article_id
stringlengths 6
9
| article_text
stringlengths 5
1.27M
| document_type
stringclasses 4
values | domain
stringclasses 3
values | language
stringclasses 28
values | language_score
float64 0
1
|
|---|---|---|---|---|---|
0003082 | The functioning of the nervous system depends upon an immensely complex and precise network of neurons. Cell adhesion is thought to play a critical role in the formation and maintenance of synaptic contacts between neurons . Among different classes of molecules involved in cell adhesion, there is evidence that heparan sulfate proteoglycans (HSPGs) are present in central synapses and neuromuscular junctions . Furthermore, HSPGs are suggested to play a role in regulating synaptic strength, thereby acting as key molecules for synaptic stabilization that underlie neural plasticity . Based on these premises, we previously examined the expression of HSPGs in cultured rat hippocampal neurons. We demonstrated that syndecan-2, a member of the syndecan family of HSPGs, is concentrated in dendritic spines. Dendritic spines are numerous small membrane appendages protruding from dendritic surfaces that consist of specialized postsynaptic structures for the vast majority of excitatory synapses . Moreover, we showed that forced expression of syndecan-2 cDNA in young (1 wk in vitro) hippocampal neurons induces the formation of morphologically mature dendritic spines, which are normally seen after 3 wk in vitro . Syndecans are a major class of membrane-spanning HSPGs . There is increasing evidence that syndecans play significant roles in the organization of specific cell-surface structures, such as focal adhesions, through their interactions with cytoskeletal and signaling molecules , and thereby provide an important linkage between extracellular event and intracellular signaling. The cytoplasmic domains of syndecans have structural features that strongly suggest their involvement in intracellular signaling and cytoskeletal interactions. These domains consist of a 13-residue juxtamembrane segment highly conserved among the members (C1 region), a variable segment, and another highly conserved 7–9-residue segment (C2 region) at the COOH terminus of the molecule . Most importantly, the Glu-Phe-Tyr-Ala (EFYA) sequence located at the COOH terminus is identical in all syndecans. Moreover, our previous studies have shown that a syndecan-2 mutant in which the EFYA sequence was deleted lacks the ability to induce the formation of dendritic spines, suggesting that the molecular interactions involving this motif are crucial for this phenomenon . It has been shown that syndecans interact with two PDZ domain–containing proteins, syntenin and CASK/LIN2A , through the EFYA motif. We previously proposed a model in which these PDZ domain–containing molecules are potential downstream effectors of syndecan-2 in dendritic spines . In this model, we suggested that the spine formation is mediated by the cytoskeletal reorganization initiated by the syndecan-2–dependent clustering of PDZ domain proteins. In this paper, we report a novel syndecan-binding protein, synbindin. Unexpectedly, the structural property and the localization of synbindin suggest an entirely different mechanism for syndecan-2–induced spine formation. Synbindin is a neuronal cytoplasmic protein identified by yeast two-hybrid screening using the syndecan-2 cytoplasmic domain as a bait. Although it bears homologies with several PDZ domain proteins and binds to the COOH-terminal EFYA tail of syndecan-2 (as do CASK and syntenin), synbindin does not contain any classical PDZ domains. Rather, synbindin shares homologies with yeast proteins involved in membrane trafficking and vesicle transport acting upstream of the soluble NSF attachment protein receptor (SNARE) complex. There is increasing evidence that functional postsynaptic maturation involves the regulation of vesicle trafficking in postsynaptic sites . Dendritic spines contain intracellular membrane-bound cisterns, known as spine apparatus , which are frequently seen in the vicinity of the postsynaptic density . Synbindin is identified in vesicles in dendritic spines as well as in synapses. Furthermore, synbindin forms clusters in dendritic spines when syndecan-2 is coexpressed in neurons. Our observations suggest a role for cell-surface syndecan-2 in the translocation of postsynaptic vesicular compartments through the cytoplasmic interaction with this novel syndecan-2–binding molecule. Yeast two-hybrid screens were performed using the L40 yeast strain, where the expression of both the reporter genes HIS3 and LacZ are driven by minimal GAL1 promoters fused to LexA-binding sites. A bait consisting of the entire cytoplasmic domain of the syndecan-2 fused in-frame to the LexA DNA–binding domain was constructed by PCR with the BTM116 vector. An embryonic mouse cDNA library constructed into the NotI site of pVP16 containing the Leu2 activation domain was screened with the syndecan-2 bait. Positive clones were selected by His prototrophy and assayed for β-galactosidase activity. Double-positive clones were isolated and characterized by sequencing. A double-positive clone (clone 28), which encodes a putative cytoplasmic protein with similarities to several PDZ domain–containing proteins (see Results), was further investigated as described in this paper. We named this protein synbindin. The specificity of the interaction between synbindin and the cytoplasmic domain of syndecan-2 was analyzed by two-hybrid assays . For this, we generated (by PCR) the following additional baits of the syndecan cytoplasmic domains: (1) a syndecan-2 deletion mutant lacking the COOH-terminal EFYA sequence (syndecan-2ΔEFYA); (2) a syndecan-4 deletion mutant lacking the COOH-terminal EFYA sequence (syndecan-4ΔEFYA); and (3) a bait with reverse sequence of syndecan-2 cytoplasmic domain. To determine the syndecan-2–binding site in synbindin, we generated by PCR four Leu2 fusion constructs representing the NH 2 -terminal half of synbindin (N-Sbd), the PDZ-related domain (P-Sbd), the COOH-terminal half (C-Sbd), and the PDZ-related domain plus the COOH-terminal half (P/C-Sbd) . Two-hybrid assays were performed as described above using HIS3 and LacZ as reporter genes. The full-length synbindin cDNA was isolated from a mouse brain λZAP cDNA library (Stratagene) with clone 28 as a probe. Four cDNA clones were isolated. One of the isolated clones contained an entire open reading frame encoding 219 amino acid residues. Full-length sequence of mouse synbindin cDNA was determined from this clone. Human and Caenorhabditis elegans synbindin homologues were identified in EST database by a BLAST search, and their entire sequences were reconstituted from overlapping EST clones. A 663-bp EcoRI-XhoI fragment containing the entire coding region of mouse synbindin was amplified by PCR with the following primers and ligated into pGEX-4T-1 (Amersham Pharmacia Biotech): 5′ primer, ACCCGGAATTCATGGCGATTTTTACCGTGTAC; and 3′ primer, CGGCCGCTCGAGCTATGACCCAGGTCCAAAAGT. The GST-synbindin expression plasmid as well as insertless pGEX-4T-1 were transfected into BL21 Escherichia coli strains according to the manufacturer's instructions. BL21 cells were lysed by sonication in 20 mM Tris-HCl containing 0.15 M NaCl, 1 mM EDTA, 1 mM PMSF, 10 μg/ml pepstatin, 10 μg/ml aprotinin, and 2 μg/ml leupeptin. Sarkosyl was added to lysates to a final concentration of 1.5%, and the lysates were gently mixed for 15 min. After centrifugation, supernatants were adjusted to 2% Triton X-100 and 1 mM CaCl 2 , and GST-synbindin was purified with glutathione-agarose. Two polyclonal antibodies against mouse synbindin were generated for this study. Rabbit anti-synbindin peptide antibody was raised against a synthetic peptide acetyl-CELFDQNLKLALELAEKV-amide (corresponding to amino acids 195–213 of mouse synbindin) and affinity-purified on amino-link/agarose beads coupled with the synthetic peptide (Quality Controlled Biochemicals). The other polyclonal antibody (No. 157) was raised against the bacterially produced recombinant synbindin protein released from GST-synbindin fusion protein by proteolytic cleavage and affinity-purified using synbindin-GST fusion protein coupled to glutathione-agarose. Other antibodies used in this study were as follows: anti–c-Myc rabbit polyclonal antibody A14 (Santa Cruz Biotechnology, Inc.); anti–syndecan-2 mAb 6G12 ; anti–syndecan-2 polyclonal antibody ; anti–PSD-95 mAb 6G6 (Affinity Bioreagents, Inc.); antisynaptophysin and anti-MAP2 mAbs (Sigma Chemical Co.); and anti-CASK polyclonal antibody . Human 293 cells were grown in DME supplemented with 10% FCS and antibiotics. Approximately 70% confluent 293 cells in 10-cm dishes were transfected with 20 μg of an expression vector for Myc-tagged full-length syndecan-2 or a control vector using the calcium phosphate method . 1 d after transfection, transfected cells were treated with or without heparitinase (Seikagaku America), and then sonicated in 25 mM Tris-HCl, pH 8.0, containing 0.15 M NaCl, 1% Triton X-100, 5 mM EDTA, 1 mM PMSF, 5 mM DTT, 10 μg/ml pepstatin, 10 μg/ml aprotinin, and 2 μg/ml leupeptin (lysis buffer). Heparitinase treatment was performed in 20 mM Hepes, pH 7.0, containing 0.15 M NaCl and 1 mM calcium acetate for 1 h at 37°C. After sonication, cell lysates were cleared by centrifugation at 14,000 rpm in a microcentrifuge. For pull-down assays, cleared lysates were incubated with glutathione-agarose beads charged with unfused GST or GST-synbindin fusion protein for 1 h at 4°C. After incubation, beads were washed once with lysis buffer and five times with 25 mM Tris-HCl, pH 7.4, containing 0.5 M NaCl and 0.2% Triton X-100 at room temperature. The materials retained on the beads were eluted with SDS-PAGE sample buffer and detected by SDS-PAGE and immunoblotting as described previously . The Myc-tagged syndecan-2 pulled down by GST-synbindin was detected with either anti–syndecan-2 mAb (clone 6G12; a gift from Dr. Guido David; 1:1,000 dilution) or anti-Myc polyclonal antibody (A14; Santa Cruz Biotechnology; 1:1,000 dilution). For coimmunoprecipitation assays, we generated intact and ΔEFYA syndecan-2 cDNAs that are epitope-tagged with the FLAG sequence (designated as FLAG-syndecan-2 and FLAG-syndecan-2ΔEFYA, respectively). A FLAG tag (DYKDDDDK) was inserted at the unique SpeI site in the ectodomain of syndecan-2. These FLAG-tagged syndecan-2 constructs were transfected into 293 cells with or without cotransfection of a synbindin expression construct in which the c-Myc epitope was added to the NH 2 terminus of synbindin (Myc-synbindin). Cell lysates from these transfectants were prepared as described above without heparitinase treatment. The lysates were incubated with the A14 anti-Myc polyclonal antibody for 2 h at 4°C, followed by an incubation with protein A–Sepharose for 1 h. Bound materials were eluted with SDS-PAGE sample buffer, separated on an 8–16% gel, and immunoblotted with the M2 anti-FLAG mAb (Sigma Chemical Co.; 1:1,000 dilution) to detect coprecipitated FLAG-tagged syndecan-2. For preparation of His-tagged syndecan-2 cytoplasmic domains, a DNA fragment encoding the entire syndecan-2 cytoplasmic domain was amplified by PCR and inserted into EcoRI-XhoI–linearized pET-30a (Novagen). The construct for His-tagged ΔEFYA syndecan-2 cytoplasmic domain was then generated by point mutagenesis of the AAG codon for the lysine residue preceding the EFYA sequence to a stop codon (TAG). These His-tagged cytoplasmic domains (intact and ΔEFYA) were expressed in BL21 (DE3) cells and purified on ProBond resin (Invitrogen). For overlay assays, equal amounts of the intact and ΔEFYA cytoplasmic domains were loaded on a 10–20% tricine gel and blotted onto a nitrocellulose membrane. The membrane was stained with Ponceau S to ascertain that equivalent amounts of the intact and ΔEFYA cytoplasmic domains were applied. The membrane was blocked with 5% nonfat dry milk in 25 mM Tris-HCl, pH 7.4, containing 0.15 M NaCl and 0.3% Tween 20 (TBS-Tween) overnight at 4°C, and incubated with 50 μg/ml of purified GST-synbindin in TBS-Tween containing 1 mM DTT and 2% BSA for 2 h at room temperature. Bound GST-synbindin was detected with goat anti-GST antibody (Amersham Pharmacia Biotech; 1:3,000 dilution) and HRP-conjugated anti-goat IgG (Sigma Chemical Co.; 1:5,000 dilution). Cultures of rat hippocampal neurons were prepared as described previously from E17 embryos . Transient transfection of hippocampal neurons was performed at 1 d in vitro by the calcium phosphate coprecipitation method . For the analysis of coclustering of syndecan-2 and synbindin, hippocampal neurons were transfected with an expression vector containing synbindin-green fluorescent protein (GFP) fusion protein alone, or together with either the full-length syndecan-2 expression vector or the syndecan-2ΔEFYA expression vector . Cotransfection of the synbindin-GFP and the syndecan-2/syndecan-2ΔEFYA expression vectors were performed at the ratio of 1:10 . We confirmed that, under this condition, essentially every GFP-positive cell coexpresses syndecan-2/syndecan-2ΔEFYA as demonstrated by immunostaining for syndecan-2. The frequency of synbindin clustering in these cotransfected cultures was determined as the percentage of cells that show >10 synbindin clusters in their dendrites to the total GFP-positive cells. A total of 40 neurons were scored in four sampling windows for each culture. Hippocampal neurons transfected with synbindin-GFP alone or together with syndecan-2 were examined 8 d after transfection (9 DIV) by a confocal microscopy as previously described . Synbindin localization was identified by GFP fluorescence. Transfected neurons were also immunostained with either anti–synapsin I polyclonal antibody (1:100 dilution; a gift from Dr. Andrew Czernik), anti–syndecan-2 polyclonal antibody (1:100 dilution; a gift from Dr. Merton Bernfield) or anti-MAP2 mAb (1:100 dilution; Sigma Chemical Co.). Rhodamine-conjugated anti-rabbit IgG (1:100 dilution; Chemicon International) or rhodamine-conjugated anti-mouse IgG (1: 50 dilution; Cappel Laboratories) were used as secondary antibodies. To localize endogenous synbindin, hippocampal neurons at 1, 2, 3, and 4 wk in vitro were double-immunostained with affinity-purified antisynbindin polyclonal antibody (No. 157; 1:100 dilution) and antisynaptophysin mAb (1:100 dilution; Sigma Chemical Co.) or antisynbindin polyclonal antibody and anti-MAP2 mAb (1:100 dilution; Sigma Chemical Co.). FITC-conjugated anti-rabbit IgG (1:100 dilution; Chemicon International) and rhodamine-conjugated anti-mouse IgG (1:50 dilution; Cappel Laboratories) were used as secondary antibodies. After staining, cells were mounted with fluorescence H-1000 medium (Vector Laboratories) and analyzed on a confocal laser scanning microscope . Total RNA was extracted from cultures of rat hippocampal neurons at different time points by using Trizol reagents (Life Technologies, Inc.). RT-PCR was performed with 2 μg of the total RNA with the following primer pair: 5′ primer, GAGGCTGAGAAGACTTTCAG; 3′ primer, AACATCGAGGCCAGCATAAG (corresponding to nucleotide numbers 291–311 and 537–557 of mouse synbindin, respectively). PCR products were analyzed on an agarose gel. The identity of amplified bands as synbindin was confirmed by sequencing. For Northern analysis, a mouse multiple tissue Northern blot (CLONTECH Laboratories, Inc.) was hybridized with a 32 P-labeled RNA probe of mouse synbindin, which was synthesized with T3 RNA polymerase (Promega) using pBluescript II SK+ containing mouse synbindin cDNA as a template. Hybridization was performed according to the manufacturer's instructions. Adult C57BL/6 mice were anesthetized and perfused transcardially with 4% paraformaldehyde in PBS. Whole brains were dissected, immersed in 30% sucrose in PBS overnight at 4°C, and embedded in OCT compound (Miles). Cryostat sections (20-μm thick) were hybridized with digoxigenin-labeled RNA probes as described previously . Antisense and sense RNA probes for mouse synbindin and syndecan-2 were in vitro transcribed from pBluescript II SK+ containing full-length synbindin or syndecan-2 cDNA using either T3 or T7 RNA polymerase (Promega) and the digoxigenin RNA labeling kit (Boehringer Mannheim). Subcellular fractions of adult mouse cortex or hippocampus were prepared as described by Li et al. 1996 and Torres et al. 1998 . In brief, adult mouse cortex was homogenized in 4 mM Hepes, pH 7.4, containing 0.32 M sucrose, 1 mM PMSF, 10 μg/ml pepstatin, 10 μg/ml aprotinin, and 2 μg/ml leupeptin with a Teflon head tissue grinder. Homogenates were centrifuged at 1,000 g for 10 min. The supernatant was collected and centrifuged at 12,000 g for 15 min, yielding a pellet (P2) and supernatant (S2). Supernatant (S2) was further centrifuged at 100,000 g for 90 min. The resulting supernatant represents the soluble fraction. The P2 pellet was resuspended in homogenization buffer and represented crude synaptosomes fraction. The crude synaptosome fraction was lysed by osmotic shock by adding 10 vol of ice-cold water containing protease inhibitors and homogenized. The synaptic membrane fraction was pelletted from this homogenate by centrifugation at 33,000 g for 20 min, and the supernatant contained synaptic vesicles. Equal amounts of proteins (50 μg per lane) from each fraction were resolved by SDS-PAGE on an 8–16% gradient gel, transferred to a nitrocellulose membrane, and analyzed by immunoblotting. The subcellular fractions were examined by immunoblotting with anti–PSD-95 (a marker for postsynaptic density), antisynaptophysin (a marker for synaptic vesicles), and anti-CASK antibodies. To identify subcellular localization of synbindin, the subcellular fractions were probed with antisynbindin peptide antibody at 1:500 dilution. As a control for specificity of antisynbindin antibody, blots were reprobed with preimmune serum. For coimmunoprecipitation of synbindin and syndecan-2 from the brain, the synaptic membrane fraction was solubilized with 1% CHAPS in TBS containing a protease inhibitor cocktail (Sigma Chemical Co.). After removing insoluble materials by centrifugation, supernatants were incubated with protein G–Sepharose charged with anti–syndecan-2 mAb (6G12) or uncharged protein G–Sepharose at 4°C for 2 h. Bound materials were eluted with SDS-PAGE sample buffer, separated on a 8–16% gel, and immunoblotted with antisynbindin polyclonal antibody (No. 157). Immunohistochemistry of synbindin was performed with free-floating sections. In brief, adult mice were perfused transcardially with ice-cold 0.9% saline followed by fixation in 4% paraformaldehyde. Free-floating Vibratome sections (50–100-mm thick) of the whole brain were first washed in 0.1 M Tris-HCl, pH 7.6, incubated with 1% hydrogen peroxide for 30 min, and washed again with 50 mM Tris-HCl, pH 7.6, containing 0.15 M NaCl (TBS). Sections were blocked for 30 min with TBS containing 0.1% Triton X-100, 3% normal goat serum and 0.1% BSA (blocking buffer), and then with the avidin-biotin blocking kit (Vector Laboratories). Blocked sections were incubated with affinity-purified antisynbindin antibody (No. 157), which was diluted in the blocking buffer at 2 μg/ml at room temperature overnight. After washing with TBS containing 0.1% Triton X-100 (TBS-T), sections were incubated with biotinylated goat anti–rabbit antibody (Vector Laboratories) at a dilution of 1:200 for 2 h, washed with TBS-T, and incubated with avidin-biotin HRP complex (Vectastain Elite; Vector Laboratories) for 2 h at room temperature. After washing with TBS-T and with 50 mM Tris-HCl, pH 7.6, sections were reacted with 0.05% diaminobenzidine and 0.001% hydrogen peroxide in TBS. For electron microscopy, adult mice were perfused through the aorta with ice-cold 0.9% NaCl and then with 4% glutaraldehyde and 0.1% paraformaldehyde in 0.1 M phosphate buffer, pH 7.4. The brain was dissected and postfixed in the same fixative for 1 h at room temperature, and coronal sections (100 μm) of the cerebral cortex were cut by Vibratome. Preembedding immunostaining was performed as follows: the sections were cut into small pieces and incubated in PBS containing 50 mM glycine for 5 min, washed three times with PBS, and blocked with PBS containing 20% normal goat serum and 0.05% Triton X-100 for 1 h. Blocked sections were incubated with affinity-purified antisynbindin antibody (No. 157) or normal rabbit IgG (as a negative control) diluted in PBS containing 3% normal goat serum, 0.05% Triton X-100 (PBS-T) overnight. The next day, sections were washed three times with PBS-T and incubated with anti-rabbit nanogold conjugates (1.4 nm; Nanoprobes Inc.) at a dilution of 1:100 in PBS-T for 90 min at room temperature. After four washes with PBS-T, the sections were further