text
string | predicted_class
string | confidence
float16 |
|---|---|---|
A number of parasitic protozoal proteins have been identified as potential targets for antiparasitic chemotherapy . In conjunction with this review, we have examined the potential parasitic targets of Copaifera diterpenoids using molecular docking. It is currently not known what biomolecular targets from Leishmania or Trypanosoma may be responsible for the antiprotozoal activities of copaiba. The Copaifera diterpenoids (Figure 1, Figure 2 and Figure 3) were screened, in silico, against Leishmania drug targets and Trypanosoma cruzi protein targets using Molegro Virtual Docker v. 6.0.1 as previously described . The docking energies are summarized in Table 4 and Table 5. | review | 99.9 |
The Leishmania protein target with the best overall docking properties with Copaifera diterpenoids was L. major dihydroorotate dehydrogenase (average Edock = −109.2 kJ/mol). These docking energies were better than the docking energy for the normal substrate, dihydroorotate (Edock = −72.1 kJ/mol) and comparable to the co-crystallized ligand for this protein, nitroorotate (Edock = −104.2 kJ/mol). Docking energies for Copaifera diterpenoids with TcDHODH (average −92.5 kJ/mol) were also better than the normal substrate (dihydroorotate, Edock = −64.2 kJ/mol), but worse than the synthetic TcDHODH inhibitor, 5-[2-(5-carboxynaphthalen-2-yl)ethyl]-2,6-dioxo-1,2,3,6-tetrahydro-pyrimidine-4-carboxylic acid (TT2-2-199, Edock = −140.7 kJ/mol). Similarly, Copaifera diterpenoids docked with L. donovani DHODH (average Edock = −89.9 kJ/mol) better than dihydroorotate (Edock = −60.9 kJ/mol). Based on these docking energies, protozoal dihydroorotate dehydrogenases are likely targets for Copaifera diterpenoids. | study | 100.0 |
Leishmania major methionyl-tRNA synthetase was another Leishmania protein target with good docking energies. Although the docking energies with this protein were excellent (average Edock = −106.9 kJ/mol), they are much poorer than the docking energy of the normal substrate, methionyl adenylate (Edock = −168.1 kJ/mol). Similarly, the T. cruzi target protein with the best docking was UDP-galactose mutase (average Edock = −104.5 kJ/mol), but the normal substrate and co-crystallized ligand, uridine diphosphate (UDP), had a much superior docking energy (Edock = −232.8 kJ/mol). Likewise, L. major UDP-glucose pyrophosphorylase showed an average docking energy of −99.9 kJ/mol, which was much worse than UDP itself (Edock = −145.9 kJ/mol). The diterpenoids showed good docking to T. cruzi spermidine synthase, with an average docking energy of −96.8 kJ/mol; however, these are much worse than the docking energy of the co-crystallized ligand, S-adenosyl methionine, with a docking energy of −133.0 kJ/mol. Thus, although they exhibited good docking properties, it is unlikely that Copaifera diterpenoids can compete with the normal substrate ligands for these proteins. | study | 100.0 |
Copaifera diterpenoids showed excellent docking to L. mexicana pyruvate kinase (average Edock = −103.4 kJ/mol), much better than the normal substrate, phosphoenolpyruvate (Edock = −59.8 kJ/mol). Docking energies with T. cruzi pyruvate kinase were not as impressive (average −80.3 kJ/mol), but still better than phosphoenolpyruvate (Edock = −48.6 kJ/mol) and comparable to the TcPYK inhibitor, ponceau S (Edock = −83.6 kJ/mol). Parasite pyruvate kinases can be expected to be target proteins for Copaifera diterpenoids. | study | 100.0 |
Protozoal triosephosphate isomerases (LmexTIM and TcTIM) are expected to be targeted by Copaifera diterpenoids. The average docking energy with LmexTIM (−90.7 kJ/mol) was much better than either the normal substrate (dihydroxyacetone phosphate, Edock = −52.4 kJ/mol) or the co-crystallized ligand, phosphoglycolohydroxamic acid (Edock = −61.1 kJ/mol). Likewise, docking energies with TcTIM (average −88.2 kJ/mol) were better than the dihydroxyacetone phosphate (Edock = −59.7 kJ/mol) and comparable to the TcTIM inhibitor, 3-(2-benzothiazolylthio)-1-propanesulfonic acid (Edock = −85.5 kJ/mol). | study | 100.0 |
Both L. major pteridine reductase and T. cruzi pteridine reductase had docking properties with Copaifera diterpenoids with comparable energies (average Edock = −93.8 and −96.8 kJ/mol, respectively) with the normal substrate dihydrobiopterin (Edock = −96.9 and −100.1 kJ/mol, respectively). Thus, Copaifera diterpenoids may compete with dihydrobiopterin for pteridine reductase. | study | 100.0 |
Sterols are the normal substrates for sterol 14α-demethylase (CYP51), and triterpenoids are expected to also target this protein as inhibitors . Nevertheless, Copaifera diterpenoids showed docking energies that may compete with normal sterols for these protein targets. L. infantum CYP51 had an average docking energy with the diterpenoids of −90.2 kJ/mol, which was generally not as good as a normal sterol substrate (obtusifoliol, Edock = −104.4 kJ/mol), but comparable to the known LinfCYP51 inhibitor fluconazole (Edock = −87.5 kJ/mol). Likewise, T. cruzi CYP51 had an average diterpenoid docking energy of −89.5 kJ/mol, but substrate (obtusifoliol) docking of −105.6 kJ/mol, and fluconazole docking energy of −90.9 kJ/mol. | study | 100.0 |
Copaifera diterpenoids generally showed weak docking energies against the parasite cysteine proteases, L. donovani cathepsin B, L. major cathepsin B, or cruzain. This docking behavior of diterpenoids with Leishmania cathepsin B and cruzain was previously observed. Leishmania donovani and T. cruzi cyclophilins also showed weak docking energies. | study | 100.0 |
Although Copaifera diterpenoids showed only weak docking to parasite glyceraldehyde-3-phosphate dehydrogenases, they may still target these proteins. LmexGAPDH had an average Edock of −73.0 kJ/mol and TcGAPDH had an average Edock of −70.3 kJ/mol, but these docking energies are better than the docking energies of the normal substrate, glyceraldehyde-3-phosphate (Edock = −58.9 and −52.6 kJ/mol, respectively). | study | 100.0 |
Additional Leishmania proteins expected to be targeted by Copaifera diterpenoids include glycerol-3-phosphate dehydrogenase, which showed excellent docking energies (average −100.4 kJ/mol) to LmexGPDH, better than the normal substrate, glycerol-3-phosphate (Edock = −62.5 kJ/mol). Also targeted with a weak docking energy are: glucose-6-phosphate isomerase (Lmex GPI Edock average = −73.0 kJ/mol), though better than the docking energy of the normal substrate (glucose-6-phosphate, Edock = −62.0 kJ/mol); and phosphomannomutase (LmexPMM Edock average = −94.2 kJ/mol), which is better compared to the normal substrate (mannose-6-phosphate, Edock = −72.5 kJ/mol). | study | 100.0 |
Additional T. cruzi protein targets may be dihydrofolate reductase—thymidylate synthase (TcDHFR–TS), which showed an average docking energy with Copaifera diterpenoids of −93.2 kJ/mol, comparable to the docking energy of the normal substrate (dihydrofolate, −99.3 kJ/mol), as well as the TcDHFR–TS inhibitor cycloguanil (Edock = −83.1 kJ/mol); farnesyl diphosphate synthase (TcFPPS), with docking energies that averaged −96.2 kJ/mol, which is comparable to the docking energy of the normal substrate, isopentenyl diphosphate (Edock = −98.9 kJ/mol); and hypoxanthine phosphoribosyltransferase (TcHPRT), having an average Edock = −82.1 kJ/mol, compared to the normal substrate, hypoxanthine, with Edock of −65.9 kJ/mol. | study | 100.0 |
Copaiba oleoresin has shown antibacterial activity against several strains, in particular, Gram-positive Bacillus subtilis and Staphylococcus aureus with minimum inhibitory concentration (MIC) values of 5 μg/mL for both organisms . Copalic acid, isolated from C. langsdorffii, showed excellent antibacterial activity against Bacillus cereus (MIC 8.0 μg/mL), B. subtilis (MIC 5.0 μg/mL), Kocuria rhizophila (MIC 5.0 μg/mL), Streptococcus pyogenes (MIC 3.0 μg/mL), S. pneumoniae (MIC 3.0 μg/mL), S. agalactiae (MIC 2.0 μg/mL), S. dysgalactiae (MIC 1.0 μg/mL), S. epidermidis (MIC 0.5 μg/mL) , S. salivarius (MIC 2.0 μg/mL), S. mutans (MIC 3.0 μg/mL), S. mitis (MIC 5.0 μg/mL), S. sobrinus (MIC 3.0 μg/mL), and S. sanguinis (MIC 6.0 μg/mL) . Likewise, kaurenoic acid showed remarkable activity against S. pyogenes (MIC 5.0 μg/mL), S. pneumoniae (MIC 5.0 μg/mL), S. dysgalactiae (MIC 8.0 μg/mL) , S. epidermidis (MIC 4–5 μg/mL), B. subtilis (MIC 3.1–6.3 μg/mL), and S. aureus (MIC 8–10 μg/mL) . 3α-Alepterolic acid acetate (acetoxycopalic acid) showed moderate antibacterial activity against cariogenic Streptococcus bacteria, with MIC values ranging from 12.0 to 60.0 μg/mL . ent-Polyalthic acid also showed moderate antibacterial activity against B. subtilis (MIC 20–30 μg/mL), S. aureus (MIC 40–50 μg/mL), and S. epidermidis (MIC 40 μg/mL) . | study | 99.9 |
In order to provide some insight into the mechanisms of activity, a virtual screening of copaiba diterpenoids has been carried out against several bacterial protein targets, including peptide deformylase, DNA gyrase, topoisomerase IV, UDP-galactopyranose mutase, protein tyrosine phosphatase, cytochrome P450 CYP 121, and nicotinamide adenine dinucleotide (NAD+)-dependent DNA ligase (see Table 6). The best bacterial target for copalic acid was Mycobacterium tuberculosis DNA gyrase B (PDB 3ZKD) with a docking energy (Edock) of −105.7 kJ/mol. The protein with the best docking energy with kaurenoic acid was S. pneumoniae peptide deformylase (PDB 2AIE, Edock = −89.7 kJ/mol). 3α-Alepterolic acid acetate was the best docking ligand to Escherichia coli topoisomerase IV (PDB 1S16) and M. tuberculosis DNAGyrB (PDB 3ZKD) with docking energies of −118.8 and −118.3 kJ/mol, respectively. 3β-Alepterolic acid acetate also showed excellent docking to these two proteins with docking energies of −117.1 and −117.3 kJ/mol, respectively. The best bacterial target for ent-polyalthic acid was M. tuberculosis protein tyrosine phosphatase (PDB 2OZ5, Edock = −107.2 kJ/mol). The copaiba diterpenoid ligand with the best docking properties was 7α-acetoxyhardwickiic acid with S. aureus peptide deformylase (PDB 3U7M, Edock = −120.6 kJ/mol). | study | 100.0 |
Copaiba oleoresins have exhibited both in vitro and in vivo antiproliferative activities (Table 3). Copaifera reticulata oleoresin, for example, has shown in vitro cytotoxic activity against GM07492-A human lung fibroblast cells with an IC50 of 51.85 μg/mL . The oleoresin of C. multijuga has shown in vitro cytotoxic activity against B16F10 murine melanoma cells with an IC50 of 457 μg/mL . Furthermore, in a mouse model of lung metastasis and tumor growth, oral administration of C. multijuga oleoresin reduced tumor growth, tumor mass, and number of lung nodules after inoculation of B16F10 tumor cells . Likewise, C. multijuga oleoresin, in doses varying between 100 and 200 mg/kg, showed antineoplastic properties against Ehrlich ascetic tumors and solid tumors in an in vivo mouse model . On the other hand, C. officinalis oleoresin actually stimulated growth of Walker 256 carcinoma by 70% in an in vivo rat model . | study | 99.94 |
Diterpenoids isolated from Copaifera species have shown cytotoxic activities (Table 3). Copalic acid, isolated from C. langsdorffii, showed in vitro cytotoxicity on MO59J human glioblastoma cells and HeLa human cervical adenocarcinoma cells with IC50 of 68.3 and 44.0 μg/mL, respectively . Kaurenoic acid has demonstrated cytotoxicity against several human tumor cell lines, including CEM leukemia, MCF-7 breast tumor, HCT-8 colon tumor , AGP01 gastric tumor, and SF-295 glioblastoma . Growth inhibition of AGP01 and SF-295 cells was also demonstrated by 3β-alepterolic acid and 3β-alepterolic acid acetate . Methyl copalate showed remarkable cytotoxic activity on P-388 murine lymphoma (IC50 = 2.5 μg/mL), A-549 human lung carcinoma (IC50 = 5 μg/mL), HT-29 human colon carcinoma (IC50 = 5 μg/mL), and MEL-28 human melanoma (IC50 = 10 μg/mL) cells . | study | 99.94 |
