluster system and that the blue objects are members of a young globular cluster system . in an apparently dust - free region , the spread in the colors of the blue clusters is small enough that it is entirely attributable to scatter from errors in the photometry , mostly due to errors in sky subtraction . this suggests that the blue clusters are a single color , single age population . this argues against the hypothesis that clusters have been forming continuously from the cooling flow , and supports the hypothesis that their formation may have been triggered by a previous merger . the luminosity function continues to rise to the limit of our observations and is inconsistent with a gaussian globular cluster luminosity function peaking near m@xmath3 = -7.3 after correction for evolutionary effects . a similar luminosity function observed in ngc 4038/9 ( the antennae ) has been used by van den bergh ( 1995 ) to argue that the young clusters observed there are not true globular clusters . however , the masses and sizes of the individual young clusters appear to be comparable to those of globulars . we suggest that either the luminosity function evolves , with fainter clusters being preferentially destroyed as time passes , or that the initial luminosity / mass function of the young cluster system is different from that of typical old globular cluster systems . if cluster destruction is responsible for the difference in luminosity function , a destruction mechanism which preferentially destroys fainter , lower mass clusters must be invoked . in order to create a turnover in the luminosity function at the same mass as in old cluster systems , the destruction of over 90% of the clusters currently seen in ngc 1275 would be required , given our assumption of 4 magnitudes of fading . given these likely differences in the luminosity functions of different globular cluster systems , whether caused by evolutionary effects or by initial differences , it is clear that some caution must be exercised in using the cluster luminosity function as a distance indicator . we have attempted to estimate the specific frequency of the young population seen in ngc 1275 to determine whether it is likely that the overall specific frequency as seen at a future time could be increased because of the proposed merger - related formation of globulars . we note that the overall specific frequency of ngc 1275 will only be slightly increased by the proposed merger event which formed the blue clusters , due to the small number of clusters expected to survive for a hubble time . but we estimate a large specific frequency of the merger related population , which suggests that mergers are efficient in forming globular clusters . however , corrections for incompleteness at faint magnitudes , clusters residing outside the current field of view , uncertainties in the mass and luminosity of the stellar population formed during a merger event , and , especially , corrections for evolutionary effects in both the background and cluster populations are all significant effects for which we have only relatively crude estimates . ashman , k. m. & zepf , s. e. 1992 , apj , 384 , 50 bahcall , j. n. & soneira , r. m. 1980 , apjs , 44 , 73 barth , a. j. , ho , l. c. , filippenko , a. v. , & sargent , w. l. w. 1995 , aj , 110 , 1009 bruzual , a. g. & charlot , s. 1993 , apj 405 , 538 burstein , d. & heiles , c. 1984 , apjs , 54 , 33 cardelli , j. a. , clayton , g. c. & mathis , j. s. 1989 , apj , 345 , 245 charlot , s. & bruzual , a. g. 1991 , apj , 367 , 126 conti , p. s. & vacca , w. d. 1994 , apj , 423 , l97 de vaucouleurs , g. , de vaucouleurs , a. , corwin , jr . , h. g. , buta , r. j. , paturel , g. , fouque , p. 1991 , third reference catalogue of bright galaxies ( new york : springer - verlag ) , vol 2 , p. 262 elmegreen , b. g. & efremov , y. n. 1997 , apj , 480 , 235 elson , r. a. & fall , s. m. 1988 , aj , 96 , 1383 gnedin , o. y. & ostriker , j. p. 1997 , apj , 474 , 223 harris , g. l. , hesser , j. e. , harris , h. c. & curry , p. j. 1984 , apj , 287 , 175 harris , w. e. , & van den bergh , s. 1981 , aj , 251 , 497 harris , w. e. 1986 , aj , 91 , 822 harris , w. e. 1993 , in the globular cluster galaxy connection , asp conf . series vol . g. h. smith and j. p. brodie ( san francisco : bookcrafters , inc . ) , p. 472 harris , w. e. , pritchet , c. j. , & mcclure , r. d. 1995 , apj , 441 , 120 harris , w. e. 1996 , aj , 112 , 1487 hodge , p. w. 1981 , in iau colloquium 68 , astrophysical parameters for globular clusters , ed . a. g. d. philip and d. s. hayes ( schenectady : l. davis press ) , p. 205 hodge , p. w. 1983 , apj , 264 , 470 holtzman , j. a. _ et al . _ 1992 , aj , 103 , 691 holtzman , j. a. _ et al . _ 1995a , pasp , 107 , 156 holtzman , j. a. _ et al . _ 1995b , pasp , 107 , 1065 holtzman , j. a. _ et al . _ 1996 , aj , 112 , 416 hughes , d. h. & robson , e. i. 1991 , mnras , 249 , 560 kaisler , d. , harris , w. e. , crabtree , d. r. , & richer , h. b. 1996 , aj , 111 , 2224 leitherer , c. & heckman , t. m. 1995 , apjs , 96 , 9 lutz , d. 1991 , a&a , 245 , 31 mandushev , g. , spassova , n. , & staneva , a. 1991 , a&a , 252 , 94 mateo , m. 1993 , in the globular cluster galaxy connection , asp conf . series vol . g. h. smith and j. p. brodie ( san francisco : bookcrafters , inc . ) , p. 387 mclaughlin , d. e. 1995 , aj , 109 , 2034 miller , b. w. , whitmore , b. c. , schweizer , f. , & fall , s. m. 1997 , submitted to aj oconnell , r. w. , gallagher , j. s. & hunter , d. a. 1994 , apj , 433 , 65 pryor , c. & meylan , g. 1993 , in asp conf . s. g. djorgovski & g. meylan ( san francisco : asp ) , p. 357 richer , h. b. , crabtree , d. r. , fabian , a. c. , & lin , d. n. c. 1993 , aj , 105 , 877 romanishin , w. 1987 , apj , 323 , l113 schweizer , f. , miller , b. w. , whitmore , b. c. , & fall , s. m. 1996 , aj , 112 , 1839 shields , j. c. & filippenko , a. 1990 , apj , 353 , l7 shields , j. c. , filippenko , a. , & basri , g. 1990 , aj , 100 , 1805 strauss , m. a. , huchra , j. p. , davis , m. , yahil , a. , fisher , k. b. , tonry , j. 1992 , apjs , 83 , 29 van den bergh , s. 1981 , a&as , 46 , 79 van den bergh , s. 1991 , apj , 369 , 1 van den bergh , s. 1995 , apj , 450 , 27 van den bergh , s. & lafontaine , a. 1984 , aj , 89 , 1822 watson , a. m. _ et al . _ 1996 , aj , 112 , 534 whitmore , b. c. & schweizer , f. 1995 , aj , 109 , 960 whitmore , b. c. , schweizer , f. , leitherer , c. , borne , k. & robert , c. 1993 , aj , 106 , 1354 zepf , s. e. , carter , d. , sharples , r. m. , & ashman , k. m. 1995 , apj , 445 , l19 zepf , s. e. , & ashman , k. m. 1993 , mnras , 264 , 611

we present an analysis of compact star clusters in deep hst / wfpc2 images of ngc 1275 . b and r band photometry of roughly 3000 clusters shows a bimodality in the b - r colors , suggesting that distinct old and young cluster populations are present . the small spread in the colors of the blue clusters is consistent with the hypothesis that they are a single age population , with an inferred age of 0.1 to 1 gyr . the luminosity function shows increasing numbers of blue clusters to the limit of our photometry , which reaches several magnitudes past the turnover predicted if the cluster population were identical to current galactic globulars seen at a younger age . the blue clusters have a spatial distribution which is more centrally peaked than that of the red clusters . the individual clusters are slightly resolved , with core radii @xmath0 pc if they have modified hubble profiles . we estimate the specific frequencies of the old and young populations and discuss the uncertainties in these estimates . we find that the specific frequency of the young population in ngc 1275 is currently larger than that of the old population and will remain so as the young population evolves , even if the majority of the low mass clusters are eventually destroyed . if the young population formed during a previous merger , this suggests that mergers can increase the specific frequency of globulars in a galaxy . however , the presently observed young population likely contains too few clusters to have a significant impact on the overall specific frequency as it will be observed in the future .

searching for neutral vector resonances is one important task in the large hadron collider ( lhc ) programme , being the drell - yan process @xmath13 the preferred one in these studies @xcite . this signal with charged leptons in the final state has smaller backgrounds than those with only hadrons , but it requires that the new boson couples to both quarks and leptons , being this process suppressed when either of these types of couplings vanishes . the @xmath3 channel is an alternative if the couplings to leptons are the ones which are negligible . among the hadronic final states , @xmath14 is very interesting by itself because , being the top very heavy , it allows for a relatively easy identification and reconstruction , and for this reason its backgrounds are relatively smaller . even more , @xmath4 is not only an alternative to the drell - yan process when the new resonance is leptophobic , but it is always complementary to determine the model because it involves a different combination of couplings , and it also allows for asymmetry measurements in the semileptonic decay @xcite . new gauge bosons are predicted in many of the best motivated standard model ( sm ) extensions . for instance , parity restoration , which can be at the tev scale , requires extending the sm gauge symmetry to @xmath15 , with new neutral and charged gauge bosons at this scale @xcite . grand unified models always predict new gauge bosons , and some of them may survive at lower energies @xcite . in general , models addressing the hierarchy problem which are not based on supersymmetry , such as little higgs models @xcite or models with large extra dimensions @xcite , also introduce ( a plethora of ) new vector bosons , with some of them at the lhc reach . many of them couple to quarks and leptons but , as already stressed , even in this case ( and obviously in the leptophobic limit ) it is important to perform a detailed resonance search in the @xmath14 channel . with this purpose in mind , we have extended @xcite with a generator for @xmath0 production , including real emissions matched with leading logarithmic ( ll ) corrections ( both real and virtual ones ) . this is presented in the next section , and applied to the search of vector resonances decaying into @xmath14 in the following ones . for the sake of illustration , we concentrate on the case of a leptophobic @xmath16 , which also decays into new heavy neutrinos @xmath17 if @xmath18 @xcite . the model is described in section [ model ] , where we also give details of the simulation of top pair production mediated by neutral gauge bosons . then , in section [ analysis ] we show the relevance of using a generator including these contributions : a combined analysis of @xmath19 and @xmath20 improves the lhc sensitivity to neutral vector resonances , raising the statistical significance of the signal by 25% compared with an inclusive analysis . precise simulations of @xmath0 production in different channels are not only essential for discovery , but to determinine the model by measuring all the @xmath0 couplings with a precision as high as possible . the last section is devoted to our conclusions . in this section we briefly describe the main features of the new code . it evaluates the matrix elements for @xmath21 jets production , with @xmath0 decaying into several final states including @xmath2 and @xmath3 . actually `` @xmath21 jets '' stands for the sum of the three possible intermediate vector bosons , namely @xmath22 , @xmath23 and @xmath0 ; their interferences as well as their widths and all spin correlations are taken into account . decay products , as for example in @xmath24 , but for simplicity we still denote these processes as @xmath25 jets . obviously , by @xmath5 we only refer to events in which the extra jet is radiated off the @xmath0 decay products . the radiation from top decay products is not included at the matrix element level . ] detailed information can be found in the readme file available at http://mlm.home.cern.ch / mlm / alpgen/. the sm parameters are controlled , as it happens for all the other processes implemented in @xcite , by the variable iewopt , whose default value is iewopt = 3 . the possible final state is selected with the parameter ifs ( e.g. ifs = 0 @xmath26 @xmath27 , ifs = 2 @xmath26 @xmath3 ) , and its left - handed ( lh ) and right - handed ( rh ) couplings to @xmath0 with glzpe , grzpe and glzptop , grzptop respectively . in addition , the new gauge boson ( lh and rh ) couplings to the initial quarks , and its mass and width can be arbitrarily defined through the variables glzpup , grzpup , glzpdown , grzpdown , glzpc , grzpc , glzps , grzps , and masszp and zpwid , respectively , the lagrangian being @xmath28 and zpwid the width of the @xmath0 boson . finally , the mlm matching prescription @xcite can be applied by taking the parameter ickkw = 1 . in table [ tab : zpjets_processes ] we gather the parton subprocesses evaluated for any given jet multiplicity . .3 cm @xmath29 & @xmath30 & @xmath31 & @xmath32 + @xmath33 & @xmath34 & @xmath35 & @xmath36 + since our aim is studying qcd corrections to the production of a single @xmath37-channel @xmath0 boson , rather than the production of two @xmath0 bosons , we neglect contributions with two light quark pairs , because in our approach the former excludes the latter . in order to illustrate the capabilities of this code we will evaluate top pair production for the leptophobic model described in the next section . the full analysis is presented in section [ analysis ] . as it can readily be seen from fig . [ fig : minv ] , taking @xmath38 tev with a total width @xmath39 gev , [ cols="^,^,^ " , ] the @xmath3 distribution for the signal plus background and background alone is presented in fig . [ fig : mtt - an0 ] . the number of events at the peak @xmath40 is also given in table [ tab : nsnb - an0 ] . as expected , in this case the background scaling factor is larger than for the other analyses , @xmath41 , and the peak significance is of @xmath8 . this number is 25% smaller than the combined significances of the other two analyses , @xmath7 . we provide a new code implemented in alpgen for neutral vector resonance production , including the higher order corrections from real emission and the virtual ll contributions . in order to illustrate its features we have generated @xmath3 and @xmath42 events by the exchange of a leptophobic gauge boson based on @xmath43 at lhc . the analysis of the @xmath19 and @xmath44 samples show that such a program is necessary to account for @xmath45% of the @xmath46 events . indeed , for these events the resonance is not found in the @xmath3 invariant mass distribution but on the @xmath47 invariant mass . therefore , their presence can not be accounted for by a @xmath6 factor multiplying the lo @xmath48 cross section but has to be properly simulated at the generator level . we have shown that the lhc discovery potential for neutral vector resonances in the @xmath49 final state benefits from a separate analysis for @xmath3 and @xmath42 . for the case examined ( with a @xmath50 mass of 1 tev ) , the enhancement over an inclusive search for @xmath3 resonances is of a 25% in the statistical significance . this improvement is expected to be maintained for larger masses , and of course for other @xmath0 models than the leptophobic @xmath50 one used in the simulations . for other @xmath3 resonances the trend is expected to be the same as well . finally , the inclusion of corrections to @xmath4 not only translates into a better discovery potential but also into a proper description of the kinematical distributions . a code implementing them is necessary to establish the model once a new vector resonance is discovered , discriminating among models by a more precise measurement of the angular distributions @xcite and the different @xmath0 couplings @xcite . this work has been partially supported by micinn ( fpa2006 - 05294 ) , by junta de andaluca ( fqm 101 , fqm 437 and fqm 03048 ) , and by the european community s marie - curie research training network under contract mrtn - ct-2006 - 035505 `` tools and precision calculations for physics discoveries at colliders '' . the work of j.a.a.s . and m.t . has been supported by micinn ramn y cajal and juan de la cierva contracts , respectively . f.p . and m.m . acknowledge warm hospitality and partial support from cern , physics department , th unit , during the completion of this work . see for a recent review p. langacker , arxiv:0801.1345 [ hep - ph ] ; and references there in . see also a. leike , phys . * 317 * ( 1999 ) 143 [ arxiv : hep - ph/9805494 ] ; c. amsler _ et al . _ [ particle data group ] , phys . b * 667 * ( 2008 ) 1 . g. aad _ et al . _ [ the atlas collaboration ] , arxiv:0901.0512 [ hep - ex ] . g. l. bayatian _ et al . _ [ cms collaboration ] , j. phys . g * 34 * ( 2007 ) 995 . for a comparison between @xmath51 generators and a study of qcd and electroweak corrections see c. buttar _ _ , arxiv:0803.0678 [ hep - ph ] . v. m. abazov _ et al . _ [ d0 collaboration ] , phys . lett . * 100 * ( 2008 ) 142002 [ arxiv:0712.0851 [ hep - ex ] ] ; t. aaltonen _ et al . _ [ cdf collaboration ] , phys . * 101 * ( 2008 ) 202001 [ arxiv:0806.2472 [ hep - ex ] ] . p. langacker , r. w. robinett and j. l. rosner , phys . d * 30 * ( 1984 ) 1470 . j. l. hewett and t. g. rizzo , phys . * 183 * ( 1989 ) 193 . see for a recent review r. diener , s. godfrey and t. a. w. martin , arxiv:0910.1334 [ hep - ph ] ; and references there in . i. antoniadis , k. benakli and m. quiros , phys . b * 331 * ( 1994 ) 313 [ arxiv : hep - ph/9403290 ] ; t. g. rizzo , phys . d * 61 * ( 2000 ) 055005 [ arxiv : hep - ph/9909232 ] ; a. djouadi , g. moreau and r. k. singh , nucl . b * 797 * ( 2008 ) 1 [ arxiv:0706.4191 [ hep - ph ] ] . m. l. mangano , m. moretti , f. piccinini , r. pittau and a. d. polosa , jhep * 0307 * ( 2003 ) 001 [ arxiv : hep - ph/0206293 ] ; f. caravaglios , m. l. mangano , m. moretti and r. pittau , nucl . b * 539 * ( 1999 ) 215 [ arxiv : hep - ph/9807570 ] . f. del aguila and j. a. aguilar - saavedra , jhep * 0711 * ( 2007 ) 072 [ arxiv:0705.4117 [ hep - ph ] ] . m. l. mangano , `` the so - called mlm prescription for me / ps matching '' , talk given at the fermilab me / mc tuning workshop , october , 2004 . m. l. mangano , m. moretti , f. piccinini and m. treccani , jhep * 0701 * , 013 ( 2007 ) [ arxiv : hep - ph/0611129 ] . f. del aguila , l. ametller and r. pittau , phys . b * 628 * ( 2005 ) 40 [ arxiv : hep - ph/0507262 ] ; pos * hep2005 * ( 2006 ) 311 [ arxiv : hep - ph/0511243 ] . aleph , delphi , l3 and opal collaborations and lep electroweak working group , cern - ppe-95 - 172 . p. chiappetta , j. layssac , f. m. renard and c. verzegnassi , phys . d * 54 * ( 1996 ) 789 [ arxiv : hep - ph/9601306 ] ; g. altarelli , n. di bartolomeo , f. feruglio , r. gatto and m. l. mangano , phys . b * 375 * ( 1996 ) 292 [ arxiv : hep - ph/9601324 ] ; v. d. barger , k. m. cheung and p. langacker , phys . b * 381 * ( 1996 ) 226 [ arxiv : hep - ph/9604298 ] ; g. montagna , f. piccinini , j. layssac , f. m. renard and c. verzegnassi , z. phys . c * 75 * ( 1997 ) 641 [ arxiv : hep - ph/9609347 ] . k. s. babu , c. f. kolda and j. march - russell , phys . d * 54 * ( 1996 ) 4635 [ arxiv : hep - ph/9603212 ] . f. gursey , p. ramond and p. sikivie , phys . b * 60 * ( 1976 ) 177 . f. del aguila , m. cvetic and p. langacker , phys . d * 52 * ( 1995 ) 37 [ arxiv : hep - ph/9501390 ] ; see also f. del aguila , acta phys . b * 25 * ( 1994 ) 1317 [ arxiv : hep - ph/9404323 ] ; s. godfrey and t. a. w. martin , phys . * 101 * ( 2008 ) 151803 [ arxiv:0807.1080 [ hep - ph ] ] . f. del aguila , g. a. blair , m. daniel and g. g. ross , nucl . b * 283 * ( 1987 ) 50 ; f. del aguila , m. quiros and f. zwirner , nucl . b * 287 * ( 1987 ) 419 . y. hosotani , phys . b * 126 * ( 1983 ) 309 ; y. hosotani , phys . b * 129 * ( 1983 ) 193 ; e. witten , phys . b * 149 * ( 1984 ) 351 . j. a. aguilar - saavedra , nucl . b * 828 * ( 2010 ) 289 [ arxiv:0905.2221 [ hep - ph ] ] . h. l. lai _ et al . _ [ cteq collaboration ] , eur . j. c * 12 * ( 2000 ) 375 [ arxiv : hep - ph/9903282 ] . d0 collaboration , d0 note 5882-conf j. a. aguilar - saavedra , jhep * 0911 * ( 2009 ) 030 [ arxiv:0907.3155 [ hep - ph ] ] . t. sjostrand , s. mrenna and p. skands , jhep * 0605 * ( 2006 ) 026 [ hep - ph/0603175 ] . j. alwall _ et al . _ , eur . j. c * 53 * , 473 ( 2008 ) [ arxiv:0706.2569 [ hep - ph ] ] . e. richter - was , hep - ph/0207355 . j. m. campbell and r. k. ellis , phys . d * 65 * , 113007 ( 2002 ) [ arxiv : hep - ph/0202176 ] ; phys . d * 62 * , 114012 ( 2000 ) [ arxiv : hep - ph/0006304 ] ; phys . d * 60 * , 113006 ( 1999 ) [ arxiv : hep - ph/9905386 ] . see , for example , w. bernreuther , m. flesch and p. haberl , phys . d * 58 * ( 1998 ) 114031 [ arxiv : hep - ph/9709284 ] ; w. bernreuther , a. brandenburg and m. flesch , arxiv : hep - ph/9812387 ; b. lillie , j. shu and t. m. p. tait , phys . d * 76 * ( 2007 ) 115016 [ arxiv:0706.3960 [ hep - ph ] ] ; r. frederix and f. maltoni , jhep * 0901 * ( 2009 ) 047 [ arxiv:0712.2355 [ hep - ph ] ] .