washed four times with deionized water and treated for 7 min with gold enhancer-EM formulation (Nanoprobes Inc.) to enhance immunoreactive signals. The sections were postfixed in 1% osmium in PBS for 30 min, washed with PBS, dehydrated through graded ethanol solutions, and infiltrated with propylene oxide to Epon resin (Ted Pella). The sections were sandwiched between strips of ACLAR plastic film (Ted Pella), flattened between glass sheets, and polymerized in Epon Araldite at 60°C for 24 h. Epon-embedded samples were glued onto resin blocks, and ultrathin sections were cut and collected on 200-mesh collodion-coated copper grids (Electron Microscopy Sciences). The grids were poststained with uranyl acetate and lead citrate, and examined on a Hitachi 600E transmission electron microscope. The distribution of gold particles was analyzed by counting particles using NIH Image software as described in Srivastava et al. 1998 . To identify novel syndecan-2–binding proteins, we performed a yeast two-hybrid screen using the syndecan-2 cytoplasmic domain as bait. Screening of a mouse embryo library resulted in isolation of positive colonies selected by HIS prototrophy and β-galactosidase activity. One of the isolates (clone 28) showed a strictly specific interaction pattern with a series of control baits. The specificity of the interaction between clone 28 and the syndecan cytoplasmic domain was studied further by two-hybrid assays . This study demonstrated that clone 28 recognizes the COOH-terminal EFYA sequence of syndecans. As shown in Fig. 1 , clone 28 binds not only the syndecan-2 domain, but also the syndecan-4 cytoplasmic domain, suggesting that it recognizes a region conserved in both syndecans. Because syndecan-2 and syndecan-4 share the COOH-terminal EFYA motif, we deleted this motif from baits (designated as syndecan-2ΔEFYA and syndecan-4ΔEFYA, respectively). Both syndecan-2ΔEFYA and syndecan-4ΔEFYA mutants failed to bind clone 28 . These results indicate that it binds to the COOH terminus of syndecans, as do syntenin and CASK. A full-length cDNA for this gene was isolated from a mouse brain library. The entire open reading frame encodes a protein consisting of 219 amino acid residues with a predicted molecular mass of ∼24 kD . The clones isolated by two-hybrid screening corresponded to amino acid residues 18–182 of this protein. No signal sequence or transmembrane domain was identified in the protein. We named this protein synbindin. Synbindin has 48% amino acid identity with the C . elegans F36D4.2 gene and 29% identity with a 23-kD yeast protein, tentatively called p23 . These C. elegans and yeast proteins are likely to be orthologues to mouse synbindin, suggesting that synbindin is highly conserved across species. While no functional data are available for the C. elegans gene, the yeast p23 is a component of a multiprotein complex (transport protein particle [TRAPP]) involved in vesicle docking and fusion . This suggests that synbindin may be involved in vesicular transport in mammalian cells. A homology search further identified three segments of substantial homology with proteins known to be involved in vesicular transport as well as synaptic functions . First, an ∼60-amino acid residue segment in the NH 2 -terminal part of synbindin bears homologies with several PDZ domains. Weak but significant homologies (20–30% identity; 40–50% similarity) were identified with the following: the sixth PDZ domain of glutamate receptor–interacting protein (GRIP) 1 and GRIP2 ; the seventh PDZ domain of the 5-HT 2C receptor–binding protein MUPP1 ; the fourth PDZ domain of human INAD-like protein ; and the second PDZ domains of Mint-1, -2, and -3 . All of these proteins have been implicated in synaptic functions. The homology with these PDZ domains does not encompass the entire PDZ domain, but is restricted to the COOH-terminal part of the domain. Therefore, this segment of synbindin does not constitute a classical PDZ domain. Second, a 76-amino acid residue segment in the middle of the molecule shows a strong similarity with the yeast gene BET5 . BET5 is a gene involved in vesicle transport in yeast. A null mutation of BET5 blocks ER-to-Golgi transport . Moreover, like p23, the protein product of BET5 (Bet5p) is a component of the yeast TRAPP complex . Considering the phylogenetic distance between mouse and yeast, the homology between synbindin and BET5 in this segment is quite high (30% identity; 50% similarity). These observations further supports the notion that synbindin is involved in vesicular transport. Finally, the 35 residue COOH-terminal segment shows 45% identity (52% similarity) to a short cytoplasmic segment of the cardiac muscle ryanodine receptor (RyR-2), which is a calcium release channel on the membrane of intracellular Ca 2+ stores . Taken together, synbindin consists of four regions: the NH 2 -terminal region, which has no significant homology with any known proteins; a PDZ-related region; a BET5-related region; and a COOH-terminal tail similar to a short segment of RyR-2 To further assess the specificity of the synbindin–syndecan-2 interaction, we performed pull-down and coimmunoprecipitation assays. For pull-down assays, glutathione-agarose beads charged with synbindin-GST fusion protein or nonfused GST were incubated with lysates of 293 cells expressing Myc-tagged syndecan-2. Bound materials were probed by immunoblotting with anti–syndecan-2 mAb or anti-Myc polyclonal antibody . As shown in Fig. 2 , GST-synbindin brought down syndecan-2 from the cell lysates . No syndecan-2 was brought down with nonfused GST or from control transfected 293 cells . To examine coimmunoprecipitation of synbindin and syndecan-2, 293 cells were cotransfected with FLAG-tagged syndecan-2 (either FLAG-syndecan-2 or FLAG-syndecan-2ΔEFYA) and Myc-tagged synbindin. The FLAG-syndecan-2 was precipitated from the lysate of cotransfected cells with anti-Myc antibody . No coimmunoprecipitation was observed when synbindin was not introduced into cells . The syndecan-2ΔEFYA mutant was not coprecipitated with synbindin . Direct binding between synbindin and the syndecan-2 cytoplasmic domain was examined using purified His-tagged syndecan-2 cytoplasmic domains and GST-synbindin. GST-synbindin bound to His-tagged syndecan-2 cytoplasmic domain in the overlay assay . Consistent with pull-down and coimmunoprecipitation assays, the ΔEFYA cytoplasmic domain failed to bind GST-synbindin. Finally, we analyzed the region of synbindin that interacts with syndecan-2 by using two-hybrid assays. The full-length synbindin and four truncated forms were tested with baits of the intact and ΔEFYA syndecan-2 cytoplasmic domains . The three fragments containing the PDZ-like segment showed a strong interaction with the intact syndecan-2 cytoplasmic domain. The strongest of the three was the P-Sbd fragment, which consists only of the PDZ-like segment followed by the N-Sbd and P/C synbindin fragments. The fragment without the PDZ-like segment (C-Sbd) did not display a signal above background. The ΔEFYA bait did not interact with any fragments. Taken together, these binding studies establish that synbindin directly interacts with syndecan-2 through the EFYA tail of syndecan-2, and that the PDZ-like segment of synbindin is involved primarily in the interaction with syndecan-2. To examine further the physiological significance of the synbindin–syndecan-2 interaction in neurons, we tested whether these two proteins interact in the cytoplasmic environment of cultured hippocampal neurons. For this, hippocampal neurons at 1 DIV were transfected with synbindin-GFP fusion protein alone or together with syndecan-2. The localization of synbindin and syndecan-2 was examined at 8 DIV by GFP signals and immunofluorescence with anti–syndecan-2 antibody, respectively. At this stage in culture, endogenous syndecan-2 is not yet expressed by hippocampal neurons. Therefore, the syndecan-2 immunoreactivities detected in these experiments represent transfected syndecan-2 . We found that the distribution of synbindin changes dependent on cotransfection of syndecan-2. In neurons transfected with synbindin-GFP alone, synbindin was distributed diffusely in cytoplasm . In contrast, when neurons were transfected with synbindin-GFP together with intact syndecan-2, synbindin formed clusters along dendrites . Immunostaining of these double-transfected neurons with anti–syndecan-2 antibody demonstrated colocalization of synbindin and syndecan-2 . These results demonstrate that not only does synbindin colocalize with syndecan-2 in transfected hippocampal neurons, but also that syndecan-2 induces synbindin clustering in dendrites. To determine the localization of the synbindin clusters, we performed a series of double labeling experiments. These experiments demonstrated that the synbindin clusters observed in synbindin/syndecan-2 double-transfected neurons are localized in dendritic spines. As shown in Fig. 3 , double staining with anti-MAP2 antibody demonstrated that the clusters of synbindin-GFP are localized in small protrusions along dendrites . Double staining with the anti–synapsin I antibody revealed that synbindin clusters exhibit partial overlap with synapsin I immunoreactivities , a pattern typically seen for postsynaptic proteins . To examine if this clustering of synbindin is mediated by the interaction with the EFYA tail of syndecan-2, as demonstrated by biochemical binding studies, the same double transfection experiments were performed with the syndecan-2ΔEFYA deletion mutant. As shown in Fig. 4 , synbindin failed to cluster in neurons double-transfected with synbindin-GFP and the syndecan-2ΔEFYA mutant . In the syndecan-2/synbindin-GFP–cotransfected cultures, the majority (83 ± 7%) of GFP-positive neurons showed extensive clustering (>10 clusters per cell) of synbindin-GFP, whereas no cells (0%) were found to contain >3 GFP clusters in the syndecan-2ΔEFYA/synbindin-GFP–cotransfected cultures. We previously demonstrated that the syndecan-2ΔEFYA mutant is expressed and forms clusters in the same manner as the intact syndecan-2 in hippocampal neurons . Therefore, the lack of synbindin clustering in syndecan-2ΔEFYA/synbindin-GFP–cotransfected neurons is not due to the aberrant expression of the syndecan-2ΔEFYA mutant. Taken together, these transfection experiments provide further evidence for the synbindin–syndecan-2 interaction through the EFYA tail of syndecan-2, and suggest that syndecan-2 induces the clustering of synbindin in dendrites. Northern blotting revealed a 4.4-kb transcript of synbindin that is widely expressed in adult mouse tissues . Such an expression pattern is similar to those of syntenin and CASK . RT-PCR and in situ hybridization studies demonstrated that synbindin is strongly expressed in neurons. RT-PCR analysis demonstrated that synbindin mRNA is expressed in cultured hippocampal neurons at 14 and 30 DIV , as was previously shown for syndecan-2 . In situ hybridization in the adult mouse central nervous system (CNS) showed that synbindin is expressed predominantly in large neurons. In the cerebrum, strong synbindin expression was observed in pyramidal neurons in the CA1-CA3 regions of hippocampus , pyramidal neurons in the cortex , and large neurons in the caudate putamen . In the cerebellum, Purkinje cells and neurons in the deep cerebellar nuclei exhibited strong synbindin expression . Motor neurons in the spinal cord also showed strong synbindin expression . In contrast, synbindin expression in smaller, granule-type neurons was much weaker or undetectable, including granule neurons in the dentate gyrus and those in the granular layer of the cerebellar cortex . Throughout the CNS, no synbindin expression was detected in glial cell types. Taken together, these observations suggest that, in the nervous system, synbindin is expressed predominantly by large, pyramidal-type neurons, which tend to have highly developed dendritic arbors. We compared spatial expression patterns of synbindin and syndecan-2 by in situ hybridization in serial sections. This analysis revealed that these two molecules exhibit almost identical expression patterns in the adult mouse brain. In the hippocampus, syndecan-2 mRNA was detected in pyramidal cells, whereas granule cells of the dentate gyrus exhibited much weaker signals . In the cerebellum, Purkinje cells express syndecan-2, but little syndecan-2 expression was observed in granule neurons . This spatial expression pattern is very similar to that of synbindin . To investigate the localization of endogenous synbindin in vivo, we generated polyclonal antisera to synbindin. Antibodies affinity-purified from this antiserum reacted with a 24-kD band in adult mouse brain extracts , which comigrate with synbindin released from GST-synbindin (lane 2). In tissue sections, synbindin immunoreactivities were observed in various neurons in the adult mouse brain. Strong immunoreactivities were found in pyramidal neurons of the cerebral cortex , pyramidal neurons of the hippocampus , Purkinje cells of the cerebellum , and neurons of the deep cerebellar nucleus . In general, this result is consistent with the expression pattern of synbindin mRNA demonstrated by in situ hybridization . Synbindin immunoreactivities were mainly associated with the soma and the apical dendrites of these neurons. In the hippocampus, strong immunoreactivities were observed in the stratum lucidum where the dendrites of CA3 pyramidal neurons are present . In the cerebellum, the cell bodies and apical dendrites of Purkinje neurons were intensely labeled . We have shown previously that endogenous syndecan-2 is concentrated in dendritic spines of cultured hippocampal neurons after 2 wk in vitro . Immunocytochemistry revealed that synbindin exhibits a similar temporal expression pattern in dendritic spines . At 7 DIV, synbindin immunoreactivity was detected diffusely in the cytoplasm of the soma . No punctate immunoreactivity was detected at this stage. At 14 DIV, punctate immunoreactivity became apparent along the dendrites . The intensity of the punctate staining grew stronger at 21 and 28 DIV . This time course is similar to that of syndecan-2 expression in dendritic spines and that of the spine morphogenesis in this culture system . Double immunostaining of 30 DIV hippocampal neurons confirmed the presence of endogenous synbindin in dendritic spines . Synbindin immunoreactivities correspond to small protrusions along MAP2-positive dendritic shafts . Double staining with antisynbindin and antisynaptophysin antibodies showed a partial overlapping pattern , as observed in transfected neurons . At high magnification , synbindin puncta (green) are in close apposition with synaptophysin puncta (red) but do not completely overlap, which is a typical distribution pattern for postsynaptic proteins. Taken together, these results demonstrate that endogenous synbindin molecules in mature neurons exist in dendritic spines, which is consistent with in vitro transfection studies . Unlike syndecan-2, which exhibits essentially no immunoreactivity on dendritic shafts in mature (30 DIV) neurons , synbindin was detected within dendritic shafts and neuronal soma , even at 30 DIV. This is consistent with the immunohistochemical results in which synbindin immunoreactivities were observed along dendrites and in the soma . Considering that synbindin has similarities with proteins involved in membrane trafficking, it is suspected that synbindin may also associate with intracellular membrane compartments within dendrites and cell bodies. To characterize the subcellular localization of synbindin, we prepared subcellular fractions from adult mouse cortex using a differential centrifugation procedure . Two marker proteins, PSD-95 (postsynaptic marker) and synaptophysin (synaptic vesicle marker), were used as controls. Synbindin was fractionated into the crude synaptosome fraction and further enriched in the synaptic membrane fraction . The fractionation pattern of synbindin was similar to that of PSD-95. These results indicate that synbindin is associated with synapses. To obtain in vivo biochemical evidence for the synbindin–syndecan-2 interaction, we examined whether endogenous synbindin and syndecan-2 coprecipitate from brain extracts. As shown in Fig. 9 B, anti–syndecan-2 mAb precipitated synbindin from the CHAPS extracts of the synaptic membrane fraction. Taken together, these results provide further evidence for the synbindin-syndecan-2 interaction in vivo. To determine the precise intracellular localization of synbindin in vivo, we performed immunogold electron microscopy in the adult mouse cerebral cortex. This analysis demonstrated synbindin immunolabeling in two distinct structures in neurons, synapses, and intracellular membrane organelles. Immunogold labeling for synbindin was concentrated at asymmetric synapses . Labeling was seen on both pre- and postsynaptic membranes, but the majority of the labeling was on the postsynaptic side in close association with postsynaptic membranes. Quantitative analysis of the distribution of gold particles confirmed that synbindin is concentrated on the postsynaptic side of synapses . Such a distribution pattern of synbindin is consistent with that of syndecan-2, as determined by immunogold labeling . Immunogold labeling demonstrated that synbindin is also associated with membrane-bound compartments within neurons . Consistent with the light microscopic findings , immunogold labeling for synbindin was observed in the soma and dendritic shafts of cortical neurons. In these sites, labeling was associated predominantly with various cisterns and vesicles. Dense labeling was observed on the Golgi apparatus and unidentified vesicles in the dendritic shaft . Membrane compartments within dendritic spines were also labeled . These observations demonstrate that synbindin is indeed associated with intracellular cisterns and vesicles, supporting the notion that synbindin is involved in vesicular transport and membrane trafficking in dendrites. Thus, these immunoelectron microscopy results indicate that synbindin is localized in two distinct subcellular structures in neurons: (1) synapses (mainly postsynaptic membranes and PSD) and (2) intracellular membrane cisterns. Similar dual localization has been reported for other cytoplasmic proteins implicated in synaptic functions, including GRIP1 and α-actinin-2 . In previous work, we demonstrated that syndecan-2 induces the formation of morphologically mature dendritic spines, and that this effect is mediated by the cytoplasmic interaction through the COOH terminus of syndecan-2 . We report here a novel syndecan-2-binding protein, synbindin. Our results indicate that synbindin is a postsynaptic protein that is likely to be involved in intracellular vesicle transport in dendritic spines. This suggests a possibility that syndecan-2 exerts its effects on spine morphogenesis by recruiting synbindin-positive membrane cisterns toward postsynaptic sites. Synbindin is the third molecule, after syntenin and CASK , that has been shown to bind the COOH terminus of syndecan-2. Both syntenin and CASK contain PDZ domains and bind syndecan-2 through these domains. Synbindin has a segment that shares homologies with PDZ domains, and this segment is primarily involved in binding to syndecan-2. However, this segment does not constitute a classical PDZ domain. It remains to be determined whether the synbindin–syndecan-2 interaction can be explained according to the well-established paradigm of the recognition of protein COOH termini by PDZ domains. Yet, the fact that proteins that bear homology with this segment of synbindin are predominantly PDZ domain proteins suggests that synbindin has some remote structural relationships with this family of proteins. On the other hand, synbindin has clear structural relationships with proteins involved in vesicular transport and membrane trafficking. Synbindin exhibits 43% homology with a yeast protein, tentatively named p23 , which has been identified as a component of multiprotein complex called TRAPP . In yeast cells, the TRAPP complex is thought to mediate the docking and fusion of ER-to-Golgi transport vesicles. Bet5p, which has sequence homology with synbindin , is also a component of the TRAPP complex . These observations suggest that synbindin is involved in membrane trafficking in neurons. Consistent with this possibility, immunoelectron microscopy demonstrated that synbindin is present on membrane-bound cisterns and vesicles within the soma and dendrites of cortical neurons. Thus, it is likely that synbindin is involved in membrane trafficking in neurons. Despite the fact that the synbindin-syndecan-2 interaction may not be explained by the well-established paradigm