Molecular docking (Molegro Virtual Docker, Aarhus, Denmark) has been carried out with Copaifera diterpenoids on cancer molecular targets, including androgen receptor, aromatase, caseine kinase II, cyclin-dependent kinases 2, 4, and 6, cyclooxygenase 2, DNA (cytosine-5)-methyltransferase-1 and -3A, epidermal growth factor receptor, estrogen receptor α, estrogen receptor β, heat shock protein 90, insulin-like growth factor 1 receptor, 5-lipoxygenase, mitogen-activated protein kinase 1, NF-κB, p90 ribosomal protein S6 kinase, P-glycoprotein, phosphatidylinositol-4,5-bisphosphate 3-kinase, topoisomerase I, topoisomerase IIα, topoisomerase IIβ, tubulin, and vascular endothelial growth factor receptor (Table 7). The best overall cancer targets for the copaiba diterpenoids were human DNA (cytosine-5)-methyltransferase-1 (HsDNMT1), human estrogen receptor β (HsERβ), and human mitogen-activated protein kinase 1 (HsMEK1), with average MolDock docking energies of −102.7, −99.2, and −101.5 kJ/mol, respectively. DNA (cytosine-5)-methyltransferase-1 (DNMT1) is the enzyme responsible for DNA methylation of carbon-5 of cytosine within CpG dinucleotides . The enzyme is required for embryonic development , but is overexpressed in lung, liver, colorectal, gastric, breast, and lung tumors . Thus, DNMT1 has emerged as an attractive target for cancer chemotherapy . The mitogen-activated protein kinase (MAPK) signaling cascade is one of the most important pathways involved in cellular proliferation and differentiation and, therefore, inhibition of components of this pathway, such as MEK1, can potentially target tumors that depend on MAPK signaling . Agonism of estrogen receptor α (ERα) stimulates proliferation of breast, uterus, and prostate tissues, whereas ERβ agonism inhibits proliferation of these tissues . Thus, compounds that can selectively bind and activate ERβ, but not ERα, could represent effective antitumor agents for treatment of prostate and breast cancer . Copalic acid and methyl copalate both targeted HsMEK1, with docking energies of −108.2 and −111.0 kJ/mol, respectively, while 3β-alepterolic acid and 3β-alepterolic acid acetate showed excellent docking with HsDNMT1 (Edock = −107.2 and −121.7 kJ/mol, respectively). Kaurenoic acid was a relatively weakly docking ligand but did show selective docking to aromatase (Edock = −93.7 kJ/mol). The best-docking ligand was patagonic acid, which had a docking energy of −121.8 kJ/mol with HsDNMT1. | study | 99.9 |
Inflammation is the biological response of body tissues to detrimental stimuli, such as pathogenic microorganisms, chemical or physical irritants, or injury. Inflammation is manifested by redness, swelling, heat, and sometimes pain. While acute inflammation is a normal part of the healing process, chronic inflammation often plays a role in chronic diseases such as osteoarthritis, lupus, and inflammatory bowel disease, and can be problematic. Several copaiba oleoresins have shown anti-inflammatory activity, including C. cearensis , C. duckei , C. langsdorffii , C. multijuga , C. officinalis , and C. reticulata (Table 3). | review | 94.75 |
The immune response is a complex cascade of interacting cytokines and reactions, and there are several biomolecular targets important in treating chronic inflammation. We have carried out virtual screening of copaiba diterpenoids against soluble epoxide hydrolase (EPHX2), fibroblast collagenase, phospholipase A2 (PLA2), 5-lipoxygenase, inducible nitric oxide synthase, phosphoinositide 3-kinase, interleukin-1 receptor-associated kinase 4, glutathione S-transferase ω-1, cyclooxygenase-1, cyclooxygenase-2, c-Jun N-terminal kinase, nuclear factor κ-light-chain-enhancer of activated B cells (NF-κB), inhibitor of κB kinase β, NF-κB essential modulator, lipid binding protein MD-2, myeloperoxidase, p38 mitogen-activated protein kinase, peroxisome proliferator-activated receptor γ, and cAMP-specific 3′,5′-cyclic phosphodiesterase 4D (Table 8). The overall best target proteins were murine soluble epoxide hydrolase and murine phospholipase A2, with average docking energies of −108.3 and −100.0 kJ/mol. Secretory phospholipase A2 and cytosolic phospholipase A2 are both targets for anti-inflammatory drug development . Soluble epoxide hydrolase has been identified as a molecular target not only for inflammatory diseases, but also as a target for neurodegenerative diseases and for treatment of pain . Thus, targeting EPHX2 and/or PLA2 by copaiba diterpenoids may explain the anti-inflammatory activities of copaiba oleoresins. | study | 99.94 |
Molecular docking analyses were carried out using Molegro Virtual Docker (v. 6.0.1, Molegro ApS, Aarhus, Denmark) against known bacterial , Leishmania , Trypanosoma cruzi , and cancer-relevant and inflammation-relevant protein targets , as previously described . | study | 99.94 |
The oleoresins from Copaifera species (copaiba) have been used by native peoples of the Amazon region for thousands of years. These materials have shown remarkable biological activities, including antibacterial, antiparasitic, antineoplastic, and anti-inflammatory activities. Copaiba resins have been distilled to give essential oils that are largely composed of sesquiterpenoids, particularly β-caryophyllene. The resins are also composed of diterpene acids, which are responsible for many of the observed biological activities. Molecular docking of copaiba diterpene acids with documented protein targets has revealed potential mechanisms of activity for these bioactive constituents. Future research to validate the molecular mechanisms of copaiba diterpenoids is encouraged. | study | 99.75 |
Epilepsy regroups a large group of highly heterogeneous disorders that have in common an abnormally increased predisposition to seizures. Epilepsy is defined as a common and diverse set of neurologic disorders characterized by spontaneous, unprovoked and recurrent epileptic seizures . | other | 99.9 |
Multiple genetic factors were identified to be involved in primary epilepsy syndromes for which epileptic seizures are the predominant clinical feature; the same hold true in brain developmental disorders for which epileptic seizures are secondary clinical features. Recent whole-exome sequencing (WES) data suggest that mutations causing epileptic encephalopathies are often sporadic. These mutations are typically de novo dominant variations that affect a single autosomal gene but autosomal recessive and X-linked inheritance were also reported . | study | 99.8 |
Generally the X-linked epileptic forms orient to a group of disorders which, among others, consist of: Epilepsy, X-linked, with Variable Learning Disabilities and Behavior Disorders (OMIM #300491), Epileptic Encephalopathy, Early Infantile, type 1 (EIEE1; OMIM #308350) and type 2 (EIEE2; OMIM #300672), and rarely Pelizaeus-Merzbacher Disease (PMD; OMIM #312080) [3–5]. | review | 95.6 |
We report here a family addressed to our department with an initial diagnosis of X-linked epileptic seizures. Given the heterogeneity of this group of diseases we used a whole-exome sequencing approach that allowed us to detect a novel PLP1 missense mutation p.Ala84Asp related to PMD. This diagnosis was consistent with the phenotype of the affected patients, and confirmed by segregation analysis of the mutation in the family. | clinical case | 99.94 |
The propositus (V-4) is a Moroccan 5 years old boy, non-consanguineous, last child of three siblings, and was addressed for familial epilepsy (Fig. 1A). His parents and older sister appear to be healthy and have been free of epilepsy seizure in the past. He had neonatal hypotonia, psychomotor delay, and no seating position with the support of the head at 2 years old. Daily-generalized seizures started at 8 months old and treated by valproate of sodium, but without any response. At clinical examination, he had stature and weight delay at <3rd percentile, microcephaly at -2SD, severe hypotonia, with no facial dysmorphia nor nystagmus. The computerized tomography (CT) scan was normal, but the electroencephalogram (EEG) showed abnormal waves at right fronto-temporal region. Unfortunately, MRI could not be available for the patient.Fig. 1a Pedigree of the studied Moroccan family with X-linked epileptic seizures, presenting the co-segregation of the c.251C > A mutation. The patient above the arrow indicates the proband. b Chromatograms by Sanger sequencing of family members who are hemizygous, heterozygous and wild-type for the PLP1 variant. c Amino acid conservation map across species demonstrating a highly conserved residues position 84 (based on Multiz Alignments Track of UCSC Genome Browser and The human genome reference hg19/GRCch37) | clinical case | 99.94 |
a Pedigree of the studied Moroccan family with X-linked epileptic seizures, presenting the co-segregation of the c.251C > A mutation. The patient above the arrow indicates the proband. b Chromatograms by Sanger sequencing of family members who are hemizygous, heterozygous and wild-type for the PLP1 variant. c Amino acid conservation map across species demonstrating a highly conserved residues position 84 (based on Multiz Alignments Track of UCSC Genome Browser and The human genome reference hg19/GRCch37) | clinical case | 99.94 |
Five cousins (V-5, V-7, V-8, V-9, V-10) and maternal uncles (IV-3, IV-9) were also followed for epilepsy. IV-3, IV-9, V-5 and V-8 died respectively at four, seven, three and two years. They had all neonatal hypotonia, psychomotor delay and epilepsy beginning at 6 months old. | clinical case | 99.9 |
The WES was performed at McGill University and Genome Québec Innovation Centre (MUGQIC) on a HiSeq 2000 sequencing instrument (Illumina Inc.). The WES capture was done using SureSelect Human All Exon V4 in solution capture kit (Agilent Technologies) according to the manufacturer’s instructions. | other | 99.94 |
The well-validated GATK software (Genome Analysis ToolKit (GATK) has been used in conjunction with the gold-standard aligner BWA (Burrow-Wheeler Alignment) for assembly. Prior to the alignment, each read was properly assessed and trimmed using various tools from the Picard suite (http://broadinstitute.github.io/picard). Once the alignment was performed, quality of each base has been normalized for each sample, and local realignment for suspected indels region was performed. Variant calling has been performed jointly on all samples processed together using UnifiedGenotyper from the GATK suite. We also used the ANNOVAR software to annotate variants using the most up-to-date public databases (dnSNP, REFSEQ) . The potential functional impact of mutations was predicted using Sorting Intolerant From Tolerant (SIFT), at http://sift.bii.a-star.edu.sg, and Polymorphism Phenotyping 2 (PolyPhen2), at http://genetics.bwh.harvard.edu/pph2/. | study | 100.0 |
The putative mutation was validated via Sanger, sequencing the DNA of 9 family members with the following primers: Forward (AGCCTTGTTAAGGTGCTCGCT) and Reverse (GCTTGATGTTGGCCTCTGGA). Sequencing was performed using BigDye Terminator v3.1 cycle sequencing, and the obtained sequences were analyzed on an ABI 3000 DNA Analyzer (Applied Biosystems). | clinical case | 99.94 |
A total of 188,043 variants were detected. The WES data covered all exons of known X-Linked Epilepsy related genes, and no known pathogenic mutations were identified in these genes. Nevertheless, we identified a single hemizygous base substitution in coding exon3, c.251C > A of the PLP1 gene (based on GRCh37/hg19, and transcript ID NM_000533), resulting in substitution of alanine by an aspartic acid at amino acid 84. This mutation was found in hemizygous state in the propositus V-4 and in his cousin V-7. Sanger sequencing confirmed this mutation in hemizygous state in the affected subjects (V-9, V-10) and in heterozygous state in the obligatory carrier mothers, showing co-segregation of the mutation with the disease phenotype (Fig. 1A). The non-affected IV-12 was wild type for this mutation (Fig. 1B). | clinical case | 99.9 |