we have implemented a code for @xmath0 + @xmath1 jets production in alpgen , with @xmath0 decays into several final states , including @xmath2 and @xmath3 . the mlm prescription is used for matching the matrix element with the parton shower , including in this way the leading soft and collinear corrections . in order to demonstrate its capabilities , we perform a combined analysis of @xmath4 and @xmath5 production for a heavy leptophobic gauge boson . it is found that the effect of the extra jet can not only be accounted for by a @xmath6 factor multiplying the leading - order cross section . in fact , the combined analysis for @xmath4 and @xmath5 presented improves the statistical significance of the signal by 25% ( @xmath7 versus @xmath8 for a @xmath0 mass of 1 tev ) , compared with the results of an inclusive analysis carried out on the same sample of @xmath9 events . * combined analysis of @xmath4 and @xmath5 production + for vector resonance searches at lhc * f. del aguila@xmath10 , j. a. aguilar saavedra@xmath10 , m. moretti@xmath11 , f. piccinini@xmath12 , r. pittau@xmath10 , + m. treccani@xmath10 + _ @xmath10 departamento de fsica terica y del cosmos and cafpe , + universidad de granada , e-18071 granada , spain _ + _ @xmath11 dipartimento di fisica , universit di ferrara , and infn , 44100 ferrara , italy _ + _ @xmath12 infn , sezione di pavia , v. a. bassi 6 , i 27100 , pavia , italy _

SECTION 1. SHORT TITLE. This Act may be cited as the ``Master Teacher Scholarship Act of 2005''. SEC. 2. FINDINGS. Congress makes the following findings: (1) Programs in title II of the Higher Education Act of 1965 (20 U.S.C. 1021 et seq.) address improving the quality of the teaching workforce and holding institutions of higher education accountable for preparing teachers. However, States are still finding it difficult to provide high-quality teachers in the areas of mathematics and science and for secondary schools. (2) Under the Elementary and Secondary Education Act of 1965 (20 U.S.C. 6301 et seq.), as amended by the No Child Left Behind Act of 2001 (Public Law 107-110, 115 Stat. 1425), States are required to ensure that all teachers teaching in core academic subjects within the State are highly qualified by not later than the end of the 2005-2006 school year. Yet schools in rural areas and high-poverty schools have trouble attracting and retaining such teachers. (3) Teacher retention is at the main root of teacher shortages, and recruitment initiatives alone will not solve this problem. SEC. 3. DEFINITIONS. In this Act: (1) Eligible local educational agency.--The term ``eligible local educational agency'' means a local educational agency that serves a school that qualifies under section 465(a)(2)(A) of the Higher Education Act of 1965 (20 U.S.C. 1087ee(a)(2)(A)) for loan cancellation for Perkins loan recipients who teach in such schools. (2) Eligible teacher.--The term ``eligible teacher'' means a teacher who is employed by the eligible local educational agency included in the partnership with the teacher preparation program and is-- (A) an elementary school or secondary school special education teacher; or (B) a middle school or secondary school teacher who teaches in the area of mathematics, science, or foreign languages. (3) Secretary.--The term ``Secretary'' means the Secretary of Education. (4) Teacher preparation program.--The term ``teacher preparation program'' means a school of education program at an institution of higher education that provides courses of study leading to a graduate degree. SEC. 4. PROGRAM AUTHORIZED. (a) In General.--The Secretary may award grants to teacher preparation programs for the purpose of enabling the teacher preparation programs to award scholarships to assist eligible teachers in obtaining a graduate level degree from the teacher preparation program. (b) Application.--Each teacher preparation program applying for a grant shall submit, in partnership with an eligible local educational agency, an application to the Secretary describing-- (1) the partnership between the teacher preparation program and the eligible local educational agency; and (2) how the teacher preparation program is designed to meet the needs of the teachers participating in the program and the partnering local educational agency, including mentoring and alignment of the teacher preparation program with the high academic standards that students of the State where the teacher preparation program is located are expected to meet. (c) Use of Funds.-- (1) In general.--Each teacher preparation program receiving a grant under this Act shall use the grant funds to award scholarships to eligible teachers pursuing a graduate degree in the area of mathematics, science, foreign language, or special education. (2) Administrative costs.--Each teacher preparation program receiving a grant under this Act may use not more than 1 percent of the grant funds-- (A) to administer the scholarship program; (B) to recruit teachers to participate in the program; and (C) to assist in designing the program to meet the needs of the teacher and school. (d) Scholarships.--Each individual awarded a scholarship under this Act shall use the scholarship funds only to pay for the tuition and fees associated with obtaining a graduate level degree. SEC. 5. SCHOLARSHIP AGREEMENT. Each eligible teacher awarded a scholarship under this Act shall enter into an agreement with the eligible local educational agency and the teacher preparation program, under which-- (1) the teacher preparation program agrees to award a scholarship of a total of not less than $5,000 and not more than $7,000 to the eligible teacher; and (2) the eligible teacher agrees-- (A) to teach for 5 years after receiving the graduate level degree, in the school the eligible teacher previously taught or in a school designated by the eligible local educational agency; (B) to mentor a novice teacher in the eligible local educational agency for 2 years; and (C) to repay a pro rata portion of the scholarship funds received if the teacher fails to comply with subparagraph (A). SEC. 6. AUTHORIZATION OF APPROPRIATIONS. There are authorized to be appropriated to carry out this Act $30,000,000 for fiscal year 2006 and each of the 5 succeeding fiscal years.

Master Teacher Scholarship Act of 2005 - Authorizes the Secretary of Education to make grants to teacher preparation programs (schools of education at institutions of higher education) to award scholarships to assist eligible teachers in obtaining a graduate level degree from such programs. Makes eligible for such scholarships any teachers who: (1) teach elementary or secondary school special education or teach middle or secondary school mathematics, science, or foreign languages; (2) are employed by a local education agency (LEA) that serves a school qualifying for teacher Perkins loan cancellation, and that is in partnership with the teacher preparation program; and (3) agree to teach, for five years after receiving the degree, at the school they previously taught or one designated by the LEA, and to mentor a novice teacher in the LEA for two years.

nom . rev . belonging to family paenibacillaceae has been classified into a distinct group based on the phenotypic characteristics , dna base composition , re - association analyses and results of cellular fatty acid and isoprenoid quinone composition analyses 1 . b. borstelensis has been described as strictly aerobic , gram - positive , spore forming , rod - shaped , motile bacteria . b. borstelensis have been also reported to produce industrially important enzymes like amidase 5 , amylase 6 and protease 7 . brevibacillus borstelensis cifa_chp40 was isolated from attri hot water spring ( 2009'n 8518'e ) of odisha , india . the bacteria can grow in a wide range of temperature from 20c to 65c and is able to degrade low - density polythene at 37c . the strain produces industrially important enzymes like amidase , lipase , protease and esterase at an optimum growth temperature of 50c . production of enzymes by thermophilic b. borstelensis at high temperatures has been previously reported 5 , 8 - 10 . for in depth genomic study and potential applications of the bacteria , b. borstelensis cifa_chp40 was subjected to whole genome sequencing on illumina miseq platform ( illumina inc . genomic dna was extracted from the bacterial culture grown in nutrient broth medium at 50c . following dna fragmentation and adapter ligation , the paired - end sequencing library was prepared using illumina truseq dna library preparation kit . after quality filtration ( mean quality score 25 ) and adapter trimming using trimmomatic software , high quality data was assembled using clc genomics workbench based on default set of parameters ( mismatch cost = 2 , insertion cost = 3 , deletion cost = 3 , length fraction = 0.5 and similarity fraction = 0.8 ) to obtain the scaffolds . the coding sequences ( cds ) were predicted from the scaffolds using ' prodigal ' software , which is a microbial gene - finding program 11 . the predicted cds were annotated by comparison with non - redundant protein database of ncbi using blastx 13 . functional annotation of the sequences was performed using gene ontology ( go ) terms with blast2go v2.8.0 software . simple sequence repeats were determined using ' misa ' , that allows the identification and localization of different microsatellites . a total of 37,456,348 high quality paired - end reads with 347x coverage ( mean read length 147 bp ) were obtained . the total length of the genome was found to be 5,196,578 bp assembled into 38 scaffolds with 14 scaffolds having > 20,000 bp and 6 scaffolds having > 30,000 bp length . the draft genome of b. borstelensis cifa_chp40 harbored 5103 genes that encoded 4831 protein - coding genes including 113 trna and 3 rrna genes ( table 1 ) . based on go annotation , maximum cds were categorized under molecular functions ( 615 ) followed by biological processes ( 468 ) and cellular components ( 159 ) . greater number of sequences was classified under the go categories viz . , catalytic activity , metabolic process , cellular process , binding , cell , cell part , localization and macromolecular complex ( figure 1 ) . besides , three transposable elements ( isc1316 , line and isc1316 ) and four simple sequence repeats were identified . the genome sequence of b. borstelensis cifa_chp40 encoded chaperone proteins and essential enzymes involved in large scale processes and required for production of different biomolecules . these enzymes include metalloprotease , serine peptidase , phospholipase , metallophosphoesterase , penicillin amidase and amidohydrolase and are involved in various biosynthesis and metabolic processes . the draft genome features of b. borstelensis cifa_chp40 indicate the biotechnological implication of the thermophilic bacteria in producing enzymes of industrial significance . the draft genome sequence of brevibacillus borstelensis cifa_chp40 was deposited in the genbank database under the accession number jprb00000000 .

brevibacillus borstelensis cifa_chp40 is a thermophilic , strictly aerobic gram positive motile bacteria isolated from the alkaline hot water spring located in the eastern ghats zone of india . it could grow in a wide range of temperature and degrade low - density polythene at 37c . the strain cifa_chp40 produces essential enzymes like protease , lipase , esterase and amidase at 50c . here , we report the draft genome sequence of b. borstelensis cifa_chp40 which will provide further insight into the metabolic capabilities , function and evolution of this important organism .