of the interaction between PDZ domains and protein COOH termini, there is ample evidence for the physiological significance of the interaction. In situ hybridization and immunohistochemistry demonstrated that, in the CNS, synbindin is expressed by certain neuronal populations, most notably large, pyramidal-type neurons. In contrast, synbindin expression is weak in granular-type neurons, such as the neurons of the dentate gyrus and the granular layer of the cerebellum. This pattern of expression is very similar to that of syndecan-2 . In mature hippocampal neurons in culture, synbindin is concentrated in dendritic spines, as previously shown for syndecan-2 . Cotransfection experiments showed that syndecan-2 causes the clustering of synbindin in dendritic spines, and that this syndecan-2–dependent clustering of synbindin occurs through the EFYA tail of syndecan-2. These results indicate that the synbindin–syndecan-2 interaction occurs in the cytoplasmic environment of hippocampal neurons with the same specificity as observed in two-hybrid assays. By immunogold electron microscopy and biochemical fractionation, we demonstrated that synbindin is associated with synaptic membranes, mainly at the postsynaptic side, where the existence of syndecan-2 has been reported previously . Finally, synbindin coimmunoprecipitates with syndecan-2 from the synaptic membrane fractions. These results strongly suggest that synbindin and syndecan-2 interact physiologically in dendritic spines of certain populations of neurons. In the previous study, we showed that the interaction of the syndecan-2 and its cytoplasmic ligands is essential for transfected syndecan-2 to induce spine formation . Furthermore, our work demonstrated that the cytoplasmic syndecan-2 ligands essential for spine formation are recruited by syndecan-2 rather than the cytoplasmic ligands recruit syndecan-2 . The sorting behavior of transfected synbindin in hippocampal neurons is consistent with the following observation: the clustering of synbindin in spines requires syndecan-2 expression . Moreover, the clustering of endogenous synbindin during the course of hippocampal cultures is also consistent with this notion: the clustering of synbindin in spines occurs after 2 wk in vitro, coinciding with the accumulation of syndecan-2 in spines . These results indicate that syndecan-2 recruits cytoplasmic proteins to the membrane sites that later become dendritic spines. Thus, syndecan-2 may act as a mediator of extracellular signals, which specify the site of prospective dendritic spines, though we have not determined if any extracellular ligands are involved in the syndecan-2 action on spine morphogenesis. In this vein, it is interesting to examine whether other intracellular syndecan-2 ligands, namely CASK and syntenin, are also translocated to spines dependent on the expression of syndecan-2. If so, the role of syndecan-2 may be a more general one. Our previous work showed that a molecule that binds to the syndecan-2 EFYA tail plays a crucial role in the process of syndecan-2–induced spine formation as a downstream effector ; however, it is not known which molecule among the three known EFYA ligands (syntenin, CASK, and synbindin) is relevant to this process. Some of these interactions may turn out to be irrelevant to spine formation. On the other hand, it is possible that all three interactions occur in neurons, as they are all expressed in neurons . It is also possible that these molecules play different roles within neurons. Having PDZ domains, CASK and syntenin are likely to be involved in the assembly of the cytoskeletal scaffold. Lacking the classical PDZ domain and other cytoskeletal motifs, synbindin is unlikely to be involved in the assembly of the postsynaptic cytoskeletal scaffold. On the other hand, the homology with the components of the yeast TRAPP complex suggests synbindin is involved in vesicle transport in neurons. There is increasing evidence that membrane trafficking plays an important role in functional maturation of postsynaptic structures. For instance, Lledo et al. 1998 showed that inhibition of membrane trafficking with the botulinum toxin suppresses LTP. In dendritic spines, AMPA receptors are present in association with intracellular vesicles, and upon stimulation of synapses, these AMPA-containing vesicles dock and fuse with the postsynaptic plasma membrane . Membrane fusion in postsynaptic sites is thought to be mediated by N -ethylmaleimide-sensitive fusion protein and SNAREs . Interestingly, there is evidence that the TRAPP complex acts upstream of the SNARE complex assembly. Rossi et al. 1995 showed that the SNARE complex does not form in the yeast BET3 mutant, indicating that BET3 genetically interacts with the SNARE pathway. As discussed above, both BET3 and p23, the putative yeast homologue of synbindin, are components of the TRAPP complex . This suggests that synbindin is involved in membrane trafficking in postsynaptic sites. At present, we do not know whether synbindin acts as a downstream effector in the syndecan-2–induced spine formation. Yet, there are a few possible scenarios that synbindin is involved in the process of spine formation. Dendritic spines contain membrane-bound organelles . These organelles, or spine apparatus, appear throughout the spine and are sometimes seen around the lateral margins of the postsynaptic density . These membrane-bound organelles are thought to play important roles in local synthesis and posttranslational modification of neurotransmitter receptors. Therefore, synbindin clustering induced by syndecan-2 expression may facilitate local synthesis and transport of neurotransmitter receptors. This may, in turn, result in an increase in synaptic efficiency and early maturation of postsynaptic structures. Another possibility, which we currently favor, is that the synbindin–syndecan-2 interaction promotes the recruitment of Ca 2+ -storing membrane compartments toward synapses, and the Ca 2+ mobilization from these compartments induces morphological changes of spines. Membrane cisterns immunoreactive for inositol trisphosphate and/or ryanodine receptors, which identify intracellular Ca 2+ stores, have been shown in dendritic spines, sometimes in the close vicinity of postsynaptic membranes . Moreover, a moderate and transient increase in [Ca 2+ ] due to release from these Ca 2+ stores has been shown to cause elongation of existing spines and the formation of new ones . These observations suggest that morphogenesis of dendritic spines involves the recruitment of Ca 2+ -storing vesicles in the vicinity of synapses. Therefore, the induction of spine formation by syndecan-2 may be due to the recruitment of synbindin-coated Ca 2+ -storing membrane compartments toward subsynaptic locations. In any event, the identification of a protein that is involved in vesicle transport as a ligand for a cell-surface proteoglycan suggests that extracellular cues may have a role in determining the destination of these vesicles over dendritic surfaces, which in turn promotes the formation of postsynaptic specialization at such a destination. | Study | biomedical | en | 0.999997 |
0003113 | Many pathologic stimuli induce the heart to undergo adaptive hypertrophic growth that temporarily augments cardiac function. Although the initial hypertrophic response may be beneficial, sustained hypertrophy often undergoes a transition to heart failure, which is a leading cause of mortality and morbidity worldwide, and is characterized by a progressive deterioration in cardiac function. Intensive investigation over the last several years has led to the identification of intracellular signaling pathways that are believed to transduce prohypertrophic signals. However, the nature of the cross-talk between these pathways remains unclear and, more importantly, negative regulators of the hypertrophic response have not been identified. Glycogen synthase kinase-3 (GSK-3) 1 is a highly conserved protein kinase that is believed to play a critical role in development as a component of the Wnt/wingless pathway, and in a number of human disease states including tumorigenesis, diabetes, and Alzheimer's disease . Unlike most protein kinases, GSK-3 is active in the unstimulated cell and becomes inactivated when cells are stimulated by a variety of mitogens or by the Wnt/wingless pathway . Many of the targets of GSK-3 that have been identified to date, including c-Jun, cyclin D1, several metabolic enzymes, β-catenin, and at least two nuclear factors of activated T cells (NF-ATs), are repressed by the action of GSK-3, and inactivation of GSK-3 relieves the repression . The list of putative substrates of GSK-3 suggested that this kinase might also play a negative modulatory role in hypertrophy since it negatively regulates the actions of major targets of two cytosolic signaling pathways that have been implicated in the hypertrophic response to pressure overload in the intact animal. These pathways, the calcineurin pathway and a pathway culminating in activation of the stress-activated protein kinases (SAPKs, also known as c-Jun NH 2 -terminal kinases or JNKs), activate NF-ATs and c-Jun, respectively . Calcineurin, activated by calmodulin binding in the presence of elevated cytosolic free [Ca 2+ ], dephosphorylates NF-ATs, exposing the nuclear localization signals . NF-ATs then translocate to the nucleus and activate transcription of a number of genes involved in a variety of responses, including the immune response . When calcium levels return to normal and calcineurin is inactivated, phosphorylation of NF-ATs leads to their rapid export from the nucleus, terminating the signal . Although the role of NF-ATs in the hypertrophic response of cardiomyocytes to physiologically relevant stimuli is not clear, Molkentin et al. 1998 were able to induce hypertrophy in transgenic mice by expressing activated NF-ATc4. These data suggest that calcineurin's prohypertrophic effects are mediated, at least in part, via activation of one or more NF-ATs. More recently, calcineurin-induced activation of NF-ATc1 (NF-AT2/c) was shown to play a role in skeletal myocyte hypertrophy . GSK-3β has been reported to regulate nuclear/cytoplasmic partitioning of various NF-ATs. GSK-3β has been shown to induce nuclear export of transfected NF-ATc1 in COS cells, and of transfected NF-ATc4 (NF-AT3) in hippocampal neurons . Although several other kinases also have been implicated in regulation of NF-AT subcellular localization , these data raise the possibility that GSK-3β could exert an antihypertrophic effect in the heart by affecting nuclear/cytoplasmic partitioning of endogenous NF-ATs in cardiac myocytes. c-Jun, a major SAPK target , is also negatively regulated by phosphorylation by GSK-3 . Phosphorylation reduces the DNA binding activity of c-Jun, and thus the activity of AP-1 (a heterodimer of c-Jun and c-Fos family members). Since the SAPKs recently have been shown to be necessary for the hypertrophic response of neonatal cardiomyocytes to endothelin-1 (ET-1) and for the development of pressure overload-induced hypertrophy in the intact rat , inhibition of activity of one of the primary targets of the SAPKs, AP-1, could be another mechanism whereby GSK-3 might negatively regulate hypertrophy. Herein, we explore the role of GSK-3β in the hypertrophic response of cardiomyocytes. Our data indicate that inhibition of GSK-3β is a critical step in the development of a cardiac hypertrophic response. Antibodies used were: anti-GSK-3β mAb (Transduction Laboratories), antiatrial natriuretic factor (anti-ANF; Peninsula Laboratories), anti-α-actinin mAb (Sigma-Aldrich), rabbit anti-NF-ATc1 (K-18), which recognizes all NF-AT family members (Santa Cruz Biotechnology), antiphospho Ser 9 GSK-3β that specifically recognizes Ser 9 phosphorylated GSK-3β (New England Biolabs), and Cy3-conjugated anti-rabbit and anti-mouse antibodies (BioRad). Other reagents included glycogen synthase peptide-2 (Upstate Biotechnology, Inc.), ET-1 and phenylephrine (PE; Sigma-Aldrich), and insulin-like growth factor-1 (IGF-I; Calbiochem). Spontaneously beating neonatal myocytes were prepared from 1–2-d-old rats and cultured in F-10 medium in the presence of 5% FBS and 10% horse serum as previously described . The cDNA encoding GSK-3βA9, carrying a Ser-to-Ala substitution at Ser 9 in the NH 2 -terminal region of GSK-3β, and an HA epitope tag at the COOH terminus was created by PCR as described . The cDNA was subcloned into the pAdTRACK-CMV shuttle vector (obtained from B. Vogelstein, Johns Hopkins University, Baltimore, MD) that encodes green fluorescent protein (GFP) from one CMV promoter and the gene of interest from a second CMV promoter . AdGSK-3βA9, the recombinant adenovirus, was prepared using the AdEASY system as described . The recombinant virus was propagated in 293 cells and high titer stocks (≥10 12 particles/ml) were purified by CsCl density gradient centrifugation. AdβgalEGFP (herein referred to as AdGFP), carrying the Escherichia coli LacZ gene in addition to the GFP gene, was used as a control virus. AdBD110, which encodes the 110-kD catalytic subunit of phosphoinositide 3-kinase (PI3-K), rendered constitutively active by including in-frame the p110-binding domain of human p85 (amino acids 474–552), has been previously described in detail . When cardiomyocytes are infected with AdBD110, they have constitutively elevated levels of 3-phosphorylated phosphoinositides and increased activity of PKB/Akt . AdPKB/Akt, encoding protein kinase B (PKB)/Akt made constitutively active by the addition of a myristylation signal at the NH 2 terminus of the kinase, was kindly provided by Dr. Thomas Franke (Columbia University, New York, NY) and has been described in detail . Cells were fractionated by hypotonic lysis. In brief, cells were suspended in lysis buffer containing Hepes (20 mM, pH 7.5) and NaCl (10 mM) with phosphatase and protease inhibitors. After 15 min on ice, lysates were spun at 2,500 rpm for 5 min in an Eppendorf centrifuge. The pellet (nuclear fraction) was washed twice in lysis buffer, and then the supernatant and pellet were spun at 14,000 rpm for 10 min. Protein concentrations of the cytosolic and nuclear fractions were equalized, and then SDS sample buffer was added to a final concentration of 1×. For Western blot analysis, cell lysates were matched for protein concentration and were then separated by SDS-PAGE and transfered to Hybond-C extra (Amersham Pharmacia Biotech). The membranes were blocked in 5% nonfat milk and then incubated with the indicated antibodies for 1 h at room temperature. Antibody binding was detected with a peroxidase-conjugated goat anti–rabbit or anti–mouse IgG and chemiluminescence. For the studies of GSK-3β activity in aortic banded hearts, the left ventricle was pulverized under liquid nitrogen, homogenized with a polytron in lysis buffer containing protease and phosphatase inhibitors , and then briefly sonicated. After 15 min on ice with vortexing, the samples were centrifuged at 100,000 g for 1 h at 4°C. Supernatants from heart lysates, or from lysates of neonatal cardiomyocytes in culture, were matched for protein concentration, and were incubated with anti-GSK-3β mAb or anti-HA mAb for 2 h, and then complexes were collected with protein G–Sepharose beads for an additional 1 h. Beads were washed six times in lysis buffer and three times in assay buffer, and then were incubated for 20 min at 30°C with glycogen synthase peptide-2 (50 μM) and 100 μM γ[ 32 P]ATP (3,000–4,000 cpm/pmol) in the presence of 10 mM MgCl 2 . Contents of the assays were spotted onto P81 phosphocellulose papers that were washed and then subjected to liquid scintillation counting. Kinase activity was reduced to background levels when 10 mM LiCl was included in the reaction mix, suggesting the activity measured was GSK-3β and not a contaminating kinase. Neonatal cardiomyocytes were infected with AdGSK-3βA9 or AdGFP in F-10 medium containing 0.1% FCS. 36 h later, cells in triplicate wells of 12-well plates were stimulated with ET-1 (100 nM) for 36 h in serum-free F-10 medium and then incubated in the same medium with 1.0 μCi/ml [ 3 H]-leucine for an additional 12 h. The cells were processed as described , and [ 3 H]-leucine incorporation was determined by liquid scintillation counting. Cardiomyocytes, grown on laminin-coated plastic coverslips, were infected with either AdGFP or AdGSK-3βA9. 36 h later, they were exposed to ET-1 or PE in serum free medium. For assessment of sarcomere organization and ANF expression, the cells were fixed 48 h later for 10 min with 4% parformaldehyde/5% sucrose in PBS. Coverslips were processed as described . For sarcomere staining, coverslips were incubated in a 1:400 dilution of anti–α-actinin mAb and for ANF staining in a 1:400 dilution of anti-ANF antibody in blocking solution. Coverslips were then incubated in a Cy3-conjugated secondary antibody diluted 1:800 in blocking solution for 1 h at room temperature. Cells were photographed using a Nikon FXA photomicroscope. Figures were prepared using Canvas 6.0.1 (Deneba Systems, Inc.) and were then transferred to Adobe Photoshop 5.5 for printing. Data are expressed and presented in the figures as mean ± SEM. A t test was used to compare the means of normally distributed continuous variables. A value of P < 0.05 was chosen as the limit of statistical significance. If GSK-3β plays an important role in the hypertrophic response, its activity should be inhibited by hypertrophic stimuli. Therefore, we exposed neonatal rat cardiomyocytes to ET-1 or, as a positive control, IGF-1, another hypertrophic agent known to inhibit GSK-3β. Cell lysates were prepared and subjected to immunoprecipitation with an anti-GSK-3β antibody, followed by assay with the glycogen synthase-2 peptide as substrate. IGF-1 produced a 45% decrease in GSK-3β activity, consistent with prior observations using insulin in various cell lines . In response to ET-1 (100 nM), GSK-3β was inhibited by as much as 60% at 40 min. Thereafter, GSK-3β activity returned toward control levels, but some inhibition persisted for at least 90 min . Inhibition with PE (20–30%) was not as marked as with ET-1, but was significant (data not shown). Although PE-induced inhibition is less than the inhibition seen with IGF-1, this percent inhibition is equivalent to that seen with NGF and HGF (20–30% inhibition), and this degree of inhibition is believed to play an important role in the antiapoptotic effect of NGF in PC12 cells and in the HGF-induced accumulation of β-catenin in mouse mammary epithelial cells . These data suggest that the degree of inhibition of GSK-3β by ET-1 and PE in cardiomyocytes is sufficient to have potentially important biological effects. To determine whether GSK-3β might play a role in the hypertrophic response to a physiologically relevant stimulus in vivo, rats were subjected to aortic banding or sham banding as described , and GSK-3β immune complex kinase assays were performed on myocardial lysates at various times after banding. We found that GSK-3β activity was significantly reduced in response to pressure overload and inhibition persisted for 24 h . Taken together, these data are consistent with a possible role for GSK-3β in the hypertrophic response of cardiomyocytes in culture and in pressure overload-induced hypertrophy in vivo. Several mechanisms of inhibition of GSK-3 have been described. Insulin and IGF-1 inactivate GSK-3 via phosphorylation of a serine residue in the NH 2 -terminal region of the kinase . This is mediated by a PI3-K-dependent kinase, possibly either PKB/Akt or the integrin-linked kinase . Other mechanisms, including one mediated by Ca 2+ and a Ca 2+ /calmodulin-dependent protein kinase kinase , and an ill-defined mechanism employed by the Wnt/wingless pathway, possibly involving protein kinase C , also inactivate GSK-3, but these pathways are not PI3-K-dependent and do not result in phosphorylation of Ser 9. Therefore, we determined the mechanism of inhibition of GSK-3β by hypertrophic stimuli. We found that ET-1 induced pronounced phosphorylation of GSK-3β on Ser 9, and that this phosphorylation was blocked by the PI3-K inhibitors, wortmannin or LY294002 . The effect of the PI3-K inhibition on Ser 9 phosphorylation exactly correlated with the effect on GSK-3β kinase activity, since wortmannin prevented the ET-1–induced inactivation of GSK-3β . These data strongly suggest that the ET-1–induced inhibition of GSK-3β is mediated via phosphorylation of Ser 9 by a PI3-K-dependent kinase. To confirm that phosphorylation of Ser 9 was the mechanism of inactivation of GSK-3β, we created an adenovirus encoding GSK-3β with a Ser 9 to Ala mutation that renders the kinase resistant to inhibition by Ser 9 kinases, and then determined whether GSK-3βA9 was inhibited in response to ET-1. Cells were transduced with AdGSK-3βA9, AdGFP (as a control), or no virus. 