Mutation c.251C > A (p.Ala84Asp) located within exon 3, results in changes of a non-polar alanine to a charged aspartic acid at position 84, it was predicted by Polyphen2 to be probably damaging with a score of 0.989 (sensitivity: 0.72, specificity: 0.97). The Mutation was also predicted to be damaging by SIFT with a score of 0. As shown in Fig. 1C, this amino acid change affects highly conserved residues. | clinical case | 99.75 |
The advent and increasingly decreasing cost of NGS and WES has opened up vast new opportunities for its application as a clinical tool to identify mutations in genes established to cause disorders, or in novel genes; altogether facilitating both discovery efforts and conclusive diagnoses . Many studies have demonstrated that systematic application of WES in specific clinical situations has been more accurate, faster, and less expensive than conventional diagnostic procedures . | review | 99.7 |
PMD is caused by mutations involving the PLP1 gene that encodes the myelin protein proteolipid protein 1 (PLP1) and the spliced variant DM20. The c.251C > A mutation, located within the second hydrophobic transmembrane domain of PLP1, has not been previously described. Mutations in the same region of the protein, including c.247G > A and c.254 T > C mutations causing a p.Gly83Arg and p.Leu85Arg amino acid substitutions respectively, have been shown to cause connatal form of PMD [11, 12]. | study | 99.94 |
There is a spectrum of PLP1-related disorders with some genotype–phenotype correlations [4, 11–13]. Generally, patients with PLP1 missense mutations show the most severe form of PMD (connatal form), the most common PLP1 duplications result in the classical PMD, whereas deletions and null mutations in mild form of PMD and SPG2 [4, 11, 13, 14]. Epilepsy, major hypotonia, and severe psychomotor delay were constant features in our affected children and they have the same clinical history. Thus, epilepsy, not being a frequent sign in PMD, represents the specificity of this family. Considering that the majority of PLP1 point mutations cause more severe dysmyelinating diseases than null mutations, Inoue speculated that the profound dysmyelination resulting from PLP1 point mutations probably arises not from the absence of functional protein, but rather from the cytotoxic effect of mutant protein . | clinical case | 97.4 |
Our study expands the mutation spectrum of PLP1 gene and shows that whole-exome analysis in a patient from a family exhibiting X-linked epilepsy could be used efficiently to identify causative mutations, thus providing help to clinicians in making a definitive diagnosis. | clinical case | 99.9 |
Human African trypanosomiasis (HAT), also known as sleeping sickness, is caused by infection with the parasitic protozoans Trypanosoma brucei gambiense (T.b.gambiense) or Trypanosoma brucei rhodesiense (T.b.rhodesiense) and is spread by the bite of the tsetse fly insect vector . The disease is usually fatal if not diagnosed and treated with appropriate chemotherapy. T.b.gambiense is by far the more prevalent of the two infections and is responsible for approximately 97% of all reported cases with T.b.rhodesiense accounting for the remaining 3%. The parasites are restricted to sub-Saharan Africa where approximately 70 million people are at risk of infection. However, following the application of effective control and surveillance strategies the number of reported new cases fell to less than 10,000 in 2009 and has continued to decline with less than 3000 new cases recorded in 2015 . These figures suggest that elimination of the disease, defined as less than one case per 10,000 population in at least 90% of endemic areas, by 2020 is an achievable target. Nevertheless, the reported case number likely depicts a significant under representation of the scale of the problem and WHO estimate that the actual case number is closer to 20,000 . Re-emergence of the disease to epidemic levels has occurred historically and this recurrence emphasises the necessity to sustain current control strategies. | review | 99.8 |
Following infection the disease progresses through two stages. During stage-1 the parasites proliferate in the blood, lymphatic system and peripheral organs. However, the most serious form of HAT, stage-2, occurs when the trypanosomes circumvent the blood-brain barrier (BBB) to enter and establish within the CNS. Gambiense infections are associated with a chronic progressive course and can take months to years before stage-2 disease is reached, while rhodesiense infections are more acute with parasites entering the CNS within a matter of weeks . The progression of the infection to the CNS-stage is associated with the development of a neuroinflammatory reaction described in only a limited number of human cases , . This neuroinflammatory response to trypanosome infection has been mirrored in both rodent and primate models of the human disease and is characterised by inflammatory cells, including lymphocytes, macrophages and plasma cells, infiltrating the meninges and choroid, followed by inflammation of the parenchymal vessels and lastly the development of encephalitis. Astrocyte and microglial cell activation accompany this response although little neuronal damage or demyelination occur until the terminal stages of the disease are reached , , , . | review | 99.7 |
The precise microenvironment required within the brain to conserve optimal function is maintained by the presence of specialised barriers situated between the neural tissue and the circulating blood . These barriers protect the brain from the vast majority of toxins and pathogens as well as regulate the exchange of nutrients, metabolites, molecules and ions between the brain parenchyma and the blood by means of specific transporters and ion channels . The most extensive barrier type is found between the blood and the brain parenchyma and is formed through a complex functional interplay between brain microvascular endothelial cells, which are bound together by sophisticated ‘tight junctions’, pericytes, astrocytes, neurons and microglial cells. Together these cells constitute the neurovascular units that comprise the ‘classical’ parenchymal BBB . There are additional barriers in the choroid plexus separating the blood from the ventricular CSF, and between the blood and subarachnoid CSF. These barriers have endothelial cells joined by tight junctions but lack the other cellular components of the parenchymal BBB . | review | 99.8 |
Numerous neurological conditions, of both infectious and non-infectious aetiology, can initiate various degrees of BBB impairment , , . However, the impact of trypanosome infection on BBB function remains controversial , , , . Rhodamine dye, injected into the jugular vein of rats during the advanced stages of T.b.brucei infection, has been found permeating the brain cortical white and grey matter, indicating the presence of BBB dysfunction in these animals . In a similar rat model, Mulenga et al. detected increasing numbers of parasites in the brain parenchyma as the infection progressed, though no changes were seen in the staining patterns of the tight junction proteins occludin and zonula occludens 1, or the penetration of fibrinogen or IgG. In this instance, the findings suggest that trypanosome infection and transmigration into the CNS does not result in loss of BBB integrity. The application of an in vitro BBB model utilising human brain microvascular endothelial cells has provided further evidence suggesting that trypanosomes do not cause lasting damage to the BBB . This study showed that T.b.rhodesiense induced only a transient reduction in transendothelial electrical resistance (TEER), which was most pronounced around 3 h following introduction of the parasites . | study | 99.94 |
More recent studies, employing contrast-enhanced magnetic resonance imaging (CE-MRI) to investigate BBB function in a murine model of HAT, demonstrated significant and widespread BBB dysfunction during CNS-stage disease . Furthermore, the barrier impairment was present in animals displaying only mild to moderate neuroinflammatory changes in the brain; typically comprised of inflammatory cells in the meninges and the development of perivascular cuffs around some of the blood vessels. In the investigation presented here we have extended these findings to ascertain when BBB impairment becomes apparent following T.b.brucei infection and measured the severity of the dysfunction. In addition, the degree of neuroinflammation and the trypanosome burden in the brain has been determined during the progression of the disease. | study | 99.94 |
The well-established Trypanosoma brucei (T.b.) brucei GVR35 mouse model of human African trypanosomiasis was used throughout this study. Briefly, 45 female CD-1 mice were infected by intraperitoneal injection of 2 × 104 parasites in 100 μL phosphate buffered saline glucose (PBS-G). The animals were divided into three cohorts and assigned to study; the neuroinflammatory reaction (n = 20), the trypanosome load (n = 20) or BBB function (n = 5). Each cohort was further divided into sub-groups (n = 5) to investigate disease progression at 7, 14, 21 and 28 days post-infection. Only one group was allocated to MRI as serial scans were performed on individual animals at each time point. Uninfected animals were included with the neuroinflammation (n = 4) and MRI (n = 3) studies to act as normal controls. | study | 100.0 |
The severity of the neuroinflammatory reaction was assessed in groups of mice sacrificed at each time-point. At sacrifice the animals were perfused transcardially with approximately 120 mL sterile saline. The brains were then excised, fixed in 4% neutral buffered formalin, and paraffin-wax processed. Coronal sections, taken through the hippocampal brain region, were then prepared and stained with haematoxylin and eosin. The stained sections were assessed in a blinded fashion and the severity of the neuroinflammatory reaction graded using a previously described grading scale . Briefly, a score of 0 describes a normal brain, grade 1 describes sections where a mild meningitis is present while grade 2 shows a moderate meningitis with perivascular cuffing of some vessels. Grade 3 is characterised by more severe meningitis and perivascular cuffing with a few inflammatory cells infiltrating the neuropil, and grade 4 describes a severe meningoencephalitis with inflammatory cells throughout the brain parenchyma. | study | 100.0 |
Trypanosome load in the brain was determined using Taqman real-time PCR as described previously , . Mice were euthanased at 7, 14, 21 and 28 days -post-infection and perfused transcardially with 120 mL of sterile saline to remove peripheral blood from the CNS. The brains were then excised, immediately placed in dry ice and stored at −70 °C until required. DNA was prepared from a 25 mg sample of whole brain homogenate (DNeasy Tissue kit; Qiagen) and Taqman real-time PCR performed , . Briefly, Taqman PCR was carried out in a 25 μL reaction volume comprising 1 x Taqman Brilliant II master mix (Agilent), 0.05 pmol/μL forward primer (CCAACCGTGTGTTTCCTCCT), 0.05 pmol/μL reverse primer (GAAAAGGTGTCAAACTACTGCCG), 0.1 pmol/μL probe (FAM-CTTGTCTTCTCCTTTTTTGTCTCTTTCCCCCT-TAMRA) (Eurofins MWG Operon) and 100 ng template DNA. The primers and probe were specifically designed to detect the trypanosome Pfr2 gene. A standard curve, constructed using a serial dilution of pCR®2.1 vector containing 1 × 106–1 × 101 copies the cloned Pfr2 target sequence (Eurofins MWG Operon), was include in each PCR plate. The amplification was performed using a MxPro 3005 (Agilent) with a thermal profile of 95 °C for 10 min followed by 45 cycles of 95 °C for 15 s, 60 °C for 1 min and 72 °C for 1 s. The trypanosome load within the brain samples was extrapolated from the standard curve using the MxPro qPCR software (Agilent). | study | 100.0 |