type 2 diabetes mellitus ( t2 dm ) refers to inadequate insulin secretion and impaired insulin sensitivity of several tissues . nowadays , the prevalence and incidence of t2 dm continue to increase worldwide and the economic burden for health care in treating diabetes as well as its related complications is quite large . t2 dm is intimately associated with peripheral vascular disease , cerebrovascular disease , coronary artery disease , and sclerosing mesenteritis . cardiovascular disease has been reported to account for 70% to 75% of total diabetes - related mortality , and the increased cardiovascular risk in t2 dm is reflected by the presence of atherosclerosis . glycemic management for t2 dm patients has become complex and controversial due to mounting concerns about the potential adverse effects and new uncertainties of the pharmacological agents on macrovascular complications . therefore , investigation for the mechanism of arteriosclerosis in t2 dm is a key challenge and necessary to be conducted . it is well accepted that the development of atherosclerosis is affected by genetic , environmental , and epigenetic factors . cardiovascular genetics has led to numerous clinical studies focusing on candidate genes . a review conducted by starevi et al . discussed the cardiovascular disease risk genes involved in lipid metabolism and statin therapy . by genetic and epigenetic fine mapping , turner et al . identified a causal coronary artery disease - associated single nucleotide polymorphism rs17293632c > t , which is associated with protection from coronary artery disease . but gene polymorphisms such as the interleukin-1 receptor antagonist gene and the inhibitor of b protein gene polymorphisms have been demonstrated to be not associated with myocardial infarction in patients with t2 dm . in addition , reynolds et al . focused on the associations of epigenetic modification - dna methylation with cigarette smoking and subclinical atherosclerosis and they indicated that the aryl hydrocarbon receptor repressor ( ahrr ) methylation may be functionally related to ahrr expression in monocytes and represents a potential biomarker of subclinical atherosclerosis in smokers . give an overview of epigenetic alternations in atherosclerosis , mainly focusing on dna and histone modifications . immune disorders are reported to be associated with the development of t2 dm and its complications . t lymphocytes can be divided into several subsets and subtypes , which produce various inflammation - related factors responding to the infection and immune reaction . it has been reported that b cells promote inflammation in t2 dm through regulating all helper cd4 + t - cell subsets including th1 , th2 , th17 , and tregs activities and a number of related inflammatory cytokine secretion . adaptive immune cytokines including ifn- , il-4 , and il-17 were secreted by polarized th subsets ( th1 , th2 and th17 , respectively ) mounting an immune response involved in reciprocal activation of eosinophils and macrophages . recently , the occurrence and development of atherosclerosis has been identified to be related to the predominance of th1 cells and the imbalance of th1/th2 . angiotensin ii ( ang ii ) is one of the most potent mitogens that induce monocytes and macrophages entering into vessel walls to cause inflammatory responses in vascular smooth muscle cells . meanwhile , ang ii has been reported to have several important effects on the pathogenesis of atherosclerosis . furthermore , increasing evidences have identified that specific t cell phenotype potentially contribute to the development of ang ii - induced hypertension and several other vascular disorders . accordingly , it was hypothesized that ang ii might be associated with the development of atherosclerosis in t2 dm patients via regulating specific t cell phenotypes . to confirm whether ang ii level contributes to the development of carotid atherosclerosis ( ca ) in t2 dm patients via regulation of specific t cell phenotypes , we investigated the relationship between t cell phenotypes and ang ii levels in t2 dm patients combined with or without ca . meanwhile , the effects of ang ii on t cell activities were further confirmed using peripheral blood mononuclear cells ( pbmcs ) cells obtained from health controls after ang ii only or ang ii plus ang ii receptor blocker ( arb ) treatment . between september 2014 and june 2015 , 57 patients with t2 dm presented to the affiliated hospital of inner mongolia medical university . t2 dm was diagnosed in patients as blood glucose levels > 200 mg / dl , glycated hemoglobin ( hba1c ) > 6.5% as recommended by the american diabetes association criteria or use of diabetic medication . if patients had one of the following : 1 ) presence of hypertension ; 2 ) with cardiovascular disease like coronary heart disease and congestive heart failure ; 3 ) presence of acute or chronic inflammation , or having inflammation - suppressing drugs such as nonsteroidal anti - inflammatory drugs and corticosteroids before ; 4 ) with history of stroke ; 5 ) with hepatic and/or renal dysfunction ; 6 ) with cancer and/or rheumatic diseases , they would be not included in the present study . after excluding seven patients for presence of hypertension ( three cases ) , congestive heart failure ( one case ) , chronic inflammation ( two cases ) and with a history of stroke ( one case ) , a total of 50 patients diagnosed with t2 dm were enrolled in the present study . the average duration of t2 dm was 6.4 years of these included patients . according to the presence of ca evaluated by the carotid ultrasound , patients were assigned to ca group ( patients with t2 dm combined with ca , n=30 ) or t2 dm group ( patients with t2 dm , n=20 ) . basic demographic and clinical data of all participants in terms of age , gender , systolic blood pressure ( sbp ) , diastolic blood pressure ( dbp ) , history of hypertension , total cholesterol ( tc ) level , triglycerides ( tg ) level , low - density lipoprotein - cholesterol ( ldl - c ) level , high - density lipoprotein - cholesterol ( hdl - c ) level , and smoking were collected and recorded after a standard interview and clinical examination . informed consent was obtained from all of the participants and the research ethics committee of the affiliated hospital of inner mongolia medical university approved the present study . before this study , a preliminary experiment was performed on th1 proportion between t2 dm patients combined with ca and those without ca to estimate the sample size . in the preliminary experiments , the th1 proportion in t2 dm patients combined with ca and patients without ca was 20% and 15% , and the standard deviation values were both 0.05 . to detect the difference in th1 proportion between t2 dm patients with and without ca with a two - sided 5% significance and a power of 80% , a sample size of 21 patients per group was necessary . considering the incidence of ca in t2 dm patients of about 65% in our hospital and total of 53 patients with t2 however , due to recruitment difficulties and the restriction of inclusion criteria , the sample size was reduced to 50 , with 30 patients in the ca group and 20 patients in the t2 dm group . after 12-hour fasting , venous blood samples were collected from median cubital vein from each participant . a portion of the blood samples was sent to assess plasma glucose concentration and the levels of tc , tg , ldl - c , and hdl - c . the remaining blood samples were divided into two aliquots and placed into different vacutainer tubes . the blood in the upper layer was dispensed into sterilized tubes and stored at 80c for analyzing ifn- , il-4 , and il-17 level in plasma . the blood sample in the lower layer was used for isolation of peripheral blood mononuclear cells ( pbmcs ) . the other aliquot was placed into an anticoagulant tube containing ethylenediaminetetraacetic acid ( edta ) . thirty - sixty minutes after blood collection , samples were centrifuged for five minutes at 3,300 rpm / minute and 4c . then the supernatant were dispensed into sterile tubes and stored at 80c for further analysis . mononuclear cells were isolated from whole blood cells via ficoll - hypaque density - gradient centrifugation at 2,500 rpm / minutes for 10 minutes of ficoll - hypaque . then the monocytes were isolated by magnetic cell sorting using the monocyte isolation kit ii ( miltenyi biotec inc . then isolated pbmcs were cultured in rpmi 1640 medium containing 10% fetal bovine serum ( fbs , gibco , grand island , usa ) and supplemented with 2 mm l - glutamine , 100 u / ml penicillin , and 100 g / ml streptomycin in a 37c , 5% co2 incubator . meanwhile , the pbmcs obtained from the healthy controls were then divided into eight aliquots and these cells were treated with 0 , 0.1 , 1 , and 10 m ang ii combined with or without 10 g / ml losartan potassium tablets ( one kind of arb ; merck sharp & dohme , uk ) for 48 hours . the pbmcs were seeded into 24-well plate at a density of 210 cells / well . after culture for 24 hours , cells were treated with 25 ng / ml polymethyl acrylate ( pma ) , 50 ng / ml ionomycin and 1 l monensin was added into each wells and placed at 37c in 5% co2 atmosphere for another four hours . cells were harvested by centrifugation at the speed of 300 rpm / minutes for 10 minutes . after blocking with rabbit serum for 30 minutes , the cells were incubated with mouse anti - human cd4-pe antibody for 20 minutes in the dark . after washed with pbs , cells were fixed with 200 l fixative solution for 10 minutes and permeated using 1 ml rupture solution for 10 minutes . then cells were incubated with mouse anti - human fitc - conjugated ifn- , il-4 , and il-17 antibodies ( ebioscience , san diego , ca , usa ) , respectively , in the dark for 20 minutes . finally , proportions of th1 ( positive with fitc - ifn- ) , th2 ( positive with fitc - il-4 ) , and th17 ( positive with fitc - il-17 ) cells were determined by flow cytometry . total rna was extracted from pbmcs using trizol reagent and reverse transcription into cdna by using cdna synthesis kit ( toyobo , osaka , japan ) according to the manufacturer s instructions . real - time pcr ( rt - pcr ) was performed utilizing a sybr green mix ( takara , shiga , japan ) on iq5 detection system ( bio - rad , hercules , ca , usa ) . the procedure was as follows : 95c for four minutes ; 45 cycles of 95c for five seconds and 62c for 30 seconds ; the sequences of primers ( invitrogen , carlsbad , ca , usa ) used for amplification were as follows : t - bet forward : 5-atccttccagtggtgacagc-3 t - bet reverse : 5-gtcggtgtcctccaacctaa-3 gata-3 forward : 5-ttcagttggcctaaggtggt-3 gata-3 reverse : 5-tgcacgctggtagctcatac-3 rort forward : 5-gggaaagtcccaatcctga-3 rort reverse : 5-tctgatcttgccttccgact-3 actin forward : 5-acttagttgcgttacaccctt-3 actin reverse : 5-gtcaccttcaccgttcca-3 the fold - change of gene expression was normalized to -actin and calculated using the 2 method . each sample was repeated in triplicates and all the experiments were conducted for three times . the levels of ang ii , ifn- , il-4 , and il-17 in the plasma were detected using elisa kits ( bender medsystems , vienna , austria ) in accordance with the manufacturer s instructions . after reacted with substrate solution for 30 minutes , the absorbance was measured using a microplate reader ( bio - rad , hercules , ca , usa ) at 450 nm . all data were presented as mean standard deviation ( sd ) and analyzed using spss 19.0 software ( spss inc . , chicago , il , usa ) . differences among different groups were compared using one - way analysis of variance ( anova ) , followed by least significant difference ( lsd ) test . between september 2014 and june 2015 , 57 patients with t2 dm presented to the affiliated hospital of inner mongolia medical university . t2 dm was diagnosed in patients as blood glucose levels > 200 mg / dl , glycated hemoglobin ( hba1c ) > 6.5% as recommended by the american diabetes association criteria or use of diabetic medication . if patients had one of the following : 1 ) presence of hypertension ; 2 ) with cardiovascular disease like coronary heart disease and congestive heart failure ; 3 ) presence of acute or chronic inflammation , or having inflammation - suppressing drugs such as nonsteroidal anti - inflammatory drugs and corticosteroids before ; 4 ) with history of stroke ; 5 ) with hepatic and/or renal dysfunction ; 6 ) with cancer and/or rheumatic diseases , they would be not included in the present study . after excluding seven patients for presence of hypertension ( three cases ) , congestive heart failure ( one case ) , chronic inflammation ( two cases ) and with a history of stroke ( one case ) , a total of 50 patients diagnosed with t2 dm were enrolled in the present study . the average duration of t2 dm was 6.4 years of these included patients . according to the presence of ca evaluated by the carotid ultrasound , patients were assigned to ca group ( patients with t2 dm combined with ca , n=30 ) or t2 dm group ( patients with t2 dm , n=20 ) . basic demographic and clinical data of all participants in terms of age , gender , systolic blood pressure ( sbp ) , diastolic blood pressure ( dbp ) , history of hypertension , total cholesterol ( tc ) level , triglycerides ( tg ) level , low - density lipoprotein - cholesterol ( ldl - c ) level , high - density lipoprotein - cholesterol ( hdl - c ) level , and smoking were collected and recorded after a standard interview and clinical examination . informed consent was obtained from all of the participants and the research ethics committee of the affiliated hospital of inner mongolia medical university approved the present study . before this study , a preliminary experiment was performed on th1 proportion between t2 dm patients combined with ca and those without ca to estimate the sample size . in the preliminary experiments , the th1 proportion in t2 dm patients combined with ca and patients without ca was 20% and 15% , and the standard deviation values were both 0.05 . to detect the difference in th1 proportion between t2 dm patients with and without ca with a two - sided 5% significance and a power of 80% , a sample size of 21 patients per group was necessary . considering the incidence of ca in t2 dm patients of about 65% in our hospital and total of 53 patients with t2 however , due to recruitment difficulties and the restriction of inclusion criteria , the sample size was reduced to 50 , with 30 patients in the ca group and 20 patients in the t2 dm group . after 12-hour fasting , venous blood samples were collected from median cubital vein from each participant . a portion of the blood samples was sent to assess plasma glucose concentration and the levels of tc , tg , ldl - c , and hdl - c . the remaining blood samples were divided into two aliquots and placed into different vacutainer tubes . the blood in the upper layer was dispensed into sterilized tubes and stored at 80c for analyzing ifn- , il-4 , and il-17 level in plasma . the blood sample in the lower layer was used for isolation of peripheral blood mononuclear cells ( pbmcs ) . the other aliquot was placed into an anticoagulant tube containing ethylenediaminetetraacetic acid ( edta ) . thirty - sixty minutes after blood collection , samples were centrifuged for five minutes at 3,300 rpm / minute and 4c . then the supernatant were dispensed into sterile tubes and stored at 80c for further analysis . mononuclear cells were isolated from whole blood cells via ficoll - hypaque density - gradient centrifugation at 2,500 rpm / minutes for 10 minutes of ficoll - hypaque . then the monocytes were isolated by magnetic cell sorting using the monocyte isolation kit ii ( miltenyi biotec inc . then isolated pbmcs were cultured in rpmi 1640 medium containing 10% fetal bovine serum ( fbs , gibco , grand island , usa ) and supplemented with 2 mm l - glutamine , 100 u / ml penicillin , and 100 g / ml streptomycin in a 37c , 5% co2 incubator . meanwhile , the pbmcs obtained from the healthy controls were then divided into eight aliquots and these cells were treated with 0 , 0.1 , 1 , and 10 m ang ii combined with or without 10 g / ml losartan potassium tablets ( one kind of arb ; merck sharp & dohme , uk ) for 48 hours . the pbmcs were seeded into 24-well plate at a density of 210 cells / well . after culture for 24 hours , cells were treated with 25 ng / ml polymethyl acrylate ( pma ) , 50 ng / ml ionomycin and 1 l monensin was added into each wells and placed at 37c in 5% co2 atmosphere for another four hours . cells were harvested by centrifugation at the speed of 300 rpm / minutes for 10 minutes . after blocking with rabbit serum for 30 minutes , the cells were incubated with mouse anti - human cd4-pe antibody for 20 minutes in the dark . after washed with pbs , cells were fixed with 200 l fixative solution for 10 minutes and permeated using 1 ml rupture solution for 10 minutes . then cells were incubated with mouse anti - human fitc - conjugated ifn- , il-4 , and il-17 antibodies ( ebioscience , san diego , ca , usa ) , respectively , in the dark for 20 minutes . finally , proportions of th1 ( positive with fitc - ifn- ) , th2 ( positive with fitc - il-4 ) , and th17 ( positive with fitc - il-17 ) cells were determined by flow cytometry . total rna was extracted from pbmcs using trizol reagent and reverse transcription into cdna by using cdna synthesis kit ( toyobo , osaka , japan ) according to the manufacturer s instructions . real - time pcr ( rt - pcr ) was performed utilizing a sybr green mix ( takara , shiga , japan ) on iq5 detection system ( bio - rad , hercules , ca , usa ) . the procedure was as follows : 95c for four minutes ; 45 cycles of 95c for five seconds and 62c for 30 seconds ; the sequences of primers ( invitrogen , carlsbad , ca , usa ) used for amplification were as follows : t - bet forward : 5-atccttccagtggtgacagc-3 t - bet reverse : 5-gtcggtgtcctccaacctaa-3 gata-3 forward : 5-ttcagttggcctaaggtggt-3 gata-3 reverse : 5-tgcacgctggtagctcatac-3 rort forward : 5-gggaaagtcccaatcctga-3 rort reverse : 5-tctgatcttgccttccgact-3 actin forward : 5-acttagttgcgttacaccctt-3 actin reverse : 5-gtcaccttcaccgttcca-3 the fold - change of gene expression was normalized to -actin and calculated using the 2 method . each sample was repeated in triplicates and all the experiments were conducted for three times . the levels of ang ii , ifn- , il-4 , and il-17 in the plasma were detected using elisa kits ( bender medsystems , vienna , austria ) in accordance with the manufacturer s instructions . after reacted with substrate solution for 30 minutes , the absorbance was measured using a microplate reader ( bio - rad , hercules , ca , usa ) at 450 nm . all data were presented as mean standard deviation ( sd ) and analyzed using spss 19.0 software ( spss inc . , differences among different groups were compared using one - way analysis of variance ( anova ) , followed by least significant difference ( lsd ) test . basic demographic and clinical data were presented in table 1 . significant difference was found in terms of age , blood glucose concentration , tc level , and ldl - c level among three groups ( p<0.05 ) . patients in the ca group were obviously older than those in t2 dm and control group . there was an obviously higher rate of presence of hypertension in the ca group compared to that in t2 dm and control groups ( p<0.05 ) . the rate of presence of smoking was also obviously higher in both ca and t2 dm groups than the control group ( p<0.05 ) . however , no significant difference was found in terms of gender , tg level , hdl - c level , sbp , and dbp among these different groups ( p>0.05 ) . furthermore , ang ii levels were notably higher in t2 dm combined with ca patients ( 80.6617.20 pg / ml ) than those in t2 dm patients ( 35.4915.01 pg / ml ) and controls ( 35.140.43 pg / ml ) ( p<0.05 ) . the cell proportions of th1 , th2 , and th17 cells in pbmcs from different groups were detected using flow cytometry ( figure 1 ) . there was an obvious increase in th1 and th17 positive cells proportion in ca group compared with t2 dm group and control group ( p<0.05 ) and no significant difference was found between t2 dm group and control group ( p>0.05 ) . besides , the cell proportions of th2 differed insignificantly among three groups ( p>0.05 ) . t - bet , gata3 , and rort are specific transcription factors for th1 , th2 , and th17 cells and were also detected for changes in pbmcs by rt - pcr assay ( figure 2a ) . consistently , the levels of t - bet and rort were significantly higher in the ca group than those in t2 dm and control groups ( p<0.05 ) , whereas the level of gata3 was similar among these three groups ( p>0.05 ) . furthermore , the ifn- , il-4 , and il-17 levels in plasma were also examined in participants from different groups and the results were displayed in figure 2b . compared with t2 dm and control groups , ifn- and il-17 levels were elevated remarkably in the ca group ( p<0.05 ) , whereas il-4 levels remained unchanged ( p>0.05 ) . in order to investigate the correction between t cell activities and ang ii levels , the activities of t cell activities in pbmcs obtained from heathy controls were detected after ang ii with or without abr treatment . according to our results , an increase of the cell proportions of th1 and th17 ( figure 3 ) , upregulated mrna levels of t - bet and rort ( figure 4a ) , as well as ifn- and il-17 levels in plasma ( figure 4b ) were observed with the increasing concentrations of ang ii ( p<0.05 ) . as expected , all these changes were remarkably alleviated after the treatment of arb ( p<0.05 ) . at the same time , ang ii and arb had no obvious effects on the cell proportions of th2 , the mrna levels of gata3 , as well as the il-4 levels in plasma ( figures 3 , 4 , p>0.05 ) . basic demographic and clinical data were presented in table 1 . significant difference was found in terms of age , blood glucose concentration , tc level , and ldl - c level among three groups ( p<0.05 ) . patients in the ca group were obviously older than those in t2 dm and control group . there was an obviously higher rate of presence of hypertension in the ca group compared to that in t2 dm and control groups ( p<0.05 ) . the rate of presence of smoking was also obviously higher in both ca and t2 dm groups than the control group ( p<0.05 ) . however , no significant difference was found in terms of gender , tg level , hdl - c level , sbp , and dbp among these different groups ( p>0.05 ) . furthermore , ang ii levels were notably higher in t2 dm combined with ca patients ( 80.6617.20 pg / ml ) than those in t2 dm patients ( 35.4915.01 pg / ml ) and controls ( 35.140.43 pg / ml ) ( p<0.05 ) . the cell proportions of th1 , th2 , and th17 cells in pbmcs from different groups were detected using flow cytometry ( figure 1 ) . there was an obvious increase in th1 and th17 positive cells proportion in ca group compared with t2 dm group and control group ( p<0.05 ) and no significant difference was found between t2 dm group and control group ( p>0.05 ) . besides , the cell proportions of th2 differed insignificantly among three groups ( p>0.05 ) . t - bet , gata3 , and rort are specific transcription factors for th1 , th2 , and th17 cells and were also detected for changes in pbmcs by rt - pcr assay ( figure 2a ) . consistently , the levels of t - bet and rort were significantly higher in the ca group than those in t2 dm and control groups ( p<0.05 ) , whereas the level of gata3 was similar among these three groups ( p>0.05 ) . furthermore , the ifn- , il-4 , and il-17 levels in plasma were also examined in participants from different groups and the results were displayed in figure 2b . compared with t2 dm and control groups , ifn- and il-17 levels were elevated remarkably in the ca group ( p<0.05 ) , whereas il-4 levels remained unchanged ( p>0.05 ) . in order to investigate the correction between t cell activities and ang ii levels , the activities of t cell activities in pbmcs obtained from heathy controls were detected after ang ii with or without abr treatment . according to our results , an increase of the cell proportions of th1 and th17 ( figure 3 ) , upregulated mrna levels of t - bet and rort ( figure 4a ) , as well as ifn- and il-17 levels in plasma ( figure 4b ) were observed with the increasing concentrations of ang ii ( p<0.05 ) . as expected , all these changes were remarkably alleviated after the treatment of arb ( p<0.05 ) . at the same time , ang ii and arb had no obvious effects on the cell proportions of th2 , the mrna levels of gata3 , as well as the il-4 levels in plasma ( figures 3 , 4 , p>0.05 ) . following the results in our study , ang ii is involved in the process of ca in t2 dm patients via regulating specific t cell activities such as increasing the cell proportions of th1 and th17 , the mrna levels of t - bet and rort , and the ifn- and il-17 levels in plasma . first , we found that the cell proportions of th1 and th17 , the mrna levels of t - bet and rort , as well as the ifn- and il-17 levels in plasma were significantly elevated in patients with both t2 dm and ca , compared with those in t2 dm patients . moreover , the increase of the sclerosis degree could amplify these changes ( data not shown ) . previous research indicated that inflammation and the immune cell infiltration ( a symbol of vascular inflammation ) are associated with many of the cardiovascular diseases and also play an important role in the development of atherosclerosis . inflammatory response is capable of activating a large number of immune t lymphocytes , leading to formation of a positive feedback loop to amplify the inflammatory response , as a result of immune function disorder and occurrence of atherosclerosis . our results were consistent with previous report that verified the role of t cells activation in the development of ca in t2 dm patients . in addition , we also found that th1 cells , t - bet , and ifn- levels were all significantly increased in t2 dm patients combined with ca than those in t2 dm patients and controls . as previously described , activation of cd4 + t cells contributes to atherosclerosis susceptibility in several animal model such as apoe mice and ldlr mice and plays an important role in the early stage of atherosclerosis development , owing to the significantly delayed fatty streak formation in cd4-deficient c57bl/6 mice . th1-related cytokines including ifn- , il-2 , tnf- , and tgf- were largely expressed in plaques of ac , activating macrophages , and endothelial cells , amplifying inflammation and promoting the development of atherosclerosis and the plaque instability . as the most important cytokine and polar reaction indictor of th1 , ifn- regulates a series of progresses during ac , including formation of macrophage foam cell , recruitment of leukocytes to the activated endothelium , and stability and remodeling of plaque . meanwhile , the activity of transcription factor of t - bet was considered to be essential for th1 cell differentiation and ca plaque progression was significantly delayed in t - bet - deleted mice . additionally , th2 cells exert their effect by secreting a variety of immunological cytokines , including il-4 which is mainly secreted by th2 and induces th2 differentiation . it is still controversial about the role of th2-type immune response in the process of development of atherosclerosis . different from the advantage of th1 cells , very small amounts of th2 cells and th2-related cytokines were found in human atherosclerotic plaques . however , several studies reported that il-4 promoted the progress of atherosclerosis and the plaques was smaller after silencing il-4 . in this study , no obvious changes of th2 , gata3 , and il-4 were found among different groups . consistent with the increase of ifn- level , proportion of th17 cells , levels of rort and il-17 were all obviously elevated in t2 dm combined with ca patients than those in t2 dm patients and controls in our study , suggesting the role of th17 and related cytokines in the development of ca in t2 dm patients . th17 , a new separated t cell subset , secrets il-17 and other chronic inflammatory diseases and is closely related to autoimmune diseases . eid et al . also confirmed that il-17 was associated with human coronary atherosclerosis and induced the production of pro - inflammatory cytokines and chemokines in vsmcs to promote pro - arteriosclerotic vascular changes . moreover , il-17 is reported to induce the production of ifn- and neutralizing ifn- activity is expected to induce an increase of il-17 , indicating an additional interaction between these two cytokines . furthermore , we also identified that th1 and th17 cells , as well as related cytokines were notably increased by addition of ang ii in a dose - depended manner and the promoted effects were significantly attenuated after treatment with abr , which demonstrated the relationship between ang ii and t cell activity in the progress of ca in t2 dm patients . ang ii has been widely suggested to be involved in the development and progression of atherosclerosis and coronary heart disease . ang ii induces inflammation and improves the activation of the immune system , and t cell activation is prevented in ang ii receptor - deficient mice . meanwhile , activated t cells may generate ang ii locally by themselves to influence multiple cell functions in an autocrine manner . recently , several studies proved that ang ii contributes to atherosclerosis by increasing the levels of vascular inflammatory genes . furthermore , modulation of th1/th2 phenotype is identified to be a major downstream mechanism of ang ii in atherosclerosis . based on the results from our study , we supposed that ang ii could promote the process of cs through regulating activities of specific t cell phenotypes . first , significant differences in age were found among different groups which was attributed to the frequent occurrence of ca in elder patients . . meanwhile , the underlying mechanism of the relationship between the ang ii and t cell activation was not exploited , which should be investigated in the further studies . the proportions of th1 and th17 cells were significantly higher in the ca group than those in the t2 dm group and control group . consistently , a remarkable increase of t - bet and rort , as well as ifn- and il-17 was found in the ca group compared with the t2 dm group and control group . additionally , th1 and th17 cells , as well as related cytokines , were notably elevated by ang ii treatment in a dose - depended manner ; and the promoted effects were significantly attenuated by treated with abr . therefore , we concluded that ang ii was closely associated with the development of ca in t2 dm patients through regulating th1 and th17 cells as well as the related pro - inflammatory cytokines . our study might provide new insights for investigating the mechanism and novel therapeutic targets for cardiovascular disease in t2 dm patients .