36 h later, cells were exposed to ET-1 for 40 min, followed by immunoprecipitation with anti-HA mAb and immune complex kinase assay. In contrast to endogenous GSK-3β , GSK-3βA9 was not inhibited by ET-1 . These data confirmed a critical role for Ser 9 phosphorylation in the ET-1–induced inactivation of GSK-3β. In addition, they demonstrated that we could employ the virus to study the role of GSK-3 inhibition in the hypertrophic response to ET-1. If the ET-1–induced inhibition of GSK-3 were mediated by activation of the PI3-K/PKB pathway, and if this inhibition were important in the hypertrophic response, then directly activating the PI3-K/PKB pathway should induce hypertrophic responses. To initially explore this question, we induced inhibition of GSK-3 by adenovirus-mediated gene transfer of either the constitutively active mutant of PKB/Akt (AdPKB/Akt), or the constitutively active PI3-K (AdBD110), which produces persistent activation of endogenous PKB/Akt , and determined their effects on protein accumulation in neonatal myocytes. Adenoviral gene transfer of either BD110 or activated PKB/Akt significantly increased protein accumulation, demonstrating that activation of the PI3-kinase/Akt pathway is sufficient to induce hypertrophic responses . In addition, we employed LiCl, which has been used to directly inhibit GSK-3 in many contexts (see below). Even in the absence of a hypertrophic stimulus, LiCl was sufficient to induce protein accumulation in cardiac myocytes . Whereas BD110, PKB/Akt, and LiCl have effects in cells in addition to inhibiting GSK-3, the data are consistent with a possible role for the PI3-K/Akt/GSK-3 pathway in the hypertrophic response. To address our primary question, whether inactivation of GSK-3β is necessary for the hypertrophic response to physiologically relevant stimuli, we expressed GSK-3βA9 in neonatal cardiomyocytes via adenoviral gene transfer and determined its effect on the hypertrophic response. GSK-3βA9 was readily expressed in culture using multiplicities of infection (MOIs) of 50–125 pfu/cell. At an MOI of 100 pfu/cell, expression levels of GSK-3βA9 were only slightly greater than levels of endogenous GSK-3β , and transduction efficiency was ∼85% (not shown). It is important to note that the expression levels that we achieved at an MOI of 100 pfu/cell did not produce marked elevations in total cellular GSK-3β activity. When we measured total GSK-3β activity in cells infected with AdGSK-3βA9, activity was increased only 1.8 ± 0.2-fold over cells infected with control virus (AdGFP). This level of activity is in distinct contrast to activity levels seen after gene transfer or transfection of constitutively active kinases that are normally off in the resting cell. In these cells, total kinase activity is often many fold greater than endogenous activity. If inhibition of GSK-3β is important in the hypertrophic response of cardiomyocytes, preventing inactivation of GSK-3 should block the hypertrophic response. Therefore, we determined whether gene transfer of GSK-3βA9 blocked the hypertrophic response to ET-1 and PE. For these studies, we took advantage of the fact that we made AdGSK-3βA9 with the pAdTRACK/pAdEASY system , which allows expression of GFP from a separate promoter in the virus. We identified transduced cells by their green fluorescence, and could then compare hypertrophic responses in cells that were successfully transduced with those that were not transduced. To summarize the data presented below, we found that expression of GSK-3βA9 significantly inhibited ET-1– and PE-induced hypertrophy and, importantly, that LiCl, which inhibits endogenous GSK-3 and GSK-3βA9, reversed the effects of gene transfer of GSK-3βA9. Enhanced organization of sarcomeres, which characterizes the hypertrophic response of neonatal cardiomyocytes, was markedly inhibited by expression of GSK-3βA9 . However, in myocytes expressing GSK-3βA9 that were also treated with LiCl (10 mM), ET-1– and PE-induced sarcomere organization was restored . Of note, treatment of myocytes with LiCl alone, in the absence of ET-1 or PE, induced only moderate sarcomere organization , suggesting that inhibition of GSK-3β is necessary, but is not sufficient for the full expression of this relatively complex component of the hypertrophic response that requires the coordinate expression of a number of genes. Next we examined the role of the GSK-3β pathway in the induction of ANF, one of the marker genes that is upregulated in response to most hypertrophic stimuli. We found that ET-1 induced expression of ANF , but that gene transfer of GSK-3βA9 markedly inhibited the ET-1–induced expression of ANF . Again, LiCl completely reversed the effects of expression of GSK-3βA9. Although LiCl alone was not sufficient to induce full sarcomere organization , LiCl was sufficient, even in the presence of GSK-3βA9, to induce ANF expression, suggesting that inhibition of GSK-3β is not only necessary, but may also be sufficient for this component of the response . To determine whether inhibition of GSK-3β is necessary for the enhanced protein accumulation that is characteristic of the hypertrophic response, we measured ET-1–induced [ 3 H]-leucine incorporation in cells transduced with AdGSK-3βA9. Expression of GSK-3βA9 significantly reduced ET-1–induced [ 3 H]-leucine incorporation . The hypertrophic response is an enormously complex response that is regulated by multiple transcription factors acting on multiple genes. This complexity makes it difficult to identify critical roles for individual transcription factors. However, several lines of evidence, in addition to the findings described above with the transgenic mouse expressing an activated mutant of NF-ATc4, suggest NF-ATs play a role in the response. In neonatal rat cardiomyocytes in culture, cyclosporin A blocks ANF induction by angiotensin II and PE , and by ET-1 (data not shown). These data confirm that calcineurin is critical to this component of the response and are compatible with a role for one or more NF-ATs in ANF induction. Furthermore, adenovirus-mediated gene transfer of activated NF-ATc4 , in the absence of hypertrophic stimuli, induces ANF expression and sarcomere organization (data not shown). We found that ET-1 induced marked nuclear translocation of an endogenous NF-AT of molecular mass ∼95 kD . Specific antibodies to the various NF-ATs are not adequate for use in the rat. However, of the three NF-ATs expressed in the heart, NF-ATc1 (NF-ATc), NF-ATc3 (NF-AT4/x), and NF-ATc4 (NF-AT3; J. Molkentin, manuscript in preparation), this molecular mass is most compatible with NF-ATc1. NF-AT first appeared in the nucleus at ∼30 min after ET-1 , corresponding to the time of maximal inhibition of GSK-3β activity . Nuclear NF-AT levels declined after 120 min, a time when GSK-3β activity was returning toward normal . Thus, the time courses of endogenous NF-AT nuclear localization and GSK-3β activity are compatible with a role for GSK-3β in regulating nuclear/cytoplasmic partitioning of NF-AT. Prior studies examining the role of GSK-3β in the nuclear export of NF-ATs have employed overexpression of GSK-3β. In these studies, GSK-3β is found in the nucleus and induces export of NF-ATs . However, it is not clear whether endogenous GSK-3β also translocates to the nucleus in a stimulus-dependent manner. We found that in the unstimulated cardiomyocyte, little GSK-3β is nuclear localized . ET-1 induced a pronounced translocation of GSK-3β to the nucleus . This translocation was evident as early as 30 min and persisted until after 90 min. These data confirm that endogenous GSK-3β translocates to the nucleus in response to hypertrophic stimuli, colocalizing with its putative target, NF-AT. Thus, the time courses of GSK-3β activity and nuclear localization, and the time course of NF-AT nuclear localization, were consistent with a role for GSK-3β in regulating NF-AT nuclear/cytoplasmic partitioning, following hypertrophic stimuli. To directly address whether GSK-3β modulated NF-AT activity in response to hypertrophic stimuli, we examined the effects of expressing GSK-3βA9 on the nuclear/cytoplasmic partitioning of NF-AT in cardiomyocytes exposed to ET-1. As noted above, NF-AT first appeared in the nucleus at ∼30 min after ET-1 in control and AdGFP-infected cells . Expression of GSK-3βA9 significantly delayed the appearance of NF-AT in the nucleus, compatible with retardation of entry by cytosolic GSK-3β . By 60 min, however, the amount of intranuclear NF-AT was equivalent in cells infected with AdGSK-3βA9 and AdGFP , suggesting the inhibitory effect of GSK-3βA9 was overcome by activated calcineurin. A significant fraction of the NF-AT remained intranuclear at 120 min after ET-1 in control and AdGFP-infected cells , but expression of GSK-3βA9 accelerated its export from the nucleus such that little remained intranuclear at 120 min . Thus, expression of GSK-3βA9 significantly reduced the duration of NF-AT nuclear localization, both by retarding entry into and enhancing exit from the nucleus. These data suggest GSK-3β modulates the hypertrophic response of cardiac myocytes in part by regulating the nuclear/cytoplasmic partitioning of NF-AT. In this manuscript, we identify a novel function of GSK-3β. We demonstrate that GSK-3β plays a critical role in the hypertrophic response of cardiomyocytes by showing that GSK-3β kinase activity is inhibited by hypertrophic stimuli both in vitro and in vivo, and that inhibition of GSK-3β activity is essential for all three components of the hypertrophic response of cardiomyocytes enhanced protein accumulation and sarcomere organization, and reexpression of fetal genes. Furthermore, we show that GSK-3β likely limits the hypertrophic response, at least in part, by negatively regulating ET-1–induced nuclear localization of NF-AT. Numerous signaling molecules have been identified, which, when activated, transduce prohypertrophic signals, and some, such as the SAPK/JNKs, calcineurin, and the α subunit of Gq heterotrimeric G proteins, have been shown to be essential for the development of cardiac hypertrophy in vivo to physiologically relevant stimuli . To date, few studies have identified pathways that negatively regulate the hypertrophic response, yet these may be equally attractive targets for therapies designed to block the progression of hypertrophy and the transition to heart failure. GSK-3 is normally active in unstimulated cells, and is inactivated in response to growth factors, especially insulin and IGF-1, which activate the PI3-K pathway . We now demonstrate that GSK-3β is potently inhibited by hypertrophic agonists with receptors coupled to heterotrimeric G proteins of the Gq class. Morisco et al. 2000 recently showed that stimulation of β-adrenergic receptors, which are coupled to Gs proteins, also inhibited GSK-3β, suggesting that inhibition of this kinase may be a generalized phenomenon of hypertrophic signaling in cells in culture. We also showed that GSK-3β is markedly inhibited in the intact animal exposed to pressure overload induced by aortic banding, a stress that mimics severe valvular or hypertensive disease. Recently, Rezvani and Liew 2000 reported that human hypertrophy is associated with elevated levels of β-catenin protein, a transcriptional activator involved in embryonic development and tumorigenesis, not previously known to play a role in hypertrophy. Since GSK-3β, when active, phosphorylates β-catenin, targeting it for ubiquitination and degradation, inhibition of GSK-3β may account, in part, for the increased expression of β-catenin. We believe β-catenin may be an additional target of GSK-3β that is involved in the hypertrophic response and studies evaluating this hypothesis are in progress. GSK-3β activity can be inhibited by a number of mechanisms, but our findings suggest that hypertrophic agonists utilize phosphorylation of Ser 9 by a PI3-K–dependent protein kinase. This phosphorylation can be catalyzed by at least two protein kinases, PKB/Akt and ILK, both of which are activated by phosphatidylinositol 3 phosphates . It is unclear which of the two is the physiologically relevant kinase that inactivates GSK-3 in response to hypertrophic stimuli. The data confirm that the inhibition of GSK-3β is not mediated via recruitment of the Wnt pathway by hypertrophic agonists since Wnt-induced inhibition of GSK-3β appears to be PI3-K-independent . Ultimately, cytosolic signaling pathways must modulate the activity of various transcription factors to direct the complex reprogramming of gene expression required to express the full hypertrophic phenotype. Our data suggest that one critical target of GSK-3 that likely plays a role in the hypertrophic response of cardiac myocytes is a member of the NF-AT family of transcription factors. NF-AT family members have been implicated in both cardiac hypertrophy and IGF-1–induced skeletal myocyte hypertrophy . NF-AT activity is largely controlled at the level of nuclear localization since the cytoplasmic forms are competent for both DNA binding and transcriptional activation . NF-ATs appear to be held in the cytoplasm by the masking of two nuclear localization signals by the intramolecular interaction of several phosphorylated serine residues with a second serine-rich region . Dephosphorylation of the serine residues by calcineurin exposes the nuclear localization signals leading to nuclear import. Several protein kinases in addition to GSK-3β have been implicated in the nuclear export and/or cytosolic anchoring of NF-AT family members. Three MAP kinases (SAPKs, ERKs, and p38), protein kinase A, casein kinase Iα in cooperation with MAP kinase/ERK kinase-1, and casein kinase 2 have been reported to phosphorylate critical residues in the SerPro-rich domain of one or more NF-ATs, blocking nuclear import and/or enhancing export . The role of these kinases has been examined primarily in T cells, hippocampal neurons, or transformed cell lines commonly used in studies using transfection (e.g., COS cells), and few studies have focused on the regulation of endogenous NF-ATs. It appears from these studies that the relevant kinase(s) regulating NF-AT nuclear/cytosolic partitioning depends on the NF-AT, the cell type, and, possibly, the stimulus. For our purposes, Beals et al. 1997b have clearly shown that GSK-3 regulates nuclear export of NF-ATc1, the NF-AT we believe to be most highly expressed in neonatal cardiomyocytes. More recently, Porter et al. 2000 proposed that casein kinase 2, which is constitutively nuclear localized, may serve as a priming kinase that phosphorylates residues of NF-ATc1, allowing more efficient phosphorylation by GSK-3β. They noted however, that GSK-3β could, itself, also serve as the priming kinase. Although the role of the other putative NF-AT kinases in cardiomyocytes is not clear, out data confirm a critical role for GSK-3β. We found that expression of GSK-3βA9 delayed the initial ET-1–induced import of NF-AT into the nucleus, and, subsequently, enhanced nuclear export, resulting in a markedly reduced duration of NF-AT nuclear localization. These data are compatible with an important role for GSK-3β in nuclear/cytoplasmic partitioning of NF-AT after stimulation by hypertrophic agonists. In addition, we found that treatment of cells with LiCl in the absence of ET-1 induced marked translocation of NF-AT to the nucleus (data not shown), suggesting that GSK-3β may not only retard stimulus-induced entry of NF-AT into the nucleus, but also may be the dominant mechanism for maintaining NF-AT in the cytosol in the unstimulated or resting cardiac myocyte. An alternative approach to studying the role of GSK-3β (and NF-ATs) in the hypertrophic response would be to create mice deleted for one or more of these genes. However, the GSK-3β deletion is embryonic lethal. Furthermore, the molecular mass of the dominant NF-AT in neonatal rat cardiomyocytes is most compatible with NF-ATc1, and mouse embryos lacking NF-ATc1 die at day 11 from congestive heart failure due to improper formation of the cardiac valves . Mice deleted for the other NF-ATs expressed in the heart are viable, but since cardiac myocytes contain more than one NF-AT, deletion of one may be compensated for by the others. Cross-breeding viable knockouts could clarify the role of the NF-ATs in hypertrophy, but increases the probability of embryonic lethality. Although we believe NF-ATs are important in the hypertrophic response, several pieces of evidence suggest that inhibition of NF-ATs is not the only mechanism by which GSK-3 attenuates the hypertrophic response. For example, in contrast to the marked hypertrophy seen when an activated mutant of NF-ATc4, NF-ATc4Δ317, is expressed in the hearts of transgenic mice , expression of NF-ATc4Δ317 in neonatal rat cardiomyocytes in culture induces a definite, but modest hypertrophic response. Therefore, either NF-ATs are necessary, but not sufficient for the full expression of the hypertrophic phenotype, or, more likely, there are additional targets activated by ET-1 and PE (and inhibited by GSK-3β) that play a role in the hypertrophic response. In support of the latter possibility, preliminary experiments suggest that expression of NF-ATc4Δ317 partially, but not completely, overcomes the inhibitory effect of GSK-3βA9 on the hypertrophic response. In this regard, GSK-3 has another target, c-Jun, which has been implicated in the hypertrophic response. c-Jun was the first transcription factor identified as a substrate of GSK-3 . GSK-3 phosphorylates several residues near the DNA binding domain of c-Jun, and this negatively regulates the DNA binding activity of the transcription factor. We have previously shown that the SAPKs/JNKs, which increase the transcriptional activating activity of c-Jun, are necessary for the hypertrophic response of cardiomyocytes both in vitro and in vivo , and, given the number of hypertrophic response genes that appear to be regulated, at least in part, by AP-1, a heterodimer of c-Jun and c-Fos , it is likely that c-Jun plays an important role in hypertrophy. Therefore, inhibition of c-Jun and, as a result, AP-1, may be a mechanism in addition to inhibition of NF-ATs, whereby GSK-3 signals to blunt the hypertrophic response. In addition to the effects of AP-1 itself on gene expression, AP-1 is also required for efficient binding of NF-ATs to DNA , suggesting an additional mechanism whereby GSK-3β, via inactivation of AP-1, could block NF-AT–dependent gene expression. We employed LiCl to inhibit activity of GSK-3βA9 and endogenous GSK-3. LiCl has been employed to this end to study the role of GSK-3 in embryonic development in organisms as diverse as Dictyostelium , Xenopus laevis , sea urchins, and zebrafish, and to study numerous processes in mammalian cells . LiCl has no known effects on other protein kinases, but does have effects on other enzymes, including inhibiting the inositol monophosphatase and adenylyl cyclase. Whereas LiCl may have other less well-described ancillary effects, the direct reversal by LiCl of the effects of GSK-3βA9 on sarcomere organization, ANF expression, and protein synthesis suggests Li + mediated its actions primarily via inhibition of GSK-3. An alternative strategy would have been to use kinase-inactive GSK-3β. In our hands and others, kinase-inactive GSK-3β is not an adequate dominant inhibitory mutant in mammalian cells , and needs to be expressed at high levels to function as an inhibitor of GSK-3 signaling. This may lead to nonspecific effects and requires infection at high MOIs that can be toxic to cardiac myocytes. Whereas this might not adversely affect activity of reporter constructs , it does disrupt the complex and highly coordinated responses required to produce the hypertrophic phenotype. In summary, we have identified a novel role for GSK-3 as a critical negative modulator of cardiomyocyte hypertrophy. Our data suggest a model whereby GSK-3 directly antagonizes the prohypertrophic effects of activated calcineurin by inhibiting activity of one of its primary targets, NF-AT. The elucidation of a central role for GSK-3 in hypertrophy identifies not only GSK-3 and its downstream effectors, but also a large number of signaling molecules upstream of GSK-3, including PI3-Ks, polyphosphatidylinositide-dependent protein kinases (PDKs), PKB/Akt, and ILK, as potential therapeutic targets for drugs to alter the natural history of hypertrophy and heart failure. | Study | biomedical | en | 0.999998 |