MRI was performed at day 7, 14, 21 and 28 post-infection. Uninfected mice were also examined. All scans were performed as described previously . Briefly, mice were anaesthetised with 1–2% isofluorane delivered in a 70:30 NO2:O2 mixture. The tail vein was cannulated with a 26 gauge × 19 mm cannula to facilitate contrast agent administration during MRI scanning (Fig.1A). The cannula was secured using super glue and masking tape and flushed with heparin to prevent the formation of blood clots. The animal was then placed prone into a mouse cradle and restrained using ear and tooth bars to minimise head movement. Anaesthesia was maintained throughout the procedures and respiration and heart rate were observed. Body temperature was continuously monitored via a rectal thermocouple and the animal maintained normothermic by an enclosed warm-water circuit (Fig.1B).Fig. 1Preparation of mouse prior to contrast enhanced magnetic resonance imaging. A. The mouse was anaesthetised (blue arrow) and the tail vein cannulated (black arrow) to allow administration of contrast agent. Electrodes were placed on the thorax and abdomen to monitor respiration and heart rate (red arrow). B. The animal was the transferred into the MRI cradle and the head restrained with ear (*) and tooth bars to prevent movement during the scan. A rectal thermocouple was used to monitor body temperature (blue wire) which was maintained by an enclosed water circuit (yellow arrow) which surrounded the mouse. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.) | clinical case | 99.8 |
Preparation of mouse prior to contrast enhanced magnetic resonance imaging. A. The mouse was anaesthetised (blue arrow) and the tail vein cannulated (black arrow) to allow administration of contrast agent. Electrodes were placed on the thorax and abdomen to monitor respiration and heart rate (red arrow). B. The animal was the transferred into the MRI cradle and the head restrained with ear (*) and tooth bars to prevent movement during the scan. A rectal thermocouple was used to monitor body temperature (blue wire) which was maintained by an enclosed water circuit (yellow arrow) which surrounded the mouse. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.) | clinical case | 98.56 |
MRI was performed on a Bruker Biospec 7T/30 cm system equipped with an inserted gradient coil (121 mm ID, 400mT/m) and a 72 mm birdcage resonator. A surface coil was used for brain imaging. The scanning protocol consisted of a RARE T1 weighted scan [effective TE (echo time) 9 ms, TR (repetition time) 8000 ms, 20 averages, matrix 176 × 176, FOV (field of view) 17.6 × 17.6 mm, 20 contiguous coronal slices of 0.4 mm thickness). Following the RARE T1 weighted scan 0.1 mL of a solution containing 50 μL gadolinium-diethylenetriamine penta-acetic acid (Gd-DPTA Magnevist®; Bayer) and 50 μL of sterile water was injected via the tail vein cannula. Five minutes later the T1 weighted scan was repeated. Gd-DTPA cannot readily cross the intact blood brain barrier due to its charge and high molecular weight . Extravasation of Gd-DTPA observed within the parenchyma demonstrates an impairment of the BBB integrity. A RARE T2 weighted scan (effective TE 76 ms, TR 5362 ms, 25 averages, matrix 176 × 176, FOV 17.6 × 17.6 mm, 20 contiguous coronal slices of 0.4 mm thickness) was then performed. On completion of the scan the animals were allowed to recover from anesthesia and the scanning procedure repeated at the next time-point. | study | 99.94 |
Images were analysed using Image J software (http://rsbweb.nih.gov/ij/). Contrast enhancement maps were generated from the pre- and post-contrast T1 weighted scans according to the equation: Enh = (Spost – Spre) ÷ Spre where Spost = post contrast agent signal and Spre = pre-contrast agent signal. Regions of interest (ROIs) were manually defined to include the entire brain slice. Percentage signal change maps were generated by multiplying Enh by 100 and the mean percentage signal change for each brain slice calculated. | study | 99.94 |
Data were analysed using analysis of variance methods in Minitab (Minitab Inc.). To identify significant differences between groups the General Linear Model (GLM) procedure, followed by Tukey’s multiple pair-wise comparison tests were applied. P values of less than 5% were considered statistically significant. Where appropriate data were log transformed prior to analysis. Group means were plotted to show means and their standard errors, and the size of treatment effects were estimated using differences between group means and their 95% confidence intervals. | study | 99.94 |
Although a few inflammatory cells infiltrating the meninges were detected in some of the mice as early as day 7 after infection (Fig.2A) the mean neuropathology score [mean ± SE (0.400 ± 0.245)] for this group of mice was not significantly different [p = 0.382, 95% CI for the difference in mean score (95% CI) = −0.254, 1.054] to the uninfected group (0.00 ± 0.00). However, a progressive increase in the severity of the neuroinflammatory reaction was seen in the mice as the disease developed (Fig.3A) and by 14 days -post-infection the neuroinflammatory reaction, characterised by the presence of a mild meningitis (Fig.2B) (0.800 ± 0.122), was significantly (p = 0.012, 95% CI = 0.146, 1.454) higher than in uninfected mice (Fig.3A). A further significant increase (p < 0.05) in the severity of the neuropathological response was found in mice killed at days 21 (1.500 ± 0.158) and 28 (2.000 ± 0.000) post-infection compared to earlier time points (Fig.3A). In both of these groups the main features of the neuroinflammatory reaction were the presence of moderate inflammatory cell infiltration of the meninges and the perivascular space surround some of the blood vessels. The presence of perivascular cuffs was most often associated with the vessels situated in the hippocampal fissure (Fig.2C and D). Summary statistics for the neuroinflammatory score data are detailed in Supplementary Table 1.Fig. 2The neuroinflammatory reaction. Coronal brain sections, prepared at the level of the hippocampus, and stained with haematoxylin and eosin were employed to assess the neuroinflammatory reaction in uninfected mice (A) and mice infected with T.b.brucei. Inflammatory cells can be seen infiltrating the meninges (blue arrows) of the cerebral cortex on day 14 post-infection (B) and are most abundant at day 21 (C) and 28 (D) post-infection. Inserts show the development of mild perivascular cuffing of the vessels in the hippocampal fissure (black arrows) on days 21 (C) and 28 (D) post-infection. (magnification; ×200, calibration bar (20 µm) shown in panel D).Fig. 3Assessing the neuroinflammatory response and brain parasite burden. A. The neuroinflammatory response scores were analysed in uninfected animals (n = 4) and animals killed at 7, 14, 21 and 28 days post-infection (n = 5 per group). An increase in the severity of the reaction can be seen as the infection progresses. B. The number of copies of the parasite specific PFR-2 gene in a 100 ng sample of DNA extracted from the brains animals killed at 7, 14, 21 and 28 days post-infection (n = 5 per group) was measured by Taqman PCR. The trypanosome burden within the CNS increases as the disease progresses with a significant increase in parasite load detected at 14 days post-infection compared to the earlier time-point. A and B. Dots represent the group mean, bars represent one standard error of the mean. The means of groups that do not share a letter are significantly different (p < 0.05) from each other. | study | 100.0 |
The neuroinflammatory reaction. Coronal brain sections, prepared at the level of the hippocampus, and stained with haematoxylin and eosin were employed to assess the neuroinflammatory reaction in uninfected mice (A) and mice infected with T.b.brucei. Inflammatory cells can be seen infiltrating the meninges (blue arrows) of the cerebral cortex on day 14 post-infection (B) and are most abundant at day 21 (C) and 28 (D) post-infection. Inserts show the development of mild perivascular cuffing of the vessels in the hippocampal fissure (black arrows) on days 21 (C) and 28 (D) post-infection. (magnification; ×200, calibration bar (20 µm) shown in panel D). | study | 100.0 |
Assessing the neuroinflammatory response and brain parasite burden. A. The neuroinflammatory response scores were analysed in uninfected animals (n = 4) and animals killed at 7, 14, 21 and 28 days post-infection (n = 5 per group). An increase in the severity of the reaction can be seen as the infection progresses. B. The number of copies of the parasite specific PFR-2 gene in a 100 ng sample of DNA extracted from the brains animals killed at 7, 14, 21 and 28 days post-infection (n = 5 per group) was measured by Taqman PCR. The trypanosome burden within the CNS increases as the disease progresses with a significant increase in parasite load detected at 14 days post-infection compared to the earlier time-point. A and B. Dots represent the group mean, bars represent one standard error of the mean. The means of groups that do not share a letter are significantly different (p < 0.05) from each other. | study | 100.0 |
Trypanosome DNA was detected in the brains of animals killed at day 7 post-infection (155.5 ± 88.7) (Fig.3B). By day 14 post-infection the detectable parasite burden had increased significantly (841 ± 192; p = 0.005) compared to the earlier time-point (Fig.3B). The trypanosome load seen in the brains of animals killed at 21 days -post-infection showed a further rise (2332 ± 770). Although this was an increase of approximately 175% the burden was not significantly (p = 0.454) higher than that seen in animals on day 14 post-infection. A further rise in the number of parasites residing in the CNS was observed at day 28 post-infection (6766 ± 1607). The trypanosome load within the brain at this time-point was significantly higher than the levels detected at both 7 days -post-infection (p < 0.001) and14 days -post-infection (p = 0.010) but failed to reach significance when compared to animals killed on day 21 post-infection (p = 0.175). Summary statistics for the trypanosome load measured at each time-point are detailed in Supplementary Table 2. | study | 100.0 |
Successful scans were obtained from at least two animals at each time-point, details of completed scans are given in Fig.4A. It was not always possible to complete an MRI scan on each mouse at every time-point. Failures were encountered due to the technically demanding nature of the technique. In some instances cannulation of the tail vein proved impossible or the cannula became dislodged, while on other occasions the indwelling cannula became obstructed, most likely due to the presence of a blood clot, and prevented injection of the contrast agent.Fig. 4Assessing BBB dysfunction. A. Summary table indicating successful scans (✓) performed at each stage after infection. B. The degree of BBB dysfunction was determined by calculating the percentage signal change present in the brain following CE-MRI. Significant levels of barrier impairment were detected on day 14 post-infection compared with uninfected animals or those scanned at 7 days post-infection. A stepwise increase in BBB dysfunction was detected at days 21 and 28 post-infection. Dots represent the group mean (n = 2–4 in each group), bars represent one standard error of the mean. The means of groups that do not share a letter are significantly different (p < 0.05) from each other. | study | 100.0 |