backgroundspecific t cell phenotype has been reported to potentially contribute to the development of angiotensin ii ( ang ii)-induced several vascular disorders . type 2 diabetes mellitus ( t2 dm ) is intimately associated with cardiovascular disease . the present study aimed to investigate the relationship between t cell phenotypes and ang ii in t2 dm patients combined with carotid atherosclerosis ( ca).material / methodsthis study was performed on 50 patients with t2 dm in our hospital . based on the presence of ca , they were divided into ca group ( presence of ca , n=30 ) or t2 dm group ( absence of ca , n=20 ) . additionally , 10 healthy participants were selected as controls . basic characteristics of all participants were collected and recorded . peripheral blood mononuclear cells ( pbmcs ) isolated from patients and controls with or without ang ii and ang ii receptor blocker ( arb ) treatment were used to detect th1 , th2 , and th17 cell proportions , mrna levels of t - bet , gata3 , and rort as well as the expression of ifn- , il-4 , and il-17 by flow cytometry , elisa , and real - time pcr.resultsang ii levels were notably higher in patients in the ca group than those in the t2 dm and control group ( p<0.05 ) . th1 and th17 positive cells , mrna levels of t - bet and rort as well as the expression of ifn- and il-17 were significantly increased in the ca group compared with the t2 dm group and control group ( p<0.05 ) . moreover , the activities of t cells and related cytokines were significantly increased of healthy controls after ang ii treatment ( p<0.05 ) , while these changes were notably weakened by arb treatment ( p<0.05).conclusionsang ii promotes the development of ca in t2 dm patients by regulating t cells activities .

such tumors are divided into two main types : 1 ) intrajugular schwannomas located at the jugular foramen , which comprise the majority of cases , and 2 ) intracisternal schwannomas , which occupy the cisterna magna13,31 ) . although the clinical manifestations of these tumors vary depending on the tumor 's location and the extent of its growth , intracisternal tumors usually present with cerebellar signs and myelopathy . intrajugular tumors are commonly associated with specific symptoms and signs of cranial nerve dysfunction , including hearing impairment , dysphagia , and difficulty in phonation1,18,20 ) . we report here on a unique case of an intracisternal schwannoma arising from the cranial root of the accessory nerve in a 58-year - old woman who presented with the atypical symptom of hoarseness . in this report , we describe potential anatomical explanations for the patient 's unusual clinical manifestations and discuss the safety of complete tumor resection with sacrifice of the originating nerve rootlet in terms of postoperative neurological deficit . a 58-year - old female presented with symptoms of hoarseness and dizziness , which had begun 2 months prior . neurological examination on admission revealed no focal neurological deficit , except for mild hypesthesia on the left side of her body . magnetic resonance ( mr ) imaging revealed a mass of 3.32.73.3 cm in the left cerebellomedullary cistern , containing both cystic and solid components ( fig . 1 ) . the solid portion located mainly in the periphery of the tumor , but not the central cystic area , was strongly enhanced by gadolinium . mr angiography revealed superiomedial displacement of the lateral medullary and tonsillomedullary segments of the left posteroinferior cerebellar artery . needle electromyography ( emg ) performed on the bilateral cricothyroid and thyroarytenoid muscles revealed polyphasic and long motor unit potentials with reduced recruitment patterns in the left thyroarytenoid muscle , suggesting the existence of left recurrent laryngeal neuropathy . mild vocal cord paralysis was noted on the left side upon otolaryngological examination . based on these imaging findings and clinical manifestations , a preoperative diagnosis of lower cranial nerve schwannoma or cystic meningioma was made . an image - guided , inferior unilateral suboccipital craniectomy with partial c1 laminectomy was performed with the patient in the prone position . after a y - shaped incision was made in the dura , the tumor was found to be located in the left foramen magnum and cerebellomedullary cistern , extending cephalad and ventrally , towards the left cerebellar hemisphere . as expected , the tumor had a firm , transparent , and smooth capsule filled with yellowish cystic contents . the tumor was easily dissected away from the surrounding structures with aspiration of the cyst . the spinal root of the left accessory nerve was adherent to the tumor capsule , but was successfully dissected from the tumor without injury to the nerve ( fig . at the final stage of the surgery , we found that one cranial rootlet of the left accessory nerve was incorporated within the tumor near the exit zone of the rootlet in the medulla ( fig . the rootlet was cut from the proximal and distal portions of the tumor and a gross total resection was performed . after the tumor had been removed , the glossopharyngeal , vagal , and hypoglossal nerves and the spinal roots of the accessory nerve were observed to be intact . histopathological examination revealed that the tumor was composed of hypercellular ( antoni type a pattern ) and hypocellular ( antoni type b pattern ) areas ( fig . the former area contained compact spindle cells with twisted nuclei arranged in short bundles of interlacing fascicles displaying nuclear palisading and whorls of cells . the latter areas were composed of wavy spindle cells and oval cells in a loose stroma . the tumor cells were immunopositive for s-100 and immunonegative for glial fibrillary acidic protein ( fig . postoperative mr imaging determined that the tumor had been totally resected and that the compression of the medullary and high cervical spinal cord had been relieved . the patient 's left side hypesthesia disappeared immediately after surgery and her hoarseness gradually improved over 6 months . schwannomas of the lower cranial nerves are rare and usually arise in the jugular foramen.14 ) in lower cranial schwannoma , the glossopharyngeal nerve is the most frequently reported site of origin , the vagus nerve is the second most common site , and the accessory nerve is the least common site of origin11,12 ) . in their review of 91 cases of jugular foramen schwannoma , shiroyama et al.28 ) similarly , when bakar1 ) reviewed the literature , describing 199 cases of lower cranial nerve schwannoma , he found that only 11 tumors were identified as originating from the accessory nerve . based on the location of the tumor , julow categorized accessory schwannomas into two types : 1 ) intrajugular schwannomas that grow into the jugular foramen and 2 ) intracisternal schwannomas that grow into the cisterna magna13 ) . since christoferson et al.6 ) first reported an accessory schwannoma of the intracisternal type , 17 additional cases of intracisternal accessory nerve schwannoma have been recorded ( table 1)4,5,13,14,15,17,18,19,22,23,24,26,29,31,32,33 ) . in most cases , the origin of these tumors was the spinal root of the accessory nerve , whereas there were only two cases exhibiting a cranial root origin32,33 ) . in one of these cases , cranial root accessory nerve schwannoma was found incidentally during cerebellomedullary angle meningioma surgery33 ) . intracisternal accessory nerve schwannomas usually manifest cerebellar signs and/or myelopathy associated with their direct compressive effects on the cerebellum , brain stem , and/or spinal cord . in contrast , intrajugular tumors typically present with otologic symptoms and jugular foramen syndrome , characterized by symptoms of tinnitus , hearing impairment , dysphagia , and hoarseness1,18,20 ) . our patient with an intracisternal tumor suffered from dizziness and hypesthesia of the body and trunk on the left side , possibly due to a mass effect on the brain stem and cerebellum . interestingly , she exhibited hoarseness associated with recurrent laryngeal neuropathy , as diagnosed by a preoperative emg examination . this finding is likely to be related to the unique anatomical features of the accessory nerve , which consists of both spinal and cranial components . the spinal root , which originates from an elongated nucleus extending between c1 and c7 , ascends through the foramen magnum and forms the conjoined accessory nerve proper by joining with the cranial roots . the cranial roots arise from the caudal region of the nucleus ambiguus before exiting the skull through the jugular foramen2,7,25 ) . after exiting the skull , the accessory nerve splits into two rami ( internal and external ) and the fibers of the cranial accessory branch ( internal ramus ) join the vagus nerve . they are then distributed to the periphery to innervate the palatal , pharyngeal , and laryngeal muscles via several branches , including the recurrent laryngeal nerve21,30 ) . the larger spinal accessory branch ( external ramus ) innervates the sternocleidomastoid and trapezius muscles8,9,10 ) . therefore , the hoarseness observed in our case was caused by dysfunction of the recurrent laryngeal nerve , which in turn was associated with the unique tumor origin in the cranial rootlet of the accessory nerve . because of the benign histological characteristics of most cases of lower cranial nerve schwannoma , complete surgical resection is normally the ideal goal of treatment for these tumors . however , considerable numbers of patients have experienced posto - perative morbidity following aggressive surgical resection , especially for intrajugular tumors3,16,20 ) . the most common surgical complications are lower cranial neuropathies1,27 ) , which can severely affect quality of life because of difficulty in phonation and swallowing . given that these complications may require the postoperative placement of tracheostomy or gastrostomy tubes , the decision to perform a complete resection must be made in balance with the need to minimize postsurgical complications . in a recent comparative study of two surgical techniques ( aggressive total resection vs. maximal safe resection ) for the treatment of jugular foramen schwannomas , a more conservative resection focusing on preserving the pars nervosa provided improved surgical morbidity without a statistically significant increase in tumor recurrence27 ) . the authors of this comparative report recommended a shifting paradigm in order to optimize patient outcomes through maximal resection with an emphasis on preservation of critical neurovascular structures . in contrast with the standard treatment for intrajugular schwannomas , more aggressive resection , which includes the nerve roots of origin , is preferred for intracisternal spinal root accessory nerve schwannomas , because sacrifice of a spinal accessory nerve root rarely results in new postoperative neurological deficits18 ) . a recent postmortem study revealed that motor fibers derived from c2 to c4 innervate the trapezius muscle in addition to the spinal accessory nerve34 ) , a fact that may explain the maintenance of trapezius function following spinal accessory nerve resection . however , definitive evidence regarding neurological complications due to sacrifice of the cranial root is lacking , because of the extreme rarity of cranial root accessory nerve schwannomas . in the present case , we achieved total tumor resection by excising the rootlet on both sides of the tumor without provoking any new neurological signs . similarly , tsukamoto et al.33 ) also reported en block tumor resection including origin nerve rootlet , cranial root of accessory nerve , without postoperative additional deficit . vagus nerve consists of two components : one is cranial root fibers of the accessory nerve and the other is vagal root fibers originating from the upper part of the nucleus ambiguous . it is therefore reasonable to believe that sacrificing the cranial rootlet of the accessory nerve to achieve total tumor resection may not lead to critical dysfunction of the vagus nerve . future anatomical studies are required to fully clarify and confirm the safety of this procedure and ensure the postoperative preservation of normal pharyngeal and laryngeal function . to our knowledge , this report is the first to describe a case of accessory nerve schwannoma that originated from a cranial rootlet and produced recurrent laryngeal neuropathy . the case presented here indicates that total removal of intracisternal - type schwannomas that have originated from the cranial root of the accessory nerve can be achieved with a good outcome .