0003137 | A particular shape and a well-defined polarity are characteristic of many cell types, as illustrated by the extended morphology of differentiated nerve cells or the asymmetric organization of polarized epithelia. The components of the cytoskeleton play an essential role in establishing and maintaining the morphology of interphase eukaryotic cells . The microtubule cytoskeleton participates in this general function by providing an intracellular framework for vesicle transport, by contributing to the internal organization of the cell, and by aiding in the organization and function of the cell cortex. The interphase microtubule network is generally dynamic, with the addition and loss of tubulin subunits occurring mostly at one microtubule end, the “plus” end , whereas a microtubule's “minus” end is less dynamic and is usually associated with the centrosome or “spindle pole body” (SPB), as it is termed in yeasts. The stability and length of microtubules are governed primarily by the rates of subunit addition and loss and by the frequency of transitions between phases of growth and shrinkage. Many proteins affect microtubule stability and length, including microtubule-associated proteins (MAPs), kinesin-like proteins (klps), and microtubule-severing enzymes . The klps comprise a superfamily of microtubule-based motor enzymes found in all eukaryotes; they share a conserved motor domain that is responsible for translocation of the enzyme along microtubules. Kinesin itself, the founding member of the superfamily, moves toward the microtubule plus end through the interactions of its NH 2 -terminal motor domain , whereas the COOH-terminal or tail region is thought to interact with cargo . Additional functions proposed for kinesins include the production of opposing inward and outward forces on the mitotic spindle and the destabilization of microtubules . The unicellular fission yeast Schizosaccharomyces pombe offers a useful model system in which to study the molecular mechanisms that control eukaryotic cellular morphology because it is amenable to detailed morphological, genetic, and molecular analyses. After cell division, growth begins only at the old end of the cell. Early in G2, growth is also initiated from the new end of the cell , and it continues from both tips until the cell enters mitosis and stops further elongation. Both cytoskeletal and regulatory components that control these events have been identified and characterized . Although the actin cytoskeleton appears to be needed for the actual deposition of growth material , the cytoplasmic microtubule network has been shown in several studies to play a role in defining the site of growth extension . Treatment with a drug that destabilizes microtubules or incubation of temperature-sensitive tubulin mutants at their restrictive temperature results in the formation of branched cells . Genetic screens for mutants with altered polarity have identified mutant alleles of the tubulin genes and tubulin-folding cofactors . Moreover, many mutant strains with altered morphology contain abnormal arrays of cytoplasmic microtubules . Cytoplasmic microtubules are also important for the localization of at least two cell tip–specific proteins, Tea1p and Pom1p . Mutations in these genes result in defects in cell morphology and/or bipolar growth . We have sought cellular components that work in conjunction with the microtubule cytoskeleton to establish and maintain cellular polarity. Through the molecular identification of tea2 + , a gene identified in a screen for morphology mutants and shown to be required for normal behavior of the cell's growing tip , we have demonstrated that a klp is required for normal cellular morphology. As described for the mutant alleles of this gene , the deletion results in defects in the cytoplasmic microtubule array and in cell shape. During the transition out of stationary phase growth, both tea2 Δ and tea2-1 cells often establish an ectopic growth site resulting in the formation of T-shaped cells. Likewise, long cells are particularly sensitive to the loss of tea2 + . Tea2p localizes to cell tips and is also often seen as dots coincident with cytoplasmic microtubule ends. All strains used are shown in Table . Strains were constructed and maintained as described in Moreno et al., 1991. Cultures were grown in rich medium containing yeast extract plus supplements (YES) or a Edinburgh minimal medium . Primers to conserved portions of the kinesin motor domain were used to amplify genomic DNA. Genomic DNA was prepared as described in Moreno et al., 1991. The 5′ primers were TAC/TGGNCAA/GACNGG (corresponding toYGQTGSGK) or TAC/TGGNCAA/GACNGG (corresponding to YGQTGTGK), and the 3′ primer was C/TTCNG/CA/TNCCNG (corresponding to DLAGSE). PCR amplifications were performed on three different samples of DNA: (a) genomic DNA from wild-type cells; (b) genomic DNA from wild-type cells digested with XbaI, which restricts within pkl1 and klp2 + ; and (c) genomic DNA from klp2 Δ cells. Reaction conditions were 30 cycles of 95°C for 30 s, 40 or 45°C for 30 s, and 72°C for 30 s, generally followed by a single 5-min incubation at 72°C. PCR products were subcloned and analyzed by colony PCR. To identify clones that represent previously identified klps, colony PCR products were digested with enzymes that cut within cut7 + , pkl1 + , and klp2 + . Potentially novel products were size-fractionated on low melting point (LMP) agarose to purify the products from PCR primers, and then were sequenced directly in the gel using vector-specific primers. A total of 163 clones with inserts were analyzed, and two novel kinesin-like genes, designated klp3 + and klp4 + , were identified; klp3 + has recently been described by others , and will be further characterized elsewhere. klp4 + was shown by the work described below to be identical to tea2 + , so that name will be used henceforth. tea2 + was cloned by positional mapping and complementation . tea2-1 was mapped to within 0.1 centimorgan (cM) of orb2ts . The loci were shown to be separate genes by complementation in a tea2-1 / orb2ts heterozygous diploid. The XhoI-BstEII fragment of pak1 + was used to probe the Cold Spring Harbor and Imperial Cancer Research Fund cosmid libraries, provided by The Sanger Centre (Cambridge, England). Hybridizing cosmids were tagged with the his7 + selectable marker and retransformed into a tea2-1 his7-36 strain; one cosmid, c1604, was able to rescue the mutant phenotype. This cosmid was used to prepare a SauIIIA partial library in pIRT2 , which was transformed into tea2-1 leu1-32 . Rescuing clones were selected by replica plating to 36°C and examining the cells over the next 2–3 h. tea2-1 cells normally form a high percentage of T shapes upon regrowth from nutrient starvation. Plasmids were recovered from clones that did not form T shapes under these conditions. Four overlapping clones were obtained, and clone 14T was used for further analyses. To show that 14T contained tea2 + and not an extragenic suppressor, the clone was integrated into the genome by homologous recombination, and this strain was crossed to leu1-32 and tea2-1 leu1-32 strains. 14T was mapped to within 0.3 cM of tea2-1 and the rescuing activity to within 0.5 cM of LEU2 , demonstrating that the tea2-1 rescuing activity is linked to 14T and that the site of integration is very close to tea2-1 . Unless otherwise specified, molecular biology techniques are essentially as described in Sambrook et al., 1989, and sequencing was performed at the University of Colorado automated DNA sequencing facility. A genomic library, provided by A. Carr , was screened using the PCR-generated clone of tea2 + . Of 20,000 clones screened, two unique clones were identified: 11B, which contained a 4.6-kb insert, and a second clone that contained only part of the tea2 + open reading frame (ORF). Subclones of 11B were constructed in pSPORT : the 4.6-kb BamHI (from vector multicloning site) to HindIII fragment was cloned into the BamHI/HindIII sites of pSPORT, creating 11–24; the 2.8-kb BglII fragment spanning the motor domain was inserted into the BamHI site of pSPORT, creating 8–24; and the 1.4-kb AvaI-HindIII fragment was inserted into the AvaI/HindIII sites of pSPORT, creating 4–24. Subclones of 11B were sequenced. To isolate DNA further 3′ of the tea2 + ORF, the 11-kb XhoI fragment extending 3′ from the tea2 + ORF was cloned by constructing and screening an XhoI genomic library of 11-kb XhoI genomic fragments cloned into pBluescript. This cloned region, cloneX/X, was digested with XhoI and BamHI, and the 4.3-kb XhoI-BamHI fragment was cloned into the XhoI/BamHI sites of pBluescript. This clone, X/B, was used for sequencing and for Northern blot analysis. A 1.4-kb AvaI/ HindIII fragment containing the 3′ half of tea2 + ORF was used to screen a cDNA library (provided by F. LaCroute, Centre de Genetique Moleculare Gif sur Yvette, France). Approximately 60,000 clones were screened, and one cDNA was identified. The cDNA was excised using NotI and were inserted into the NotI site of pSPORT to construct pSPORT tea2 + cDNA, and this clone was sequenced. Total RNA was isolated from wild-type S . pombe cells as described in Moreno et al., 1991. Poly(A + ) RNA was isolated using GIBCO BRL oligo(dT) cellulose columns according to the manufacturer's recommendations. Northern blot analyses were performed as described in Browning and Strome 1996 . Probes were labeled by random priming using 32 P-labeled dATP from Amersham Pharmacia Biotech or NEN Life Science Products. Reverse transcription followed by PCR (RT-PCR) was performed using the Promega Access RT-PCR kit. Total RNA was used as template with the primer 5′-CGTAGTATATGATTGTAGCAGGTCGTC-3′ for reverse transcription and the primer combination 5′-CGTAGTATATGATTGTAGCAGGTCGTC-3′ and 5′-CTGTGACTCAGGAAACGCAACTTC-3′ for PCR. The BLAST program available at http://www.ncbi.nlm.nih.gov/BLAST/ was used for sequence searches. The BestFit program from the GCG sequence analysis package was used for direct sequence comparison. For phylogenetic analysis, the ∼340–amino acid (aa) motor domains of Tea2p and 42 other klps were aligned using the ClustalW program available at http://dot.imgen.bcm.tmc.edu:9331/multi-align/multi-align.html. This alignment was analyzed with the phylogenetic program PAUP version 4.0 (Sinauer Associates, Inc.), assuming maximum parsimony and using a heuristic search method with stepwise addition. 100 bootstrap replicas were performed. For coiled coil predictions, the Coils program available at http://www.ch.embnet.org/software/COILS_form. html was used . Both matrices (MTK and MTIDK) were tested, with and without the weighting option. A null allele of tea2 + was constructed by single-step gene replacement protocol, replacing the tea2 + ORF with his3 + by homologous recombination. To construct the integration plasmid, clone 11–24 was digested with BbsI, blunt ended with Klenow, then digested with HindIII, and the 423-bp [BbsI]-HindIII fragment beginning 14 bp 3′ of tea2 + ORF was isolated. A SalI/SmaI fragment containing his3 + was isolated from pAFI . These two fragments were simultaneously ligated into the SalI and HindIII sites in pSPORT to create an intermediate integration construct. To place tea2 + 5′ flanking DNA into this plasmid, clone 8–24 was digested with PflmI, DNA ends were blunt ended with T4 DNA polymerase, the plasmid was further digested with KpnI, and the fragment from KpnI (in the vector multicloning site) to [PflmI], which contains the tea2 + 5′ flanking DNA, was ligated into the KpnI/SmaI sites of the intermediate integration construct. The final integration plasmid contained 1,063 bp of 5′ and 423 bp of 3′ DNA from the region flanking the tea2 + ORF placed on the 5′ and 3′ sides of his3 + , respectively. For transformation, the tea2-his3 + cassette was excised by digestion with PvuII. Diploids ( his3-D1/his3-D1, ura4-D18/ura4-D18, ade6-M210/ade6-M216, leu1-32/leu1-32 , h + /h − ) were transformed with this cassette using the PLATE method . Homologous integrants were identified by PCR and confirmed by Southern blot analysis. The gene initially characterized as klp4 + was found to be entirely contained within the 14T plasmid using PCR primers specific to klp4 + . Clone 14T was used to construct 5′ and 3′ deletions to further define the rescuing region . 14B and 14H are 3′ truncations with deletions extending to the BamHI and HindIII sites, respectively. 14X is a deletion with 5′ sequences removed to the XhoI site. The tea2-1 allele was sequenced by PCR amplification of tea2-1 genomic DNA using primers specific to the tea2 + region followed by sequencing of the PCR products. Cells were grown in YES or EMM at 32°C until they reached stationary phase growth, generally 1 d beyond logarithmic growth in YES or 2 d after logarithmic growth in EMM. Cells were then diluted 1:10 or 1:25 in fresh medium and examined by microscopy at various times after dilution. For tea2Δ complementation tests, cells were grown to saturation in EMM with appropriate supplements. For lineage analysis, cells were grown to saturation in YES, placed on a YES agar pad (YES medium with 2% agar) on a microscope slide, and examined by differential interference contrast (DIC) microscopy using a Zeiss microscope. The slide was warmed to 32°C with an air curtain incubator (Sage Instruments) or a heatlamp. The temperature was controlled using a CN76000 microprocessor-based temperature and process controller from Omega Engineering. Images were captured using an Empix charge-coupled device camera and Metamorph software (Universal Imaging). For protein expression in Escherichia coli , a construct was made by digestion of clone 4–24 with BsmI and BbsI and generation of blunt ends with T4 DNA polymerase and Klenow. The 440-bp [BsmI-BbsI] fragment corresponding to the COOH-terminal region of Tea2p (which lacks motor sequences) was cloned into the EcoRI site of pGEXKG , which had been blunt ended with Klenow. Inclusion bodies were purified from cells expressing this construct, pGEXKG tea2 s/t, by the method of Lin and Cheng 1991 . The fusion protein was further purified by SDS-PAGE. Fusion protein was electroeluted from the gel, dialyzed against 1X PBS, and sent to Strategic Biosolutions for the immunization of two rabbits. A second fusion protein was constructed for antibody purification. The 440-bp [BsmI-BbsI] tea2 + fragment described above was cloned into the PvuII site of pRSETc (Invitrogen) and the fusion protein expressed in the BL21(DE3) E . coli strain. The fusion protein was solubilized by denaturization and then purified by chromatography on nickel columns according to the procedure recommended by Invitrogen. A column for affinity purification was made with purified fusion protein covalently cross-linked to cyanogen bromide–activated sepharose 4B (Sigma-Aldrich) as recommended by Amersham Pharmacia Biotech. The serum was purified on the column essentially as described in Harlow and Lane 1988 , except 1× PBS was substituted for 10 mM Tris (pH 7.5 and 8.8), and the unbound antibody was washed off the column with 5 bed volumes 1× PBS, 10 bed volumes 3× PBS, and 15 bed volumes 1× PBS. Cells were prepared for immunofluorescence staining by aldehyde or cold methanol fixation as described in Hagan and Hyams, 1988. For tubulin staining, a mouse moncolonal antibody against Drosophila α-tubulin was used (provided by M.T. Fuller, Stanford University, Stanford, CA) or tat1 with goat anti–mouse Alexa secondary antibody (Molecular Probes). Tea2p–green fluorescence protein (GFP) was visualized using a rabbit polyclonal antibody at 1:200 (a gift from Ken Sawin, Imperial Cancer Research Fund, London, UK) and Alexa 488 (Molecular Probes) as the secondary antibody. For Tea2p antibody staining, secondary antibodies were fluorescein-labeled goat anti–rabbit immunoglobulin (Jackson ImmunoResearch Laboratories). Tea1p staining was as described in Mata and Nurse, 1997. Tea2p staining was performed on methanol-fixed cells. Cells were mounted in Citifluor Mountant Media No. 0 (Ted Pella, Inc.). Immunofluorescence microscopy was performed on a Leica DMRXA/RF4/V automated universal microscope, and images were acquired with a Cooke SensiCam high performance digital camera using the Slidebook software package (Intelligent Imaging Innovations, Inc.) or a Zeiss LSM510 Confocal microscope. In all cases, images were exported to Adobe Photoshop for figure preparation. pREP3X tea2 + cDNA was constructed by cloning the BamHI/SmaI 4.6-kb fragment from pSPORT tea2 + cDNA into the BamH1 and SmaI sites of pREP3X . The truncated cDNA construct was made by digesting pREP3X tea2 + cDNA with BbsI, filling in the 5′ overhang with Klenow, and then digesting with BamHI. The BamHI/[BbsI] fragment containing the entire ORF of tea2 + was then cloned into the SmaI and BamHI sites of pREP3X. tea2 Δ cells transformed with these constructs were grown in EMM with appropriate supplements and 5 μg/ml thiamine (Sigma-Aldrich), and cells were washed three times with thiamine-free medium then grown overnight in thiamine-free medium. Cells were harvested, and protein extracts prepared by vortexing cells with glass beads in sample buffer. Western blot analysis was performed as described in Towbin et al. 1979 . 4% nonfat dry milk was used as a blocking agent. Blots were developed using enhanced chemiluminescence (ECL) reagents from Amersham Pharmacia Biotech. Tea2 was tagged with GFP at the COOH terminus as described in Bahler et al. 1998 using the forward primer 5′GAAACTAAAACTGAAATTTTGCCAGACGATCAACAGCAATCGAAAAAGGATTCTGTG-ACTCAGGAAACGCAACTTCTTTCTCGGATCCCCGGGTTAATTAA 3′ and the reverse primer 3′AATTTAAGGAGACATACAGGTT-GAATGGGTATAAAATTGTAAACAAGGTTGATGAGAGACG-CCTATAATTAAACAAGGTAGAATTCGAGCTCGTTTAAAC 3′. 1–2 μg of PCR product was transformed into ade6-M210/216 leu1-32/1-32 h + /h + cells and G418-resistant clones were selected and then sporulated. G418-resistant haploids were screened by PCR for homologous integration at the tea2 + locus. The morphology of one strain was tested upon recovery from nutrient starvation and in exponential growth. The strain was also tested for Tea1p localization and microtubule length. In all conditions tested, the Tea2p-GFP–tagged strain behaved as wild-type cells. To understand the roles of klps in S . pombe , we carried out a PCR screen using degenerate primers to highly conserved regions in the motor domain of the kinesin superfamily. Two new S . pombe klps were identified, klp3 + and klp4 + . The PCR-generated clone for klp4 + was used to identify a genomic clone, 11B, containing the klp4 + ORF , and a fragment of this genomic region was used to identify a cDNA clone . Sequence analysis revealed that the 4583-bp cDNA contained the entire klp4 + ORF with a stop codon at the same position as predicted from the genomic sequence, as well as 2.6 kb of additional 3′ sequence that unexpectedly contained a second ORF of 658 aa . A fragment containing the downstream genomic region was cloned, clone X/X, and both this clone and clone 14T (described below) were used to sequence the genomic region corresponding to the cDNA clone . Comparison of the genomic and cDNA sequences indicated that there are no introns in klp4 + . The PCR-generated clone also was used to map klp4 + by hybridization to a cosmid filter of the S . pombe genome to chromosome 2 between puc1 + and nda3 + . This region has since been sequenced by the S . pombe Sanger Centre genome project, and is located on cosmid c1604 with EMBL/GenBank/DDBJ accession nos. AL034433 and PID g4376084. In an independent, parallel series of experiments, we were investigating the localization of Tea1p in tea2-1 cells and found that Tea1p was mostly delocalized from the cell tips compared with wild-type cells and was found along the microtubules and in the cytoplasm (data not shown). This result suggests that Tea2p might be required to transport Tea1p to the cell tips. To investigate this possibility, tea2 + was mapped by positional cloning to cosmid c1604 (described in Materials and Methods). This cosmid was subcloned, and the 14T plasmid, a subclone capable of rescuing the tea2-1 morphology defects, was used for further analyses. The similarity of the phenotypes of the knockout of klp4 + (described below) and mutant alleles of tea2 + , together with the mapping data described above and in Materials and Methods, suggested that these two independently identified genes might be the same genetic locus. To explore this possibility, three sets of PCR primers covering the klp4 + region were used to amplify DNA from the 14T plasmid, and all three gave bands of the expected size, indicating that the 14T plasmid contained the entire klp4 + ORF. Transformation of the 14T plasmid into a strain deleted for klp4 + (described below) resulted in rescue of the klp4 Δ phenotype ( Table ), and the plasmids 14B and 14H also rescued both the klp4 Δ phenotype ( Table ) and