Assessing BBB dysfunction. A. Summary table indicating successful scans (✓) performed at each stage after infection. B. The degree of BBB dysfunction was determined by calculating the percentage signal change present in the brain following CE-MRI. Significant levels of barrier impairment were detected on day 14 post-infection compared with uninfected animals or those scanned at 7 days post-infection. A stepwise increase in BBB dysfunction was detected at days 21 and 28 post-infection. Dots represent the group mean (n = 2–4 in each group), bars represent one standard error of the mean. The means of groups that do not share a letter are significantly different (p < 0.05) from each other. | study | 100.0 |
The base-line level of signal enhancement present in normal mice following administration of Gd-DPTA was determined in uninfected animals. The mean percentage signal change measured in these mice was 7.105 ± 0.162% (Figs. 4B and 5). A similar level of enhancement was seen in animals scanned at 7 days -post-infection (7.6 ± 0.397%). However by day 14 post-infection the mean percentage signal change (15.269 ± 0.586%) had risen significantly compared to uninfected mice (p < 0.001, CI = 5.21, 10.93) and mice scanned at 7 days -post-infection (p < 0.001, CI = 5.179, 9.992). At this point the most prominent areas of signal enhancement were found in the ventricular and hypothalamic areas although more subtle changes could be seen throughout the parenchyma (Fig. 5). A significant (p < 0.001, CI = 6.881, 11.476) increase in barrier dysfunction of approximately 9% when compared to 14 days -post-infection was detected on day 21 post-infection (24.447 ± 0.968%). A further stepwise rise was apparent in animals scanned on day 28 post-infection (28.056 ± 0.766%). The mean percentage signal change measured at day 28 post-infection was significantly higher (p < 0.005) than in all earlier time-points (Fig.4B). Although the ventricular and hypothalamic regions exhibited the highest level of contrast infiltration, increased signal change was also evident in the striatum, cerebral cortex, thalamus, and pons (Fig. 5). Diffuse BBB impairment was therefore present throughout the brain parenchyma and not confined to specific regions, such as the circumventricular organs and ventricles, where barrier function is intrinsically weaker. Summary statistics for the percentage signal enhancement data are detailed in Supplementary Table 3.Fig. 5MRI percentage signal change maps. Percentage signal change maps (coloured), together with their respective T2 weighted scan images (grey), from an individual mouse, at each time-point studied are provided. In each case three slices, from the 20 measured in the procedure, are shown. The slices illustrated have been taken at similar levels in each mouse and cover the range of the scan. The colour bar represents the percentage signal change, with brighter colours corresponding to higher levels of change and therefore more severe BBB dysfunction. An increase in the intensity of the colours within the signal change maps can be clearly seen from day 14 post-infection and is most apparent in animals scanned on day 28 post-infection. Brain structures relevant to the images shown are described. LV, lateral ventricle; CTX, cerebral cortex; cing, cingulum; Str, striatum; aco,‘anterior commissure; ACB, nucleus accumbens; CP, Caudate putamen; V3, third ventricle; cc, corpus callosum; HPF, hippocampal formation; HY, hypothalamus; int, internal capsule; SC, superior colliculus; AQ, aqueduct (4th ventricle); pons, pons. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.) | study | 100.0 |
MRI percentage signal change maps. Percentage signal change maps (coloured), together with their respective T2 weighted scan images (grey), from an individual mouse, at each time-point studied are provided. In each case three slices, from the 20 measured in the procedure, are shown. The slices illustrated have been taken at similar levels in each mouse and cover the range of the scan. The colour bar represents the percentage signal change, with brighter colours corresponding to higher levels of change and therefore more severe BBB dysfunction. An increase in the intensity of the colours within the signal change maps can be clearly seen from day 14 post-infection and is most apparent in animals scanned on day 28 post-infection. Brain structures relevant to the images shown are described. LV, lateral ventricle; CTX, cerebral cortex; cing, cingulum; Str, striatum; aco,‘anterior commissure; ACB, nucleus accumbens; CP, Caudate putamen; V3, third ventricle; cc, corpus callosum; HPF, hippocampal formation; HY, hypothalamus; int, internal capsule; SC, superior colliculus; AQ, aqueduct (4th ventricle); pons, pons. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.) | study | 100.0 |
The GVR 35 T.b.brucei mouse model is well established and characterised. In this model administration of trypanocidal drugs used to treat stage-1 infections, such as diminazene aceturate or suramin, will successfully cure the disease when they are given prior to day 21 post-infection. If chemotherapy is delayed beyond this point, only drugs tailored to cure stage-2 infections such as melarsoprol will prove effective . Melarsoprol, unlike the stage-1 drugs, can cross the BBB to reach therapeutic concentrations within the brain. This information allows us to deduce that mice, infected with T.b.brucei GVR35, have entered stage-2 disease, with parasites established within the brain, by 21 days following initial infection , , . The results of the present study indicate the development of statistically significant neuroinflammatory reactions, parasite burden and BBB dysfunction in animals at 14 days -post-infection, prior to the onset of established CNS-stage disease. All of the criteria investigated increased as the infection progressed through to the CNS-stage and demonstrated significantly greater levels on day 28 post-infection compared with day 14 post-infection. | study | 100.0 |
The presence of trypanosomes situated in the brain parenchyma has been frequently documented in rodent models of HAT during both the chronic , , and more acute stages of the infection , . Furthermore, manipulation of the immunological microenvironment has been shown to alter the ability of the parasites to enter the neuropil and mice deficient in CXCL10 or IFN-γ show reduced parasite numbers in the parenchyma or fail to develop CNS-stage infections , . In this study, Taqman PCR was used to assess the number of trypanosome present within the brain. This technique is highly sensitive and showed that parasite DNA was present at low levels as early as 7-days after infection and found in rising quantities at 14, 21 and 28 days -post-infection. Taqman PCR does not provide details regarding the location of the parasites within the brain tissue. It is possible that small quantities of blood, remaining in the blood-vessels following perfusion, could be responsible for the low numbers of trypanosomes identified during the early stage of the infection. At later time-points a more substantial parasite burden was detected. However, since we have no information regarding the location of the parasites, it could be argued that they may not be present in the brain parenchyma but situated in the meninges, ventricles or other areas such as the circumventricular organs where the blood-vessel epithelium is fenestrated. In fact, recent investigations in a rat model of infection, using freeze fracture electron microscopy, suggested that trypanosomes do not reside in the neuropil of the brain, until the terminal stages of the infection, but persist between the cell layers in the pia mater where the population size is controlled by prostaglandin-D2 . The increasing brain parasite burden detected here argues against this scenario in this study; and since no cyclical fluctuations in the trypanosome population were apparent this would suggest that the parasites were not situated in the choroid plexus, or CSF , . The presence of high levels of residual DNA from dead or dying parasites also seems unlikely due to the high turnover of CSF in the brain , , . | study | 100.0 |
The apparent inception of neurological involvement during early-stage infections has been identified previously in animal models of trypanosomiasis. The presence of trypanosomes within the CNS, only hours following infection, was demonstrated in a murine model of sleeping sickness . Here the authors used intravital microscopy to show fluorescently tagged T.b.rhodesiense IL1852 and T.b.brucei GVR35 in the cortical microvasculature and brain parenchyma 5 h following intravenous infection. A recent study by Laperchia et al. demonstrated the presence of parasites and T-cells in the brain parenchyma at day 9 post-infection in a T.b.brucei rat model of HAT. The authors present confocal images illustrating parasite traversal of the blood vessel endothelia to enter the neuropil on day 9 post-infection and show high parasite burdens by day 21 post-infection. In addition, this study detected the occurrence of sleep-onset rapid eye movement (SOREM) episodes in the rats during the first week following infection and demonstrated that the number and duration of these episodes did not correlate with the trypanosome load found in the brain parenchyma. SOREM periods represent a disruption of the normal sleep architecture and are typically thought to be associated with CNS-stage infections . However, in the Laperchia study they became apparent early after infection demonstrating the presence of neurological features associated with early-stage disease. In human cases of sleeping sickness, caused by T.b.rhodesiense, a similar disconnect between the incidence of neurological signs, and development of stage-2 infection occurs . Patients presenting with either early and late-stage infections exhibited symptoms such as altered gait, tremors, incontinence, cranial nerve palsy, somnolence and reduced Glasgow coma score. Indicating that these neurological signs can occur prior to progression to stage-2 disease. | review | 65.5 |
The few reports detailing the neuropathological features in post-mortem samples from fatal cases of HAT describe the development of a diffuse meningoencephalitis, with the inflammatory infiltrate comprised of macrophages, lymphocytes and plasma cells , , . Astrocyte and microglial cell activation was also noted. The neuroinflammatory changes were most apparent in the white matter of the cerebral hemispheres but also occurred in the circumventricular areas. The neuroinflammatory picture has also been described in rodent , , , , , , , , and primate , , , models of trypanosome infection. Although these studies reported a similar response to that described in human cases the development of a meningoencephalitis, with inflammatory cells infiltrating the brain parenchyma, was only seen on a few occasions and was more commonly associated with treatment failures , , . In the T.b.brucei murine model used in this study only mild to moderate neuroinflammation, with inflammatory cells present in the meninges and infiltrating the perivascular space in the later stages of the infection, was found corresponding with the reaction previously reported in the alternative animal models. | study | 99.94 |