intracisternal accessory nerve schwannomas are very rare ; only 18 cases have been reported in the literature . in the majority of cases , the tumor origin was the spinal root of the accessory nerve and the tumors usually presented with symptoms and signs of intracranial hypertension , cerebellar ataxia , and myelopathy . here , we report a unique case of an intracisternal schwannoma arising from the cranial root of the accessory nerve in a 58-year - old woman . the patient presented with the atypical symptom of hoarseness associated with recurrent laryngeal neuropathy which is noted by needle electromyography , and mild hypesthesia on the left side of her body . the tumor was completely removed with sacrifice of the originating nerve rootlet , but no additional neurological deficits . in this report , we describe the anatomical basis for the patient 's unusual clinical symptoms and discuss the feasibility and safety of sacrificing the cranial rootlet of the accessory nerve in an effort to achieve total tumor resection . to our knowledge , this is the first case of schwannoma originating from the cranial root of the accessory nerve that has been associated with the symptoms of recurrent laryngeal neuropathy .

in recent years several experimental and theoretical considerations indicate that the qgp right above the deconfining phase transition does not behave like a weakly coupled gas of quarks and gluons but that the interactions among plasma constituents are not small . this observation has lead to increasing interest in the dynamics of strongly coupled plasmas analyzed via the ads / cft correspondence . in these proceedings we report about a generic feature of all strongly coupled plasmas with a gravity dual @xcite . our discussion is based on two assumptions about the properties of heavy mesons in a deconfined medium which are fulfilled by all gauge theories with a gravity dual : 1 . heavy vector mesons such as the @xmath2 remain bound above the deconfinement transition . even though this is the subject of intense theoretical research , studies of lattice data indicate that this might be the case @xcite 2 . the in - medium dispersion relation of these mesons is significantly modified and they posses a ( sub - luminal ) maximum speed of propagation . we will also need to assume that the dispersion relation extends to sufficiently large momentum and that the meson states remain sufficiently narrow . these assumptions are enough to describe the main features of the in - medium dispersion relation ; its generic form is shown in a ) . at high momentum , the dispersion relation approaches a constant slope , which determines the in - medium limiting velocity @xmath3 . at small momentum the dispersion relation approaches a finite value of @xmath4 , the in medium mass . as a consequence of this asymptotic behavior , the dispersion relation crosses the light - cone at a position @xmath5 . note that this crossing does not mean that heavy quark becomes massless at this point ; the dispersion relation is very different from the vacuum one and there is no reason why the invariant @xmath6 should be considered as the mass . at the point @xmath7 the in - medium @xmath2 has the same quantum numbers of the photon ; thus , the electromagnetic interaction leads to mixing of these two degenerate states . what this means is that at @xmath7 the in - medium @xmath2 can decay into an _ on shell _ photon . this is different from the standard @xmath2 decay into dileptons , in which the @xmath2 leads to an _ off shell _ photon of virtuality of the @xmath2 mass . the mixing between the in - medium @xmath2 and the on shell photon leads to a peak in the current - curren correlator at null momentum @xmath8 at @xmath9 . a direct consequence of this observation is that if the dispersion relation of mesons is of the type described , a quark gluon plasma at finite temperature with a @xmath2 in kinetic equilibrium would lead to an almost monochromatic peak of photons at @xmath7 with a width given by the in - medium width of the @xmath2 . sym plasma at strong coupling @xcite . the black straight line corresponds to @xmath10 . right : thermal photon spectrum for lhc energies with arbitrary normalization . the continuous , monotonically decreasing , blue curve is the background from light quarks . the continuous , red curve is the signal from @xmath2 mesons . the dashed , black curve is the sum of the two.[thefigures],title="fig : " ] sym plasma at strong coupling @xcite . the black straight line corresponds to @xmath10 . right : thermal photon spectrum for lhc energies with arbitrary normalization . the continuous , monotonically decreasing , blue curve is the background from light quarks . the continuous , red curve is the signal from @xmath2 mesons . the dashed , black curve is the sum of the two.[thefigures],title="fig : " ] we can find an example in which the assumed features of the meson dispersion relation are realized : @xmath11 super - symmetric yang mills with @xmath12 flavors in the @xmath13 , @xmath14 limit with @xmath15 at finite temperature . in this case , the dynamics can be described by a dual gravitational theory with @xmath16 d7 probe branes ; the fact that @xmath15 implies that the back - reaction of the branes can be neglected and the metric is that of thermal @xmath11 without d7 branes which in suitable coordinates is given by ds^2= ( -f(z ) dt^2 + + dx^2 ) + l^2 d_5 with @xmath17 and t is the temperature . the d7 branes span the coordinates @xmath18 and a 3-sphere within the @xmath19 . the d7 branes can end `` in thin air '' at a scale @xmath20 ; if @xmath21 the branes are outside the black hole ( minkowski embedding ) . in this case , the small excitations of the brane correspond to ( infinitely narrow ) mesons in the dual gauge theory and the scale @xmath22 determines their mass . if the temperature is higher , the brane falls inside of the black - hole and there are no mesons excitations ( black - hole embedding ) @xcite . the d3-d7 model in the minkowski phase constitutes an interesting model to study the dynamics of meson in a strongly coupled , deconfined gauge theory plasma . in the minkowski embedding , due to the gravitational attraction , the meson wave function is concentrated around the tip of the brane , @xmath20 . as a consequence of the gravitational redshift in the presence of the black hole , the speed of light in the @xmath23 hyperplane is reduced and it is given by [ eqvl ] = = 1-(t ) ^4 thus , meson excitations in this theory can not move faster than @xmath3 . this observation provides a simple geometrical interpretation for the meson dispersion relation computed in the d3/d7 model a ) . we now note that discussion above is common to all strongly coupled , large @xmath0 gauge theory plasmas with a gravity dual since in these theories a finite number of flavors @xmath12 is described by @xmath12 d - brane probes and since the deconfined phase of these theories is described by background with a black - hole . since at the black - hole horizon the time component of the metric @xmath24 the limiting velocity of the mesons excitations is sub - luminal . thus , if qcd has a gravity dual in the large @xmath0 limit , the dispersion relation of heavy mesons ( and in particular heavy vector mesons ) must cross the lightcone leading to a peak on the photon spectrum as discussed in the previous section . we now address whether such a peak could be observed in a relativistic nucleus - nucleus collision . the natural vector meson candidates to consider are the @xmath2 and the @xmath25 since they may survive the deconfining transition ( we have not considered the @xmath26 since its survival is more controversial ) . the main difference with the analysis above is that in a collision the temperature of the plasma is not fixed , but it evolves as the plasma expands and cools . as a consequence , the energy at which the peak would occur changes : it grows as the temperature is reduced . depending on how fast the expansion happens , the peak may be transformed into an enhancement in the neighborhood of the meson mass . another difficulty for the observation of the peak is the existence of more sources for photons such as the thermal emission from light degrees of freedom and the prompt photon emission ( perturbative contribution ) . addressing the exact magnitude of the effect in a nuclear collision is a complicated task that demands an accurate model of the dynamics of the medium , the dynamics of mesons in the plasma and the meson production mechanism . however there are significant theoretical uncertainties in these issues , specially in the interaction of meson with the plasmas ; there are different theoretical models that address the @xmath2 suppression pattern . thus , we will not try to improve the current description of in - medium meson , but we will construct a model in which the peak can be observed in the final photon distribution . instead of embedding the thermal rate into a hydrodynamical calculation , for this estimate we use a fireball model in which the volume of the system expands as @xmath27 and , in the qgp phase the product @xmath28 is constant . we will assume that the initial temperature of the fireball is larger than the meson dissociation temperature . we first consider the @xmath29 since the thermal photon emission in the region of @xmath30 gev is dominant at the lhc . inspired by statistical recombination @xcite , we assume that the @xmath31-pairs produced in the initial collisions become kinetically equilibrated in the qgp but their total number , @xmath32 , stays constant . this condition is implemented via a fugacity factor g_c(t ) = , where @xmath33 is the in - medium charm - quark mass . at @xmath34 the temperature reaches the dissociation temperature of the @xmath29 in the medium and a fraction of the @xmath31-pairs recombine forming @xmath29 mesons . their contribution to the total number of photons is s ( ) _ t_diss^t_hadro dt v(t ) g_c(t(t))^2 e^-/t(t ) _ j/ ( , t(t ) ) , [ signal ] where the ` s ' stands for ` signal ' . the overall normalization is not important since it is the same as that for the background of thermal photons emitted by the light quarks , which is given by b ( ) _ 0^t_hadro dt v(t ) e^-/t(t ) . [ b ] we have omitted @xmath35 since , guided by the results for plasmas with a gravity dual , we assume it is structureless . we model the spectral function for the @xmath2 by a unit - area gaussian distribution of width @xmath36 mev centered at @xmath37 . the dispersion relation we use is a fit to a ) and the @xmath38 . the @xmath2 dissociation temperature is @xmath39 . the results of numerically evaluating and for lhc values of the parameters are plotted in b ) where the effect of the @xmath2 peak is clearly seen on the spectrum . however , this figure should be taken as illustrative , since the precise form is very sensitive to the value of the parameter used . the enhancement is , in particular , is quadratically sensitive to @xmath38 ; thus , our estimates indicate that at rhic , where @xmath40 is ten times smaller , the enhancement can not be observed . we have also explored the possibility of a similar enhancement for the @xmath25 meson at @xmath41 gev ; however at these energies the thermal photon contribution is exponentially suppressed as compare to pqcd photons . as a conclusion , we have seen that a modified dispersion relation of the type shown in a ) for the @xmath2 leads , under certain assumptions , to a distinct peak in the thermal photon yield at the lhc in the region of @xmath42 gev . this dispersion relation is expected in all strongly coupled gauge theory plasma , so its observation would be in agreement with the interpretation of the qgp as strongly coupled . unfortunately , there are many model assumptions in the analysis and not observing this peak would not necessarily imply a weakly coupled picture of the qgp . this work was done in collaboration with d. mateos and it has been supported by a marie curie intra - european fellowship of the european community s seventh framework programme under contract number ( pief - ga-2008 - 220207 )

we show that if a flavour - less vector meson remains bound after deconfinement , and if its limiting velocity in the quark - gluon plasma is subluminal , then this meson produces a distinct peak in the spectrum of thermal photons emitted by the plasma . we also demonstrate that this effect is a universal property of all strongly coupled , large-@xmath0 plasmas with a gravity dual . for the @xmath1 the corresponding peak lies between 3 and 5 gev and could be observed at the lhc .