the tea2-1 phenotype. However, neither the deletion nor the tea2-1 mutant was rescued by the 5′ truncation construct, 14X, that lacks 896 bp of the klp4 + ORF but leaves the downstream ORF intact . The 14T plasmid was also integrated into the genome, and the site of integration was genetically mapped to the tea2 + locus (described in Materials and Methods). In addition, the region corresponding to the klp4 + ORF was sequenced in DNA isolated from tea2-1 cells and shown to have a serine to phenylalanine transition at aa 384. This serine residue is in the motor domain and is a highly conserved aa found in nearly all klps. These results establish that tea2 + and klp4 + encode the same gene; from this point on, the gene will be referred to as tea2 + and its protein product as Tea2p. Sequence analysis of the genomic and cDNA clones indicated that tea2 + potentially encodes a 628-aa protein that is expressed from a transcript of at least 4.6 kb and that contains 2.6 kb of 3′ sequence. This 3′ region contains a second ORF of 658 aa . Because this is an unusual structure for an S . pombe gene, we sought additional evidence for the gene structure of tea2 + . The region corresponding to the tea2 + ORF hybridized to a ∼5-kb transcript on Northern blots . Northern blot analyses using probes further 3′ indicate that the ∼5-kb tea2 + transcript extends in this direction, and that a second transcript of 2.5 kb is present in this region . This smaller transcript presumably codes for the ORF in this region that is predicted from the genomic sequence. The junction between the two ORFs was confirmed by RT-PCR performed on RNA from wild-type cells. Primer B at the predicted 5′ end of the downstream gene was used for the reverse transcriptase reaction, and this primer in combination with primer A corresponding to the 3′ end of the tea2 + ORF was used for PCR. An RT-PCR product of 315 nucleotides was produced, indicating that this region is uninterrupted by introns (not shown). Analysis of the protein product further supports the proposed genomic structure of the region. Affinity-purified antibodies generated to the COOH-terminal region of Tea2p reacted with an ∼70-kD protein in wild-type cells, which was absent in cells deleted for the tea2 + ORF . Furthermore, tea2Δ cells expressing just the tea2 + ORF or the entire tea2 + cDNA under the control of the inducible nmt + promoter produced a protein of the expected size for Tea2p . Finally, the 2.6-kb 3′ region of the tea2 + transcript is not essential for rescue of the mutant phenotype. A multicopy plasmid containing the tea2 + ORF, 14H, rescued the phenotype of both tea2Δ and tea2-1 cells . Sequence searches using the motor domain of Tea2p revealed that of all the klps that have been characterized (beyond mere identification in a genome project), it is most similar to Saccharomyces cerevisiae Kip2p. Direct comparison of the motor domains, using the BestFit program from the GCG sequence analysis package, demonstrated that Tea2p and Kip2p are 58% similar and 51% identical over 332 aa. The motor domains of both proteins lie roughly in the middle of the proteins: the Kip2p motor domain extends from residues 97 to 500 within the 706-aa protein, and the Tea2p motor domain runs from residues 129 to 467 within the 628-aa protein. Outside the motor domain, the sequences are 35% similar and 26% identical over an 83-aa stretch in the NH 2 -terminal region and 46% similar and 32% identical over an 87-aa stretch in the COOH-terminal region . In the COOH terminus, Tea2p is predicted to contain one or two coiled coil regions of 28–41 aa, depending on the matrix employed and whether the weighting option was used . Kip2p also contains regions in the COOH terminus predicted to form a coiled coil, suggesting that both these motors are capable of self-association. An alignment containing Tea2p, Kip2p, and 41 other kinesin family members was analyzed with the phylogenetic program PAUP (version 4.0), assuming maximum parsimony and using a heuristic search method with stepwise addition (described in Materials and Methods). This analysis revealed that of 100 bootstrap replicas, 93 grouped Kip2p, Tea2p, and CaKrp together . A value of >90 strongly supports a phylogenetic relationship on statistical grounds . These klps represent a new subfamily, which we will refer to as the Kip2p subfamily after its founding member. To investigate further the cellular roles of Tea2p in S . pombe , a deletion allele was constructed by replacing the tea2 + ORF with his3 + . Transformants were screened by PCR, and homologous integration was confirmed by Southern blot analysis (not shown). At 32°C, tea2 Δ cells grow at rates similar to wild-type cells. These cells were examined by DIC microscopy to see if the deletion had an effect on the morphology of the cells. Cultures of exponentially growing cells contain ∼18% ( n = 117) obviously bent cells, whereas wild-type cells were generally straight cylinders, 0% bent . At 37°C, tea2Δ cells grew more slowly than wild-type cells, and a high percentage of T shaped cells were seen in the culture (up to 9%). These defects in cell morphology are similar to the tea2-1 mutant . Because defects in cell shape may be related to defects in the cytoskeleton and because tea2 mutant alleles have short cytoplasmic microtubules , we examined the microtubule cytoskeleton in tea2Δ cells . Exponentially growing cells were stained with antibodies to tubulin, and the cytoplasmic microtubule network was found to be severely reduced . The defects appeared to be more severe when the cells were fixed with aldehyde rather than methanol, perhaps because of a difference in microtubule stability that is reflected by sensitivity to fixation. Astral microtubules were examined in tea2Δ cells using a tubulin-gfp construct , and were found to be much shorter than those seen in wild-type cells (data not shown). It seemed possible that a transition from a phase of nongrowth to a phase of growth might involve an extensive reestablishment of cell polarity and therefore necessitate a relocalization of tip-defining components. This possibility was supported by an observation made during the cloning of tea2 + : tea2-1 cells had a more severe phenotype upon recovery from nutrient starvation. In addition, colonies of tea2Δ cells had variable percentages of T-shaped cells, perhaps caused by nutrient variations in the colony . To investigate these observations in more detail, we examined polarity reestablishment in tea2Δ cells as they emerged from stationary phase at 32°C. After tea2 Δ cells were grown to saturation in liquid rich medium and then diluted into fresh medium, 75% ( n = 700) acquired a T-shaped morphology. (Hundreds of wild-type cells examined all maintained their cylindical shape upon exit from stationary phase.) To more fully examine this defect in tea2Δ cells, 107 individual cells were followed by DIC microscopy through the first few divisions after release from stationary phase . 63 of the cells developed a T shape, 7 developed an L shape, and 6 developed other abnormal morphologies, whereas 31 developed relatively normally. T-shaped cells were tracked through their second division, and 36/39 of these cells grew again from the same ectopic site in the next division . In contrast, 34/34 of the normal shaped cells produced from the first division of the T-shaped cells underwent a normal subsequent division . This lineage analysis suggests that upon exit from stationary phase, a cell that intiates growth from an ectopic site generally continues to use that ectopic site in the subsequent division. Furthermore, once a cell acquires a nonbranched morphology (i.e., the daughter cell formed from the base of the T), this cell is able to maintain a relatively normal morphology in the following divisions. This latter point is further supported by the absence of T-shaped cells in exponentially growing cultures at 32°C. The short cytoplasmic microtubules in tea2Δ cells were generally clustered around the nucleus. This arrangement of the cytoskeleton might be especially detrimental in long cells because they may require a more extensive microtubule transport system for tip specification. To test this idea, the phenotype of tea2 Δ in genetic backgrounds that result in long cells was examined. Entry into mitosis is delayed in cdc25-22 cells even at permissive temperature, so these cells are 54% longer than wild-type cells at the time of division . tea2 Δ cdc25-22 cells grown at permissive temperature formed microcolonies of very long and often branched cells , indicating that the extra length of cdc25-22 cells cannot be tolerated in a tea2 Δ background. This interpretation was supported by similar observations in diploid cells, which are 85% longer than haploid cells . Homozygous diploid tea2 Δ cells grew poorly; they are very unstable, haploidize at a high frequency, and are often bent or branched . To investigate redundancy for essential functions of tea2 + and other klps, double, triple, and quadruple mutants were constructed with pkl1Δ , klp2Δ (C. Troxell and J.R. McIntosh, personal communication), klp3Δ , and tea2 Δ. All possible mutant combinations were constructed. Deletions were monitored by the auxotrophic markers used to delete each gene and by colony PCR using primers specific for each deletion. All combinations were viable at 32°C. To test for temperature sensitivity, each strain was streaked on a YES agar plate and grown at 32°C. These plates were replica plated to EMM agar with appropriate supplements and YES agar plates, and were incubated at 20°C, 25°C, 32°C, and 35.5°C. All mutant combinations were able to grow at these temperatures, suggesting that there are no redundancies of essential functions between Tea2p and these other klps. The cellular localization of Tea2p was determined by fusing the endogenous tea2 + at its 3′ end with the gene for GFP by homologous recombination. Exponentially growing cells were examined by epifluorescence microscopy, and Tea2p-GFP was seen concentrated at the cell tips with some fluorescence throughout the cytoplasm, particularly as cytoplasmic dots . Because the fluorescence from Tea2p-GFP was faint, some cells were fixed and stained with antibodies to GFP in an effort to enhance the signal . As in live cells, Tea2p-GFP was seen at the cell tips, but the signal to noise ratio of the overall cytoplasmic pattern was enhanced in fixed cells. Punctate staining throughout the cytoplasm was observed in these cells. This is likely to be a combined result of signal enhancement, due to the use of antibodies, and some delocalization caused by fixation. Costaining with antibodies to GFP and microtubules revealed that the most intense cytoplasmic dots generally colocalized with the interphase microtubules and were sometimes at the microtubules' ends . In mitotic cells, Tea2p-GFP was less concentrated at the cell tips . The localization of the GFP tagged allele was confirmed using antibodies generated against a fusion protein containing GST and the stalk/tail region of Tea2p. The resulting immune sera were affinity purified against a second fusion protein that contained the Tea2p stalk/tail region tagged with six histidines, and the purified antibodies were used to examine the localization of Tea2p in exponentially growing cells. Staining of tea2 Δ cells showed very faint cytoplasmic background fluorescence . In exponentially growing wild-type cells, Tea2p was detected at the cell tips and often at the end of cytoplasmic microtubules , whereas in mitotic cells Tea2p was less concentrated at the cell tips (not shown). Because of the severity of the morphological defects observed as cells emerged from stationary phase, the localization of Tea2p was examined in stationary phase cells and in cells as they were released from growth arrest. In fixed cells, Tea2p was more concentrated at the cell tips in stationary phase cells and in cells released from stationary phase than in exponentially growing cultures . This could be a reflection of increased resistance to delocalization by fixation, as well as to a change in distribution. Both in stationary phase and in cells exiting stationary phase, non–cell tip staining was often found to be coincident with microtubules or microtubule ends . To determine whether microtubules are required for Tea2p localization, the position of Tea2p was determined in the presence of the microtubule poison methyl 2-benzimidazolecarbamate (MBC). Because Tea2p is concentrated at the cell tips in cells exiting from stationary phase, this transition was used to characterize the need for microtubules for Tea2p tip localization. Wild-type cells were grown to stationary phase, diluted into fresh medium, and allowed to grow for 25 min. MBC (25 μg/ml) or DMSO (control cells) was then added to the culture, and the cells were further incubated with aliquots removed at 5, 8, and 20 min for staining with antibodies to Tea2p and microtubules. Although the cytoplasmic microtubule network was severely reduced at the 5- and 8-min time points, Tea2p remained concentrated at the cell tips . By 20 min, Tea2p was no longer concentrated at the cell tips, but after the drug was washed out and the microtubules were allowed to repolymerize, Tea2p relocalized to the cell tips . These results suggest that microtubules are required for transporting Tea2p to the tip but not for the short-term maintenance of this localization. Treatment with the microtubule poison thiabendazole (TBZ) or cold shock also resulted in the delocalization of Tea2p (data not shown). Tea1p is proposed to be an end marker that directs the growth machinery to the cell tip . It localizes to the cell tips throughout the cell cycle, and this localization is dependent on microtubules. To investigate the possible role of Tea2p in the localization of Tea1p, exponentially growing tea2-1 , tea2 Δ, and wild-type cells were stained with antibodies to Tea1p . In wild-type cells, Tea1p localized to the cell tips , whereas in the tea2-1 and tea2 Δ mutant cells, Tea1p localized primarily to the short cytoplasmic microtubules . Finally, to investigate whether Tea1p had an effect on Tea2p localization, we examined the localization of Tea2p-GFP in a tea1Δ strain. Tea2p-GFP was still localized at the cell tips, but was more extended in distribution along the microtubules compared with a wild- type strain . We have shown that tea2 + encodes a klp that is required to establish proper cellular morphology in the fission yeast. Mutant alleles of tea2 + , including its complete deletion, result in cytoplasmic microtubules of reduced length. Because microtubules are required for proper cellular morphology in S . pombe , the abnormal microtubule cytoskeleton is likely to contribute to the morphological abnormalities observed in tea2 Δ cells. These shape abnormalities are most severe in long cells, either diploids or mutants that are longer than haploid wild-type cells, and in cells progressing from a phase of nongrowth to a phase of growth. These results suggest that the importance of microtubules for normal cell growth varies with cell length and growth stage. Tea2p localizes to the cell tips and often to the ends of cytoplasmic microtubules including microtubules that do not reach the cell tip; its localization at cell tips is dependent on cytoplasmic microtubules. Analysis of microtubule dynamics in wild-type cells suggests that microtubules extend from the cell center out to the cell tips, with the minus ends located near the nucleus and the plus ends at the cell tips . Microtubules seen in fixed cells to extend from cell tip to tip probably represent two interphase arrays with minus ends overlapping near the cell equator . Thus, the localization of Tea2p at the cell tips suggests that, if this kinesin has motor activity, it is plus end directed. The localization of Tea2p and the phenotype of tea2 Δ and tea2-1 mutants are consistent with two mechanisms by which Tea2p might function: Tea2p may affect the length of microtubules through a direct interaction with the microtubules, or it could act indirectly by transporting one or more proteins to the plus end of microtubules, which in turn results in microtubule stabilization. In either case, because there is a high concentration of microtubule plus ends at the cell tips , the concentration of Tea2p at the cell tips supports the hypothesis that the Tea2p-mediated stabilization of microtubules is occurring at the plus ends of the microtubules. In the first model, Tea2p could act directly on the end of a microtubule to affect the rate of polymerization or depolymerization, or the frequency of rescue or catastrophy. Previous analyses have revealed that klps can affect the dynamic stability of microtubules in vitro . For example, Kar3p, a klp from S . cerevisiae , induces depolymerization from microtubule minus ends in vitro , and XKCM1 and XKIF2 from Xenopus destabilize both microtubule ends in vitro . Several microtubule-based motor proteins affect the lengths of the spindle and/or cytoplasmic microtubules of S . cerevisiae in vivo: deletion of KAR3 , DYN1 , or KIP3 results in longer cytoplasmic microtubules or spindles, whereas deletion or mutation of KIP2 , CIN8 , or KIP1 result in shorter cytoplasmic microtubules or spindles . In the second model, Tea2p would bind tip-specific protein(s) and transport them along microtubules to their plus ends. The cargo proteins could then modulate microtubule stability, promoting growth. As the microtubules elongate, by either the direct or indirect mechanism, they would be expected to reach the cell tip; interaction there with the cell cortex could provide additional regulation of the length and stability of the microtubule. Kirschner and Mitchison 1986 proposed a similar model to explain the reorganization of the microtubule cytoskeleton observed during polarization of various cell types. They suggested that the asymmetric reorganization of the microtubule cytoskeleton could be controlled at the cell periphery by a localized stabilization of the microtubule ends. Cortical complexes that interact with microtubules have been described previously. For example, in several organisms, alignment of the mitotic spindle is thought to occur through an interaction of the astral microtubules and the cell cortex, resulting in the rotation or movement of the centrosome–nuclear complex or mitotic spindle toward the cortical site . In S . cerevisiae , capture of astral microtubules at the cortical site appears to occur through an interaction between the EB1 homologue Bim1p and the cortical marker protein Kar9p . The analyses of klps in S . cerevisiae have provided a wealth of information about the roles of these enzymes in cell behavior, but none of the mutations in budding yeast has the effect described here for the deletion of tea2 + in fission yeast. This is likely to be due to the observation that S . cerevisiae , in contrast to S . pombe , does not require cytoplasmic microtubules for morphological decisions and development . Instead, microtubules and microtubule motors are required for the proper positioning of the nucleus, spindle formation and function, mating, and karyogamy . Tea2p is most similar in sequence to the S . cerevisiae Kip2p and to a klp identified by the Candida albicans genome project. Phylogenetic analysis illustrates that these enzymes represent a new subfamily of klps. Although deletion of KIP2 also results in short cytoplasmic microtubules, the consequence is a defect in nuclear migration rather than a change in cellular morphology . This difference in phenotypic effect could be a result of the different functions of cytoplasmic microtubules in these two yeasts rather than a divergence in the role of the related klps. Tea2p may also transport proteins that help to define the cell's growing tip. Several proteins that are important for cell morphology are also localized to the cell tip including Tea1p and Pom1p . These two proteins are candidates for cargoes of Tea2p because disruption of microtubules disrupts their localization . Pom1p is a protein kinase required for the reinitiation of growth from the old end of the cell after cytokinesis, the switch to bipolar growth, and the positioning of the septum . The microtubule network in pom1 Δ cells appears normal , so this protein is more likely to be part of a tip-defining complex rather a microtubule-regulating complex. Tea1p has been proposed to direct the cell growth machinery to the cell tip . Tea1p localizes to the cell tips throughout the cell cycle, and its localization is dependent on microtubules. In the absence of Tea1p, 30–35% of cells are obviously bent during phases of growth, suggesting that this protein is required for normal antipodal growth. Cells deleted for tea1 + can have unusually long cytoplasmic microtubules that curl around the end of the cell in 10–15% of the cells versus <0.5% in wild-type cells . This microtubule phenotype supports the hypothesis that Tea1p is part of a microtubule-controlling complex. In the absence of Tea2p, Tea1p localizes along the short cytoplasmic microtubules characteristic of tea2 Δ cells. Therefore, although Tea1p has an affinity for microtubules in the absence of Tea2p, proper localization of Tea1p to the cell tip requires Tea2p. One possibility is that Tea2p transports Tea1p along microtubules and deposits it at the cell tip. A second possibility is that Tea1p uses another microtubule-mediated mechanism to get to the tip of the cell, and the absence of a normal array of cytoplasmic microtubules in tea2 Δ cells results in the mislocalization of Tea1p. Tea1p may also have a direct effect on Tea2p localization. When tea1 + is deleted, Tea2p is distributed more broadly along the microtubules, possibly because it is moving more slowly or binding to microtubules less efficiently. Alternatively, Tea1p may be required for efficient anchoring of Tea2p to the cell tip. Interestingly, although both proteins require microtubules for tip-specific localization, they are able to remain at the cell tips for short periods in the absence of microtubules, suggesting that the requirement for microtubules is for transport but not for anchorage . Our analyses of Tea2p and tea2 mutant cells provide new evidence for the role of microtubules in the proper positioning of the growth site in fission yeast. The involvement of the microtubule cytoskeleton in the control of cell shape is a widely observed phenomenon that is likely to have many conserved components. Determining whether the mechanism by which Tea2p functions is through the direct stabilization of microtubules or the transport of a microtubule-regulating complex will provide insight into the control of morphogenesis in S . pombe , and this mechanism may represent a more general function of klps in the morphology of eukaryotic cells. | Other | biomedical | en | 0.999998 |