Contrast-enhanced MRI has been used previously to demonstrate BBB dysfunction during stage-2 infections . In the present study these findings have been confirmed and extended to examine earlier time-points following infection. It is now clear that barrier impairment becomes apparent during the haemolymphatic stage of the infection since a significant enhancement in signal intensity, to a mean of 15.85%, was apparent on day 14 post-infection compared to uninfected animals and those examined at the earlier time-point. The degree of barrier damage was further augmented to 25.41% at 21 days -post-infection and 28.82% on day 28 post-infection indicating that the trypanosome infection results in a progressive loss of BBB function. Although the increased signal intensity was most marked in the ventricular regions, infiltration of the contrast agent was not confined to these areas (Fig. 5) but found throughout the brain slice. Since signal enhancement was present throughout the brain parenchyma it is unlikely that the influx of contrast agent is restricted to traversal of the blood-CSF barrier and seems also to occur through the BBB. In earlier studies using an in situ perfusion model, the authors found evidence of BBB impairment, assessed by measuring [14C]sucrose concentrations in the parenchyma, during the late-stage of infection in a BALB/c mouse model , . Philip et al. also found evidence of BBB dysfunction in a rat model of HAT. In this case rhodamine dye was injected into the jugular vein at specific time-points following infection. Low levels of dye leakage into the brain, at first confined to the thalamus and hypothalamus, were seen at 21 days post-infection with widespread penetration of both the white and grey matter evident by day 40 after infection. Again, this study fails to identify any barrier impairment at the earlier time-points after infection. The disparity between the current study and those previously published is likely a result of the differing methodologies used. MRI uses contemporary contrast agents that result in low levels of signal enhancement in the brain even in normal animals whereas rhodamine may remain excluded until more overt changes in barrier function develop. A similar situation exists with the use of sucrose as a marker of BBB permeability since this compound is considered to be excluded from the brain parenchyma under normal conditions . Interestingly, BBB dysfunction, assessed using the CSF/serum quotient of albumin, were detected in 6% of patients presenting with stage-1 T.b.rhodesiense infections . This figure increased to 42% when the stage-2 cases were examined indicating the development of progressive BBB impairment with advancing disease. | study | 99.94 |
This results of this study highlight the apparent inconsistency between the trypanosome burden in the brain and the degree of BBB impairment as evidenced by the severity of the neuroinflammatory reaction present within the brain of trypanosome infected animals. Although statistical differences between the neuropathology scores were apparent between the groups of mice examined through the various stages of disease progression the neuroinflammatory response remained mild to moderate throughout with no inflammatory cells infiltrating the neuropil. This suggests that the mechanisms in place within the brain to control the inflammatory response and maintain homeostasis remain largely effective despite the barrier dysfunction and the increasing parasite burden. Furthermore, the neuroanatomical expression patterns of tight junction proteins and adhesion molecules differ between the BBB, the blood-meningeal barrier and the blood-CSF barrier . This could result in differential infiltration of specific regions dependent on the particular immune environment. Several host and parasite factors have been implicated as key determinants of disease progression. These include molecules regulating both the innate and adaptive immune response. For example, Toll-like receptor (TLR) 2- and TLR9- MyD88 signalling have been shown to stimulate the expression of inflammatory mediators such as TNF-α and IFN α/β which initiate leucocyte and parasite transmigration into the CNS and additional inflammatory mediators such as IFN-γ , and CXCL10 have also been shown to play a vital role in this process. Furthermore, the migration of leucocytes across the BBB as well as the laminin subtype composition of the basement membrane, influence the ability of trypanosomes to enter the CNS , and increased levels of ICAM and E-selectin have been demonstrated following infection . Other non-immune molecules such as matrix metalloproteases , and parasite cysteine proteases also appear to affect BBB penetration by the parasites. | study | 100.0 |
The ability to stage human infection accurately has become a focus of attention in recent years. The current WHO guidelines suggest that the presence of more than five white blood cells/µL of CSF or the presence of trypanosomes indicates that the infection has entered stage-2 . Nevertheless, WHO recognise that many of the patients presenting with between six and 20 white blood cells/µL are likely to be in an intermediate stage, prior to the onset of stage-2 disease . Precise disease staging is pivotal in determining the correct chemotherapeutic approach for optimal therapy. Treatment of stage-2 infections with suramin or pentamidine will fail to cure the infection resulting in relapse or exacerbation of the neuroinflammatory reaction while unnecessary use of toxic stage-2 drugs, such as melarsoprol, should be avoided due to the high incidence of extremely severe adverse reactions , . The results reported here show that BBB dysfunction and neuroinflammation manifest before the onset of stage-2 infections. In addition, parasite DNA can be detected in the brain tissue early after infection. These findings challenge the prevailing notion that parasites simply cross the BBB to enter the CNS and initiate inflammation during the transition from acute to CNS-stage disease, and also highlight the need for further research into the neuropathogenesis of trypanosomiasis. In addition the results reported here question the value of the criteria currently employed to defining stage-1 and stage-2 HAT and highlight a requirement to elucidate accurate markers of stage-2 infection to facilitate the development of improved, accurate diseases staging tools. | study | 99.9 |
Gastric cancer (GC) is one of the leading causes of cancer-related mortality worldwide, with high incidence in Asia . For patients with resectable GC, surgery and adjuvant chemoradiotherapy are the main way to cure this malignance. However, many patients still suffered recurrence and metastasis, though they received standard treatments. The concept of cancer stem cells (CSCs) has been put forward to explain the cause of therapy resistance and many studies have discovered that CSCs might play a pivotal role in tumor recurrence and metastasis [2, 3]. Meanwhile, some specific markers or their combinations have also been demonstrated valuable in identifying CSCs. These specific markers might be the key points in target therapy and prognostic prediction. From previous studies, we found that intercellular adhesion molecule 1 (CD54), leucine rich repeat containing G protein coupled receptor 5 (Lgr5), prominin 1 (CD133), POU class 5 homeobox 1 (Oct4), epithelial cell adhesion molecule (EpCAM) and sex determining region Y-box 2 (Sox2) were demonstrated as the putative markers of CSCs in many kinds of tumors [4–6]. The relationship between these markers and clinicopathological characteristics and the prognostic significance of these markers have been investigated in GC [7, 8]. However, many studies only focused on several of these six markers and the results were still controversial. Therefore, the significance of these markers were still under debate and should be further demonstrated. | study | 98.25 |
Nowadays, TNM stage revealing tumor invasion depth, regional metastatic lymph nodes (LNs) and distant metastasis is one of the most important classifications of tumor progression and a useful clinical tool in prognostic prediction of GC [1, 9]. Nevertheless, TNM stage cannot illustrate complete information of tumors and patients. As far as we know, heterogeneity extensively exists in many tumors [10, 11]. In clinical practice, some patients with the same TNM stage are found to have different prognosis. Therefore, it is necessary to find new tools or crucial supplementary of TNM stage that represents the individual characteristics to accurately predict the prognosis of patients with GC. The aim of this study was to investigate the clinical significance of these six markers of CSCs and establish a new model based on these markers to predict the prognosis of patients with GC. | study | 99.94 |
In GCSCs, EpCAM and CD54 were highly expressed on the cytomembrane, CD133 was weakly but Lgr5 and Oct4 were highly expressed in cytoplasm, and Sox2 was highly expressed in cytoplasm and nucleus (Figure 1). The expressions of these markers in primary lesions and metastatic LNs of GC through IHC were similar to GCSCs, except that CD133 was mainly expressed in the lumen of glands and Oct4 was expressed in nucleus (Figure 2). The relationships among these six markers in primary lesions were also analyzed and showed that EpCAM had significantly negative correlation to Lgr5 (p=0.007), CD133 (p=0.006) and Oct4 (p=0.001), while Oct4 was positively associated with Lgr5 (p<0.001) and CD133 (p=0.024) in immunohistochemistry (IHC). With respect to quantitative polymerase chain reaction (qPCR), we found that Lgr5 and Sox2 were remarkably positively correlated with CD54 (p=0.006) and Oct4 (p=0.006), respectively (Table 1). | study | 100.0 |
In IHC, 276 (73.2%) and 101 (26.8%) patients were in Lgr5 low and Lgr5 high expression groups, respectively. The results showed that Lgr5 high expression group had remarkably more patients with >60 years (p=0.001), male (p=0.024), macroscopic type III (p=0.030), tumor size 4cm-7cm (p=0.044) and TNM III stage (p=0.046) than Lgr5 low expression group. Multivariate analysis revealed that Lgr5 expression was only independently associated with age (p=0.001, OR=1.756, 95%CI [1.263-2.442]). | study | 100.0 |
In qPCR, there were 50 (53.8%) patients in Lgr5 low expression group and 43 (46.2%) patients in Lgr5 high expression group. We found that well or moderate differentiation grade was significantly independently related to Lgr5 high expression (p=0.041, OR=0.527, 95%CI [0.286-0.973]). | study | 100.0 |
In IHC, the patients were divided into Oct4 low (n=266, 70.6%) and high (n=111, 29.4%) expression groups. Oct4 high expression was significantly related to age >60 years (p=0.020), male (p=0.020), macroscopic type III-IV (p<0.001), tumor size >7cm (p=0.023), N3 stage (p=0.003), M1 stage (p=0.011) and TNM III-IV stage (p=0.001). Multivariate analysis showed that gender (p=0.014, OR=0.487, 95%CI [0.275-0.864]) and macroscopic type (p<0.001, OR=1.559, 95%CI [1.228-1.979]) were independent related factors to Oct4 expression. | study | 100.0 |
In qPCR, 44 (47.3%) and 49 (52.7%) patients were divided into Oct4 low and Oct4 high expression groups, respectively. We found that T stage was significantly correlated with Oct4 expression (p=0.035), however, no independent related clinicopathological characteristics to Oct4 were found. | study | 100.0 |
In IHC, there were 311 (82.5%) and 66 (17.5%) patients in CD133 low and high expression groups, respectively. CD133 high expression had obviously relation to age >60 years (p=0.001), upper parts of stomach (p=0.003), macroscopic type IV (p=0.047), well or moderate differentiation grade (p=0.014), N2 stage (p=0.016) and TNM III stage (p=0.018). In multivariate analysis, age (p=0.008, OR=1.769, 95%CI [1.162-2.692]), longitudinal location (p=0.022, OR=0.694, 95%CI [0.509-0.948]), differentiation grade (p=0.014, OR=0.600, 95%CI [0.401-0.900]) and N stage (p=0.003, OR=1.504, 95%CI [1.154-1.961]) were independently related factors. | study | 100.0 |