while the total energy involved in a heavy ion collision can be measured directly by particle calorimeters , an analogous direct measurement of the locally reached energy density does not exist . an indirect determination of the size of the interaction region is possible through hanbury - brown / twiss ( hbt ) intensity interferometry @xcite . however , the interpretation of the measured correlations between the produced particles is in general model - dependent , and a considerable amount of theoretical effort has recently been spent on the question to what extent this intrinsic model dependence can be reduced by a refined analysis @xcite . compared to hbt interferometry on stars , the situation in heavy - ion collisions is complicated by the finite lifetime and the strong dynamical evolution of the particle emitting source @xcite . as a result the 2-body correlation function is in general characterized by different width parameters ( hbt radii " ) if the relative momentum between the two identical particles points in different directions @xcite . furthermore , the dynamical expansion of the source leads to correlations between the momenta of the emitted particles and their emission point ( so - called @xmath1 correlations ) which in turn generate a characteristic dependence of the hbt radii on the total pair momentum @xcite . in this paper we discuss this last issue in some detail . our work was motivated by the simple scaling laws for the hbt radii as a function of the transverse mass @xmath0 of the particle pair which were proposed in refs . these predictions are based on simple models for the emission function , and it is natural to ask which of the predicted features are independent of the model and which are not . for example , the model of ref . @xcite makes definite assumptions about the shape of the longitudinal and transverse expansion flow profiles whose influence on the result for the correlation function , in particular on the functional form of the @xmath0-dependence of the correlation radii , is not known . the work reported here provides an answer to this question within a certain class of models . more importantly , however , we discovered on our way that the simple scaling laws of refs . @xcite are based on approximations which are quantitatively unreliable and in some typical cases give even qualitatively misleading results . we will show , for example , that a fit of the exact correlation function with the simple analytical expression from ref . @xcite for the longitudinal hbt radius @xmath2 gives an estimate for the decoupling time which is too large by a factor @xmath3 . ( this was recently also pointed out in @xcite . ) the effect of the finite duration of particle emission on the difference between the hbt radii in out " and side " directions , @xmath4 which , as we will show , is also present in models with sharp freeze - out along a proper - time hypersurface , is completely missed by the approximations used in ref . @xcite , giving rise to a qualitatively wrong @xmath0 dependence of the out "- correlator . we conclude from our findings that a quantitative analysis of the @xmath0-dependence of hbt radii necessitates a numerical evaluation of the theoretical expressions for the correlation radii , or requires at least a much more sophisticated analytical approximation scheme than so far employed . we begin by shortly reviewing the general approach and defining our notation . we restrict our discussion to two - particle correlations . we start from the usual abstraction of the collision region as an assembly of classical boson emitting sources in a certain space - time region @xcite . their wigner transform @xcite defines the emission function @xmath5 which describes the probability that a particle with on - shell momentum @xmath6 ( @xmath7 ) is emitted from the space - time point @xmath8 . the emission function determines the single particle momentum spectrum @xmath9 as well as the hbt two - particle correlation function @xmath10 where @xmath11 is the average momentum of the two particles and @xmath12 their relative momentum . in the plane wave approximation the latter is given in terms of the 1- and 2-particle distributions @xmath13 , @xmath14 and the average number @xmath15 ( @xmath16 ) of particles ( particle pairs ) produced in the reaction as @xcite @xmath17 in the numerator of the last expression we have introduced off - shell momentum 4-vectors @xmath18 and @xmath19 for the total and relative momentum of the particles in the pair by defining @xmath20 and @xmath21 where @xmath22 . a popular approximation whose accuracy was studied quantitatively in @xcite consists of putting @xmath18 on - shell , @xmath23 , and setting @xmath24 in the denominator : @xmath25 the aim of hbt interferometry is to obtain from the measured correlation function @xmath26 information about @xmath27 which in turn should characterize the size of the interaction region . one usually compares @xmath26 to experimental data by taking recourse to the gaussian approximation @xcite @xmath28 \ , , \label{3}\ ] ] which is valid for azimuthally symmetric sources . here @xmath29 , @xmath30 , @xmath31 denote the spatial components of @xmath32 in the beam direction ( longitudinal " or @xmath33-direction ) , parallel to the transverse components @xmath34 of @xmath35 ( out " or @xmath8-direction ) , and in the remaining third cartesian direction ( side " or @xmath36-direction ) , respectively . in practice the last term in ( [ 3 ] ) which mixes the components @xmath30 and @xmath29 has usually been neglected because its existence was only recently pointed out @xcite and confirmed experimentally @xcite . the main purpose of the present work is to investigate the transverse momentum dependence of the hbt correlation radii @xmath37 in ( [ 3 ] ) . as already mentioned it reflects the @xmath1-correlations in the emission function @xmath27 generated by collective expansion of the source , information that can not be obtained from @xmath35-averaged correlation radii . our analysis will be based on a specific model for the emission function , but the method is general and can later be combined with a comprehensive investigation of the model dependence of 2-particle correlations . in the present paper we will compare two different methods to calculate the @xmath37 : the first consists of fitting the numerically determined hbt correlation function @xmath26 to the form ( [ 3 ] ) in such a way that its half width is correctly reproduced , while in the second approach we will use the following model - independent expressions @xcite : @xmath38 which are guaranteed to yield the correct gaussian curvature of the correlation function @xmath26 near @xmath39 @xcite . in eqs . ( [ 4 ] ) we defined @xmath40 and introduced the notation @xmath41 for gaussian sources , the set of equations ( [ 4 ] ) can be alternatively derived by expanding ( [ 1 ] ) for small relative momenta @xmath32 up to second order and re - exponentiating @xcite , or by making a gaussian saddle point approximation of the emission function around its maximum @xcite . a more general justification of eqs . ( [ 4 ] ) , which ( as we will show ) remain rather accurate even for non - gaussian sources , is based on the following parametrization of the emission function : @xmath42 where the saddle point @xmath43 is defined as the point where all first derivatives of @xmath27 vanish . if one identifies @xmath44 with the tensor of second derivatives of @xmath45 , the first term on the r.h.s . ( [ 5a ] ) amounts to the gaussian saddle point approximation around @xmath46 which was used in @xcite . for non - gaussian forms of @xmath27 , the typical corrections to eqs . ( [ 4 ] ) , ( [ 5 ] ) from @xmath47 can be minimized by instead defining @xmath48 in terms of the variance of @xmath27 , @xmath49 which measures the width of @xmath27 . with this definition the fourier transform ( [ 2 ] ) of the first term in ( [ 5a ] ) can be done analytically and leads directly to the expressions ( [ 3 ] ) and ( [ 4 ] ) , with the expectation value ( [ 5 ] ) defined in terms of the _ full _ emission function @xmath27 . we will see that , in contrast to other approximation schemes ( see for example @xcite ) , the determination of the hbt radii via ( [ 4 ] ) yields an accurate representation of the width of the exact correlation function , independent of the validity of the gaussian saddle point approximation for @xmath27 . except for the few special cases for which the four - dimensional fourier transform of @xmath27 is known exactly , an analytical investigation of equation ( [ 1 ] ) or ( [ 4 ] ) must involve a suitable approximation scheme . the existing analytical calculations @xcite of ( the @xmath35-dependence of ) the hbt radii for particular emission functions @xmath27 cover certain limiting cases of parameter space only , and their validity has not been checked numerically . in the present work , we investigate the complete @xmath35-dependence of the hbt radii by both analytical and numerical methods without any restriction to limiting cases . our paper is organized as follows : in section [ sec2 ] , we review a recently introduced simple model for the emission function @xcite which we will also study here . it may not be the most realistic model for heavy - ion collisions , but it possesses a number of essential physical features and allows for a controlled investigation of our analytical approximation scheme and a direct comparison with previously published approximations . in section [ sec3 ] we develop a new analytical approximation scheme for the hbt radii ( [ 4 ] ) of this model . in section [ sec4 ] we provide some intermediate results for the numerical evaluation of the correlation function . in section [ sec5 ] we compare the analytical and numerical values for the hbt radii . we find that the analytical approach works very well for a linear transverse flow profile , if the approximation scheme ( which involves an expansion in powers of @xmath50 , @xmath51 being the lorentz factor associated with the transverse flow ) is carried to third non - leading order . for the out " and longitudinal " radii the leading terms in this approximation scheme are found to be insufficient . for parabolic transverse flow profiles our approximation scheme and , _ a fortiori _ , all previously suggested simpler approximations are found to fail completely . the physical consequences of our findings are discussed in section [ sec6 ] . for ease of comparison with published results in the literature , we consider the emission function @xcite @xmath52 where the boltzmann factor @xmath53 reflects the assumed local thermal equilibration of a source with local temperature @xmath54 moving with hydrodynamic @xmath55-velocity @xmath56 . we will take @xmath57 to be constant . we assume sharp freeze - out of the particles from the thermalized fluid along a hypersurface @xmath58 , and the 4-vector @xmath59 denotes the normal - pointing freeze - out hypersurface element . the factor @xmath60 $ ] imposes a gaussian transverse density profile with geometric radius @xmath61 ; the exponent can be interpreted in terms of an effective chemical potential @xmath62 which depends only on the transverse coordinate @xmath63 . for the flow velocity profile @xmath64 we assume longitudinal boost invariance by setting @xmath65 , i.e. identifying the flow rapidity @xmath66 $ ] with the space - time rapidity @xmath67 $ ] . we can thus parametrize @xmath64 in the form @xmath68 where @xmath69 is the transverse flow rapidity . the momentum @xmath18 is parametrized in the usual way through the transverse mass @xmath70 and the rapidity @xmath71 as @xmath72 . assuming sharp freeze - out at constant proper time @xmath73 , the freeze - out hypersurface is parametrized as @xmath74 , resulting in @xmath75 . the emission function can thus be rewritten as @xmath76/t } \ , e^{-r^2/(2 r^2 ) } \ , \delta(\tau-\tau_0)\ , . \label{8}\ ] ] the @xmath77-function renders the @xmath78-integration in @xmath79 trivial , and only the integrations over space - time rapidity @xmath80 and the transverse coordinates @xmath81 remain to be done . exploiting the boost invariance and infinite longitudinal extension of our source we can simplify the structure of eqs . ( [ 4 ] ) by going to the longitudinally comoving system ( lcms ) . in this frame @xmath82 . in this section we will discuss the model - independent expressions ( [ 4 ] ) for the hbt radii . our analysis of these expressions proceeds in two steps : first , the @xmath80-integration is done analytically . we then find the approximate saddle point of the resulting integrand in the @xmath8- and @xmath36-directions and carry out those integrations by saddle point integration . to begin with we note that by the symmetry of our infinite boost - invariant emission function ( [ 8 ] ) the expectation values of all odd functions of @xmath80 vanish . therefore , in this model the cross term @xmath83 is zero @xcite . writing @xmath84 , @xmath85 and including the @xmath86 prefactor in eq . ( [ 8 ] ) ( recall that we use the lcms frame where @xmath87 ) , the @xmath80-integrations in the expectation values ( [ 4 ] ) can be done analytically and expressed in terms of modified bessel functions @xmath88 . defining @xmath89 with @xmath90 the expressions ( [ 4 ] ) for the hbt radii can be written as sums of terms of the general form @xmath91 where @xmath92 is a simple polynomial in @xmath8 or @xmath36 and @xmath93 is the transverse weight function for the @xmath94 average in ( [ 10 ] ) . the functions @xmath95 needed in ( [ 4 ] ) are given explicitly by @xmath96 with @xmath97 from ( [ 11 ] ) . with these definitions the hbt radii ( [ 4 ] ) take the form @xmath98 for the model ( [ 6 ] ) these expressions are exact . in some previous papers @xcite the @xmath80-integration was not done exactly , but by saddle point integration around @xmath99 . to this end one expands the exponent of ( [ 8 ] ) as @xmath100 , and replaces all @xmath86 prefactors by their saddle point value @xmath101 . this amounts to replacing the modified bessel functions by their leading term for large @xmath102 , @xmath103 . it is easy to see that in this approximation the @xmath104-dependent terms in eq . ( [ 13 ] ) for @xmath105 vanish exactly . one would thus conclude that for sharp freeze - out at @xmath106 there is no influence of the source lifetime on @xmath105 and on the difference @xmath4 . the exact expressions ( [ 13 ] ) show , however , that this is not true : @xmath4 is sensitive to the time structure of the source . the physical mechanism behind this is quite interesting : since particles from different points on the freeze - out surface contribute to the correlation function as long as they are separated in @xmath33-direction by less than the longitudinal region of homogeneity @xmath2 , the correlation function indeed probes a finite range of coordinate times @xmath107 along the proper - time hyperbola @xmath108 : @xmath109 ( assuming that only half of the longitudinal region of homogeneity contributes effectively ) . this shows up in the hbt radius for the out - direction as a contribution from a finite duration of the emission process and is formally reflected by the last two lines in the expression ( [ 13 ] ) for @xmath105 . we will see the practical consequences of this in sections [ sec5 ] and [ sec6 ] . since in most realistic situations we can assume @xmath110 ( low-@xmath111 photons from a high - temperature source being the exception ) , it makes sense to use in the transverse integrals the asymptotic expansion of the bessel functions for large arguments : @xmath112 clearly , how many orders @xmath6 must be taken into account to obtain a good approximation for ( [ 10 ] ) depends on both the order @xmath113 and the lower limit for @xmath102 , as reflected by the upper bound @xcite @xmath114 for the remainder term in eq . ( [ 14 ] ) . substituting the expansion ( [ 14 ] ) back into ( [ 13 ] ) , we are left with sums of integrands of the type @xmath115 where @xmath116 the integer @xmath117 labels the order in the expansion ( [ 14 ] ) . the resulting transverse integrals can be done by a saddle point approximation of @xmath118 . to obtain accurate results it is , however , important to find a good approximation for the exact saddle point @xmath119 of @xmath118 which can not be obtained analytically except for simple limiting cases @xcite . in previous studies @xcite a gaussian approximation of the first exponential factor in ( [ 16 ] ) around its own saddle point was used ; the resulting product of two gaussian factors was integrated out analytically , without however including the effects from the @xmath120 prefactor in ( [ 16 ] ) . unfortunately , we found that in most cases the resulting analytical expressions for the hbt radii do not exhibit the correct @xmath0 dependence of the exact results obtained by evaluating the expressions ( [ 13 ] ) numerically . in appendix [ appa ] we derive an analytical approximation scheme for obtaining a better estimate of the true saddle point which yields much more accurate results . we derive there the following gaussian approximation for the transverse weight function @xmath118 : @xmath121 \ , , \label{17}\ ] ] with effective gaussian size parameters @xmath122 here @xmath119 is the @xmath8-component of the transverse saddle point @xmath123 which should be determined from the condition @xmath124 barred quantities with an index @xmath117 denote values at the saddle point , and primes indicate @xmath8-derivatives . since this equation can not be solved analytically for @xmath119 , one replaces in eqs . ( [ 18 ] ) the true saddle point @xmath119 by an analytically obtained approximate value @xmath125 and calculates the ` lengths of homogeneity ' @xmath126 and @xmath127 by evaluating the expressions ( [ a6],[a6a ] ) at that point . the correct saddle point @xmath119 is then related to the approximate value @xmath125 by eqs . ( [ a7],[a9 ] ) , while the constant @xmath128 is determined by eq . ( [ a11 ] ) . a good choice for the approximate saddle point @xmath125 is also derived in appendix [ appa ] and given analytically by eqs . ( [ a12 ] ) , ( [ a4 ] ) and ( [ a6c ] ) . please note that according to eqs . ( [ a6],[a6a ] ) the homogeneity lengths in the ` side ' and ` out ' directions , @xmath129 and @xmath130 , are in general different ; this was also recently found by akkelin and sinyukov @xcite . only for a linear transverse rapidity profile with a small slope ( the nonrelativistic transverse expansion scenario studied in refs . @xcite ) , where the transverse saddle point can be taken as @xmath131 , do the two expressions agree . we will see in section [ sec5 ] that in some situations this difference can be drastic , causing sizeable differences between @xmath132 and @xmath133 which have nothing to do with a finite duration of the emission process . using the expansion ( [ 14 ] ) , the hbt radii ( [ 13 ] ) can be rewritten in terms of integrals over the auxiliary functions @xmath134 , eqs . ( [ 16]/[17 ] ) . both the numerator and denominator of ( [ 10 ] ) reduce to integrals of the type @xmath135 with certain coefficients @xmath136 which depend on the particular hbt radius under consideration ( see appendix [ appb ] ) . for the polynomials @xmath92 occuring