0004087 | Dynamic regulation of the actin cytoskeleton plays a central role in a variety of cellular events, including adhesion, division, spreading, and motility . Engagement or activation of cell surface growth factors and adhesion receptors influences the assembly and arrangement of F-actin networks . Transmission of extracellular signals to the actin cytoskeleton is governed by small GTPases of the Rho family, as well as by the activity of numerous actin-binding proteins . The Rho family GTPases, Cdc42 and Rac, play a critical role in the formation and organization of cortical actin networks in mammalian cells. Treatment of cells with agents that increase GTP-bound Cdc42 stimulates filopodia formation , whereas activation of Rac leads to membrane ruffle and lamellipodia formation . Formation of cortical actin networks, resulting either from EGF stimulation or activated Rac , requires de novo formation of F-actin filaments, indicating that Cdc42 and Rac integrate signal pathways leading to actin polymerization. In addition, Rac activation is closely coupled to activation of Cdc42 , allowing for the coincident and coordinated formation of filopodia and lamellipodia that are often concurrently observed at the leading edge in motile cells . Actin polymerization at the leading edge provides the protrusive force required for the extension of lamellipodia observed during cell motility and spreading . Cortical actin polymerization initiated by Cdc42 and Rac requires the participation of members of the Wiskott-Aldrich Syndrome protein (WASp) superfamily . Binding of activated Cdc42 to N-WASp induces filopodia , whereas Rac-induced membrane ruffling utilizes the structurally related protein Scar1 (also known as WASp family verpolin-homologus protein [WAVE]) . All WASp/Scar family proteins contain a carboxyl-terminal motif rich in acidic residues, which is responsible for their activity and mediates binding to the actin-related protein (Arp) 2/3 complex . Arp2/3 complexes consist of the actin-related proteins Arp2 and Arp3 along with five other proteins designated p41-, p34-, p21-, p20-, and p16-Arc (also designated as ARPC1–5). Arp2/3 complex binds to the sides of preexisting actin filaments and stimulates new filament formation to create branched actin networks, a process termed the “dendritic nucleation” model of cortical actin assembly . As predicted by this model, the Arp2/3 complex is located at branch points of actin filament networks in lamellipodia, as seen by electron microscopy , and is localized to sites of dynamic actin assembly and motility in living cells . Arp2/3-induced actin nucleation and polymerization are greatly enhanced by the binding of WASp family acidic carboxyl-terminal domains to p21-Arc , thus providing a molecular link for Cdc42 and Rac leading to cortical actin polymerization . In addition to the Arp2/3 complex, several actin binding proteins are selectively recruited into cortical actin structures upon activation of Cdc42 or Rac , including the Src kinase substrate cortactin , an actin binding protein enriched within lamellipodia . The localization of cortactin within membrane ruffles and lamellipodia is controlled by activation of Rac . Cortactin possess a multidomain structure consisting of an acidic domain at the amino terminus, followed by 6 and 1/2 tandemly repeated 37–amino acid segments, an α helical region, a proline-rich segment, and a Src homology (SH) 3 domain located at the carboxyl terminus . The direct binding to F-actin is mediated through sequences within the tandem repeat region . The SH3 domain interacts with several postsynaptic density (PSD)95/dlg/ZO-1 (PDZ) domain–containing proteins, including cortactin-binding protein 1 (CortBP1) , SHANK3 , ZO-1 , and an unrelated protein cortactin-binding protein (CBP-90) . Tyrosine phosphorylation of cortactin occurs in response to a wide variety of cellular events, including v-Src transformation , growth factor treatment , bacterial invasion , osmotic stress , and integrin or syndecan-3 ligation with the extracellular matrix . These previous studies suggest that cortactin plays an important role in coupling tyrosine kinase–based signaling events to cortical cytoskeletal reorganization. We have investigated the molecular mechanism by which cortactin interacts with the dynamic actin cytoskeleton. In this report we provide evidence that the Rac-induced localization of cortactin to the cell periphery requires two separate regions within the amino terminus: the amino-terminal acidic domain (NTA) and the fourth tandem repeat. We find that the fourth repeat is necessary for the F-actin binding activity of cortactin and that the NTA region binds directly to the Arp2/3 complex. Cortactin colocalizes with Arp2/3 complex at sites of dynamic actin assembly in lamellipodia. We propose that one of the roles of cortactin is to link PDZ-containing scaffolding proteins to sites of Arp2/3-mediated cortical actin assembly. Cortactin expression constructs were created by PCR amplification of mp85.L7 . For production of cytomegalovirus (CMV)-driven cortactin constructs containing the FLAG epitope, the following cDNA fragments were produced by PCR: N-term (codons 1–330), NTA (codons 1–84), repeats (codons 85–330), and C-term (codons 350–546). All 5′ primers contained a KpnI restriction endonuclease site and all 3′ primers contained a stop codon followed by an EcoRI site. Amplified products were subcloned into KpnI-EcoRI–digested pcDNA3FLAG2AB . In some cases, PCR fragments were first cloned into PCR-Script (Stratagene) before subcloning. For construction of full-length cortactin lacking the fourth repeat, a KpnI-BamHI PCR fragment spanning the amino terminus to the end of the third repeat (codons 1–195) was ligated in frame with a BamHI-EcoRI fragment encoding the start of the fifth repeat through the carboxyl terminus (codons 232–546) and KpnI-EcoRI–digested pcDNA3FLAG2AB. The full-length FLAG-tagged cortactin construct has been described previously . CMV-driven myc-tagged cortactin expression constructs were produced by PCR as BamHI-EcoRI fragments and subcloned into BamHI-EcoRI–digested pRK5myc . Constructs produced were: full-length (codons 1–546), N-term (codons 1–330), N-repeat 5 (codons 1–269), N-repeat 4 (codons 1–232), N-repeat 3 (codons 1–195), N-repeat 2 (codons 1–158), N-repeat 1 (codons 1–121), repeat 3-C-term (codons 158–546), repeat 4-C-term (codons 195–546), repeat 5-C-term (codons 232–546), repeat 6-C-term (codons 269–546), and C-term (codons 350–546). FLAG-RacL61 was constructed by digestion of pRK5myc-RacL61 with BamHI and EcoRI, and the resultant Rac cDNA fragment was subcloned into BamHI-EcoRI–digested pcDNA3FLAG2AB. Expression and immunoreactivity of each cortactin variant were verified by Western blotting of whole cell lysates with either the antiepitope tag mAbs M5 (against FLAG) or 9E10 (against myc) and anticortactin antibodies (data not shown). For production of the glutathione S -transferase (GST)-cortactin prokaryotic expression constructs, GST-N-term, GST-NTA, and GST-repeats, BamHI-EcoRI PCR fragments were produced encoding the appropriate codons and subcloned into BamHI-EcoRI–digested pGST-parallel 2 (a gift from P. Sheffield, University of Virginia), as described previously . For the GST-N-repeat 5 construct, pRK5myc-N-repeat 5 was digested with BamHI and EcoRI and the cortactin fragment was subcloned into pGST-parallel 2. The GST construct containing the verpolin homology, cofilin, and acidic (VCA) domains of N-WASp has been described previously . All PCR-generated constructs were verified by DNA sequencing. The anticortactin antibodies anti-N-term, anti-C-term, and 4F11, have been described previously . The specificity of the anti-N-term and C-term cortactin antibodies was verified by Western blotting of transfected cell lysates . The 9E10 mAb against the cmyc epitope was purchased from Santa Cruz Biotechnology, Inc. Anti-FLAG mAb M5 was purchased from Sigma-Aldrich. Affinity-purified rabbit pAbs against p21-Arc and Arp3 (a gift from M. Welch, University of California at Berkley, Berkeley, CA) were used for immunofluorescence detection of the Arp2/3 complex; rabbit antisera against Arp3, Arp2, and p34-Arc were used for Western blotting (a gift from L. Machesky, University of Birmingham, Birmingham, England) . Fluorescently labeled secondary antibodies were purchased from Molecular Probes, Jackson ImmunoResearch Laboratories, and CHEMICON International, Inc. Secondary antibodies coupled to horseradish peroxidase were purchased from Amersham Pharmacia Biotech. Western blotting was performed as described previously . Primary antibodies were used at the following concentrations or dilutions: 9E10 (3 μg/ml), M5 (5 μg/ml), 4F11 (1 μg/ml), anti-N-term or anti-C-term (1 μg/ml), Arp3 (1:500), and p34-Arc (1:500). Primary antibodies were detected with the appropriate horseradish peroxidase–conjugated secondary antibody (1:2,000) and immunoreactive bands were visualized using enhanced chemiluminescence (ECL; Amersham Pharmacia Biotech). Protein concentrations were determined using a bicinchonic acid assay kit (BCA; Pierce Chemical Co.). Swiss 3T3, C3H 10T1/2 (a gift from S. Parsons, University of Virginia), and PtK1 cells expressing a green fluorescent protein (GFP)-Arp3 fusion were cultured as described previously . Subconfluent, serum-starved Swiss 3T3 cells were prepared as described . Microinjection of myc-tagged cortactin constructs and membrane ruffling initiated by PDGF and PMA were performed as described . At least 50 microinjected cells expressed each construct as determined by immunofluorescence microscopy. For transfection experiments, C3H 10T1/2 cells were grown to 80% confluence in 100-mm dishes and transfected with 10 μg of each epitope-tagged cortactin construct using SuperFect™ (QIAGEN). Cotransfection experiments with epitope-tagged RacL61 and cortactin constructs were conducted at a 4:1 (wt/wt) Rac/cortactin ratio. For immunofluoresence studies, cells were cultured 18 h after transfection, detached with trypsin/EDTA, neutralized with soybean trypsin inhibitor (Sigma-Aldrich), plated onto fibronectin-coated coverslips, and allowed to spread for 1 h, after which cells were fixed and processed for immunofluorescence microscopy. A minimum of 75 cotransfected cells was evaluated for each cortactin construct. Swiss 3T3 and C3H 10T1/2 cells were fixed and immunolabeled as described . Epitope-tagged constructs were detected with either M5 (5 μg/ml) or 9E10 (3 μg/ml). Endogenous cortactin was labeled with either anti-N-term or anti-C-term (2 μg/ml). PtK1 cells were immunolabeled as described . Cells were double labeled with the anticortactin mAb 4F11 (0.9 μg/ml) and anti-Arp3 (4 μg/ml) or p21-Arc (6 μg/ml). GFP-Arp3–expressing cells were labeled with 4F11. F-actin binding assays were adapted from Fanning et al. 1998 . Confluent 100-mm dishes of transfected C3H 10T1/2 cells were rinsed twice with PBS and collected on ice by scraping into 0.5 ml of binding buffer (10 mM imidazole, pH 7.2, 75 mM KCl, 5 mM MgCl 2 , and 0.5 mM DTT) supplemented with 1 mM EGTA, 1 μg/ml leupeptin, and 1 μg/ml aprotinin. Cells were lysed with a Dounce homogenizer (50 strokes), and the lysate was centrifuged at 100,000 g for 1 h at 4°C. Rabbit muscle G-actin (Cytoskeleton) was diluted to 2.5 mg/ml in binding buffer and polymerized for 1 h at room temperature. F-actin (5.5 μM) was incubated with 60–80 μl of cell lysate (∼50 μg of protein) in a final volume of 200 μl for 30 min at room temperature. Samples were centrifuged at 100,000 g for 1 h at 20°C in a 42.2 Ti rotor (Beckman Instruments), the supernatant was removed, and the pellet was incubated for 1 h at 4°C with 50 μl of G buffer (5 mM Tris-HCl, pH 8.0, 0.2 mM ATP, 0.5 mM DTT, and 0.2 mM CaCl 2 ) . Supernatant and pellet fractions were normalized, and equal amounts were solublized in 2× SDS-PAGE sample buffer. Fractions were analyzed by SDS-PAGE and Western blotting with 4F11, M5, or 9E10 mAbs. Binding was quantitated by densitometric scans of the x-ray films shown in Fig. 3 and Fig. 4 for each immunoreactive band or an equivalent area from films exposed in a linear range using the program ImageQuant ® (v.1.2; Molecular Dynamics). Percent bound was calculated as: P / S + P × 100, where S and P are the amounts of cortactin immunoreactivity in the supernatant ( S ) and pellet ( P ) fraction. GST-cortactin constructs were transformed into Escherichia coli strain DH5α, and fusion proteins were purified from isopropyl-1-thio-β- d -galactopyranoside–induced bacteria, as described . Fusion proteins were captured by incubation with glutathione–Sepharose 4B (5 ml/2 liters of culture; Amersham Pharmacia Biotech) and eluted with 10 mM reduced glutathione in suspension buffer (20 mM Tris-HCl, pH 8.0, 0.3 M NaCl, and 0.5 mM EDTA). TEV™ protease (300 U; GIBCO BRL) was added to the eluate, and the solution was dialyzed overnight at 4°C against 4 liters of suspension buffer containing 1 mM DTT. In cases of incomplete digestion, an additional 200 U of TEV™ was added, and the solution was incubated at 16°C overnight. Cleaved GST was removed by the addition of glutathione-Sepharose. TEV™ protease was removed by the addition of 200 μl of Ni-NTA™ agarose (50% slurry; QIAGEN). Arp2/3 complex was purified from bovine brain as described . Protein purity was monitored by Coomassie blue staining after SDS-PAGE, with all products estimated to be at least 90–95% pure. Recombinant cortactin fragments (10 mg) were coupled to cyanogen bromide–activated Sepharose 4B (Amersham Pharmacia Biotech) according to the manufacturer's instructions. Resins were suspended in 1 ml of column buffer (20 mM Hepes-KOH, pH 7.8, 50 mM KCl, 1 mM EDTA, and 1% NP40) and stored at 4°C. Coupling efficiency was ∼90%. For affinity purification of amino-terminal cortactin binding proteins, extracts were initially prepared from murine brain. Whole brain tissue from 11 5–6-wk-old NIH 3T3 mice was Dounce homogenized in 8 ml of column buffer containing 10 mg/ml leupeptin and 1 mM PMSF. The lysate was centrifuged at 1,900 g for 10 min, and the supernatant was stored at −80°C. Cortactin N-term–Sepharose beads (100 μl of a 50% slurry containing ∼1 mg of coupled protein) were incubated with 16 mg of brain lysate (4 mg/ml) for 30 min at 4°C. Beads were then washed with 4 ml of column buffer followed by 3 ml of column buffer containing 150 mM KCl. Bound proteins were eluted with 60 μl of SDS-PAGE sample buffer, separated by SDS-PAGE, and visualized by Coomassie blue staining or by Western blotting. Coomassie-stained bands representing proteins specifically associated with cortactin N-term were excised, trypsin digested, subjected to liquid chromatography mass spectrometry (LC-MS) analysis , and analyzed by searching the NCBI database using a computer-based algorithm . Additional experiments were performed using C3H 10T1/2 fibroblast lysate with an N-repeat 5 resin, since this protein was purified at much higher yields than cortactin N-term. Cells were lysed in column buffer containing inhibitors and centrifuged at 5,000 g for 5 min, and 3 mg of lysates (6 mg/ml) were incubated with 80 μl of GST, N-repeat 5, NTA, or repeats-Sepharose for 2 h at 4°C. After incubation, beads were washed twice with lysis buffer, and bound proteins were analyzed by Western blotting with anti-Arp3 antibodies. C3H 10T1/2 cells transfected with FLAG-tagged cortactin constructs were lysed in lysis buffer supplemented with protease and phosphatase inhibitors (10 μg/ml leupeptin, 1.0 U/ml aprotinin, 0.5 mM PMSF, 0.5 mM EDTA, 1 mM sodium vanadate, and 40 mM sodium fluoride) and centrifuged at 5,000 g for 5 min. Clarified lysates (700 μg) were incubated with 20 μl of FLAG M2 affinity resin (Sigma-Aldrich) for 2 h at 4°C. Immune complexes were collected by centrifugation, washed twice with 1.0 ml of lysis buffer, separated by SDS-PAGE, and Western blotted with anti-Arp2, -Arp3, and -M5 antibodies. Arp2/3 complex (700 ng) was incubated with Sepharose conjugated to GST, cortactin NTA, cortactin N-repeat 5 or cortactin repeats 1–5 in 200 μl of binding buffer (20 mM Hepes, pH 7.5, 50 mM KCl, 1 mM EDTA, 0.1 mM ATP, 1% NP40) for 30 min at 4°C. The Sepharose was collected by centrifugation, washed twice with binding buffer without ATP, and bound Arp2/3 was visualized by Western blotting with anti-Arp3 after SDS-PAGE. For affinity measurements, 2.1 nM Arp2/3 was incubated with 0.46, 1.2, 2.3, and 4.7 μM cortactin N-repeat 5, as described above. The amount of Arp2/3 bound to cortactin was quantitated by densitometry and ImageQuant ® as described above. Actin polymerization assays were conducted essentially as described . In brief, recombinant cortactin proteins (0.2–2.0 μM) or the GST-VCA fragment of human N-WASp (a gift from Marie-France Carlier, Dynamique du Cytosquelette, Laboratoire d'Enzymologie et Biochemie Structurales, Gif-sur-Yvette, France) were incubated with 10 nM Arp2/3 complex in 20 mM imidazole, pH 7.0, 100 mM KCl, 2 mM MgCl 2 , and 1 mM EGTA at 25°C. Actin polymerization was initiated by the addition of monomeric actin (7.5% pyrene labeled) and monitored by continuous measurement of the emission at 386 nm in a SPEX FluoroMax fluorometer (JY, Inc.). The temperature was maintained at 25°C throughout the experiment. In serum-starved cells, growth factor–mediated activation of Rac1 leads to the translocation of cortactin from cytoplasmic pools into lamellipodia, where it colocalizes with cortical F-actin . To identify the cortactin sequences necessary for lamellipodia localization, epitope-tagged cortactin expression constructs encoding various regions of the protein were introduced into mouse fibroblasts, and the Rac-induced translocation of the variant cortactin proteins to the cell cortex was evaluated . Subconfluent, serum-starved Swiss 3T3 fibroblasts were microinjected with either myc-N-term or myc-C-term constructs, and the intracellular distribution of N-term and C-term cortactin was compared with that of endogenous cortactin . In serum-deprived cells, myc-N-term, myc-C-term, and endogenous cortactin were diffusely distributed throughout the cytoplasm . Treatment of cells with PDGF or PMA, agents that activate Rac , resulted in the accumulation of myc-N-term and endogenous cortactin within membrane ruffles at the cell cortex . Myc-C-term cortactin failed to translocate efficiently to the cell periphery . Therefore, the amino-terminal half of the cortactin molecule is necessary to target cortactin to the cell periphery. To determine which region(s) within the amino-terminal domain are required for Rac-induced cortactin translocation, FLAG-tagged cortactin expression constructs