In IHC, the patients were divided into EpCAM low (n=123, 32.6%) and high (n=254, 67.4%) expression groups. EpCAM high expression significantly had something to do with to age >60 years (p<0.001), upper parts of stomach (p=0.040), macroscopic type III (p=0.020), tumor size >7cm (p=0.002), T3 stage (p=0.017), N2-3 stage (p=0.019) and TNM III stage (p=0.004). Multivariate analysis showed that age (p=0.001, OR=1.619, 95%CI [1.204-2.178]) and tumor size (p=0.008, OR=1.492, 95%CI [1.109-2.008]) were independent related factors to EpCAM expression. | study | 100.0 |
In qPCR, there were 65 (69.9%) and 28 (30.1%) patients in EpCAM low and high expression groups. EpCAM expression was remarkably concerned in M stage (p=0.006) in univariate analysis, but no clinicopathological traits were significantly related to EpCAM expression in multivariate analysis. | study | 100.0 |
In IHC, there were 321 (85.1%) patients in CD54 low expression and 56 (14.9%) patients in CD54 high expression group. CD54 expression was only significantly related to T stage (p=0.047) in univariate analysis, showing that CD54 high expression group had more T4 stage than CD54 low expression group. But no clinicopathological features were independently associated with CD54 expression. | study | 100.0 |
In IHC, 307 patients were divided into Sox2 low (n=211, 68.7%) and high (96, 31.3%) expression groups. Sox2 high expression was significantly correlated with well or moderate differentiation grade both in univariate (p=0.042) and multivariate (p=0.041, OR=0.699, 95%CI [0.495-0.986]) analyses. | study | 100.0 |
In qPCR, 43 (46.2%) and 50 (53.8%) patients were divided into Sox2 low expression and high expression groups. Sox2 expression was notably associated with age ≤60 years (p=0.008) and T3-4 stage (p=0.030) in univariate analysis. In logistic regression, only age was the independent related factor to Sox2 (p=0.009, OR=0.322, 95%CI [0.137-0.755]). | study | 100.0 |
In primary lesions (n=93) tested by qPCR and IHC, we found that there were no relationships between IHC and qPCR in CD54 (p=0.477), Lgr5 (p=0.576), CD133 (p=0.792), Oct4 (p=0.834), EpCAM (p=0.630) and Sox2 (p=0.250). We have also compared the expression of these markers in some patients through Western Blot, the results of which was similar to IHC, but not consistent with qPCR in EpCAM, CD133, Oct4 and Lgr5 (Figure 3). | study | 100.0 |
In this study, 341(90.5%) patients in IHC and 89 (95.7%) in qPCR were followed up. But we only included 325 (86.2%) patients in IHC (Sox2: 86.0%, 264/307) and 80 (86.0%) patients in qPCR with R0 resection to perform the survival analyses. The median survival time (MST) and 2-year overall survival rates of different groups of these markers in IHC and qPCR were shown in Table 5. The MST was not applicable when the survival rates at the end of follow-up time were still higher than 50%. | study | 100.0 |
In IHC, we found that the patients with Oct4 (p=0.024) and EpCAM (p=0.005) high expressions had significantly worse prognosis than those with low expression in Kaplan-Meier analyses (Figure 4). The differences between low expression and high expression of Lgr5 (p=0.163), CD133 (p=0.308), CD54 (p=0.204) and Sox2 (p=0.055) were not significant (Figure 4). To eliminate the potential bias from TNM stage, we compared the prognosis between low and high expressions of these markers stratified by TNM stage (Figure 5). We found that the prognostic differences were significant between Oct4 low and high expressions in TNM IV stage (p=0.045), EpCAM low and high expression in TNM I stage (p=0.045) and TNM II stage (p<0.001). We found that more patients received chemotherapy in EpCAM low expression group than EpCAM high expression group (p=0.003). To eliminate the influence of chemotherapy, we compared the prognosis of patients with or without chemotherapy between EpCAM low and high expression. Kaplan Meier curve showed that although there were no significant differences between EpCAM low and high expression in patients with (p=0.078) or without chemotherapy (p=0.126), the trend that EpCAM high expression group had worse prognosis than low expression group was still visible (Figure 6). In Cox regression of patients with all markers tested except Sox2, no markers were the independent prognostic factors. Instead, we found that age (p=0.006, HR=1.303, 95%CI [1.052-1.613]), tumor size (p=0.041, HR=1.255, 95%CI [1.010-1.559]) and TNM stage (p<0.001, HR=2.038, 95%CI [1.633-2.544]) were independently related to prognosis. For Cox regression of patients with Sox2 tested, we found that age (p=0.001, HR=1.477, 95%CI [1.165-1.873]), Sox2 (p=0.013, HR=0.616, 95%CI [0.421-0.901]) and TNM stage (p<0.001, HR=2.008, 95%CI [1.597-2.526]) were independently associated with prognosis. The results showed that the patients with Sox2 high expression had significantly better survival outcomes than those with Sox2 low expression. | study | 100.0 |
Because Oct4 and EpCAM were significantly related to prognosis in univariate analyses, we combined Oct4 and EpCAM to investigate their prognostic significance. The patients with both Oct4 and EpCAM low expressions were subsequently enrolled into double low expressions group (26.8%, 101/377) and other patients were in control group (73.2%, 276/377). Finally, out of 325 patients in survival analyses, 93 (28.6%) patients in Oct4-EpCAM double low expression group had significantly better prognosis than 232 (71.4%) patients in control group in Kaplan-Meier analysis (p<0.001) (Figure 7). Multivariate survival analyses indicated that age (p=0.036, HR=1.259, 95%CI [1.016-1.561]), Oct4-EpCAM expression (p=0.035, HR=1.485, 95%CI [1.028-2.145]) and TNM stage (p<0.001, HR=2.133, 95%CI [1.720-2.646]) were independent prognostic factors in IHC. | study | 100.0 |
In qPCR, the univariate survival analyses revealed that the patients with Lgr5 low expression (p=0.038) and CD133 high expression (p<0.001) had significantly worse prognosis than those with Lgr5 high expression and CD133 low expression, respectively (Figure 8). Contrarily, no significant differences in prognosis were found between the low and high expression of Oct4 (p=0.351), CD54 (p=0.237), EpCAM (P=0.172) and Sox2 (p=0.189) (Figure 8). In multivariate analyses, only CD133 was demonstrated to be independently related to survival outcomes (p<0.001, HR=4.338, 95%CI [2.152-8.747]). | study | 100.0 |
Further, we used nomogram to predict 2-year overall survival rate of individual patient in IHC. The results showed that age, T stage, N stage, M stage, and Oct4-EpCAM expression (p=0.040, HR=1.484, 95%CI 1.019-2.160) were included in the nomogram (Figure 9), indicating that Oct4-EpCAM double low expression group had better survival outcomes, which was similar to that of aforementioned multivariate analyses. The calibration curve of nomogram showed that the predictive probability of 2-year survival were very closely to the actual 2-year survival (Figure 10). Subsequently, we compared the predictive accuracy of prognosis between the nomograms based on Oct4-EpCAM expression and TNM staging (only T stage, N stage and M stage included, Figure 11, 12). The C-indexes of nomograms were 0.711 (95%CI 0.676-0.746), compared with 0.698 (95%CI 0.659-0.737) of TNM staging system in this study. The results indicated that the prognostic prediction accuracy of nomograms based on Oct4-EpCAM expression and other parameters was significantly better than TNM staging system alone (p=0.003). | study | 100.0 |
In 275 patients with positive N stage, we collected 206 (74.9%) metastatic LNs to perform IHC. There were 24 (11.7%) patients in CD54, 45 (21.8%) in Lgr5, 23 (11.2%) in CD133, 43 (20.9%) in Oct4 and 167 (81.1%) in EpCAM in high expression groups. For Sox2, out of 223 patients with positive N stage, 185 (83.0%) metastatic LNs were collected to be investigated by IHC, and the high expression rate was 33.5% (n=62). All the expressions of these markers in metastatic LNs had significantly relation to the expressions in primary lesions (all p<0.001). | study | 100.0 |
EpCAM high expression was significantly associated with old age (p=0.011), greater curvature and anterior wall of stomach (p=0.034), larger tumor size (p=0.036). Multivariate analysis showed that only age was independently related to EpCAM expression (p=0.004, OR=2.031, 95%CI [1.259, 3.277]). Oct4 high expression was related to N3 stage (univariate analysis: p=0.044, multivariate analysis: p=0.042, OR=1.812, 95%CI [1.021, 3.215]). CD133 high expression was correlated with well or moderate differentiation (p<0.001). Multivariate analysis also showed that longitudinal location (p=0.043, OR=0.571, 95%CI [0.332, 0.982]) and differentiation (p<0.001, OR=0.299, 95%CI [0.165, 0.541]) were independent related factors to CD133 expression. In univariate analyses, Lgr5 and CD54 low expression were significantly connected to middle part of stomach (p=0.022) and female (p=0.004), respectively. Sox2 low expression were significantly related to old age (univariate analysis: p=0.007, multivariate analysis: p=0.016, OR=0.594, 95%CI [0.389, 0.907]). | study | 100.0 |
In Kaplan-Meier analyses, there were no significant differences between high expression and low expression groups of CD54 (p=0.610), Lgr5 (p=0.053), Sox2 (p=0.858), EpCAM (p=0.733) and CD133 (P=0.276). However, Oct4 high expression group had significantly worse prognosis than Oct4 low expression group (p=0.006), and we found that Oct4 was also an independent prognostic factor in Cox regression (p=0.034, HR=1.626, 95%CI [1.038-2.547]). | study | 100.0 |
The accurate prognostic prediction of GC are pivotal in clinical practice. At present, as the main method, TNM stage system is widely applied to reveal tumor progression and predict prognosis of patients. Nevertheless, TNM stage can only reflect the general information of tumor progression. Because of the heterogeneity, the individual specific characteristics of tumors and patients cannot be completely revealed only through TNM stage system. With the development of biological technology, the heterogeneity of genetics, like proteomics, genomics, has been gradually discovered in GC . Therefore, besides TNM stage, it is very important to take the heterogeneity of GC into consideration in prognostic prediction. Additionally, CSCs, as the putative source of tumor maintaining and therapy resistance, have also been investigated deeply and widely in many tumors in recent years. In this present study, we focused on the expressions of specific markers of CSCs in GC tissues to find out their clinical significance in GC and potential application in clinical practice. | study | 99.94 |
In this study, we investigated the expressions of Lgr5, Oct4, CD133, EpCAM, CD54 and Sox2 through IHC and qPCR in GC tissues. In IHC, multivariate analyses demonstrated that Lgr5, CD133 and EpCAM were independently related to old age, CD133 and Sox2 were independently associated with well or moderate differentiation, while Oct4, CD133 and EpCAM were independently related to tumor progression. Regarding qPCR, logistic regression analyses showed that Lgr5 and Sox2 were independently related to well or moderate differentiation and young age, respectively. With respect to prognosis in IHC, we only found that the patients with high expression of Oct4 and EpCAM had significantly worse survival outcomes than those with low expression in univariate analyses. The differences between the high and low expression groups of other four markers were not significant. However, none of these six markers were independent prognostic factors. Based on the differences in survival outcomes between the patients in high and low expression of Oct4 and EpCAM, we combined Oct4 and EpCAM together to investigate the survival outcomes between low expression of Oct4-EpCAM and high expression of Oct4/EpCAM (control group). Cox regression showed that Oct4-EpCAM was the independent prognostic factor. In qPCR, we only found that CD133 was an independent prognostic factor, indicating that the patients with CD133 high expression had significantly worse prognosis than those with CD133 low expression. | study | 100.0 |