in ( [ 13 ] ) the necessary integrals are easily evaluated in terms of the size parameters ( [ 18 ] ) : @xmath137 before combining these results into analytical expressions for the hbt radii ( see appendix [ appb ] and section [ sec3c ] ) , let us shortly comment on the validity of the transverse saddle point approximation introduced in this subsection . we have checked three possible sources of deviations of the approximate analytical hbt radii from the results obtained by exact numerical integration of the expressions ( [ 13 ] ) : * the expansion ( [ 14 ] ) of the bessel functions @xmath138 is asymptotic , but not convergent . in our case this is not a problem since we found that in all cases where the approximation scheme worked ( see below ) , convergence was reached at low orders @xmath139 , cf . section [ sec5a ] . * the factor @xmath140 in @xmath118 was substituted by @xmath141 $ ] , cf . appendix [ appa ] . numerical checks showed that in all the cases considered in section [ sec5 ] the errors introduced by this approximation are negligible . * the crucial approximation in our method turns out to be the substitution of the transverse weight function @xmath118 ( in the form ( [ a2 ] ) ) by the gaussian ( [ 17 ] ) . this is good only as long as the quadratic term in the expansion of @xmath142 around @xmath119 dominates the behaviour of the integrand . as we will discuss in section [ sec5b ] , this places a strong mathematical constraint on the form of the transversal flow @xmath69 . it is now only a matter of patience to combine eqs . ( [ 10 ] ) , ( [ 12 ] ) , ( [ 14 ] ) , ( [ 19 ] ) , and ( [ 20 ] ) to obtain analytical expressions for all the hbt radii ( [ 13 ] ) in terms of the two effective gaussian size parameters ( [ 18 ] ) . this is done in appendix [ appb ] . since the comparison in section [ sec5 ] with numerical results will show that we typically must keep several terms from the expansion of the bessel functions , these analytical results are rather complicated and do nt lend themselves easily to an intuitive interpretation . in particular , different terms of the expansion generate different types of @xmath0 dependences , and there is no simple @xmath0 scaling law for the hbt radii . it is nevertheless instructive to compare our analytical results with simpler ones previously proposed by several other authors @xcite . those results were attractive because they implied simple scaling laws for the hbt radius parameters as a function of the average transverse momentum @xmath111 of the boson pair ( resp . of its transverse mass @xmath0 ) , and for this reason they are still popular with experimentalists ( see , e.g. , @xcite ) . we will discuss here which limits have to be taken in order to recover these results from our expressions , and what these limits imply . let us begin with the longitudinal hbt radius @xmath2 . historically the first expression was derived by makhlin and sinyukov in a model without transverse flow , via saddle point approximation around @xmath143 . they found @xmath144 } \ , , \label{21a}\ ] ] and this has been used by experimentalists to fit their data @xcite . for boson emitting sources with a non - relativistic linear transverse flow @xmath145 , @xmath146 , a next order correction to ( [ 21a ] ) was calculated by chapman _ et al . _ who found in the boost - invariant limit } \ , , \ ] ] which was found by saddle point approximation for a source with a finite longitudinal extension @xmath147 which breaks the boost - invariance . in the limit @xmath148 , this expression reduces to ( [ 21a ] ) . the results of ref . @xcite generalize it by non - leading corrections to the saddle point approximation . our investigation here is restricted to boost - invariant models . ] ( @xmath148 in their notation ) @xmath149 } \ , . \label{21b}\ ] ] in that paper the transverse shift of the saddle point away from @xmath150 was neglected , which is justified for small transverse flow velocities . an analytical expression without any approximation was recently derived for the case of vanishing transverse flow : @xmath151}\ , . \label{21c}\ ] ] in the limit @xmath152 , ( [ 21b ] ) reduces to the first two terms from an expansion of ( [ 21c ] ) for @xmath153 . our expression ( [ 13 ] ) for the longitudinal radius in the case of arbitrary transverse flow reads ( cf . appendix [ appb ] ) @xmath154}\ , . \label{21d}\ ] ] from this result eq . ( [ 21c ] ) follows immediately in the limit of vanishing transverse flow , @xmath155 , and eq . ( [ 21a ] ) is the leading term of an expansion of ( [ 21c ] ) for large @xmath156 . it was pointed out before @xcite that keeping only this lowest order term is an insufficient approximation for realistic values of @xmath57 and @xmath0 , and that therefore ( [ 21a ] ) should not be used to extract the freeze - out time @xmath104 from data . in the presence of transverse flow the @xmath0-dependence of @xmath2 is much more complicated than either ( [ 21a ] ) or ( [ 21c ] ) . the approximate result ( [ 21b ] ) for a weak linear transverse flow can not , in this form , be derived from ( [ 21d ] ) ; one can show that for @xmath157 the leading term @xmath158 agrees in both expressions , but differences occur in higher orders . these arise from the transverse shift of the saddle point @xmath159 which was neglected in ref . @xcite , but must be taken into account for stronger transverse flows . this leads to a significant further modification of the @xmath0-dependence which will be studied in detail in the following section . let us now turn to the side"- and out "- radii . here we can again compare ) . ] with the expressions obtained by chapman _ @xcite for a weak linear transverse flow , expanding around @xmath160 . ( earlier results by csrg and lrstad @xcite can be obtained from those of ref . @xcite by keeping only the leading terms of this expansion . ) in the limit of a boost - invariant source ( @xmath148 in their notation ) and sudden freeze - out at proper time @xmath104 ( @xmath161 ) they find in the lcms frame ( @xmath162 ) @xmath163 { \displaystyle { r_s^2 = { r^2 \over 1 + { m_\perp \over t } v^2 } \ , . } } \end{array}\right\ } \qquad\hbox{[{\it chapman , scotto and heinz } \cite{csh95 } ] } \label{22}\ ] ] let us compare this with the lowest order ( @xmath164 ) contributions from our approximation scheme ( see appendix [ appb ] ) : @xmath165 { \displaystyle { { 1\over r_o^2 } = { 1\over r_o^2(0 ) } = { 1\over r^2 } + { 1\over { \lambda}_o^2(\bar{x}_0)}\ , . } } \end{array}\right\ } \qquad\hbox{[{\it our lowest order contribution } ] } \label{23}\ ] ] for a weak linear transverse flow @xmath166 , @xmath167 , one may approximate the transverse saddle point by @xmath168 . then with a little algebra eqs . ( [ a6]/[a6a ] ) can be shown to yield @xmath169 . inserting this into ( [ 23 ] ) one recovers the first term on the right hand sides of eqs . ( [ 22 ] ) except that in the denominator @xmath156 is replaced by @xmath170 . the reason for this slight discrepancy is that in ref . @xcite ( as in all other previous discussions of the emission function ( [ 8 ] ) ) the contribution of the factor @xmath171 in ( [ 16 ] ) to the lengths of homogeneity was overlooked . these first terms in eqs . ( [ 22 ] ) arise from the geometric " parts , @xmath172 and @xmath173 , respectively , in the model - independent expressions ( [ 4 ] ) , which for weak linear transverse flow coincide to lowest order of our approximation scheme . the second term in the expression ( [ 22 ] ) for @xmath132 is due to the finite duration of particle emission by the source ( [ 8 ] ) and comes from the term @xmath174 in ( [ 4 ] ) . it is identical with the lowest non - vanishing contribution from eq . ( [ b6 ] ) . thus the authors of @xcite have correctly identified the lowest order contributions to @xmath175 , @xmath176 , and @xmath174 . ( the term @xmath177 in @xmath105 is much smaller and according to ( [ b5 ] ) can only be seen if the effect of the transverse flow on the saddle point @xmath178 is taken into account . ) in the following section we will show , however , that for realistic values of the transverse flow velocity these lowest order contributions are unreliable , and a correct description of the @xmath111-dependence of the hbt radii requires the inclusion of higher order corrections from our general expressions in appendix [ appb ] . we already noted that for transverse flows which are not weak or have a non - linear dependence on @xmath179 , the two transverse homogeneity lengths @xmath180 and @xmath181 are no longer equal ( see also @xcite ) . in that case it is no longer guaranteed that the finite duration of particle emission yields the dominant contribution to the difference @xmath4 as in models with weak or vanishing transverse flow @xcite . since transverse flow is a generic feature of the sources generated in heavy - ion collisions @xcite , its effect must to be taken into account when trying to interpret measured differences between @xmath132 and @xmath133 in terms of the emission time . the @xmath80-integration for the full 2-particle correlation function @xmath26 as given by eq . ( [ 2 ] ) can be done analytically by the same methods as used in section [ sec3a ] . the resulting 2-dimensional transverse fourier integrals will then be evaluated numerically . the half widths of the numerically computed exact correlator can then be compared with the analytical expressions for the hbt radii from the previous section , allowing us to check our approximations . the @xmath80-integral for the denominator of eq . ( [ 2 ] ) was already evaluated in section [ sec3a ] : @xmath182 for the numerator let us first study the limit @xmath183 . writing @xmath184 , @xmath185 and using @xmath186 ( which is true in the lcms frame where @xmath162 ) , we find @xmath187 the @xmath29-dependence of @xmath26 can be obtained by using @xmath188 for real values of @xmath102 and @xmath189 . this leads to @xmath190 with these ( exact ) expressions the correlation functions @xmath191 and @xmath192 reduce to a ratio of 2-dimensional integrals . these have been evaluated numerically . from the numerical result for the correlator we determine new hbt radii @xmath193 by requiring that the function @xmath194 reproduces exactly the half point , @xmath195 , of the numerically computed correlator ( the other two components @xmath196 are set equal to zero ) . in the following section these values @xmath193 will be compared with hbt radii obtained from the expressions ( [ 13 ] ) by either numerical or analytical evaluation of the transverse integrals @xmath197 . in this section we give a detailed and quantitative analysis of the hbt radii for the source function ( [ 6]/[7 ] ) , both for a linear and a quadratic transverse flow rapidity profile @xmath69 . we will compare the analytic methods developed in section [ sec3 ] with exact numerical results . we will show that for the linear transverse flow the analytical approximation scheme works very well , but only if higher order contributions ( non - leading terms in the bessel function expansion and an improved value for the transverse saddle point ) are properly taken into account . for the quadratic flow the saddle point methods from section [ sec3 ] are found to fail . for a weak quadratic transverse flow we also find an unexpected effect : in the @xmath198-plane the emission region _ increases _ with rising transverse momentum of the pair . although this case may be somewhat pathological , it provides a specific counter example to the folklore @xcite that transverse collective flow leads to a reduction of the transverse hbt radii at finite transverse pair momentum . another example with a different velocity profile , but similar behaviour for @xmath132 was found in ref . @xcite . all the sources studied in this section have a transverse geometric ( gaussian ) radius @xmath199 fm and freeze out along a hyperbola of constant longitudinal proper time @xmath200 fm/@xmath201 at temperature @xmath202 mev . the longitudinal flow is always boost - invariant , and we study the sensitivity to the transverse flow . let us begin with a linear transverse flow rapidity profile : @xmath203 for this case the transverse momentum dependence of the hbt radii @xmath133 , @xmath132 , and @xmath2 is shown in fig . [ f1 ] . in the figure we compare various approximations : the solid lines are obtained by numerical evaluation of the expectation values in the model - independent expressions ( [ 4 ] ) in the form ( [ 13 ] ) with our source ( [ 6 ] ) . the long - dashed lines show the radii @xmath204 from eq . ( [ 27 ] ) which reproduce the half width of the exact correlation function in direction @xmath205 . the short - dashed lines represent our analytical results ( [ b2 ] ) - ( [ b6 ] ) , evaluated with the effective size parameters ( [ 18 ] ) obtained in appendix [ appa ] and including all terms up to order @xmath206 from the expansion of the bessel functions . the dash - dotted lines show the same analytic expressions but truncating the expansion ( [ 14 ] ) at lowest order @xmath207 . let us summarize the most important features of fig . [ f1 ] : * for @xmath133 our analytical expression ( [ b2 ] ) approximates very accurately , even for @xmath207 , the exact value obtained numerically from eq . ( [ 13 ] ) . thus for @xmath133 the leading order expression @xmath208 can be used with excellent accuracy . however , it is necessary that the homogeneity length @xmath129 is evaluated sufficiently closely to the exact transverse saddle point @xmath209 as described in appendix [ appa ] . our studies showed that , if used with the lowest order estimate ( [ a6b ] ) , eq . ( [ 28 ] ) develops for large transverse flow rapidities @xmath210 a much stronger @xmath111-dependence than the exact side "- radius . clearly this renders an analytical determination of the transverse flow velocity from the @xmath111-dependence of @xmath133 a somewhat subtle issue , to say the least . * the exact numerical value for @xmath133 from eq . ( [ 13 ] ) also coincides very accurately with @xmath211 from ( [ 27 ] ) . for the source ( [ 6 ] ) our model - independent expressions ( [ 4 ] ) thus correctly reproduce not only the curvature of the correlation function at small values of @xmath31 ( which is difficult to access experimentally ) , but also its half width . this should not be too surprising after one checks that in the side "- direction the source ( [ 6 ] ) has a rather gaussian shape for all relevant values of @xmath111 . * in the out "- direction the situation is more complicated : there the leading term from the bessel function expansion is seen to yield qualitatively wrong results . after including higher order terms up to @xmath212 , the agreement with the exact numerical results improves dramatically , although some deviations remain at large @xmath111 for strong transverse flows . this remaining discrepancy can be traced back to the fact that we use for the transverse integration only an approximate saddle point . for the naive " saddle point @xmath213 the disagreement is much worse . this shows that for the out "- direction and strong transverse flow the usefulness of the analytical approach relies crucially on an accurate approximation for the transverse saddle point . * it is important to note that the lowest order approximation ( dash - dotted line ) completely misses the rise of @xmath132 at small values of @xmath111 . this is a lifetime effect and arises from the time variance given in ( [ b3 ] ) . the rise was also noted previously in correlation functions based on numerical hydrodynamic calculations @xcite , but without a detailed theoretical analysis of its origin . as seen from eq . ( [ b9 ] ) , the time variance only begins to receive contributions at third order of the bessel function expansion , but the coefficients of these higher order terms are larger than unity . the physics of this effect has been explained at the end of section [ sec3a ] . for weak flow ( @xmath214 ) it yields the dominant contribution to the difference @xmath4 between the out " and side " radii . * for strong transverse flow , that difference remains appreciable even if the contribution from the time variance is neglected ; it is then due to the difference between the homogeneity lengths in the two directions , see eqs . ( [ a6]/[a6a ] ) . this difference can be rather accurately estimated by comparing the dash - dotted lines in fig . [ f1]a ( our lowest order analytical results for @xmath132 which give essentially @xmath215 ) with fig . [ f1]b . for @xmath216 one finds , for example , that in the region @xmath217 mev/@xmath201 the expressions @xmath176 and @xmath218 differ by more than 50% . * the agreement between the exact hbt radius @xmath132 from the model - independent expression ( [ 4 ] ) and the half widths described by @xmath219 is excellent for all values of @xmath220 and @xmath111 . the reason is again the rather gaussian shape of the source function also in the out "- direction . * for the longitudinal radius @xmath2 , the leading term from the bessel function expansion is insufficient again ( this is even true for vanishing transverse flow , see @xcite ) , but excellent agreement with the exact value from the model - independent expression ( [ 4 ] ) is reached for @xmath221 , for all values of @xmath111 . for small transverse momenta , however , one sees a disagreement with the half width of the exact correlator as given by the parameter @xmath222 . on the other hand we checked numerically that @xmath223 from eq . ( [ 4 ] ) correctly reproduces the curvature of @xmath224 at @xmath183 , as it should . in this case the disagreement arises from non - gaussian features of our source ( [ 6 ] ) in the longitudinal ( @xmath80 ) direction : for small @xmath111 the source decreases at large values of @xmath80 much more steeply than a gaussian . however , the discrepancy is small , and in spite of these non - gaussian features of the source the model - independent radii ( [ 4 ] ) , evaluated with the full source ( [ 6 ] ) , reproduce the half width of the correlation function with an accuracy of a few percent . * all three hbt radii are strongly affected by the transverse flow , even at @xmath225 . the influence on @xmath2 is relatively weaker than on @xmath133 and @xmath132 . as transverse flow increases , the transverse region of homogeneity decreases , and the hbt correlator receives contributions from a smaller and smaller fraction of the total source . at @xmath225 the out- " and side- " radii are equal , @xmath226 ; this must be true because for @xmath225 there is nothing to distinguish between the two transverse directions @xcite . * an extraction of the geometric transverse radius @xmath61 from the data requires to disentangle geometrical from dynamical effects . based on fig . [ f1 ] it appears to us that the most promising way to achieve this is as follows : one estimates the amount of transverse flow from the strength of the @xmath111-dependence of the side "- radius @xmath133 . one then extrapolates @xmath227 to @xmath225 and uses the estimate for the transverse flow rapidity to correct it for flow effects , thus extracting the geometric transverse radius @xmath61 . * from fig . [ f1]a it is clear that the extraction of the duration of particle emission , which is related to the rate at which @xmath228 rises for small @xmath111 , requires an accurate measurement of the @xmath111-dependence of the out "- radius in the domain @xmath229 mev/@xmath201 . this is not easy , because for very small @xmath111 the detection efficiency tends to decrease ( in a tpc the track density becomes high , in a single arm spectrometer one of the two particles tends to miss the detector ) . it therefore helps to know that @xmath132 agrees with @xmath133 at @xmath225 ; the latter can be extracted much more easily by extrapolation , due to its smooth @xmath111-dependence . [ f1 ] shows that the leading terms from a saddle point approximation produce quantitatively and qualitatively unreliable results for the @xmath0-dependence of the hbt radii @xmath2 and @xmath132 . quantitative attempts to extract values for the freeze - out time @xmath104 , the transverse flow @xmath220 and the transverse geometric size @xmath61 from hbt data must thus be based on a numerical evaluation of the model - independent expressions ( [ 4 ] ) rather than on simple @xmath0-scaling laws extracted from insufficient analytical approximations . a linear transverse flow rapidity profile is perhaps the simplest , but not obviously the most realistic assumption . dynamical studies based on a numerical solution of the hydrodynamic equations @xcite produce transverse flow velocity profiles which for small values of @xmath179 look parabolic and for large @xmath179 saturate at the light velocity ; the parabolic rise is zero initially , but builds up gradually as the hydrodynamic pressure generates transverse flow . on the other hand , when combining such hydrodynamic calculations with a dynamic model for the freeze - out kinetics , taking into account sequential transverse freeze - out of the matter from the dilute edge at early times to the center at later times , the resulting flow profile _ along the freeze - out hypersurface _ turns out @xcite to be _ linear _ again for small @xmath179 , reaching a maximum at intermediate @xmath179 and dropping to zero again at the edge of the firetube ( because that part of the matter freezes out immediately due to its diluteness , before transverse flow is able to build up ) . numerical kinetic simulations of pion production based on the rqmd code , finally , produce a transverse flow profile at freeze - out @xcite which rises quadratically at small @xmath179 , reaches a maximum and slightly drops again at large @xmath179 . the shape of the transverse flow profile is thus not at all clear . investigations of particle freeze - out based on hydrodynamic or kinetic models , which result in source functions which are only numerically known , and their influence on the shape of the hbt correlation function should thus be supplemented by systematic studies of simple model sources with various types of simple flow profiles . in this subsection we therefore supplement the results from the previous one by a discussion of quadratic transverse flow rapidity profiles : @xmath230 the resulting transverse momentum dependence of the hbt radii is shown in fig . the labelling and meaning of the various curves is the same as in the previous subsection . however , the curves corresponding to analytical approximations are missing ; the reason is that the scheme developed in section [ sec3 ] and appendix [ appa ] fails for a quadratic transverse flow rapidity profile . that scheme relied on a gaussian saddle point approximation in the transverse direction ; since for small @xmath111 the dominant contribution from the transverse flow arises from the factor @xmath231 in the exponent which contributes only at order @xmath232 , a gaussian saddle point approximation misses the dominant flow effects completely . an improved analytical approximation scheme on the other hand would be much more complicated . comparing figs . [ f1 ] and [ f2 ] we see that qualitatively the @xmath111-dependence of the hbt radii is similar for both types of transverse flow profile . in all cases the model - independent expressions ( [ 4 ] ) yield hbt radii which give an excellent representation of the half - width of the correlator . for a given flow scale @xmath220 , the flow effects on the hbt radii are stronger for the quadratic flow ( [ 28a ] ) than for the linear flow ( [ 27a ] ) . this indicates that emission from regions @xmath233 in the source plays a significant role for the shape of the correlation function . the only unusual feature in fig . [ f2 ] is the rise of @xmath132 with @xmath111 for a weak quadratic transverse flow with @xmath234 . it can be traced to a rise of the variance in the out "- direction , @xmath235 , with @xmath111 . this is different from the generic decrease of the effective region of homogeneity with increasing @xmath111 which is seen in all other cases . it seems to be due to an accidental coincidence of parameters : in fig . [ f3 ] we show a contour plot of the transverse weight function ( [ 10a ] ) ; only for small quadratic transverse flow it gets wider in the @xmath8 direction with increasing @xmath111 . although exotic , this example should be kept in mind as a reminder that transverse flow not always leads to a decrease of the effective source size . the aim of hbt interferometry with hadrons produced in heavy ion collisions is to obtain information about the space - time structure of the emitter . unfortunately , a unique reconstruction of the emission function @xmath27 from the 2-particle correlation function @xmath236 is impossible , since the frequency @xmath237 and the spatial momenta @xmath32 in the fourier transformation relating the two functions are not independent , as the final state hadrons are on mass - shell . however , the class of possible models for the emission function can be strongly restricted by a careful multidimensional hbt analysis of the 2-body correlation function . in particular , a careful analysis of the dependence of the hbt radii ( which describe the width of the correlator as a function of the relative momentum @xmath32 ) on the pair momentum @xmath35 provides crucial information on the correlations between emission point @xmath8 and particle momentum @xmath18 in the source . such @xmath238 correlations are generated , for example , by the collective expansion of the sources generated in heavy ion collisions . recently heavy ion experiments @xcite have begun to provide first quantitative information on the @xmath35-dependence of the hbt correlation functions . the hope to obtain access to the collective behaviour in heavy ion collisions by analyzing these results has refuelled the theoretical interest in the @xmath35-dependence of the hbt radii . in this paper we reanalyzed this issue with a combination of numerical and analytical methods . for a given source model , the numerical methods provide us with exact predictions for the transverse momentum dependence of the hbt radii . they thus establish a reliable link between various possible models for the emission function and the experimental data for the correlation function . the analytical approach provides , in the context of a specific source model studied in this paper , a mathematical understanding of the numerical results and a bridge between approximate analytical expressions published previously and the exact numerical results obtained here , and thus permits to test their reliability . our numerical studies showed that the model - independent expressions ( [ 4 ] ) for the hbt radii not only give the correct curvature of the correlation function @xmath239 for small values of @xmath240 ( as was known before @xcite ) , but also reproduce on most cases the width of the correlator quite accurately . as long as the measured correlation function has a roughly gaussian shape in @xmath32 , these expressions provide an accurate and valuable link between theory and experiment and permit to relate the ( @xmath35-dependent ) width parameters of the correlation function to the ( @xmath35-dependent ) space - time width of the original source function . in this context it should be cautioned , however , that the effects of resonance decays , which are numerically known to give the correlation function a non - gaussian shape @xcite , remain to be studied in more detail . furthermore , this result means that _ only _ the half - widths of the emission function in space - time can be reconstructed from the width of the correlation function . finer details of the space - time structure of the emitter ( like sharp edges or holes in the center ) do not affect the width of the correlator , but can only be estimated by a very accurate study of the long - range decay of the correlator ( e.g. by looking for side maxima at larger values of @xmath32 ) . the numerical study also enables us to give a detailed assessment of the accuracy of previously published approximate analytical results for the hbt radius parameters . this is of particular interest since some of these results have gained great popularity because of their simple scaling behaviour as a function of @xmath0 . here our results cause disappointment : none of the so far suggested simple scaling laws is quantitatively reliable , except for very limiting situations which are not likely to be established in experiments . to make quantitative use of the measured @xmath35-dependence of the correlation function and to obtain reasonably accurate estimates for the lifetime , transverse geometric size and collective expansion rate of the source , a full - blown numerical evaluation of the expressions ( [ 4 ] ) is required , at least . the simple scaling laws should not be used we showed that they yield badly misleading results . for the specific source studied in this paper the duration of particle emission is very short , of order @xmath241 ( @xmath242 fm/@xmath201 at @xmath225 ) . this leads to a rise of @xmath132 at small @xmath111 . the rise stops at @xmath243 ( when @xmath244 approaches unity ) , and beyond that point @xmath132 and the difference between @xmath245 decreases again ( because @xmath246 decreases ) . the experimental verification of the effect of a finite duration of particle emission thus requires a high - statistics study of the correlation function at small @xmath111 . one might argue that realistic models in which the sharp freeze - out along a proper time hyperbola is replaced by continuous freeze - out over a longer time period should lead to a larger effect which is more easily seen in the data . however , in such models usually the source shrinks as the particles evaporate , and particles emitted at later times come from smaller regions near the center of the fireball ; the net effect on the difference @xmath247 seems to remain small and concentrated at small @xmath229 mev/@xmath201 @xcite . in the light of these new expectations the failure of the experiments so far @xcite to provide positive evidence for a finite period of particle emission appears less puzzling . we no longer believe that these data show that in heavy - ion collisions pion emission occurs in a flash " . we would like to thank s. chapman and u. mayer for clarifying and stimulating discussions . this work was supported in part by bmbf , dfg , and gsi . here we give the technical details of our saddle point approximation of expression ( [ 16 ] ) . we begin by writing the prefactor as @xmath248 $ ] and expanding the logarithm around @xmath249 : @xmath250 we checked numerically that keeping only the first term in the brackets is sufficient in the following . this allows us to combine the exponent with the @xmath251-term from the boltzmann weight factor and to rewrite @xmath118 in the form @xmath252where @xmath253 with @xmath254 the saddle point @xmath255 of the modified dynamical term @xmath256 alone is found to satisfy @xmath257 omitting the term @xmath258 in the denominator , this reduces to the expression given in @xcite whose shortcomings were discussed in section [ sec5a ] . in this case the saddle point is given by that point of the source at which the transverse flow velocity @xmath259 agrees with the transverse velocity @xmath260 of the pion pair . numerically a gaussian approximation around this point leads , however , to unsatisfactory results . including the effects of the @xmath261 prefactor both in the saddle point and in the gaussian curvature considerably improves the approximation . in addition , the saddle point @xmath123 of the full function @xmath118 is further shifted away from @xmath262 by the geometric factor @xmath263 in ( [ a2 ] ) . due to the symmetry of the function @xmath118 this shift will be only in @xmath8-direction , i.e. @xmath264 will stay zero . to estimate the position of the exact saddle point @xmath265 we proceed as follows : we expand @xmath266 to second order around an arbitrary point @xmath267 . after combining the resulting gaussian with the geometric factor @xmath263 we try to adjust @xmath125 iteratively to obtain an analytical approximation to the true saddle point @xmath119 of the full weight function . the quadratic expansion of the dynamical term reads @xmath268 where @xmath269 , @xmath270 , etc . , and @xmath271 inserting for @xmath125 the saddle point @xmath272 of the dynamical factor as determined by ( [ a4 ] ) , the linear term in ( [ a5 ] ) as well as the first terms on the right hand sides of eqs . ( [ a6],[a6a ] ) vanish as they should : @xmath273 at any other point @xmath125 this no longer true . inserting the expansion ( [ a5 ] ) into ( [ a2 ] ) and completing the squares we end up with a single gaussian @xmath274 whose saddle point @xmath119 is related to the point @xmath275 around which the dynamical factor was expanded by @xmath276 with @xmath277 the radius parameters in ( [ a8 ] ) are given in terms of the geometric radius @xmath61 and the homogeneity lengths ( [ a6],[a6a ] ) by @xmath278 while the constant term is given by @xmath279 identifying the expansion point @xmath125 with the true saddle point @xmath119 requires setting @xmath280 and amounts to solving the condition ( [ 18a ] ) . the constant @xmath281 then simplifies accordingly . instead of solving ( [ 18a ] ) numerically we can , however , solve ( [ a4 ] ) analytically for @xmath272 and then set ( see eq . ( [ a6c ] ) ) @xmath282 this is the saddle point of @xmath118 which would be obtained by expanding @xmath283 around @xmath262 . we want to stress that this procedure largely corrects for the fact that the radius parameters @xmath284 should be calculated from the curvature at the full saddle point @xmath119 instead of the saddle point @xmath272 of the modified dynamical factor alone . as shown in section [ sec5 ] , it is found to yield a very good approximation for the hbt radii and their @xmath0-dependence . in this appendix , we give expressions for the hbt - radii ( [ 12 ] ) with coefficients calculated from the series expansions ( [ 19]/[20 ] ) explicitly up to order @xmath206 . using the notational shorthand @xmath285 and the results derived in section [ sec3b ] , we obtain @xmath286 and @xmath287 the expansion of the out "- radius @xmath105 involves three contributions : @xmath288 here , up to order @xmath221 the coefficients are given by @xmath289 it is interesting to note that only the expressions ( [ b3 ] ) and ( [ b6 ] ) contain coefficients larger than @xmath290 ( cf . our discussion in section [ sec3c ] ) . d. boal , c.k . gelbke and b. jennings , rev . * 62 * , 553 ( 1990 ) . u. mayer , e. schnedermann , and u. heinz , phys . b*294 * , 69 ( 1992 ) . t. csrg and b. lrstad , lund preprint lunfd6(nffl-7082 ) ( 1994 ) , unpublished . s. chapman , p. scotto and u. heinz , phys . * 74 * , 4400 ( 1995 ) ; and heavy ion physics * 1 * , 1 ( 1995 ) ( los alamos e - print archive hep - ph/9409349 ) . s. chapman , j.r . nix , and u. heinz , los alamos e - print archive nucl - th/9505032 , phys . c , in press . yu . sinyukov , in hot hadronic matter : theory and experiment " , p. 309 , edited by j. letessier et al . ( plenum , new york , 1995 ) . s.v . akkelin and y.m . sinyukov , bogolyubov institute for theoretical physics , preprint itp-63 - 94e , phys . b , in press . g.i . kopylov and m.i . podgoretskii , sov . * 14 * , 604 ( 1972 ) . s. pratt , phys . rev . d*33 * , 1314 ( 1986 ) . a.n . makhlin and yu.m . sinyukov , z. phys . c*39 * , 69 ( 1988 ) . s. pratt , t. csrg , and j. zimnyi , phys . c*42 * , 2646 ( 1990 ) . g. bertsch , nucl . a*498 * , 173 ( 1989 ) . m. herrmann and g.f . bertsch , phys . c*51 * , 328 ( 1995 ) . m. gyulassy , s.k . kauffmann , and l.w . wilson , phys . c*20 * , 2267 ( 1979 ) . e. shuryak , phys . b*44 * , 387 ( 1973 ) ; sov . . phys . * 18 * , 667 ( 1974 ) . s. pratt , phys . 53 * , 1219 ( 1984 ) ; and phys . rev . d*33 * , 72 ( 1986 ) . s. chapman and u. heinz , phys . b*340 * , 250 ( 1994 ) . na35 coll . , t. alber et al . , talk given at the conference , quark matter 95 " , nucl . a , in press . the model - independent expressions ( [ 4 ] ) were found independently by m. herrmann and g.f . bertsch @xcite ( without the @xmath83 cross term ) and by s. chapman _ a 1-dimensional analogue was given earlier in g. bertsch , p. danielewicz , and m. herrmann , phys . c*49 * , 442 ( 1994 ) . m. abramowitz and i.a . stegun , _ handbook of mathematical functions _ ( dover publ . , new york , 1965 ) . d. ferenc , nucl . phys . a * 544 * ( 1992 ) , 531c . na35 coll . , t. alber et al . , z.phys . * c66 * , 77 ( 1995 ) ; t. alber et al . lett . * 74 * , 1303 ( 1995 ) . na44 coll . , h. beker et al . lett . * 74 * , 3340 ( 1995 ) . t. csrg and s. pratt , in : proc . of the workshop on relativistic heavy ion physics , budapest , 1991 , kfki-1991 - 28/a , p.75 . e. schnedermann and u. heinz , phys . lett . * 69 * , 2908 ( 1992 ) ; e. schnedermann , j. sollfrank , and u. heinz , phys . c*48 * , 2462 ( 1993 ) ; e. schnedermann and u. heinz , phys . c*50 * , 1675 ( 1994 ) . schlei , u. ornik , m. plmer and r. m. weiner , phys . lett . * b293 * , 275 ( 1992 ) ; j. bolz , u. ornik , m. plmer , b.r . schlei and r. m. weiner , phys . lett . * b300 * , 404 ( 1993 ) ; and phys . rev . d*47 * , 3860 ( 1993 ) . u. ornik , f. pottag , and r.m . weiner , phys . lett . * 63 * , 2641 ( 1989 ) ; u. ornik and r.m . weiner , phys . b*263 * , 503 ( 1991 ) . u. mayer , ph.d . thesis , universitt regensburg , 1995 . nu xu , private communication .

the transverse momentum dependence of hanbury - brown / twiss ( hbt ) interferometry radii for 2-body correlation functions provides experimental access to the collective dynamics in heavy - ion collisions . we present an analytical approximation scheme for these hbt radii which combines the recently derived model - independent expressions with an approximate determination of the saddle point of the emission function . the method is illustrated for a longitudinally boost - invariant hydrodynamical model of a heavy ion collision with freeze - out on a sharp hypersurface . the analytical approximation converges rapidly to the width of the numerically computed correlation function and reproduces correctly its exact transverse momentum dependence . however , higher order corrections within our approximation scheme are essential , and the previously published lowest order results with simple @xmath0 scaling behaviour are quantitatively and qualitatively unreliable . -1 cm