were cotransfected with constitutively active myc-RacL61 into 10T1/2 fibroblasts. After plating on fibronectin for 1 h, cells expressing RacL61 were flat and round, with cortactin localized almost exclusively at the cell cortex . FLAG-full-length cortactin and FLAG-N-term showed peripheral localization, whereas FLAG-C-term did not localize to the cortex, although endogenous cortactin did localize correctly . To further delineate the regions within the amino-terminal domain responsible for cortical targeting, FLAG-tagged constructs that encoded the NTA and the repeats domain (encompassing the six and one half tandem repeat sequences) were tested . Both FLAG-NTA and FLAG-repeats failed to accumulate at the cell cortex when coexpressed with myc-RacL61, in spite of the near complete translocation of endogenous cortactin in cells expressing these constructs . These data indicate that both the NTA and the repeat region are necessary for translocation of cortactin to the cell cortex, and that neither region alone is sufficient for translocation. Since the actin binding activity of cortactin is contained within the tandem repeat region , cells expressing various FLAG-tagged cortactin constructs were lysed and the actin binding activity of the tagged cortactin constructs was evaluated . FLAG-full-length and FLAG-N-term cosedimented with F-actin, whereas FLAG-C-term did not . FLAG-repeats, which lacks the NTA region, bound actin at levels comparable to FLAG-N-term . These data suggest that F-actin binding alone is insufficient for the peripheral localization of cortactin. The sequences of the six 37–amino acid tandem repeats in the cortactin amino terminus are highly similar to each other . To determine whether one or more of the tandem repeats was involved in cortical targeting, a series of myc-tagged cortactin expression constructs was produced that retained the NTA, but in which the individual tandem repeats were truncated from the carboxyl terminus of the myc-N-term construct . Myc-N-term, Myc-N-repeat 5, and N-repeat 4 accumulated at the cell edge, but translocation of N-repeat 3, N-repeat 2, or N-repeat 1 (not shown) was significantly reduced . These results suggest that the fourth repeat is required for cortical targeting. To directly test this, a full-length cortactin construct was produced lacking the fourth repeat (FLAG-full-lengthΔ4) and assayed for cortical localization, where it also failed to accumulate at the cell periphery . Endogenous cortactin translocated normally in all experiments. Taken together with the data presented above, we conclude that sequence elements within the fourth tandem repeat of cortactin are necessary for localization to the cell cortex. Cortactin binds directly to F-actin with a K d of 0.4 μM , suggesting that targeting of cortactin to the leading edge may involve direct binding to cortical actin filaments. To define the portion of the repeat region responsible for actin binding, myc-N-term constructs containing serial deletions of individual repeats were assayed for F-actin binding in cell lysates . Myc-N-term and myc-N-repeat 5 bound actin at comparable levels, whereas myc-N-repeat 4 bound actin at diminished levels . Myc-N-repeat 3, myc-N-repeat 2, and myc-N-repeat 1 all failed to bind F-actin . These data map the actin binding region of cortactin between the fourth complete and seventh partial tandem repeats. To further define which sequences within this region were required for actin binding, myc-tagged cortactin constructs were produced where the NTA and the individual tandem repeats were serially deleted from full-length cortactin beginning with the third repeat . Myc-repeat 3-C-term displayed strong binding to F-actin, whereas myc-repeat 4-C-term weakly associated with F-actin . Myc-repeat 5-C-term, myc-repeat 6-C-term, and myc-C-term all failed to significantly bind F-actin . These data indicate that repeat four is central to the actin binding activity of cortactin, with efficient binding requiring a single adjacent repeat, either repeat three or repeat five . The requirement for repeat four in actin binding was directly examined using FLAG-full-lengthΔ4, where removal of repeat four eliminated the binding of cortactin to F-actin . These data, combined with the requirement for repeat four in cortical targeting, suggest that the ability of cortactin to localize with cortical actin networks in vivo requires the actin binding site located within the fourth tandem repeat. Although the actin binding domain in repeat four is essential for cortical localization, the inability of the repeats region alone to target the cell cortex indicated that actin binding alone is insufficient for localization at the cell periphery. The NTA alone also failed to target to the cortex, but the NTA plus the repeats (i.e., N-term) did target appropriately. Therefore, we searched for other proteins that might interact with the amino-terminal domain and contribute to cortactin translocation. The cortactin amino-terminal domain was expressed in E . coli as a GST fusion protein, and the purified protein was covalently coupled to agarose beads. After application of a mouse brain extract, the affinity matrix was washed extensively and bound proteins were subjected to SDS-PAGE . Based on a comparison with control lanes, 13 bands that appeared to represent proteins specifically associated with the cortactin amino-terminal domain were selected for LC-MS analysis. Sequence analysis and a search of the National Center for Biotechnology Information database revealed that four bands contained peptide sequences corresponding to five members of the Arp2/3 complex . The presence of Arp2/3 complex proteins associated with N-term, but not control beads, was confirmed by Western blotting with antisera specific for Arp3 and p34Arc . These data indicate that the Arp2/3 complex represents a subset of the proteins that interact with the amino terminus of cortactin. To identify the region within the cortactin amino terminus responsible for associating with the Arp2/3 complex, Sepharose beads covalently coupled to the NTA and repeats regions were incubated with 10T1/2 fibroblast lysate, and Arp2/3 binding was assayed by immunoblotting . Arp3 specifically bound to N-repeat 5 (see Materials and Methods) and NTA beads, but not to GST and repeats beads , indicating that the NTA region is responsible for association with the Arp2/3 complex. To confirm the interaction between cortactin and the Arp2/3 complex in vivo, 10T1/2 fibroblasts were transfected with FLAG-cortactin expression constructs, and overexpressed cortactin fusion proteins were immunoprecipitated with anti-FLAG. Coimmunoprecipitation of Arp2/3 complex proteins was assessed by immunoblotting. Both Arp3 and Arp2 (data not shown) coimmunoprecipitated with FLAG-full-length, FLAG-N-term, and FLAG-NTA. Precipitation of FLAG-repeats and FLAG-C-term fusion proteins failed to coprecipitate the Arp2/3 complex . Precipitation of each FLAG-cortactin peptide was verified by immunoblotting with the anti-FLAG mAb M5 . These data support the conclusion that cortactin interacts with the Arp2/3 complex through sequences within the 84–amino acid NTA domain. To determine whether the association of cortactin with Arp2/3 was direct, affinity chromatography assays were performed with various Sepharose-conjugated amino-terminal cortactin proteins and purified Arp2/3 complex . Purified Arp2/3 complex bound to both NTA- and N-repeat 5–Sepharose but failed to bind to Sepharose alone, GST, or repeat 1–5–Sepharose . Furthermore, addition of increasing amounts of cortactin N-repeat 5-Sepharose to a fixed amount of Arp2/3 complex displayed saturable binding, with an estimated K d of 1.3 μM . These data strongly indicate that cortactin directly interacts with the Arp2/3 complex. Since cortactin binds directly to Arp2/3 complex, we hypothesized that cortactin might stimulate the actin nucleation activity of Arp2/3. Stimulation of Arp2/3 complex was measured in a pyrene actin polymerization assay . Nucleation of new actin filaments by Arp2/3 complex causes a rapid rise in pyrene actin fluorescence due to the increased number of free barbed ends available for polymerization . In the presence of 10 nM Arp2/3 complex and 2.5 μM actin, cortactin N-repeat 5 (curve b), repeat 1–5 (curve c), full-length (curve d), and NTA (curve f) (all at 0.5 μM) failed to stimulate Arp2/3 complex to nucleate new actin filaments . Concentrations of cortactin proteins up to 1 μM did not activate the Arp2/3 complex ( n = 3, data not shown). Addition of the N-WASp VCA domain (curve a) strongly promoted actin nucleation, indicating that the Arp2/3 complex was functional. Also, cortactin proteins, at concentrations up to 2 μM, did not inhibit the ability of the VCA fragment at threshold (0.5 nM) concentrations to activate Arp2/3 complex. When the concentration of the Arp2/3 complex was increased 10-fold to 100 nM, cortactin at 0.5 μM showed weak activation of nucleation. The nature of the weak cortactin-dependent nucleation activity is currently under study. To determine if cortactin and the Arp2/3 complex were present within the same subcellular compartments, cortactin and Arp2/3 complex localization in fibroblast lamellipodia was determined by indirect immunofluoresence. Double staining of PtK1 cells with antibodies specific for Arp3 or p21-Arc and the anticortactin mAb 4F11 yielded very similar staining patterns, with both components being present at the leading edge and in peripheral spots . Merged images demonstrated a large degree of overlap in both subcellular regions. Colocalization of cortactin with Arp3 was also demonstrated in a PtK1 cell line stably expressing GFP-Arp3 . GFP-Arp3 and cortactin were both present at the leading edge and within peripheral spots, with significant overlap in merged images . Based on these data, we conclude that cortactin is a component of the Arp2/3-regulated cortical actin structures present in lamellipodia. Cortactin is involved in several protein tyrosine kinase–based signaling pathways, where its phosphorylation is coincident with reorganization of cortical actin cytoskeletal networks. The localization of cortactin with cortical F-actin within lamellipodia requires Rac activity . The sequences responsible for the selective targeting of cortactin to the cell periphery are unknown. In this report we provide evidence that Rac-induced localization of cortactin to the cell cortex requires two distinct sequence motifs within the amino-terminal half of the protein. One targeting motif encompasses the fourth 37–amino acid tandem repeat. Removal of repeat four abolishes the ability of cortactin to localize at the cell periphery in cells cotransfected with RacL61 and greatly diminishes binding of cortactin to F-actin in vitro. The second localization motif resides within the 84–amino acid NTA region and is also required for Rac-induced cortical localization. The NTA region binds to the Arp2/3 complex as determined by affinity chromatography and immunoprecipitation from cell lysates and by direct binding assays with purified cortactin and the Arp2/3 complex. Immunofluoresence localization experiments support a functional interaction between cortactin and the Arp2/3 complex in that the Arp2/3 complex and cortactin colocalize at the leading edge and within punctate spots within lamellipodia, both regions of active actin dynamics. Therefore, we conclude that the Rac-induced interaction of cortactin with cortical sites of actin assembly requires the bipartite interaction of cortactin with actin filaments and the Arp2/3 complex . Cortactin interacts with components of the cortical actin network in several cell types. In addition to the lamellipodia of cultured cells , cortactin is also found at sites of cortical F-actin reorganization in many differentiated cells, including growth cones and the PSD of neurons , the terminal web of polarized epithelia , and neuromuscular junctions . The biochemical mechanism discussed here, in which cortactin interacts with both F-actin and the Arp2/3 complex, may also be the basis for the interaction of cortactin with dynamic actin in these other specialized cellular compartments. Regulation of the actin cytoskeleton plays an essential role in the organization of transmembrane receptor complexes within highly specialized cell structures . The data presented in this report, in conjunction with the characterization of several cortactin SH3 domain binding proteins, leads us to propose that cortactin functions to link a variety of cell surface receptors to sites of Arp2/3-directed actin polymerization . In neurons, the SH3 domain of cortactin interacts with members of the CortBP1/SHANK family of scaffolding proteins . CortBP1/SHANK proteins possess a single PDZ domain and are capable of interacting directly with the type 2 somatostatin receptor or indirectly through the scaffolding proteins guanylate kinase–associated protein (GKAP), PSD95, or Homer to the N -methyl- d -aspartate (NMDA), inositiol trisphosphate, or metabotropic glutamate receptors . Additionally, the SH3 domain of cortactin binds ZO-1, a component of tight junctions . Tight junctions occur in the terminal web of polarized epithelia , a region where ZO-1 and cortactin are colocalized . ZO-1 is structurally similar to PSD-95 and has been implicated in regulating tight junction assembly . ZO-1 binds to cytoplasmic motifs in occludin and claudin , two transmembrane proteins implicated in forming the paracellular seal between adjacent cells . Therefore, the coupling of ZO-1 to Arp2/3-mediated actin dynamics by cortactin may in part contribute to the organization and assembly of transmembrane networks within tight junctions as well as at the PSD . Activation of the Arp2/3 complex has been suggested to be critical for protrusive-based actin locomotion . Colocalization of cortactin with the Arp2/3 complex at the leading edge and in protrusive distal lamellar regions , the direct binding of cortactin to Arp2/3 in vitro, and the tyrosine phosphorylation of cortactin in response to growth factor receptor activation suggest a role for cortactin in linking sites of actin polymerization to cell surface receptor complexes. The observation that cortactin does not efficiently stimulate Arp2/3-dependent actin nucleation (although low levels of nucleation are observed at higher concentrations of Arp2/3) is consistent with cortactin not being a direct activator of actin polymerization. However, it is possible that additional factors/proteins may cooperate to increase the effect of cortactin on Arp2/3 activation. Thus, possible functions of cortactin may be to bridge sites of dynamic actin reorganization with receptor signaling complexes and/or to recruit, via SH3 interactions, other proteins that may positively or negatively regulate Arp2/3 actin polymerization. In addition to WASp/Scar family proteins, binding of ActA from Listeria monocytogenes or yeast Myo3p and 5p stimulates actin reorganization mediated entirely, or in part, by the Arp2/3 complex. Whereas carboxyl-terminal acidic regions from WASp and Scar bind to p21-Arc , Myo3p and 5p bind Arc40p (equivalent to mammalian p41-Arc) through the carboxyl-terminal tryptophan residue . The cortactin NTA region contains a sequence motif (DDW) that is identical to the last three amino acids in Myo3 and Myo5p, and homologous sequences are present in the carboxyl terminus of nearly all WASp/Scar family proteins . The ActA amino terminus contains a similar motif near sequence elements required for the maintenance of Listeria actin tail formation . This sequence in cortactin is conserved across species and is also present in the cortactin-related protein HS1 . We are currently testing if this motif is required for the binding of cortactin to the Arp2/3 complex. The data presented here indicate that the fourth tandem repeat is necessary for the F-actin binding activity of cortactin and for targeting cortactin to cortical actin structures. The sequence of repeat four is not homologous to other actin binding domains. Isoforms of cortactin are generated by alternative splicing, with cortactin A corresponding to the full-length cortactin form used in these studies. Alternative splicing removes repeat six (cortactin B) or repeats 5 and 6 (cortactin C); all of these isoforms bind F-actin. These results, coupled with the reported inability of the first three cortactin repeats to bind F-actin , support the conclusion that the F-actin binding domain is contained within repeat four. Cortactin variants containing the sixth repeat are reported to cross-link F-actin , an activity that can be downregulated by Src-mediated phosphorylation of cortactin . Furthermore, based on the analysis of the cortactin-related protein HS1 and HS1–cortactin hybrid proteins, the fourth cortactin tandem repeat has been suggested to interact with phosphatidylinositol 4,5-bisphosphate (PIP 2 ), which also downregulates F-actin cross-linking by cortactin . In spite of these data, the mechanism by which cortactin cross-links actin filaments is currently unknown. The association of cortactin with the Arp2/3 complex and F-actin is likely to impact multiple signaling pathways in a variety of cell types. In addition to linking scaffolding proteins in neuronal and epithelial systems, cortactin may also link the machinery for actin polymerization, Arp2/3 complexes, to signals emanating from the leading edge of motile cells. Ectopic overexpression of cortactin stimulates cell motility that is dependent on Src phosphorylation , suggesting that cortactin contributes to cell migration mediated by Src kinase activity . Cortactin is overexpressed in many cell lines derived from human tumors containing amplification of chromosome 11q13 that posses high metastatic potential and is present within invadopodia in invasive breast cancer cell lines . Invadopodia serve as sites of extracellular matrix degradation by sequestering or secreting various serine and metalloproteinases , and such structures directly correlate with invasive potential. How cortactin overexpression leads to increased motility and metastatic potential is currently unclear. The proper spatial and temporal localization of cortactin with newly forming cortical actin networks is likely to be important for cortactin function. Recently, it was shown that the activity of Rac and the EGF receptor synergize to enhance signaling to the Raf-Mek-Erk pathway leading to cell motility . Therefore, Rac-induced localization of cortactin at sites of Arp2/3 activity may enhance the efficiency of signal transmission at the leading edge by linking growth factor–mediated receptor signals to downstream effector pathways . Activated Arp2/3 complex forms a polarized gradient during neutrophil chemotaxis, becoming concentrated at the migratory front , and is coincident with sites of activation of chemoattractant receptor signaling complexes . Organization of receptor signaling complexes at the leading edge may in part be controlled by Arp2/3 and/or cortactin. EGF-induced cell motility also requires the integration of multiple signaling pathways . Tyrosine phosphorylation of cortactin initiated by EGF , in conjunction with the distribution of cortactin with dynamic cortical actin structures, positions cortactin as a potential mediator of one or more of these signaling pathways. The possibility that cortactin plays a role in the regulation of cortical actin assembly and/or spatial organization of cell surface receptors suggests that cortactin may provide an important site of signal integration between protein tyrosine kinases and the actin cytoskeleton. | Study | biomedical | en | 0.999996 |
0004096 | "Messenger RNA degradation is a mechanism by which eukaryotic cells regulate gene expression and inf(...TRUNCATED) | Study | biomedical | en | 0.999997 |
0004111 | "Receptor-mediated endocytosis for recycling receptors is a process in which a ligand binds to its c(...TRUNCATED) | Study | biomedical | en | 0.999998 |
0005018 | "The ends of eukaryotic chromosomes (telomeres) consist of simple DNA repeats associated with protei(...TRUNCATED) | Study | biomedical | en | 0.999997 |
0005026 | "The congression of chromosomes to the metaphase plate and subsequent poleward movement at anaphase (...TRUNCATED) | Study | biomedical | en | 0.999998 |
0005034 | "Differentiated oligodendrocytes synthesize large amounts of myelin, a multilamellar membrane that e(...TRUNCATED) | Study | biomedical | en | 0.999997 |
0006005 | "A significant component of eukaryotic cellular protein degradation occurs at the ER. ER-associated (...TRUNCATED) | Study | biomedical | en | 0.999997 |
End of preview. Expand
in Data Studio
README.md exists but content is empty.
- Downloads last month
- 23