Lgr5 was identified as the putative marker of CSCs in colon cancers . Lgr5 was found to be related to depth of invasion, LNs metastasis, distance of metastasis and poor prognosis, and after Lgr5 was inhibited by siRNAs, fewer GC cells migrated through transwell model . Lgr5 had also been considered as an important marker in carcinogenesis of GC, indicating that Lgr5 expression was gradually increased from normal control tissues to GC tissues . Lgr5 was also been studied as a potential novel biomarker in chemoresistance of GC cells and predicting response to chemotherapy and prognosis . However, other study demonstrated that Lgr5 was increased expressed in well-moderate differentiation, stage I and stage II, compared with stage III and stage IV . | study | 99.9 |
Oct4 was identified as the putative marker of oral cancer stem-like cells and played a pivotal role in the chemoresistance of CSCs derived from prostate cancer [18, 19]. Previous study showed that GC patients with negative expression of Oct4 had worse prognosis than those with positive expression ; however, other report showed that Oct4 was expressed higher in GC tissues than non-cancerous tissues and associated with poor differentiation . It was demonstrated that metastatic lesions had more Oct4 positive expression than negative expression . | study | 99.94 |
CD133 has been widely investigated as the specific marker of CSCs of brain tumors, prostate cancer, melanoma and pancreatic cancer, but there are still some controversial results indicating that CD133 negative cells might also include CSCs [4, 5, 23, 24]. In our study, CD133 was generally expressed in the lumen of carcinoma glands, which was also reported by other previous research . However, besides luminal expression, cytoplasmic location was another kind of expression and previous research showed that the cytoplasmic expression of CD133 was related to metastasis and tumor progression, but this relationship was not observed in luminal expression . The GC patients with CD133 positive expression were related to poorly differentiation, and had significantly poor survival outcomes than those with CD133 negative expression [26–27]. In our study, although CD133 expression was related to well or moderate differentiation, CD133 expression was also associated with N2-3 stage, which was also similar to previous studies [28–29]. However, we did not found that CD133 was related to survival outcomes in IHC. Instead, we demonstrated that the patients with CD133 high expression had significantly worse prognosis through qPCR. | study | 100.0 |
EpCAM has also been targeted as the putative marker of epithelial CSCs of ovarian cancer and pancreatic cancer [24, 30]. EpCAM was found significantly related to large tumor size and poor survival outcomes through IHC, which was similar to a previous study . EpCAM was also found high expressed in peritoneal metastasis of GC, indicating that only GC cells with high expression of EpCAM might metastasize to the peritoneum . In some experiments, the capabilities of cell proliferation and tumor formation in nude mice of GC cell lines were impaired after EpCAM downregulation . However, another study reported that the patients with loss of EpCAM expression had significantly worse prognosis than those without loss and in stage I and II disease, loss of EpCAM expression was related to aggressive tumors . | study | 99.9 |
CD54 was found as the surface marker of cancer stem cells of hepatocellular carcinoma, GC and rectal cancer [6, 35, 36]. We found that CD54 was not independently associated with any clinical pathological characteristics and CD54 was not related to prognosis. However, a previous report with 108 patients demonstrated that CD54 was significantly related to advanced stage and liver metastasis . Additionally, many reports found that serum level of soluble CD54 was closely associated with GC progression, hematogenous metastasis and prognosis [7, 8]. | study | 99.94 |
Sox2 was expressed in the spheres of glioblastoma and gliosarcoma, and also played an important role in the epithelial mesenchymal transition of glioma stem cells . Our study found that Sox2 was expressed in nuclei and cytoplasm. Some studies found that Sox2 high expression might be associated with invasion of gastric cancer and poor survival outcomes [20, 22, 39]. Loss of expression of Sox2 indicated a worse prognosis . However, we found that Sox2 high expression was a favorable prognostic factor. | study | 100.0 |
In this study, we used X-tile software to calculate the cut-point of each marker tested through IHC and qPCR to divide the patients into low expression and high expression groups. These cut-points were on the basis of survival data. Hence, we thought that the cut-points could reveal the differences between low and high expression more realistically. Additionally, we used monoclonal antibodies of all these markers in IHC to try our best to make the results more specific and solid. However, polyclonal antibodies were used in some studies [25, 17, 21, 29, 37, 41–44]. We thought that different types of antibodies might also be the reason of the variable high expression rates among our study and some previous ones. Moreover, we applied C-index to compare the accuracy of prognostic prediction and nomogram, a visualized method based on several valuable parameters to illustrate the prognosis of individual patients in this study. Through C-index and nomogram, we found that the prognostic prediction of nomogram based on Oct4 and EpCAM, age and TNM stage had significantly better accuracy than TNM alone, which indicated that the expressions of Oct4 and EpCAM were valuable in prognosis prediction of patient with GC. The results suggested that we should not only focus on TNM stage, but also pay attention to some specific characteristics of patients and tumors. However, we found that few previous studies had applied these kinds of methods in GC. | study | 99.94 |
Our study applied IHC and qPCR to investigate the protein and mRNA expression of GC tissues. Moreover, qPCR also tested the mRNA expression of normal gastric tissues. These might be the reason why the results of IHC and qPCR were not correlated with each other. The results of Western Blot was similar to IHC, but not consistent with qPCR in some markers. We thought that the expression of mRNA in qPCR might differ from the expression of protein in IHC because of the changes after transcription and transduction. Additionally, our study only investigated the clinical significance of these markers, but did not involve the molecular mechanism of these markers. At present, these markers were mainly applied in identification of CSCs and investigation of their clinical significance. Regarding the mechanism, some study found that TR4-Oct4-IL1Ra axis might play a critical role in the development of chemoresistance in the prostate cancer stem/progenitor cells . GC cell migration was enhanced through increasing CD54 through Rho/ROCK pathway by leptin . | study | 100.0 |
There were still some limitations in our study. This study was a retrospective one with 377 patients in IHC and 93 patients in qPCR. Because of the difficulty and feasibility of GC tissues, we could only collect and test GC tissues with enough size to avoid the influence of postoperative pathological examination. Therefore, most GC tissues in qPCR were TNM III-IV stage. In addition, CD44 was another very important marker of GC and gastric CSCs and had been reported widely. In this study, we mainly focused on these six markers with fewer reports. Additionally, this study only enrolled the patients in our hospital, and the results should be still further demonstrated through external validation. | study | 100.0 |
Available formalin-fixed paraffin-embedded primary lesions (n=377) and metastatic LNs (n=194) of patients with GC in Department of Gastrointestinal Surgery, West China Hospital, Sichuan University from January 2006 to October 2012 were retrospectively enrolled for CD54, Lgr5, Oct4, CD133 and EpCAM tests through IHC. For Sox2, available formalin-fixed paraffin-embedded primary lesions (n=307) and metastatic LNs (n=184) were collected from January 2007 to October 2012. We also collected 93 pairs of primary lesions and corresponding adjacent normal gastric tissues stored in liquid nitrogen of patients with GC from December 2011 to October 2012 to perform qPCR. The primary lesions of these 93 patients had also been tested by IHC. All patients were followed up through telephones, mails and outpatient visits up to January 2015. The clinicopathological characteristics and follow-up details were collected. The West China Hospital research ethics committee approved retrospective analysis of anonymous data. Signed patient informed consent was waived per the committee approval, because it was a retrospective analysis. The flow chart of the patients was shown in Figure 13. | study | 100.0 |
The tissue slices (4 μm) were deparaffinized with xylene and rehydrated in a graded alcohol series and distilled water. After blocking the endogenous peroxidase with hydrogen peroxide, citrate buffer (ZhongShan Golden Bridge Biotechnology Co., Ltd) was used to perform antigen retrieval in water bath at 95°C for 35 minutes. After naturally cooling down, the slices were incubated with primary monoclonal antibodies to CD54 (1:75, Abcam), Lgr5 (1:60, Abcam), Oct4 (1:200, Abcam), EpCAM (1:800, Abcam), Sox2 (1:200, ProMab) at 4°C and with primary monoclonal antibody to CD133 (1:10, Miltenyi Biotec) at room temperature overnight. For immunofluorescence, the frozen slices (8 μm) of GCSCs spheres were incubated with these primary monoclonal antibodies under the same conditions, except EpCAM (1:200, Abcam). Subsequently, these slices were incubated with peroxidase-conjugated polymer (EnVision™ Detection Kit, Gene Tech (Shanghai) Company Limited) for 30 minutes or fluorescent secondary antibody (1:800, Alexa Fluor 555) for 90 minutes at room temperature. Finally, the slices were stained with diaminobenzidine chromogen solution (1:50, EnVision™ Detection Kit, Gene Tech (Shanghai) Company Limited) and counterstained with hematoxylin (ZhongShan Golden Bridge Biotechnology Co., Ltd) or DAPI (1:4000). Primary antibody incubation was omitted in negative controls. The specificity of all antibodies was demonstrated by providers. The figures were captured through Axio Imager A2 (Zeiss) and Scope A1 (Zeiss). As reported previously, GCSCs were cultured in serum free DMEM/F12 medium supplemented with 20 ng/ml EGF and 10 ng/ml b-FGF . | study | 100.0 |
Total RNA was isolated from GC tissues by TRIzol (Invitrogen) according to the instructions. Reverse transcription of total RNA was carried out with PrimeScript RT reagent kit (TAKARA Biotechnology (Dalian) Co., Ltd) on PCR amplifier under the following conditions: 37°C for 15 min, 85°C for 5 seconds. After that, cDNA was tested in real-time qPCR on the CFX96 Real Time PCR System with the use of Premix Ex Taq (SYBR and probe qPCR, TAKARA Biotechnology (Dalian) Co., Ltd) under the following conditions: 95°C activation for 30 seconds, 95°C denaturation for 5 seconds, 60°C annealing and elongation for 30 seconds, which repeated for 40 cycles. The results were recorded with CT value. After comparison of amplification efficiency, Livak method (2−ΔΔCT) was used to compare the difference between GC tissues and corresponding adjacent normal gastric tissues, in which GAPDH was used as reference gene and corresponding adjacent normal gastric tissues were applied as calibration control. All the sequences of primers and probes of these genes were designed and synthesized by TAKARA Biotechnology (Dalian) Co., Ltd (Table 6). | study | 100.0 |
Subsets and Splits